crystallin, gamma A (CRYGA) - coding DNA reference sequence

(used for variant description)

(last modified March 7, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_014617.3 in the CRYGA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_028157.1, covering CRYGA transcript NM_014617.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5017
                                            accctctgtcaacaacc       c.-1

           | 02        .         .         .         .         .    g.5178
 ATGGGGAAG | ATCACCTTCTACGAGGACCGAGACTTTCAGGGTCGCTGCTACAATTGCATC    c.60
 M  G  K   | I  T  F  Y  E  D  R  D  F  Q  G  R  C  Y  N  C  I      p.20

          .         .         .         .         .         .       g.5238
 AGTGACTGCCCCAACCTGCGGGTCTACTTCAGCCGCTGCAACTCCATCCGAGTAGACAGC       c.120
 S  D  C  P  N  L  R  V  Y  F  S  R  C  N  S  I  R  V  D  S         p.40

          .         .         .         .         .         .       g.5298
 GGCTGCTGGATGCTCTATGAGCGTCCCAATTACCAGGGCCACCAGTACTTCCTGCGCCGA       c.180
 G  C  W  M  L  Y  E  R  P  N  Y  Q  G  H  Q  Y  F  L  R  R         p.60

          .         .         .         .         .         .       g.5358
 GGCAAGTACCCCGACTATCAGCACTGGATGGGCCTCAGCGACTCGGTCCAATCCTGCCGT       c.240
 G  K  Y  P  D  Y  Q  H  W  M  G  L  S  D  S  V  Q  S  C  R         p.80

          .   | 03     .         .         .         .         .    g.7545
 ATAATTCCTCAT | ACCAGCTCGCACAAGTTAAGGCTGTACGAGAGAGATGACTACCGAGGC    c.300
 I  I  P  H   | T  S  S  H  K  L  R  L  Y  E  R  D  D  Y  R  G      p.100

          .         .         .         .         .         .       g.7605
 CTTATGTCTGAGCTCACTGATGACTGCGCCTGTGTTCCAGAACTGTTCCGTCTCCCTGAG       c.360
 L  M  S  E  L  T  D  D  C  A  C  V  P  E  L  F  R  L  P  E         p.120

          .         .         .         .         .         .       g.7665
 ATCTATTCCCTCCACGTACTGGAGGGCTGCTGGGTCCTCTATGAAATGCCCAACTACCGG       c.420
 I  Y  S  L  H  V  L  E  G  C  W  V  L  Y  E  M  P  N  Y  R         p.140

          .         .         .         .         .         .       g.7725
 GGGCGGCAGTATCTGCTGAGGCCTGGGGACTACAGAAGGTACCACGACTGGGGGGGTGCA       c.480
 G  R  Q  Y  L  L  R  P  G  D  Y  R  R  Y  H  D  W  G  G  A         p.160

          .         .         .         .                           g.7770
 GATGCCAAAGTCGGCTCTTTGAGACGGGTCACCGATTTGTACTAA                      c.525
 D  A  K  V  G  S  L  R  R  V  T  D  L  Y  X                        p.174

          .         .         .         .         .         .       g.7830
 gctgtgcctgccttgttgtgatccccatagaaacataataaatatacaagttgtgttccc       c.*60

                                                                    g.7834
 tgca                                                               c.*64

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Crystallin, gamma A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.