guanylate cyclase activator 1A (retina) (GUCA1A) - coding DNA reference sequence

(used for variant description)

(last modified February 28, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_000409.3 in the GUCA1A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009938.1, covering GUCA1A transcript NM_000409.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5045
                agtatcctgccaagagtcctccctgaccaccagaagttccacctc       c.-601

 .         .         .         .         .         .                g.5105
 accatcaagaaaggccctggtccaggatgtgcaaggtgtgatgaaatcacagggctgggg       c.-541

 .         .         .         .         .         .                g.5165
 aaggtcagctcggggtcacaagaagcctgatgggcaggaaagagcatgaaagccccagcc       c.-481

 .         .         .   | 02     .         .         .             g.12551
 agcctcacatgtgcggctgggag | gactcacagaaaccctctgtacccagtcatgggccaa    c.-421

 .         .         .         .         .         .                g.12611
 agacaccgtcatgcaagggggtgaaggctccacactcgtcccggccccgggcgtggaagc       c.-361

 .         .         .         .         .         .                g.12671
 aggacctcgagcagtctctggcagcagcctatgtgccggtcgttgtggactctaaggggc       c.-301

 .         .         | 03         .         .         .             g.22968
 agaatccggacaagctcag | ggtacagtctcccctggggctgcaaggatttagtggagact    c.-241

 .         .         .         .         .         .                g.23028
 cttaacaccagttctctggcatctgtgagtttgagtgtgggccatcatcttcttccttct       c.-181

 .         .         .         .         .         .                g.23088
 gctctctccctctccacatttcccggtaccatctgatccatcaggcccttctttgctcag       c.-121

 .         .         .         .         .         .                g.23148
 gcctgaaggactcaggcctgtgagagaggacggccccgttgtcggccaagacacctttgg       c.-61

 .         .         .         .         .         .                g.23208
 gcgaggagcagcgaacagggcctgtccatctcagacgtcagccccctgaaggcctgagca       c.-1

          .         .         .         .         .         .       g.23268
 ATGGGCAACGTGATGGAGGGAAAGTCAGTGGAGGAGCTGAGCAGCACCGAGTGCCACCAG       c.60
 M  G  N  V  M  E  G  K  S  V  E  E  L  S  S  T  E  C  H  Q         p.20

          .         .         .         .         .         .       g.23328
 TGGTACAAGAAGTTCATGACTGAGTGCCCCTCTGGCCAACTCACCCTCTATGAGTTCCGC       c.120
 W  Y  K  K  F  M  T  E  C  P  S  G  Q  L  T  L  Y  E  F  R         p.40

          .         .         .         .         .         .       g.23388
 CAGTTCTTCGGCCTCAAGAACCTGAGCCCGTCGGCCAGCCAGTACGTGGAACAGATGTTT       c.180
 Q  F  F  G  L  K  N  L  S  P  S  A  S  Q  Y  V  E  Q  M  F         p.60

          .         .  | 04      .         .         .         .    g.27913
 GAGACTTTTGACTTCAACAAG | GACGGCTACATTGATTTCATGGAGTACGTGGCAGCGCTC    c.240
 E  T  F  D  F  N  K   | D  G  Y  I  D  F  M  E  Y  V  A  A  L      p.80

          .         .         .         .         .         .       g.27973
 AGCTTGGTCCTCAAGGGGAAGGTGGAACAGAAGCTCCGCTGGTACTTCAAGCTCTATGAT       c.300
 S  L  V  L  K  G  K  V  E  Q  K  L  R  W  Y  F  K  L  Y  D         p.100

          .         .         .         .         .  | 05      .    g.28405
 GTAGATGGCAACGGCTGCATTGACCGCGATGAGCTGCTCACCATCATCCAG | GCCATTCGC    c.360
 V  D  G  N  G  C  I  D  R  D  E  L  L  T  I  I  Q   | A  I  R      p.120

          .         .         .         .         .         .       g.28465
 GCCATTAACCCCTGCAGCGATACCACCATGACTGCAGAGGAGTTCACCGATACAGTGTTC       c.420
 A  I  N  P  C  S  D  T  T  M  T  A  E  E  F  T  D  T  V  F         p.140

          .         .      | 06  .         .         .         .    g.28872
 TCCAAGATTGACGTCAACGGGGATG | GGGAACTCTCCCTGGAAGAGTTTATAGAGGGCGTC    c.480
 S  K  I  D  V  N  G  D  G |   E  L  S  L  E  E  F  I  E  G  V      p.160

          .         .         .         .         .         .       g.28932
 CAGAAGGACCAGATGCTCCTGGACACACTGACACGAAGCCTGGACCTTACCCGCATCGTG       c.540
 Q  K  D  Q  M  L  L  D  T  L  T  R  S  L  D  L  T  R  I  V         p.180

          .         .         .         .         .         .       g.28992
 CGCAGGCTCCAGAATGGCGAGCAAGACGAGGAGGGGGCTGACGAGGCCGCTGAGGCAGCC       c.600
 R  R  L  Q  N  G  E  Q  D  E  E  G  A  D  E  A  A  E  A  A         p.200

                                                                    g.28998
 GGCTGA                                                             c.606
 G  X                                                               p.201

          .         .         .         .         .         .       g.29058
 gtgcaccgcccggctgcttctgcactagcgggtggggtggtatggtggtgcctgttggtg       c.*60

          .         .         .         .         .         .       g.29118
 gtgttcttgtcttaaccctagatagaatctaatgaactcagaggcttagctcgcctcttt       c.*120

          .         .         .         .         .         .       g.29178
 agggtccatggtggcagcagagaggcagaagtgggagtccagagccaggaacagtgaagg       c.*180

          .         .         .         .         .         .       g.29238
 atggttcctggcccctctgagtgacagctggtggcagcactccttgctggggggcactgt       c.*240

          .         .         .         .         .         .       g.29298
 tcaacatccctctgccgtcgggtgaccccctagcccttctgactcctctcccagcttttc       c.*300

          .         .         .         .         .         .       g.29358
 ccagctttccccactgagcttctccagtccatgctcttctggacgtggactctctgaggc       c.*360

          .         .         .         .         .         .       g.29418
 agaactgagcttttccaggcctcttatggaatcctgcagatccagtggctgcagcttcaa       c.*420

          .         .         .         .         .         .       g.29478
 tcccagtgctgcaatcacacatccattctgccctgggggaccctggagcctacttgtgcg       c.*480

          .         .         .         .         .         .       g.29538
 ctttgcatttcattgattgacgcctcccttcaacaagcatttactgagcgcctactatgt       c.*540

          .         .         .         .         .         .       g.29598
 actaatgctagatgttagatgtacaaagaagacagttttcatcctctaggaactcatagg       c.*600

          .         .         .         .         .                 g.29651
 ctaatggtgagacacacagacaaacatcattataataaaatatgctaagagaa              c.*653

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Guanylate cyclase activator 1A (retina) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.