### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = AGL)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"AGL"	"amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase"	"1"	"p21"	"unknown"	"NG_012865.1"	"UD_132085257483"	""	"http://www.LOVD.nl/AGL"	""	"1"	"321"	"178"	"610860"	"1"	"1"	"1"	"1"	"Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project."	""	"g"	"http://databases.lovd.nl/shared/refseq/AGL_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00002"	"2010-04-29 00:00:00"	"00006"	"2016-05-19 17:47:32"	"00000"	"2025-05-05 21:14:00"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00024135"	"AGL"	"transcript variant 1"	"002"	"NM_000642.2"	""	"NP_000633.2"	""	""	""	"-400"	"6971"	"4599"	"100315640"	"100389579"	"00006"	"2016-05-19 17:46:17"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 9
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00138"	"autism"	"autism"	""	"209850"	""	""	""	"00084"	"2013-06-04 18:17:33"	"00006"	"2015-12-08 23:54:35"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"01273"	"hCK"	"hyperCKemia (hCK, elevated serum creatine phosphokinase)"	"AD"	"123320"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"01823"	"GSD3"	"storage disease, glycogen, type III (GSD-3)"	"AR"	"232400"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"02087"	"SIDS"	"death, sudden, syndrome, infant (SIDS)"	"AR"	"272120"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"04216"	"GSD"	"storage disease, glycogen (GSD)"	""	""	""	""	""	"00006"	"2015-03-05 15:32:25"	""	""
"05126"	"LGMD"	"dystrophy, muscular, limb-girdle (LGMD)"	""	""	""	""	""	"00006"	"2016-01-26 06:05:36"	""	""
"05166"	"SUD"	"death, sudden, unexplained (SUD)"	""	""	""	""	""	"00006"	"2016-05-19 16:34:23"	"00006"	"2018-09-11 12:14:13"
"05378"	"BMD/DMD"	"dystrophinopathy (BMD or DMD)"	""	""	""	""	""	"00006"	"2018-01-13 20:18:25"	"00006"	"2019-03-26 16:49:54"


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 1
"{{geneid}}"	"{{diseaseid}}"
"AGL"	"01823"


## Individuals ## Do not remove or alter this header ##
## Count = 47
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00000004"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	""	""	""	""	""
"00000013"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	"0"	""	""	""	""
"00065124"	""	""	""	"1"	""	"01602"	"{PMID:Neubauer 2017:28074886} {DOI:Neubauer 2017:10.1038/ejhg.2016.199}"	""	"F"	"?"	"Switzerland"	"00y04m"	"0"	""	""	"Europe"	"SIDS041"
"00095189"	""	""	""	"1"	""	"01865"	""	""	"M"	"?"	"Iran"	""	"0"	""	""	""	""
"00095197"	""	""	""	"1"	""	"01865"	""	""	"M"	"?"	"Iran"	""	"0"	""	""	""	""
"00095199"	""	""	""	"1"	""	"01865"	""	""	"M"	"?"	"Iran"	""	"0"	""	""	""	""
"00095202"	""	""	""	"1"	""	"01865"	""	""	"M"	"?"	"Iran"	""	"0"	""	""	""	""
"00095204"	""	""	""	"1"	""	"01865"	""	""	"F"	"?"	"Iran"	""	"0"	""	""	""	""
"00204558"	""	""	""	"1"	""	"00000"	""	""	""	""	"United States"	""	"0"	""	""	""	""
"00204559"	""	""	""	"3"	""	"00000"	""	"3 unrelated patients"	""	""	"United States"	""	"0"	""	""	""	""
"00204560"	""	""	""	"1"	""	"00000"	""	""	""	""	"United States"	""	"0"	""	""	""	""
"00204561"	""	""	""	"1"	""	"00000"	""	""	""	""	"United States"	""	"0"	""	""	""	""
"00204562"	""	""	""	"1"	""	"00000"	""	""	""	""	"United States"	""	"0"	""	""	""	""
"00204563"	""	""	""	"1"	""	"00000"	""	""	""	""	"United States"	""	"0"	""	""	""	""
"00204564"	""	""	""	"1"	""	"00000"	""	""	""	""	"United States"	""	"0"	""	""	""	""
"00204565"	""	""	""	"1"	""	"00000"	""	""	""	""	"United States"	""	"0"	""	""	"white"	""
"00204566"	""	""	""	"1"	""	"02976"	""	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00204567"	""	""	""	"1"	""	"00000"	""	""	"M"	""	""	""	"0"	""	""	"Jewish-Ashkenazi"	""
"00204568"	""	""	""	"1"	""	"02976"	""	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00204569"	""	""	""	"1"	""	"00000"	""	""	"F"	""	"United States"	""	"0"	""	""	"African-American"	""
"00204570"	""	""	""	"1"	""	"00000"	""	"2nd patient, unrelated"	""	""	"United States"	""	"0"	""	""	""	""
"00204571"	""	""	""	"1"	""	"00000"	""	""	"F"	""	"Japan"	""	"0"	""	""	""	""
"00204572"	""	""	""	"1"	""	"02976"	""	"affected brother of 223003-Pat2"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00204573"	""	""	""	"1"	""	"02976"	""	"affected brother of 223003-Pat1"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00204574"	""	""	""	"1"	""	"00000"	""	""	"F"	""	"United States"	""	"0"	""	""	"white"	""
"00228778"	""	""	""	"1"	""	"01864"	""	""	"F"	"no"	"China"	""	"0"	""	""	""	""
"00265255"	""	""	""	"1"	""	"03426"	""	""	"M"	""	"Spain"	""	"0"	""	""	""	""
"00281793"	""	""	""	"1"	""	"03573"	""	""	"M"	"no"	"(Nepal)"	""	"0"	""	""	""	"G1"
"00285774"	""	""	""	"2"	""	"03573"	""	""	"F"	"yes"	"India"	"02y"	"0"	""	""	""	"G3"
"00289451"	""	""	""	"27"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00289452"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00289453"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00289454"	""	""	""	"2"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00289455"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00289456"	""	""	""	"26"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00289457"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00289458"	""	""	""	"21"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00295235"	""	""	""	"24"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00305334"	""	""	""	"2"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00314025"	""	""	""	"2"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00314026"	""	""	""	"2"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00329082"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2013:22899091}"	""	"M"	""	"United States"	""	"0"	""	""	""	"P11"
"00329084"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2013:22899091}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	"United States"	""	"0"	""	""	""	"P17"
"00329085"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2013:22899091}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	"United States"	""	"0"	""	""	""	"P18"
"00431570"	""	""	""	"1"	""	"00006"	"{PMID:Neubauer 2021:33895855}"	""	"M"	""	"Switzerland"	""	"0"	""	""	""	"SUDS027"
"00451437"	""	""	""	"1"	""	"04221"	"{PMID:Vela-Amieva 2024:39519275}"	"Likely consanguinity"	"F"	"no"	"Mexico"	""	""	""	""	"Mexican"	"3bINP-025"
"00460230"	""	""	""	"1"	""	"00006"	"{PMID:Marti 2025:39666917}"	"patient, no family history"	""	""	"Spain"	""	"0"	""	""	""	"Pat1"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 47
"{{individualid}}"	"{{diseaseid}}"
"00000013"	"00138"
"00000013"	"05378"
"00065124"	"02087"
"00095189"	"01823"
"00095197"	"01823"
"00095199"	"01823"
"00095202"	"01823"
"00095204"	"01823"
"00204558"	"01823"
"00204559"	"01823"
"00204560"	"01823"
"00204561"	"01823"
"00204562"	"01823"
"00204563"	"01823"
"00204564"	"01823"
"00204565"	"01823"
"00204566"	"01823"
"00204567"	"01823"
"00204568"	"01823"
"00204569"	"01823"
"00204570"	"01823"
"00204571"	"01823"
"00204572"	"01823"
"00204573"	"01823"
"00204574"	"01823"
"00228778"	"01823"
"00265255"	"01823"
"00281793"	"01823"
"00285774"	"01823"
"00289451"	"00198"
"00289452"	"00198"
"00289453"	"00198"
"00289454"	"00198"
"00289455"	"00198"
"00289456"	"00198"
"00289457"	"00198"
"00289458"	"00198"
"00295235"	"00198"
"00305334"	"00198"
"00314025"	"05126"
"00314026"	"05126"
"00329082"	"04216"
"00329084"	"04216"
"00329085"	"04216"
"00431570"	"05166"
"00451437"	"01823"
"00460230"	"01273"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00138, 00198, 01273, 01823, 02087, 04216, 05126, 05166, 05378
## Count = 17
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000015274"	"00187"	"00000004"	"00124"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000051229"	"02087"	"00065124"	"01602"	"Unknown"	""	"SIDS"	""	""	""	""	""	""	""	""	""	""	""
"0000073593"	"01823"	"00095189"	"01865"	"Familial, autosomal recessive"	""	"weakness : distal and proximal, upper and lower limbs perdominaltly distal upper limbs\r\nsevere axial and mild neck weakness, foot drop\r\nachilles contracture, atrophy in deltoid, supraspinatus and intrinsic hand muscles"	"24y"	"48y"	""	""	""	""	""	""	""	""	""
"0000073596"	"01823"	"00095197"	"01865"	"Familial, autosomal recessive"	"26y"	"weakness: distal and proximal, upper and lower limbs predominantly distal upper limbs\r\nthoracis scoliosis"	"21y"	""	""	""	""	""	""	""	""	""	""
"0000073599"	"01823"	"00095199"	"01865"	"Familial, autosomal recessive"	"15y"	"weakness: distal and proximal upper limbs and proximal lower limbs\r\natrophy in thenar and hypothenar\r\ncardiac involvement since 15y/o"	"15y"	""	""	""	""	""	""	""	""	""	""
"0000073601"	"01823"	"00095202"	"01865"	"Familial, autosomal recessive"	"40y"	"weakness: distal and proximal upper limbs and proximal lower limbs\r\ncardiac involvement since 39 y/o\r\ncirrhosis at 36 y/o"	"37y"	""	""	""	""	""	""	""	""	""	""
"0000073603"	"01823"	"00095204"	"01865"	"Familial, autosomal recessive"	"51y"	"weakness: distal and proximal upper limbs and proximal lower limbs\r\natrophy in first dorsal interosseus\r\nhepatomegaly and hypoglycemia"	"46y"	""	""	""	""	""	""	""	""	""	""
"0000152861"	"01823"	"00204569"	"00000"	"-"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000152862"	"01823"	"00204570"	"00000"	"-"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000172717"	"01823"	"00228778"	"01864"	"-"	"00y18m"	"hepatomegaly, short stature, and muscle weakness. She had experienced episodes of hypoglycaemia."	""	"00y18m"	""	""	""	""	""	""	""	""	""
"0000219684"	"01823"	"00281793"	"03573"	"Familial, autosomal recessive"	"04y"	"Hepatomegaly (HP:0002240);short stature (HP:0004322); Jaundice (HP:0000952) Full cheeks (HP:0000293); Growth delay (HP:0001510) Lethargy (HP:0001254); Muscular hypotonia (HP:0001252); Hypertriglyceridemia (HP:0002155), Hypoglycemia (HP:0001943); Elevated hepatic transaminase (HP:0002910); Elevated serum creatine kinase (HP:0003236);"	"00y09m"	"04y"	""	""	""	""	""	""	"GSDIII"	"GSDIII"	""
"0000247279"	"04216"	"00329082"	"00000"	"Familial, autosomal recessive"	"2y"	"see paper; ..., hepatomegaly"	""	""	""	""	""	""	""	""	""	"glycogen storage disease"	""
"0000247281"	"04216"	"00329084"	"00000"	"Familial, autosomal recessive"	"10y"	"see paper; ..., GSD III"	""	""	""	""	""	""	""	""	""	"glycogen storage disease"	""
"0000247282"	"04216"	"00329085"	"00000"	"Familial, autosomal recessive"	"9y"	"see paper; ..., GSD III"	""	""	""	""	""	""	""	""	""	"glycogen storage disease"	""
"0000322148"	"05166"	"00431570"	"00006"	"Unknown"	""	"acute heart failure"	""	""	""	""	""	""	""	""	""	"sudden unexplained death"	""
"0000340187"	"01823"	"00451437"	"04221"	"Familial, autosomal recessive"	""	"Hypoglycemia"	""	"06y"	""	""	""	""	""	""	"Glycogen storage disease IIIb"	"Glycogen storage disease III"	""
"0000347959"	"01273"	"00460230"	"00006"	"Unknown"	"0y-9y"	"exercise intolerance; elevated CK level 1300-3500 UI/L; vacuoles, glycogen storage; MRI muscle focal fat replacement leg compartment"	""	""	""	"IHC normal sarcolemma immunostaining"	""	""	""	""	""	"exercise intolerance"	""


## Screenings ## Do not remove or alter this header ##
## Count = 47
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000000004"	"00000004"	"1"	"00004"	""	"2012-05-11 13:18:36"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000013"	"00000013"	"1"	"00004"	""	"2012-05-11 13:18:38"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000065275"	"00065124"	"1"	"01602"	"01602"	"2016-05-19 12:58:50"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000095592"	"00095189"	"1"	"01865"	"01865"	"2017-01-11 10:54:46"	""	""	"SEQ"	"DNA"	""	""
"0000095595"	"00095197"	"1"	"01865"	"01865"	"2017-01-11 11:05:47"	""	""	"SEQ"	"DNA"	"blood"	""
"0000095598"	"00095199"	"1"	"01865"	"01865"	"2017-01-11 11:13:38"	""	""	"SEQ"	"DNA"	"blood"	""
"0000095600"	"00095202"	"1"	"01865"	"01865"	"2017-01-11 11:22:00"	""	""	"SEQ"	"DNA"	""	""
"0000095602"	"00095204"	"1"	"01865"	"01865"	"2017-01-11 11:29:35"	""	""	"SEQ"	"DNA"	""	""
"0000205587"	"00204558"	"1"	"00000"	"00006"	"2012-01-21 09:33:24"	""	""	"SEQ"	"DNA"	""	""
"0000205588"	"00204559"	"1"	"00000"	"00006"	"2012-01-21 09:33:24"	""	""	"SEQ"	"DNA"	""	""
"0000205589"	"00204560"	"1"	"00000"	"00006"	"2012-01-21 09:33:24"	""	""	"SEQ"	"DNA"	""	""
"0000205590"	"00204561"	"1"	"00000"	"00006"	"2012-01-21 09:33:24"	""	""	"SEQ"	"DNA"	""	""
"0000205591"	"00204562"	"1"	"00000"	"00006"	"2012-01-21 09:33:24"	""	""	"SEQ"	"DNA"	""	""
"0000205592"	"00204563"	"1"	"00000"	"00006"	"2012-01-21 09:33:24"	""	""	"SEQ"	"DNA"	""	""
"0000205593"	"00204564"	"1"	"00000"	"00006"	"2012-01-21 09:33:24"	""	""	"SEQ"	"DNA"	""	""
"0000205594"	"00204565"	"1"	"00000"	"00006"	"2012-01-21 09:33:24"	""	""	"SEQ;SSCA"	"DNA"	""	""
"0000205595"	"00204566"	"1"	"02976"	"02976"	"2012-01-21 09:33:24"	""	""	"SEQ-NG-I;SEQ"	"DNA"	""	""
"0000205596"	"00204567"	"1"	"00000"	"00006"	"2012-01-21 09:33:24"	""	""	"SEQ;SSCA"	"DNA"	""	""
"0000205597"	"00204568"	"1"	"02976"	"02976"	"2012-01-21 09:33:24"	""	""	"SEQ-NG-I;SEQ"	"DNA"	""	""
"0000205598"	"00204569"	"1"	"00000"	"00006"	"2012-01-21 09:33:24"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000205599"	"00204570"	"1"	"00000"	"00006"	"2012-01-21 09:33:24"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000205600"	"00204571"	"1"	"00000"	"00006"	"2012-01-21 09:33:24"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000205601"	"00204572"	"1"	"02976"	"02976"	"2012-01-21 09:33:24"	""	""	"SEQ-NG-I;SEQ"	"DNA"	""	""
"0000205602"	"00204573"	"1"	"02976"	"02976"	"2012-01-21 09:33:24"	""	""	"SEQ"	"DNA"	""	""
"0000205603"	"00204574"	"1"	"00000"	"00006"	"2012-01-21 09:33:24"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000229867"	"00228778"	"1"	"01864"	"01864"	"2019-03-26 02:19:19"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000266374"	"00265255"	"1"	"03426"	"03426"	"2019-09-18 10:23:04"	""	""	"SEQ-NG-IT"	"DNA"	""	""
"0000282941"	"00281793"	"1"	"03573"	"03573"	"2020-02-03 12:43:16"	"00006"	"2020-05-27 10:56:40"	"SEQ"	"DNA"	""	""
"0000288326"	"00285774"	"1"	"03573"	"03573"	"2020-02-13 09:32:07"	"00006"	"2020-02-13 12:02:07"	"SEQ"	"DNA"	"Blood"	""
"0000290619"	"00289451"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000290620"	"00289452"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000290621"	"00289453"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000290622"	"00289454"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000290623"	"00289455"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000290624"	"00289456"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000290625"	"00289457"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000290626"	"00289458"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000296403"	"00295235"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000306463"	"00305334"	"1"	"03575"	"00006"	"2020-06-24 11:55:42"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000315198"	"00314025"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000315199"	"00314026"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000330299"	"00329082"	"1"	"00000"	"00006"	"2021-02-03 15:44:42"	""	""	"SEQ"	"DNA"	""	""
"0000330301"	"00329084"	"1"	"00000"	"00006"	"2021-02-03 15:44:42"	""	""	"SEQ"	"DNA"	""	""
"0000330302"	"00329085"	"1"	"00000"	"00006"	"2021-02-03 15:44:42"	""	""	"SEQ"	"DNA"	""	""
"0000433003"	"00431570"	"1"	"00006"	"00006"	"2023-02-15 10:58:05"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000453037"	"00451437"	"1"	"04221"	"04221"	"2024-06-03 21:21:34"	""	""	"SEQ-NG-I"	"DNA"	"gDNA from peripheral blood"	"whole exome sequencing"
"0000461861"	"00460230"	"1"	"00006"	"00006"	"2025-01-22 12:23:09"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 51
"{{screeningid}}"	"{{geneid}}"
"0000000004"	"ACADM"
"0000000004"	"AGL"
"0000000004"	"DPYD"
"0000000004"	"ETFB"
"0000000004"	"GAA"
"0000000004"	"HESX1"
"0000000004"	"NHLRC1"
"0000000004"	"NPHS1"
"0000000004"	"SBDS"
"0000000004"	"SLC26A2"
"0000000004"	"SMPD1"
"0000000013"	"AGL"
"0000000013"	"ATP7B"
"0000000013"	"COL7A1"
"0000000013"	"HADHA"
"0000000013"	"MEFV"
"0000000013"	"NHLRC1"
"0000000013"	"PAH"
"0000000013"	"SMPD1"
"0000095592"	"AGL"
"0000095595"	"AGL"
"0000095598"	"AGL"
"0000095600"	"AGL"
"0000095602"	"AGL"
"0000205587"	"AGL"
"0000205588"	"AGL"
"0000205589"	"AGL"
"0000205590"	"AGL"
"0000205591"	"AGL"
"0000205592"	"AGL"
"0000205593"	"AGL"
"0000205594"	"AGL"
"0000205595"	"AGL"
"0000205596"	"AGL"
"0000205597"	"AGL"
"0000205598"	"AGL"
"0000205599"	"AGL"
"0000205600"	"AGL"
"0000205601"	"AGL"
"0000205602"	"AGL"
"0000205603"	"AGL"
"0000229867"	"AGL"
"0000266374"	"AGL"
"0000282941"	"AGL"
"0000288326"	"AGL"
"0000315198"	"AGL"
"0000315199"	"AGL"
"0000330299"	"AGL"
"0000330301"	"AGL"
"0000330302"	"AGL"
"0000453037"	"AGL"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 142
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000096946"	"0"	"50"	"1"	"100361872"	"100361872"	"subst"	"8.52944E-5"	"01602"	"AGL_000017"	"g.100361872G>A"	""	"{PMID:Neubauer 2017:28074886}, {DOI:Neubauer 2017:10.1038/ejhg.2016.199}"	""	""	""	"Germline"	"?"	"rs185947256"	"0"	""	""	"g.99896316G>A"	""	"VUS"	""
"0000096988"	"0"	"50"	"1"	"100327088"	"100327088"	"subst"	"0.00362443"	"00006"	"AGL_000016"	"g.100327088A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.99861532A>G"	""	"VUS"	""
"0000154180"	"3"	"90"	"1"	"100327897"	"100327897"	"subst"	"0"	"01865"	"AGL_000018"	"g.100327897T>A"	""	""	""	""	""	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.99862341T>A"	""	"pathogenic"	""
"0000154182"	"3"	"70"	"1"	"100361877"	"100361877"	"subst"	"0"	"01865"	"AGL_000021"	"g.100361877T>C"	""	""	""	""	""	"Germline/De novo (untested)"	"yes"	""	"0"	""	""	"g.99896321T>C"	""	"likely pathogenic"	""
"0000154185"	"3"	"90"	"1"	"100340810"	"100340810"	"subst"	"0"	"01865"	"AGL_000019"	"g.100340810C>T"	""	""	""	""	""	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.99875254C>T"	""	"pathogenic"	""
"0000154187"	"3"	"90"	"1"	"100376344"	"100376344"	"subst"	"0"	"01865"	"AGL_000022"	"g.100376344G>A"	""	""	""	""	""	"Germline/De novo (untested)"	"yes"	""	"0"	""	""	"g.99910788G>A"	""	"pathogenic"	""
"0000154189"	"3"	"90"	"1"	"100346846"	"100346846"	"subst"	"0"	"01865"	"AGL_000020"	"g.100346846A>G"	""	""	""	""	""	"Germline/De novo (untested)"	"yes"	""	"0"	""	""	"g.99881290A>G"	""	"pathogenic"	""
"0000248957"	"0"	"10"	"1"	"100316589"	"100316589"	"subst"	"0.469761"	"02325"	"AGL_000002"	"g.100316589A>G"	""	""	""	"AGL(NM_000028.2):c.-10A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99851033A>G"	""	"benign"	""
"0000252388"	"0"	"70"	"1"	"100346329"	"100346329"	"subst"	"0"	"02326"	"AGL_000034"	"g.100346329A>G"	""	""	""	"AGL(NM_000642.3):c.1877A>G (p.H626R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99880773A>G"	""	"likely pathogenic"	""
"0000256355"	"0"	"50"	"1"	"100376331"	"100376331"	"subst"	"0.000443396"	"01943"	"AGL_000041"	"g.100376331A>G"	""	""	""	"AGL(NM_000028.2):c.3764A>G (p.N1255S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99910775A>G"	""	"VUS"	""
"0000258987"	"0"	"10"	"1"	"100327026"	"100327026"	"subst"	"0.183682"	"02325"	"AGL_000025"	"g.100327026C>T"	""	""	""	"AGL(NM_000028.2):c.83-33C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99861470C>T"	""	"benign"	""
"0000258988"	"0"	"10"	"1"	"100340782"	"100340782"	"subst"	"0.0136026"	"02325"	"AGL_000030"	"g.100340782G>T"	""	""	""	"AGL(NM_000028.2):c.1155G>T (p.(Lys385Asn), p.K385N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99875226G>T"	""	"benign"	""
"0000258989"	"0"	"10"	"1"	"100346741"	"100346741"	"subst"	"0.554136"	"02325"	"AGL_000003"	"g.100346741T>C"	""	""	""	"AGL(NM_000028.2):c.2001+8T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99881185T>C"	""	"benign"	""
"0000258990"	"0"	"10"	"1"	"100353675"	"100353675"	"subst"	"0.690765"	"02325"	"AGL_000038"	"g.100353675G>A"	""	""	""	"AGL(NM_000028.2):c.2812+11G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99888119G>A"	""	"benign"	""
"0000258991"	"0"	"10"	"1"	"100336361"	"100336361"	"subst"	"0.716811"	"02325"	"AGL_000027"	"g.100336361C>T"	""	""	""	"AGL(NM_000028.2):c.894C>T (p.L298=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99870805C>T"	""	"benign"	""
"0000258992"	"0"	"10"	"1"	"100340225"	"100340225"	"subst"	"0.717279"	"02325"	"AGL_000028"	"g.100340225G>A"	""	""	""	"AGL(NM_000642.3):c.959-18G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99874669G>A"	""	"benign"	""
"0000259437"	"0"	"30"	"1"	"100336151"	"100336151"	"subst"	"9.76396E-5"	"02325"	"AGL_000026"	"g.100336151G>A"	""	""	""	"AGL(NM_000028.2):c.846+14G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99870595G>A"	""	"likely benign"	""
"0000260664"	"0"	"30"	"1"	"100340782"	"100340782"	"subst"	"0.0136026"	"02326"	"AGL_000030"	"g.100340782G>T"	""	""	""	"AGL(NM_000028.2):c.1155G>T (p.(Lys385Asn), p.K385N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99875226G>T"	""	"likely benign"	""
"0000260665"	"0"	"10"	"1"	"100340827"	"100340827"	"subst"	"0.0308521"	"02326"	"AGL_000031"	"g.100340827T>C"	""	""	""	"AGL(NM_000028.2):c.1185+15T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99875271T>C"	""	"benign"	""
"0000260666"	"0"	"30"	"1"	"100346327"	"100346327"	"subst"	"0.00145481"	"02326"	"AGL_000033"	"g.100346327G>T"	""	""	""	"AGL(NM_000028.2):c.1875G>T (p.T625=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99880771G>T"	""	"likely benign"	""
"0000260667"	"0"	"30"	"1"	"100318245"	"100318245"	"subst"	"0.0161413"	"02326"	"AGL_000024"	"g.100318245T>G"	""	""	""	"AGL(NM_000646.2):c.20T>G (p.(Ile7Ser), p.I7S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99852689T>G"	""	"likely benign"	""
"0000262071"	"0"	"30"	"1"	"100340326"	"100340326"	"subst"	"3.25061E-5"	"01943"	"AGL_000029"	"g.100340326G>A"	""	""	""	"AGL(NM_000028.2):c.1042G>A (p.V348I, p.(Val348Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99874770G>A"	""	"likely benign"	""
"0000262072"	"0"	"10"	"1"	"100366213"	"100366213"	"subst"	"0.000909992"	"01943"	"AGL_000039"	"g.100366213G>A"	""	""	""	"AGL(NM_000028.2):c.3384G>A (p.A1128=, p.(Ala1128=)), AGL(NM_000642.3):c.3384G>A (p.A1128=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99900657G>A"	""	"benign"	""
"0000320885"	"0"	"30"	"1"	"100343254"	"100343254"	"subst"	"0.00859749"	"01804"	"AGL_000032"	"g.100343254G>A"	""	""	""	"AGL(NM_000028.2):c.1481G>A (p.(Arg494His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99877698G>A"	""	"likely benign"	""
"0000320886"	"0"	"30"	"1"	"100349757"	"100349757"	"subst"	"0.00173792"	"01804"	"AGL_000037"	"g.100349757A>G"	""	""	""	"AGL(NM_000028.2):c.2390A>G (p.(Asn797Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99884201A>G"	""	"likely benign"	""
"0000336870"	"0"	"70"	"1"	"100327811"	"100327811"	"subst"	"0"	"02327"	"AGL_000042"	"g.100327811A>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.99862255A>T"	""	"likely pathogenic"	""
"0000434973"	"1"	"15"	"1"	"100316589"	"100316589"	"subst"	"0.469761"	"00000"	"AGL_000002"	"g.100316589A>G"	""	"{PMID:Shen 1997:08990006}"	""	"-10G/A (ex3)"	""	"Unknown"	""	""	"0"	""	""	"g.99851033A>G"	""	"benign"	""
"0000434974"	"1"	"95"	"1"	"100327070"	"100327070"	"subst"	"4.06388E-6"	"00000"	"AGL_000007"	"g.100327070C>T"	""	"{PMID:Shaiu 2000:10655153}"	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99861514C>T"	""	"pathogenic"	""
"0000434975"	"1"	"95"	"1"	"100327232"	"100327232"	"subst"	"4.8765E-5"	"00000"	"AGL_000008"	"g.100327232C>T"	""	"{PMID:Shaiu 2000:10655153}"	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99861676C>T"	""	"pathogenic"	""
"0000434976"	"1"	"95"	"1"	"100346671"	"100346673"	"del"	"0"	"00000"	"AGL_000011"	"g.100346671_100346673del"	""	"{PMID:Shaiu 2000:10655153}"	""	"1937delTTG"	""	"Unknown"	""	""	"0"	""	""	"g.99881115_99881117del"	""	"pathogenic"	""
"0000434977"	"1"	"15"	"1"	"100346741"	"100346741"	"subst"	"0.554136"	"00000"	"AGL_000003"	"g.100346741T>C"	""	"{PMID:Shen 1997:08990006}"	""	"IVS16+8C/T"	""	"Unknown"	""	""	"0"	""	""	"g.99881185T>C"	""	"benign"	""
"0000434978"	"1"	"95"	"1"	"100357226"	"100357226"	"del"	"1.62529E-5"	"00000"	"AGL_000006"	"g.100357226del"	""	"{PMID:Shaiu 2000:10655153}"	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99891670del"	""	"pathogenic"	""
"0000434979"	"0"	"95"	"1"	"100357226"	"100357226"	"del"	"1.62529E-5"	"02976"	"AGL_000006"	"g.100357226del"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99891670del"	""	"pathogenic"	""
"0000434980"	"1"	"95"	"1"	"100361925"	"100361925"	"subst"	"0.0731549"	"00000"	"AGL_000009"	"g.100361925G>A"	""	"{PMID:Shaiu 2000:10655153}"	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99896369G>A"	""	"pathogenic"	""
"0000434981"	"1"	"95"	"1"	"100368315"	"100368315"	"del"	"0"	"00000"	"AGL_000010"	"g.100368315del"	""	"{PMID:Shaiu 2000:10655153}"	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99902759del"	""	"pathogenic"	""
"0000434982"	"21"	"95"	"1"	"100378035"	"100378035"	"dup"	"0"	"00000"	"AGL_000005"	"g.100378035dup"	""	"{PMID:Pavari 1998:09584265}"	""	"3904insA"	""	"Unknown"	""	""	"0"	""	""	"g.99912479dup"	""	"pathogenic"	""
"0000434983"	"10"	"95"	"1"	"100378035"	"100378035"	"dup"	"0"	"02976"	"AGL_000005"	"g.100378035dup"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99912479dup"	""	"pathogenic"	""
"0000434984"	"20"	"95"	"1"	"100378035"	"100378035"	"dup"	"0"	"02976"	"AGL_000005"	"g.100378035dup"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99912479dup"	""	"pathogenic"	""
"0000434985"	"11"	"95"	"1"	"100379098"	"100379098"	"del"	"8.14127E-6"	"00000"	"AGL_000012"	"g.100379098del"	""	"{PMID:Shaiu 2000:10655153}"	"AvaII-"	"3964delT"	""	"Unknown"	""	""	"0"	""	""	"g.99913542del"	""	"pathogenic"	""
"0000434986"	"21"	"95"	"1"	"100379098"	"100379098"	"del"	"8.14127E-6"	"00000"	"AGL_000012"	"g.100379098del"	""	"{PMID:Shaiu 2000:10655153}"	"AvaII-"	"3964delT"	""	"Unknown"	""	""	"0"	""	""	"g.99913542del"	""	"pathogenic"	""
"0000434987"	"10"	"95"	"1"	"100379098"	"100379098"	"del"	"8.14127E-6"	"00000"	"AGL_000012"	"g.100379098del"	""	"{PMID:Shaiu 2000:10655153}"	"AvaII-"	"3964delT"	""	"Unknown"	""	""	"0"	""	""	"g.99913542del"	""	"pathogenic"	""
"0000434988"	"20"	"95"	"1"	"100379098"	"100379098"	"del"	"8.14127E-6"	"00000"	"AGL_000012"	"g.100379098del"	""	"{PMID:Shaiu 2000:10655153}"	"AvaII-"	"3964delT"	""	"Unknown"	""	""	"0"	""	""	"g.99913542del"	""	"pathogenic"	""
"0000434989"	"1"	"95"	"1"	"100379098"	"100379098"	"del"	"8.14127E-6"	"00000"	"AGL_000012"	"g.100379098del"	""	"{PMID:Shaiu 2000:10655153}"	"AvaII-"	"3964delT"	""	"Unknown"	""	""	"0"	""	""	"g.99913542del"	""	"pathogenic"	""
"0000434990"	"11"	"95"	"1"	"100381004"	"100381004"	"dup"	"0"	"00000"	"AGL_000005"	"g.100381004dup"	""	"{PMID:Pavari 1998:09584265}"	""	"4214insA"	""	"Unknown"	""	""	"0"	""	""	"g.99915448dup"	""	"pathogenic"	""
"0000434991"	"10"	"95"	"1"	"100381954"	"100381954"	"subst"	"5.86864E-5"	"00000"	"AGL_000004"	"g.100381954A>G"	""	"{PMID:Okubo 1998:09490286}"	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99916398A>G"	""	"pathogenic"	""
"0000434992"	"21"	"95"	"1"	"100381954"	"100381954"	"subst"	"5.86864E-5"	"00000"	"AGL_000004"	"g.100381954A>G"	""	"{PMID:Okubo 1998:09490286}"	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99916398A>G"	""	"pathogenic"	""
"0000434993"	"10"	"95"	"1"	"100381954"	"100381954"	"subst"	"5.86864E-5"	"02976"	"AGL_000004"	"g.100381954A>G"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99916398A>G"	""	"pathogenic"	""
"0000434994"	"20"	"95"	"1"	"100381954"	"100381954"	"subst"	"5.86864E-5"	"02976"	"AGL_000004"	"g.100381954A>G"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99916398A>G"	""	"pathogenic"	""
"0000434995"	"10"	"95"	"1"	"100381954"	"100381954"	"subst"	"5.86864E-5"	"02976"	"AGL_000004"	"g.100381954A>G"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99916398A>G"	""	"pathogenic"	""
"0000434996"	"20"	"95"	"1"	"100381954"	"100381954"	"subst"	"5.86864E-5"	"02976"	"AGL_000004"	"g.100381954A>G"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99916398A>G"	""	"pathogenic"	""
"0000434997"	"1"	"95"	"1"	"100381954"	"100381954"	"subst"	"5.86864E-5"	"00000"	"AGL_000004"	"g.100381954A>G"	""	"{PMID:Shaiu 2000:10655153}"	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99916398A>G"	""	"pathogenic"	""
"0000434998"	"2"	"95"	"1"	"100381954"	"100381954"	"subst"	"5.86864E-5"	"00000"	"AGL_000004"	"g.100381954A>G"	""	"{PMID:Shaiu 2000:10655153}"	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99916398A>G"	""	"pathogenic"	""
"0000434999"	"21"	"95"	"1"	"100387137"	"100387137"	"dup"	"0"	"00000"	"AGL_000001"	"g.100387137dup"	""	"{PMID:Shen 1997:08990006}"	"RsaI-"	"4529insA (ex35)"	""	"Unknown"	""	""	"0"	""	""	"g.99921581dup"	""	"pathogenic"	""
"0000435000"	"10"	"95"	"1"	"100387137"	"100387137"	"dup"	"0"	"00000"	"AGL_000001"	"g.100387137dup"	""	"{PMID:Shen 1997:08990006}"	"RsaI-"	"4529insA (ex35)"	""	"Unknown"	""	""	"0"	""	""	"g.99921581dup"	""	"pathogenic"	""
"0000435001"	"0"	"95"	"1"	"100387137"	"100387137"	"dup"	"0"	"02976"	"AGL_000001"	"g.100387137dup"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.99921581dup"	""	"pathogenic"	""
"0000471103"	"11"	"70"	"1"	"100366252"	"100366253"	"del"	"0"	"01864"	"AGL_000043"	"g.100366252_100366253del"	""	""	""	"3423_3424delTG"	""	"Uniparental disomy, paternal allele"	""	""	"0"	""	""	"g.99900696_99900697del"	""	"pathogenic"	""
"0000502177"	"0"	"90"	"1"	"100316614"	"100316614"	"subst"	"1.62441E-5"	"02325"	"AGL_000044"	"g.100316614C>T"	""	""	""	"AGL(NM_000028.2):c.16C>T (p.Q6*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99851058C>T"	""	"pathogenic"	""
"0000502179"	"0"	"30"	"1"	"100327962"	"100327962"	"subst"	"0.000316749"	"01804"	"AGL_000045"	"g.100327962G>A"	""	""	""	"AGL(NM_000028.2):c.443G>A (p.(Arg148Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99862406G>A"	""	"likely benign"	""
"0000502180"	"0"	"30"	"1"	"100340787"	"100340787"	"subst"	"0.0523741"	"01804"	"AGL_000046"	"g.100340787G>A"	""	""	""	"AGL(NM_000028.2):c.1160G>A (p.(Arg387Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99875231G>A"	""	"likely benign"	""
"0000502181"	"0"	"50"	"1"	"100343205"	"100343205"	"subst"	"0.000130083"	"01943"	"AGL_000047"	"g.100343205G>A"	""	""	""	"AGL(NM_000028.2):c.1432G>A (p.V478I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99877649G>A"	""	"VUS"	""
"0000502182"	"0"	"90"	"1"	"100346953"	"100346954"	"ins"	"0"	"02325"	"AGL_000048"	"g.100346953_100346954insA"	""	""	""	"AGL(NM_000028.2):c.2107_2108insA (p.C703*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99881397_99881398insA"	""	"pathogenic"	""
"0000502184"	"0"	"30"	"1"	"100353589"	"100353589"	"subst"	"0"	"01804"	"AGL_000050"	"g.100353589T>A"	""	""	""	"AGL(NM_000028.2):c.2737T>A (p.(Ser913Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99888033T>A"	""	"likely benign"	""
"0000502185"	"0"	"10"	"1"	"100356846"	"100356846"	"subst"	"0.00089028"	"01943"	"AGL_000051"	"g.100356846A>G"	""	""	""	"AGL(NM_000028.2):c.2883A>G (p.R961=, p.(Arg961=)), AGL(NM_000642.3):c.2883A>G (p.R961=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99891290A>G"	""	"benign"	""
"0000502186"	"0"	"30"	"1"	"100376305"	"100376305"	"subst"	"9.35682E-5"	"01943"	"AGL_000052"	"g.100376305A>T"	""	""	""	"AGL(NM_000028.2):c.3738A>T (p.G1246=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99910749A>T"	""	"likely benign"	""
"0000502190"	"0"	"90"	"1"	"100387137"	"100387137"	"dup"	"0"	"02325"	"AGL_000055"	"g.100387137dup"	""	""	""	"AGL(NM_000028.2):c.4529dupA (p.Y1510*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99921581dup"	""	"pathogenic"	""
"0000597034"	"10"	"70"	"1"	"100336426"	"100336426"	"subst"	"0"	"03426"	"AGL_000056"	"g.100336426G>A"	""	""	""	""	"in trans with c.1019delA"	"Germline"	""	"rs1553184657"	"0"	""	""	"g.99870870G>A"	"{CV-RCV:000664741.1}"	"pathogenic (recessive)"	""
"0000597035"	"20"	"70"	"1"	"100340304"	"100340304"	"del"	"0"	"03426"	"AGL_000057"	"g.100340304del"	""	""	""	"1020delA"	"in trans with c.958+1G>A"	"Germline"	""	""	"0"	""	""	"g.99874748del"	""	"pathogenic (recessive)"	""
"0000604596"	"0"	"50"	"1"	"100327924"	"100327924"	"subst"	"0"	"02327"	"AGL_000058"	"g.100327924G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99862368G>C"	""	"VUS"	""
"0000604597"	"0"	"50"	"1"	"100340312"	"100340312"	"subst"	"0.000426649"	"02327"	"AGL_000059"	"g.100340312G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99874756G>A"	""	"VUS"	""
"0000604598"	"0"	"50"	"1"	"100340360"	"100340360"	"subst"	"7.31594E-5"	"02327"	"AGL_000060"	"g.100340360C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99874804C>T"	""	"VUS"	""
"0000604599"	"0"	"70"	"1"	"100343278"	"100343287"	"del"	"0"	"02327"	"AGL_000062"	"g.100343278_100343287del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99877722_99877731del"	""	"likely pathogenic"	""
"0000604600"	"0"	"50"	"1"	"100347247"	"100347247"	"subst"	"7.73225E-5"	"02327"	"AGL_000064"	"g.100347247G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99881691G>C"	""	"VUS"	""
"0000604601"	"0"	"30"	"1"	"100353534"	"100353534"	"subst"	"0"	"02327"	"AGL_000065"	"g.100353534T>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99887978T>A"	""	"likely benign"	""
"0000604602"	"0"	"50"	"1"	"100366413"	"100366413"	"subst"	"0.000101546"	"02327"	"AGL_000066"	"g.100366413C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99900857C>G"	""	"VUS"	""
"0000620311"	"0"	"70"	"1"	"100340911"	"100340911"	"subst"	"0"	"02325"	"AGL_000061"	"g.100340911C>G"	""	""	""	"AGL(NM_000028.2):c.1186-3C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99875355C>G"	""	"likely pathogenic"	""
"0000620312"	"0"	"50"	"1"	"100347100"	"100347100"	"subst"	"0"	"01943"	"AGL_000063"	"g.100347100T>C"	""	""	""	"AGL(NM_000028.2):c.2161T>C (p.Y721H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.99881544T>C"	""	"VUS"	""
"0000638678"	"3"	"90"	"1"	"100366355"	"100366355"	"subst"	"0"	"03573"	"AGL_000068"	"g.100366355A>T"	""	""	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.99900799A>T"	""	"pathogenic (recessive)"	""
"0000644239"	"3"	"90"	"1"	"100345499"	"100345499"	"dup"	"0"	"03573"	"AGL_000069"	"g.100345499dup"	""	""	""	"1632dupG"	""	"Germline"	"yes"	""	"0"	""	""	"g.99879943dup"	""	"pathogenic (recessive)"	""
"0000647308"	"1"	"30"	"1"	"100327183"	"100327183"	"subst"	"0.0162842"	"03575"	"AGL_000067"	"g.100327183T>C"	"27/2792 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"27 heterozygous, no homozygous; {DB:CLININrs2230305}"	"Germline"	""	"rs2230305"	"0"	""	""	"g.99861627T>C"	""	"likely benign"	""
"0000647309"	"1"	"30"	"1"	"100343254"	"100343254"	"subst"	"0.00859749"	"03575"	"AGL_000032"	"g.100343254G>A"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs141043166}"	"Germline"	""	"rs141043166"	"0"	""	""	"g.99877698G>A"	""	"likely benign"	""
"0000647310"	"1"	"50"	"1"	"100346211"	"100346211"	"subst"	"0.00054495"	"03575"	"AGL_000070"	"g.100346211C>T"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs139488862}"	"Germline"	""	"rs139488862"	"0"	""	""	"g.99880655C>T"	""	"VUS"	""
"0000647311"	"1"	"50"	"1"	"100349757"	"100349757"	"subst"	"0.00173792"	"03575"	"AGL_000037"	"g.100349757A>G"	"2/2792 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"2 heterozygous, no homozygous; {DB:CLININrs149210307}"	"Germline"	""	"rs149210307"	"0"	""	""	"g.99884201A>G"	""	"VUS"	""
"0000647312"	"1"	"30"	"1"	"100368318"	"100368318"	"subst"	"0.000212042"	"03575"	"AGL_000071"	"g.100368318G>A"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs202046937}"	"Germline"	""	"rs202046937"	"0"	""	""	"g.99902762G>A"	""	"likely benign"	""
"0000647313"	"1"	"30"	"1"	"100377973"	"100377973"	"subst"	"0.013905"	"03575"	"AGL_000072"	"g.100377973T>C"	"26/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"26 heterozygous, no homozygous; {DB:CLININrs28730706}"	"Germline"	""	"rs28730706"	"0"	""	""	"g.99912417T>C"	""	"likely benign"	""
"0000647314"	"1"	"70"	"1"	"100381954"	"100381954"	"subst"	"5.86864E-5"	"03575"	"AGL_000004"	"g.100381954A>G"	"1/2788 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs369973784}"	"Germline"	""	"rs369973784"	"0"	""	""	"g.99916398A>G"	""	"likely pathogenic"	""
"0000647315"	"1"	"50"	"1"	"100382037"	"100382037"	"subst"	"0.000900233"	"03575"	"AGL_000073"	"g.100382037A>G"	"21/2791 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 21 heterozygous, no homozygous; {DB:CLININrs143815159}"	"Germline"	""	"rs143815159"	"0"	""	""	"g.99916481A>G"	""	"VUS"	""
"0000653092"	"1"	"30"	"1"	"100340782"	"100340782"	"subst"	"0.0136026"	"03575"	"AGL_000030"	"g.100340782G>T"	"24/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"24 heterozygous; {DB:CLININrs28730701}"	"Germline"	""	"rs28730701"	"0"	""	""	"g.99875226G>T"	""	"likely benign"	""
"0000670151"	"3"	"30"	"1"	"100340782"	"100340782"	"subst"	"0.0136026"	"03575"	"AGL_000030"	"g.100340782G>T"	"2/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"2 homozygous; {DB:CLININrs28730701}"	"Germline"	""	"rs28730701"	"0"	""	""	"g.99875226G>T"	""	"likely benign"	""
"0000675378"	"0"	"50"	"1"	"100327863"	"100327863"	"subst"	"0.000365473"	"01943"	"AGL_000074"	"g.100327863T>C"	""	""	""	"AGL(NM_000028.2):c.344T>C (p.V115A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000675379"	"0"	"50"	"1"	"100347161"	"100347161"	"subst"	"4.87527E-5"	"01943"	"AGL_000075"	"g.100347161A>G"	""	""	""	"AGL(NM_000028.2):c.2222A>G (p.Q741R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000687787"	"0"	"30"	"1"	"100318245"	"100318245"	"subst"	"0.0161413"	"01804"	"AGL_000024"	"g.100318245T>G"	""	""	""	"AGL(NM_000646.2):c.20T>G (p.(Ile7Ser), p.I7S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000687789"	"0"	"30"	"1"	"100340782"	"100340782"	"subst"	"0.0136026"	"01804"	"AGL_000030"	"g.100340782G>T"	""	""	""	"AGL(NM_000028.2):c.1155G>T (p.(Lys385Asn), p.K385N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000697287"	"0"	"70"	"1"	"100347001"	"100347001"	"subst"	"0"	"00006"	"AGL_000076"	"g.100347001C>T"	"2/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.99881445C>T"	""	"likely pathogenic"	""
"0000697288"	"0"	"70"	"1"	"100378014"	"100378014"	"del"	"0"	"00006"	"AGL_000077"	"g.100378014del"	"2/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.99912458del"	""	"likely pathogenic"	""
"0000714830"	"1"	"90"	"1"	"100327232"	"100327232"	"subst"	"4.8765E-5"	"00000"	"AGL_000008"	"g.100327232C>T"	""	"{PMID:Wang 2013:22899091}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.99861676C>T"	""	"pathogenic (recessive)"	""
"0000714832"	"1"	"90"	"1"	"100330139"	"100330139"	"subst"	"0"	"00000"	"AGL_000078"	"g.100330139C>T"	""	"{PMID:Wang 2013:22899091}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.99864583C>T"	""	"pathogenic (recessive)"	""
"0000714833"	"3"	"90"	"1"	"100345603"	"100345603"	"subst"	"8.12783E-6"	"00000"	"AGL_000079"	"g.100345603G>T"	""	"{PMID:Wang 2013:22899091}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.99880047G>T"	""	"pathogenic (recessive)"	""
"0000714871"	"2"	"90"	"1"	"100353575"	"100353575"	"subst"	"8.13332E-6"	"00000"	"AGL_000080"	"g.100353575T>G"	""	"{PMID:Wang 2013:22899091}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.99888019T>G"	""	"pathogenic (recessive)"	""
"0000714873"	"2"	"90"	"1"	"100345603"	"100345603"	"subst"	"8.12783E-6"	"00000"	"AGL_000079"	"g.100345603G>T"	""	"{PMID:Wang 2013:22899091}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.99880047G>T"	""	"pathogenic (recessive)"	""
"0000787782"	"0"	"50"	"1"	"100346211"	"100346211"	"subst"	"0.00054495"	"03779"	"AGL_000070"	"g.100346211C>T"	""	""	""	""	""	"CLASSIFICATION record"	""	"rs139488862"	"0"	""	""	""	""	"VUS"	""
"0000798624"	"0"	"30"	"1"	"100349983"	"100349983"	"subst"	"0.0027805"	"01804"	"AGL_000081"	"g.100349983C>T"	""	""	""	"AGL(NM_000028.2):c.2522C>T (p.(Ser841Phe))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000798625"	"0"	"30"	"1"	"100356777"	"100356777"	"subst"	"3.65922E-5"	"01943"	"AGL_000082"	"g.100356777T>G"	""	""	""	"AGL(NM_000028.2):c.2814T>G (p.G938=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000798626"	"0"	"50"	"1"	"100357294"	"100357294"	"subst"	"4.06438E-6"	"01943"	"AGL_000083"	"g.100357294A>G"	""	""	""	"AGL(NM_000028.2):c.3082A>G (p.S1028G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000848196"	"0"	"30"	"1"	"100356846"	"100356846"	"subst"	"0.00089028"	"02326"	"AGL_000051"	"g.100356846A>G"	""	""	""	"AGL(NM_000028.2):c.2883A>G (p.R961=, p.(Arg961=)), AGL(NM_000642.3):c.2883A>G (p.R961=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000848198"	"0"	"30"	"1"	"100366213"	"100366213"	"subst"	"0.000909992"	"02326"	"AGL_000039"	"g.100366213G>A"	""	""	""	"AGL(NM_000028.2):c.3384G>A (p.A1128=, p.(Ala1128=)), AGL(NM_000642.3):c.3384G>A (p.A1128=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856844"	"0"	"30"	"1"	"100340252"	"100340252"	"subst"	"0.00034291"	"01943"	"AGL_000084"	"g.100340252G>A"	""	""	""	"AGL(NM_000028.2):c.968G>A (p.R323Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856845"	"0"	"30"	"1"	"100350017"	"100350017"	"subst"	"0.000486843"	"01943"	"AGL_000085"	"g.100350017T>C"	""	""	""	"AGL(NM_000028.2):c.2546+10T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856846"	"0"	"50"	"1"	"100379128"	"100379128"	"subst"	"4.06702E-6"	"01943"	"AGL_000086"	"g.100379128A>C"	""	""	""	"AGL(NM_000028.2):c.3995A>C (p.Q1332P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856847"	"0"	"30"	"1"	"100387183"	"100387183"	"subst"	"0.000228058"	"01943"	"AGL_000087"	"g.100387183T>A"	""	""	""	"AGL(NM_000028.2):c.4575T>A (p.I1525=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000882641"	"0"	"50"	"1"	"100340225"	"100340226"	"ins"	"0.00287132"	"02326"	"AGL_000088"	"g.100340225_100340226insAAAATAGTGACAGTTTTAATCTCTTTGTAGATATTTGCATTTAAGGTATCA"	""	""	""	"AGL(NM_000642.3):c.959-18_959-17ins51"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000882642"	"0"	"90"	"1"	"100356892"	"100356892"	"subst"	"0"	"02326"	"AGL_000089"	"g.100356892C>T"	""	""	""	"AGL(NM_000642.3):c.2929C>T (p.R977*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000882643"	"0"	"30"	"1"	"100366260"	"100366260"	"subst"	"0.00144561"	"02326"	"AGL_000090"	"g.100366260T>A"	""	""	""	"AGL(NM_000642.2):c.3431T>A (p.(Ile1144Asn)), AGL(NM_000642.3):c.3431T>A (p.I1144N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000882644"	"0"	"50"	"1"	"100377978"	"100377978"	"subst"	"0"	"02327"	"AGL_000091"	"g.100377978A>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000910721"	"0"	"50"	"1"	"100340963"	"100340963"	"subst"	"8.12565E-6"	"01804"	"AGL_000092"	"g.100340963A>G"	""	""	""	"AGL(NM_000028.2):c.1235A>G (p.(His412Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000918632"	"0"	"70"	"1"	"100345498"	"100345498"	"subst"	"0"	"00006"	"AGL_000093"	"g.100345498G>T"	""	"{PMID:Neubauer 2021:33895855}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"VUS"	"ACMG"
"0000920860"	"0"	"90"	"1"	"100368302"	"100368302"	"subst"	"8.15142E-6"	"03779"	"AGL_000094"	"g.100368302C>T"	""	""	""	""	""	"Unknown"	""	"rs771853367"	"0"	""	""	""	""	"pathogenic"	""
"0000922891"	"0"	"90"	"1"	"100340950"	"100340950"	"subst"	"1.62541E-5"	"02327"	"AGL_000095"	"g.100340950C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000922892"	"0"	"30"	"1"	"100346211"	"100346211"	"subst"	"0.00054495"	"02326"	"AGL_000070"	"g.100346211C>T"	""	""	""	"AGL(NM_000642.3):c.1759C>T (p.H587Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000922893"	"0"	"90"	"1"	"100387137"	"100387137"	"dup"	"0"	"02327"	"AGL_000001"	"g.100387137dup"	""	""	""	"AGL(NM_000028.2):c.4529dupA (p.Y1510*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000927958"	"0"	"50"	"1"	"100336010"	"100336010"	"subst"	"0"	"02327"	"AGL_000096"	"g.100336010A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000945232"	"0"	"50"	"1"	"100327088"	"100327088"	"subst"	"0.00362443"	"00002"	"AGL_000016"	"g.100327088A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.99861532A>G"	""	"VUS"	""
"0000973127"	"0"	"50"	"1"	"100316684"	"100316684"	"subst"	"0.00027616"	"01804"	"AGL_000097"	"g.100316684A>C"	""	""	""	"AGL(NM_000642.3):c.82+4A>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000973129"	"0"	"30"	"1"	"100327183"	"100327183"	"subst"	"0.0162842"	"01804"	"AGL_000067"	"g.100327183T>C"	""	""	""	"AGL(NM_000642.3):c.207T>C (p.(Asn69=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000973130"	"0"	"50"	"1"	"100340326"	"100340326"	"subst"	"3.25061E-5"	"01804"	"AGL_000029"	"g.100340326G>A"	""	""	""	"AGL(NM_000028.2):c.1042G>A (p.V348I, p.(Val348Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000973131"	"0"	"30"	"1"	"100356846"	"100356846"	"subst"	"0.00089028"	"01804"	"AGL_000051"	"g.100356846A>G"	""	""	""	"AGL(NM_000028.2):c.2883A>G (p.R961=, p.(Arg961=)), AGL(NM_000642.3):c.2883A>G (p.R961=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000973132"	"0"	"30"	"1"	"100366213"	"100366213"	"subst"	"0.000909992"	"01804"	"AGL_000039"	"g.100366213G>A"	""	""	""	"AGL(NM_000028.2):c.3384G>A (p.A1128=, p.(Ala1128=)), AGL(NM_000642.3):c.3384G>A (p.A1128=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000973133"	"0"	"30"	"1"	"100377973"	"100377973"	"subst"	"0.013905"	"01804"	"AGL_000072"	"g.100377973T>C"	""	""	""	"AGL(NM_000642.3):c.3849T>C (p.(Ala1283=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000973134"	"0"	"50"	"1"	"100379110"	"100379110"	"subst"	"0"	"01804"	"AGL_000098"	"g.100379110A>G"	""	""	""	"AGL(NM_000642.3):c.3977A>G (p.(Glu1326Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000987537"	"3"	"70"	"1"	"100353655"	"100353655"	"subst"	"0"	"04221"	"AGL_000099"	"g.100353655G>T"	""	""	""	""	"Variant classified as per ACMG guidelines (Richards et al 2015) and to the recently developed ACMG scoring system (Tavtigian et al 2020)."	"Germline"	"yes"	"rs1051512948"	"0"	""	""	"g.99888099G>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0000990035"	"0"	"30"	"1"	"100350133"	"100350133"	"subst"	"0"	"01804"	"AGL_000100"	"g.100350133T>C"	""	""	""	"AGL(NM_000642.2):c.2555T>C (p.(Leu852Pro))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000990036"	"0"	"30"	"1"	"100366260"	"100366260"	"subst"	"0.00144561"	"01804"	"AGL_000090"	"g.100366260T>A"	""	""	""	"AGL(NM_000642.2):c.3431T>A (p.(Ile1144Asn)), AGL(NM_000642.3):c.3431T>A (p.I1144N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000990037"	"0"	"90"	"1"	"100378035"	"100378035"	"dup"	"0"	"01804"	"AGL_000005"	"g.100378035dup"	""	""	""	"AGL(NM_000642.2):c.3911dupA (p.(Asn1304fs))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000990038"	"0"	"10"	"1"	"100380934"	"100380934"	"subst"	"0.00259171"	"02326"	"AGL_000101"	"g.100380934G>A"	""	""	""	"AGL(NM_000642.3):c.4162-11G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000990039"	"0"	"50"	"1"	"100380941"	"100380941"	"subst"	"4.06653E-6"	"01804"	"AGL_000102"	"g.100380941C>G"	""	""	""	"AGL(NM_000642.2):c.4162-4C>G (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000990040"	"0"	"50"	"1"	"100382007"	"100382007"	"subst"	"1.22255E-5"	"01804"	"AGL_000103"	"g.100382007A>G"	""	""	""	"AGL(NM_000642.2):c.4301A>G (p.(Asn1434Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001021236"	"1"	"90"	"1"	"100327867"	"100327892"	"del"	"0"	"00006"	"AGL_000104"	"g.100327867_100327892del"	""	"{PMID:Marti 2025:39666917}"	""	"c.348_373delTGCTGATAATCATGTGCTACCCTTGG"	""	"Germline"	""	""	"0"	""	""	"g.99862311_99862336del"	""	"pathogenic (recessive)"	""
"0001021281"	"2"	"90"	"1"	"100358120"	"100358121"	"del"	"0"	"00006"	"AGL_000105"	"g.100358120_100358121del"	""	"{PMID:Marti 2025:39666917}"	""	"c.3216_3217delGA"	""	"Germline"	""	""	"0"	""	""	"g.99892564_99892565del"	""	"pathogenic (recessive)"	""
"0001030984"	"0"	"30"	"1"	"100318116"	"100318116"	"subst"	"0"	"01804"	"AGL_000106"	"g.100318116G>T"	""	""	""	"AGL(NM_000646.2):c.-109-1G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001030987"	"0"	"30"	"1"	"100347219"	"100347219"	"subst"	"0.00107748"	"01804"	"AGL_000107"	"g.100347219C>T"	""	""	""	"AGL(NM_000642.3):c.2280C>T (p.(Ser760=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001030988"	"0"	"50"	"1"	"100366389"	"100366394"	"del"	"0"	"01804"	"AGL_000108"	"g.100366389_100366394del"	""	""	""	"AGL(NM_000642.3):c.3560_3565del (p.(Asp1187_Ser1188del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001030989"	"0"	"50"	"1"	"100379185"	"100379185"	"subst"	"0.000154494"	"01804"	"AGL_000109"	"g.100379185A>G"	""	""	""	"AGL(NM_000642.3):c.4052A>G (p.(Lys1351Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001030990"	"0"	"50"	"1"	"100381989"	"100381989"	"subst"	"1.22367E-5"	"01804"	"AGL_000110"	"g.100381989A>C"	""	""	""	"AGL(NM_000642.3):c.4283A>C (p.(Tyr1428Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes AGL
## Count = 142
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000096946"	"00024135"	"50"	"3290"	"0"	"3290"	"0"	"c.3290G>A"	"r.(?)"	"p.(Arg1097His)"	"25"
"0000096988"	"00024135"	"50"	"112"	"0"	"112"	"0"	"c.112A>G"	"r.(?)"	"p.(Thr38Ala)"	"3"
"0000154180"	"00024135"	"90"	"378"	"0"	"378"	"0"	"c.378T>A"	"r.(?)"	"p.(Cys126*)"	"4"
"0000154182"	"00024135"	"70"	"3295"	"0"	"3295"	"0"	"c.3295T>C"	"r.(3295u>c)"	"p.(Trp1099Arg)"	"25"
"0000154185"	"00024135"	"90"	"1183"	"0"	"1183"	"0"	"c.1183C>T"	"r.(1183c>u)"	"p.(Gln395*)"	"9"
"0000154187"	"00024135"	"90"	"3777"	"0"	"3777"	"0"	"c.3777G>A"	"r.(3777g>a)"	"p.(Trp1259*)"	"28"
"0000154189"	"00024135"	"90"	"2002"	"-2"	"2002"	"-2"	"c.2002-2A>G"	"r.spl"	"p.?"	"15i"
"0000248957"	"00024135"	"10"	"-10"	"0"	"-10"	"0"	"c.-10A>G"	"r.(?)"	"p.(=)"	""
"0000252388"	"00024135"	"70"	"1877"	"0"	"1877"	"0"	"c.1877A>G"	"r.(?)"	"p.(His626Arg)"	""
"0000256355"	"00024135"	"50"	"3764"	"0"	"3764"	"0"	"c.3764A>G"	"r.(?)"	"p.(Asn1255Ser)"	""
"0000258987"	"00024135"	"10"	"83"	"-33"	"83"	"-33"	"c.83-33C>T"	"r.(=)"	"p.(=)"	""
"0000258988"	"00024135"	"10"	"1155"	"0"	"1155"	"0"	"c.1155G>T"	"r.(?)"	"p.(Lys385Asn)"	""
"0000258989"	"00024135"	"10"	"2001"	"8"	"2001"	"8"	"c.2001+8T>C"	"r.(=)"	"p.(=)"	""
"0000258990"	"00024135"	"10"	"2812"	"11"	"2812"	"11"	"c.2812+11G>A"	"r.(=)"	"p.(=)"	""
"0000258991"	"00024135"	"10"	"894"	"0"	"894"	"0"	"c.894C>T"	"r.(?)"	"p.(Leu298=)"	""
"0000258992"	"00024135"	"10"	"959"	"-18"	"959"	"-18"	"c.959-18G>A"	"r.(=)"	"p.(=)"	""
"0000259437"	"00024135"	"30"	"846"	"14"	"846"	"14"	"c.846+14G>A"	"r.(=)"	"p.(=)"	""
"0000260664"	"00024135"	"30"	"1155"	"0"	"1155"	"0"	"c.1155G>T"	"r.(?)"	"p.(Lys385Asn)"	""
"0000260665"	"00024135"	"10"	"1185"	"15"	"1185"	"15"	"c.1185+15T>C"	"r.(=)"	"p.(=)"	""
"0000260666"	"00024135"	"30"	"1875"	"0"	"1875"	"0"	"c.1875G>T"	"r.(?)"	"p.(Thr625=)"	""
"0000260667"	"00024135"	"30"	"82"	"1565"	"82"	"1565"	"c.82+1565T>G"	"r.(=)"	"p.(=)"	""
"0000262071"	"00024135"	"30"	"1042"	"0"	"1042"	"0"	"c.1042G>A"	"r.(?)"	"p.(Val348Ile)"	""
"0000262072"	"00024135"	"10"	"3384"	"0"	"3384"	"0"	"c.3384G>A"	"r.(?)"	"p.(Ala1128=)"	""
"0000320885"	"00024135"	"30"	"1481"	"0"	"1481"	"0"	"c.1481G>A"	"r.(?)"	"p.(Arg494His)"	""
"0000320886"	"00024135"	"30"	"2390"	"0"	"2390"	"0"	"c.2390A>G"	"r.(?)"	"p.(Asn797Ser)"	""
"0000336870"	"00024135"	"70"	"294"	"-2"	"294"	"-2"	"c.294-2A>T"	"r.spl?"	"p.?"	""
"0000434973"	"00024135"	"15"	"-10"	"0"	"-10"	"0"	"c.-10A>G"	"r.(?)"	"p.(=)"	"2"
"0000434974"	"00024135"	"95"	"94"	"0"	"94"	"0"	"c.94C>T"	"r.(?)"	"p.(Gln32*)"	"3"
"0000434975"	"00024135"	"95"	"256"	"0"	"256"	"0"	"c.256C>T"	"r.(?)"	"p.(Gln862*)"	"3"
"0000434976"	"00024135"	"95"	"1939"	"0"	"1941"	"0"	"c.1939_1941del"	"r.(?)"	"p.(Val647del)"	"15"
"0000434977"	"00024135"	"15"	"2001"	"8"	"2001"	"8"	"c.2001+8T>C"	"r.(=)"	"p.(=)"	"15i"
"0000434978"	"00024135"	"95"	"3014"	"0"	"3014"	"0"	"c.3014del"	"r.(?)"	"p.(Cys1005PhefsTer7)"	"23"
"0000434979"	"00024135"	"95"	"3014"	"0"	"3014"	"0"	"c.3014del"	"r.(?)"	"p.(Cys1005PhefsTer7)"	"25"
"0000434980"	"00024135"	"95"	"3343"	"0"	"3343"	"0"	"c.3343G>A"	"r.(?)"	"p.(Gly1115Arg)"	"25"
"0000434981"	"00024135"	"95"	"3665"	"0"	"3665"	"0"	"c.3665del"	"r.(?)"	"p.(Ala1222ValfsTer5)"	"27"
"0000434982"	"00024135"	"95"	"3911"	"0"	"3911"	"0"	"c.3911dup"	"r.(?)"	"p.(Asn1304LysfsTer7)"	"29"
"0000434983"	"00024135"	"95"	"3911"	"0"	"3911"	"0"	"c.3911dup"	"r.(?)"	"p.(Asn1304LysfsTer7)"	"29"
"0000434984"	"00024135"	"95"	"3911"	"0"	"3911"	"0"	"c.3911dup"	"r.(?)"	"p.(Asn1304LysfsTer7)"	"29"
"0000434985"	"00024135"	"95"	"3965"	"0"	"3965"	"0"	"c.3965del"	"r.3965del"	"p.(Val1322AlafsTer27)"	"30"
"0000434986"	"00024135"	"95"	"3965"	"0"	"3965"	"0"	"c.3965del"	"r.3965del"	"p.(Val1322AlafsTer27)"	"30"
"0000434987"	"00024135"	"95"	"3965"	"0"	"3965"	"0"	"c.3965del"	"r.3965del"	"p.(Val1322AlafsTer27)"	"30"
"0000434988"	"00024135"	"95"	"3965"	"0"	"3965"	"0"	"c.3965del"	"r.3965del"	"p.(Val1322AlafsTer27)"	"30"
"0000434989"	"00024135"	"95"	"3965"	"0"	"3965"	"0"	"c.3965del"	"r.(?)"	"p.(Val1322AlafsTer27)"	"30"
"0000434990"	"00024135"	"95"	"4221"	"0"	"4221"	"0"	"c.4221dup"	"r.(?)"	"p.(Leu1408IlefsTer14)"	"31"
"0000434991"	"00024135"	"95"	"4260"	"-12"	"4260"	"-12"	"c.4260-12A>G"	"r.4259_4260ins4260-11_4260-1"	"p.Phe1420Hisfs*16"	"31i"
"0000434992"	"00024135"	"95"	"4260"	"-12"	"4260"	"-12"	"c.4260-12A>G"	"r.4259_4260ins4260-11_4260-1"	"p.Phe1420Hisfs*16"	"31i"
"0000434993"	"00024135"	"95"	"4260"	"-12"	"4260"	"-12"	"c.4260-12A>G"	"r.spl?"	"p.(Phe1420Hisfs*16)"	"31i"
"0000434994"	"00024135"	"95"	"4260"	"-12"	"4260"	"-12"	"c.4260-12A>G"	"r.spl?"	"p.(Phe1420Hisfs*16)"	"31i"
"0000434995"	"00024135"	"95"	"4260"	"-12"	"4260"	"-12"	"c.4260-12A>G"	"r.spl?"	"p.(Phe1420Hisfs*16)"	"31i"
"0000434996"	"00024135"	"95"	"4260"	"-12"	"4260"	"-12"	"c.4260-12A>G"	"r.spl?"	"p.(Phe1420Hisfs*16)"	"31i"
"0000434997"	"00024135"	"95"	"4260"	"-12"	"4260"	"-12"	"c.4260-12A>G"	"r.4259_4260ins4260-11_4260-1"	"p.Phe1420Hisfs*16"	"31i"
"0000434998"	"00024135"	"95"	"4260"	"-12"	"4260"	"-12"	"c.4260-12A>G"	"r.4259_4260ins4260-11_4260-1"	"p.Phe1420Hisfs*16"	"31i"
"0000434999"	"00024135"	"95"	"4529"	"0"	"4529"	"0"	"c.4529dup"	"r.(?)"	"p.(Tyr1510*)"	"34"
"0000435000"	"00024135"	"95"	"4529"	"0"	"4529"	"0"	"c.4529dup"	"r.(?)"	"p.(Tyr1510*)"	"34"
"0000435001"	"00024135"	"95"	"4529"	"0"	"4529"	"0"	"c.4529dup"	"r.(?)"	"p.(Tyr1510*)"	"34"
"0000471103"	"00024135"	"70"	"3423"	"0"	"3424"	"0"	"c.3423_3424del"	"r.(?)"	"p.(Glu1142Argfs*24)"	""
"0000502177"	"00024135"	"90"	"16"	"0"	"16"	"0"	"c.16C>T"	"r.(?)"	"p.(Gln6Ter)"	""
"0000502179"	"00024135"	"30"	"443"	"0"	"443"	"0"	"c.443G>A"	"r.(?)"	"p.(Arg148Lys)"	""
"0000502180"	"00024135"	"30"	"1160"	"0"	"1160"	"0"	"c.1160G>A"	"r.(?)"	"p.(Arg387Gln)"	""
"0000502181"	"00024135"	"50"	"1432"	"0"	"1432"	"0"	"c.1432G>A"	"r.(?)"	"p.(Val478Ile)"	""
"0000502182"	"00024135"	"90"	"2107"	"0"	"2108"	"0"	"c.2107_2108insA"	"r.(?)"	"p.(Cys703Ter)"	""
"0000502184"	"00024135"	"30"	"2737"	"0"	"2737"	"0"	"c.2737T>A"	"r.(?)"	"p.(Ser913Thr)"	""
"0000502185"	"00024135"	"10"	"2883"	"0"	"2883"	"0"	"c.2883A>G"	"r.(?)"	"p.(Arg961=)"	""
"0000502186"	"00024135"	"30"	"3738"	"0"	"3738"	"0"	"c.3738A>T"	"r.(?)"	"p.(Gly1246=)"	""
"0000502190"	"00024135"	"90"	"4529"	"0"	"4529"	"0"	"c.4529dup"	"r.(?)"	"p.(Tyr1510Ter)"	""
"0000597034"	"00024135"	"70"	"958"	"1"	"958"	"1"	"c.958+1G>A"	"r.spl"	"p.?"	""
"0000597035"	"00024135"	"70"	"1020"	"0"	"1020"	"0"	"c.1020del"	"r.(?)"	"p.(Glu340Aspfs*9)"	""
"0000604596"	"00024135"	"50"	"405"	"0"	"405"	"0"	"c.405G>C"	"r.(?)"	"p.(Lys135Asn)"	""
"0000604597"	"00024135"	"50"	"1028"	"0"	"1028"	"0"	"c.1028G>A"	"r.(?)"	"p.(Arg343Gln)"	""
"0000604598"	"00024135"	"50"	"1076"	"0"	"1076"	"0"	"c.1076C>T"	"r.(?)"	"p.(Pro359Leu)"	""
"0000604599"	"00024135"	"70"	"1505"	"0"	"1514"	"0"	"c.1505_1514del"	"r.(?)"	"p.(Cys502SerfsTer5)"	""
"0000604600"	"00024135"	"50"	"2308"	"0"	"2308"	"0"	"c.2308G>C"	"r.(?)"	"p.(Gly770Arg)"	""
"0000604601"	"00024135"	"30"	"2682"	"0"	"2682"	"0"	"c.2682T>A"	"r.(?)"	"p.(Ser894=)"	""
"0000604602"	"00024135"	"50"	"3584"	"0"	"3584"	"0"	"c.3584C>G"	"r.(?)"	"p.(Thr1195Arg)"	""
"0000620311"	"00024135"	"70"	"1186"	"-3"	"1186"	"-3"	"c.1186-3C>G"	"r.spl?"	"p.?"	""
"0000620312"	"00024135"	"50"	"2161"	"0"	"2161"	"0"	"c.2161T>C"	"r.(?)"	"p.(Tyr721His)"	""
"0000638678"	"00024135"	"90"	"3526"	"0"	"3526"	"0"	"c.3526A>T"	"r.(?)"	"p.(Lys1176*)"	""
"0000644239"	"00024135"	"90"	"1632"	"0"	"1632"	"0"	"c.1632dup"	"r.(?)"	"p.(Asn545Glufs*11)"	""
"0000647308"	"00024135"	"30"	"207"	"0"	"207"	"0"	"c.207T>C"	"r.(=)"	"p.(=)"	""
"0000647309"	"00024135"	"30"	"1481"	"0"	"1481"	"0"	"c.1481G>A"	"r.(?)"	"p.(Arg494His)"	""
"0000647310"	"00024135"	"50"	"1759"	"0"	"1759"	"0"	"c.1759C>T"	"r.(?)"	"p.(His587Tyr)"	""
"0000647311"	"00024135"	"50"	"2390"	"0"	"2390"	"0"	"c.2390A>G"	"r.(?)"	"p.(Asn797Ser)"	""
"0000647312"	"00024135"	"30"	"3668"	"0"	"3668"	"0"	"c.3668G>A"	"r.(?)"	"p.(Gly1223Asp)"	""
"0000647313"	"00024135"	"30"	"3849"	"0"	"3849"	"0"	"c.3849T>C"	"r.(=)"	"p.(=)"	""
"0000647314"	"00024135"	"70"	"4260"	"-12"	"4260"	"-12"	"c.4260-12A>G"	"r.(=)"	"p.(=)"	""
"0000647315"	"00024135"	"50"	"4331"	"0"	"4331"	"0"	"c.4331A>G"	"r.(?)"	"p.(Asn1444Ser)"	""
"0000653092"	"00024135"	"30"	"1155"	"0"	"1155"	"0"	"c.1155G>T"	"r.(?)"	"p.(Lys385Asn)"	""
"0000670151"	"00024135"	"30"	"1155"	"0"	"1155"	"0"	"c.1155G>T"	"r.(?)"	"p.(Lys385Asn)"	""
"0000675378"	"00024135"	"50"	"344"	"0"	"344"	"0"	"c.344T>C"	"r.(?)"	"p.(Val115Ala)"	""
"0000675379"	"00024135"	"50"	"2222"	"0"	"2222"	"0"	"c.2222A>G"	"r.(?)"	"p.(Gln741Arg)"	""
"0000687787"	"00024135"	"30"	"82"	"1565"	"82"	"1565"	"c.82+1565T>G"	"r.(=)"	"p.(=)"	""
"0000687789"	"00024135"	"30"	"1155"	"0"	"1155"	"0"	"c.1155G>T"	"r.(?)"	"p.(Lys385Asn)"	""
"0000697287"	"00024135"	"70"	"2155"	"0"	"2155"	"0"	"c.2155C>T"	"r.(?)"	"p.(Gln719*)"	""
"0000697288"	"00024135"	"70"	"3890"	"0"	"3890"	"0"	"c.3890del"	"r.(?)"	"p.(Leu1297Cysfs*17)"	""
"0000714830"	"00024135"	"90"	"256"	"0"	"256"	"0"	"c.256C>T"	"r.(?)"	"p.(Gln86*)"	""
"0000714832"	"00024135"	"90"	"658"	"0"	"658"	"0"	"c.658C>T"	"r.(?)"	"p.(His220Tyr)"	""
"0000714833"	"00024135"	"90"	"1735"	"1"	"1735"	"1"	"c.1735+1G>T"	"r.spl"	"p.?"	""
"0000714871"	"00024135"	"90"	"2723"	"0"	"2723"	"0"	"c.2723T>G"	"r.(?)"	"p.(Leu908Arg)"	""
"0000714873"	"00024135"	"90"	"1735"	"1"	"1735"	"1"	"c.1735+1G>T"	"r.spl"	"p.?"	""
"0000787782"	"00024135"	"50"	"1759"	"0"	"1759"	"0"	"c.1759C>T"	"r.(?)"	"p.(His587Tyr)"	""
"0000798624"	"00024135"	"30"	"2522"	"0"	"2522"	"0"	"c.2522C>T"	"r.(?)"	"p.(Ser841Phe)"	""
"0000798625"	"00024135"	"30"	"2814"	"0"	"2814"	"0"	"c.2814T>G"	"r.(?)"	"p.(Gly938=)"	""
"0000798626"	"00024135"	"50"	"3082"	"0"	"3082"	"0"	"c.3082A>G"	"r.(?)"	"p.(Ser1028Gly)"	""
"0000848196"	"00024135"	"30"	"2883"	"0"	"2883"	"0"	"c.2883A>G"	"r.(?)"	"p.(Arg961=)"	""
"0000848198"	"00024135"	"30"	"3384"	"0"	"3384"	"0"	"c.3384G>A"	"r.(?)"	"p.(Ala1128=)"	""
"0000856844"	"00024135"	"30"	"968"	"0"	"968"	"0"	"c.968G>A"	"r.(?)"	"p.(Arg323Gln)"	""
"0000856845"	"00024135"	"30"	"2546"	"10"	"2546"	"10"	"c.2546+10T>C"	"r.(=)"	"p.(=)"	""
"0000856846"	"00024135"	"50"	"3995"	"0"	"3995"	"0"	"c.3995A>C"	"r.(?)"	"p.(Gln1332Pro)"	""
"0000856847"	"00024135"	"30"	"4575"	"0"	"4575"	"0"	"c.4575T>A"	"r.(?)"	"p.(Ile1525=)"	""
"0000882641"	"00024135"	"50"	"959"	"-18"	"959"	"-17"	"c.959-18_959-17insAAAATAGTGACAGTTTTAATCTCTTTGTAGATATTTGCATTTAAGGTATCA"	"r.(=)"	"p.(=)"	""
"0000882642"	"00024135"	"90"	"2929"	"0"	"2929"	"0"	"c.2929C>T"	"r.(?)"	"p.(Arg977*)"	""
"0000882643"	"00024135"	"30"	"3431"	"0"	"3431"	"0"	"c.3431T>A"	"r.(?)"	"p.(Ile1144Asn)"	""
"0000882644"	"00024135"	"50"	"3854"	"0"	"3854"	"0"	"c.3854A>C"	"r.(?)"	"p.(Glu1285Ala)"	""
"0000910721"	"00024135"	"50"	"1235"	"0"	"1235"	"0"	"c.1235A>G"	"r.(?)"	"p.(His412Arg)"	""
"0000918632"	"00024135"	"70"	"1631"	"0"	"1631"	"0"	"c.1631G>T"	"r.(?)"	"p.(Arg544Met)"	""
"0000920860"	"00024135"	"90"	"3652"	"0"	"3652"	"0"	"c.3652C>T"	"r.(?)"	"p.(Arg1218Ter)"	""
"0000922891"	"00024135"	"90"	"1222"	"0"	"1222"	"0"	"c.1222C>T"	"r.(?)"	"p.(Arg408*)"	""
"0000922892"	"00024135"	"30"	"1759"	"0"	"1759"	"0"	"c.1759C>T"	"r.(?)"	"p.(His587Tyr)"	""
"0000922893"	"00024135"	"90"	"4529"	"0"	"4529"	"0"	"c.4529dup"	"r.(?)"	"p.(Tyr1510Ter)"	""
"0000927958"	"00024135"	"50"	"719"	"0"	"719"	"0"	"c.719A>G"	"r.(?)"	"p.(Asn240Ser)"	""
"0000945232"	"00024135"	"50"	"112"	"0"	"112"	"0"	"c.112A>G"	"r.(?)"	"p.(Thr38Ala)"	"3"
"0000973127"	"00024135"	"50"	"82"	"4"	"82"	"4"	"c.82+4A>C"	"r.spl?"	"p.?"	""
"0000973129"	"00024135"	"30"	"207"	"0"	"207"	"0"	"c.207T>C"	"r.(?)"	"p.(=)"	""
"0000973130"	"00024135"	"50"	"1042"	"0"	"1042"	"0"	"c.1042G>A"	"r.(?)"	"p.(Val348Ile)"	""
"0000973131"	"00024135"	"30"	"2883"	"0"	"2883"	"0"	"c.2883A>G"	"r.(?)"	"p.(Arg961=)"	""
"0000973132"	"00024135"	"30"	"3384"	"0"	"3384"	"0"	"c.3384G>A"	"r.(?)"	"p.(Ala1128=)"	""
"0000973133"	"00024135"	"30"	"3849"	"0"	"3849"	"0"	"c.3849T>C"	"r.(?)"	"p.(=)"	""
"0000973134"	"00024135"	"50"	"3977"	"0"	"3977"	"0"	"c.3977A>G"	"r.(?)"	"p.(Glu1326Gly)"	""
"0000987537"	"00024135"	"70"	"2803"	"0"	"2803"	"0"	"c.2803G>T"	"r.(?)"	"p.(Gly935Cys)"	"21"
"0000990035"	"00024135"	"30"	"2555"	"0"	"2555"	"0"	"c.2555T>C"	"r.(?)"	"p.(Leu852Pro)"	""
"0000990036"	"00024135"	"30"	"3431"	"0"	"3431"	"0"	"c.3431T>A"	"r.(?)"	"p.(Ile1144Asn)"	""
"0000990037"	"00024135"	"90"	"3911"	"0"	"3911"	"0"	"c.3911dup"	"r.(?)"	"p.(Asn1304Lysfs*7)"	""
"0000990038"	"00024135"	"10"	"4162"	"-11"	"4162"	"-11"	"c.4162-11G>A"	"r.(=)"	"p.(=)"	""
"0000990039"	"00024135"	"50"	"4162"	"-4"	"4162"	"-4"	"c.4162-4C>G"	"r.spl?"	"p.?"	""
"0000990040"	"00024135"	"50"	"4301"	"0"	"4301"	"0"	"c.4301A>G"	"r.(?)"	"p.(Asn1434Ser)"	""
"0001021236"	"00024135"	"90"	"348"	"0"	"373"	"0"	"c.348_373del"	"r.(?)"	"p.(Ala117LeufsTer10)"	""
"0001021281"	"00024135"	"90"	"3216"	"0"	"3217"	"0"	"c.3216_3217del"	"r.(?)"	"p.(Glu1072AspfsTer36)"	""
"0001030984"	"00024135"	"30"	"82"	"1436"	"82"	"1436"	"c.82+1436G>T"	"r.(=)"	"p.(=)"	""
"0001030987"	"00024135"	"30"	"2280"	"0"	"2280"	"0"	"c.2280C>T"	"r.(?)"	"p.(=)"	""
"0001030988"	"00024135"	"50"	"3560"	"0"	"3565"	"0"	"c.3560_3565del"	"r.(?)"	"p.(Asp1187_Ser1188del)"	""
"0001030989"	"00024135"	"50"	"4052"	"0"	"4052"	"0"	"c.4052A>G"	"r.(?)"	"p.(Lys1351Arg)"	""
"0001030990"	"00024135"	"50"	"4283"	"0"	"4283"	"0"	"c.4283A>C"	"r.(?)"	"p.(Tyr1428Ser)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 63
"{{screeningid}}"	"{{variantid}}"
"0000000004"	"0000945232"
"0000000013"	"0000096988"
"0000065275"	"0000096946"
"0000095592"	"0000154180"
"0000095595"	"0000154182"
"0000095598"	"0000154185"
"0000095600"	"0000154187"
"0000095602"	"0000154189"
"0000205587"	"0000434978"
"0000205588"	"0000434989"
"0000205589"	"0000434974"
"0000205590"	"0000434975"
"0000205591"	"0000434980"
"0000205592"	"0000434981"
"0000205593"	"0000434976"
"0000205594"	"0000434973"
"0000205594"	"0000434977"
"0000205594"	"0000434999"
"0000205594"	"0000435000"
"0000205595"	"0000434979"
"0000205595"	"0000435001"
"0000205596"	"0000434982"
"0000205596"	"0000434990"
"0000205597"	"0000434983"
"0000205597"	"0000434984"
"0000205598"	"0000434985"
"0000205598"	"0000434986"
"0000205599"	"0000434987"
"0000205599"	"0000434988"
"0000205600"	"0000434991"
"0000205600"	"0000434992"
"0000205601"	"0000434993"
"0000205601"	"0000434994"
"0000205602"	"0000434995"
"0000205602"	"0000434996"
"0000205603"	"0000434997"
"0000205603"	"0000434998"
"0000229867"	"0000471103"
"0000266374"	"0000597034"
"0000266374"	"0000597035"
"0000282941"	"0000638678"
"0000288326"	"0000644239"
"0000290619"	"0000647308"
"0000290620"	"0000647309"
"0000290621"	"0000647310"
"0000290622"	"0000647311"
"0000290623"	"0000647312"
"0000290624"	"0000647313"
"0000290625"	"0000647314"
"0000290626"	"0000647315"
"0000296403"	"0000653092"
"0000306463"	"0000670151"
"0000315198"	"0000697287"
"0000315199"	"0000697288"
"0000330299"	"0000714830"
"0000330299"	"0000714871"
"0000330301"	"0000714832"
"0000330301"	"0000714873"
"0000330302"	"0000714833"
"0000433003"	"0000918632"
"0000453037"	"0000987537"
"0000461861"	"0001021236"
"0000461861"	"0001021281"