Adenomatous Polyposis Coli (APC) - coding DNA reference sequence

(used for mutation description)

(last modified July 12, 2013)


NOTE: exon numbering has been changed, the old exon 2 is now exon 4. The APC gene variant database has a column with the old exon numbering.
This file was created to facilitate the description of sequence variants in the APC gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from LRG_130 (RefSeqGene NG_008481.4, part of NC_000005.9), covering APC transcript variant-3 ( NM_000038.4, Ensembl ENST00000257430). The APC gene has two alternative promoters/exons 1 designated 1A (exon 2 below) and 1B (located 5' of 1A). Transcript variant-1 (NM_001127510.2) contains an alternatively spliced exon 3 (located in intron 2). Transcript variant-2 (NM_001127511.2) uses promoter/exon 1b and does not contain exon 3 (intron 2) and exon 4 (transcript NM_001127511.1 did contain exon 3).

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                                         .         .                g.50363
                                    gtattggtgcagcccgccagggtgt       c.-61

 .         .         .         .         .  | 04      .             g.67370
 cactggagacagaatggaggtgctgccggactcggaaatggg | gtccaagggtagccaagg    c.-1
                                            ^  alternatively spliced exon 3

          .         .         .         .         .         .       g.67430
 ATGGCTGCAGCTTCATATGATCAGTTGTTAAAGCAAGTTGAGGCACTGAAGATGGAGAAC       c.60
 M  A  A  A  S  Y  D  Q  L  L  K  Q  V  E  A  L  K  M  E  N         p.20

          .         .         .         .         .         .       g.67490
 TCAAATCTTCGACAAGAGCTAGAAGATAATTCCAATCATCTTACAAAACTGGAAACTGAG       c.120
 S  N  L  R  Q  E  L  E  D  N  S  N  H  L  T  K  L  E  T  E         p.40

          .      | 05  .         .         .         .         .    g.78850
 GCATCTAATATGAAG | GAAGTACTTAAACAACTACAAGGAAGTATTGAAGATGAAGCTATG    c.180
 A  S  N  M  K   | E  V  L  K  Q  L  Q  G  S  I  E  D  E  A  M      p.60

          .         .         .         . | 06       .         .    g.79688
 GCTTCTTCTGGACAGATTGATTTATTAGAGCGTCTTAAAG | AGCTTAACTTAGATAGCAGT    c.240
 A  S  S  G  Q  I  D  L  L  E  R  L  K  E |   L  N  L  D  S  S      p.80

          .         .         .         .         .         .       g.79748
 AATTTCCCTGGAGTAAAACTGCGGTCAAAAATGTCCCTCCGTTCTTATGGAAGCCGGGAA       c.300
 N  F  P  G  V  K  L  R  S  K  M  S  L  R  S  Y  G  S  R  E         p.100

          .         .         .         .         .         .       g.79808
 GGATCTGTATCAAGCCGTTCTGGAGAGTGCAGTCCTGTTCCTATGGGTTCATTTCCAAGA       c.360
 G  S  V  S  S  R  S  G  E  C  S  P  V  P  M  G  S  F  P  R         p.120

          .         .         .         .         .         .       g.79868
 AGAGGGTTTGTAAATGGAAGCAGAGAAAGTACTGGATATTTAGAAGAACTTGAGAAAGAG       c.420
 R  G  F  V  N  G  S  R  E  S  T  G  Y  L  E  E  L  E  K  E         p.140

    | 07     .         .         .         .         .         .    g.88166
 AG | GTCATTGCTTCTTGCTGATCTTGACAAAGAAGAAAAGGAAAAAGACTGGTATTACGCT    c.480
 R  |  S  L  L  L  A  D  L  D  K  E  E  K  E  K  D  W  Y  Y  A      p.160

          .         .         .         .         .  | 08      .    g.93278
 CAACTTCAGAATCTCACTAAAAGAATAGATAGTCTTCCTTTAACTGAAAAT | TTTTCCTTA    c.540
 Q  L  Q  N  L  T  K  R  I  D  S  L  P  L  T  E  N   | F  S  L      p.180

          .         .         .         .         .         .       g.93338
 CAAACAGATATGACCAGAAGGCAATTGGAATATGAAGCAAGGCAAATCAGAGTTGCGATG       c.600
 Q  T  D  M  T  R  R  Q  L  E  Y  E  A  R  Q  I  R  V  A  M         p.200

          .         .         .         .      | 09  .         .    g.104940
 GAAGAACAACTAGGTACCTGCCAGGATATGGAAAAACGAGCACAG | CGAAGAATAGCCAGA    c.660
 E  E  Q  L  G  T  C  Q  D  M  E  K  R  A  Q   | R  R  I  A  R      p.220

          .         .         .         .         .         .       g.105000
 ATTCAGCAAATCGAAAAGGACATACTTCGTATACGACAGCTTTTACAGTCCCAAGCAACA       c.720
 I  Q  Q  I  E  K  D  I  L  R  I  R  Q  L  L  Q  S  Q  A  T         p.240

           | 10        .         .         .         .         .    g.113809
 GAAGCAGAG | AGGTCATCTCAGAACAAGCATGAAACCGGCTCACATGATGCTGAGCGGCAG    c.780
 E  A  E   | R  S  S  Q  N  K  H  E  T  G  S  H  D  A  E  R  Q      p.260

          .         .         .         .         .     | 11   .    g.127980
 AATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAG | GGTTCA    c.840
 N  E  G  Q  G  V  G  E  I  N  M  A  T  S  G  N  G  Q   | G  S      p.280

          .         .         .         .         .         .       g.128040
 ACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCA       c.900
 T  T  R  M  D  H  E  T  A  S  V  L  S  S  S  S  T  H  S  A         p.300

          .         .         .    | 12    .         .         .    g.131472
 CCTCGAAGGCTGACAAGTCATCTGGGAACCAAG | GTGGAAATGGTGTATTCATTGTTGTCA    c.960
 P  R  R  L  T  S  H  L  G  T  K   | V  E  M  V  Y  S  L  L  S      p.320

          .         .         .         .         .         .       g.131532
 ATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCC       c.1020
 M  L  G  T  H  D  K  D  D  M  S  R  T  L  L  A  M  S  S  S         p.340

          .         .         .         .         .         .       g.131592
 CAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTA       c.1080
 Q  D  S  C  I  S  M  R  Q  S  G  C  L  P  L  L  I  Q  L  L         p.360

          .         .         .         .         .         .       g.131652
 CATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGG       c.1140
 H  G  N  D  K  D  S  V  L  L  G  N  S  R  G  S  K  E  A  R         p.380

          .         .         .         .         .         .       g.131712
 GCCAGGGCCAGTGCAGCACTCCACAACATCATTCACTCACAGCCTGATGACAAGAGAGGC       c.1200
 A  R  A  S  A  A  L  H  N  I  I  H  S  Q  P  D  D  K  R  G         p.400

          .         .         .         .         .         .       g.131772
 AGGCGTGAAATCCGAGTCCTTCATCTTTTGGAACAGATACGCGCTTACTGTGAAACCTGT       c.1260
 R  R  E  I  R  V  L  H  L  L  E  Q  I  R  A  Y  C  E  T  C         p.420

          .         .         .         .         .   | 13     .    g.134383
 TGGGAGTGGCAGGAAGCTCATGAACCAGGCATGGACCAGGACAAAAATCCAA | TGCCAGCT    c.1320
 W  E  W  Q  E  A  H  E  P  G  M  D  Q  D  K  N  P  M |   P  A      p.440

          .         .         .         .         .         .       g.134443
 CCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTTGATGAA       c.1380
 P  V  E  H  Q  I  C  P  A  V  C  V  L  M  K  L  S  F  D  E         p.460

          .         .         | 14         .         .         .    g.139619
 GAGCATAGACATGCAATGAATGAACTAG | GGGGACTACAGGCCATTGCAGAATTATTGCAA    c.1440
 E  H  R  H  A  M  N  E  L  G |   G  L  Q  A  I  A  E  L  L  Q      p.480

          .         .         .         .         .         .       g.139679
 GTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAGACGATAT       c.1500
 V  D  C  E  M  Y  G  L  T  N  D  H  Y  S  I  T  L  R  R  Y         p.500

          .         .         .         .         | 15         .    g.140420
 GCTGGAATGGCTTTGACAAACTTGACTTTTGGAGATGTAGCCAACAAG | GCTACGCTATGC    c.1560
 A  G  M  A  L  T  N  L  T  F  G  D  V  A  N  K   | A  T  L  C      p.520

          .         .         .         .         .         .       g.140480
 TCTATGAAAGGCTGCATGAGAGCACTTGTGGCCCAACTAAAATCTGAAAGTGAAGACTTA       c.1620
 S  M  K  G  C  M  R  A  L  V  A  Q  L  K  S  E  S  E  D  L         p.540

        | 16 .         .         .         .         .         .    g.141389
 CAGCAG | GTTATTGCGAGTGTTTTGAGGAATTTGTCTTGGCGAGCAGATGTAAATAGTAAA    c.1680
 Q  Q   | V  I  A  S  V  L  R  N  L  S  W  R  A  D  V  N  S  K      p.560

          .         .         .         .         .         .       g.141449
 AAGACGTTGCGAGAAGTTGGAAGTGTGAAAGCATTGATGGAATGTGCTTTAGAAGTTAAA       c.1740
 K  T  L  R  E  V  G  S  V  K  A  L  M  E  C  A  L  E  V  K         p.580

     | 17    .         .         .         .         .         .    g.147487
 AAG | GAATCAACCCTCAAAAGCGTATTGAGTGCCTTATGGAATTTGTCAGCACATTGCACT    c.1800
 K   | E  S  T  L  K  S  V  L  S  A  L  W  N  L  S  A  H  C  T      p.600

          .         .         .         .         .         .       g.147547
 GAGAATAAAGCTGATATATGTGCTGTAGATGGTGCACTTGCATTTTTGGTTGGCACTCTT       c.1860
 E  N  K  A  D  I  C  A  V  D  G  A  L  A  F  L  V  G  T  L         p.620

          .         .         .         .         .         .       g.147607
 ACTTACCGGAGCCAGACAAACACTTTAGCCATTATTGAAAGTGGAGGTGGGATATTACGG       c.1920
 T  Y  R  S  Q  T  N  T  L  A  I  I  E  S  G  G  G  I  L  R         p.640

          .         .         .         | 18         .         .    g.150054
 AATGTGTCCAGCTTGATAGCTACAAATGAGGACCACAG | GCAAATCCTAAGAGAGAACAAC    c.1980
 N  V  S  S  L  I  A  T  N  E  D  H  R  |  Q  I  L  R  E  N  N      p.660

          .         .         .         .         .         .       g.150114
 TGTCTACAAACTTTATTACAACACTTAAAATCTCATAGTTTGACAATAGTCAGTAATGCA       c.2040
 C  L  Q  T  L  L  Q  H  L  K  S  H  S  L  T  I  V  S  N  A         p.680

          .         .         .         .         .         .       g.150174
 TGTGGAACTTTGTGGAATCTCTCAGCAAGAAATCCTAAAGACCAGGAAGCATTATGGGAC       c.2100
 C  G  T  L  W  N  L  S  A  R  N  P  K  D  Q  E  A  L  W  D         p.700

          .         .         .         .         .         .       g.150234
 ATGGGGGCAGTTAGCATGCTCAAGAACCTCATTCATTCAAAGCACAAAATGATTGCTATG       c.2160
 M  G  A  V  S  M  L  K  N  L  I  H  S  K  H  K  M  I  A  M         p.720

          .         .         .         .         .         .       g.150294
 GGAAGTGCTGCAGCTTTAAGGAATCTCATGGCAAATAGGCCTGCGAAGTACAAGGATGCC       c.2220
 G  S  A  A  A  L  R  N  L  M  A  N  R  P  A  K  Y  K  D  A         p.740

          .         .         .         .         .         .       g.150354
 AATATTATGTCTCCTGGCTCAAGCTTGCCATCTCTTCATGTTAGGAAACAAAAAGCCCTA       c.2280
 N  I  M  S  P  G  S  S  L  P  S  L  H  V  R  K  Q  K  A  L         p.760

          .         .         .         .         .         .       g.150414
 GAAGCAGAATTAGATGCTCAGCACTTATCAGAAACTTTTGACAATATAGACAATTTAAGT       c.2340
 E  A  E  L  D  A  Q  H  L  S  E  T  F  D  N  I  D  N  L  S         p.780

          .         .         .         .         .         .       g.150474
 CCCAAGGCATCTCATCGTAGTAAGCAGAGACACAAGCAAAGTCTCTATGGTGATTATGTT       c.2400
 P  K  A  S  H  R  S  K  Q  R  H  K  Q  S  L  Y  G  D  Y  V         p.800

          .         .         .         .         .         .       g.150534
 TTTGACACCAATCGACATGATGATAATAGGTCAGACAATTTTAATACTGGCAACATGACT       c.2460
 F  D  T  N  R  H  D  D  N  R  S  D  N  F  N  T  G  N  M  T         p.820

          .         .         .         .         .         .       g.150594
 GTCCTTTCACCATATTTGAATACTACAGTGTTACCCAGCTCCTCTTCATCAAGAGGAAGC       c.2520
 V  L  S  P  Y  L  N  T  T  V  L  P  S  S  S  S  S  R  G  S         p.840

          .         .         .         .         .         .       g.150654
 TTAGATAGTTCTCGTTCTGAAAAAGATAGAAGTTTGGAGAGAGAACGCGGAATTGGTCTA       c.2580
 L  D  S  S  R  S  E  K  D  R  S  L  E  R  E  R  G  I  G  L         p.860

          .         .         .         .         .         .       g.150714
 GGCAACTACCATCCAGCAACAGAAAATCCAGGAACTTCTTCAAAGCGAGGTTTGCAGATC       c.2640
 G  N  Y  H  P  A  T  E  N  P  G  T  S  S  K  R  G  L  Q  I         p.880

          .         .         .         .         .         .       g.150774
 TCCACCACTGCAGCCCAGATTGCCAAAGTCATGGAAGAAGTGTCAGCCATTCATACCTCT       c.2700
 S  T  T  A  A  Q  I  A  K  V  M  E  E  V  S  A  I  H  T  S         p.900

          .         .         .         .         .         .       g.150834
 CAGGAAGACAGAAGTTCTGGGTCTACCACTGAATTACATTGTGTGACAGATGAGAGAAAT       c.2760
 Q  E  D  R  S  S  G  S  T  T  E  L  H  C  V  T  D  E  R  N         p.920

          .         .         .         .         .         .       g.150894
 GCACTTAGAAGAAGCTCTGCTGCCCATACACATTCAAACACTTACAATTTCACTAAGTCG       c.2820
 A  L  R  R  S  S  A  A  H  T  H  S  N  T  Y  N  F  T  K  S         p.940

          .         .         .         .         .         .       g.150954
 GAAAATTCAAATAGGACATGTTCTATGCCTTATGCCAAATTAGAATACAAGAGATCTTCA       c.2880
 E  N  S  N  R  T  C  S  M  P  Y  A  K  L  E  Y  K  R  S  S         p.960

          .         .         .         .         .         .       g.151014
 AATGATAGTTTAAATAGTGTCAGTAGTAGTGATGGTTATGGTAAAAGAGGTCAAATGAAA       c.2940
 N  D  S  L  N  S  V  S  S  S  D  G  Y  G  K  R  G  Q  M  K         p.980

          .         .         .         .         .         .       g.151074
 CCCTCGATTGAATCCTATTCTGAAGATGATGAAAGTAAGTTTTGCAGTTATGGTCAATAC       c.3000
 P  S  I  E  S  Y  S  E  D  D  E  S  K  F  C  S  Y  G  Q  Y         p.1000

          .         .         .         .         .         .       g.151134
 CCAGCCGACCTAGCCCATAAAATACATAGTGCAAATCATATGGATGATAATGATGGAGAA       c.3060
 P  A  D  L  A  H  K  I  H  S  A  N  H  M  D  D  N  D  G  E         p.1020

          .         .         .         .         .         .       g.151194
 CTAGATACACCAATAAATTATAGTCTTAAATATTCAGATGAGCAGTTGAACTCTGGAAGG       c.3120
 L  D  T  P  I  N  Y  S  L  K  Y  S  D  E  Q  L  N  S  G  R         p.1040

          .         .         .         .         .         .       g.151254
 CAAAGTCCTTCACAGAATGAAAGATGGGCAAGACCCAAACACATAATAGAAGATGAAATA       c.3180
 Q  S  P  S  Q  N  E  R  W  A  R  P  K  H  I  I  E  D  E  I         p.1060

          .         .         .         .         .         .       g.151314
 AAACAAAGTGAGCAAAGACAATCAAGGAATCAAAGTACAACTTATCCTGTTTATACTGAG       c.3240
 K  Q  S  E  Q  R  Q  S  R  N  Q  S  T  T  Y  P  V  Y  T  E         p.1080

          .         .         .         .         .         .       g.151374
 AGCACTGATGATAAACACCTCAAGTTCCAACCACATTTTGGACAGCAGGAATGTGTTTCT       c.3300
 S  T  D  D  K  H  L  K  F  Q  P  H  F  G  Q  Q  E  C  V  S         p.1100

          .         .         .         .         .         .       g.151434
 CCATACAGGTCACGGGGAGCCAATGGTTCAGAAACAAATCGAGTGGGTTCTAATCATGGA       c.3360
 P  Y  R  S  R  G  A  N  G  S  E  T  N  R  V  G  S  N  H  G         p.1120

          .         .         .         .         .         .       g.151494
 ATTAATCAAAATGTAAGCCAGTCTTTGTGTCAAGAAGATGACTATGAAGATGATAAGCCT       c.3420
 I  N  Q  N  V  S  Q  S  L  C  Q  E  D  D  Y  E  D  D  K  P         p.1140

          .         .         .         .         .         .       g.151554
 ACCAATTATAGTGAACGTTACTCTGAAGAAGAACAGCATGAAGAAGAAGAGAGACCAACA       c.3480
 T  N  Y  S  E  R  Y  S  E  E  E  Q  H  E  E  E  E  R  P  T         p.1160

          .         .         .         .         .         .       g.151614
 AATTATAGCATAAAATATAATGAAGAGAAACGTCATGTGGATCAGCCTATTGATTATAGT       c.3540
 N  Y  S  I  K  Y  N  E  E  K  R  H  V  D  Q  P  I  D  Y  S         p.1180

          .         .         .         .         .         .       g.151674
 TTAAAATATGCCACAGATATTCCTTCATCACAGAAACAGTCATTTTCATTCTCAAAGAGT       c.3600
 L  K  Y  A  T  D  I  P  S  S  Q  K  Q  S  F  S  F  S  K  S         p.1200

          .         .         .         .         .         .       g.151734
 TCATCTGGACAAAGCAGTAAAACCGAACATATGTCTTCAAGCAGTGAGAATACGTCCACA       c.3660
 S  S  G  Q  S  S  K  T  E  H  M  S  S  S  S  E  N  T  S  T         p.1220

          .         .         .         .         .         .       g.151794
 CCTTCATCTAATGCCAAGAGGCAGAATCAGCTCCATCCAAGTTCTGCACAGAGTAGAAGT       c.3720
 P  S  S  N  A  K  R  Q  N  Q  L  H  P  S  S  A  Q  S  R  S         p.1240

          .         .         .         .         .         .       g.151854
 GGTCAGCCTCAAAAGGCTGCCACTTGCAAAGTTTCTTCTATTAACCAAGAAACAATACAG       c.3780
 G  Q  P  Q  K  A  A  T  C  K  V  S  S  I  N  Q  E  T  I  Q         p.1260

          .         .         .         .         .         .       g.151914
 ACTTATTGTGTAGAAGATACTCCAATATGTTTTTCAAGATGTAGTTCATTATCATCTTTG       c.3840
 T  Y  C  V  E  D  T  P  I  C  F  S  R  C  S  S  L  S  S  L         p.1280

          .         .         .         .         .         .       g.151974
 TCATCAGCTGAAGATGAAATAGGATGTAATCAGACGACACAGGAAGCAGATTCTGCTAAT       c.3900
 S  S  A  E  D  E  I  G  C  N  Q  T  T  Q  E  A  D  S  A  N         p.1300

          .         .         .         .         .         .       g.152034
 ACCCTGCAAATAGCAGAAATAAAAGAAAAGATTGGAACTAGGTCAGCTGAAGATCCTGTG       c.3960
 T  L  Q  I  A  E  I  K  E  K  I  G  T  R  S  A  E  D  P  V         p.1320

          .         .         .         .         .         .       g.152094
 AGCGAAGTTCCAGCAGTGTCACAGCACCCTAGAACCAAATCCAGCAGACTGCAGGGTTCT       c.4020
 S  E  V  P  A  V  S  Q  H  P  R  T  K  S  S  R  L  Q  G  S         p.1340

          .         .         .         .         .         .       g.152154
 AGTTTATCTTCAGAATCAGCCAGGCACAAAGCTGTTGAATTTTCTTCAGGAGCGAAATCT       c.4080
 S  L  S  S  E  S  A  R  H  K  A  V  E  F  S  S  G  A  K  S         p.1360

          .         .         .         .         .         .       g.152214
 CCCTCCAAAAGTGGTGCTCAGACACCCAAAAGTCCACCTGAACACTATGTTCAGGAGACC       c.4140
 P  S  K  S  G  A  Q  T  P  K  S  P  P  E  H  Y  V  Q  E  T         p.1380

          .         .         .         .         .         .       g.152274
 CCACTCATGTTTAGCAGATGTACTTCTGTCAGTTCACTTGATAGTTTTGAGAGTCGTTCG       c.4200
 P  L  M  F  S  R  C  T  S  V  S  S  L  D  S  F  E  S  R  S         p.1400

          .         .         .         .         .         .       g.152334
 ATTGCCAGCTCCGTTCAGAGTGAACCATGCAGTGGAATGGTAAGTGGCATTATAAGCCCC       c.4260
 I  A  S  S  V  Q  S  E  P  C  S  G  M  V  S  G  I  I  S  P         p.1420

          .         .         .         .         .         .       g.152394
 AGTGATCTTCCAGATAGCCCTGGACAAACCATGCCACCAAGCAGAAGTAAAACACCTCCA       c.4320
 S  D  L  P  D  S  P  G  Q  T  M  P  P  S  R  S  K  T  P  P         p.1440

          .         .         .         .         .         .       g.152454
 CCACCTCCTCAAACAGCTCAAACCAAGCGAGAAGTACCTAAAAATAAAGCACCTACTGCT       c.4380
 P  P  P  Q  T  A  Q  T  K  R  E  V  P  K  N  K  A  P  T  A         p.1460

          .         .         .         .         .         .       g.152514
 GAAAAGAGAGAGAGTGGACCTAAGCAAGCTGCAGTAAATGCTGCAGTTCAGAGGGTCCAG       c.4440
 E  K  R  E  S  G  P  K  Q  A  A  V  N  A  A  V  Q  R  V  Q         p.1480

          .         .         .         .         .         .       g.152574
 GTTCTTCCAGATGCTGATACTTTATTACATTTTGCCACGGAAAGTACTCCAGATGGATTT       c.4500
 V  L  P  D  A  D  T  L  L  H  F  A  T  E  S  T  P  D  G  F         p.1500

          .         .         .         .         .         .       g.152634
 TCTTGTTCATCCAGCCTGAGTGCTCTGAGCCTCGATGAGCCATTTATACAGAAAGATGTG       c.4560
 S  C  S  S  S  L  S  A  L  S  L  D  E  P  F  I  Q  K  D  V         p.1520

          .         .         .         .         .         .       g.152694
 GAATTAAGAATAATGCCTCCAGTTCAGGAAAATGACAATGGGAATGAAACAGAATCAGAG       c.4620
 E  L  R  I  M  P  P  V  Q  E  N  D  N  G  N  E  T  E  S  E         p.1540

          .         .         .         .         .         .       g.152754
 CAGCCTAAAGAATCAAATGAAAACCAAGAGAAAGAGGCAGAAAAAACTATTGATTCTGAA       c.4680
 Q  P  K  E  S  N  E  N  Q  E  K  E  A  E  K  T  I  D  S  E         p.1560

          .         .         .         .         .         .       g.152814
 AAGGACCTATTAGATGATTCAGATGATGATGATATTGAAATACTAGAAGAATGTATTATT       c.4740
 K  D  L  L  D  D  S  D  D  D  D  I  E  I  L  E  E  C  I  I         p.1580

          .         .         .         .         .         .       g.152874
 TCTGCCATGCCAACAAAGTCATCACGTAAAGCAAAAAAGCCAGCCCAGACTGCTTCAAAA       c.4800
 S  A  M  P  T  K  S  S  R  K  A  K  K  P  A  Q  T  A  S  K         p.1600

          .         .         .         .         .         .       g.152934
 TTACCTCCACCTGTGGCAAGGAAACCAAGTCAGCTGCCTGTGTACAAACTTCTACCATCA       c.4860
 L  P  P  P  V  A  R  K  P  S  Q  L  P  V  Y  K  L  L  P  S         p.1620

          .         .         .         .         .         .       g.152994
 CAAAACAGGTTGCAACCCCAAAAGCATGTTAGTTTTACACCGGGGGATGATATGCCACGG       c.4920
 Q  N  R  L  Q  P  Q  K  H  V  S  F  T  P  G  D  D  M  P  R         p.1640

          .         .         .         .         .         .       g.153054
 GTGTATTGTGTTGAAGGGACACCTATAAACTTTTCCACAGCTACATCTCTAAGTGATCTA       c.4980
 V  Y  C  V  E  G  T  P  I  N  F  S  T  A  T  S  L  S  D  L         p.1660

          .         .         .         .         .         .       g.153114
 ACAATCGAATCCCCTCCAAATGAGTTAGCTGCTGGAGAAGGAGTTAGAGGAGGGGCACAG       c.5040
 T  I  E  S  P  P  N  E  L  A  A  G  E  G  V  R  G  G  A  Q         p.1680

          .         .         .         .         .         .       g.153174
 TCAGGTGAATTTGAAAAACGAGATACCATTCCTACAGAAGGCAGAAGTACAGATGAGGCT       c.5100
 S  G  E  F  E  K  R  D  T  I  P  T  E  G  R  S  T  D  E  A         p.1700

          .         .         .         .         .         .       g.153234
 CAAGGAGGAAAAACCTCATCTGTAACCATACCTGAATTGGATGACAATAAAGCAGAGGAA       c.5160
 Q  G  G  K  T  S  S  V  T  I  P  E  L  D  D  N  K  A  E  E         p.1720

          .         .         .         .         .         .       g.153294
 GGTGATATTCTTGCAGAATGCATTAATTCTGCTATGCCCAAAGGGAAAAGTCACAAGCCT       c.5220
 G  D  I  L  A  E  C  I  N  S  A  M  P  K  G  K  S  H  K  P         p.1740

          .         .         .         .         .         .       g.153354
 TTCCGTGTGAAAAAGATAATGGACCAGGTCCAGCAAGCATCTGCGTCTTCTTCTGCACCC       c.5280
 F  R  V  K  K  I  M  D  Q  V  Q  Q  A  S  A  S  S  S  A  P         p.1760

          .         .         .         .         .         .       g.153414
 AACAAAAATCAGTTAGATGGTAAGAAAAAGAAACCAACTTCACCAGTAAAACCTATACCA       c.5340
 N  K  N  Q  L  D  G  K  K  K  K  P  T  S  P  V  K  P  I  P         p.1780

          .         .         .         .         .         .       g.153474
 CAAAATACTGAATATAGGACACGTGTAAGAAAAAATGCAGACTCAAAAAATAATTTAAAT       c.5400
 Q  N  T  E  Y  R  T  R  V  R  K  N  A  D  S  K  N  N  L  N         p.1800

          .         .         .         .         .         .       g.153534
 GCTGAGAGAGTTTTCTCAGACAACAAAGATTCAAAGAAACAGAATTTGAAAAATAATTCC       c.5460
 A  E  R  V  F  S  D  N  K  D  S  K  K  Q  N  L  K  N  N  S         p.1820

          .         .         .         .         .         .       g.153594
 AAGGTCTTCAATGATAAGCTCCCAAATAATGAAGATAGAGTCAGAGGAAGTTTTGCTTTT       c.5520
 K  V  F  N  D  K  L  P  N  N  E  D  R  V  R  G  S  F  A  F         p.1840

          .         .         .         .         .         .       g.153654
 GATTCACCTCATCATTACACGCCTATTGAAGGAACTCCTTACTGTTTTTCACGAAATGAT       c.5580
 D  S  P  H  H  Y  T  P  I  E  G  T  P  Y  C  F  S  R  N  D         p.1860

          .         .         .         .         .         .       g.153714
 TCTTTGAGTTCTCTAGATTTTGATGATGATGATGTTGACCTTTCCAGGGAAAAGGCTGAA       c.5640
 S  L  S  S  L  D  F  D  D  D  D  V  D  L  S  R  E  K  A  E         p.1880

          .         .         .         .         .         .       g.153774
 TTAAGAAAGGCAAAAGAAAATAAGGAATCAGAGGCTAAAGTTACCAGCCACACAGAACTA       c.5700
 L  R  K  A  K  E  N  K  E  S  E  A  K  V  T  S  H  T  E  L         p.1900

          .         .         .         .         .         .       g.153834
 ACCTCCAACCAACAATCAGCTAATAAGACACAAGCTATTGCAAAGCAGCCAATAAATCGA       c.5760
 T  S  N  Q  Q  S  A  N  K  T  Q  A  I  A  K  Q  P  I  N  R         p.1920

          .         .         .         .         .         .       g.153894
 GGTCAGCCTAAACCCATACTTCAGAAACAATCCACTTTTCCCCAGTCATCCAAAGACATA       c.5820
 G  Q  P  K  P  I  L  Q  K  Q  S  T  F  P  Q  S  S  K  D  I         p.1940

          .         .         .         .         .         .       g.153954
 CCAGACAGAGGGGCAGCAACTGATGAAAAGTTACAGAATTTTGCTATTGAAAATACTCCG       c.5880
 P  D  R  G  A  A  T  D  E  K  L  Q  N  F  A  I  E  N  T  P         p.1960

          .         .         .         .         .         .       g.154014
 GTTTGCTTTTCTCATAATTCCTCTCTGAGTTCTCTCAGTGACATTGACCAAGAAAACAAC       c.5940
 V  C  F  S  H  N  S  S  L  S  S  L  S  D  I  D  Q  E  N  N         p.1980

          .         .         .         .         .         .       g.154074
 AATAAAGAAAATGAACCTATCAAAGAGACTGAGCCCCCTGACTCACAGGGAGAACCAAGT       c.6000
 N  K  E  N  E  P  I  K  E  T  E  P  P  D  S  Q  G  E  P  S         p.2000

          .         .         .         .         .         .       g.154134
 AAACCTCAAGCATCAGGCTATGCTCCTAAATCATTTCATGTTGAAGATACCCCAGTTTGT       c.6060
 K  P  Q  A  S  G  Y  A  P  K  S  F  H  V  E  D  T  P  V  C         p.2020

          .         .         .         .         .         .       g.154194
 TTCTCAAGAAACAGTTCTCTCAGTTCTCTTAGTATTGACTCTGAAGATGACCTGTTGCAG       c.6120
 F  S  R  N  S  S  L  S  S  L  S  I  D  S  E  D  D  L  L  Q         p.2040

          .         .         .         .         .         .       g.154254
 GAATGTATAAGCTCCGCAATGCCAAAAAAGAAAAAGCCTTCAAGACTCAAGGGTGATAAT       c.6180
 E  C  I  S  S  A  M  P  K  K  K  K  P  S  R  L  K  G  D  N         p.2060

          .         .         .         .         .         .       g.154314
 GAAAAACATAGTCCCAGAAATATGGGTGGCATATTAGGTGAAGATCTGACACTTGATTTG       c.6240
 E  K  H  S  P  R  N  M  G  G  I  L  G  E  D  L  T  L  D  L         p.2080

          .         .         .         .         .         .       g.154374
 AAAGATATACAGAGACCAGATTCAGAACATGGTCTATCCCCTGATTCAGAAAATTTTGAT       c.6300
 K  D  I  Q  R  P  D  S  E  H  G  L  S  P  D  S  E  N  F  D         p.2100

          .         .         .         .         .         .       g.154434
 TGGAAAGCTATTCAGGAAGGTGCAAATTCCATAGTAAGTAGTTTACATCAAGCTGCTGCT       c.6360
 W  K  A  I  Q  E  G  A  N  S  I  V  S  S  L  H  Q  A  A  A         p.2120

          .         .         .         .         .         .       g.154494
 GCTGCATGTTTATCTAGACAAGCTTCGTCTGATTCAGATTCCATCCTTTCCCTGAAATCA       c.6420
 A  A  C  L  S  R  Q  A  S  S  D  S  D  S  I  L  S  L  K  S         p.2140

          .         .         .         .         .         .       g.154554
 GGAATCTCTCTGGGATCACCATTTCATCTTACACCTGATCAAGAAGAAAAACCCTTTACA       c.6480
 G  I  S  L  G  S  P  F  H  L  T  P  D  Q  E  E  K  P  F  T         p.2160

          .         .         .         .         .         .       g.154614
 AGTAATAAAGGCCCACGAATTCTAAAACCAGGGGAGAAAAGTACATTGGAAACTAAAAAG       c.6540
 S  N  K  G  P  R  I  L  K  P  G  E  K  S  T  L  E  T  K  K         p.2180

          .         .         .         .         .         .       g.154674
 ATAGAATCTGAAAGTAAAGGAATCAAAGGAGGAAAAAAAGTTTATAAAAGTTTGATTACT       c.6600
 I  E  S  E  S  K  G  I  K  G  G  K  K  V  Y  K  S  L  I  T         p.2200

          .         .         .         .         .         .       g.154734
 GGAAAAGTTCGATCTAATTCAGAAATTTCAGGCCAAATGAAACAGCCCCTTCAAGCAAAC       c.6660
 G  K  V  R  S  N  S  E  I  S  G  Q  M  K  Q  P  L  Q  A  N         p.2220

          .         .         .         .         .         .       g.154794
 ATGCCTTCAATCTCTCGAGGCAGGACAATGATTCATATTCCAGGAGTTCGAAATAGCTCC       c.6720
 M  P  S  I  S  R  G  R  T  M  I  H  I  P  G  V  R  N  S  S         p.2240

          .         .         .         .         .         .       g.154854
 TCAAGTACAAGTCCTGTTTCTAAAAAAGGCCCACCCCTTAAGACTCCAGCCTCCAAAAGC       c.6780
 S  S  T  S  P  V  S  K  K  G  P  P  L  K  T  P  A  S  K  S         p.2260

          .         .         .         .         .         .       g.154914
 CCTAGTGAAGGTCAAACAGCCACCACTTCTCCTAGAGGAGCCAAGCCATCTGTGAAATCA       c.6840
 P  S  E  G  Q  T  A  T  T  S  P  R  G  A  K  P  S  V  K  S         p.2280

          .         .         .         .         .         .       g.154974
 GAATTAAGCCCTGTTGCCAGGCAGACATCCCAAATAGGTGGGTCAAGTAAAGCACCTTCT       c.6900
 E  L  S  P  V  A  R  Q  T  S  Q  I  G  G  S  S  K  A  P  S         p.2300

          .         .         .         .         .         .       g.155034
 AGATCAGGATCTAGAGATTCGACCCCTTCAAGACCTGCCCAGCAACCATTAAGTAGACCT       c.6960
 R  S  G  S  R  D  S  T  P  S  R  P  A  Q  Q  P  L  S  R  P         p.2320

          .         .         .         .         .         .       g.155094
 ATACAGTCTCCTGGCCGAAACTCAATTTCCCCTGGTAGAAATGGAATAAGTCCTCCTAAC       c.7020
 I  Q  S  P  G  R  N  S  I  S  P  G  R  N  G  I  S  P  P  N         p.2340

          .         .         .         .         .         .       g.155154
 AAATTATCTCAACTTCCAAGGACATCATCCCCTAGTACTGCTTCAACTAAGTCCTCAGGT       c.7080
 K  L  S  Q  L  P  R  T  S  S  P  S  T  A  S  T  K  S  S  G         p.2360

          .         .         .         .         .         .       g.155214
 TCTGGAAAAATGTCATATACATCTCCAGGTAGACAGATGAGCCAACAGAACCTTACCAAA       c.7140
 S  G  K  M  S  Y  T  S  P  G  R  Q  M  S  Q  Q  N  L  T  K         p.2380

          .         .         .         .         .         .       g.155274
 CAAACAGGTTTATCCAAGAATGCCAGTAGTATTCCAAGAAGTGAGTCTGCCTCCAAAGGA       c.7200
 Q  T  G  L  S  K  N  A  S  S  I  P  R  S  E  S  A  S  K  G         p.2400

          .         .         .         .         .         .       g.155334
 CTAAATCAGATGAATAATGGTAATGGAGCCAATAAAAAGGTAGAACTTTCTAGAATGTCT       c.7260
 L  N  Q  M  N  N  G  N  G  A  N  K  K  V  E  L  S  R  M  S         p.2420

          .         .         .         .         .         .       g.155394
 TCAACTAAATCAAGTGGAAGTGAATCTGATAGATCAGAAAGACCTGTATTAGTACGCCAG       c.7320
 S  T  K  S  S  G  S  E  S  D  R  S  E  R  P  V  L  V  R  Q         p.2440

          .         .         .         .         .         .       g.155454
 TCAACTTTCATCAAAGAAGCTCCAAGCCCAACCTTAAGAAGAAAATTGGAGGAATCTGCT       c.7380
 S  T  F  I  K  E  A  P  S  P  T  L  R  R  K  L  E  E  S  A         p.2460

          .         .         .         .         .         .       g.155514
 TCATTTGAATCTCTTTCTCCATCATCTAGACCAGCTTCTCCCACTAGGTCCCAGGCACAA       c.7440
 S  F  E  S  L  S  P  S  S  R  P  A  S  P  T  R  S  Q  A  Q         p.2480

          .         .         .         .         .         .       g.155574
 ACTCCAGTTTTAAGTCCTTCCCTTCCTGATATGTCTCTATCCACACATTCGTCTGTTCAG       c.7500
 T  P  V  L  S  P  S  L  P  D  M  S  L  S  T  H  S  S  V  Q         p.2500

          .         .         .         .         .         .       g.155634
 GCTGGTGGATGGCGAAAACTCCCACCTAATCTCAGTCCCACTATAGAGTATAATGATGGA       c.7560
 A  G  G  W  R  K  L  P  P  N  L  S  P  T  I  E  Y  N  D  G         p.2520

          .         .         .         .         .         .       g.155694
 AGACCAGCAAAGCGCCATGATATTGCACGGTCTCATTCTGAAAGTCCTTCTAGACTTCCA       c.7620
 R  P  A  K  R  H  D  I  A  R  S  H  S  E  S  P  S  R  L  P         p.2540

          .         .         .         .         .         .       g.155754
 ATCAATAGGTCAGGAACCTGGAAACGTGAGCACAGCAAACATTCATCATCCCTTCCTCGA       c.7680
 I  N  R  S  G  T  W  K  R  E  H  S  K  H  S  S  S  L  P  R         p.2560

          .         .         .         .         .         .       g.155814
 GTAAGCACTTGGAGAAGAACTGGAAGTTCATCTTCAATTCTTTCTGCTTCATCAGAATCC       c.7740
 V  S  T  W  R  R  T  G  S  S  S  S  I  L  S  A  S  S  E  S         p.2580

          .         .         .         .         .         .       g.155874
 AGTGAAAAAGCAAAAAGTGAGGATGAAAAACATGTGAACTCTATTTCAGGAACCAAACAA       c.7800
 S  E  K  A  K  S  E  D  E  K  H  V  N  S  I  S  G  T  K  Q         p.2600

          .         .         .         .         .         .       g.155934
 AGTAAAGAAAACCAAGTATCCGCAAAAGGAACATGGAGAAAAATAAAAGAAAATGAATTT       c.7860
 S  K  E  N  Q  V  S  A  K  G  T  W  R  K  I  K  E  N  E  F         p.2620

          .         .         .         .         .         .       g.155994
 TCTCCCACAAATAGTACTTCTCAGACCGTTTCCTCAGGTGCTACAAATGGTGCTGAATCA       c.7920
 S  P  T  N  S  T  S  Q  T  V  S  S  G  A  T  N  G  A  E  S         p.2640

          .         .         .         .         .         .       g.156054
 AAGACTCTAATTTATCAAATGGCACCTGCTGTTTCTAAAACAGAGGATGTTTGGGTGAGA       c.7980
 K  T  L  I  Y  Q  M  A  P  A  V  S  K  T  E  D  V  W  V  R         p.2660

          .         .         .         .         .         .       g.156114
 ATTGAGGACTGTCCCATTAACAATCCTAGATCTGGAAGATCTCCCACAGGTAATACTCCC       c.8040
 I  E  D  C  P  I  N  N  P  R  S  G  R  S  P  T  G  N  T  P         p.2680

          .         .         .         .         .         .       g.156174
 CCGGTGATTGACAGTGTTTCAGAAAAGGCAAATCCAAACATTAAAGATTCAAAAGATAAT       c.8100
 P  V  I  D  S  V  S  E  K  A  N  P  N  I  K  D  S  K  D  N         p.2700

          .         .         .         .         .         .       g.156234
 CAGGCAAAACAAAATGTGGGTAATGGCAGTGTTCCCATGCGTACCGTGGGTTTGGAAAAT       c.8160
 Q  A  K  Q  N  V  G  N  G  S  V  P  M  R  T  V  G  L  E  N         p.2720

          .         .         .         .         .         .       g.156294
 CGCCTGAACTCCTTTATTCAGGTGGATGCCCCTGACCAAAAAGGAACTGAGATAAAACCA       c.8220
 R  L  N  S  F  I  Q  V  D  A  P  D  Q  K  G  T  E  I  K  P         p.2740

          .         .         .         .         .         .       g.156354
 GGACAAAATAATCCTGTCCCTGTATCAGAGACTAATGAAAGTTCTATAGTGGAACGTACC       c.8280
 G  Q  N  N  P  V  P  V  S  E  T  N  E  S  S  I  V  E  R  T         p.2760

          .         .         .         .         .         .       g.156414
 CCATTCAGTTCTAGCAGCTCAAGCAAACACAGTTCACCTAGTGGGACTGTTGCTGCCAGA       c.8340
 P  F  S  S  S  S  S  S  K  H  S  S  P  S  G  T  V  A  A  R         p.2780

          .         .         .         .         .         .       g.156474
 GTGACTCCTTTTAATTACAACCCAAGCCCTAGGAAAAGCAGCGCAGATAGCACTTCAGCT       c.8400
 V  T  P  F  N  Y  N  P  S  P  R  K  S  S  A  D  S  T  S  A         p.2800

          .         .         .         .         .         .       g.156534
 CGGCCATCTCAGATCCCAACTCCAGTGAATAACAACACAAAGAAGCGAGATTCCAAAACT       c.8460
 R  P  S  Q  I  P  T  P  V  N  N  N  T  K  K  R  D  S  K  T         p.2820

          .         .         .         .         .         .       g.156594
 GACAGCACAGAATCCAGTGGAACCCAAAGTCCTAAGCGCCATTCTGGGTCTTACCTTGTG       c.8520
 D  S  T  E  S  S  G  T  Q  S  P  K  R  H  S  G  S  Y  L  V         p.2840

          .                                                         g.156606
 ACATCTGTTTAA                                                       c.8532
 T  S  V  X                                                         p.2843

          .         .         .         .         .         .       g.156666
 aagagaggaagaatgaaactaagaaaattctatgttaattacaactgctatatagacatt       c.*60

          .         .         .         .         .         .       g.156726
 ttgtttcaaatgaaactttaaaagactgaaaaattttgtaaataggtttgattcttgtta       c.*120

          .         .         .         .         .         .       g.156786
 gagggtttttgttctggaagccatatttgatagtatactttgtcttcactggtcttattt       c.*180

          .         .         .         .         .         .       g.156846
 tgggaggcactcttgatggttaggaaaaaaatagtaaagccaagtatgtttgtacagtat       c.*240

          .         .         .         .         .         .       g.156906
 gttttacatgtatttaaagtagcatcccatcccaacttcctttaattattgcttgtctta       c.*300

          .         .         .         .         .         .       g.156966
 aaataatgaacactacagatagaaaatatgatatattgctgttatcaatcatttctagat       c.*360

          .         .         .         .         .         .       g.157026
 tataaactgactaaacttacatcagggaaaaattggtatttatgcaaaaaaaaatgtttt       c.*420

          .         .         .         .         .         .       g.157086
 tgtccttgtgagtccatctaacatcataattaatcatgtggctgtgaaattcacagtaat       c.*480

          .         .         .         .         .         .       g.157146
 atggttcccgatgaacaagtttacccagcctgctttgctttactgcatgaatgaaactga       c.*540

          .         .         .         .         .         .       g.157206
 tggttcaatttcagaagtaatgattaacagttatgtggtcacatgatgtgcatagagata       c.*600

          .         .         .         .         .         .       g.157266
 gctacagtgtaataatttacactattttgtgctccaaacaaaacaaaaatctgtgtaact       c.*660

          .         .         .         .         .         .       g.157326
 gtaaaacattgaatgaaactattttacctgaactagattttatctgaaagtaggtagaat       c.*720

          .         .         .         .         .         .       g.157386
 ttttgctatgctgtaatttgttgtatattctggtatttgaggtgagatggctgctctttt       c.*780

          .         .         .         .         .         .       g.157446
 attaatgagacatgaattgtgtctcaacagaaactaaatgaacatttcagaataaattat       c.*840

          .         .         .         .         .         .       g.157506
 tgctgtatgtaaactgttactgaaattggtatttgtttgaagggtcttgtttcacatttg       c.*900

          .         .         .         .         .         .       g.157566
 tattaataattgtttaaaatgcctcttttaaaagcttatataaatttttttcttcagctt       c.*960

          .         .         .         .         .         .       g.157626
 ctatgcattaagagtaaaattcctcttactgtaataaaaacaattgaagaagactgttgc       c.*1020

          .         .         .         .         .         .       g.157686
 cacttaaccattccatgcgttggcacttatctattcctgaaatttcttttatgtgattag       c.*1080

          .         .         .         .         .         .       g.157746
 ctcatcttgatttttaatatttttccacttaaacttttttttcttactccactggagctc       c.*1140

          .         .         .         .         .         .       g.157806
 agtaaaagtaaattcatgtaatagcaatgcaagcagcctagcacagactaagcattgagc       c.*1200

          .         .         .         .         .         .       g.157866
 ataataggcccacataatttcctctttcttaatattatagaattctgtacttgaaattga       c.*1260

          .         .         .         .         .         .       g.157926
 ttcttagacattgcagtctcttcgaggctttacagtgtaaactgtcttgccccttcatct       c.*1320

          .         .         .         .         .         .       g.157986
 tcttgttgcaactgggtctgacatgaacactttttatcaccctgtatgttagggcaagat       c.*1380

          .         .         .         .         .         .       g.158046
 ctcagcagtgaagtataatcagcactttgccatgctcagaaaattcaaatcacatggaac       c.*1440

          .         .         .         .         .         .       g.158106
 tttagaggtagatttaatacgattaagatattcagaagtatattttagaatccctgcctg       c.*1500

          .         .         .         .         .         .       g.158166
 ttaaggaaactttatttgtggtaggtacagttctggggtacatgttaagtgtccccttat       c.*1560

          .         .         .         .         .         .       g.158226
 acagtggagggaagtcttccttcctgaaggaaaataaactgacacttattaactaagata       c.*1620

          .         .         .         .         .         .       g.158286
 atttacttaatatatcttccctgatttgttttaaaagatcagagggtgactgatgataca       c.*1680

          .         .         .         .         .         .       g.158346
 tgcatacatatttgttgaataaatgaaaatttatttttagtgataagattcatacactct       c.*1740

          .         .         .         .         .         .       g.158406
 gtatttggggagggaaaacctttttaagcatggtggggcactcagataggagtgaataca       c.*1800

          .         .         .         .         .         .       g.158466
 cctacctggtgccttgaaaatcacatcaagtagttaattatctaccccttacctgtgttt       c.*1860

          .         .         .         .         .         .       g.158526
 ataacttccaggtaatgagaatgattttttttaaagctaaaatgccagtaaataaaagtg       c.*1920

          .         .         .         .         .         .       g.158586
 ctatgacttgagctaagatatttgactccaatgcctgtactgtgtctactgcaccacttt       c.*1980

          .         .         .         .         .         .       g.158646
 gtaaacacttcaatttactatctttgaaatgattgacctttaaatttttgccaaatgtta       c.*2040

          .         .         .         .         .         .       g.158706
 tctgaaattgtctatgaataccatctacttctgttgttttcccaggcttccataaacaat       c.*2100

          .                                                         g.158719
 ggagatacatgca                                                      c.*2113

 (downstream sequence)

style="font-size : 15px;">

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Adenomatous Polyposis Coli protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVD v.2.0 Build 35
2004-2013 Leiden University Medical Center