### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = AGL) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "AGL" "amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase" "1" "p21" "unknown" "NG_012865.1" "UD_132085257483" "" "http://www.LOVD.nl/AGL" "" "1" "321" "178" "610860" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/AGL_codingDNA.html" "1" "" "" "-1" "" "-1" "00002" "2010-04-29 00:00:00" "00006" "2016-05-19 17:47:32" "00006" "2026-08-03 15:19:31" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00024135" "AGL" "transcript variant 1" "002" "NM_000642.2" "" "NP_000633.2" "" "" "" "-400" "6971" "4599" "100315640" "100389579" "00006" "2016-05-19 17:46:17" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 13 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00138" "autism" "autism" "" "209850" "" "" "" "00084" "2013-06-04 18:17:33" "00006" "2015-12-08 23:54:35" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00244" "MYOP" "myopathy (MYOP)" "" "" "" "" "" "00006" "2013-10-12 23:00:55" "00006" "2019-06-19 11:52:31" "01273" "hCK" "hyperCKemia (hCK, elevated serum creatine phosphokinase)" "AD" "123320" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01823" "GSD3" "storage disease, glycogen, type III (GSD-3)" "AR" "232400" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02087" "SIDS" "death, sudden, syndrome, infant (SIDS)" "AR" "272120" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02554" "metabolic disease" "metabolic disease" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2026-02-16 15:43:43" "04216" "GSD" "storage disease, glycogen (GSD)" "" "" "" "" "" "00006" "2015-03-05 15:32:25" "" "" "05121" "MD" "dystrophy, muscular (MD)" "" "" "" "" "" "00006" "2016-01-24 01:27:29" "" "" "05126" "LGMD" "dystrophy, muscular, limb-girdle (LGMD)" "" "" "" "" "" "00006" "2016-01-26 06:05:36" "" "" "05166" "SUD" "death, sudden, unexplained (SUD)" "" "" "" "" "" "00006" "2016-05-19 16:34:23" "00006" "2018-09-11 12:14:13" "05378" "BMD/DMD" "dystrophinopathy (BMD or DMD)" "" "" "" "" "" "00006" "2018-01-13 20:18:25" "00006" "2019-03-26 16:49:54" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "AGL" "01823" ## Individuals ## Do not remove or alter this header ## ## Count = 67 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000004" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000013" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00065124" "" "" "" "1" "" "01602" "{PMID:Neubauer 2017:28074886} {DOI:Neubauer 2017:10.1038/ejhg.2016.199}" "" "F" "?" "Switzerland" "00y04m" "0" "" "" "Europe" "SIDS041" "00095189" "" "" "" "1" "" "01865" "" "" "M" "?" "Iran" "" "0" "" "" "" "" "00095197" "" "" "" "1" "" "01865" "" "" "M" "?" "Iran" "" "0" "" "" "" "" "00095199" "" "" "" "1" "" "01865" "" "" "M" "?" "Iran" "" "0" "" "" "" "" "00095202" "" "" "" "1" "" "01865" "" "" "M" "?" "Iran" "" "0" "" "" "" "" "00095204" "" "" "" "1" "" "01865" "" "" "F" "?" "Iran" "" "0" "" "" "" "" "00204558" "" "" "" "1" "" "00000" "" "" "" "" "United States" "" "0" "" "" "" "" "00204559" "" "" "" "3" "" "00000" "" "3 unrelated patients" "" "" "United States" "" "0" "" "" "" "" "00204560" "" "" "" "1" "" "00000" "" "" "" "" "United States" "" "0" "" "" "" "" "00204561" "" "" "" "1" "" "00000" "" "" "" "" "United States" "" "0" "" "" "" "" "00204562" "" "" "" "1" "" "00000" "" "" "" "" "United States" "" "0" "" "" "" "" "00204563" "" "" "" "1" "" "00000" "" "" "" "" "United States" "" "0" "" "" "" "" "00204564" "" "" "" "1" "" "00000" "" "" "" "" "United States" "" "0" "" "" "" "" "00204565" "" "" "" "1" "" "00000" "" "" "" "" "United States" "" "0" "" "" "white" "" "00204566" "" "" "" "1" "" "02976" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00204567" "" "" "" "1" "" "00000" "" "" "M" "" "" "" "0" "" "" "Jewish-Ashkenazi" "" "00204568" "" "" "" "1" "" "02976" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00204569" "" "" "" "1" "" "00000" "" "" "F" "" "United States" "" "0" "" "" "African-American" "" "00204570" "" "" "" "1" "" "00000" "" "2nd patient, unrelated" "" "" "United States" "" "0" "" "" "" "" "00204571" "" "" "" "1" "" "00000" "" "" "F" "" "Japan" "" "0" "" "" "" "" "00204572" "" "" "" "1" "" "02976" "" "affected brother of 223003-Pat2" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00204573" "" "" "" "1" "" "02976" "" "affected brother of 223003-Pat1" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00204574" "" "" "" "1" "" "00000" "" "" "F" "" "United States" "" "0" "" "" "white" "" "00228778" "" "" "" "1" "" "01864" "" "" "F" "no" "China" "" "0" "" "" "" "" "00265255" "" "" "" "1" "" "03426" "" "" "M" "" "Spain" "" "0" "" "" "" "" "00281793" "" "" "" "1" "" "03573" "" "" "M" "no" "(Nepal)" "" "0" "" "" "" "G1" "00285774" "" "" "" "2" "" "03573" "" "" "F" "yes" "India" "02y" "0" "" "" "" "G3" "00289451" "" "" "" "27" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00289452" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00289453" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00289454" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00289455" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00289456" "" "" "" "26" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00289457" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00289458" "" "" "" "21" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295235" "" "" "" "24" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00305334" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00314025" "" "" "" "2" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314026" "" "" "" "2" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00329082" "" "" "" "1" "" "00000" "{PMID:Wang 2013:22899091}" "" "M" "" "United States" "" "0" "" "" "" "P11" "00329084" "" "" "" "1" "" "00000" "{PMID:Wang 2013:22899091}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "United States" "" "0" "" "" "" "P17" "00329085" "" "" "" "1" "" "00000" "{PMID:Wang 2013:22899091}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "United States" "" "0" "" "" "" "P18" "00431570" "" "" "" "1" "" "00006" "{PMID:Neubauer 2021:33895855}" "" "M" "" "Switzerland" "" "0" "" "" "" "SUDS027" "00451437" "" "" "" "1" "" "04221" "{PMID:Vela-Amieva 2024:39519275}" "Likely consanguinity" "F" "no" "Mexico" "" "" "" "" "Mexican" "3bINP-025" "00460230" "" "" "" "1" "" "00006" "{PMID:Marti 2025:39666917}" "patient, no family history" "" "" "Spain" "" "0" "" "" "" "Pat1" "00472447" "" "" "" "1" "" "00006" "{PMID:Soriano-Sexto 2026:41588148}" "" "" "" "Spain" "" "0" "" "" "" "Pat5" "00472919" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, family history" "M" "no" "Iran" "" "0" "" "" "" "Fam106684Pat16" "00473070" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, no family history" "M" "yes" "Iran" "" "0" "" "" "" "Fam14300Pat188" "00473193" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, family history" "M" "yes" "Iran" "" "0" "" "" "" "Fam107264Pat366" "00473291" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, no family history" "M" "yes" "Iran" "" "0" "" "" "" "Fam202277Pat528" "00473479" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, no family history" "F" "yes" "Iran" "" "0" "" "" "" "Fam301186Pat830" "00476288" "" "" "" "1" "" "00006" "{PMID:Beecroft 2020:32153140}" "analysis 2249 neurology patients" "F" "" "(Australia);(New Zealand)" "" "0" "" "" "" "VD11" "00476894" "" "" "" "1" "" "00006" "{PMID:Alhammad 2024:39232665}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00476901" "" "" "" "1" "" "00006" "{PMID:Alhammad 2024:39232665}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00478147" "" "" "" "1" "" "00006" "{PMID:Sambuughin 2024:39457051}" "analysis 53 cases with exertional heat illness events" "" "" "United States" "" "0" "" "" "" "?" "00478413" "" "" "" "1" "" "00006" "{PMID:Kruijt 2021:32978841}" "patient" "" "" "Netherlands" "" "0" "" "" "" "Pat7" "00482248" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" "Fam114PatB-49" "00482249" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" "Fam115PatB-2" "00482250" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" "Fam116PatB-191" "00482251" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" "Fam117PatB-95" "00482252" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" "Fam118PatB-79" "00482253" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" "Fam119-2PatB-29" "00482254" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" "Fam120-1PatB-75" "00482255" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" "Fam120-2PatB-74" "00482256" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" "Fam122-2PatB-152" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 67 "{{individualid}}" "{{diseaseid}}" "00000013" "00138" "00000013" "05378" "00065124" "02087" "00095189" "01823" "00095197" "01823" "00095199" "01823" "00095202" "01823" "00095204" "01823" "00204558" "01823" "00204559" "01823" "00204560" "01823" "00204561" "01823" "00204562" "01823" "00204563" "01823" "00204564" "01823" "00204565" "01823" "00204566" "01823" "00204567" "01823" "00204568" "01823" "00204569" "01823" "00204570" "01823" "00204571" "01823" "00204572" "01823" "00204573" "01823" "00204574" "01823" "00228778" "01823" "00265255" "01823" "00281793" "01823" "00285774" "01823" "00289451" "00198" "00289452" "00198" "00289453" "00198" "00289454" "00198" "00289455" "00198" "00289456" "00198" "00289457" "00198" "00289458" "00198" "00295235" "00198" "00305334" "00198" "00314025" "05126" "00314026" "05126" "00329082" "04216" "00329084" "04216" "00329085" "04216" "00431570" "05166" "00451437" "01823" "00460230" "01273" "00472447" "02554" "00472919" "00244" "00473070" "00244" "00473193" "00244" "00473291" "00244" "00473479" "00244" "00476288" "05121" "00476894" "00244" "00476901" "00244" "00478147" "00198" "00478413" "01273" "00482248" "00000" "00482249" "00000" "00482250" "00000" "00482251" "00000" "00482252" "00000" "00482253" "00000" "00482254" "00000" "00482255" "00000" "00482256" "00000" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00138, 00198, 00244, 01273, 01823, 02087, 02554, 04216, 05121, 05126, 05166, 05378 ## Count = 27 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000015274" "00187" "00000004" "00124" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "0000051229" "02087" "00065124" "01602" "Unknown" "" "SIDS" "" "" "" "" "" "" "" "" "" "" "0000073593" "01823" "00095189" "01865" "Familial, autosomal recessive" "" "weakness : distal and proximal, upper and lower limbs perdominaltly distal upper limbs\r\nsevere axial and mild neck weakness, foot drop\r\nachilles contracture, atrophy in deltoid, supraspinatus and intrinsic hand muscles" "24y" "48y" "" "" "" "" "" "" "" "" "0000073596" "01823" "00095197" "01865" "Familial, autosomal recessive" "26y" "weakness: distal and proximal, upper and lower limbs predominantly distal upper limbs\r\nthoracis scoliosis" "21y" "" "" "" "" "" "" "" "" "" "0000073599" "01823" "00095199" "01865" "Familial, autosomal recessive" "15y" "weakness: distal and proximal upper limbs and proximal lower limbs\r\natrophy in thenar and hypothenar\r\ncardiac involvement since 15y/o" "15y" "" "" "" "" "" "" "" "" "" "0000073601" "01823" "00095202" "01865" "Familial, autosomal recessive" "40y" "weakness: distal and proximal upper limbs and proximal lower limbs\r\ncardiac involvement since 39 y/o\r\ncirrhosis at 36 y/o" "37y" "" "" "" "" "" "" "" "" "" "0000073603" "01823" "00095204" "01865" "Familial, autosomal recessive" "51y" "weakness: distal and proximal upper limbs and proximal lower limbs\r\natrophy in first dorsal interosseus\r\nhepatomegaly and hypoglycemia" "46y" "" "" "" "" "" "" "" "" "" "0000152861" "01823" "00204569" "00000" "-" "" "severe" "" "" "" "" "" "" "" "" "" "" "0000152862" "01823" "00204570" "00000" "-" "" "severe" "" "" "" "" "" "" "" "" "" "" "0000172717" "01823" "00228778" "01864" "-" "00y18m" "hepatomegaly, short stature, and muscle weakness. She had experienced episodes of hypoglycaemia." "" "00y18m" "" "" "" "" "" "" "" "" "0000219684" "01823" "00281793" "03573" "Familial, autosomal recessive" "04y" "Hepatomegaly (HP:0002240);short stature (HP:0004322); Jaundice (HP:0000952) Full cheeks (HP:0000293); Growth delay (HP:0001510) Lethargy (HP:0001254); Muscular hypotonia (HP:0001252); Hypertriglyceridemia (HP:0002155), Hypoglycemia (HP:0001943); Elevated hepatic transaminase (HP:0002910); Elevated serum creatine kinase (HP:0003236);" "00y09m" "04y" "" "" "" "" "" "GSDIII" "GSDIII" "" "0000247279" "04216" "00329082" "00000" "Familial, autosomal recessive" "2y" "see paper; ..., hepatomegaly" "" "" "" "" "" "" "" "" "glycogen storage disease" "" "0000247281" "04216" "00329084" "00000" "Familial, autosomal recessive" "10y" "see paper; ..., GSD III" "" "" "" "" "" "" "" "" "glycogen storage disease" "" "0000247282" "04216" "00329085" "00000" "Familial, autosomal recessive" "9y" "see paper; ..., GSD III" "" "" "" "" "" "" "" "" "glycogen storage disease" "" "0000322148" "05166" "00431570" "00006" "Unknown" "" "acute heart failure" "" "" "" "" "" "" "" "" "sudden unexplained death" "" "0000340187" "01823" "00451437" "04221" "Familial, autosomal recessive" "" "Hypoglycemia" "" "06y" "" "" "" "" "" "Glycogen storage disease IIIb" "Glycogen storage disease III" "" "0000347959" "01273" "00460230" "00006" "Unknown" "0y-9y" "exercise intolerance; elevated CK level 1300-3500 UI/L; vacuoles, glycogen storage; MRI muscle focal fat replacement leg compartment" "" "" "" "IHC normal sarcolemma immunostaining" "" "" "" "" "exercise intolerance" "" "0000357257" "02554" "00472447" "00006" "Familial, autosomal recessive" "19y" "hepatomegaly (HP:0002240); fasting hypoglycemia (HP:0003162), ketonuria (HP:0002919); elevated circulating hepatic transaminase concentration (HP:0002910); elevated circulating creatine kinase concentration (HP:0003236); ventricular septal hypertrophy (HP:0005144)" "" "" "" "" "" "" "" "GSD3" "glycogen storage disease" "" "0000357714" "00244" "00472919" "00006" "Familial, autosomal recessive" "38y" "Non -related parents, multiple affected individuals, myopathy, seizure, history of hypoglycemia, positive Gower’s sign, climbing and running difficulty, GSD reported in liver biopsy, normal echocardiography,elevated SGOT,SGPT,CPK and LDH, mixed neurogenic and myogenic reported in EMG/NCV" "" "" "" "" "" "" "" "" "metabolic myopathy" "" "0000357865" "00244" "00473070" "00006" "Unknown" "3y" "onset 1-month; Short stature; Growth retardation; Seizures; Depressed nasal bridge; Broad nasal tip; Midface hypoplasia, mild; Bow shaped lip; Deep set eyes; Mild cardiac hypertrophy & SDS; Hepatomegaly; Prominent abdomen; Hypoglycemia; Inguinal hernia, bilateral; Hx of vomiting & diarrhea; Elevated level of SGOT, SGPT, CPK, LDH & Aldolase; Abdomen & pelvis ultrasound suggestive of GSD and LSD." "" "" "" "" "" "" "" "" "metabolic myopathy" "" "0000357988" "00244" "00473193" "00006" "Familial, autosomal recessive" "39y" "epatosplenomegaly; Generalized muscle weakness, proximal>distal in limbs; Muscle wasting; Scapular winging; Achilles tendon contracture; Mental retardation, mild; Seizure; Elevated CPK, LDH & Aldolase levels; Increased AST & ALT; EMG-NCV: non-irritable myopathic process; MRI of Lt. leg & femur & Rt. femur: fatty degeneration suggestive of myopthy; Muscle biopsy: suggestive of GSD type 3." "" "" "" "" "" "" "" "" "myopathy" "" "0000358086" "00244" "00473291" "00006" "Familial, autosomal recessive" "38y" "onset 3y , hepatomegaly, generalized muscle weakness, positive Gower’s sign , elevated liver enzymes, elevated CPK and myopathy reported in EMG." "" "" "" "" "" "" "" "" "metabolic myopathy" "" "0000358274" "00244" "00473479" "00006" "Familial, autosomal recessive" "44y" "Sporadic case, 44y old, proximal upper and lower muscle weakness, positive Gower s sign, climbing difficulty, heel -toe walking inability, irritable myopathy process reported in EMG, early stage of pompe disease suggested in muscle biopsy and elevated CPK, LDH and aldolase." "" "" "" "" "" "" "" "" "metabolic myopathy" "" "0000360962" "05121" "00476288" "00006" "Familial, autosomal recessive" "55y" "details not specified; no correlation clinical diagnosis with genetic diagnosis" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000361569" "00244" "00476894" "00006" "Familial, autosomal recessive" "" "not specified" "" "" "" "" "" "" "" "GSD3" "myopathy" "" "0000361576" "00244" "00476901" "00006" "Familial, autosomal recessive" "" "not specified" "" "" "" "" "" "" "" "GSD3" "myopathy" "" "0000362928" "01273" "00478413" "00006" "Unknown" "" "not specified" "" "" "" "" "" "" "" "GSD3" "rhabdomyolysis, hyperCKemia" "" ## Screenings ## Do not remove or alter this header ## ## Count = 67 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000004" "00000004" "1" "00004" "" "2012-05-11 13:18:36" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000013" "00000013" "1" "00004" "" "2012-05-11 13:18:38" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000065275" "00065124" "1" "01602" "01602" "2016-05-19 12:58:50" "" "" "SEQ-NG-I" "DNA" "" "" "0000095592" "00095189" "1" "01865" "01865" "2017-01-11 10:54:46" "" "" "SEQ" "DNA" "" "" "0000095595" "00095197" "1" "01865" "01865" "2017-01-11 11:05:47" "" "" "SEQ" "DNA" "blood" "" "0000095598" "00095199" "1" "01865" "01865" "2017-01-11 11:13:38" "" "" "SEQ" "DNA" "blood" "" "0000095600" "00095202" "1" "01865" "01865" "2017-01-11 11:22:00" "" "" "SEQ" "DNA" "" "" "0000095602" "00095204" "1" "01865" "01865" "2017-01-11 11:29:35" "" "" "SEQ" "DNA" "" "" "0000205587" "00204558" "1" "00000" "00006" "2012-01-21 09:33:24" "" "" "SEQ" "DNA" "" "" "0000205588" "00204559" "1" "00000" "00006" "2012-01-21 09:33:24" "" "" "SEQ" "DNA" "" "" "0000205589" "00204560" "1" "00000" "00006" "2012-01-21 09:33:24" "" "" "SEQ" "DNA" "" "" "0000205590" "00204561" "1" "00000" "00006" "2012-01-21 09:33:24" "" "" "SEQ" "DNA" "" "" "0000205591" "00204562" "1" "00000" "00006" "2012-01-21 09:33:24" "" "" "SEQ" "DNA" "" "" "0000205592" "00204563" "1" "00000" "00006" "2012-01-21 09:33:24" "" "" "SEQ" "DNA" "" "" "0000205593" "00204564" "1" "00000" "00006" "2012-01-21 09:33:24" "" "" "SEQ" "DNA" "" "" "0000205594" "00204565" "1" "00000" "00006" "2012-01-21 09:33:24" "" "" "SEQ;SSCA" "DNA" "" "" "0000205595" "00204566" "1" "02976" "02976" "2012-01-21 09:33:24" "" "" "SEQ-NG-I;SEQ" "DNA" "" "" "0000205596" "00204567" "1" "00000" "00006" "2012-01-21 09:33:24" "" "" "SEQ;SSCA" "DNA" "" "" "0000205597" "00204568" "1" "02976" "02976" "2012-01-21 09:33:24" "" "" "SEQ-NG-I;SEQ" "DNA" "" "" "0000205598" "00204569" "1" "00000" "00006" "2012-01-21 09:33:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000205599" "00204570" "1" "00000" "00006" "2012-01-21 09:33:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000205600" "00204571" "1" "00000" "00006" "2012-01-21 09:33:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000205601" "00204572" "1" "02976" "02976" "2012-01-21 09:33:24" "" "" "SEQ-NG-I;SEQ" "DNA" "" "" "0000205602" "00204573" "1" "02976" "02976" "2012-01-21 09:33:24" "" "" "SEQ" "DNA" "" "" "0000205603" "00204574" "1" "00000" "00006" "2012-01-21 09:33:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000229867" "00228778" "1" "01864" "01864" "2019-03-26 02:19:19" "" "" "SEQ-NG" "DNA" "blood" "" "0000266374" "00265255" "1" "03426" "03426" "2019-09-18 10:23:04" "" "" "SEQ-NG-IT" "DNA" "" "" "0000282941" "00281793" "1" "03573" "03573" "2020-02-03 12:43:16" "00006" "2020-05-27 10:56:40" "SEQ" "DNA" "" "" "0000288326" "00285774" "1" "03573" "03573" "2020-02-13 09:32:07" "00006" "2020-02-13 12:02:07" "SEQ" "DNA" "Blood" "" "0000290619" "00289451" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000290620" "00289452" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000290621" "00289453" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000290622" "00289454" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000290623" "00289455" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000290624" "00289456" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000290625" "00289457" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000290626" "00289458" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296403" "00295235" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000306463" "00305334" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000315198" "00314025" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315199" "00314026" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000330299" "00329082" "1" "00000" "00006" "2021-02-03 15:44:42" "" "" "SEQ" "DNA" "" "" "0000330301" "00329084" "1" "00000" "00006" "2021-02-03 15:44:42" "" "" "SEQ" "DNA" "" "" "0000330302" "00329085" "1" "00000" "00006" "2021-02-03 15:44:42" "" "" "SEQ" "DNA" "" "" "0000433003" "00431570" "1" "00006" "00006" "2023-02-15 10:58:05" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000453037" "00451437" "1" "04221" "04221" "2024-06-03 21:21:34" "" "" "SEQ-NG-I" "DNA" "gDNA from peripheral blood" "whole exome sequencing" "0000461861" "00460230" "1" "00006" "00006" "2025-01-22 12:23:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000474115" "00472447" "1" "00006" "00006" "2026-02-16 15:46:49" "00006" "2026-02-17 12:38:48" "RT-PCR;SEQ;SEQ-ON;SEQ-NG" "DNA;RNA" "" "" "0000474588" "00472919" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000474739" "00473070" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000474862" "00473193" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000474960" "00473291" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000475148" "00473479" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000477932" "00476288" "1" "00006" "00006" "2026-04-13 18:16:22" "" "" "SEQ;SEQ-NG" "DNA" "" "336-gene panel" "0000478538" "00476894" "1" "00006" "00006" "2026-04-20 14:19:26" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000478545" "00476901" "1" "00006" "00006" "2026-04-20 14:19:26" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000479794" "00478147" "1" "00006" "00006" "2026-05-04 13:34:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000480060" "00478413" "1" "00006" "00006" "2026-05-07 19:40:02" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000483896" "00482248" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel" "0000483897" "00482249" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel" "0000483898" "00482250" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel" "0000483899" "00482251" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel" "0000483900" "00482252" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel" "0000483901" "00482253" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel" "0000483902" "00482254" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel" "0000483903" "00482255" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel" "0000483904" "00482256" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 52 "{{screeningid}}" "{{geneid}}" "0000000004" "ACADM" "0000000004" "AGL" "0000000004" "DPYD" "0000000004" "ETFB" "0000000004" "GAA" "0000000004" "HESX1" "0000000004" "NHLRC1" "0000000004" "NPHS1" "0000000004" "SBDS" "0000000004" "SLC26A2" "0000000004" "SMPD1" "0000000013" "AGL" "0000000013" "ATP7B" "0000000013" "COL7A1" "0000000013" "HADHA" "0000000013" "MEFV" "0000000013" "NHLRC1" "0000000013" "PAH" "0000000013" "SMPD1" "0000095592" "AGL" "0000095595" "AGL" "0000095598" "AGL" "0000095600" "AGL" "0000095602" "AGL" "0000205587" "AGL" "0000205588" "AGL" "0000205589" "AGL" "0000205590" "AGL" "0000205591" "AGL" "0000205592" "AGL" "0000205593" "AGL" "0000205594" "AGL" "0000205595" "AGL" "0000205596" "AGL" "0000205597" "AGL" "0000205598" "AGL" "0000205599" "AGL" "0000205600" "AGL" "0000205601" "AGL" "0000205602" "AGL" "0000205603" "AGL" "0000229867" "AGL" "0000266374" "AGL" "0000282941" "AGL" "0000288326" "AGL" "0000315198" "AGL" "0000315199" "AGL" "0000330299" "AGL" "0000330301" "AGL" "0000330302" "AGL" "0000453037" "AGL" "0000474115" "AGL" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 173 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000096946" "0" "50" "1" "100361872" "100361872" "subst" "8.52944E-5" "01602" "AGL_000017" "g.100361872G>A" "" "{PMID:Neubauer 2017:28074886}, {DOI:Neubauer 2017:10.1038/ejhg.2016.199}" "" "" "" "Germline" "?" "rs185947256" "0" "" "" "g.99896316G>A" "" "VUS" "" "0000096988" "0" "50" "1" "100327088" "100327088" "subst" "0.00362443" "00006" "AGL_000016" "g.100327088A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.99861532A>G" "" "VUS" "" "0000154180" "3" "90" "1" "100327897" "100327897" "subst" "0" "01865" "AGL_000018" "g.100327897T>A" "" "" "" "" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.99862341T>A" "" "pathogenic" "" "0000154182" "3" "70" "1" "100361877" "100361877" "subst" "0" "01865" "AGL_000021" "g.100361877T>C" "" "" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.99896321T>C" "" "likely pathogenic" "" "0000154185" "3" "90" "1" "100340810" "100340810" "subst" "0" "01865" "AGL_000019" "g.100340810C>T" "" "" "" "" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.99875254C>T" "" "pathogenic" "" "0000154187" "3" "90" "1" "100376344" "100376344" "subst" "0" "01865" "AGL_000022" "g.100376344G>A" "" "" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.99910788G>A" "" "pathogenic" "" "0000154189" "3" "90" "1" "100346846" "100346846" "subst" "0" "01865" "AGL_000020" "g.100346846A>G" "" "" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.99881290A>G" "" "pathogenic" "" "0000248957" "0" "10" "1" "100316589" "100316589" "subst" "0.469761" "02325" "AGL_000002" "g.100316589A>G" "" "" "" "AGL(NM_000028.2):c.-10A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99851033A>G" "" "benign" "" "0000252388" "0" "70" "1" "100346329" "100346329" "subst" "0" "02326" "AGL_000034" "g.100346329A>G" "" "" "" "AGL(NM_000642.3):c.1877A>G (p.H626R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99880773A>G" "" "likely pathogenic" "" "0000256355" "0" "50" "1" "100376331" "100376331" "subst" "0.000443396" "01943" "AGL_000041" "g.100376331A>G" "" "" "" "AGL(NM_000028.2):c.3764A>G (p.N1255S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99910775A>G" "" "VUS" "" "0000258987" "0" "10" "1" "100327026" "100327026" "subst" "0.183682" "02325" "AGL_000025" "g.100327026C>T" "" "" "" "AGL(NM_000028.2):c.83-33C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99861470C>T" "" "benign" "" "0000258988" "0" "10" "1" "100340782" "100340782" "subst" "0.0136026" "02325" "AGL_000030" "g.100340782G>T" "" "" "" "AGL(NM_000028.2):c.1155G>T (p.(Lys385Asn), p.K385N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99875226G>T" "" "benign" "" "0000258989" "0" "10" "1" "100346741" "100346741" "subst" "0.554136" "02325" "AGL_000003" "g.100346741T>C" "" "" "" "AGL(NM_000028.2):c.2001+8T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99881185T>C" "" "benign" "" "0000258990" "0" "10" "1" "100353675" "100353675" "subst" "0.690765" "02325" "AGL_000038" "g.100353675G>A" "" "" "" "AGL(NM_000028.2):c.2812+11G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99888119G>A" "" "benign" "" "0000258991" "0" "10" "1" "100336361" "100336361" "subst" "0.716811" "02325" "AGL_000027" "g.100336361C>T" "" "" "" "AGL(NM_000028.2):c.894C>T (p.L298=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99870805C>T" "" "benign" "" "0000258992" "0" "10" "1" "100340225" "100340225" "subst" "0.717279" "02325" "AGL_000028" "g.100340225G>A" "" "" "" "AGL(NM_000642.3):c.959-18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99874669G>A" "" "benign" "" "0000259437" "0" "30" "1" "100336151" "100336151" "subst" "9.76396E-5" "02325" "AGL_000026" "g.100336151G>A" "" "" "" "AGL(NM_000028.2):c.846+14G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99870595G>A" "" "likely benign" "" "0000260664" "0" "30" "1" "100340782" "100340782" "subst" "0.0136026" "02326" "AGL_000030" "g.100340782G>T" "" "" "" "AGL(NM_000028.2):c.1155G>T (p.(Lys385Asn), p.K385N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99875226G>T" "" "likely benign" "" "0000260665" "0" "10" "1" "100340827" "100340827" "subst" "0.0308521" "02326" "AGL_000031" "g.100340827T>C" "" "" "" "AGL(NM_000028.2):c.1185+15T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99875271T>C" "" "benign" "" "0000260666" "0" "30" "1" "100346327" "100346327" "subst" "0.00145481" "02326" "AGL_000033" "g.100346327G>T" "" "" "" "AGL(NM_000028.2):c.1875G>T (p.T625=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99880771G>T" "" "likely benign" "" "0000260667" "0" "30" "1" "100318245" "100318245" "subst" "0.0161413" "02326" "AGL_000024" "g.100318245T>G" "" "" "" "AGL(NM_000646.2):c.20T>G (p.(Ile7Ser), p.I7S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99852689T>G" "" "likely benign" "" "0000262071" "0" "30" "1" "100340326" "100340326" "subst" "3.25061E-5" "01943" "AGL_000029" "g.100340326G>A" "" "" "" "AGL(NM_000028.2):c.1042G>A (p.V348I, p.(Val348Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99874770G>A" "" "likely benign" "" "0000262072" "0" "10" "1" "100366213" "100366213" "subst" "0.000909992" "01943" "AGL_000039" "g.100366213G>A" "" "" "" "AGL(NM_000028.2):c.3384G>A (p.A1128=, p.(Ala1128=)), AGL(NM_000642.3):c.3384G>A (p.A1128=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99900657G>A" "" "benign" "" "0000320885" "0" "30" "1" "100343254" "100343254" "subst" "0.00859749" "01804" "AGL_000032" "g.100343254G>A" "" "" "" "AGL(NM_000028.2):c.1481G>A (p.(Arg494His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99877698G>A" "" "likely benign" "" "0000320886" "0" "30" "1" "100349757" "100349757" "subst" "0.00173792" "01804" "AGL_000037" "g.100349757A>G" "" "" "" "AGL(NM_000028.2):c.2390A>G (p.(Asn797Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99884201A>G" "" "likely benign" "" "0000336870" "0" "70" "1" "100327811" "100327811" "subst" "0" "02327" "AGL_000042" "g.100327811A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.99862255A>T" "" "likely pathogenic" "" "0000434973" "1" "15" "1" "100316589" "100316589" "subst" "0.469761" "00000" "AGL_000002" "g.100316589A>G" "" "{PMID:Shen 1997:08990006}" "" "-10G/A (ex3)" "" "Unknown" "" "" "0" "" "" "g.99851033A>G" "" "benign" "" "0000434974" "1" "95" "1" "100327070" "100327070" "subst" "4.06388E-6" "00000" "AGL_000007" "g.100327070C>T" "" "{PMID:Shaiu 2000:10655153}" "" "" "" "Unknown" "" "" "0" "" "" "g.99861514C>T" "" "pathogenic" "" "0000434975" "1" "95" "1" "100327232" "100327232" "subst" "4.8765E-5" "00000" "AGL_000008" "g.100327232C>T" "" "{PMID:Shaiu 2000:10655153}" "" "" "" "Unknown" "" "" "0" "" "" "g.99861676C>T" "" "pathogenic" "" "0000434976" "1" "95" "1" "100346671" "100346673" "del" "0" "00000" "AGL_000011" "g.100346671_100346673del" "" "{PMID:Shaiu 2000:10655153}" "" "1937delTTG" "" "Unknown" "" "" "0" "" "" "g.99881115_99881117del" "" "pathogenic" "" "0000434977" "1" "15" "1" "100346741" "100346741" "subst" "0.554136" "00000" "AGL_000003" "g.100346741T>C" "" "{PMID:Shen 1997:08990006}" "" "IVS16+8C/T" "" "Unknown" "" "" "0" "" "" "g.99881185T>C" "" "benign" "" "0000434978" "1" "95" "1" "100357226" "100357226" "del" "1.62529E-5" "00000" "AGL_000006" "g.100357226del" "" "{PMID:Shaiu 2000:10655153}" "" "" "" "Unknown" "" "" "0" "" "" "g.99891670del" "" "pathogenic" "" "0000434979" "0" "95" "1" "100357226" "100357226" "del" "1.62529E-5" "02976" "AGL_000006" "g.100357226del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.99891670del" "" "pathogenic" "" "0000434980" "1" "95" "1" "100361925" "100361925" "subst" "0.0731549" "00000" "AGL_000009" "g.100361925G>A" "" "{PMID:Shaiu 2000:10655153}" "" "" "" "Unknown" "" "" "0" "" "" "g.99896369G>A" "" "pathogenic" "" "0000434981" "1" "95" "1" "100368315" "100368315" "del" "0" "00000" "AGL_000010" "g.100368315del" "" "{PMID:Shaiu 2000:10655153}" "" "" "" "Unknown" "" "" "0" "" "" "g.99902759del" "" "pathogenic" "" "0000434982" "21" "95" "1" "100378035" "100378035" "dup" "0" "00000" "AGL_000005" "g.100378035dup" "" "{PMID:Pavari 1998:09584265}" "" "3904insA" "" "Unknown" "" "" "0" "" "" "g.99912479dup" "" "pathogenic" "" "0000434983" "10" "95" "1" "100378035" "100378035" "dup" "0" "02976" "AGL_000005" "g.100378035dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.99912479dup" "" "pathogenic" "" "0000434984" "20" "95" "1" "100378035" "100378035" "dup" "0" "02976" "AGL_000005" "g.100378035dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.99912479dup" "" "pathogenic" "" "0000434985" "11" "95" "1" "100379098" "100379098" "del" "8.14127E-6" "00000" "AGL_000012" "g.100379098del" "" "{PMID:Shaiu 2000:10655153}" "AvaII-" "3964delT" "" "Unknown" "" "" "0" "" "" "g.99913542del" "" "pathogenic" "" "0000434986" "21" "95" "1" "100379098" "100379098" "del" "8.14127E-6" "00000" "AGL_000012" "g.100379098del" "" "{PMID:Shaiu 2000:10655153}" "AvaII-" "3964delT" "" "Unknown" "" "" "0" "" "" "g.99913542del" "" "pathogenic" "" "0000434987" "10" "95" "1" "100379098" "100379098" "del" "8.14127E-6" "00000" "AGL_000012" "g.100379098del" "" "{PMID:Shaiu 2000:10655153}" "AvaII-" "3964delT" "" "Unknown" "" "" "0" "" "" "g.99913542del" "" "pathogenic" "" "0000434988" "20" "95" "1" "100379098" "100379098" "del" "8.14127E-6" "00000" "AGL_000012" "g.100379098del" "" "{PMID:Shaiu 2000:10655153}" "AvaII-" "3964delT" "" "Unknown" "" "" "0" "" "" "g.99913542del" "" "pathogenic" "" "0000434989" "1" "95" "1" "100379098" "100379098" "del" "8.14127E-6" "00000" "AGL_000012" "g.100379098del" "" "{PMID:Shaiu 2000:10655153}" "AvaII-" "3964delT" "" "Unknown" "" "" "0" "" "" "g.99913542del" "" "pathogenic" "" "0000434990" "11" "95" "1" "100381004" "100381004" "dup" "0" "00000" "AGL_000005" "g.100381004dup" "" "{PMID:Pavari 1998:09584265}" "" "4214insA" "" "Unknown" "" "" "0" "" "" "g.99915448dup" "" "pathogenic" "" "0000434991" "10" "95" "1" "100381954" "100381954" "subst" "5.86864E-5" "00000" "AGL_000004" "g.100381954A>G" "" "{PMID:Okubo 1998:09490286}" "" "" "" "Unknown" "" "" "0" "" "" "g.99916398A>G" "" "pathogenic" "" "0000434992" "21" "95" "1" "100381954" "100381954" "subst" "5.86864E-5" "00000" "AGL_000004" "g.100381954A>G" "" "{PMID:Okubo 1998:09490286}" "" "" "" "Unknown" "" "" "0" "" "" "g.99916398A>G" "" "pathogenic" "" "0000434993" "10" "95" "1" "100381954" "100381954" "subst" "5.86864E-5" "02976" "AGL_000004" "g.100381954A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.99916398A>G" "" "pathogenic" "" "0000434994" "20" "95" "1" "100381954" "100381954" "subst" "5.86864E-5" "02976" "AGL_000004" "g.100381954A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.99916398A>G" "" "pathogenic" "" "0000434995" "10" "95" "1" "100381954" "100381954" "subst" "5.86864E-5" "02976" "AGL_000004" "g.100381954A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.99916398A>G" "" "pathogenic" "" "0000434996" "20" "95" "1" "100381954" "100381954" "subst" "5.86864E-5" "02976" "AGL_000004" "g.100381954A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.99916398A>G" "" "pathogenic" "" "0000434997" "1" "95" "1" "100381954" "100381954" "subst" "5.86864E-5" "00000" "AGL_000004" "g.100381954A>G" "" "{PMID:Shaiu 2000:10655153}" "" "" "" "Unknown" "" "" "0" "" "" "g.99916398A>G" "" "pathogenic" "" "0000434998" "2" "95" "1" "100381954" "100381954" "subst" "5.86864E-5" "00000" "AGL_000004" "g.100381954A>G" "" "{PMID:Shaiu 2000:10655153}" "" "" "" "Unknown" "" "" "0" "" "" "g.99916398A>G" "" "pathogenic" "" "0000434999" "21" "95" "1" "100387137" "100387137" "dup" "0" "00000" "AGL_000001" "g.100387137dup" "" "{PMID:Shen 1997:08990006}" "RsaI-" "4529insA (ex35)" "" "Unknown" "" "" "0" "" "" "g.99921581dup" "" "pathogenic" "" "0000435000" "10" "95" "1" "100387137" "100387137" "dup" "0" "00000" "AGL_000001" "g.100387137dup" "" "{PMID:Shen 1997:08990006}" "RsaI-" "4529insA (ex35)" "" "Unknown" "" "" "0" "" "" "g.99921581dup" "" "pathogenic" "" "0000435001" "0" "95" "1" "100387137" "100387137" "dup" "0" "02976" "AGL_000001" "g.100387137dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.99921581dup" "" "pathogenic" "" "0000471103" "11" "70" "1" "100366252" "100366253" "del" "0" "01864" "AGL_000043" "g.100366252_100366253del" "" "" "" "3423_3424delTG" "" "Uniparental disomy, paternal allele" "" "" "0" "" "" "g.99900696_99900697del" "" "pathogenic" "" "0000502177" "0" "90" "1" "100316614" "100316614" "subst" "1.62441E-5" "02325" "AGL_000044" "g.100316614C>T" "" "" "" "AGL(NM_000028.2):c.16C>T (p.Q6*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99851058C>T" "" "pathogenic" "" "0000502179" "0" "30" "1" "100327962" "100327962" "subst" "0.000316749" "01804" "AGL_000045" "g.100327962G>A" "" "" "" "AGL(NM_000028.2):c.443G>A (p.(Arg148Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99862406G>A" "" "likely benign" "" "0000502180" "0" "30" "1" "100340787" "100340787" "subst" "0.0523741" "01804" "AGL_000046" "g.100340787G>A" "" "" "" "AGL(NM_000028.2):c.1160G>A (p.(Arg387Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99875231G>A" "" "likely benign" "" "0000502181" "0" "50" "1" "100343205" "100343205" "subst" "0.000130083" "01943" "AGL_000047" "g.100343205G>A" "" "" "" "AGL(NM_000028.2):c.1432G>A (p.V478I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99877649G>A" "" "VUS" "" "0000502182" "0" "90" "1" "100346953" "100346954" "ins" "0" "02325" "AGL_000048" "g.100346953_100346954insA" "" "" "" "AGL(NM_000028.2):c.2107_2108insA (p.C703*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99881397_99881398insA" "" "pathogenic" "" "0000502184" "0" "30" "1" "100353589" "100353589" "subst" "0" "01804" "AGL_000050" "g.100353589T>A" "" "" "" "AGL(NM_000028.2):c.2737T>A (p.(Ser913Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99888033T>A" "" "likely benign" "" "0000502185" "0" "10" "1" "100356846" "100356846" "subst" "0.00089028" "01943" "AGL_000051" "g.100356846A>G" "" "" "" "AGL(NM_000028.2):c.2883A>G (p.R961=, p.(Arg961=)), AGL(NM_000642.3):c.2883A>G (p.R961=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99891290A>G" "" "benign" "" "0000502186" "0" "30" "1" "100376305" "100376305" "subst" "9.35682E-5" "01943" "AGL_000052" "g.100376305A>T" "" "" "" "AGL(NM_000028.2):c.3738A>T (p.G1246=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99910749A>T" "" "likely benign" "" "0000502190" "0" "90" "1" "100387137" "100387137" "dup" "0" "02325" "AGL_000055" "g.100387137dup" "" "" "" "AGL(NM_000028.2):c.4529dupA (p.Y1510*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99921581dup" "" "pathogenic" "" "0000597034" "10" "70" "1" "100336426" "100336426" "subst" "0" "03426" "AGL_000056" "g.100336426G>A" "" "" "" "" "in trans with c.1019delA" "Germline" "" "rs1553184657" "0" "" "" "g.99870870G>A" "{CV-RCV:000664741.1}" "pathogenic (recessive)" "" "0000597035" "20" "70" "1" "100340304" "100340304" "del" "0" "03426" "AGL_000057" "g.100340304del" "" "" "" "1020delA" "in trans with c.958+1G>A" "Germline" "" "" "0" "" "" "g.99874748del" "" "pathogenic (recessive)" "" "0000604596" "0" "50" "1" "100327924" "100327924" "subst" "0" "02327" "AGL_000058" "g.100327924G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99862368G>C" "" "VUS" "" "0000604597" "0" "50" "1" "100340312" "100340312" "subst" "0.000426649" "02327" "AGL_000059" "g.100340312G>A" "" "" "" "AGL(NM_000642.3):c.1028G>A (p.(Arg343Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99874756G>A" "" "VUS" "" "0000604598" "0" "50" "1" "100340360" "100340360" "subst" "7.31594E-5" "02327" "AGL_000060" "g.100340360C>T" "" "" "" "AGL(NM_000642.3):c.1076C>T (p.(Pro359Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99874804C>T" "" "VUS" "" "0000604599" "0" "70" "1" "100343278" "100343287" "del" "0" "02327" "AGL_000062" "g.100343278_100343287del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99877722_99877731del" "" "likely pathogenic" "" "0000604600" "0" "50" "1" "100347247" "100347247" "subst" "7.73225E-5" "02327" "AGL_000064" "g.100347247G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99881691G>C" "" "VUS" "" "0000604601" "0" "30" "1" "100353534" "100353534" "subst" "0" "02327" "AGL_000065" "g.100353534T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99887978T>A" "" "likely benign" "" "0000604602" "0" "50" "1" "100366413" "100366413" "subst" "0.000101546" "02327" "AGL_000066" "g.100366413C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99900857C>G" "" "VUS" "" "0000620311" "0" "70" "1" "100340911" "100340911" "subst" "0" "02325" "AGL_000061" "g.100340911C>G" "" "" "" "AGL(NM_000028.2):c.1186-3C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99875355C>G" "" "likely pathogenic" "" "0000620312" "0" "50" "1" "100347100" "100347100" "subst" "0" "01943" "AGL_000063" "g.100347100T>C" "" "" "" "AGL(NM_000028.2):c.2161T>C (p.Y721H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.99881544T>C" "" "VUS" "" "0000638678" "3" "90" "1" "100366355" "100366355" "subst" "0" "03573" "AGL_000068" "g.100366355A>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.99900799A>T" "" "pathogenic (recessive)" "" "0000644239" "3" "90" "1" "100345499" "100345499" "dup" "0" "03573" "AGL_000069" "g.100345499dup" "" "" "" "1632dupG" "" "Germline" "yes" "" "0" "" "" "g.99879943dup" "" "pathogenic (recessive)" "" "0000647308" "1" "30" "1" "100327183" "100327183" "subst" "0.0162842" "03575" "AGL_000067" "g.100327183T>C" "27/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "27 heterozygous, no homozygous; {DB:CLININrs2230305}" "Germline" "" "rs2230305" "0" "" "" "g.99861627T>C" "" "likely benign" "" "0000647309" "1" "30" "1" "100343254" "100343254" "subst" "0.00859749" "03575" "AGL_000032" "g.100343254G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs141043166}" "Germline" "" "rs141043166" "0" "" "" "g.99877698G>A" "" "likely benign" "" "0000647310" "1" "50" "1" "100346211" "100346211" "subst" "0.00054495" "03575" "AGL_000070" "g.100346211C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs139488862}" "Germline" "" "rs139488862" "0" "" "" "g.99880655C>T" "" "VUS" "" "0000647311" "1" "50" "1" "100349757" "100349757" "subst" "0.00173792" "03575" "AGL_000037" "g.100349757A>G" "2/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs149210307}" "Germline" "" "rs149210307" "0" "" "" "g.99884201A>G" "" "VUS" "" "0000647312" "1" "30" "1" "100368318" "100368318" "subst" "0.000212042" "03575" "AGL_000071" "g.100368318G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs202046937}" "Germline" "" "rs202046937" "0" "" "" "g.99902762G>A" "" "likely benign" "" "0000647313" "1" "30" "1" "100377973" "100377973" "subst" "0.013905" "03575" "AGL_000072" "g.100377973T>C" "26/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "26 heterozygous, no homozygous; {DB:CLININrs28730706}" "Germline" "" "rs28730706" "0" "" "" "g.99912417T>C" "" "likely benign" "" "0000647314" "1" "70" "1" "100381954" "100381954" "subst" "5.86864E-5" "03575" "AGL_000004" "g.100381954A>G" "1/2788 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs369973784}" "Germline" "" "rs369973784" "0" "" "" "g.99916398A>G" "" "likely pathogenic" "" "0000647315" "1" "50" "1" "100382037" "100382037" "subst" "0.000900233" "03575" "AGL_000073" "g.100382037A>G" "21/2791 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 21 heterozygous, no homozygous; {DB:CLININrs143815159}" "Germline" "" "rs143815159" "0" "" "" "g.99916481A>G" "" "VUS" "" "0000653092" "1" "30" "1" "100340782" "100340782" "subst" "0.0136026" "03575" "AGL_000030" "g.100340782G>T" "24/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "24 heterozygous; {DB:CLININrs28730701}" "Germline" "" "rs28730701" "0" "" "" "g.99875226G>T" "" "likely benign" "" "0000670151" "3" "30" "1" "100340782" "100340782" "subst" "0.0136026" "03575" "AGL_000030" "g.100340782G>T" "2/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 homozygous; {DB:CLININrs28730701}" "Germline" "" "rs28730701" "0" "" "" "g.99875226G>T" "" "likely benign" "" "0000675378" "0" "50" "1" "100327863" "100327863" "subst" "0.000365473" "01943" "AGL_000074" "g.100327863T>C" "" "" "" "AGL(NM_000028.2):c.344T>C (p.V115A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000675379" "0" "50" "1" "100347161" "100347161" "subst" "4.87527E-5" "01943" "AGL_000075" "g.100347161A>G" "" "" "" "AGL(NM_000028.2):c.2222A>G (p.Q741R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000687787" "0" "30" "1" "100318245" "100318245" "subst" "0.0161413" "01804" "AGL_000024" "g.100318245T>G" "" "" "" "AGL(NM_000646.2):c.20T>G (p.(Ile7Ser), p.I7S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000687789" "0" "30" "1" "100340782" "100340782" "subst" "0.0136026" "01804" "AGL_000030" "g.100340782G>T" "" "" "" "AGL(NM_000028.2):c.1155G>T (p.(Lys385Asn), p.K385N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000697287" "0" "70" "1" "100347001" "100347001" "subst" "0" "00006" "AGL_000076" "g.100347001C>T" "2/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.99881445C>T" "" "likely pathogenic" "" "0000697288" "0" "70" "1" "100378014" "100378014" "del" "0" "00006" "AGL_000077" "g.100378014del" "2/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.99912458del" "" "likely pathogenic" "" "0000714830" "1" "90" "1" "100327232" "100327232" "subst" "4.8765E-5" "00000" "AGL_000008" "g.100327232C>T" "" "{PMID:Wang 2013:22899091}" "" "" "" "Germline" "" "" "0" "" "" "g.99861676C>T" "" "pathogenic (recessive)" "" "0000714832" "1" "90" "1" "100330139" "100330139" "subst" "0" "00000" "AGL_000078" "g.100330139C>T" "" "{PMID:Wang 2013:22899091}" "" "" "" "Germline" "" "" "0" "" "" "g.99864583C>T" "" "pathogenic (recessive)" "" "0000714833" "3" "90" "1" "100345603" "100345603" "subst" "8.12783E-6" "00000" "AGL_000079" "g.100345603G>T" "" "{PMID:Wang 2013:22899091}" "" "" "" "Germline" "" "" "0" "" "" "g.99880047G>T" "" "pathogenic (recessive)" "" "0000714871" "2" "90" "1" "100353575" "100353575" "subst" "8.13332E-6" "00000" "AGL_000080" "g.100353575T>G" "" "{PMID:Wang 2013:22899091}" "" "" "" "Germline" "" "" "0" "" "" "g.99888019T>G" "" "pathogenic (recessive)" "" "0000714873" "2" "90" "1" "100345603" "100345603" "subst" "8.12783E-6" "00000" "AGL_000079" "g.100345603G>T" "" "{PMID:Wang 2013:22899091}" "" "" "" "Germline" "" "" "0" "" "" "g.99880047G>T" "" "pathogenic (recessive)" "" "0000787782" "0" "50" "1" "100346211" "100346211" "subst" "0.00054495" "03779" "AGL_000070" "g.100346211C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs139488862" "0" "" "" "" "" "VUS" "" "0000798624" "0" "30" "1" "100349983" "100349983" "subst" "0.0027805" "01804" "AGL_000081" "g.100349983C>T" "" "" "" "AGL(NM_000028.2):c.2522C>T (p.(Ser841Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000798625" "0" "30" "1" "100356777" "100356777" "subst" "3.65922E-5" "01943" "AGL_000082" "g.100356777T>G" "" "" "" "AGL(NM_000028.2):c.2814T>G (p.G938=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000798626" "0" "50" "1" "100357294" "100357294" "subst" "4.06438E-6" "01943" "AGL_000083" "g.100357294A>G" "" "" "" "AGL(NM_000028.2):c.3082A>G (p.S1028G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000848196" "0" "30" "1" "100356846" "100356846" "subst" "0.00089028" "02326" "AGL_000051" "g.100356846A>G" "" "" "" "AGL(NM_000028.2):c.2883A>G (p.R961=, p.(Arg961=)), AGL(NM_000642.3):c.2883A>G (p.R961=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000848198" "0" "30" "1" "100366213" "100366213" "subst" "0.000909992" "02326" "AGL_000039" "g.100366213G>A" "" "" "" "AGL(NM_000028.2):c.3384G>A (p.A1128=, p.(Ala1128=)), AGL(NM_000642.3):c.3384G>A (p.A1128=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856844" "0" "30" "1" "100340252" "100340252" "subst" "0.00034291" "01943" "AGL_000084" "g.100340252G>A" "" "" "" "AGL(NM_000028.2):c.968G>A (p.R323Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856845" "0" "30" "1" "100350017" "100350017" "subst" "0.000486843" "01943" "AGL_000085" "g.100350017T>C" "" "" "" "AGL(NM_000028.2):c.2546+10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856846" "0" "50" "1" "100379128" "100379128" "subst" "4.06702E-6" "01943" "AGL_000086" "g.100379128A>C" "" "" "" "AGL(NM_000028.2):c.3995A>C (p.Q1332P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856847" "0" "30" "1" "100387183" "100387183" "subst" "0.000228058" "01943" "AGL_000087" "g.100387183T>A" "" "" "" "AGL(NM_000028.2):c.4575T>A (p.I1525=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000882641" "0" "50" "1" "100340225" "100340226" "ins" "0.00287132" "02326" "AGL_000088" "g.100340225_100340226insAAAATAGTGACAGTTTTAATCTCTTTGTAGATATTTGCATTTAAGGTATCA" "" "" "" "AGL(NM_000642.3):c.959-18_959-17ins51" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000882642" "0" "90" "1" "100356892" "100356892" "subst" "0" "02326" "AGL_000089" "g.100356892C>T" "" "" "" "AGL(NM_000642.3):c.2929C>T (p.R977*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000882643" "0" "30" "1" "100366260" "100366260" "subst" "0.00144561" "02326" "AGL_000090" "g.100366260T>A" "" "" "" "AGL(NM_000642.2):c.3431T>A (p.(Ile1144Asn)), AGL(NM_000642.3):c.3431T>A (p.I1144N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000882644" "0" "50" "1" "100377978" "100377978" "subst" "0" "02327" "AGL_000091" "g.100377978A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000910721" "0" "50" "1" "100340963" "100340963" "subst" "8.12565E-6" "01804" "AGL_000092" "g.100340963A>G" "" "" "" "AGL(NM_000028.2):c.1235A>G (p.(His412Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000918632" "0" "70" "1" "100345498" "100345498" "subst" "0" "00006" "AGL_000093" "g.100345498G>T" "" "{PMID:Neubauer 2021:33895855}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "VUS" "ACMG" "0000920860" "0" "90" "1" "100368302" "100368302" "subst" "8.15142E-6" "03779" "AGL_000094" "g.100368302C>T" "" "" "" "" "" "Unknown" "" "rs771853367" "0" "" "" "" "" "pathogenic" "" "0000922891" "0" "90" "1" "100340950" "100340950" "subst" "1.62541E-5" "02327" "AGL_000095" "g.100340950C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000922892" "0" "30" "1" "100346211" "100346211" "subst" "0.00054495" "02326" "AGL_000070" "g.100346211C>T" "" "" "" "AGL(NM_000642.3):c.1759C>T (p.H587Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000922893" "0" "90" "1" "100387137" "100387137" "dup" "0" "02327" "AGL_000001" "g.100387137dup" "" "" "" "AGL(NM_000028.2):c.4529dupA (p.Y1510*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000927958" "0" "50" "1" "100336010" "100336010" "subst" "0" "02327" "AGL_000096" "g.100336010A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000945232" "0" "50" "1" "100327088" "100327088" "subst" "0.00362443" "00002" "AGL_000016" "g.100327088A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.99861532A>G" "" "VUS" "" "0000973127" "0" "50" "1" "100316684" "100316684" "subst" "0.00027616" "01804" "AGL_000097" "g.100316684A>C" "" "" "" "AGL(NM_000642.3):c.82+4A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000973129" "0" "30" "1" "100327183" "100327183" "subst" "0.0162842" "01804" "AGL_000067" "g.100327183T>C" "" "" "" "AGL(NM_000642.3):c.207T>C (p.(Asn69=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000973130" "0" "50" "1" "100340326" "100340326" "subst" "3.25061E-5" "01804" "AGL_000029" "g.100340326G>A" "" "" "" "AGL(NM_000028.2):c.1042G>A (p.V348I, p.(Val348Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000973131" "0" "30" "1" "100356846" "100356846" "subst" "0.00089028" "01804" "AGL_000051" "g.100356846A>G" "" "" "" "AGL(NM_000028.2):c.2883A>G (p.R961=, p.(Arg961=)), AGL(NM_000642.3):c.2883A>G (p.R961=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000973132" "0" "30" "1" "100366213" "100366213" "subst" "0.000909992" "01804" "AGL_000039" "g.100366213G>A" "" "" "" "AGL(NM_000028.2):c.3384G>A (p.A1128=, p.(Ala1128=)), AGL(NM_000642.3):c.3384G>A (p.A1128=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000973133" "0" "30" "1" "100377973" "100377973" "subst" "0.013905" "01804" "AGL_000072" "g.100377973T>C" "" "" "" "AGL(NM_000642.3):c.3849T>C (p.(Ala1283=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000973134" "0" "50" "1" "100379110" "100379110" "subst" "0" "01804" "AGL_000098" "g.100379110A>G" "" "" "" "AGL(NM_000642.3):c.3977A>G (p.(Glu1326Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000987537" "3" "70" "1" "100353655" "100353655" "subst" "0" "04221" "AGL_000099" "g.100353655G>T" "" "" "" "" "Variant classified as per ACMG guidelines (Richards et al 2015) and to the recently developed ACMG scoring system (Tavtigian et al 2020)." "Germline" "yes" "rs1051512948" "0" "" "" "g.99888099G>T" "" "likely pathogenic (recessive)" "ACMG" "0000990035" "0" "30" "1" "100350133" "100350133" "subst" "0" "01804" "AGL_000100" "g.100350133T>C" "" "" "" "AGL(NM_000642.2):c.2555T>C (p.(Leu852Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000990036" "0" "30" "1" "100366260" "100366260" "subst" "0.00144561" "01804" "AGL_000090" "g.100366260T>A" "" "" "" "AGL(NM_000642.2):c.3431T>A (p.(Ile1144Asn)), AGL(NM_000642.3):c.3431T>A (p.I1144N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000990037" "0" "90" "1" "100378035" "100378035" "dup" "0" "01804" "AGL_000005" "g.100378035dup" "" "" "" "AGL(NM_000642.2):c.3911dupA (p.(Asn1304fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000990038" "0" "10" "1" "100380934" "100380934" "subst" "0.00259171" "02326" "AGL_000101" "g.100380934G>A" "" "" "" "AGL(NM_000642.3):c.4162-11G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000990039" "0" "50" "1" "100380941" "100380941" "subst" "4.06653E-6" "01804" "AGL_000102" "g.100380941C>G" "" "" "" "AGL(NM_000642.2):c.4162-4C>G (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000990040" "0" "50" "1" "100382007" "100382007" "subst" "1.22255E-5" "01804" "AGL_000103" "g.100382007A>G" "" "" "" "AGL(NM_000642.2):c.4301A>G (p.(Asn1434Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001021236" "1" "90" "1" "100327867" "100327892" "del" "0" "00006" "AGL_000104" "g.100327867_100327892del" "" "{PMID:Marti 2025:39666917}" "" "c.348_373delTGCTGATAATCATGTGCTACCCTTGG" "" "Germline" "" "" "0" "" "" "g.99862311_99862336del" "" "pathogenic (recessive)" "" "0001021281" "2" "90" "1" "100358120" "100358121" "del" "0" "00006" "AGL_000105" "g.100358120_100358121del" "" "{PMID:Marti 2025:39666917}" "" "c.3216_3217delGA" "" "Germline" "" "" "0" "" "" "g.99892564_99892565del" "" "pathogenic (recessive)" "" "0001030984" "0" "30" "1" "100318116" "100318116" "subst" "0" "01804" "AGL_000106" "g.100318116G>T" "" "" "" "AGL(NM_000646.2):c.-109-1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001030987" "0" "30" "1" "100347219" "100347219" "subst" "0.00107748" "01804" "AGL_000107" "g.100347219C>T" "" "" "" "AGL(NM_000642.3):c.2280C>T (p.(Ser760=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001030988" "0" "50" "1" "100366389" "100366394" "del" "0" "01804" "AGL_000108" "g.100366389_100366394del" "" "" "" "AGL(NM_000642.3):c.3560_3565del (p.(Asp1187_Ser1188del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001030989" "0" "50" "1" "100379185" "100379185" "subst" "0.000154494" "01804" "AGL_000109" "g.100379185A>G" "" "" "" "AGL(NM_000642.3):c.4052A>G (p.(Lys1351Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001030990" "0" "50" "1" "100381989" "100381989" "subst" "1.22367E-5" "01804" "AGL_000110" "g.100381989A>C" "" "" "" "AGL(NM_000642.3):c.4283A>C (p.(Tyr1428Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001050169" "0" "50" "1" "100336354" "100336354" "subst" "0.000170935" "01804" "AGL_000111" "g.100336354T>G" "" "" "" "AGL(NM_000642.3):c.887T>G (p.(Leu296Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001050170" "0" "50" "1" "100340312" "100340312" "subst" "0.000426649" "01804" "AGL_000059" "g.100340312G>A" "" "" "" "AGL(NM_000642.3):c.1028G>A (p.(Arg343Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001050171" "0" "50" "1" "100340360" "100340360" "subst" "7.31594E-5" "01804" "AGL_000060" "g.100340360C>T" "" "" "" "AGL(NM_000642.3):c.1076C>T (p.(Pro359Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001050172" "0" "50" "1" "100342156" "100342156" "subst" "0.000113807" "01804" "AGL_000112" "g.100342156A>G" "" "" "" "AGL(NM_000642.3):c.1423+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001050173" "0" "50" "1" "100358162" "100358163" "delins" "0" "01804" "AGL_000113" "g.100358162_100358163delinsCC" "" "" "" "AGL(NM_000642.3):c.3258_3259delinsCC (p.(Gly1087Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001050174" "0" "70" "1" "100366273" "100366273" "subst" "0" "01804" "AGL_000114" "g.100366273C>G" "" "" "" "AGL(NM_000642.3):c.3444C>G (p.(Tyr1148*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001063113" "0" "50" "1" "100336321" "100336321" "subst" "0.000248454" "01804" "AGL_000115" "g.100336321G>A" "" "" "" "AGL(NM_000642.3):c.854G>A (p.(Arg285Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001068308" "1" "90" "1" "100381965" "100381965" "subst" "0" "00006" "AGL_000116" "g.100381965G>T" "" "{PMID:Soriano-Sexto 2026:41588148}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.99916409G>T" "" "likely pathogenic (recessive)" "" "0001068309" "2" "70" "1" "100359090" "100359090" "subst" "0" "00006" "AGL_000117" "g.100359090A>G" "" "{PMID:Soriano-Sexto 2026:41588148}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.99893534A>G" "" "likely pathogenic (recessive)" "" "0001068986" "1" "70" "1" "100327235" "100327235" "subst" "0" "00006" "AGL_000119" "g.100327235C>T" "" "{PMID:Molaei 2025:41315541}" "" "" "ACMG PVS1, PM2" "Germline" "" "" "0" "" "" "g.99861679C>T" "SCV006075387" "likely pathogenic" "ACMG" "0001069137" "0" "70" "1" "100327057" "100327981" "del" "0" "00006" "AGL_000118" "g.(?_100327057)_(100327981_?)del" "" "{PMID:Molaei 2025:41315541}" "" "del non-coding, NC_000001.10:g.(?_100327057)_(100327981_?)del" "ACMG 1A, 2B, 2E, 3A" "Germline" "" "" "0" "" "" "g.(?_99861501)_(99862425_?)del" "" "likely pathogenic" "ACMG" "0001069260" "3" "70" "1" "100361933" "100361933" "subst" "0" "00006" "AGL_000122" "g.100361933T>G" "" "{PMID:Molaei 2025:41315541}" "" "" "ACMG PVS1, PM2" "Germline" "" "" "0" "" "" "g.99896377T>G" "SCV006074700" "likely pathogenic" "ACMG" "0001069358" "3" "90" "1" "100376383" "100376384" "del" "0" "00006" "AGL_000123" "g.100376383_100376384del" "" "{PMID:Molaei 2025:41315541}" "" "3816_3817delAG" "ACMG PVS1, PM2, PM3, PP5" "Germline" "" "" "0" "" "" "g.99910827_99910828del" "SCV006074701" "pathogenic" "ACMG" "0001069544" "3" "70" "1" "100341002" "100341002" "subst" "0" "00006" "AGL_000120" "g.100341002T>A" "" "{PMID:Molaei 2025:41315541}" "" "" "ACMG PVS1_vs, PM2" "Germline" "" "" "0" "" "" "g.99875446T>A" "SCV006075388" "likely pathogenic" "ACMG" "0001070070" "2" "90" "1" "100343360" "100343360" "del" "0" "00006" "AGL_000121" "g.100343360del" "" "{PMID:Molaei 2025:41315541}" "" "" "ACMG PVS1, PM2, PP5" "Germline" "" "" "0" "" "" "g.99877804del" "SCV001755664" "pathogenic" "ACMG" "0001073319" "1" "90" "1" "100343350" "100343350" "subst" "4.0653E-6" "00006" "AGL_000124" "g.100343350A>G" "" "{PMID:Beecroft 2020:32153140}" "" "" "" "Germline" "" "" "0" "" "" "g.99877794A>G" "" "pathogenic (recessive)" "" "0001073733" "2" "90" "1" "100350168" "100350168" "subst" "7.3244E-5" "00006" "AGL_000125" "g.100350168C>T" "" "{PMID:Beecroft 2020:32153140}" "" "" "" "Germline" "" "" "0" "" "" "g.99884612C>T" "" "pathogenic (recessive)" "" "0001074269" "3" "90" "1" "100330146" "100330146" "subst" "0" "00006" "AGL_000126" "g.100330146G>A" "" "{PMID:Alhammad 2024:39232665}" "" "" "" "Germline" "" "" "0" "" "" "g.99864590G>A" "" "pathogenic (recessive)" "" "0001074276" "3" "90" "1" "100330146" "100330146" "subst" "0" "00006" "AGL_000126" "g.100330146G>A" "" "{PMID:Alhammad 2024:39232665}" "" "" "" "Germline" "" "" "0" "" "" "g.99864590G>A" "" "pathogenic (recessive)" "" "0001075785" "0" "50" "1" "100350175" "100350175" "subst" "8.13656E-6" "00006" "AGL_000127" "g.100350175A>T" "" "{PMID:Sambuughin 2024:39457051}" "" "" "combination with other variants not reported" "Germline/De novo (untested)" "" "rs367713487" "0" "" "" "g.99884619A>T" "" "VUS" "" "0001076112" "0" "90" "1" "0" "0" "" "" "00006" "ABCA4_000000" "g.?" "" "{PMID:Kruijt 2021:32978841}" "" "848T>C (Val283Ala)" "no variant 2nd chromosome reported" "Germline" "" "" "0" "" "" "g.?" "" "pathogenic" "" "0001081410" "1" "70" "1" "0" "0" "" "" "00006" "AGL_000000" "g.?" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "exon 27 deletion" "" "Germline" "" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0001081615" "1" "90" "1" "100327076" "100327076" "subst" "2.84518E-5" "00006" "chr1_018374" "g.100327076C>T" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "" "" "Germline" "" "" "0" "" "" "g.99861520C>T" "" "pathogenic" "" "0001081616" "1" "70" "1" "100340804" "100340804" "subst" "0" "00006" "chr1_018375" "g.100340804C>T" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "" "" "Germline" "" "" "0" "" "" "g.99875248C>T" "" "likely pathogenic" "" "0001081617" "1" "70" "1" "100346738" "100346738" "subst" "0" "00006" "chr1_018376" "g.100346738G>A" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "" "" "Germline" "" "" "0" "" "" "g.99881182G>A" "" "likely pathogenic" "" "0001081618" "1" "70" "1" "100350147" "100350147" "subst" "0" "00006" "chr1_018377" "g.100350147C>T" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "" "" "Germline" "" "" "0" "" "" "g.99884591C>T" "" "likely pathogenic" "" "0001081619" "1" "70" "1" "100366191" "100366191" "subst" "0" "00006" "chr1_018378" "g.100366191G>A" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "" "" "Germline" "" "" "0" "" "" "g.99900635G>A" "" "likely pathogenic" "" "0001081620" "1" "70" "1" "100378035" "100378035" "del" "0" "00006" "chr1_018379" "g.100378035del" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "3911delA" "" "Germline" "" "" "0" "" "" "g.99912479del" "" "likely pathogenic" "" "0001081621" "1" "70" "1" "100378074" "100378074" "subst" "0" "00006" "chr1_018380" "g.100378074G>A" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "" "" "Germline" "" "" "0" "" "" "g.99912518G>A" "" "likely pathogenic" "" "0001081622" "1" "90" "1" "100381004" "100381004" "dup" "0" "00006" "AGL_000005" "g.100381004dup" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "4221dupA" "" "Germline" "" "" "0" "" "" "g.99915448dup" "" "pathogenic" "" "0001081623" "1" "90" "1" "100336320" "100336320" "subst" "8.14684E-6" "00006" "chr1_018381" "g.100336320C>T" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "" "" "Germline" "" "" "0" "" "" "g.99870764C>T" "" "pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes AGL ## Count = 173 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000096946" "00024135" "50" "3290" "0" "3290" "0" "c.3290G>A" "r.(?)" "p.(Arg1097His)" "25" "0000096988" "00024135" "50" "112" "0" "112" "0" "c.112A>G" "r.(?)" "p.(Thr38Ala)" "3" "0000154180" "00024135" "90" "378" "0" "378" "0" "c.378T>A" "r.(?)" "p.(Cys126*)" "4" "0000154182" "00024135" "70" "3295" "0" "3295" "0" "c.3295T>C" "r.(3295u>c)" "p.(Trp1099Arg)" "25" "0000154185" "00024135" "90" "1183" "0" "1183" "0" "c.1183C>T" "r.(1183c>u)" "p.(Gln395*)" "9" "0000154187" "00024135" "90" "3777" "0" "3777" "0" "c.3777G>A" "r.(3777g>a)" "p.(Trp1259*)" "28" "0000154189" "00024135" "90" "2002" "-2" "2002" "-2" "c.2002-2A>G" "r.spl" "p.?" "15i" "0000248957" "00024135" "10" "-10" "0" "-10" "0" "c.-10A>G" "r.(?)" "p.(=)" "" "0000252388" "00024135" "70" "1877" "0" "1877" "0" "c.1877A>G" "r.(?)" "p.(His626Arg)" "" "0000256355" "00024135" "50" "3764" "0" "3764" "0" "c.3764A>G" "r.(?)" "p.(Asn1255Ser)" "" "0000258987" "00024135" "10" "83" "-33" "83" "-33" "c.83-33C>T" "r.(=)" "p.(=)" "" "0000258988" "00024135" "10" "1155" "0" "1155" "0" "c.1155G>T" "r.(?)" "p.(Lys385Asn)" "" "0000258989" "00024135" "10" "2001" "8" "2001" "8" "c.2001+8T>C" "r.(=)" "p.(=)" "" "0000258990" "00024135" "10" "2812" "11" "2812" "11" "c.2812+11G>A" "r.(=)" "p.(=)" "" "0000258991" "00024135" "10" "894" "0" "894" "0" "c.894C>T" "r.(?)" "p.(Leu298=)" "" "0000258992" "00024135" "10" "959" "-18" "959" "-18" "c.959-18G>A" "r.(=)" "p.(=)" "" "0000259437" "00024135" "30" "846" "14" "846" "14" "c.846+14G>A" "r.(=)" "p.(=)" "" "0000260664" "00024135" "30" "1155" "0" "1155" "0" "c.1155G>T" "r.(?)" "p.(Lys385Asn)" "" "0000260665" "00024135" "10" "1185" "15" "1185" "15" "c.1185+15T>C" "r.(=)" "p.(=)" "" "0000260666" "00024135" "30" "1875" "0" "1875" "0" "c.1875G>T" "r.(?)" "p.(Thr625=)" "" "0000260667" "00024135" "30" "82" "1565" "82" "1565" "c.82+1565T>G" "r.(=)" "p.(=)" "" "0000262071" "00024135" "30" "1042" "0" "1042" "0" "c.1042G>A" "r.(?)" "p.(Val348Ile)" "" "0000262072" "00024135" "10" "3384" "0" "3384" "0" "c.3384G>A" "r.(?)" "p.(Ala1128=)" "" "0000320885" "00024135" "30" "1481" "0" "1481" "0" "c.1481G>A" "r.(?)" "p.(Arg494His)" "" "0000320886" "00024135" "30" "2390" "0" "2390" "0" "c.2390A>G" "r.(?)" "p.(Asn797Ser)" "" "0000336870" "00024135" "70" "294" "-2" "294" "-2" "c.294-2A>T" "r.spl?" "p.?" "" "0000434973" "00024135" "15" "-10" "0" "-10" "0" "c.-10A>G" "r.(?)" "p.(=)" "2" "0000434974" "00024135" "95" "94" "0" "94" "0" "c.94C>T" "r.(?)" "p.(Gln32*)" "3" "0000434975" "00024135" "95" "256" "0" "256" "0" "c.256C>T" "r.(?)" "p.(Gln862*)" "3" "0000434976" "00024135" "95" "1939" "0" "1941" "0" "c.1939_1941del" "r.(?)" "p.(Val647del)" "15" "0000434977" "00024135" "15" "2001" "8" "2001" "8" "c.2001+8T>C" "r.(=)" "p.(=)" "15i" "0000434978" "00024135" "95" "3014" "0" "3014" "0" "c.3014del" "r.(?)" "p.(Cys1005PhefsTer7)" "23" "0000434979" "00024135" "95" "3014" "0" "3014" "0" "c.3014del" "r.(?)" "p.(Cys1005PhefsTer7)" "25" "0000434980" "00024135" "95" "3343" "0" "3343" "0" "c.3343G>A" "r.(?)" "p.(Gly1115Arg)" "25" "0000434981" "00024135" "95" "3665" "0" "3665" "0" "c.3665del" "r.(?)" "p.(Ala1222ValfsTer5)" "27" "0000434982" "00024135" "95" "3911" "0" "3911" "0" "c.3911dup" "r.(?)" "p.(Asn1304LysfsTer7)" "29" "0000434983" "00024135" "95" "3911" "0" "3911" "0" "c.3911dup" "r.(?)" "p.(Asn1304LysfsTer7)" "29" "0000434984" "00024135" "95" "3911" "0" "3911" "0" "c.3911dup" "r.(?)" "p.(Asn1304LysfsTer7)" "29" "0000434985" "00024135" "95" "3965" "0" "3965" "0" "c.3965del" "r.3965del" "p.(Val1322AlafsTer27)" "30" "0000434986" "00024135" "95" "3965" "0" "3965" "0" "c.3965del" "r.3965del" "p.(Val1322AlafsTer27)" "30" "0000434987" "00024135" "95" "3965" "0" "3965" "0" "c.3965del" "r.3965del" "p.(Val1322AlafsTer27)" "30" "0000434988" "00024135" "95" "3965" "0" "3965" "0" "c.3965del" "r.3965del" "p.(Val1322AlafsTer27)" "30" "0000434989" "00024135" "95" "3965" "0" "3965" "0" "c.3965del" "r.(?)" "p.(Val1322AlafsTer27)" "30" "0000434990" "00024135" "95" "4221" "0" "4221" "0" "c.4221dup" "r.(?)" "p.(Leu1408IlefsTer14)" "31" "0000434991" "00024135" "95" "4260" "-12" "4260" "-12" "c.4260-12A>G" "r.4259_4260ins4260-11_4260-1" "p.Phe1420Hisfs*16" "31i" "0000434992" "00024135" "95" "4260" "-12" "4260" "-12" "c.4260-12A>G" "r.4259_4260ins4260-11_4260-1" "p.Phe1420Hisfs*16" "31i" "0000434993" "00024135" "95" "4260" "-12" "4260" "-12" "c.4260-12A>G" "r.spl?" "p.(Phe1420Hisfs*16)" "31i" "0000434994" "00024135" "95" "4260" "-12" "4260" "-12" "c.4260-12A>G" "r.spl?" "p.(Phe1420Hisfs*16)" "31i" "0000434995" "00024135" "95" "4260" "-12" "4260" "-12" "c.4260-12A>G" "r.spl?" "p.(Phe1420Hisfs*16)" "31i" "0000434996" "00024135" "95" "4260" "-12" "4260" "-12" "c.4260-12A>G" "r.spl?" "p.(Phe1420Hisfs*16)" "31i" "0000434997" "00024135" "95" "4260" "-12" "4260" "-12" "c.4260-12A>G" "r.4259_4260ins4260-11_4260-1" "p.Phe1420Hisfs*16" "31i" "0000434998" "00024135" "95" "4260" "-12" "4260" "-12" "c.4260-12A>G" "r.4259_4260ins4260-11_4260-1" "p.Phe1420Hisfs*16" "31i" "0000434999" "00024135" "95" "4529" "0" "4529" "0" "c.4529dup" "r.(?)" "p.(Tyr1510*)" "34" "0000435000" "00024135" "95" "4529" "0" "4529" "0" "c.4529dup" "r.(?)" "p.(Tyr1510*)" "34" "0000435001" "00024135" "95" "4529" "0" "4529" "0" "c.4529dup" "r.(?)" "p.(Tyr1510*)" "34" "0000471103" "00024135" "70" "3423" "0" "3424" "0" "c.3423_3424del" "r.(?)" "p.(Glu1142Argfs*24)" "" "0000502177" "00024135" "90" "16" "0" "16" "0" "c.16C>T" "r.(?)" "p.(Gln6Ter)" "" "0000502179" "00024135" "30" "443" "0" "443" "0" "c.443G>A" "r.(?)" "p.(Arg148Lys)" "" "0000502180" "00024135" "30" "1160" "0" "1160" "0" "c.1160G>A" "r.(?)" "p.(Arg387Gln)" "" "0000502181" "00024135" "50" "1432" "0" "1432" "0" "c.1432G>A" "r.(?)" "p.(Val478Ile)" "" "0000502182" "00024135" "90" "2107" "0" "2108" "0" "c.2107_2108insA" "r.(?)" "p.(Cys703Ter)" "" "0000502184" "00024135" "30" "2737" "0" "2737" "0" "c.2737T>A" "r.(?)" "p.(Ser913Thr)" "" "0000502185" "00024135" "10" "2883" "0" "2883" "0" "c.2883A>G" "r.(?)" "p.(Arg961=)" "" "0000502186" "00024135" "30" "3738" "0" "3738" "0" "c.3738A>T" "r.(?)" "p.(Gly1246=)" "" "0000502190" "00024135" "90" "4529" "0" "4529" "0" "c.4529dup" "r.(?)" "p.(Tyr1510Ter)" "" "0000597034" "00024135" "70" "958" "1" "958" "1" "c.958+1G>A" "r.spl" "p.?" "" "0000597035" "00024135" "70" "1020" "0" "1020" "0" "c.1020del" "r.(?)" "p.(Glu340Aspfs*9)" "" "0000604596" "00024135" "50" "405" "0" "405" "0" "c.405G>C" "r.(?)" "p.(Lys135Asn)" "" "0000604597" "00024135" "50" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Arg343Gln)" "" "0000604598" "00024135" "50" "1076" "0" "1076" "0" "c.1076C>T" "r.(?)" "p.(Pro359Leu)" "" "0000604599" "00024135" "70" "1505" "0" "1514" "0" "c.1505_1514del" "r.(?)" "p.(Cys502SerfsTer5)" "" "0000604600" "00024135" "50" "2308" "0" "2308" "0" "c.2308G>C" "r.(?)" "p.(Gly770Arg)" "" "0000604601" "00024135" "30" "2682" "0" "2682" "0" "c.2682T>A" "r.(?)" "p.(Ser894=)" "" "0000604602" "00024135" "50" "3584" "0" "3584" "0" "c.3584C>G" "r.(?)" "p.(Thr1195Arg)" "" "0000620311" "00024135" "70" "1186" "-3" "1186" "-3" "c.1186-3C>G" "r.spl?" "p.?" "" "0000620312" "00024135" "50" "2161" "0" "2161" "0" "c.2161T>C" "r.(?)" "p.(Tyr721His)" "" "0000638678" "00024135" "90" "3526" "0" "3526" "0" "c.3526A>T" "r.(?)" "p.(Lys1176*)" "" "0000644239" "00024135" "90" "1632" "0" "1632" "0" "c.1632dup" "r.(?)" "p.(Asn545Glufs*11)" "" "0000647308" "00024135" "30" "207" "0" "207" "0" "c.207T>C" "r.(=)" "p.(=)" "" "0000647309" "00024135" "30" "1481" "0" "1481" "0" "c.1481G>A" "r.(?)" "p.(Arg494His)" "" "0000647310" "00024135" "50" "1759" "0" "1759" "0" "c.1759C>T" "r.(?)" "p.(His587Tyr)" "" "0000647311" "00024135" "50" "2390" "0" "2390" "0" "c.2390A>G" "r.(?)" "p.(Asn797Ser)" "" "0000647312" "00024135" "30" "3668" "0" "3668" "0" "c.3668G>A" "r.(?)" "p.(Gly1223Asp)" "" "0000647313" "00024135" "30" "3849" "0" "3849" "0" "c.3849T>C" "r.(=)" "p.(=)" "" "0000647314" "00024135" "70" "4260" "-12" "4260" "-12" "c.4260-12A>G" "r.(=)" "p.(=)" "" "0000647315" "00024135" "50" "4331" "0" "4331" "0" "c.4331A>G" "r.(?)" "p.(Asn1444Ser)" "" "0000653092" "00024135" "30" "1155" "0" "1155" "0" "c.1155G>T" "r.(?)" "p.(Lys385Asn)" "" "0000670151" "00024135" "30" "1155" "0" "1155" "0" "c.1155G>T" "r.(?)" "p.(Lys385Asn)" "" "0000675378" "00024135" "50" "344" "0" "344" "0" "c.344T>C" "r.(?)" "p.(Val115Ala)" "" "0000675379" "00024135" "50" "2222" "0" "2222" "0" "c.2222A>G" "r.(?)" "p.(Gln741Arg)" "" "0000687787" "00024135" "30" "82" "1565" "82" "1565" "c.82+1565T>G" "r.(=)" "p.(=)" "" "0000687789" "00024135" "30" "1155" "0" "1155" "0" "c.1155G>T" "r.(?)" "p.(Lys385Asn)" "" "0000697287" "00024135" "70" "2155" "0" "2155" "0" "c.2155C>T" "r.(?)" "p.(Gln719*)" "" "0000697288" "00024135" "70" "3890" "0" "3890" "0" "c.3890del" "r.(?)" "p.(Leu1297Cysfs*17)" "" "0000714830" "00024135" "90" "256" "0" "256" "0" "c.256C>T" "r.(?)" "p.(Gln86*)" "" "0000714832" "00024135" "90" "658" "0" "658" "0" "c.658C>T" "r.(?)" "p.(His220Tyr)" "" "0000714833" "00024135" "90" "1735" "1" "1735" "1" "c.1735+1G>T" "r.spl" "p.?" "" "0000714871" "00024135" "90" "2723" "0" "2723" "0" "c.2723T>G" "r.(?)" "p.(Leu908Arg)" "" "0000714873" "00024135" "90" "1735" "1" "1735" "1" "c.1735+1G>T" "r.spl" "p.?" "" "0000787782" "00024135" "50" "1759" "0" "1759" "0" "c.1759C>T" "r.(?)" "p.(His587Tyr)" "" "0000798624" "00024135" "30" "2522" "0" "2522" "0" "c.2522C>T" "r.(?)" "p.(Ser841Phe)" "" "0000798625" "00024135" "30" "2814" "0" "2814" "0" "c.2814T>G" "r.(?)" "p.(Gly938=)" "" "0000798626" "00024135" "50" "3082" "0" "3082" "0" "c.3082A>G" "r.(?)" "p.(Ser1028Gly)" "" "0000848196" "00024135" "30" "2883" "0" "2883" "0" "c.2883A>G" "r.(?)" "p.(Arg961=)" "" "0000848198" "00024135" "30" "3384" "0" "3384" "0" "c.3384G>A" "r.(?)" "p.(Ala1128=)" "" "0000856844" "00024135" "30" "968" "0" "968" "0" "c.968G>A" "r.(?)" "p.(Arg323Gln)" "" "0000856845" "00024135" "30" "2546" "10" "2546" "10" "c.2546+10T>C" "r.(=)" "p.(=)" "" "0000856846" "00024135" "50" "3995" "0" "3995" "0" "c.3995A>C" "r.(?)" "p.(Gln1332Pro)" "" "0000856847" "00024135" "30" "4575" "0" "4575" "0" "c.4575T>A" "r.(?)" "p.(Ile1525=)" "" "0000882641" "00024135" "50" "959" "-18" "959" "-17" "c.959-18_959-17insAAAATAGTGACAGTTTTAATCTCTTTGTAGATATTTGCATTTAAGGTATCA" "r.(=)" "p.(=)" "" "0000882642" "00024135" "90" "2929" "0" "2929" "0" "c.2929C>T" "r.(?)" "p.(Arg977*)" "" "0000882643" "00024135" "30" "3431" "0" "3431" "0" "c.3431T>A" "r.(?)" "p.(Ile1144Asn)" "" "0000882644" "00024135" "50" "3854" "0" "3854" "0" "c.3854A>C" "r.(?)" "p.(Glu1285Ala)" "" "0000910721" "00024135" "50" "1235" "0" "1235" "0" "c.1235A>G" "r.(?)" "p.(His412Arg)" "" "0000918632" "00024135" "70" "1631" "0" "1631" "0" "c.1631G>T" "r.(?)" "p.(Arg544Met)" "" "0000920860" "00024135" "90" "3652" "0" "3652" "0" "c.3652C>T" "r.(?)" "p.(Arg1218Ter)" "" "0000922891" "00024135" "90" "1222" "0" "1222" "0" "c.1222C>T" "r.(?)" "p.(Arg408*)" "" "0000922892" "00024135" "30" "1759" "0" "1759" "0" "c.1759C>T" "r.(?)" "p.(His587Tyr)" "" "0000922893" "00024135" "90" "4529" "0" "4529" "0" "c.4529dup" "r.(?)" "p.(Tyr1510Ter)" "" "0000927958" "00024135" "50" "719" "0" "719" "0" "c.719A>G" "r.(?)" "p.(Asn240Ser)" "" "0000945232" "00024135" "50" "112" "0" "112" "0" "c.112A>G" "r.(?)" "p.(Thr38Ala)" "3" "0000973127" "00024135" "50" "82" "4" "82" "4" "c.82+4A>C" "r.spl?" "p.?" "" "0000973129" "00024135" "30" "207" "0" "207" "0" "c.207T>C" "r.(?)" "p.(=)" "" "0000973130" "00024135" "50" "1042" "0" "1042" "0" "c.1042G>A" "r.(?)" "p.(Val348Ile)" "" "0000973131" "00024135" "30" "2883" "0" "2883" "0" "c.2883A>G" "r.(?)" "p.(Arg961=)" "" "0000973132" "00024135" "30" "3384" "0" "3384" "0" "c.3384G>A" "r.(?)" "p.(Ala1128=)" "" "0000973133" "00024135" "30" "3849" "0" "3849" "0" "c.3849T>C" "r.(?)" "p.(=)" "" "0000973134" "00024135" "50" "3977" "0" "3977" "0" "c.3977A>G" "r.(?)" "p.(Glu1326Gly)" "" "0000987537" "00024135" "70" "2803" "0" "2803" "0" "c.2803G>T" "r.(?)" "p.(Gly935Cys)" "21" "0000990035" "00024135" "30" "2555" "0" "2555" "0" "c.2555T>C" "r.(?)" "p.(Leu852Pro)" "" "0000990036" "00024135" "30" "3431" "0" "3431" "0" "c.3431T>A" "r.(?)" "p.(Ile1144Asn)" "" "0000990037" "00024135" "90" "3911" "0" "3911" "0" "c.3911dup" "r.(?)" "p.(Asn1304Lysfs*7)" "" "0000990038" "00024135" "10" "4162" "-11" "4162" "-11" "c.4162-11G>A" "r.(=)" "p.(=)" "" "0000990039" "00024135" "50" "4162" "-4" "4162" "-4" "c.4162-4C>G" "r.spl?" "p.?" "" "0000990040" "00024135" "50" "4301" "0" "4301" "0" "c.4301A>G" "r.(?)" "p.(Asn1434Ser)" "" "0001021236" "00024135" "90" "348" "0" "373" "0" "c.348_373del" "r.(?)" "p.(Ala117LeufsTer10)" "" "0001021281" "00024135" "90" "3216" "0" "3217" "0" "c.3216_3217del" "r.(?)" "p.(Glu1072AspfsTer36)" "" "0001030984" "00024135" "30" "82" "1436" "82" "1436" "c.82+1436G>T" "r.(=)" "p.(=)" "" "0001030987" "00024135" "30" "2280" "0" "2280" "0" "c.2280C>T" "r.(?)" "p.(=)" "" "0001030988" "00024135" "50" "3560" "0" "3565" "0" "c.3560_3565del" "r.(?)" "p.(Asp1187_Ser1188del)" "" "0001030989" "00024135" "50" "4052" "0" "4052" "0" "c.4052A>G" "r.(?)" "p.(Lys1351Arg)" "" "0001030990" "00024135" "50" "4283" "0" "4283" "0" "c.4283A>C" "r.(?)" "p.(Tyr1428Ser)" "" "0001050169" "00024135" "50" "887" "0" "887" "0" "c.887T>G" "r.(?)" "p.(Leu296Arg)" "" "0001050170" "00024135" "50" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Arg343Gln)" "" "0001050171" "00024135" "50" "1076" "0" "1076" "0" "c.1076C>T" "r.(?)" "p.(Pro359Leu)" "" "0001050172" "00024135" "50" "1423" "3" "1423" "3" "c.1423+3A>G" "r.spl?" "p.?" "" "0001050173" "00024135" "50" "3258" "0" "3259" "0" "c.3258_3259delinsCC" "r.(?)" "p.(Gly1087Arg)" "" "0001050174" "00024135" "70" "3444" "0" "3444" "0" "c.3444C>G" "r.(?)" "p.(Tyr1148*)" "" "0001063113" "00024135" "50" "854" "0" "854" "0" "c.854G>A" "r.(?)" "p.(Arg285Gln)" "" "0001068308" "00024135" "90" "4260" "-1" "4260" "-1" "c.4260-1G>T" "r.4260_4347del" "p.Asp1420GlufsTer20" "" "0001068309" "00024135" "70" "3259" "927" "3259" "927" "c.3259+927A>G" "r.3259_3260ins[3259+818_3259+922]" "p.?" "24i" "0001068986" "00024135" "70" "259" "0" "259" "0" "c.259C>T" "r.(?)" "p.(Gln87Ter)" "" "0001069137" "00024135" "70" "83" "-2" "460" "2" "c.(?_83-2)_(460+2_?)del" "r.?" "p.?" "" "0001069260" "00024135" "70" "3351" "0" "3351" "0" "c.3351T>G" "r.(?)" "p.(Tyr1117Ter)" "" "0001069358" "00024135" "90" "3816" "0" "3817" "0" "c.3816_3817del" "r.(?)" "p.(Gly1273AsnfsTer18)" "" "0001069544" "00024135" "70" "1274" "0" "1274" "0" "c.1274T>A" "r.(?)" "p.(Leu425Ter)" "" "0001070070" "00024135" "90" "1587" "0" "1587" "0" "c.1587del" "r.(?)" "p.(Ser530GlnfsTer6)" "" "0001073319" "00024135" "90" "1577" "0" "1577" "0" "c.1577A>G" "r.(?)" "p.(Asp526Gly)" "14" "0001073733" "00024135" "90" "2590" "0" "2590" "0" "c.2590C>T" "r.(?)" "p.(Arg864Ter)" "22" "0001074269" "00024135" "90" "664" "1" "664" "1" "c.664+1G>A" "r.spl" "p.?" "" "0001074276" "00024135" "90" "664" "1" "664" "1" "c.664+1G>A" "r.spl" "p.?" "" "0001075785" "00024135" "50" "2597" "0" "2597" "0" "c.2597A>T" "r.(?)" "p.(His866Leu)" "" "0001076112" "00024135" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0001081410" "00024135" "70" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0001081615" "00024135" "90" "100" "0" "100" "0" "c.100C>T" "r.(?)" "p.(Arg34Ter)" "3" "0001081616" "00024135" "70" "1177" "0" "1177" "0" "c.1177C>T" "r.(?)" "p.(Gln393Ter)" "9" "0001081617" "00024135" "70" "2001" "5" "2001" "5" "c.2001+5G>A" "r.spl" "p.?" "" "0001081618" "00024135" "70" "2569" "0" "2569" "0" "c.2569C>T" "r.(?)" "p.(Gln857Ter)" "20" "0001081619" "00024135" "70" "3363" "-1" "3363" "-1" "c.3363-1G>A" "r.spl" "p.?" "" "0001081620" "00024135" "70" "3911" "0" "3911" "0" "c.3911del" "r.(?)" "p.(Asn1304IlefsTer10)" "29" "0001081621" "00024135" "70" "3949" "1" "3949" "1" "c.3949+1G>A" "r.spl" "p.?" "" "0001081622" "00024135" "90" "4221" "0" "4221" "0" "c.4221dup" "r.(?)" "p.(Leu1408IlefsTer14)" "31" "0001081623" "00024135" "90" "853" "0" "853" "0" "c.853C>T" "r.(?)" "p.(Arg285Ter)" "7" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 86 "{{screeningid}}" "{{variantid}}" "0000000004" "0000945232" "0000000013" "0000096988" "0000065275" "0000096946" "0000095592" "0000154180" "0000095595" "0000154182" "0000095598" "0000154185" "0000095600" "0000154187" "0000095602" "0000154189" "0000205587" "0000434978" "0000205588" "0000434989" "0000205589" "0000434974" "0000205590" "0000434975" "0000205591" "0000434980" "0000205592" "0000434981" "0000205593" "0000434976" "0000205594" "0000434973" "0000205594" "0000434977" "0000205594" "0000434999" "0000205594" "0000435000" "0000205595" "0000434979" "0000205595" "0000435001" "0000205596" "0000434982" "0000205596" "0000434990" "0000205597" "0000434983" "0000205597" "0000434984" "0000205598" "0000434985" "0000205598" "0000434986" "0000205599" "0000434987" "0000205599" "0000434988" "0000205600" "0000434991" "0000205600" "0000434992" "0000205601" "0000434993" "0000205601" "0000434994" "0000205602" "0000434995" "0000205602" "0000434996" "0000205603" "0000434997" "0000205603" "0000434998" "0000229867" "0000471103" "0000266374" "0000597034" "0000266374" "0000597035" "0000282941" "0000638678" "0000288326" "0000644239" "0000290619" "0000647308" "0000290620" "0000647309" "0000290621" "0000647310" "0000290622" "0000647311" "0000290623" "0000647312" "0000290624" "0000647313" "0000290625" "0000647314" "0000290626" "0000647315" "0000296403" "0000653092" "0000306463" "0000670151" "0000315198" "0000697287" "0000315199" "0000697288" "0000330299" "0000714830" "0000330299" "0000714871" "0000330301" "0000714832" "0000330301" "0000714873" "0000330302" "0000714833" "0000433003" "0000918632" "0000453037" "0000987537" "0000461861" "0001021236" "0000461861" "0001021281" "0000474115" "0001068308" "0000474115" "0001068309" "0000474588" "0001068986" "0000474588" "0001070070" "0000474739" "0001069137" "0000474862" "0001069260" "0000474960" "0001069358" "0000475148" "0001069544" "0000477932" "0001073319" "0000477932" "0001073733" "0000478538" "0001074269" "0000478545" "0001074276" "0000479794" "0001075785" "0000480060" "0001076112" "0000483896" "0001081615" "0000483897" "0001081616" "0000483898" "0001081617" "0000483899" "0001081618" "0000483900" "0001081619" "0000483901" "0001081620" "0000483902" "0001081621" "0000483903" "0001081622" "0000483904" "0001081623"