crystallin, alpha A (CRYAA) - coding DNA reference sequence

(used for variant description)

(last modified March 7, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_000394.2 in the CRYAA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009823.1, covering CRYAA transcript NM_000394.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5009
                                                    acactgcgc       c.-61

 .         .         .         .         .         .                g.5069
 tgcccagaggccccgctgactcctgccagcctccaggtccccgtggtaccaaagctgaac       c.-1

          .         .         .         .         .         .       g.5129
 ATGGACGTGACCATCCAGCACCCCTGGTTCAAGCGCACCCTGGGGCCCTTCTACCCCAGC       c.60
 M  D  V  T  I  Q  H  P  W  F  K  R  T  L  G  P  F  Y  P  S         p.20

          .         .         .         .         .         .       g.5189
 CGGCTGTTCGACCAGTTTTTCGGCGAGGGCCTTTTTGAGTATGACCTGCTGCCCTTCCTG       c.120
 R  L  F  D  Q  F  F  G  E  G  L  F  E  Y  D  L  L  P  F  L         p.40

          .         .         .         .         .         .       g.5249
 TCGTCCACCATCAGCCCCTACTACCGCCAGTCCCTCTTCCGCACCGTGCTGGACTCCGGC       c.180
 S  S  T  I  S  P  Y  Y  R  Q  S  L  F  R  T  V  L  D  S  G         p.60

           | 02        .         .         .         .         .    g.6537
 ATCTCTGAG | GTTCGATCCGACCGGGACAAGTTCGTCATCTTCCTCGATGTGAAGCACTTC    c.240
 I  S  E   | V  R  S  D  R  D  K  F  V  I  F  L  D  V  K  H  F      p.80

          .         .         .         .         .         .       g.6597
 TCCCCGGAGGACCTCACCGTGAAGGTGCAGGACGACTTTGTGGAGATCCACGGAAAGCAC       c.300
 S  P  E  D  L  T  V  K  V  Q  D  D  F  V  E  I  H  G  K  H         p.100

          .   | 03     .         .         .         .         .    g.8088
 AACGAGCGCCAG | GACGACCACGGCTACATTTCCCGTGAGTTCCACCGCCGCTACCGCCTG    c.360
 N  E  R  Q   | D  D  H  G  Y  I  S  R  E  F  H  R  R  Y  R  L      p.120

          .         .         .         .         .         .       g.8148
 CCGTCCAACGTGGACCAGTCGGCCCTCTCTTGCTCCCTGTCTGCCGATGGCATGCTGACC       c.420
 P  S  N  V  D  Q  S  A  L  S  C  S  L  S  A  D  G  M  L  T         p.140

          .         .         .         .         .         .       g.8208
 TTCTGTGGCCCCAAGATCCAGACTGGCCTGGATGCCACCCACGCCGAGCGAGCCATCCCC       c.480
 F  C  G  P  K  I  Q  T  G  L  D  A  T  H  A  E  R  A  I  P         p.160

          .         .         .         .                           g.8250
 GTGTCGCGGGAGGAGAAGCCCACCTCGGCTCCCTCGTCCTAA                         c.522
 V  S  R  E  E  K  P  T  S  A  P  S  S  X                           p.173

          .         .         .         .         .         .       g.8310
 gcaggcattgcctcggctggctcccctgcagccctggcccatcatggggggagcaccctg       c.*60

          .         .         .         .         .         .       g.8370
 agggcggggtgtctgtcttcctttgcttcccttttttcctttccaccttctcacatggaa       c.*120

          .         .         .         .         .         .       g.8430
 tgagggtttgagagagcagccaggagagcttagggtctcagggtgtcccagaccccgaca       c.*180

          .         .         .         .         .         .       g.8490
 ccggccagtggcggaagtgaccgcacctcacactcctttagatagcagcctggctcccct       c.*240

          .         .         .         .         .         .       g.8550
 ggggtgcaggcgcctcaactctgctgagggtccagaaggagggggtgacctccggccagg       c.*300

          .         .         .         .         .         .       g.8610
 tgcctcctgacacacctgcagcctccctccgcggcgggccctgcccacacctcctggggc       c.*360

          .         .         .         .         .         .       g.8670
 gcgtgaggcccgtggggccggggcttctgtgcacctgggctctcgcggcctcttctctca       c.*420

          .         .         .         .         .         .       g.8730
 gaccgtcttcctccaacccctctatgtagtgccgctcttggggacatgggtcgcccatga       c.*480

          .         .         .         .                           g.8773
 gagcgcagcccgcggcaatcaataaacagcaggtgatacaagc                        c.*523

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Crystallin, alpha A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.