carbonic anhydrase IV (CA4) - coding DNA reference sequence

(used for variant description)

(last modified February 27, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_000717.3 in the CA4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012050.1, covering CA4 transcript NM_000717.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5034
                           cgctataaaacccaggccggcaggatcgctgcac       c.-61

 .         .         .         .         .         .                g.5094
 ccgcggcggcctcctcggtgcgcgacccccggctcagaggactctttgctgtcccgcaag       c.-1

          .         .         .         .         .         | 02    g.10375
 ATGCGGATGCTGCTGGCGCTCCTGGCCCTCTCCGCGGCGCGGCCATCGGCCAGTGCAG | AG    c.60
 M  R  M  L  L  A  L  L  A  L  S  A  A  R  P  S  A  S  A  E |       p.20

          .         .         .         .         .   | 03     .    g.11627
 TCACACTGGTGCTACGAGGTTCAAGCCGAGTCCTCCAACTACCCCTGCTTGG | TGCCAGTC    c.120
 S  H  W  C  Y  E  V  Q  A  E  S  S  N  Y  P  C  L  V |   P  V      p.40

          .         .         .         .         .         .       g.11687
 AAGTGGGGTGGAAACTGCCAGAAGGACCGCCAGTCCCCCATCAACATCGTCACCACCAAG       c.180
 K  W  G  G  N  C  Q  K  D  R  Q  S  P  I  N  I  V  T  T  K         p.60

          .         .         .         .         .         .       g.11747
 GCAAAGGTGGACAAAAAACTGGGACGCTTCTTCTTCTCTGGCTACGATAAGAAGCAAACG       c.240
 A  K  V  D  K  K  L  G  R  F  F  F  S  G  Y  D  K  K  Q  T         p.80

          .         .         | 04         .         .         .    g.12518
 TGGACTGTCCAAAATAACGGGCACTCAG | TGATGATGTTGCTGGAGAACAAGGCCAGCATT    c.300
 W  T  V  Q  N  N  G  H  S  V |   M  M  L  L  E  N  K  A  S  I      p.100

          .         .         .         .         .         .       g.12578
 TCTGGAGGAGGACTGCCTGCCCCATACCAGGCCAAACAGTTGCACCTGCACTGGTCCGAC       c.360
 S  G  G  G  L  P  A  P  Y  Q  A  K  Q  L  H  L  H  W  S  D         p.120

          .         .         .         .         .     | 05   .    g.12755
 TTGCCATATAAGGGCTCGGAGCACAGCCTCGATGGGGAGCACTTTGCCATGGAG | ATGCAC    c.420
 L  P  Y  K  G  S  E  H  S  L  D  G  E  H  F  A  M  E   | M  H      p.140

          .         .         .         .         .         .       g.12815
 ATAGTACATGAGAAAGAGAAGGGGACATCGAGGAATGTGAAAGAGGCCCAGGACCCTGAA       c.480
 I  V  H  E  K  E  K  G  T  S  R  N  V  K  E  A  Q  D  P  E         p.160

          .         .         .    | 06    .         .         .    g.13147
 GACGAAATTGCGGTGCTGGCCTTTCTGGTGGAG | GCTGGAACCCAGGTGAACGAGGGCTTC    c.540
 D  E  I  A  V  L  A  F  L  V  E   | A  G  T  Q  V  N  E  G  F      p.180

          .         .         .         . | 07       .         .    g.13362
 CAGCCACTGGTGGAGGCACTGTCTAATATCCCCAAACCTG | AGATGAGCACTACGATGGCA    c.600
 Q  P  L  V  E  A  L  S  N  I  P  K  P  E |   M  S  T  T  M  A      p.200

          .         .         .         .         .         .       g.13422
 GAGAGCAGCCTGTTGGACCTGCTCCCCAAGGAGGAGAAACTGAGGCACTACTTCCGCTAC       c.660
 E  S  S  L  L  D  L  L  P  K  E  E  K  L  R  H  Y  F  R  Y         p.220

          .         .         .         .         .         .       g.13482
 CTGGGCTCACTCACCACACCGACCTGCGATGAGAAGGTCGTCTGGACTGTGTTCCGGGAG       c.720
 L  G  S  L  T  T  P  T  C  D  E  K  V  V  W  T  V  F  R  E         p.240

          .         .     | 08   .         .         .         .    g.14325
 CCCATTCAGCTTCACAGAGAACAG | ATCCTGGCATTCTCTCAGAAGCTGTACTACGACAAG    c.780
 P  I  Q  L  H  R  E  Q   | I  L  A  F  S  Q  K  L  Y  Y  D  K      p.260

          .         .         .         .         .         .       g.14385
 GAACAGACAGTGAGCATGAAGGACAATGTCAGGCCCCTGCAGCAGCTGGGGCAGCGCACG       c.840
 E  Q  T  V  S  M  K  D  N  V  R  P  L  Q  Q  L  G  Q  R  T         p.280

          .         .         .         .         .         .       g.14445
 GTGATAAAGTCCGGGGCCCCGGGTCGGCCGCTGCCCTGGGCCCTGCCTGCCCTGCTGGGC       c.900
 V  I  K  S  G  A  P  G  R  P  L  P  W  A  L  P  A  L  L  G         p.300

          .         .         .                                     g.14484
 CCCATGCTGGCCTGCCTGCTGGCCGGCTTCCTGCGATGA                            c.939
 P  M  L  A  C  L  L  A  G  F  L  R  X                              p.312

          .         .         .         .         .         .       g.14544
 tggctcacttctgcacgcagcctctctgttgcctcagctctccaagttccaggcttccgg       c.*60

          .         .         .         .         .         .       g.14604
 tccttagccttcccaggtgggactttaggcatgattaaaatatggacatatttttggaga       c.*120

                                                                    g.14606
 aa                                                                 c.*122

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Carbonic anhydrase IV protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center