interleukin 8 (IL8) - coding DNA reference sequence

(used for mutation description)

(last modified July 9, 2012)


This file was created to facilitate the description of sequence variants on transcript NM_000584.3 in the IL8 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_029889.1, covering IL8 transcript NM_000584.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5033
                            gagggtgcataagttctctagtagggtgatgat       c.-121

 .         .         .         .         .         .                g.5093
 ataaaaagccaccggagcactccataaggcacaaactttcagagacagcagagcacacaa       c.-61

 .         .         .         .         .         .                g.5153
 gcttctaggacaagagccaggaagaaaccaccggaaggaaccatctcactgtgtgtaaac       c.-1

          .         .         .         .         .         .       g.5213
 ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT       c.60
 M  T  S  K  L  A  V  A  L  L  A  A  F  L  I  S  A  A  L  C         p.20

      | 02   .         .         .         .         .         .    g.6092
 GAAG | GTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC    c.120
 E  G |   A  V  L  P  R  S  A  K  E  L  R  C  Q  C  I  K  T  Y      p.40

          .         .         .         .         .         .       g.6152
 TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC       c.180
 S  K  P  F  H  P  K  F  I  K  E  L  R  V  I  E  S  G  P  H         p.60

          .         . | 03       .         .         .         .    g.6483
 TGCGCCAACACAGAAATTAT | TGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC    c.240
 C  A  N  T  E  I  I  |  V  K  L  S  D  G  R  E  L  C  L  D  P      p.80

          .         .         .         .     | 04   .         .    g.6959
 AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAG | GGCTGAGAATTCATAA    c.300
 K  E  N  W  V  Q  R  V  V  E  K  F  L  K  R  |  A  E  N  S  X      p.99

          .         .         .         .         .         .       g.7019
 aaaaattcattctctgtggtatccaagaatcagtgaagatgccagtgaaacttcaagcaa       c.*60

          .         .         .         .         .         .       g.7079
 atctacttcaacacttcatgtattgtgtgggtctgttgtagggttgccagatgcaataca       c.*120

          .         .         .         .         .         .       g.7139
 agattcctggttaaatttgaatttcagtaaacaatgaatagtttttcattgtaccatgaa       c.*180

          .         .         .         .         .         .       g.7199
 atatccagaacatacttatatgtaaagtattatttatttgaatctacaaaaaacaacaaa       c.*240

          .         .         .         .         .         .       g.7259
 taatttttaaatataaggattttcctagatattgcacgggagaatatacaaatagcaaaa       c.*300

          .         .         .         .         .         .       g.7319
 ttgaggccaagggccaagagaatatccgaactttaatttcaggaattgaatgggtttgct       c.*360

          .         .         .         .         .         .       g.7379
 agaatgtgatatttgaagcatcacataaaaatgatgggacaataaattttgccataaagt       c.*420

          .         .         .         .         .         .       g.7439
 caaatttagctggaaatcctggatttttttctgttaaatctggcaaccctagtctgctag       c.*480

          .         .         .         .         .         .       g.7499
 ccaggatccacaagtccttgttccactgtgccttggtttctcctttatttctaagtggaa       c.*540

          .         .         .         .         .         .       g.7559
 aaagtattagccaccatcttacctcacagtgatgttgtgaggacatgtggaagcacttta       c.*600

          .         .         .         .         .         .       g.7619
 agttttttcatcataacataaattattttcaagtgtaacttattaacctatttattattt       c.*660

          .         .         .         .         .         .       g.7679
 atgtatttatttaagcatcaaatatttgtgcaagaatttggaaaaatagaagatgaatca       c.*720

          .         .         .         .         .         .       g.7739
 ttgattgaatagttataaagatgttatagtaaatttattttattttagatattaaatgat       c.*780

          .         .         .         .         .         .       g.7799
 gttttattagataaatttcaatcagggtttttagattaaacaaacaaacaattgggtacc       c.*840

          .         .         .         .         .         .       g.7859
 cagttaaattttcatttcagataaacaacaaataattttttagtataagtacattattgt       c.*900

          .         .         .         .         .         .       g.7919
 ttatctgaaattttaattgaactaacaatcctagtttgatactcccagtcttgtcattgc       c.*960

          .         .         .         .         .         .       g.7979
 cagctgtgttggtagtgctgtgttgaattacggaataatgagttagaactattaaaacag       c.*1020

          .         .         .         .         .         .       g.8039
 ccaaaactccacagtcaatattagtaatttcttgctggttgaaacttgtttattatgtac       c.*1080

          .         .         .         .         .         .       g.8099
 aaatagattcttataatattatttaaatgactgcatttttaaatacaaggctttatattt       c.*1140

          .         .         .         .         .         .       g.8159
 ttaactttaagatgtttttatgtgctctccaaattttttttactgtttctgattgtatgg       c.*1200

          .         .         .         .         .                 g.8211
 aaatataaaagtaaatatgaaacatttaaaatataatttgttgtcaaagtaa               c.*1252

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Interleukin 8 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build beta-06
©2004-2012 Leiden University Medical Center