sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A (SEMA3A) - coding DNA reference sequence

(used for variant description)

(last modified October 21, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_006080.2 in the SEMA3A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011489.1, covering SEMA3A transcript NM_006080.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5015
                                              aagcaccactgcagc       c.-301

 .         .         .         .         .         .                g.5075
 agaccttgttaattttttttttttttctttccacacaacagttgtgcctcattatccggt       c.-241

 .         .         .         .         .         .                g.5135
 gcctggctcggaatttttttttttttttttctttttggagggtttgaagtttctgtgctt       c.-181

 .         .         .         .         .         .                g.5195
 cagtgactgttacagaagaagaggtgttagtgttgccatgaggtcttgattgtctgcatt       c.-121

 .         .         .         .         .         .                g.5255
 tatgaatgaaactgacctaaatcacctgttacctccagtttccagattgtttgaacttct       c.-61

 .         .         .         .         .         .                g.5315
 ctggccgcacaatacaggaaggaagactaaagcagcaaagggacctacagcgtctgcagc       c.-1

          .         .         .         .         .         .       g.5375
 ATGGGCTGGTTAACTAGGATTGTCTGTCTTTTCTGGGGAGTATTACTTACAGCAAGAGCA       c.60
 M  G  W  L  T  R  I  V  C  L  F  W  G  V  L  L  T  A  R  A         p.20

          .         .         .         .         .   | 02     .    g.64958
 AACTATCAGAATGGGAAGAACAATGTGCCAAGGCTGAAATTATCCTACAAAG | AAATGTTG    c.120
 N  Y  Q  N  G  K  N  N  V  P  R  L  K  L  S  Y  K  E |   M  L      p.40

          .         .         .         .         .         .       g.65018
 GAATCCAACAATGTGATCACTTTCAATGGCTTGGCCAACAGCTCCAGTTATCATACCTTC       c.180
 E  S  N  N  V  I  T  F  N  G  L  A  N  S  S  S  Y  H  T  F         p.60

          .         .         .         .         .         .       g.65078
 CTTTTGGATGAGGAACGGAGTAGGCTGTATGTTGGAGCAAAGGATCACATATTTTCATTC       c.240
 L  L  D  E  E  R  S  R  L  Y  V  G  A  K  D  H  I  F  S  F         p.80

          .         .         . | 03       .         .         .    g.70746
 GACCTGGTTAATATCAAGGATTTTCAAAAG | ATTGTGTGGCCAGTATCTTACACCAGAAGA    c.300
 D  L  V  N  I  K  D  F  Q  K   | I  V  W  P  V  S  Y  T  R  R      p.100

          .         .         .    | 04    .         .         .    g.89339
 GATGAATGCAAGTGGGCTGGAAAAGACATCCTG | AAAGAATGTGCTAATTTCATCAAGGTA    c.360
 D  E  C  K  W  A  G  K  D  I  L   | K  E  C  A  N  F  I  K  V      p.120

          .         .         .         .         .         .       g.89399
 CTTAAGGCATATAATCAGACTCACTTGTACGCCTGTGGAACGGGGGCTTTTCATCCAATT       c.420
 L  K  A  Y  N  Q  T  H  L  Y  A  C  G  T  G  A  F  H  P  I         p.140

          .         .         .    | 05    .         .         .    g.139370
 TGCACCTACATTGAAATTGGACATCATCCTGAG | GACAATATTTTTAAGCTGGAGAACTCA    c.480
 C  T  Y  I  E  I  G  H  H  P  E   | D  N  I  F  K  L  E  N  S      p.160

          .         .         .         .         .         .       g.139430
 CATTTTGAAAACGGCCGTGGGAAGAGTCCATATGACCCTAAGCTGCTGACAGCATCCCTT       c.540
 H  F  E  N  G  R  G  K  S  P  Y  D  P  K  L  L  T  A  S  L         p.180

         | 06.         .         .         .         .         .    g.153511
 TTAATAG | ATGGAGAATTATACTCTGGAACTGCAGCTGATTTTATGGGGCGAGACTTTGCT    c.600
 L  I  D |   G  E  L  Y  S  G  T  A  A  D  F  M  G  R  D  F  A      p.200

          .         .         .         .         .         .       g.153571
 ATCTTCCGAACTCTTGGGCACCACCACCCAATCAGGACAGAGCAGCATGATTCCAGGTGG       c.660
 I  F  R  T  L  G  H  H  H  P  I  R  T  E  Q  H  D  S  R  W         p.220

         | 07.         .         .         .         .         .    g.185603
 CTCAATG | ATCCAAAGTTCATTAGTGCCCACCTCATCTCAGAGAGTGACAATCCTGAAGAT    c.720
 L  N  D |   P  K  F  I  S  A  H  L  I  S  E  S  D  N  P  E  D      p.240

          .         .         .         .         .         .       g.185663
 GACAAAGTATACTTTTTCTTCCGTGAAAATGCAATAGATGGAGAACACTCTGGAAAAGCT       c.780
 D  K  V  Y  F  F  F  R  E  N  A  I  D  G  E  H  S  G  K  A         p.260

          .         .         . | 08       .         .         .    g.188634
 ACTCACGCTAGAATAGGTCAGATATGCAAG | AATGACTTTGGAGGGCACAGAAGTCTGGTG    c.840
 T  H  A  R  I  G  Q  I  C  K   | N  D  F  G  G  H  R  S  L  V      p.280

          .         .         .         .         .         .       g.188694
 AATAAATGGACAACATTCCTCAAAGCTCGTCTGATTTGCTCAGTGCCAGGTCCAAATGGC       c.900
 N  K  W  T  T  F  L  K  A  R  L  I  C  S  V  P  G  P  N  G         p.300

          .         .      | 09  .         .         .         .    g.188845
 ATTGACACTCATTTTGATGAACTGC | AGGATGTATTCCTAATGAACTTTAAAGATCCTAAA    c.960
 I  D  T  H  F  D  E  L  Q |   D  V  F  L  M  N  F  K  D  P  K      p.320

          .         .         .      | 10  .         .         .    g.192429
 AATCCAGTTGTATATGGAGTGTTTACGACTTCCAG | TAACATTTTCAAGGGATCAGCCGTG    c.1020
 N  P  V  V  Y  G  V  F  T  T  S  S  |  N  I  F  K  G  S  A  V      p.340

          .         .         .         .         .         .       g.192489
 TGTATGTATAGCATGAGTGATGTGAGAAGGGTGTTCCTTGGTCCATATGCCCACAGGGAT       c.1080
 C  M  Y  S  M  S  D  V  R  R  V  F  L  G  P  Y  A  H  R  D         p.360

          .         .         .         .         .         .       g.192549
 GGACCCAACTATCAATGGGTGCCTTATCAAGGAAGAGTCCCCTATCCACGGCCAGGAACT       c.1140
 G  P  N  Y  Q  W  V  P  Y  Q  G  R  V  P  Y  P  R  P  G  T         p.380

  | 11       .         .         .         .         .         .    g.194403
  | TGTCCCAGCAAAACATTTGGTGGTTTTGACTCTACAAAGGACCTTCCTGATGATGTTATA    c.1200
  | C  P  S  K  T  F  G  G  F  D  S  T  K  D  L  P  D  D  V  I      p.400

          .         .         .         .         .         .       g.194463
 ACCTTTGCAAGAAGTCATCCAGCCATGTACAATCCAGTGTTTCCTATGAACAATCGCCCA       c.1260
 T  F  A  R  S  H  P  A  M  Y  N  P  V  F  P  M  N  N  R  P         p.420

          .         .         .         .         .         .       g.194523
 ATAGTGATCAAAACGGATGTAAATTATCAATTTACACAAATTGTCGTAGACCGAGTGGAT       c.1320
 I  V  I  K  T  D  V  N  Y  Q  F  T  Q  I  V  V  D  R  V  D         p.440

          .         .         .         . | 12       .         .    g.197875
 GCAGAAGATGGACAGTATGATGTTATGTTTATCGGAACAG | ATGTTGGGACCGTTCTTAAA    c.1380
 A  E  D  G  Q  Y  D  V  M  F  I  G  T  D |   V  G  T  V  L  K      p.460

          .         .         .         .         .         .       g.197935
 GTAGTTTCAATTCCTAAGGAGACTTGGTATGATTTAGAAGAGGTTCTGCTGGAAGAAATG       c.1440
 V  V  S  I  P  K  E  T  W  Y  D  L  E  E  V  L  L  E  E  M         p.480

          .   | 13     .         .         .         .     | 14   . g.218429
 ACAGTTTTTCGG | GAACCGACTGCTATTTCAGCAATGGAGCTTTCCACTAAGCAG | CAACAA c.1500
 T  V  F  R   | E  P  T  A  I  S  A  M  E  L  S  T  K  Q   | Q  Q   p.500

          .         .         .         .         .         .       g.218489
 CTATATATTGGTTCAACGGCTGGGGTTGCCCAGCTCCCTTTACACCGGTGTGATATTTAC       c.1560
 L  Y  I  G  S  T  A  G  V  A  Q  L  P  L  H  R  C  D  I  Y         p.520

          .         .         .         .         .         .       g.218549
 GGGAAAGCGTGTGCTGAGTGTTGCCTCGCCCGAGACCCTTACTGTGCTTGGGATGGTTCT       c.1620
 G  K  A  C  A  E  C  C  L  A  R  D  P  Y  C  A  W  D  G  S         p.540

          .         .         .   | 15     .         .         .    g.222733
 GCATGTTCTCGCTATTTTCCCACTGCAAAGAG | ACGCACAAGACGACAAGATATAAGAAAT    c.1680
 A  C  S  R  Y  F  P  T  A  K  R  |  R  T  R  R  Q  D  I  R  N      p.560

          .         .         .        | 16.         .         .    g.236577
 GGAGACCCACTGACTCACTGTTCAGACTTACACCATG | ATAATCACCATGGCCACAGCCCT    c.1740
 G  D  P  L  T  H  C  S  D  L  H  H  D |   N  H  H  G  H  S  P      p.580

          .         .         .         .         .         .       g.236637
 GAAGAGAGAATCATCTATGGTGTAGAGAATAGTAGCACATTTTTGGAATGCAGTCCGAAG       c.1800
 E  E  R  I  I  Y  G  V  E  N  S  S  T  F  L  E  C  S  P  K         p.600

          .         .         .         .         .         .       g.236697
 TCGCAGAGAGCGCTGGTCTATTGGCAATTCCAGAGGCGAAATGAAGAGCGAAAAGAAGAG       c.1860
 S  Q  R  A  L  V  Y  W  Q  F  Q  R  R  N  E  E  R  K  E  E         p.620

  | 17       .         .         .         .         .         .    g.238135
  | ATCAGAGTGGATGATCATATCATCAGGACAGATCAAGGCCTTCTGCTACGTAGTCTACAA    c.1920
  | I  R  V  D  D  H  I  I  R  T  D  Q  G  L  L  L  R  S  L  Q      p.640

          .         .         .         .         .         .       g.238195
 CAGAAGGATTCAGGCAATTACCTCTGCCATGCGGTGGAACATGGGTTCATACAAACTCTT       c.1980
 Q  K  D  S  G  N  Y  L  C  H  A  V  E  H  G  F  I  Q  T  L         p.660

          .         .         .         .         .         .       g.238255
 CTTAAGGTAACCCTGGAAGTCATTGACACAGAGCATTTGGAAGAACTTCTTCATAAAGAT       c.2040
 L  K  V  T  L  E  V  I  D  T  E  H  L  E  E  L  L  H  K  D         p.680

          .         .         .         .         .         .       g.238315
 GATGATGGAGATGGCTCTAAGACCAAAGAAATGTCCAATAGCATGACACCTAGCCAGAAG       c.2100
 D  D  G  D  G  S  K  T  K  E  M  S  N  S  M  T  P  S  Q  K         p.700

          .         .         .         .         .         .       g.238375
 GTCTGGTACAGAGACTTCATGCAGCTCATCAACCACCCCAATCTCAACACAATGGATGAG       c.2160
 V  W  Y  R  D  F  M  Q  L  I  N  H  P  N  L  N  T  M  D  E         p.720

          .         .         .         .         .         .       g.238435
 TTCTGTGAACAAGTTTGGAAAAGGGACCGAAAACAACGTCGGCAAAGGCCAGGACATACC       c.2220
 F  C  E  Q  V  W  K  R  D  R  K  Q  R  R  Q  R  P  G  H  T         p.740

          .         .         .         .         .         .       g.238495
 CCAGGGAACAGTAACAAATGGAAGCACTTACAAGAAAATAAGAAAGGTAGAAACAGGAGG       c.2280
 P  G  N  S  N  K  W  K  H  L  Q  E  N  K  K  G  R  N  R  R         p.760

          .         .         .                                     g.238531
 ACCCACGAATTTGAGAGGGCACCCAGGAGTGTCTGA                               c.2316
 T  H  E  F  E  R  A  P  R  S  V  X                                 p.771

          .         .         .         .         .         .       g.238591
 gctgcattacctctagaaacctcaaacaagtagaaacttgcctagacaataactggaaaa       c.*60

          .         .         .         .         .         .       g.238651
 acaaatgcaatatacatgaacttttttcatggcattatgtggatgtttacaatggtggga       c.*120

          .         .         .         .         .         .       g.238711
 aattcagctgagttccaccaattataaattaaatccatgagtaactttcctaataggctt       c.*180

          .         .         .         .         .         .       g.238771
 tttttcctaataccaccacctaacagagaacacaggtgaatgcagatgttcactttagca       c.*240

          .         .         .         .         .         .       g.238831
 gacttaatgtttcctatgagatttcactgtacaggtttgtctttcttctttgcctgagaa       c.*300

          .         .         .         .         .         .       g.238891
 ataaaaatgtcatttgccatattgccatctaaaggagaaaaactgcatcagcaaagccat       c.*360

          .         .         .         .         .         .       g.238951
 tgtattgaactaaaagtttaaaatgaactgcatggatttactaagctgatgaatattcca       c.*420

          .         .         .         .         .         .       g.239011
 aaacgtggttggattcaaggatatattttgtctaccggccctcatgtttgtatgtacttg       c.*480

          .         .         .         .         .         .       g.239071
 aggagtaaaatgagtaaaatgatactgaatgaaatgttctgtggaaatattaaaaaaaaa       c.*540

          .         .         .         .         .         .       g.239131
 aaaaaacataagccatccatcatccagaagaaaaatggaatacactgatctactactgat       c.*600

          .         .         .         .         .         .       g.239191
 gtcttctttcagctttgatctaaagatgtattttattaaaactataatttaaatgtacca       c.*660

          .         .         .         .         .         .       g.239251
 tgaaaaatatgcagtaaaaattagttgttttctaagctagagtaggatttgtcttacaat       c.*720

          .         .         .         .         .         .       g.239311
 tattgtgctatgtagtttttgttttaaaaattccaatggtgtgctgctttctttggacat       c.*780

          .         .         .         .         .         .       g.239371
 tttattttcaattctataagagggatagatgacattgttctagaaacacatatacatcat       c.*840

          .         .         .         .         .         .       g.239431
 taagagtgaatctctaaaaccaggatataaattatgctttatttctctgagaaaatcaaa       c.*900

          .         .         .         .         .         .       g.239491
 caaatggaagctgttcacacctccccttctttaagcattatctaaattaatttttacttg       c.*960

          .         .         .         .         .         .       g.239551
 cataatgttcttagaaaaaaaaacagaacatttaagcaggaaaaaaggaagaaacaagtt       c.*1020

          .         .         .         .         .         .       g.239611
 gatttttaagtgcattttactataatgaatcaatgaagggaaaaggaactgcatatttca       c.*1080

          .         .         .         .         .         .       g.239671
 tgaaaataataagcattgtcttaatatactgttaatagaaaatgtgtcttaattccgtgc       c.*1140

          .         .         .         .         .         .       g.239731
 ttgaatccctgcatgatatttgagactaagatctctcttatgattctaccaagaattata       c.*1200

          .         .         .         .         .         .       g.239791
 tctgtgtcacttaatttttttaaaagagagagatcaataactattcagagcaacatgtta       c.*1260

          .         .         .         .         .         .       g.239851
 aaggcaaagtttccaatcatttacatctgtatcaggtgcctcttacctttccttatttaa       c.*1320

          .         .         .         .         .         .       g.239911
 gacaattatttgtacaagaaacacatgactcttttcatatcaatgggagggacttttcta       c.*1380

          .         .         .         .         .         .       g.239971
 caaagtattttccaggatgcaacccacatttaaacaatgtaaaattctttgtttcctgca       c.*1440

          .         .         .         .         .         .       g.240031
 acaacttacaaaataaggtaaaagactaaaattcaagatttgcttccttcattgtcctaa       c.*1500

          .         .         .         .         .         .       g.240091
 gacgattcgttgagaatcactgactttgagatatttaaaactttcagcattatactgtgg       c.*1560

          .         .         .         .         .         .       g.240151
 tttcttttgcactgcactcacctattcaggactcctcccccaggttcctcatcatgcaca       c.*1620

          .         .         .         .         .         .       g.240211
 aaaatgcaaagaaaacatcttattagtaattaatgaagcaacattgaaattctaactcta       c.*1680

          .         .         .         .         .         .       g.240271
 gctgtctttggattctaattaactcagcatcaatttctcacctcagactacagtgaattt       c.*1740

          .         .         .         .         .         .       g.240331
 ttatttcctatcagctgaaatatttcacagatggaagctcatgtttcagttttaatgact       c.*1800

          .         .         .         .         .         .       g.240391
 gccttgaataaacaagttgttgccacttgtttcaaacaaaagcctaaaaataatctacat       c.*1860

          .         .         .         .         .         .       g.240451
 tcaattttaggctccattgactaatatggtgttgcttttggaagtactgtatatcctcac       c.*1920

          .         .         .         .         .         .       g.240511
 atggaagccaaattgttaaattatttgaaggacacaccactgtacagaaagtagtgtttc       c.*1980

          .         .         .         .         .         .       g.240571
 aaatataaatcgaagaacaaagagtgctccaaaaaataggtcattcttttattttcataa       c.*2040

          .         .         .         .         .         .       g.240631
 agtatctaaactgtactaacattcagtgttgtgtttcattctaaatttgcagctgaaata       c.*2100

          .         .         .         .         .         .       g.240691
 aatttatttgcgatagcagaaatatcttattattcatcctcagaaataaaggatttgaag       c.*2160

          .         .         .         .         .         .       g.240751
 ggatagagattatatgataaatttatagaagactttcagaatttgaatgcattttgttta       c.*2220

          .         .         .         .         .         .       g.240811
 gtgttatgaaatgacaatagaaaaaagtctcgacttcaattaaaagttacacaaacaaac       c.*2280

          .         .         .         .         .         .       g.240871
 aaatctacaggcatgtctttatataccatcaggtctaagttttcaaagaaaattgtagat       c.*2340

          .         .         .         .         .         .       g.240931
 ataacttgcagataactcattacagtcataatctctgcccatgtgtattgagagggggca       c.*2400

          .         .         .         .         .         .       g.240991
 gtttgcacgaaaaagaattattggcccatttaataattcagctttaaatagactttgtca       c.*2460

          .         .         .         .         .         .       g.241051
 tatgcatgaatcatcagagatgaaactgtttgagagactcatgtgaccttacgaaaatta       c.*2520

          .         .         .         .         .         .       g.241111
 caacagcagtcttaaagtatgaaaaagatgcatcacagcagagacattatggcccagttg       c.*2580

          .         .         .         .         .         .       g.241171
 atatcaaatgtaaaatgtaaatgcatgtaaatgcacacttcattttatgtattatttagt       c.*2640

          .         .         .         .         .         .       g.241231
 aatttgcagtggtatgtgtttaatatttttgctacctacacattaggcaaaaaaaagatg       c.*2700

          .         .         .         .         .         .       g.241291
 taaataatttgggagaaaaagaggaagaacagtgtaaaataaaactttctataagtactc       c.*2760

          .         .         .         .         .         .       g.241351
 catttcaatgtgttcaacatcatcctaaaaggcaagattttcccacgcaggtgacaaggt       c.*2820

          .         .         .         .         .         .       g.241411
 ggtttatgtactatttaagggcggaaggtgcgtgcccgttcaataagcatgttttttgcc       c.*2880

          .         .         .         .         .         .       g.241471
 aggtaggaaatatgttccatatctttacttatcattgcatttcagatgggaactagaaaa       c.*2940

          .         .         .         .         .         .       g.241531
 actggagagaaaaatgtaatgaaactgctgctgtaaattattccttttagcatgtattca       c.*3000

          .         .                                               g.241559
 cttgctaaatacacatttcttcaaaata                                       c.*3028

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center