### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = ABHD12)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"ABHD12" "abhydrolase domain containing 12" "20" "p11.21" "unknown" "NG_028119.1" "UD_132084487863" "" "https://www.LOVD.nl/ABHD12" "" "1" "15868" "26090" "613599" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases..\r\nEstablishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/ABHD12_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00001" "2013-02-13 00:00:00" "00006" "2018-01-26 11:18:15" "00000" "2025-05-05 21:14:00"
## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00023827" "ABHD12" "transcript variant 1" "002" "NM_001042472.2" "" "NP_001035937.1" "" "" "" "-279" "1844" "1197" "25371618" "25280834" "00008" "2013-07-15 15:41:47" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 8
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26"
"00168" "PHARC" "polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, cataract (PHARC)" "AR" "612674" "" "" "" "00006" "2013-07-29 22:25:56" "00006" "2021-12-10 21:51:32"
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"00296" "CTRCT" "cataract (CTRCT)" "" "" "" "" "" "00006" "2014-01-16 08:42:13" "00006" "2015-03-07 14:30:33"
"04213" "COD" "dystrophy, cone (COD)" "" "" "" "" "" "00006" "2015-02-27 19:22:18" "" ""
"04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26"
"05086" "HL" "hearing loss (HL)" "" "" "" "" "" "00006" "2015-10-23 11:41:05" "00006" "2015-10-23 11:43:00"
"05113" "CMT" "Charcot-Marie-Tooth disease (CMT)" "" "" "" "" "" "00006" "2016-01-11 01:40:57" "" ""
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 1
"{{geneid}}" "{{diseaseid}}"
"ABHD12" "00168"
## Individuals ## Do not remove or alter this header ##
## Count = 67
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00001632" "" "" "" "1" "" "00101" "{PMID:Chen 2013:24027063}" "3-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "no" "United States" "" "0" "" "" "Germany;British" "24027063-FamPatIII1"
"00059898" "" "" "" "3" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "M" "" "United Arab Emirates" "" "0" "" "" "Arab" "20797687-Fam6Pat1"
"00059899" "" "" "00059898" "1" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "M" "" "United Arab Emirates" "" "0" "" "" "Arab" "20797687-Fam6Pat2"
"00059900" "" "" "00059898" "1" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "F" "" "United Arab Emirates" "" "0" "" "" "Arab" "20797687-Fam6Pat3"
"00059901" "" "" "" "3" "" "00115" "{PMID:Fiskerstrand 2009:19005174}, {DOI:Fiskerstrand 2009:10.1212/01.wnl.0000333664.90605.23}" "5-generation family, 3 affecteds (F, 2M), unaffected heterozygous carrier parents/relatives" "F" "" "Norway" "" "0" "" "" "Norwegian" "19005174-FamPatIV1"
"00059902" "" "" "00059901" "1" "" "00115" "{PMID:Fiskerstrand 2009:19005174}, {DOI:Fiskerstrand 2009:10.1212/01.wnl.0000333664.90605.23}" "brother PatIV2" "M" "" "Norway" "" "0" "" "" "Norwegian" "19005174-FamPatIV2"
"00059903" "" "" "00059901" "1" "" "00115" "{PMID:Fiskerstrand 2009:19005174}, {DOI:Fiskerstrand 2009:10.1212/01.wnl.0000333664.90605.23}" "third cousin PatIV4" "M" "" "Norway" "" "0" "" "" "Norwegian" "19005174-FamPatIV4"
"00059904" "" "" "" "2" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "Sibling 2.2" "M" "" "Norway" "" "0" "" "" "Norwegian" "20797687-Fam2Pat2"
"00059905" "" "" "00059904" "1" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "Sibling 2.1" "F" "" "Norway" "" "0" "" "" "Norwegian" "20797687-Fam2Pat1"
"00059906" "" "" "" "1" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "F" "" "Norway" "" "0" "" "" "Norwegian" "20797687-Fam3Pat1"
"00059907" "" "" "" "1" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "M" "" "Norway" "" "0" "" "" "Norwegian" "20797687-Fam4Pat1"
"00059908" "" "" "" "1" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "M" "" "Norway" "" "0" "" "" "Norwegian" "20797687-Fam5Pat1"
"00059909" "" "" "" "2" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "Sibling 8.2" "M" "" "Algeria" "" "0" "" "" "" "20797687-Fam8Pat2"
"00059910" "" "" "00059909" "1" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "Sibling 8.1" "F" "" "Algeria" "" "0" "" "" "" "20797687-Fam8Pat1"
"00059911" "" "" "" "2" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "Sibling 9.2" "M" "" "Algeria" "" "0" "" "" "" "20797687-Fam9Pat2"
"00059912" "" "" "00059911" "1" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "Sibling 9.1" "F" "" "Algeria" "" "0" "" "" "" "20797687-Fam9Pat1"
"00059913" "" "" "" "2" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "Sibling 10.2" "F" "" "Algeria" "" "0" "" "" "" "20797687-Fam10Pat2"
"00059914" "" "" "00059913" "1" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "Sibling 10.1" "F" "" "Algeria" "" "0" "" "" "" "20797687-Fam10Pat1"
"00059915" "" "" "" "1" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "F" "" "Algeria" "" "0" "" "" "" "20797687-Fam11Pat1"
"00059916" "" "" "" "1" "" "00115" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "F" "" "United States" "" "0" "" "" "" "20797687-Fam7Pat1"
"00080792" "" "" "" "1" "" "01763" "{PMID:Nishiguchi 2014:24697911}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "no" "Netherlands" "" "0" "" "" "" "24697911-FamW08-1833PatII1"
"00100101" "" "" "" "1" "" "01769" "{PMID:Maranha 2015:26352687}, {DOI:Maranhao 2015:10.1371/journal.pone.0136561}, {PMID:Li 2017:28418496}" "" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "PKRD185;61185"
"00151792" "" "" "" "1" "" "02371" "{PMID:Lerat 2017:28448692},{DOI:Lerat 2017:10.1111/jns.12216}" "" "M" "yes" "France" "36y" "0" "" "no" "" "15B135"
"00151822" "" "" "" "4" "" "00006" "{PMID:Nishiguchi 2014:24697911}" "2-generation family, 4 affecteds (2F, 2M), unaffected carrier parents, PatII4" "F" "no" "Spain" "" "0" "" "" "" "24697911-FamRP-1292PatII4"
"00151824" "" "" "00151822" "1" "" "00006" "{PMID:Nishiguchi 2014:24697911}" "PatII6" "F" "no" "Spain" "" "0" "" "" "" "24697911-FamRP-1292PatII6"
"00151825" "" "" "00151822" "1" "" "00006" "{PMID:Nishiguchi 2014:24697911}" "PatII7" "M" "no" "Spain" "" "0" "" "" "" "24697911-FamRP-1292PatII7"
"00151826" "" "" "" "1" "" "00006" "{PMID:Nishiguchi 2014:24697911}" "2-generation family, 1 affected, unaffected heterozygous father" "F" "yes" "Spain" "" "0" "" "" "" "24697911-FamRP-1487PatII2"
"00151827" "" "" "" "2" "" "00006" "{PMID:Eisenberger 2012:22938382}" "4-generation family, affected brother/sister, unaffected heterozygous carrier parents" "F;M" "yes" "Lebanon" "" "0" "" "" "" "22938382-Fam"
"00151828" "" "" "" "3" "" "00006" "{PMID:Yoshimura 2015:25743180}" "2-generation family, 3 affecteds (3M), unaffected heterozygous carrier parents" "M" "yes" "Japan" "" "0" "" "" "" "25743180-Fam1"
"00151829" "" "" "" "1" "" "00006" "{PMID:Yoshimura 2015:25743180}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "?" "Japan" "" "0" "" "" "" "25743180-Fam2"
"00151830" "" "" "" "1" "" "00006" "{PMID:Tingaud-Sequeira 2017:27890673}" "3-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "no" "Sweden" "" "0" "" "" "" "27890673-FamPatII1"
"00292899" "" "" "" "136" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00292900" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00304848" "" "" "" "4" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00308597" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 homozygous patient" "" "" "Norway" "" "0" "" "" "" ""
"00328247" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Asia-South" "G008991"
"00328292" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Asia-South" "W000163"
"00331625" "" "" "" "1" "" "00000" "{PMID:Sun 2018:29625443}" "sporadic case" "" "no" "China" "" "0" "" "" "" "19676"
"00333806" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "2"
"00335080" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "no" "Netherlands" "" "0" "" "" "" "5085"
"00376783" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "49"
"00380164" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_BDC_0012"
"00387503" "" "" "" "1" "" "00000" "{PMID:Bifari 2015:26359340}" "Excels in school" "M" "yes" "Saudi Arabia" "" "0" "" "" "Saudi" ""
"00390158" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "G008991"
"00390159" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "W000163"
"00404067" "" "" "" "1" "" "00435" "" "" "M" "yes" "Egypt" "" "" "" "" "" ""
"00404074" "" "" "" "4" "" "00435" "" "" "F" "" "Egypt" "" "" "" "" "" ""
"00408696" "" "" "" "4" "" "00006" "{PMID:Thomas 2022:34085946}" "patient, affected sister, aunt and cousin" "" "no" "France" "" "0" "" "" "" "Pat25"
"00408936" "" "" "" "1" "" "00000" "{PMID:Frasquet-2018:29571850}" "" "" "yes" "Spain" "" "0" "" "" "Spanish" "II-1"
"00408937" "" "" "" "1" "" "00000" "{PMID:Frasquet-2018:29571850}" "" "M" "yes" "Spain" "" "0" "" "" "Spanish" "II-3"
"00408938" "" "" "" "1" "" "00000" "{PMID:li-2019:30974196}" "" "M" "" "China" "" "0" "" "" "Hunan" "II:1"
"00408939" "" "" "" "1" "" "00000" "{PMID:li-2019:30974196}" "" "M" "" "China" "" "0" "" "" "Hunan" "II:5"
"00408957" "" "" "" "1" "" "00000" "{PMID:Lerat-2019:31393079}" "" "M" "" "France" "" "0" "" "" "French" "XXVI"
"00408958" "" "" "" "1" "" "00000" "{PMID:Thimm-2020:32077159}" "" "M" "" "(Germany)" "" "0" "" "" "Iraqi" "Patient A"
"00408959" "" "" "" "1" "" "00000" "{PMID:Thimm-2020:32077159}" "" "M" "" "(Germany)" "" "0" "" "" "Iraqi" "Patient B"
"00408960" "" "" "" "1" "" "00000" "{PMID:Thimm-2020:32077159}" "" "M" "" "(Germany)" "" "0" "" "" "Iraqi" "Patient B"
"00408961" "" "" "" "1" "" "00000" "{PMID:Thimm-2020:32077159}" "" "M" "" "(Germany)" "" "0" "" "" "Iraqi" "Patient B"
"00431002" "" "" "" "1" "" "00006" "{PMID:Igelman 2021:34223797}" "" "F" "no" "" "" "0" "" "" "" "AHBD12-1"
"00431003" "" "" "" "1" "" "00006" "{PMID:Igelman 2021:34223797}" "" "F" "no" "" "" "0" "" "" "" "AHBD12-2"
"00431004" "" "" "" "1" "" "00006" "{PMID:Igelman 2021:34223797}" "" "M" "yes" "" "" "0" "" "" "" "AHBD12-3"
"00431005" "" "" "" "1" "" "00006" "{PMID:Igelman 2021:34223797}" "" "M" "no" "" "" "0" "" "" "" "AHBD12-4"
"00431006" "" "" "" "1" "" "00006" "{PMID:Igelman 2021:34223797}" "" "M" "yes" "" "" "0" "" "" "" "AHBD12-5"
"00431007" "" "" "" "1" "" "00006" "{PMID:Igelman 2021:34223797}" "" "M" "no" "" "" "0" "" "" "" "AHBD12-6"
"00434130" "" "" "" "3" "" "00006" "{PMID:Li 2019:31842807}" "2-generation family, affected mother/2 daughters" "F" "" "China" "" "0" "" "" "" "Fam2PatII1"
"00434131" "" "" "" "5" "" "00006" "{PMID:Li 2019:31842807}" "4-generation family, 5 affected (5F)" "F" "" "China" "" "0" "" "" "" "Fam3PatIV1"
"00434132" "" "" "" "4" "" "00006" "{PMID:Li 2019:31842807}" "4-generation family, 4 affected (2F, 2M)" "F" "" "China" "" "0" "" "" "" "Fam4PatIV1"
"00447544" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "CRD-843"
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 67
"{{individualid}}" "{{diseaseid}}"
"00001632" "00168"
"00059898" "00168"
"00059899" "00168"
"00059900" "00168"
"00059901" "00168"
"00059902" "00168"
"00059903" "00168"
"00059904" "00168"
"00059905" "00168"
"00059906" "00168"
"00059907" "00168"
"00059908" "00168"
"00059909" "00168"
"00059910" "00168"
"00059911" "00168"
"00059912" "00168"
"00059913" "00168"
"00059914" "00168"
"00059915" "00168"
"00059916" "00168"
"00080792" "04213"
"00100101" "04214"
"00151792" "00168"
"00151822" "00168"
"00151824" "00168"
"00151825" "00168"
"00151826" "00168"
"00151827" "00168"
"00151828" "00168"
"00151829" "00168"
"00151830" "00168"
"00292899" "00198"
"00292900" "00198"
"00304848" "00198"
"00308597" "04214"
"00328247" "04214"
"00328292" "04214"
"00331625" "05086"
"00333806" "04214"
"00335080" "00198"
"00376783" "04214"
"00380164" "00112"
"00387503" "04214"
"00390158" "04214"
"00390159" "04214"
"00404067" "05113"
"00404074" "05113"
"00408696" "00198"
"00408936" "04214"
"00408937" "04214"
"00408938" "04214"
"00408939" "04214"
"00408957" "04214"
"00408958" "04214"
"00408959" "04214"
"00408960" "04214"
"00408961" "04214"
"00431002" "04214"
"00431003" "04214"
"00431004" "04214"
"00431005" "04214"
"00431006" "04214"
"00431007" "04214"
"00434130" "00296"
"00434131" "00296"
"00434132" "00296"
"00447544" "00198"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00112, 00168, 00198, 00296, 04213, 04214, 05086, 05113
## Count = 60
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Hearing/Problems}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000046390" "00168" "00059898" "00115" "Familial, autosomal recessive" "24y" "pec cavus from childhood, absent tendon reflexes; abnormal neurography and EMG ; 14y-deaf; mild ataxia; brain MR/CT normal; Indifferent plantar response; 20-ies Retinitis Pigmentosa; 15y-cataract;" "" "sensorineural" "14y" "" "" "" "" "" "" "" "" ""
"0000046391" "00168" "00059899" "00115" "Familial, autosomal recessive" "20y" "4y-pes cavus, absent tendon reflexes; demyelinating polyneuropathy; 6y-sensorineural hearing loss; 2y-gait, limb, speech ataxia; 10y-wheelchair-bound; Cerebellar atrophy (age 3); Extensor plantar response; Retinitis Pigmentosa; cataract;" "" "sensorineural" "6y" "" "" "" "" "" "" "" "" ""
"0000046392" "00168" "00059900" "00115" "Familial, autosomal recessive" "6y" "absent tendon reflexes; sensorineural hearing loss; speech and limb ataxia; Cerebellar atrophy; Indifferent plantar response; no Retinitis Pigmentosa; cataract" "" "sensorineural" "" "" "" "" "" "" "" "" "" ""
"0000046393" "00168" "00059901" "00115" "Familial, autosomal recessive" "62y" "38y-pes cavus, sensory loss, absent ankle reflexes; demyelinating polyneuropathy; 20-ies sensorineural hearing loss; no ataxia; brain MR/CT normal; no pyramidal tract signs ; 38y-Retinitis Pigmentosa ; ERG rod-cone dystrophy; 28y-cataract" "" "sensorineural" ">20y<" "" "" "" "" "" "" "" "" ""
"0000046394" "00168" "00059902" "00115" "Familial, autosomal recessive" "56y" "37y-pes cavus from childhood; demyelinating polyneuropathy; 30-ies sensorineural hearing loss; 37y-gait ataxia; brain MR/CT normal; Extensor plantar response at lower limbs; spasticity; hyperreflexia; 37y-Retinitis Pigmentosa ; ERG rod-cone dystrophy; 37y-cataract" "" "sensorineural" ">30y<" "" "" "" "" "" "" "" "" ""
"0000046395" "00168" "00059903" "00115" "Familial, autosomal recessive" "46y" "38y-no pes cavus, sensory loss distally; demyelinating polyneuropathy; childhood sensorineural hearing loss; 43y-gait ataxia, upper limb intention tremor; Cerebellar atrophy; Extensor plantar response at lower limbs; spasticity; hyperreflexia; 46y-Retinitis Pigmentosa ; ERG rod-cone dystrophy; 25y-cataract" "" "sensorineural" "" "" "" "" "" "" "" "" "" ""
"0000046396" "00168" "00059904" "00115" "Familial, autosomal recessive" "54y" "53y-pes cavus, normal sensibility, reduced tendon reflexes; 20-ies sensorineural hearing loss; no ataxia; no pyramidal tract signs ; 25y-Retinitis Pigmentosa ; ERG flat; 25y-cataract" "" "sensorineural" "" "" "" "" "" "" "" "" "" ""
"0000046397" "00168" "00059905" "00115" "Familial, autosomal recessive" "58y" "51y-pes cavus, sensory loss, reduced tendon reflexes; demyelinating/axonal polyneuropathy; 20-ies sensorineural hearing loss; no ataxia; Cerebellar atrophy; Extensor plantar response at lower limbs; 35y-Retinitis Pigmentosa ; ERG rod-cone dystrophy; 26y-cataract" "" "sensorineural" ">20y<" "" "" "" "" "" "" "" "" ""
"0000046398" "00168" "00059906" "00115" "Unknown" "36y" "pes cavus, normal sensibility, reduced tendon reflexes in lower limbs; demyelinating polyneuropathy; 10y-deaf; ataxia; Atrophy of vermis and medulla oblongata; Extensor plantar response at right side; spasticity; 36y-Retinitis Pigmentosa ; ERG rod-cone dystrophy; 32y-cataract" "" "sensorineural" "10y" "" "" "" "" "" "" "" "" ""
"0000046399" "00168" "00059907" "00115" "Unknown" "24y" "pec cavus, hammertoes, reduced tendon reflexes in upper and lower limbs; demyelinating polyneuropathy; late in teens sensorineural hearing loss; no ataxia; Slight ventricular assymmetry.No cerebellar atrophy; Indifferent plantar response; no Retinitis Pigmentosa; ERG normal; 15y-cataract" "" "sensorineural" ">10y<" "" "" "" "" "" "" "" "" ""
"0000046400" "00168" "00059908" "00115" "Unknown" "16y" "pes cavus, reduced sensibility, reduced tendon reflexes in upper limbs, absent in lower limbs ; demyelinating polyneuropathy; 13y-sensorineural hearing loss; no ataxia; brain MR/CT normal; no pyramidal tract signs ; no Retinitis Pigmentosa; ERG normal; 16y-cataract (slight)" "" "sensorineural" "13y" "" "" "" "" "" "" "" "" ""
"0000046401" "00168" "00059909" "00115" "Familial, autosomal recessive" "10y" "absent tendon reflexes of lower limbs, normal sensibility; no sensorineural hearing loss; 4-5y-gait ataxia; Vermian atrophy; Extensor plantar response at lower limbs; no Retinitis Pigmentosa; no cataract" "" "sensorineural" "" "" "" "" "" "" "" "" "" ""
"0000046402" "00168" "00059910" "00115" "Familial, autosomal recessive" "11y" "absent tendon reflexes, moderate muscle weakness of lower limbs, normal sensibility; no sensorineural hearing loss; 3-4y-limb and gait ataxia, horizontal nystagmus, dysarthria, dysmetria upper and lower limbs; 15m-delayed walking; action and intention tremor ; Cerebellar atrophy; Extensor plantar response at lower limbs; no Retinitis Pigmentosa; no cataract" "" "sensorineural" "" "" "" "" "" "" "" "" "" ""
"0000046403" "00168" "00059911" "00115" "Familial, autosomal recessive" "26y" "pes cavus, sensory loss, reduced tendon reflexes at upper limbs/ absent at lower limbs ; severe demyelinating polyneuropathy; deaf; 4–9y-gait and limb ataxia, horizontal nystagmus, moderate dysarthria, dysmetria at upper and lower limbs ; Vermian atrophy; Extensor plantar response at lower limbs; tongue fasciculations; Retinitis Pigmentosa; cataract;" "" "sensorineural" "" "" "" "" "" "" "" "" "" ""
"0000046404" "00168" "00059912" "00115" "Familial, autosomal recessive" "44y" "pes cavus, sensory loss, absent tendon reflexes at lower limbs, scoliosis; demyelinating polyneuropathy; sensorineural hearing loss; 7–10y-gait and limb ataxia, cerebellar dysarthria, dysmetria at upper limbs with adiadocokinesia, head titubation ; Vermian atrophy; Extensor plantar response at lower limbs; macroglossia; amblyopia" "" "" "" "" "" "" "" "" "" "" "" ""
"0000046405" "00168" "00059913" "00115" "Familial, autosomal recessive" "19y" "12y-pes cavus, sensory loss, absent tendon reflexes at upper and lower limbs; no sensorineural hearing loss" "" "sensorineural" "6y" "" "" "" "" "" "" "" "" ""
"0000046406" "00168" "00059914" "00115" "Familial, autosomal recessive" "26y" "pes cavus, sensory loss, absent tendon reflexes; severe demyelinating polyneuropathy on nerve biopsy; 6y-sensorineural hearing loss; 6–12y-gait and limb ataxia; brain MR/CT normal; Indifferent plantar response; no Retinitis Pigmentosa; no cataract;" "" "" "" "" "" "" "" "" "" "" "" ""
"0000046407" "00168" "00059915" "00115" "Familial, autosomal recessive" "32y" "pes cavus, sensory loss and absent tendon reflexes at lower limbs; axonal polyneuropathy; sensorineural hearing loss; 16–20y-gait ataxia, dysarthria, dysmetria at upper limbs; Cerebellar atrophy; Extensor plantar response at lower limbs; decreased visual acuity and amblyopia; no cataract" "" "sensorineural" "" "" "" "" "" "" "" "" "" ""
"0000046408" "00168" "00059916" "00115" "Unknown" "50y" "34y-pes cavus, hammertoes, sensibility slightly reduced; abnormal neurography and EMG ; 17y-sensorineural hearing loss; 18y-dysarthria, gait ataxia, jerky eye movements, tremor in hands; Cerebellar atrophy Increased signal in periventricular white matter.; Flexor plantar response; spasticity; preserved reflexes; 20-ies Retinitis Pigmentosa; 22y-cataract;" "" "sensorineural" "17y" "" "" "" "" "" "" "" "" ""
"0000060677" "04213" "00080792" "01763" "Unknown" "05y" "cone dystrophy" "" "" "" "" "" "" "" "" "" "" "" ""
"0000078338" "04214" "00100101" "01769" "Familial, autosomal recessive" "" "RP, deafness" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000124160" "00168" "00151792" "02371" "Familial, autosomal recessive" "15y" "bilateral sensorineural deafness (HP 0008619), bilateral congenital cataract (HP 0000519)" "15y" "progressive" "36y" "28y" "" "" "" "" "" "PHARC" "sensory and motor neuropathy and ataxia" ""
"0000124192" "00168" "00151827" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" ""
"0000124193" "00168" "00151828" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" ""
"0000124194" "00168" "00001632" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" ""
"0000124195" "00168" "00151829" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" ""
"0000124196" "00168" "00151830" "00006" "Familial, autosomal recessive" "31y" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" ""
"0000234025" "04214" "00308597" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000246474" "04214" "00328247" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000246519" "04214" "00328292" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000249817" "05086" "00331625" "00000" "Familial, autosomal recessive" "29y" "severe hearing loss" "7y" "" "" "" "" "" "" "" "" "" "Usher syndrome, type II" ""
"0000251991" "04214" "00333806" "00000" "Familial, autosomal recessive" "30y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252795" "00198" "00335080" "00000" "Unknown" "" "5y-diagnosis visual impairment" "" "" "" "" "" "" "" "" "" "" "cone dystrophy" ""
"0000271994" "04214" "00376783" "00000" "Familial, autosomal dominant" "54y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, macular subatrophy, pseudohole" ""
"0000274019" "00112" "00380164" "03508" "Familial, autosomal recessive" "" "HP:0030515,\tHP:0000662,\tHP:0000613,\tHP:0001133,\tHP:0000365,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000281066" "04214" "00387503" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amarosis (LCA)" ""
"0000283696" "04214" "00390158" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283697" "04214" "00390159" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "retinal disease" ""
"0000296659" "05113" "00404067" "00435" "Familial, autosomal recessive" "15y" "15-y boy with progressive weakness and wasting of both upper and lower limbs, behavioral abnormalities and hearing loss. He has delayed motor development but normal mental development. His nerve conduction velocity study showed demyelinating peripheral neuropathy. He has bilateral sensorineural hearing loss." "08y" "" "" "" "" "" "" "" "" "" "Autosomal recessive Hereditary sensorimotor neuropathy" ""
"0000296666" "05113" "00404074" "00435" "Familial, autosomal recessive" "07y" "7-y old patient with marked developmental delay (crawling started at the age of 3) but no apparent mental delay. progressive weakness and wasting of the upper and lower limbs started at the age of 5. There was feet inward inversion. Nerve conduction velocity study showed demyelinating peripheral neuropathy. There was a family history of 3 paternal cousins (18y female, 16y male, 10ys male) with developmental delay and progressive weakness and wasting of lower limbs, among were a male (18 years old) with additional progressive hearing loss." "05y" "" "" "" "" "" "" "" "" "CMT" "Autosomal recessive Hereditary sensorimotor neuropathy" ""
"0000300814" "00198" "00408696" "00006" "Familial, autosomal dominant" "" "" "55y" "" "" "" "" "" "" "" "" "PHARC" "" ""
"0000301054" "04214" "00408936" "00000" "Familial, autosomal recessive" "" "retinopathy, pes cavus, sensorimotor neuropathy, hearing loss, retinitis pigmentosa and juvenile; incipient cataracts in both eyes; gait ataxia, but also dysarthria and mild lower limb dysmetria; mild cerebellar atrophy" "" "" "" "demyelinating Charcot-Marie-Tooth (CMT)" "" "" "" "" "" "" "Polyneuropathy, Hearing loss, Ataxia, Retinitis pigmentosa and Cataracts (PHARC)" ""
"0000301055" "04214" "00408937" "00000" "Familial, autosomal recessive" "42y" "mild cerebellar atrophy" "" "" "" "pes cavus, demyelinating Charcot-Marie-Tooth (CMT)" "" "" "" "" "" "" "Polyneuropathy, Hearing loss, Ataxia, Retinitis pigmentosa and Cataracts (PHARC)" ""
"0000301056" "04214" "00408938" "00000" "Familial, autosomal recessive" "41y" "sensorineural hearing loss, visual acuity, and olfactory decline" "" "" "" "" "" "" "" "" "" "" "Usher syndrome type 3 (USH3)" ""
"0000301057" "04214" "00408939" "00000" "Familial, autosomal recessive" "31y" "sensorineural hearing loss, visual acuity, and olfactory decline" "" "" "" "" "" "" "" "" "" "" "Usher syndrome type 3 (USH3)" ""
"0000301075" "04214" "00408957" "00000" "Isolated (sporadic)" "38y" "cataracts, ataxia, moderate to profound auditory neuropathy hearing loss" "15y" "" "" "Sensori?motor Demyelinating" "" "" "" "" "" "" "inherited peripheral neuropathy (IPN)" ""
"0000301076" "04214" "00408958" "00000" "Familial, autosomal recessive" "21y" "bilateral pes cavus, mild stabbing pain in his feet while climbing stairs, and a slight gait disturbance in terms of balance" "9y" "" "" "progressive hearing impairment" "" "" "" "" "" "" "polyneuropathy, hearing loss, cerebellar ataxia, retinitis pigmentosa, early-onset cataracts (PHARC)" ""
"0000301077" "04214" "00408959" "00000" "Familial, autosomal recessive" "25y" "bilateral deafness at the age of 18 years and one-sided cochlear implant surgery at the age of 20 years." "12y" "" "" "developed a slowly progressive hearing impairment" "" "" "" "" "" "" "polyneuropathy, hearing loss, cerebellar ataxia, retinitis pigmentosa, early-onset cataracts (PHARC)" ""
"0000301078" "04214" "00408960" "00000" "Familial, autosomal recessive" "25y" "bilateral deafness at the age of 18 years and one-sided cochlear implant surgery at the age of 20 years." "12y" "" "" "developed a slowly progressive hearing impairment" "" "" "" "" "" "" "polyneuropathy, hearing loss, cerebellar ataxia, retinitis pigmentosa, early-onset cataracts (PHARC)" ""
"0000301079" "04214" "00408961" "00000" "Familial, autosomal recessive" "25y" "bilateral deafness at the age of 18 years and one-sided cochlear implant surgery at the age of 20 years." "12y" "" "" "developed a slowly progressive hearing impairment" "" "" "" "" "" "" "polyneuropathy, hearing loss, cerebellar ataxia, retinitis pigmentosa, early-onset cataracts (PHARC)" ""
"0000321610" "04214" "00431002" "00006" "Familial, autosomal recessive" "" "see paper; ..., cataract; atrophy; no sensorineural hearing loss; no vestibular symptoms" "18y" "" "" "" "" "" "" "" "" "" "atypical Usher syndrome" ""
"0000321611" "04214" "00431003" "00006" "Familial, autosomal recessive" "28y" "see paper; ..., no cataract; atrophy; ffERG severe rod dysfunction, mild cone dysfunction; no sensorineural hearing loss; no vestibular symptoms" "20y" "" "" "" "" "" "" "" "" "" "atypical Usher syndrome" ""
"0000321612" "04214" "00431004" "00006" "Familial, autosomal recessive" "22y" "see paper; ..., no cataract; Bull\'s eye; ffERG mild rod-cone dystrophy; no sensorineural hearing loss; no vestibular symptoms" "16y" "" "" "" "" "" "" "" "" "" "Usher syndrome" ""
"0000321613" "04214" "00431005" "00006" "Familial, autosomal recessive" "34y" "see paper; ..., cataract; atrophy; ffERG moderate rod-cone dystrophy, mild cone dysfunction; 20y-moderately progressive sensorineural hearing loss; no vestibular symptoms" "22y" "" "" "" "" "" "" "" "" "" "Usher syndrome" ""
"0000321614" "04214" "00431006" "00006" "Familial, autosomal recessive" "53y" "see paper; ..., cataract; macular findings Hole; 44y-moderately progressive sensorineural hearing loss; no vestibular symptoms" "30y-35y" "" "" "" "" "" "" "" "" "" "Usher syndrome" ""
"0000321615" "04214" "00431007" "00006" "Familial, autosomal recessive" "" "see paper; ..., no cataract; atrophy; 20y-severe progressive sensorineural hearing loss; no vestibular symptoms" "18y" "" "" "" "" "" "" "" "" "" "Usher syndrome" ""
"0000324484" "00296" "00434130" "00006" "Familial, autosomal dominant" "" "see paper; ..., nuclear/lamellar cataract, blue punctate opacities" "" "" "" "" "" "" "" "" "" "CTRCT14" "cataract" ""
"0000324485" "00296" "00434131" "00006" "Familial, autosomal dominant" "" "see paper; ..., total cataract" "" "" "" "" "" "" "" "" "" "CTRCT33" "cataract" ""
"0000324486" "00296" "00434132" "00006" "Familial, autosomal dominant" "" "see paper; ..., total cataract" "" "" "" "" "" "" "" "" "" "CTRCT6" "cataract" ""
"0000336743" "00198" "00447544" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
## Screenings ## Do not remove or alter this header ##
## Count = 69
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000001440" "00001632" "1" "00101" "00101" "2013-07-31 02:31:30" "00101" "2013-08-01 13:20:58" "PCR;PCRq;RT-PCR;SEQ;TaqMan" "DNA;RNA" "" ""
"0000001442" "00001632" "1" "00101" "00101" "2013-08-01 12:44:41" "" "" "arrayCGH;arrayCNV;PCR;PCRlr;PCRq;RT-PCR;SEQ;TaqMan;Western" "DNA;RNA" "" ""
"0000059885" "00059898" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059886" "00059899" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059887" "00059900" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059888" "00059901" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059889" "00059902" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059890" "00059903" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059891" "00059904" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059892" "00059905" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059893" "00059906" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059894" "00059907" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059895" "00059908" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059896" "00059909" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059897" "00059910" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059898" "00059911" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059899" "00059912" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059900" "00059913" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059901" "00059914" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059902" "00059915" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000059903" "00059916" "1" "00115" "00115" "2010-10-19 14:47:56" "" "" "SEQ" "DNA" "" ""
"0000080904" "00080792" "1" "01763" "01763" "2016-09-13 16:40:44" "" "" "SEQ-NG" "DNA" "" ""
"0000100505" "00100101" "1" "01769" "01769" "2017-01-30 19:23:06" "" "" "SEQ" "DNA" "WBC" ""
"0000152647" "00151792" "1" "02371" "02371" "2018-01-21 19:06:55" "" "" "SEQ-NG-IT" "DNA" "blood" ""
"0000152679" "00151822" "1" "00006" "00006" "2018-01-26 13:29:50" "" "" "SEQ" "DNA" "" "WES"
"0000152681" "00151824" "1" "00006" "00006" "2018-01-26 13:29:50" "" "" "SEQ" "DNA" "" "WES"
"0000152682" "00151825" "1" "00006" "00006" "2018-01-26 13:29:50" "" "" "SEQ" "DNA" "" "WES"
"0000152683" "00151826" "1" "00006" "00006" "2018-01-26 13:29:50" "" "" "SEQ" "DNA" "" "WES"
"0000152684" "00151827" "1" "00006" "00006" "2018-01-26 15:01:37" "" "" "SEQ;SEQ-NG" "DNA" "" "wes"
"0000152685" "00151828" "1" "00006" "00006" "2018-01-26 15:13:09" "00006" "2018-01-26 15:54:46" "SEQ" "DNA" "" ""
"0000152686" "00151829" "1" "00006" "00006" "2018-01-26 15:58:12" "" "" "SEQ" "DNA" "" ""
"0000152687" "00151830" "1" "00006" "00006" "2018-01-26 16:03:40" "" "" "SEQ" "DNA" "" ""
"0000294067" "00292899" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000294068" "00292900" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000305977" "00304848" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000309742" "00308597" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000329462" "00328247" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329507" "00328292" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000332844" "00331625" "1" "00000" "00006" "2021-02-12 13:51:13" "" "" "SEQ-NG" "DNA" "" ""
"0000335032" "00333806" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000336309" "00335080" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000377989" "00376783" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel"
"0000381366" "00380164" "1" "03508" "03508" "2021-08-10 11:19:55" "" "" "SEQ-NG-I" "DNA" "" ""
"0000381437" "00380164" "1" "03508" "03508" "2021-08-13 05:49:06" "" "" "SEQ-NG-I" "DNA" "" ""
"0000388729" "00387503" "1" "00000" "00008" "2021-10-29 21:32:58" "" "" "SEQ-NG;SEQ" "DNA" "blood" ""
"0000391399" "00390158" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391400" "00390159" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000405303" "00404067" "1" "00435" "00435" "2022-02-25 21:18:40" "" "" "SEQ" "DNA" "blood" ""
"0000405311" "00404074" "1" "00435" "00435" "2022-02-25 22:07:27" "" "" "SEQ" "DNA" "blood" ""
"0000409958" "00408696" "1" "00006" "00006" "2022-04-25 19:53:26" "" "" "SEQ" "DNA" "" ""
"0000410201" "00408936" "1" "00000" "00008" "2022-04-29 01:04:01" "" "" "SEQ" "DNA" "" ""
"0000410202" "00408937" "1" "00000" "00008" "2022-04-29 01:04:01" "" "" "SEQ" "DNA" "" ""
"0000410203" "00408938" "1" "00000" "00008" "2022-04-29 01:04:01" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood leukocytes" "WES"
"0000410204" "00408939" "1" "00000" "00008" "2022-04-29 01:04:01" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood leukocytes" "WES"
"0000410222" "00408957" "1" "00000" "00008" "2022-04-29 01:04:01" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood" ""
"0000410223" "00408958" "1" "00000" "00008" "2022-04-29 01:04:01" "" "" "SEQ" "DNA" "" ""
"0000410224" "00408959" "1" "00000" "00008" "2022-04-29 01:04:01" "" "" "SEQ;SEQ-NG;MLPA" "DNA" "" ""
"0000410225" "00408960" "1" "00000" "00008" "2022-04-29 01:04:01" "" "" "SEQ;SEQ-NG;MLPA" "DNA" "" ""
"0000410226" "00408961" "1" "00000" "00008" "2022-04-29 01:04:01" "" "" "SEQ;SEQ-NG;MLPA" "DNA" "" ""
"0000432412" "00431002" "1" "00006" "00006" "2023-01-25 15:27:06" "" "" "SEQ" "DNA" "" ""
"0000432413" "00431003" "1" "00006" "00006" "2023-01-25 15:27:06" "" "" "SEQ" "DNA" "" ""
"0000432414" "00431004" "1" "00006" "00006" "2023-01-25 15:27:06" "" "" "SEQ" "DNA" "" ""
"0000432415" "00431005" "1" "00006" "00006" "2023-01-25 15:27:06" "" "" "SEQ" "DNA" "" ""
"0000432416" "00431006" "1" "00006" "00006" "2023-01-25 15:27:06" "" "" "SEQ" "DNA" "" ""
"0000432417" "00431007" "1" "00006" "00006" "2023-01-25 15:27:06" "" "" "SEQ" "DNA" "" ""
"0000435597" "00434130" "1" "00006" "00006" "2023-03-20 14:55:46" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000435598" "00434131" "1" "00006" "00006" "2023-03-20 14:55:46" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000435599" "00434132" "1" "00006" "00006" "2023-03-20 14:55:46" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000449121" "00447544" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS"
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 51
"{{screeningid}}" "{{geneid}}"
"0000001440" "ABHD12"
"0000001442" "ABHD12"
"0000059885" "ABHD12"
"0000059886" "ABHD12"
"0000059887" "ABHD12"
"0000059888" "ABHD12"
"0000059889" "ABHD12"
"0000059890" "ABHD12"
"0000059891" "ABHD12"
"0000059892" "ABHD12"
"0000059893" "ABHD12"
"0000059894" "ABHD12"
"0000059895" "ABHD12"
"0000059896" "ABHD12"
"0000059897" "ABHD12"
"0000059898" "ABHD12"
"0000059899" "ABHD12"
"0000059900" "ABHD12"
"0000059901" "ABHD12"
"0000059902" "ABHD12"
"0000059903" "ABHD12"
"0000100505" "USH2A"
"0000152647" "ABHD12"
"0000152679" "ABHD12"
"0000152681" "ABHD12"
"0000152682" "ABHD12"
"0000152683" "ABHD12"
"0000152684" "ABHD12"
"0000152685" "ABHD12"
"0000152686" "ABHD12"
"0000152687" "ABHD12"
"0000309742" "ABHD12"
"0000329462" "ABHD12"
"0000329507" "ABHD12"
"0000332844" "ABHD12"
"0000335032" "ABHD12"
"0000336309" "ABHD12"
"0000388729" "IFT140"
"0000391399" "ABHD12"
"0000391400" "ABHD12"
"0000405303" "ABHD12"
"0000405311" "ABHD12"
"0000410201" "ABHD12"
"0000410202" "ABHD12"
"0000410203" "ABHD12"
"0000410204" "ABHD12"
"0000410222" "ABHD12"
"0000410223" "ABHD12"
"0000410224" "ABHD12"
"0000410225" "ABHD12"
"0000410226" "ABHD12"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 168
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000019237" "10" "70" "20" "25282883" "25282883" "subst" "8.1217E-6" "00101" "ABHD12_000006" "g.25282883T>A" "" "{PMID:Chen 2013:24027063}" "" "c.1129A>T" "" "Germline" "yes" "" "0" "" "" "g.25302247T>A" "" "likely pathogenic" ""
"0000019239" "21" "90" "20" "25340671" "25399883" "del" "0" "00101" "ABHD12_000005" "g.25340671_25399883delins[25390635_25390697;AAGAAACTTAACTTAACCCAACACTTAACTTAAC]" "" "{PMID:Chen 2013:24027063}" "" "1-192_oGINS1:c.327+1052del" "59 kb deletion" "Germline" "yes" "" "0" "" "" "g.25360035_25419247delins[25409999_25410061;AAGAAACTTAACTTAACCCAACACTTAACTTAAC]" "" "pathogenic" ""
"0000091133" "3" "90" "20" "25364252" "25378259" "del" "0" "00115" "ABHD12_000002" "g.25364252_25378259del" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "14 bb del removing exon 1" "" "Germline" "" "" "0" "" "" "g.25383616_25397623del" "" "pathogenic" ""
"0000091134" "3" "90" "20" "25364252" "25378259" "del" "0" "00115" "ABHD12_000002" "g.25364252_25378259del" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "14 kb del removing exon 1" "" "Germline" "" "" "0" "" "" "g.25383616_25397623del" "" "pathogenic" ""
"0000091135" "3" "90" "20" "25364252" "25378259" "del" "0" "00115" "ABHD12_000002" "g.25364252_25378259del" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "14 kb del removing exon 1" "" "Germline" "" "" "0" "" "" "g.25383616_25397623del" "" "pathogenic" ""
"0000091136" "3" "90" "20" "25304045" "25304046" "delins" "0" "00115" "ABHD12_000001" "g.25304045_25304046delinsAAA" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "337_338delGAinsTTT [Asp113PhefsX15]" "" "Unknown" "" "" "0" "" "" "g.25323409_25323410delinsAAA" "" "pathogenic" ""
"0000091137" "3" "90" "20" "25304045" "25304046" "delins" "0" "00115" "ABHD12_000001" "g.25304045_25304046delinsAAA" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "337_338delGAinsTTT [Asp113PhefsX15]" "" "Unknown" "" "" "0" "" "" "g.25323409_25323410delinsAAA" "" "pathogenic" ""
"0000091138" "3" "90" "20" "25304045" "25304046" "delins" "0" "00115" "ABHD12_000001" "g.25304045_25304046delinsAAA" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "337_338delGAinsTTT [Asp113PhefsX15]" "" "Unknown" "" "" "0" "" "" "g.25323409_25323410delinsAAA" "" "pathogenic" ""
"0000091139" "3" "90" "20" "25304045" "25304046" "delins" "0" "00115" "ABHD12_000001" "g.25304045_25304046delinsAAA" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "337_338delGAinsTTT [Asp113PhefsX15]" "" "Unknown" "" "" "0" "" "" "g.25323409_25323410delinsAAA" "" "pathogenic" ""
"0000091140" "3" "90" "20" "25304045" "25304046" "delins" "0" "00115" "ABHD12_000001" "g.25304045_25304046delinsAAA" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "337_338delGAinsTTT [Asp113PhefsX15]" "" "Unknown" "" "" "0" "" "" "g.25323409_25323410delinsAAA" "" "pathogenic" ""
"0000091141" "3" "90" "20" "25304045" "25304046" "delins" "0" "00115" "ABHD12_000001" "g.25304045_25304046delinsAAA" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "337_338delGAinsTTT [Asp113PhefsX15]" "" "Unknown" "" "" "0" "" "" "g.25323409_25323410delinsAAA" "" "pathogenic" ""
"0000091142" "3" "90" "20" "25304045" "25304046" "delins" "0" "00115" "ABHD12_000001" "g.25304045_25304046delinsAAA" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "337_338delGAinsTTT [Asp113PhefsX15]" "" "Unknown" "" "" "0" "" "" "g.25323409_25323410delinsAAA" "" "pathogenic" ""
"0000091143" "3" "90" "20" "25304045" "25304046" "delins" "0" "00115" "ABHD12_000001" "g.25304045_25304046delinsAAA" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "337_338delGAinsTTT [Asp113PhefsX15]" "" "Unknown" "" "" "0" "" "" "g.25323409_25323410delinsAAA" "" "pathogenic" ""
"0000091144" "3" "90" "20" "25288620" "25288626" "dup" "0" "00115" "ABHD12_000004" "g.25288620_25288626dup" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "846_852dupTAAGAGC [His285fsX1]" "" "Unknown" "" "" "0" "" "" "g.25307984_25307990dup" "" "pathogenic" ""
"0000091145" "3" "90" "20" "25288620" "25288626" "dup" "0" "00115" "ABHD12_000004" "g.25288620_25288626dup" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "846_852dupTAAGAGC [His285fsX1]" "" "Unknown" "" "" "0" "" "" "g.25307984_25307990dup" "" "pathogenic" ""
"0000091146" "3" "90" "20" "25288620" "25288626" "dup" "0" "00115" "ABHD12_000004" "g.25288620_25288626dup" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "846_852dupTAAGAGC [His285fsX1]" "" "Unknown" "" "" "0" "" "" "g.25307984_25307990dup" "" "pathogenic" ""
"0000091147" "3" "90" "20" "25288620" "25288626" "dup" "0" "00115" "ABHD12_000004" "g.25288620_25288626dup" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "846_852dupTAAGAGC [His285fsX1]" "" "Unknown" "" "" "0" "" "" "g.25307984_25307990dup" "" "pathogenic" ""
"0000091148" "3" "90" "20" "25288620" "25288626" "dup" "0" "00115" "ABHD12_000004" "g.25288620_25288626dup" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "846_852dupTAAGAGC [His285fsX1]" "" "Unknown" "" "" "0" "" "" "g.25307984_25307990dup" "" "pathogenic" ""
"0000091149" "3" "90" "20" "25288620" "25288626" "dup" "0" "00115" "ABHD12_000004" "g.25288620_25288626dup" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "846_852dupTAAGAGC [His285fsX1]" "" "Unknown" "" "" "0" "" "" "g.25307984_25307990dup" "" "pathogenic" ""
"0000091150" "3" "90" "20" "25288620" "25288626" "dup" "0" "00115" "ABHD12_000004" "g.25288620_25288626dup" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "846_852dupTAAGAGC [His285fsX1]" "" "Unknown" "" "" "0" "" "" "g.25307984_25307990dup" "" "pathogenic" ""
"0000091151" "3" "90" "20" "25282958" "25282958" "subst" "0" "00115" "ABHD12_000003" "g.25282958G>A" "" "{PMID:Fiskerstrand 2010:20797687}, {DOI:Fiskerstrand 2010:10.1016/j.ajhg.2010.08.002}" "" "Arg352X" "" "Unknown" "" "" "0" "" "" "g.25302322G>A" "" "pathogenic" ""
"0000129972" "1" "90" "20" "25300900" "25300900" "subst" "0" "01763" "ABHD12_000008" "g.25300900C>T" "" "{PMID:Nishiguchi 2014:24697911}" "" "" "Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "{CV-RCV:000132768.3}" "pathogenic" ""
"0000129973" "2" "90" "20" "25297700" "25297700" "subst" "0" "01763" "ABHD12_000007" "g.25297700C>G" "" "{PMID:Nishiguchi 2014:24697911}" "" "" "" "Germline" "" "rs587777604" "0" "" "" "g.25317064C>G" "{CV-RCV:000132769.3}" "pathogenic" ""
"0000247663" "0" "10" "20" "25282944" "25282944" "subst" "0.458065" "02330" "ABHD12_000012" "g.25282944A>G" "" "" "" "ABHD12(NM_001042472.3):c.1068T>C (p.D356=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25302308A>G" "" "benign" ""
"0000247666" "0" "10" "20" "25304071" "25304071" "subst" "2.43655E-5" "02330" "ABHD12_000022" "g.25304071A>G" "" "" "" "ABHD12(NM_001042472.3):c.317-5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25323435A>G" "" "benign" ""
"0000247673" "0" "50" "20" "25319976" "25319976" "subst" "0.000227443" "02330" "ABHD12_000024" "g.25319976A>G" "" "" "" "ABHD12(NM_001042472.3):c.203T>C (p.V68A), ABHD12(NM_015600.5):c.203T>C (p.V68A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25339340A>G" "" "VUS" ""
"0000257154" "0" "50" "20" "25281468" "25281468" "subst" "0.000105717" "02330" "ABHD12_000009" "g.25281468C>A" "" "" "" "ABHD12(NM_001042472.3):c.*13G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25300832C>A" "" "VUS" ""
"0000257155" "0" "30" "20" "25275602" "25275602" "subst" "1.21819E-5" "02330" "PYGB_000003" "g.25275602G>A" "" "" "" "ABHD12(NM_015600.5):c.*7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25294966G>A" "" "likely benign" ""
"0000257156" "0" "50" "20" "25371237" "25371237" "subst" "0" "02330" "ABHD12_000031" "g.25371237G>A" "" "" "" "ABHD12(NM_001042472.3):c.103C>T (p.R35C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25390601G>A" "" "VUS" ""
"0000257157" "0" "10" "20" "25282967" "25282967" "subst" "0.0415874" "02330" "ABHD12_000013" "g.25282967C>T" "" "" "" "ABHD12(NM_001042472.3):c.1045G>A (p.A349T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25302331C>T" "" "benign" ""
"0000257158" "0" "90" "20" "25282937" "25282937" "del" "8.12196E-6" "02330" "ABHD12_000011" "g.25282937del" "" "" "" "ABHD12(NM_001042472.3):c.1075delG (p.V359Ffs*27)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25302301del" "" "pathogenic" ""
"0000257159" "0" "10" "20" "25275621" "25275621" "subst" "0.047067" "02330" "PYGB_000004" "g.25275621T>C" "" "" "" "ABHD12(NM_015600.5):c.1203A>G (p.S401=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25294985T>C" "" "benign" ""
"0000257160" "0" "10" "20" "25371211" "25371211" "subst" "0.000124196" "02330" "ABHD12_000030" "g.25371211C>T" "" "" "" "ABHD12(NM_001042472.3):c.129G>A (p.T43=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25390575C>T" "" "benign" ""
"0000257161" "0" "10" "20" "25371151" "25371151" "subst" "5.6273E-5" "02330" "ABHD12_000028" "g.25371151G>C" "" "" "" "ABHD12(NM_001042472.3):c.189C>G (p.G63=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25390515G>C" "" "benign" ""
"0000257162" "0" "10" "20" "25371130" "25371130" "subst" "0" "02330" "ABHD12_000026" "g.25371130G>C" "" "" "" "ABHD12(NM_001042472.3):c.191+19C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25390494G>C" "" "benign" ""
"0000257163" "0" "10" "20" "25319977" "25319977" "subst" "0.00174244" "02330" "ABHD12_000025" "g.25319977C>T" "" "" "" "ABHD12(NM_001042472.3):c.202G>A (p.V68M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25339341C>T" "" "benign" ""
"0000257164" "0" "10" "20" "25300924" "25300924" "subst" "8.12638E-5" "02330" "ABHD12_000019" "g.25300924G>A" "" "" "" "ABHD12(NM_001042472.3):c.453C>T (p.N151=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25320288G>A" "" "benign" ""
"0000257165" "0" "50" "20" "25289111" "25289111" "subst" "0.00102412" "02330" "ABHD12_000017" "g.25289111G>A" "" "" "" "ABHD12(NM_001042472.3):c.769C>T (p.R257W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25308475G>A" "" "VUS" ""
"0000257166" "0" "10" "20" "25288632" "25288632" "subst" "0.47986" "02330" "ABHD12_000016" "g.25288632G>A" "" "" "" "ABHD12(NM_001042472.3):c.837C>T (p.R279=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25307996G>A" "" "benign" ""
"0000258712" "0" "10" "20" "25288632" "25288632" "subst" "0.47986" "02325" "ABHD12_000016" "g.25288632G>A" "" "" "" "ABHD12(NM_001042472.3):c.837C>T (p.R279=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25307996G>A" "" "benign" ""
"0000261730" "0" "30" "20" "25281502" "25281502" "subst" "0.002911" "01943" "ABHD12_000010" "g.25281502C>T" "" "" "" "ABHD12(NM_001042472.3):c.1176G>A (p.S392=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25300866C>T" "" "likely benign" ""
"0000261731" "0" "50" "20" "25371158" "25371158" "subst" "0" "01943" "ABHD12_000029" "g.25371158G>T" "" "" "" "ABHD12(NM_001042472.3):c.182C>A (p.A61E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25390522G>T" "" "VUS" ""
"0000261732" "0" "30" "20" "25371139" "25371142" "del" "0" "01943" "ABHD12_000027" "g.25371139_25371142del" "" "" "" "ABHD12(NM_001042472.3):c.191+7_191+10delCTTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25390503_25390506del" "" "likely benign" ""
"0000261733" "0" "10" "20" "25319977" "25319977" "subst" "0.00174244" "01943" "ABHD12_000025" "g.25319977C>T" "" "" "" "ABHD12(NM_001042472.3):c.202G>A (p.V68M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25339341C>T" "" "benign" ""
"0000261734" "0" "30" "20" "25319911" "25319911" "subst" "4.06088E-6" "01943" "ABHD12_000023" "g.25319911T>C" "" "" "" "ABHD12(NM_001042472.3):c.268A>G (p.I90V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25339275T>C" "" "likely benign" ""
"0000261735" "0" "70" "20" "25304068" "25304068" "subst" "0" "01943" "ABHD12_000021" "g.25304068T>C" "" "" "" "ABHD12(NM_001042472.3):c.317-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25323432T>C" "" "likely pathogenic" ""
"0000261736" "0" "50" "20" "25300947" "25300947" "subst" "1.22014E-5" "01943" "ABHD12_000020" "g.25300947C>T" "" "" "" "ABHD12(NM_001042472.3):c.430G>A (p.V144I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25320311C>T" "" "VUS" ""
"0000261737" "0" "50" "20" "25289132" "25289132" "subst" "0" "01943" "ABHD12_000018" "g.25289132T>C" "" "" "" "ABHD12(NM_001042472.3):c.750-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25308496T>C" "" "VUS" ""
"0000261738" "0" "30" "20" "25288593" "25288593" "subst" "0" "01943" "ABHD12_000015" "g.25288593T>G" "" "" "" "ABHD12(NM_001042472.3):c.867+9A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25307957T>G" "" "likely benign" ""
"0000261739" "0" "30" "20" "25284273" "25284273" "subst" "2.86062E-5" "01943" "ABHD12_000014" "g.25284273G>A" "" "" "" "ABHD12(NM_001042472.3):c.951-9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25303637G>A" "" "likely benign" ""
"0000306653" "0" "50" "20" "25271155" "25271155" "subst" "0.000414176" "01943" "PYGB_000002" "g.25271155G>C" "" "" "" "PYGB(NM_002862.4):c.1866G>C (p.K622N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25290519G>C" "" "VUS" ""
"0000337625" "0" "10" "20" "25371382" "25371383" "ins" "0" "02327" "ABHD12_000042" "g.25371382_25371383insCCGCCGCCT" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25390746_25390747insCCGCCGCCT" "" "benign" ""
"0000339761" "0" "10" "20" "25282944" "25282944" "subst" "0.458065" "02327" "ABHD12_000012" "g.25282944A>G" "" "" "" "ABHD12(NM_001042472.3):c.1068T>C (p.D356=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25302308A>G" "" "benign" ""
"0000339762" "0" "10" "20" "25288632" "25288632" "subst" "0.47986" "02327" "ABHD12_000016" "g.25288632G>A" "" "" "" "ABHD12(NM_001042472.3):c.837C>T (p.R279=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25307996G>A" "" "benign" ""
"0000340961" "0" "10" "20" "25275621" "25275621" "subst" "0.047067" "02327" "PYGB_000004" "g.25275621T>C" "" "" "" "ABHD12(NM_015600.5):c.1203A>G (p.S401=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25294985T>C" "" "benign" ""
"0000342135" "0" "50" "20" "25297700" "25297700" "subst" "0" "02327" "ABHD12_000007" "g.25297700C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25317064C>G" "" "VUS" ""
"0000347110" "0" "50" "20" "25284232" "25284232" "subst" "4.07342E-6" "02327" "ABHD12_000040" "g.25284232A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25303596A>G" "" "VUS" ""
"0000349703" "0" "90" "20" "25300900" "25300900" "subst" "0" "02327" "ABHD12_000008" "g.25300900C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25320264C>T" "" "pathogenic" ""
"0000350504" "0" "90" "20" "25282937" "25282937" "del" "8.12196E-6" "02327" "ABHD12_000011" "g.25282937del" "" "" "" "ABHD12(NM_001042472.3):c.1075delG (p.V359Ffs*27)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25302301del" "" "pathogenic" ""
"0000351488" "3" "70" "20" "25303998" "25304004" "del" "0" "02371" "ABHD12_000032" "g.25303998_25304004delins[25305006_25305048;TC]" "" "{PMID:Lerat 2017:28448692}, {DOI:Lerat 2017:10.1111/jns.12216}" "" "379_385delAACTACTinsGATTCCTTATATACCATTGTAGTCTTACTGCTTTTGGTGAACACA" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000351508" "1" "90" "20" "25304065" "25304065" "del" "0" "00006" "ABHD12_000033" "g.25304065del" "" "{PMID:Nishiguchi 2014:24697911}" "" "" "" "Germline" "yes" "" "0" "" "" "g.25323429del" "" "pathogenic" ""
"0000351509" "2" "90" "20" "25295575" "25295575" "subst" "0" "00006" "ABHD12_000034" "g.25295575G>A" "" "{PMID:Nishiguchi 2014:24697911}" "" "" "" "Germline" "yes" "" "0" "" "" "g.25314939G>A" "" "pathogenic" ""
"0000351510" "3" "90" "20" "25282896" "25282896" "subst" "0" "00006" "ABHD12_000035" "g.25282896G>C" "" "{PMID:Nishiguchi 2014:24697911}" "" "" "" "Germline" "yes" "" "0" "" "" "g.25302260G>C" "" "pathogenic" ""
"0000351511" "1" "90" "20" "25304065" "25304065" "del" "0" "00006" "ABHD12_000033" "g.25304065del" "" "{PMID:Nishiguchi 2014:24697911}" "" "" "" "Germline" "yes" "" "0" "" "" "g.25323429del" "" "pathogenic" ""
"0000351512" "2" "90" "20" "25295575" "25295575" "subst" "0" "00006" "ABHD12_000034" "g.25295575G>A" "" "{PMID:Nishiguchi 2014:24697911}" "" "" "" "Germline" "yes" "" "0" "" "" "g.25314939G>A" "" "pathogenic" ""
"0000351513" "1" "90" "20" "25304065" "25304065" "del" "0" "00006" "ABHD12_000033" "g.25304065del" "" "{PMID:Nishiguchi 2014:24697911}" "" "" "" "Germline" "yes" "" "0" "" "" "g.25323429del" "" "pathogenic" ""
"0000351514" "2" "90" "20" "25295575" "25295575" "subst" "0" "00006" "ABHD12_000034" "g.25295575G>A" "" "{PMID:Nishiguchi 2014:24697911}" "" "" "" "Germline" "yes" "" "0" "" "" "g.25314939G>A" "" "pathogenic" ""
"0000351515" "1" "90" "20" "25304065" "25304065" "del" "0" "00006" "ABHD12_000033" "g.25304065del" "" "{PMID:Nishiguchi 2014:24697911}" "" "" "" "Germline" "yes" "" "0" "" "" "g.25323429del" "" "pathogenic" ""
"0000351516" "2" "90" "20" "25295575" "25295575" "subst" "0" "00006" "ABHD12_000034" "g.25295575G>A" "" "{PMID:Nishiguchi 2014:24697911}" "" "" "" "Germline" "yes" "" "0" "" "" "g.25314939G>A" "" "pathogenic" ""
"0000351517" "3" "90" "20" "25319986" "25319986" "subst" "2.03084E-5" "00006" "ABHD12_000036" "g.25319986G>A" "" "{PMID:Eisenberger 2012:22938382}" "" "" "" "Germline" "yes" "" "0" "" "" "g.25339350G>A" "" "pathogenic" ""
"0000351520" "3" "90" "20" "25319861" "25319861" "subst" "0" "00006" "ABHD12_000038" "g.25319861A>T" "" "{PMID:Yoshimura 2015:25743180}" "" "" "" "Germline" "yes" "" "0" "" "" "g.25339225A>T" "" "pathogenic" ""
"0000351522" "3" "90" "20" "25319861" "25319861" "subst" "0" "00006" "ABHD12_000038" "g.25319861A>T" "" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "" "" "" "Germline" "" "" "0" "" "" "g.25339225A>T" "" "pathogenic" ""
"0000351523" "3" "90" "20" "25289122" "25289122" "subst" "2.0812E-5" "00006" "ABHD12_000039" "g.25289122G>C" "" "{PMID:Tingaud-Sequeira 2017:27890673}" "" "" "" "Germline" "yes" "" "0" "" "" "g.25308486G>C" "" "pathogenic" ""
"0000569257" "0" "10" "20" "25275617" "25275617" "subst" "0.00902262" "02330" "PYGB_000014" "g.25275617G>A" "" "" "" "ABHD12(NM_015600.5):c.1207C>T (p.L403=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25294981G>A" "" "benign" ""
"0000569258" "0" "30" "20" "25275618" "25275618" "subst" "2.03034E-5" "02330" "PYGB_000015" "g.25275618C>T" "" "" "" "ABHD12(NM_015600.5):c.1206G>A (p.E402=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25294982C>T" "" "likely benign" ""
"0000569259" "0" "30" "20" "25282852" "25282852" "subst" "3.24934E-5" "01943" "PYGB_000016" "g.25282852C>T" "" "" "" "ABHD12(NM_001042472.3):c.1157+3G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25302216C>T" "" "likely benign" ""
"0000569260" "0" "30" "20" "25282899" "25282899" "subst" "0.000393915" "01943" "PYGB_000017" "g.25282899C>T" "" "" "" "ABHD12(NM_001042472.3):c.1113G>A (p.R371=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25302263C>T" "" "likely benign" ""
"0000569261" "0" "30" "20" "25288693" "25288696" "del" "0" "01943" "PYGB_000018" "g.25288693_25288696del" "" "" "" "ABHD12(NM_001042472.3):c.788-10_788-7delGTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25308057_25308060del" "" "likely benign" ""
"0000569262" "0" "50" "20" "25289111" "25289111" "subst" "0.00102412" "01943" "ABHD12_000017" "g.25289111G>A" "" "" "" "ABHD12(NM_001042472.3):c.769C>T (p.R257W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25308475G>A" "" "VUS" ""
"0000569263" "0" "50" "20" "25295602" "25295602" "subst" "4.06081E-6" "02325" "PYGB_000019" "g.25295602A>T" "" "" "" "ABHD12(NM_001042472.3):c.578T>A (p.L193Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25314966A>T" "" "VUS" ""
"0000569264" "0" "50" "20" "25297701" "25297701" "subst" "0" "02330" "PYGB_000020" "g.25297701G>A" "" "" "" "ABHD12(NM_001042472.3):c.556C>T (p.R186C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25317065G>A" "" "VUS" ""
"0000569265" "0" "30" "20" "25300837" "25300837" "subst" "8.54423E-5" "01943" "PYGB_000021" "g.25300837G>A" "" "" "" "ABHD12(NM_001042472.3):c.540C>T (p.T180=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25320201G>A" "" "likely benign" ""
"0000569266" "0" "50" "20" "25304039" "25304039" "subst" "0" "02330" "PYGB_000022" "g.25304039T>A" "" "" "" "ABHD12(NM_001042472.3):c.344A>T (p.K115I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25323403T>A" "" "VUS" ""
"0000569267" "0" "90" "20" "25304045" "25304046" "del" "2.84248E-5" "02330" "PYGB_000023" "g.25304045_25304046del" "" "" "" "ABHD12(NM_001042472.3):c.337_338delGA (p.D113Ffs*14)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25323409_25323410del" "" "pathogenic" ""
"0000569268" "0" "30" "20" "25319883" "25319883" "subst" "0" "01943" "PYGB_000024" "g.25319883T>C" "" "" "" "ABHD12(NM_001042472.3):c.296A>G (p.K99R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25339247T>C" "" "likely benign" ""
"0000569269" "0" "50" "20" "25319967" "25319967" "subst" "4.87417E-5" "01943" "PYGB_000025" "g.25319967C>T" "" "" "" "ABHD12(NM_001042472.3):c.212G>A (p.R71H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25339331C>T" "" "VUS" ""
"0000569270" "0" "30" "20" "25371112" "25371113" "ins" "0" "02330" "PYGB_000026" "g.25371112_25371113insCCCCCCCCCCCCCCCC" "" "" "" "ABHD12(NM_001042472.3):c.191+33_191+36delGGGCinsGGGCGGGGGGGGGGGGGGGG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25390476_25390477insCCCCCCCCCCCCCCCC" "" "likely benign" ""
"0000569271" "0" "30" "20" "25371112" "25371113" "ins" "0" "02330" "PYGB_000027" "g.25371112_25371113insCCCCCCCCCCCCCCCCCCCCC" "" "" "" "ABHD12(NM_001042472.3):c.191+31_191+36delGGGGGCinsGGGGGCGGGGGGGGGGGGGGGGGGGGG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25390476_25390477insCCCCCCCCCCCCCCCCCCCCC" "" "likely benign" ""
"0000569272" "0" "30" "20" "25371130" "25371132" "del" "0.00758669" "02330" "PYGB_000029" "g.25371130_25371132del" "" "" "" "ABHD12(NM_001042472.3):c.191+17_191+19delAGC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25390494_25390496del" "" "likely benign" ""
"0000569273" "0" "30" "20" "25371130" "25371130" "del" "0.00553273" "02330" "PYGB_000028" "g.25371130del" "" "" "" "ABHD12(NM_001042472.3):c.191+19delC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25390494del" "" "likely benign" ""
"0000569274" "0" "10" "20" "25371132" "25371132" "subst" "0" "02330" "PYGB_000030" "g.25371132T>C" "" "" "" "ABHD12(NM_001042472.3):c.191+17A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25390496T>C" "" "benign" ""
"0000569275" "0" "10" "20" "25371135" "25371135" "subst" "0" "02330" "PYGB_000031" "g.25371135G>C" "" "" "" "ABHD12(NM_001042472.3):c.191+14C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25390499G>C" "" "benign" ""
"0000569276" "0" "30" "20" "25371135" "25371142" "del" "0.00271621" "01943" "PYGB_000032" "g.25371135_25371142del" "" "" "" "ABHD12(NM_001042472.3):c.191+7_191+14delCTTCGCGC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25390499_25390506del" "" "likely benign" ""
"0000569277" "0" "50" "20" "25371151" "25371151" "subst" "5.6273E-5" "01943" "ABHD12_000028" "g.25371151G>C" "" "" "" "ABHD12(NM_001042472.3):c.189C>G (p.G63=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25390515G>C" "" "VUS" ""
"0000569278" "0" "30" "20" "25371205" "25371205" "subst" "0" "01943" "PYGB_000033" "g.25371205C>T" "" "" "" "ABHD12(NM_001042472.3):c.135G>A (p.P45=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25390569C>T" "" "likely benign" ""
"0000569279" "0" "30" "20" "25371211" "25371211" "subst" "0.000124196" "01943" "ABHD12_000030" "g.25371211C>T" "" "" "" "ABHD12(NM_001042472.3):c.129G>A (p.T43=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25390575C>T" "" "likely benign" ""
"0000624132" "0" "50" "20" "25275638" "25275638" "subst" "0" "02330" "PYGB_000034" "g.25275638C>G" "" "" "" "ABHD12(NM_015600.5):c.1186G>C (p.D396H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25295002C>G" "" "VUS" ""
"0000624133" "0" "50" "20" "25289111" "25289111" "subst" "0.00102412" "02325" "ABHD12_000017" "g.25289111G>A" "" "" "" "ABHD12(NM_001042472.3):c.769C>T (p.R257W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25308475G>A" "" "VUS" ""
"0000624134" "0" "30" "20" "25303978" "25303978" "subst" "5.68486E-5" "02330" "PYGB_000035" "g.25303978G>A" "" "" "" "ABHD12(NM_001042472.3):c.405C>T (p.D135=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25323342G>A" "" "likely benign" ""
"0000650756" "1" "30" "20" "25281027" "25281027" "subst" "0" "03575" "ABHD12_000043" "g.25281027C>T" "136/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "136 heterozygous; {DB:CLININrs41309917}" "Germline" "" "rs41309917" "0" "" "" "g.25300391C>T" "" "likely benign" ""
"0000650757" "1" "50" "20" "25289111" "25289111" "subst" "0.00102412" "03575" "ABHD12_000017" "g.25289111G>A" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; {DB:CLININrs41306784}" "Germline" "" "rs41306784" "0" "" "" "g.25308475G>A" "" "VUS" ""
"0000658732" "0" "30" "20" "25319976" "25319976" "subst" "0.000227443" "01943" "ABHD12_000024" "g.25319976A>G" "" "" "" "ABHD12(NM_001042472.3):c.203T>C (p.V68A), ABHD12(NM_015600.5):c.203T>C (p.V68A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25339340A>G" "" "likely benign" ""
"0000669665" "3" "30" "20" "25281027" "25281027" "subst" "0" "03575" "ABHD12_000043" "g.25281027C>T" "4/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "4 homozygous; {DB:CLININrs41309917}" "Germline" "" "rs41309917" "0" "" "" "g.25300391C>T" "" "likely benign" ""
"0000681575" "0" "50" "20" "25371237" "25371237" "subst" "0" "01943" "ABHD12_000031" "g.25371237G>A" "" "" "" "ABHD12(NM_001042472.3):c.103C>T (p.R35C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000684615" "3" "70" "20" "25304045" "25304046" "delins" "0" "00004" "ABHD12_000001" "g.25304045_25304046delinsAAA" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "c.337_338delGAinsTTT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000692947" "0" "30" "20" "25289090" "25289090" "subst" "0.000574134" "01943" "PYGB_000036" "g.25289090C>T" "" "" "" "ABHD12(NM_001042472.3):c.787+3G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000713585" "3" "90" "20" "25319986" "25319986" "subst" "2.03084E-5" "00000" "ABHD12_000036" "g.25319986G>A" "" "{PMID:Carss 2017:28041643}" "" "20:25319986G>A ENST00000376542.3:c.193C>T (Arg65Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713630" "3" "90" "20" "25290213" "25290213" "subst" "0" "00000" "ABHD12_000044" "g.25290213T>C" "" "{PMID:Carss 2017:28041643}" "" "20:25290213T>C ENST00000376542.3:c.620-2A>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000727628" "0" "30" "20" "25275591" "25275591" "subst" "8.12123E-6" "02330" "PYGB_000037" "g.25275591G>C" "" "" "" "ABHD12(NM_015600.5):c.*18C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000727629" "0" "90" "20" "25282937" "25282937" "del" "8.12196E-6" "02329" "ABHD12_000011" "g.25282937del" "" "" "" "ABHD12(NM_001042472.3):c.1075delG (p.V359Ffs*27)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000727630" "0" "50" "20" "25284236" "25284236" "subst" "4.07246E-5" "01943" "PYGB_000038" "g.25284236T>A" "" "" "" "ABHD12(NM_001042472.3):c.979A>T (p.I327F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000727631" "0" "90" "20" "25304045" "25304046" "del" "2.84248E-5" "02329" "PYGB_000023" "g.25304045_25304046del" "" "" "" "ABHD12(NM_001042472.3):c.337_338delGA (p.D113Ffs*14)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000727632" "0" "30" "20" "25319846" "25319846" "subst" "1.21848E-5" "02330" "PYGB_000039" "g.25319846G>A" "" "" "" "ABHD12(NM_001042472.3):c.316+17C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000730132" "1" "70" "20" "25319858" "25319858" "subst" "0" "00000" "ABHD12_000045" "g.25319858C>T" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.25339222C>T" "" "likely pathogenic" "ACMG"
"0000730225" "2" "90" "20" "25300900" "25300900" "subst" "0" "00000" "ABHD12_000008" "g.25300900C>T" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.25320264C>T" "" "pathogenic" "ACMG"
"0000733041" "3" "70" "20" "25281521" "25281521" "subst" "0" "00000" "ABHD12_000046" "g.25281521C>A" "" "{PMID:Stone 2017:28559085}" "" "IVS12-1G>T" "" "Germline" "" "" "0" "" "" "g.25300885C>A" "" "likely pathogenic" ""
"0000735194" "3" "70" "20" "25282967" "25282967" "subst" "0.0415874" "00000" "ABHD12_000013" "g.25282967C>T" "" "{PMID:Maranha 2015:26352687}, {DOI:Maranhao 2015:10.1371/journal.pone.0136561}" "" "" "" "Germline" "" "rs746748" "0" "" "" "g.25302331C>T" "" "likely pathogenic" ""
"0000735584" "1" "90" "20" "25300930" "25300930" "subst" "0" "00000" "ABHD12_000008" "g.25300930C>T" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.25320294C>T" "" "pathogenic" ""
"0000735711" "2" "90" "20" "25297700" "25297700" "subst" "0" "00000" "ABHD12_000007" "g.25297700C>G" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.25317064C>G" "" "pathogenic" ""
"0000790602" "0" "50" "20" "25319977" "25319977" "subst" "0.00174244" "00000" "ABHD12_000025" "g.25319977C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs11904930" "0" "" "" "g.25339341C>T" "" "VUS" ""
"0000794781" "0" "70" "20" "25287522" "25287522" "subst" "0" "03508" "ABHD12_000048" "g.25287522C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "pathogenic" "ACMG"
"0000794895" "0" "70" "20" "25287468" "25287552" "del" "0" "03508" "ABHD12_000047" "g.(25284265_25287468)_(25287552_25288601)del" "" "" "" "868-?_950+?del" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000809182" "0" "90" "20" "25282937" "25282937" "del" "8.12196E-6" "01943" "ABHD12_000011" "g.25282937del" "" "" "" "ABHD12(NM_001042472.3):c.1075delG (p.V359Ffs*27)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000809183" "0" "30" "20" "25282971" "25282971" "subst" "0.000268162" "01943" "PYGB_000040" "g.25282971G>A" "" "" "" "ABHD12(NM_001042472.3):c.1041C>T (p.I347=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000809184" "0" "30" "20" "25284255" "25284255" "subst" "0.000448332" "01943" "PYGB_000041" "g.25284255G>A" "" "" "" "ABHD12(NM_001042472.3):c.960C>T (p.H320=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000809185" "0" "30" "20" "25290105" "25290105" "subst" "8.93459E-5" "01943" "PYGB_000042" "g.25290105G>A" "" "" "" "ABHD12(NM_001042472.3):c.726C>T (p.I242=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000809186" "0" "50" "20" "25303977" "25303977" "subst" "3.24857E-5" "01943" "PYGB_000043" "g.25303977C>T" "" "" "" "ABHD12(NM_001042472.3):c.406G>A (p.V136M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000809187" "0" "30" "20" "25371275" "25371275" "subst" "2.72993E-5" "01943" "PYGB_000044" "g.25371275G>A" "" "" "" "ABHD12(NM_001042472.3):c.65C>T (p.S22F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000817480" "3" "50" "20" "25281489" "25281489" "subst" "3.65848E-5" "00000" "ABHD12_000049" "g.25281489G>A" "" "{PMID:Bifari 2015:26359340}" "" "(c.1189C>T, p.Gln397*)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000821148" "3" "90" "20" "25319986" "25319986" "subst" "2.03084E-5" "00000" "ABHD12_000036" "g.25319986G>A" "" "{PMID:Turro 2020:32581362}" "" "ABHD12 c.193C>T, p.Arg65Ter" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.25339350G>A" "" "pathogenic" ""
"0000821149" "3" "70" "20" "25290213" "25290213" "subst" "0" "00000" "ABHD12_000044" "g.25290213T>C" "" "{PMID:Turro 2020:32581362}" "" "ABHD12 c.620-2A>G," "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.25309577T>C" "" "likely pathogenic" ""
"0000841381" "3" "90" "20" "25300850" "25300850" "subst" "0" "00435" "ABHD12_000050" "g.25300850C>T" "" "" "" "" "" "Germline" "yes" "" "" "" "" "" "" "pathogenic (recessive)" ""
"0000841395" "3" "90" "20" "25300850" "25300850" "subst" "0" "00435" "ABHD12_000050" "g.25300850C>T" "" "" "" "" "" "Germline" "yes" "" "" "" "" "" "" "pathogenic (recessive)" ""
"0000841396" "3" "90" "20" "25300850" "25300850" "subst" "0" "00435" "ABHD12_000050" "g.25300850C>T" "" "" "" "" "" "Germline" "yes" "" "" "" "" "" "" "pathogenic (recessive)" ""
"0000847174" "0" "90" "20" "25287545" "25287545" "subst" "1.22321E-5" "00006" "ABHD12_000052" "g.25287545G>A" "" "{PMID:Thomas 2022:34085946}" "" "c.874C>T" "" "Germline" "" "" "0" "" "" "g.25306909G>A" "" "pathogenic" ""
"0000847466" "3" "90" "20" "25319956" "25319968" "del" "0" "00000" "ABHD12_000056" "g.25319956_25319968del" "" "" "" "c.211_223del (p.Arg71Tyrfs*26)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000847467" "3" "90" "20" "25319956" "25319968" "del" "0" "00000" "ABHD12_000056" "g.25319956_25319968del" "" "" "" "c.211_223del (p.Arg71Tyrfs*26)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000847468" "3" "90" "20" "25319930" "25319930" "subst" "0" "00000" "ABHD12_000055" "g.25319930G>C" "" "" "" "c.249C>G" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000847469" "3" "90" "20" "25319930" "25319930" "subst" "0" "00000" "ABHD12_000055" "g.25319930G>C" "" "" "" "c.249C>G" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000847491" "3" "90" "20" "25303998" "25304004" "delins" "0" "00000" "ABHD12_000054" "g.25303998_25304004delinsTGTGTTCACCAAAAGCAGTAAGACTACAATGGTATATAAGGAATC" "" "" "" "c.379_385delinsGATTCCTTATA TACCATTGTAGTCTTACTGCTTTTGGTGAACACA" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000847492" "3" "90" "20" "25289096" "25289096" "subst" "0" "00000" "ABHD12_000053" "g.25289096G>A" "" "" "" "c.784C > T, p.Arg262*" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000847493" "3" "90" "20" "25289096" "25289096" "subst" "0" "00000" "ABHD12_000053" "g.25289096G>A" "" "" "" "c.784C > T, p.Arg262*" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000847494" "0" "50" "20" "25280957" "25280957" "subst" "0" "00000" "ABHD12_000051" "g.25280957T>C" "" "" "" "c.1721A>G (p.Asn574Ser)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000847495" "0" "50" "20" "25280661" "25280661" "subst" "0" "00000" "ABHD12_000051" "g.25280661C>T" "" "" "" "c.2017G>A (p.Ala673Thr)" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000855778" "0" "50" "20" "25281483" "25281483" "subst" "4.06428E-6" "02330" "PYGB_000045" "g.25281483A>G" "" "" "" "ABHD12(NM_001042472.3):c.1195T>C (p.*399Rext*90)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000855779" "0" "90" "20" "25282949" "25282949" "subst" "4.06134E-6" "02330" "PYGB_000046" "g.25282949G>A" "" "" "" "ABHD12(NM_001042472.3):c.1063C>T (p.R355*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000855780" "0" "50" "20" "25284245" "25284245" "subst" "4.07395E-6" "02330" "PYGB_000047" "g.25284245G>A" "" "" "" "ABHD12(NM_001042472.3):c.970C>T (p.P324S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000855781" "0" "50" "20" "25319898" "25319898" "subst" "0" "01943" "PYGB_000049" "g.25319898G>A" "" "" "" "ABHD12(NM_001042472.3):c.281C>T (p.P94L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000855782" "0" "50" "20" "25371222" "25371222" "subst" "0.000273535" "01943" "PYGB_000050" "g.25371222G>C" "" "" "" "ABHD12(NM_001042472.3):c.118C>G (p.L40V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000866402" "0" "30" "20" "25300832" "25300832" "subst" "3.25539E-5" "01943" "PYGB_000048" "g.25300832C>T" "" "" "" "ABHD12(NM_001042472.3):c.542+3G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000915350" "0" "50" "20" "25371287" "25371287" "subst" "2.91605E-5" "02330" "PYGB_000051" "g.25371287G>C" "" "" "" "ABHD12(NM_001042472.3):c.53C>G (p.A18G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000917879" "1" "90" "20" "25282958" "25282958" "subst" "0" "00006" "ABHD12_000003" "g.25282958G>A" "" "{PMID:Igelman 2021:34223797}" "" "" "" "Germline" "" "" "0" "" "" "g.25302322G>A" "" "pathogenic (recessive)" ""
"0000917880" "1" "90" "20" "25282949" "25282949" "subst" "4.06134E-6" "00006" "PYGB_000046" "g.25282949G>A" "" "{PMID:Igelman 2021:34223797}" "" "" "" "Germline" "" "" "0" "" "" "g.25302313G>A" "" "pathogenic (recessive)" ""
"0000917881" "3" "90" "20" "25319986" "25319986" "subst" "2.03084E-5" "00006" "ABHD12_000036" "g.25319986G>A" "" "{PMID:Igelman 2021:34223797}" "" "" "" "Germline" "" "" "0" "" "" "g.25339350G>A" "" "pathogenic (recessive)" ""
"0000917882" "3" "90" "20" "25290213" "25290213" "subst" "0" "00006" "ABHD12_000044" "g.25290213T>C" "" "{PMID:Igelman 2021:34223797}" "" "" "" "Germline" "" "" "0" "" "" "g.25309577T>C" "" "pathogenic (recessive)" ""
"0000917883" "1" "90" "20" "25304009" "25304009" "subst" "8.12143E-6" "00006" "ABHD12_000060" "g.25304009G>A" "" "{PMID:Igelman 2021:34223797}" "" "" "" "Germline" "" "" "0" "" "" "g.25323373G>A" "" "pathogenic (recessive)" ""
"0000917884" "1" "90" "20" "25289096" "25289096" "subst" "0" "00006" "ABHD12_000053" "g.25289096G>A" "" "{PMID:Igelman 2021:34223797}" "" "" "" "Germline" "" "" "0" "" "" "g.25308460G>A" "" "pathogenic (recessive)" ""
"0000917891" "2" "90" "20" "25281482" "25281482" "del" "0" "00006" "ABHD12_000057" "g.25281482del" "" "{PMID:Igelman 2021:34223797}" "" "c.1196del (*399Serfs*122)" "" "Germline" "" "" "0" "" "" "g.25300846del" "" "pathogenic (recessive)" ""
"0000917892" "2" "90" "20" "25319920" "25319920" "subst" "2.43677E-5" "00006" "ABHD12_000061" "g.25319920G>T" "" "{PMID:Igelman 2021:34223797}" "" "" "" "Germline" "" "" "0" "" "" "g.25339284G>T" "" "pathogenic (recessive)" ""
"0000917893" "2" "90" "20" "25282858" "25282858" "subst" "0" "00006" "ABHD12_000058" "g.25282858A>G" "" "{PMID:Igelman 2021:34223797}" "" "" "" "Germline" "" "" "0" "" "" "g.25302222A>G" "" "pathogenic (recessive)" ""
"0000917894" "2" "90" "20" "25288597" "25288597" "subst" "4.06868E-6" "00006" "ABHD12_000059" "g.25288597C>T" "" "{PMID:Igelman 2021:34223797}" "" "" "" "Germline" "" "" "0" "" "" "g.25307961C>T" "" "pathogenic (recessive)" ""
"0000921667" "3" "30" "20" "25282944" "25282944" "subst" "0.458065" "00006" "ABHD12_000012" "g.25282944A>G" "" "{PMID:Li 2019:31842807}" "" "" "" "Germline" "" "rs10966" "0" "" "" "g.25302308A>G" "" "likely benign" ""
"0000921698" "3" "30" "20" "25282944" "25282944" "subst" "0.458065" "00006" "ABHD12_000012" "g.25282944A>G" "" "{PMID:Li 2019:31842807}" "" "" "" "Germline" "" "rs10966" "0" "" "" "g.25302308A>G" "" "likely benign" ""
"0000921723" "3" "30" "20" "25282944" "25282944" "subst" "0.458065" "00006" "ABHD12_000012" "g.25282944A>G" "" "{PMID:Li 2019:31842807}" "" "" "" "Germline" "" "rs10966" "0" "" "" "g.25302308A>G" "" "likely benign" ""
"0000931153" "0" "50" "20" "25371332" "25371332" "subst" "0" "02330" "PYGB_000052" "g.25371332T>C" "" "" "" "ABHD12(NM_001042472.3):c.8A>G (p.K3R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000958888" "0" "70" "20" "25282912" "25282924" "del" "0" "00006" "ABHD12_000062" "g.25282912_25282924del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.25302276_25302288del" "" "likely pathogenic (recessive)" "ACMG"
"0000959326" "0" "50" "20" "25295575" "25295575" "subst" "0" "00006" "ABHD12_000034" "g.25295575G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.25314939G>A" "" "VUS" "ACMG"
"0001008484" "0" "90" "20" "25282896" "25282896" "subst" "0" "03779" "ABHD12_000035" "g.25282896G>C" "" "" "" "" "" "CLASSIFICATION record" "" "rs587777602" "0" "" "" "" "" "pathogenic" ""
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes ABHD12
## Count = 168
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}"
"0000019237" "00023827" "70" "1129" "0" "1129" "0" "c.1129A>T" "r.1129a>u" "p.Lys377*" "12"
"0000019239" "00023827" "90" "-28544" "0" "192" "-20684" "c.-28544_192-20684delins[GTTAAGTTAAGTGTTGGGTTAAGTTAAGTTTCTT;NM_021067.3:75+2104_75+2166]" "r.0?" "p.0?" "_1_1i"
"0000091133" "00023827" "90" "-6920" "0" "191" "6897" "c.-6920_191+6897del" "r.0?" "p.0?" "_1_1i"
"0000091134" "00023827" "90" "-6920" "0" "191" "6897" "c.-6920_191+6897del" "r.0?" "p.0?" "_1_1i"
"0000091135" "00023827" "90" "-6920" "0" "191" "6897" "c.-6920_191+6897del" "r.0?" "p.0?" "_1_1i"
"0000091136" "00023827" "90" "337" "0" "338" "0" "c.337_338delinsTTT" "r.(?)" "p.(Asp113Phefs*15)" "3"
"0000091137" "00023827" "90" "337" "0" "338" "0" "c.337_338delinsTTT" "r.(?)" "p.(Asp113Phefs*15)" "3"
"0000091138" "00023827" "90" "337" "0" "338" "0" "c.337_338delinsTTT" "r.(?)" "p.(Asp113Phefs*15)" "3"
"0000091139" "00023827" "90" "337" "0" "338" "0" "c.337_338delinsTTT" "r.(?)" "p.(Asp113Phefs*15)" "3"
"0000091140" "00023827" "90" "337" "0" "338" "0" "c.337_338delinsTTT" "r.(?)" "p.(Asp113Phefs*15)" "3"
"0000091141" "00023827" "90" "337" "0" "338" "0" "c.337_338delinsTTT" "r.(?)" "p.(Asp113Phefs*15)" "3"
"0000091142" "00023827" "90" "337" "0" "338" "0" "c.337_338delinsTTT" "r.(?)" "p.(Asp113Phefs*15)" "3"
"0000091143" "00023827" "90" "337" "0" "338" "0" "c.337_338delinsTTT" "r.(?)" "p.(Asp113Phefs*15)" "3"
"0000091144" "00023827" "90" "846" "0" "852" "0" "c.846_852dup" "r.(?)" "p.(His285*)" "9"
"0000091145" "00023827" "90" "846" "0" "852" "0" "c.846_852dup" "r.(?)" "p.(His285*)" "9"
"0000091146" "00023827" "90" "846" "0" "852" "0" "c.846_852dup" "r.(?)" "p.(His285*)" "9"
"0000091147" "00023827" "90" "846" "0" "852" "0" "c.846_852dup" "r.(?)" "p.(His285*)" "9"
"0000091148" "00023827" "90" "846" "0" "852" "0" "c.846_852dup" "r.(?)" "p.(His285*)" "9"
"0000091149" "00023827" "90" "846" "0" "852" "0" "c.846_852dup" "r.(?)" "p.(His285*)" "9"
"0000091150" "00023827" "90" "846" "0" "852" "0" "c.846_852dup" "r.(?)" "p.(His285*)" "9"
"0000091151" "00023827" "90" "1054" "0" "1054" "0" "c.1054C>T" "r.(?)" "p.(Arg352*)" "12"
"0000129972" "00023827" "90" "447" "0" "447" "0" "c.447G>A" "r.(?)" "p.(Trp159*)" ""
"0000129973" "00023827" "90" "557" "0" "557" "0" "c.557G>C" "r.(?)" "p.(Arg186Pro)" ""
"0000247663" "00023827" "10" "1068" "0" "1068" "0" "c.1068T>C" "r.(?)" "p.(Asp356=)" ""
"0000247666" "00023827" "10" "317" "-5" "317" "-5" "c.317-5T>C" "r.spl?" "p.?" ""
"0000247673" "00023827" "50" "203" "0" "203" "0" "c.203T>C" "r.(?)" "p.(Val68Ala)" ""
"0000257154" "00023827" "50" "1210" "0" "1210" "0" "c.*13G>T" "r.(=)" "p.(=)" ""
"0000257155" "00023827" "30" "7076" "0" "7076" "0" "c.*5879C>T" "r.(=)" "p.(=)" ""
"0000257156" "00023827" "50" "103" "0" "103" "0" "c.103C>T" "r.(?)" "p.(Arg35Cys)" ""
"0000257157" "00023827" "10" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Ala349Thr)" ""
"0000257158" "00023827" "90" "1075" "0" "1075" "0" "c.1075del" "r.(?)" "p.(Val359PhefsTer27)" ""
"0000257159" "00023827" "10" "7057" "0" "7057" "0" "c.*5860A>G" "r.(=)" "p.(=)" ""
"0000257160" "00023827" "10" "129" "0" "129" "0" "c.129G>A" "r.(?)" "p.(Thr43=)" ""
"0000257161" "00023827" "10" "189" "0" "189" "0" "c.189C>G" "r.(?)" "p.(Gly63=)" ""
"0000257162" "00023827" "10" "191" "19" "191" "19" "c.191+19C>G" "r.(=)" "p.(=)" ""
"0000257163" "00023827" "10" "202" "0" "202" "0" "c.202G>A" "r.(?)" "p.(Val68Met)" ""
"0000257164" "00023827" "10" "453" "0" "453" "0" "c.453C>T" "r.(?)" "p.(Asn151=)" ""
"0000257165" "00023827" "50" "769" "0" "769" "0" "c.769C>T" "r.(?)" "p.(Arg257Trp)" ""
"0000257166" "00023827" "10" "837" "0" "837" "0" "c.837C>T" "r.(?)" "p.(Arg279=)" ""
"0000258712" "00023827" "10" "837" "0" "837" "0" "c.837C>T" "r.(?)" "p.(Arg279=)" ""
"0000261730" "00023827" "30" "1176" "0" "1176" "0" "c.1176G>A" "r.(?)" "p.(Ser392=)" ""
"0000261731" "00023827" "50" "182" "0" "182" "0" "c.182C>A" "r.(?)" "p.(Ala61Glu)" ""
"0000261732" "00023827" "30" "191" "7" "191" "10" "c.191+7_191+10del" "r.(=)" "p.(=)" ""
"0000261733" "00023827" "10" "202" "0" "202" "0" "c.202G>A" "r.(?)" "p.(Val68Met)" ""
"0000261734" "00023827" "30" "268" "0" "268" "0" "c.268A>G" "r.(?)" "p.(Ile90Val)" ""
"0000261735" "00023827" "70" "317" "-2" "317" "-2" "c.317-2A>G" "r.spl?" "p.?" ""
"0000261736" "00023827" "50" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Val144Ile)" ""
"0000261737" "00023827" "50" "750" "-2" "750" "-2" "c.750-2A>G" "r.spl?" "p.?" ""
"0000261738" "00023827" "30" "867" "9" "867" "9" "c.867+9A>C" "r.(=)" "p.(=)" ""
"0000261739" "00023827" "30" "951" "-9" "951" "-9" "c.951-9C>T" "r.(=)" "p.(=)" ""
"0000306653" "00023827" "50" "11523" "0" "11523" "0" "c.*10326C>G" "r.(=)" "p.(=)" ""
"0000337625" "00023827" "10" "-40" "0" "-39" "0" "c.-40_-39insGGCGGAGGC" "r.(?)" "p.(=)" ""
"0000339761" "00023827" "10" "1068" "0" "1068" "0" "c.1068T>C" "r.(?)" "p.(Asp356=)" ""
"0000339762" "00023827" "10" "837" "0" "837" "0" "c.837C>T" "r.(?)" "p.(Arg279=)" ""
"0000340961" "00023827" "10" "7057" "0" "7057" "0" "c.*5860A>G" "r.(=)" "p.(=)" ""
"0000342135" "00023827" "50" "557" "0" "557" "0" "c.557G>C" "r.(?)" "p.(Arg186Pro)" ""
"0000347110" "00023827" "50" "983" "0" "983" "0" "c.983T>C" "r.(?)" "p.(Leu328Pro)" ""
"0000349703" "00023827" "90" "477" "0" "477" "0" "c.477G>A" "r.(?)" "p.(Trp159Ter)" ""
"0000350504" "00023827" "90" "1075" "0" "1075" "0" "c.1075del" "r.(?)" "p.(Val359PhefsTer27)" ""
"0000351488" "00023827" "70" "379" "0" "385" "0" "c.379_385delins[GA;317-82_317-40inv]" "r.(?)" "p.(Asn127Aspfs*23)" "3"
"0000351508" "00023827" "90" "319" "0" "319" "0" "c.319del" "r.(?)" "p.(Arg107Glufs*8)" ""
"0000351509" "00023827" "90" "605" "0" "605" "0" "c.605C>T" "r.(?)" "p.(Thr202Ile)" ""
"0000351510" "00023827" "90" "1116" "0" "1116" "0" "c.1116C>G" "r.(?)" "p.(His372Gln)" ""
"0000351511" "00023827" "90" "319" "0" "319" "0" "c.319del" "r.(?)" "p.(Arg107Glufs*8)" ""
"0000351512" "00023827" "90" "605" "0" "605" "0" "c.605C>T" "r.(?)" "p.(Thr202Ile)" ""
"0000351513" "00023827" "90" "319" "0" "319" "0" "c.319del" "r.(?)" "p.(Arg107Glufs*8)" ""
"0000351514" "00023827" "90" "605" "0" "605" "0" "c.605C>T" "r.(?)" "p.(Thr202Ile)" ""
"0000351515" "00023827" "90" "319" "0" "319" "0" "c.319del" "r.(?)" "p.(Arg107Glufs*8)" ""
"0000351516" "00023827" "90" "605" "0" "605" "0" "c.605C>T" "r.(?)" "p.(Thr202Ile)" ""
"0000351517" "00023827" "90" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65*)" ""
"0000351520" "00023827" "90" "316" "2" "316" "2" "c.316+2T>A" "r.spl" "p.?" "2i"
"0000351522" "00023827" "90" "316" "2" "316" "2" "c.316+2T>A" "r.spl" "p.?" "2i"
"0000351523" "00023827" "90" "758" "0" "758" "0" "c.758C>G" "r.(?)" "p.(Thr253Arg)" "8"
"0000569257" "00023827" "10" "7061" "0" "7061" "0" "c.*5864C>T" "r.(=)" "p.(=)" ""
"0000569258" "00023827" "30" "7060" "0" "7060" "0" "c.*5863G>A" "r.(=)" "p.(=)" ""
"0000569259" "00023827" "30" "1157" "3" "1157" "3" "c.1157+3G>A" "r.spl?" "p.?" ""
"0000569260" "00023827" "30" "1113" "0" "1113" "0" "c.1113G>A" "r.(?)" "p.(Arg371=)" ""
"0000569261" "00023827" "30" "788" "-10" "788" "-7" "c.788-10_788-7del" "r.(=)" "p.(=)" ""
"0000569262" "00023827" "50" "769" "0" "769" "0" "c.769C>T" "r.(?)" "p.(Arg257Trp)" ""
"0000569263" "00023827" "50" "578" "0" "578" "0" "c.578T>A" "r.(?)" "p.(Leu193Gln)" ""
"0000569264" "00023827" "50" "556" "0" "556" "0" "c.556C>T" "r.(?)" "p.(Arg186Cys)" ""
"0000569265" "00023827" "30" "540" "0" "540" "0" "c.540C>T" "r.(?)" "p.(Thr180=)" ""
"0000569266" "00023827" "50" "344" "0" "344" "0" "c.344A>T" "r.(?)" "p.(Lys115Ile)" ""
"0000569267" "00023827" "90" "337" "0" "338" "0" "c.337_338del" "r.(?)" "p.(Asp113PhefsTer14)" ""
"0000569268" "00023827" "30" "296" "0" "296" "0" "c.296A>G" "r.(?)" "p.(Lys99Arg)" ""
"0000569269" "00023827" "50" "212" "0" "212" "0" "c.212G>A" "r.(?)" "p.(Arg71His)" ""
"0000569270" "00023827" "30" "191" "36" "191" "37" "c.191+36_191+37insGGGGGGGGGGGGGGGG" "r.(=)" "p.(=)" ""
"0000569271" "00023827" "30" "191" "36" "191" "37" "c.191+36_191+37insGGGGGGGGGGGGGGGGGGGGG" "r.(=)" "p.(=)" ""
"0000569272" "00023827" "30" "191" "17" "191" "19" "c.191+17_191+19del" "r.(=)" "p.(=)" ""
"0000569273" "00023827" "30" "191" "19" "191" "19" "c.191+19del" "r.(=)" "p.(=)" ""
"0000569274" "00023827" "10" "191" "17" "191" "17" "c.191+17A>G" "r.(=)" "p.(=)" ""
"0000569275" "00023827" "10" "191" "14" "191" "14" "c.191+14C>G" "r.(=)" "p.(=)" ""
"0000569276" "00023827" "30" "191" "7" "191" "14" "c.191+7_191+14del" "r.(=)" "p.(=)" ""
"0000569277" "00023827" "50" "189" "0" "189" "0" "c.189C>G" "r.(?)" "p.(Gly63=)" ""
"0000569278" "00023827" "30" "135" "0" "135" "0" "c.135G>A" "r.(?)" "p.(Pro45=)" ""
"0000569279" "00023827" "30" "129" "0" "129" "0" "c.129G>A" "r.(?)" "p.(Thr43=)" ""
"0000624132" "00023827" "50" "7040" "0" "7040" "0" "c.*5843G>C" "r.(=)" "p.(=)" ""
"0000624133" "00023827" "50" "769" "0" "769" "0" "c.769C>T" "r.(?)" "p.(Arg257Trp)" ""
"0000624134" "00023827" "30" "405" "0" "405" "0" "c.405C>T" "r.(?)" "p.(Asp135=)" ""
"0000650756" "00023827" "30" "1651" "0" "1651" "0" "c.*454G>A" "r.(=)" "p.(=)" ""
"0000650757" "00023827" "50" "769" "0" "769" "0" "c.769C>T" "r.(?)" "p.(Arg257Trp)" ""
"0000658732" "00023827" "30" "203" "0" "203" "0" "c.203T>C" "r.(?)" "p.(Val68Ala)" ""
"0000669665" "00023827" "30" "1651" "0" "1651" "0" "c.*454G>A" "r.(=)" "p.(=)" ""
"0000681575" "00023827" "50" "103" "0" "103" "0" "c.103C>T" "r.(?)" "p.(Arg35Cys)" ""
"0000684615" "00023827" "70" "337" "0" "338" "0" "c.337_338delinsTTT" "r.(?)" "p.(Asp113Phefs*15)" ""
"0000692947" "00023827" "30" "787" "3" "787" "3" "c.787+3G>A" "r.spl?" "p.?" ""
"0000713585" "00023827" "90" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65*)" ""
"0000713630" "00023827" "90" "620" "-2" "620" "-2" "c.620-2A>G" "r.spl?" "p.?" ""
"0000727628" "00023827" "30" "7087" "0" "7087" "0" "c.*5890C>G" "r.(=)" "p.(=)" ""
"0000727629" "00023827" "90" "1075" "0" "1075" "0" "c.1075del" "r.(?)" "p.(Val359PhefsTer27)" ""
"0000727630" "00023827" "50" "979" "0" "979" "0" "c.979A>T" "r.(?)" "p.(Ile327Phe)" ""
"0000727631" "00023827" "90" "337" "0" "338" "0" "c.337_338del" "r.(?)" "p.(Asp113PhefsTer14)" ""
"0000727632" "00023827" "30" "316" "17" "316" "17" "c.316+17C>T" "r.(=)" "p.(=)" ""
"0000730132" "00023827" "70" "316" "5" "316" "5" "c.316+5G>A" "r.spl?" "p.?" ""
"0000730225" "00023827" "90" "477" "0" "477" "0" "c.477G>A" "r.(?)" "p.(Trp159*)" ""
"0000733041" "00023827" "70" "1158" "-1" "1158" "-1" "c.1158-1G>T" "r.spl" "p.?" ""
"0000735194" "00023827" "70" "1045" "0" "1045" "0" "c.1045G>A" "r.(?)" "p.(Ala349Thr)" ""
"0000735584" "00023827" "90" "447" "0" "447" "0" "c.447G>A" "r.(?)" "p.(Trp149*)" ""
"0000735711" "00023827" "90" "557" "0" "557" "0" "c.557G>C" "r.(?)" "p.(Arg186Pro)" ""
"0000790602" "00023827" "50" "202" "0" "202" "0" "c.202G>A" "r.(?)" "p.(Val68Met)" ""
"0000794781" "00023827" "70" "897" "0" "897" "0" "c.897G>A" "r.(?)" "p.(Trp299*)" ""
"0000794895" "00023827" "70" "868" "-1" "950" "1" "c.(867+1_868-1)_(950+1_951-1)del" "r.spl" "p.(Ile290Argfs*14)" ""
"0000809182" "00023827" "90" "1075" "0" "1075" "0" "c.1075del" "r.(?)" "p.(Val359PhefsTer27)" ""
"0000809183" "00023827" "30" "1041" "0" "1041" "0" "c.1041C>T" "r.(?)" "p.(Ile347=)" ""
"0000809184" "00023827" "30" "960" "0" "960" "0" "c.960C>T" "r.(?)" "p.(His320=)" ""
"0000809185" "00023827" "30" "726" "0" "726" "0" "c.726C>T" "r.(?)" "p.(Ile242=)" ""
"0000809186" "00023827" "50" "406" "0" "406" "0" "c.406G>A" "r.(?)" "p.(Val136Met)" ""
"0000809187" "00023827" "30" "65" "0" "65" "0" "c.65C>T" "r.(?)" "p.(Ser22Phe)" ""
"0000817480" "00023827" "50" "1189" "0" "1189" "0" "c.1189C>T" "r.(?)" "p.(Gln397*)" "13"
"0000821148" "00023827" "90" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65*)" ""
"0000821149" "00023827" "70" "620" "-2" "620" "-2" "c.620-2A>G" "r.spl" "p.(?)" ""
"0000841381" "00023827" "90" "527" "0" "527" "0" "c.527G>A" "r.(?)" "p.(Gly176Glu)" "4"
"0000841395" "00023827" "90" "527" "0" "527" "0" "c.527G>A" "r.(?)" "p.(Gly176Glu)" "4"
"0000841396" "00023827" "90" "527" "0" "527" "0" "c.527G>A" "r.(?)" "p.(Gly176Glu)" "4"
"0000847174" "00023827" "90" "874" "0" "874" "0" "c.874C>T" "r.(?)" "p.(Arg292Ter)" ""
"0000847466" "00023827" "90" "211" "0" "223" "0" "c.211_223del" "r.(?)" "p.(Arg71Tyrfs*26)" "2"
"0000847467" "00023827" "90" "211" "0" "223" "0" "c.211_223del" "r.(?)" "p.(Arg71Tyrfs*26)" "2"
"0000847468" "00023827" "90" "249" "0" "249" "0" "c.249C>G" "r.(?)" "p.(Tyr83*)" "2"
"0000847469" "00023827" "90" "249" "0" "249" "0" "c.249C>G" "r.(?)" "p.(Tyr83*)" "2"
"0000847491" "00023827" "90" "379" "0" "385" "0" "c.379_385delinsGATTCCTTATATACCATTGTAGTCTTACTGCTTTTGGTGAACACA" "r.(?)" "p.(Asn127Aspfs*23)" "3"
"0000847492" "00023827" "90" "784" "0" "784" "0" "c.784C>T" "r.(?)" "p.(Arg262*)" "8"
"0000847493" "00023827" "90" "784" "0" "784" "0" "c.784C>T" "r.(?)" "p.(Arg262*)" "8"
"0000847494" "00023827" "50" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "13"
"0000847495" "00023827" "50" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "13"
"0000855778" "00023827" "50" "1195" "0" "1195" "0" "c.1195T>C" "r.(?)" "p.(*399Argext*90)" ""
"0000855779" "00023827" "90" "1063" "0" "1063" "0" "c.1063C>T" "r.(?)" "p.(Arg355*)" ""
"0000855780" "00023827" "50" "970" "0" "970" "0" "c.970C>T" "r.(?)" "p.(Pro324Ser)" ""
"0000855781" "00023827" "50" "281" "0" "281" "0" "c.281C>T" "r.(?)" "p.(Pro94Leu)" ""
"0000855782" "00023827" "50" "118" "0" "118" "0" "c.118C>G" "r.(?)" "p.(Leu40Val)" ""
"0000866402" "00023827" "30" "542" "3" "542" "3" "c.542+3G>A" "r.spl?" "p.?" ""
"0000915350" "00023827" "50" "53" "0" "53" "0" "c.53C>G" "r.(?)" "p.(Ala18Gly)" ""
"0000917879" "00023827" "90" "1054" "0" "1054" "0" "c.1054C>T" "r.(?)" "p.(Arg352Ter)" ""
"0000917880" "00023827" "90" "1063" "0" "1063" "0" "c.1063C>T" "r.(?)" "p.(Arg355Ter)" ""
"0000917881" "00023827" "90" "193" "0" "193" "0" "c.193C>T" "r.(?)" "p.(Arg65Ter)" ""
"0000917882" "00023827" "90" "620" "-2" "620" "-2" "c.620-2A>G" "r.spl" "p.?" ""
"0000917883" "00023827" "90" "374" "0" "374" "0" "c.374C>T" "r.(?)" "p.(Thr125Met)" ""
"0000917884" "00023827" "90" "784" "0" "784" "0" "c.784C>T" "r.(?)" "p.(Arg262Ter)" ""
"0000917891" "00023827" "90" "1195" "0" "1196" "0" "c.1195_1196del" "r.(?)" "p.(Ter399SerextTer121)" ""
"0000917892" "00023827" "90" "259" "0" "259" "0" "c.259C>A" "r.(?)" "p.(Pro87Thr)" ""
"0000917893" "00023827" "90" "1154" "0" "1154" "0" "c.1154T>C" "r.(?)" "p.(Leu385Pro)" ""
"0000917894" "00023827" "90" "867" "5" "867" "5" "c.867+5G>A" "r.spl" "p.?" ""
"0000921667" "00023827" "30" "1068" "0" "1068" "0" "c.1068T>C" "r.(?)" "p.(Asp356=)" ""
"0000921698" "00023827" "30" "1068" "0" "1068" "0" "c.1068T>C" "r.(?)" "p.(Asp356=)" ""
"0000921723" "00023827" "30" "1068" "0" "1068" "0" "c.1068T>C" "r.(?)" "p.(Asp356=)" ""
"0000931153" "00023827" "50" "8" "0" "8" "0" "c.8A>G" "r.(?)" "p.(Lys3Arg)" ""
"0000958888" "00023827" "70" "1092" "0" "1104" "0" "c.1092_1104del" "r.(?)" "p.(Phe364LeufsTer18)" ""
"0000959326" "00023827" "50" "605" "0" "605" "0" "c.605C>T" "r.(?)" "p.(Thr202Ile)" ""
"0001008484" "00023827" "90" "1116" "0" "1116" "0" "c.1116C>G" "r.(?)" "p.(His372Gln)" ""
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 83
"{{screeningid}}" "{{variantid}}"
"0000001440" "0000019237"
"0000001442" "0000019239"
"0000059885" "0000091133"
"0000059886" "0000091134"
"0000059887" "0000091135"
"0000059888" "0000091136"
"0000059889" "0000091137"
"0000059890" "0000091138"
"0000059891" "0000091139"
"0000059892" "0000091140"
"0000059893" "0000091141"
"0000059894" "0000091142"
"0000059895" "0000091143"
"0000059896" "0000091144"
"0000059897" "0000091145"
"0000059898" "0000091146"
"0000059899" "0000091147"
"0000059900" "0000091148"
"0000059901" "0000091149"
"0000059902" "0000091150"
"0000059903" "0000091151"
"0000080904" "0000129972"
"0000080904" "0000129973"
"0000100505" "0000735194"
"0000152647" "0000351488"
"0000152679" "0000351508"
"0000152679" "0000351509"
"0000152681" "0000351511"
"0000152681" "0000351512"
"0000152682" "0000351513"
"0000152682" "0000351514"
"0000152683" "0000351510"
"0000152683" "0000351515"
"0000152683" "0000351516"
"0000152684" "0000351517"
"0000152685" "0000351520"
"0000152686" "0000351522"
"0000152687" "0000351523"
"0000294067" "0000650756"
"0000294068" "0000650757"
"0000305977" "0000669665"
"0000309742" "0000684615"
"0000329462" "0000713585"
"0000329507" "0000713630"
"0000332844" "0000730132"
"0000332844" "0000730225"
"0000335032" "0000733041"
"0000336309" "0000735584"
"0000336309" "0000735711"
"0000377989" "0000790602"
"0000381366" "0000794781"
"0000381437" "0000794895"
"0000388729" "0000817480"
"0000391399" "0000821148"
"0000391400" "0000821149"
"0000405303" "0000841381"
"0000405311" "0000841395"
"0000405311" "0000841396"
"0000409958" "0000847174"
"0000410201" "0000847466"
"0000410202" "0000847467"
"0000410203" "0000847468"
"0000410204" "0000847469"
"0000410222" "0000847491"
"0000410223" "0000847492"
"0000410224" "0000847493"
"0000410225" "0000847494"
"0000410226" "0000847495"
"0000432412" "0000917879"
"0000432412" "0000917891"
"0000432413" "0000917880"
"0000432413" "0000917892"
"0000432414" "0000917881"
"0000432415" "0000917882"
"0000432416" "0000917883"
"0000432416" "0000917893"
"0000432417" "0000917884"
"0000432417" "0000917894"
"0000435597" "0000921667"
"0000435598" "0000921698"
"0000435599" "0000921723"
"0000449121" "0000958888"
"0000449121" "0000959326"