interleukin 18 (interferon-gamma-inducing factor) (IL18) - coding DNA reference sequence

(used for mutation description)

(last modified July 9, 2012)

This file was created to facilitate the description of sequence variants on transcript NM_001562.2 in the IL18 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering IL18 transcript NM_001562.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5040
                     attctctccccagcttgctgagccctttgctcccctggcg       c.-181

 .         .         .         .         .         .                g.5100
 actgcctggacagtcagcaaggaattgtctcccagtgcattttgccctcctggctgccaa       c.-121

 .         .         .         .         .         .                g.5160
 ctctggctgctaaagcggctgccacctgctgcagtctacacagcttcgggaagaggaaag       c.-61

 .         .         .         .         .         .  | 02          g.14064
 gaacctcagaccttccagatcgcttcctctcgcaacaaactatttgtcgcag | gaataaag    c.-1

          .         .         .         .         .         .       g.14124
 ATGGCTGCTGAACCAGTAGAAGACAATTGCATCAACTTTGTGGCAATGAAATTTATTGAC       c.60
 M  A  A  E  P  V  E  D  N  C  I  N  F  V  A  M  K  F  I  D         p.20

          .          | 03        .  | 04      .         .         . g.18940
 AATACGCTTTACTTTATAG | CTGAAGATGATG | AAAACCTGGAATCAGATTACTTTGGCAAG c.120
 N  T  L  Y  F  I  A |   E  D  D  E |   N  L  E  S  D  Y  F  G  K   p.40

          .         .         .         .         .         .       g.19000
 CTTGAATCTAAATTATCAGTCATAAGAAATTTGAATGACCAAGTTCTCTTCATTGACCAA       c.180
 L  E  S  K  L  S  V  I  R  N  L  N  D  Q  V  L  F  I  D  Q         p.60

          .         .         .         .       | 05 .         .    g.20395
 GGAAATCGGCCTCTATTTGAAGATATGACTGATTCTGACTGTAGAG | ATAATGCACCCCGG    c.240
 G  N  R  P  L  F  E  D  M  T  D  S  D  C  R  D |   N  A  P  R      p.80

          .         .         .         .         .         .       g.20455
 ACCATATTTATTATAAGTATGTATAAAGATAGCCAGCCTAGAGGTATGGCTGTAACTATC       c.300
 T  I  F  I  I  S  M  Y  K  D  S  Q  P  R  G  M  A  V  T  I         p.100

          .         .         .         .         .         .       g.20515
 TCTGTGAAGTGTGAGAAAATTTCAACTCTCTCCTGTGAGAACAAAATTATTTCCTTTAAG       c.360
 S  V  K  C  E  K  I  S  T  L  S  C  E  N  K  I  I  S  F  K         p.120

  | 06       .         .         .         .         .         .    g.25360
  | GAAATGAATCCTCCTGATAACATCAAGGATACAAAAAGTGACATCATATTCTTTCAGAGA    c.420
  | E  M  N  P  P  D  N  I  K  D  T  K  S  D  I  I  F  F  Q  R      p.140

          .         .         .         .         .         .       g.25420
 AGTGTCCCAGGACATGATAATAAGATGCAATTTGAATCTTCATCATACGAAGGATACTTT       c.480
 S  V  P  G  H  D  N  K  M  Q  F  E  S  S  S  Y  E  G  Y  F         p.160

          .         .         .         .         .         .       g.25480
 CTAGCTTGTGAAAAAGAGAGAGACCTTTTTAAACTCATTTTGAAAAAAGAGGATGAATTG       c.540
 L  A  C  E  K  E  R  D  L  F  K  L  I  L  K  K  E  D  E  L         p.180

          .         .         .         .                           g.25522
 GGGGATAGATCTATAATGTTCACTGTTCAAAACGAAGACTAG                         c.582
 G  D  R  S  I  M  F  T  V  Q  N  E  D  X                           p.193

          .         .         .         .         .         .       g.25582
 ctattaaaatttcatgccgggcgcagtggctcacgcctgtaatcccagccctttgggagg       c.*60

          .         .         .         .         .         .       g.25642
 ctgaggcgggcagatcaccagaggtcaggtgttcaagaccagcctgaccaacatggtgaa       c.*120

          .         .         .         .         .         .       g.25702
 acctcatctctactaaaaatacaaaaaattagctgagtgtagtgacgcatgccctcaatc       c.*180

          .         .         .         .         .         .       g.25762
 ccagctactcaagaggctgaggcaggagaatcacttgcactccggaggtagaggttgtgg       c.*240

          .         .         .         .         .         .       g.25822
 tgagccgagattgcaccattgcgctctagcctgggcaacaacagcaaaactccatctcaa       c.*300

          .         .         .         .                           g.25865
 aaaataaaataaataaataaacaaataaaaaattcataatgtg                        c.*343

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Interleukin 18 (interferon-gamma-inducing factor) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.