centrosomal protein 290kDa (CEP290) - coding DNA reference sequence

(used for variant description)

(last modified February 27, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_025114.3 in the CEP290 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008417.1, covering CEP290 transcript NM_025114.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5044
                 atttgaagtcctcgttccacgccttctcatcatcctgaacaccg       c.-301

 .         .         .         .         .         .                g.5104
 agctctgggactccggcggagaatctaaacgtaaagcatcacccacggtcgtgaactgta       c.-241

 .         .         .         .         .         .                g.5164
 ggctctcctggcatccgggatcttattctggccttggcggagttggggatggtgtcgcct       c.-181

 .         .         .         .         .         .                g.5224
 agcagccgctgccgctttggcttgctcgggaccatttggctggacccagagtccgcgtgg       c.-121

 .         .         .         .         .         .                g.5284
 aaccgcgatagggatctgtcagggcccgcggccgggtccagcttggtggttgcggtagtg       c.-61

 .         .         .         .   | 02     .         .             g.5909
 agaggcctccgctggttgccaggcttggtctag | aggtggagcacagtgaaagaattcaag    c.-1

          .         .         .         .         .         .       g.5969
 ATGCCACCTAATATAAACTGGAAAGAAATAATGAAAGTTGACCCAGATGACCTGCCCCGT       c.60
 M  P  P  N  I  N  W  K  E  I  M  K  V  D  P  D  D  L  P  R         p.20

          .         .         .         .   | 03     .         .    g.6201
 CAAGAAGAACTGGCAGATAATTTATTGATTTCCTTATCCAAG | GTGGAAGTAAATGAGCTA    c.120
 Q  E  E  L  A  D  N  L  L  I  S  L  S  K   | V  E  V  N  E  L      p.40

          .         .         .         .         .         .       g.6261
 AAAAGTGAAAAGCAAGAAAATGTGATACACCTTTTCAGAATTACTCAGTCACTAATGAAG       c.180
 K  S  E  K  Q  E  N  V  I  H  L  F  R  I  T  Q  S  L  M  K         p.60

  | 04       .         .         .         .         .         .    g.7712
  | ATGAAAGCTCAAGAAGTGGAGCTGGCTTTGGAAGAAGTAGAAAAAGCTGGAGAAGAACAA    c.240
  | M  K  A  Q  E  V  E  L  A  L  E  E  V  E  K  A  G  E  E  Q      p.80

          . | 05       .         .         .         .        | 06. g.10433
 GCAAAATTTG | AAAATCAATTAAAAACTAAAGTAATGAAACTGGAAAATGAACTGGAG | ATG c.300
 A  K  F  E |   N  Q  L  K  T  K  V  M  K  L  E  N  E  L  E   | M   p.100

          .         .         .         .         .         .       g.10493
 GCTCAGCAGTCTGCAGGTGGACGAGATACTCGGTTTTTACGTAATGAAATTTGCCAACTT       c.360
 A  Q  Q  S  A  G  G  R  D  T  R  F  L  R  N  E  I  C  Q  L         p.120

          .         .         .         .         .         .       g.10553
 GAAAAACAATTAGAACAAAAAGATAGAGAATTGGAGGACATGGAAAAGGAGTTGGAGAAA       c.420
 E  K  Q  L  E  Q  K  D  R  E  L  E  D  M  E  K  E  L  E  K         p.140

          .         .  | 07      .         .         .         .    g.16037
 GAGAAGAAAGTTAATGAGCAA | TTGGCTCTTCGAAATGAGGAGGCAGAAAATGAAAACAGC    c.480
 E  K  K  V  N  E  Q   | L  A  L  R  N  E  E  A  E  N  E  N  S      p.160

          .      | 08  .         .       | 09 .         .         . g.16820
 AAATTAAGAAGAGAG | AACAAACGTCTAAAGAAAAAG | AATGAACAACTTTGTCAGGATATT c.540
 K  L  R  R  E   | N  K  R  L  K  K  K   | N  E  Q  L  C  Q  D  I   p.180

          .         .         .         .         .         .       g.16880
 ATTGACTACCAGAAACAAATAGATTCACAGAAAGAAACACTTTTATCAAGAAGAGGGGAA       c.600
 I  D  Y  Q  K  Q  I  D  S  Q  K  E  T  L  L  S  R  R  G  E         p.200

          .         .         .         .         .         .       g.16940
 GACAGTGACTACCGATCACAGTTGTCTAAAAAAAACTATGAGCTTATCCAATATCTTGAT       c.660
 D  S  D  Y  R  S  Q  L  S  K  K  N  Y  E  L  I  Q  Y  L  D         p.220

           | 10        .         .         .         .         .    g.17391
 GAAATTCAG | ACTTTAACAGAAGCTAATGAGAAAATTGAAGTTCAGAATCAAGAAATGAGA    c.720
 E  I  Q   | T  L  T  E  A  N  E  K  I  E  V  Q  N  Q  E  M  R      p.240

          .         .         .         .         .         .       g.17451
 AAAAATTTAGAAGAGTCTGTACAGGAAATGGAGAAGATGACTGATGAATATAATAGAATG       c.780
 K  N  L  E  E  S  V  Q  E  M  E  K  M  T  D  E  Y  N  R  M         p.260

          .         .         .         .         .         .       g.17511
 AAAGCTATTGTGCATCAGACAGATAATGTAATAGATCAGTTAAAAAAAGAAAACGATCAT       c.840
 K  A  I  V  H  Q  T  D  N  V  I  D  Q  L  K  K  E  N  D  H         p.280

          .   | 11     .         .         .         .         .    g.18229
 TATCAACTTCAA | GTGCAGGAGCTTACAGATCTTCTGAAATCAAAAAATGAAGAAGATGAT    c.900
 Y  Q  L  Q   | V  Q  E  L  T  D  L  L  K  S  K  N  E  E  D  D      p.300

          .         .         .         .   | 12     .         .    g.20796
 CCAATTATGGTAGCTGTCAATGCAAAAGTAGAAGAATGGAAG | CTAATTTTGTCTTCTAAA    c.960
 P  I  M  V  A  V  N  A  K  V  E  E  W  K   | L  I  L  S  S  K      p.320

          .         .         .         .         .         .       g.20856
 GATGATGAAATTATTGAGTATCAGCAAATGTTACATAACCTAAGGGAGAAACTTAAGAAT       c.1020
 D  D  E  I  I  E  Y  Q  Q  M  L  H  N  L  R  E  K  L  K  N         p.340

          .         .         .         .      | 13  .         .    g.21862
 GCTCAGCTTGATGCTGATAAAAGTAATGTTATGGCTCTACAGCAG | GGTATACAGGAACGA    c.1080
 A  Q  L  D  A  D  K  S  N  V  M  A  L  Q  Q   | G  I  Q  E  R      p.360

          .         .         .         .         .         .       g.21922
 GACAGTCAAATTAAGATGCTCACCGAACAAGTAGAACAATATACAAAAGAAATGGAAAAG       c.1140
 D  S  Q  I  K  M  L  T  E  Q  V  E  Q  Y  T  K  E  M  E  K         p.380

          .         .         .         .          | 14        .    g.26061
 AATACTTGTATTATTGAAGATTTGAAAAATGAGCTCCAAAGAAACAAAG | GTGCTTCAACC    c.1200
 N  T  C  I  I  E  D  L  K  N  E  L  Q  R  N  K  G |   A  S  T      p.400

          .         .         .         .         .         .       g.26121
 CTTTCTCAACAGACTCATATGAAAATTCAGTCAACGTTAGACATTTTAAAAGAGAAAACT       c.1260
 L  S  Q  Q  T  H  M  K  I  Q  S  T  L  D  I  L  K  E  K  T         p.420

          .         .         .         .         .         .       g.26181
 AAAGAGGCTGAGAGAACAGCTGAACTGGCTGAGGCTGATGCTAGGGAAAAGGATAAAGAA       c.1320
 K  E  A  E  R  T  A  E  L  A  E  A  D  A  R  E  K  D  K  E         p.440

          .         .         .          | 15        .         .    g.26961
 TTAGTTGAGGCTCTGAAGAGGTTAAAAGATTATGAATCG | GGAGTATATGGTTTAGAAGAT    c.1380
 L  V  E  A  L  K  R  L  K  D  Y  E  S   | G  V  Y  G  L  E  D      p.460

          .         .         .         .         .         .       g.27021
 GCTGTCGTTGAAATAAAGAATTGTAAAAACCAAATTAAAATAAGAGATCGAGAGATTGAA       c.1440
 A  V  V  E  I  K  N  C  K  N  Q  I  K  I  R  D  R  E  I  E         p.480

          .         .         .         .         .         .       g.27081
 ATATTAACAAAGGAAATCAATAAACTTGAATTGAAGATCAGTGATTTCCTTGATGAAAAT       c.1500
 I  L  T  K  E  I  N  K  L  E  L  K  I  S  D  F  L  D  E  N         p.500

          .         .   | 16     .         .         .         .    g.28511
 GAGGCACTTAGAGAGCGTGTGG | GCCTTGAACCAAAGACAATGATTGATTTAACTGAATTT    c.1560
 E  A  L  R  E  R  V  G |   L  E  P  K  T  M  I  D  L  T  E  F      p.520

          .         .         .         .         .         .       g.28571
 AGAAATAGCAAACACTTAAAACAGCAGCAGTACAGAGCTGAAAACCAGATTCTTTTGAAA       c.1620
 R  N  S  K  H  L  K  Q  Q  Q  Y  R  A  E  N  Q  I  L  L  K         p.540

     | 17    .         .         .         .         .         .    g.28703
 GAG | ATTGAAAGTCTAGAGGAAGAACGACTTGATCTGAAAAAAAAAATTCGTCAAATGGCT    c.1680
 E   | I  E  S  L  E  E  E  R  L  D  L  K  K  K  I  R  Q  M  A      p.560

          .         .         .  | 18      .         .         .    g.30100
 CAAGAAAGAGGAAAAAGAAGTGCAACTTCAG | GATTAACCACTGAGGACCTGAACCTAACT    c.1740
 Q  E  R  G  K  R  S  A  T  S  G |   L  T  T  E  D  L  N  L  T      p.580

          .         .         .         .         .         .       g.30160
 GAAAACATTTCTCAAGGAGATAGAATAAGTGAAAGAAAATTGGATTTATTGAGCCTCAAA       c.1800
 E  N  I  S  Q  G  D  R  I  S  E  R  K  L  D  L  L  S  L  K         p.600

          .         .     | 19   .         .         .         .    g.32070
 AATATGAGTGAAGCACAATCAAAG | AATGAATTTCTTTCAAGAGAACTAATTGAAAAAGAA    c.1860
 N  M  S  E  A  Q  S  K   | N  E  F  L  S  R  E  L  I  E  K  E      p.620

          .         .         .         .          | 20        .    g.32665
 AGAGATTTAGAAAGGAGTAGGACAGTGATAGCCAAATTTCAGAATAAAT | TAAAAGAATTA    c.1920
 R  D  L  E  R  S  R  T  V  I  A  K  F  Q  N  K  L |   K  E  L      p.640

          .         .         .         .         .         .       g.32725
 GTTGAAGAAAATAAGCAACTTGAAGAAGGTATGAAAGAAATATTGCAAGCAATTAAGGAA       c.1980
 V  E  E  N  K  Q  L  E  E  G  M  K  E  I  L  Q  A  I  K  E         p.660

          .         .         .         .         .         .       g.32785
 ATGCAGAAAGATCCTGATGTTAAAGGAGGAGAAACATCTCTAATTATCCCTAGCCTTGAA       c.2040
 M  Q  K  D  P  D  V  K  G  G  E  T  S  L  I  I  P  S  L  E         p.680

          .   | 21     .         .         .         .         .    g.35406
 AGACTAGTTAAT | GCTATAGAATCAAAGAATGCAGAAGGAATCTTTGATGCGAGTCTGCAT    c.2100
 R  L  V  N   | A  I  E  S  K  N  A  E  G  I  F  D  A  S  L  H      p.700

          .         .         .         .         .         .       g.35466
 TTGAAAGCCCAAGTTGATCAGCTTACCGGAAGAAATGAAGAATTAAGACAGGAGCTCAGG       c.2160
 L  K  A  Q  V  D  Q  L  T  G  R  N  E  E  L  R  Q  E  L  R         p.720

          .         .         .         .         .        | 22.    g.35868
 GAATCTCGGAAAGAGGCTATAAATTATTCACAGCAGTTGGCAAAAGCTAATTTAAAG | ATA    c.2220
 E  S  R  K  E  A  I  N  Y  S  Q  Q  L  A  K  A  N  L  K   | I      p.740

          .         .         .         .         .         .       g.35928
 GACCATCTTGAAAAAGAAACTAGTCTTTTACGACAATCAGAAGGATCGAATGTTGTTTTT       c.2280
 D  H  L  E  K  E  T  S  L  L  R  Q  S  E  G  S  N  V  V  F         p.760

          .         .         .         .         .         .       g.35988
 AAAGGAATTGACTTACCTGATGGGATAGCACCATCTAGTGCCAGTATCATTAATTCTCAG       c.2340
 K  G  I  D  L  P  D  G  I  A  P  S  S  A  S  I  I  N  S  Q         p.780

          .         .        | 23.         .         .         .    g.38068
 AATGAATATTTAATACATTTGTTACAG | GAACTAGAAAATAAAGAAAAAAAGTTAAAGAAT    c.2400
 N  E  Y  L  I  H  L  L  Q   | E  L  E  N  K  E  K  K  L  K  N      p.800

          .         .         .         .         .         .       g.38128
 TTAGAAGATTCTCTTGAAGATTACAACAGAAAATTTGCTGTAATTCGTCATCAACAAAGT       c.2460
 L  E  D  S  L  E  D  Y  N  R  K  F  A  V  I  R  H  Q  Q  S         p.820

          .         .    | 24    .         .         .         .    g.40155
 TTGTTGTATAAAGAATACCTAAG | TGAAAAGGAGACCTGGAAAACAGAATCTAAAACAATA    c.2520
 L  L  Y  K  E  Y  L  S  |  E  K  E  T  W  K  T  E  S  K  T  I      p.840

          .         .         .         .         .         .       g.40215
 AAAGAGGAAAAGAGAAAACTTGAGGATCAAGTCCAACAAGATGCTATAAAAGTAAAAGAA       c.2580
 K  E  E  K  R  K  L  E  D  Q  V  Q  Q  D  A  I  K  V  K  E         p.860

        | 25 .         .         .         .         .         .    g.40365
 TATAAT | AATTTGCTCAATGCTCTTCAGATGGATTCGGATGAAATGAAAAAAATACTTGCA    c.2640
 Y  N   | N  L  L  N  A  L  Q  M  D  S  D  E  M  K  K  I  L  A      p.880

          .         .         .         .         .         .       g.40425
 GAAAATAGTAGGAAAATTACTGTTTTGCAAGTGAATGAAAAATCACTTATAAGGCAATAT       c.2700
 E  N  S  R  K  I  T  V  L  Q  V  N  E  K  S  L  I  R  Q  Y         p.900

          .         .         .         .         .         .       g.40485
 ACAACCTTAGTAGAATTGGAGCGACAACTTAGAAAAGAAAATGAGAAGCAAAAGAATGAA       c.2760
 T  T  L  V  E  L  E  R  Q  L  R  K  E  N  E  K  Q  K  N  E         p.920

          .         .         .         .         .        | 26.    g.44208
 TTGTTGTCAATGGAGGCTGAAGTTTGTGAAAAAATTGGGTGTTTGCAAAGATTTAAG | GAA    c.2820
 L  L  S  M  E  A  E  V  C  E  K  I  G  C  L  Q  R  F  K   | E      p.940

          .         .         .         .         .         .       g.44268
 ATGGCCATTTTCAAGATTGCAGCTCTCCAAAAAGTTGTAGATAATAGTGTTTCTTTGTCT       c.2880
 M  A  I  F  K  I  A  A  L  Q  K  V  V  D  N  S  V  S  L  S         p.960

          .         .         .         .         .         .       g.44328
 GAACTAGAACTGGCTAATAAACAGTACAATGAACTGACTGCTAAGTACAGGGACATCTTG       c.2940
 E  L  E  L  A  N  K  Q  Y  N  E  L  T  A  K  Y  R  D  I  L         p.980

          .         .         .         .         .  | 27      .    g.50226
 CAAAAAGATAATATGCTTGTTCAAAGAACAAGTAACTTGGAACACCTGGAG | TGTGAAAAC    c.3000
 Q  K  D  N  M  L  V  Q  R  T  S  N  L  E  H  L  E   | C  E  N      p.1000

          .         .         .         .         .         .       g.50286
 ATCTCCTTAAAAGAACAAGTGGAGTCTATAAATAAAGAACTGGAGATTACCAAGGAAAAA       c.3060
 I  S  L  K  E  Q  V  E  S  I  N  K  E  L  E  I  T  K  E  K         p.1020

          .         .         .         .    | 28    .         .    g.53258
 CTTCACACTATTGAACAAGCCTGGGAACAGGAAACTAAATTAG | GTAATGAATCTAGCATG    c.3120
 L  H  T  I  E  Q  A  W  E  Q  E  T  K  L  G |   N  E  S  S  M      p.1040

          .         .         .         .         .         .       g.53318
 GATAAGGCAAAGAAATCAATAACCAACAGTGACATTGTTTCCATTTCAAAAAAAATAACT       c.3180
 D  K  A  K  K  S  I  T  N  S  D  I  V  S  I  S  K  K  I  T         p.1060

          .         .         .         .         .         .       g.53378
 ATGCTGGAAATGAAGGAATTAAATGAAAGGCAGCGGGCTGAACATTGTCAAAAAATGTAT       c.3240
 M  L  E  M  K  E  L  N  E  R  Q  R  A  E  H  C  Q  K  M  Y         p.1080

          .         .         .         .         .         .       g.53438
 GAACACTTACGGACTTCGTTAAAGCAAATGGAGGAACGTAATTTTGAATTGGAAACCAAA       c.3300
 E  H  L  R  T  S  L  K  Q  M  E  E  R  N  F  E  L  E  T  K         p.1100

           | 29        .         .         .         .         .    g.54435
 TTTGCTGAG | CTTACCAAAATCAATTTGGATGCACAGAAGGTGGAACAGATGTTAAGAGAT    c.3360
 F  A  E   | L  T  K  I  N  L  D  A  Q  K  V  E  Q  M  L  R  D      p.1120

          .         .         .         .         .         .       g.54495
 GAATTAGCTGATAGTGTGAGCAAGGCAGTAAGTGATGCTGATAGGCAACGGATTCTAGAA       c.3420
 E  L  A  D  S  V  S  K  A  V  S  D  A  D  R  Q  R  I  L  E         p.1140

          .         .         .         .  | 30      .         .    g.56396
 TTAGAGAAGAATGAAATGGAACTAAAAGTTGAAGTGTCAAA | ACTGAGAGAGATTTCTGAT    c.3480
 L  E  K  N  E  M  E  L  K  V  E  V  S  K  |  L  R  E  I  S  D      p.1160

          .         .         .         .         .         .       g.56456
 ATTGCCAGAAGACAAGTTGAAATTTTGAATGCACAACAACAATCTAGGGACAAGGAAGTA       c.3540
 I  A  R  R  Q  V  E  I  L  N  A  Q  Q  Q  S  R  D  K  E  V         p.1180

          .         .         .    | 31    .         .         .    g.57756
 GAGTCCCTCAGAATGCAACTGCTAGACTATCAG | GCACAGTCTGATGAAAAGTCGCTCATT    c.3600
 E  S  L  R  M  Q  L  L  D  Y  Q   | A  Q  S  D  E  K  S  L  I      p.1200

          .         .         .         .         .         .       g.57816
 GCCAAGTTGCACCAACATAATGTCTCTCTTCAACTGAGTGAGGCTACTGCTCTTGGTAAG       c.3660
 A  K  L  H  Q  H  N  V  S  L  Q  L  S  E  A  T  A  L  G  K         p.1220

          .         .         .         .         .         .       g.57876
 TTGGAGTCAATTACATCTAAACTGCAGAAGATGGAGGCCTACAACTTGCGCTTAGAGCAG       c.3720
 L  E  S  I  T  S  K  L  Q  K  M  E  A  Y  N  L  R  L  E  Q         p.1240

          .         .         .         .         .         .       g.57936
 AAACTTGATGAAAAAGAACAGGCTCTCTATTATGCTCGTTTGGAGGGAAGAAACAGAGCA       c.3780
 K  L  D  E  K  E  Q  A  L  Y  Y  A  R  L  E  G  R  N  R  A         p.1260

          .         .         .         .         .         .       g.57996
 AAACATCTGCGCCAAACAATTCAGTCTCTACGACGACAGTTTAGTGGAGCTTTACCCTTG       c.3840
 K  H  L  R  Q  T  I  Q  S  L  R  R  Q  F  S  G  A  L  P  L         p.1280

          .         .         .         .         .         .       g.58056
 GCACAACAGGAAAAGTTCTCCAAAACAATGATTCAACTACAAAATGACAAACTTAAGATA       c.3900
 A  Q  Q  E  K  F  S  K  T  M  I  Q  L  Q  N  D  K  L  K  I         p.1300

          .         .         .         .         .         .       g.58116
 ATGCAAGAAATGAAAAATTCTCAACAAGAACATAGAAATATGGAGAACAAAACATTGGAG       c.3960
 M  Q  E  M  K  N  S  Q  Q  E  H  R  N  M  E  N  K  T  L  E         p.1320

          .         .         .         .         .         .       g.58176
 ATGGAATTAAAATTAAAGGGCCTGGAAGAGTTAATAAGCACTTTAAAGGATACCAAAGGA       c.4020
 M  E  L  K  L  K  G  L  E  E  L  I  S  T  L  K  D  T  K  G         p.1340

           | 32        .         .         .         .         .    g.59323
 GCCCAAAAG | GTAATCAACTGGCATATGAAAATAGAAGAACTTCGTCTTCAAGAACTTAAA    c.4080
 A  Q  K   | V  I  N  W  H  M  K  I  E  E  L  R  L  Q  E  L  K      p.1360

          .         .         .         .         .         .       g.59383
 CTAAATCGGGAATTAGTCAAGGATAAAGAAGAAATAAAATATTTGAATAACATAATTTCT       c.4140
 L  N  R  E  L  V  K  D  K  E  E  I  K  Y  L  N  N  I  I  S         p.1380

          .         .         .         .         .     | 33   .    g.60724
 GAATATGAACGTACAATCAGCAGTCTTGAAGAAGAAATTGTGCAACAGAACAAG | TTTCAT    c.4200
 E  Y  E  R  T  I  S  S  L  E  E  E  I  V  Q  Q  N  K   | F  H      p.1400

          .         .         .         .         .         .       g.60784
 GAAGAAAGACAAATGGCCTGGGATCAAAGAGAAGTTGACCTGGAACGCCAACTAGACATT       c.4260
 E  E  R  Q  M  A  W  D  Q  R  E  V  D  L  E  R  Q  L  D  I         p.1420

          .         .         .         .   | 34     .         .    g.61061
 TTTGACCGTCAGCAAAATGAAATACTAAATGCGGCACAAAAG | TTTGAAGAAGCTACAGGA    c.4320
 F  D  R  Q  Q  N  E  I  L  N  A  A  Q  K   | F  E  E  A  T  G      p.1440

          .         .         .         .         .         .       g.61121
 TCAATCCCTGACCCTAGTTTGCCCCTTCCAAATCAACTTGAGATCGCTCTAAGGAAAATT       c.4380
 S  I  P  D  P  S  L  P  L  P  N  Q  L  E  I  A  L  R  K  I         p.1460

          .         .         .         .         .        | 35.    g.62367
 AAGGAGAACATTCGAATAATTCTAGAAACACGGGCAACTTGCAAATCACTAGAAGAG | AAA    c.4440
 K  E  N  I  R  I  I  L  E  T  R  A  T  C  K  S  L  E  E   | K      p.1480

          .         .         .         .         .         .       g.62427
 CTAAAAGAGAAAGAATCTGCTTTAAGGTTAGCAGAACAAAATATACTGTCAAGAGACAAA       c.4500
 L  K  E  K  E  S  A  L  R  L  A  E  Q  N  I  L  S  R  D  K         p.1500

          .         .         .         .         .         .       g.62487
 GTAATCAATGAACTGAGGCTTCGATTGCCTGCCACTGCAGAAAGAGAAAAGCTCATAGCT       c.4560
 V  I  N  E  L  R  L  R  L  P  A  T  A  E  R  E  K  L  I  A         p.1520

          .         .         .         .         .         .       g.62547
 GAGCTAGGCAGAAAAGAGATGGAACCAAAATCTCACCACACATTGAAAATTGCTCATCAA       c.4620
 E  L  G  R  K  E  M  E  P  K  S  H  H  T  L  K  I  A  H  Q         p.1540

          .         .         .         .         .         .       g.62607
 ACCATTGCAAACATGCAAGCAAGGTTAAATCAAAAAGAAGAAGTATTAAAGAAGTATCAA       c.4680
 T  I  A  N  M  Q  A  R  L  N  Q  K  E  E  V  L  K  K  Y  Q         p.1560

          .         .     | 36   .         .         .         .    g.63298
 CGTCTTCTAGAAAAAGCCAGAGAG | GAGCAAAGAGAAATTGTGAAGAAACATGAGGAAGAC    c.4740
 R  L  L  E  K  A  R  E   | E  Q  R  E  I  V  K  K  H  E  E  D      p.1580

          .         .         .         .         .         .       g.63358
 CTTCATATTCTTCATCACAGATTAGAACTACAGGCTGATAGTTCACTAAATAAATTCAAA       c.4800
 L  H  I  L  H  H  R  L  E  L  Q  A  D  S  S  L  N  K  F  K         p.1600

          .   | 37     .         .         .         .         .    g.64034
 CAAACGGCTTGG | GATTTAATGAAACAGTCTCCCACTCCAGTTCCTACCAACAAGCATTTT    c.4860
 Q  T  A  W   | D  L  M  K  Q  S  P  T  P  V  P  T  N  K  H  F      p.1620

          .         .         .         .         .         .       g.64094
 ATTCGTCTGGCTGAGATGGAACAGACAGTAGCAGAACAAGATGACTCTCTTTCCTCACTC       c.4920
 I  R  L  A  E  M  E  Q  T  V  A  E  Q  D  D  S  L  S  S  L         p.1640

          .         .         .         .         .         .       g.64154
 TTGGTCAAACTAAAGAAAGTATCACAAGATTTGGAGAGACAAAGAGAAATCACTGAATTA       c.4980
 L  V  K  L  K  K  V  S  Q  D  L  E  R  Q  R  E  I  T  E  L         p.1660

          .         .         .   | 38     .         .         .    g.66849
 AAAGTAAAAGAATTTGAAAATATCAAATTACA | GCTTCAAGAAAACCATGAAGATGAAGTG    c.5040
 K  V  K  E  F  E  N  I  K  L  Q  |  L  Q  E  N  H  E  D  E  V      p.1680

          .         .         .         .         .         .       g.66909
 AAAAAAGTAAAAGCGGAAGTAGAGGATTTAAAGTATCTTCTGGACCAGTCACAAAAGGAG       c.5100
 K  K  V  K  A  E  V  E  D  L  K  Y  L  L  D  Q  S  Q  K  E         p.1700

          .         .         .         .         .         .       g.66969
 TCACAGTGTTTAAAATCTGAACTTCAGGCTCAAAAAGAAGCAAATTCAAGAGCTCCAACA       c.5160
 S  Q  C  L  K  S  E  L  Q  A  Q  K  E  A  N  S  R  A  P  T         p.1720

          .         .         .         .         .         .       g.67029
 ACTACAATGAGAAATCTAGTAGAACGGCTAAAGAGCCAATTAGCCTTGAAGGAGAAACAA       c.5220
 T  T  M  R  N  L  V  E  R  L  K  S  Q  L  A  L  K  E  K  Q         p.1740

        | 39 .         .         .         .         .         .    g.68041
 CAGAAA | GCACTTAGTCGGGCACTTTTAGAACTCCGGGCAGAAATGACAGCAGCTGCTGAA    c.5280
 Q  K   | A  L  S  R  A  L  L  E  L  R  A  E  M  T  A  A  A  E      p.1760

          .         .         .         .         .         .       g.68101
 GAACGTATTATTTCTGCAACTTCTCAAAAAGAGGCCCATCTCAATGTTCAACAAATCGTT       c.5340
 E  R  I  I  S  A  T  S  Q  K  E  A  H  L  N  V  Q  Q  I  V         p.1780

          .         .     | 40   .         .         .         .    g.69334
 GATCGACATACTAGAGAGCTAAAG | ACACAAGTTGAAGATTTAAATGAAAATCTTTTAAAA    c.5400
 D  R  H  T  R  E  L  K   | T  Q  V  E  D  L  N  E  N  L  L  K      p.1800

          .         .         .         .         .         .       g.69394
 TTGAAAGAAGCACTTAAAACAAGTAAAAACAGAGAAAACTCACTAACTGATAATTTGAAT       c.5460
 L  K  E  A  L  K  T  S  K  N  R  E  N  S  L  T  D  N  L  N         p.1820

          .         .         .         .         .         .       g.69454
 GACTTAAATAATGAACTGCAAAAGAAACAAAAAGCCTATAATAAAATACTTAGAGAGAAA       c.5520
 D  L  N  N  E  L  Q  K  K  Q  K  A  Y  N  K  I  L  R  E  K         p.1840

          .         .         .         .         .         .       g.69514
 GAGGAAATTGATCAAGAGAATGATGAACTGAAAAGGCAAATTAAAAGACTAACCAGTGGA       c.5580
 E  E  I  D  Q  E  N  D  E  L  K  R  Q  I  K  R  L  T  S  G         p.1860

        | 41 .         .         .         .         .         .    g.69926
 TTACAG | GGCAAACCCCTGACAGATAATAAACAAAGTCTAATTGAAGAACTCCAAAGGAAA    c.5640
 L  Q   | G  K  P  L  T  D  N  K  Q  S  L  I  E  E  L  Q  R  K      p.1880

          .         .         .         .         .         .       g.69986
 GTTAAAAAACTAGAGAACCAATTAGAGGGAAAGGTGGAGGAAGTAGACCTAAAACCTATG       c.5700
 V  K  K  L  E  N  Q  L  E  G  K  V  E  E  V  D  L  K  P  M         p.1900

           | 42        .         .         .         .         .    g.75341
 AAAGAAAAG | AATGCTAAAGAAGAATTAATTAGGTGGGAAGAAGGTAAAAAGTGGCAAGCC    c.5760
 K  E  K   | N  A  K  E  E  L  I  R  W  E  E  G  K  K  W  Q  A      p.1920

          .         .         .         .         .         .       g.75401
 AAAATAGAAGGAATTCGAAACAAGTTAAAAGAGAAAGAGGGGGAAGTCTTTACTTTAACA       c.5820
 K  I  E  G  I  R  N  K  L  K  E  K  E  G  E  V  F  T  L  T         p.1940

          .         .         .      | 43  .         .         .    g.75792
 AAGCAGTTGAATACTTTGAAGGATCTTTTTGCCAA | AGCCGATAAAGAGAAACTTACTTTG    c.5880
 K  Q  L  N  T  L  K  D  L  F  A  K  |  A  D  K  E  K  L  T  L      p.1960

          .         .         .         .         .         .       g.75852
 CAGAGGAAACTAAAAACAACTGGCATGACTGTTGATCAGGTTTTGGGAATACGAGCTTTG       c.5940
 Q  R  K  L  K  T  T  G  M  T  V  D  Q  V  L  G  I  R  A  L         p.1980

          .         .         .         .         .         .       g.75912
 GAGTCAGAAAAAGAATTGGAAGAATTAAAAAAGAGAAATCTTGACTTAGAAAATGATATA       c.6000
 E  S  E  K  E  L  E  E  L  K  K  R  N  L  D  L  E  N  D  I         p.2000

          .  | 44      .         .         .         .         .    g.78620
 TTGTATATGAG | GGCCCACCAAGCTCTTCCTCGAGATTCTGTTGTAGAAGATTTACATTTA    c.6060
 L  Y  M  R  |  A  H  Q  A  L  P  R  D  S  V  V  E  D  L  H  L      p.2020

          .         .         .         .         .         .       g.78680
 CAAAATAGATACCTCCAAGAAAAACTTCATGCTTTAGAAAAACAGTTTTCAAAGGATACA       c.6120
 Q  N  R  Y  L  Q  E  K  L  H  A  L  E  K  Q  F  S  K  D  T         p.2040

          .      | 45  .         .         .         .         .    g.83146
 TATTCTAAGCCTTCA | ATTTCAGGAATAGAGTCAGATGATCATTGTCAGAGAGAACAGGAG    c.6180
 Y  S  K  P  S   | I  S  G  I  E  S  D  D  H  C  Q  R  E  Q  E      p.2060

          .         .         .         .         .         .       g.83206
 CTTCAGAAGGAAAACTTGAAGTTGTCATCTGAAAATATTGAACTGAAATTTCAGCTTGAA       c.6240
 L  Q  K  E  N  L  K  L  S  S  E  N  I  E  L  K  F  Q  L  E         p.2080

          .         .         . | 46       .         .         .    g.84468
 CAAGCAAATAAAGATTTGCCAAGATTAAAG | AATCAAGTCAGAGATTTGAAGGAAATGTGT    c.6300
 Q  A  N  K  D  L  P  R  L  K   | N  Q  V  R  D  L  K  E  M  C      p.2100

          .         .         .         .         .        | 47.    g.86225
 GAATTTCTTAAGAAAGAAAAAGCAGAAGTTCAGCGGAAACTTGGCCATGTTAGAGGG | TCT    c.6360
 E  F  L  K  K  E  K  A  E  V  Q  R  K  L  G  H  V  R  G   | S      p.2120

          .         .         .         .         .         .       g.86285
 GGTAGAAGTGGAAAGACAATCCCAGAACTGGAAAAAACCATTGGTTTAATGAAAAAAGTA       c.6420
 G  R  S  G  K  T  I  P  E  L  E  K  T  I  G  L  M  K  K  V         p.2140

          .         .         .         .         .         .       g.86345
 GTTGAAAAAGTCCAGAGAGAAAATGAACAGTTGAAAAAAGCATCAGGAATATTGACTAGT       c.6480
 V  E  K  V  Q  R  E  N  E  Q  L  K  K  A  S  G  I  L  T  S         p.2160

          .         .         .         .   | 48     .         .    g.87214
 GAAAAAATGGCTAATATTGAGCAGGAAAATGAAAAATTGAAG | GCTGAATTAGAAAAACTT    c.6540
 E  K  M  A  N  I  E  Q  E  N  E  K  L  K   | A  E  L  E  K  L      p.2180

          .         .         .         .         .         .       g.87274
 AAAGCTCATCTTGGGCATCAGTTGAGCATGCACTATGAATCCAAGACCAAAGGCACAGAA       c.6600
 K  A  H  L  G  H  Q  L  S  M  H  Y  E  S  K  T  K  G  T  E         p.2200

          .         .         .         .      | 49  .         .    g.88211
 AAAATTATTGCTGAAAATGAAAGGCTTCGTAAAGAACTTAAAAAA | GAAACTGATGCTGCA    c.6660
 K  I  I  A  E  N  E  R  L  R  K  E  L  K  K   | E  T  D  A  A      p.2220

          .         .         .         .         .         .       g.88271
 GAGAAATTACGGATAGCAAAGAATAATTTAGAGATATTAAATGAGAAGATGACAGTTCAA       c.6720
 E  K  L  R  I  A  K  N  N  L  E  I  L  N  E  K  M  T  V  Q         p.2240

          .         .         .         .         .         .       g.88331
 CTAGAAGAGACTGGTAAGAGATTGCAGTTTGCAGAAAGCAGAGGTCCACAGCTTGAAGGT       c.6780
 L  E  E  T  G  K  R  L  Q  F  A  E  S  R  G  P  Q  L  E  G         p.2260

          .         .         .         | 50         .         .    g.91521
 GCTGACAGTAAGAGCTGGAAATCCATTGTGGTTACAAG | AATGTATGAAACCAAGTTAAAA    c.6840
 A  D  S  K  S  W  K  S  I  V  V  T  R  |  M  Y  E  T  K  L  K      p.2280

          .         .         .         .         .         .       g.91581
 GAATTGGAAACTGATATTGCCAAAAAAAATCAAAGCATTACTGACCTTAAACAGCTTGTA       c.6900
 E  L  E  T  D  I  A  K  K  N  Q  S  I  T  D  L  K  Q  L  V         p.2300

          .         .         .         .         .         .       g.91641
 AAAGAAGCAACAGAGAGAGAACAAAAAGTTAACAAATACAATGAAGACCTTGAACAACAG       c.6960
 K  E  A  T  E  R  E  Q  K  V  N  K  Y  N  E  D  L  E  Q  Q         p.2320

  | 51       .         .         .         .         .         .    g.92863
  | ATTAAGATTCTTAAACATGTTCCTGAAGGTGCTGAGACAGAGCAAGGCCTTAAACGGGAG    c.7020
  | I  K  I  L  K  H  V  P  E  G  A  E  T  E  Q  G  L  K  R  E      p.2340

          .     | 52   .         .         .         .         .    g.93516
 CTTCAAGTTCTTAG | ATTAGCTAATCATCAGCTGGATAAAGAGAAAGCAGAATTAATCCAT    c.7080
 L  Q  V  L  R  |  L  A  N  H  Q  L  D  K  E  K  A  E  L  I  H      p.2360

          .         .         .         .          | 53        .    g.96794
 CAGATAGAAGCTAACAAGGACCAAAGTGGAGCTGAAAGCACCATACCTG | ATGCTGATCAA    c.7140
 Q  I  E  A  N  K  D  Q  S  G  A  E  S  T  I  P  D |   A  D  Q      p.2380

          .         .         .         .         .         .       g.96854
 CTAAAGGAAAAAATAAAAGATCTAGAGACACAGCTCAAAATGTCAGATCTAGAAAAGCAG       c.7200
 L  K  E  K  I  K  D  L  E  T  Q  L  K  M  S  D  L  E  K  Q         p.2400

           | 54        .         .         .         .         .    g.97853
 CATTTGAAG | GAGGAAATAAAGAAGCTGAAAAAAGAACTGGAAAATTTTGATCCTTCATTT    c.7260
 H  L  K   | E  E  I  K  K  L  K  K  E  L  E  N  F  D  P  S  F      p.2420

          .         .         .         .         .         .       g.97913
 TTTGAAGAAATTGAAGATCTTAAGTATAATTACAAGGAAGAAGTGAAGAAGAATATTCTC       c.7320
 F  E  E  I  E  D  L  K  Y  N  Y  K  E  E  V  K  K  N  I  L         p.2440

          .         .         .         .         .         .       g.97973
 TTAGAAGAGAAGGTAAAAAAACTTTCAGAACAATTGGGAGTTGAATTAACTAGCCCTGTT       c.7380
 L  E  E  K  V  K  K  L  S  E  Q  L  G  V  E  L  T  S  P  V         p.2460

          .         .         .         .         .         .       g.98033
 GCTGCTTCTGAAGAGTTTGAAGATGAAGAAGAAAGTCCTGTTAATTTCCCCATTTACTAA       c.7440
 A  A  S  E  E  F  E  D  E  E  E  S  P  V  N  F  P  I  Y  X         p.2479

          .         .         .         .         .         .       g.98093
 aggtcacctataaactttgtttcatttaactatttattaactttataagttaaatatact       c.*60

          .         .         .         .         .         .       g.98153
 tggaaataagcagttctccgaactgtagtatttccttctcactaccttgtacctttatac       c.*120

          .         .         .         .         .                 g.98204
 ttagattggaattcttaataaataaaattatatgaaattttcaacttatta                c.*171

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Centrosomal protein 290kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center