crystallin, gamma C (CRYGC) - coding DNA reference sequence

(used for variant description)

(last modified March 7, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_020989.3 in the CRYGC gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008038.1, covering CRYGC transcript NM_020989.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5038
                       ccatcacactgaactcgcatcatccgtgtcaaccagcc       c.-1

           | 02        .         .         .         .         .    g.5198
 ATGGGGAAG | ATCACCTTCTATGAGGACAGGGCCTTCCAGGGCCGCAGCTACGAAACCACC    c.60
 M  G  K   | I  T  F  Y  E  D  R  A  F  Q  G  R  S  Y  E  T  T      p.20

          .         .         .         .         .         .       g.5258
 ACTGACTGCCCCAACCTGCAGCCGTATTTCAGCCGCTGCAACTCCATCCGGGTGGAGAGC       c.120
 T  D  C  P  N  L  Q  P  Y  F  S  R  C  N  S  I  R  V  E  S         p.40

          .         .         .         .         .         .       g.5318
 GGCTGCTGGATGCTCTATGAGCGTCCCAACTACCAAGGTCAACAATACTTGCTGCGGCGA       c.180
 G  C  W  M  L  Y  E  R  P  N  Y  Q  G  Q  Q  Y  L  L  R  R         p.60

          .         .         .         .         .         .       g.5378
 GGGGAGTACCCCGACTACCAGCAATGGATGGGCCTCAGCGACTCCATCCGCTCCTGTTGT       c.240
 G  E  Y  P  D  Y  Q  Q  W  M  G  L  S  D  S  I  R  S  C  C         p.80

          .   | 03     .         .         .         .         .    g.6403
 CTCATCCCCCAA | ACAGTCTCCCACAGGCTGCGGCTGTACGAGAGGGAAGACCACAAAGGC    c.300
 L  I  P  Q   | T  V  S  H  R  L  R  L  Y  E  R  E  D  H  K  G      p.100

          .         .         .         .         .         .       g.6463
 CTCATGATGGAGCTGAGTGAAGACTGCCCCAGCATCCAGGACCGCTTCCACCTCAGCGAG       c.360
 L  M  M  E  L  S  E  D  C  P  S  I  Q  D  R  F  H  L  S  E         p.120

          .         .         .         .         .         .       g.6523
 ATCCGTTCCCTCCACGTGCTGGAGGGCTGCTGGGTCCTCTACGAGCTGCCCAACTACCGG       c.420
 I  R  S  L  H  V  L  E  G  C  W  V  L  Y  E  L  P  N  Y  R         p.140

          .         .         .         .         .         .       g.6583
 GGGCGGCAATACCTGCTGAGGCCCCAAGAGTACAGGCGGTGCCAGGACTGGGGGGCCATG       c.480
 G  R  Q  Y  L  L  R  P  Q  E  Y  R  R  C  Q  D  W  G  A  M         p.160

          .         .         .         .                           g.6628
 GATGCTAAGGCAGGCTCTTTGCGGAGAGTGGTGGATTTGTATTAA                      c.525
 D  A  K  A  G  S  L  R  R  V  V  D  L  Y  X                        p.174

          .         .         .         .         .         .       g.6688
 aatagcttaacactaccaatttcccattttggaacctaataaatatttagtctgcattgc       c.*60

                                                                    g.6694
 tggcaa                                                             c.*66

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Crystallin, gamma C protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center