### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = APOE)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"APOE"	"apolipoprotein E"	"19"	"q13.31"	"unknown"	"NC_000019.9"	"UD_132085426601"	""	"https://www.LOVD.nl/APOE"	""	"1"	"613"	"348"	"107741"	"1"	"1"	"1"	"1"	"Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by <a href=\'http://www.variome.org\' target=\'_blank\'>Global Variome</a>."	""	"g"	"http://databases.lovd.nl/shared/refseq/APOE_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00001"	"2013-05-03 00:00:00"	"00006"	"2023-05-02 16:20:26"	"00006"	"2025-12-05 13:23:08"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00002703"	"APOE"	"apolipoprotein E"	"001"	"NM_000041.2"	""	"NP_000032.1"	""	""	""	"-83"	"1097"	"954"	"45409039"	"45412650"	""	"0000-00-00 00:00:00"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 12
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00000"	"Healthy/Control"	"Healthy individual / control"	""	""	""	""	""	"00000"	"2012-07-26 17:29:43"	""	""
"00095"	"AD3"	"Alzheimer disease, type 3 (protection against, due to APOE3-Christchurch)"	"AD"	"607822"	""	""	""	"00008"	"2012-12-10 14:00:23"	"00006"	"2023-05-02 16:27:06"
"00173"	"SLOS"	"Smith-Lemli-Opitz syndrome (SLOS)"	"AR"	"270400"	""	""	""	"00006"	"2013-08-01 11:16:14"	"00006"	"2021-12-10 21:51:32"
"00174"	"FH"	"hypercholesterolemia, familial (FH)"	"AD"	""	""	""	""	"00006"	"2013-08-11 14:06:36"	"00006"	"2020-02-26 12:49:47"
"00177"	"AD2"	"Alzheimer disease, type 2 (AD-2)"	""	"104310"	""	""	""	"00006"	"2013-08-11 14:11:35"	"00006"	"2021-12-10 21:51:32"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00204"	"AD"	"Alzheimer disease (AD)"	"AD"	"104300"	""	""	""	"00006"	"2013-09-24 20:52:38"	"00006"	"2021-12-10 21:51:32"
"00395"	"ARMD1"	"macular degeneration, age-related, type 1"	"AD"	"603075"	""	""	""	"00006"	"2014-06-02 08:48:10"	"00006"	"2025-11-19 14:09:16"
"02068"	"sea blue"	"sea-blue histiocyte disease"	"AR"	"269600"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2023-05-02 16:22:23"
"03052"	"LPG"	"Lipoprotein glomerulopathy"	""	"611771"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"06419"	"HL3"	"hyperlipoproteinemia, type III"	""	"617347"	""	""	""	"00006"	"2021-12-10 23:20:41"	"00006"	"2023-05-02 16:38:25"
"07210"	"scoliosis"	"scoliosis"	""	""	""	""	""	"00006"	"2025-12-05 11:13:58"	""	""


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 6
"{{geneid}}"	"{{diseaseid}}"
"APOE"	"00095"
"APOE"	"00177"
"APOE"	"00395"
"APOE"	"02068"
"APOE"	"03052"
"APOE"	"06419"


## Individuals ## Do not remove or alter this header ##
## Count = 133
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00001831"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Germany"	""	""	""	""	"white"	""
"00001832"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Germany"	""	""	""	""	"white"	""
"00001836"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Germany"	""	""	""	""	"white"	""
"00001840"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Germany"	""	""	""	""	"white"	""
"00001852"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Germany"	""	""	""	""	"white"	""
"00001854"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Germany"	""	""	""	""	"white"	""
"00001855"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Spain"	""	""	""	""	"white"	""
"00001857"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Spain"	""	""	""	""	"white"	""
"00001860"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Spain"	""	""	""	""	"white"	""
"00001861"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Germany"	""	""	""	""	"white"	""
"00001862"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Finland;Morocco"	""	""	""	""	"white"	""
"00001863"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Germany"	""	""	""	""	"white"	""
"00001866"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Italy"	""	""	""	""	"white"	""
"00001868"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Italy"	""	""	""	""	"white"	""
"00001874"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Poland"	""	""	""	""	"white"	""
"00001876"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Poland"	""	""	""	""	"white"	""
"00001879"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Poland"	""	""	""	""	"white"	""
"00001881"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Poland"	""	""	""	""	"white"	""
"00001882"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Poland"	""	""	""	""	"white"	""
"00001885"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Poland"	""	""	""	""	"white"	""
"00001886"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Poland"	""	""	""	""	"white"	""
"00001889"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Poland"	""	""	""	""	"white"	""
"00001891"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Poland"	""	""	""	""	"white"	""
"00001893"	""	""	""	"1"	""	"00025"	""	""	"F"	""	""	""	""	""	""	""	""
"00001895"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Poland"	""	""	""	""	"white"	""
"00001902"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Italy"	""	""	""	""	"white"	""
"00001904"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"United States"	""	""	""	""	"white"	""
"00001905"	""	""	""	"1"	""	"00025"	""	""	"F"	""	"Italy"	""	""	""	""	"white"	""
"00001908"	""	""	""	"1"	""	"00025"	""	""	"M"	""	"Germany"	""	""	""	""	"white"	""
"00001911"	""	""	""	"1"	""	"00025"	""	""	"M"	""	"Germany;Poland"	""	""	""	""	"white"	""
"00001913"	""	""	""	"1"	""	"00025"	""	""	"M"	""	"Germany"	""	""	""	""	"white"	""
"00001918"	""	""	""	"1"	""	"00025"	""	""	"M"	""	"Spain"	""	""	""	""	"white"	""
"00001919"	""	""	""	"1"	""	"00025"	""	""	"M"	""	"Spain"	""	""	""	""	"white"	""
"00001920"	""	""	""	"1"	""	"00025"	""	""	"M"	""	"Germany"	""	""	""	""	"white"	""
"00001922"	""	""	""	"1"	""	"00025"	""	""	"M"	""	"Spain"	""	""	""	""	"white"	""
"00001929"	""	""	""	"1"	""	"00025"	""	""	"M"	""	"Germany"	""	""	""	""	"white"	""
"00001931"	""	""	""	"1"	""	"00025"	""	""	"M"	""	"Italy"	""	""	""	""	"white"	""
"00001932"	""	""	""	"1"	""	"00025"	""	""	"M"	""	"Italy"	""	""	""	""	"white"	""
"00001944"	""	""	""	"1"	""	"00025"	""	""	"M"	""	"Poland"	""	""	""	""	"white"	""
"00001947"	""	""	""	"1"	""	"00025"	""	""	"M"	""	"Poland"	""	""	""	""	"white"	""
"00001948"	""	""	""	"1"	""	"00025"	""	""	"M"	""	"Poland"	""	""	""	""	"white"	""
"00001953"	""	""	""	"1"	""	"00025"	""	""	"M"	""	""	""	""	""	""	"white"	""
"00001958"	"00001906"	"00001832"	""	"1"	""	"00025"	""	""	"M"	"?"	"Germany"	""	""	""	""	"white"	""
"00001964"	"00001908"	"00001834"	""	"1"	""	"00025"	""	""	"F"	"?"	"Germany"	""	""	""	""	"white"	""
"00001966"	"00001909"	"00001836"	""	"1"	""	"00025"	""	""	"F"	"?"	"Germany"	""	""	""	""	"white"	""
"00001971"	"00001911"	"00001838"	""	"1"	""	"00025"	""	""	"M"	"?"	"Germany;Poland"	""	""	""	""	"white"	""
"00001995"	"00001918"	"00001850"	""	"1"	""	"00025"	""	""	"M"	"?"	"Spain"	""	""	""	""	"white"	""
"00002002"	"00001922"	"00001855"	""	"1"	""	"00025"	""	""	"F"	"?"	"Spain"	""	""	""	""	"white"	""
"00002004"	"00001924"	"00001857"	""	"1"	""	"00025"	""	"Fetus for respective diagnostic gender is not sure"	"?"	"?"	"Spain"	""	""	""	""	"white"	""
"00002009"	"00001926"	"00001860"	""	"1"	""	"00025"	""	"since 13 years cholesterol supplementation"	"M"	"?"	"Spain"	""	""	""	""	"white"	""
"00002013"	"00001927"	"00001861"	""	"1"	""	"00025"	""	""	"F"	"?"	"Germany"	""	""	""	""	"white"	""
"00002028"	"00001929"	"00001863"	""	"1"	""	"00025"	""	""	"M"	"?"	"Germany"	""	""	""	""	"white"	""
"00002031"	"00001931"	"00001866"	""	"1"	""	"00025"	""	""	"F"	"?"	"Italy"	""	""	""	""	"white"	""
"00002032"	"00001932"	"00001867"	""	"1"	""	"00025"	""	""	"F"	"?"	"Italy"	""	""	""	""	"white"	""
"00002033"	"00001933"	"00001868"	""	"1"	""	"00025"	""	""	"M"	"?"	"Italy"	""	""	""	""	"white"	""
"00002047"	""	"00001874"	""	"1"	""	"00025"	""	"brother of A194"	"M"	"?"	"Poland"	""	""	""	""	"white"	""
"00002086"	""	"00001880"	""	"1"	""	"00025"	""	""	"M"	"?"	"Poland"	""	""	""	""	"white"	""
"00002087"	"00001941"	"00001881"	""	"1"	""	"00025"	""	""	"M"	"?"	"Poland"	""	""	""	""	"white"	""
"00002094"	"00001947"	"00001888"	""	"1"	""	"00025"	""	""	"M"	"?"	"Poland"	""	""	""	""	"white"	""
"00002095"	"00001948"	"00001889"	""	"1"	""	"00025"	""	""	"M"	"?"	"Poland"	""	""	""	""	"white"	""
"00002100"	"00001953"	"00001894"	""	"1"	""	"00025"	""	""	"M"	"?"	""	"00y03m"	""	""	""	"white"	""
"00045149"	""	""	""	"1"	""	"00006"	""	"reference haplotype"	"-"	"-"	""	""	"0"	""	""	""	""
"00045150"	""	""	""	"1"	""	"00006"	""	"reference haplotype"	"-"	"-"	""	""	"0"	""	""	""	""
"00045151"	""	""	""	"1"	""	"00006"	""	"reference haplotype"	"-"	"-"	""	""	"0"	""	""	""	""
"00103464"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"?"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-?"
"00103465"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"?"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-?"
"00103470"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"?"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-?"
"00103472"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103473"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103479"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103480"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103482"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103483"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103486"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103487"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103490"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103491"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103493"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103495"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103501"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103503"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103504"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103505"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103508"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103520"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103523"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103525"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103526"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103527"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103530"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103532"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103534"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103538"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103542"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103543"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"640 early- and late onset AD cases"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cases"
"00103545"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103551"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103554"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103559"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103562"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103567"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103568"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103569"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103574"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103576"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103580"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103587"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103595"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103596"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103597"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103598"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103602"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103603"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103604"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103606"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103610"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103611"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103612"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103613"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103614"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103615"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103618"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103623"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103625"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103626"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00103629"	""	""	""	"1"	""	"01957"	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	"1268 controls"	""	""	"Netherlands"	""	"0"	""	""	""	"Holstege-cons"
"00204227"	""	""	""	"1"	""	"02991"	""	""	"M"	"no"	"France"	""	"0"	""	""	"white"	""
"00292151"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00292152"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00292153"	""	""	""	"195"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00304665"	""	""	""	"4"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00470701"	""	""	""	"1"	""	"00006"	"{PMID:Horbacz 2025:41210864}"	"patient, affected"	"M"	""	"Poland"	""	"0"	""	""	""	"Pat62"
"00470704"	""	""	""	"1"	""	"00006"	"{PMID:Horbacz 2025:41210864}"	"patient, affected"	"F"	""	"Poland"	""	"0"	""	""	""	"Pat65"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 98
"{{individualid}}"	"{{diseaseid}}"
"00001831"	"00000"
"00001832"	"00000"
"00001836"	"00000"
"00001840"	"00000"
"00001852"	"00000"
"00001854"	"00000"
"00001855"	"00000"
"00001857"	"00000"
"00001860"	"00000"
"00001861"	"00000"
"00001862"	"00000"
"00001863"	"00000"
"00001866"	"00000"
"00001868"	"00000"
"00001874"	"00000"
"00001876"	"00000"
"00001879"	"00000"
"00001881"	"00000"
"00001882"	"00000"
"00001885"	"00000"
"00001886"	"00000"
"00001889"	"00000"
"00001891"	"00000"
"00001893"	"00000"
"00001895"	"00000"
"00001902"	"00000"
"00001904"	"00000"
"00001905"	"00000"
"00001908"	"00000"
"00001911"	"00000"
"00001913"	"00000"
"00001918"	"00000"
"00001919"	"00000"
"00001920"	"00000"
"00001922"	"00000"
"00001929"	"00000"
"00001931"	"00000"
"00001932"	"00000"
"00001944"	"00000"
"00001947"	"00000"
"00001948"	"00000"
"00001953"	"00000"
"00001958"	"00173"
"00001964"	"00173"
"00001966"	"00173"
"00001971"	"00173"
"00001995"	"00173"
"00002002"	"00173"
"00002004"	"00173"
"00002009"	"00173"
"00002013"	"00173"
"00002028"	"00173"
"00002031"	"00173"
"00002032"	"00173"
"00002033"	"00173"
"00002047"	"00173"
"00002086"	"00173"
"00002087"	"00173"
"00002094"	"00173"
"00002095"	"00173"
"00002100"	"00173"
"00045149"	"00000"
"00045150"	"00000"
"00103472"	"00204"
"00103473"	"00204"
"00103479"	"00204"
"00103480"	"00204"
"00103482"	"00204"
"00103483"	"00204"
"00103486"	"00204"
"00103487"	"00204"
"00103490"	"00204"
"00103491"	"00204"
"00103493"	"00204"
"00103495"	"00204"
"00103501"	"00204"
"00103503"	"00204"
"00103504"	"00204"
"00103505"	"00204"
"00103508"	"00204"
"00103520"	"00204"
"00103523"	"00204"
"00103525"	"00204"
"00103526"	"00204"
"00103527"	"00204"
"00103530"	"00204"
"00103532"	"00204"
"00103534"	"00204"
"00103538"	"00204"
"00103542"	"00204"
"00103543"	"00204"
"00204227"	"00174"
"00292151"	"00198"
"00292152"	"00198"
"00292153"	"00198"
"00304665"	"00198"
"00470701"	"07210"
"00470704"	"07210"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00000, 00095, 00173, 00174, 00177, 00198, 00204, 00395, 02068, 03052, 06419, 07210
## Count = 50
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Biochem_param}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Severity_score}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000000937"	"00173"	"00001958"	"00025"	"Familial"	""	"ascertainment clinical presentation; 2-3 toe syndactyly"	"7DHC: 162.3 ug/ml, 8DHC: 85.6 ug/ml"	""	"00y08m"	"25"	""	""	""	""	""	""	""	""	""
"0000000943"	"00173"	"00001964"	"00025"	"Familial"	""	"ascertainment clinical presentation; hexadactyly; microcephaly"	"7DHC: 156 ug/ml, 8DHC: 45.7 ug/ml"	""	""	"25"	""	""	""	""	""	""	""	""	""
"0000000945"	"00173"	"00001966"	"00025"	"Familial"	""	"ascertainment clinical presentation; 2-3 toe syndactyly"	"7DHC: 191  ug/ml, 8DHC: 94  ug/ml"	""	""	"50"	""	""	""	""	""	""	""	""	""
"0000000950"	"00173"	"00001971"	"00025"	"Familial"	""	"ascertainment clinical presentation; postaxial polydactyly, 2-3 toe syndactyly, hypospadia, decreased head circumference"	"elevated precursors of cholesterol, cholesterol: 227 ug/ml, 7DHC: 69 ug/ml, 8DHC: 69 ug/ml"	""	"00y02m"	"10"	""	""	""	""	""	""	""	""	""
"0000000974"	"00173"	"00001995"	"00025"	"Familial"	""	"ascertainment clinical presentation"	"cholesterol: 778 ug/ml, 7DHC: 89 ug/ml"	""	""	"25"	""	""	""	""	""	""	""	""	""
"0000000981"	"00173"	"00002002"	"00025"	"Familial"	""	"ascertainment clinical presentation; 2-3 toe syndactyly"	"cholesterol: 346 ug/ml, 7DHC: 99 ug/ml, 8DHC: 50 ug/ml"	""	""	"19"	""	""	""	""	""	""	""	""	""
"0000000983"	"00173"	"00002004"	"00025"	"Familial"	""	"diagnosis fetal; ascertainment clinical presentation; 2-3 toe syndactyly"	"cholesterol: 200 ug/ml, 7DHC: 168 ug/ml, 8DHC: 85 ug/ml"	""	"<00y00m00d"	"40"	""	""	""	""	""	""	""	""	""
"0000000988"	"00173"	"00002009"	"00025"	"Familial"	""	"ascertainment clinical presentation; head circumference < -3 SD, ptosis, anteverted nares, 2-3 toe syndactyly, clubfoot, pyloric stenosis"	"abnormal sterols, cholesterol: 386 ug/ml, 7DHC: 76 ug/ml, 8DHC: 66 ug/ml"	""	"14y"	""	""	""	""	""	""	""	""	""	""
"0000000992"	"00173"	"00002013"	"00025"	"Familial"	""	"ascertainment clinical presentation; 2-3 toe syndactyly"	"cholesterol: 140 ug/ml, 7DHC: 74 ug/ml, 8DHC: 95 ug/ml"	""	""	"15"	""	""	""	""	""	""	""	""	""
"0000001007"	"00173"	"00002028"	"00025"	"Familial"	""	"ascertainment clinical presentation; corpus callosum hypoplasia, polydactyly"	"cholesterol: 289 ug/ml, 7DHC: 169 ug/ml, 8DHC: 187 ug/ml"	""	""	"45"	""	""	""	""	""	""	""	""	""
"0000001010"	"00173"	"00002031"	"00025"	"Familial"	""	"ascertainment clinical presentation; 2-3 toe syndactyly"	"cholesterol: 251 ug/ml, 7DHC: 171 ug/ml, 8DHC: 123 ug/ml"	""	""	"35"	""	""	""	""	""	""	""	""	""
"0000001011"	"00173"	"00002032"	"00025"	"Familial"	""	"ascertainment clinical presentation; 2-3 toe syndactyly"	"cholesterol: 361 ug/ml, 7DHC: 90 ug/ml, 8DHC: 91 ug/ml"	""	""	"25"	""	""	""	""	""	""	""	""	""
"0000001012"	"00173"	"00002033"	"00025"	"Familial"	""	"ascertainment clinical presentation; no 2-3 toe syndactyly"	"cholesterol: 531 ug/ml, 7DHC: 485 ug/ml, 8DHC: 406 ug/ml"	""	""	"25"	""	""	""	""	""	""	""	""	""
"0000001026"	"00173"	"00002047"	"00025"	"Familial"	""	"ascertainment clinical presentation"	"cholesterol: 1496 ug/ml, 7DHC: 196 ug/ml, 8DHC: 189 ug/ml"	""	""	"11"	""	""	""	""	""	""	""	""	""
"0000001065"	"00173"	"00002086"	"00025"	"Familial"	""	"ascertainment clinical presentation"	"cholesterol: 364 ug/ml, 7DHC: 45 ug/ml, 8DHC: 9 ug/ml"	""	""	"30"	""	""	""	""	""	""	""	""	""
"0000001066"	"00173"	"00002087"	"00025"	"Familial"	""	"ascertainment clinical presentation"	"cholesterol: 15.8 mg/dl, 7DHC: 4.08 mg/dl, 8DHC: 0.72 mg/dl"	""	""	"35"	""	""	""	""	""	""	""	""	""
"0000001073"	"00173"	"00002094"	"00025"	"Familial"	""	"ascertainment clinical presentation"	"cholesterol: 68.6 mg/dl, 7DHC: 6.46 mg/dl, 8DHC: 3.46 mg/dl"	""	""	"22"	""	""	""	""	""	""	""	""	""
"0000001074"	"00173"	"00002095"	"00025"	"Familial"	""	"ascertainment clinical presentation"	"cholesterol: 1050 ug/ml, 7DHC: 26.3 ug/ml, 8DHC: 11.1 ug/ml"	""	""	"25"	""	""	""	""	""	""	""	""	""
"0000001079"	"00173"	"00002100"	"00025"	"Familial"	""	"ascertainment clinical presentation"	"cholesterol: 147 mg/dl, 7DHC: 29.5 mg/ld, 8DHC: 27.5 mg/dl"	""	""	"64"	""	""	""	""	""	""	""	""	""
"0000081484"	"00204"	"00103472"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081485"	"00204"	"00103473"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081491"	"00204"	"00103479"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081492"	"00204"	"00103480"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081494"	"00204"	"00103482"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081495"	"00204"	"00103483"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081498"	"00204"	"00103486"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081499"	"00204"	"00103487"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081502"	"00204"	"00103490"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081503"	"00204"	"00103491"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081505"	"00204"	"00103493"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081507"	"00204"	"00103495"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081513"	"00204"	"00103501"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081515"	"00204"	"00103503"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081516"	"00204"	"00103504"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081517"	"00204"	"00103505"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081520"	"00204"	"00103508"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081532"	"00204"	"00103520"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081535"	"00204"	"00103523"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081537"	"00204"	"00103525"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081538"	"00204"	"00103526"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081539"	"00204"	"00103527"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081542"	"00204"	"00103530"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081544"	"00204"	"00103532"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081546"	"00204"	"00103534"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081550"	"00204"	"00103538"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081554"	"00204"	"00103542"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000081555"	"00204"	"00103543"	"01957"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000152731"	"00174"	"00204227"	"02991"	"Familial, autosomal dominant"	""	"ADH, OMIM #143890"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000355595"	"07210"	"00470701"	"00006"	"Familial"	"13y"	"see paper; ... scoliosis, no other skeletal defects; no symptoms; asperger syndrome; no physical activity"	""	""	""	""	""	""	""	""	""	""	""	"severe adolescent idiopathic scoliosis"	""
"0000355598"	"07210"	"00470704"	"00006"	"Isolated (sporadic)"	"13y"	"see paper; ... scoliosis, no other skeletal defects; no symptoms; physical activity"	""	""	""	""	""	""	""	""	""	""	""	"severe adolescent idiopathic scoliosis"	""


## Screenings ## Do not remove or alter this header ##
## Count = 133
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000002090"	"00001831"	"1"	"00025"	"00006"	"2010-03-11 10:05:16"	""	""	"SEQ"	"DNA"	""	""
"0000002091"	"00001832"	"1"	"00025"	"00006"	"2010-03-11 10:42:00"	""	""	"SEQ"	"DNA"	""	""
"0000002095"	"00001836"	"1"	"00025"	"00006"	"2010-03-15 14:55:04"	""	""	"SEQ"	"DNA"	""	""
"0000002099"	"00001840"	"1"	"00025"	"00006"	"2010-03-16 15:58:28"	""	""	"SEQ"	"DNA"	""	""
"0000002111"	"00001852"	"1"	"00025"	"00006"	"2010-03-24 18:23:47"	""	""	"SEQ"	"DNA"	""	""
"0000002113"	"00001854"	"1"	"00025"	"00006"	"2010-03-25 17:39:16"	""	""	"SEQ"	"DNA"	""	""
"0000002114"	"00001855"	"1"	"00025"	"00006"	"2010-03-25 17:54:24"	""	""	"SEQ"	"DNA"	""	""
"0000002116"	"00001857"	"1"	"00025"	"00006"	"2010-03-25 18:20:02"	""	""	"SEQ"	"DNA"	""	""
"0000002119"	"00001860"	"1"	"00025"	"00006"	"2010-03-29 17:46:43"	""	""	"SEQ"	"DNA"	""	""
"0000002120"	"00001861"	"1"	"00025"	"00006"	"2010-03-29 18:13:43"	""	""	"SEQ"	"DNA"	""	""
"0000002121"	"00001862"	"1"	"00025"	"00006"	"2010-04-09 16:21:46"	""	""	"SEQ"	"DNA"	""	""
"0000002122"	"00001863"	"1"	"00025"	"00006"	"2010-04-21 12:39:28"	""	""	"SEQ"	"DNA"	""	""
"0000002125"	"00001866"	"1"	"00025"	"00006"	"2010-04-21 14:23:34"	""	""	"SEQ"	"DNA"	""	""
"0000002127"	"00001868"	"1"	"00025"	"00006"	"2010-04-21 14:38:18"	""	""	"SEQ"	"DNA"	""	""
"0000002133"	"00001874"	"1"	"00025"	"00006"	"2010-04-26 17:29:18"	""	""	"SEQ"	"DNA"	""	""
"0000002135"	"00001876"	"1"	"00025"	"00006"	"2010-04-29 11:33:31"	""	""	"SEQ"	"DNA"	""	""
"0000002138"	"00001879"	"1"	"00025"	"00006"	"2012-04-16 11:33:37"	""	""	"SEQ"	"DNA"	""	""
"0000002140"	"00001881"	"1"	"00025"	"00006"	"2012-04-16 11:46:54"	""	""	"SEQ"	"DNA"	""	""
"0000002141"	"00001882"	"1"	"00025"	"00006"	"2012-04-16 11:52:09"	""	""	"SEQ"	"DNA"	""	""
"0000002144"	"00001885"	"1"	"00025"	"00006"	"2012-04-16 12:33:10"	""	""	"SEQ"	"DNA"	""	""
"0000002145"	"00001886"	"1"	"00025"	"00006"	"2012-04-16 12:40:16"	""	""	"SEQ"	"DNA"	""	""
"0000002148"	"00001889"	"1"	"00025"	"00006"	"2012-04-16 13:19:01"	""	""	"SEQ"	"DNA"	""	""
"0000002150"	"00001891"	"1"	"00025"	"00006"	"2012-04-16 14:31:37"	""	""	"SEQ"	"DNA"	""	""
"0000002152"	"00001893"	"1"	"00025"	"00006"	"2012-04-16 14:43:32"	""	""	"SEQ"	"DNA"	""	""
"0000002154"	"00001895"	"1"	"00025"	"00006"	"2012-04-16 15:42:59"	""	""	"SEQ"	"DNA"	""	""
"0000002155"	"00001902"	"1"	"00025"	"00006"	"2012-05-18 12:39:10"	""	""	"SEQ"	"DNA"	""	""
"0000002157"	"00001904"	"1"	"00025"	"00006"	"2012-05-18 13:08:25"	""	""	"SEQ"	"DNA"	""	""
"0000002158"	"00001905"	"1"	"00025"	"00006"	"2012-05-18 13:18:03"	""	""	"SEQ"	"DNA"	""	""
"0000002161"	"00001908"	"1"	"00025"	"00006"	"2010-03-12 13:41:13"	""	""	"SEQ"	"DNA"	""	""
"0000002164"	"00001911"	"1"	"00025"	"00006"	"2010-03-15 16:16:49"	""	""	"SEQ"	"DNA"	""	""
"0000002166"	"00001913"	"1"	"00025"	"00006"	"2010-03-18 15:46:00"	""	""	"SEQ"	"DNA"	""	""
"0000002171"	"00001918"	"1"	"00025"	"00006"	"2010-03-24 18:09:16"	""	""	"SEQ"	"DNA"	""	""
"0000002172"	"00001919"	"1"	"00025"	"00006"	"2010-03-24 18:16:04"	""	""	"SEQ"	"DNA"	""	""
"0000002173"	"00001920"	"1"	"00025"	"00006"	"2010-03-24 18:23:47"	""	""	"SEQ"	"DNA"	""	""
"0000002175"	"00001922"	"1"	"00025"	"00006"	"2010-03-25 17:54:24"	""	""	"SEQ"	"DNA"	""	""
"0000002182"	"00001929"	"1"	"00025"	"00006"	"2010-04-21 12:39:28"	""	""	"SEQ"	"DNA"	""	""
"0000002184"	"00001931"	"1"	"00025"	"00006"	"2010-04-21 14:23:34"	""	""	"SEQ"	"DNA"	""	""
"0000002185"	"00001932"	"1"	"00025"	"00006"	"2010-04-21 14:32:08"	""	""	"SEQ"	"DNA"	""	""
"0000002197"	"00001944"	"1"	"00025"	"00006"	"2012-04-16 12:23:54"	""	""	"SEQ"	"DNA"	""	""
"0000002200"	"00001947"	"1"	"00025"	"00006"	"2012-04-16 13:09:17"	""	""	"SEQ"	"DNA"	""	""
"0000002201"	"00001948"	"1"	"00025"	"00006"	"2012-04-16 13:19:01"	""	""	"SEQ"	"DNA"	""	""
"0000002206"	"00001953"	"1"	"00025"	"00006"	"2012-04-16 14:48:10"	""	""	"SEQ"	"DNA"	""	""
"0000002208"	"00001958"	"1"	"00025"	"00006"	"2010-03-11 10:42:00"	""	""	"SEQ"	"DNA"	""	""
"0000002209"	"00001964"	"1"	"00025"	"00006"	"2010-03-12 13:41:13"	""	""	"SEQ"	"DNA"	""	""
"0000002210"	"00001966"	"1"	"00025"	"00006"	"2010-03-15 14:55:04"	""	""	"SEQ"	"DNA"	""	""
"0000002211"	"00001971"	"1"	"00025"	"00006"	"2010-03-15 16:16:49"	""	""	"SEQ"	"DNA"	""	""
"0000002212"	"00001995"	"1"	"00025"	"00006"	"2010-03-24 18:09:16"	""	""	"SEQ"	"DNA"	""	""
"0000002213"	"00002002"	"1"	"00025"	"00006"	"2010-03-25 17:54:24"	""	""	"SEQ"	"DNA"	""	""
"0000002214"	"00002004"	"1"	"00025"	"00006"	"2010-03-25 18:20:02"	""	""	"SEQ"	"DNA"	""	""
"0000002215"	"00002009"	"1"	"00025"	"00006"	"2010-03-29 17:46:43"	""	""	"SEQ"	"DNA"	""	""
"0000002216"	"00002013"	"1"	"00025"	"00006"	"2010-03-29 18:13:43"	""	""	"SEQ"	"DNA"	""	""
"0000002217"	"00002028"	"1"	"00025"	"00006"	"2010-04-21 12:39:28"	""	""	"SEQ"	"DNA"	""	""
"0000002218"	"00002031"	"1"	"00025"	"00006"	"2010-04-21 14:23:34"	""	""	"SEQ"	"DNA"	""	""
"0000002219"	"00002032"	"1"	"00025"	"00006"	"2010-04-21 14:32:08"	""	""	"SEQ"	"DNA"	""	""
"0000002220"	"00002033"	"1"	"00025"	"00006"	"2010-04-21 14:38:18"	""	""	"SEQ"	"DNA"	""	""
"0000002221"	"00002047"	"1"	"00025"	"00006"	"2010-04-26 17:29:18"	""	""	"SEQ"	"DNA"	""	""
"0000002222"	"00002086"	"1"	"00025"	"00006"	"2012-04-16 11:39:32"	""	""	"SEQ"	"DNA"	""	""
"0000002223"	"00002087"	"1"	"00025"	"00006"	"2012-04-16 11:46:54"	""	""	"SEQ"	"DNA"	""	""
"0000002226"	"00002094"	"1"	"00025"	"00006"	"2012-04-16 13:09:17"	""	""	"SEQ"	"DNA"	""	""
"0000002227"	"00002095"	"1"	"00025"	"00006"	"2012-04-16 13:19:01"	""	""	"SEQ"	"DNA"	""	""
"0000002228"	"00002100"	"1"	"00025"	"00006"	"2012-04-16 14:48:10"	""	""	"SEQ"	"DNA"	""	""
"0000045254"	"00045149"	"1"	"00006"	"00006"	"2015-07-03 12:13:09"	""	""	"SEQ"	"DNA;RNA"	""	""
"0000045255"	"00045150"	"1"	"00006"	"00006"	"2015-07-03 12:20:35"	""	""	"SEQ"	"DNA;RNA"	""	""
"0000045256"	"00045151"	"1"	"00006"	"00006"	"2015-07-03 12:29:00"	""	""	"SEQ"	"DNA;RNA"	""	""
"0000103921"	"00103464"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103922"	"00103465"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103927"	"00103470"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103929"	"00103472"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103930"	"00103473"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103936"	"00103479"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103937"	"00103480"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103939"	"00103482"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103940"	"00103483"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103943"	"00103486"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103944"	"00103487"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103947"	"00103490"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103948"	"00103491"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103950"	"00103493"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103952"	"00103495"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103958"	"00103501"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103960"	"00103503"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103961"	"00103504"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103962"	"00103505"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103965"	"00103508"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103977"	"00103520"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103980"	"00103523"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103982"	"00103525"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103983"	"00103526"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103984"	"00103527"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103987"	"00103530"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103989"	"00103532"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103991"	"00103534"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103995"	"00103538"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000103999"	"00103542"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104000"	"00103543"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104002"	"00103545"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104008"	"00103551"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104011"	"00103554"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104016"	"00103559"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104019"	"00103562"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104024"	"00103567"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104025"	"00103568"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104026"	"00103569"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104031"	"00103574"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104033"	"00103576"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104037"	"00103580"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104044"	"00103587"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104052"	"00103595"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104053"	"00103596"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104054"	"00103597"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104055"	"00103598"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104059"	"00103602"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104060"	"00103603"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104061"	"00103604"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104063"	"00103606"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104067"	"00103610"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104068"	"00103611"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104069"	"00103612"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104070"	"00103613"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ-NG"	"DNA"	""	""
"0000104071"	"00103614"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104072"	"00103615"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104075"	"00103618"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104080"	"00103623"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104082"	"00103625"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104083"	"00103626"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000104086"	"00103629"	"1"	"01957"	"00006"	"2017-04-11 15:22:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000205256"	"00204227"	"1"	"02991"	"02991"	"2012-08-07 12:52:57"	""	""	"SEQ"	"DNA"	""	""
"0000293319"	"00292151"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000293320"	"00292152"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000293321"	"00292153"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000305794"	"00304665"	"1"	"03575"	"00006"	"2020-06-24 11:55:42"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000472368"	"00470701"	"1"	"00006"	"00006"	"2025-12-05 11:16:06"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000472371"	"00470704"	"1"	"00006"	"00006"	"2025-12-05 11:16:06"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 189
"{{screeningid}}"	"{{geneid}}"
"0000002090"	"APOE"
"0000002091"	"APOE"
"0000002095"	"APOE"
"0000002099"	"APOE"
"0000002111"	"APOE"
"0000002113"	"APOE"
"0000002114"	"APOE"
"0000002116"	"APOE"
"0000002119"	"APOE"
"0000002120"	"APOE"
"0000002121"	"APOE"
"0000002122"	"APOE"
"0000002125"	"APOE"
"0000002127"	"APOE"
"0000002133"	"APOE"
"0000002135"	"APOE"
"0000002138"	"APOE"
"0000002140"	"APOE"
"0000002141"	"APOE"
"0000002144"	"APOE"
"0000002145"	"APOE"
"0000002148"	"APOE"
"0000002150"	"APOE"
"0000002152"	"APOE"
"0000002154"	"APOE"
"0000002155"	"APOE"
"0000002157"	"APOE"
"0000002158"	"APOE"
"0000002161"	"APOE"
"0000002164"	"APOE"
"0000002166"	"APOE"
"0000002171"	"APOE"
"0000002172"	"APOE"
"0000002173"	"APOE"
"0000002175"	"APOE"
"0000002182"	"APOE"
"0000002184"	"APOE"
"0000002185"	"APOE"
"0000002197"	"APOE"
"0000002200"	"APOE"
"0000002201"	"APOE"
"0000002206"	"APOE"
"0000002208"	"APOE"
"0000002209"	"APOE"
"0000002210"	"APOE"
"0000002211"	"APOE"
"0000002212"	"APOE"
"0000002213"	"APOE"
"0000002214"	"APOE"
"0000002215"	"APOE"
"0000002216"	"APOE"
"0000002217"	"APOE"
"0000002218"	"APOE"
"0000002219"	"APOE"
"0000002220"	"APOE"
"0000002221"	"APOE"
"0000002222"	"APOE"
"0000002223"	"APOE"
"0000002226"	"APOE"
"0000002227"	"APOE"
"0000002228"	"APOE"
"0000045254"	"APOE"
"0000045255"	"APOE"
"0000045256"	"APOE"
"0000103921"	"APOE"
"0000103921"	"SORL1"
"0000103922"	"APOE"
"0000103922"	"SORL1"
"0000103927"	"APOE"
"0000103927"	"SORL1"
"0000103929"	"APOE"
"0000103929"	"SORL1"
"0000103930"	"APOE"
"0000103930"	"SORL1"
"0000103936"	"APOE"
"0000103936"	"SORL1"
"0000103937"	"APOE"
"0000103937"	"SORL1"
"0000103939"	"APOE"
"0000103939"	"SORL1"
"0000103940"	"APOE"
"0000103940"	"SORL1"
"0000103943"	"APOE"
"0000103943"	"SORL1"
"0000103944"	"APOE"
"0000103944"	"SORL1"
"0000103947"	"APOE"
"0000103947"	"SORL1"
"0000103948"	"APOE"
"0000103948"	"SORL1"
"0000103950"	"APOE"
"0000103950"	"SORL1"
"0000103952"	"APOE"
"0000103952"	"SORL1"
"0000103958"	"APOE"
"0000103958"	"SORL1"
"0000103960"	"APOE"
"0000103960"	"SORL1"
"0000103961"	"APOE"
"0000103961"	"SORL1"
"0000103962"	"APOE"
"0000103962"	"SORL1"
"0000103965"	"APOE"
"0000103965"	"SORL1"
"0000103977"	"APOE"
"0000103977"	"SORL1"
"0000103980"	"APOE"
"0000103980"	"SORL1"
"0000103982"	"APOE"
"0000103982"	"SORL1"
"0000103983"	"APOE"
"0000103983"	"SORL1"
"0000103984"	"APOE"
"0000103984"	"SORL1"
"0000103987"	"APOE"
"0000103987"	"SORL1"
"0000103989"	"APOE"
"0000103989"	"SORL1"
"0000103991"	"APOE"
"0000103991"	"SORL1"
"0000103995"	"APOE"
"0000103995"	"SORL1"
"0000103999"	"APOE"
"0000103999"	"SORL1"
"0000104000"	"APOE"
"0000104000"	"SORL1"
"0000104002"	"APOE"
"0000104002"	"SORL1"
"0000104008"	"APOE"
"0000104008"	"SORL1"
"0000104011"	"APOE"
"0000104011"	"SORL1"
"0000104016"	"APOE"
"0000104016"	"SORL1"
"0000104019"	"APOE"
"0000104019"	"SORL1"
"0000104024"	"APOE"
"0000104024"	"SORL1"
"0000104025"	"APOE"
"0000104025"	"SORL1"
"0000104026"	"APOE"
"0000104026"	"SORL1"
"0000104031"	"APOE"
"0000104031"	"SORL1"
"0000104033"	"APOE"
"0000104033"	"SORL1"
"0000104037"	"APOE"
"0000104037"	"SORL1"
"0000104044"	"APOE"
"0000104044"	"SORL1"
"0000104052"	"APOE"
"0000104052"	"SORL1"
"0000104053"	"APOE"
"0000104053"	"SORL1"
"0000104054"	"APOE"
"0000104054"	"SORL1"
"0000104055"	"APOE"
"0000104055"	"SORL1"
"0000104059"	"APOE"
"0000104059"	"SORL1"
"0000104060"	"APOE"
"0000104060"	"SORL1"
"0000104061"	"APOE"
"0000104061"	"SORL1"
"0000104063"	"APOE"
"0000104063"	"SORL1"
"0000104067"	"APOE"
"0000104067"	"SORL1"
"0000104068"	"APOE"
"0000104068"	"SORL1"
"0000104069"	"APOE"
"0000104069"	"SORL1"
"0000104070"	"APOE"
"0000104070"	"SORL1"
"0000104071"	"APOE"
"0000104071"	"SORL1"
"0000104072"	"APOE"
"0000104072"	"SORL1"
"0000104075"	"APOE"
"0000104075"	"SORL1"
"0000104080"	"APOE"
"0000104080"	"SORL1"
"0000104082"	"APOE"
"0000104082"	"SORL1"
"0000104083"	"APOE"
"0000104083"	"SORL1"
"0000104086"	"APOE"
"0000104086"	"SORL1"
"0000205256"	"APOE"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 294
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000019563"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019564"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019565"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Krakowiak et al. 2000:10995508}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019566"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Neklason et al. 1999:10405455}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019567"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019568"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019569"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019570"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019571"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Yu et al. 2000:10814720}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019572"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019573"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Waterham et al. 2000:11111101}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019574"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019575"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019576"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019577"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019578"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Witsch-Baumgartner et al. 2000:10677299}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019579"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Witsch-Baumgartner et al. 2000:10677299}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019580"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019581"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019582"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019583"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019584"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019585"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Witsch-Baumgartner et al. 2000:10677299}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019586"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019587"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Witsch-Baumgartner et al. 2000:10677299}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019588"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019589"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019590"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019591"	"2"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019592"	"2"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019593"	"2"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019594"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019595"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019596"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Nowaczyk et al. (2001):11767235}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019597"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Witsch-Baumgartner et al. 2000:10677299}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019598"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019599"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019600"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019601"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019602"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019603"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019604"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019605"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Witsch-Baumgartner et al. 2001:11175299}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019606"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019607"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019608"	"2"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Witsch-Baumgartner et al. 2000:10677299}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019609"	"2"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Unknown"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019610"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Germline"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019611"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Germline"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019612"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Krakowiak et al. 2000:10995508}"	""	"apoE2"	""	"Germline"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019613"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Germline"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019614"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Witsch-Baumgartner et al. 2000:10677299}"	""	"apoE4"	""	"Germline"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019615"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Germline"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019616"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Germline"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019617"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Yu et al. 2000:10814720}"	""	"apoE4"	""	"Germline"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019618"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Germline"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019619"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Germline"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019620"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE2"	""	"Germline"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019621"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Germline"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019622"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE4"	""	"Germline"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019623"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Germline"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019624"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}, {PMID:Witsch-Baumgartner et al. 2008:17965227}"	""	"apoE2"	""	"Germline"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019625"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Germline"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019626"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Germline"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019627"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Germline"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019628"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Witsch-Baumgartner et al. 2001:11175299}"	""	"apoE4"	""	"Germline"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000019629"	"1"	"55"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00025"	"APOE_000002"	"g.45412079C>T"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE2"	""	"Germline"	"no"	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000019630"	"1"	"55"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00025"	"APOE_000001"	"g.45411941T>C"	""	"{PMID:Fitzky et al. 1998:9653161}"	""	"apoE4"	""	"Germline"	"no"	""	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000072980"	"1"	"11"	"19"	"45411941"	"45411941"	""	"0"	"00006"	"APOE_000000"	"g.45411941="	""	""	""	""	"reference haplotype apoE3"	"Germline"	"-"	"rs429358"	"0"	""	""	"g.44908684="	""	"benign"	""
"0000072981"	"1"	"11"	"19"	"45412079"	"45412079"	""	"0"	"00006"	"APOE_000000"	"g.45412079="	""	""	""	""	"reference haplotype apoE3"	"Germline"	"-"	"rs7412"	"0"	""	""	"g.44908822="	""	"benign"	""
"0000072982"	"1"	"50"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"00006"	"APOE_000002"	"g.45412079C>T"	""	"Reference Haplotype; {OMIM107741:0001}"	""	"Arg158Cys"	"reference haplotype apoE2"	"Germline"	"-"	"rs7412"	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000072984"	"1"	"50"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"00006"	"APOE_000001"	"g.45411941T>C"	""	"Reference Haplotype; {OMIM107741:0016}"	""	"Cys112Arg"	"reference haplotype apoE4"	"Germline"	"-"	"rs429358"	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000168633"	"3"	"50"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"01957"	"APOE_000002"	"g.45412079C>T"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000168634"	"1"	"50"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"01957"	"APOE_000002"	"g.45412079C>T"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000168635"	"1"	"50"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"01957"	"APOE_000002"	"g.45412079C>T"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000168636"	"1"	"50"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"01957"	"APOE_000002"	"g.45412079C>T"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000168637"	"1"	"50"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"01957"	"APOE_000002"	"g.45412079C>T"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000168638"	"1"	"50"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"01957"	"APOE_000002"	"g.45412079C>T"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000168639"	"1"	"50"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"01957"	"APOE_000002"	"g.45412079C>T"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000168640"	"1"	"50"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"01957"	"APOE_000002"	"g.45412079C>T"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000168641"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168642"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168643"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168644"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168645"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168646"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168647"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168648"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168649"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168650"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168651"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168652"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168653"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168654"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168655"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168656"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168657"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168658"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168659"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168660"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168661"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168662"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168663"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168664"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168665"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168666"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168667"	"3"	"10"	"19"	"45411941"	"45411941"	""	"0"	"01957"	"APOE_000000"	"g.45411941="	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684="	""	"benign"	""
"0000168668"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168669"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168670"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168671"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168672"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168673"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168674"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168675"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168676"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168677"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168678"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168679"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168680"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168681"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168682"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168683"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168684"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168685"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168686"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168687"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168688"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168689"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168690"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168691"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168692"	"1"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168693"	"3"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168694"	"3"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168695"	"2"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000168696"	"2"	"70"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"01957"	"APOE_000001"	"g.45411941T>C"	""	"{DOI:Holstege 2017:10.1038/ejhg.2017.87}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.44908684T>C"	""	"likely pathogenic"	""
"0000247630"	"0"	"90"	"19"	"45412043"	"45412043"	"subst"	"6.74445E-6"	"02330"	"APOE_000032"	"g.45412043A>C"	""	""	""	"APOE(NM_001302688.2):c.568A>C (p.K190Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44908786A>C"	""	"pathogenic"	""
"0000258241"	"0"	"30"	"19"	"45409113"	"45409113"	"subst"	"0.00139397"	"02330"	"APOE_000003"	"g.45409113C>T"	""	""	""	"APOE(NM_000041.4):c.-24+15C>T, APOE(NM_001302688.2):c.-13C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44905856C>T"	""	"likely benign"	""
"0000258242"	"0"	"10"	"19"	"45409167"	"45409167"	"subst"	"0.603854"	"02330"	"APOE_000005"	"g.45409167C>G"	""	""	""	"APOE(NM_000041.4):c.-24+69C>G, APOE(NM_001302688.2):c.42C>G (p.N14K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44905910C>G"	""	"benign"	""
"0000258243"	"0"	"30"	"19"	"45412509"	"45412509"	"subst"	"0.000114406"	"02330"	"APOE_000031"	"g.45412509C>T"	""	""	""	"APOE(NM_001302688.2):c.*2C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44909252C>T"	""	"likely benign"	""
"0000258244"	"0"	"50"	"19"	"45409916"	"45409916"	"subst"	"4.06075E-6"	"02330"	"APOE_000007"	"g.45409916T>A"	""	""	""	"APOE(NM_001302688.2):c.113T>A (p.F38Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44906659T>A"	""	"VUS"	""
"0000258245"	"0"	"30"	"19"	"45409136"	"45409136"	"subst"	"0.00033553"	"02330"	"APOE_000004"	"g.45409136G>A"	""	""	""	"APOE(NM_001302688.2):c.11G>A (p.G4E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44905879G>A"	""	"likely benign"	""
"0000258246"	"0"	"10"	"19"	"45410002"	"45410002"	"subst"	"0"	"02330"	"APOE_000008"	"g.45410002G>A"	""	""	""	"APOE(NM_001302688.2):c.121+78G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44906745G>A"	""	"benign"	""
"0000258247"	"0"	"30"	"19"	"45411042"	"45411042"	"subst"	"0.000205628"	"02330"	"APOE_000009"	"g.45411042G>A"	""	""	""	"APOE(NM_001302688.2):c.147G>A (p.A49=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44907785G>A"	""	"likely benign"	""
"0000258248"	"0"	"10"	"19"	"45411093"	"45411093"	"subst"	"3.66709E-5"	"02330"	"APOE_000010"	"g.45411093C>T"	""	""	""	"APOE(NM_000041.4):c.120C>T (p.S40=), APOE(NM_001302688.2):c.198C>T (p.S66=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44907836C>T"	""	"benign"	""
"0000258249"	"0"	"30"	"19"	"45411110"	"45411110"	"subst"	"0.00256287"	"02330"	"APOE_000011"	"g.45411110T>C"	""	""	""	"APOE(NM_000041.4):c.137T>C (p.L46P), APOE(NM_001302688.2):c.215T>C (p.L72P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44907853T>C"	""	"likely benign"	""
"0000258250"	"0"	"50"	"19"	"45411165"	"45411165"	"subst"	"0.000134275"	"02330"	"APOE_000012"	"g.45411165G>C"	""	""	""	"APOE(NM_001302688.2):c.270G>C (p.Q90H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44907908G>C"	""	"VUS"	""
"0000258251"	"0"	"10"	"19"	"45411774"	"45411777"	"del"	"0"	"02330"	"APOE_000013"	"g.45411774_45411777del"	""	""	""	"APOE(NM_000041.4):c.237-16_237-13delGCCC, APOE(NM_001302688.2):c.315-16_315-13delGCCC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44908517_44908520del"	""	"benign"	""
"0000258252"	"0"	"50"	"19"	"45411840"	"45411840"	"subst"	"0"	"02330"	"APOE_000014"	"g.45411840T>C"	""	""	""	"APOE(NM_001302688.2):c.365T>C (p.L122P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44908583T>C"	""	"VUS"	""
"0000258253"	"0"	"50"	"19"	"45411963"	"45411963"	"subst"	"1.97545E-5"	"02330"	"APOE_000016"	"g.45411963G>A"	""	""	""	"APOE(NM_001302688.2):c.488G>A (p.R163H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44908706G>A"	""	"VUS"	""
"0000258255"	"0"	"50"	"19"	"45411987"	"45411987"	"subst"	"0.000150382"	"02330"	"APOE_000017"	"g.45411987G>A"	""	""	""	"APOE(NM_000041.4):c.434G>A (p.G145D), APOE(NM_001302688.2):c.512G>A (p.G171D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44908730G>A"	""	"VUS"	""
"0000258256"	"0"	"50"	"19"	"45412004"	"45412004"	"subst"	"0"	"02330"	"APOE_000018"	"g.45412004C>A"	""	""	""	"APOE(NM_001302688.2):c.529C>A (p.L177M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44908747C>A"	""	"VUS"	""
"0000258257"	"0"	"50"	"19"	"45412008"	"45412008"	"subst"	"0"	"02330"	"APOE_000019"	"g.45412008G>A"	""	""	""	"APOE(NM_000041.4):c.455G>A (p.(Arg152Gln), p.R152Q), APOE(NM_001302688.2):c.533G>A (p.R178Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44908751G>A"	""	"VUS"	""
"0000258258"	"0"	"30"	"19"	"45412016"	"45412016"	"subst"	"0"	"02330"	"APOE_000020"	"g.45412016C>G"	""	""	""	"APOE(NM_001302688.2):c.541C>G (p.L181V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44908759C>G"	""	"likely benign"	""
"0000258259"	"0"	"50"	"19"	"45412032"	"45412032"	"subst"	"0"	"02330"	"APOE_000021"	"g.45412032G>A"	""	""	""	"APOE(NM_001302688.2):c.557G>A (p.R186H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44908775G>A"	""	"VUS"	""
"0000258260"	"0"	"50"	"19"	"45409180"	"45409180"	"subst"	"0.000538706"	"02330"	"APOE_000006"	"g.45409180G>A"	""	""	""	"APOE(NM_000041.4):c.-24+82G>A, APOE(NM_001302688.2):c.55G>A (p.D19N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44905923G>A"	""	"VUS"	""
"0000258263"	"0"	"10"	"19"	"45412108"	"45412108"	"subst"	"5.7771E-5"	"02330"	"APOE_000023"	"g.45412108C>T"	""	""	""	"APOE(NM_001302688.2):c.633C>T (p.R211=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44908851C>T"	""	"benign"	""
"0000258264"	"0"	"10"	"19"	"45412204"	"45412204"	"subst"	"0.00113729"	"02330"	"APOE_000024"	"g.45412204C>T"	""	""	""	"APOE(NM_000041.4):c.651C>T (p.A217=), APOE(NM_001302688.2):c.729C>T (p.A243=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44908947C>T"	""	"benign"	""
"0000258265"	"0"	"30"	"19"	"45412252"	"45412252"	"subst"	"0"	"02330"	"APOE_000025"	"g.45412252C>T"	""	""	""	"APOE(NM_001302688.2):c.777C>T (p.R259=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44908995C>T"	""	"likely benign"	""
"0000258266"	"0"	"10"	"19"	"45412314"	"45412314"	"subst"	"0.000453958"	"02330"	"APOE_000026"	"g.45412314T>A"	""	""	""	"APOE(NM_001302688.2):c.839T>A (p.V280E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44909057T>A"	""	"benign"	""
"0000258267"	"0"	"30"	"19"	"45412339"	"45412339"	"subst"	"0.000324254"	"02330"	"APOE_000027"	"g.45412339G>A"	""	""	""	"APOE(NM_001302688.2):c.864G>A (p.E288=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44909082G>A"	""	"likely benign"	""
"0000258268"	"0"	"50"	"19"	"45412358"	"45412358"	"subst"	"0.000394645"	"02330"	"APOE_000028"	"g.45412358C>G"	""	""	""	"APOE(NM_001302688.2):c.883C>G (p.R295G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44909101C>G"	""	"VUS"	""
"0000258269"	"0"	"50"	"19"	"45412376"	"45412376"	"subst"	"0"	"02330"	"APOE_000029"	"g.45412376T>G"	""	""	""	"APOE(NM_001302688.2):c.901T>G (p.F301V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44909119T>G"	""	"VUS"	""
"0000258270"	"0"	"10"	"19"	"45412408"	"45412408"	"subst"	"0"	"02330"	"APOE_000030"	"g.45412408C>G"	""	""	""	"APOE(NM_001302688.2):c.933C>G (p.P311=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44909151C>G"	""	"benign"	""
"0000258790"	"0"	"10"	"19"	"45409167"	"45409167"	"subst"	"0.603854"	"02325"	"APOE_000005"	"g.45409167C>G"	""	""	""	"APOE(NM_000041.4):c.-24+69C>G, APOE(NM_001302688.2):c.42C>G (p.N14K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44905910C>G"	""	"benign"	""
"0000260148"	"0"	"10"	"19"	"45409167"	"45409167"	"subst"	"0.603854"	"02329"	"APOE_000005"	"g.45409167C>G"	""	""	""	"APOE(NM_000041.4):c.-24+69C>G, APOE(NM_001302688.2):c.42C>G (p.N14K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44905910C>G"	""	"benign"	""
"0000260151"	"0"	"30"	"19"	"45412314"	"45412314"	"subst"	"0.000453958"	"02329"	"APOE_000026"	"g.45412314T>A"	""	""	""	"APOE(NM_001302688.2):c.839T>A (p.V280E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.44909057T>A"	""	"likely benign"	""
"0000426592"	"10"	"95"	"19"	"45412053"	"45412055"	"del"	"0"	"02991"	"APOE_000033"	"g.45412053_45412055del"	""	""	""	"500_502delTCC"	""	"Germline"	""	""	"0"	""	""	"g.44908796_44908798del"	""	"pathogenic"	""
"0000567628"	"0"	"30"	"19"	"45409118"	"45409118"	"subst"	"2.22354E-5"	"02330"	"APOE_000034"	"g.45409118G>A"	""	""	""	"APOE(NM_001302688.2):c.-8G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44905861G>A"	""	"likely benign"	""
"0000567629"	"0"	"30"	"19"	"45411042"	"45411042"	"subst"	"0.000205628"	"02329"	"APOE_000009"	"g.45411042G>A"	""	""	""	"APOE(NM_001302688.2):c.147G>A (p.A49=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907785G>A"	""	"likely benign"	""
"0000567630"	"0"	"30"	"19"	"45411057"	"45411057"	"subst"	"3.27514E-5"	"02330"	"APOE_000035"	"g.45411057G>A"	""	""	""	"APOE(NM_001302688.2):c.162G>A (p.P54=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907800G>A"	""	"likely benign"	""
"0000567631"	"0"	"30"	"19"	"45411063"	"45411063"	"subst"	"0.000118553"	"02330"	"APOE_000036"	"g.45411063C>G"	""	""	""	"APOE(NM_001302688.2):c.168C>G (p.P56=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907806C>G"	""	"likely benign"	""
"0000567632"	"0"	"50"	"19"	"45411064"	"45411064"	"subst"	"0.000130707"	"02330"	"APOE_000037"	"g.45411064G>A"	""	""	""	"APOE(NM_001302688.2):c.169G>A (p.E57K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907807G>A"	""	"VUS"	""
"0000567633"	"0"	"30"	"19"	"45411077"	"45411077"	"subst"	"0"	"02329"	"APOE_000038"	"g.45411077A>C"	""	""	""	"APOE(NM_001302688.2):c.182A>C (p.Q61P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907820A>C"	""	"likely benign"	""
"0000567634"	"0"	"50"	"19"	"45411110"	"45411110"	"subst"	"0.00256287"	"02325"	"APOE_000011"	"g.45411110T>C"	""	""	""	"APOE(NM_000041.4):c.137T>C (p.L46P), APOE(NM_001302688.2):c.215T>C (p.L72P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907853T>C"	""	"VUS"	""
"0000567635"	"0"	"30"	"19"	"45411171"	"45411171"	"subst"	"0"	"02330"	"APOE_000039"	"g.45411171G>A"	""	""	""	"APOE(NM_001302688.2):c.276G>A (p.Q92=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907914G>A"	""	"likely benign"	""
"0000567636"	"0"	"50"	"19"	"45411179"	"45411179"	"subst"	"8.141E-6"	"02330"	"APOE_000040"	"g.45411179T>C"	""	""	""	"APOE(NM_001302688.2):c.284T>C (p.L95P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907922T>C"	""	"VUS"	""
"0000567637"	"0"	"30"	"19"	"45411934"	"45411934"	"subst"	"1.17629E-5"	"02330"	"APOE_000041"	"g.45411934G>A"	""	""	""	"APOE(NM_001302688.2):c.459G>A (p.E153=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908677G>A"	""	"likely benign"	""
"0000567640"	"0"	"70"	"19"	"45411968"	"45411988"	"dup"	"0"	"02330"	"APOE_000042"	"g.45411968_45411988dup"	""	""	""	"APOE(NM_001302688.2):c.493_513dupGAGGTGCAGGCCATGCTCGGC (p.E165_G171dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908711_44908731dup"	""	"likely pathogenic"	""
"0000567641"	"0"	"50"	"19"	"45412000"	"45412000"	"subst"	"0"	"02330"	"APOE_000043"	"g.45412000G>C"	""	""	""	"APOE(NM_001302688.2):c.525G>C (p.E175D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908743G>C"	""	"VUS"	""
"0000567642"	"0"	"90"	"19"	"45412013"	"45412013"	"subst"	"0"	"02330"	"APOE_000044"	"g.45412013C>A"	""	""	""	"APOE(NM_001302688.2):c.538C>A (p.R180S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908756C>A"	""	"pathogenic"	""
"0000567643"	"0"	"90"	"19"	"45412013"	"45412013"	"subst"	"0"	"02330"	"APOE_000045"	"g.45412013C>T"	""	""	""	"APOE(NM_001302688.2):c.538C>T (p.R180C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908756C>T"	""	"pathogenic"	""
"0000567644"	"0"	"90"	"19"	"45412014"	"45412014"	"subst"	"0"	"02330"	"APOE_000046"	"g.45412014G>A"	""	""	""	"APOE(NM_000041.4):c.461G>A (p.R154H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908757G>A"	""	"pathogenic"	""
"0000567645"	"0"	"30"	"19"	"45412060"	"45412060"	"subst"	"0"	"02330"	"APOE_000047"	"g.45412060T>C"	""	""	""	"APOE(NM_001302688.2):c.585T>C (p.D195=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908803T>C"	""	"likely benign"	""
"0000567646"	"0"	"50"	"19"	"45412158"	"45412158"	"subst"	"0"	"02330"	"APOE_000048"	"g.45412158T>C"	""	""	""	"APOE(NM_001302688.2):c.683T>C (p.L228P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908901T>C"	""	"VUS"	""
"0000567647"	"0"	"30"	"19"	"45412180"	"45412180"	"subst"	"0.00013036"	"02330"	"APOE_000049"	"g.45412180G>A"	""	""	""	"APOE(NM_001302688.2):c.705G>A (p.R235=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908923G>A"	""	"likely benign"	""
"0000567648"	"0"	"50"	"19"	"45412244"	"45412244"	"subst"	"0"	"02330"	"APOE_000050"	"g.45412244C>T"	""	""	""	"APOE(NM_001302688.2):c.769C>T (p.R257W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908987C>T"	""	"VUS"	""
"0000567649"	"0"	"50"	"19"	"45412298"	"45412298"	"subst"	"6.76105E-6"	"02330"	"APOE_000051"	"g.45412298G>A"	""	""	""	"APOE(NM_001302688.2):c.823G>A (p.E275K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44909041G>A"	""	"VUS"	""
"0000567650"	"0"	"30"	"19"	"45412339"	"45412339"	"subst"	"0.000324254"	"02329"	"APOE_000027"	"g.45412339G>A"	""	""	""	"APOE(NM_001302688.2):c.864G>A (p.E288=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44909082G>A"	""	"likely benign"	""
"0000567651"	"0"	"30"	"19"	"45412360"	"45412360"	"subst"	"5.06509E-6"	"02330"	"APOE_000052"	"g.45412360C>G"	""	""	""	"APOE(NM_001302688.2):c.885C>G (p.R295=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44909103C>G"	""	"likely benign"	""
"0000567652"	"0"	"50"	"19"	"45412428"	"45412428"	"subst"	"0"	"02330"	"APOE_000053"	"g.45412428G>A"	""	""	""	"APOE(NM_001302688.2):c.953G>A (p.R318H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44909171G>A"	""	"VUS"	""
"0000567653"	"0"	"50"	"19"	"45412439"	"45412439"	"subst"	"1.36479E-5"	"02330"	"APOE_000054"	"g.45412439G>T"	""	""	""	"APOE(NM_001302688.2):c.964G>T (p.G322W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44909182G>T"	""	"VUS"	""
"0000567654"	"0"	"10"	"19"	"45412477"	"45412477"	"subst"	"0"	"02330"	"APOE_000055"	"g.45412477C>T"	""	""	""	"APOE(NM_001302688.2):c.1002C>T (p.S334=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44909220C>T"	""	"benign"	""
"0000567655"	"0"	"30"	"19"	"45412520"	"45412520"	"subst"	"9.17271E-6"	"02330"	"APOC1_000001"	"g.45412520G>A"	""	""	""	"APOE(NM_001302688.2):c.*13G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44909263G>A"	""	"likely benign"	""
"0000617674"	"0"	"50"	"19"	"45409917"	"45409917"	"subst"	"8.1215E-6"	"02330"	"APOE_000057"	"g.45409917C>A"	""	""	""	"APOE(NM_001302688.2):c.114C>A (p.F38L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44906660C>A"	""	"VUS"	""
"0000617675"	"0"	"50"	"19"	"45411061"	"45411061"	"subst"	"0"	"02330"	"APOE_000058"	"g.45411061C>A"	""	""	""	"APOE(NM_001302688.2):c.166C>A (p.P56T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907804C>A"	""	"VUS"	""
"0000617676"	"0"	"30"	"19"	"45411138"	"45411138"	"subst"	"3.25288E-5"	"02330"	"APOE_000059"	"g.45411138G>C"	""	""	""	"APOE(NM_001302688.2):c.243G>C (p.L81=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907881G>C"	""	"likely benign"	""
"0000617677"	"0"	"30"	"19"	"45411221"	"45411221"	"del"	"0"	"02330"	"APOE_000061"	"g.45411221del"	""	""	""	"APOE(NM_001302688.2):c.314+12delC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907964del"	""	"likely benign"	""
"0000617678"	"0"	"30"	"19"	"45411774"	"45411777"	"del"	"0"	"02329"	"APOE_000013"	"g.45411774_45411777del"	""	""	""	"APOE(NM_000041.4):c.237-16_237-13delGCCC, APOE(NM_001302688.2):c.315-16_315-13delGCCC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908517_44908520del"	""	"likely benign"	""
"0000617679"	"0"	"30"	"19"	"45411793"	"45411793"	"subst"	"2.46496E-5"	"02330"	"APOE_000062"	"g.45411793G>A"	""	""	""	"APOE(NM_001302688.2):c.318G>A (p.A106=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908536G>A"	""	"likely benign"	""
"0000617680"	"0"	"50"	"19"	"45412272"	"45412272"	"subst"	"0"	"02330"	"APOE_000066"	"g.45412272G>A"	""	""	""	"APOE(NM_001302688.2):c.797G>A (p.G266D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44909015G>A"	""	"VUS"	""
"0000617681"	"0"	"50"	"19"	"45412435"	"45412435"	"subst"	"0"	"02330"	"APOE_000068"	"g.45412435G>T"	""	""	""	"APOE(NM_001302688.2):c.960G>T (p.W320C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44909178G>T"	""	"VUS"	""
"0000617682"	"0"	"50"	"19"	"45412436"	"45412436"	"subst"	"0"	"02330"	"APOE_000069"	"g.45412436G>A"	""	""	""	"APOE(NM_001302688.2):c.961G>A (p.A321T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44909179G>A"	""	"VUS"	""
"0000624024"	"0"	"10"	"19"	"45409579"	"45409579"	"subst"	"0"	"02330"	"APOE_000056"	"g.45409579C>T"	""	""	""	"APOE(NM_001302688.2):c.56-280C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44906322C>T"	""	"benign"	""
"0000624025"	"0"	"50"	"19"	"45411077"	"45411077"	"subst"	"0"	"02330"	"APOE_000038"	"g.45411077A>C"	""	""	""	"APOE(NM_001302688.2):c.182A>C (p.Q61P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907820A>C"	""	"VUS"	""
"0000624026"	"0"	"50"	"19"	"45411165"	"45411165"	"subst"	"0"	"02330"	"APOE_000060"	"g.45411165G>T"	""	""	""	"APOE(NM_001302688.2):c.270G>T (p.Q90H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907908G>T"	""	"VUS"	""
"0000624028"	"0"	"50"	"19"	"45411948"	"45411948"	"subst"	"0"	"02330"	"APOE_000063"	"g.45411948G>A"	""	""	""	"APOE(NM_001302688.2):c.473G>A (p.R158H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908691G>A"	""	"VUS"	""
"0000624029"	"0"	"30"	"19"	"45411952"	"45411952"	"subst"	"0"	"02330"	"APOE_000064"	"g.45411952G>A"	""	""	""	"APOE(NM_001302688.2):c.477G>A (p.L159=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908695G>A"	""	"likely benign"	""
"0000624030"	"0"	"30"	"19"	"45412129"	"45412129"	"subst"	"0"	"02330"	"APOE_000065"	"g.45412129C>T"	""	""	""	"APOE(NM_001302688.2):c.654C>T (p.L218=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908872C>T"	""	"likely benign"	""
"0000624031"	"0"	"50"	"19"	"45412402"	"45412402"	"subst"	"0"	"02330"	"APOE_000067"	"g.45412402C>G"	""	""	""	"APOE(NM_001302688.2):c.927C>G (p.F309L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44909145C>G"	""	"VUS"	""
"0000624032"	"0"	"30"	"19"	"45412532"	"45412532"	"subst"	"0.000911843"	"02330"	"APOC1_000002"	"g.45412532C>T"	""	""	""	"APOE(NM_001302688.2):c.*25C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44909275C>T"	""	"likely benign"	""
"0000650008"	"1"	"50"	"19"	"45411902"	"45411902"	"subst"	"0"	"03575"	"APOE_000070"	"g.45411902G>A"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"no interpretation available; 1 heterozygous, no homozygous; {DB:CLININrs28931577}"	"Germline"	""	"rs28931577"	"0"	""	""	"g.44908645G>A"	""	"VUS"	""
"0000650009"	"1"	"50"	"19"	"45411941"	"45411941"	"subst"	"0.138354"	"03575"	"APOE_000001"	"g.45411941T>C"	"1/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"risk factor; 1 heterozygous, no homozygous; {DB:CLININrs429358}"	"Germline"	""	"rs429358"	"0"	""	""	"g.44908684T>C"	""	"VUS"	""
"0000650010"	"1"	"50"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"03575"	"APOE_000002"	"g.45412079C>T"	"195/2780 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"drug response; 195 heterozygous; {DB:CLININrs7412}"	"Germline"	""	"rs7412"	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000658598"	"0"	"30"	"19"	"45410911"	"45410911"	"subst"	"0"	"02330"	"APOE_000071"	"g.45410911T>G"	""	""	""	"APOE(NM_001302688.2):c.122-106T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44907654T>G"	""	"likely benign"	""
"0000658599"	"0"	"50"	"19"	"45411832"	"45411832"	"subst"	"4.09199E-6"	"02330"	"APOE_000072"	"g.45411832A>C"	""	""	""	"APOE(NM_001302688.2):c.357A>C (p.K119N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908575A>C"	""	"VUS"	""
"0000658600"	"0"	"70"	"19"	"45412053"	"45412055"	"del"	"0"	"02330"	"APOE_000033"	"g.45412053_45412055del"	""	""	""	"APOE(NM_001302688.2):c.578_580delTCC (p.L193del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908796_44908798del"	""	"likely pathogenic"	""
"0000658601"	"0"	"70"	"19"	"45412166"	"45412166"	"subst"	"0"	"02330"	"APOE_000073"	"g.45412166C>T"	""	""	""	"APOE(NM_001302688.2):c.691C>T (p.Q231*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44908909C>T"	""	"likely pathogenic"	""
"0000658602"	"0"	"30"	"19"	"45412409"	"45412409"	"subst"	"4.48077E-6"	"02330"	"APOE_000074"	"g.45412409C>T"	""	""	""	"APOE(NM_001302688.2):c.934C>T (p.L312=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.44909152C>T"	""	"likely benign"	""
"0000669482"	"3"	"50"	"19"	"45412079"	"45412079"	"subst"	"0.0612197"	"03575"	"APOE_000002"	"g.45412079C>T"	"4/2780 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"drug response; 4 homozygous; {DB:CLININrs7412}"	"Germline"	""	"rs7412"	"0"	""	""	"g.44908822C>T"	""	"VUS"	""
"0000681442"	"0"	"30"	"19"	"45409802"	"45409802"	"subst"	"0"	"02330"	"APOE_000075"	"g.45409802G>A"	""	""	""	"APOE(NM_001302688.2):c.56-57G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000681443"	"0"	"30"	"19"	"45410273"	"45410273"	"subst"	"0"	"02330"	"APOE_000076"	"g.45410273G>A"	""	""	""	"APOE(NM_001302688.2):c.121+349G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000681444"	"0"	"30"	"19"	"45412300"	"45412300"	"subst"	"1.99566E-5"	"02330"	"APOE_000077"	"g.45412300G>A"	""	""	""	"APOE(NM_001302688.2):c.825G>A (p.E275=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000681445"	"0"	"30"	"19"	"45412495"	"45412495"	"subst"	"5.48336E-5"	"02330"	"APOE_000078"	"g.45412495C>T"	""	""	""	"APOE(NM_001302688.2):c.1020C>T (p.S340=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000692825"	"0"	"30"	"19"	"45409433"	"45409433"	"dup"	"0"	"02330"	"APOE_000079"	"g.45409433dup"	""	""	""	"APOE(NM_001302688.2):c.55+253dupA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000692826"	"0"	"50"	"19"	"45409993"	"45409993"	"subst"	"0"	"02330"	"APOE_000080"	"g.45409993C>T"	""	""	""	"APOE(NM_001302688.2):c.121+69C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000692827"	"0"	"10"	"19"	"45410444"	"45410444"	"subst"	"0"	"02330"	"APOE_000081"	"g.45410444G>A"	""	""	""	"APOE(NM_001302688.2):c.121+520G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000692828"	"0"	"30"	"19"	"45411428"	"45411428"	"subst"	"0"	"02330"	"APOE_000082"	"g.45411428G>A"	""	""	""	"APOE(NM_001302688.2):c.314+219G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000692829"	"0"	"50"	"19"	"45412145"	"45412145"	"subst"	"0"	"02330"	"APOE_000083"	"g.45412145C>T"	""	""	""	"APOE(NM_001302688.2):c.670C>T (p.R224C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000727416"	"0"	"30"	"19"	"45411063"	"45411063"	"subst"	"0.000118553"	"02329"	"APOE_000036"	"g.45411063C>G"	""	""	""	"APOE(NM_001302688.2):c.168C>G (p.P56=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000727417"	"0"	"50"	"19"	"45411122"	"45411122"	"subst"	"4.06636E-6"	"02330"	"APOE_000084"	"g.45411122G>C"	""	""	""	"APOE(NM_001302688.2):c.227G>C (p.R76P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000727418"	"0"	"50"	"19"	"45411858"	"45411858"	"subst"	"2.89632E-5"	"02330"	"APOE_000085"	"g.45411858C>G"	""	""	""	"APOE(NM_000041.4):c.305C>G (p.(Pro102Arg)), APOE(NM_001302688.2):c.383C>G (p.P128R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000727419"	"0"	"50"	"19"	"45411893"	"45411893"	"dup"	"0"	"02330"	"APOE_000086"	"g.45411893dup"	""	""	""	"APOE(NM_001302688.2):c.418dupG (p.E140Gfs*51)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000727420"	"0"	"50"	"19"	"45412181"	"45412181"	"subst"	"0"	"02330"	"APOE_000087"	"g.45412181G>T"	""	""	""	"APOE(NM_001302688.2):c.706G>T (p.A236S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000727421"	"0"	"30"	"19"	"45412495"	"45412495"	"subst"	"5.48336E-5"	"02329"	"APOE_000078"	"g.45412495C>T"	""	""	""	"APOE(NM_001302688.2):c.1020C>T (p.S340=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000808916"	"0"	"30"	"19"	"45409417"	"45409417"	"subst"	"0"	"02330"	"APOE_000088"	"g.45409417C>A"	""	""	""	"APOE(NM_001302688.2):c.55+237C>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000808917"	"0"	"50"	"19"	"45411858"	"45411858"	"subst"	"0"	"02330"	"APOE_000089"	"g.45411858C>T"	""	""	""	"APOE(NM_001302688.2):c.383C>T (p.P128L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000808918"	"0"	"30"	"19"	"45411884"	"45411884"	"subst"	"0"	"02330"	"APOE_000090"	"g.45411884C>T"	""	""	""	"APOE(NM_001302688.2):c.409C>T (p.L137=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000808920"	"0"	"50"	"19"	"45411987"	"45411987"	"subst"	"0.000150382"	"02329"	"APOE_000017"	"g.45411987G>A"	""	""	""	"APOE(NM_000041.4):c.434G>A (p.G145D), APOE(NM_001302688.2):c.512G>A (p.G171D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000855610"	"0"	"50"	"19"	"45411041"	"45411041"	"subst"	"2.47355E-5"	"02330"	"APOE_000094"	"g.45411041C>T"	""	""	""	"APOE(NM_001302688.2):c.146C>T (p.A49V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000855611"	"0"	"50"	"19"	"45412493"	"45412493"	"subst"	"9.595E-5"	"02330"	"APOE_000098"	"g.45412493A>C"	""	""	""	"APOE(NM_001302688.2):c.1018A>C (p.S340R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866162"	"0"	"50"	"19"	"45409159"	"45409159"	"subst"	"1.4819E-5"	"02330"	"APOE_000091"	"g.45409159C>T"	""	""	""	"APOE(NM_001302688.2):c.34C>T (p.P12S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866163"	"0"	"30"	"19"	"45409608"	"45409608"	"subst"	"0"	"02330"	"APOE_000092"	"g.45409608A>C"	""	""	""	"APOE(NM_001302688.2):c.56-251A>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000866164"	"0"	"30"	"19"	"45409928"	"45409928"	"subst"	"0"	"02330"	"APOE_000093"	"g.45409928T>A"	""	""	""	"APOE(NM_001302688.2):c.121+4T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000866165"	"0"	"70"	"19"	"45412062"	"45412062"	"subst"	"0"	"02326"	"APOE_000095"	"g.45412062C>A"	""	""	""	"APOE(NM_000041.4):c.509C>A (p.A170D), APOE(NM_001302688.2):c.587C>A (p.A196D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000866166"	"0"	"50"	"19"	"45412466"	"45412466"	"subst"	"0"	"02330"	"APOE_000096"	"g.45412466G>A"	""	""	""	"APOE(NM_001302688.2):c.991G>A (p.V331M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866167"	"0"	"30"	"19"	"45412480"	"45412480"	"subst"	"0"	"02330"	"APOE_000097"	"g.45412480C>G"	""	""	""	"APOE(NM_001302688.2):c.1005C>G (p.A335=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895033"	"0"	"50"	"19"	"45409183"	"45409183"	"subst"	"4.45137E-5"	"02330"	"APOE_000099"	"g.45409183A>C"	""	""	""	"APOE(NM_001302688.2):c.55+3A>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895034"	"0"	"30"	"19"	"45409944"	"45409944"	"subst"	"0"	"02330"	"APOE_000100"	"g.45409944T>C"	""	""	""	"APOE(NM_001302688.2):c.121+20T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895035"	"0"	"30"	"19"	"45409988"	"45409988"	"subst"	"0"	"02330"	"APOE_000101"	"g.45409988C>T"	""	""	""	"APOE(NM_001302688.2):c.121+64C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895036"	"0"	"30"	"19"	"45411081"	"45411081"	"subst"	"5.70916E-5"	"02330"	"APOE_000102"	"g.45411081C>T"	""	""	""	"APOE(NM_001302688.2):c.186C>T (p.T62=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895037"	"0"	"30"	"19"	"45411110"	"45411110"	"subst"	"0.00256287"	"02326"	"APOE_000011"	"g.45411110T>C"	""	""	""	"APOE(NM_000041.4):c.137T>C (p.L46P), APOE(NM_001302688.2):c.215T>C (p.L72P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895038"	"0"	"30"	"19"	"45411150"	"45411150"	"subst"	"0"	"02330"	"APOE_000103"	"g.45411150G>A"	""	""	""	"APOE(NM_001302688.2):c.255G>A (p.Q85=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895039"	"0"	"30"	"19"	"45411774"	"45411777"	"del"	"0"	"02326"	"APOE_000013"	"g.45411774_45411777del"	""	""	""	"APOE(NM_000041.4):c.237-16_237-13delGCCC, APOE(NM_001302688.2):c.315-16_315-13delGCCC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895040"	"0"	"30"	"19"	"45411802"	"45411802"	"subst"	"2.04999E-5"	"02330"	"APOE_000104"	"g.45411802C>T"	""	""	""	"APOE(NM_001302688.2):c.327C>T (p.D109=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895041"	"0"	"50"	"19"	"45411938"	"45411938"	"subst"	"2.99175E-5"	"02330"	"APOE_000105"	"g.45411938G>A"	""	""	""	"APOE(NM_001302688.2):c.463G>A (p.V155M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895042"	"0"	"30"	"19"	"45412036"	"45412036"	"subst"	"0"	"02330"	"APOE_000106"	"g.45412036G>A"	""	""	""	"APOE(NM_001302688.2):c.561G>A (p.K187=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895043"	"0"	"70"	"19"	"45412062"	"45412062"	"subst"	"0"	"02330"	"APOE_000095"	"g.45412062C>A"	""	""	""	"APOE(NM_000041.4):c.509C>A (p.A170D), APOE(NM_001302688.2):c.587C>A (p.A196D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000895044"	"0"	"30"	"19"	"45412204"	"45412204"	"subst"	"0.00113729"	"02326"	"APOE_000024"	"g.45412204C>T"	""	""	""	"APOE(NM_000041.4):c.651C>T (p.A217=), APOE(NM_001302688.2):c.729C>T (p.A243=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895045"	"0"	"50"	"19"	"45412271"	"45412271"	"subst"	"0"	"02330"	"APOE_000107"	"g.45412271G>A"	""	""	""	"APOE(NM_001302688.2):c.796G>A (p.G266S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895046"	"0"	"50"	"19"	"45412337"	"45412337"	"subst"	"0.000203911"	"02330"	"APOE_000108"	"g.45412337G>A"	""	""	""	"APOE(NM_001302688.2):c.862G>A (p.E288K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895047"	"0"	"50"	"19"	"45412340"	"45412340"	"subst"	"0.000201656"	"02330"	"APOE_000109"	"g.45412340G>A"	""	""	""	"APOE(NM_001302688.2):c.865G>A (p.E289K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895048"	"0"	"30"	"19"	"45412402"	"45412402"	"subst"	"8.9945E-6"	"02330"	"APOE_000110"	"g.45412402C>T"	""	""	""	"APOE(NM_001302688.2):c.927C>T (p.F309=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895049"	"0"	"50"	"19"	"45412524"	"45412524"	"subst"	"0"	"02330"	"APOC1_000003"	"g.45412524C>T"	""	""	""	"APOE(NM_001302688.2):c.*17C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915246"	"0"	"50"	"19"	"45409180"	"45409180"	"subst"	"0.000538706"	"02325"	"APOE_000006"	"g.45409180G>A"	""	""	""	"APOE(NM_000041.4):c.-24+82G>A, APOE(NM_001302688.2):c.55G>A (p.D19N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915247"	"0"	"50"	"19"	"45411089"	"45411089"	"subst"	"2.03742E-5"	"02330"	"APOE_000111"	"g.45411089A>G"	""	""	""	"APOE(NM_001302688.2):c.194A>G (p.Q65R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915249"	"0"	"50"	"19"	"45412424"	"45412424"	"subst"	"0"	"02330"	"APOE_000112"	"g.45412424C>T"	""	""	""	"APOE(NM_001302688.2):c.949C>T (p.Q317*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000926901"	"0"	"30"	"19"	"45409902"	"45409902"	"subst"	"0"	"02330"	"APOE_000113"	"g.45409902G>C"	""	""	""	"APOE(NM_001302688.2):c.99G>C (p.A33=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000926902"	"0"	"50"	"19"	"45411965"	"45411965"	"subst"	"0"	"02330"	"APOE_000114"	"g.45411965G>T"	""	""	""	"APOE(NM_001302688.2):c.490G>T (p.G164C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000926903"	"0"	"50"	"19"	"45412292"	"45412292"	"subst"	"0"	"02330"	"APOE_000115"	"g.45412292C>G"	""	""	""	"APOE(NM_001302688.2):c.817C>G (p.L273V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000926904"	"0"	"50"	"19"	"45412526"	"45412526"	"subst"	"0"	"02330"	"APOC1_000004"	"g.45412526A>G"	""	""	""	"APOE(NM_001302688.2):c.*19A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000931068"	"0"	"30"	"19"	"45409113"	"45409113"	"subst"	"0.00139397"	"02326"	"APOE_000003"	"g.45409113C>T"	""	""	""	"APOE(NM_000041.4):c.-24+15C>T, APOE(NM_001302688.2):c.-13C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000951311"	"0"	"30"	"19"	"45411093"	"45411093"	"subst"	"3.66709E-5"	"02326"	"APOE_000010"	"g.45411093C>T"	""	""	""	"APOE(NM_000041.4):c.120C>T (p.S40=), APOE(NM_001302688.2):c.198C>T (p.S66=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000969800"	"0"	"50"	"19"	"45411987"	"45411987"	"subst"	"0.000150382"	"02325"	"APOE_000017"	"g.45411987G>A"	""	""	""	"APOE(NM_000041.4):c.434G>A (p.G145D), APOE(NM_001302688.2):c.512G>A (p.G171D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000983521"	"0"	"50"	"19"	"45411819"	"45411819"	"subst"	"0"	"02330"	"APOE_000116"	"g.45411819T>G"	""	""	""	"APOE(NM_001302688.2):c.344T>G (p.L115W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000983522"	"0"	"50"	"19"	"45411858"	"45411858"	"subst"	"2.89632E-5"	"01804"	"APOE_000085"	"g.45411858C>G"	""	""	""	"APOE(NM_000041.4):c.305C>G (p.(Pro102Arg)), APOE(NM_001302688.2):c.383C>G (p.P128R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000983524"	"0"	"50"	"19"	"45412008"	"45412008"	"subst"	"0"	"01804"	"APOE_000019"	"g.45412008G>A"	""	""	""	"APOE(NM_000041.4):c.455G>A (p.(Arg152Gln), p.R152Q), APOE(NM_001302688.2):c.533G>A (p.R178Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000983525"	"0"	"50"	"19"	"45412008"	"45412008"	"subst"	"0"	"02325"	"APOE_000019"	"g.45412008G>A"	""	""	""	"APOE(NM_000041.4):c.455G>A (p.(Arg152Gln), p.R152Q), APOE(NM_001302688.2):c.533G>A (p.R178Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000983526"	"0"	"50"	"19"	"45412208"	"45412208"	"subst"	"8.82348E-6"	"02330"	"APOE_000117"	"g.45412208C>G"	""	""	""	"APOE(NM_001302688.2):c.733C>G (p.Q245E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001004865"	"0"	"50"	"19"	"45409114"	"45409114"	"subst"	"0"	"02330"	"APOE_000118"	"g.45409114G>A"	""	""	""	"APOE(NM_001302688.2):c.-12G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001004866"	"0"	"50"	"19"	"45411947"	"45411947"	"subst"	"0"	"02326"	"APOE_000119"	"g.45411947C>T"	""	""	""	"APOE(NM_000041.4):c.394C>T (p.R132C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001004867"	"0"	"50"	"19"	"45411962"	"45411962"	"subst"	"0"	"02330"	"APOE_000120"	"g.45411962C>G"	""	""	""	"APOE(NM_001302688.2):c.487C>G (p.R163G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001004868"	"0"	"50"	"19"	"45412056"	"45412056"	"subst"	"0.000142225"	"01804"	"APOE_000121"	"g.45412056G>A"	""	""	""	"APOE(NM_000041.2):c.503G>A (p.(Arg168His)), APOE(NM_001302688.2):c.581G>A (p.R194H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001004869"	"0"	"50"	"19"	"45412241"	"45412241"	"subst"	"0"	"02330"	"APOE_000122"	"g.45412241G>A"	""	""	""	"APOE(NM_001302688.2):c.766G>A (p.E256K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001015800"	"0"	"50"	"19"	"45409920"	"45409920"	"subst"	"0"	"02330"	"APOE_000123"	"g.45409920G>A"	""	""	""	"APOE(NM_001302688.2):c.117G>A (p.L39=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001015801"	"0"	"50"	"19"	"45411882"	"45411882"	"subst"	"1.32426E-5"	"02330"	"APOE_000124"	"g.45411882G>A"	""	""	""	"APOE(NM_001302688.2):c.407G>A (p.R136Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001015802"	"0"	"50"	"19"	"45412245"	"45412245"	"subst"	"0"	"02330"	"APOE_000125"	"g.45412245G>A"	""	""	""	"APOE(NM_001302688.2):c.770G>A (p.R257Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001027230"	"0"	"30"	"19"	"45411917"	"45411917"	"subst"	"0"	"02330"	"APOE_000126"	"g.45411917C>T"	""	""	""	"APOE(NM_001302688.2):c.442C>T (p.L148=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001027231"	"0"	"50"	"19"	"45412056"	"45412056"	"subst"	"0.000142225"	"02330"	"APOE_000121"	"g.45412056G>A"	""	""	""	"APOE(NM_000041.2):c.503G>A (p.(Arg168His)), APOE(NM_001302688.2):c.581G>A (p.R194H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001027232"	"0"	"50"	"19"	"45412132"	"45412132"	"subst"	"0"	"02330"	"APOE_000127"	"g.45412132C>A"	""	""	""	"APOE(NM_001302688.2):c.657C>A (p.S219R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001043028"	"0"	"50"	"19"	"45411821"	"45411821"	"subst"	"4.09283E-6"	"02330"	"APOE_000128"	"g.45411821A>G"	""	""	""	"APOE(NM_001302688.2):c.346A>G (p.K116E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001043029"	"0"	"50"	"19"	"45411909"	"45411909"	"subst"	"3.96075E-5"	"01804"	"APOE_000129"	"g.45411909A>C"	""	""	""	"APOE(NM_000041.4):c.356A>C (p.(Gln119Pro))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001060768"	"0"	"70"	"19"	"45412013"	"45412013"	"subst"	"0"	"00006"	"APOE_000045"	"g.45412013C>T"	""	"{PMID:Horbacz 2025:41210864}"	""	""	"ACMG PM2, PM5, PP5, PP3; not in 142 controls"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.44908756C>T"	""	"likely pathogenic"	"ACMG"
"0001060769"	"0"	"70"	"19"	"45412013"	"45412013"	"subst"	"0"	"00006"	"APOE_000045"	"g.45412013C>T"	""	"{PMID:Horbacz 2025:41210864}"	""	""	"ACMG PM2, PM5, PP5, PP3; not in 142 controls"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.44908756C>T"	""	"likely pathogenic"	"ACMG"


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes APOE
## Count = 294
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"	"{{VariantOnTranscript/Haplotype}}"
"0000019563"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019564"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019565"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019566"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019567"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019568"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019569"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019570"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019571"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019572"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019573"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019574"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019575"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019576"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019577"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019578"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019579"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019580"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019581"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019582"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019583"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019584"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019585"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019586"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019587"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019588"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019589"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019590"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019591"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019592"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019593"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019594"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019595"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019596"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019597"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019598"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019599"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019600"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019601"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019602"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019603"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019604"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019605"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019606"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019607"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019608"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019609"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019610"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019611"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019612"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019613"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019614"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019615"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019616"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019617"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019618"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019619"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019620"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019621"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019622"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019623"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019624"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019625"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019626"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019627"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019628"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000019629"	"00002703"	"55"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000019630"	"00002703"	"55"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000072980"	"00002703"	"11"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.Cys130="	"4"	"E3"
"0000072981"	"00002703"	"11"	"526"	"0"	"526"	"0"	"c.526C="	"r.(=)"	"p.Arg176="	"4"	"E3"
"0000072982"	"00002703"	"50"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.526c>u"	"p.Arg176Cys"	"4"	"E2"
"0000072984"	"00002703"	"50"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.388u>c"	"p.Cys130Arg"	"4"	"E4"
"0000168633"	"00002703"	"50"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2;E2"
"0000168634"	"00002703"	"50"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2;E3"
"0000168635"	"00002703"	"50"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2;E3"
"0000168636"	"00002703"	"50"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2;E3"
"0000168637"	"00002703"	"50"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2;E3"
"0000168638"	"00002703"	"50"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2;E3"
"0000168639"	"00002703"	"50"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000168640"	"00002703"	"50"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	"4"	"E2"
"0000168641"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168642"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168643"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168644"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168645"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168646"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168647"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168648"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168649"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168650"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168651"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168652"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168653"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168654"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168655"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168656"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168657"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168658"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168659"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168660"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168661"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168662"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168663"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168664"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168665"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168666"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168667"	"00002703"	"10"	"388"	"0"	"388"	"0"	"c.388T="	"r.(=)"	"p.(Cys130=)"	"4"	"E3;E3"
"0000168668"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168669"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168670"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168671"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168672"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168673"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168674"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168675"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168676"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168677"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168678"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168679"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168680"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168681"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168682"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168683"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168684"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168685"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168686"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168687"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168688"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168689"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168690"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168691"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168692"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E3;E4"
"0000168693"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4;E4"
"0000168694"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4;E4"
"0000168695"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000168696"	"00002703"	"70"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	"4"	"E4"
"0000247630"	"00002703"	"90"	"490"	"0"	"490"	"0"	"c.490A>C"	"r.(?)"	"p.(Lys164Gln)"	""	""
"0000258241"	"00002703"	"30"	"-24"	"15"	"-24"	"15"	"c.-24+15C>T"	"r.(=)"	"p.(=)"	""	""
"0000258242"	"00002703"	"10"	"-24"	"69"	"-24"	"69"	"c.-24+69C>G"	"r.(=)"	"p.(=)"	""	""
"0000258243"	"00002703"	"30"	"956"	"0"	"956"	"0"	"c.*2C>T"	"r.(=)"	"p.(=)"	""	""
"0000258244"	"00002703"	"50"	"35"	"0"	"35"	"0"	"c.35T>A"	"r.(?)"	"p.(Phe12Tyr)"	""	""
"0000258245"	"00002703"	"30"	"-24"	"38"	"-24"	"38"	"c.-24+38G>A"	"r.(=)"	"p.(=)"	""	""
"0000258246"	"00002703"	"10"	"43"	"78"	"43"	"78"	"c.43+78G>A"	"r.(=)"	"p.(=)"	""	""
"0000258247"	"00002703"	"30"	"69"	"0"	"69"	"0"	"c.69G>A"	"r.(?)"	"p.(Ala23=)"	""	""
"0000258248"	"00002703"	"10"	"120"	"0"	"120"	"0"	"c.120C>T"	"r.(?)"	"p.(Ser40=)"	""	""
"0000258249"	"00002703"	"30"	"137"	"0"	"137"	"0"	"c.137T>C"	"r.(?)"	"p.(Leu46Pro)"	""	""
"0000258250"	"00002703"	"50"	"192"	"0"	"192"	"0"	"c.192G>C"	"r.(?)"	"p.(Gln64His)"	""	""
"0000258251"	"00002703"	"10"	"237"	"-16"	"237"	"-13"	"c.237-16_237-13del"	"r.(=)"	"p.(=)"	""	""
"0000258252"	"00002703"	"50"	"287"	"0"	"287"	"0"	"c.287T>C"	"r.(?)"	"p.(Leu96Pro)"	""	""
"0000258253"	"00002703"	"50"	"410"	"0"	"410"	"0"	"c.410G>A"	"r.(?)"	"p.(Arg137His)"	""	""
"0000258255"	"00002703"	"50"	"434"	"0"	"434"	"0"	"c.434G>A"	"r.(?)"	"p.(Gly145Asp)"	""	""
"0000258256"	"00002703"	"50"	"451"	"0"	"451"	"0"	"c.451C>A"	"r.(?)"	"p.(Leu151Met)"	""	""
"0000258257"	"00002703"	"50"	"455"	"0"	"455"	"0"	"c.455G>A"	"r.(?)"	"p.(Arg152Gln)"	""	""
"0000258258"	"00002703"	"30"	"463"	"0"	"463"	"0"	"c.463C>G"	"r.(?)"	"p.(Leu155Val)"	""	""
"0000258259"	"00002703"	"50"	"479"	"0"	"479"	"0"	"c.479G>A"	"r.(?)"	"p.(Arg160His)"	""	""
"0000258260"	"00002703"	"50"	"-24"	"82"	"-24"	"82"	"c.-24+82G>A"	"r.(=)"	"p.(=)"	""	""
"0000258263"	"00002703"	"10"	"555"	"0"	"555"	"0"	"c.555C>T"	"r.(?)"	"p.(Arg185=)"	""	""
"0000258264"	"00002703"	"10"	"651"	"0"	"651"	"0"	"c.651C>T"	"r.(?)"	"p.(Ala217=)"	""	""
"0000258265"	"00002703"	"30"	"699"	"0"	"699"	"0"	"c.699C>T"	"r.(?)"	"p.(Arg233=)"	""	""
"0000258266"	"00002703"	"10"	"761"	"0"	"761"	"0"	"c.761T>A"	"r.(?)"	"p.(Val254Glu)"	""	""
"0000258267"	"00002703"	"30"	"786"	"0"	"786"	"0"	"c.786G>A"	"r.(?)"	"p.(Glu262=)"	""	""
"0000258268"	"00002703"	"50"	"805"	"0"	"805"	"0"	"c.805C>G"	"r.(?)"	"p.(Arg269Gly)"	""	""
"0000258269"	"00002703"	"50"	"823"	"0"	"823"	"0"	"c.823T>G"	"r.(?)"	"p.(Phe275Val)"	""	""
"0000258270"	"00002703"	"10"	"855"	"0"	"855"	"0"	"c.855C>G"	"r.(?)"	"p.(Pro285=)"	""	""
"0000258790"	"00002703"	"10"	"-24"	"69"	"-24"	"69"	"c.-24+69C>G"	"r.(=)"	"p.(=)"	""	""
"0000260148"	"00002703"	"10"	"-24"	"69"	"-24"	"69"	"c.-24+69C>G"	"r.(=)"	"p.(=)"	""	""
"0000260151"	"00002703"	"30"	"761"	"0"	"761"	"0"	"c.761T>A"	"r.(?)"	"p.(Val254Glu)"	""	""
"0000426592"	"00002703"	"95"	"500"	"0"	"502"	"0"	"c.500_502del"	"r.(?)"	"p.(Leu167del)"	"4"	""
"0000567628"	"00002703"	"30"	"-24"	"20"	"-24"	"20"	"c.-24+20G>A"	"r.(=)"	"p.(=)"	""	""
"0000567629"	"00002703"	"30"	"69"	"0"	"69"	"0"	"c.69G>A"	"r.(?)"	"p.(Ala23=)"	""	""
"0000567630"	"00002703"	"30"	"84"	"0"	"84"	"0"	"c.84G>A"	"r.(?)"	"p.(Pro28=)"	""	""
"0000567631"	"00002703"	"30"	"90"	"0"	"90"	"0"	"c.90C>G"	"r.(?)"	"p.(Pro30=)"	""	""
"0000567632"	"00002703"	"50"	"91"	"0"	"91"	"0"	"c.91G>A"	"r.(?)"	"p.(Glu31Lys)"	""	""
"0000567633"	"00002703"	"30"	"104"	"0"	"104"	"0"	"c.104A>C"	"r.(?)"	"p.(Gln35Pro)"	""	""
"0000567634"	"00002703"	"50"	"137"	"0"	"137"	"0"	"c.137T>C"	"r.(?)"	"p.(Leu46Pro)"	""	""
"0000567635"	"00002703"	"30"	"198"	"0"	"198"	"0"	"c.198G>A"	"r.(?)"	"p.(Gln66=)"	""	""
"0000567636"	"00002703"	"50"	"206"	"0"	"206"	"0"	"c.206T>C"	"r.(?)"	"p.(Leu69Pro)"	""	""
"0000567637"	"00002703"	"30"	"381"	"0"	"381"	"0"	"c.381G>A"	"r.(?)"	"p.(Glu127=)"	""	""
"0000567640"	"00002703"	"70"	"415"	"0"	"435"	"0"	"c.415_435dup"	"r.(?)"	"p.(Glu139_Gly145dup)"	""	""
"0000567641"	"00002703"	"50"	"447"	"0"	"447"	"0"	"c.447G>C"	"r.(?)"	"p.(Glu149Asp)"	""	""
"0000567642"	"00002703"	"90"	"460"	"0"	"460"	"0"	"c.460C>A"	"r.(?)"	"p.(Arg154Ser)"	""	""
"0000567643"	"00002703"	"90"	"460"	"0"	"460"	"0"	"c.460C>T"	"r.(?)"	"p.(Arg154Cys)"	""	""
"0000567644"	"00002703"	"90"	"461"	"0"	"461"	"0"	"c.461G>A"	"r.(?)"	"p.(Arg154His)"	""	""
"0000567645"	"00002703"	"30"	"507"	"0"	"507"	"0"	"c.507T>C"	"r.(?)"	"p.(Asp169=)"	""	""
"0000567646"	"00002703"	"50"	"605"	"0"	"605"	"0"	"c.605T>C"	"r.(?)"	"p.(Leu202Pro)"	""	""
"0000567647"	"00002703"	"30"	"627"	"0"	"627"	"0"	"c.627G>A"	"r.(?)"	"p.(Arg209=)"	""	""
"0000567648"	"00002703"	"50"	"691"	"0"	"691"	"0"	"c.691C>T"	"r.(?)"	"p.(Arg231Trp)"	""	""
"0000567649"	"00002703"	"50"	"745"	"0"	"745"	"0"	"c.745G>A"	"r.(?)"	"p.(Glu249Lys)"	""	""
"0000567650"	"00002703"	"30"	"786"	"0"	"786"	"0"	"c.786G>A"	"r.(?)"	"p.(Glu262=)"	""	""
"0000567651"	"00002703"	"30"	"807"	"0"	"807"	"0"	"c.807C>G"	"r.(?)"	"p.(Arg269=)"	""	""
"0000567652"	"00002703"	"50"	"875"	"0"	"875"	"0"	"c.875G>A"	"r.(?)"	"p.(Arg292His)"	""	""
"0000567653"	"00002703"	"50"	"886"	"0"	"886"	"0"	"c.886G>T"	"r.(?)"	"p.(Gly296Trp)"	""	""
"0000567654"	"00002703"	"10"	"924"	"0"	"924"	"0"	"c.924C>T"	"r.(?)"	"p.(Ser308=)"	""	""
"0000567655"	"00002703"	"30"	"967"	"0"	"967"	"0"	"c.*13G>A"	"r.(=)"	"p.(=)"	""	""
"0000617674"	"00002703"	"50"	"36"	"0"	"36"	"0"	"c.36C>A"	"r.(?)"	"p.(Phe12Leu)"	""	""
"0000617675"	"00002703"	"50"	"88"	"0"	"88"	"0"	"c.88C>A"	"r.(?)"	"p.(Pro30Thr)"	""	""
"0000617676"	"00002703"	"30"	"165"	"0"	"165"	"0"	"c.165G>C"	"r.(?)"	"p.(Leu55=)"	""	""
"0000617677"	"00002703"	"30"	"236"	"12"	"236"	"12"	"c.236+12del"	"r.(=)"	"p.(=)"	""	""
"0000617678"	"00002703"	"30"	"237"	"-16"	"237"	"-13"	"c.237-16_237-13del"	"r.(=)"	"p.(=)"	""	""
"0000617679"	"00002703"	"30"	"240"	"0"	"240"	"0"	"c.240G>A"	"r.(?)"	"p.(Ala80=)"	""	""
"0000617680"	"00002703"	"50"	"719"	"0"	"719"	"0"	"c.719G>A"	"r.(?)"	"p.(Gly240Asp)"	""	""
"0000617681"	"00002703"	"50"	"882"	"0"	"882"	"0"	"c.882G>T"	"r.(?)"	"p.(Trp294Cys)"	""	""
"0000617682"	"00002703"	"50"	"883"	"0"	"883"	"0"	"c.883G>A"	"r.(?)"	"p.(Ala295Thr)"	""	""
"0000624024"	"00002703"	"10"	"-23"	"-280"	"-23"	"-280"	"c.-23-280C>T"	"r.(=)"	"p.(=)"	""	""
"0000624025"	"00002703"	"50"	"104"	"0"	"104"	"0"	"c.104A>C"	"r.(?)"	"p.(Gln35Pro)"	""	""
"0000624026"	"00002703"	"50"	"192"	"0"	"192"	"0"	"c.192G>T"	"r.(?)"	"p.(Gln64His)"	""	""
"0000624028"	"00002703"	"50"	"395"	"0"	"395"	"0"	"c.395G>A"	"r.(?)"	"p.(Arg132His)"	""	""
"0000624029"	"00002703"	"30"	"399"	"0"	"399"	"0"	"c.399G>A"	"r.(?)"	"p.(Leu133=)"	""	""
"0000624030"	"00002703"	"30"	"576"	"0"	"576"	"0"	"c.576C>T"	"r.(?)"	"p.(Leu192=)"	""	""
"0000624031"	"00002703"	"50"	"849"	"0"	"849"	"0"	"c.849C>G"	"r.(?)"	"p.(Phe283Leu)"	""	""
"0000624032"	"00002703"	"30"	"979"	"0"	"979"	"0"	"c.*25C>T"	"r.(=)"	"p.(=)"	""	""
"0000650008"	"00002703"	"50"	"349"	"0"	"349"	"0"	"c.349G>A"	"r.(?)"	"p.(Ala117Thr)"	""	""
"0000650009"	"00002703"	"50"	"388"	"0"	"388"	"0"	"c.388T>C"	"r.(?)"	"p.(Cys130Arg)"	""	""
"0000650010"	"00002703"	"50"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	""	""
"0000658598"	"00002703"	"30"	"44"	"-106"	"44"	"-106"	"c.44-106T>G"	"r.(=)"	"p.(=)"	""	""
"0000658599"	"00002703"	"50"	"279"	"0"	"279"	"0"	"c.279A>C"	"r.(?)"	"p.(Lys93Asn)"	""	""
"0000658600"	"00002703"	"70"	"500"	"0"	"502"	"0"	"c.500_502del"	"r.(?)"	"p.(Leu167del)"	""	""
"0000658601"	"00002703"	"70"	"613"	"0"	"613"	"0"	"c.613C>T"	"r.(?)"	"p.(Gln205Ter)"	""	""
"0000658602"	"00002703"	"30"	"856"	"0"	"856"	"0"	"c.856C>T"	"r.(?)"	"p.(Leu286=)"	""	""
"0000669482"	"00002703"	"50"	"526"	"0"	"526"	"0"	"c.526C>T"	"r.(?)"	"p.(Arg176Cys)"	""	""
"0000681442"	"00002703"	"30"	"-23"	"-57"	"-23"	"-57"	"c.-23-57G>A"	"r.(=)"	"p.(=)"	""	""
"0000681443"	"00002703"	"30"	"43"	"349"	"43"	"349"	"c.43+349G>A"	"r.(=)"	"p.(=)"	""	""
"0000681444"	"00002703"	"30"	"747"	"0"	"747"	"0"	"c.747G>A"	"r.(?)"	"p.(Glu249=)"	""	""
"0000681445"	"00002703"	"30"	"942"	"0"	"942"	"0"	"c.942C>T"	"r.(?)"	"p.(Ser314=)"	""	""
"0000692825"	"00002703"	"30"	"-24"	"335"	"-24"	"335"	"c.-24+335dup"	"r.(=)"	"p.(=)"	""	""
"0000692826"	"00002703"	"50"	"43"	"69"	"43"	"69"	"c.43+69C>T"	"r.(=)"	"p.(=)"	""	""
"0000692827"	"00002703"	"10"	"43"	"520"	"43"	"520"	"c.43+520G>A"	"r.(=)"	"p.(=)"	""	""
"0000692828"	"00002703"	"30"	"236"	"219"	"236"	"219"	"c.236+219G>A"	"r.(=)"	"p.(=)"	""	""
"0000692829"	"00002703"	"50"	"592"	"0"	"592"	"0"	"c.592C>T"	"r.(?)"	"p.(Arg198Cys)"	""	""
"0000727416"	"00002703"	"30"	"90"	"0"	"90"	"0"	"c.90C>G"	"r.(?)"	"p.(Pro30=)"	""	""
"0000727417"	"00002703"	"50"	"149"	"0"	"149"	"0"	"c.149G>C"	"r.(?)"	"p.(Arg50Pro)"	""	""
"0000727418"	"00002703"	"50"	"305"	"0"	"305"	"0"	"c.305C>G"	"r.(?)"	"p.(Pro102Arg)"	""	""
"0000727419"	"00002703"	"50"	"340"	"0"	"340"	"0"	"c.340dup"	"r.(?)"	"p.(Glu114Glyfs*51)"	""	""
"0000727420"	"00002703"	"50"	"628"	"0"	"628"	"0"	"c.628G>T"	"r.(?)"	"p.(Ala210Ser)"	""	""
"0000727421"	"00002703"	"30"	"942"	"0"	"942"	"0"	"c.942C>T"	"r.(?)"	"p.(Ser314=)"	""	""
"0000808916"	"00002703"	"30"	"-24"	"319"	"-24"	"319"	"c.-24+319C>A"	"r.(=)"	"p.(=)"	""	""
"0000808917"	"00002703"	"50"	"305"	"0"	"305"	"0"	"c.305C>T"	"r.(?)"	"p.(Pro102Leu)"	""	""
"0000808918"	"00002703"	"30"	"331"	"0"	"331"	"0"	"c.331C>T"	"r.(?)"	"p.(Leu111=)"	""	""
"0000808920"	"00002703"	"50"	"434"	"0"	"434"	"0"	"c.434G>A"	"r.(?)"	"p.(Gly145Asp)"	""	""
"0000855610"	"00002703"	"50"	"68"	"0"	"68"	"0"	"c.68C>T"	"r.(?)"	"p.(Ala23Val)"	""	""
"0000855611"	"00002703"	"50"	"940"	"0"	"940"	"0"	"c.940A>C"	"r.(?)"	"p.(Ser314Arg)"	""	""
"0000866162"	"00002703"	"50"	"-24"	"61"	"-24"	"61"	"c.-24+61C>T"	"r.(=)"	"p.(=)"	""	""
"0000866163"	"00002703"	"30"	"-23"	"-251"	"-23"	"-251"	"c.-23-251A>C"	"r.(=)"	"p.(=)"	""	""
"0000866164"	"00002703"	"30"	"43"	"4"	"43"	"4"	"c.43+4T>A"	"r.spl?"	"p.?"	""	""
"0000866165"	"00002703"	"70"	"509"	"0"	"509"	"0"	"c.509C>A"	"r.(?)"	"p.(Ala170Asp)"	""	""
"0000866166"	"00002703"	"50"	"913"	"0"	"913"	"0"	"c.913G>A"	"r.(?)"	"p.(Val305Met)"	""	""
"0000866167"	"00002703"	"30"	"927"	"0"	"927"	"0"	"c.927C>G"	"r.(?)"	"p.(Ala309=)"	""	""
"0000895033"	"00002703"	"50"	"-24"	"85"	"-24"	"85"	"c.-24+85A>C"	"r.(=)"	"p.(=)"	""	""
"0000895034"	"00002703"	"30"	"43"	"20"	"43"	"20"	"c.43+20T>C"	"r.(=)"	"p.(=)"	""	""
"0000895035"	"00002703"	"30"	"43"	"64"	"43"	"64"	"c.43+64C>T"	"r.(=)"	"p.(=)"	""	""
"0000895036"	"00002703"	"30"	"108"	"0"	"108"	"0"	"c.108C>T"	"r.(?)"	"p.(Thr36=)"	""	""
"0000895037"	"00002703"	"30"	"137"	"0"	"137"	"0"	"c.137T>C"	"r.(?)"	"p.(Leu46Pro)"	""	""
"0000895038"	"00002703"	"30"	"177"	"0"	"177"	"0"	"c.177G>A"	"r.(?)"	"p.(Gln59=)"	""	""
"0000895039"	"00002703"	"30"	"237"	"-16"	"237"	"-13"	"c.237-16_237-13del"	"r.(=)"	"p.(=)"	""	""
"0000895040"	"00002703"	"30"	"249"	"0"	"249"	"0"	"c.249C>T"	"r.(?)"	"p.(Asp83=)"	""	""
"0000895041"	"00002703"	"50"	"385"	"0"	"385"	"0"	"c.385G>A"	"r.(?)"	"p.(Val129Met)"	""	""
"0000895042"	"00002703"	"30"	"483"	"0"	"483"	"0"	"c.483G>A"	"r.(?)"	"p.(Lys161=)"	""	""
"0000895043"	"00002703"	"70"	"509"	"0"	"509"	"0"	"c.509C>A"	"r.(?)"	"p.(Ala170Asp)"	""	""
"0000895044"	"00002703"	"30"	"651"	"0"	"651"	"0"	"c.651C>T"	"r.(?)"	"p.(Ala217=)"	""	""
"0000895045"	"00002703"	"50"	"718"	"0"	"718"	"0"	"c.718G>A"	"r.(?)"	"p.(Gly240Ser)"	""	""
"0000895046"	"00002703"	"50"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	""	""
"0000895047"	"00002703"	"50"	"787"	"0"	"787"	"0"	"c.787G>A"	"r.(?)"	"p.(Glu263Lys)"	""	""
"0000895048"	"00002703"	"30"	"849"	"0"	"849"	"0"	"c.849C>T"	"r.(?)"	"p.(Phe283=)"	""	""
"0000895049"	"00002703"	"50"	"971"	"0"	"971"	"0"	"c.*17C>T"	"r.(=)"	"p.(=)"	""	""
"0000915246"	"00002703"	"50"	"-24"	"82"	"-24"	"82"	"c.-24+82G>A"	"r.(=)"	"p.(=)"	""	""
"0000915247"	"00002703"	"50"	"116"	"0"	"116"	"0"	"c.116A>G"	"r.(?)"	"p.(Gln39Arg)"	""	""
"0000915249"	"00002703"	"50"	"871"	"0"	"871"	"0"	"c.871C>T"	"r.(?)"	"p.(Gln291*)"	""	""
"0000926901"	"00002703"	"30"	"21"	"0"	"21"	"0"	"c.21G>C"	"r.(?)"	"p.(Ala7=)"	""	""
"0000926902"	"00002703"	"50"	"412"	"0"	"412"	"0"	"c.412G>T"	"r.(?)"	"p.(Gly138Cys)"	""	""
"0000926903"	"00002703"	"50"	"739"	"0"	"739"	"0"	"c.739C>G"	"r.(?)"	"p.(Leu247Val)"	""	""
"0000926904"	"00002703"	"50"	"973"	"0"	"973"	"0"	"c.*19A>G"	"r.(=)"	"p.(=)"	""	""
"0000931068"	"00002703"	"30"	"-24"	"15"	"-24"	"15"	"c.-24+15C>T"	"r.(=)"	"p.(=)"	""	""
"0000951311"	"00002703"	"30"	"120"	"0"	"120"	"0"	"c.120C>T"	"r.(?)"	"p.(Ser40=)"	""	""
"0000969800"	"00002703"	"50"	"434"	"0"	"434"	"0"	"c.434G>A"	"r.(?)"	"p.(Gly145Asp)"	""	""
"0000983521"	"00002703"	"50"	"266"	"0"	"266"	"0"	"c.266T>G"	"r.(?)"	"p.(Leu89Trp)"	""	""
"0000983522"	"00002703"	"50"	"305"	"0"	"305"	"0"	"c.305C>G"	"r.(?)"	"p.(Pro102Arg)"	""	""
"0000983524"	"00002703"	"50"	"455"	"0"	"455"	"0"	"c.455G>A"	"r.(?)"	"p.(Arg152Gln)"	""	""
"0000983525"	"00002703"	"50"	"455"	"0"	"455"	"0"	"c.455G>A"	"r.(?)"	"p.(Arg152Gln)"	""	""
"0000983526"	"00002703"	"50"	"655"	"0"	"655"	"0"	"c.655C>G"	"r.(?)"	"p.(Gln219Glu)"	""	""
"0001004865"	"00002703"	"50"	"-24"	"16"	"-24"	"16"	"c.-24+16G>A"	"r.(=)"	"p.(=)"	""	""
"0001004866"	"00002703"	"50"	"394"	"0"	"394"	"0"	"c.394C>T"	"r.(?)"	"p.(Arg132Cys)"	""	""
"0001004867"	"00002703"	"50"	"409"	"0"	"409"	"0"	"c.409C>G"	"r.(?)"	"p.(Arg137Gly)"	""	""
"0001004868"	"00002703"	"50"	"503"	"0"	"503"	"0"	"c.503G>A"	"r.(?)"	"p.(Arg168His)"	""	""
"0001004869"	"00002703"	"50"	"688"	"0"	"688"	"0"	"c.688G>A"	"r.(?)"	"p.(Glu230Lys)"	""	""
"0001015800"	"00002703"	"50"	"39"	"0"	"39"	"0"	"c.39G>A"	"r.(?)"	"p.(=)"	""	""
"0001015801"	"00002703"	"50"	"329"	"0"	"329"	"0"	"c.329G>A"	"r.(?)"	"p.(Arg110Gln)"	""	""
"0001015802"	"00002703"	"50"	"692"	"0"	"692"	"0"	"c.692G>A"	"r.(?)"	"p.(Arg231Gln)"	""	""
"0001027230"	"00002703"	"30"	"364"	"0"	"364"	"0"	"c.364C>T"	"r.(?)"	"p.(=)"	""	""
"0001027231"	"00002703"	"50"	"503"	"0"	"503"	"0"	"c.503G>A"	"r.(?)"	"p.(Arg168His)"	""	""
"0001027232"	"00002703"	"50"	"579"	"0"	"579"	"0"	"c.579C>A"	"r.(?)"	"p.(Ser193Arg)"	""	""
"0001043028"	"00002703"	"50"	"268"	"0"	"268"	"0"	"c.268A>G"	"r.(?)"	"p.(Lys90Glu)"	""	""
"0001043029"	"00002703"	"50"	"356"	"0"	"356"	"0"	"c.356A>C"	"r.(?)"	"p.(Gln119Pro)"	""	""
"0001060768"	"00002703"	"70"	"460"	"0"	"460"	"0"	"c.460C>T"	"r.(?)"	"p.(Arg154Cys)"	""	""
"0001060769"	"00002703"	"70"	"460"	"0"	"460"	"0"	"c.460C>T"	"r.(?)"	"p.(Arg154Cys)"	""	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 141
"{{screeningid}}"	"{{variantid}}"
"0000002090"	"0000019563"
"0000002091"	"0000019564"
"0000002095"	"0000019565"
"0000002099"	"0000019566"
"0000002111"	"0000019567"
"0000002113"	"0000019568"
"0000002114"	"0000019569"
"0000002114"	"0000019591"
"0000002116"	"0000019570"
"0000002119"	"0000019571"
"0000002120"	"0000019572"
"0000002121"	"0000019573"
"0000002122"	"0000019574"
"0000002125"	"0000019575"
"0000002127"	"0000019576"
"0000002133"	"0000019577"
"0000002135"	"0000019578"
"0000002138"	"0000019579"
"0000002140"	"0000019580"
"0000002141"	"0000019581"
"0000002144"	"0000019582"
"0000002144"	"0000019592"
"0000002145"	"0000019583"
"0000002145"	"0000019593"
"0000002148"	"0000019584"
"0000002150"	"0000019585"
"0000002152"	"0000019586"
"0000002154"	"0000019587"
"0000002155"	"0000019588"
"0000002157"	"0000019589"
"0000002158"	"0000019590"
"0000002161"	"0000019594"
"0000002164"	"0000019595"
"0000002166"	"0000019596"
"0000002171"	"0000019597"
"0000002171"	"0000019608"
"0000002172"	"0000019598"
"0000002173"	"0000019599"
"0000002175"	"0000019600"
"0000002182"	"0000019601"
"0000002184"	"0000019602"
"0000002185"	"0000019603"
"0000002185"	"0000019609"
"0000002197"	"0000019604"
"0000002200"	"0000019605"
"0000002201"	"0000019606"
"0000002206"	"0000019607"
"0000002208"	"0000019610"
"0000002209"	"0000019611"
"0000002210"	"0000019612"
"0000002211"	"0000019613"
"0000002212"	"0000019614"
"0000002213"	"0000019615"
"0000002214"	"0000019616"
"0000002215"	"0000019617"
"0000002216"	"0000019618"
"0000002217"	"0000019619"
"0000002218"	"0000019620"
"0000002219"	"0000019621"
"0000002220"	"0000019622"
"0000002221"	"0000019623"
"0000002222"	"0000019624"
"0000002223"	"0000019625"
"0000002226"	"0000019628"
"0000002227"	"0000019629"
"0000002228"	"0000019630"
"0000045254"	"0000072980"
"0000045254"	"0000072981"
"0000045255"	"0000072982"
"0000045256"	"0000072984"
"0000103921"	"0000168641"
"0000103922"	"0000168642"
"0000103927"	"0000168668"
"0000103929"	"0000168663"
"0000103930"	"0000168664"
"0000103936"	"0000168677"
"0000103937"	"0000168639"
"0000103937"	"0000168695"
"0000103939"	"0000168678"
"0000103940"	"0000168665"
"0000103943"	"0000168666"
"0000103944"	"0000168679"
"0000103947"	"0000168693"
"0000103948"	"0000168636"
"0000103950"	"0000168640"
"0000103950"	"0000168696"
"0000103952"	"0000168637"
"0000103958"	"0000168694"
"0000103960"	"0000168680"
"0000103961"	"0000168681"
"0000103962"	"0000168682"
"0000103965"	"0000168683"
"0000103977"	"0000168684"
"0000103980"	"0000168685"
"0000103982"	"0000168686"
"0000103983"	"0000168687"
"0000103984"	"0000168688"
"0000103987"	"0000168667"
"0000103989"	"0000168689"
"0000103991"	"0000168638"
"0000103995"	"0000168690"
"0000103999"	"0000168691"
"0000104000"	"0000168692"
"0000104002"	"0000168669"
"0000104008"	"0000168643"
"0000104011"	"0000168644"
"0000104016"	"0000168645"
"0000104019"	"0000168646"
"0000104024"	"0000168647"
"0000104025"	"0000168648"
"0000104026"	"0000168649"
"0000104031"	"0000168650"
"0000104033"	"0000168670"
"0000104037"	"0000168651"
"0000104044"	"0000168652"
"0000104052"	"0000168671"
"0000104053"	"0000168672"
"0000104054"	"0000168653"
"0000104055"	"0000168654"
"0000104059"	"0000168655"
"0000104060"	"0000168656"
"0000104061"	"0000168673"
"0000104063"	"0000168657"
"0000104067"	"0000168674"
"0000104068"	"0000168634"
"0000104069"	"0000168635"
"0000104070"	"0000168658"
"0000104071"	"0000168659"
"0000104072"	"0000168675"
"0000104075"	"0000168660"
"0000104080"	"0000168676"
"0000104082"	"0000168633"
"0000104083"	"0000168661"
"0000104086"	"0000168662"
"0000205256"	"0000426592"
"0000293319"	"0000650008"
"0000293320"	"0000650009"
"0000293321"	"0000650010"
"0000305794"	"0000669482"
"0000472368"	"0001060768"
"0000472371"	"0001060769"