interleukin 2 (IL2) - coding DNA reference sequence

(used for mutation description)

(last modified July 9, 2012)


This file was created to facilitate the description of sequence variants on transcript NM_000586.3 in the IL2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016779.1, covering IL2 transcript NM_000586.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5055
      agttccctatcactctctttaatcactactcacagtaacctcaactcctgccaca       c.-1

          .         .         .         .         .         .       g.5115
 ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACAAACAGT       c.60
 M  Y  R  M  Q  L  L  S  C  I  A  L  S  L  A  L  V  T  N  S         p.20

          .         .         .         .         .         .       g.5175
 GCACCTACTTCAAGTTCTACAAAGAAAACACAGCTACAACTGGAGCATTTACTGCTGGAT       c.120
 A  P  T  S  S  S  T  K  K  T  Q  L  Q  L  E  H  L  L  L  D         p.40

          .         .        | 02.         .         .         .    g.5325
 TTACAGATGATTTTGAATGGAATTAAT | AATTACAAGAATCCCAAACTCACCAGGATGCTC    c.180
 L  Q  M  I  L  N  G  I  N   | N  Y  K  N  P  K  L  T  R  M  L      p.60

          .         .        | 03.         .         .         .    g.7675
 ACATTTAAGTTTTACATGCCCAAGAAG | GCCACAGAACTGAAACATCTTCAGTGTCTAGAA    c.240
 T  F  K  F  Y  M  P  K  K   | A  T  E  L  K  H  L  Q  C  L  E      p.80

          .         .         .         .         .         .       g.7735
 GAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGCAAAAACTTTCACTTA       c.300
 E  E  L  K  P  L  E  E  V  L  N  L  A  Q  S  K  N  F  H  L         p.100

          .         .         .         .         .  | 04      .    g.9642
 AGACCCAGGGACTTAATCAGCAATATCAACGTAATAGTTCTGGAACTAAAG | GGATCTGAA    c.360
 R  P  R  D  L  I  S  N  I  N  V  I  V  L  E  L  K   | G  S  E      p.120

          .         .         .         .         .         .       g.9702
 ACAACATTCATGTGTGAATATGCTGATGAGACAGCAACCATTGTAGAATTTCTGAACAGA       c.420
 T  T  F  M  C  E  Y  A  D  E  T  A  T  I  V  E  F  L  N  R         p.140

          .         .         .         .                           g.9744
 TGGATTACCTTTTGTCAAAGCATCATCTCAACACTGACTTGA                         c.462
 W  I  T  F  C  Q  S  I  I  S  T  L  T  X                           p.153

          .         .         .         .         .         .       g.9804
 taattaagtgcttcccacttaaaacatatcaggccttctatttatttaaatatttaaatt       c.*60

          .         .         .         .         .         .       g.9864
 ttatatttattgttgaatgtatggtttgctacctattgtaactattattcttaatcttaa       c.*120

          .         .         .         .         .         .       g.9924
 aactataaatatggatcttttatgattctttttgtaagccctaggggctctaaaatggtt       c.*180

          .         .         .         .         .         .       g.9984
 tcacttatttatcccaaaatatttattattatgttgaatgttaaatatagtatctatgta       c.*240

          .         .         .         .                           g.10026
 gattggttagtaaaactatttaataaatttgataaatataaa                         c.*282

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Interleukin 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build beta-06
©2004-2012 Leiden University Medical Center