DNA replication helicase 2 homolog (yeast) (DNA2) - coding DNA reference sequence

(used for variant description)

(last modified November 22, 2013)


This file was created to facilitate the description of sequence variants on transcript NM_001080449.2 in the DNA2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000010.10, covering DNA2 transcript NM_001080449.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5049
            atgcgcgcgaggtgcgcaggctcgcgcctttttcccttttctaagcttt       c.-61

 .         .         .         .         .         .                g.5109
 ctgtgttacccccggttccgctgtcttttctgtctacagtttgcgatccccgcgtccagg       c.-1

          .         .         .         .         .         .       g.5169
 ATGGAGCAGCTGAACGAACTGGAGCTGCTGATGGAGAAGAGTTTTTGGGAGGAGGCGGAG       c.60
 M  E  Q  L  N  E  L  E  L  L  M  E  K  S  F  W  E  E  A  E         p.20

          .     | 02   .         .         .         .         .    g.6856
 CTGCCGGCGGAGCT | ATTTCAGAAGAAAGTGGTAGCTTCCTTTCCAAGAACAGTTCTGAGC    c.120
 L  P  A  E  L  |  F  Q  K  K  V  V  A  S  F  P  R  T  V  L  S      p.40

          .         .         .         .         .         .       g.6916
 ACAGGAATGGATAACCGGTACCTGGTGTTGGCAGTCAATACTGTACAGAACAAAGAGGGA       c.180
 T  G  M  D  N  R  Y  L  V  L  A  V  N  T  V  Q  N  K  E  G         p.60

          .         .         .         .         .         .       g.6976
 AACTGTGAAAAGCGCCTGGTCATCACTGCTTCACAGTCACTAGAAAATAAAGAACTATGC       c.240
 N  C  E  K  R  L  V  I  T  A  S  Q  S  L  E  N  K  E  L  C         p.80

          .        | 03.         .         .         .         .    g.8710
 ATCCTTAGGAATGACTG | GTGTTCTGTTCCAGTAGAGCCAGGAGATATCATTCATTTGGAG    c.300
 I  L  R  N  D  W  |  C  S  V  P  V  E  P  G  D  I  I  H  L  E      p.100

          .         .         .         .         .         .       g.8770
 GGAGACTGCACATCTGACACTTGGATAATAGATAAAGATTTTGGATATTTGATTCTGTAT       c.360
 G  D  C  T  S  D  T  W  I  I  D  K  D  F  G  Y  L  I  L  Y         p.120

          .         .         .         .         .         .       g.8830
 CCAGACATGCTGATTTCTGGCACCAGCATAGCCAGTAGTATTCGATGTATGAGAAGAGCT       c.420
 P  D  M  L  I  S  G  T  S  I  A  S  S  I  R  C  M  R  R  A         p.140

          .         .  | 04      .         .         .         .    g.11200
 GTCCTGAGTGAAACTTTTAGG | AGCTCTGATCCAGCCACACGCCAAATGCTAATTGGTACG    c.480
 V  L  S  E  T  F  R   | S  S  D  P  A  T  R  Q  M  L  I  G  T      p.160

          .         .         .         .         .         .       g.11260
 GTTCTCCATGAGGTGTTTCAAAAAGCCATAAATAATAGCTTTGCCCCAGAAAAGCTACAA       c.540
 V  L  H  E  V  F  Q  K  A  I  N  N  S  F  A  P  E  K  L  Q         p.180

          .         .         .         .        | 05.         .    g.17751
 GAACTTGCTTTTCAAACAATTCAAGAAATAAGACATTTGAAGGAAAT | GTACCGCTTAAAT    c.600
 E  L  A  F  Q  T  I  Q  E  I  R  H  L  K  E  M  |  Y  R  L  N      p.200

          .         .         .         .         .         .       g.17811
 CTAAGTCAAGATGAAATAAAACAAGAAGTAGAGGACTATCTTCCTTCGTTTTGTAAATGG       c.660
 L  S  Q  D  E  I  K  Q  E  V  E  D  Y  L  P  S  F  C  K  W         p.220

          .         .         .         .         .          | 06    g.26727
 GCAGGAGATTTCATGCATAAAAACACTTCGACTGACTTCCCTCAGATGCAGCTCTCTCT | G    c.720
 A  G  D  F  M  H  K  N  T  S  T  D  F  P  Q  M  Q  L  S  L  |      p.240

          .         .         .         .         .         .       g.26787
 CCAAGTGATAATAGTAAGGATAATTCAACATGTAACATTGAAGTCGTGAAACCAATGGAT       c.780
 P  S  D  N  S  K  D  N  S  T  C  N  I  E  V  V  K  P  M  D         p.260

          .         .         .         .         .         .       g.26847
 ATTGAAGAAAGCATTTGGTCCCCTAGGTTTGGATTGAAAGGCAAAATAGATGTTACAGTT       c.840
 I  E  E  S  I  W  S  P  R  F  G  L  K  G  K  I  D  V  T  V         p.280

          .         .         .         .         .         .       g.26907
 GGTGTGAAAATACATCGAGGGTATAAAACAAAATACAAGATAATGCCGCTGGAACTTAAA       c.900
 G  V  K  I  H  R  G  Y  K  T  K  Y  K  I  M  P  L  E  L  K         p.300

          .         .         .          | 07        .         .    g.30581
 ACTGGCAAAGAATCAAATTCTATTGAACACCGTAGTCAG | GTTGTTCTGTACACTCTACTA    c.960
 T  G  K  E  S  N  S  I  E  H  R  S  Q   | V  V  L  Y  T  L  L      p.320

          .         .         .         .         .         .       g.30641
 AGCCAAGAGAGAAGAGCTGATCCAGAGGCTGGCTTGCTTCTCTACCTCAAGACTGGTCAG       c.1020
 S  Q  E  R  R  A  D  P  E  A  G  L  L  L  Y  L  K  T  G  Q         p.340

          .         .         .        | 08.         .         .    g.31913
 ATGTACCCTGTGCCTGCCAACCATCTAGATAAAAGAG | AATTATTAAAGCTAAGAAACCAG    c.1080
 M  Y  P  V  P  A  N  H  L  D  K  R  E |   L  L  K  L  R  N  Q      p.360

          .         .         .         .         .         .       g.31973
 ATGGCATTCTCATTGTTTCACCGTATTAGCAAATCTGCTACTAGACAGAAGACACAGCTT       c.1140
 M  A  F  S  L  F  H  R  I  S  K  S  A  T  R  Q  K  T  Q  L         p.380

          .         .         .         .         .         .       g.32033
 GCTTCTTTGCCACAAATAATTGAGGAAGAGAAAACTTGTAAATATTGTTCACAAATTGGC       c.1200
 A  S  L  P  Q  I  I  E  E  E  K  T  C  K  Y  C  S  Q  I  G         p.400

          .         . | 09       .         .         .         .    g.33902
 AATTGTGCTCTTTATAGCAG | AGCAGTTGAACAACAGATGGATTGTAGTTCAGTCCCAATT    c.1260
 N  C  A  L  Y  S  R  |  A  V  E  Q  Q  M  D  C  S  S  V  P  I      p.420

          .         .         .         .         .         .       g.33962
 GTGATGCTGCCCAAAATAGAAGAAGAAACCCAGCATCTGAAGCAAACACACTTAGAATAT       c.1320
 V  M  L  P  K  I  E  E  E  T  Q  H  L  K  Q  T  H  L  E  Y         p.440

          .         .         .         .         .         .       g.34022
 TTCAGCCTTTGGTGTCTAATGTTAACCCTGGAGTCACAATCGAAGGATAATAAAAAGAAT       c.1380
 F  S  L  W  C  L  M  L  T  L  E  S  Q  S  K  D  N  K  K  N         p.460

          .         .         .      | 10  .         .         .    g.39757
 CACCAAAATATCTGGCTAATGCCTGCTTCGGAAAT | GGAGAAGAGTGGCAGTTGCATTGGA    c.1440
 H  Q  N  I  W  L  M  P  A  S  E  M  |  E  K  S  G  S  C  I  G      p.480

          .         .         .         .         .         .       g.39817
 AACCTGATTAGAATGGAACATGTAAAGATAGTTTGTGATGGGCAATATTTACATAATTTC       c.1500
 N  L  I  R  M  E  H  V  K  I  V  C  D  G  Q  Y  L  H  N  F         p.500

          .         .         .         .         .         .       g.39877
 CAATGTAAACATGGTGCCATACCTGTCACAAATCTAATGGCAGGTGACAGAGTTATTGTA       c.1560
 Q  C  K  H  G  A  I  P  V  T  N  L  M  A  G  D  R  V  I  V         p.520

          .         .         .         .         .         .       g.39937
 AGTGGAGAAGAAAGGTCACTGTTTGCTTTGTCTAGAGGATATGTGAAGGAGATTAACATG       c.1620
 S  G  E  E  R  S  L  F  A  L  S  R  G  Y  V  K  E  I  N  M         p.540

          .         .       | 11 .         .         .         .    g.44497
 ACAACAGTAACTTGTTTATTAGACAG | AAACTTGTCGGTCCTTCCAGAATCAACTTTGTTC    c.1680
 T  T  V  T  C  L  L  D  R  |  N  L  S  V  L  P  E  S  T  L  F      p.560

          .         .         .         .         .         .       g.44557
 AGATTAGACCAAGAAGAAAAAAATTGTGATATAGATACCCCATTAGGAAATCTTTCCAAA       c.1740
 R  L  D  Q  E  E  K  N  C  D  I  D  T  P  L  G  N  L  S  K         p.580

          .         .    | 12    .         .         .         .    g.44695
 TTGATGGAAAACACGTTTGTCAG | CAAAAAACTTCGAGATTTAATTATTGACTTTCGTGAA    c.1800
 L  M  E  N  T  F  V  S  |  K  K  L  R  D  L  I  I  D  F  R  E      p.600

          .         .         .         .         .         .       g.44755
 CCTCAGTTTATATCCTACCTTAGTTCTGTTCTTCCACATGATGCAAAGGATACAGTTGCC       c.1860
 P  Q  F  I  S  Y  L  S  S  V  L  P  H  D  A  K  D  T  V  A         p.620

          .    | 13    .         .         .         .         .    g.45049
 TGCATTCTAAAGG | GTTTGAATAAGCCTCAGAGGCAAGCGATGAAAAAGGTACTTCTTTCA    c.1920
 C  I  L  K  G |   L  N  K  P  Q  R  Q  A  M  K  K  V  L  L  S      p.640

          .         .         .         .         .         .       g.45109
 AAAGACTACACACTCATCGTGGGTATGCCTGGGACAGGAAAAACAACTACGATATGTACT       c.1980
 K  D  Y  T  L  I  V  G  M  P  G  T  G  K  T  T  T  I  C  T         p.660

     | 14    .         .         .         .         .         .    g.46370
 CTC | GTAAGAATTCTCTACGCCTGTGGTTTTAGCGTTTTGTTGACCAGCTATACACACTCT    c.2040
 L   | V  R  I  L  Y  A  C  G  F  S  V  L  L  T  S  Y  T  H  S      p.680

          .         .         .         .         .         .       g.46430
 GCTGTTGACAATATTCTTTTGAAGTTAGCCAAGTTTAAAATAGGATTTTTGCGTTTGGGT       c.2100
 A  V  D  N  I  L  L  K  L  A  K  F  K  I  G  F  L  R  L  G         p.700

          .         .         .         .         .         .       g.46490
 CAGATTCAGAAGGTTCATCCAGCTATCCAGCAATTTACAGAGCAAGAAATTTGCAGATCA       c.2160
 Q  I  Q  K  V  H  P  A  I  Q  Q  F  T  E  Q  E  I  C  R  S         p.720

          .         .         .         .         | 15         .    g.54095
 AAGTCCATTAAATCCTTAGCTCTTCTAGAAGAACTCTACAATAGTCAA | CTTATAGTTGCA    c.2220
 K  S  I  K  S  L  A  L  L  E  E  L  Y  N  S  Q   | L  I  V  A      p.740

          .         .         .         .         .         .       g.54155
 ACAACATGTATGGGAATAAACCATCCAATATTTTCCCGTAAAATTTTTGATTTTTGTATT       c.2280
 T  T  C  M  G  I  N  H  P  I  F  S  R  K  I  F  D  F  C  I         p.760

          .         .         .         .         .         .       g.54215
 GTGGATGAAGCCTCTCAAATTAGCCAACCAATTTGTCTGGGCCCCCTTTTTTTTTCACGG       c.2340
 V  D  E  A  S  Q  I  S  Q  P  I  C  L  G  P  L  F  F  S  R         p.780

          .         .         .         .         .         .       g.54275
 AGATTTGTGTTAGTGGGGGACCATCAGCAGCTTCCTCCCCTGGTGCTAAACCGTGAAGCA       c.2400
 R  F  V  L  V  G  D  H  Q  Q  L  P  P  L  V  L  N  R  E  A         p.800

    | 16     .         .         .         .         .         .    g.54427
 AG | AGCTCTTGGCATGAGTGAAAGCTTATTCAAGAGGCTGGAGCAGAATAAGAGTGCTGTT    c.2460
 R  |  A  L  G  M  S  E  S  L  F  K  R  L  E  Q  N  K  S  A  V      p.820

          .         .         .   | 17     .         .         .    g.54572
 GTACAGTTAACCGTGCAGTACAGAATGAACAG | TAAAATTATGTCCTTAAGTAATAAGCTG    c.2520
 V  Q  L  T  V  Q  Y  R  M  N  S  |  K  I  M  S  L  S  N  K  L      p.840

          .         .         .         .         .         .       g.54632
 ACCTATGAGGGCAAGCTGGAGTGTGGATCAGACAAAGTGGCCAATGCAGTGATAAACCTA       c.2580
 T  Y  E  G  K  L  E  C  G  S  D  K  V  A  N  A  V  I  N  L         p.860

          .         .         .         .         .         .       g.54692
 CGTCACTTTAAAGATGTGAAGCTGGAACTGGAATTTTATGCTGACTATTCTGATAATCCT       c.2640
 R  H  F  K  D  V  K  L  E  L  E  F  Y  A  D  Y  S  D  N  P         p.880

          .         .         .         .         .        | 18.    g.57084
 TGGTTGATGGGAGTATTTGAACCCAACAATCCTGTTTGTTTCCTTAATACAGACAAG | GTT    c.2700
 W  L  M  G  V  F  E  P  N  N  P  V  C  F  L  N  T  D  K   | V      p.900

          .         .         .         .         .         .       g.57144
 CCAGCGCCAGAACAAGTTGAAAAAGGTGGTGTGAGCAATGTAACAGAAGCCAAACTCATA       c.2760
 P  A  P  E  Q  V  E  K  G  G  V  S  N  V  T  E  A  K  L  I         p.920

          .         .        | 19.         .         .         .    g.57793
 GTTTTCCTAACCTCCATTTTTGTTAAG | GCTGGATGCAGTCCCTCTGATATTGGTATTATT    c.2820
 V  F  L  T  S  I  F  V  K   | A  G  C  S  P  S  D  I  G  I  I      p.940

          .         .         .         .         .         .       g.57853
 GCACCGTACAGGCAGCAATTAAAGATCATCAATGATTTATTGGCACGTTCTATTGGGATG       c.2880
 A  P  Y  R  Q  Q  L  K  I  I  N  D  L  L  A  R  S  I  G  M         p.960

          .         .         .         .         .         .       g.57913
 GTCGAAGTTAATACAGTAGACAAATACCAAGGAAGGGACAAAAGTATTGTCCTAGTATCT       c.2940
 V  E  V  N  T  V  D  K  Y  Q  G  R  D  K  S  I  V  L  V  S         p.980

          .         .        | 20.         .         .         .    g.60151
 TTTGTTAGAAGTAATAAGGATGGAACT | GTTGGTGAACTCTTGAAAGATTGGCGACGTCTT    c.3000
 F  V  R  S  N  K  D  G  T   | V  G  E  L  L  K  D  W  R  R  L      p.1000

          .         .         .         .         .         .       g.60211
 AATGTTGCTATAACCAGAGCCAAACATAAACTGATTCTTCTGGGGTGTGTGCCCTCACTA       c.3060
 N  V  A  I  T  R  A  K  H  K  L  I  L  L  G  C  V  P  S  L         p.1020

          .         .         .         .         .     | 21   .    g.61872
 AATTGCTATCCTCCTTTGGAGAAGCTGCTTAATCATTTAAACTCAGAAAAATTA | ATCATT    c.3120
 N  C  Y  P  P  L  E  K  L  L  N  H  L  N  S  E  K  L   | I  I      p.1040

          .         .         .         .         .         .       g.61932
 GATCTTCCATCAAGAGAACATGAAAGTCTTTGCCACATATTGGGTGACTTTCAAAGAGAA       c.3180
 D  L  P  S  R  E  H  E  S  L  C  H  I  L  G  D  F  Q  R  E         p.1060

                                                                    g.61935
 TAA                                                                c.3183
 X                                                                  p.1060

          .         .         .         .         .         .       g.61995
 aacactatttcccttgccttttcatactagggcagtatctcctctagctagtgcccatac       c.*60

          .         .         .         .         .         .       g.62055
 agaaaattctatcaccatacaaaatttaatgcagtatttatgttttaaagcacaggtgta       c.*120

          .         .         .         .         .         .       g.62115
 ccgaaaactgtgaaaagtctgaatttatgggttctatgcatgcatttttgcctaacctag       c.*180

          .         .         .         .         .         .       g.62175
 agaaagagtttgataaatttttaccagctttgaagatggattaacttttgactttgagct       c.*240

          .         .         .         .         .         .       g.62235
 ttaaacttttaagtcagacatttcaggactaatttgattttgtagatatcattgtaagaa       c.*300

          .         .         .         .         .         .       g.62295
 ctttatttgaaagactgaataaagggatttgatttgttttcatcatttaagcacagtctt       c.*360

          .         .         .         .         .         .       g.62355
 gtgatgatgagaacataagtgtgattcttttctgtattttgaggtccctaatccaaagcc       c.*420

          .         .         .         .         .         .       g.62415
 cattttgctaggattttttctgctatcagatgtgttttcactctaaacctagtcttttat       c.*480

          .         .         .         .         .         .       g.62475
 gacatgaattgattacttcctgttaattttctatcctcccttactatcctccttttttgt       c.*540

          .         .         .         .         .         .       g.62535
 tttcagtattcagtatttcagtattctagagtagattttgatataaaagaaaataattct       c.*600

          .         .         .         .         .         .       g.62595
 tacatcatcttttgcaacaaattttgttttctgaattgataataaatttaaaaagttgat       c.*660

          .         .         .         .         .         .       g.62655
 tcctattttcacatatgttcatatgcccctatgtttgggggtatcactcagttttccctt       c.*720

          .         .         .         .         .         .       g.62715
 ttttgtgtaaagatgttttgtaaaacaaaattgtctcaaagtgattatattatatatata       c.*780

          .         .         .         .         .         .       g.62775
 aaaagtaacagattttaacaaaggttaaaagattcttggggtaacagattcttctggggc       c.*840

          .         .         .         .         .         .       g.62835
 ttggaaatcttccatttctcttgagggttttttttaatgagtgttaaatatgttaaaatt       c.*900

          .         .         .         .         .         .       g.62895
 tttatttctacctcatgtgtttttttaaattattacttgaagttttttatttaataaatt       c.*960

          .                                                         g.62910
 ttttctactaatgga                                                    c.*975

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The DNA replication helicase 2 homolog (yeast) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 08
©2004-2013 Leiden University Medical Center