### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = ADAMTS2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "ADAMTS2" "ADAM metallopeptidase with thrombospondin type 1 motif, 2" "5" "q35.3" "unknown" "NG_023212.3" "UD_132118305071" "" "https://www.LOVD.nl/ADAMTS2" "" "1" "218" "9509" "604539" "1" "1" "1" "1" "Establishment of the database was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "https://databases.lovd.nl/shared/refseq/ADAMTS2_codingDNA.html" "1" "" "

Ehlers Danlos Syndrome Variant Database

\r\n\r\n\r\n
\r\n
\r\n
" "-1" "" "-1" "00000" "2012-09-13 00:00:00" "00085" "2024-02-13 13:58:54" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001306" "ADAMTS2" "transcript variant 1" "001" "NM_014244.4" "" "NP_055059.2" "" "" "" "-102" "6652" "3636" "178537852" "178772431" "00000" "2012-09-13 13:24:58" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 4 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00169" "EDS" "Ehlers-Danlos syndrome (EDS)" "" "" "" "" "" "00006" "2013-08-01 11:03:44" "00006" "2021-12-10 21:51:32" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01769" "EDSDERMS" "Ehlers-Danlos syndrome, dermatosparaxis type" "AR" "225410" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "ADAMTS2" "00169" "ADAMTS2" "01769" ## Individuals ## Do not remove or alter this header ## ## Count = 26 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00293828" "" "" "" "28" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293829" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293830" "" "" "" "19" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00318169" "" "" "" "1" "" "01819" "{PMID:Van Damme et al., 2016:26765342}" "" "" "" "" "" "0" "" "" "" "" "00318170" "" "" "" "1" "" "00085" "{PMID:Bo et al., 2020:31939527}" "The patient was diagnosed with situs inversus totalis, and idiopathic thrombocytopenia purpura. The variant was described in the paper as an insertion at c.123_124, but is in fact a duplication of c.102_123. It was detected via exome sequencing, and thus the authors were uncertain if the patient had compound heterogeneity for another variant in ADAMTS2. The technique used was whole exome sequencing." "" "" "" "" "0" "" "" "" "" "00318171" "" "" "" "1" "" "00085" "{PMID:Chen et al., 2020:32095376}" "This deleterious SNP is highly associated with intracranial aneurysm. The technique used was whole exome sequencing. The technique used was whole genome sequencing." "" "" "China" "" "0" "" "" "Han Chinese" "" "00318172" "" "" "" "1" "" "00085" "{PMID:Colige et al., 2004:15373769}" "This patient was subsequently described by {PMID:Malfait et al., 2004:15389701}. The exact boundaries of the maternal deletion were not determined." "" "" "" "" "0" "" "" "white" "P8" "00318173" "" "" "" "1" "" "00085" "{PMID:Colige et al., 2004:15373769}" "This patient was subsequently described by {PMID:Malfait et al., 2004:15389701}. The exact boundaries of the deletion variant were not determined." "" "" "" "" "0" "" "" "white" "P7" "00318174" "" "" "" "1" "" "00085" "{PMID:Colige et al., 1999:10417273}" "" "" "" "" "" "0" "" "" "Jewish-Ashkenazi" "Patient 6" "00318175" "" "" "" "1" "" "00085" "{PMID:Colige et al., 1999:10417273}" "This patient was previously described by {PMID:Smith et al., 1992:1642226}." "" "" "" "" "0" "" "" "" "Patient 2" "00318176" "" "" "" "1" "" "00085" "{PMID:Colige et al., 1999:10417273}" "This patient was previously described by {PMID8215497:Petty et al., 1993}." "" "" "" "" "0" "" "" "" "Patient 3" "00318177" "" "" "" "1" "" "00085" "{PMID:Colige et al., 1999:10417273}" "This patient was previously described by {PMID8986271:Fujimoto et al., 1997}." "" "" "Mexico" "" "0" "" "" "Mexican" "Patient 4" "00318178" "" "" "" "1" "" "00085" "{PMID:Colige et al., 1999:10417273}" "This patient was previously described by {PMID7735500:Reardon et al., 1995}." "" "" "United Kingdom (Great Britain)" "" "0" "" "" "British" "Patient 5" "00318179" "" "" "" "1" "" "00085" "{PMID:Bar-Yosef et al., 2008:18973246}" "This variant is later described in {PMID29795570:Rivas et al., 2018} as a variant significantly enriched in the Ashkenazi Jewish population, with further detail." "" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00318180" "" "" "" "1" "" "00085" "{PMID:Matullo et al., 2013:23626673}" "This variant is significantly associated with malignant pleural mesothelioma, a condition caused by exposure to asbestos with genetic components. The technique used was whole genome sequencing." "" "" "Italy" "" "0" "" "" "" "" "00318181" "" "" "" "1" "" "00085" "{PMID:Iglesias et al., 2018:29760442}" "This variant is associated with central corneal thickness, derived from a meta-analysis of GWAS. It has an average population frequency of 0.29 in Europeans and 0.11 in an Asian population. The technique used was whole genome sequencing." "" "" "" "" "0" "" "" "" "" "00318182" "" "" "" "1" "" "00085" "{PMID:Arning et al., 2012:22990015}" "This SNP is highly associated with pediatric stroke. The technique used was whole genome sequencing." "" "" "" "" "0" "" "" "" "" "00318183" "" "" "" "1" "" "01819" "{PMID:Van Damme et al., 2016:26765342}" "" "" "" "" "" "0" "" "" "" "" "00318184" "" "" "" "1" "" "00085" "{PMID:Colige et al., 1999:10417273}" "This patient was previously descibed by {PMID:Nusgens et al., 1992:1303238} and subsequently by {PMID:Malfait et al., 2004:15389701} and in {PMID:De Coster et al., 2006:17118335}" "" "" "" "" "0" "" "" "white" "Patient 1" "00318185" "" "" "" "1" "" "00085" "{PMID:Solomons et al., 2013:23495203}" "The parents of this patient are first cousins with no family history of the disease." "" "" "Pakistan" "" "0" "" "" "Pakistani" "" "00318186" "" "" "" "1" "" "01819" "{PMID:Van Damme et al., 2016:26765342}" "" "" "" "" "" "0" "" "" "" "" "00318187" "" "" "" "1" "" "01819" "{PMID:Van Damme et al., 2016:26765342}" "" "" "" "" "" "0" "" "" "" "" "00318188" "" "" "" "1" "" "00085" "{PMID:Chen et al., 2020:32095376}" "This deleterious SNP is highly associated with intracranial aneurysms. The technique used was whole exome sequencing. The technique used was whole genome sequencing." "" "" "China" "" "0" "" "" "Han Chinese" "" "00318189" "" "" "" "1" "" "00085" "{PMID:van der Wekken et al., 2017:28854272}" "This variant is associated with afatinib-resistance in non-small cell lung carcinoma (NSCLC) patients that have been previously treated with geftinib or erlotinib, and subsequently with afatinib. The variant has a CADD score of 40, and is highly deleterious.The technique used was whole exome sequencing." "" "" "" "" "0" "" "" "" "Patient 4" "00359337" "" "" "" "1" "" "04027" "Invitae Diagnostic Testing" "" "F" "" "United States" "" "" "" "" "Hispanic, white" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 40 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00293828" "00198" "00293829" "00198" "00293830" "00198" "00318169" "00169" "00318169" "01769" "00318170" "00198" "00318171" "00198" "00318172" "00169" "00318172" "01769" "00318173" "00169" "00318173" "01769" "00318174" "00169" "00318174" "01769" "00318175" "00169" "00318175" "01769" "00318176" "00169" "00318176" "01769" "00318177" "00169" "00318177" "01769" "00318178" "00169" "00318178" "01769" "00318179" "00169" "00318179" "01769" "00318180" "00198" "00318181" "00198" "00318182" "00198" "00318183" "00169" "00318183" "01769" "00318184" "00169" "00318184" "01769" "00318185" "00169" "00318185" "01769" "00318186" "00169" "00318186" "01769" "00318187" "00169" "00318187" "01769" "00318188" "00198" "00318189" "00198" "00359337" "00169" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00169, 00198, 01157, 01769 ## Count = 4 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Hearing/Problems}}" "{{Phenotype/Enzyme/CreatineKinase}}" "{{Phenotype/Muscle/Electromyography}}" "{{Phenotype/Muscle/Biopsy}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "" "" "" "" "3w" "" "" "" "" "" "" "" "" "" "0000241835" "00198" "00318171" "00085" "-" "" "Distal aneurysms and dissections," "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000241836" "00198" "00318188" "00085" "-" "" "Distal aneurysms and dissections," "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000254633" "00169" "00359337" "04027" "Familial, autosomal recessive" ">54y" "" "" "" "" "" "" "" "" "" "" "" "" "" "EDS VIIC" "? EDS" "" ## Screenings ## Do not remove or alter this header ## ## Count = 26 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000294996" "00293828" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294997" "00293829" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294998" "00293830" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000319351" "00318169" "1" "01819" "01819" "2015-07-31 10:21:53" "00085" "2016-01-18 16:34:30" "PCR;SEQ" "DNA" "" "" "0000319352" "00318170" "1" "00085" "00085" "2020-05-11 16:38:18" "00085" "2020-05-11 16:39:24" "SEQ-NG" "DNA" "" "" "0000319353" "00318171" "1" "00085" "00085" "2020-05-05 15:25:45" "00085" "2020-05-05 15:26:02" "SEQ-NG;SEQ-NG" "DNA" "" "" "0000319354" "00318172" "1" "00085" "00085" "2013-11-11 22:46:03" "00085" "2013-11-13 13:07:10" "PCR;SEQ" "DNA" "" "" "0000319355" "00318173" "1" "00085" "00085" "2013-11-11 22:35:18" "00085" "2013-11-13 13:44:46" "PCR;SEQ" "DNA" "" "" "0000319356" "00318174" "1" "00085" "00085" "2013-11-05 13:11:48" "" "" "PCR;SEQ" "DNA" "" "" "0000319357" "00318175" "1" "00085" "00085" "2013-11-10 22:53:15" "00085" "2013-11-10 22:55:00" "SEQ" "DNA" "" "" "0000319358" "00318176" "1" "00085" "00085" "2013-11-10 23:04:38" "" "" "SEQ" "DNA" "" "" "0000319359" "00318177" "1" "00085" "00085" "2013-11-10 23:17:40" "" "" "SEQ" "DNA" "" "" "0000319360" "00318178" "1" "00085" "00085" "2013-11-10 23:22:45" "" "" "SEQ" "DNA" "" "" "0000319361" "00318179" "1" "00085" "00085" "2013-11-12 15:56:20" "00085" "2020-05-13 15:09:40" "SEQ" "DNA" "" "" "0000319362" "00318180" "1" "00085" "00085" "2020-05-05 12:10:09" "" "" "SEQ-NG" "DNA" "" "" "0000319363" "00318181" "1" "00085" "00085" "2020-05-04 16:44:46" "00085" "2020-05-04 16:44:58" "SEQ-NG" "DNA" "" "" "0000319364" "00318182" "1" "00085" "00085" "2020-05-05 17:16:29" "" "" "SEQ-NG" "DNA" "" "" "0000319365" "00318183" "1" "01819" "01819" "2015-07-31 10:29:29" "00085" "2016-01-18 16:35:15" "PCR;SEQ" "DNA" "" "" "0000319366" "00318184" "1" "00085" "00085" "2013-11-01 15:59:43" "00085" "2020-04-30 15:48:27" "PCR;SEQ" "DNA" "" "" "0000319367" "00318185" "1" "00085" "00085" "2013-11-12 16:04:25" "" "" "PCR;SEQ" "DNA" "" "" "0000319368" "00318186" "1" "01819" "01819" "2015-07-31 10:35:35" "00085" "2016-01-18 16:36:06" "PCR;SEQ" "DNA" "" "" "0000319369" "00318187" "1" "01819" "01819" "2015-07-31 10:11:47" "00085" "2016-01-18 16:36:25" "PCR;SEQ" "DNA" "" "" "0000319370" "00318188" "1" "00085" "00085" "2020-05-05 15:30:17" "" "" "SEQ-NG;SEQ-NG" "DNA" "" "" "0000319371" "00318189" "1" "00085" "00085" "2020-05-06 18:00:47" "" "" "SEQ-NG" "DNA" "" "" "0000360579" "00359337" "1" "04027" "04027" "2021-03-19 16:28:59" "" "" "?" "?" "saliva sample" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 22 "{{screeningid}}" "{{geneid}}" "0000319351" "ADAMTS2" "0000319352" "ADAMTS2" "0000319353" "ADAMTS2" "0000319354" "ADAMTS2" "0000319355" "ADAMTS2" "0000319356" "ADAMTS2" "0000319357" "ADAMTS2" "0000319358" "ADAMTS2" "0000319359" "ADAMTS2" "0000319360" "ADAMTS2" "0000319361" "ADAMTS2" "0000319362" "ADAMTS2" "0000319363" "ADAMTS2" "0000319364" "ADAMTS2" "0000319365" "ADAMTS2" "0000319366" "ADAMTS2" "0000319367" "ADAMTS2" "0000319368" "ADAMTS2" "0000319369" "ADAMTS2" "0000319370" "ADAMTS2" "0000319371" "ADAMTS2" "0000360579" "ADAMTS2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 119 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000004264" "3" "50" "5" "178551299" "178551299" "subst" "0" "00037" "ADAMTS2_000061" "g.178551299T>G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.179124298T>G" "" "VUS" "" "0000248300" "0" "10" "5" "178770981" "178770981" "subst" "0.409911" "02325" "ADAMTS2_000035" "g.178770981A>G" "" "" "" "ADAMTS2(NM_014244.5):c.321T>C (p.S107=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179343980A>G" "" "benign" "" "0000248329" "0" "10" "5" "178567054" "178567054" "subst" "0.270146" "02325" "ADAMTS2_000076" "g.178567054A>G" "" "" "" "ADAMTS2(NM_014244.5):c.1630-18T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179140053A>G" "" "benign" "" "0000250035" "0" "10" "5" "178770981" "178770981" "subst" "0.409911" "02329" "ADAMTS2_000035" "g.178770981A>G" "" "" "" "ADAMTS2(NM_014244.5):c.321T>C (p.S107=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179343980A>G" "" "benign" "" "0000250064" "0" "10" "5" "178567054" "178567054" "subst" "0.270146" "02329" "ADAMTS2_000076" "g.178567054A>G" "" "" "" "ADAMTS2(NM_014244.5):c.1630-18T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179140053A>G" "" "benign" "" "0000250378" "0" "30" "5" "178772262" "178772262" "subst" "0" "02329" "ADAMTS2_000039" "g.178772262A>G" "" "" "" "ADAMTS2(NM_014244.5):c.68T>C (p.L23P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179345261A>G" "" "likely benign" "" "0000250400" "0" "30" "5" "178559254" "178559254" "subst" "0.000804237" "02329" "ADAMTS2_000072" "g.178559254A>G" "" "" "" "ADAMTS2(NM_014244.5):c.2267T>C (p.V756A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179132253A>G" "" "likely benign" "" "0000258939" "0" "10" "5" "178581859" "178581859" "subst" "0.265011" "02325" "ADAMTS2_000023" "g.178581859G>A" "" "" "" "ADAMTS2(NM_014244.5):c.1194C>T (p.D398=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179154858G>A" "" "benign" "" "0000258940" "0" "10" "5" "178581797" "178581797" "subst" "0.262773" "02325" "ADAMTS2_000022" "g.178581797C>T" "" "" "" "ADAMTS2(NM_014244.5):c.1238+18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179154796C>T" "" "benign" "" "0000258941" "0" "10" "5" "178549791" "178549791" "subst" "0.282056" "02325" "ADAMTS2_000065" "g.178549791G>A" "" "" "" "ADAMTS2(NM_014244.5):c.2959-17C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179122790G>A" "" "benign" "" "0000258942" "0" "10" "5" "178540975" "178540975" "subst" "0.30894" "02325" "ADAMTS2_000062" "g.178540975G>A" "" "" "" "ADAMTS2(NM_014244.5):c.3529C>T (p.P1177S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179113974G>A" "" "benign" "" "0000258943" "0" "10" "5" "178770759" "178770759" "subst" "0.407225" "02325" "ADAMTS2_000033" "g.178770759C>G" "" "" "" "ADAMTS2(NM_014244.5):c.534+9G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179343758C>G" "" "benign" "" "0000258944" "0" "10" "5" "178634683" "178634683" "subst" "0.0876322" "02325" "ADAMTS2_000030" "g.178634683C>T" "" "" "" "ADAMTS2(NM_014244.5):c.722G>A (p.R241H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179207682C>T" "" "benign" "" "0000258945" "0" "10" "5" "178634619" "178634619" "subst" "0.933241" "02325" "ADAMTS2_000027" "g.178634619C>T" "" "" "" "ADAMTS2(NM_014244.5):c.786G>A (p.A262=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179207618C>T" "" "benign" "" "0000259968" "0" "10" "5" "178581859" "178581859" "subst" "0.265011" "02329" "ADAMTS2_000023" "g.178581859G>A" "" "" "" "ADAMTS2(NM_014244.5):c.1194C>T (p.D398=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179154858G>A" "" "benign" "" "0000259969" "0" "10" "5" "178581797" "178581797" "subst" "0.262773" "02329" "ADAMTS2_000022" "g.178581797C>T" "" "" "" "ADAMTS2(NM_014244.5):c.1238+18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179154796C>T" "" "benign" "" "0000259970" "0" "10" "5" "178581151" "178581151" "subst" "0.00671188" "02329" "ADAMTS2_000021" "g.178581151G>A" "" "" "" "ADAMTS2(NM_014244.5):c.1281C>T (p.D427=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179154150G>A" "" "benign" "" "0000259971" "0" "30" "5" "178581124" "178581124" "subst" "0.00256644" "02329" "ADAMTS2_000020" "g.178581124C>T" "" "" "" "ADAMTS2(NM_014244.5):c.1308G>A (p.A436=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179154123C>T" "" "likely benign" "" "0000259972" "0" "30" "5" "178580519" "178580519" "subst" "0.00210283" "02329" "ADAMTS2_000079" "g.178580519G>A" "" "" "" "ADAMTS2(NM_014244.4):c.1488C>T (p.F496=), ADAMTS2(NM_014244.5):c.1488C>T (p.F496=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179153518G>A" "" "likely benign" "" "0000259973" "0" "30" "5" "178580474" "178580474" "subst" "0" "02329" "ADAMTS2_000078" "g.178580474G>A" "" "" "" "ADAMTS2(NM_014244.5):c.1515+18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179153473G>A" "" "likely benign" "" "0000259974" "0" "10" "5" "178579134" "178579134" "subst" "0.00803672" "02329" "ADAMTS2_000077" "g.178579134C>T" "" "" "" "ADAMTS2(NM_014244.5):c.1629+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179152133C>T" "" "benign" "" "0000259975" "0" "10" "5" "178564813" "178564813" "subst" "0.00638463" "02329" "ADAMTS2_000075" "g.178564813G>A" "" "" "" "ADAMTS2(NM_014244.5):c.1908C>T (p.H636=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179137812G>A" "" "benign" "" "0000259976" "0" "10" "5" "178563002" "178563002" "subst" "0.00777556" "02329" "ADAMTS2_000074" "g.178563002C>T" "" "" "" "ADAMTS2(NM_014244.5):c.1993G>A (p.G665R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179136001C>T" "" "benign" "" "0000259977" "0" "10" "5" "178562967" "178562967" "subst" "0.223417" "02329" "ADAMTS2_000073" "g.178562967G>A" "" "" "" "ADAMTS2(NM_014244.5):c.2028C>T (p.D676=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179135966G>A" "" "benign" "" "0000259978" "0" "10" "5" "178557107" "178557107" "subst" "0.0579981" "02329" "ADAMTS2_000071" "g.178557107T>C" "" "" "" "ADAMTS2(NM_014244.5):c.2291-8A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179130106T>C" "" "benign" "" "0000259979" "0" "10" "5" "178555097" "178555097" "subst" "0.0261542" "02329" "ADAMTS2_000070" "g.178555097C>T" "" "" "" "ADAMTS2(NM_014244.5):c.2480G>A (p.R827Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179128096C>T" "" "benign" "" "0000259980" "0" "10" "5" "178555045" "178555045" "subst" "0.206998" "02329" "ADAMTS2_000069" "g.178555045G>A" "" "" "" "ADAMTS2(NM_014244.5):c.2532C>T (p.D844=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179128044G>A" "" "benign" "" "0000259981" "0" "50" "5" "178553044" "178553044" "subst" "8.12916E-6" "02329" "ADAMTS2_000068" "g.178553044T>C" "" "" "" "ADAMTS2(NM_014244.5):c.2705A>G (p.K902R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179126043T>C" "" "VUS" "" "0000259982" "0" "10" "5" "178553019" "178553019" "subst" "0.00916159" "02329" "ADAMTS2_000067" "g.178553019T>C" "" "" "" "ADAMTS2(NM_014244.5):c.2730A>G (p.P910=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179126018T>C" "" "benign" "" "0000259983" "0" "30" "5" "178552137" "178552137" "subst" "0.00118615" "02329" "ADAMTS2_000066" "g.178552137C>T" "" "" "" "ADAMTS2(NM_014244.4):c.2795G>A (p.R932Q), ADAMTS2(NM_014244.5):c.2795G>A (p.R932Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179125136C>T" "" "likely benign" "" "0000259984" "0" "30" "5" "178549790" "178549790" "subst" "0.00660588" "02329" "ADAMTS2_000064" "g.178549790C>T" "" "" "" "ADAMTS2(NM_014244.5):c.2959-16G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179122789C>T" "" "likely benign" "" "0000259985" "0" "10" "5" "178549791" "178549791" "subst" "0.282056" "02329" "ADAMTS2_000065" "g.178549791G>A" "" "" "" "ADAMTS2(NM_014244.5):c.2959-17C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179122790G>A" "" "benign" "" "0000259986" "0" "10" "5" "178541024" "178541024" "subst" "0.00242011" "02329" "ADAMTS2_000063" "g.178541024G>T" "" "" "" "ADAMTS2(NM_014244.5):c.3480C>A (p.A1160=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179114023G>T" "" "benign" "" "0000259987" "0" "10" "5" "178540975" "178540975" "subst" "0.30894" "02329" "ADAMTS2_000062" "g.178540975G>A" "" "" "" "ADAMTS2(NM_014244.5):c.3529C>T (p.P1177S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179113974G>A" "" "benign" "" "0000259988" "0" "30" "5" "178770897" "178770897" "subst" "9.19236E-6" "02329" "ADAMTS2_000034" "g.178770897G>A" "" "" "" "ADAMTS2(NM_014244.5):c.405C>T (p.A135=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179343896G>A" "" "likely benign" "" "0000259989" "0" "10" "5" "178770759" "178770759" "subst" "0.407225" "02329" "ADAMTS2_000033" "g.178770759C>G" "" "" "" "ADAMTS2(NM_014244.5):c.534+9G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179343758C>G" "" "benign" "" "0000259990" "0" "30" "5" "178772283" "178772285" "del" "0" "02329" "ADAMTS2_000038" "g.178772283_178772285del" "" "" "" "ADAMTS2(NM_014244.5):c.68_70del (p.(Leu23del)), ADAMTS2(NM_014244.5):c.68_70delTGC (p.L23del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179345282_179345284del" "" "likely benign" "" "0000259992" "0" "30" "5" "178634734" "178634734" "subst" "0.00170563" "02329" "ADAMTS2_000032" "g.178634734C>T" "" "" "" "ADAMTS2(NM_014244.5):c.689-18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179207733C>T" "" "likely benign" "" "0000259993" "0" "10" "5" "178634704" "178634704" "subst" "0.00776276" "02329" "ADAMTS2_000031" "g.178634704T>C" "" "" "" "ADAMTS2(NM_014244.5):c.701A>G (p.D234G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179207703T>C" "" "benign" "" "0000259994" "0" "10" "5" "178634683" "178634683" "subst" "0.0876322" "02329" "ADAMTS2_000030" "g.178634683C>T" "" "" "" "ADAMTS2(NM_014244.5):c.722G>A (p.R241H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179207682C>T" "" "benign" "" "0000259995" "0" "30" "5" "178634641" "178634641" "subst" "0.00199092" "02329" "ADAMTS2_000029" "g.178634641C>T" "" "" "" "ADAMTS2(NM_014244.5):c.764G>A (p.R255Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179207640C>T" "" "likely benign" "" "0000259996" "0" "10" "5" "178634619" "178634619" "subst" "0.933241" "02329" "ADAMTS2_000027" "g.178634619C>T" "" "" "" "ADAMTS2(NM_014244.5):c.786G>A (p.A262=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179207618C>T" "" "benign" "" "0000259998" "0" "10" "5" "178634547" "178634547" "subst" "0.167151" "02329" "ADAMTS2_000026" "g.178634547G>A" "" "" "" "ADAMTS2(NM_014244.5):c.858C>T (p.H286=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179207546G>A" "" "benign" "" "0000259999" "0" "30" "5" "178634505" "178634505" "subst" "1.65161E-5" "02329" "ADAMTS2_000025" "g.178634505C>T" "" "" "" "ADAMTS2(NM_014244.5):c.891+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179207504C>T" "" "likely benign" "" "0000260000" "0" "10" "5" "178608112" "178608112" "subst" "0.0270211" "02329" "ADAMTS2_000024" "g.178608112G>A" "" "" "" "ADAMTS2(NM_014244.5):c.936C>T (p.N312=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179181111G>A" "" "benign" "" "0000330781" "0" "50" "5" "178634632" "178634632" "subst" "2.03117E-5" "01804" "ADAMTS2_000028" "g.178634632C>T" "" "" "" "ADAMTS2(NM_014244.4):c.773G>A (p.(Arg258His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.179207631C>T" "" "VUS" "" "0000525376" "0" "10" "5" "178541225" "178541225" "subst" "0.00184557" "02329" "ADAMTS2_000040" "g.178541225A>G" "" "" "" "ADAMTS2(NM_014244.5):c.3279T>C (p.C1093=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179114224A>G" "" "benign" "" "0000525377" "0" "30" "5" "178553151" "178553151" "subst" "2.03656E-5" "02329" "ADAMTS2_000041" "g.178553151C>T" "" "" "" "ADAMTS2(NM_014244.5):c.2618-20G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179126150C>T" "" "likely benign" "" "0000525378" "0" "30" "5" "178559249" "178559249" "subst" "0.00044278" "02329" "ADAMTS2_000042" "g.178559249C>T" "" "" "" "ADAMTS2(NM_014244.5):c.2272G>A (p.A758T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179132248C>T" "" "likely benign" "" "0000525380" "0" "10" "5" "178564918" "178564918" "subst" "0.00185476" "01943" "ADAMTS2_000043" "g.178564918C>T" "" "" "" "ADAMTS2(NM_014244.4):c.1803G>A (p.S601=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179137917C>T" "" "benign" "" "0000525381" "0" "30" "5" "178580519" "178580519" "subst" "0.00210283" "01943" "ADAMTS2_000079" "g.178580519G>A" "" "" "" "ADAMTS2(NM_014244.4):c.1488C>T (p.F496=), ADAMTS2(NM_014244.5):c.1488C>T (p.F496=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179153518G>A" "" "likely benign" "" "0000525382" "0" "10" "5" "178580549" "178580549" "subst" "0.00421404" "02329" "ADAMTS2_000044" "g.178580549G>A" "" "" "" "ADAMTS2(NM_014244.5):c.1458C>T (p.Y486=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179153548G>A" "" "benign" "" "0000525383" "0" "30" "5" "178585734" "178585734" "subst" "0.000235552" "02329" "ADAMTS2_000045" "g.178585734G>A" "" "" "" "ADAMTS2(NM_014244.5):c.1122C>T (p.S374=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179158733G>A" "" "likely benign" "" "0000525384" "0" "50" "5" "178585769" "178585769" "subst" "8.12183E-6" "01943" "ADAMTS2_000046" "g.178585769C>T" "" "" "" "ADAMTS2(NM_014244.4):c.1087G>A (p.A363T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179158768C>T" "" "VUS" "" "0000525385" "0" "30" "5" "178585773" "178585773" "subst" "0.000300505" "02329" "ADAMTS2_000047" "g.178585773A>G" "" "" "" "ADAMTS2(NM_014244.5):c.1083T>C (p.D361=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179158772A>G" "" "likely benign" "" "0000525386" "0" "50" "5" "178585865" "178585865" "subst" "0.00015445" "01943" "ADAMTS2_000048" "g.178585865C>T" "" "" "" "ADAMTS2(NM_014244.4):c.991G>A (p.E331K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179158864C>T" "" "VUS" "" "0000525387" "0" "10" "5" "178634672" "178634672" "subst" "0.349613" "02325" "ADAMTS2_000049" "g.178634672C>T" "" "" "" "ADAMTS2(NM_014244.5):c.733G>A (p.V245I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179207671C>T" "" "benign" "" "0000525388" "0" "10" "5" "178634672" "178634672" "subst" "0.349613" "02329" "ADAMTS2_000049" "g.178634672C>T" "" "" "" "ADAMTS2(NM_014244.5):c.733G>A (p.V245I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179207671C>T" "" "benign" "" "0000525389" "0" "30" "5" "178772187" "178772187" "subst" "0" "01943" "ADAMTS2_000050" "g.178772187C>T" "" "" "" "ADAMTS2(NM_014244.4):c.139+4G>A, ADAMTS2(NM_014244.5):c.139+4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179345186C>T" "" "likely benign" "" "0000525390" "0" "30" "5" "178772241" "178772261" "dup" "0" "02329" "ADAMTS2_000051" "g.178772241_178772261dup" "" "" "" "ADAMTS2(NM_014244.5):c.80_100dupTCCTGCCGCCGCCGCCGCCGC (p.L27_P33dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179345240_179345260dup" "" "likely benign" "" "0000525391" "0" "30" "5" "178772280" "178772285" "dup" "0" "02329" "ADAMTS2_000052" "g.178772280_178772285dup" "" "" "" "ADAMTS2(NM_014244.5):c.65_70dupTGCTGC (p.L22_L23dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179345279_179345284dup" "" "likely benign" "" "0000525392" "0" "10" "5" "178772283" "178772285" "dup" "0" "02329" "ADAMTS2_000053" "g.178772283_178772285dup" "" "" "" "ADAMTS2(NM_014244.5):c.68_70dupTGC (p.L23dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179345282_179345284dup" "" "benign" "" "0000621546" "0" "30" "5" "178552137" "178552137" "subst" "0.00118615" "01943" "ADAMTS2_000066" "g.178552137C>T" "" "" "" "ADAMTS2(NM_014244.4):c.2795G>A (p.R932Q), ADAMTS2(NM_014244.5):c.2795G>A (p.R932Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179125136C>T" "" "likely benign" "" "0000621548" "0" "30" "5" "178634607" "178634607" "subst" "0.000292464" "01943" "ADAMTS2_000054" "g.178634607G>A" "" "" "" "ADAMTS2(NM_014244.4):c.798C>T (p.Y266=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179207606G>A" "" "likely benign" "" "0000651685" "1" "30" "5" "178555097" "178555097" "subst" "0.0261542" "03575" "ADAMTS2_000070" "g.178555097C>T" "28/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "28 heterozygous, no homozygous; {DB:CLININrs35445112}" "Germline" "" "rs35445112" "0" "" "" "g.179128096C>T" "" "likely benign" "" "0000651686" "1" "50" "5" "178562980" "178562980" "subst" "0.000190947" "03575" "ADAMTS2_000055" "g.178562980C>A" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs200806292}" "Germline" "" "rs200806292" "0" "" "" "g.179135979C>A" "" "VUS" "" "0000651687" "1" "50" "5" "178771082" "178771082" "subst" "0.00174354" "03575" "ADAMTS2_000014" "g.178771082C>T" "19/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 19 heterozygous, no homozygous; {DB:CLININrs2271211}" "Germline" "" "rs2271211" "0" "" "" "g.179344081C>T" "" "VUS" "" "0000655362" "0" "30" "5" "178551544" "178551544" "subst" "0" "02329" "ADAMTS2_000057" "g.178551544T>C" "" "" "" "ADAMTS2(NM_014244.5):c.2958+430A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.179124543T>C" "" "likely benign" "" "0000677490" "0" "30" "5" "178634673" "178634673" "subst" "0.000146514" "02329" "ADAMTS2_000058" "g.178634673G>A" "" "" "" "ADAMTS2(NM_014244.5):c.732C>T (p.G244=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000702059" "11" "99" "5" "178772328" "178772328" "subst" "0" "01819" "ADAMTS2_000008" "g.178772328A>G" "" "{PMID:Van Damme et al., 2016:26765342}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702060" "0" "11" "5" "178772207" "178772228" "dup" "0" "00085" "ADAMTS2_000018" "g.178772207_178772228dup" "" "{PMID:Bo et al., 2020:31939527}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely benign" "" "0000702061" "0" "11" "5" "178771082" "178771082" "subst" "0.00174354" "00085" "ADAMTS2_000014" "g.178771082C>T" "" "{PMID:Chen et al., 2020:32095376}" "" "" "" "Unknown" "" "rs2271211" "0" "" "" "" "" "likely benign" "" "0000702062" "21" "99" "5" "178699912" "178700065" "del" "0" "00085" "ADAMTS2_000005" "g.178699912_178700065del" "" "{PMID:Colige et al., 2004:15373769}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702063" "3" "99" "5" "178608073" "178700065" "del" "0" "00085" "ADAMTS2_000003" "g.178608073_178700065del" "" "{PMID:Colige et al., 2004:15373769}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702064" "3" "99" "5" "178699927" "178699927" "subst" "0.000152207" "00085" "ADAMTS2_000002" "g.178699927G>A" "" "{PMID:Colige et al., 1999:10417273}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702065" "3" "99" "5" "178699927" "178699927" "subst" "0.000152207" "00085" "ADAMTS2_000002" "g.178699927G>A" "" "{PMID:Colige et al., 1999:10417273}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702066" "3" "99" "5" "178699927" "178699927" "subst" "0.000152207" "00085" "ADAMTS2_000002" "g.178699927G>A" "" "{PMID:Colige et al., 1999:10417273}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702067" "3" "99" "5" "178699927" "178699927" "subst" "0.000152207" "00085" "ADAMTS2_000002" "g.178699927G>A" "" "{PMID:Colige et al., 1999:10417273}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702068" "3" "99" "5" "178699927" "178699927" "subst" "0.000152207" "00085" "ADAMTS2_000002" "g.178699927G>A" "" "{PMID:Colige et al., 1999:10417273}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702069" "3" "99" "5" "178699927" "178699927" "subst" "0.000152207" "00085" "ADAMTS2_000002" "g.178699927G>A" "" "{PMID:Bar-Yosef et al., 2008:18973246}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702070" "0" "33" "5" "178674076" "178674076" "subst" "0" "00085" "ADAMTS2_000013" "g.178674076A>G" "" "{PMID:Matullo et al., 2013:23626673}" "" "" "" "Unknown" "" "rs4701085" "0" "" "" "" "" "benign" "" "0000702071" "0" "33" "5" "178671143" "178671143" "dup" "0" "00085" "ADAMTS2_000012" "g.178671143dup" "" "{PMID:Iglesias et al., 2018:29760442}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "benign" "" "0000702072" "0" "11" "5" "178663408" "178663408" "subst" "0" "00085" "ADAMTS2_000016" "g.178663408A>C" "" "{PMID:Arning et al., 2012:22990015}" "" "" "" "Unknown" "" "rs469568" "0" "" "" "" "" "likely benign" "" "0000702073" "3" "99" "5" "178699930" "178699931" "dup" "0" "01819" "ADAMTS2_000010" "g.178699930_178699931dup" "" "{PMID:Van Damme et al., 2016:26765342}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702074" "21" "99" "5" "178634518" "178634521" "del" "0" "01819" "ADAMTS2_000009" "g.178634518_178634521del" "" "{PMID:Van Damme et al., 2016:26765342}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702075" "11" "99" "5" "178555597" "178561488" "delins" "0" "00085" "ADAMTS2_000004" "g.178555597_178561488delinsGGA" "" "{PMID:Colige et al., 2004:15373769}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702076" "3" "99" "5" "178557006" "178557006" "subst" "0" "00085" "ADAMTS2_000001" "g.178557006C>T" "" "{PMID:Colige et al., 1999:10417273}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702077" "3" "99" "5" "178555119" "178555125" "del" "0" "00085" "ADAMTS2_000006" "g.178555119_178555125del" "" "{PMID:Solomons et al., 2013:23495203}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702078" "3" "99" "5" "178552183" "178552183" "subst" "0" "01819" "ADAMTS2_000011" "g.178552183T>A" "" "{PMID:Van Damme et al., 2016:26765342}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702079" "3" "99" "5" "178552004" "178552005" "del" "0" "01819" "ADAMTS2_000007" "g.178552004_178552005del" "" "{PMID:Van Damme et al., 2016:26765342}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000702080" "0" "11" "5" "178549705" "178549705" "subst" "4.02344E-5" "00085" "ADAMTS2_000015" "g.178549705C>T" "" "{PMID:Chen et al., 2020:32095376}" "" "" "" "Unknown" "" "rs368690576" "0" "" "" "" "" "likely benign" "" "0000702081" "0" "11" "5" "178548685" "178548685" "subst" "0" "00085" "ADAMTS2_000017" "g.178548685G>T" "" "{PMID:van der Wekken et al., 2017:28854272}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely benign" "" "0000760619" "0" "55" "5" "178559779" "178559779" "subst" "0" "04027" "ADAMTS2_000080" "g.178559779A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.179132778A>G" "" "VUS" "" "0000886783" "0" "30" "5" "178541162" "178541162" "subst" "0.000244332" "02329" "ADAMTS2_000081" "g.178541162G>A" "" "" "" "ADAMTS2(NM_014244.5):c.3342C>T (p.N1114=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000912301" "0" "30" "5" "178554964" "178554964" "subst" "0.000170701" "02329" "ADAMTS2_000082" "g.178554964G>A" "" "" "" "ADAMTS2(NM_014244.5):c.2613C>T (p.G871=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924321" "0" "10" "5" "178634497" "178634497" "subst" "0" "02329" "ADAMTS2_000083" "g.178634497T>C" "" "" "" "ADAMTS2(NM_014244.5):c.891+17A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000924322" "0" "30" "5" "178634499" "178634499" "subst" "0" "02329" "ADAMTS2_000084" "g.178634499A>C" "" "" "" "ADAMTS2(NM_014244.5):c.891+15T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924323" "0" "30" "5" "178700085" "178700085" "subst" "0.000183041" "02329" "ADAMTS2_000085" "g.178700085G>A" "" "" "" "ADAMTS2(NM_014244.5):c.535-20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929062" "0" "30" "5" "178772187" "178772187" "subst" "0" "02329" "ADAMTS2_000050" "g.178772187C>T" "" "" "" "ADAMTS2(NM_014244.4):c.139+4G>A, ADAMTS2(NM_014244.5):c.139+4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948539" "0" "30" "5" "178634503" "178634503" "subst" "0" "02329" "ADAMTS2_000086" "g.178634503A>C" "" "" "" "ADAMTS2(NM_014244.5):c.891+11T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000963579" "0" "30" "5" "178564807" "178564807" "subst" "0" "02329" "ADAMTS2_000087" "g.178564807G>A" "" "" "" "ADAMTS2(NM_014244.5):c.1914C>T (p.D638=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000963580" "0" "30" "5" "178578300" "178578300" "subst" "0" "02329" "ADAMTS2_000088" "g.178578300G>C" "" "" "" "ADAMTS2(NM_014244.5):c.1629+843C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000963581" "0" "30" "5" "178581675" "178581675" "subst" "0" "02329" "ADAMTS2_000089" "g.178581675G>A" "" "" "" "ADAMTS2(NM_014244.5):c.1238+140C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000963582" "0" "30" "5" "178634476" "178634476" "subst" "0" "02329" "ADAMTS2_000090" "g.178634476T>C" "" "" "" "ADAMTS2(NM_014244.5):c.891+38A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000963583" "0" "30" "5" "178634499" "178634500" "del" "0" "02329" "ADAMTS2_000091" "g.178634499_178634500del" "" "" "" "ADAMTS2(NM_014244.5):c.891+14_891+15delCT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000976750" "0" "30" "5" "178562961" "178562961" "subst" "2.43867E-5" "02329" "ADAMTS2_000092" "g.178562961C>T" "" "" "" "ADAMTS2(NM_014244.5):c.2034G>A (p.T678=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000976751" "0" "30" "5" "178578184" "178578184" "subst" "8.40642E-5" "02329" "ADAMTS2_000093" "g.178578184C>A" "" "" "" "ADAMTS2(NM_014244.5):c.1629+959G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000976752" "0" "30" "5" "178579488" "178579488" "subst" "0" "02329" "ADAMTS2_000094" "g.178579488G>A" "" "" "" "ADAMTS2(NM_014244.5):c.1516-232C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000976753" "0" "30" "5" "178581124" "178581124" "subst" "2.9109E-5" "02329" "ADAMTS2_000095" "g.178581124C>G" "" "" "" "ADAMTS2(NM_014244.5):c.1308G>C (p.A436=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000976754" "0" "30" "5" "178772283" "178772285" "del" "0" "01804" "ADAMTS2_000038" "g.178772283_178772285del" "" "" "" "ADAMTS2(NM_014244.5):c.68_70del (p.(Leu23del)), ADAMTS2(NM_014244.5):c.68_70delTGC (p.L23del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001014117" "0" "50" "5" "178552098" "178552098" "subst" "6.11237E-5" "02325" "ADAMTS2_000096" "g.178552098G>A" "" "" "" "ADAMTS2(NM_014244.5):c.2834C>T (p.P945L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001025081" "0" "30" "5" "178552185" "178552185" "subst" "0.00285219" "02329" "ADAMTS2_000097" "g.178552185C>T" "" "" "" "ADAMTS2(NM_014244.5):c.2751-4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001025082" "0" "30" "5" "178554954" "178554954" "subst" "0" "02329" "ADAMTS2_000098" "g.178554954C>A" "" "" "" "ADAMTS2(NM_014244.5):c.2617+6G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001025083" "0" "30" "5" "178563060" "178563060" "subst" "2.03244E-5" "02329" "ADAMTS2_000099" "g.178563060T>G" "" "" "" "ADAMTS2(NM_014244.5):c.1952-17A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001025084" "0" "30" "5" "178581198" "178581198" "subst" "1.39278E-5" "02329" "ADAMTS2_000100" "g.178581198G>A" "" "" "" "ADAMTS2(NM_014244.5):c.1239-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001035140" "0" "30" "5" "178549719" "178549719" "subst" "0.00153248" "02329" "ADAMTS2_000101" "g.178549719G>A" "" "" "" "ADAMTS2(NM_014244.5):c.3014C>T (p.A1005V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001035141" "0" "30" "5" "178551967" "178551967" "subst" "5.71909E-5" "02329" "ADAMTS2_000102" "g.178551967T>C" "" "" "" "ADAMTS2(NM_014244.5):c.2958+7A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001035142" "0" "10" "5" "178567022" "178567022" "subst" "0.0018641" "02329" "ADAMTS2_000103" "g.178567022T>C" "" "" "" "ADAMTS2(NM_014244.5):c.1644A>G (p.G548=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001064474" "0" "50" "5" "178607190" "178607190" "subst" "0" "02325" "chr5_007906" "g.178607190G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes ADAMTS2 ## Count = 119 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "{{VariantOnTranscript/Variant/Type}}" "{{VariantOnTranscript/Consequence/Predicted}}" "0000004264" "00001306" "50" "2958" "675" "2958" "675" "c.2958+675A>C" "r.(=)" "p.(=)" "" "" "" "0000248300" "00001306" "10" "321" "0" "321" "0" "c.321T>C" "r.(?)" "p.(Ser107=)" "" "" "" "0000248329" "00001306" "10" "1630" "-18" "1630" "-18" "c.1630-18T>C" "r.(=)" "p.(=)" "" "" "" "0000250035" "00001306" "10" "321" "0" "321" "0" "c.321T>C" "r.(?)" "p.(Ser107=)" "" "" "" "0000250064" "00001306" "10" "1630" "-18" "1630" "-18" "c.1630-18T>C" "r.(=)" "p.(=)" "" "" "" "0000250378" "00001306" "30" "68" "0" "68" "0" "c.68T>C" "r.(?)" "p.(Leu23Pro)" "" "" "" "0000250400" "00001306" "30" "2267" "0" "2267" "0" "c.2267T>C" "r.(?)" "p.(Val756Ala)" "" "" "" "0000258939" "00001306" "10" "1194" "0" "1194" "0" "c.1194C>T" "r.(?)" "p.(Asp398=)" "" "" "" "0000258940" "00001306" "10" "1238" "18" "1238" "18" "c.1238+18G>A" "r.(=)" "p.(=)" "" "" "" "0000258941" "00001306" "10" "2959" "-17" "2959" "-17" "c.2959-17C>T" "r.(=)" "p.(=)" "" "" "" "0000258942" "00001306" "10" "3529" "0" "3529" "0" "c.3529C>T" "r.(?)" "p.(Pro1177Ser)" "" "" "" "0000258943" "00001306" "10" "534" "9" "534" "9" "c.534+9G>C" "r.(=)" "p.(=)" "" "" "" "0000258944" "00001306" "10" "722" "0" "722" "0" "c.722G>A" "r.(?)" "p.(Arg241His)" "" "" "" "0000258945" "00001306" "10" "786" "0" "786" "0" "c.786G>A" "r.(?)" "p.(Ala262=)" "" "" "" "0000259968" "00001306" "10" "1194" "0" "1194" "0" "c.1194C>T" "r.(?)" "p.(Asp398=)" "" "" "" "0000259969" "00001306" "10" "1238" "18" "1238" "18" "c.1238+18G>A" "r.(=)" "p.(=)" "" "" "" "0000259970" "00001306" "10" "1281" "0" "1281" "0" "c.1281C>T" "r.(?)" "p.(Asp427=)" "" "" "" "0000259971" "00001306" "30" "1308" "0" "1308" "0" "c.1308G>A" "r.(?)" "p.(Ala436=)" "" "" "" "0000259972" "00001306" "30" "1488" "0" "1488" "0" "c.1488C>T" "r.(?)" "p.(Phe496=)" "" "" "" "0000259973" "00001306" "30" "1515" "18" "1515" "18" "c.1515+18C>T" "r.(=)" "p.(=)" "" "" "" "0000259974" "00001306" "10" "1629" "9" "1629" "9" "c.1629+9G>A" "r.(=)" "p.(=)" "" "" "" "0000259975" "00001306" "10" "1908" "0" "1908" "0" "c.1908C>T" "r.(?)" "p.(His636=)" "" "" "" "0000259976" "00001306" "10" "1993" "0" "1993" "0" "c.1993G>A" "r.(?)" "p.(Gly665Arg)" "" "" "" "0000259977" "00001306" "10" "2028" "0" "2028" "0" "c.2028C>T" "r.(?)" "p.(Asp676=)" "" "" "" "0000259978" "00001306" "10" "2291" "-8" "2291" "-8" "c.2291-8A>G" "r.(=)" "p.(=)" "" "" "" "0000259979" "00001306" "10" "2480" "0" "2480" "0" "c.2480G>A" "r.(?)" "p.(Arg827Gln)" "" "" "" "0000259980" "00001306" "10" "2532" "0" "2532" "0" "c.2532C>T" "r.(?)" "p.(Asp844=)" "" "" "" "0000259981" "00001306" "50" "2705" "0" "2705" "0" "c.2705A>G" "r.(?)" "p.(Lys902Arg)" "" "" "" "0000259982" "00001306" "10" "2730" "0" "2730" "0" "c.2730A>G" "r.(?)" "p.(Pro910=)" "" "" "" "0000259983" "00001306" "30" "2795" "0" "2795" "0" "c.2795G>A" "r.(?)" "p.(Arg932Gln)" "" "" "" "0000259984" "00001306" "30" "2959" "-16" "2959" "-16" "c.2959-16G>A" "r.(=)" "p.(=)" "" "" "" "0000259985" "00001306" "10" "2959" "-17" "2959" "-17" "c.2959-17C>T" "r.(=)" "p.(=)" "" "" "" "0000259986" "00001306" "10" "3480" "0" "3480" "0" "c.3480C>A" "r.(?)" "p.(Ala1160=)" "" "" "" "0000259987" "00001306" "10" "3529" "0" "3529" "0" "c.3529C>T" "r.(?)" "p.(Pro1177Ser)" "" "" "" "0000259988" "00001306" "30" "405" "0" "405" "0" "c.405C>T" "r.(?)" "p.(Ala135=)" "" "" "" "0000259989" "00001306" "10" "534" "9" "534" "9" "c.534+9G>C" "r.(=)" "p.(=)" "" "" "" "0000259990" "00001306" "30" "68" "0" "70" "0" "c.68_70del" "r.(?)" "p.(Leu23del)" "" "" "" "0000259992" "00001306" "30" "689" "-18" "689" "-18" "c.689-18G>A" "r.(=)" "p.(=)" "" "" "" "0000259993" "00001306" "10" "701" "0" "701" "0" "c.701A>G" "r.(?)" "p.(Asp234Gly)" "" "" "" "0000259994" "00001306" "10" "722" "0" "722" "0" "c.722G>A" "r.(?)" "p.(Arg241His)" "" "" "" "0000259995" "00001306" "30" "764" "0" "764" "0" "c.764G>A" "r.(?)" "p.(Arg255Gln)" "" "" "" "0000259996" "00001306" "10" "786" "0" "786" "0" "c.786G>A" "r.(?)" "p.(Ala262=)" "" "" "" "0000259998" "00001306" "10" "858" "0" "858" "0" "c.858C>T" "r.(?)" "p.(His286=)" "" "" "" "0000259999" "00001306" "30" "891" "9" "891" "9" "c.891+9G>A" "r.(=)" "p.(=)" "" "" "" "0000260000" "00001306" "10" "936" "0" "936" "0" "c.936C>T" "r.(?)" "p.(Asn312=)" "" "" "" "0000330781" "00001306" "50" "773" "0" "773" "0" "c.773G>A" "r.(?)" "p.(Arg258His)" "" "" "" "0000525376" "00001306" "10" "3279" "0" "3279" "0" "c.3279T>C" "r.(?)" "p.(Cys1093=)" "" "" "" "0000525377" "00001306" "30" "2618" "-20" "2618" "-20" "c.2618-20G>A" "r.(=)" "p.(=)" "" "" "" "0000525378" "00001306" "30" "2272" "0" "2272" "0" "c.2272G>A" "r.(?)" "p.(Ala758Thr)" "" "" "" "0000525380" "00001306" "10" "1803" "0" "1803" "0" "c.1803G>A" "r.(?)" "p.(Ser601=)" "" "" "" "0000525381" "00001306" "30" "1488" "0" "1488" "0" "c.1488C>T" "r.(?)" "p.(Phe496=)" "" "" "" "0000525382" "00001306" "10" "1458" "0" "1458" "0" "c.1458C>T" "r.(?)" "p.(Tyr486=)" "" "" "" "0000525383" "00001306" "30" "1122" "0" "1122" "0" "c.1122C>T" "r.(?)" "p.(Ser374=)" "" "" "" "0000525384" "00001306" "50" "1087" "0" "1087" "0" "c.1087G>A" "r.(?)" "p.(Ala363Thr)" "" "" "" "0000525385" "00001306" "30" "1083" "0" "1083" "0" "c.1083T>C" "r.(?)" "p.(Asp361=)" "" "" "" "0000525386" "00001306" "50" "991" "0" "991" "0" "c.991G>A" "r.(?)" "p.(Glu331Lys)" "" "" "" "0000525387" "00001306" "10" "733" "0" "733" "0" "c.733G>A" "r.(?)" "p.(Val245Ile)" "" "" "" "0000525388" "00001306" "10" "733" "0" "733" "0" "c.733G>A" "r.(?)" "p.(Val245Ile)" "" "" "" "0000525389" "00001306" "30" "139" "4" "139" "4" "c.139+4G>A" "r.spl?" "p.?" "" "" "" "0000525390" "00001306" "30" "80" "0" "100" "0" "c.80_100dup" "r.(?)" "p.(Leu27_Pro33dup)" "" "" "" "0000525391" "00001306" "30" "65" "0" "70" "0" "c.65_70dup" "r.(?)" "p.(Leu22_Leu23dup)" "" "" "" "0000525392" "00001306" "10" "68" "0" "70" "0" "c.68_70dup" "r.(?)" "p.(Leu23dup)" "" "" "" "0000621546" "00001306" "30" "2795" "0" "2795" "0" "c.2795G>A" "r.(?)" "p.(Arg932Gln)" "" "" "" "0000621548" "00001306" "30" "798" "0" "798" "0" "c.798C>T" "r.(?)" "p.(Tyr266=)" "" "" "" "0000651685" "00001306" "30" "2480" "0" "2480" "0" "c.2480G>A" "r.(?)" "p.(Arg827Gln)" "" "" "" "0000651686" "00001306" "50" "2015" "0" "2015" "0" "c.2015G>T" "r.(?)" "p.(Arg672Leu)" "" "" "" "0000651687" "00001306" "50" "220" "0" "220" "0" "c.220G>A" "r.(?)" "p.(Val74Met)" "" "" "" "0000655362" "00001306" "30" "2958" "430" "2958" "430" "c.2958+430A>G" "r.(=)" "p.(=)" "" "" "" "0000677490" "00001306" "30" "732" "0" "732" "0" "c.732C>T" "r.(?)" "p.(Gly244=)" "" "" "" "0000702059" "00001306" "99" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.0?" "1" "substitution" "initiating methionine" "0000702060" "00001306" "11" "102" "0" "123" "0" "c.102_123dup" "r.(?)" "p.(Ala42Argfs*31)" "1" "duplication" "frameshift" "0000702061" "00001306" "11" "220" "0" "220" "0" "c.220G>A" "r.(?)" "p.(Val74Met)" "2" "substitution" "missense" "0000702062" "00001306" "99" "535" "-1" "688" "1" "c.535-?_688+?del" "r.?" "p.(Ala179Glyfs*17)" "3" "deletion" "deletion, exon" "0000702063" "00001306" "99" "535" "-1" "975" "1" "c.535-?_975+?del" "r.?" "p.(Ala179_Lys325del)" "03_05" "deletion" "deletion, multi exon" "0000702064" "00001306" "99" "673" "0" "673" "0" "c.673C>T" "r.(?)" "p.(Gln225*)" "3" "substitution" "nonsense" "0000702065" "00001306" "99" "673" "0" "673" "0" "c.673C>T" "r.(?)" "p.(Gln225*)" "3" "substitution" "nonsense" "0000702066" "00001306" "99" "673" "0" "673" "0" "c.673C>T" "r.(?)" "p.(Gln225*)" "3" "substitution" "nonsense" "0000702067" "00001306" "99" "673" "0" "673" "0" "c.673C>T" "r.(?)" "p.(Gln225*)" "3" "substitution" "nonsense" "0000702068" "00001306" "99" "673" "0" "673" "0" "c.673C>T" "r.(?)" "p.(Gln225*)" "3" "substitution" "nonsense" "0000702069" "00001306" "99" "673" "0" "673" "0" "c.673C>T" "r.(?)" "p.(Gln225*)" "3" "substitution" "nonsense" "0000702070" "00001306" "33" "688" "25836" "688" "25836" "c.688+25836T>C" "r.(?)" "-" "3i" "substitution" "other/complex" "0000702071" "00001306" "33" "688" "28769" "688" "28769" "c.688+28769dup" "r.(?)" "-" "3i" "duplication" "splicing affected?" "0000702072" "00001306" "11" "689" "-28692" "689" "-28692" "c.689-28692T>G" "r.(?)" "-" "3i" "substitution" "other/complex" "0000702073" "00001306" "99" "669" "0" "670" "0" "c.669_670dup" "r.(?)" "p.(Pro224Argfs*24)" "4" "duplication" "frameshift" "0000702074" "00001306" "99" "884" "0" "887" "0" "c.884_887del" "r.(?)" "p.(Met295Thrfs*26)" "4" "deletion" "frameshift" "0000702075" "00001306" "99" "2085" "1422" "2458" "-478" "c.2085+1422_2458-478delinsTCC" "r.?" "-" "14_16" "delins" "deletion, multi exon" "0000702076" "00001306" "99" "2384" "0" "2384" "0" "c.2384G>A" "r.(?)" "p.(Trp795*)" "16" "substitution" "nonsense" "0000702077" "00001306" "99" "2458" "-6" "2458" "0" "c.2458-6_2458del" "r.spl" "-" "17" "deletion" "splicing affected, exon skipped" "0000702078" "00001306" "99" "2751" "-2" "2751" "-2" "c.2751-2A>T" "r.spl" "-" "19" "substitution" "splicing affected?" "0000702079" "00001306" "99" "2927" "0" "2928" "0" "c.2927_2928del" "r.(?)" "p.(Pro976Argfs42*)" "19" "deletion" "frameshift" "0000702080" "00001306" "11" "3028" "0" "3028" "0" "c.3028G>A" "r.(?)" "p.(Gly1010Ser)" "20" "substitution" "missense" "0000702081" "00001306" "11" "3155" "0" "3155" "0" "c.3155C>A" "r.(?)" "p.(Ser1052*)" "21" "substitution" "nonsense" "0000760619" "00001306" "55" "2208" "0" "2208" "0" "c.2208T>C" "r.(=)" "p.(=)" "14" "substitution" "silent" "0000886783" "00001306" "30" "3342" "0" "3342" "0" "c.3342C>T" "r.(?)" "p.(Asn1114=)" "" "" "" "0000912301" "00001306" "30" "2613" "0" "2613" "0" "c.2613C>T" "r.(?)" "p.(Gly871=)" "" "" "" "0000924321" "00001306" "10" "891" "17" "891" "17" "c.891+17A>G" "r.(=)" "p.(=)" "" "" "" "0000924322" "00001306" "30" "891" "15" "891" "15" "c.891+15T>G" "r.(=)" "p.(=)" "" "" "" "0000924323" "00001306" "30" "535" "-20" "535" "-20" "c.535-20C>T" "r.(=)" "p.(=)" "" "" "" "0000929062" "00001306" "30" "139" "4" "139" "4" "c.139+4G>A" "r.spl?" "p.?" "" "" "" "0000948539" "00001306" "30" "891" "11" "891" "11" "c.891+11T>G" "r.(=)" "p.(=)" "" "" "" "0000963579" "00001306" "30" "1914" "0" "1914" "0" "c.1914C>T" "r.(?)" "p.(=)" "" "" "" "0000963580" "00001306" "30" "1629" "843" "1629" "843" "c.1629+843C>G" "r.(=)" "p.(=)" "" "" "" "0000963581" "00001306" "30" "1238" "140" "1238" "140" "c.1238+140C>T" "r.(=)" "p.(=)" "" "" "" "0000963582" "00001306" "30" "891" "38" "891" "38" "c.891+38A>G" "r.(=)" "p.(=)" "" "" "" "0000963583" "00001306" "30" "891" "14" "891" "15" "c.891+14_891+15del" "r.(=)" "p.(=)" "" "" "" "0000976750" "00001306" "30" "2034" "0" "2034" "0" "c.2034G>A" "r.(?)" "p.(=)" "" "" "" "0000976751" "00001306" "30" "1629" "959" "1629" "959" "c.1629+959G>T" "r.(=)" "p.(=)" "" "" "" "0000976752" "00001306" "30" "1516" "-232" "1516" "-232" "c.1516-232C>T" "r.(=)" "p.(=)" "" "" "" "0000976753" "00001306" "30" "1308" "0" "1308" "0" "c.1308G>C" "r.(?)" "p.(=)" "" "" "" "0000976754" "00001306" "30" "68" "0" "70" "0" "c.68_70del" "r.(?)" "p.(Leu23del)" "" "" "" "0001014117" "00001306" "50" "2834" "0" "2834" "0" "c.2834C>T" "r.(?)" "p.(Pro945Leu)" "" "" "" "0001025081" "00001306" "30" "2751" "-4" "2751" "-4" "c.2751-4G>A" "r.spl?" "p.?" "" "" "" "0001025082" "00001306" "30" "2617" "6" "2617" "6" "c.2617+6G>T" "r.(=)" "p.(=)" "" "" "" "0001025083" "00001306" "30" "1952" "-17" "1952" "-17" "c.1952-17A>C" "r.(=)" "p.(=)" "" "" "" "0001025084" "00001306" "30" "1239" "-5" "1239" "-5" "c.1239-5C>T" "r.spl?" "p.?" "" "" "" "0001035140" "00001306" "30" "3014" "0" "3014" "0" "c.3014C>T" "r.(?)" "p.(Ala1005Val)" "" "" "" "0001035141" "00001306" "30" "2958" "7" "2958" "7" "c.2958+7A>G" "r.(=)" "p.(=)" "" "" "" "0001035142" "00001306" "10" "1644" "0" "1644" "0" "c.1644A>G" "r.(?)" "p.(=)" "" "" "" "0001064474" "00001306" "50" "975" "883" "975" "883" "c.975+883C>A" "r.(=)" "p.(=)" "" "" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 28 "{{screeningid}}" "{{variantid}}" "0000000209" "0000004264" "0000294996" "0000651685" "0000294997" "0000651686" "0000294998" "0000651687" "0000319351" "0000702059" "0000319351" "0000702074" "0000319352" "0000702060" "0000319353" "0000702061" "0000319354" "0000702062" "0000319354" "0000702075" "0000319355" "0000702063" "0000319356" "0000702064" "0000319357" "0000702065" "0000319358" "0000702066" "0000319359" "0000702067" "0000319360" "0000702068" "0000319361" "0000702069" "0000319362" "0000702070" "0000319363" "0000702071" "0000319364" "0000702072" "0000319365" "0000702073" "0000319366" "0000702076" "0000319367" "0000702077" "0000319368" "0000702078" "0000319369" "0000702079" "0000319370" "0000702080" "0000319371" "0000702081" "0000360579" "0000760619"