interleukin 4 (IL4) - coding DNA reference sequence

(used for mutation description)

(last modified July 9, 2012)

This file was created to facilitate the description of sequence variants on transcript NM_000589.2 in the IL4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_023252.1, covering IL4 transcript NM_000589.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5010
                                                   ttctatgcaa       c.-361

 .         .         .         .         .         .                g.5070
 agcaaaaagccagcagcagccccaagctgataagattaatctaaagagcaaattatggtg       c.-301

 .         .         .         .         .         .                g.5130
 taatttcctatgctgaaactttgtagttaattttttaaaaaggtttcattttcctattgg       c.-241

 .         .         .         .         .         .                g.5190
 tctgatttcacaggaacattttacctgtttgtgaggcattttttctcctggaagagaggt       c.-181

 .         .         .         .         .         .                g.5250
 gctgattggccccaagtgactgacaatctggtgtaacgaaaatttccaatgtaaactcat       c.-121

 .         .         .         .         .         .                g.5310
 tttccctcggtttcagcaattttaaatctatatatagagatatctttgtcagcattgcat       c.-61

 .         .         .         .         .         .                g.5370
 cgttagcttctcctgataaactaattgcctcacattgtcactgcaaatcgacacctatta       c.-1

          .         .         .         .         .         .       g.5430
 ATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGGCAAC       c.60
 M  G  L  T  S  Q  L  L  P  P  L  F  F  L  L  A  C  A  G  N         p.20

          .         .         .         .         .         .       g.5490
 TTTGTCCACGGACACAAGTGCGATATCACCTTACAGGAGATCATCAAAACTTTGAACAGC       c.120
 F  V  H  G  H  K  C  D  I  T  L  Q  E  I  I  K  T  L  N  S         p.40

          .      | 02  .         .         .         .         .    g.5823
 CTCACAGAGCAGAAG | ACTCTGTGCACCGAGTTGACCGTAACAGACATCTTTGCTGCCTCC    c.180
 L  T  E  Q  K   | T  L  C  T  E  L  T  V  T  D  I  F  A  A  S      p.60

     | 03    .         .         .         .         .         .    g.11090
 AAG | AACACAACTGAGAAGGAAACCTTCTGCAGGGCTGCGACTGTGCTCCGGCAGTTCTAC    c.240
 K   | N  T  T  E  K  E  T  F  C  R  A  A  T  V  L  R  Q  F  Y      p.80

          .         .         .         .         .         .       g.11150
 AGCCACCATGAGAAGGACACTCGCTGCCTGGGTGCGACTGCACAGCAGTTCCACAGGCAC       c.300
 S  H  H  E  K  D  T  R  C  L  G  A  T  A  Q  Q  F  H  R  H         p.100

          .         .         .         .         .         .       g.11210
 AAGCAGCTGATCCGATTCCTGAAACGGCTCGACAGGAACCTCTGGGGCCTGGCGGGCTTG       c.360
 K  Q  L  I  R  F  L  K  R  L  D  R  N  L  W  G  L  A  G  L         p.120

  | 04       .         .         .         .         .         .    g.13865
  | AATTCCTGTCCTGTGAAGGAAGCCAACCAGAGTACGTTGGAAAACTTCTTGGAAAGGCTA    c.420
  | N  S  C  P  V  K  E  A  N  Q  S  T  L  E  N  F  L  E  R  L      p.140

          .         .         .         .                           g.13907
 AAGACGATCATGAGAGAGAAATATTCAAAGTGTTCGAGCTGA                         c.462
 K  T  I  M  R  E  K  Y  S  K  C  S  S  X                           p.153

          .         .         .         .         .         .       g.13967
 atattttaatttatgagtttttgatagctttattttttaagtatttatatatttataact       c.*60

          .         .                                               g.13996
 catcataaaataaagtatatatagaatct                                      c.*89

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Interleukin 4 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.