serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 (SERPINA1) - coding DNA reference sequence

(used for variant description)

(last modified July 21, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_001127701.1 in the SERPINA1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008290.1, covering SERPINA1 transcript NM_001127701.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5033
                            tgggcaggaactgggcactgtgcccagggcatg       c.-541

 .         .         .         .         .         .                g.5093
 cactgcctccacgcagcaaccctcagagtcctgagctgaaccaagaaggaggagggggtc       c.-481

 .         .         .         .         .         .                g.5153
 gggcctccgaggaaggcctagccgctgctgctgccaggaattccaggttggaggggcggc       c.-421

 .         .         .         .         .         .                g.5213
 aacctcctgccagccttcaggccactctcctgtgcctgccagaagagacagagcttgagg       c.-361

 .         .         .         .         .         .                g.5273
 agagcttgaggagagcaggaaaggtgggacattgctgctgctgctcactcagttccacag       c.-301

  | 02        .         .         .         .         .             g.6742
  | ggcggcagtaagtcttcagcatcaggcattttggggtgactcagtaaatggtagatcttg    c.-241

 .         .         .         .         .         .                g.6802
 ctaccagtggaacagccactaaggattctgcagtgagagcagagggccagctaagtggta       c.-181

 .         .         .         .         .         .                g.6862
 ctctcccagagactgtctgactcacgccaccccctccaccttggacacaggacgctgtgg       c.-121

 .         .  | 03      .         .         .         .             g.7077
 tttctgagccag | cagcctcccccgttgcccctctggatccactgcttaaatacggacgag    c.-61

 .         .         .         .         .         .      | 04      g.12455
 gacagggccctgtctcctcagcttcaggcaccaccactgacctgggacagtgaatc | gaca    c.-1

          .         .         .         .         .         .       g.12515
 ATGCCGTCTTCTGTCTCGTGGGGCATCCTCCTGCTGGCAGGCCTGTGCTGCCTGGTCCCT       c.60
 M  P  S  S  V  S  W  G  I  L  L  L  A  G  L  C  C  L  V  P         p.20

          .         .         .         .         .         .       g.12575
 GTCTCCCTGGCTGAGGATCCCCAGGGAGATGCTGCCCAGAAGACAGATACATCCCACCAT       c.120
 V  S  L  A  E  D  P  Q  G  D  A  A  Q  K  T  D  T  S  H  H         p.40

          .         .         .         .         .         .       g.12635
 GATCAGGATCACCCAACCTTCAACAAGATCACCCCCAACCTGGCTGAGTTCGCCTTCAGC       c.180
 D  Q  D  H  P  T  F  N  K  I  T  P  N  L  A  E  F  A  F  S         p.60

          .         .         .         .         .         .       g.12695
 CTATACCGCCAGCTGGCACACCAGTCCAACAGCACCAATATCTTCTTCTCCCCAGTGAGC       c.240
 L  Y  R  Q  L  A  H  Q  S  N  S  T  N  I  F  F  S  P  V  S         p.80

          .         .         .         .         .         .       g.12755
 ATCGCTACAGCCTTTGCAATGCTCTCCCTGGGGACCAAGGCTGACACTCACGATGAAATC       c.300
 I  A  T  A  F  A  M  L  S  L  G  T  K  A  D  T  H  D  E  I         p.100

          .         .         .         .         .         .       g.12815
 CTGGAGGGCCTGAATTTCAACCTCACGGAGATTCCGGAGGCTCAGATCCATGAAGGCTTC       c.360
 L  E  G  L  N  F  N  L  T  E  I  P  E  A  Q  I  H  E  G  F         p.120

          .         .         .         .         .         .       g.12875
 CAGGAACTCCTCCGTACCCTCAACCAGCCAGACAGCCAGCTCCAGCTGACCACCGGCAAT       c.420
 Q  E  L  L  R  T  L  N  Q  P  D  S  Q  L  Q  L  T  T  G  N         p.140

          .         .         .         .         .         .       g.12935
 GGCCTGTTCCTCAGCGAGGGCCTGAAGCTAGTGGATAAGTTTTTGGAGGATGTTAAAAAG       c.480
 G  L  F  L  S  E  G  L  K  L  V  D  K  F  L  E  D  V  K  K         p.160

          .         .         .         .         .         .       g.12995
 TTGTACCACTCAGAAGCCTTCACTGTCAACTTCGGGGACACCGAAGAGGCCAAGAAACAG       c.540
 L  Y  H  S  E  A  F  T  V  N  F  G  D  T  E  E  A  K  K  Q         p.180

          .         .         .         .         .         .       g.13055
 ATCAACGATTACGTGGAGAAGGGTACTCAAGGGAAAATTGTGGATTTGGTCAAGGAGCTT       c.600
 I  N  D  Y  V  E  K  G  T  Q  G  K  I  V  D  L  V  K  E  L         p.200

          .         .         .         .       | 05 .         .    g.14565
 GACAGAGACACAGTTTTTGCTCTGGTGAATTACATCTTCTTTAAAG | GCAAATGGGAGAGA    c.660
 D  R  D  T  V  F  A  L  V  N  Y  I  F  F  K  G |   K  W  E  R      p.220

          .         .         .         .         .         .       g.14625
 CCCTTTGAAGTCAAGGACACCGAGGAAGAGGACTTCCACGTGGACCAGGTGACCACCGTG       c.720
 P  F  E  V  K  D  T  E  E  E  D  F  H  V  D  Q  V  T  T  V         p.240

          .         .         .         .         .         .       g.14685
 AAGGTGCCTATGATGAAGCGTTTAGGCATGTTTAACATCCAGCACTGTAAGAAGCTGTCC       c.780
 K  V  P  M  M  K  R  L  G  M  F  N  I  Q  H  C  K  K  L  S         p.260

          .         .         .         .         .         .       g.14745
 AGCTGGGTGCTGCTGATGAAATACCTGGGCAATGCCACCGCCATCTTCTTCCTGCCTGAT       c.840
 S  W  V  L  L  M  K  Y  L  G  N  A  T  A  I  F  F  L  P  D         p.280

          .         .         .         .         .         .       g.14805
 GAGGGGAAACTACAGCACCTGGAAAATGAACTCACCCACGATATCATCACCAAGTTCCTG       c.900
 E  G  K  L  Q  H  L  E  N  E  L  T  H  D  I  I  T  K  F  L         p.300

          .        | 06.         .         .         .         .    g.16124
 GAAAATGAAGACAGAAG | GTCTGCCAGCTTACATTTACCCAAACTGTCCATTACTGGAACC    c.960
 E  N  E  D  R  R  |  S  A  S  L  H  L  P  K  L  S  I  T  G  T      p.320

          .         .         .         .         .         .       g.16184
 TATGATCTGAAGAGCGTCCTGGGTCAACTGGGCATCACTAAGGTCTTCAGCAATGGGGCT       c.1020
 Y  D  L  K  S  V  L  G  Q  L  G  I  T  K  V  F  S  N  G  A         p.340

          .         .         .         .      | 07  .         .    g.17067
 GACCTCTCCGGGGTCACAGAGGAGGCACCCCTGAAGCTCTCCAAG | GCCGTGCATAAGGCT    c.1080
 D  L  S  G  V  T  E  E  A  P  L  K  L  S  K   | A  V  H  K  A      p.360

          .         .         .         .         .         .       g.17127
 GTGCTGACCATCGACGAGAAAGGGACTGAAGCTGCTGGGGCCATGTTTTTAGAGGCCATA       c.1140
 V  L  T  I  D  E  K  G  T  E  A  A  G  A  M  F  L  E  A  I         p.380

          .         .         .         .         .         .       g.17187
 CCCATGTCTATCCCCCCCGAGGTCAAGTTCAACAAACCCTTTGTCTTCTTAATGATTGAA       c.1200
 P  M  S  I  P  P  E  V  K  F  N  K  P  F  V  F  L  M  I  E         p.400

          .         .         .         .         .                 g.17244
 CAAAATACCAAGTCTCCCCTCTTCATGGGAAAAGTGGTGAATCCCACCCAAAAATAA          c.1257
 Q  N  T  K  S  P  L  F  M  G  K  V  V  N  P  T  Q  K  X            p.418

          .         .         .         .         .         .       g.17304
 ctgcctctcgctcctcaacccctcccctccatccctggccccctccctggatgacattaa       c.*60

          .         .         .         .         .         .       g.17364
 agaagggttgagctggtccctgcctgcatgtgactgtaaatccctcccatgttttctctg       c.*120

          .         .         .         .         .         .       g.17424
 agtctccctttgcctgctgaggctgtatgtgggctccaggtaacagtgctgtcttcgggc       c.*180

          .         .         .         .         .         .       g.17484
 cccctgaactgtgttcatggagcatctggctgggtaggcacatgctgggcttgaatccag       c.*240

          .         .         .         .         .         .       g.17544
 gggggactgaatcctcagcttacggacctgggcccatctgtttctggagggctccagtct       c.*300

          .         .         .         .         .         .       g.17604
 tccttgtcctgtcttggagtccccaagaaggaatcacaggggaggaaccagataccagcc       c.*360

          .         .         .         .         .         .       g.17664
 atgaccccaggctccaccaagcatcttcatgtccccctgctcatcccccactccccccca       c.*420

          .         .         .         .         .         .       g.17724
 cccagagttgctcatcctgccagggctggctgtgcccaccccaaggctgccctcctgggg       c.*480

          .         .         .         .         .         .       g.17784
 gccccagaactgcctgatcgtgccgtggcccagttttgtggcatctgcagcaacacaaga       c.*540

          .         .         .         .         .         .       g.17844
 gagaggacaatgtcctcctcttgacccgctgtcacctaaccagactcgggccctgcacct       c.*600

          .         .         .         .         .         .       g.17904
 ctcaggcacttctggaaaatgactgaggcagattcttcctgaagcccattctccatgggg       c.*660

          .         .         .         .         .         .       g.17964
 caacaaggacacctattctgtccttgtccttccatcgctgccccagaaagcctcacatat       c.*720

          .         .         .         .         .         .       g.18024
 ctccgtttagaatcaggtcccttctccccagatgaagaggagggtctctgctttgttttc       c.*780

          .         .         .         .         .         .       g.18084
 tctatctcctcctcagacttgaccaggcccagcaggccccagaagaccattaccctatat       c.*840

          .         .         .         .         .         .       g.18144
 cccttctcctccctagtcacatggccataggcctgctgatggctcaggaaggccattgca       c.*900

          .         .         .         .         .         .       g.18204
 aggactcctcagctatgggagaggaagcacatcacccattgacccccgcaacccctccct       c.*960

          .         .         .         .         .         .       g.18264
 ttcctcctctgagtcccgactggggccacatgcagcctgacttctttgtgcctgttgctg       c.*1020

          .         .         .         .         .         .       g.18324
 tccctgcagtcttcagagggccaccgcagctccagtgccacggcaggaggctgttcctga       c.*1080

          .         .         .         .         .         .       g.18384
 atagcccctgtggtaagggccaggagagtccttccatcctccaaggccctgctaaaggac       c.*1140

          .         .         .         .         .         .       g.18444
 acagcagccaggaagtcccctgggcccctagctgaaggacagcctgctccctccgtctct       c.*1200

          .         .         .         .         .         .       g.18504
 accaggaatggccttgtcctatggaaggcactgccccatcccaaactaatctaggaatca       c.*1260

          .         .         .         .         .         .       g.18564
 ctgtctaaccactcactgtcatgaatgtgtacttaaaggatgaggttgagtcataccaaa       c.*1320

          .         .         .         .         .         .       g.18624
 tagtgatttcgatagttcaaaatggtgaaattagcaattctacatgattcagtctaatca       c.*1380

          .         .         .         .         .         .       g.18684
 atggataccgactgtttcccacacaagtctcctgttctcttaagcttactcactgacagc       c.*1440

          .         .         .         .         .         .       g.18744
 ctttcactctccacaaatacattaaagatatggccatcaccaagccccctaggatgacac       c.*1500

          .         .         .         .         .         .       g.18804
 cagacctgagagtctgaagacctggatccaagttctgacttttccccctgacagctgtgt       c.*1560

          .         .         .         .         .         .       g.18864
 gaccttcgtgaagtcgccaaacctctctgagccccagtcattgctagtaagacctgcctt       c.*1620

          .         .         .         .         .         .       g.18924
 tgagttggtatgatgttcaagttagataacaaaatgtttatacccattagaacagagaat       c.*1680

          .         .                                               g.18946
 aaatagaactacatttcttgca                                             c.*1702

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center