v-raf murine sarcoma viral oncogene homolog B1 (BRAF) - coding DNA reference sequence

(used for variant description)

(last modified March 27, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_004333.4 in the BRAF gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007873.2, covering BRAF transcript NM_004333.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5001
                                                            c       c.-61

 .         .         .         .         .         .                g.5061
 gcctcccttccccctccccgcccgacagcggccgctcgggccccggctctcggttataag       c.-1

          .         .         .         .         .         .       g.5121
 ATGGCGGCGCTGAGCGGTGGCGGTGGTGGCGGCGCGGAGCCGGGCCAGGCTCTGTTCAAC       c.60
 M  A  A  L  S  G  G  G  G  G  G  A  E  P  G  Q  A  L  F  N         p.20

          .         .         .         .         .         .       g.5181
 GGGGACATGGAGCCCGAGGCCGGCGCCGGCGCCGGCGCCGCGGCCTCTTCGGCTGCGGAC       c.120
 G  D  M  E  P  E  A  G  A  G  A  G  A  A  A  S  S  A  A  D         p.40

          .         | 02         .         .         .         .    g.79594
 CCTGCCATTCCGGAGGAG | GTGTGGAATATCAAACAAATGATTAAGTTGACACAGGAACAT    c.180
 P  A  I  P  E  E   | V  W  N  I  K  Q  M  I  K  L  T  Q  E  H      p.60

          .         .         .         .         .         .       g.79654
 ATAGAGGCCCTATTGGACAAATTTGGTGGGGAGCATAATCCACCATCAATATATCTGGAG       c.240
 I  E  A  L  L  D  K  F  G  G  E  H  N  P  P  S  I  Y  L  E         p.80

  | 03       .         .         .         .         .         .    g.94952
  | GCCTATGAAGAATACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTG    c.300
  | A  Y  E  E  Y  T  S  K  L  D  A  L  Q  Q  R  E  Q  Q  L  L      p.100

          .         .         .         .         .         .       g.95012
 GAATCTCTGGGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTT       c.360
 E  S  L  G  N  G  T  D  F  S  V  S  S  S  A  S  M  D  T  V         p.120

          .         .         .         .         .         .       g.95072
 ACATCTTCTTCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAAT       c.420
 T  S  S  S  S  S  S  L  S  V  L  P  S  S  L  S  V  F  Q  N         p.140

          .         .         .         .         .         .       g.95132
 CCCACAGATGTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTC       c.480
 P  T  D  V  A  R  S  N  P  K  S  P  Q  K  P  I  V  R  V  F         p.160

          .         .     | 04   .         .         .         .    g.120805
 CTGCCCAACAAACAGAGGACAGTG | GTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT    c.540
 L  P  N  K  Q  R  T  V   | V  P  A  R  C  G  V  T  V  R  D  S      p.180

          .         .         .         .         .         .       g.120865
 CTAAAGAAAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATT       c.600
 L  K  K  A  L  M  M  R  G  L  I  P  E  C  C  A  V  Y  R  I         p.200

          | 05         .         .         .         .         .    g.121754
 CAGGATGG | AGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAA    c.660
 Q  D  G  |  E  K  K  P  I  G  W  D  T  D  I  S  W  L  T  G  E      p.220

          .         .         .         .         .  | 06      .    g.128213
 GAATTGCATGTGGAAGTGTTGGAGAATGTTCCACTTACAACACACAACTTT | GTACGAAAA    c.720
 E  L  H  V  E  V  L  E  N  V  P  L  T  T  H  N  F   | V  R  K      p.240

          .         .         .         .         .         .       g.128273
 ACGTTTTTCACCTTAGCATTTTGTGACTTTTGTCGAAAGCTGCTTTTCCAGGGTTTCCGC       c.780
 T  F  F  T  L  A  F  C  D  F  C  R  K  L  L  F  Q  G  F  R         p.260

          .         .         .         .         .         .       g.128333
 TGTCAAACATGTGGTTATAAATTTCACCAGCGTTGTAGTACAGAAGTTCCACTGATGTGT       c.840
 C  Q  T  C  G  Y  K  F  H  Q  R  C  S  T  E  V  P  L  M  C         p.280

          .         . | 07       .         .         .         .    g.129323
 GTTAATTATGACCAACTTGA | TTTGCTGTTTGTCTCCAAGTTCTTTGAACACCACCCAATA    c.900
 V  N  Y  D  Q  L  D  |  L  L  F  V  S  K  F  F  E  H  H  P  I      p.300

          .         .         .         .         .         .       g.129383
 CCACAGGAAGAGGCGTCCTTAGCAGAGACTGCCCTAACATCTGGATCATCCCCTTCCGCA       c.960
 P  Q  E  E  A  S  L  A  E  T  A  L  T  S  G  S  S  P  S  A         p.320

          .         . | 08       .         .         .         .    g.135337
 CCCGCCTCGGACTCTATTGG | GCCCCAAATTCTCACCAGTCCGTCTCCTTCAAAATCCATT    c.1020
 P  A  S  D  S  I  G  |  P  Q  I  L  T  S  P  S  P  S  K  S  I      p.340

          .         .         .         .         .         .       g.135397
 CCAATTCCACAGCCCTTCCGACCAGCAGATGAAGATCATCGAAATCAATTTGGGCAACGA       c.1080
 P  I  P  Q  P  F  R  P  A  D  E  D  H  R  N  Q  F  G  Q  R         p.360

          .         .         .         .         .         .       g.135457
 GACCGATCCTCATCAGCTCCCAATGTGCATATAAACACAATAGAACCTGTCAATATTGAT       c.1140
 D  R  S  S  S  A  P  N  V  H  I  N  T  I  E  P  V  N  I  D         p.380

  | 09       .         .         .        | 10.         .         . g.146630
  | GACTTGATTAGAGACCAAGGATTTCGTGGTGATGGAG | GATCAACCACAGGTTTGTCTGCT c.1200
  | D  L  I  R  D  Q  G  F  R  G  D  G  G |   S  T  T  G  L  S  A   p.400

          .         .         .         .         .         .       g.146690
 ACCCCCCCTGCCTCATTACCTGGCTCACTAACTAACGTGAAAGCCTTACAGAAATCTCCA       c.1260
 T  P  P  A  S  L  P  G  S  L  T  N  V  K  A  L  Q  K  S  P         p.420

          .         .         .         .         .     | 11   .    g.148077
 GGACCTCAGCGAGAAAGGAAGTCATCTTCATCCTCAGAAGACAGGAATCGAATG | AAAACA    c.1320
 G  P  Q  R  E  R  K  S  S  S  S  S  E  D  R  N  R  M   | K  T      p.440

          .         .         .         .         .         .       g.148137
 CTTGGTAGACGGGACTCGAGTGATGATTGGGAGATTCCTGATGGGCAGATTACAGTGGGA       c.1380
 L  G  R  R  D  S  S  D  D  W  E  I  P  D  G  Q  I  T  V  G         p.460

          .         .         .         .         .   | 12     .    g.151697
 CAAAGAATTGGATCTGGATCATTTGGAACAGTCTACAAGGGAAAGTGGCATG | GTGATGTG    c.1440
 Q  R  I  G  S  G  S  F  G  T  V  Y  K  G  K  W  H  G |   D  V      p.480

          .         .         .         .         .         .       g.151757
 GCAGTGAAAATGTTGAATGTGACAGCACCTACACCTCAGCAGTTACAAGCCTTCAAAAAT       c.1500
 A  V  K  M  L  N  V  T  A  P  T  P  Q  Q  L  Q  A  F  K  N         p.500

          .        | 13.         .         .         .         .    g.152719
 GAAGTAGGAGTACTCAG | GAAAACACGACATGTGAATATCCTACTCTTCATGGGCTATTCC    c.1560
 E  V  G  V  L  R  |  K  T  R  H  V  N  I  L  L  F  M  G  Y  S      p.520

          .         .         .         .         .         .       g.152779
 ACAAAGCCACAACTGGCTATTGTTACCCAGTGGTGTGAGGGCTCCAGCTTGTATCACCAT       c.1620
 T  K  P  Q  L  A  I  V  T  Q  W  C  E  G  S  S  L  Y  H  H         p.540

          .         .         .         .         .         .       g.152839
 CTCCATATCATTGAGACCAAATTTGAGATGATCAAACTTATAGATATTGCACGACAGACT       c.1680
 L  H  I  I  E  T  K  F  E  M  I  K  L  I  D  I  A  R  Q  T         p.560

          .     | 14   .         .         .         .         .    g.175577
 GCACAGGGCATGGA | TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAAT    c.1740
 A  Q  G  M  D  |  Y  L  H  A  K  S  I  I  H  R  D  L  K  S  N      p.580

   | 15      .         .         .         .         .         .    g.176430
 A | ATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTG    c.1800
 N |   I  F  L  H  E  D  L  T  V  K  I  G  D  F  G  L  A  T  V      p.600

          .         .         .         .         .         .       g.176490
 AAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATG       c.1860
 K  S  R  W  S  G  S  H  Q  F  E  Q  L  S  G  S  I  L  W  M         p.620

  | 16       .         .         .         .         .         .    g.180406
  | GCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATAT    c.1920
  | A  P  E  V  I  R  M  Q  D  K  N  P  Y  S  F  Q  S  D  V  Y      p.640

          .         .         .         .         .         .       g.180466
 GCATTTGGAATTGTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAAC       c.1980
 A  F  G  I  V  L  Y  E  L  M  T  G  Q  L  P  Y  S  N  I  N         p.660

          .   | 17     .         .         .         .         .    g.189866
 AACAGGGACCAG | ATAATTTTTATGGTGGGACGAGGATACCTGTCTCCAGATCTCAGTAAG    c.2040
 N  R  D  Q   | I  I  F  M  V  G  R  G  Y  L  S  P  D  L  S  K      p.680

          .         .         .         .         .         .       g.189926
 GTACGGAGTAACTGTCCAAAAGCCATGAAGAGATTAATGGCAGAGTGCCTCAAAAAGAAA       c.2100
 V  R  S  N  C  P  K  A  M  K  R  L  M  A  E  C  L  K  K  K         p.700

          .         .        | 18.         .         .         .    g.195027
 AGAGATGAGAGACCACTCTTTCCCCAA | ATTCTCGCCTCTATTGAGCTGCTGGCCCGCTCA    c.2160
 R  D  E  R  P  L  F  P  Q   | I  L  A  S  I  E  L  L  A  R  S      p.720

          .         .         .         .         .         .       g.195087
 TTGCCAAAAATTCACCGCAGTGCATCAGAACCCTCCTTGAATCGGGCTGGTTTCCAAACA       c.2220
 L  P  K  I  H  R  S  A  S  E  P  S  L  N  R  A  G  F  Q  T         p.740

          .         .         .         .         .         .       g.195147
 GAGGATTTTAGTCTATATGCTTGTGCTTCTCCAAAAACACCCATCCAGGCAGGGGGATAT       c.2280
 E  D  F  S  L  Y  A  C  A  S  P  K  T  P  I  Q  A  G  G  Y         p.760

          .         .                                               g.195168
 GGTGCGTTTCCTGTCCACTGA                                              c.2301
 G  A  F  P  V  H  X                                                p.766

          .         .         .         .         .         .       g.195228
 aacaaatgagtgagagagttcaggagagtagcaacaaaaggaaaataaatgaacatatgt       c.*60

          .         .         .         .         .         .       g.195288
 ttgcttatatgttaaattgaataaaatactctctttttttttaaggtgaaccaaagaaca       c.*120

          .         .         .         .         .         .       g.195348
 cttgtgtggttaaagactagatataatttttccccaaactaaaatttatacttaacattg       c.*180

          .         .         .         .         .         .       g.195408
 gatttttaacatccaagggttaaaatacatagacattgctaaaaattggcagagcctctt       c.*240

          .         .         .         .         .         .       g.195468
 ctagaggctttactttctgttccgggtttgtatcattcacttggttattttaagtagtaa       c.*300

          .         .         .         .         .         .       g.195528
 acttcagtttctcatgcaacttttgttgccagctatcacatgtccactagggactccaga       c.*360

          .         .         .         .         .         .       g.195588
 agaagaccctacctatgcctgtgtttgcaggtgagaagttggcagtcggttagcctgggt       c.*420

          .         .         .         .         .         .       g.195648
 tagataaggcaaactgaacagatctaatttaggaagtcagtagaatttaataattctatt       c.*480

          .         .         .         .         .         .       g.195708
 attattcttaataatttttctataactatttctttttataacaatttggaaaatgtggat       c.*540

          .         .         .         .                           g.195753
 gtcttttatttccttgaagcaataaactaagtttctttttataaa                      c.*585

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The V-raf murine sarcoma viral oncogene homolog B1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center