chromosome 6 open reading frame 221 (C6orf221) - coding DNA reference sequence

(used for mutation description)

(last modified July 20, 2012)

This file was created to facilitate the description of sequence variants on transcript NM_001017361.2 in the C6orf221 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering C6orf221 transcript NM_001017361.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5053
        tcggcctttgggtttgctgtggtgtccttgtctcctgcaggaccggccgcagc       c.-1

          .         .         .         .         .         .       g.5113
 ATGGACGCTCCCAGGCGGTTTCCGACGCTCGTGCAACTGATGCAGCCAAAAGCAATGCCA       c.60
 M  D  A  P  R  R  F  P  T  L  V  Q  L  M  Q  P  K  A  M  P         p.20

          .         .         .         .         .         .       g.5173
 GTGGAGGTGCTCGGTCACCTCCCTAAGCGGTTCTCCTGGTTCCACTCTGAGTTCCTGAAG       c.120
 V  E  V  L  G  H  L  P  K  R  F  S  W  F  H  S  E  F  L  K         p.40

          .         .         .         .          | 02        .    g.5429
 AATCCGAAGGTAGTTCGCCTTGAGGTTTGGCTGGTGGAAAAGATCTTCG | GCCGGGGCGGA    c.180
 N  P  K  V  V  R  L  E  V  W  L  V  E  K  I  F  G |   R  G  G      p.60

          .         .         .         .         .         .       g.5489
 GAACGCATCCCGCACGTCCAGGGTATGTCCCAAATCTTGATTCACGTGAATCGATTGGAC       c.240
 E  R  I  P  H  V  Q  G  M  S  Q  I  L  I  H  V  N  R  L  D         p.80

          .         .         .         .         .         .       g.5549
 CCTAACGGCGAGGCTGAGATCTTGGTATTTGGGAGGCCTTCTTACCAGGAGGACACAATC       c.300
 P  N  G  E  A  E  I  L  V  F  G  R  P  S  Y  Q  E  D  T  I         p.100

          .         .         .         .          | 03        .    g.5890
 AAGATGATCATGAACCTGGCTGACTATCACCGCCAGCTCCAGGCGAAAG | GCTCAGGAAAG    c.360
 K  M  I  M  N  L  A  D  Y  H  R  Q  L  Q  A  K  G |   S  G  K      p.120

          .         .         .         .         .         .       g.5950
 GCCCTCGCCCAGGATGTCGCCACTCAGAAGGCCGAGACCCAGCGGTCTTCAATAGAAGTC       c.420
 A  L  A  Q  D  V  A  T  Q  K  A  E  T  Q  R  S  S  I  E  V         p.140

          .         .         .         .         .         .       g.6010
 CGGGAGGCCGGGACGCAGCGTTCGGTGGAGGTCCGGGAGGCCGGGACCCAGCGTTCGGTG       c.480
 R  E  A  G  T  Q  R  S  V  E  V  R  E  A  G  T  Q  R  S  V         p.160

          .         .         .         .         .         .       g.6070
 GAAGTCCAGGAGGTCGGGACACAGGGTTCTCCGGTGGAGGTGCAGGAGGCCGGGACCCAG       c.540
 E  V  Q  E  V  G  T  Q  G  S  P  V  E  V  Q  E  A  G  T  Q         p.180

          .         .         .         .         .         .       g.6130
 CAGTCTCTCCAGGCTGCCAACAAGTCGGGGACCCAGCGATCCCCCGAAGCTGCCAGCAAG       c.600
 Q  S  L  Q  A  A  N  K  S  G  T  Q  R  S  P  E  A  A  S  K         p.200

          .         .         .         .         .                 g.6184
 GCAGTGACCCAGCGGTTTCGCGAGGATGCCCGGGACCCAGTTACTAGATTATGA             c.654
 A  V  T  Q  R  F  R  E  D  A  R  D  P  V  T  R  L  X               p.217

          .         .         .         .         .         .       g.6244
 aggcatctcaggccctggagccagagccagtcaggggttaaagtgaaagcccgtatttcc       c.*60

          .         .         .         .         .         .       g.6304
 gcccagaagctggggttggggagaggatgtggattttttgttttaccctttctgttgcat       c.*120

          .         .         .         .         .         .       g.6364
 ggttgcaaacacaaacttgagttctaataaagaattgcaaagtggaagcccgccccccgc       c.*180

          .         .         .         .         .         .       g.6424
 ctcccccccgcctcacttaagtccaggaagctggggtggcgaggaaggatgatgtggatt       c.*240

          .         .         .         .         .         .       g.6484
 gtttttgttttacaccttctgttgaatggttgccaacacaaacttgagttctaataaata       c.*300

          .                                                         g.6499
 attgcatttccctaa                                                    c.*315

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Chromosome 6 open reading frame 221 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.