surfeit 1 (SURF1) - coding DNA reference sequence

(used for variant description)

(last modified November 12, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_003172.3 in the SURF1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008477.1, covering SURF1 transcript NM_003172.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5032
                             gcgtcccggaagcgcccgcggggccgggtgcg       c.-1

          .         .         .         .         .     | 02   .    g.5192
 ATGGCGGCGGTGGCTGCGTTGCAGCTGGGGCTGCGGGCGGCGGGGCTGGGACGG | GCCCCG    c.60
 M  A  A  V  A  A  L  Q  L  G  L  R  A  A  G  L  G  R   | A  P      p.20

          .         .         .         .       | 03 .         .    g.6563
 GCCAGCGCCGCCTGGAGGAGCGTCCTCAGGGTCTCCCCGCGCCCAG | GGGTGGCCTGGAGG    c.120
 A  S  A  A  W  R  S  V  L  R  V  S  P  R  P  G |   V  A  W  R      p.40

          .         .         .         .         .         .       g.6623
 CCAAGCAGATGTGGCAGTTCTGCAGCAGAAGCATCTGCCACAAAAGCGGAAGATGACTCC       c.180
 P  S  R  C  G  S  S  A  A  E  A  S  A  T  K  A  E  D  D  S         p.60

          .         .         .         .         .         .       g.6683
 TTTCTTCAGTGGGTCCTGCTCCTCATCCCTGTGACTGCCTTTGGCTTGGGGACATGGCAG       c.240
 F  L  Q  W  V  L  L  L  I  P  V  T  A  F  G  L  G  T  W  Q         p.80

  | 04       .         .         .         .         .         .    g.6825
  | GTCCAGCGTCGGAAGTGGAAGCTGAACCTGATTGCAGAGTTGGAGTCCAGAGTTCTGGCT    c.300
  | V  Q  R  R  K  W  K  L  N  L  I  A  E  L  E  S  R  V  L  A      p.100

          .         .    | 05    .         .         .         .    g.7603
 GAGCCTGTCCCTCTGCCAGCCGA | CCCAATGGAACTGAAAAATCTGGAGTATAGGCCAGTG    c.360
 E  P  V  P  L  P  A  D  |  P  M  E  L  K  N  L  E  Y  R  P  V      p.120

          .         .         .         .         .         .       g.7663
 AAGGTCAGGGGGTGCTTTGACCATTCCAAGGAGCTGTATATGATGCCCCGGACCATGGTG       c.420
 K  V  R  G  C  F  D  H  S  K  E  L  Y  M  M  P  R  T  M  V         p.140

          .         .         .         .         .         .       g.7723
 GACCCTGTCCGGGAGGCCCGGGAGGGCGGCCTCATCTCCTCCTCAACTCAGAGTGGGGCC       c.480
 D  P  V  R  E  A  R  E  G  G  L  I  S  S  S  T  Q  S  G  A         p.160

          .         .         .      | 06  .         .         .    g.8765
 TATGTGGTCACTCCCTTCCACTGCACCGACCTGGG | AGTCACCATCCTGGTAAATAGAGGG    c.540
 Y  V  V  T  P  F  H  C  T  D  L  G  |  V  T  I  L  V  N  R  G      p.180

          .         .         .         .         | 07         .    g.8910
 TTCGTTCCCAGGAAGAAAGTGAATCCTGAAACCCGGCAGAAAGGCCAG | ATTGAGGGAGAA    c.600
 F  V  P  R  K  K  V  N  P  E  T  R  Q  K  G  Q   | I  E  G  E      p.200

          .         .         .         .         .         .       g.8970
 GTGGACCTCATTGGGATGGTGAGGCTGACAGAAACCAGGCAGCCTTTTGTCCCTGAGAAC       c.660
 V  D  L  I  G  M  V  R  L  T  E  T  R  Q  P  F  V  P  E  N         p.220

          .         .         .         .         .         .       g.9030
 AATCCAGAAAGGAACCACTGGCATTATCGAGACCTGGAAGCTATGGCCAGAATCACAGGC       c.720
 N  P  E  R  N  H  W  H  Y  R  D  L  E  A  M  A  R  I  T  G         p.240

          .         .         .  | 08      .         .         .    g.9393
 GCAGAGCCCATCTTCATTGATGCCAACTTCC | AGAGCACAGTCCCTGGAGGACCCATTGGA    c.780
 A  E  P  I  F  I  D  A  N  F  Q |   S  T  V  P  G  G  P  I  G      p.260

          .         .         .         .         .    | 09    .    g.9531
 GGGCAAACCAGAGTTACTCTGAGGAACGAGCATCTGCAGTACATCGTGACCTG | GTATGGA    c.840
 G  Q  T  R  V  T  L  R  N  E  H  L  Q  Y  I  V  T  W  |  Y  G      p.280

          .         .         .         .         .         .       g.9591
 CTCTCTGCAGCTACATCCTACCTGTGGTTTAAGAAATTCCTACGTGGGACACCTGGTGTG       c.900
 L  S  A  A  T  S  Y  L  W  F  K  K  F  L  R  G  T  P  G  V         p.300

                                                                    g.9594
 TGA                                                                c.903
 X                                                                  p.300

          .         .         .         .         .         .       g.9654
 cagatcagctgctgaagccctgtccctggataatgcagtatttcaagactgcctttatgc       c.*60

          .         .         .         .                           g.9702
 tggatcatgtgctactggtataaagttctggccttctaccttaaatga                   c.*108

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Surfeit 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center