### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = ANKRD11) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "ANKRD11" "ankyrin repeat domain 11" "16" "q24.3" "unknown" "NG_032003.1" "UD_136018164141" "" "https://www.LOVD.nl/ANKRD11" "" "1" "21316" "29123" "611192" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/ANKRD11_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2018-01-26 21:26:43" "00006" "2025-10-10 16:21:07" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00002505" "ANKRD11" "transcript variant 2" "002" "NM_013275.5" "" "NP_037407.4" "" "" "" "-461" "8849" "7992" "89556969" "89334029" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 11 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00232" "SRS;RSS" "Silver-Russell syndrome (SRS, Russell-Silver syndrome (RSS))" "AD" "180860" "" "" "" "00006" "2013-10-09 19:30:21" "00006" "2021-12-10 21:51:32" "00344" "EE" "encephalopathy, epileptic (EE)" "" "" "" "" "" "00006" "2014-03-12 21:57:45" "00006" "2015-12-07 07:11:25" "00388" "KBGS" "KBG syndrome (KBGS)" "AD" "148050" "" "autosomal dominant" "" "00006" "2014-05-29 10:09:45" "00006" "2021-12-10 21:51:32" "03900" "CPPB2" "precocious puberty, central, type 2 (CPPB-2)" "AD" "615346" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04281" "CDLS" "Cornelia de Lange syndrome (CDLS)" "" "" "" "" "" "00006" "2015-06-15 14:50:45" "" "" "05521" "seizures" "seizures" "" "" "" "" "" "00006" "2018-11-18 17:02:13" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "06906" "DEE" "encephalopathy, developmental and epileptic" "" "" "" "" "" "00006" "2022-04-07 09:24:23" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "ANKRD11" "00139" "ANKRD11" "00388" ## Individuals ## Do not remove or alter this header ## ## Count = 82 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00016589" "" "" "" "1" "" "00705" "{PMID:Xia 2014:24791903}" "2-generation family, 1 affected" "M" "?" "(United States)" "" "0" "" "" "European" "" "00019951" "" "" "" "5" "" "00784" "{PMID:Ockeloen 2015:25424714}" "family, 5 affecteds (2F, 3M)" "F;M" "" "(Netherlands)" "" "0" "" "" "white" "Fam1PatA-E" "00019952" "" "" "" "1" "" "00784" "{PMID:Ockeloen 2015:25424714}" "" "M" "" "(Netherlands)" "" "0" "" "" "" "Pat2" "00019953" "" "" "" "1" "" "00784" "{PMID:Ockeloen 2015:25424714}" "" "M" "" "(Netherlands)" "" "0" "" "" "" "Pat3" "00019954" "" "" "" "1" "" "00784" "{PMID:Ockeloen 2015:25424714}" "" "F" "" "(Netherlands)" "" "0" "" "" "" "Pat4" "00019955" "" "" "" "1" "" "00784" "{PMID:Ockeloen 2015:25424714}" "" "M" "" "(Netherlands)" "" "0" "" "" "" "Pat5" "00019956" "" "" "" "1" "" "00784" "{PMID:Ockeloen 2015:25424714}" "" "F" "" "(Netherlands)" "" "0" "" "" "" "Pat6" "00019957" "" "" "" "3" "" "00784" "{PMID:Ockeloen 2015:25424714}" "family, 3 affecteds (2F, M)" "F;M" "" "(Netherlands)" "" "0" "" "" "" "Fam7PatA-C" "00019958" "" "" "" "1" "" "00784" "{PMID:Ockeloen 2015:25424714}" "" "M" "" "(Netherlands)" "" "0" "" "" "" "Pat8" "00019959" "" "" "" "2" "" "00784" "{PMID:Ockeloen 2015:25424714}, {PMID:Monroe 2016:26845106}" "2 generation family, affected twins (F, M), unaffected non carrier parents" "F" "" "(Netherlands)" "" "0" "" "" "" "Pat9;Pat4" "00019960" "" "" "" "1" "" "00784" "{PMID:Ockeloen 2015:25424714}" "" "M" "" "(Netherlands)" "" "0" "" "" "" "Pat10" "00019961" "" "" "" "1" "" "00784" "{PMID:Ockeloen 2015:25424714}" "" "M" "" "(Netherlands)" "" "0" "" "" "" "Pat11" "00019962" "" "" "" "2" "" "00784" "{PMID:Ockeloen 2015:25424714}" "family, 2 affecteds (2F)" "F" "" "(Netherlands)" "" "0" "" "" "" "Fam12PatA-B" "00025861" "" "" "" "1" "" "01175" "{PMID:Parenti 2015:25652421}, {DOI:Parenti 2015:10.1111/cge.12564}" "" "F" "no" "Germany" "" "0" "" "" "" "" "00025862" "" "" "" "1" "" "01175" "{PMID:Parenti 2015:25652421}, {DOI:Parenti 2015:10.1111/cge.12564}" "" "M" "no" "Italy" "" "0" "" "" "" "" "00050381" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050385" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050480" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050481" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050488" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050537" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050604" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00050713" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00080118" "" "" "" "1" "" "01594" "{PMID:Spengler 2012:22683032}, {PMID:Spengler 2013:23885231}, for EUCID-SRS consortium" "" "M" "" "" "" "0" "" "" "" "22683032-PatSR596/07" "00080883" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected non-carrier parents" "" "" "" "" "0" "" "" "" "" "00111392" "" "" "" "1" "" "00729" "{PMID:Popp 2017:29158550}, {DOI:Popp 2017:10.1038/s41431-017-0022-1}" "" "F" "no" "" "" "0" "" "" "" "S_079" "00144510" "" "" "" "1" "" "01807" "" "" "M" "" "(Germany)" "" "0" "" "" "" "" "00151390" "" "" "" "1" "" "01807" "" "" "M" "" "(Germany)" "" "0" "" "" "" "" "00174388" "" "" "" "1" "" "01807" "" "" "M" "" "(Germany)" "" "0" "" "" "" "" "00180155" "" "" "" "1" "" "00006" "{PMID:Tumienė 2018:29286531}" "" "" "" "(Slovenia)" "" "0" "" "" "" "29286531-Pat07" "00183679" "" "" "" "1" "" "00006" "{PMID:Martinez 2017:27620904}, {DOI:Martinez 2017:10.1136/jmedgenet-2017-103964}" "" "" "" "Spain" "" "0" "" "" "" "27620904-Pat24" "00207888" "" "" "" "1" "" "00006" "{PMID:Lionel 2018:28771251}" "" "F" "" "Canada" "" "0" "" "" "" "28771251-Pat36" "00247794" "" "" "" "1" "" "03368" "{DOI:Aspromonte 2019:10.1002/humu.23822}" "" "M" "" "Italy" "" "0" "" "" "" "" "00247796" "" "" "" "1" "" "03368" "" "" "F" "" "" "" "0" "" "" "" "2338.01" "00263970" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" "" "00269124" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00269525" "" "" "" "1" "" "03512" "{PMID:Minardi 2020:32725632}" "" "F" "" "Italy" "" "0" "" "" "" "" "00269556" "" "" "" "3" "" "00006" "{PMID:Sirmaci 2011:21782149}" "2-generation family, 3 affected (3M)" "M" "" "Turkey" "" "0" "" "" "" "FamPatI1" "00269557" "" "" "00269556" "1" "" "00006" "{PMID:Sirmaci 2011:21782149}" "" "M" "" "Turkey" "" "0" "" "" "" "FamPatII1" "00269558" "" "" "00269556" "1" "" "00006" "{PMID:Sirmaci 2011:21782149}" "" "M" "" "Turkey" "" "0" "" "" "" "FamPatII2" "00269559" "" "" "" "1" "" "00006" "{PMID:Sirmaci 2011:21782149}" "2-generation family, 1 affected" "M" "" "Turkey" "" "0" "" "" "" "Fam2" "00269560" "" "" "" "1" "" "00006" "{PMID:Sirmaci 2011:21782149}" "2-generation family, 1 affected" "M" "" "Turkey" "" "0" "" "" "" "Fam3" "00269561" "" "" "" "1" "" "00006" "{PMID:Sirmaci 2011:21782149}" "2-generation family, 1 affected" "M" "" "Italy" "" "0" "" "" "" "Fam4" "00269562" "" "" "" "1" "" "00006" "{PMID:Sirmaci 2011:21782149}" "2-generation family, 1 affected" "M" "" "Italy" "" "0" "" "" "" "Fam5" "00269889" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00276057" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00289302" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" "" "00291591" "" "" "" "6" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291592" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00291593" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295604" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00296786" "" "" "" "2" "" "00006" "{PMID:Redin 2014:25167861}" "analysis 106 patients; 2-generation family, affected male twins, unaffected heterozygous carrier parents" "M" "" "France" "" "0" "" "" "" "APN-131" "00299445" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00301087" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00302677" "" "" "" "1" "" "01807" "" "" "F" "" "(Germany)" "" "0" "" "" "" "" "00302959" "" "" "" "1" "" "00006" "{PMID:Helbig 2016:26795593}" "" "" "" "United States" "" "0" "" "" "" "Pat4" "00302960" "" "" "" "1" "" "00006" "{PMID:Helbig 2016:26795593}" "" "" "" "United States" "" "0" "" "" "" "Pat5" "00307316" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00308025" "" "" "" "1" "" "00006" "{PMID:Mahler 2019:31056085}" "2-generation family, 1 affected, unaffected non-carrier parents" "" "no" "Germany" "" "0" "" "" "" "Pat4" "00324887" "" "" "" "1" "" "00006" "{DOI:Schalk 2020:10.1101/2020.12.23.424103}, {PMID:Schalk 2022:34930816}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "United States" "" "0" "" "" "" "Fam21" "00377570" "" "" "" "1" "" "04131" "" "" "" "" "" "" "" "" "" "" "" "00382753" "" "" "" "1" "" "01164" "" "" "M" "no" "Germany" "" "0" "" "" "" "184941" "00401298" "" "" "" "1" "" "02494" "" "" "F" "no" "Spain" "" "0" "" "" "" "045P" "00401642" "" "" "" "1" "" "02494" "" "" "F" "no" "Spain" "" "" "" "" "" "211P" "00401997" "" "" "" "1" "" "01164" "" "" "M" "?" "Turkey" "" "0" "" "" "" "191471" "00403865" "" "" "00403864" "1" "" "00006" "{PMID:Froukh 2020:32056211}" "sib" "F" "" "Jordan" "" "0" "" "" "" "TF042_4" "00414242" "" "" "" "1" "" "01164" "" "" "M" "-" "Germany" "" "0" "" "" "" "199193" "00415283" "" "" "" "1" "" "00000" "{PMID:Alfares 2018:30202406}" "" "M" "" "" "" "0" "" "" "" "1_AD" "00432294" "" "" "" "1" "" "01164" "" "" "F" "?" "" "" "0" "" "" "" "214326" "00434980" "" "" "" "1" "" "04451" "" "" "F" "no" "China" "" "" "" "" "East Asia" "YQL" "00438576" "" "" "" "1" "" "00006" "{PMID:Hamdan 2017:29100083}" "WGS analysis 197 individuals with unexplained DEE (unaffected parents)" "" "" "Canada" "" "0" "" "pharmaco-resistant seizures" "" "HSC0024" "00440372" "" "" "" "1" "" "00006" "{PMID:Nambot 2018:29095811}" "" "" "" "France" "" "0" "" "" "" "PED2231.1" "00440429" "" "" "" "1" "" "00006" "{PMID:Nambot 2018:29095811}" "" "" "" "France" "" "0" "" "" "" "PED3024.1" "00443473" "" "" "" "1" "" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "275800" "00453447" "" "" "" "1" "" "01164" "" "" "F" "no" "Germany" "" "0" "" "" "" "303049" "00457992" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" "00458105" "" "" "" "1" "" "03544" "" "" "F" "-" "- (not applicable)" "" "" "" "" "white" "" "00458172" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" "00458263" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" "00459413" "" "" "" "1" "" "03544" "" "" "F" "-" "- (not applicable)" "" "" "" "" "white" "" "00464552" "" "" "" "1" "" "04333" "" "" "M" "no" "Israel" "" "" "" "" "Ashkenazi Jewish" "" "00467287" "" "" "" "1" "" "00006" "{PMID:Soden 2014:25473036}" "family, 1 affected" "" "" "United States" "" "0" "" "" "" "CMH230" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 85 "{{individualid}}" "{{diseaseid}}" "00016589" "00198" "00019951" "00388" "00019952" "00388" "00019953" "00388" "00019954" "00388" "00019955" "00388" "00019956" "00388" "00019957" "00388" "00019958" "00388" "00019959" "00388" "00019960" "00388" "00019961" "00388" "00019962" "00388" "00025861" "04281" "00025862" "04281" "00050381" "00198" "00050385" "00198" "00050480" "00198" "00050481" "00198" "00050488" "00198" "00050537" "00198" "00050604" "00198" "00050713" "00198" "00080118" "00198" "00080118" "00232" "00080883" "00388" "00111392" "00388" "00144510" "00198" "00151390" "00198" "00174388" "00198" "00180155" "00198" "00183679" "00139" "00207888" "00198" "00247794" "00388" "00247796" "00388" "00263970" "00198" "00269124" "00198" "00269525" "00344" "00269556" "00388" "00269557" "00388" "00269558" "00388" "00269559" "00388" "00269560" "00388" "00269561" "00388" "00269562" "00388" "00269889" "00198" "00276057" "00198" "00289302" "00198" "00291591" "00198" "00291592" "00198" "00291593" "00198" "00295604" "00198" "00296786" "00139" "00299445" "00198" "00301087" "00198" "00302677" "00198" "00302959" "05521" "00302960" "05521" "00307316" "00198" "00308025" "00198" "00324887" "05611" "00377570" "00388" "00382753" "00388" "00401298" "00139" "00401298" "00388" "00401642" "00139" "00401997" "00388" "00403865" "05611" "00414242" "00388" "00415283" "04214" "00432294" "00388" "00432294" "03900" "00434980" "00388" "00438576" "06906" "00440372" "00198" "00440429" "00198" "00443473" "00388" "00453447" "00388" "00457992" "05611" "00458105" "05611" "00458172" "05611" "00458263" "00198" "00459413" "00198" "00464552" "00388" "00467287" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 00232, 00344, 00388, 03900, 04214, 04281, 05521, 05611, 06906 ## Count = 75 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Head/Microcephaly}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Feeding/Problems}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Intrauterine_growth_retardation/HPO/0001511}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Growth/Retardation/Postnatal/HPO_0008897}}" "{{Phenotype/Asymmetry/Body}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000015215" "00198" "00016589" "00705" "Isolated (sporadic)" "11y" "intellectual disability, (moderate to severe), no words, noncommunicating autism; 15m-sitting; no independent ambulation, hypotonia, failure to thrive, upturned earlobes, hypertelorism, esotropia, flat nasal bridge, suspected tracheomalacia in infancy, history of snoring; no macrodontia, no skeletal defects, nor other features of\r\nKGB syndrome" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017727" "00388" "00019951" "00784" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017728" "00388" "00019952" "00784" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017729" "00388" "00019953" "00784" "Isolated (sporadic)" "8y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017730" "00388" "00019954" "00784" "Isolated (sporadic)" "25y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017731" "00388" "00019955" "00784" "Isolated (sporadic)" "6y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017732" "00388" "00019956" "00784" "Isolated (sporadic)" "38y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017733" "00388" "00019957" "00784" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017734" "00388" "00019958" "00784" "Isolated (sporadic)" "11y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017735" "00388" "00019959" "00784" "Isolated (sporadic)" "10y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017736" "00388" "00019960" "00784" "Isolated (sporadic)" "11y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017737" "00388" "00019961" "00784" "Isolated (sporadic)" "19y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017738" "00388" "00019962" "00784" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000034225" "04281" "00025861" "01175" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000034226" "04281" "00025862" "01175" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000036993" "00198" "00050381" "00006" "Isolated (sporadic)" "" "global developmental delay, trigonocephaly, hypertelorism, long palpebral fissure, abnormality of the lower limb, arachnodactyly, aplasia/hypoplasia of the extremities" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000036997" "00198" "00050385" "00006" "Isolated (sporadic)" "" "cubitus valgus, joint stiffness, specific learning disability, mild short stature, dislocated radial head, triangular face, thoracic kyphosis, aggressive behavior" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000037092" "00198" "00050480" "00006" "Isolated (sporadic)" "" "ventricular septal defect, severe postnatal growth retardation, specific learning disability, delayed speech and language development, hyperhidrosis, stereotypic behavior" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000037093" "00198" "00050481" "00006" "Isolated (sporadic)" "" "intellectual disability, behavioural/psychiatric abnormality, prominent ears, proportionate short stature" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000037100" "00198" "00050488" "00006" "Isolated (sporadic)" "" "submucous cleft hard palate, specific learning disability, abnormality of the lip, microcephaly, mild conductive hearing impairment, bifid uvula, widely-spaced maxillary central incisors" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000037149" "00198" "00050537" "00006" "Isolated (sporadic)" "" "global developmental delay, ventricular septal defect, recurrent respiratory infections, astigmatism, strabismus, upslanted palpebral fissure, prominent nasal bridge, smooth philtrum, thin upper lip vermilion" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000037216" "00198" "00050604" "00006" "Isolated (sporadic)" "" "submucous cleft hard palate, attention deficit hyperactivity disorder, intellectual disability, upslanted palpebral fissure, hoarse voice, wide mouth, macrotia, bilateral single transverse palmar creases, broad toe, broad finger" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000037325" "00198" "00050713" "00006" "Isolated (sporadic)" "" "global developmental delay, autism, wide anterior fontanel, brachycephaly, tall stature, hypoplasia of the supraorbital ridges, abnormal iris pigmentation, downslanted palpebral fissures, convex nasal ridge, thin lips, low-set ears, cryptorchidism, clinodactyly of the 5th finger, turricephaly, large fontanelles, proptosis, inverted nipples" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000060452" "00388" "00080883" "01758" "Isolated (sporadic)" "" "KBG syndrome (OMIM:148050)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000082741" "00232" "00080118" "01594" "Unknown" "" "prominent forehead (HP:0011220)" "" "no macrocephaly congenital" "" "nr" "" "" "" "not small" "" "" "" "" "growth retardation (postnatal)" "no asymmetric growth" "unlikely SRS (Netchine Harbison-Score 2/5)" "SRS like (Bartholdi score: 35.7%), but due to the array results diagnosed as 16q24.3 microdeletion syndrome with normal intelligence" "" "0000087477" "00388" "00111392" "00729" "Isolated (sporadic)" "" "Feeding difficulties, short stature, microcephaly, moderate to severe ID, facial freckling" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000117248" "00198" "00144510" "01807" "Unknown" "" "Absence seizure (HP:0002121); Global developmental delay (HP:0001263)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000123784" "00198" "00151390" "01807" "Unknown" "" "Global developmental delay (HP:0001263); Microcephaly (HP:0000252); Short stature (HP:0004322); Seizures (HP:0001250)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000139226" "00198" "00174388" "01807" "Unknown" "" "Delayed speech and language development (HP:0000750); Autism (HP:0000717)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000142609" "00198" "00180155" "00006" "Familial, autosomal dominant" "" "(Pharmacoresistant) epilepsy (HP:0001250), myoclonic absences (HP:0011150), generalized tonic-clonic seizures (HP:0025190), specific learning disability (HP:0001328), facial dysmorphism (HP:0001999)." "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBG syndrome" "epilepsy or seizures associated with neurodevelopmental disorders and/or congenital malformations" "" "0000144365" "00139" "00183679" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBGS" "intellectual disability" "" "0000155672" "00198" "00207888" "00006" "Familial, autosomal dominant" "" "Intellectual disability; seizures; generalized hypotonia; abnormal facial shape; short stature" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBGS; ETL-1" "" "" "0000201829" "00198" "00263970" "01807" "Unknown" "" "Cryptorchidism (HP:0000028); Delayed speech and language development (HP:0000750); Global developmental delay (HP:0001263); Motor delay (HP:0001270); Abnormal facial shape (HP:0001999); Abnormality of fontanelles (HP:0011328)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000206969" "00198" "00269124" "01807" "Unknown" "" "Short stature (HP:0004322); Global developmental delay (HP:0001263); Autism (HP:0000717); Seizures (HP:0001250); Synophrys (HP:0000664)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000207356" "00344" "00269525" "03512" "Unknown" "" "Epileptic Encephalopathy (HP:0200134)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000207384" "00388" "00269556" "00006" "Familial, autosomal dominant" "" "macrodontia; low anterior and posterior hairlines, brachycephaly, triangular face, synophrys, long palpebral fissures, hypertelorism, ptosis, prominent nasal bridge, anteverted nostrils, long philtrum, large and prominent ears; short hands with clinodactyly of the 5th fingers and ulnar deviation of the 2nd fingers; short stature; seizures, mild-moderate intellectual disability; delayed bone age; accessory cervical ribs; cryptorchidism" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBG syndrome" "" "0000207385" "00388" "00269557" "00006" "Familial, autosomal dominant" "" "macrodontia; low anterior and posterior hairlines, brachycephaly, triangular face, synophrys, long palpebral fissures, hypertelorism, ptosis, prominent nasal bridge, anteverted nostrils, long philtrum, large and prominent ears; short hands with clinodactyly of the 5th fingers and ulnar deviation of the 2nd fingers; short stature; seizures, mild-moderate intellectual disability, attention deficit hyperactivity disorder; delayed bone age; closed spina bifida; cryptorchidism, mild sensorineural hearing loss" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBG syndrome" "" "0000207386" "00388" "00269558" "00006" "Familial, autosomal dominant" "" "macrodontia; low anterior and posterior hairlines, brachycephaly, triangular face, synophrys, long palpebral fissures, hypertelorism, ptosis, prominent nasal bridge, anteverted nostrils, long philtrum, large and prominent ears; short hands with clinodactyly of the 5th fingers and ulnar deviation of the 2nd fingers; short stature; moderate intellectual disability; thoracic kyphosis, closed spina bifida; cryptorchidism, epispadias" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBG syndrome" "" "0000207387" "00388" "00269559" "00006" "Isolated (sporadic)" "" "macrodontia; triangular face with pointed chin, low anterior hairline, long palpebral fissures, ptosis, anteverted nostrils, long philtrum, prominent ears; short hands with clinodactyly of the 5th fingers and ulnar deviation of the 2nd fingers, cutaneous syndactyly of fingers and toes; short stature; mild intellectual disability; delayed bone age; accessory cervical ribs; cryptorchidism" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBG syndrome" "" "0000207388" "00388" "00269560" "00006" "Isolated (sporadic)" "" "macrodontia; prominent forehead, brachycephaly, triangular face, synophrys, long palpebral fissures, hypertelorism, anteverted nostrils, posteriorly rotated ears, long philtrum, short and webbed neck; short hands with clinodactyly of the 5th fingers; no short stature; history of developmental delay, moderate intellectual disability; no costovertebral anomalies; cryptorchidism" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBG syndrome" "" "0000207389" "00388" "00269561" "00006" "Isolated (sporadic)" "" "macrodontia; low anterior and posterior hairlines, triangular face, ptosis, hypertelorism, prominent nasal bridge, anteverted nostrils, long philtrum, large and prominent ears, short and webbed neck; short hands with clinodactyly of the 5th fingers, cutaneous syndactyly of fingers and toes; short stature; moderate intellectual disability, hyperactivity, anxiety, poor concentration; accessory cervical ribs" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBG syndrome" "" "0000207390" "00388" "00269562" "00006" "Isolated (sporadic)" "" "low anterior and posterior hairlines, triangular face with pointed chin, synophrys, long and downslanting palpebral fissures, ptosis, hypertelorism, prominent nasal bridge, anteverted nostrils, long philtrum, tented upper lip, prominent ears; short hands with clinodactyly of the 5th fingers and ulnar deviation of the 2nd fingers; short stature; moderate intellectual disability; delayed bone age; no costovertebral anomalies; cryptorchidism" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBG syndrome" "" "0000207685" "00198" "00269889" "01807" "Unknown" "" "Global developmental delay (HP:0001263); Aggressive behavior (HP:0000718); Hypertrichosis (HP:0000998)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000210613" "00198" "00276057" "01807" "Unknown" "" "Global developmental delay (HP:0001263); Behavioral abnormality (HP:0000708); Short attention span (HP:0000736); Telecanthus (HP:0000506); Short stature (HP:0004322); Delayed closure of the anterior fontanelle (HP:0001476)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000222933" "00198" "00289302" "01807" "Unknown" "" "Intellectual disability (HP:0001249); Anteverted nares (HP:0000463); Thick lower lip vermilion (HP:0000179); Thick upper lip vermilion (HP:0000215); Low-set ears (HP:0000369); Thick eyebrow (HP:0000574); Synophrys (HP:0000664); Hypertelorism (HP:0000316); Broad neck (HP:0000475)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223169" "00198" "00295604" "01807" "Unknown" "" "Hearing impairment (HP:0000365); Sleep terror (HP:0030765); Nasal speech (HP:0001611)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000224185" "00139" "00296786" "00006" "Familial, autosomal dominant" "" "see paper; ..., severe intellectual disability; evocative symptoms of both SLC2A1 and ANKRD11 variants (major hypotonia, skeletal abnormalities" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000226755" "00198" "00299445" "01164" "Unknown" "" "Global developmental delay (HP:0001263)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000228392" "00198" "00301087" "01164" "Unknown" "" "Global developmental delay (HP:0001263); Abnormality of nervous system physiology (HP:0012638); Abnormality of head or neck (HP:0000152); Abnormal facial shape (HP:0001999)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000229758" "00198" "00302677" "01807" "Unknown" "" "Global developmental delay (HP:0001263); Autistic behavior (HP:0000729); Autism (HP:0000717); Muscular hypotonia (HP:0001252)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000230042" "05521" "00302959" "00006" "Isolated (sporadic)" "" "Single unprovoked seizure; age onset childhood" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "seizures" "" "0000230043" "05521" "00302960" "00006" "Isolated (sporadic)" "" "Unclassified epilepsy; age onset childhood" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "seizures" "" "0000233116" "00198" "00307316" "01164" "Unknown" "" "Intellectual disability (HP:0001249); Seizures (HP:0001250)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000233451" "00198" "00308025" "00006" "Isolated (sporadic)" "" "moderate global developmental delay, short stature, facial dysmorphism" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBGS" "developmental delay" "" "0000243383" "05611" "00324887" "00006" "Isolated (sporadic)" "09y" "see paper; ..., birth 40w, weight +0/13SD, OFC -1.3SD; weight -1.7SD, length -2.6SD, OFC -2.07SD; severe intellectual disability/developemental delay; hypotonia; seizures; motor delay; 35m-walk; speech delay; no speech; autistic behaviour; stereotypies; hyperactivity; feeding difficulties; sleeping disturbance; almond eyes; thin upper lip; epicanthus" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000272723" "00388" "00377570" "04131" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000276610" "00388" "00382753" "01164" "Isolated (sporadic)" "18y" "Intellectual disability, Global developmental delay, Absent speech, Seizure, Growth delay, Edema of the dorsum of hands, Edema of the dorsum of feet, Behavioral abnormality" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000294760" "00388" "00401997" "01164" "Isolated (sporadic)" "06y" "Delayed speech and language development, Poor speech, Neurological speech impairment, Abnormality of higher mental function, Abnormal nervous system physiology, Abnormality of the face" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000296545" "05611" "00403865" "00006" "Isolated (sporadic)" "" "aggressive behavior, mild intellectual disability" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "neurodevelopmental delay" "" "0000306094" "00388" "00414242" "01164" "Unknown" "" "Hypospadias, Hypertelorism, Hearing impairment, Long palpebral fissure, Single transverse palmar crease, Motor delay, Neurodevelopmental delay" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000307081" "04214" "00415283" "00000" "Familial, autosomal dominant" "" "OMIM: 148050; developmental delay, short stature, macrodontia, triangular face, and large and prominent ears" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBG Syndrome" "" "" "0000322861" "00388" "00432294" "01164" "Unknown" "10y" "Generalized non-motor (absence) seizure, Neurodevelopmental delay, Precocious puberty" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000322862" "03900" "00432294" "01164" "Unknown" "10y" "Generalized non-motor (absence) seizure, Neurodevelopmental delay, Precocious puberty" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000325227" "00388" "00434980" "04451" "Complex" "7" "High-arch and narrow palate, congenital heart defect; fifth finger brachydactyly, short hands, short feet, scoliosis, intellectual disability, short stature, delayed bone age" "" "" "" "" "" "" "DYH" "" "" "" "" "" "" "" "KBG syndrome" "Syndromic short stature" "" "0000328479" "06906" "00438576" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "developmental and epileptic encephalopathy" "" "0000330282" "00198" "00440372" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBG syndrome (MIM #148050)" "" "" "0000330339" "00198" "00440429" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBG syndrome (MIM #148050)" "" "" "0000332806" "00388" "00443473" "01164" "Isolated (sporadic)" "21+5" "Intrauterine growth retardation, Abnormality of prenatal development or birth, Polyhydramnios, Arteria lusoria" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "prenatal" "" "0000342112" "00388" "00453447" "01164" "Isolated (sporadic)" "06y" "Neurodevelopmental delay, Microcephaly, Hypertelorism, Autism, Intellectual disability, Infantile muscular hypotonia" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000346442" "05611" "00457992" "03544" "Isolated (sporadic)" "" "HP:0001249, HP:0001270, HP:0004322, HP:0000271" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBGS" "neurodevelopmental disorder" "" "0000346550" "05611" "00458105" "03544" "Familial" "" "HP:0000252, HP:0002474, HP:0001328, HP:0000736" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBGS" "complex neurodevelopmental disorder" "" "0000346608" "05611" "00458172" "03544" "Isolated (sporadic)" "" "HP:0000028, HP:0000256, HP:0000666, HP:0001252, HP:0001263, HP:0012758" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBGS" "complex neurodevelopmental disorder" "" "0000346700" "00198" "00458263" "03544" "Isolated (sporadic)" "" "Hp:0000750, HP:0002474, HP:0005487, HP:0000316, HP:0000426, HP:00004141, HP:0000369, HP:0000322, HP:0000319, HP:0000194, HP:0000219, HP:0011304, HP:0004209, HP:0001702, HP:0001633" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "complex neurodevelopmental disorder" "" "0000347489" "00198" "00459413" "03544" "Isolated (sporadic)" "" "HP:0004481, HP:0011885, HP:0006256, HP:0000271, HP:0410263, HP:0001249" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBGS" "KBGS" "" "0000352494" "00198" "00467287" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "KBG syndrome" "" ## Screenings ## Do not remove or alter this header ## ## Count = 82 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000016541" "00016589" "1" "00705" "00705" "2014-05-09 14:29:41" "00006" "2014-05-29 10:10:49" "SEQ" "DNA" "" "" "0000019943" "00019951" "1" "00784" "00784" "2014-09-21 22:26:34" "00006" "2014-09-26 23:09:55" "SEQ" "DNA" "" "" "0000019945" "00019952" "1" "00784" "00784" "2014-09-21 22:50:06" "00006" "2014-09-26 23:10:43" "SEQ" "DNA" "" "" "0000019947" "00019953" "1" "00784" "00784" "2014-09-21 22:38:18" "00006" "2014-09-26 23:11:30" "SEQ" "DNA" "" "" "0000019948" "00019954" "1" "00784" "00784" "2014-09-21 22:38:18" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000019949" "00019955" "1" "00784" "00784" "2014-09-21 22:38:18" "00006" "2014-09-26 23:12:23" "SEQ" "DNA" "" "" "0000019950" "00019956" "1" "00784" "00784" "2014-09-21 22:38:18" "00006" "2014-09-26 23:13:24" "SEQ" "DNA" "" "" "0000019951" "00019957" "1" "00784" "00784" "2014-09-21 22:38:18" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000019952" "00019958" "1" "00784" "00784" "2014-09-21 22:38:18" "00006" "2014-09-26 23:16:53" "SEQ" "DNA" "" "" "0000019953" "00019959" "1" "00784" "00784" "2014-09-21 22:38:18" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000019954" "00019960" "1" "00784" "00784" "2014-09-21 22:38:18" "00006" "2014-09-26 23:19:51" "SEQ-NG" "DNA" "" "" "0000019955" "00019961" "1" "00784" "00784" "2014-09-21 22:38:18" "00006" "2014-09-26 23:21:30" "SEQ-NG" "DNA" "" "" "0000019956" "00019962" "1" "00784" "00784" "2014-09-21 22:38:18" "00006" "2014-09-26 23:22:05" "SEQ" "DNA" "" "" "0000025863" "00025861" "1" "01175" "01175" "2014-12-17 10:15:54" "" "" "SEQ-NG" "DNA" "Blood" "" "0000025864" "00025862" "1" "01175" "01175" "2014-12-17 10:26:16" "" "" "SEQ-NG" "DNA" "Blood" "" "0000050326" "00050381" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050330" "00050385" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050425" "00050480" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050426" "00050481" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050433" "00050488" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050482" "00050537" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050549" "00050604" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000050658" "00050713" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000080211" "00080118" "1" "01594" "00008" "2016-09-01 17:30:25" "" "" "arrayCNV; PCRq" "DNA" "" "" "0000080995" "00080883" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000111857" "00111392" "1" "00729" "00729" "2017-08-03 00:35:52" "" "" "SEQ-NG" "DNA" "" "" "0000145367" "00144510" "0" "01807" "01807" "2017-12-15 14:21:18" "" "" "SEQ" "DNA" "" "" "0000152245" "00151390" "0" "01807" "01807" "2018-01-15 20:24:34" "" "" "SEQ" "DNA" "" "" "0000175279" "00174388" "1" "01807" "01807" "2018-08-08 12:36:23" "" "" "SEQ" "DNA" "" "" "0000181058" "00180155" "1" "00006" "00006" "2018-08-24 19:40:22" "" "" "SEQ-NG" "DNA" "" "WES" "0000184647" "00183679" "1" "00006" "00006" "2018-10-27 10:06:27" "" "" "SEQ;SEQ-NG" "DNA" "" "1256 gene panel" "0000208930" "00207888" "1" "00006" "00006" "2018-12-02 17:52:50" "" "" "SEQ" "DNA" "" "WGS" "0000248899" "00247794" "1" "03368" "03368" "2019-07-18 12:02:39" "03368" "2019-07-18 12:38:08" "SEQ-NG-IT" "DNA" "" "" "0000248902" "00247796" "1" "03368" "03368" "2019-07-18 13:00:44" "" "" "SEQ-NG-IT" "DNA" "" "" "0000265083" "00263970" "1" "01807" "01807" "2019-09-02 18:38:17" "" "" "SEQ" "DNA" "" "" "0000270255" "00269124" "1" "01807" "01807" "2019-11-06 14:42:55" "" "" "SEQ" "DNA" "" "" "0000270679" "00269525" "1" "03512" "03512" "2019-11-29 10:52:26" "" "" "SEQ-NG-I" "DNA" "" "WES" "0000270710" "00269556" "1" "00006" "00006" "2019-11-29 14:13:05" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000270711" "00269557" "1" "00006" "00006" "2019-11-29 14:13:05" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000270712" "00269558" "1" "00006" "00006" "2019-11-29 14:13:05" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000270713" "00269559" "1" "00006" "00006" "2019-11-29 14:13:05" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000270714" "00269560" "1" "00006" "00006" "2019-11-29 14:13:05" "" "" "SEQ" "DNA" "" "" "0000270715" "00269561" "1" "00006" "00006" "2019-11-29 14:13:05" "" "" "SEQ" "DNA" "" "" "0000270716" "00269562" "1" "00006" "00006" "2019-11-29 14:13:05" "" "" "SEQ" "DNA" "" "" "0000271042" "00269889" "1" "01807" "01807" "2019-12-10 12:31:47" "" "" "SEQ" "DNA" "" "" "0000277204" "00276057" "1" "01807" "01807" "2020-01-24 11:03:12" "" "" "SEQ" "DNA" "" "" "0000290472" "00289302" "1" "01807" "01807" "2020-03-02 12:27:16" "" "" "SEQ" "DNA" "" "" "0000292759" "00291591" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292760" "00291592" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000292761" "00291593" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296774" "00295604" "1" "01807" "01807" "2020-03-18 10:50:26" "" "" "SEQ" "DNA" "" "" "0000297896" "00296786" "1" "00006" "00006" "2020-04-13 12:27:32" "" "" "SEQ;SEQ-NG" "DNA" "" "241-gene ID panel" "0000300555" "00299445" "1" "01164" "01164" "2020-04-16 10:02:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000302209" "00301087" "1" "01164" "01164" "2020-05-07 10:03:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000303802" "00302677" "1" "01807" "01807" "2020-05-27 17:25:01" "" "" "SEQ" "DNA" "" "" "0000304084" "00302959" "1" "00006" "00006" "2020-06-05 14:08:27" "" "" "SEQ-NG" "DNA" "" "WES" "0000304085" "00302960" "1" "00006" "00006" "2020-06-05 14:08:27" "" "" "SEQ-NG" "DNA" "" "WES" "0000308458" "00307316" "1" "01164" "01164" "2020-08-10 12:26:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000309169" "00308025" "1" "00006" "00006" "2020-08-25 19:47:51" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000326094" "00324887" "1" "00006" "00006" "2020-12-24 15:03:09" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000378774" "00377570" "1" "04131" "04131" "2021-07-26 11:26:00" "" "" "SEQ-NG-IT" "DNA" "" "" "0000383967" "00382753" "1" "01164" "01164" "2021-09-10 10:23:45" "" "" "SEQ-NG-I" "DNA" "" "" "0000402542" "00401298" "1" "02494" "02494" "2022-01-31 10:26:05" "" "" "SEQ-NG" "DNA" "" "WES" "0000402885" "00401642" "1" "02494" "02494" "2022-02-01 11:08:26" "" "" "SEQ-NG" "DNA" "" "WES" "0000403238" "00401997" "1" "01164" "01164" "2022-02-03 11:53:44" "" "" "SEQ-NG-I" "DNA" "" "" "0000405103" "00403865" "1" "00006" "00006" "2022-02-24 16:43:58" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000415523" "00414242" "1" "01164" "01164" "2022-07-28 10:49:19" "" "" "SEQ-NG-I" "DNA" "Blood" "WES" "0000416565" "00415283" "1" "00000" "03840" "2022-08-10 20:39:58" "" "" "SEQ-NG" "DNA" "" "exome sequencing done at a commercial CAPaccredited laboratory" "0000433734" "00432294" "1" "01164" "01164" "2023-02-21 09:34:38" "" "" "SEQ-NG-I" "DNA" "" "" "0000436453" "00434980" "1" "04451" "04451" "2023-04-17 08:17:33" "" "" "SEQ-NG" "DNA" "Peripheral venous blood" "" "0000440058" "00438576" "1" "00006" "00006" "2023-10-21 19:20:17" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000441857" "00440372" "1" "00006" "00006" "2023-11-02 14:36:08" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000441914" "00440429" "1" "00006" "00006" "2023-11-02 14:36:08" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444966" "00443473" "1" "01164" "01164" "2023-11-27 17:08:20" "" "" "SEQ-NG-I" "DNA" "amniotic fluid" "" "0000455061" "00453447" "1" "01164" "01164" "2024-08-29 13:09:42" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000459612" "00457992" "1" "03544" "03544" "2024-11-24 17:17:17" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "CES" "0000459723" "00458105" "1" "03544" "03544" "2024-11-30 15:51:17" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "CES" "0000459793" "00458172" "1" "03544" "03544" "2024-12-06 10:57:49" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" "0000459885" "00458263" "1" "03544" "03544" "2024-12-12 07:25:44" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "CES" "0000461036" "00459413" "1" "03544" "03544" "2024-12-27 09:55:15" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "CES" "0000466191" "00464552" "1" "04333" "04333" "2025-03-27 12:46:57" "" "" "SEQ-NG" "DNA" "" "" "0000468950" "00467287" "1" "00006" "00006" "2025-10-10 16:20:58" "" "" "SEQ;SEQ-NG" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 51 "{{screeningid}}" "{{geneid}}" "0000016541" "AHDC1" "0000016541" "ANKRD11" "0000019943" "ANKRD11" "0000019945" "ANKRD11" "0000019947" "ANKRD11" "0000019948" "ANKRD11" "0000019949" "ANKRD11" "0000019950" "ANKRD11" "0000019951" "ANKRD11" "0000019952" "ANKRD11" "0000019953" "ANKRD11" "0000019954" "ANKRD11" "0000019955" "ANKRD11" "0000019956" "ANKRD11" "0000050326" "ANKRD11" "0000050330" "ANKRD11" "0000050425" "ANKRD11" "0000050433" "ANKRD11" "0000050482" "ANKRD11" "0000050549" "ANKRD11" "0000050658" "ANKRD11" "0000080995" "ANKRD11" "0000111857" "ANKRD11" "0000181058" "ANKRD11" "0000184647" "ANKRD11" "0000208930" "ANKRD11" "0000208930" "LGI1" "0000248899" "ANKRD11" "0000248902" "ANKRD11" "0000270710" "ANKRD11" "0000270711" "ANKRD11" "0000270712" "ANKRD11" "0000270713" "ANKRD11" "0000270714" "ANKRD11" "0000270715" "ANKRD11" "0000270716" "ANKRD11" "0000297896" "ANKRD11" "0000297896" "SLC2A1" "0000304084" "ANKRD11" "0000304085" "ANKRD11" "0000309169" "ANKRD11" "0000326094" "EIF2C1" "0000383967" "ANKRD11" "0000403238" "ANKRD11" "0000415523" "ANKRD11" "0000416565" "ANKRD11" "0000433734" "ANKRD11" "0000433734" "MKRN3" "0000436453" "ANKRD11" "0000444966" "ANKRD11" "0000455061" "ANKRD11" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 541 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000036677" "0" "55" "16" "89350944" "89350944" "subst" "0" "00006" "ANKRD11_000001" "g.89350944T>G" "" "{PMID:Xia 2014:24791903}" "" "" "not associated with phenotype" "De novo" "?" "" "0" "" "" "g.89284536T>G" "" "VUS" "" "0000040450" "0" "70" "16" "89341593" "89341593" "dup" "0" "00784" "ANKRD11_000002" "g.89341593dup" "" "{PMID:Ockeloen 2015:25424714}" "" "" "" "Germline" "yes" "" "0" "" "" "g.89275185dup" "" "likely pathogenic" "" "0000040452" "0" "70" "16" "89348559" "89348560" "del" "0" "00784" "ANKRD11_000003" "g.89348559_89348560del" "" "{PMID:Ockeloen 2015:25424714}" "" "" "" "De novo" "" "" "0" "" "" "g.89282151_89282152del" "" "likely pathogenic" "" "0000040462" "0" "70" "16" "89351049" "89351053" "del" "0" "00784" "ANKRD11_000004" "g.89351049_89351053del" "" "{PMID:Ockeloen 2015:25424714}" "" "Ockeloen 2014" "" "De novo" "" "" "0" "" "" "g.89284641_89284645del" "" "likely pathogenic" "" "0000040463" "0" "70" "16" "89346766" "89346766" "del" "0" "00784" "ANKRD11_000005" "g.89346766del" "" "{PMID:Ockeloen 2015:25424714}" "" "Ockeloen 2014" "" "De novo" "" "" "0" "" "" "g.89280358del" "" "likely pathogenic" "" "0000040464" "0" "70" "16" "89349828" "89349831" "del" "0" "00784" "ANKRD11_000006" "g.89349828_89349831del" "" "{PMID:Ockeloen 2015:25424714}" "" "Ockeloen 2014" "" "De novo" "" "" "0" "" "" "g.89283420_89283423del" "" "likely pathogenic" "" "0000040465" "0" "70" "16" "89351489" "89351492" "del" "0" "00784" "ANKRD11_000007" "g.89351489_89351492del" "" "{PMID:Ockeloen 2015:25424714}" "" "Ockeloen 2014" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.89285081_89285084del" "" "likely pathogenic" "" "0000040466" "0" "70" "16" "89351049" "89351053" "del" "0" "00784" "ANKRD11_000004" "g.89351049_89351053del" "" "{PMID:Ockeloen 2015:25424714}" "" "" "" "De novo" "" "" "0" "" "" "g.89284641_89284645del" "" "likely pathogenic" "" "0000040467" "0" "70" "16" "89349570" "89349571" "del" "0" "00784" "ANKRD11_000009" "g.89349570_89349571del" "" "{PMID:Ockeloen 2015:25424714}, {PMID:Monroe 2016:26845106}" "" "" "" "De novo" "" "" "0" "" "" "g.89283162_89283163del" "" "likely pathogenic" "" "0000040468" "0" "70" "16" "89350199" "89350199" "dup" "0" "00784" "ANKRD11_000010" "g.89350199dup" "" "{PMID:Ockeloen 2015:25424714}" "" "Ockeloen 2014" "" "De novo" "" "" "0" "" "" "g.89283791dup" "" "likely pathogenic" "" "0000040469" "1" "70" "16" "89282710" "89282710" "subst" "0" "00784" "ANKRD11_000011" "g.89282710T>A" "" "{PMID:Ockeloen 2015:25424714}" "" "" "" "Germline" "" "" "0" "" "" "g.89283160T>A" "" "likely pathogenic" "" "0000040470" "0" "70" "16" "89346441" "89346441" "dup" "0" "00784" "ANKRD11_000008" "g.89346441dup" "" "{PMID:Ockeloen 2015:25424714}" "" "" "" "De novo" "" "" "0" "" "" "g.89280033dup" "" "likely pathogenic" "" "0000040471" "0" "70" "16" "89351632" "89351632" "subst" "0" "00784" "ANKRD11_000013" "g.89351632G>A" "" "{PMID:Ockeloen 2015:25424714}" "" "" "" "Germline" "" "" "0" "" "" "g.89285224G>A" "" "likely pathogenic" "" "0000048874" "0" "70" "16" "89347467" "89347467" "subst" "0" "01175" "ANKRD11_000014" "g.89347467G>T" "" "{PMID:Parenti 2015:25652421}" "" "5483G>T" "mosaic variant (836/2664 reads)" "Somatic" "" "" "0" "" "" "g.89281059G>T" "" "likely pathogenic" "" "0000048875" "0" "70" "16" "89350649" "89350652" "del" "0" "01175" "ANKRD11_000015" "g.89350649_89350652del" "" "{PMID:Parenti 2015:25652421}" "" "2297_2300delAGAA (K766_K767fsX9)" "" "De novo" "" "" "0" "" "" "g.89284241_89284244del" "" "likely pathogenic" "" "0000079306" "0" "90" "16" "89350537" "89350543" "delins" "0" "00006" "ANKRD11_000016" "g.89350537_89350543delCTTTTTinsC" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "Variant Error [EINCONSISTENTLENGTH]: This genomic variant has an error (Length implied by coordinates must equal sequence deletion length). Please fix this entry and then remove this message." "De novo" "" "" "0" "" "" "g.89284129_89284135delinsC" "" "pathogenic" "" "0000079310" "0" "90" "16" "89348845" "89348848" "delins" "0" "00006" "ANKRD11_000019" "g.89348845_89348848delCTTinsC" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "Variant Error [EINCONSISTENTLENGTH]: This genomic variant has an error (Length implied by coordinates must equal sequence deletion length). Please fix this entry and then remove this message." "De novo" "" "" "0" "" "" "g.89282437_89282440delinsC" "" "pathogenic" "" "0000079405" "0" "90" "16" "89350537" "89350543" "delins" "0" "00006" "ANKRD11_000016" "g.89350537_89350543delCTTTTTinsC" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "Variant Error [EINCONSISTENTLENGTH]: This genomic variant has an error (Length implied by coordinates must equal sequence deletion length). Please fix this entry and then remove this message." "De novo" "" "" "0" "" "" "g.89284129_89284135delinsC" "" "pathogenic" "" "0000079406" "0" "90" "16" "89351049" "89351053" "del" "0" "00006" "ANKRD11_000017" "g.89351049_89351053del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.89284641_89284645del" "" "pathogenic" "" "0000079413" "0" "90" "16" "89351149" "89351149" "subst" "0" "00006" "ANKRD11_000018" "g.89351149G>A" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.89284741G>A" "" "pathogenic" "" "0000079462" "0" "90" "16" "89349367" "89349371" "delins" "0" "00006" "ANKRD11_000021" "g.89349367_89349371delTCinsT" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "Variant Error [EINCONSISTENTLENGTH]: This genomic variant has an error (Length implied by coordinates must equal sequence deletion length). Please fix this entry and then remove this message." "De novo" "" "" "0" "" "" "g.89282959_89282963delinsT" "" "pathogenic" "" "0000079529" "0" "90" "16" "89349493" "89349518" "del" "0" "00006" "ANKRD11_000022" "g.89349493_89349518del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.89283085_89283110del" "" "pathogenic" "" "0000079638" "0" "90" "16" "89349242" "89349242" "delins" "0" "00006" "ANKRD11_000020" "g.89349242_89349242delCTGTTTinsCT" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "Variant Error [EINCONSISTENTLENGTH]: This genomic variant has an error (Length implied by coordinates must equal sequence deletion length). Please fix this entry and then remove this message." "De novo" "" "" "0" "" "" "g.89282834delinsCT" "" "pathogenic" "" "0000129160" "0" "50" "16" "0" "0" "" "0" "01594" "ANKRD11_000024" "g.(88700001_89371838)_(89607414_qter)del" "" "{PMID:Spengler 2012:22683032}, {PMID:Spengler 2013:23885231}, for EUCID-SRS consortium" "" "" "deletion affecting ANKRD11 and part of SPG7" "De novo" "" "" "0" "normal methylation H19/IGF2:IG-DMR, KCNQ1OT1:TSS-DMR" "arr[hg19] 16q24.3(89,371,838-89,607,414)x1 dn" "" "" "VUS" "" "0000130081" "0" "70" "16" "89341367" "89341367" "subst" "0" "01758" "ANKRD11_000023" "g.89341367T>C" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "De novo" "" "" "0" "" "" "g.89274959T>C" "" "likely pathogenic" "ACMG" "0000179015" "0" "90" "16" "89351049" "89351053" "del" "0" "00729" "ANKRD11_000004" "g.89351049_89351053del" "" "" "" "" "" "De novo" "yes" "" "0" "" "" "g.89284641_89284645del" "" "pathogenic" "ACMG" "0000236480" "0" "90" "16" "89351804" "89351804" "dup" "0" "01807" "ANKRD11_000025" "g.89351804dup" "" "" "" "1146dupT" "" "Unknown" "" "" "0" "" "" "g.89285396dup" "" "pathogenic" "" "0000245379" "0" "90" "16" "89351528" "89351528" "dup" "0" "01807" "ANKRD11_000077" "g.89351528dup" "" "" "" "1422dupC" "" "Unknown" "" "" "0" "" "" "g.89285120dup" "" "pathogenic" "" "0000249401" "0" "30" "16" "89349587" "89349587" "subst" "0.000117856" "02325" "ANKRD11_000062" "g.89349587A>G" "" "" "" "ANKRD11(NM_001256182.2):c.3363T>C (p.D1121=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283179A>G" "" "likely benign" "" "0000259085" "0" "10" "16" "89350178" "89350178" "subst" "0.792992" "02325" "ANKRD11_000071" "g.89350178G>A" "" "" "" "ANKRD11(NM_001256182.2):c.2772C>T (p.T924=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283770G>A" "" "benign" "" "0000259086" "0" "10" "16" "89350038" "89350038" "subst" "0.636069" "02325" "ANKRD11_000068" "g.89350038G>A" "" "" "" "ANKRD11(NM_001256182.2):c.2912C>T (p.A971V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283630G>A" "" "benign" "" "0000259087" "0" "10" "16" "89345928" "89345928" "subst" "9.93029E-6" "02325" "ANKRD11_000030" "g.89345928G>A" "" "" "" "ANKRD11(NM_001256182.2):c.7022C>T (p.A2341V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279520G>A" "" "benign" "" "0000259486" "0" "30" "16" "89345889" "89345889" "subst" "1.10009E-5" "02325" "ANKRD11_000029" "g.89345889G>T" "" "" "" "ANKRD11(NM_001256182.2):c.7061C>A (p.P2354H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279481G>T" "" "likely benign" "" "0000259487" "0" "30" "16" "89352026" "89352026" "subst" "8.93582E-5" "02325" "ANKRD11_000081" "g.89352026G>A" "" "" "" "ANKRD11(NM_001256182.1):c.924C>T (p.F308=), ANKRD11(NM_001256182.2):c.924C>T (p.F308=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89285618G>A" "" "likely benign" "" "0000259658" "0" "50" "16" "89357574" "89357574" "subst" "0" "02325" "ANKRD11_000083" "g.89357574G>A" "" "" "" "ANKRD11(NM_001256182.2):c.244C>T (p.R82W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89291166G>A" "" "VUS" "" "0000259659" "0" "30" "16" "89350070" "89350070" "subst" "7.76087E-5" "02325" "ANKRD11_000070" "g.89350070C>G" "" "" "" "ANKRD11(NM_001256182.1):c.2880G>C (p.E960D), ANKRD11(NM_013275.6):c.2880G>C (p.E960D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283662C>G" "" "likely benign" "" "0000259660" "0" "50" "16" "89348894" "89348894" "subst" "0" "02325" "ANKRD11_000059" "g.89348894G>C" "" "" "" "ANKRD11(NM_001256182.2):c.4056C>G (p.H1352Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89282486G>C" "" "VUS" "" "0000259750" "0" "90" "16" "89351049" "89351053" "del" "0" "02325" "ANKRD11_000004" "g.89351049_89351053del" "" "" "" "ANKRD11(NM_001256182.1):c.1903_1907del (p.?), ANKRD11(NM_001256182.2):c.1903_1907delAAACA (p.K635Qfs*26), ANKRD11(NM_013275.6):c.1903_1907delAAACA ..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89284641_89284645del" "" "pathogenic" "" "0000259751" "0" "90" "16" "89347178" "89347178" "dup" "0" "02325" "ANKRD11_000044" "g.89347178dup" "" "" "" "ANKRD11(NM_001256182.2):c.5777dupC (p.E1927Gfs*23)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89280770dup" "" "pathogenic" "" "0000260119" "0" "90" "16" "89351049" "89351053" "del" "0" "02329" "ANKRD11_000004" "g.89351049_89351053del" "" "" "" "ANKRD11(NM_001256182.1):c.1903_1907del (p.?), ANKRD11(NM_001256182.2):c.1903_1907delAAACA (p.K635Qfs*26), ANKRD11(NM_013275.6):c.1903_1907delAAACA ..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89284641_89284645del" "" "pathogenic" "" "0000260120" "0" "90" "16" "89350973" "89350973" "subst" "0" "02329" "ANKRD11_000076" "g.89350973G>T" "" "" "" "ANKRD11(NM_001256182.2):c.1977C>A (p.Y659*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89284565G>T" "" "pathogenic" "" "0000260121" "0" "90" "16" "89348863" "89348863" "subst" "0" "02329" "ANKRD11_000058" "g.89348863G>A" "" "" "" "ANKRD11(NM_001256182.2):c.4087C>T (p.R1363*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89282455G>A" "" "pathogenic" "" "0000260122" "0" "90" "16" "89346103" "89346103" "subst" "0" "02329" "ANKRD11_000036" "g.89346103G>A" "" "" "" "ANKRD11(NM_001256182.2):c.6847C>T (p.Q2283*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279695G>A" "" "pathogenic" "" "0000260984" "0" "90" "16" "89347198" "89347198" "subst" "0" "02326" "ANKRD11_000045" "g.89347198G>A" "" "" "" "ANKRD11(NM_001256182.2):c.5752C>T (p.Q1918*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89280790G>A" "" "pathogenic" "" "0000260985" "0" "90" "16" "89346103" "89346103" "subst" "0" "02326" "ANKRD11_000036" "g.89346103G>A" "" "" "" "ANKRD11(NM_001256182.2):c.6847C>T (p.Q2283*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279695G>A" "" "pathogenic" "" "0000260986" "0" "30" "16" "89346031" "89346031" "subst" "0.000484552" "02326" "ANKRD11_000033" "g.89346031G>A" "" "" "" "ANKRD11(NM_001256182.1):c.6919C>T (p.P2307S, p.(Pro2307Ser)), ANKRD11(NM_001256182.2):c.6919C>T (p.P2307S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279623G>A" "" "likely benign" "" "0000262491" "0" "30" "16" "89350710" "89350710" "subst" "0.000536804" "01943" "ANKRD11_000075" "g.89350710G>A" "" "" "" "ANKRD11(NM_001256182.1):c.2240C>T (p.S747L), ANKRD11(NM_013275.5):c.2240C>T (p.(Ser747Leu)), ANKRD11(NM_013275.6):c.2240C>T (p.S747L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89284302G>A" "" "likely benign" "" "0000262492" "0" "90" "16" "89350587" "89350587" "subst" "0" "01943" "ANKRD11_000073" "g.89350587G>T" "" "" "" "ANKRD11(NM_001256182.1):c.2363C>A (p.S788*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89284179G>T" "" "pathogenic" "" "0000262493" "0" "50" "16" "89350431" "89350431" "subst" "0.000719097" "01943" "ANKRD11_000072" "g.89350431C>T" "" "" "" "ANKRD11(NM_001256182.1):c.2519G>A (p.R840Q), ANKRD11(NM_001256182.2):c.2519G>A (p.R840Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89284023C>T" "" "VUS" "" "0000262494" "0" "70" "16" "89350043" "89350043" "del" "0" "01943" "ANKRD11_000069" "g.89350043del" "" "" "" "ANKRD11(NM_001256182.1):c.2908delG (p.E970Rfs*7)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283635del" "" "likely pathogenic" "" "0000262495" "0" "30" "16" "89349508" "89349508" "subst" "3.65803E-5" "01943" "ANKRD11_000060" "g.89349508C>T" "" "" "" "ANKRD11(NM_001256182.1):c.3442G>A (p.G1148S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283100C>T" "" "likely benign" "" "0000262496" "0" "30" "16" "89348596" "89348596" "subst" "0" "01943" "ANKRD11_000057" "g.89348596C>T" "" "" "" "ANKRD11(NM_001256182.1):c.4354G>A (p.A1452T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89282188C>T" "" "likely benign" "" "0000262497" "0" "30" "16" "89347862" "89347862" "subst" "0.000736209" "01943" "ANKRD11_000051" "g.89347862G>C" "" "" "" "ANKRD11(NM_001256182.1):c.5088C>G (p.D1696E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281454G>C" "" "likely benign" "" "0000262498" "0" "50" "16" "89347654" "89347654" "subst" "1.21969E-5" "01943" "ANKRD11_000049" "g.89347654C>T" "" "" "" "ANKRD11(NM_001256182.1):c.5296G>A (p.V1766M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281246C>T" "" "VUS" "" "0000262499" "0" "30" "16" "89347441" "89347441" "subst" "0.00420363" "01943" "ANKRD11_000046" "g.89347441G>A" "" "" "" "ANKRD11(NM_001256182.1):c.5509C>T (p.P1837S, p.(Pro1837Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281033G>A" "" "likely benign" "" "0000262500" "0" "30" "16" "89346031" "89346031" "subst" "0.000484552" "01943" "ANKRD11_000033" "g.89346031G>A" "" "" "" "ANKRD11(NM_001256182.1):c.6919C>T (p.P2307S, p.(Pro2307Ser)), ANKRD11(NM_001256182.2):c.6919C>T (p.P2307S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279623G>A" "" "likely benign" "" "0000262501" "0" "30" "16" "89337300" "89337300" "subst" "0.000723718" "01943" "ANKRD11_000026" "g.89337300T>G" "" "" "" "ANKRD11(NM_001256182.1):c.7731A>C (p.S2577=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89270892T>G" "" "likely benign" "" "0000325031" "0" "50" "16" "89345973" "89345973" "subst" "1.08712E-5" "01804" "ANKRD11_000032" "g.89345973G>T" "" "" "" "ANKRD11(NM_001256182.1):c.6977C>A (p.(Ala2326Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279565G>T" "" "VUS" "" "0000325032" "0" "30" "16" "89346031" "89346031" "subst" "0.000484552" "01804" "ANKRD11_000033" "g.89346031G>A" "" "" "" "ANKRD11(NM_001256182.1):c.6919C>T (p.P2307S, p.(Pro2307Ser)), ANKRD11(NM_001256182.2):c.6919C>T (p.P2307S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279623G>A" "" "likely benign" "" "0000325033" "0" "30" "16" "89346082" "89346082" "subst" "0.00525492" "01804" "ANKRD11_000034" "g.89346082G>A" "" "" "" "ANKRD11(NM_013275.6):c.6868C>T (p.(Pro2290Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279674G>A" "" "likely benign" "" "0000325034" "0" "50" "16" "89346099" "89346099" "subst" "8.47716E-6" "01804" "ANKRD11_000035" "g.89346099G>A" "" "" "" "ANKRD11(NM_001256182.1):c.6851C>T (p.(Ala2284Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279691G>A" "" "VUS" "" "0000325035" "0" "50" "16" "89346270" "89346270" "subst" "0" "01804" "ANKRD11_000038" "g.89346270G>A" "" "" "" "ANKRD11(NM_001256182.1):c.6680C>T (p.(Pro2227Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279862G>A" "" "VUS" "" "0000325036" "0" "50" "16" "89346379" "89346379" "subst" "4.25217E-5" "01804" "ANKRD11_000039" "g.89346379G>A" "" "" "" "ANKRD11(NM_001256182.1):c.6571C>T (p.(Pro2191Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279971G>A" "" "VUS" "" "0000325037" "0" "30" "16" "89346798" "89346798" "subst" "2.57769E-5" "01804" "ANKRD11_000040" "g.89346798G>A" "" "" "" "ANKRD11(NM_013275.5):c.6152C>T (p.(Ser2051Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89280390G>A" "" "likely benign" "" "0000325038" "0" "30" "16" "89346865" "89346865" "subst" "0.000456457" "01804" "ANKRD11_000041" "g.89346865C>T" "" "" "" "ANKRD11(NM_013275.6):c.6085G>A (p.(Val2029Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89280457C>T" "" "likely benign" "" "0000325039" "0" "50" "16" "89346985" "89346985" "subst" "4.17865E-6" "01804" "ANKRD11_000042" "g.89346985C>T" "" "" "" "ANKRD11(NM_001256182.1):c.5965G>A (p.(Glu1989Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89280577C>T" "" "VUS" "" "0000325040" "0" "70" "16" "89346995" "89346996" "del" "0" "01804" "ANKRD11_000043" "g.89346995_89346996del" "" "" "" "ANKRD11(NM_001256182.1):c.5957_5958del (p.(Arg1986IlefsTer45))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89280587_89280588del" "" "likely pathogenic" "" "0000325041" "0" "50" "16" "89347541" "89347541" "subst" "0" "01804" "ANKRD11_000047" "g.89347541G>C" "" "" "" "ANKRD11(NM_013275.6):c.5409C>G (p.(Phe1803Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281133G>C" "" "VUS" "" "0000325042" "0" "30" "16" "89347612" "89347612" "subst" "0.0049467" "01804" "ANKRD11_000048" "g.89347612C>T" "" "" "" "ANKRD11(NM_001256182.1):c.5338G>A (p.(Ala1780Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281204C>T" "" "likely benign" "" "0000325043" "0" "50" "16" "89347800" "89347800" "subst" "8.21234E-6" "01804" "ANKRD11_000050" "g.89347800T>A" "" "" "" "ANKRD11(NM_001256182.1):c.5150A>T (p.(Glu1717Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281392T>A" "" "VUS" "" "0000325044" "0" "50" "16" "89347980" "89347980" "subst" "1.62566E-5" "01804" "ANKRD11_000052" "g.89347980G>A" "" "" "" "ANKRD11(NM_001256182.1):c.4970C>T (p.(Ser1657Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281572G>A" "" "VUS" "" "0000325045" "0" "50" "16" "89348331" "89348331" "subst" "0.000240048" "01804" "ANKRD11_000053" "g.89348331T>C" "" "" "" "ANKRD11(NM_001256182.1):c.4619A>G (p.K1540R, p.(Lys1540Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281923T>C" "" "VUS" "" "0000325047" "0" "50" "16" "89348474" "89348497" "del" "0" "01804" "ANKRD11_000055" "g.89348474_89348497del" "" "" "" "ANKRD11(NM_001256182.1):c.4475_4498del (p.?), ANKRD11(NM_001256182.1):c.4475_4498delTCCTGCGGCATCACAGGGACGAGC (p.L1492_E1499del), ANKRD11(NM_013275...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89282066_89282089del" "" "VUS" "" "0000325048" "0" "50" "16" "89348486" "89348486" "subst" "6.91405E-5" "01804" "ANKRD11_000056" "g.89348486G>T" "" "" "" "ANKRD11(NM_001256182.1):c.4464C>A (p.(His1488Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89282078G>T" "" "VUS" "" "0000325049" "0" "30" "16" "89349543" "89349543" "subst" "4.06428E-5" "01804" "ANKRD11_000061" "g.89349543T>G" "" "" "" "ANKRD11(NM_001256182.1):c.3407A>C (p.(Lys1136Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283135T>G" "" "likely benign" "" "0000325050" "0" "70" "16" "89349648" "89349648" "dup" "0" "01804" "ANKRD11_000063" "g.89349648dup" "" "" "" "ANKRD11(NM_001256182.1):c.3309dup (p.(Asp1104ArgfsTer2))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283240dup" "" "likely pathogenic" "" "0000325051" "0" "50" "16" "89349694" "89349696" "del" "0" "01804" "ANKRD11_000064" "g.89349694_89349696del" "" "" "" "ANKRD11(NM_001256182.1):c.3259_3261del (p.(Lys1087del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283286_89283288del" "" "VUS" "" "0000325054" "0" "50" "16" "89350618" "89350620" "del" "0" "01804" "ANKRD11_000074" "g.89350618_89350620del" "" "" "" "ANKRD11(NM_001256182.1):c.2337_2339del (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89284210_89284212del" "" "VUS" "" "0000325055" "0" "50" "16" "89351049" "89351053" "del" "0" "01804" "ANKRD11_000004" "g.89351049_89351053del" "" "" "" "ANKRD11(NM_001256182.1):c.1903_1907del (p.?), ANKRD11(NM_001256182.2):c.1903_1907delAAACA (p.K635Qfs*26), ANKRD11(NM_013275.6):c.1903_1907delAAACA ..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89284641_89284645del" "" "VUS" "" "0000325056" "0" "50" "16" "89351535" "89351535" "subst" "1.64301E-5" "01804" "ANKRD11_000078" "g.89351535C>T" "" "" "" "ANKRD11(NM_001256182.1):c.1415G>A (p.(Arg472Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89285127C>T" "" "VUS" "" "0000325059" "0" "50" "16" "89352449" "89352449" "subst" "0.00129134" "01804" "ANKRD11_000082" "g.89352449G>A" "" "" "" "ANKRD11(NM_001256182.1):c.890C>T (p.(Thr297Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89286041G>A" "" "VUS" "" "0000338853" "0" "90" "16" "89337223" "89337223" "subst" "0" "02327" "ANKRD11_000087" "g.89337223A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89270815A>G" "" "pathogenic" "" "0000338854" "0" "90" "16" "89337224" "89337224" "subst" "0" "02327" "ANKRD11_000088" "g.89337224C>A" "" "" "" "ANKRD11(NM_001256182.1):c.7806+1G>T, ANKRD11(NM_001256182.2):c.7806+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89270816C>A" "" "pathogenic" "" "0000339199" "0" "10" "16" "89350178" "89350178" "subst" "0.792992" "02327" "ANKRD11_000071" "g.89350178G>A" "" "" "" "ANKRD11(NM_001256182.2):c.2772C>T (p.T924=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283770G>A" "" "benign" "" "0000340520" "0" "30" "16" "89346041" "89346041" "subst" "0" "02327" "ANKRD11_000095" "g.89346041G>A" "" "" "" "ANKRD11(NM_001256182.1):c.6909C>T (p.A2303=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279633G>A" "" "likely benign" "" "0000340521" "0" "10" "16" "89346866" "89346866" "subst" "0.00362602" "02327" "ANKRD11_000104" "g.89346866G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89280458G>A" "" "benign" "" "0000340522" "0" "30" "16" "89347286" "89347286" "subst" "4.92676E-5" "02327" "ANKRD11_000106" "g.89347286T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89280878T>C" "" "likely benign" "" "0000340523" "0" "10" "16" "89348018" "89348018" "subst" "0.0404044" "02327" "ANKRD11_000111" "g.89348018C>T" "" "" "" "ANKRD11(NM_013275.6):c.4932G>A (p.(Gly1644=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281610C>T" "" "benign" "" "0000340524" "0" "30" "16" "89348090" "89348090" "subst" "7.31208E-5" "02327" "ANKRD11_000115" "g.89348090G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281682G>C" "" "likely benign" "" "0000340525" "0" "10" "16" "89348606" "89348606" "subst" "0.0277717" "02327" "ANKRD11_000118" "g.89348606A>G" "" "" "" "ANKRD11(NM_001256182.1):c.4344T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89282198A>G" "" "benign" "" "0000340526" "0" "10" "16" "89349128" "89349128" "subst" "0.0403408" "02327" "ANKRD11_000121" "g.89349128G>A" "" "" "" "ANKRD11(NM_013275.6):c.3822C>T (p.(Ala1274=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89282720G>A" "" "benign" "" "0000340527" "0" "10" "16" "89349377" "89349377" "subst" "0.0404144" "02327" "ANKRD11_000127" "g.89349377G>C" "" "" "" "ANKRD11(NM_013275.6):c.3573C>G (p.(Ala1191=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89282969G>C" "" "benign" "" "0000340528" "0" "10" "16" "89351930" "89351930" "subst" "0.0165412" "02327" "ANKRD11_000155" "g.89351930C>T" "" "" "" "ANKRD11(NM_001256182.1):c.1020G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89285522C>T" "" "benign" "" "0000340529" "0" "10" "16" "89357446" "89357446" "subst" "0.00283359" "02327" "ANKRD11_000160" "g.89357446C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89291038C>T" "" "benign" "" "0000341259" "0" "10" "16" "89346883" "89346883" "subst" "0.0458597" "02327" "ANKRD11_000105" "g.89346883C>G" "" "" "" "ANKRD11(NM_013275.6):c.6067G>C (p.(Ala2023Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89280475C>G" "" "benign" "" "0000341279" "0" "90" "16" "89346164" "89346164" "dup" "0" "02327" "ANKRD11_000096" "g.89346164dup" "" "" "" "ANKRD11(NM_001256182.1):c.6792dupC (p.A2265Rfs*8), ANKRD11(NM_013275.5):c.6792dupC (p.(Ala2265fs)), ANKRD11(NM_013275.6):c.6792dupC (p.A2265Rfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279756dup" "" "pathogenic" "" "0000341644" "0" "10" "16" "89350038" "89350038" "subst" "0.636069" "02327" "ANKRD11_000068" "g.89350038G>A" "" "" "" "ANKRD11(NM_001256182.2):c.2912C>T (p.A971V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283630G>A" "" "benign" "" "0000342431" "0" "70" "16" "89341328" "89341328" "subst" "0" "02327" "ANKRD11_000089" "g.89341328C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89274920C>G" "" "likely pathogenic" "" "0000342432" "0" "90" "16" "89341329" "89341329" "subst" "0" "02327" "ANKRD11_000090" "g.89341329G>A" "" "" "" "ANKRD11(NM_001256182.2):c.7606C>T (p.R2536W), ANKRD11(NM_013275.6):c.7606C>T (p.R2536W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89274921G>A" "" "pathogenic" "" "0000342901" "0" "90" "16" "89351632" "89351632" "subst" "0" "02327" "ANKRD11_000013" "g.89351632G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89285224G>A" "" "pathogenic" "" "0000343821" "0" "90" "16" "89350777" "89350780" "del" "0" "02327" "ANKRD11_000142" "g.89350777_89350780del" "" "" "" "ANKRD11(NM_001256182.1):c.2175_2178del (p.(Asn725LysfsTer23)), ANKRD11(NM_013275.6):c.2175_2178delCAAA (p.N725Kfs*23)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89284369_89284372del" "" "pathogenic" "" "0000343952" "0" "30" "16" "89347862" "89347862" "subst" "0.000736209" "02327" "ANKRD11_000051" "g.89347862G>C" "" "" "" "ANKRD11(NM_001256182.1):c.5088C>G (p.D1696E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281454G>C" "" "likely benign" "" "0000344009" "0" "30" "16" "89345822" "89345822" "subst" "0.116386" "02327" "ANKRD11_000094" "g.89345822G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279414G>C" "" "likely benign" "" "0000344090" "0" "10" "16" "89351705" "89351705" "subst" "0.00118315" "02327" "ANKRD11_000152" "g.89351705G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89285297G>A" "" "benign" "" "0000344653" "0" "90" "16" "89346679" "89346679" "subst" "0" "02327" "ANKRD11_000101" "g.89346679G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89280271G>A" "" "pathogenic" "" "0000344675" "0" "90" "16" "89346184" "89346184" "subst" "0" "02327" "ANKRD11_000098" "g.89346184G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279776G>A" "" "pathogenic" "" "0000344847" "0" "90" "16" "89351611" "89351611" "subst" "0" "02327" "ANKRD11_000150" "g.89351611G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89285203G>A" "" "pathogenic" "" "0000344892" "0" "70" "16" "89351329" "89351329" "subst" "0" "02327" "ANKRD11_000147" "g.89351329G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89284921G>A" "" "likely pathogenic" "" "0000345069" "0" "90" "16" "89349490" "89349490" "subst" "0" "02327" "ANKRD11_000128" "g.89349490C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283082C>A" "" "pathogenic" "" "0000345229" "0" "90" "16" "89346730" "89346730" "subst" "0" "02327" "ANKRD11_000102" "g.89346730C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89280322C>A" "" "pathogenic" "" "0000345387" "0" "90" "16" "89351830" "89351830" "subst" "0" "02327" "ANKRD11_000154" "g.89351830C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89285422C>A" "" "pathogenic" "" "0000345557" "0" "90" "16" "89350552" "89350555" "del" "0" "02327" "ANKRD11_000138" "g.89350552_89350555del" "" "" "" "ANKRD11(NM_013275.6):c.2398_2401delGAAA (p.E800Nfs*62)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89284144_89284147del" "" "pathogenic" "" "0000346976" "0" "30" "16" "89357512" "89357512" "subst" "0.000532226" "02327" "ANKRD11_000161" "g.89357512C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89291104C>G" "" "likely benign" "" "0000347394" "0" "90" "16" "89349118" "89349118" "subst" "0" "02327" "ANKRD11_000120" "g.89349118T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89282710T>A" "" "pathogenic" "" "0000348128" "0" "30" "16" "89349676" "89349676" "subst" "6.90439E-5" "02327" "ANKRD11_000131" "g.89349676G>A" "" "" "" "ANKRD11(NM_001256182.2):c.3274C>T (p.P1092S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89283268G>A" "" "likely benign" "" "0000348222" "0" "90" "16" "89348074" "89348074" "del" "0" "02327" "ANKRD11_000113" "g.89348074del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281666del" "" "pathogenic" "" "0000348226" "0" "10" "16" "89348038" "89348038" "subst" "0.0585585" "02327" "ANKRD11_000112" "g.89348038G>C" "" "" "" "ANKRD11(NM_001256182.2):c.4912C>G (p.P1638A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281630G>C" "" "benign" "" "0000348269" "0" "10" "16" "89346774" "89346774" "subst" "0.0553988" "02327" "ANKRD11_000103" "g.89346774G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89280366G>T" "" "benign" "" "0000348297" "0" "10" "16" "89346163" "89346163" "subst" "0.0331055" "02327" "ANKRD11_000097" "g.89346163G>A" "" "" "" "ANKRD11(NM_001256182.2):c.6787C>T (p.P2263S), ANKRD11(NM_013275.6):c.6787C>T (p.(Pro2263Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279755G>A" "" "benign" "" "0000348310" "0" "70" "16" "89345562" "89345562" "subst" "0" "02327" "ANKRD11_000093" "g.89345562G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89279154G>T" "" "likely pathogenic" "" "0000348690" "0" "70" "16" "89349171" "89349171" "subst" "0" "02327" "ANKRD11_000123" "g.89349171G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89282763G>T" "" "likely pathogenic" "" "0000349167" "0" "90" "16" "89350644" "89350644" "subst" "0" "02327" "ANKRD11_000140" "g.89350644G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89284236G>C" "" "pathogenic" "" "0000349318" "0" "50" "16" "89347788" "89347788" "subst" "4.10647E-6" "02327" "ANKRD11_000107" "g.89347788G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281380G>A" "" "VUS" "" "0000349603" "0" "10" "16" "89350911" "89350911" "subst" "0.0113238" "02327" "ANKRD11_000145" "g.89350911G>C" "" "" "" "ANKRD11(NM_013275.6):c.2039C>G (p.(Thr680Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89284503G>C" "" "benign" "" "0000349948" "0" "90" "16" "89347805" "89347805" "subst" "0" "02327" "ANKRD11_000108" "g.89347805G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281397G>C" "" "pathogenic" "" "0000349982" "0" "90" "16" "89355043" "89355044" "ins" "0" "02327" "ANKRD11_000158" "g.89355043_89355044insC" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89288635_89288636insC" "" "pathogenic" "" "0000350027" "0" "90" "16" "89352472" "89352472" "subst" "0" "02327" "ANKRD11_000156" "g.89352472G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89286064G>C" "" "pathogenic" "" "0000350072" "0" "90" "16" "89351777" "89351777" "subst" "0" "02327" "ANKRD11_000153" "g.89351777G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89285369G>C" "" "pathogenic" "" "0000350709" "0" "70" "16" "89335072" "89335072" "subst" "0" "02327" "ANKRD11_000086" "g.89335072C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89268664C>G" "" "likely pathogenic" "" "0000351415" "0" "90" "16" "89341367" "89341367" "subst" "0" "02327" "ANKRD11_000091" "g.89341367T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89274959T>G" "" "pathogenic" "" "0000351416" "0" "10" "16" "89348078" "89348078" "subst" "0.0046358" "02327" "ANKRD11_000114" "g.89348078C>T" "" "" "" "ANKRD11(NM_001256182.1):c.4872G>A (p.A1624=), ANKRD11(NM_013275.6):c.4872G>A (p.(Ala1624=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89281670C>T" "" "benign" "" "0000351417" "0" "10" "16" "89354918" "89354918" "subst" "0.00394857" "02327" "ANKRD11_000157" "g.89354918G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.89288510G>C" "" "benign" "" "0000395150" "0" "90" "16" "89350246" "89350246" "subst" "0" "01807" "ANKRD11_000164" "g.89350246C>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.89283838C>A" "" "pathogenic" "" "0000404694" "0" "90" "16" "89348474" "89348497" "dup" "0" "00006" "ANKRD11_000165" "g.89348474_89348497dup" "" "{PMID:Tumienė 2018:29286531}" "" "4475_4498dupTCCTGCGGCATCACAGGGACGAGC" "" "De novo" "" "" "0" "" "" "g.89282066_89282089dup" "" "pathogenic" "ACMG" "0000408770" "11" "90" "16" "89349581" "89349584" "del" "0" "00006" "ANKRD11_000166" "g.89349581_89349584del" "" "{PMID:Martinez 2017:27620904}, {DOI:Martinez 2017:10.1136/jmedgenet-2017-103964}" "" "3369_3372delTGAG" "Somatic mosaicism father" "Germline" "" "" "0" "" "" "g.89283173_89283176del" "" "pathogenic (dominant)" "" "0000438965" "1" "90" "16" "89350438" "89350438" "subst" "0" "00006" "ANKRD11_000167" "g.89350438G>A" "" "{PMID:Lionel 2018:28771251}" "" "" "associated with KBG syndrome" "Germline/De novo (untested)" "" "" "0" "" "" "g.89284030G>A" "" "pathogenic" "" "0000501874" "0" "70" "16" "89345981" "89345988" "del" "0" "03368" "ANKRD11_000168" "g.89345981_89345988del" "1/485 patients" "{DOI:Aspromonte 2019:10.1002/humu.23822}" "" "" "ACMG PVS1, PM2, PM4, PM6, PP4" "De novo" "-" "" "0" "" "" "g.89279573_89279580del" "" "pathogenic (dominant)" "ACMG" "0000501875" "0" "70" "16" "89346137" "89346138" "del" "0" "03368" "ANKRD11_000184" "g.89346137_89346138del" "1/485 patients" "{DOI:Aspromonte 2019:10.1002/humu.23822}" "" "" "" "De novo" "-" "" "0" "" "" "g.89279729_89279730del" "" "pathogenic (dominant)" "" "0000559816" "0" "50" "16" "89337293" "89337293" "subst" "0" "01804" "ANKRD11_000170" "g.89337293C>T" "" "" "" "ANKRD11(NM_013275.5):c.7738G>A (p.(Asp2580Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89270885C>T" "" "VUS" "" "0000559818" "0" "70" "16" "89341221" "89341221" "subst" "0" "01943" "ANKRD11_000173" "g.89341221C>T" "" "" "" "ANKRD11(NM_001256182.1):c.7713+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89274813C>T" "" "likely pathogenic" "" "0000559819" "0" "50" "16" "89341266" "89341266" "subst" "0" "02327" "ANKRD11_000174" "g.89341266T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89274858T>A" "" "VUS" "" "0000559820" "0" "50" "16" "89341329" "89341329" "subst" "0" "01943" "ANKRD11_000090" "g.89341329G>A" "" "" "" "ANKRD11(NM_001256182.2):c.7606C>T (p.R2536W), ANKRD11(NM_013275.6):c.7606C>T (p.R2536W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89274921G>A" "" "VUS" "" "0000559821" "0" "70" "16" "89341329" "89341329" "subst" "0" "02329" "ANKRD11_000090" "g.89341329G>A" "" "" "" "ANKRD11(NM_001256182.2):c.7606C>T (p.R2536W), ANKRD11(NM_013275.6):c.7606C>T (p.R2536W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89274921G>A" "" "likely pathogenic" "" "0000559822" "0" "90" "16" "89341500" "89341500" "subst" "0" "01804" "ANKRD11_000175" "g.89341500C>A" "" "" "" "ANKRD11(NM_001256182.1):c.7569+1G>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89275092C>A" "" "pathogenic" "" "0000559823" "0" "70" "16" "89341506" "89341506" "subst" "0" "02325" "ANKRD11_000176" "g.89341506C>T" "" "" "" "ANKRD11(NM_001256182.2):c.7564G>A (p.E2522K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89275098C>T" "" "likely pathogenic" "" "0000559826" "0" "90" "16" "89345737" "89345737" "subst" "0" "02327" "ANKRD11_000179" "g.89345737G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279329G>A" "" "pathogenic" "" "0000559827" "0" "30" "16" "89345844" "89345844" "subst" "0" "02325" "ANKRD11_000180" "g.89345844G>A" "" "" "" "ANKRD11(NM_001256182.2):c.7106C>T (p.A2369V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279436G>A" "" "likely benign" "" "0000559828" "0" "50" "16" "89345863" "89345863" "subst" "6.73621E-5" "01943" "ANKRD11_000181" "g.89345863G>C" "" "" "" "ANKRD11(NM_001256182.1):c.7087C>G (p.P2363A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279455G>C" "" "VUS" "" "0000559830" "0" "10" "16" "89346124" "89346124" "subst" "0.000597721" "02326" "ANKRD11_000183" "g.89346124G>A" "" "" "" "ANKRD11(NM_001256182.2):c.6826C>T (p.P2276S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279716G>A" "" "benign" "" "0000559831" "0" "30" "16" "89346163" "89346163" "subst" "0.0331055" "01804" "ANKRD11_000097" "g.89346163G>A" "" "" "" "ANKRD11(NM_001256182.2):c.6787C>T (p.P2263S), ANKRD11(NM_013275.6):c.6787C>T (p.(Pro2263Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279755G>A" "" "likely benign" "" "0000559832" "0" "90" "16" "89346164" "89346164" "dup" "0" "01943" "ANKRD11_000096" "g.89346164dup" "" "" "" "ANKRD11(NM_001256182.1):c.6792dupC (p.A2265Rfs*8), ANKRD11(NM_013275.5):c.6792dupC (p.(Ala2265fs)), ANKRD11(NM_013275.6):c.6792dupC (p.A2265Rfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279756dup" "" "pathogenic" "" "0000559833" "0" "30" "16" "89346204" "89346204" "subst" "0.000552392" "01943" "ANKRD11_000185" "g.89346204C>T" "" "" "" "ANKRD11(NM_001256182.1):c.6746G>A (p.R2249H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279796C>T" "" "likely benign" "" "0000559834" "0" "30" "16" "89346205" "89346205" "subst" "0.000248251" "01804" "ANKRD11_000186" "g.89346205G>A" "" "" "" "ANKRD11(NM_001256182.1):c.6745C>T (p.(Arg2249Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279797G>A" "" "likely benign" "" "0000559836" "0" "30" "16" "89346225" "89346225" "subst" "0.000366909" "01943" "ANKRD11_000188" "g.89346225G>A" "" "" "" "ANKRD11(NM_001256182.1):c.6725C>T (p.A2242V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279817G>A" "" "likely benign" "" "0000559837" "0" "30" "16" "89346453" "89346453" "subst" "0.00187886" "01804" "ANKRD11_000189" "g.89346453A>C" "" "" "" "ANKRD11(NM_001256182.1):c.6497T>G (p.(Met2166Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280045A>C" "" "likely benign" "" "0000559839" "0" "90" "16" "89346551" "89346551" "del" "0" "02329" "ANKRD11_000191" "g.89346551del" "" "" "" "ANKRD11(NM_001256182.2):c.6402delG (p.F2136Sfs*39), ANKRD11(NM_013275.6):c.6402delG (p.F2136Sfs*39)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280143del" "" "pathogenic" "" "0000559840" "0" "30" "16" "89346596" "89346596" "subst" "4.42607E-6" "01943" "ANKRD11_000192" "g.89346596C>T" "" "" "" "ANKRD11(NM_001256182.1):c.6354G>A (p.V2118=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280188C>T" "" "likely benign" "" "0000559844" "0" "70" "16" "89346822" "89346822" "del" "0" "01943" "ANKRD11_000195" "g.89346822del" "" "" "" "ANKRD11(NM_001256182.1):c.6129delC (p.V2044Sfs*43)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280414del" "" "likely pathogenic" "" "0000559845" "0" "30" "16" "89346838" "89346838" "subst" "0.000629323" "01804" "ANKRD11_000196" "g.89346838T>C" "" "" "" "ANKRD11(NM_001256182.2):c.6112A>G (p.K2038E), ANKRD11(NM_013275.5):c.6112A>G (p.(Lys2038Glu)), ANKRD11(NM_013275.6):c.6112A>G (p.K2038E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280430T>C" "" "likely benign" "" "0000559846" "0" "30" "16" "89346838" "89346838" "subst" "0.000629323" "02326" "ANKRD11_000196" "g.89346838T>C" "" "" "" "ANKRD11(NM_001256182.2):c.6112A>G (p.K2038E), ANKRD11(NM_013275.5):c.6112A>G (p.(Lys2038Glu)), ANKRD11(NM_013275.6):c.6112A>G (p.K2038E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280430T>C" "" "likely benign" "" "0000559847" "0" "30" "16" "89346883" "89346883" "subst" "0.0458597" "01804" "ANKRD11_000105" "g.89346883C>G" "" "" "" "ANKRD11(NM_013275.6):c.6067G>C (p.(Ala2023Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280475C>G" "" "likely benign" "" "0000559848" "0" "30" "16" "89346885" "89346885" "subst" "0.00084031" "01804" "ANKRD11_000197" "g.89346885G>A" "" "" "" "ANKRD11(NM_001256182.1):c.6065C>T (p.P2022L, p.(Pro2022Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280477G>A" "" "likely benign" "" "0000559850" "0" "50" "16" "89347177" "89347177" "subst" "0.000121145" "01804" "ANKRD11_000199" "g.89347177G>T" "" "" "" "ANKRD11(NM_001256182.1):c.5773C>A (p.(Pro1925Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280769G>T" "" "VUS" "" "0000559851" "0" "30" "16" "89347204" "89347204" "subst" "8.28082E-6" "01804" "ANKRD11_000200" "g.89347204C>T" "" "" "" "ANKRD11(NM_001256182.1):c.5746G>A (p.(Asp1916Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280796C>T" "" "likely benign" "" "0000559852" "0" "30" "16" "89347318" "89347318" "subst" "0.000532814" "01804" "ANKRD11_000201" "g.89347318A>G" "" "" "" "ANKRD11(NM_001256182.1):c.5632T>C (p.S1878P, p.(Ser1878Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280910A>G" "" "likely benign" "" "0000559853" "0" "30" "16" "89347363" "89347363" "subst" "1.38086E-5" "01804" "ANKRD11_000202" "g.89347363C>T" "" "" "" "ANKRD11(NM_001256182.1):c.5587G>A (p.(Asp1863Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280955C>T" "" "likely benign" "" "0000559854" "0" "50" "16" "89347372" "89347372" "subst" "0.000575529" "01943" "ANKRD11_000203" "g.89347372G>A" "" "" "" "ANKRD11(NM_001256182.1):c.5578C>T (p.P1860S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280964G>A" "" "VUS" "" "0000559855" "0" "30" "16" "89347441" "89347441" "subst" "0.00420363" "01804" "ANKRD11_000046" "g.89347441G>A" "" "" "" "ANKRD11(NM_001256182.1):c.5509C>T (p.P1837S, p.(Pro1837Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281033G>A" "" "likely benign" "" "0000559857" "0" "30" "16" "89347676" "89347676" "subst" "1.62591E-5" "01943" "ANKRD11_000205" "g.89347676G>A" "" "" "" "ANKRD11(NM_001256182.1):c.5274C>T (p.P1758=), ANKRD11(NM_001256182.2):c.5274C>T (p.P1758=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281268G>A" "" "likely benign" "" "0000559858" "0" "30" "16" "89347676" "89347676" "subst" "1.62591E-5" "02326" "ANKRD11_000205" "g.89347676G>A" "" "" "" "ANKRD11(NM_001256182.1):c.5274C>T (p.P1758=), ANKRD11(NM_001256182.2):c.5274C>T (p.P1758=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281268G>A" "" "likely benign" "" "0000559859" "0" "70" "16" "89347711" "89347711" "del" "0" "01804" "ANKRD11_000206" "g.89347711del" "" "" "" "ANKRD11(NM_013275.5):c.5241del (p.(Val1748CysfsTer215))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281303del" "" "likely pathogenic" "" "0000559864" "0" "30" "16" "89348715" "89348715" "subst" "0.000255844" "01804" "ANKRD11_000211" "g.89348715A>G" "" "" "" "ANKRD11(NM_001256182.1):c.4235T>C (p.(Ile1412Thr)), ANKRD11(NM_001256182.2):c.4235T>C (p.I1412T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282307A>G" "" "likely benign" "" "0000559865" "0" "30" "16" "89348715" "89348715" "subst" "0.000255844" "02326" "ANKRD11_000211" "g.89348715A>G" "" "" "" "ANKRD11(NM_001256182.1):c.4235T>C (p.(Ile1412Thr)), ANKRD11(NM_001256182.2):c.4235T>C (p.I1412T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282307A>G" "" "likely benign" "" "0000559866" "0" "50" "16" "89348944" "89348944" "subst" "0" "01943" "ANKRD11_000212" "g.89348944C>T" "" "" "" "ANKRD11(NM_001256182.1):c.4006G>A (p.E1336K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282536C>T" "" "VUS" "" "0000559867" "0" "30" "16" "89348949" "89348949" "subst" "2.0313E-5" "01943" "ANKRD11_000213" "g.89348949G>A" "" "" "" "ANKRD11(NM_001256182.1):c.4001C>T (p.P1334L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282541G>A" "" "likely benign" "" "0000559868" "0" "30" "16" "89348973" "89348973" "subst" "0.000605396" "01804" "ANKRD11_000214" "g.89348973G>A" "" "" "" "ANKRD11(NM_001256182.1):c.3977C>T (p.(Thr1326Met)), ANKRD11(NM_013275.6):c.3977C>T (p.T1326M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282565G>A" "" "likely benign" "" "0000559870" "0" "90" "16" "89349061" "89349061" "del" "0" "02327" "ANKRD11_000216" "g.89349061del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282653del" "" "pathogenic" "" "0000559871" "0" "90" "16" "89349180" "89349181" "del" "0" "01943" "ANKRD11_000217" "g.89349180_89349181del" "" "" "" "ANKRD11(NM_001256182.1):c.3770_3771delAA (p.K1257Rfs*25)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282772_89282773del" "" "pathogenic" "" "0000559873" "0" "50" "16" "89349227" "89349227" "subst" "0" "01943" "ANKRD11_000219" "g.89349227C>A" "" "" "" "ANKRD11(NM_001256182.1):c.3723G>T (p.K1241N), ANKRD11(NM_013275.5):c.3723G>T (p.(Lys1241Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282819C>A" "" "VUS" "" "0000559875" "0" "30" "16" "89349293" "89349293" "subst" "0" "01943" "ANKRD11_000221" "g.89349293G>T" "" "" "" "ANKRD11(NM_001256182.1):c.3657C>A (p.D1219E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282885G>T" "" "likely benign" "" "0000559876" "0" "90" "16" "89349388" "89349388" "subst" "0" "02327" "ANKRD11_000222" "g.89349388G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282980G>A" "" "pathogenic" "" "0000559877" "0" "50" "16" "89349466" "89349466" "subst" "3.65741E-5" "02329" "ANKRD11_000223" "g.89349466C>T" "" "" "" "ANKRD11(NM_001256182.1):c.3484G>A (p.D1162N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89283058C>T" "" "VUS" "" "0000559878" "0" "30" "16" "89349513" "89349513" "subst" "0.000227624" "01804" "ANKRD11_000224" "g.89349513G>A" "" "" "" "ANKRD11(NM_001256182.1):c.3437C>T (p.(Thr1146Met)), ANKRD11(NM_001256182.2):c.3437C>T (p.T1146M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89283105G>A" "" "likely benign" "" "0000559879" "0" "50" "16" "89349673" "89349673" "subst" "0" "02327" "ANKRD11_000225" "g.89349673C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89283265C>T" "" "VUS" "" "0000559880" "0" "30" "16" "89349676" "89349676" "subst" "6.90439E-5" "02326" "ANKRD11_000131" "g.89349676G>A" "" "" "" "ANKRD11(NM_001256182.2):c.3274C>T (p.P1092S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89283268G>A" "" "likely benign" "" "0000559881" "0" "30" "16" "89349905" "89349905" "subst" "0.000414594" "01943" "ANKRD11_000226" "g.89349905G>C" "" "" "" "ANKRD11(NM_001256182.1):c.3045C>G (p.P1015=), ANKRD11(NM_001256182.2):c.3045C>G (p.P1015=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89283497G>C" "" "likely benign" "" "0000559882" "0" "30" "16" "89349905" "89349905" "subst" "0.000414594" "02325" "ANKRD11_000226" "g.89349905G>C" "" "" "" "ANKRD11(NM_001256182.1):c.3045C>G (p.P1015=), ANKRD11(NM_001256182.2):c.3045C>G (p.P1015=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89283497G>C" "" "likely benign" "" "0000559886" "0" "30" "16" "89350411" "89350411" "subst" "0" "02327" "ANKRD11_000228" "g.89350411C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284003C>G" "" "likely benign" "" "0000559888" "0" "30" "16" "89350577" "89350577" "subst" "0.00020266" "02326" "ANKRD11_000230" "g.89350577C>T" "" "" "" "ANKRD11(NM_001256182.1):c.2373G>A (p.K791=), ANKRD11(NM_001256182.2):c.2373G>A (p.K791=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284169C>T" "" "likely benign" "" "0000559889" "0" "70" "16" "89350777" "89350780" "del" "0" "01804" "ANKRD11_000142" "g.89350777_89350780del" "" "" "" "ANKRD11(NM_001256182.1):c.2175_2178del (p.(Asn725LysfsTer23)), ANKRD11(NM_013275.6):c.2175_2178delCAAA (p.N725Kfs*23)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284369_89284372del" "" "likely pathogenic" "" "0000559890" "0" "30" "16" "89350802" "89350802" "subst" "0.000228458" "02326" "ANKRD11_000231" "g.89350802T>C" "" "" "" "ANKRD11(NM_001256182.2):c.2148A>G (p.K716=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284394T>C" "" "likely benign" "" "0000559891" "0" "90" "16" "89350859" "89350860" "del" "0" "02327" "ANKRD11_000232" "g.89350859_89350860del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284451_89284452del" "" "pathogenic" "" "0000559892" "0" "30" "16" "89350874" "89350874" "subst" "4.06375E-6" "01804" "ANKRD11_000233" "g.89350874G>A" "" "" "" "ANKRD11(NM_001256182.1):c.2076C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284466G>A" "" "likely benign" "" "0000559893" "0" "10" "16" "89350911" "89350911" "subst" "0.0113238" "01804" "ANKRD11_000145" "g.89350911G>C" "" "" "" "ANKRD11(NM_013275.6):c.2039C>G (p.(Thr680Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284503G>C" "" "benign" "" "0000559896" "0" "70" "16" "89351054" "89351055" "del" "0" "02327" "ANKRD11_000235" "g.89351054_89351055del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284646_89284647del" "" "likely pathogenic" "" "0000559897" "0" "10" "16" "89351106" "89351106" "subst" "0.00171667" "01943" "ANKRD11_000236" "g.89351106G>C" "" "" "" "ANKRD11(NM_001256182.1):c.1844C>G (p.A615G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284698G>C" "" "benign" "" "0000559898" "0" "50" "16" "89351286" "89351300" "del" "0" "02325" "ANKRD11_000237" "g.89351286_89351300del" "" "" "" "ANKRD11(NM_001256182.2):c.1652_1666delGGAAAACCATTTCTT (p.W551_S555del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284878_89284892del" "" "VUS" "" "0000559900" "0" "70" "16" "89351554" "89351554" "subst" "0" "01804" "ANKRD11_000239" "g.89351554C>A" "" "" "" "ANKRD11(NM_001256182.1):c.1396G>T (p.(Glu466Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89285146C>A" "" "likely pathogenic" "" "0000559902" "0" "90" "16" "89351594" "89351597" "del" "0" "02329" "ANKRD11_000241" "g.89351594_89351597del" "" "" "" "ANKRD11(NM_001256182.2):c.1356_1359delTAAA (p.N452Kfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89285186_89285189del" "" "pathogenic" "" "0000559903" "0" "50" "16" "89351728" "89351728" "subst" "0" "02329" "ANKRD11_000242" "g.89351728A>T" "" "" "" "ANKRD11(NM_001256182.1):c.1222T>A (p.S408T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89285320A>T" "" "VUS" "" "0000559904" "0" "30" "16" "89351851" "89351851" "subst" "0.000117757" "01943" "ANKRD11_000243" "g.89351851A>G" "" "" "" "ANKRD11(NM_001256182.1):c.1099T>C (p.L367=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89285443A>G" "" "likely benign" "" "0000559908" "0" "30" "16" "89357091" "89357091" "subst" "3.65886E-5" "02326" "ANKRD11_000246" "g.89357091G>A" "" "" "" "ANKRD11(NM_001256182.2):c.543C>T (p.A181=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89290683G>A" "" "likely benign" "" "0000559909" "0" "30" "16" "89357412" "89357412" "subst" "4.13182E-5" "02326" "ANKRD11_000247" "g.89357412C>T" "" "" "" "ANKRD11(NM_001256182.2):c.397+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89291004C>T" "" "likely benign" "" "0000559910" "0" "30" "16" "89357536" "89357536" "subst" "0.000361636" "02326" "ANKRD11_000248" "g.89357536G>C" "" "" "" "ANKRD11(NM_001256182.2):c.282C>G (p.A94=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89291128G>C" "" "likely benign" "" "0000559911" "0" "30" "16" "89371724" "89371724" "subst" "0.00015032" "01804" "ANKRD11_000249" "g.89371724G>A" "" "" "" "ANKRD11(NM_001256182.2):c.116C>T (p.T39I), ANKRD11(NM_013275.6):c.116C>T (p.(Thr39Ile), p.T39I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89305316G>A" "" "likely benign" "" "0000595666" "0" "90" "16" "89349897" "89349901" "del" "0" "01807" "ANKRD11_000253" "g.89349897_89349901del" "" "" "" "3055_3059delAGGAA (Arg1019Glyfs*14)" "" "Unknown" "" "" "0" "" "" "g.89283489_89283493del" "" "pathogenic" "" "0000602995" "0" "70" "16" "89357044" "89357048" "del" "0" "01807" "ANKRD11_000254" "g.89357044_89357048del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.89290636_89290640del" "" "likely pathogenic" "" "0000604463" "0" "90" "16" "89351632" "89351632" "subst" "0" "03512" "ANKRD11_000013" "g.89351632G>A" "" "{PMID:Minardi 2020:32725632}" "" "" "mosaicism in mother" "De novo" "" "" "0" "" "" "g.89285224G>A" "" "pathogenic" "" "0000604500" "0" "90" "16" "89341366" "89341366" "subst" "0" "00006" "ANKRD11_000259" "g.89341366C>G" "" "{PMID:Sirmaci 2011:21782149}" "" "" "" "Germline" "" "" "0" "" "" "g.89274958C>G" "" "pathogenic (dominant)" "" "0000604501" "11" "90" "16" "89341366" "89341366" "subst" "0" "00006" "ANKRD11_000259" "g.89341366C>G" "" "{PMID:Sirmaci 2011:21782149}" "" "" "" "Germline" "" "" "0" "" "" "g.89274958C>G" "" "pathogenic (dominant)" "" "0000604502" "11" "90" "16" "89341366" "89341366" "subst" "0" "00006" "ANKRD11_000259" "g.89341366C>G" "" "{PMID:Sirmaci 2011:21782149}" "" "" "" "Germline" "" "" "0" "" "" "g.89274958C>G" "" "pathogenic (dominant)" "" "0000604503" "0" "90" "16" "89350645" "89350645" "del" "0" "00006" "ANKRD11_000258" "g.89350645del" "" "{PMID:Sirmaci 2011:21782149}" "" "2305delT" "" "De novo" "" "" "0" "" "" "g.89284237del" "" "pathogenic (dominant)" "" "0000604504" "0" "90" "16" "89345761" "89345761" "subst" "0" "00006" "ANKRD11_000256" "g.89345761G>A" "" "{PMID:Sirmaci 2011:21782149}" "" "" "" "De novo" "" "" "0" "" "" "g.89279353G>A" "" "pathogenic (dominant)" "" "0000604505" "0" "90" "16" "89346998" "89346999" "del" "0" "00006" "ANKRD11_000257" "g.89346998_89346999del" "" "{PMID:Sirmaci 2011:21782149}" "" "5953_5954delCA" "" "De novo" "" "" "0" "" "" "g.89280590_89280591del" "" "pathogenic (dominant)" "" "0000604506" "0" "90" "16" "89346872" "89346885" "del" "0" "00006" "ANKRD11_000255" "g.89346872_89346885del" "" "{PMID:Sirmaci 2011:21782149}" "" "6071_6084delCGTACGCTCTGCCC" "" "De novo" "" "" "0" "" "" "g.89280464_89280477del" "" "pathogenic (dominant)" "" "0000616260" "0" "50" "16" "89341232" "89341232" "subst" "0" "02325" "ANKRD11_000260" "g.89341232A>G" "" "" "" "ANKRD11(NM_001256182.2):c.7703T>C (p.L2568P), ANKRD11(NM_013275.5):c.7703T>C (p.(Leu2568Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89274824A>G" "" "VUS" "" "0000616261" "0" "90" "16" "89341535" "89341535" "subst" "0" "02327" "ANKRD11_000262" "g.89341535C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89275127C>T" "" "pathogenic" "" "0000616262" "0" "70" "16" "89345613" "89345615" "del" "0" "02327" "ANKRD11_000263" "g.89345613_89345615del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279205_89279207del" "" "likely pathogenic" "" "0000616263" "0" "30" "16" "89346049" "89346049" "subst" "0" "02327" "ANKRD11_000266" "g.89346049C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279641C>G" "" "likely benign" "" "0000616265" "0" "30" "16" "89346353" "89346353" "subst" "0.00028128" "01943" "ANKRD11_000268" "g.89346353G>C" "" "" "" "ANKRD11(NM_001256182.1):c.6597C>G (p.L2199=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279945G>C" "" "likely benign" "" "0000616266" "0" "30" "16" "89347172" "89347172" "subst" "4.98716E-5" "01943" "ANKRD11_000270" "g.89347172C>T" "" "" "" "ANKRD11(NM_001256182.1):c.5778G>A (p.P1926=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280764C>T" "" "likely benign" "" "0000616267" "0" "90" "16" "89347820" "89347820" "dup" "0" "02327" "ANKRD11_000271" "g.89347820dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281412dup" "" "pathogenic" "" "0000616268" "0" "30" "16" "89348078" "89348078" "subst" "0.0046358" "01943" "ANKRD11_000114" "g.89348078C>T" "" "" "" "ANKRD11(NM_001256182.1):c.4872G>A (p.A1624=), ANKRD11(NM_013275.6):c.4872G>A (p.(Ala1624=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281670C>T" "" "likely benign" "" "0000616269" "0" "50" "16" "89348474" "89348497" "del" "0" "01943" "ANKRD11_000055" "g.89348474_89348497del" "" "" "" "ANKRD11(NM_001256182.1):c.4475_4498del (p.?), ANKRD11(NM_001256182.1):c.4475_4498delTCCTGCGGCATCACAGGGACGAGC (p.L1492_E1499del), ANKRD11(NM_013275...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282066_89282089del" "" "VUS" "" "0000616270" "0" "90" "16" "89348557" "89348558" "del" "0" "02327" "ANKRD11_000273" "g.89348557_89348558del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282149_89282150del" "" "pathogenic" "" "0000616271" "0" "90" "16" "89348566" "89348566" "dup" "0" "02327" "ANKRD11_000274" "g.89348566dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282158dup" "" "pathogenic" "" "0000616272" "0" "30" "16" "89349290" "89349290" "subst" "0.00110382" "01943" "ANKRD11_000220" "g.89349290C>T" "" "" "" "ANKRD11(NM_001256182.1):c.3660G>A (p.R1220=), ANKRD11(NM_013275.6):c.3660G>A (p.(Arg1220=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282882C>T" "" "likely benign" "" "0000616274" "0" "30" "16" "89350145" "89350145" "subst" "0" "01943" "ANKRD11_000278" "g.89350145C>A" "" "" "" "ANKRD11(NM_001256182.1):c.2805G>T (p.S935=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89283737C>A" "" "likely benign" "" "0000616275" "0" "30" "16" "89350146" "89350146" "subst" "1.21966E-5" "01943" "ANKRD11_000279" "g.89350146G>A" "" "" "" "ANKRD11(NM_001256182.1):c.2804C>T (p.S935L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89283738G>A" "" "likely benign" "" "0000616276" "0" "30" "16" "89350431" "89350431" "subst" "0.000719097" "02325" "ANKRD11_000072" "g.89350431C>T" "" "" "" "ANKRD11(NM_001256182.1):c.2519G>A (p.R840Q), ANKRD11(NM_001256182.2):c.2519G>A (p.R840Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284023C>T" "" "likely benign" "" "0000616277" "0" "30" "16" "89350431" "89350431" "subst" "0.000719097" "02327" "ANKRD11_000072" "g.89350431C>T" "" "" "" "ANKRD11(NM_001256182.1):c.2519G>A (p.R840Q), ANKRD11(NM_001256182.2):c.2519G>A (p.R840Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284023C>T" "" "likely benign" "" "0000616278" "0" "70" "16" "89350585" "89350586" "del" "0" "01804" "ANKRD11_000280" "g.89350585_89350586del" "" "" "" "ANKRD11(NM_013275.5):c.2366_2367del (p.(Lys789ArgfsTer7))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284177_89284178del" "" "likely pathogenic" "" "0000616279" "0" "90" "16" "89350722" "89350729" "del" "0" "02327" "ANKRD11_000281" "g.89350722_89350729del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284314_89284321del" "" "pathogenic" "" "0000616280" "0" "90" "16" "89350753" "89350753" "subst" "0" "02325" "ANKRD11_000282" "g.89350753G>A" "" "" "" "ANKRD11(NM_001256182.2):c.2197C>T (p.R733*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284345G>A" "" "pathogenic" "" "0000616281" "0" "30" "16" "89351947" "89351947" "subst" "4.06095E-6" "01943" "ANKRD11_000283" "g.89351947C>T" "" "" "" "ANKRD11(NM_001256182.1):c.1003G>A (p.E335K), ANKRD11(NM_013275.5):c.1003G>A (p.(Glu335Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89285539C>T" "" "likely benign" "" "0000616282" "0" "30" "16" "89352026" "89352026" "subst" "8.93582E-5" "01943" "ANKRD11_000081" "g.89352026G>A" "" "" "" "ANKRD11(NM_001256182.1):c.924C>T (p.F308=), ANKRD11(NM_001256182.2):c.924C>T (p.F308=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89285618G>A" "" "likely benign" "" "0000616283" "0" "30" "16" "89357139" "89357139" "subst" "2.84666E-5" "01943" "ANKRD11_000284" "g.89357139G>A" "" "" "" "ANKRD11(NM_001256182.1):c.495C>T (p.N165=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89290731G>A" "" "likely benign" "" "0000616284" "0" "30" "16" "89357538" "89357538" "subst" "0.000414445" "01943" "ANKRD11_000285" "g.89357538C>G" "" "" "" "ANKRD11(NM_001256182.1):c.280G>C (p.A94P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89291130C>G" "" "likely benign" "" "0000623574" "0" "70" "16" "89341328" "89341328" "subst" "0" "02325" "ANKRD11_000261" "g.89341328C>T" "" "" "" "ANKRD11(NM_001256182.2):c.7607G>A (p.R2536Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89274920C>T" "" "likely pathogenic" "" "0000623575" "0" "50" "16" "89345617" "89345617" "subst" "0" "02325" "ANKRD11_000264" "g.89345617T>C" "" "" "" "ANKRD11(NM_001256182.2):c.7333A>G (p.R2445G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279209T>C" "" "VUS" "" "0000623576" "0" "30" "16" "89345972" "89345972" "subst" "0.000752716" "02326" "ANKRD11_000265" "g.89345972G>A" "" "" "" "ANKRD11(NM_001256182.2):c.6978C>T (p.A2326=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279564G>A" "" "likely benign" "" "0000623577" "0" "90" "16" "89346999" "89347000" "ins" "0" "02325" "ANKRD11_000269" "g.89346999_89347000insA" "" "" "" "ANKRD11(NM_001256182.2):c.5950_5951insT (p.P1984Lfs*48)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89280591_89280592insA" "" "pathogenic" "" "0000623579" "0" "50" "16" "89349066" "89349066" "subst" "0" "02325" "ANKRD11_000275" "g.89349066T>C" "" "" "" "ANKRD11(NM_001256182.2):c.3884A>G (p.D1295G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282658T>C" "" "VUS" "" "0000623580" "0" "30" "16" "89349366" "89349366" "subst" "0.00021148" "02326" "ANKRD11_000276" "g.89349366C>T" "" "" "" "ANKRD11(NM_001256182.2):c.3584G>A (p.R1195K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282958C>T" "" "likely benign" "" "0000624890" "0" "90" "16" "89351718" "89351718" "subst" "0" "01807" "ANKRD11_000287" "g.89351718G>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.89285310G>T" "" "pathogenic" "" "0000631948" "0" "90" "16" "89350289" "89350293" "del" "0" "01807" "ANKRD11_000288" "g.89350289_89350293del" "" "" "" "2662_2666delAGGAG" "" "Unknown" "" "" "0" "" "" "g.89283881_89283885del" "" "pathogenic" "" "0000647141" "0" "90" "16" "89349763" "89349763" "subst" "0" "01807" "ANKRD11_000289" "g.89349763T>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.89283355T>A" "" "pathogenic" "" "0000649448" "1" "10" "16" "89347285" "89347285" "subst" "0.00168719" "03575" "ANKRD11_000290" "g.89347285T>C" "6/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "6 heterozygous, no homozygous; {DB:CLININrs202034147}" "Germline" "" "rs202034147" "0" "" "" "g.89280877T>C" "" "benign" "" "0000649449" "1" "50" "16" "89350266" "89350266" "subst" "8.13531E-6" "03575" "ANKRD11_000291" "g.89350266C>T" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; {DB:CLININrs199800166}" "Germline" "" "rs199800166" "0" "" "" "g.89283858C>T" "" "VUS" "" "0000649450" "1" "50" "16" "89371704" "89371704" "subst" "0.000162521" "03575" "ANKRD11_000292" "g.89371704C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs144947610}" "Germline" "" "rs144947610" "0" "" "" "g.89305296C>T" "" "VUS" "" "0000653485" "0" "90" "16" "89351671" "89351672" "del" "0" "01807" "ANKRD11_000293" "g.89351671_89351672del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.89285263_89285264del" "" "pathogenic" "" "0000657990" "0" "50" "16" "89334934" "89334934" "subst" "0" "02327" "ANKRD11_000294" "g.89334934G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89268526G>C" "" "VUS" "" "0000657991" "0" "90" "16" "89346196" "89346197" "del" "0" "02327" "ANKRD11_000295" "g.89346196_89346197del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279788_89279789del" "" "pathogenic" "" "0000657992" "0" "50" "16" "89346246" "89346246" "subst" "7.17535E-6" "02327" "ANKRD11_000296" "g.89346246G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89279838G>A" "" "VUS" "" "0000657993" "0" "70" "16" "89347723" "89347723" "subst" "0" "02327" "ANKRD11_000297" "g.89347723G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281315G>A" "" "likely pathogenic" "" "0000657994" "0" "30" "16" "89348280" "89348280" "subst" "2.03239E-5" "01943" "ANKRD11_000298" "g.89348280G>A" "" "" "" "ANKRD11(NM_001256182.1):c.4670C>T (p.P1557L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89281872G>A" "" "likely benign" "" "0000657995" "0" "30" "16" "89349371" "89349371" "subst" "4.06636E-5" "01943" "ANKRD11_000299" "g.89349371C>T" "" "" "" "ANKRD11(NM_001256182.1):c.3579G>A (p.A1193=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89282963C>T" "" "likely benign" "" "0000657996" "0" "90" "16" "89350676" "89350677" "del" "0" "02327" "ANKRD11_000300" "g.89350676_89350677del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89284268_89284269del" "" "pathogenic" "" "0000657997" "0" "30" "16" "89351692" "89351692" "subst" "0.0001189" "02326" "ANKRD11_000301" "g.89351692C>T" "" "" "" "ANKRD11(NM_001256182.2):c.1258G>A (p.V420M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89285284C>T" "" "likely benign" "" "0000657998" "0" "90" "16" "89352472" "89352472" "subst" "0" "02327" "ANKRD11_000302" "g.89352472G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89286064G>T" "" "pathogenic" "" "0000657999" "0" "30" "16" "89355034" "89355034" "subst" "0.000223388" "02326" "ANKRD11_000303" "g.89355034C>T" "" "" "" "ANKRD11(NM_001256182.2):c.646G>A (p.V216I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89288626C>T" "" "likely benign" "" "0000658000" "0" "30" "16" "89357144" "89357144" "subst" "0" "01943" "ANKRD11_000304" "g.89357144T>G" "" "" "" "ANKRD11(NM_001256182.1):c.490A>C (p.R164=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89290736T>G" "" "likely benign" "" "0000658001" "0" "30" "16" "89371724" "89371724" "subst" "0.00015032" "02326" "ANKRD11_000249" "g.89371724G>A" "" "" "" "ANKRD11(NM_001256182.2):c.116C>T (p.T39I), ANKRD11(NM_013275.6):c.116C>T (p.(Thr39Ile), p.T39I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.89305316G>A" "" "likely benign" "" "0000660602" "21" "70" "16" "89348867" "89348867" "subst" "0" "00006" "ANKRD11_000305" "g.89348867G>T" "" "{PMID:Redin 2014:25167861}" "" "2196-15del14" "" "Germline" "" "" "0" "" "" "g.89282459G>T" "" "likely pathogenic" "" "0000663269" "0" "70" "16" "89349648" "89349648" "dup" "0" "01164" "ANKRD11_000130" "g.89349648dup" "" "" "" "" "ACMG grading: PVS1,PM2; 6 month old boy with suspected syndromological mental retardation" "Germline" "" "rs772267579" "0" "" "" "g.89283240dup" "" "likely pathogenic" "ACMG" "0000665321" "0" "70" "16" "89348568" "89348569" "del" "0" "01164" "ANKRD11_000306" "g.89348568_89348569del" "" "" "" "" "ACMG grading: PVS1,PM2" "Germline" "" "" "0" "" "" "g.89282160_89282161del" "" "likely pathogenic" "ACMG" "0000667197" "0" "90" "16" "89350619" "89350622" "del" "0" "01807" "ANKRD11_000307" "g.89350619_89350622del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.89284211_89284214del" "" "pathogenic" "" "0000667482" "0" "90" "16" "89335053" "89335053" "subst" "0" "00006" "ANKRD11_000308" "g.89335053G>A" "" "{PMID:Helbig 2016:26795593}" "" "" "" "De novo" "" "" "0" "" "" "g.89268645G>A" "" "pathogenic (dominant)" "ACMG" "0000667483" "0" "90" "16" "89350432" "89350432" "del" "0" "00006" "ANKRD11_000309" "g.89350432del" "" "{PMID:Helbig 2016:26795593}" "" "2518delC" "" "De novo" "" "" "0" "" "" "g.89284024del" "" "pathogenic (dominant)" "ACMG" "0000680732" "0" "70" "16" "89334902" "89334908" "dup" "0" "01804" "ANKRD11_000310" "g.89334902_89334908dup" "" "" "" "ANKRD11(NM_001256182.1):c.7977_7978insCTTTGTA (p.(Leu2661CysfsTer91))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000680733" "0" "30" "16" "89337320" "89337320" "subst" "0.000284801" "01943" "ANKRD11_000311" "g.89337320G>T" "" "" "" "ANKRD11(NM_001256182.1):c.7714-3C>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680734" "0" "70" "16" "89345973" "89345973" "dup" "0" "01804" "ANKRD11_000182" "g.89345973dup" "" "" "" "ANKRD11(NM_001256182.2):c.6982dupC (p.R2328Pfs*204), ANKRD11(NM_013275.5):c.6982dup (p.(Arg2328Profs*204))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000680735" "0" "30" "16" "89346041" "89346041" "subst" "0" "01943" "ANKRD11_000095" "g.89346041G>A" "" "" "" "ANKRD11(NM_001256182.1):c.6909C>T (p.A2303=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680736" "0" "30" "16" "89346728" "89346728" "subst" "0" "01943" "ANKRD11_000312" "g.89346728T>C" "" "" "" "ANKRD11(NM_001256182.1):c.6222A>G (p.E2074=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680737" "0" "30" "16" "89347217" "89347217" "subst" "1.23952E-5" "01943" "ANKRD11_000313" "g.89347217C>T" "" "" "" "ANKRD11(NM_001256182.1):c.5733G>A (p.L1911=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680738" "0" "90" "16" "89347299" "89347299" "subst" "0" "02327" "ANKRD11_000314" "g.89347299G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000680739" "0" "30" "16" "89348507" "89348507" "subst" "1.62674E-5" "02326" "ANKRD11_000315" "g.89348507C>T" "" "" "" "ANKRD11(NM_001256182.2):c.4443G>A (p.A1481=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680740" "0" "30" "16" "89348510" "89348510" "subst" "0.000219569" "01943" "ANKRD11_000316" "g.89348510A>G" "" "" "" "ANKRD11(NM_001256182.1):c.4440T>C (p.H1480=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680741" "0" "90" "16" "89348567" "89348568" "del" "0" "02325" "ANKRD11_000117" "g.89348567_89348568del" "" "" "" "ANKRD11(NM_001256182.2):c.4389_4390delGA (p.K1464Tfs*89)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000680742" "0" "30" "16" "89348633" "89348633" "subst" "0.000499594" "01943" "ANKRD11_000317" "g.89348633C>T" "" "" "" "ANKRD11(NM_001256182.1):c.4317G>A (p.K1439=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680743" "0" "30" "16" "89350577" "89350577" "subst" "0.00020266" "01943" "ANKRD11_000230" "g.89350577C>T" "" "" "" "ANKRD11(NM_001256182.1):c.2373G>A (p.K791=), ANKRD11(NM_001256182.2):c.2373G>A (p.K791=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680744" "0" "30" "16" "89350658" "89350658" "subst" "0.000761413" "01943" "ANKRD11_000318" "g.89350658C>T" "" "" "" "ANKRD11(NM_001256182.1):c.2292G>A (p.E764=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680745" "0" "30" "16" "89351456" "89351456" "subst" "4.89205E-5" "01943" "ANKRD11_000319" "g.89351456G>A" "" "" "" "ANKRD11(NM_001256182.1):c.1494C>T (p.S498=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000680746" "0" "90" "16" "89351581" "89351581" "subst" "0" "01943" "ANKRD11_000320" "g.89351581T>A" "" "" "" "ANKRD11(NM_001256182.1):c.1369A>T (p.K457*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000680747" "0" "50" "16" "89371644" "89371644" "subst" "0" "01943" "ANKRD11_000321" "g.89371644C>T" "" "" "" "ANKRD11(NM_001256182.1):c.196G>A (p.A66T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000682865" "0" "90" "16" "89351044" "89351048" "del" "0" "01164" "ANKRD11_000004" "g.89351044_89351048del" "" "Miyatake et al. 2017. J Hum Genet 62: 741; McRae et al. 2017. Nature 542: 433; Kosmicki et al. 2017. Nat Genet 49: 504" "" "" "ACMG grading: PVS1,PS4,PM2,PP4" "Germline" "" "rs886041125" "0" "" "" "g.89284636_89284640del" "" "pathogenic" "ACMG" "0000683669" "0" "90" "16" "0" "0" "" "0" "00006" "ANKRD11_000000" "g.?" "" "{PMID:Mahler 2019:31056085}" "" "4886G>C (Ser1629Stop)" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000692206" "0" "90" "16" "89345758" "89345758" "subst" "0" "02325" "ANKRD11_000322" "g.89345758G>A" "" "" "" "ANKRD11(NM_013275.6):c.7192C>T (p.Q2398*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000692207" "0" "30" "16" "89347448" "89347448" "subst" "0" "01943" "ANKRD11_000323" "g.89347448G>A" "" "" "" "ANKRD11(NM_001256182.1):c.5502C>T (p.P1834=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692208" "0" "90" "16" "89349633" "89349637" "del" "0" "01943" "ANKRD11_000324" "g.89349633_89349637del" "" "" "" "ANKRD11(NM_001256182.1):c.3315_3319delCAAGA (p.D1105Efs*16)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000692209" "0" "90" "16" "89349862" "89349862" "subst" "0" "01943" "ANKRD11_000325" "g.89349862C>A" "" "" "" "ANKRD11(NM_001256182.1):c.3088G>T (p.E1030*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000692210" "0" "50" "16" "89351056" "89351056" "subst" "0" "01943" "ANKRD11_000326" "g.89351056G>A" "" "" "" "ANKRD11(NM_001256182.1):c.1894C>T (p.H632Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692211" "0" "30" "16" "89351202" "89351202" "subst" "6.09761E-5" "01943" "ANKRD11_000327" "g.89351202C>G" "" "" "" "ANKRD11(NM_001256182.1):c.1748G>C (p.G583A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692212" "0" "50" "16" "89351594" "89351596" "del" "0" "01943" "ANKRD11_000328" "g.89351594_89351596del" "" "" "" "ANKRD11(NM_001256182.1):c.1356_1358delTAA (p.N452del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692213" "0" "50" "16" "89354944" "89354944" "subst" "0" "02325" "ANKRD11_000329" "g.89354944G>A" "" "" "" "ANKRD11(NM_013275.6):c.736C>T (p.H246Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692214" "0" "50" "16" "89371619" "89371619" "subst" "0" "02327" "ANKRD11_000330" "g.89371619T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726057" "0" "90" "16" "89337224" "89337224" "subst" "0" "02329" "ANKRD11_000088" "g.89337224C>A" "" "" "" "ANKRD11(NM_001256182.1):c.7806+1G>T, ANKRD11(NM_001256182.2):c.7806+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726058" "0" "50" "16" "89337295" "89337295" "subst" "0" "02329" "ANKRD11_000171" "g.89337295C>T" "" "" "" "ANKRD11(NM_001256182.1):c.7736G>A (p.R2579H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726059" "0" "90" "16" "89341261" "89341261" "del" "0" "02329" "ANKRD11_000027" "g.89341261del" "" "" "" "ANKRD11(NM_001256182.2):c.7674delG (p.L2559Wfs*43)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726060" "0" "90" "16" "89345825" "89345825" "del" "0" "02329" "ANKRD11_000028" "g.89345825del" "" "" "" "ANKRD11(NM_013275.6):c.7126delG (p.D2376Tfs*25)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726061" "0" "90" "16" "89345973" "89345973" "dup" "0" "02329" "ANKRD11_000182" "g.89345973dup" "" "" "" "ANKRD11(NM_001256182.2):c.6982dupC (p.R2328Pfs*204), ANKRD11(NM_013275.5):c.6982dup (p.(Arg2328Profs*204))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726062" "0" "90" "16" "89346126" "89346126" "dup" "0" "02329" "ANKRD11_000267" "g.89346126dup" "" "" "" "ANKRD11(NM_001256182.2):c.6827dupC (p.N2277Efs*19)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726063" "0" "90" "16" "89346217" "89346217" "dup" "0" "02329" "ANKRD11_000187" "g.89346217dup" "" "" "" "ANKRD11(NM_001256182.2):c.6737dupC (p.E2247Rfs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726064" "0" "30" "16" "89346496" "89346496" "subst" "4.20338E-6" "01943" "ANKRD11_000331" "g.89346496C>T" "" "" "" "ANKRD11(NM_001256182.1):c.6454G>A (p.E2152K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726065" "0" "30" "16" "89346825" "89346825" "subst" "0.000260262" "02326" "ANKRD11_000332" "g.89346825T>C" "" "" "" "ANKRD11(NM_001256182.2):c.6125A>G (p.D2042G), ANKRD11(NM_013275.5):c.6125A>G (p.(Asp2042Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726066" "0" "50" "16" "89346896" "89346904" "del" "0" "01943" "ANKRD11_000333" "g.89346896_89346904del" "" "" "" "ANKRD11(NM_001256182.1):c.6052_6060delCCTCCCGCC (p.P2018_A2020del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726067" "0" "90" "16" "89346918" "89346918" "subst" "0" "02329" "ANKRD11_000198" "g.89346918G>T" "" "" "" "ANKRD11(NM_001256182.2):c.6032C>A (p.S2011*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726068" "0" "30" "16" "89347289" "89347289" "subst" "0.00148372" "01943" "ANKRD11_000334" "g.89347289T>C" "" "" "" "ANKRD11(NM_001256182.1):c.5661A>G (p.Q1887=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726069" "0" "90" "16" "89347446" "89347446" "del" "0" "02329" "ANKRD11_000204" "g.89347446del" "" "" "" "ANKRD11(NM_001256182.2):c.5504delT (p.L1835Rfs*128)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726070" "0" "50" "16" "89347747" "89347747" "subst" "0" "02329" "ANKRD11_000207" "g.89347747G>A" "" "" "" "ANKRD11(NM_001256182.1):c.5203C>T (p.L1735F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726071" "0" "50" "16" "89348455" "89348455" "subst" "8.13597E-6" "02329" "ANKRD11_000272" "g.89348455C>T" "" "" "" "ANKRD11(NM_001256182.1):c.4495G>A (p.E1499K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726072" "0" "30" "16" "89348801" "89348801" "subst" "0.00246047" "01943" "ANKRD11_000335" "g.89348801G>A" "" "" "" "ANKRD11(NM_001256182.1):c.4149C>T (p.G1383=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726073" "0" "30" "16" "89349170" "89349170" "subst" "0.000150602" "01943" "ANKRD11_000336" "g.89349170C>T" "" "" "" "ANKRD11(NM_001256182.1):c.3780G>A (p.S1260=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726074" "0" "90" "16" "89349727" "89349730" "del" "0" "02329" "ANKRD11_000065" "g.89349727_89349730del" "" "" "" "ANKRD11(NM_001256182.2):c.3224_3227delAAAG (p.E1075Gfs*242)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726075" "0" "90" "16" "89351049" "89351052" "del" "0" "02329" "ANKRD11_000234" "g.89351049_89351052del" "" "" "" "ANKRD11(NM_001256182.2):c.1901_1904delCAAA (p.T634Nfs*18)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726076" "0" "90" "16" "89351219" "89351219" "dup" "0" "02325" "ANKRD11_000337" "g.89351219dup" "" "" "" "ANKRD11(NM_013275.6):c.1731dupT (p.D578*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726077" "0" "30" "16" "89351531" "89351531" "subst" "5.33793E-5" "01943" "ANKRD11_000338" "g.89351531G>A" "" "" "" "ANKRD11(NM_001256182.1):c.1419C>T (p.S473=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726078" "0" "90" "16" "89351578" "89351578" "subst" "0" "02329" "ANKRD11_000240" "g.89351578G>A" "" "" "" "ANKRD11(NM_001256182.2):c.1372C>T (p.R458*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726079" "0" "30" "16" "89351870" "89351870" "subst" "8.93321E-5" "01943" "ANKRD11_000339" "g.89351870C>T" "" "" "" "ANKRD11(NM_001256182.1):c.1080G>A (p.P360=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000726080" "0" "50" "16" "89352510" "89352510" "subst" "0" "02329" "ANKRD11_000340" "g.89352510G>C" "" "" "" "ANKRD11(NM_001256182.1):c.829C>G (p.P277A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000726081" "0" "90" "16" "89352571" "89352571" "subst" "0" "02329" "ANKRD11_000244" "g.89352571G>C" "" "" "" "ANKRD11(NM_001256182.2):c.768C>G (p.Y256*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000726082" "0" "70" "16" "89357123" "89357123" "subst" "4.07259E-6" "02327" "ANKRD11_000341" "g.89357123G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000791666" "21" "90" "16" "89350438" "89350438" "subst" "0" "04131" "ANKRD11_000167" "g.89350438G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "pathogenic" "" "0000798377" "0" "90" "16" "89349648" "89349648" "dup" "0" "01164" "ANKRD11_000063" "g.89349648dup" "" "" "" "" "ACMG: PVS1, PS4_SUP, PM2_SUP" "Germline/De novo (untested)" "?" "" "0" "" "" "g.89283240dup" "VCV000812782.8" "pathogenic (dominant)" "ACMG" "0000807712" "0" "50" "16" "89337281" "89337281" "subst" "8.13365E-6" "02325" "ANKRD11_000342" "g.89337281C>T" "" "" "" "ANKRD11(NM_013275.6):c.7750G>A (p.A2584T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807713" "0" "50" "16" "89345787" "89345787" "subst" "0" "02325" "ANKRD11_000343" "g.89345787C>T" "" "" "" "ANKRD11(NM_013275.6):c.7163G>A (p.R2388H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807714" "0" "30" "16" "89345814" "89345814" "subst" "1.54667E-5" "01943" "ANKRD11_000344" "g.89345814G>C" "" "" "" "ANKRD11(NM_001256182.1):c.7136C>G (p.A2379G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807715" "0" "30" "16" "89346885" "89346885" "subst" "0.00084031" "01943" "ANKRD11_000197" "g.89346885G>A" "" "" "" "ANKRD11(NM_001256182.1):c.6065C>T (p.P2022L, p.(Pro2022Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807716" "0" "90" "16" "89347586" "89347586" "subst" "0" "02327" "ANKRD11_000345" "g.89347586G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000807717" "0" "90" "16" "89347647" "89347647" "subst" "0" "02329" "ANKRD11_000346" "g.89347647G>T" "" "" "" "ANKRD11(NM_001256182.2):c.5303C>A (p.S1768*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000807718" "0" "30" "16" "89348474" "89348497" "del" "0" "02325" "ANKRD11_000055" "g.89348474_89348497del" "" "" "" "ANKRD11(NM_001256182.1):c.4475_4498del (p.?), ANKRD11(NM_001256182.1):c.4475_4498delTCCTGCGGCATCACAGGGACGAGC (p.L1492_E1499del), ANKRD11(NM_013275...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807719" "0" "90" "16" "89348484" "89348485" "del" "0" "02327" "ANKRD11_000347" "g.89348484_89348485del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000807720" "0" "90" "16" "89348578" "89348579" "del" "0" "02327" "ANKRD11_000348" "g.89348578_89348579del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000807721" "0" "30" "16" "89348819" "89348819" "subst" "1.2203E-5" "01943" "ANKRD11_000349" "g.89348819G>A" "" "" "" "ANKRD11(NM_001256182.1):c.4131C>T (p.G1377=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807722" "0" "50" "16" "89349254" "89349254" "subst" "0" "01943" "ANKRD11_000350" "g.89349254C>A" "" "" "" "ANKRD11(NM_001256182.1):c.3696G>T (p.K1232N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000807723" "0" "30" "16" "89350070" "89350070" "subst" "7.76087E-5" "01943" "ANKRD11_000070" "g.89350070C>G" "" "" "" "ANKRD11(NM_001256182.1):c.2880G>C (p.E960D), ANKRD11(NM_013275.6):c.2880G>C (p.E960D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000807724" "0" "30" "16" "89350310" "89350310" "subst" "1.62492E-5" "01943" "ANKRD11_000351" "g.89350310C>T" "" "" "" "ANKRD11(NM_001256182.1):c.2640G>A (p.T880=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000836772" "0" "70" "16" "89351049" "89351053" "del" "0" "02494" "ANKRD11_000004" "g.89351049_89351053del" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.89284641_89284645del" "" "likely pathogenic (dominant)" "" "0000837164" "0" "70" "16" "89346164" "89346164" "dup" "0" "02494" "ANKRD11_000096" "g.89346164dup" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.89279756dup" "" "likely pathogenic (dominant)" "" "0000838397" "0" "90" "16" "89348863" "89348863" "subst" "0" "01164" "ANKRD11_000058" "g.89348863G>A" "" "PMID: 33955014, 27605097, 29258554" "" "" "ACMG: PVS1, PS2, PS4_SUP, PM2_SUP" "Germline/De novo (untested)" "?" "" "" "" "" "" "" "pathogenic (dominant)" "ACMG" "0000841164" "0" "90" "16" "89351718" "89351718" "subst" "0" "00006" "ANKRD11_000287" "g.89351718G>T" "" "{PMID:Froukh 2020:32056211}" "" "" "" "De novo" "" "" "0" "" "" "g.89285310G>T" "" "pathogenic (dominant)" "" "0000842563" "0" "90" "16" "89346370" "89346370" "subst" "0" "03779" "ANKRD11_000352" "g.89346370G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs201589586" "0" "" "" "" "" "pathogenic" "" "0000854712" "0" "30" "16" "89346163" "89346163" "subst" "0.0331055" "02326" "ANKRD11_000097" "g.89346163G>A" "" "" "" "ANKRD11(NM_001256182.2):c.6787C>T (p.P2263S), ANKRD11(NM_013275.6):c.6787C>T (p.(Pro2263Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854713" "0" "90" "16" "89346212" "89346212" "dup" "0" "01943" "ANKRD11_000354" "g.89346212dup" "" "" "" "ANKRD11(NM_001256182.1):c.6738dupA (p.E2247Rfs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000854714" "0" "30" "16" "89347318" "89347318" "subst" "0.000532814" "01943" "ANKRD11_000201" "g.89347318A>G" "" "" "" "ANKRD11(NM_001256182.1):c.5632T>C (p.S1878P, p.(Ser1878Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854715" "0" "30" "16" "89348021" "89348021" "subst" "2.43776E-5" "01943" "ANKRD11_000361" "g.89348021C>G" "" "" "" "ANKRD11(NM_001256182.1):c.4929G>C (p.P1643=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854716" "0" "30" "16" "89348972" "89348972" "subst" "3.25034E-5" "01943" "ANKRD11_000363" "g.89348972C>T" "" "" "" "ANKRD11(NM_001256182.1):c.3978G>A (p.T1326=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854717" "0" "30" "16" "89351098" "89351098" "subst" "0.000615929" "01943" "ANKRD11_000367" "g.89351098C>T" "" "" "" "ANKRD11(NM_001256182.1):c.1852G>A (p.A618T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000854718" "0" "70" "16" "89352058" "89352058" "subst" "0" "02327" "ANKRD11_000368" "g.89352058C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000854719" "0" "90" "16" "89352518" "89352518" "dup" "0" "02327" "ANKRD11_000369" "g.89352518dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000854720" "0" "70" "16" "89357491" "89357491" "dup" "0" "02327" "ANKRD11_000370" "g.89357491dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000865008" "0" "30" "16" "89346190" "89346190" "subst" "2.38167E-5" "01943" "ANKRD11_000353" "g.89346190C>T" "" "" "" "ANKRD11(NM_001256182.1):c.6760G>A (p.G2254R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865009" "0" "90" "16" "89346551" "89346551" "del" "0" "02325" "ANKRD11_000191" "g.89346551del" "" "" "" "ANKRD11(NM_001256182.2):c.6402delG (p.F2136Sfs*39), ANKRD11(NM_013275.6):c.6402delG (p.F2136Sfs*39)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865010" "0" "30" "16" "89346627" "89346627" "subst" "0.000301528" "01943" "ANKRD11_000355" "g.89346627C>T" "" "" "" "ANKRD11(NM_001256182.1):c.6323G>A (p.G2108D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865011" "0" "30" "16" "89347064" "89347064" "subst" "8.32563E-6" "01943" "ANKRD11_000356" "g.89347064C>T" "" "" "" "ANKRD11(NM_001256182.1):c.5886G>A (p.L1962=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865012" "0" "30" "16" "89347184" "89347184" "subst" "7.48609E-5" "01943" "ANKRD11_000357" "g.89347184G>A" "" "" "" "ANKRD11(NM_001256182.1):c.5766C>T (p.A1922=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865013" "0" "30" "16" "89347271" "89347271" "subst" "4.10499E-6" "01943" "ANKRD11_000358" "g.89347271G>A" "" "" "" "ANKRD11(NM_001256182.1):c.5679C>T (p.S1893=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865014" "0" "50" "16" "89347541" "89347541" "subst" "1.22665E-5" "01943" "ANKRD11_000359" "g.89347541G>T" "" "" "" "ANKRD11(NM_001256182.1):c.5409C>A (p.F1803L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865015" "0" "30" "16" "89347986" "89347986" "subst" "4.06349E-6" "01943" "ANKRD11_000360" "g.89347986T>C" "" "" "" "ANKRD11(NM_001256182.1):c.4964A>G (p.K1655R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865016" "0" "30" "16" "89348331" "89348331" "subst" "0.000240048" "01943" "ANKRD11_000053" "g.89348331T>C" "" "" "" "ANKRD11(NM_001256182.1):c.4619A>G (p.K1540R, p.(Lys1540Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865017" "0" "50" "16" "89348575" "89348577" "del" "0" "02325" "ANKRD11_000210" "g.89348575_89348577del" "" "" "" "ANKRD11(NM_013275.6):c.4382_4384delAGA (p.K1461del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000865018" "0" "90" "16" "89348606" "89348606" "del" "0" "02327" "ANKRD11_000362" "g.89348606del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865019" "0" "30" "16" "89349527" "89349527" "subst" "0.000361886" "01804" "ANKRD11_000364" "g.89349527G>A" "" "" "" "ANKRD11(NM_001256182.1):c.3423C>T (p.(Ser1141=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000865020" "0" "90" "16" "89349571" "89349571" "dup" "0" "01943" "ANKRD11_000365" "g.89349571dup" "" "" "" "ANKRD11(NM_001256182.1):c.3379dupA (p.R1127Kfs*43)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865021" "0" "90" "16" "89350539" "89350543" "del" "0" "01804" "ANKRD11_000366" "g.89350539_89350543del" "" "" "" "ANKRD11(NM_013275.5):c.2408_2412del (p.(Lys803Argfs*5))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865022" "0" "90" "16" "89357502" "89357502" "subst" "0" "01943" "ANKRD11_000371" "g.89357502G>A" "" "" "" "ANKRD11(NM_001256182.1):c.316C>T (p.R106*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000865023" "0" "30" "16" "89357554" "89357554" "subst" "2.03171E-5" "01943" "ANKRD11_000372" "g.89357554C>T" "" "" "" "ANKRD11(NM_001256182.1):c.264G>A (p.E88=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000873321" "0" "70" "16" "89346164" "89346164" "dup" "0" "01164" "ANKRD11_000096" "g.89346164dup" "" "Goldenberg 27605097" "" "" "ACMG: PVS1, PS4_MOD, PM6, PM2_SUP" "Germline/De novo (untested)" "" "" "0" "" "" "g.89279756dup" "" "pathogenic (dominant)" "ACMG" "0000874693" "0" "70" "16" "89351578" "89351578" "subst" "0" "00000" "ANKRD11_000240" "g.89351578G>A" "frequency in 1500 in-house samples: 0" "{PMID:Alfares 2018:30202406}" "" "ANKRD11, NM_013275, c.1372C>T, p.Arg458*" "heterozygous" "Unknown" "?" "" "0" "" "" "g.89285170G>A" "" "likely pathogenic" "ACMG" "0000880112" "11" "70" "16" "89348700" "89348700" "subst" "0" "00006" "ANKRD11_000373" "g.89348700T>C" "" "{PMID:Schalk 2022:34930816}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000893233" "0" "50" "16" "89345767" "89345767" "subst" "0" "02325" "ANKRD11_000374" "g.89345767G>C" "" "" "" "ANKRD11(NM_013275.6):c.7183C>G (p.Q2395E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893234" "0" "50" "16" "89345799" "89345799" "subst" "0" "02325" "ANKRD11_000375" "g.89345799G>T" "" "" "" "ANKRD11(NM_013275.6):c.7151C>A (p.P2384Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893235" "0" "50" "16" "89346393" "89346398" "del" "0" "02329" "ANKRD11_000376" "g.89346393_89346398del" "" "" "" "ANKRD11(NM_001256182.1):c.6552_6557delTGAGGA (p.E2185_E2186del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893236" "0" "50" "16" "89346534" "89346534" "subst" "5.10217E-5" "02325" "ANKRD11_000377" "g.89346534G>A" "" "" "" "ANKRD11(NM_013275.6):c.6416C>T (p.P2139L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893237" "0" "90" "16" "89346591" "89346591" "subst" "0" "02329" "ANKRD11_000378" "g.89346591C>T" "" "" "" "ANKRD11(NM_001256182.2):c.6359G>A (p.W2120*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000893238" "0" "30" "16" "89346930" "89346930" "subst" "0.000284057" "02325" "ANKRD11_000379" "g.89346930G>A" "" "" "" "ANKRD11(NM_013275.6):c.6020C>T (p.P2007L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893239" "0" "50" "16" "89348466" "89348466" "subst" "0" "02329" "ANKRD11_000380" "g.89348466T>C" "" "" "" "ANKRD11(NM_001256182.1):c.4484A>G (p.H1495R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893240" "0" "30" "16" "89348606" "89348606" "subst" "0.0277717" "01804" "ANKRD11_000118" "g.89348606A>G" "" "" "" "ANKRD11(NM_001256182.1):c.4344T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893241" "0" "30" "16" "89350125" "89350125" "subst" "0" "02327" "ANKRD11_000381" "g.89350125C>T" "" "" "" "ANKRD11(NM_013275.5):c.2825G>A (p.(Arg942Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893242" "0" "30" "16" "89350225" "89350225" "subst" "4.07163E-6" "02327" "ANKRD11_000382" "g.89350225C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893243" "0" "30" "16" "89350233" "89350233" "subst" "8.14511E-6" "02327" "ANKRD11_000383" "g.89350233C>A" "" "" "" "ANKRD11(NM_013275.5):c.2717G>T (p.(Arg906Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893244" "0" "90" "16" "89350540" "89350543" "del" "0" "02329" "ANKRD11_000384" "g.89350540_89350543del" "" "" "" "ANKRD11(NM_001256182.2):c.2409_2412delAAAA (p.E805Rfs*57)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000893245" "0" "90" "16" "89350552" "89350555" "del" "0" "02325" "ANKRD11_000138" "g.89350552_89350555del" "" "" "" "ANKRD11(NM_013275.6):c.2398_2401delGAAA (p.E800Nfs*62)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000893246" "0" "30" "16" "89351930" "89351930" "subst" "0.0165412" "01804" "ANKRD11_000155" "g.89351930C>T" "" "" "" "ANKRD11(NM_001256182.1):c.1020G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000893247" "0" "50" "16" "89357523" "89357523" "subst" "0" "02329" "ANKRD11_000385" "g.89357523C>T" "" "" "" "ANKRD11(NM_001256182.1):c.295G>A (p.G99S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000893248" "0" "50" "16" "89383411" "89383411" "subst" "4.0791E-6" "02325" "ANKRD11_000386" "g.89383411C>T" "" "" "" "ANKRD11(NM_013275.6):c.17G>A (p.C6Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000899446" "0" "70" "16" "89341367" "89341367" "subst" "0" "03779" "ANKRD11_000023" "g.89341367T>C" "" "" "" "" "" "Unknown" "" "rs1165683688" "0" "" "" "" "" "likely pathogenic" "" "0000914715" "0" "10" "16" "89348038" "89348038" "subst" "0.0585585" "02326" "ANKRD11_000112" "g.89348038G>C" "" "" "" "ANKRD11(NM_001256182.2):c.4912C>G (p.P1638A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914716" "0" "50" "16" "89349385" "89349385" "subst" "4.06464E-6" "02325" "ANKRD11_000387" "g.89349385C>G" "" "" "" "ANKRD11(NM_013275.6):c.3565G>C (p.G1189R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914717" "0" "50" "16" "89349783" "89349783" "subst" "0" "02329" "ANKRD11_000388" "g.89349783A>C" "" "" "" "ANKRD11(NM_001256182.2):c.3167T>G (p.F1056C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914718" "0" "50" "16" "89351530" "89351530" "subst" "8.20897E-6" "02325" "ANKRD11_000389" "g.89351530C>T" "" "" "" "ANKRD11(NM_013275.6):c.1420G>A (p.D474N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000919373" "0" "90" "16" "89346164" "89346164" "dup" "0" "03779" "ANKRD11_000096" "g.89346164dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000919374" "0" "70" "16" "89345806" "89345806" "subst" "0" "01164" "ANKRD11_000390" "g.89345806G>A" "" "" "" "" "ACMG: PVS1, PS2_SUP, PM2_SUP" "Germline" "?" "" "" "" "" "" "VCV001333832.2" "likely pathogenic (dominant)" "ACMG" "0000926370" "0" "50" "16" "89337251" "89337251" "subst" "0" "02325" "ANKRD11_000391" "g.89337251C>T" "" "" "" "ANKRD11(NM_013275.6):c.7780G>A (p.V2594M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000926371" "0" "70" "16" "89345911" "89345911" "subst" "0" "02327" "ANKRD11_000392" "g.89345911G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000926372" "0" "90" "16" "89348348" "89348348" "del" "0" "02329" "ANKRD11_000393" "g.89348348del" "" "" "" "ANKRD11(NM_001256182.2):c.4602delC (p.F1534Lfs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000926373" "0" "30" "16" "89348420" "89348420" "subst" "2.0352E-5" "02325" "ANKRD11_000394" "g.89348420C>T" "" "" "" "ANKRD11(NM_013275.6):c.4530G>A (p.P1510=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926374" "0" "30" "16" "89350710" "89350710" "subst" "0.000536804" "02325" "ANKRD11_000075" "g.89350710G>A" "" "" "" "ANKRD11(NM_001256182.1):c.2240C>T (p.S747L), ANKRD11(NM_013275.5):c.2240C>T (p.(Ser747Leu)), ANKRD11(NM_013275.6):c.2240C>T (p.S747L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000926375" "0" "50" "16" "89354941" "89354941" "subst" "0" "02325" "ANKRD11_000395" "g.89354941A>T" "" "" "" "ANKRD11(NM_013275.6):c.739T>A (p.Y247N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000926376" "0" "90" "16" "89357032" "89357032" "subst" "0" "02327" "ANKRD11_000396" "g.89357032C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000926377" "0" "30" "16" "89371724" "89371724" "subst" "0.00015032" "02325" "ANKRD11_000249" "g.89371724G>A" "" "" "" "ANKRD11(NM_001256182.2):c.116C>T (p.T39I), ANKRD11(NM_013275.6):c.116C>T (p.(Thr39Ile), p.T39I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927440" "21" "90" "16" "89350670" "89350671" "del" "0" "04451" "ANKRD11_000397" "g.89350670_89350671del" "" "" "" "" "" "Germline" "no" "" "0" "" "" "g.89284262_89284263del" "" "pathogenic" "ACMG" "0000930673" "0" "90" "16" "89346164" "89346164" "dup" "0" "02325" "ANKRD11_000096" "g.89346164dup" "" "" "" "ANKRD11(NM_001256182.1):c.6792dupC (p.A2265Rfs*8), ANKRD11(NM_013275.5):c.6792dupC (p.(Ala2265fs)), ANKRD11(NM_013275.6):c.6792dupC (p.A2265Rfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000930674" "0" "90" "16" "89347190" "89347190" "del" "0" "02329" "ANKRD11_000398" "g.89347190del" "" "" "" "ANKRD11(NM_013275.6):c.5761delG (p.A1921Pfs*42)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000930675" "0" "30" "16" "89347212" "89347212" "subst" "0.000239487" "02325" "ANKRD11_000399" "g.89347212G>T" "" "" "" "ANKRD11(NM_013275.6):c.5738C>A (p.T1913N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930676" "0" "50" "16" "89347797" "89347797" "subst" "0" "02325" "ANKRD11_000400" "g.89347797A>C" "" "" "" "ANKRD11(NM_013275.6):c.5153T>G (p.V1718G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000930677" "0" "30" "16" "89348893" "89348893" "subst" "0" "02327" "ANKRD11_000401" "g.89348893A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930678" "0" "50" "16" "89357054" "89357054" "subst" "1.63203E-5" "02325" "ANKRD11_000402" "g.89357054C>T" "" "" "" "ANKRD11(NM_013275.6):c.580G>A (p.V194I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000936216" "0" "90" "16" "89350438" "89350438" "subst" "0" "00006" "ANKRD11_000167" "g.89350438G>A" "" "{PMID:Hamdan 2017:29100083}" "" "NM_013275:c.C2512T (R838X)" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000939799" "0" "70" "16" "89349866" "89349866" "subst" "0" "00006" "ANKRD11_000403" "g.89349866G>T" "" "{PMID:Nambot 2018:29095811}" "" "NM_001256183.1:c.3084C>A" "" "De novo" "" "" "0" "" "" "g.89283458G>T" "" "likely pathogenic (dominant)" "" "0000939856" "0" "70" "16" "89350623" "89350623" "subst" "0" "00006" "ANKRD11_000404" "g.89350623A>C" "" "{PMID:Nambot 2018:29095811}" "" "NM_001256183.1:c.2327T>G" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.89284215A>C" "" "likely pathogenic" "" "0000946908" "0" "70" "16" "89341328" "89341328" "subst" "0" "01164" "ANKRD11_000261" "g.89341328C>T" "" "PMID: 35970914" "" "" "ACMG: PS2_MOD, PM5, PS4_SUP, PM2_SUP; confirmed de novo" "De novo" "" "" "" "" "" "g.89274920C>T" "VCV001012410.20" "likely pathogenic (dominant)" "ACMG" "0000950770" "0" "30" "16" "89337320" "89337320" "subst" "0.000284801" "01804" "ANKRD11_000311" "g.89337320G>T" "" "" "" "ANKRD11(NM_001256182.1):c.7714-3C>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000950771" "0" "50" "16" "89345719" "89345719" "subst" "1.63606E-5" "02327" "ANKRD11_000405" "g.89345719T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950772" "0" "50" "16" "89345759" "89345759" "subst" "8.50839E-6" "02325" "ANKRD11_000406" "g.89345759C>A" "" "" "" "ANKRD11(NM_013275.6):c.7191G>T (p.Q2397H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950773" "0" "50" "16" "89346771" "89346771" "subst" "0" "02325" "ANKRD11_000407" "g.89346771G>C" "" "" "" "ANKRD11(NM_013275.6):c.6179C>G (p.S2060C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950774" "0" "50" "16" "89350418" "89350418" "subst" "8.12532E-6" "02325" "ANKRD11_000408" "g.89350418G>C" "" "" "" "ANKRD11(NM_013275.6):c.2532C>G (p.D844E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950775" "0" "70" "16" "89350816" "89350817" "ins" "0" "02327" "ANKRD11_000409" "g.89350816_89350817insTC" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000968603" "0" "50" "16" "89345725" "89345725" "subst" "0" "02327" "ANKRD11_000410" "g.89345725C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000968604" "0" "50" "16" "89345980" "89345980" "subst" "0" "02325" "ANKRD11_000411" "g.89345980G>A" "" "" "" "ANKRD11(NM_013275.6):c.6970C>T (p.P2324S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000968612" "0" "90" "16" "89348669" "89348672" "del" "0" "02329" "ANKRD11_000414" "g.89348669_89348672del" "" "" "" "ANKRD11(NM_013275.6):c.4283_4286delAAGA (p.K1428Ifs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000982202" "0" "50" "16" "89346589" "89346589" "subst" "0" "01804" "ANKRD11_000416" "g.89346589C>A" "" "" "" "ANKRD11(NM_013275.5):c.6361G>T (p.(Ala2121Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982203" "0" "70" "16" "89347047" "89347047" "del" "0" "01804" "ANKRD11_000417" "g.89347047del" "" "" "" "ANKRD11(NM_013275.6):c.5906del (p.(Asn1969Thrfs*3))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000982204" "0" "30" "16" "89347052" "89347052" "subst" "2.08219E-5" "01804" "ANKRD11_000418" "g.89347052G>A" "" "" "" "ANKRD11(NM_001256182.1):c.5898C>T (p.(Thr1966=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982205" "0" "30" "16" "89347933" "89347933" "subst" "4.06398E-6" "01804" "ANKRD11_000419" "g.89347933C>G" "" "" "" "ANKRD11(NM_013275.6):c.5017G>C (p.(Gly1673Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982206" "0" "10" "16" "89348018" "89348018" "subst" "0.0404044" "01804" "ANKRD11_000111" "g.89348018C>T" "" "" "" "ANKRD11(NM_013275.6):c.4932G>A (p.(Gly1644=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000982207" "0" "10" "16" "89349128" "89349128" "subst" "0.0403408" "01804" "ANKRD11_000121" "g.89349128G>A" "" "" "" "ANKRD11(NM_013275.6):c.3822C>T (p.(Ala1274=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000982208" "0" "10" "16" "89349377" "89349377" "subst" "0.0404144" "01804" "ANKRD11_000127" "g.89349377G>C" "" "" "" "ANKRD11(NM_013275.6):c.3573C>G (p.(Ala1191=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000982209" "0" "50" "16" "89349837" "89349837" "subst" "4.0618E-6" "01804" "ANKRD11_000420" "g.89349837C>T" "" "" "" "ANKRD11(NM_013275.6):c.3113G>A (p.(Ser1038Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982210" "0" "90" "16" "89350333" "89350334" "del" "0" "01804" "ANKRD11_000421" "g.89350333_89350334del" "" "" "" "ANKRD11(NM_013275.6):c.2618_2619del (p.(Val873Glyfs*42))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000982211" "0" "30" "16" "89350710" "89350710" "subst" "0.000536804" "01804" "ANKRD11_000075" "g.89350710G>A" "" "" "" "ANKRD11(NM_001256182.1):c.2240C>T (p.S747L), ANKRD11(NM_013275.5):c.2240C>T (p.(Ser747Leu)), ANKRD11(NM_013275.6):c.2240C>T (p.S747L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982212" "0" "90" "16" "89350777" "89350780" "del" "0" "02325" "ANKRD11_000142" "g.89350777_89350780del" "" "" "" "ANKRD11(NM_001256182.1):c.2175_2178del (p.(Asn725LysfsTer23)), ANKRD11(NM_013275.6):c.2175_2178delCAAA (p.N725Kfs*23)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000982213" "0" "50" "16" "89350856" "89350856" "subst" "0" "01804" "ANKRD11_000422" "g.89350856C>G" "" "" "" "ANKRD11(NM_013275.6):c.2094G>C (p.(Glu698Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982214" "0" "50" "16" "89350883" "89350883" "subst" "0" "01804" "ANKRD11_000423" "g.89350883G>C" "" "" "" "ANKRD11(NM_013275.6):c.2067C>G (p.(His689Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982215" "0" "30" "16" "89352438" "89352438" "subst" "0" "01804" "ANKRD11_000424" "g.89352438G>A" "" "" "" "ANKRD11(NM_013275.6):c.892+9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982216" "0" "30" "16" "89357134" "89357134" "subst" "2.03507E-5" "01804" "ANKRD11_000425" "g.89357134C>T" "" "" "" "ANKRD11(NM_013275.6):c.500G>A (p.(Arg167His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000982217" "0" "50" "16" "89371728" "89371728" "subst" "8.12526E-6" "02325" "ANKRD11_000426" "g.89371728T>G" "" "" "" "ANKRD11(NM_013275.6):c.112A>C (p.K38Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000982218" "0" "30" "16" "89404137" "89404137" "subst" "0" "01804" "ANKRD11_000427" "g.89404137T>C" "" "" "" "ANKRD11(NM_013275.6):c.-59-20651A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000988702" "0" "90" "16" "89345543" "89345543" "subst" "0" "03779" "ANKRD11_000428" "g.89345543G>T" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "pathogenic" "" "0001002752" "0" "50" "16" "89335044" "89335044" "subst" "0" "02327" "ANKRD11_000430" "g.89335044C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002753" "0" "50" "16" "89341232" "89341232" "subst" "0" "01804" "ANKRD11_000260" "g.89341232A>G" "" "" "" "ANKRD11(NM_001256182.2):c.7703T>C (p.L2568P), ANKRD11(NM_013275.5):c.7703T>C (p.(Leu2568Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002754" "0" "90" "16" "89341500" "89341500" "subst" "0" "01804" "ANKRD11_000431" "g.89341500C>T" "" "" "" "ANKRD11(NM_013275.5):c.7569+1G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001002755" "0" "50" "16" "89345769" "89345769" "subst" "0" "01804" "ANKRD11_000432" "g.89345769T>C" "" "" "" "ANKRD11(NM_013275.5):c.7181A>G (p.(Gln2394Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002756" "0" "30" "16" "89345845" "89345845" "subst" "0" "01804" "ANKRD11_000433" "g.89345845C>A" "" "" "" "ANKRD11(NM_013275.5):c.7105G>T (p.(Ala2369Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002757" "0" "30" "16" "89345887" "89345887" "subst" "1.16328E-5" "01804" "ANKRD11_000434" "g.89345887A>T" "" "" "" "ANKRD11(NM_013275.5):c.7063T>A (p.(Ser2355Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002758" "0" "70" "16" "89346037" "89346037" "del" "0" "01804" "ANKRD11_000435" "g.89346037del" "" "" "" "ANKRD11(NM_013275.5):c.6914delG (p.(Gly2305fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001002759" "0" "30" "16" "89346133" "89346133" "subst" "0" "01804" "ANKRD11_000436" "g.89346133C>T" "" "" "" "ANKRD11(NM_013275.5):c.6817G>A (p.(Gly2273Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002760" "0" "30" "16" "89346159" "89346159" "subst" "0.000107321" "01804" "ANKRD11_000437" "g.89346159G>A" "" "" "" "ANKRD11(NM_013275.5):c.6791C>T (p.(Pro2264Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002761" "0" "90" "16" "89346164" "89346164" "dup" "0" "01804" "ANKRD11_000096" "g.89346164dup" "" "" "" "ANKRD11(NM_001256182.1):c.6792dupC (p.A2265Rfs*8), ANKRD11(NM_013275.5):c.6792dupC (p.(Ala2265fs)), ANKRD11(NM_013275.6):c.6792dupC (p.A2265Rfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001002762" "0" "30" "16" "89346387" "89346387" "subst" "8.5131E-6" "01804" "ANKRD11_000438" "g.89346387G>A" "" "" "" "ANKRD11(NM_013275.5):c.6563C>T (p.(Pro2188Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002763" "0" "30" "16" "89346600" "89346600" "subst" "3.98643E-5" "02325" "ANKRD11_000439" "g.89346600G>A" "" "" "" "ANKRD11(NM_013275.6):c.6350C>T (p.P2117L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002764" "0" "30" "16" "89346684" "89346684" "subst" "0" "01804" "ANKRD11_000440" "g.89346684A>C" "" "" "" "ANKRD11(NM_013275.5):c.6266T>G (p.(Val2089Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002765" "0" "50" "16" "89346690" "89346690" "subst" "0" "01804" "ANKRD11_000441" "g.89346690G>A" "" "" "" "ANKRD11(NM_013275.5):c.6260C>T (p.(Ala2087Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002766" "0" "30" "16" "89346723" "89346723" "subst" "1.84249E-5" "01804" "ANKRD11_000442" "g.89346723G>A" "" "" "" "ANKRD11(NM_013275.5):c.6227C>T (p.(Pro2076Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002767" "0" "30" "16" "89346825" "89346825" "subst" "0.000260262" "01804" "ANKRD11_000332" "g.89346825T>C" "" "" "" "ANKRD11(NM_001256182.2):c.6125A>G (p.D2042G), ANKRD11(NM_013275.5):c.6125A>G (p.(Asp2042Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002768" "0" "50" "16" "89346837" "89346837" "subst" "0.000107207" "01804" "ANKRD11_000443" "g.89346837T>G" "" "" "" "ANKRD11(NM_013275.5):c.6113A>C (p.(Lys2038Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002769" "0" "30" "16" "89346976" "89346976" "subst" "0" "01804" "ANKRD11_000444" "g.89346976T>G" "" "" "" "ANKRD11(NM_013275.5):c.5974A>C (p.(Lys1992Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002770" "0" "50" "16" "89347326" "89347326" "subst" "0" "01804" "ANKRD11_000445" "g.89347326A>G" "" "" "" "ANKRD11(NM_013275.5):c.5624T>C (p.(Val1875Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002771" "0" "30" "16" "89347444" "89347444" "subst" "3.35239E-5" "01804" "ANKRD11_000446" "g.89347444G>A" "" "" "" "ANKRD11(NM_013275.5):c.5506C>T (p.(Pro1836Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002772" "0" "50" "16" "89347536" "89347536" "subst" "0" "01804" "ANKRD11_000447" "g.89347536A>T" "" "" "" "ANKRD11(NM_013275.5):c.5414T>A (p.(Val1805Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002773" "0" "50" "16" "89347581" "89347581" "subst" "8.1664E-6" "01804" "ANKRD11_000448" "g.89347581G>A" "" "" "" "ANKRD11(NM_013275.5):c.5369C>T (p.(Ser1790Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002774" "0" "30" "16" "89347597" "89347597" "subst" "0" "01804" "ANKRD11_000449" "g.89347597T>C" "" "" "" "ANKRD11(NM_013275.5):c.5353A>G (p.(Thr1785Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002775" "0" "30" "16" "89347635" "89347635" "subst" "4.47577E-5" "01804" "ANKRD11_000450" "g.89347635G>A" "" "" "" "ANKRD11(NM_013275.5):c.5315C>T (p.(Ser1772Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002776" "0" "30" "16" "89347734" "89347734" "subst" "2.04055E-5" "01804" "ANKRD11_000451" "g.89347734C>T" "" "" "" "ANKRD11(NM_013275.5):c.5216G>A (p.(Cys1739Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002777" "0" "30" "16" "89348415" "89348415" "subst" "3.25672E-5" "01804" "ANKRD11_000452" "g.89348415C>T" "" "" "" "ANKRD11(NM_013275.5):c.4535G>A (p.(Arg1512His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002778" "0" "30" "16" "89348474" "89348497" "dup" "0" "01804" "ANKRD11_000165" "g.89348474_89348497dup" "" "" "" "ANKRD11(NM_013275.5):c.4475_4498dupTCCTGCGGCATCACAGGGACGAGC (p.(Leu1492_Glu1499dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002779" "0" "30" "16" "89348589" "89348589" "subst" "3.65589E-5" "01804" "ANKRD11_000453" "g.89348589T>C" "" "" "" "ANKRD11(NM_013275.5):c.4361A>G (p.(Asn1454Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002780" "0" "30" "16" "89348808" "89348808" "subst" "4.06626E-6" "01804" "ANKRD11_000454" "g.89348808T>G" "" "" "" "ANKRD11(NM_013275.5):c.4142A>C (p.(Lys1381Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002781" "0" "30" "16" "89348973" "89348973" "subst" "0.000605396" "02325" "ANKRD11_000214" "g.89348973G>A" "" "" "" "ANKRD11(NM_001256182.1):c.3977C>T (p.(Thr1326Met)), ANKRD11(NM_013275.6):c.3977C>T (p.T1326M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002782" "0" "30" "16" "89349138" "89349138" "subst" "2.8449E-5" "02327" "ANKRD11_000455" "g.89349138G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002783" "0" "30" "16" "89349227" "89349227" "subst" "0" "01804" "ANKRD11_000219" "g.89349227C>A" "" "" "" "ANKRD11(NM_001256182.1):c.3723G>T (p.K1241N), ANKRD11(NM_013275.5):c.3723G>T (p.(Lys1241Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002784" "0" "70" "16" "89349229" "89349229" "subst" "0" "01804" "ANKRD11_000456" "g.89349229T>A" "" "" "" "ANKRD11(NM_013275.5):c.3721A>T (p.(Lys1241*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001002785" "0" "50" "16" "89349362" "89349362" "subst" "0" "01804" "ANKRD11_000457" "g.89349362G>C" "" "" "" "ANKRD11(NM_013275.5):c.3588C>G (p.(Asp1196Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002786" "0" "30" "16" "89349904" "89349904" "subst" "2.43843E-5" "01804" "ANKRD11_000458" "g.89349904C>T" "" "" "" "ANKRD11(NM_013275.5):c.3046G>A (p.(Asp1016Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002787" "0" "30" "16" "89350125" "89350125" "subst" "0" "01804" "ANKRD11_000381" "g.89350125C>T" "" "" "" "ANKRD11(NM_013275.5):c.2825G>A (p.(Arg942Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002788" "0" "50" "16" "89350128" "89350128" "subst" "3.66044E-5" "01804" "ANKRD11_000459" "g.89350128C>T" "" "" "" "ANKRD11(NM_013275.5):c.2822G>A (p.(Arg941Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002789" "0" "50" "16" "89350176" "89350176" "subst" "0" "01804" "ANKRD11_000460" "g.89350176T>C" "" "" "" "ANKRD11(NM_013275.5):c.2774A>G (p.(Glu925Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002790" "0" "50" "16" "89350233" "89350233" "subst" "8.14511E-6" "01804" "ANKRD11_000383" "g.89350233C>A" "" "" "" "ANKRD11(NM_013275.5):c.2717G>T (p.(Arg906Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002791" "0" "30" "16" "89350484" "89350484" "subst" "1.6295E-5" "01804" "ANKRD11_000461" "g.89350484C>G" "" "" "" "ANKRD11(NM_013275.5):c.2466G>C (p.(Gln822His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002792" "0" "70" "16" "89350749" "89350749" "del" "0" "01804" "ANKRD11_000462" "g.89350749del" "" "" "" "ANKRD11(NM_013275.5):c.2202delA (p.(Glu735fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001002793" "0" "50" "16" "89350761" "89350761" "subst" "0" "01804" "ANKRD11_000463" "g.89350761C>T" "" "" "" "ANKRD11(NM_013275.5):c.2189G>A (p.(Arg730Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002794" "0" "50" "16" "89350863" "89350863" "subst" "2.03328E-5" "01804" "ANKRD11_000464" "g.89350863T>G" "" "" "" "ANKRD11(NM_013275.5):c.2087A>C (p.(Lys696Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002795" "0" "30" "16" "89350956" "89350956" "subst" "2.84264E-5" "01804" "ANKRD11_000465" "g.89350956T>C" "" "" "" "ANKRD11(NM_013275.5):c.1994A>G (p.(Lys665Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002796" "0" "50" "16" "89351199" "89351199" "subst" "4.0654E-6" "01804" "ANKRD11_000466" "g.89351199G>C" "" "" "" "ANKRD11(NM_013275.5):c.1751C>G (p.(Ser584Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002797" "0" "30" "16" "89351224" "89351224" "subst" "8.12387E-6" "01804" "ANKRD11_000467" "g.89351224C>T" "" "" "" "ANKRD11(NM_013275.5):c.1726G>A (p.(Glu576Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002798" "0" "30" "16" "89351400" "89351400" "subst" "4.06273E-5" "01804" "ANKRD11_000468" "g.89351400G>T" "" "" "" "ANKRD11(NM_013275.5):c.1550C>A (p.(Ser517Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002799" "0" "30" "16" "89351461" "89351461" "subst" "0" "01804" "ANKRD11_000469" "g.89351461C>T" "" "" "" "ANKRD11(NM_013275.5):c.1489G>A (p.(Gly497Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002800" "0" "70" "16" "89351462" "89351462" "dup" "0" "01804" "ANKRD11_000470" "g.89351462dup" "" "" "" "ANKRD11(NM_013275.5):c.1491dupG (p.(Ser498fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001002801" "0" "90" "16" "89351574" "89351577" "del" "0" "01804" "ANKRD11_000148" "g.89351574_89351577del" "" "" "" "ANKRD11(NM_013275.5):c.1381_1384delGAAA (p.(Glu461fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001002802" "0" "70" "16" "89351601" "89351601" "del" "0" "01804" "ANKRD11_000471" "g.89351601del" "" "" "" "ANKRD11(NM_013275.5):c.1355delA (p.(Asn452fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001002803" "0" "30" "16" "89351947" "89351947" "subst" "4.06095E-6" "01804" "ANKRD11_000283" "g.89351947C>T" "" "" "" "ANKRD11(NM_001256182.1):c.1003G>A (p.E335K), ANKRD11(NM_013275.5):c.1003G>A (p.(Glu335Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001002804" "0" "50" "16" "89351971" "89351971" "subst" "0" "01804" "ANKRD11_000472" "g.89351971G>C" "" "" "" "ANKRD11(NM_013275.5):c.979C>G (p.(Leu327Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002805" "0" "50" "16" "89371622" "89371622" "subst" "1.63059E-5" "01804" "ANKRD11_000473" "g.89371622G>A" "" "" "" "ANKRD11(NM_013275.5):c.218C>T (p.(Ser73Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001002806" "0" "30" "16" "89556775" "89556777" "del" "0" "02327" "ANKRD11_000474" "g.89556775_89556777del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001007038" "0" "70" "16" "89341499" "89341499" "subst" "0" "01164" "ANKRD11_000429" "g.89341499A>G" "" "" "" "" "ACMG: PVS1_STR, PS2_MOD, PM2_SUP; confirmed de novo" "De novo" "-" "" "" "" "" "g.89275091A>G" "" "likely pathogenic (dominant)" "ACMG" "0001015446" "0" "90" "16" "89347400" "89347400" "subst" "0" "02329" "ANKRD11_000475" "g.89347400G>C" "" "" "" "ANKRD11(NM_001256182.2):c.5550C>G (p.Y1850*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001015447" "0" "50" "16" "89347951" "89347951" "subst" "8.12823E-6" "02325" "ANKRD11_000208" "g.89347951T>G" "" "" "" "ANKRD11(NM_013275.6):c.4999A>C (p.K1667Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015448" "0" "30" "16" "89349513" "89349513" "subst" "0.000227624" "02326" "ANKRD11_000224" "g.89349513G>A" "" "" "" "ANKRD11(NM_001256182.1):c.3437C>T (p.(Thr1146Met)), ANKRD11(NM_001256182.2):c.3437C>T (p.T1146M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015449" "0" "50" "16" "89349812" "89349813" "inv" "0" "02327" "ANKRD11_000476" "g.89349812_89349813inv" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015450" "0" "90" "16" "89350699" "89350699" "subst" "0" "02329" "ANKRD11_000477" "g.89350699T>A" "" "" "" "ANKRD11(NM_001256182.2):c.2251A>T (p.K751*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001015451" "0" "90" "16" "89357502" "89357502" "subst" "0" "02327" "ANKRD11_000371" "g.89357502G>A" "" "" "" "ANKRD11(NM_001256182.1):c.316C>T (p.R106*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001017683" "0" "70" "16" "89348302" "89348302" "del" "0" "03544" "ANKRD11_000478" "g.89348302del" "" "" "" "" "" "De novo" "-" "" "0" "" "" "g.89281894del" "{CV:3381751}" "likely pathogenic" "ACMG" "0001017837" "11" "70" "16" "89349120" "89349120" "dup" "0" "03544" "ANKRD11_000479" "g.89349120dup" "" "" "" "" "variant is related to KBG syndrome for which intrafamilial phenotypic variability is reported (https://www.ncbi.nlm.nih.gov/sites/books/NBK487886/)" "Germline" "-" "" "0" "" "" "g.89282712dup" "{CV:2503465}" "likely pathogenic" "ACMG" "0001017940" "0" "90" "16" "89349645" "89349648" "del" "0" "03544" "ANKRD11_000480" "g.89349645_89349648del" "" "" "" "" "" "De novo" "yes" "rs772267579" "0" "" "" "g.89283237_89283240del" "{CV:817421}" "pathogenic" "ACMG" "0001018830" "0" "70" "16" "89346939" "89346939" "del" "0" "03544" "ANKRD11_000481" "g.89346939del" "" "" "" "" "" "De novo" "-" "" "0" "" "" "g.89280531del" "{CV:3387766}" "likely pathogenic" "ACMG" "0001020090" "0" "70" "16" "89350556" "89350556" "del" "0" "03544" "ANKRD11_000482" "g.89350556del" "" "" "" "" "" "De novo" "-" "" "0" "" "" "g.89284148del" "{CV:3393447}" "likely pathogenic" "ACMG" "0001026794" "0" "10" "16" "89346838" "89346838" "subst" "0.000629323" "02325" "ANKRD11_000196" "g.89346838T>C" "" "" "" "ANKRD11(NM_001256182.2):c.6112A>G (p.K2038E), ANKRD11(NM_013275.5):c.6112A>G (p.(Lys2038Glu)), ANKRD11(NM_013275.6):c.6112A>G (p.K2038E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001026795" "0" "90" "16" "89349866" "89349866" "subst" "0" "02327" "ANKRD11_000403" "g.89349866G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001026796" "0" "50" "16" "89349925" "89349925" "subst" "0" "02329" "ANKRD11_000483" "g.89349925T>C" "" "" "" "ANKRD11(NM_013275.6):c.3025A>G (p.K1009E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001026797" "0" "90" "16" "89351489" "89351492" "del" "0" "02329" "ANKRD11_000007" "g.89351489_89351492del" "" "" "" "ANKRD11(NM_013275.6):c.1460_1463delAGAG (p.E487Vfs*22)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001026798" "0" "30" "16" "89351960" "89351960" "subst" "0" "02327" "ANKRD11_000484" "g.89351960C>G" "" "" "" "ANKRD11(NM_013275.6):c.990G>C (p.(Lys330Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001030001" "0" "70" "16" "89341221" "89341221" "subst" "0" "03779" "ANKRD11_000173" "g.89341221C>T" "" "" "" "" "" "Unknown" "" "rs1279485702" "0" "" "" "" "" "likely pathogenic" "" "0001030087" "0" "70" "16" "89347161" "89347175" "del" "0" "04333" "ANKRD11_000485" "g.89347161_89347175del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.89280753_89280767del" "" "VUS" "" "0001041479" "0" "30" "16" "89340957" "89340957" "subst" "0" "01804" "ANKRD11_000486" "g.89340957T>A" "" "" "" "ANKRD11(NM_013275.6):c.7713+265A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041480" "0" "30" "16" "89341551" "89341551" "subst" "5.43574E-5" "02325" "ANKRD11_000487" "g.89341551G>T" "" "" "" "ANKRD11(NM_013275.6):c.7519C>A (p.Q2507K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041481" "0" "50" "16" "89346040" "89346040" "subst" "3.94027E-5" "01804" "ANKRD11_000488" "g.89346040C>T" "" "" "" "ANKRD11(NM_013275.6):c.6910G>A (p.(Glu2304Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041482" "0" "30" "16" "89347460" "89347462" "dup" "0" "01804" "ANKRD11_000489" "g.89347460_89347462dup" "" "" "" "ANKRD11(NM_013275.6):c.5490_5492dup (p.(Glu1830dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041483" "0" "30" "16" "89347537" "89347537" "subst" "0.000159451" "01804" "ANKRD11_000490" "g.89347537C>T" "" "" "" "ANKRD11(NM_013275.6):c.5413G>A (p.(Val1805Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041484" "0" "30" "16" "89347600" "89347600" "subst" "0" "01804" "ANKRD11_000491" "g.89347600A>G" "" "" "" "ANKRD11(NM_013275.6):c.5350T>C (p.(Ser1784Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041485" "0" "50" "16" "89347972" "89347972" "subst" "1.21933E-5" "01804" "ANKRD11_000492" "g.89347972T>C" "" "" "" "ANKRD11(NM_013275.6):c.4978A>G (p.(Ile1660Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041486" "0" "30" "16" "89348078" "89348078" "subst" "0.0046358" "01804" "ANKRD11_000114" "g.89348078C>T" "" "" "" "ANKRD11(NM_001256182.1):c.4872G>A (p.A1624=), ANKRD11(NM_013275.6):c.4872G>A (p.(Ala1624=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041487" "0" "50" "16" "89348244" "89348244" "subst" "0" "01804" "ANKRD11_000493" "g.89348244C>G" "" "" "" "ANKRD11(NM_013275.6):c.4706G>C (p.(Arg1569Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041488" "0" "30" "16" "89349134" "89349135" "ins" "0" "01804" "ANKRD11_000494" "g.89349134_89349135insAAAAAAAAAAA" "" "" "" "ANKRD11(NM_013275.6):c.-59-32067_-59-32057dup" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041489" "0" "10" "16" "89349290" "89349290" "subst" "0.00110382" "01804" "ANKRD11_000220" "g.89349290C>T" "" "" "" "ANKRD11(NM_001256182.1):c.3660G>A (p.R1220=), ANKRD11(NM_013275.6):c.3660G>A (p.(Arg1220=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001041490" "0" "70" "16" "89349306" "89349306" "del" "0" "01804" "ANKRD11_000495" "g.89349306del" "" "" "" "ANKRD11(NM_013275.6):c.3647del (p.(Lys1216Serfs*102))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001041491" "0" "50" "16" "89349906" "89349906" "subst" "3.25135E-5" "01804" "ANKRD11_000496" "g.89349906G>A" "" "" "" "ANKRD11(NM_013275.6):c.3044C>T (p.(Pro1015Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041492" "0" "90" "16" "89349931" "89349931" "subst" "0" "01804" "ANKRD11_000497" "g.89349931G>A" "" "" "" "ANKRD11(NM_013275.6):c.3019C>T (p.(Arg1007*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001041493" "0" "30" "16" "89350117" "89350117" "subst" "2.84947E-5" "01804" "ANKRD11_000498" "g.89350117C>T" "" "" "" "ANKRD11(NM_013275.6):c.2833G>A (p.(Ala945Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041494" "0" "50" "16" "89350429" "89350431" "del" "0" "01804" "ANKRD11_000499" "g.89350429_89350431del" "" "" "" "ANKRD11(NM_013275.6):c.2522_2524del (p.(Trp841del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001041495" "0" "30" "16" "89351960" "89351960" "subst" "0" "01804" "ANKRD11_000484" "g.89351960C>G" "" "" "" "ANKRD11(NM_013275.6):c.990G>C (p.(Lys330Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041496" "0" "30" "16" "89368371" "89368372" "ins" "0" "01804" "ANKRD11_000500" "g.89368371_89368372insTTTT" "" "" "" "ANKRD11(NM_013275.6):c.-60+49909_-60+49912dup" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041497" "0" "30" "16" "89368372" "89368373" "del" "0" "01804" "ANKRD11_000501" "g.89368372_89368373del" "" "" "" "ANKRD11(NM_013275.6):c.-60+49911_-60+49912del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041498" "0" "90" "16" "89371614" "89371614" "subst" "0" "01804" "ANKRD11_000502" "g.89371614C>T" "" "" "" "ANKRD11(NM_013275.6):c.226G>A (p.(Glu76Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001041499" "0" "30" "16" "89372939" "89372939" "subst" "0" "01804" "ANKRD11_000503" "g.89372939G>A" "" "" "" "ANKRD11(NM_013275.6):c.88-1187C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041500" "0" "30" "16" "89384863" "89384865" "del" "0" "01804" "ANKRD11_000504" "g.89384863_89384865del" "" "" "" "ANKRD11(NM_013275.6):c.-60+33419_-60+33421del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041501" "0" "30" "16" "89404095" "89404095" "subst" "0" "01804" "ANKRD11_000505" "g.89404095G>A" "" "" "" "ANKRD11(NM_013275.6):c.-59-20609C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041502" "0" "30" "16" "89409631" "89409631" "subst" "0" "01804" "ANKRD11_000506" "g.89409631T>C" "" "" "" "ANKRD11(NM_013275.6):c.-60+8653A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041503" "0" "30" "16" "89451714" "89451714" "subst" "0" "01804" "ANKRD11_000507" "g.89451714T>G" "" "" "" "ANKRD11(NM_013275.6):c.-60+32978A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041504" "0" "30" "16" "89529414" "89529414" "del" "0" "01804" "ANKRD11_000508" "g.89529414del" "" "" "" "ANKRD11(NM_013275.6):c.-145+27245del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001041505" "0" "30" "16" "89533910" "89533910" "subst" "0" "01804" "ANKRD11_000509" "g.89533910A>C" "" "" "" "ANKRD11(NM_013275.6):c.-145+22743T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001049044" "0" "90" "16" "89351565" "89351568" "del" "0" "00006" "ANKRD11_000510" "g.89351565_89351568del" "" "{PMID:Soden 2014:25473036}" "" "ref?:c.1385_1388delCAAA" "" "De novo" "" "" "0" "" "" "g.89285157_89285160del" "" "pathogenic (dominant)" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes ANKRD11 ## Count = 541 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000036677" "00002505" "55" "2006" "0" "2006" "0" "c.2006A>C" "r.(?)" "p.(Asp669Ala)" "9" "0000040450" "00002505" "70" "7481" "0" "7481" "0" "c.7481dup" "r.(?)" "p.(Pro2495Serfs*37)" "10" "0000040452" "00002505" "70" "4391" "0" "4392" "0" "c.4391_4392del" "r.(?)" "p.(Lys1464Thrfs*89)" "9" "0000040462" "00002505" "70" "1903" "0" "1907" "0" "c.1903_1907del" "r.(?)" "p.(Lys635Glnfs*26)" "9" "0000040463" "00002505" "70" "6184" "0" "6184" "0" "c.6184del" "r.(?)" "p.(Leu2062Trpfs*25)" "9" "0000040464" "00002505" "70" "3123" "0" "3126" "0" "c.3123_3126del" "r.(?)" "p.(Ile1042Trpfs*275)" "9" "0000040465" "00002505" "70" "1460" "0" "1463" "0" "c.1460_1463del" "r.(?)" "p.(Glu487Valfs*22)" "9" "0000040466" "00002505" "70" "1903" "0" "1907" "0" "c.1903_1907del" "r.(?)" "p.(Lys635Glnfs*26)" "9" "0000040467" "00002505" "70" "3382" "0" "3383" "0" "c.3382_3383del" "r.(?)" "p.(Asp1128Glnfs*41)" "9" "0000040468" "00002505" "70" "2751" "0" "2751" "0" "c.2751dup" "r.(?)" "p.(Glu918*)" "9" "0000040469" "00002505" "70" "3832" "0" "3832" "0" "c.3832A>T" "r.(?)" "p.(Lys1278*)" "9" "0000040470" "00002505" "70" "6513" "0" "6513" "0" "c.6513dup" "r.(?)" "p.(Gly2172Argfs*14)" "9" "0000040471" "00002505" "70" "1318" "0" "1318" "0" "c.1318C>T" "r.(?)" "p.(Arg440*)" "9" "0000048874" "00002505" "70" "5483" "0" "5483" "0" "c.5483C>A" "r.(?)" "p.(Ser1828*)" "9" "0000048875" "00002505" "70" "2298" "0" "2301" "0" "c.2298_2301del" "r.(?)" "p.(Lys767Asnfs*9)" "9" "0000079306" "00002505" "00" "2407" "0" "2413" "0" "c.2407_2413delinsG" "r.(?)" "p.(Lys803_Lys804del)" "" "0000079310" "00002505" "00" "4102" "0" "4105" "0" "c.4102_4105delinsG" "r.(?)" "p.(Lys1368del)" "" "0000079405" "00002505" "00" "2407" "0" "2413" "0" "c.2407_2413delinsG" "r.(?)" "p.(Lys803_Lys804del)" "" "0000079406" "00002505" "00" "1903" "0" "1907" "0" "c.1903_1907del" "r.(?)" "p.(Lys635Glnfs*26)" "" "0000079413" "00002505" "00" "1801" "0" "1801" "0" "c.1801C>T" "r.(?)" "p.(Arg601*)" "" "0000079462" "00002505" "00" "3579" "0" "3583" "0" "c.3579_3583delinsA" "r.(?)" "p.(Gly1194Glufs*123)" "" "0000079529" "00002505" "00" "3432" "0" "3457" "0" "c.3432_3457del" "r.(?)" "p.(Arg1145Glyfs*16)" "" "0000079638" "00002505" "00" "3708" "0" "3708" "0" "c.3708delinsAG" "r.(?)" "p.(Lys1237Glufs*7)" "" "0000129160" "00002505" "50" "-1" "0" "87" "1" "c.(?_-1)_(87+1_?)del" "r.0?" "p.0?" "" "0000130081" "00002505" "70" "7570" "-2" "7570" "-2" "c.7570-2A>G" "r.spl?" "p.?" "" "0000179015" "00002505" "90" "1903" "0" "1907" "0" "c.1903_1907del" "r.(?)" "p.(Lys635Glnfs*26)" "" "0000236480" "00002505" "90" "1146" "0" "1146" "0" "c.1146dup" "r.(?)" "p.(Ile383Tyrfs*7)" "" "0000245379" "00002505" "90" "1422" "0" "1422" "0" "c.1422dup" "r.(?)" "p.(Lys475Glnfs*18)" "" "0000249401" "00002505" "30" "3363" "0" "3363" "0" "c.3363T>C" "r.(?)" "p.(Asp1121=)" "" "0000259085" "00002505" "10" "2772" "0" "2772" "0" "c.2772C>T" "r.(?)" "p.(Thr924=)" "" "0000259086" "00002505" "10" "2912" "0" "2912" "0" "c.2912C>T" "r.(?)" "p.(Ala971Val)" "" "0000259087" "00002505" "10" "7022" "0" "7022" "0" "c.7022C>T" "r.(?)" "p.(Ala2341Val)" "" "0000259486" "00002505" "30" "7061" "0" "7061" "0" "c.7061C>A" "r.(?)" "p.(Pro2354His)" "" "0000259487" "00002505" "30" "924" "0" "924" "0" "c.924C>T" "r.(?)" "p.(Phe308=)" "" "0000259658" "00002505" "50" "244" "0" "244" "0" "c.244C>T" "r.(?)" "p.(Arg82Trp)" "" "0000259659" "00002505" "30" "2880" "0" "2880" "0" "c.2880G>C" "r.(?)" "p.(Glu960Asp)" "" "0000259660" "00002505" "50" "4056" "0" "4056" "0" "c.4056C>G" "r.(?)" "p.(His1352Gln)" "" "0000259750" "00002505" "90" "1903" "0" "1907" "0" "c.1903_1907del" "r.(?)" "p.(Lys635GlnfsTer26)" "" "0000259751" "00002505" "90" "5777" "0" "5777" "0" "c.5777dup" "r.(?)" "p.(Glu1927GlyfsTer23)" "" "0000260119" "00002505" "90" "1903" "0" "1907" "0" "c.1903_1907del" "r.(?)" "p.(Lys635GlnfsTer26)" "" "0000260120" "00002505" "90" "1977" "0" "1977" "0" "c.1977C>A" "r.(?)" "p.(Tyr659Ter)" "" "0000260121" "00002505" "90" "4087" "0" "4087" "0" "c.4087C>T" "r.(?)" "p.(Arg1363Ter)" "" "0000260122" "00002505" "90" "6847" "0" "6847" "0" "c.6847C>T" "r.(?)" "p.(Gln2283Ter)" "" "0000260984" "00002505" "90" "5752" "0" "5752" "0" "c.5752C>T" "r.(?)" "p.(Gln1918Ter)" "" "0000260985" "00002505" "90" "6847" "0" "6847" "0" "c.6847C>T" "r.(?)" "p.(Gln2283Ter)" "" "0000260986" "00002505" "30" "6919" "0" "6919" "0" "c.6919C>T" "r.(?)" "p.(Pro2307Ser)" "" "0000262491" "00002505" "30" "2240" "0" "2240" "0" "c.2240C>T" "r.(?)" "p.(Ser747Leu)" "" "0000262492" "00002505" "90" "2363" "0" "2363" "0" "c.2363C>A" "r.(?)" "p.(Ser788Ter)" "" "0000262493" "00002505" "50" "2519" "0" "2519" "0" "c.2519G>A" "r.(?)" "p.(Arg840Gln)" "" "0000262494" "00002505" "70" "2908" "0" "2908" "0" "c.2908del" "r.(?)" "p.(Glu970ArgfsTer7)" "" "0000262495" "00002505" "30" "3442" "0" "3442" "0" "c.3442G>A" "r.(?)" "p.(Gly1148Ser)" "" "0000262496" "00002505" "30" "4354" "0" "4354" "0" "c.4354G>A" "r.(?)" "p.(Ala1452Thr)" "" "0000262497" "00002505" "30" "5088" "0" "5088" "0" "c.5088C>G" "r.(?)" "p.(Asp1696Glu)" "" "0000262498" "00002505" "50" "5296" "0" "5296" "0" "c.5296G>A" "r.(?)" "p.(Val1766Met)" "" "0000262499" "00002505" "30" "5509" "0" "5509" "0" "c.5509C>T" "r.(?)" "p.(Pro1837Ser)" "" "0000262500" "00002505" "30" "6919" "0" "6919" "0" "c.6919C>T" "r.(?)" "p.(Pro2307Ser)" "" "0000262501" "00002505" "30" "7731" "0" "7731" "0" "c.7731A>C" "r.(?)" "p.(Ser2577=)" "" "0000325031" "00002505" "50" "6977" "0" "6977" "0" "c.6977C>A" "r.(?)" "p.(Ala2326Asp)" "" "0000325032" "00002505" "30" "6919" "0" "6919" "0" "c.6919C>T" "r.(?)" "p.(Pro2307Ser)" "" "0000325033" "00002505" "30" "6868" "0" "6868" "0" "c.6868C>T" "r.(?)" "p.(Pro2290Ser)" "" "0000325034" "00002505" "50" "6851" "0" "6851" "0" "c.6851C>T" "r.(?)" "p.(Ala2284Val)" "" "0000325035" "00002505" "50" "6680" "0" "6680" "0" "c.6680C>T" "r.(?)" "p.(Pro2227Leu)" "" "0000325036" "00002505" "50" "6571" "0" "6571" "0" "c.6571C>T" "r.(?)" "p.(Pro2191Ser)" "" "0000325037" "00002505" "30" "6152" "0" "6152" "0" "c.6152C>T" "r.(?)" "p.(Ser2051Leu)" "" "0000325038" "00002505" "30" "6085" "0" "6085" "0" "c.6085G>A" "r.(?)" "p.(Val2029Ile)" "" "0000325039" "00002505" "50" "5965" "0" "5965" "0" "c.5965G>A" "r.(?)" "p.(Glu1989Lys)" "" "0000325040" "00002505" "70" "5957" "0" "5958" "0" "c.5957_5958del" "r.(?)" "p.(Arg1986IlefsTer45)" "" "0000325041" "00002505" "50" "5409" "0" "5409" "0" "c.5409C>G" "r.(?)" "p.(Phe1803Leu)" "" "0000325042" "00002505" "30" "5338" "0" "5338" "0" "c.5338G>A" "r.(?)" "p.(Ala1780Thr)" "" "0000325043" "00002505" "50" "5150" "0" "5150" "0" "c.5150A>T" "r.(?)" "p.(Glu1717Val)" "" "0000325044" "00002505" "50" "4970" "0" "4970" "0" "c.4970C>T" "r.(?)" "p.(Ser1657Leu)" "" "0000325045" "00002505" "50" "4619" "0" "4619" "0" "c.4619A>G" "r.(?)" "p.(Lys1540Arg)" "" "0000325047" "00002505" "50" "4475" "0" "4498" "0" "c.4475_4498del" "r.(?)" "p.(Leu1492_Glu1499del)" "" "0000325048" "00002505" "50" "4464" "0" "4464" "0" "c.4464C>A" "r.(?)" "p.(His1488Gln)" "" "0000325049" "00002505" "30" "3407" "0" "3407" "0" "c.3407A>C" "r.(?)" "p.(Lys1136Thr)" "" "0000325050" "00002505" "70" "3309" "0" "3309" "0" "c.3309dup" "r.(?)" "p.(Asp1104ArgfsTer2)" "" "0000325051" "00002505" "50" "3259" "0" "3261" "0" "c.3259_3261del" "r.(?)" "p.(Lys1087del)" "" "0000325054" "00002505" "50" "2337" "0" "2339" "0" "c.2337_2339del" "r.(?)" "p.(Lys779del)" "" "0000325055" "00002505" "50" "1903" "0" "1907" "0" "c.1903_1907del" "r.(?)" "p.(Lys635GlnfsTer26)" "" "0000325056" "00002505" "50" "1415" "0" "1415" "0" "c.1415G>A" "r.(?)" "p.(Arg472Gln)" "" "0000325059" "00002505" "50" "890" "0" "890" "0" "c.890C>T" "r.(?)" "p.(Thr297Met)" "" "0000338853" "00002505" "90" "7806" "2" "7806" "2" "c.7806+2T>C" "r.spl?" "p.?" "" "0000338854" "00002505" "90" "7806" "1" "7806" "1" "c.7806+1G>T" "r.spl?" "p.?" "" "0000339199" "00002505" "10" "2772" "0" "2772" "0" "c.2772C>T" "r.(?)" "p.(Thr924=)" "" "0000340520" "00002505" "30" "6909" "0" "6909" "0" "c.6909C>T" "r.(?)" "p.(Ala2303=)" "" "0000340521" "00002505" "10" "6084" "0" "6084" "0" "c.6084C>T" "r.(?)" "p.(Pro2028=)" "" "0000340522" "00002505" "30" "5664" "0" "5664" "0" "c.5664A>G" "r.(?)" "p.(Ala1888=)" "" "0000340523" "00002505" "10" "4932" "0" "4932" "0" "c.4932G>A" "r.(?)" "p.(Gly1644=)" "" "0000340524" "00002505" "30" "4860" "0" "4860" "0" "c.4860C>G" "r.(?)" "p.(Leu1620=)" "" "0000340525" "00002505" "10" "4344" "0" "4344" "0" "c.4344T>C" "r.(?)" "p.(Tyr1448=)" "" "0000340526" "00002505" "10" "3822" "0" "3822" "0" "c.3822C>T" "r.(?)" "p.(Ala1274=)" "" "0000340527" "00002505" "10" "3573" "0" "3573" "0" "c.3573C>G" "r.(?)" "p.(Ala1191=)" "" "0000340528" "00002505" "10" "1020" "0" "1020" "0" "c.1020G>A" "r.(?)" "p.(Thr340=)" "" "0000340529" "00002505" "10" "372" "0" "372" "0" "c.372G>A" "r.(?)" "p.(Thr124=)" "" "0000341259" "00002505" "10" "6067" "0" "6067" "0" "c.6067G>C" "r.(?)" "p.(Ala2023Pro)" "" "0000341279" "00002505" "90" "6792" "0" "6792" "0" "c.6792dup" "r.(?)" "p.(Ala2265ArgfsTer8)" "" "0000341644" "00002505" "10" "2912" "0" "2912" "0" "c.2912C>T" "r.(?)" "p.(Ala971Val)" "" "0000342431" "00002505" "70" "7607" "0" "7607" "0" "c.7607G>C" "r.(?)" "p.(Arg2536Pro)" "" "0000342432" "00002505" "90" "7606" "0" "7606" "0" "c.7606C>T" "r.(?)" "p.(Arg2536Trp)" "" "0000342901" "00002505" "90" "1318" "0" "1318" "0" "c.1318C>T" "r.(?)" "p.(Arg440Ter)" "" "0000343821" "00002505" "90" "2175" "0" "2178" "0" "c.2175_2178del" "r.(?)" "p.(Asn725LysfsTer23)" "" "0000343952" "00002505" "30" "5088" "0" "5088" "0" "c.5088C>G" "r.(?)" "p.(Asp1696Glu)" "" "0000344009" "00002505" "30" "7128" "0" "7128" "0" "c.7128C>G" "r.(?)" "p.(Asp2376Glu)" "" "0000344090" "00002505" "10" "1245" "0" "1245" "0" "c.1245C>T" "r.(?)" "p.(Asp415=)" "" "0000344653" "00002505" "90" "6271" "0" "6271" "0" "c.6271C>T" "r.(?)" "p.(Gln2091Ter)" "" "0000344675" "00002505" "90" "6766" "0" "6766" "0" "c.6766C>T" "r.(?)" "p.(Gln2256Ter)" "" "0000344847" "00002505" "90" "1339" "0" "1339" "0" "c.1339C>T" "r.(?)" "p.(Gln447Ter)" "" "0000344892" "00002505" "70" "1621" "0" "1621" "0" "c.1621C>T" "r.(?)" "p.(Gln541Ter)" "" "0000345069" "00002505" "90" "3460" "0" "3460" "0" "c.3460G>T" "r.(?)" "p.(Glu1154Ter)" "" "0000345229" "00002505" "90" "6220" "0" "6220" "0" "c.6220G>T" "r.(?)" "p.(Glu2074Ter)" "" "0000345387" "00002505" "90" "1120" "0" "1120" "0" "c.1120G>T" "r.(?)" "p.(Glu374Ter)" "" "0000345557" "00002505" "90" "2398" "0" "2401" "0" "c.2398_2401del" "r.(?)" "p.(Glu800AsnfsTer62)" "" "0000346976" "00002505" "30" "306" "0" "306" "0" "c.306G>C" "r.(?)" "p.(Leu102=)" "" "0000347394" "00002505" "90" "3832" "0" "3832" "0" "c.3832A>T" "r.(?)" "p.(Lys1278Ter)" "" "0000348128" "00002505" "30" "3274" "0" "3274" "0" "c.3274C>T" "r.(?)" "p.(Pro1092Ser)" "" "0000348222" "00002505" "90" "4877" "0" "4877" "0" "c.4877del" "r.(?)" "p.(Pro1626ArgfsTer60)" "" "0000348226" "00002505" "10" "4912" "0" "4912" "0" "c.4912C>G" "r.(?)" "p.(Pro1638Ala)" "" "0000348269" "00002505" "10" "6176" "0" "6176" "0" "c.6176C>A" "r.(?)" "p.(Pro2059His)" "" "0000348297" "00002505" "10" "6787" "0" "6787" "0" "c.6787C>T" "r.(?)" "p.(Pro2263Ser)" "" "0000348310" "00002505" "70" "7388" "0" "7388" "0" "c.7388C>A" "r.(?)" "p.(Pro2463His)" "" "0000348690" "00002505" "70" "3779" "0" "3779" "0" "c.3779C>A" "r.(?)" "p.(Ser1260Ter)" "" "0000349167" "00002505" "90" "2306" "0" "2306" "0" "c.2306C>G" "r.(?)" "p.(Ser769Ter)" "" "0000349318" "00002505" "50" "5162" "0" "5162" "0" "c.5162C>T" "r.(?)" "p.(Thr1721Met)" "" "0000349603" "00002505" "10" "2039" "0" "2039" "0" "c.2039C>G" "r.(?)" "p.(Thr680Ser)" "" "0000349948" "00002505" "90" "5145" "0" "5145" "0" "c.5145C>G" "r.(?)" "p.(Tyr1715Ter)" "" "0000349982" "00002505" "90" "636" "0" "637" "0" "c.636_637insG" "r.(?)" "p.(Tyr213ValfsTer22)" "" "0000350027" "00002505" "90" "867" "0" "867" "0" "c.867C>G" "r.(?)" "p.(Tyr289Ter)" "" "0000350072" "00002505" "90" "1173" "0" "1173" "0" "c.1173C>G" "r.(?)" "p.(Tyr391Ter)" "" "0000350709" "00002505" "70" "7807" "-1" "7807" "-1" "c.7807-1G>C" "r.spl?" "p.?" "" "0000351415" "00002505" "90" "7570" "-2" "7570" "-2" "c.7570-2A>C" "r.spl?" "p.?" "" "0000351416" "00002505" "10" "4872" "0" "4872" "0" "c.4872G>A" "r.(?)" "p.(Ala1624=)" "" "0000351417" "00002505" "10" "744" "18" "744" "18" "c.744+18C>G" "r.(=)" "p.(=)" "" "0000395150" "00002505" "90" "2704" "0" "2704" "0" "c.2704G>T" "r.(?)" "p.(Glu902*)" "" "0000404694" "00002505" "90" "4475" "0" "4498" "0" "c.4475_4498dup" "r.(?)" "p.(Leu1492_Glu1499dup)" "9" "0000408770" "00002505" "90" "3369" "0" "3372" "0" "c.3369_3372del" "r.(?)" "p.(Ser1123Argfs*194)" "9" "0000438965" "00002505" "90" "2512" "0" "2512" "0" "c.2512C>T" "r.(?)" "p.(Arg838*)" "" "0000501874" "00002505" "70" "6968" "0" "6975" "0" "c.6968_6975del" "r.(?)" "p.(Ala2323Glyfs*206)" "9" "0000501875" "00002505" "70" "6812" "0" "6813" "0" "c.6812_6813del" "r.(?)" "p.(Pro2271Argfs*24)" "9" "0000559816" "00002505" "50" "7738" "0" "7738" "0" "c.7738G>A" "r.(?)" "p.(Asp2580Asn)" "" "0000559818" "00002505" "70" "7713" "1" "7713" "1" "c.7713+1G>A" "r.spl?" "p.?" "" "0000559819" "00002505" "50" "7669" "0" "7669" "0" "c.7669A>T" "r.(?)" "p.(Met2557Leu)" "" "0000559820" "00002505" "50" "7606" "0" "7606" "0" "c.7606C>T" "r.(?)" "p.(Arg2536Trp)" "" "0000559821" "00002505" "70" "7606" "0" "7606" "0" "c.7606C>T" "r.(?)" "p.(Arg2536Trp)" "" "0000559822" "00002505" "90" "7569" "1" "7569" "1" "c.7569+1G>T" "r.spl?" "p.?" "" "0000559823" "00002505" "70" "7564" "0" "7564" "0" "c.7564G>A" "r.(?)" "p.(Glu2522Lys)" "" "0000559826" "00002505" "90" "7213" "0" "7213" "0" "c.7213C>T" "r.(?)" "p.(Gln2405Ter)" "" "0000559827" "00002505" "30" "7106" "0" "7106" "0" "c.7106C>T" "r.(?)" "p.(Ala2369Val)" "" "0000559828" "00002505" "50" "7087" "0" "7087" "0" "c.7087C>G" "r.(?)" "p.(Pro2363Ala)" "" "0000559830" "00002505" "10" "6826" "0" "6826" "0" "c.6826C>T" "r.(?)" "p.(Pro2276Ser)" "" "0000559831" "00002505" "30" "6787" "0" "6787" "0" "c.6787C>T" "r.(?)" "p.(Pro2263Ser)" "" "0000559832" "00002505" "90" "6792" "0" "6792" "0" "c.6792dup" "r.(?)" "p.(Ala2265ArgfsTer8)" "" "0000559833" "00002505" "30" "6746" "0" "6746" "0" "c.6746G>A" "r.(?)" "p.(Arg2249His)" "" "0000559834" "00002505" "30" "6745" "0" "6745" "0" "c.6745C>T" "r.(?)" "p.(Arg2249Cys)" "" "0000559836" "00002505" "30" "6725" "0" "6725" "0" "c.6725C>T" "r.(?)" "p.(Ala2242Val)" "" "0000559837" "00002505" "30" "6497" "0" "6497" "0" "c.6497T>G" "r.(?)" "p.(Met2166Arg)" "" "0000559839" "00002505" "90" "6402" "0" "6402" "0" "c.6402del" "r.(?)" "p.(Phe2136SerfsTer39)" "" "0000559840" "00002505" "30" "6354" "0" "6354" "0" "c.6354G>A" "r.(?)" "p.(Val2118=)" "" "0000559844" "00002505" "70" "6129" "0" "6129" "0" "c.6129del" "r.(?)" "p.(Val2044SerfsTer43)" "" "0000559845" "00002505" "30" "6112" "0" "6112" "0" "c.6112A>G" "r.(?)" "p.(Lys2038Glu)" "" "0000559846" "00002505" "30" "6112" "0" "6112" "0" "c.6112A>G" "r.(?)" "p.(Lys2038Glu)" "" "0000559847" "00002505" "30" "6067" "0" "6067" "0" "c.6067G>C" "r.(?)" "p.(Ala2023Pro)" "" "0000559848" "00002505" "30" "6065" "0" "6065" "0" "c.6065C>T" "r.(?)" "p.(Pro2022Leu)" "" "0000559850" "00002505" "50" "5773" "0" "5773" "0" "c.5773C>A" "r.(?)" "p.(Pro1925Thr)" "" "0000559851" "00002505" "30" "5746" "0" "5746" "0" "c.5746G>A" "r.(?)" "p.(Asp1916Asn)" "" "0000559852" "00002505" "30" "5632" "0" "5632" "0" "c.5632T>C" "r.(?)" "p.(Ser1878Pro)" "" "0000559853" "00002505" "30" "5587" "0" "5587" "0" "c.5587G>A" "r.(?)" "p.(Asp1863Asn)" "" "0000559854" "00002505" "50" "5578" "0" "5578" "0" "c.5578C>T" "r.(?)" "p.(Pro1860Ser)" "" "0000559855" "00002505" "30" "5509" "0" "5509" "0" "c.5509C>T" "r.(?)" "p.(Pro1837Ser)" "" "0000559857" "00002505" "30" "5274" "0" "5274" "0" "c.5274C>T" "r.(?)" "p.(Pro1758=)" "" "0000559858" "00002505" "30" "5274" "0" "5274" "0" "c.5274C>T" "r.(?)" "p.(Pro1758=)" "" "0000559859" "00002505" "70" "5241" "0" "5241" "0" "c.5241del" "r.(?)" "p.(Val1748CysfsTer215)" "" "0000559864" "00002505" "30" "4235" "0" "4235" "0" "c.4235T>C" "r.(?)" "p.(Ile1412Thr)" "" "0000559865" "00002505" "30" "4235" "0" "4235" "0" "c.4235T>C" "r.(?)" "p.(Ile1412Thr)" "" "0000559866" "00002505" "50" "4006" "0" "4006" "0" "c.4006G>A" "r.(?)" "p.(Glu1336Lys)" "" "0000559867" "00002505" "30" "4001" "0" "4001" "0" "c.4001C>T" "r.(?)" "p.(Pro1334Leu)" "" "0000559868" "00002505" "30" "3977" "0" "3977" "0" "c.3977C>T" "r.(?)" "p.(Thr1326Met)" "" "0000559870" "00002505" "90" "3890" "0" "3890" "0" "c.3890del" "r.(?)" "p.(Asn1297ThrfsTer21)" "" "0000559871" "00002505" "90" "3770" "0" "3771" "0" "c.3770_3771del" "r.(?)" "p.(Lys1257ArgfsTer25)" "" "0000559873" "00002505" "50" "3723" "0" "3723" "0" "c.3723G>T" "r.(?)" "p.(Lys1241Asn)" "" "0000559875" "00002505" "30" "3657" "0" "3657" "0" "c.3657C>A" "r.(?)" "p.(Asp1219Glu)" "" "0000559876" "00002505" "90" "3562" "0" "3562" "0" "c.3562C>T" "r.(?)" "p.(Arg1188Ter)" "" "0000559877" "00002505" "50" "3484" "0" "3484" "0" "c.3484G>A" "r.(?)" "p.(Asp1162Asn)" "" "0000559878" "00002505" "30" "3437" "0" "3437" "0" "c.3437C>T" "r.(?)" "p.(Thr1146Met)" "" "0000559879" "00002505" "50" "3277" "0" "3277" "0" "c.3277G>A" "r.(?)" "p.(Gly1093Arg)" "" "0000559880" "00002505" "30" "3274" "0" "3274" "0" "c.3274C>T" "r.(?)" "p.(Pro1092Ser)" "" "0000559881" "00002505" "30" "3045" "0" "3045" "0" "c.3045C>G" "r.(?)" "p.(Pro1015=)" "" "0000559882" "00002505" "30" "3045" "0" "3045" "0" "c.3045C>G" "r.(?)" "p.(Pro1015=)" "" "0000559886" "00002505" "30" "2539" "0" "2539" "0" "c.2539G>C" "r.(?)" "p.(Asp847His)" "" "0000559888" "00002505" "30" "2373" "0" "2373" "0" "c.2373G>A" "r.(?)" "p.(Lys791=)" "" "0000559889" "00002505" "70" "2175" "0" "2178" "0" "c.2175_2178del" "r.(?)" "p.(Asn725LysfsTer23)" "" "0000559890" "00002505" "30" "2148" "0" "2148" "0" "c.2148A>G" "r.(?)" "p.(Lys716=)" "" "0000559891" "00002505" "90" "2090" "0" "2091" "0" "c.2090_2091del" "r.(?)" "p.(Glu697GlyfsTer4)" "" "0000559892" "00002505" "30" "2076" "0" "2076" "0" "c.2076C>T" "r.(?)" "p.(Asp692=)" "" "0000559893" "00002505" "10" "2039" "0" "2039" "0" "c.2039C>G" "r.(?)" "p.(Thr680Ser)" "" "0000559896" "00002505" "70" "1896" "0" "1897" "0" "c.1896_1897del" "r.(?)" "p.(His632GlnfsTer30)" "" "0000559897" "00002505" "10" "1844" "0" "1844" "0" "c.1844C>G" "r.(?)" "p.(Ala615Gly)" "" "0000559898" "00002505" "50" "1652" "0" "1666" "0" "c.1652_1666del" "r.(?)" "p.(Trp551_Ser555del)" "" "0000559900" "00002505" "70" "1396" "0" "1396" "0" "c.1396G>T" "r.(?)" "p.(Glu466Ter)" "" "0000559902" "00002505" "90" "1356" "0" "1359" "0" "c.1356_1359del" "r.(?)" "p.(Asn452LysfsTer2)" "" "0000559903" "00002505" "50" "1222" "0" "1222" "0" "c.1222T>A" "r.(?)" "p.(Ser408Thr)" "" "0000559904" "00002505" "30" "1099" "0" "1099" "0" "c.1099T>C" "r.(?)" "p.(Leu367=)" "" "0000559908" "00002505" "30" "543" "0" "543" "0" "c.543C>T" "r.(?)" "p.(Ala181=)" "" "0000559909" "00002505" "30" "397" "9" "397" "9" "c.397+9G>A" "r.(=)" "p.(=)" "" "0000559910" "00002505" "30" "282" "0" "282" "0" "c.282C>G" "r.(?)" "p.(Ala94=)" "" "0000559911" "00002505" "30" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Thr39Ile)" "" "0000595666" "00002505" "90" "3055" "0" "3059" "0" "c.3055_3059del" "r.(?)" "p.(Arg1019Glyfs*14)" "" "0000602995" "00002505" "70" "587" "0" "591" "0" "c.587_591del" "r.(?)" "p.(Val196Glyfs*13)" "" "0000604463" "00002505" "90" "1318" "0" "1318" "0" "c.1318C>T" "r.(?)" "p.(Arg440*)" "" "0000604500" "00002505" "90" "7570" "-1" "7570" "-1" "c.7570-1G>C" "r.7570_7575del" "p.Glu2524_Lys2525del" "" "0000604501" "00002505" "90" "7570" "-1" "7570" "-1" "c.7570-1G>C" "r.7570_7575del" "p.Glu2524_Lys2525del" "" "0000604502" "00002505" "90" "7570" "-1" "7570" "-1" "c.7570-1G>C" "r.7570_7575del" "p.Glu2524_Lys2525del" "" "0000604503" "00002505" "90" "2305" "0" "2305" "0" "c.2305del" "r.(?)" "p.(Ser769Glnfs*8)" "" "0000604504" "00002505" "90" "7189" "0" "7189" "0" "c.7189C>T" "r.(?)" "p.(Gln2397*)" "" "0000604505" "00002505" "90" "5953" "0" "5954" "0" "c.5953_5954del" "r.(?)" "p.(Gln1985Glufs*46)" "" "0000604506" "00002505" "90" "6071" "0" "6084" "0" "c.6071_6084del" "r.(?)" "p.(Pro2024Argfs*3)" "" "0000616260" "00002505" "50" "7703" "0" "7703" "0" "c.7703T>C" "r.(?)" "p.(Leu2568Pro)" "" "0000616261" "00002505" "90" "7535" "0" "7535" "0" "c.7535G>A" "r.(?)" "p.(Arg2512Gln)" "" "0000616262" "00002505" "70" "7340" "0" "7342" "0" "c.7340_7342del" "r.(?)" "p.(Lys2447del)" "" "0000616263" "00002505" "30" "6901" "0" "6901" "0" "c.6901G>C" "r.(?)" "p.(Ala2301Pro)" "" "0000616265" "00002505" "30" "6597" "0" "6597" "0" "c.6597C>G" "r.(?)" "p.(Leu2199=)" "" "0000616266" "00002505" "30" "5778" "0" "5778" "0" "c.5778G>A" "r.(?)" "p.(Pro1926=)" "" "0000616267" "00002505" "90" "5130" "0" "5130" "0" "c.5130dup" "r.(?)" "p.(Ser1711IlefsTer21)" "" "0000616268" "00002505" "30" "4872" "0" "4872" "0" "c.4872G>A" "r.(?)" "p.(Ala1624=)" "" "0000616269" "00002505" "50" "4475" "0" "4498" "0" "c.4475_4498del" "r.(?)" "p.(Leu1492_Glu1499del)" "" "0000616270" "00002505" "90" "4395" "0" "4396" "0" "c.4395_4396del" "r.(?)" "p.(His1465GlnfsTer88)" "" "0000616271" "00002505" "90" "4384" "0" "4384" "0" "c.4384dup" "r.(?)" "p.(Arg1462LysfsTer92)" "" "0000616272" "00002505" "30" "3660" "0" "3660" "0" "c.3660G>A" "r.(?)" "p.(Arg1220=)" "" "0000616274" "00002505" "30" "2805" "0" "2805" "0" "c.2805G>T" "r.(?)" "p.(Ser935=)" "" "0000616275" "00002505" "30" "2804" "0" "2804" "0" "c.2804C>T" "r.(?)" "p.(Ser935Leu)" "" "0000616276" "00002505" "30" "2519" "0" "2519" "0" "c.2519G>A" "r.(?)" "p.(Arg840Gln)" "" "0000616277" "00002505" "30" "2519" "0" "2519" "0" "c.2519G>A" "r.(?)" "p.(Arg840Gln)" "" "0000616278" "00002505" "70" "2366" "0" "2367" "0" "c.2366_2367del" "r.(?)" "p.(Lys789ArgfsTer7)" "" "0000616279" "00002505" "90" "2225" "0" "2232" "0" "c.2225_2232del" "r.(?)" "p.(Ala742GlyfsTer37)" "" "0000616280" "00002505" "90" "2197" "0" "2197" "0" "c.2197C>T" "r.(?)" "p.(Arg733Ter)" "" "0000616281" "00002505" "30" "1003" "0" "1003" "0" "c.1003G>A" "r.(?)" "p.(Glu335Lys)" "" "0000616282" "00002505" "30" "924" "0" "924" "0" "c.924C>T" "r.(?)" "p.(Phe308=)" "" "0000616283" "00002505" "30" "495" "0" "495" "0" "c.495C>T" "r.(?)" "p.(Asn165=)" "" "0000616284" "00002505" "30" "280" "0" "280" "0" "c.280G>C" "r.(?)" "p.(Ala94Pro)" "" "0000623574" "00002505" "70" "7607" "0" "7607" "0" "c.7607G>A" "r.(?)" "p.(Arg2536Gln)" "" "0000623575" "00002505" "50" "7333" "0" "7333" "0" "c.7333A>G" "r.(?)" "p.(Arg2445Gly)" "" "0000623576" "00002505" "30" "6978" "0" "6978" "0" "c.6978C>T" "r.(?)" "p.(Ala2326=)" "" "0000623577" "00002505" "90" "5950" "0" "5951" "0" "c.5950_5951insT" "r.(?)" "p.(Pro1984LeufsTer48)" "" "0000623579" "00002505" "50" "3884" "0" "3884" "0" "c.3884A>G" "r.(?)" "p.(Asp1295Gly)" "" "0000623580" "00002505" "30" "3584" "0" "3584" "0" "c.3584G>A" "r.(?)" "p.(Arg1195Lys)" "" "0000624890" "00002505" "90" "1232" "0" "1232" "0" "c.1232C>A" "r.(?)" "p.(Ser411Ter)" "" "0000631948" "00002505" "90" "2662" "0" "2666" "0" "c.2662_2666del" "r.(?)" "p.(Arg888Alafs*26)" "" "0000647141" "00002505" "90" "3187" "0" "3187" "0" "c.3187A>T" "r.(?)" "p.(Lys1063*)" "" "0000649448" "00002505" "10" "5665" "0" "5665" "0" "c.5665A>G" "r.(?)" "p.(Lys1889Glu)" "" "0000649449" "00002505" "50" "2684" "0" "2684" "0" "c.2684G>A" "r.(?)" "p.(Arg895Gln)" "" "0000649450" "00002505" "50" "136" "0" "136" "0" "c.136G>A" "r.(?)" "p.(Asp46Asn)" "" "0000653485" "00002505" "90" "1280" "0" "1281" "0" "c.1280_1281del" "r.(?)" "p.(Arg427ThrfsTer10)" "" "0000657990" "00002505" "50" "7944" "0" "7944" "0" "c.7944C>G" "r.(?)" "p.(Tyr2648Ter)" "" "0000657991" "00002505" "90" "6755" "0" "6756" "0" "c.6755_6756del" "r.(?)" "p.(Gly2252GlufsTer7)" "" "0000657992" "00002505" "50" "6704" "0" "6704" "0" "c.6704C>T" "r.(?)" "p.(Pro2235Leu)" "" "0000657993" "00002505" "70" "5227" "0" "5227" "0" "c.5227C>T" "r.(?)" "p.(Gln1743Ter)" "" "0000657994" "00002505" "30" "4670" "0" "4670" "0" "c.4670C>T" "r.(?)" "p.(Pro1557Leu)" "" "0000657995" "00002505" "30" "3579" "0" "3579" "0" "c.3579G>A" "r.(?)" "p.(Ala1193=)" "" "0000657996" "00002505" "90" "2273" "0" "2274" "0" "c.2273_2274del" "r.(?)" "p.(Leu758GlnfsTer23)" "" "0000657997" "00002505" "30" "1258" "0" "1258" "0" "c.1258G>A" "r.(?)" "p.(Val420Met)" "" "0000657998" "00002505" "90" "867" "0" "867" "0" "c.867C>A" "r.(?)" "p.(Tyr289Ter)" "" "0000657999" "00002505" "30" "646" "0" "646" "0" "c.646G>A" "r.(?)" "p.(Val216Ile)" "" "0000658000" "00002505" "30" "490" "0" "490" "0" "c.490A>C" "r.(?)" "p.(Arg164=)" "" "0000658001" "00002505" "30" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Thr39Ile)" "" "0000660602" "00002505" "70" "4083" "0" "4083" "0" "c.4083C>A" "r.(?)" "p.(His1361Gln)" "" "0000663269" "00002505" "70" "3309" "0" "3309" "0" "c.3309dup" "r.(?)" "p.(Asp1104Argfs*2)" "" "0000665321" "00002505" "70" "4381" "0" "4382" "0" "c.4381_4382del" "r.(?)" "p.(Lys1461Glufs*92)" "" "0000667197" "00002505" "90" "2329" "0" "2332" "0" "c.2329_2332del" "r.(?)" "p.(Glu777Argfs*5)" "" "0000667482" "00002505" "90" "7825" "0" "7825" "0" "c.7825C>T" "r.(?)" "p.(Gln2609*)" "" "0000667483" "00002505" "90" "2518" "0" "2518" "0" "c.2518del" "r.(?)" "p.(Arg840Glyfs*23)" "" "0000680732" "00002505" "70" "7971" "0" "7977" "0" "c.7971_7977dup" "r.(?)" "p.(Leu2661CysfsTer91)" "" "0000680733" "00002505" "30" "7714" "-3" "7714" "-3" "c.7714-3C>A" "r.spl?" "p.?" "" "0000680734" "00002505" "70" "6982" "0" "6982" "0" "c.6982dup" "r.(?)" "p.(Arg2328ProfsTer204)" "" "0000680735" "00002505" "30" "6909" "0" "6909" "0" "c.6909C>T" "r.(?)" "p.(Ala2303=)" "" "0000680736" "00002505" "30" "6222" "0" "6222" "0" "c.6222A>G" "r.(?)" "p.(Glu2074=)" "" "0000680737" "00002505" "30" "5733" "0" "5733" "0" "c.5733G>A" "r.(?)" "p.(Leu1911=)" "" "0000680738" "00002505" "90" "5651" "0" "5651" "0" "c.5651C>G" "r.(?)" "p.(Ser1884Ter)" "" "0000680739" "00002505" "30" "4443" "0" "4443" "0" "c.4443G>A" "r.(?)" "p.(Ala1481=)" "" "0000680740" "00002505" "30" "4440" "0" "4440" "0" "c.4440T>C" "r.(?)" "p.(His1480=)" "" "0000680741" "00002505" "90" "4389" "0" "4390" "0" "c.4389_4390del" "r.(?)" "p.(Lys1464ThrfsTer89)" "" "0000680742" "00002505" "30" "4317" "0" "4317" "0" "c.4317G>A" "r.(?)" "p.(Lys1439=)" "" "0000680743" "00002505" "30" "2373" "0" "2373" "0" "c.2373G>A" "r.(?)" "p.(Lys791=)" "" "0000680744" "00002505" "30" "2292" "0" "2292" "0" "c.2292G>A" "r.(?)" "p.(Glu764=)" "" "0000680745" "00002505" "30" "1494" "0" "1494" "0" "c.1494C>T" "r.(?)" "p.(Ser498=)" "" "0000680746" "00002505" "90" "1369" "0" "1369" "0" "c.1369A>T" "r.(?)" "p.(Lys457Ter)" "" "0000680747" "00002505" "50" "196" "0" "196" "0" "c.196G>A" "r.(?)" "p.(Ala66Thr)" "" "0000682865" "00002505" "90" "1903" "0" "1907" "0" "c.1903_1907del" "r.(?)" "p.(Lys635Glnfs*26)" "" "0000683669" "00002505" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Ser?*)" "" "0000692206" "00002505" "90" "7192" "0" "7192" "0" "c.7192C>T" "r.(?)" "p.(Gln2398Ter)" "" "0000692207" "00002505" "30" "5502" "0" "5502" "0" "c.5502C>T" "r.(?)" "p.(Pro1834=)" "" "0000692208" "00002505" "90" "3315" "0" "3319" "0" "c.3315_3319del" "r.(?)" "p.(Asp1105GlufsTer16)" "" "0000692209" "00002505" "90" "3088" "0" "3088" "0" "c.3088G>T" "r.(?)" "p.(Glu1030Ter)" "" "0000692210" "00002505" "50" "1894" "0" "1894" "0" "c.1894C>T" "r.(?)" "p.(His632Tyr)" "" "0000692211" "00002505" "30" "1748" "0" "1748" "0" "c.1748G>C" "r.(?)" "p.(Gly583Ala)" "" "0000692212" "00002505" "50" "1356" "0" "1358" "0" "c.1356_1358del" "r.(?)" "p.(Asn452del)" "" "0000692213" "00002505" "50" "736" "0" "736" "0" "c.736C>T" "r.(?)" "p.(His246Tyr)" "" "0000692214" "00002505" "50" "221" "0" "221" "0" "c.221A>G" "r.(?)" "p.(Asp74Gly)" "" "0000726057" "00002505" "90" "7806" "1" "7806" "1" "c.7806+1G>T" "r.spl?" "p.?" "" "0000726058" "00002505" "50" "7736" "0" "7736" "0" "c.7736G>A" "r.(?)" "p.(Arg2579His)" "" "0000726059" "00002505" "90" "7674" "0" "7674" "0" "c.7674del" "r.(?)" "p.(Leu2559TrpfsTer43)" "" "0000726060" "00002505" "90" "7126" "0" "7126" "0" "c.7126del" "r.(?)" "p.(Asp2376ThrfsTer25)" "" "0000726061" "00002505" "90" "6982" "0" "6982" "0" "c.6982dup" "r.(?)" "p.(Arg2328ProfsTer204)" "" "0000726062" "00002505" "90" "6827" "0" "6827" "0" "c.6827dup" "r.(?)" "p.(Asn2277GlufsTer19)" "" "0000726063" "00002505" "90" "6737" "0" "6737" "0" "c.6737dup" "r.(?)" "p.(Glu2247ArgfsTer13)" "" "0000726064" "00002505" "30" "6454" "0" "6454" "0" "c.6454G>A" "r.(?)" "p.(Glu2152Lys)" "" "0000726065" "00002505" "30" "6125" "0" "6125" "0" "c.6125A>G" "r.(?)" "p.(Asp2042Gly)" "" "0000726066" "00002505" "50" "6052" "0" "6060" "0" "c.6052_6060del" "r.(?)" "p.(Pro2018_Ala2020del)" "" "0000726067" "00002505" "90" "6032" "0" "6032" "0" "c.6032C>A" "r.(?)" "p.(Ser2011Ter)" "" "0000726068" "00002505" "30" "5661" "0" "5661" "0" "c.5661A>G" "r.(?)" "p.(Gln1887=)" "" "0000726069" "00002505" "90" "5504" "0" "5504" "0" "c.5504del" "r.(?)" "p.(Leu1835ArgfsTer128)" "" "0000726070" "00002505" "50" "5203" "0" "5203" "0" "c.5203C>T" "r.(?)" "p.(Leu1735Phe)" "" "0000726071" "00002505" "50" "4495" "0" "4495" "0" "c.4495G>A" "r.(?)" "p.(Glu1499Lys)" "" "0000726072" "00002505" "30" "4149" "0" "4149" "0" "c.4149C>T" "r.(?)" "p.(Gly1383=)" "" "0000726073" "00002505" "30" "3780" "0" "3780" "0" "c.3780G>A" "r.(?)" "p.(Ser1260=)" "" "0000726074" "00002505" "90" "3224" "0" "3227" "0" "c.3224_3227del" "r.(?)" "p.(Glu1075GlyfsTer242)" "" "0000726075" "00002505" "90" "1901" "0" "1904" "0" "c.1901_1904del" "r.(?)" "p.(Thr634AsnfsTer18)" "" "0000726076" "00002505" "90" "1731" "0" "1731" "0" "c.1731dup" "r.(?)" "p.(Asp578*)" "" "0000726077" "00002505" "30" "1419" "0" "1419" "0" "c.1419C>T" "r.(?)" "p.(Ser473=)" "" "0000726078" "00002505" "90" "1372" "0" "1372" "0" "c.1372C>T" "r.(?)" "p.(Arg458Ter)" "" "0000726079" "00002505" "30" "1080" "0" "1080" "0" "c.1080G>A" "r.(?)" "p.(Pro360=)" "" "0000726080" "00002505" "50" "829" "0" "829" "0" "c.829C>G" "r.(?)" "p.(Pro277Ala)" "" "0000726081" "00002505" "90" "768" "0" "768" "0" "c.768C>G" "r.(?)" "p.(Tyr256Ter)" "" "0000726082" "00002505" "70" "511" "0" "511" "0" "c.511C>T" "r.(?)" "p.(Arg171Cys)" "" "0000791666" "00002505" "90" "2512" "0" "2512" "0" "c.2512C>T" "r.(?)" "p.(Arg838*)" "" "0000798377" "00002505" "90" "3309" "0" "3309" "0" "c.3309dup" "r.(?)" "p.(Asp1104Argfs*2)" "" "0000807712" "00002505" "50" "7750" "0" "7750" "0" "c.7750G>A" "r.(?)" "p.(Ala2584Thr)" "" "0000807713" "00002505" "50" "7163" "0" "7163" "0" "c.7163G>A" "r.(?)" "p.(Arg2388His)" "" "0000807714" "00002505" "30" "7136" "0" "7136" "0" "c.7136C>G" "r.(?)" "p.(Ala2379Gly)" "" "0000807715" "00002505" "30" "6065" "0" "6065" "0" "c.6065C>T" "r.(?)" "p.(Pro2022Leu)" "" "0000807716" "00002505" "90" "5364" "0" "5364" "0" "c.5364C>A" "r.(?)" "p.(Tyr1788*)" "" "0000807717" "00002505" "90" "5303" "0" "5303" "0" "c.5303C>A" "r.(?)" "p.(Ser1768*)" "" "0000807718" "00002505" "30" "4475" "0" "4498" "0" "c.4475_4498del" "r.(?)" "p.(Leu1492_Glu1499del)" "" "0000807719" "00002505" "90" "4465" "0" "4466" "0" "c.4465_4466del" "r.(?)" "p.(Arg1489Glyfs*64)" "" "0000807720" "00002505" "90" "4374" "0" "4375" "0" "c.4374_4375del" "r.(?)" "p.(Lys1459Glufs*94)" "" "0000807721" "00002505" "30" "4131" "0" "4131" "0" "c.4131C>T" "r.(?)" "p.(Gly1377=)" "" "0000807722" "00002505" "50" "3696" "0" "3696" "0" "c.3696G>T" "r.(?)" "p.(Lys1232Asn)" "" "0000807723" "00002505" "30" "2880" "0" "2880" "0" "c.2880G>C" "r.(?)" "p.(Glu960Asp)" "" "0000807724" "00002505" "30" "2640" "0" "2640" "0" "c.2640G>A" "r.(?)" "p.(Thr880=)" "" "0000836772" "00002505" "70" "1903" "0" "1907" "0" "c.1903_1907del" "r.(?)" "p.(Lys635Glnfs*26)" "" "0000837164" "00002505" "70" "6792" "0" "6792" "0" "c.6792dup" "r.(?)" "p.(Ala2265Argfs*8)" "" "0000838397" "00002505" "90" "4087" "0" "4087" "0" "c.4087C>T" "r.(?)" "p.(Arg1363*)" "" "0000841164" "00002505" "90" "1232" "0" "1232" "0" "c.1232C>A" "r.(?)" "p.(Ser411Ter)" "" "0000842563" "00002505" "90" "6580" "0" "6580" "0" "c.6580C>T" "r.(?)" "p.(Gln2194Ter)" "" "0000854712" "00002505" "30" "6787" "0" "6787" "0" "c.6787C>T" "r.(?)" "p.(Pro2263Ser)" "" "0000854713" "00002505" "90" "6738" "0" "6738" "0" "c.6738dup" "r.(?)" "p.(Glu2247Argfs*13)" "" "0000854714" "00002505" "30" "5632" "0" "5632" "0" "c.5632T>C" "r.(?)" "p.(Ser1878Pro)" "" "0000854715" "00002505" "30" "4929" "0" "4929" "0" "c.4929G>C" "r.(?)" "p.(Pro1643=)" "" "0000854716" "00002505" "30" "3978" "0" "3978" "0" "c.3978G>A" "r.(?)" "p.(Thr1326=)" "" "0000854717" "00002505" "30" "1852" "0" "1852" "0" "c.1852G>A" "r.(?)" "p.(Ala618Thr)" "" "0000854718" "00002505" "70" "893" "-1" "893" "-1" "c.893-1G>C" "r.spl?" "p.?" "" "0000854719" "00002505" "90" "822" "0" "822" "0" "c.822dup" "r.(?)" "p.(Asn275Glnfs*74)" "" "0000854720" "00002505" "70" "331" "0" "331" "0" "c.331dup" "r.(?)" "p.(Leu111Profs*50)" "" "0000865008" "00002505" "30" "6760" "0" "6760" "0" "c.6760G>A" "r.(?)" "p.(Gly2254Arg)" "" "0000865009" "00002505" "90" "6402" "0" "6402" "0" "c.6402del" "r.(?)" "p.(Phe2136SerfsTer39)" "" "0000865010" "00002505" "30" "6323" "0" "6323" "0" "c.6323G>A" "r.(?)" "p.(Gly2108Asp)" "" "0000865011" "00002505" "30" "5886" "0" "5886" "0" "c.5886G>A" "r.(?)" "p.(Leu1962=)" "" "0000865012" "00002505" "30" "5766" "0" "5766" "0" "c.5766C>T" "r.(?)" "p.(Ala1922=)" "" "0000865013" "00002505" "30" "5679" "0" "5679" "0" "c.5679C>T" "r.(?)" "p.(Ser1893=)" "" "0000865014" "00002505" "50" "5409" "0" "5409" "0" "c.5409C>A" "r.(?)" "p.(Phe1803Leu)" "" "0000865015" "00002505" "30" "4964" "0" "4964" "0" "c.4964A>G" "r.(?)" "p.(Lys1655Arg)" "" "0000865016" "00002505" "30" "4619" "0" "4619" "0" "c.4619A>G" "r.(?)" "p.(Lys1540Arg)" "" "0000865017" "00002505" "50" "4382" "0" "4384" "0" "c.4382_4384del" "r.(?)" "p.(Lys1461del)" "" "0000865018" "00002505" "90" "4344" "0" "4344" "0" "c.4344del" "r.(?)" "p.(Tyr1448*)" "" "0000865019" "00002505" "30" "3423" "0" "3423" "0" "c.3423C>T" "r.(?)" "p.(Ser1141=)" "" "0000865020" "00002505" "90" "3379" "0" "3379" "0" "c.3379dup" "r.(?)" "p.(Arg1127Lysfs*43)" "" "0000865021" "00002505" "90" "2408" "0" "2412" "0" "c.2408_2412del" "r.(?)" "p.(Lys803Argfs*5)" "" "0000865022" "00002505" "90" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106*)" "" "0000865023" "00002505" "30" "264" "0" "264" "0" "c.264G>A" "r.(?)" "p.(Glu88=)" "" "0000873321" "00002505" "70" "6792" "0" "6792" "0" "c.6792dup" "r.(?)" "p.(Ala2265Argfs*8)" "" "0000874693" "00002505" "70" "1372" "0" "1372" "0" "c.1372C>T" "r.(?)" "p.(Arg458*)" "" "0000880112" "00002505" "70" "4250" "0" "4250" "0" "c.4250A>G" "r.(?)" "p.(Asp1417Gly)" "" "0000893233" "00002505" "50" "7183" "0" "7183" "0" "c.7183C>G" "r.(?)" "p.(Gln2395Glu)" "" "0000893234" "00002505" "50" "7151" "0" "7151" "0" "c.7151C>A" "r.(?)" "p.(Pro2384Gln)" "" "0000893235" "00002505" "50" "6552" "0" "6557" "0" "c.6552_6557del" "r.(?)" "p.(Glu2185_Glu2186del)" "" "0000893236" "00002505" "50" "6416" "0" "6416" "0" "c.6416C>T" "r.(?)" "p.(Pro2139Leu)" "" "0000893237" "00002505" "90" "6359" "0" "6359" "0" "c.6359G>A" "r.(?)" "p.(Trp2120*)" "" "0000893238" "00002505" "30" "6020" "0" "6020" "0" "c.6020C>T" "r.(?)" "p.(Pro2007Leu)" "" "0000893239" "00002505" "50" "4484" "0" "4484" "0" "c.4484A>G" "r.(?)" "p.(His1495Arg)" "" "0000893240" "00002505" "30" "4344" "0" "4344" "0" "c.4344T>C" "r.(?)" "p.(Tyr1448=)" "" "0000893241" "00002505" "30" "2825" "0" "2825" "0" "c.2825G>A" "r.(?)" "p.(Arg942Lys)" "" "0000893242" "00002505" "30" "2725" "0" "2725" "0" "c.2725G>A" "r.(?)" "p.(Asp909Asn)" "" "0000893243" "00002505" "30" "2717" "0" "2717" "0" "c.2717G>T" "r.(?)" "p.(Arg906Leu)" "" "0000893244" "00002505" "90" "2409" "0" "2412" "0" "c.2409_2412del" "r.(?)" "p.(Glu805Argfs*57)" "" "0000893245" "00002505" "90" "2398" "0" "2401" "0" "c.2398_2401del" "r.(?)" "p.(Glu800AsnfsTer62)" "" "0000893246" "00002505" "30" "1020" "0" "1020" "0" "c.1020G>A" "r.(?)" "p.(Thr340=)" "" "0000893247" "00002505" "50" "295" "0" "295" "0" "c.295G>A" "r.(?)" "p.(Gly99Ser)" "" "0000893248" "00002505" "50" "17" "0" "17" "0" "c.17G>A" "r.(?)" "p.(Cys6Tyr)" "" "0000899446" "00002505" "70" "7570" "-2" "7570" "-2" "c.7570-2A>G" "r.(?)" "p.(?)" "" "0000914715" "00002505" "10" "4912" "0" "4912" "0" "c.4912C>G" "r.(?)" "p.(Pro1638Ala)" "" "0000914716" "00002505" "50" "3565" "0" "3565" "0" "c.3565G>C" "r.(?)" "p.(Gly1189Arg)" "" "0000914717" "00002505" "50" "3167" "0" "3167" "0" "c.3167T>G" "r.(?)" "p.(Phe1056Cys)" "" "0000914718" "00002505" "50" "1420" "0" "1420" "0" "c.1420G>A" "r.(?)" "p.(Asp474Asn)" "" "0000919373" "00002505" "90" "6792" "0" "6792" "0" "c.6792dup" "r.(?)" "p.(Ala2265ArgfsTer8)" "" "0000919374" "00002505" "70" "7144" "0" "7144" "0" "c.7144C>T" "r.(?)" "p.(Gln2382*)" "" "0000926370" "00002505" "50" "7780" "0" "7780" "0" "c.7780G>A" "r.(?)" "p.(Val2594Met)" "" "0000926371" "00002505" "70" "7039" "0" "7039" "0" "c.7039C>T" "r.(?)" "p.(Gln2347*)" "" "0000926372" "00002505" "90" "4602" "0" "4602" "0" "c.4602del" "r.(?)" "p.(Phe1534Leufs*13)" "" "0000926373" "00002505" "30" "4530" "0" "4530" "0" "c.4530G>A" "r.(?)" "p.(Pro1510=)" "" "0000926374" "00002505" "30" "2240" "0" "2240" "0" "c.2240C>T" "r.(?)" "p.(Ser747Leu)" "" "0000926375" "00002505" "50" "739" "0" "739" "0" "c.739T>A" "r.(?)" "p.(Tyr247Asn)" "" "0000926376" "00002505" "90" "601" "1" "601" "1" "c.601+1G>A" "r.spl?" "p.?" "" "0000926377" "00002505" "30" "116" "0" "116" "0" "c.116C>T" "r.(?)" "p.(Thr39Ile)" "" "0000927440" "00002505" "90" "2280" "0" "2281" "0" "c.2280_2281del" "r.(?)" "p.(Tyr761Glnfs*20)" "" "0000930673" "00002505" "90" "6792" "0" "6792" "0" "c.6792dup" "r.(?)" "p.(Ala2265ArgfsTer8)" "" "0000930674" "00002505" "90" "5761" "0" "5761" "0" "c.5761del" "r.(?)" "p.(Ala1921Profs*42)" "" "0000930675" "00002505" "30" "5738" "0" "5738" "0" "c.5738C>A" "r.(?)" "p.(Thr1913Asn)" "" "0000930676" "00002505" "50" "5153" "0" "5153" "0" "c.5153T>G" "r.(?)" "p.(Val1718Gly)" "" "0000930677" "00002505" "30" "4057" "0" "4057" "0" "c.4057T>A" "r.(?)" "p.(Ser1353Thr)" "" "0000930678" "00002505" "50" "580" "0" "580" "0" "c.580G>A" "r.(?)" "p.(Val194Ile)" "" "0000936216" "00002505" "90" "2512" "0" "2512" "0" "c.2512C>T" "r.(?)" "p.(Arg838*)" "" "0000939799" "00002505" "70" "3084" "0" "3084" "0" "c.3084C>A" "r.(?)" "p.(Tyr1028*)" "" "0000939856" "00002505" "70" "2327" "0" "2327" "0" "c.2327T>G" "r.(?)" "p.(Leu776*)" "" "0000946908" "00002505" "70" "7607" "0" "7607" "0" "c.7607G>A" "r.(?)" "p.(Arg2536Gln)" "11" "0000950770" "00002505" "30" "7714" "-3" "7714" "-3" "c.7714-3C>A" "r.spl?" "p.?" "" "0000950771" "00002505" "50" "7231" "0" "7231" "0" "c.7231A>G" "r.(?)" "p.(Ile2411Val)" "" "0000950772" "00002505" "50" "7191" "0" "7191" "0" "c.7191G>T" "r.(?)" "p.(Gln2397His)" "" "0000950773" "00002505" "50" "6179" "0" "6179" "0" "c.6179C>G" "r.(?)" "p.(Ser2060Cys)" "" "0000950774" "00002505" "50" "2532" "0" "2532" "0" "c.2532C>G" "r.(?)" "p.(Asp844Glu)" "" "0000950775" "00002505" "70" "2133" "0" "2134" "0" "c.2133_2134insGA" "r.(?)" "p.(Phe712Aspfs*8)" "" "0000968603" "00002505" "50" "7225" "0" "7225" "0" "c.7225G>C" "r.(?)" "p.(Glu2409Gln)" "" "0000968604" "00002505" "50" "6970" "0" "6970" "0" "c.6970C>T" "r.(?)" "p.(Pro2324Ser)" "" "0000968612" "00002505" "90" "4283" "0" "4286" "0" "c.4283_4286del" "r.(?)" "p.(Lys1428Ilefs*13)" "" "0000982202" "00002505" "50" "6361" "0" "6361" "0" "c.6361G>T" "r.(?)" "p.(Ala2121Ser)" "" "0000982203" "00002505" "70" "5906" "0" "5906" "0" "c.5906del" "r.(?)" "p.(Asn1969Thrfs*3)" "" "0000982204" "00002505" "30" "5898" "0" "5898" "0" "c.5898C>T" "r.(?)" "p.(=)" "" "0000982205" "00002505" "30" "5017" "0" "5017" "0" "c.5017G>C" "r.(?)" "p.(Gly1673Arg)" "" "0000982206" "00002505" "10" "4932" "0" "4932" "0" "c.4932G>A" "r.(?)" "p.(Gly1644=)" "" "0000982207" "00002505" "10" "3822" "0" "3822" "0" "c.3822C>T" "r.(?)" "p.(Ala1274=)" "" "0000982208" "00002505" "10" "3573" "0" "3573" "0" "c.3573C>G" "r.(?)" "p.(Ala1191=)" "" "0000982209" "00002505" "50" "3113" "0" "3113" "0" "c.3113G>A" "r.(?)" "p.(Ser1038Asn)" "" "0000982210" "00002505" "90" "2618" "0" "2619" "0" "c.2618_2619del" "r.(?)" "p.(Val873Glyfs*42)" "" "0000982211" "00002505" "30" "2240" "0" "2240" "0" "c.2240C>T" "r.(?)" "p.(Ser747Leu)" "" "0000982212" "00002505" "90" "2175" "0" "2178" "0" "c.2175_2178del" "r.(?)" "p.(Asn725LysfsTer23)" "" "0000982213" "00002505" "50" "2094" "0" "2094" "0" "c.2094G>C" "r.(?)" "p.(Glu698Asp)" "" "0000982214" "00002505" "50" "2067" "0" "2067" "0" "c.2067C>G" "r.(?)" "p.(His689Gln)" "" "0000982215" "00002505" "30" "892" "9" "892" "9" "c.892+9C>T" "r.(=)" "p.(=)" "" "0000982216" "00002505" "30" "500" "0" "500" "0" "c.500G>A" "r.(?)" "p.(Arg167His)" "" "0000982217" "00002505" "50" "112" "0" "112" "0" "c.112A>C" "r.(?)" "p.(Lys38Gln)" "" "0000982218" "00002505" "30" "-59" "-20651" "-59" "-20651" "c.-59-20651A>G" "r.(=)" "p.(=)" "" "0000988702" "00002505" "90" "7407" "0" "7407" "0" "c.7407C>A" "r.(?)" "p.(Tyr2469Ter)" "" "0001002752" "00002505" "50" "7834" "0" "7834" "0" "c.7834G>A" "r.(?)" "p.(Glu2612Lys)" "" "0001002753" "00002505" "50" "7703" "0" "7703" "0" "c.7703T>C" "r.(?)" "p.(Leu2568Pro)" "" "0001002754" "00002505" "90" "7569" "1" "7569" "1" "c.7569+1G>A" "r.spl?" "p.?" "" "0001002755" "00002505" "50" "7181" "0" "7181" "0" "c.7181A>G" "r.(?)" "p.(Gln2394Arg)" "" "0001002756" "00002505" "30" "7105" "0" "7105" "0" "c.7105G>T" "r.(?)" "p.(Ala2369Ser)" "" "0001002757" "00002505" "30" "7063" "0" "7063" "0" "c.7063T>A" "r.(?)" "p.(Ser2355Thr)" "" "0001002758" "00002505" "70" "6914" "0" "6914" "0" "c.6914del" "r.(?)" "p.(Gly2305Alafs*32)" "" "0001002759" "00002505" "30" "6817" "0" "6817" "0" "c.6817G>A" "r.(?)" "p.(Gly2273Ser)" "" "0001002760" "00002505" "30" "6791" "0" "6791" "0" "c.6791C>T" "r.(?)" "p.(Pro2264Leu)" "" "0001002761" "00002505" "90" "6792" "0" "6792" "0" "c.6792dup" "r.(?)" "p.(Ala2265ArgfsTer8)" "" "0001002762" "00002505" "30" "6563" "0" "6563" "0" "c.6563C>T" "r.(?)" "p.(Pro2188Leu)" "" "0001002763" "00002505" "30" "6350" "0" "6350" "0" "c.6350C>T" "r.(?)" "p.(Pro2117Leu)" "" "0001002764" "00002505" "30" "6266" "0" "6266" "0" "c.6266T>G" "r.(?)" "p.(Val2089Gly)" "" "0001002765" "00002505" "50" "6260" "0" "6260" "0" "c.6260C>T" "r.(?)" "p.(Ala2087Val)" "" "0001002766" "00002505" "30" "6227" "0" "6227" "0" "c.6227C>T" "r.(?)" "p.(Pro2076Leu)" "" "0001002767" "00002505" "30" "6125" "0" "6125" "0" "c.6125A>G" "r.(?)" "p.(Asp2042Gly)" "" "0001002768" "00002505" "50" "6113" "0" "6113" "0" "c.6113A>C" "r.(?)" "p.(Lys2038Thr)" "" "0001002769" "00002505" "30" "5974" "0" "5974" "0" "c.5974A>C" "r.(?)" "p.(Lys1992Gln)" "" "0001002770" "00002505" "50" "5624" "0" "5624" "0" "c.5624T>C" "r.(?)" "p.(Val1875Ala)" "" "0001002771" "00002505" "30" "5506" "0" "5506" "0" "c.5506C>T" "r.(?)" "p.(Pro1836Ser)" "" "0001002772" "00002505" "50" "5414" "0" "5414" "0" "c.5414T>A" "r.(?)" "p.(Val1805Asp)" "" "0001002773" "00002505" "50" "5369" "0" "5369" "0" "c.5369C>T" "r.(?)" "p.(Ser1790Leu)" "" "0001002774" "00002505" "30" "5353" "0" "5353" "0" "c.5353A>G" "r.(?)" "p.(Thr1785Ala)" "" "0001002775" "00002505" "30" "5315" "0" "5315" "0" "c.5315C>T" "r.(?)" "p.(Ser1772Leu)" "" "0001002776" "00002505" "30" "5216" "0" "5216" "0" "c.5216G>A" "r.(?)" "p.(Cys1739Tyr)" "" "0001002777" "00002505" "30" "4535" "0" "4535" "0" "c.4535G>A" "r.(?)" "p.(Arg1512His)" "" "0001002778" "00002505" "30" "4475" "0" "4498" "0" "c.4475_4498dup" "r.(?)" "p.(Leu1492_Glu1499dup)" "" "0001002779" "00002505" "30" "4361" "0" "4361" "0" "c.4361A>G" "r.(?)" "p.(Asn1454Ser)" "" "0001002780" "00002505" "30" "4142" "0" "4142" "0" "c.4142A>C" "r.(?)" "p.(Lys1381Thr)" "" "0001002781" "00002505" "30" "3977" "0" "3977" "0" "c.3977C>T" "r.(?)" "p.(Thr1326Met)" "" "0001002782" "00002505" "30" "3812" "0" "3812" "0" "c.3812C>T" "r.(?)" "p.(Ser1271Leu)" "" "0001002783" "00002505" "30" "3723" "0" "3723" "0" "c.3723G>T" "r.(?)" "p.(Lys1241Asn)" "" "0001002784" "00002505" "70" "3721" "0" "3721" "0" "c.3721A>T" "r.(?)" "p.(Lys1241*)" "" "0001002785" "00002505" "50" "3588" "0" "3588" "0" "c.3588C>G" "r.(?)" "p.(Asp1196Glu)" "" "0001002786" "00002505" "30" "3046" "0" "3046" "0" "c.3046G>A" "r.(?)" "p.(Asp1016Asn)" "" "0001002787" "00002505" "30" "2825" "0" "2825" "0" "c.2825G>A" "r.(?)" "p.(Arg942Lys)" "" "0001002788" "00002505" "50" "2822" "0" "2822" "0" "c.2822G>A" "r.(?)" "p.(Arg941Lys)" "" "0001002789" "00002505" "50" "2774" "0" "2774" "0" "c.2774A>G" "r.(?)" "p.(Glu925Gly)" "" "0001002790" "00002505" "50" "2717" "0" "2717" "0" "c.2717G>T" "r.(?)" "p.(Arg906Leu)" "" "0001002791" "00002505" "30" "2466" "0" "2466" "0" "c.2466G>C" "r.(?)" "p.(Gln822His)" "" "0001002792" "00002505" "70" "2202" "0" "2202" "0" "c.2202del" "r.(?)" "p.(Glu735Argfs*14)" "" "0001002793" "00002505" "50" "2189" "0" "2189" "0" "c.2189G>A" "r.(?)" "p.(Arg730Lys)" "" "0001002794" "00002505" "50" "2087" "0" "2087" "0" "c.2087A>C" "r.(?)" "p.(Lys696Thr)" "" "0001002795" "00002505" "30" "1994" "0" "1994" "0" "c.1994A>G" "r.(?)" "p.(Lys665Arg)" "" "0001002796" "00002505" "50" "1751" "0" "1751" "0" "c.1751C>G" "r.(?)" "p.(Ser584Cys)" "" "0001002797" "00002505" "30" "1726" "0" "1726" "0" "c.1726G>A" "r.(?)" "p.(Glu576Lys)" "" "0001002798" "00002505" "30" "1550" "0" "1550" "0" "c.1550C>A" "r.(?)" "p.(Ser517Tyr)" "" "0001002799" "00002505" "30" "1489" "0" "1489" "0" "c.1489G>A" "r.(?)" "p.(Gly497Arg)" "" "0001002800" "00002505" "70" "1491" "0" "1491" "0" "c.1491dup" "r.(?)" "p.(Ser498Glufs*81)" "" "0001002801" "00002505" "90" "1381" "0" "1384" "0" "c.1381_1384del" "r.(?)" "p.(Glu461GlnfsTer48)" "" "0001002802" "00002505" "70" "1355" "0" "1355" "0" "c.1355del" "r.(?)" "p.(Asn452Ilefs*3)" "" "0001002803" "00002505" "30" "1003" "0" "1003" "0" "c.1003G>A" "r.(?)" "p.(Glu335Lys)" "" "0001002804" "00002505" "50" "979" "0" "979" "0" "c.979C>G" "r.(?)" "p.(Leu327Val)" "" "0001002805" "00002505" "50" "218" "0" "218" "0" "c.218C>T" "r.(?)" "p.(Ser73Leu)" "" "0001002806" "00002505" "30" "-253" "0" "-251" "0" "c.-253_-251del" "r.(?)" "p.(=)" "" "0001007038" "00002505" "70" "7569" "2" "7569" "2" "c.7569+2T>C" "r.spl?" "p.?" "In10" "0001015446" "00002505" "90" "5550" "0" "5550" "0" "c.5550C>G" "r.(?)" "p.(Tyr1850*)" "" "0001015447" "00002505" "50" "4999" "0" "4999" "0" "c.4999A>C" "r.(?)" "p.(Lys1667Gln)" "" "0001015448" "00002505" "30" "3437" "0" "3437" "0" "c.3437C>T" "r.(?)" "p.(Thr1146Met)" "" "0001015449" "00002505" "50" "3137" "0" "3138" "0" "c.3137_3138inv" "r.(?)" "p.(Cys1046Tyr)" "" "0001015450" "00002505" "90" "2251" "0" "2251" "0" "c.2251A>T" "r.(?)" "p.(Lys751*)" "" "0001015451" "00002505" "90" "316" "0" "316" "0" "c.316C>T" "r.(?)" "p.(Arg106*)" "" "0001017683" "00002505" "70" "4649" "0" "4649" "0" "c.4649del" "r.(?)" "p.(Asn1550Thrfs*6)" "9" "0001017837" "00002505" "70" "3835" "0" "3835" "0" "c.3835dup" "r.(?)" "p.(Ser1279Lysfs*4)" "9" "0001017940" "00002505" "90" "3306" "0" "3309" "0" "c.3306_3309del" "r.(3306_3309del)" "p.(Lys1103Metfs*214)" "9" "0001018830" "00002505" "70" "6014" "0" "6014" "0" "c.6014del" "r.(?)" "p.(Pro2005Glnfs*82)" "9" "0001020090" "00002505" "70" "2394" "0" "2394" "0" "c.2394del" "r.(?)" "p.(Asp798Glufs*65)" "9" "0001026794" "00002505" "10" "6112" "0" "6112" "0" "c.6112A>G" "r.(?)" "p.(Lys2038Glu)" "" "0001026795" "00002505" "90" "3084" "0" "3084" "0" "c.3084C>A" "r.(?)" "p.(Tyr1028*)" "" "0001026796" "00002505" "50" "3025" "0" "3025" "0" "c.3025A>G" "r.(?)" "p.(Lys1009Glu)" "" "0001026797" "00002505" "90" "1460" "0" "1463" "0" "c.1460_1463del" "r.(?)" "p.(Glu487ValfsTer22)" "" "0001026798" "00002505" "30" "990" "0" "990" "0" "c.990G>C" "r.(?)" "p.(Lys330Asn)" "" "0001030001" "00002505" "70" "7713" "1" "7713" "1" "c.7713+1G>A" "r.(?)" "p.(?)" "" "0001030087" "00002505" "70" "5777" "0" "5791" "0" "c.5777_5791del" "r.(?)" "p.(Pro1926_Tyr1930del)" "" "0001041479" "00002505" "30" "7713" "265" "7713" "265" "c.7713+265A>T" "r.(=)" "p.(=)" "" "0001041480" "00002505" "30" "7519" "0" "7519" "0" "c.7519C>A" "r.(?)" "p.(Gln2507Lys)" "" "0001041481" "00002505" "50" "6910" "0" "6910" "0" "c.6910G>A" "r.(?)" "p.(Glu2304Lys)" "" "0001041482" "00002505" "30" "5490" "0" "5492" "0" "c.5490_5492dup" "r.(?)" "p.(Glu1830dup)" "" "0001041483" "00002505" "30" "5413" "0" "5413" "0" "c.5413G>A" "r.(?)" "p.(Val1805Ile)" "" "0001041484" "00002505" "30" "5350" "0" "5350" "0" "c.5350T>C" "r.(?)" "p.(Ser1784Pro)" "" "0001041485" "00002505" "50" "4978" "0" "4978" "0" "c.4978A>G" "r.(?)" "p.(Ile1660Val)" "" "0001041486" "00002505" "30" "4872" "0" "4872" "0" "c.4872G>A" "r.(?)" "p.(Ala1624=)" "" "0001041487" "00002505" "50" "4706" "0" "4706" "0" "c.4706G>C" "r.(?)" "p.(Arg1569Thr)" "" "0001041488" "00002505" "30" "3815" "0" "3816" "0" "c.3815_3816insTTTTTTTTTTT" "r.(?)" "p.(Arg1272Serfs*5)" "" "0001041489" "00002505" "10" "3660" "0" "3660" "0" "c.3660G>A" "r.(?)" "p.(Arg1220=)" "" "0001041490" "00002505" "70" "3647" "0" "3647" "0" "c.3647del" "r.(?)" "p.(Lys1216Serfs*102)" "" "0001041491" "00002505" "50" "3044" "0" "3044" "0" "c.3044C>T" "r.(?)" "p.(Pro1015Leu)" "" "0001041492" "00002505" "90" "3019" "0" "3019" "0" "c.3019C>T" "r.(?)" "p.(Arg1007*)" "" "0001041493" "00002505" "30" "2833" "0" "2833" "0" "c.2833G>A" "r.(?)" "p.(Ala945Thr)" "" "0001041494" "00002505" "50" "2522" "0" "2524" "0" "c.2522_2524del" "r.(?)" "p.(Trp841del)" "" "0001041495" "00002505" "30" "990" "0" "990" "0" "c.990G>C" "r.(?)" "p.(Lys330Asn)" "" "0001041496" "00002505" "30" "226" "3242" "226" "3243" "c.226+3242_226+3243insAAAA" "r.(=)" "p.(=)" "" "0001041497" "00002505" "30" "226" "3241" "226" "3242" "c.226+3241_226+3242del" "r.(=)" "p.(=)" "" "0001041498" "00002505" "90" "226" "0" "226" "0" "c.226G>A" "r.(?)" "p.(Glu76Lys)" "" "0001041499" "00002505" "30" "88" "-1187" "88" "-1187" "c.88-1187C>T" "r.(=)" "p.(=)" "" "0001041500" "00002505" "30" "-59" "-1378" "-59" "-1376" "c.-59-1378_-59-1376del" "r.(=)" "p.(=)" "" "0001041501" "00002505" "30" "-59" "-20609" "-59" "-20609" "c.-59-20609C>T" "r.(=)" "p.(=)" "" "0001041502" "00002505" "30" "-59" "-26145" "-59" "-26145" "c.-59-26145A>G" "r.(=)" "p.(=)" "" "0001041503" "00002505" "30" "-60" "32978" "-60" "32978" "c.-60+32978A>C" "r.(=)" "p.(=)" "" "0001041504" "00002505" "30" "-145" "27245" "-145" "27245" "c.-145+27245del" "r.(=)" "p.(=)" "" "0001041505" "00002505" "30" "-145" "22743" "-145" "22743" "c.-145+22743T>G" "r.(=)" "p.(=)" "" "0001049044" "00002505" "90" "1385" "0" "1388" "0" "c.1385_1388del" "r.(?)" "p.(Thr462LysfsTer47)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 82 "{{screeningid}}" "{{variantid}}" "0000016541" "0000036677" "0000019943" "0000040450" "0000019945" "0000040452" "0000019947" "0000040463" "0000019948" "0000040464" "0000019949" "0000040465" "0000019950" "0000040462" "0000019951" "0000040469" "0000019952" "0000040468" "0000019953" "0000040467" "0000019954" "0000040466" "0000019955" "0000040470" "0000019956" "0000040471" "0000025863" "0000048874" "0000025864" "0000048875" "0000050326" "0000079306" "0000050330" "0000079310" "0000050425" "0000079405" "0000050426" "0000079406" "0000050433" "0000079413" "0000050482" "0000079462" "0000050549" "0000079529" "0000050658" "0000079638" "0000080211" "0000129160" "0000080995" "0000130081" "0000111857" "0000179015" "0000145367" "0000236480" "0000152245" "0000245379" "0000175279" "0000395150" "0000181058" "0000404694" "0000184647" "0000408770" "0000208930" "0000438965" "0000248899" "0000501874" "0000248902" "0000501875" "0000265083" "0000595666" "0000270255" "0000602995" "0000270679" "0000604463" "0000270710" "0000604500" "0000270711" "0000604501" "0000270712" "0000604502" "0000270713" "0000604503" "0000270714" "0000604504" "0000270715" "0000604505" "0000270716" "0000604506" "0000271042" "0000624890" "0000277204" "0000631948" "0000290472" "0000647141" "0000292759" "0000649448" "0000292760" "0000649449" "0000292761" "0000649450" "0000296774" "0000653485" "0000297896" "0000660602" "0000300555" "0000663269" "0000302209" "0000665321" "0000303802" "0000667197" "0000304084" "0000667482" "0000304085" "0000667483" "0000308458" "0000682865" "0000309169" "0000683669" "0000326094" "0000880112" "0000378774" "0000791666" "0000383967" "0000798377" "0000402542" "0000836772" "0000402885" "0000837164" "0000403238" "0000838397" "0000405103" "0000841164" "0000415523" "0000873321" "0000416565" "0000874693" "0000433734" "0000919374" "0000436453" "0000927440" "0000440058" "0000936216" "0000441857" "0000939799" "0000441914" "0000939856" "0000444966" "0000946908" "0000455061" "0001007038" "0000459612" "0001017683" "0000459723" "0001017837" "0000459793" "0001017940" "0000459885" "0001018830" "0000461036" "0001020090" "0000466191" "0001030087" "0000468950" "0001049044"