crystallin, beta B2 (CRYBB2) - coding DNA reference sequence

(used for variant description)

(last modified March 7, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_000496.2 in the CRYBB2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009827.1, covering CRYBB2 transcript NM_000496.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .    | 02    .         .             g.6785
             ctcgcaggggctggtgtcactg | gtcattcctgcacaggacagtccacc    c.-1

          .         .         .         .         .     | 03   .    g.10279
 ATGGCCTCAGATCACCAGACCCAGGCGGGCAAGCCACAGTCCCTCAACCCCAAG | ATCATC    c.60
 M  A  S  D  H  Q  T  Q  A  G  K  P  Q  S  L  N  P  K   | I  I      p.20

          .         .         .         .         .         .       g.10339
 ATCTTTGAGCAGGAAAACTTTCAAGGCCACTCGCATGAGCTCAATGGGCCCTGCCCCAAC       c.120
 I  F  E  Q  E  N  F  Q  G  H  S  H  E  L  N  G  P  C  P  N         p.40

          .         .         .         .         .    | 04    .    g.13215
 CTGAAGGAAACTGGCGTGGAGAAGGCAGGTTCTGTCCTAGTGCAGGCTGGACC | CTGGGTG    c.180
 L  K  E  T  G  V  E  K  A  G  S  V  L  V  Q  A  G  P  |  W  V      p.60

          .         .         .         .         .         .       g.13275
 GGCTATGAACAGGCCAACTGCAAGGGCGAGCAGTTTGTGTTTGAGAAGGGTGAGTACCCC       c.240
 G  Y  E  Q  A  N  C  K  G  E  Q  F  V  F  E  K  G  E  Y  P         p.80

          .         .         .         .         .         .       g.13335
 CGCTGGGACTCATGGACCAGCAGCCGAAGGACGGACTCCCTCAGCTCCCTGAGGCCCATC       c.300
 R  W  D  S  W  T  S  S  R  R  T  D  S  L  S  S  L  R  P  I         p.100

        | 05 .         .         .         .         .         .    g.14845
 AAAGTG | GACAGCCAAGAGCACAAGATCATCCTCTATGAAAACCCCAACTTCACCGGGAAG    c.360
 K  V   | D  S  Q  E  H  K  I  I  L  Y  E  N  P  N  F  T  G  K      p.120

          .         .         .         .         .         .       g.14905
 AAGATGGAAATCATAGATGACGATGTACCCAGCTTCCACGCCCATGGCTACCAGGAGAAG       c.420
 K  M  E  I  I  D  D  D  V  P  S  F  H  A  H  G  Y  Q  E  K         p.140

          .         .          | 06        .         .         .    g.16990
 GTGTCATCTGTGCGGGTGCAGAGTGGCAC | GTGGGTTGGCTACCAGTACCCCGGCTACCGT    c.480
 V  S  S  V  R  V  Q  S  G  T  |  W  V  G  Y  Q  Y  P  G  Y  R      p.160

          .         .         .         .         .         .       g.17050
 GGGCTGCAGTACCTGCTGGAGAAGGGAGACTACAAGGACAGCAGCGACTTTGGGGCCCCT       c.540
 G  L  Q  Y  L  L  E  K  G  D  Y  K  D  S  S  D  F  G  A  P         p.180

          .         .         .         .         .         .       g.17110
 CACCCCCAGGTGCAGTCCGTGCGCCGTATCCGCGACATGCAGTGGCACCAACGTGGTGCC       c.600
 H  P  Q  V  Q  S  V  R  R  I  R  D  M  Q  W  H  Q  R  G  A         p.200

          .                                                         g.17128
 TTCCACCCCTCCAACTAG                                                 c.618
 F  H  P  S  N  X                                                   p.205

          .         .         .         .         .         .       g.17188
 tgccctccccaccatgcctccttcccaggacccaggtctgctgcccaggaaccctccaga       c.*60

          .         .         .                                     g.17225
 cctcccagagagtgaataaagtgtgacttgcaacttg                              c.*97

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Crystallin, beta B2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center