solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 (SLC25A1) - coding DNA reference sequence

(used for variant description)

(last modified November 16, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_005984.3 in the SLC25A1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000022.10, covering SLC25A1 transcript NM_005984.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5032
                             ctggctcggaccacgcggggcgggacctggag       c.-121

 .         .         .         .         .         .                g.5092
 ctgacgcggccgccccgcccctgggaccataaccggccgccgccgccaccgcggaccgag       c.-61

 .         .         .         .         .         .                g.5152
 cgcggagttctggagtctcggacccgaagccgccacagggcgccccgcctcccgcccgcc       c.-1

          .         .         .         .         .         .       g.5212
 ATGCCCGCGCCCCGCGCCCCGCGCGCTCTGGCGGCCGCCGCGCCCGCGTCCGGGAAGGCC       c.60
 M  P  A  P  R  A  P  R  A  L  A  A  A  A  P  A  S  G  K  A         p.20

          .         .         .     | 02   .         .         .    g.5611
 AAGCTGACGCACCCGGGGAAGGCGATCCTGGCAG | GCGGCCTGGCGGGTGGCATCGAGATC    c.120
 K  L  T  H  P  G  K  A  I  L  A  G |   G  L  A  G  G  I  E  I      p.40

          .         .         .         .         .         .       g.5671
 TGCATCACCTTCCCCACCGAGTACGTGAAGACGCAGCTGCAGCTGGACGAGCGCTCGCAC       c.180
 C  I  T  F  P  T  E  Y  V  K  T  Q  L  Q  L  D  E  R  S  H         p.60

          .         .   | 03     .         .         .         .    g.5822
 CCGCCGCGGTACCGGGGCATCG | GGGACTGCGTGCGGCAGACGGTTCGCAGCCATGGCGTC    c.240
 P  P  R  Y  R  G  I  G |   D  C  V  R  Q  T  V  R  S  H  G  V      p.80

          .         .         .         .         .         .       g.5882
 CTGGGCCTGTACCGCGGCCTTAGCTCCCTGCTCTACGGTTCCATCCCCAAGGCGGCCGTC       c.300
 L  G  L  Y  R  G  L  S  S  L  L  Y  G  S  I  P  K  A  A  V         p.100

    | 04     .         .         .         .         .         .    g.6018
 AG | GTTTGGAATGTTCGAGTTCCTCAGCAACCACATGCGGGATGCCCAGGGACGGCTGGAC    c.360
 R  |  F  G  M  F  E  F  L  S  N  H  M  R  D  A  Q  G  R  L  D      p.120

          .         .         .         .         .         .       g.6078
 AGCACGCGTGGGCTGCTGTGCGGCCTGGGCGCTGGCGTGGCCGAGGCCGTGGTGGTCGTG       c.420
 S  T  R  G  L  L  C  G  L  G  A  G  V  A  E  A  V  V  V  V         p.140

          .         .  | 05      .         .         .         .    g.6660
 TGCCCCATGGAGACCATCAAG | GTGAAGTTCATCCACGACCAGACCTCCCCAAACCCCAAG    c.480
 C  P  M  E  T  I  K   | V  K  F  I  H  D  Q  T  S  P  N  P  K      p.160

          .         .         .         .       | 06 .         .    g.6889
 TACAGAGGATTCTTCCACGGGGTTAGGGAGATTGTGCGGGAACAAG | GGCTGAAGGGGACG    c.540
 Y  R  G  F  F  H  G  V  R  E  I  V  R  E  Q  G |   L  K  G  T      p.180

          .         .         .         .         .         .       g.6949
 TACCAGGGCCTCACAGCCACTGTCCTGAAGCAGGGCTCGAACCAGGCCATCCGCTTCTTC       c.600
 Y  Q  G  L  T  A  T  V  L  K  Q  G  S  N  Q  A  I  R  F  F         p.200

          .         .         .  | 07      .         .         .    g.7161
 GTCATGACCTCCCTGCGCAACTGGTACCGAG | GGGACAACCCCAACAAGCCCATGAACCCT    c.660
 V  M  T  S  L  R  N  W  Y  R  G |   D  N  P  N  K  P  M  N  P      p.220

          .         .         .         .         .         .       g.7221
 CTGATCACTGGGGTCTTCGGAGCTATTGCAGGCGCAGCCAGTGTCTTTGGAAACACTCCT       c.720
 L  I  T  G  V  F  G  A  I  A  G  A  A  S  V  F  G  N  T  P         p.240

          .         .        | 08.         .         .         .    g.7364
 CTGGATGTGATTAAGACCCGGATGCAG | GGCCTGGAGGCGCACAAATACCGGAACACGTGG    c.780
 L  D  V  I  K  T  R  M  Q   | G  L  E  A  H  K  Y  R  N  T  W      p.260

          .         .         .         .  | 09      .         .    g.7600
 GACTGCGGCTTGCAGATCCTGAAGAAGGAGGGGCTCAAGGC | ATTCTACAAGGGCACTGTC    c.840
 D  C  G  L  Q  I  L  K  K  E  G  L  K  A  |  F  Y  K  G  T  V      p.280

          .         .         .         .         .         .       g.7660
 CCCCGCCTGGGCCGGGTCTGCCTGGATGTGGCCATAGTGTTTGTCATCTATGATGAAGTG       c.900
 P  R  L  G  R  V  C  L  D  V  A  I  V  F  V  I  Y  D  E  V         p.300

          .         .         .                                     g.7696
 GTGAAGCTGCTCAACAAAGTGTGGAAGACGGACTAA                               c.936
 V  K  L  L  N  K  V  W  K  T  D  X                                 p.311

          .         .         .         .         .         .       g.7756
 gcctagagaggccgcaaggggaccgccccaggcaccgccagagtgtcctgctacctttgt       c.*60

          .         .         .         .         .         .       g.7816
 ctcacgattccagtgcagtagtgccaaaaggccccttcccacgtccctcgagctctgtag       c.*120

          .         .         .         .         .         .       g.7876
 cctggtctgtgcattgtggctgtcaaatccatgtgtcccccctgtggtctgtgtgtgaca       c.*180

          .         .         .         .         .         .       g.7936
 ccaccactgtgtcccagtgtctggcccagccatggctggatgtgcatctggcctatgacc       c.*240

          .         .         .         .         .         .       g.7996
 ctgtgcctgtgtttcatgttctgtgtcacgtgaccctgtgccccgcctcccggggtgccc       c.*300

          .         .         .         .         .         .       g.8056
 gtgtggcctgggtcctcggccctgtagccctggcccggtcccagtccggtgccttccacc       c.*360

          .         .         .         .         .         .       g.8116
 ctgccctggcctaccacagctgcctccgggcctcggcctggcttcaccgcattccagggg       c.*420

          .         .         .         .         .         .       g.8176
 ctgcagccccctgcttctcccgccattggccttaactggccctcgggccctctctccgcc       c.*480

          .         .         .         .         .         .       g.8236
 ccggacagggtggcacccaccactctcaggaccaccctgccaaggcagaataaaccggat       c.*540

          .                                                         g.8251
 cctgttgcagcctcc                                                    c.*555

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center