crystallin, beta B3 (CRYBB3) - coding DNA reference sequence

(used for variant description)

(last modified March 7, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_004076.3 in the CRYBB3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009828.1, covering CRYBB3 transcript NM_004076.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5012
                                                 gagtctgcagac       c.-61

 .         .         .         .          | 02        .             g.6539
 ggccgtggctcctctgttcttcccgaggctacagcaacag | ccagaggtgttcctggggag    c.-1

          .         .         .         .         .         .       g.6599
 ATGGCGGAACAGCACGGAGCACCCGAACAGGCTGCAGCTGGCAAGAGCCATGGAGACCTT       c.60
 M  A  E  Q  H  G  A  P  E  Q  A  A  A  G  K  S  H  G  D  L         p.20

          .      | 03  .         .         .         .         .    g.7861
 GGGGGCAGCTACAAG | GTGATCTTGTACGAACTAGAGAACTTCCAAGGCAAACGCTGCGAG    c.120
 G  G  S  Y  K   | V  I  L  Y  E  L  E  N  F  Q  G  K  R  C  E      p.40

          .         .         .         .         .         .       g.7921
 CTCTCGGCCGAGTGCCCCAGCCTGACCGACAGCCTGCTGGAGAAGGTGGGCTCCATCCAA       c.180
 L  S  A  E  C  P  S  L  T  D  S  L  L  E  K  V  G  S  I  Q         p.60

          .     | 04   .         .         .         .         .    g.8951
 GTGGAGTCCGGGCC | GTGGCTGGCATTTGAGTCCAGGGCCTTCCGCGGGGAGCAGTTTGTT    c.240
 V  E  S  G  P  |  W  L  A  F  E  S  R  A  F  R  G  E  Q  F  V      p.80

          .         .         .         .         .         .       g.9011
 CTGGAGAAGGGGGATTATCCTCGCTGGGATGCCTGGTCCAACAGCCGTGATAGTGACAGC       c.300
 L  E  K  G  D  Y  P  R  W  D  A  W  S  N  S  R  D  S  D  S         p.100

          .         .        | 05.         .         .         .    g.10395
 CTTCTGTCCCTCCGGCCTCTGAATATT | GATAGTCCACATCACAAGCTGCATCTGTTTGAG    c.360
 L  L  S  L  R  P  L  N  I   | D  S  P  H  H  K  L  H  L  F  E      p.120

          .         .         .         .         .         .       g.10455
 AACCCAGCTTTCAGTGGCCGCAAGATGGAGATAGTGGATGATGACGTGCCCAGCCTGTGG       c.420
 N  P  A  F  S  G  R  K  M  E  I  V  D  D  D  V  P  S  L  W         p.140

          .         .         .         .         . | 06       .    g.12199
 GCTCATGGCTTCCAGGACCGTGTGGCGAGTGTCCGTGCCATCAACGGGAC | GTGGGTTGGC    c.480
 A  H  G  F  Q  D  R  V  A  S  V  R  A  I  N  G  T  |  W  V  G      p.160

          .         .         .         .         .         .       g.12259
 TATGAGTTCCCCGGCTACCGTGGGCGCCAGTACGTGTTTGAGCGGGGCGAGTACCGCCAC       c.540
 Y  E  F  P  G  Y  R  G  R  Q  Y  V  F  E  R  G  E  Y  R  H         p.180

          .         .         .         .         .         .       g.12319
 TGGAATGAGTGGGACGCCAGCCAGCCGCAGCTGCAGTCTGTGCGCCGCATCCGTGACCAG       c.600
 W  N  E  W  D  A  S  Q  P  Q  L  Q  S  V  R  R  I  R  D  Q         p.200

          .         .         .                                     g.12355
 AAGTGGCACAAGCGGGGCCGCTTCCCCAGCAGCTGA                               c.636
 K  W  H  K  R  G  R  F  P  S  S  X                                 p.211

          .         .         .         .         .         .       g.12415
 aaggcacccagacttcaaggacccagacccaccctggggggctgcaagggcaagaagagg       c.*60

          .         .         .         .         .         .       g.12475
 aggctccagggttggggcgagggccgacctgtccacccttccctggaatctgctcaataa       c.*120

          .         .                                               g.12500
 agcctggggttggtcccccacccgc                                          c.*145

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Crystallin, beta B3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.