crystallin, gamma B (CRYGB) - coding DNA reference sequence

(used for variant description)

(last modified March 7, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_005210.3 in the CRYGB gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_028158.1, covering CRYGB transcript NM_005210.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5033
                            gcaaccagaaaacatctgctcacttccttcaaa       c.-1

           | 02        .         .         .         .         .    g.5188
 ATGGGAAAG | ATCACCTTCTACGAGGACAGGGCCTTCCAGGGCCGCAGCTACGAATGCACC    c.60
 M  G  K   | I  T  F  Y  E  D  R  A  F  Q  G  R  S  Y  E  C  T      p.20

          .         .         .         .         .         .       g.5248
 ACTGACTGCCCCAACCTACAACCCTATTTCAGCCGCTGCAACTCCATCAGGGTGGAGAGC       c.120
 T  D  C  P  N  L  Q  P  Y  F  S  R  C  N  S  I  R  V  E  S         p.40

          .         .         .         .         .         .       g.5308
 GGCTGCTGGATGATCTATGAGCGCCCCAACTACCAGGGCCACCAGTACTTCCTGCGGCGT       c.180
 G  C  W  M  I  Y  E  R  P  N  Y  Q  G  H  Q  Y  F  L  R  R         p.60

          .         .         .         .         .         .       g.5368
 GGGGAGTACCCTGACTACCAGCAATGGATGGGCCTCAGCGACTCCATCCGCTCCTGCTGC       c.240
 G  E  Y  P  D  Y  Q  Q  W  M  G  L  S  D  S  I  R  S  C  C         p.80

          .   | 03     .         .         .         .         .    g.8288
 CTCATCCCCCCG | CACTCTGGCGCTTACAGAATGAAGATCTACGACAGAGATGAATTGAGG    c.300
 L  I  P  P   | H  S  G  A  Y  R  M  K  I  Y  D  R  D  E  L  R      p.100

          .         .         .         .         .         .       g.8348
 GGACAAATGTCAGAGCTCACAGACGACTGTATCTCTGTTCAGGACCGCTTCCACCTCACT       c.360
 G  Q  M  S  E  L  T  D  D  C  I  S  V  Q  D  R  F  H  L  T         p.120

          .         .         .         .         .         .       g.8408
 GAAATTCACTCCCTCAATGTGCTGGAGGGCAGCTGGATCCTCTATGAGATGCCCAACTAC       c.420
 E  I  H  S  L  N  V  L  E  G  S  W  I  L  Y  E  M  P  N  Y         p.140

          .         .         .         .         .         .       g.8468
 AGGGGGAGGCAGTATCTGCTGAGGCCGGGGGAGTACAGGAGGTTTCTTGATTGGGGGGCT       c.480
 R  G  R  Q  Y  L  L  R  P  G  E  Y  R  R  F  L  D  W  G  A         p.160

          .         .         .         .                           g.8516
 CCAAATGCCAAAGTTGGCTCTCTTAGACGAGTCATGGATTTGTACTGA                   c.528
 P  N  A  K  V  G  S  L  R  R  V  M  D  L  Y  X                     p.175

          .         .         .         .         .         .       g.8576
 agtatttacgttttccacttttctcctttaaaatctaataaaatatttagcttgtgtttc       c.*60

                                                                    g.8581
 tggca                                                              c.*65

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Crystallin, gamma B protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.