Fanconi anemia, complementation group A (FANCA) - coding DNA reference sequence

(used for variant description)

(last modified October 7, 2014)


This file was created to facilitate the description of sequence variants in the FANCA gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_011706.1 (identical to LRG_495), covering FANCA transcript NM_000135.2


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5042
                   cgggcgcagggagccgccgccggggctgtaggcgccaaggcc       c.-1

          .         .         .         .         .         .       g.5102
 ATGTCCGACTCGTGGGTCCCGAACTCCGCCTCGGGCCAGGACCCAGGGGGCCGCCGGAGG       c.60
 M  S  D  S  W  V  P  N  S  A  S  G  Q  D  P  G  G  R  R  R         p.20

          .          | 02        .         .         .         .    g.5712
 GCCTGGGCCGAGCTGCTGG | CGGGAAGGGTCAAGAGGGAAAAATATAATCCTGAAAGGGCA    c.120
 A  W  A  E  L  L  A |   G  R  V  K  R  E  K  Y  N  P  E  R  A      p.40

          .         .         .         .         .         .       g.5772
 CAGAAATTAAAGGAATCAGCTGTGCGCCTCCTGCGAAGCCATCAGGACCTGAATGCCCTT       c.180
 Q  K  L  K  E  S  A  V  R  L  L  R  S  H  Q  D  L  N  A  L         p.60

           | 03        .         .         .         .         .    g.7095
 TTGCTTGAG | GTAGAAGGTCCACTGTGTAAAAAATTGTCTCTCAGCAAAGTGATTGACTGT    c.240
 L  L  E   | V  E  G  P  L  C  K  K  L  S  L  S  K  V  I  D  C      p.80

          .         .         .         .    | 04    .         .    g.10603
 GACAGTTCTGAGGCCTATGCTAATCATTCTAGTTCATTTATAG | GCTCTGCTTTGCAGGAT    c.300
 D  S  S  E  A  Y  A  N  H  S  S  S  F  I  G |   S  A  L  Q  D      p.100

          .         .         .         .         .         .       g.10663
 CAAGCCTCAAGGCTGGGGGTTCCCGTGGGTATTCTCTCAGCCGGGATGGTTGCCTCTAGC       c.360
 Q  A  S  R  L  G  V  P  V  G  I  L  S  A  G  M  V  A  S  S         p.120

          .         .         .         .         .         .       g.10723
 GTGGGACAGATCTGCACGGCTCCAGCGGAGACCAGTCACCCTGTGCTGCTGACTGTGGAG       c.420
 V  G  Q  I  C  T  A  P  A  E  T  S  H  P  V  L  L  T  V  E         p.140

        | 05 .         .         .         .         .         .    g.10909
 CAGAGA | AAGAAGCTGTCTTCCCTGTTAGAGTTTGCTCAGTATTTATTGGCACACAGTATG    c.480
 Q  R   | K  K  L  S  S  L  L  E  F  A  Q  Y  L  L  A  H  S  M      p.160

          .         .         .         .   | 06     .         .    g.13308
 TTCTCCCGTCTTTCCTTCTGTCAAGAATTATGGAAAATACAG | AGTTCTTTGTTGCTTGAA    c.540
 F  S  R  L  S  F  C  Q  E  L  W  K  I  Q   | S  S  L  L  L  E      p.180

          .         .         .         .         .       | 07 .    g.16269
 GCGGTGTGGCATCTTCACGTACAAGGCATTGTGAGCCTGCAAGAGCTGCTGGAAAG | CCAT    c.600
 A  V  W  H  L  H  V  Q  G  I  V  S  L  Q  E  L  L  E  S  |  H      p.200

          .         .         .         .         .         .       g.16329
 CCCGACATGCATGCTGTGGGATCGTGGCTCTTCAGGAATCTGTGCTGCCTTTGTGAACAG       c.660
 P  D  M  H  A  V  G  S  W  L  F  R  N  L  C  C  L  C  E  Q         p.220

          .         .         .         .          | 08        .    g.18327
 ATGGAAGCATCCTGCCAGCATGCTGACGTCGCCAGGGCCATGCTTTCTG | ATTTTGTTCAA    c.720
 M  E  A  S  C  Q  H  A  D  V  A  R  A  M  L  S  D |   F  V  Q      p.240

          .         .         .         .         .         .       g.18387
 ATGTTTGTTTTGAGGGGATTTCAGAAAAACTCAGATCTGAGAAGAACTGTGGAGCCTGAA       c.780
 M  F  V  L  R  G  F  Q  K  N  S  D  L  R  R  T  V  E  P  E         p.260

          .   | 09     .         .         .       | 10 .         . g.22439
 AAAATGCCGCAG | GTCACGGTTGATGTACTGCAGAGAATGCTGATTT | TTGCACTTGACGCT c.840
 K  M  P  Q   | V  T  V  D  V  L  Q  R  M  L  I  F |   A  L  D  A   p.280

          .         .         .         .         .    | 11    .    g.25646
 TTGGCTGCTGGAGTACAGGAGGAGTCCTCCACTCACAAGATCGTGAGGTGCTG | GTTCGGA    c.900
 L  A  A  G  V  Q  E  E  S  S  T  H  K  I  V  R  C  W  |  F  G      p.300

          .         .         .         .         .         .       g.25706
 GTGTTCAGTGGACACACGCTTGGCAGTGTAATTTCCACAGATCCTCTGAAGAGGTTCTTC       c.960
 V  F  S  G  H  T  L  G  S  V  I  S  T  D  P  L  K  R  F  F         p.320

          .         .         .         .       | 12 .         .    g.29124
 AGTCATACCCTGACTCAGATACTCACTCACAGCCCTGTGCTGAAAG | CATCTGATGCTGTT    c.1020
 S  H  T  L  T  Q  I  L  T  H  S  P  V  L  K  A |   S  D  A  V      p.340

          .         .         .         .         .         .       g.29184
 CAGATGCAGAGAGAGTGGAGCTTTGCGCGGACACACCCTCTGCTCACCTCACTGTACCGC       c.1080
 Q  M  Q  R  E  W  S  F  A  R  T  H  P  L  L  T  S  L  Y  R         p.360

     | 13    .         .         .         .         .         .    g.29646
 AGG | CTCTTTGTGATGCTGAGTGCAGAGGAGTTGGTTGGCCATTTGCAAGAAGTTCTGGAA    c.1140
 R   | L  F  V  M  L  S  A  E  E  L  V  G  H  L  Q  E  V  L  E      p.380

          .         .         .         .         .         .       g.29706
 ACGCAGGAGGTTCACTGGCAGAGAGTGCTCTCCTTTGTGTCTGCCCTGGTTGTCTGCTTT       c.1200
 T  Q  E  V  H  W  Q  R  V  L  S  F  V  S  A  L  V  V  C  F         p.400

          .         .      | 14  .         .         .         .    g.30156
 CCAGAAGCGCAGCAGCTGCTTGAAG | ACTGGGTGGCGCGTTTGATGGCCCAGGCATTCGAG    c.1260
 P  E  A  Q  Q  L  L  E  D |   W  V  A  R  L  M  A  Q  A  F  E      p.420

          .         .         .         .         .         .       g.30216
 AGCTGCCAGCTGGACAGCATGGTCACTGCGTTCCTGGTTGTGCGCCAGGCAGCACTGGAG       c.1320
 S  C  Q  L  D  S  M  V  T  A  F  L  V  V  R  Q  A  A  L  E         p.440

          .         .         .          | 15        .         .    g.36714
 GGCCCCTCTGCGTTCCTGTCATATGCAGACTGGTTCAAG | GCCTCCTTTGGGAGCACACGA    c.1380
 G  P  S  A  F  L  S  Y  A  D  W  F  K   | A  S  F  G  S  T  R      p.460

          .         .         .         .         .         .       g.36774
 GGCTACCATGGCTGCAGCAAGAAGGCCCTGGTCTTCCTGTTTACGTTCTTGTCAGAACTC       c.1440
 G  Y  H  G  C  S  K  K  A  L  V  F  L  F  T  F  L  S  E  L         p.480

          .         .         . | 16       .         .         .    g.38585
 GTGCCTTTTGAGTCTCCCCGGTACCTGCAG | GTGCACATTCTCCACCCACCCCTGGTTCCC    c.1500
 V  P  F  E  S  P  R  Y  L  Q   | V  H  I  L  H  P  P  L  V  P      p.500

          .         .         .         .         .         .       g.38645
 GGCAAGTACCGCTCCCTCCTCACAGACTACATCTCATTGGCCAAGACACGGCTGGCCGAC       c.1560
 G  K  Y  R  S  L  L  T  D  Y  I  S  L  A  K  T  R  L  A  D         p.520

        | 17 .         .         .         .         .         .    g.38793
 CTCAAG | GTTTCTATAGAAAACATGGGACTCTACGAGGATTTGTCATCAGCTGGGGACATT    c.1620
 L  K   | V  S  I  E  N  M  G  L  Y  E  D  L  S  S  A  G  D  I      p.540

        | 18 .         .         .         .         .         .    g.41754
 ACTGAG | CCCCACAGCCAAGCTCTTCAGGATGTTGAAAAGGCCATCATGGTGTTTGAGCAT    c.1680
 T  E   | P  H  S  Q  A  L  Q  D  V  E  K  A  I  M  V  F  E  H      p.560

          .         .         .      | 19  .         .         .    g.42679
 ACGGGGAACATCCCAGTCACCGTCATGGAGGCCAG | CATATTCAGGAGGCCTTACTACGTG    c.1740
 T  G  N  I  P  V  T  V  M  E  A  S  |  I  F  R  R  P  Y  Y  V      p.580

          .         .         .       | 20 .         .         .    g.42831
 TCCCACTTCCTCCCCGCCCTGCTCACACCTCGAGTG | CTCCCCAAAGTCCCTGACTCCCGT    c.1800
 S  H  F  L  P  A  L  L  T  P  R  V   | L  P  K  V  P  D  S  R      p.600

          .         .       | 21 .         .         .         .    g.45876
 GTGGCGTTTATAGAGTCTCTGAAGAG | AGCAGATAAAATCCCCCCATCTCTGTACTCCACC    c.1860
 V  A  F  I  E  S  L  K  R  |  A  D  K  I  P  P  S  L  Y  S  T      p.620

          .         .         .         . | 22       .         .    g.48293
 TACTGCCAGGCCTGCTCTGCTGCTGAAGAGAAGCCAGAAG | ATGCAGCCCTGGGAGTGAGG    c.1920
 Y  C  Q  A  C  S  A  A  E  E  K  P  E  D |   A  A  L  G  V  R      p.640

          .         .         .         .         .         .       g.48353
 GCAGAACCCAACTCTGCTGAGGAGCCCCTGGGACAGCTCACAGCTGCACTGGGAGAGCTG       c.1980
 A  E  P  N  S  A  E  E  P  L  G  Q  L  T  A  A  L  G  E  L         p.660

          .         .         .     | 23   .         .         .    g.49869
 AGAGCCTCCATGACAGACCCCAGCCAGCGTGATG | TTATATCGGCACAGGTGGCAGTGATT    c.2040
 R  A  S  M  T  D  P  S  Q  R  D  V |   I  S  A  Q  V  A  V  I      p.680

          .         .         .         .         .         .       g.49929
 TCTGAAAGACTGAGGGCTGTCCTGGGCCACAATGAGGATGACAGCAGCGTTGAGATATCA       c.2100
 S  E  R  L  R  A  V  L  G  H  N  E  D  D  S  S  V  E  I  S         p.700

          .         .         .         .         .  | 24      .    g.51032
 AAGATTCAGCTCAGCATCAACACGCCGAGACTGGAGCCACGGGAACACATG | GCTGTGGAC    c.2160
 K  I  Q  L  S  I  N  T  P  R  L  E  P  R  E  H  M   | A  V  D      p.720

          .         .         .         .         .         .       g.51092
 CTCCTGCTGACGTCTTTCTGTCAGAACCTGATGGCTGCCTCCAGTGTCGCTCCCCCGGAG       c.2220
 L  L  L  T  S  F  C  Q  N  L  M  A  A  S  S  V  A  P  P  E         p.740

    | 25     .         .         .         .         .         .    g.51456
 AG | GCAGGGTCCCTGGGCTGCCCTCTTCGTGAGGACCATGTGTGGACGTGTGCTCCCTGCA    c.2280
 R  |  Q  G  P  W  A  A  L  F  V  R  T  M  C  G  R  V  L  P  A      p.760

          .         .         .       | 26 .         .         .    g.51657
 GTGCTCACCCGGCTCTGCCAGCTGCTCCGTCACCAG | GGCCCGAGCCTGAGTGCCCCACAT    c.2340
 V  L  T  R  L  C  Q  L  L  R  H  Q   | G  P  S  L  S  A  P  H      p.780

          .         .         .         .         .         .       g.51717
 GTGCTGGGGTTGGCTGCCCTGGCCGTGCACCTGGGTGAGTCCAGGTCTGCGCTCCCAGAG       c.2400
 V  L  G  L  A  A  L  A  V  H  L  G  E  S  R  S  A  L  P  E         p.800

          .         .         .         .         .         .       g.51777
 GTGGATGTGGGTCCTCCTGCACCTGGTGCTGGCCTTCCTGTCCCTGCGCTCTTTGACAGC       c.2460
 V  D  V  G  P  P  A  P  G  A  G  L  P  V  P  A  L  F  D  S         p.820

          .         .         .         .     | 27   .         .    g.54436
 CTCCTGACCTGTAGGACGAGGGATTCCTTGTTCTTCTGCCTGAA | ATTTTGTACAGCAGCA    c.2520
 L  L  T  C  R  T  R  D  S  L  F  F  C  L  K  |  F  C  T  A  A      p.840

          .         .         .         .         .         .       g.54496
 ATTTCTTACTCTCTCTGCAAGTTTTCTTCCCAGTCACGAGATACTTTGTGCAGCTGCTTA       c.2580
 I  S  Y  S  L  C  K  F  S  S  Q  S  R  D  T  L  C  S  C  L         p.860

          .         .  | 28      .         .         .         .    g.56630
 TCTCCAGGCCTTATTAAAAAG | TTTCAGTTCCTCATGTTCAGATTGTTCTCAGAGGCCCGA    c.2640
 S  P  G  L  I  K  K   | F  Q  F  L  M  F  R  L  F  S  E  A  R      p.880

          .         .         .         .         .         .       g.56690
 CAGCCTCTTTCTGAGGAGGACGTAGCCAGCCTTTCCTGGAGACCCTTGCACCTTCCTTCT       c.2700
 Q  P  L  S  E  E  D  V  A  S  L  S  W  R  P  L  H  L  P  S         p.900

          .         .         .         .         .         .       g.56750
 GCAGACTGGCAGAGAGCTGCCCTCTCTCTCTGGACACACAGAACCTTCCGAGAGGTGTTG       c.2760
 A  D  W  Q  R  A  A  L  S  L  W  T  H  R  T  F  R  E  V  L         p.920

          .         | 29         .         .         .         .    g.59677
 AAAGAGGAAGATGTTCAC | TTAACTTACCAAGACTGGTTACACCTGGAGCTGGAAATTCAA    c.2820
 K  E  E  D  V  H   | L  T  Y  Q  D  W  L  H  L  E  L  E  I  Q      p.940

          .         .         .   | 30     .         .         .    g.62980
 CCTGAAGCTGATGCTCTTTCAGATACTGAACG | GCAGGACTTCCACCAGTGGGCGATCCAT    c.2880
 P  E  A  D  A  L  S  D  T  E  R  |  Q  D  F  H  Q  W  A  I  H      p.960

          .         .         .         .         .         .       g.63040
 GAGCACTTTCTCCCTGAGTCCTCGGCTTCAGGGGGCTGTGACGGAGACCTGCAGGCTGCG       c.2940
 E  H  F  L  P  E  S  S  A  S  G  G  C  D  G  D  L  Q  A  A         p.980

          .         .         .         .  | 31      .         .    g.69454
 TGTACCATTCTTGTCAACGCACTGATGGATTTCCACCAAAG | CTCAAGGAGTTATGACCAC    c.3000
 C  T  I  L  V  N  A  L  M  D  F  H  Q  S  |  S  R  S  Y  D  H      p.1000

          .         .         .         .         .         .       g.69514
 TCAGAAAATTCTGATTTGGTCTTTGGTGGCCGCACAGGAAATGAGGATATTATTTCCAGA       c.3060
 S  E  N  S  D  L  V  F  G  G  R  T  G  N  E  D  I  I  S  R         p.1020

        | 32 .         .         .         .         .         .    g.71809
 TTGCAG | GAGATGGTAGCTGACCTGGAGCTGCAGCAAGACCTCATAGTGCCTCTCGGCCAC    c.3120
 L  Q   | E  M  V  A  D  L  E  L  Q  Q  D  L  I  V  P  L  G  H      p.1040

          .         .         .         .         .         .       g.71869
 ACCCCTTCCCAGGAGCACTTCCTCTTTGAGATTTTCCGCAGACGGCTCCAGGCTCTGACA       c.3180
 T  P  S  Q  E  H  F  L  F  E  I  F  R  R  R  L  Q  A  L  T         p.1060

          .         .         .         .         .          | 33    g.72891
 AGCGGGTGGAGCGTGGCTGCCAGCCTTCAGAGACAGAGGGAGCTGCTAATGTACAAACG | G    c.3240
 S  G  W  S  V  A  A  S  L  Q  R  Q  R  E  L  L  M  Y  K  R  |      p.1080

          .         .         .         .         .         .       g.72951
 ATCCTCCTCCGCCTGCCTTCGTCTGTCCTCTGCGGCAGCAGCTTCCAGGCAGAACAGCCC       c.3300
 I  L  L  R  L  P  S  S  V  L  C  G  S  S  F  Q  A  E  Q  P         p.1100

          .         .         .         .         | 34         .    g.74779
 ATCACTGCCAGATGCGAGCAGTTCTTCCACTTGGTCAACTCTGAGATG | AGAAACTTCTGC    c.3360
 I  T  A  R  C  E  Q  F  F  H  L  V  N  S  E  M   | R  N  F  C      p.1120

          .         .         .         .         | 35         .    g.74981
 TCCCACGGAGGTGCCCTGACACAGGACATCACTGCCCACTTCTTCAGG | GGCCTCCTGAAC    c.3420
 S  H  G  G  A  L  T  Q  D  I  T  A  H  F  F  R   | G  L  L  N      p.1140

          .         .         .         .         .         .       g.75041
 GCCTGTCTGCGGAGCAGAGACCCCTCCCTGATGGTCGACTTCATACTGGCCAAGTGCCAG       c.3480
 A  C  L  R  S  R  D  P  S  L  M  V  D  F  I  L  A  K  C  Q         p.1160

          .         .         .    | 36    .         .         .    g.76613
 ACGAAATGCCCCTTAATTTTGACCTCTGCTCTG | GTGTGGTGGCCGAGCCTGGAGCCTGTG    c.3540
 T  K  C  P  L  I  L  T  S  A  L   | V  W  W  P  S  L  E  P  V      p.1180

          .         .         .         .         .         .       g.76673
 CTGCTCTGCCGGTGGAGGAGACACTGCCAGAGCCCGCTGCCCCGGGAACTGCAGAAGCTA       c.3600
 L  L  C  R  W  R  R  H  C  Q  S  P  L  P  R  E  L  Q  K  L         p.1200

          .         .       | 37 .         .         .         .    g.78753
 CAAGAAGGCCGGCAGTTTGCCAGCGA | TTTCCTCTCCCCTGAGGCTGCCTCCCCAGCACCC    c.3660
 Q  E  G  R  Q  F  A  S  D  |  F  L  S  P  E  A  A  S  P  A  P      p.1220

          .         .         .         .         .         .       g.78813
 AACCCGGACTGGCTCTCAGCTGCTGCACTGCACTTTGCGATTCAACAAGTCAGGGAAGAA       c.3720
 N  P  D  W  L  S  A  A  A  L  H  F  A  I  Q  Q  V  R  E  E         p.1240

          .         .         .         .      | 38  .         .    g.80806
 AACATCAGGAAGCAGCTAAAGAAGCTGGACTGCGAGAGAGAGGAG | CTATTGGTTTTCCTT    c.3780
 N  I  R  K  Q  L  K  K  L  D  C  E  R  E  E   | L  L  V  F  L      p.1260

          .         .         .         .         | 39         .    g.81570
 TTCTTCTTCTCCTTGATGGGCCTGCTGTCGTCACATCTGACCTCAAAT | AGCACCACAGAC    c.3840
 F  F  F  S  L  M  G  L  L  S  S  H  L  T  S  N   | S  T  T  D      p.1280

          .         .         .         .         .         .       g.81630
 CTGCCAAAGGCTTTCCACGTTTGTGCAGCAATCCTCGAGTGTTTAGAGAAGAGGAAGATA       c.3900
 L  P  K  A  F  H  V  C  A  A  I  L  E  C  L  E  K  R  K  I         p.1300

          .         .         .     | 40   .         .         .    g.82130
 TCCTGGCTGGCACTCTTTCAGTTGACAGAGAGTG | ACCTCAGGCTGGGGCGGCTCCTCCTC    c.3960
 S  W  L  A  L  F  Q  L  T  E  S  D |   L  R  L  G  R  L  L  L      p.1320

          .         .         .         .         . | 41       .    g.82378
 CGTGTGGCCCCGGATCAGCACACCAGGCTGCTGCCTTTCGCTTTTTACAG | TCTTCTCTCC    c.4020
 R  V  A  P  D  Q  H  T  R  L  L  P  F  A  F  Y  S  |  L  L  S      p.1340

          .         .         .         .         .         .       g.82438
 TACTTCCATGAAGACGCGGCCATCAGGGAAGAGGCCTTCCTGCATGTTGCTGTGGACATG       c.4080
 Y  F  H  E  D  A  A  I  R  E  E  A  F  L  H  V  A  V  D  M         p.1360

          .         .         .         .         .         .       g.82498
 TACTTGAAGCTGGTCCAGCTCTTCGTGGCTGGGGATACAAGCACAGTTTCACCTCCAGCT       c.4140
 Y  L  K  L  V  Q  L  F  V  A  G  D  T  S  T  V  S  P  P  A         p.1380

          .         .        | 42.         .         .         .    g.82716
 GGCAGGAGCCTGGAGCTCAAGGGTCAG | GGCAACCCCGTGGAACTGATAACAAAAGCTCGT    c.4200
 G  R  S  L  E  L  K  G  Q   | G  N  P  V  E  L  I  T  K  A  R      p.1400

          .         .         .         .         .         .       g.82776
 CTTTTTCTGCTGCAGTTAATACCTCGGTGCCCGAAAAAGAGCTTCTCACACGTGGCAGAG       c.4260
 L  F  L  L  Q  L  I  P  R  C  P  K  K  S  F  S  H  V  A  E         p.1420

  | 43       .         .         .         .         .         .    g.83009
  | CTGCTGGCTGATCGTGGGGACTGCGACCCAGAGGTGAGCGCCGCCCTCCAGAGCAGACAG    c.4320
  | L  L  A  D  R  G  D  C  D  P  E  V  S  A  A  L  Q  S  R  Q      p.1440

          .         .         .         .                           g.83057
 CAGGCTGCCCCTGACGCTGACCTGTCCCAGGAGCCTCATCTCTTCTGA                   c.4368
 Q  A  A  P  D  A  D  L  S  Q  E  P  H  L  F  X                     p.1455

          .         .         .         .         .         .       g.83117
 cgggacctgccactgcacaccagcccagctcccgtgtaaataatttattacaagcataac       c.*60

          .         .         .         .         .         .       g.83177
 atggagctcttgttgcactaaaaagtggattacaaatctcctcgactgctttagtgggga       c.*120

          .         .         .         .         .         .       g.83237
 aaggaatcaattatttatgaactgtccggccccgagtcactcagcgtttgcgggaaaata       c.*180

          .         .         .         .         .         .       g.83297
 aaccactggtcccagagcagaggaaggctacttgagccggacaccaagcccgcctccagc       c.*240

          .         .         .         .         .         .       g.83357
 accaagggcgggcagcaccctccgaccctcccatgcgggtgcacacgaagggtgaggctg       c.*300

          .         .         .         .         .         .       g.83417
 acacagccactgcggagtccaggctgctagaggtgctcatcctcactgccgtcctcaggt       c.*360

          .         .         .         .         .         .       g.83477
 gggttcgggcttcaccgcctggccctctgtggtcacagaggggctcggtggcccaggtgg       c.*420

          .         .         .         .         .         .       g.83537
 tggttccgcctccaggggcagggccttgtcctgggtctgtgtcagcgggtgcaccatgga       c.*480

          .         .         .         .         .         .       g.83597
 catgtgtacattgaggttgtgggccttctcaaaccgccggccacactggtcacaggcaaa       c.*540

          .         .         .         .         .         .       g.83657
 gtccagctcagtctcagccttgtgtttggtcatgtggtacttgagggatgcccgctgcct       c.*600

          .         .         .         .         .         .       g.83717
 gcactggaacccacagacctcacacctgggggacagaggcagataagaaggtgcgagggc       c.*660

          .         .         .         .         .         .       g.83777
 cacagccctgggagggggtcctgactcacacttactgcaaaggcttggctcccgaatgtc       c.*720

          .         .         .         .         .         .       g.83837
 gcatttggtggacgagaaggtgcttccgctgcttgaaggtttgtccacattcgtcacaga       c.*780

          .         .         .         .         .         .       g.83897
 tatagttccgcacctctgagaggggagagtccagtgagtccaggcccctgatgctccaac       c.*840

          .         .         .         .         .         .       g.83957
 ctcccggggggacgacgatgacaatgtgaaaccatcacagctgggaagacatttctgcac       c.*900

          .         .         .         .         .         .       g.84017
 atggttcaccatgcagtgggcccaagcaaggggcctatgagggcctcgtttattaagatc       c.*960

          .         .         .         .         .         .       g.84077
 tttaaactgctttatacactgtcacgtggcttcatcagctgtgtgcatttcaggatggtt       c.*1020

          .         .         .                                     g.84107
 tttaaagaaacctcagaaagctatttcctt                                     c.*1050

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Fanconi anemia, complementation group A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 11c
©2004-2014 Leiden University Medical Center