huntingtin (HTT) - coding DNA reference sequence

(used for variant description)

(last modified October 23, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_002111.6 in the HTT gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000004.11, covering HTT transcript NM_002111.6.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5025
                                    gctgccgggacgggtccaagatgga       c.-121

 .         .         .         .         .         .                g.5085
 cggccgctcaggttctgcttttacctgcggcccagagccccattcattgccccggtgctg       c.-61

 .         .         .         .         .         .                g.5145
 agcggcgccgcgagtcggcccgaggcctccggggactgccgtgccgggcgggagaccgcc       c.-1

          .         .         .         .         .         .       g.5205
 ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTCCAGCAGCAG       c.60
 M  A  T  L  E  K  L  M  K  A  F  E  S  L  K  S  F  Q  Q  Q         p.20

          .         .         .         .         .         .       g.5265
 CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAACAGCCGCCA       c.120
 Q  Q  Q  Q  Q  Q  Q  Q  Q  Q  Q  Q  Q  Q  Q  Q  Q  Q  P  P         p.40

          .         .         .         .         .         .       g.5325
 CCGCCGCCGCCGCCGCCGCCGCCTCCTCAGCTTCCTCAGCCGCCGCCGCAGGCACAGCCG       c.180
 P  P  P  P  P  P  P  P  P  Q  L  P  Q  P  P  P  Q  A  Q  P         p.60

          .         .         .         .         .         .       g.5385
 CTGCTGCCTCAGCCGCAGCCGCCCCCGCCGCCGCCCCCGCCGCCACCCGGCCCGGCTGTG       c.240
 L  L  P  Q  P  Q  P  P  P  P  P  P  P  P  P  P  G  P  A  V         p.80

          .         .    | 02    .         .         .         .    g.17295
 GCTGAGGAGCCGCTGCACCGACC | AAAGAAAGAACTTTCAGCTACCAAGAAAGACCGTGTG    c.300
 A  E  E  P  L  H  R  P  |  K  K  E  L  S  A  T  K  K  D  R  V      p.100

          .         .         .         .        | 03.         .    g.29606
 AATCATTGTCTGACAATATGTGAAAACATAGTGGCACAGTCTGTCAG | AAATTCTCCAGAA    c.360
 N  H  C  L  T  I  C  E  N  I  V  A  Q  S  V  R  |  N  S  P  E      p.120

          .         .         .         .         .         .       g.29666
 TTTCAGAAACTTCTGGGCATCGCTATGGAACTTTTTCTGCTGTGCAGTGATGACGCAGAG       c.420
 F  Q  K  L  L  G  I  A  M  E  L  F  L  L  C  S  D  D  A  E         p.140

          .         .         .         .         | 04         .    g.34155
 TCAGATGTCAGGATGGTGGCTGACGAATGCCTCAACAAAGTTATCAAA | GCTTTGATGGAT    c.480
 S  D  V  R  M  V  A  D  E  C  L  N  K  V  I  K   | A  L  M  D      p.160

          .         .         .         .         | 05         .    g.35688
 TCTAATCTTCCAAGGTTACAGCTCGAGCTCTATAAGGAAATTAAAAAG | AATGGTGCCCCT    c.540
 S  N  L  P  R  L  Q  L  E  L  Y  K  E  I  K  K   | N  G  A  P      p.180

          .         .         .         .         .         .       g.35748
 CGGAGTTTGCGTGCTGCCCTGTGGAGGTTTGCTGAGCTGGCTCACCTGGTTCGGCCTCAG       c.600
 R  S  L  R  A  A  L  W  R  F  A  E  L  A  H  L  V  R  P  Q         p.200

          | 06         .         .         .         .         .    g.37656
 AAATGCAG | GCCTTACCTGGTGAACCTTCTGCCGTGCCTGACTCGAACAAGCAAGAGACCC    c.660
 K  C  R  |  P  Y  L  V  N  L  L  P  C  L  T  R  T  S  K  R  P      p.220

          .         .         .         .         .         .       g.37716
 GAAGAATCAGTCCAGGAGACCTTGGCTGCAGCTGTTCCCAAAATTATGGCTTCTTTTGGC       c.720
 E  E  S  V  Q  E  T  L  A  A  A  V  P  K  I  M  A  S  F  G         p.240

          .         .        | 07.         .         .         .    g.45656
 AATTTTGCAAATGACAATGAAATTAAG | GTTTTGTTAAAGGCCTTCATAGCGAACCTGAAG    c.780
 N  F  A  N  D  N  E  I  K   | V  L  L  K  A  F  I  A  N  L  K      p.260

          .         .         .         .         .         .       g.45716
 TCAAGCTCCCCCACCATTCGGCGGACAGCGGCTGGATCAGCAGTGAGCATCTGCCAGCAC       c.840
 S  S  S  P  T  I  R  R  T  A  A  G  S  A  V  S  I  C  Q  H         p.280

          .         .         .         .          | 08        .    g.46415
 TCAAGAAGGACACAATATTTCTATAGTTGGCTACTAAATGTGCTCTTAG | GCTTACTCGTT    c.900
 S  R  R  T  Q  Y  F  Y  S  W  L  L  N  V  L  L  G |   L  L  V      p.300

          .         .         .         .         .         .       g.46475
 CCTGTCGAGGATGAACACTCCACTCTGCTGATTCTTGGCGTGCTGCTCACCCTGAGGTAT       c.960
 P  V  E  D  E  H  S  T  L  L  I  L  G  V  L  L  T  L  R  Y         p.320

          .         .         .         .         .         .       g.46535
 TTGGTGCCCTTGCTGCAGCAGCAGGTCAAGGACACAAGCCTGAAAGGCAGCTTCGGAGTG       c.1020
 L  V  P  L  L  Q  Q  Q  V  K  D  T  S  L  K  G  S  F  G  V         p.340

          .         .         .         .         | 09         .    g.51559
 ACAAGGAAAGAAATGGAAGTCTCTCCTTCTGCAGAGCAGCTTGTCCAG | GTTTATGAACTG    c.1080
 T  R  K  E  M  E  V  S  P  S  A  E  Q  L  V  Q   | V  Y  E  L      p.360

          .         .         .         .         .         .       g.51619
 ACGTTACATCATACACAGCACCAAGACCACAATGTTGTGACCGGAGCCCTGGAGCTGTTG       c.1140
 T  L  H  H  T  Q  H  Q  D  H  N  V  V  T  G  A  L  E  L  L         p.380

          .         .         .         .         .         .       g.51679
 CAGCAGCTCTTCAGAACGCCTCCACCCGAGCTTCTGCAAACCCTGACCGCAGTCGGGGGC       c.1200
 Q  Q  L  F  R  T  P  P  P  E  L  L  Q  T  L  T  A  V  G  G         p.400

          .         .         .         .         .         .       g.51739
 ATTGGGCAGCTCACCGCTGCTAAGGAGGAGTCTGGTGGCCGAAGCCGTAGTGGGAGTATT       c.1260
 I  G  Q  L  T  A  A  K  E  E  S  G  G  R  S  R  S  G  S  I         p.420

          .    | 10    .         .         .         .         .    g.53255
 GTGGAACTTATAG | CTGGAGGGGGTTCCTCATGCAGCCCTGTCCTTTCAAGAAAACAAAAA    c.1320
 V  E  L  I  A |   G  G  G  S  S  C  S  P  V  L  S  R  K  Q  K      p.440

   | 11      .         .         .         .         .         .    g.55927
 G | GCAAAGTGCTCTTAGGAGAAGAAGAAGCCTTGGAGGATGACTCTGAATCGAGATCGGAT    c.1380
 G |   K  V  L  L  G  E  E  E  A  L  E  D  D  S  E  S  R  S  D      p.460

          .         .   | 12     .         .         .         .    g.57621
 GTCAGCAGCTCTGCCTTAACAG | CCTCAGTGAAGGATGAGATCAGTGGAGAGCTGGCTGCT    c.1440
 V  S  S  S  A  L  T  A |   S  V  K  D  E  I  S  G  E  L  A  A      p.480

          .         .         .         .         .         .       g.57681
 TCTTCAGGGGTTTCCACTCCAGGGTCAGCAGGTCATGACATCATCACAGAACAGCCACGG       c.1500
 S  S  G  V  S  T  P  G  S  A  G  H  D  I  I  T  E  Q  P  R         p.500

          .         .         .         .         .         .       g.57741
 TCACAGCACACACTGCAGGCGGACTCAGTGGATCTGGCCAGCTGTGACTTGACAAGCTCT       c.1560
 S  Q  H  T  L  Q  A  D  S  V  D  L  A  S  C  D  L  T  S  S         p.520

          .         .         .         .         .         .       g.57801
 GCCACTGATGGGGATGAGGAGGATATCTTGAGCCACAGCTCCAGCCAGGTCAGCGCCGTC       c.1620
 A  T  D  G  D  E  E  D  I  L  S  H  S  S  S  Q  V  S  A  V         p.540

          .         .         .         .         .         .       g.57861
 CCATCTGACCCTGCCATGGACCTGAATGATGGGACCCAGGCCTCGTCGCCCATCAGCGAC       c.1680
 P  S  D  P  A  M  D  L  N  D  G  T  Q  A  S  S  P  I  S  D         p.560

          .         .         .         .         .         .       g.57921
 AGCTCCCAGACCACCACCGAAGGGCCTGATTCAGCTGTTACCCCTTCAGACAGTTCTGAA       c.1740
 S  S  Q  T  T  T  E  G  P  D  S  A  V  T  P  S  D  S  S  E         p.580

     | 13    .         .         .         .         .         .    g.60300
 ATT | GTGTTAGACGGTACCGACAACCAGTATTTGGGCCTGCAGATTGGACAGCCCCAGGAT    c.1800
 I   | V  L  D  G  T  D  N  Q  Y  L  G  L  Q  I  G  Q  P  Q  D      p.600

          .         .         .         .         .         .       g.60360
 GAAGATGAGGAAGCCACAGGTATTCTTCCTGATGAAGCCTCGGAGGCCTTCAGGAACTCT       c.1860
 E  D  E  E  A  T  G  I  L  P  D  E  A  S  E  A  F  R  N  S         p.620

         | 14.         .         .         .         .         .    g.60677
 TCCATGG | CCCTTCAACAGGCACATTTATTGAAAAACATGAGTCACTGCAGGCAGCCTTCT    c.1920
 S  M  A |   L  Q  Q  A  H  L  L  K  N  M  S  H  C  R  Q  P  S      p.640

          .         .         .         .         .         .       g.60737
 GACAGCAGTGTTGATAAATTTGTGTTGAGAGATGAAGCTACTGAACCGGGTGATCAAGAA       c.1980
 D  S  S  V  D  K  F  V  L  R  D  E  A  T  E  P  G  D  Q  E         p.660

        | 15 .         .         .         .         .         .    g.61659
 AACAAG | CCTTGCCGCATCAAAGGTGACATTGGACAGTCCACTGATGATGACTCTGCACCT    c.2040
 N  K   | P  C  R  I  K  G  D  I  G  Q  S  T  D  D  D  S  A  P      p.680

          .         .         .         .         .         | 16    g.61959
 CTTGTCCATTGTGTCCGCCTTTTATCTGCTTCGTTTTTGCTAACAGGGGGAAAAAATG | TG    c.2100
 L  V  H  C  V  R  L  L  S  A  S  F  L  L  T  G  G  K  N  V |       p.700

          .         .         .         .         .         .       g.62019
 CTGGTTCCGGACAGGGATGTGAGGGTCAGCGTGAAGGCCCTGGCCCTCAGCTGTGTGGGA       c.2160
 L  V  P  D  R  D  V  R  V  S  V  K  A  L  A  L  S  C  V  G         p.720

          .         .         .         .         .         .       g.62079
 GCAGCTGTGGCCCTCCACCCGGAATCTTTCTTCAGCAAACTCTATAAAGTTCCTCTTGAC       c.2220
 A  A  V  A  L  H  P  E  S  F  F  S  K  L  Y  K  V  P  L  D         p.740

          .       | 17 .         .         .         .         .    g.62925
 ACCACGGAATACCCTG | AGGAACAGTATGTCTCAGACATCTTGAACTACATCGATCATGGA    c.2280
 T  T  E  Y  P  E |   E  Q  Y  V  S  D  I  L  N  Y  I  D  H  G      p.760

          .         .         .         .         .         .       g.62985
 GACCCACAGGTTCGAGGAGCCACTGCCATTCTCTGTGGGACCCTCATCTGCTCCATCCTC       c.2340
 D  P  Q  V  R  G  A  T  A  I  L  C  G  T  L  I  C  S  I  L         p.780

          .         .         .         .         .      | 18  .    g.63138
 AGCAGGTCCCGCTTCCACGTGGGAGATTGGATGGGCACCATTAGAACCCTCACAG | GAAAT    c.2400
 S  R  S  R  F  H  V  G  D  W  M  G  T  I  R  T  L  T  G |   N      p.800

          .         .         .         .         .         .       g.63198
 ACATTTTCTTTGGCGGATTGCATTCCTTTGCTGCGGAAAACACTGAAGGATGAGTCTTCT       c.2460
 T  F  S  L  A  D  C  I  P  L  L  R  K  T  L  K  D  E  S  S         p.820

          .         .         .    | 19    .         .         .    g.64747
 GTTACTTGCAAGTTAGCTTGTACAGCTGTGAGG | AACTGTGTCATGAGTCTCTGCAGCAGC    c.2520
 V  T  C  K  L  A  C  T  A  V  R   | N  C  V  M  S  L  C  S  S      p.840

          .         .         .         .         .         .       g.64807
 AGCTACAGTGAGTTAGGACTGCAGCTGATCATCGATGTGCTGACTCTGAGGAACAGTTCC       c.2580
 S  Y  S  E  L  G  L  Q  L  I  I  D  V  L  T  L  R  N  S  S         p.860

          .         .         .         .         .    | 20    .    g.66230
 TATTGGCTGGTGAGGACAGAGCTTCTGGAAACCCTTGCAGAGATTGACTTCAG | GCTGGTG    c.2640
 Y  W  L  V  R  T  E  L  L  E  T  L  A  E  I  D  F  R  |  L  V      p.880

          .         .         .         .         .        | 21.    g.66548
 AGCTTTTTGGAGGCAAAAGCAGAAAACTTACACAGAGGGGCTCATCATTATACAGGG | CTT    c.2700
 S  F  L  E  A  K  A  E  N  L  H  R  G  A  H  H  Y  T  G   | L      p.900

          .         .         .         .         .         .       g.66608
 TTAAAACTGCAAGAACGAGTGCTCAATAATGTTGTCATCCATTTGCTTGGAGATGAAGAC       c.2760
 L  K  L  Q  E  R  V  L  N  N  V  V  I  H  L  L  G  D  E  D         p.920

          .         .         .         | 22         .         .    g.70851
 CCCAGGGTGCGACATGTTGCCGCAGCATCACTAATTAG | GCTTGTCCCAAAGCTGTTTTAT    c.2820
 P  R  V  R  H  V  A  A  A  S  L  I  R  |  L  V  P  K  L  F  Y      p.940

          .         .         .         .         .         .       g.70911
 AAATGTGACCAAGGACAAGCTGATCCAGTAGTGGCCGTGGCAAGAGATCAAAGCAGTGTT       c.2880
 K  C  D  Q  G  Q  A  D  P  V  V  A  V  A  R  D  Q  S  S  V         p.960

          .         .         .         .         .         .       g.70971
 TACCTGAAACTTCTCATGCATGAGACGCAGCCTCCATCTCATTTCTCCGTCAGCACAATA       c.2940
 Y  L  K  L  L  M  H  E  T  Q  P  P  S  H  F  S  V  S  T  I         p.980

       | 23  .         .         .         .         .         .    g.73140
 ACCAG | AATATATAGAGGCTATAACCTACTACCAAGCATAACAGACGTCACTATGGAAAAT    c.3000
 T  R  |  I  Y  R  G  Y  N  L  L  P  S  I  T  D  V  T  M  E  N      p.1000

          .         .         .         .         .         .       g.73200
 AACCTTTCAAGAGTTATTGCAGCAGTTTCTCATGAACTAATCACATCAACCACCAGAGCA       c.3060
 N  L  S  R  V  I  A  A  V  S  H  E  L  I  T  S  T  T  R  A         p.1020

        | 24 .         .         .         .         .         .    g.75525
 CTCACA | TTTGGATGCTGTGAAGCTTTGTGTCTTCTTTCCACTGCCTTCCCAGTTTGCATT    c.3120
 L  T   | F  G  C  C  E  A  L  C  L  L  S  T  A  F  P  V  C  I      p.1040

          .         .    | 25    .         .         .         .    g.77153
 TGGAGTTTAGGTTGGCACTGTGG | AGTGCCTCCACTGAGTGCCTCAGATGAGTCTAGGAAG    c.3180
 W  S  L  G  W  H  C  G  |  V  P  P  L  S  A  S  D  E  S  R  K      p.1060

          .         .         .         .         .         .       g.77213
 AGCTGTACCGTTGGGATGGCCACAATGATTCTGACCCTGCTCTCGTCAGCTTGGTTCCCA       c.3240
 S  C  T  V  G  M  A  T  M  I  L  T  L  L  S  S  A  W  F  P         p.1080

          .         .         .         .         .      | 26  .    g.78329
 TTGGATCTCTCAGCCCATCAAGATGCTTTGATTTTGGCCGGAAACTTGCTTGCAG | CCAGT    c.3300
 L  D  L  S  A  H  Q  D  A  L  I  L  A  G  N  L  L  A  A |   S      p.1100

          .         .         .         .         .         .       g.78389
 GCTCCCAAATCTCTGAGAAGTTCATGGGCCTCTGAAGAAGAAGCCAACCCAGCAGCCACC       c.3360
 A  P  K  S  L  R  S  S  W  A  S  E  E  E  A  N  P  A  A  T         p.1120

          .         .         .         .         .         .       g.78449
 AAGCAAGAGGAGGTCTGGCCAGCCCTGGGGGACCGGGCCCTGGTGCCCATGGTGGAGCAG       c.3420
 K  Q  E  E  V  W  P  A  L  G  D  R  A  L  V  P  M  V  E  Q         p.1140

          .         .         .         .         .         .       g.78509
 CTCTTCTCTCACCTGCTGAAGGTGATTAACATTTGTGCCCACGTCCTGGATGACGTGGCT       c.3480
 L  F  S  H  L  L  K  V  I  N  I  C  A  H  V  L  D  D  V  A         p.1160

          .         | 27         .         .         .         .    g.84654
 CCTGGACCCGCAATAAAG | GCAGCCTTGCCTTCTCTAACAAACCCCCCTTCTCTAAGTCCC    c.3540
 P  G  P  A  I  K   | A  A  L  P  S  L  T  N  P  P  S  L  S  P      p.1180

          .         .         .         .         .         .       g.84714
 ATCCGACGAAAGGGGAAGGAGAAAGAACCAGGAGAACAAGCATCTGTACCGTTGAGTCCC       c.3600
 I  R  R  K  G  K  E  K  E  P  G  E  Q  A  S  V  P  L  S  P         p.1200

          .         .      | 28  .         .         .         .    g.87426
 AAGAAAGGCAGTGAGGCCAGTGCAG | CTTCTAGACAATCTGATACCTCAGGTCCTGTTACA    c.3660
 K  K  G  S  E  A  S  A  A |   S  R  Q  S  D  T  S  G  P  V  T      p.1220

          .         .         .         .         .         .       g.87486
 ACAAGTAAATCCTCATCACTGGGGAGTTTCTATCATCTTCCTTCATACCTCAAACTGCAT       c.3720
 T  S  K  S  S  S  L  G  S  F  Y  H  L  P  S  Y  L  K  L  H         p.1240

          .         .         .    | 29    .         .         .    g.90628
 GATGTCCTGAAAGCTACACACGCTAACTACAAG | GTCACGCTGGATCTTCAGAACAGCACG    c.3780
 D  V  L  K  A  T  H  A  N  Y  K   | V  T  L  D  L  Q  N  S  T      p.1260

          .         .         .         .         .         .       g.90688
 GAAAAGTTTGGAGGGTTTCTCCGCTCAGCCTTGGATGTTCTTTCTCAGATACTAGAGCTG       c.3840
 E  K  F  G  G  F  L  R  S  A  L  D  V  L  S  Q  I  L  E  L         p.1280

          .         .     | 30   .         .         .         .    g.102675
 GCCACACTGCAGGACATTGGGAAG | TGTGTTGAAGAGATCCTAGGATACCTGAAATCCTGC    c.3900
 A  T  L  Q  D  I  G  K   | C  V  E  E  I  L  G  Y  L  K  S  C      p.1300

          .         .         .         .   | 31     .         .    g.103245
 TTTAGTCGAGAACCAATGATGGCAACTGTTTGTGTTCAACAA | TTGTTGAAGACTCTCTTT    c.3960
 F  S  R  E  P  M  M  A  T  V  C  V  Q  Q   | L  L  K  T  L  F      p.1320

          .         .         .         .         .         .       g.103305
 GGCACAAACTTGGCCTCCCAGTTTGATGGCTTATCTTCCAACCCCAGCAAGTCACAAGGC       c.4020
 G  T  N  L  A  S  Q  F  D  G  L  S  S  N  P  S  K  S  Q  G         p.1340

          .         .         .         .         .         .       g.103365
 CGAGCACAGCGCCTTGGCTCCTCCAGTGTGAGGCCAGGCTTGTACCACTACTGCTTCATG       c.4080
 R  A  Q  R  L  G  S  S  S  V  R  P  G  L  Y  H  Y  C  F  M         p.1360

          .         .         .         .         .         .       g.103425
 GCCCCGTACACCCACTTCACCCAGGCCCTCGCTGACGCCAGCCTGAGGAACATGGTGCAG       c.4140
 A  P  Y  T  H  F  T  Q  A  L  A  D  A  S  L  R  N  M  V  Q         p.1380

          .         .       | 32 .         .         .         .    g.105074
 GCGGAGCAGGAGAACGACACCTCGGG | ATGGTTTGATGTCCTCCAGAAAGTGTCTACCCAG    c.4200
 A  E  Q  E  N  D  T  S  G  |  W  F  D  V  L  Q  K  V  S  T  Q      p.1400

          .         .         .         .      | 33  .         .    g.105280
 TTGAAGACAAACCTCACGAGTGTCACAAAGAACCGTGCAGATAAG | AATGCTATTCATAAT    c.4260
 L  K  T  N  L  T  S  V  T  K  N  R  A  D  K   | N  A  I  H  N      p.1420

          .         .         .         .         .         .       g.105340
 CACATTCGTTTGTTTGAACCTCTTGTTATAAAAGCTTTAAAACAGTACACGACTACAACA       c.4320
 H  I  R  L  F  E  P  L  V  I  K  A  L  K  Q  Y  T  T  T  T         p.1440

          .         .         .         .         .         .       g.105400
 TGTGTGCAGTTACAGAAGCAGGTTTTAGATTTGCTGGCGCAGCTGGTTCAGTTACGGGTT       c.4380
 C  V  Q  L  Q  K  Q  V  L  D  L  L  A  Q  L  V  Q  L  R  V         p.1460

          .         .        | 34.         .         .         .    g.107684
 AATTACTGTCTTCTGGATTCAGATCAG | GTGTTTATTGGCTTTGTATTGAAACAGTTTGAA    c.4440
 N  Y  C  L  L  D  S  D  Q   | V  F  I  G  F  V  L  K  Q  F  E      p.1480

          .         .    | 35    .         .         .         .    g.108654
 TACATTGAAGTGGGCCAGTTCAG | GGAATCAGAGGCAATCATTCCAAACATCTTTTTCTTC    c.4500
 Y  I  E  V  G  Q  F  R  |  E  S  E  A  I  I  P  N  I  F  F  F      p.1500

          .         .         .         .         .         .       g.108714
 TTGGTATTACTATCTTATGAACGCTATCATTCAAAACAGATCATTGGAATTCCTAAAATC       c.4560
 L  V  L  L  S  Y  E  R  Y  H  S  K  Q  I  I  G  I  P  K  I         p.1520

          .         .         .         .         .   | 36     .    g.110842
 ATTCAGCTCTGTGATGGCATCATGGCCAGTGGAAGGAAGGCTGTGACACATG | CCATACCG    c.4620
 I  Q  L  C  D  G  I  M  A  S  G  R  K  A  V  T  H  A |   I  P      p.1540

          .         .         .         .         .         .       g.110902
 GCTCTGCAGCCCATAGTCCACGACCTCTTTGTATTAAGAGGAACAAATAAAGCTGATGCA       c.4680
 A  L  Q  P  I  V  H  D  L  F  V  L  R  G  T  N  K  A  D  A         p.1560

          .         .         .         .         .         .       g.110962
 GGAAAAGAGCTTGAAACCCAAAAAGAGGTGGTGGTGTCAATGTTACTGAGACTCATCCAG       c.4740
 G  K  E  L  E  T  Q  K  E  V  V  V  S  M  L  L  R  L  I  Q         p.1580

           | 37        .         .         .         .         .    g.112724
 TACCATCAG | GTGTTGGAGATGTTCATTCTTGTCCTGCAGCAGTGCCACAAGGAGAATGAA    c.4800
 Y  H  Q   | V  L  E  M  F  I  L  V  L  Q  Q  C  H  K  E  N  E      p.1600

          .         .         .         .         .         .       g.112784
 GACAAGTGGAAGCGACTGTCTCGACAGATAGCTGACATCATCCTCCCAATGTTAGCCAAA       c.4860
 D  K  W  K  R  L  S  R  Q  I  A  D  I  I  L  P  M  L  A  K         p.1620

        | 38 .         .         .         .         .         .    g.116970
 CAGCAG | ATGCACATTGACTCTCATGAAGCCCTTGGAGTGTTAAATACATTATTTGAGATT    c.4920
 Q  Q   | M  H  I  D  S  H  E  A  L  G  V  L  N  T  L  F  E  I      p.1640

          .         .         .         .         .         .       g.117030
 TTGGCCCCTTCCTCCCTCCGTCCGGTAGACATGCTTTTACGGAGTATGTTCGTCACTCCA       c.4980
 L  A  P  S  S  L  R  P  V  D  M  L  L  R  S  M  F  V  T  P         p.1660

           | 39        .         .         .         .         .    g.118021
 AACACAATG | GCGTCCGTGAGCACTGTTCAACTGTGGATATCGGGAATTCTGGCCATTTTG    c.5040
 N  T  M   | A  S  V  S  T  V  Q  L  W  I  S  G  I  L  A  I  L      p.1680

          .         .         .         .         .         .       g.118081
 AGGGTTCTGATTTCCCAGTCAACTGAAGATATTGTTCTTTCTCGTATTCAGGAGCTCTCC       c.5100
 R  V  L  I  S  Q  S  T  E  D  I  V  L  S  R  I  Q  E  L  S         p.1700

          .         .         .         .         .         .       g.118141
 TTCTCTCCGTATTTAATCTCCTGTACAGTAATTAATAGGTTAAGAGATGGGGACAGTACT       c.5160
 F  S  P  Y  L  I  S  C  T  V  I  N  R  L  R  D  G  D  S  T         p.1720

          .         .         .         .         .         .       g.118201
 TCAACGCTAGAAGAACACAGTGAAGGGAAACAAATAAAGAATTTGCCAGAAGAAACATTT       c.5220
 S  T  L  E  E  H  S  E  G  K  Q  I  K  N  L  P  E  E  T  F         p.1740

       | 40  .         .         .         .         .         .    g.119325
 TCAAG | GTTTCTATTACAACTGGTTGGTATTCTTTTAGAAGACATTGTTACAAAACAGCTG    c.5280
 S  R  |  F  L  L  Q  L  V  G  I  L  L  E  D  I  V  T  K  Q  L      p.1760

          .         .         .         .         .         .       g.119385
 AAGGTGGAAATGAGTGAGCAGCAACATACTTTCTATTGCCAGGAACTAGGCACACTGCTA       c.5340
 K  V  E  M  S  E  Q  Q  H  T  F  Y  C  Q  E  L  G  T  L  L         p.1780

          .         .         | 41         .         .         .    g.130083
 ATGTGTCTGATCCACATCTTCAAGTCTG | GAATGTTCCGGAGAATCACAGCAGCTGCCACT    c.5400
 M  C  L  I  H  I  F  K  S  G |   M  F  R  R  I  T  A  A  A  T      p.1800

          .         .         .         .         .         .       g.130143
 AGGCTGTTCCGCAGTGATGGCTGTGGCGGCAGTTTCTACACCCTGGACAGCTTGAACTTG       c.5460
 R  L  F  R  S  D  G  C  G  G  S  F  Y  T  L  D  S  L  N  L         p.1820

          .         .         .         .         .         .       g.130203
 CGGGCTCGTTCCATGATCACCACCCACCCGGCCCTGGTGCTGCTCTGGTGTCAGATACTG       c.5520
 R  A  R  S  M  I  T  T  H  P  A  L  V  L  L  W  C  Q  I  L         p.1840

          .         .         .         .         .       | 42 .    g.134330
 CTGCTTGTCAACCACACCGACTACCGCTGGTGGGCAGAAGTGCAGCAGACCCCGAA | AAGA    c.5580
 L  L  V  N  H  T  D  Y  R  W  W  A  E  V  Q  Q  T  P  K  |  R      p.1860

          .         .         .         .         .         .       g.134390
 CACAGTCTGTCCAGCACAAAGTTACTTAGTCCCCAGATGTCTGGAGAAGAGGAGGATTCT       c.5640
 H  S  L  S  S  T  K  L  L  S  P  Q  M  S  G  E  E  E  D  S         p.1880

          .         .         .         .         .         .       g.134450
 GACTTGGCAGCCAAACTTGGAATGTGCAATAGAGAAATAGTACGAAGAGGGGCTCTCATT       c.5700
 D  L  A  A  K  L  G  M  C  N  R  E  I  V  R  R  G  A  L  I         p.1900

          .         | 43         .         .         .         .    g.136857
 CTCTTCTGTGATTATGTC | TGTCAGAACCTCCATGACTCCGAGCACTTAACGTGGCTCATT    c.5760
 L  F  C  D  Y  V   | C  Q  N  L  H  D  S  E  H  L  T  W  L  I      p.1920

          .         .         .         .         .         .       g.136917
 GTAAATCACATTCAAGATCTGATCAGCCTTTCCCACGAGCCTCCAGTACAGGACTTCATC       c.5820
 V  N  H  I  Q  D  L  I  S  L  S  H  E  P  P  V  Q  D  F  I         p.1940

          .         .         .         .         .         .       g.136977
 AGTGCCGTTCATCGGAACTCTGCTGCCAGCGGCCTGTTCATCCAGGCAATTCAGTCTCGT       c.5880
 S  A  V  H  R  N  S  A  A  S  G  L  F  I  Q  A  I  Q  S  R         p.1960

          .         | 44         .         .         .         .    g.137168
 TGTGAAAACCTTTCAACT | CCAACCATGCTGAAGAAAACTCTTCAGTGCTTGGAGGGGATC    c.5940
 C  E  N  L  S  T   | P  T  M  L  K  K  T  L  Q  C  L  E  G  I      p.1980

          .         .         .         .         .         .       g.137228
 CATCTCAGCCAGTCGGGAGCTGTGCTCACGCTGTATGTGGACAGGCTTCTGTGCACCCCT       c.6000
 H  L  S  Q  S  G  A  V  L  T  L  Y  V  D  R  L  L  C  T  P         p.2000

          .         .         .         .         .         .       g.137288
 TTCCGTGTGCTGGCTCGCATGGTCGACATCCTTGCTTGTCGCCGGGTAGAAATGCTTCTG       c.6060
 F  R  V  L  A  R  M  V  D  I  L  A  C  R  R  V  E  M  L  L         p.2020

          .      | 45  .         .         .         .         .    g.137645
 GCTGCAAATTTACAG | AGCAGCATGGCCCAGTTGCCAATGGAAGAACTCAACAGAATCCAG    c.6120
 A  A  N  L  Q   | S  S  M  A  Q  L  P  M  E  E  L  N  R  I  Q      p.2040

          .         .         .   | 46     .         .         .    g.139120
 GAATACCTTCAGAGCAGCGGGCTCGCTCAGAG | ACACCAAAGGCTCTATTCCCTGCTGGAC    c.6180
 E  Y  L  Q  S  S  G  L  A  Q  R  |  H  Q  R  L  Y  S  L  L  D      p.2060

          .         .         .         .         .         .       g.139180
 AGGTTTCGTCTCTCCACCATGCAAGACTCACTTAGTCCCTCTCCTCCAGTCTCTTCCCAC       c.6240
 R  F  R  L  S  T  M  Q  D  S  L  S  P  S  P  P  V  S  S  H         p.2080

          .         .         .         .         .  | 47      .    g.140155
 CCGCTGGACGGGGATGGGCACGTGTCACTGGAAACAGTGAGTCCGGACAAA | GACTGGTAC    c.6300
 P  L  D  G  D  G  H  V  S  L  E  T  V  S  P  D  K   | D  W  Y      p.2100

          .         .         .         .         .         .       g.140215
 GTTCATCTTGTCAAATCCCAGTGTTGGACCAGGTCAGATTCTGCACTGCTGGAAGGTGCA       c.6360
 V  H  L  V  K  S  Q  C  W  T  R  S  D  S  A  L  L  E  G  A         p.2120

          .         .         .         .         .     | 48   .    g.142254
 GAGCTGGTGAATCGGATTCCTGCTGAAGATATGAATGCCTTCATGATGAACTCG | GAGTTC    c.6420
 E  L  V  N  R  I  P  A  E  D  M  N  A  F  M  M  N  S   | E  F      p.2140

          .         .         .         .         .         .       g.142314
 AACCTAAGCCTGCTAGCTCCATGCTTAAGCCTAGGGATGAGTGAAATTTCTGGTGGCCAG       c.6480
 N  L  S  L  L  A  P  C  L  S  L  G  M  S  E  I  S  G  G  Q         p.2160

          .         .         .         .         .         .       g.142374
 AAGAGTGCCCTTTTTGAAGCAGCCCGTGAGGTGACTCTGGCCCGTGTGAGCGGCACCGTG       c.6540
 K  S  A  L  F  E  A  A  R  E  V  T  L  A  R  V  S  G  T  V         p.2180

          .         .         .         .         .         .       g.142434
 CAGCAGCTCCCTGCTGTCCATCATGTCTTCCAGCCCGAGCTGCCTGCAGAGCCGGCGGCC       c.6600
 Q  Q  L  P  A  V  H  H  V  F  Q  P  E  L  P  A  E  P  A  A         p.2200

          .         .         | 49         .         .         .    g.142915
 TACTGGAGCAAGTTGAATGATCTGTTTG | GGGATGCTGCACTGTATCAGTCCCTGCCCACT    c.6660
 Y  W  S  K  L  N  D  L  F  G |   D  A  A  L  Y  Q  S  L  P  T      p.2220

          .         .         .         .         .         .       g.142975
 CTGGCCCGGGCCCTGGCACAGTACCTGGTGGTGGTCTCCAAACTGCCCAGTCATTTGCAC       c.6720
 L  A  R  A  L  A  Q  Y  L  V  V  V  S  K  L  P  S  H  L  H         p.2240

          .         .         .         .         .     | 50   .    g.144283
 CTTCCTCCTGAGAAAGAGAAGGACATTGTGAAATTCGTGGTGGCAACCCTTGAG | GCCCTG    c.6780
 L  P  P  E  K  E  K  D  I  V  K  F  V  V  A  T  L  E   | A  L      p.2260

          .         .         .         .         .         .       g.144343
 TCCTGGCATTTGATCCATGAGCAGATCCCGCTGAGTCTGGATCTCCAGGCAGGGCTGGAC       c.6840
 S  W  H  L  I  H  E  Q  I  P  L  S  L  D  L  Q  A  G  L  D         p.2280

          .         .         .         .         .         .       g.144403
 TGCTGCTGCCTGGCCCTGCAGCTGCCTGGCCTCTGGAGCGTGGTCTCCTCCACAGAGTTT       c.6900
 C  C  C  L  A  L  Q  L  P  G  L  W  S  V  V  S  S  T  E  F         p.2300

          .         .         .         .         .   | 51     .    g.145437
 GTGACCCACGCCTGCTCCCTCATCTACTGTGTGCACTTCATCCTGGAGGCCG | TTGCAGTG    c.6960
 V  T  H  A  C  S  L  I  Y  C  V  H  F  I  L  E  A  V |   A  V      p.2320

          .         .         .         .         .         .       g.145497
 CAGCCTGGAGAGCAGCTTCTTAGTCCAGAAAGAAGGACAAATACCCCAAAAGCCATCAGC       c.7020
 Q  P  G  E  Q  L  L  S  P  E  R  R  T  N  T  P  K  A  I  S         p.2340

          .         .         .     | 52   .         .         .    g.148110
 GAGGAGGAGGAGGAAGTAGATCCAAACACACAGA | ATCCTAAGTATATCACTGCAGCCTGT    c.7080
 E  E  E  E  E  V  D  P  N  T  Q  N |   P  K  Y  I  T  A  A  C      p.2360

          .         .         .         .         .         .       g.148170
 GAGATGGTGGCAGAAATGGTGGAGTCTCTGCAGTCGGTGTTGGCCTTGGGTCATAAAAGG       c.7140
 E  M  V  A  E  M  V  E  S  L  Q  S  V  L  A  L  G  H  K  R         p.2380

          .         .         .         .         .         .       g.148230
 AATAGCGGCGTGCCGGCGTTTCTCACGCCATTGCTAAGGAACATCATCATCAGCCTGGCC       c.7200
 N  S  G  V  P  A  F  L  T  P  L  L  R  N  I  I  I  S  L  A         p.2400

          .         .         .         .   | 53     .         .    g.150519
 CGCCTGCCCCTTGTCAACAGCTACACACGTGTGCCCCCACTG | GTGTGGAAGCTTGGATGG    c.7260
 R  L  P  L  V  N  S  Y  T  R  V  P  P  L   | V  W  K  L  G  W      p.2420

          .         .         .         .         .         .       g.150579
 TCACCCAAACCGGGAGGGGATTTTGGCACAGCATTCCCTGAGATCCCCGTGGAGTTCCTC       c.7320
 S  P  K  P  G  G  D  F  G  T  A  F  P  E  I  P  V  E  F  L         p.2440

          .         .         .         .          | 54        .    g.152717
 CAGGAAAAGGAAGTCTTTAAGGAGTTCATCTACCGCATCAACACACTAG | GCTGGACCAGT    c.7380
 Q  E  K  E  V  F  K  E  F  I  Y  R  I  N  T  L  G |   W  T  S      p.2460

          .         .         .         .         .         .       g.152777
 CGTACTCAGTTTGAAGAAACTTGGGCCACCCTCCTTGGTGTCCTGGTGACGCAGCCCCTC       c.7440
 R  T  Q  F  E  E  T  W  A  T  L  L  G  V  L  V  T  Q  P  L         p.2480

          .         .         . | 55       .         .         .    g.153755
 GTGATGGAGCAGGAGGAGAGCCCACCAGAA | GAAGACACAGAGAGGACCCAGATCAACGTC    c.7500
 V  M  E  Q  E  E  S  P  P  E   | E  D  T  E  R  T  Q  I  N  V      p.2500

          .         .         .         .         .         .       g.153815
 CTGGCCGTGCAGGCCATCACCTCACTGGTGCTCAGTGCAATGACTGTGCCTGTGGCCGGC       c.7560
 L  A  V  Q  A  I  T  S  L  V  L  S  A  M  T  V  P  V  A  G         p.2520

          .         .         .         .         .         .       g.153875
 AACCCAGCTGTAAGCTGCTTGGAGCAGCAGCCCCGGAACAAGCCTCTGAAAGCTCTCGAC       c.7620
 N  P  A  V  S  C  L  E  Q  Q  P  R  N  K  P  L  K  A  L  D         p.2540

       | 56  .         .         .         .         .         .    g.154366
 ACCAG | GTTTGGGAGGAAGCTGAGCATTATCAGAGGGATTGTGGAGCAAGAGATTCAAGCA    c.7680
 T  R  |  F  G  R  K  L  S  I  I  R  G  I  V  E  Q  E  I  Q  A      p.2560

          .         .         .         .         .         .       g.154426
 ATGGTTTCAAAGAGAGAGAATATTGCCACCCATCATTTATATCAGGCATGGGATCCTGTC       c.7740
 M  V  S  K  R  E  N  I  A  T  H  H  L  Y  Q  A  W  D  P  V         p.2580

          .         .      | 57  .         .         .         .    g.156015
 CCTTCTCTGTCTCCGGCTACTACAG | GTGCCCTCATCAGCCACGAGAAGCTGCTGCTACAG    c.7800
 P  S  L  S  P  A  T  T  G |   A  L  I  S  H  E  K  L  L  L  Q      p.2600

          .         .         .         .         | 58         .    g.158946
 ATCAACCCCGAGCGGGAGCTGGGGAGCATGAGCTACAAACTCGGCCAG | GTGTCCATACAC    c.7860
 I  N  P  E  R  E  L  G  S  M  S  Y  K  L  G  Q   | V  S  I  H      p.2620

          .         .         .         .         .         .       g.159006
 TCCGTGTGGCTGGGGAACAGCATCACACCCCTGAGGGAGGAGGAATGGGACGAGGAAGAG       c.7920
 S  V  W  L  G  N  S  I  T  P  L  R  E  E  E  W  D  E  E  E         p.2640

          .         .         .         .         .          | 59    g.159200
 GAGGAGGAGGCCGACGCCCCTGCACCTTCGTCACCACCCACGTCTCCAGTCAACTCCAG | G    c.7980
 E  E  E  A  D  A  P  A  P  S  S  P  P  T  S  P  V  N  S  R  |      p.2660

          .         .         .         .         .         .       g.159260
 AAACACCGGGCTGGAGTTGACATCCACTCCTGTTCGCAGTTTTTGCTTGAGTTGTACAGC       c.8040
 K  H  R  A  G  V  D  I  H  S  C  S  Q  F  L  L  E  L  Y  S         p.2680

          .         .         .         .         .         .       g.159320
 CGCTGGATCCTGCCGTCCAGCTCAGCCAGGAGGACCCCGGCCATCCTGATCAGTGAGGTG       c.8100
 R  W  I  L  P  S  S  S  A  R  R  T  P  A  I  L  I  S  E  V         p.2700

           | 60        .         .         .         .         .    g.160257
 GTCAGATCC | CTTCTAGTGGTCTCAGACTTGTTCACCGAGCGCAACCAGTTTGAGCTGATG    c.8160
 V  R  S   | L  L  V  V  S  D  L  F  T  E  R  N  Q  F  E  L  M      p.2720

          .         .         .         .         .         .       g.160317
 TATGTGACGCTGACAGAACTGCGAAGGGTGCACCCTTCAGAAGACGAGATCCTCGCTCAG       c.8220
 Y  V  T  L  T  E  L  R  R  V  H  P  S  E  D  E  I  L  A  Q         p.2740

          .         .         .         .      | 61  .         .    g.163497
 TACCTGGTGCCTGCCACCTGCAAGGCAGCTGCCGTCCTTGGGATG | GACAAGGCCGTGGCG    c.8280
 Y  L  V  P  A  T  C  K  A  A  A  V  L  G  M   | D  K  A  V  A      p.2760

          .         .         .         .         .         .       g.163557
 GAGCCTGTCAGCCGCCTGCTGGAGAGCACGCTCAGGAGCAGCCACCTGCCCAGCAGGGTT       c.8340
 E  P  V  S  R  L  L  E  S  T  L  R  S  S  H  L  P  S  R  V         p.2780

          .         .         .         .         .         .       g.163617
 GGAGCCCTGCACGGCGTCCTCTATGTGCTGGAGTGCGACCTGCTGGACGACACTGCCAAG       c.8400
 G  A  L  H  G  V  L  Y  V  L  E  C  D  L  L  D  D  T  A  K         p.2800

          .         .         .         .         .       | 62 .    g.165607
 CAGCTCATCCCGGTCATCAGCGACTATCTCCTCTCCAACCTGAAAGGGATCGCCCA | CTGC    c.8460
 Q  L  I  P  V  I  S  D  Y  L  L  S  N  L  K  G  I  A  H  |  C      p.2820

          .         .         .         .         .         .       g.165667
 GTGAACATTCACAGCCAGCAGCACGTACTGGTCATGTGTGCCACTGCGTTTTACCTCATT       c.8520
 V  N  I  H  S  Q  Q  H  V  L  V  M  C  A  T  A  F  Y  L  I         p.2840

          .         .         .         .         .  | 63      .    g.165893
 GAGAACTATCCTCTGGACGTAGGGCCGGAATTTTCAGCATCAATAATACAG | ATGTGTGGG    c.8580
 E  N  Y  P  L  D  V  G  P  E  F  S  A  S  I  I  Q   | M  C  G      p.2860

          .         .         .         .         .         .       g.165953
 GTGATGCTGTCTGGAAGTGAGGAGTCCACCCCCTCCATCATTTACCACTGTGCCCTCAGA       c.8640
 V  M  L  S  G  S  E  E  S  T  P  S  I  I  Y  H  C  A  L  R         p.2880

          .         .         .         .         .         .       g.166013
 GGCCTGGAGCGCCTCCTGCTCTCTGAGCAGCTCTCCCGCCTGGATGCAGAATCGCTGGTC       c.8700
 G  L  E  R  L  L  L  S  E  Q  L  S  R  L  D  A  E  S  L  V         p.2900

          .         .         .         .         .         .       g.166073
 AAGCTGAGTGTGGACAGAGTGAACGTGCACAGCCCGCACCGGGCCATGGCGGCTCTGGGC       c.8760
 K  L  S  V  D  R  V  N  V  H  S  P  H  R  A  M  A  A  L  G         p.2920

          .         .      | 64  .         .         .         .    g.166503
 CTGATGCTCACCTGCATGTACACAG | GAAAGGAGAAAGTCAGTCCGGGTAGAACTTCAGAC    c.8820
 L  M  L  T  C  M  Y  T  G |   K  E  K  V  S  P  G  R  T  S  D      p.2940

          .         .         .         .         .         .       g.166563
 CCTAATCCTGCAGCCCCCGACAGCGAGTCAGTGATTGTTGCTATGGAGCGGGTATCTGTT       c.8880
 P  N  P  A  A  P  D  S  E  S  V  I  V  A  M  E  R  V  S  V         p.2960

          .  | 65      .         .         .         .         .    g.168815
 CTTTTTGATAG | GATCAGGAAAGGCTTTCCTTGTGAAGCCAGAGTGGTGGCCAGGATCCTG    c.8940
 L  F  D  R  |  I  R  K  G  F  P  C  E  A  R  V  V  A  R  I  L      p.2980

          .         .         .         .         .         .       g.168875
 CCCCAGTTTCTAGACGACTTCTTCCCACCCCAGGACATCATGAACAAAGTCATCGGAGAG       c.9000
 P  Q  F  L  D  D  F  F  P  P  Q  D  I  M  N  K  V  I  G  E         p.3000

          .         .         .         .         .     | 66   .    g.169143
 TTTCTGTCCAACCAGCAGCCATACCCCCAGTTCATGGCCACCGTGGTGTATAAG | GTGTTT    c.9060
 F  L  S  N  Q  Q  P  Y  P  Q  F  M  A  T  V  V  Y  K   | V  F      p.3020

          .         .         .         .         .         .       g.169203
 CAGACTCTGCACAGCACCGGGCAGTCGTCCATGGTCCGGGACTGGGTCATGCTGTCCCTC       c.9120
 Q  T  L  H  S  T  G  Q  S  S  M  V  R  D  W  V  M  L  S  L         p.3040

          .         .         .         .         .         .       g.169263
 TCCAACTTCACGCAGAGGGCCCCGGTCGCCATGGCCACGTGGAGCCTCTCCTGCTTCTTT       c.9180
 S  N  F  T  Q  R  A  P  V  A  M  A  T  W  S  L  S  C  F  F         p.3060

          .         .         .      | 67  .         .         .    g.170190
 GTCAGCGCGTCCACCAGCCCGTGGGTCGCGGCGAT | CCTCCCACATGTCATCAGCAGGATG    c.9240
 V  S  A  S  T  S  P  W  V  A  A  I  |  L  P  H  V  I  S  R  M      p.3080

          .         .         .         .         .         .       g.170250
 GGCAAGCTGGAGCAGGTGGACGTGAACCTTTTCTGCCTGGTCGCCACAGACTTCTACAGA       c.9300
 G  K  L  E  Q  V  D  V  N  L  F  C  L  V  A  T  D  F  Y  R         p.3100

          .         .         .         .         .         .       g.170310
 CACCAGATAGAGGAGGAGCTCGACCGCAGGGCCTTCCAGTCTGTGCTTGAGGTGGTTGCA       c.9360
 H  Q  I  E  E  E  L  D  R  R  A  F  Q  S  V  L  E  V  V  A         p.3120

          .         .         .         .         .         .       g.170370
 GCCCCAGGAAGCCCATATCACCGGCTGCTGACTTGTTTACGAAATGTCCACAAGGTCACC       c.9420
 A  P  G  S  P  Y  H  R  L  L  T  C  L  R  N  V  H  K  V  T         p.3140

                                                                    g.170379
 ACCTGCTGA                                                          c.9429
 T  C  X                                                            p.3142

          .         .         .         .         .         .       g.170439
 gcgccatggtgggagagactgtgaggcggcagctggggccggagcctttggaagtctgcg       c.*60

          .         .         .         .         .         .       g.170499
 cccttgtgccctgcctccaccgagccagcttggtccctatgggcttccgcacatgccgcg       c.*120

          .         .         .         .         .         .       g.170559
 ggcggccaggcaacgtgcgtgtctctgccatgtggcagaagtgctctttgtggcagtggc       c.*180

          .         .         .         .         .         .       g.170619
 caggcagggagtgtctgcagtcctggtggggctgagcctgaggccttccagaaagcagga       c.*240

          .         .         .         .         .         .       g.170679
 gcagctgtgctgcaccccatgtgggtgaccaggtcctttctcctgatagtcacctgctgg       c.*300

          .         .         .         .         .         .       g.170739
 ttgttgccaggttgcagctgctcttgcatctgggccagaagtcctccctcctgcaggctg       c.*360

          .         .         .         .         .         .       g.170799
 gctgttggcccctctgctgtcctgcagtagaaggtgccgtgagcaggctttgggaacact       c.*420

          .         .         .         .         .         .       g.170859
 ggcctgggtctccctggtggggtgtgcatgccacgccccgtgtctggatgcacagatgcc       c.*480

          .         .         .         .         .         .       g.170919
 atggcctgtgctgggccagtggctgggggtgctagacacccggcaccattctcccttctc       c.*540

          .         .         .         .         .         .       g.170979
 tcttttcttctcaggatttaaaatttaattatatcagtaaagagattaattttaacgtaa       c.*600

          .         .         .         .         .         .       g.171039
 ctctttctatgcccgtgtaaagtatgtgaatcgcaaggcctgtgctgcatgcgacagcgt       c.*660

          .         .         .         .         .         .       g.171099
 ccggggtggtggacagggcccccggccacgctccctctcctgtagccactggcatagccc       c.*720

          .         .         .         .         .         .       g.171159
 tcctgagcacccgctgacatttccgttgtacatgttcctgtttatgcattcacaaggtga       c.*780

          .         .         .         .         .         .       g.171219
 ctgggatgtagagaggcgttagtgggcaggtggccacagcaggactgaggacaggccccc       c.*840

          .         .         .         .         .         .       g.171279
 attatcctaggggtgcgctcacctgcagcccctcctcctcgggcacagacgactgtcgtt       c.*900

          .         .         .         .         .         .       g.171339
 ctccacccaccagtcagggacagcagcctccctgtcactcagctgagaaggccagccctc       c.*960

          .         .         .         .         .         .       g.171399
 cctggctgtgagcagcctccactgtgtccagagacatgggcctcccactcctgttccttg       c.*1020

          .         .         .         .         .         .       g.171459
 ctagccctggggtggcgtctgcctaggagctggctggcaggtgttgggacctgctgctcc       c.*1080

          .         .         .         .         .         .       g.171519
 atggatgcatgccctaagagtgtcactgagctgtgttttgtctgagcctctctcggtcaa       c.*1140

          .         .         .         .         .         .       g.171579
 cagcaaagcttggtgtcttggcactgttagtgacagagcccagcatcccttctgcccccg       c.*1200

          .         .         .         .         .         .       g.171639
 ttccagctgacatcttgcacggtgaccccttttagtcaggagagtgcagatctgtgctca       c.*1260

          .         .         .         .         .         .       g.171699
 tcggagactgccccacggccctgtcagagccgccactcctatccccaggccaggtccctg       c.*1320

          .         .         .         .         .         .       g.171759
 gaccagcctcctgtttgcaggcccagaggagccaagtcattaaaatggaagtggattctg       c.*1380

          .         .         .         .         .         .       g.171819
 gatggccgggctgctgctgatgtaggagctggatttgggagctctgcttgccgactggct       c.*1440

          .         .         .         .         .         .       g.171879
 gtgagacgaggcaggggctctgcttcctcagccctagaggcgagccaggcaaggttggcg       c.*1500

          .         .         .         .         .         .       g.171939
 actgtcatgtggcttggtttggtcatgcccgtcgatgttttgggtattgaatgtggtaag       c.*1560

          .         .         .         .         .         .       g.171999
 tggaggaaatgttggaactctgtgcaggtgctgccttgagacccccaagcttccacctgt       c.*1620

          .         .         .         .         .         .       g.172059
 ccctctcctatgtggcagctggggagcagctgagatgtggacttgtatgctgcccacata       c.*1680

          .         .         .         .         .         .       g.172119
 cgtgagggggagctgaaagggagcccctcctctgagcagcctctgccaggcctgtatgag       c.*1740

          .         .         .         .         .         .       g.172179
 gcttttcccaccagctcccaacagaggcctcccccagccaggaccacctcgtcctcgtgg       c.*1800

          .         .         .         .         .         .       g.172239
 cggggcagcaggagcggtagaaaggggtccgatgtttgaggaggcccttaagggaagcta       c.*1860

          .         .         .         .         .         .       g.172299
 ctgaattataacacgtaagaaaatcaccattccgtattggttgggggctcctgtttctca       c.*1920

          .         .         .         .         .         .       g.172359
 tcctagctttttcctggaaagcccgctagaaggtttgggaacgaggggaaagttctcaga       c.*1980

          .         .         .         .         .         .       g.172419
 actgttggctgctccccacccgcctcccgcctcccccgcaggttatgtcagcagctctga       c.*2040

          .         .         .         .         .         .       g.172479
 gacagcagtatcacaggccagatgttgttcctggctagatgtttacatttgtaagaaata       c.*2100

          .         .         .         .         .         .       g.172539
 acactgtgaatgtaaaacagagccattcccttggaatgcatatcgctgggctcaacatag       c.*2160

          .         .         .         .         .         .       g.172599
 agtttgtcttcctcttgtttacgacgtgatctaaaccagtccttagcaaggggctcagaa       c.*2220

          .         .         .         .         .         .       g.172659
 caccccgctctggcagtaggtgtcccccacccccaaagacctgcctgtgtgctccggaga       c.*2280

          .         .         .         .         .         .       g.172719
 tgaatatgagctcattagtaaaaatgacttcacccacgcatatacataaagtatccatgc       c.*2340

          .         .         .         .         .         .       g.172779
 atgtgcatatagacacatctataattttacacacacacctctcaagacggagatgcatgg       c.*2400

          .         .         .         .         .         .       g.172839
 cctctaagagtgcccgtgtcggttcttcctggaagttgactttccttagacccgccaggt       c.*2460

          .         .         .         .         .         .       g.172899
 caagttagccgcgtgacggacatccaggcgtgggacgtggtcagggcagggctcattcat       c.*2520

          .         .         .         .         .         .       g.172959
 tgcccactaggatcccactggcgaagatggtctccatatcagctctctgcagaagggagg       c.*2580

          .         .         .         .         .         .       g.173019
 aagactttatcatgttcctaaaaatctgtggcaagcacccatcgtattatccaaattttg       c.*2640

          .         .         .         .         .         .       g.173079
 ttgcaaatgtgattaatttggttgtcaagttttgggggtgggctgtggggagattgcttt       c.*2700

          .         .         .         .         .         .       g.173139
 tgttttcctgctggtaatatcgggaaagattttaatgaaaccagggtagaattgtttggc       c.*2760

          .         .         .         .         .         .       g.173199
 aatgcactgaagcgtgtttctttcccaaaatgtgcctcccttccgctgcgggcccagctg       c.*2820

          .         .         .         .         .         .       g.173259
 agtctatgtaggtgatgtttccagctgccaagtgctctttgttactgtccaccctcattt       c.*2880

          .         .         .         .         .         .       g.173319
 ctgccagcgcatgtgtcctttcaaggggaaaatgtgaagctgaaccccctccagacaccc       c.*2940

          .         .         .         .         .         .       g.173379
 agaatgtagcatctgagaaggccctgtgccctaaaggacacccctcgcccccatcttcat       c.*3000

          .         .         .         .         .         .       g.173439
 ggagggggtcatttcagagccctcggagccaatgaacagctcctcctcttggagctgaga       c.*3060

          .         .         .         .         .         .       g.173499
 tgagccccacgtggagctcgggacggatagtagacagcaataactcggtgtgtggccgcc       c.*3120

          .         .         .         .         .         .       g.173559
 tggcaggtggaacttcctcccgttgcggggtggagtgaggttagttctgtgtgtctggtg       c.*3180

          .         .         .         .         .         .       g.173619
 ggtggagtcaggcttctcttgctacctgtgagcatccttcccagcagacatcctcatcgg       c.*3240

          .         .         .         .         .         .       g.173679
 gctttgtccctcccccgcttcctccctctgcggggaggacccgggaccacagctgctggc       c.*3300

          .         .         .         .         .         .       g.173739
 cagggtagacttggagctgtcctccagaggggtcacgtgtaggagtgagaagaaggaaga       c.*3360

          .         .         .         .         .         .       g.173799
 tcttgagagctgctgagggaccttggagagctcaggatggctcagacgaggacactcgct       c.*3420

          .         .         .         .         .         .       g.173859
 tgccgggcctgggcctcctgggaaggagggagctgctcagaatgccgcatgacaactgaa       c.*3480

          .         .         .         .         .         .       g.173919
 ggcaacctggaaggttcaggggccgctcttcccccatgtgcctgtcacgctctggtgcag       c.*3540

          .         .         .         .         .         .       g.173979
 tcaaaggaacgccttcccctcagttgtttctaagagcagagtctcccgctgcaatctggg       c.*3600

          .         .         .         .         .         .       g.174039
 tggtaactgccagccttggaggatcgtggccaacgtggacctgcctacggagggtgggct       c.*3660

          .         .         .         .         .         .       g.174099
 ctgacccaagtggggcctccttgtccaggtctcactgctttgcaccgtggtcagagggac       c.*3720

          .         .         .         .         .         .       g.174159
 tgtcagctgagcttgagctcccctggagccagcagggctgtgatgggcgagtcccggagc       c.*3780

          .         .         .         .         .         .       g.174219
 cccacccagacctgaatgcttctgagagcaaagggaaggactgacgagagatgtatattt       c.*3840

          .         .         .         .         .         .       g.174279
 aattttttaactgctgcaaacattgtacatccaaattaaaggaaaaaaatggaaaccatc       c.*3900

                                                                    g.174280
 a                                                                  c.*3901

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Huntingtin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center