### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = ARHGEF18) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "ARHGEF18" "Rho/Rac guanine nucleotide exchange factor (GEF) 18" "19" "p13.3" "unknown" "NG_047135.1" "UD_132439366373" "" "https://www.LOVD.nl/ARHGEF18" "" "1" "17090" "23370" "616432" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/ARHGEF18_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2020-04-17 19:40:34" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00002823" "ARHGEF18" "transcript variant 1" "001" "NM_015318.3" "" "NP_056133.2" "" "" "" "-206" "5014" "3048" "7459999" "7537371" "" "0000-00-00 00:00:00" "" "" "00025503" "ARHGEF18" "transcript variant 2" "003" "NM_001130955.1" "" "NP_001124427.1" "" "" "" "-253" "5488" "3522" "7504574" "7537371" "00006" "2020-04-18 10:18:00" "" "" "00026037" "ARHGEF18" "transcript variant 3" "000" "NM_001367823.1" "" "NP_001354752.1" "" "" "MANE select" "-415" "6266" "4086" "1" "1" "00006" "2025-11-26 10:00:10" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04249" "macular dystrophy" "dystrophy, macular" "" "" "" "" "" "00006" "2015-05-04 22:10:58" "00006" "2024-02-15 21:18:39" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "05723" "RP78" "retinitis pigmentosa, type 78 (RP78)" "AR" "617433" "" "" "" "00006" "2020-04-10 19:41:39" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "ARHGEF18" "05723" ## Individuals ## Do not remove or alter this header ## ## Count = 12 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00299640" "" "" "" "1" "" "00006" "{PMID:Arno 2017:28132693}" "3-generation family, 1 affeted, unaffected heterozygous carrier parents" "F" "" "" "" "0" "" "" "" "FamGC18203Pat1" "00299641" "" "" "" "1" "" "00006" "{PMID:Arno 2017:28132693}" "2-generation family, 1 affeted" "M" "" "" "" "0" "" "" "" "FamGC3626Pat2" "00299642" "" "" "" "1" "" "00006" "{PMID:Arno 2017:28132693}" "3-generation family, 1 affeted, unaffected heterozygous carrier parents/relatives" "F" "yes" "" "" "0" "" "" "" "FamGC17880Pat3" "00299643" "" "" "" "1" "" "00006" "{PMID:Arno 2017:28132693}" "phenotype unrelated to RP78, causative variant not identified" "" "" "" "" "0" "" "" "" "PatA" "00299644" "" "" "" "1" "" "00006" "{PMID:Arno 2017:28132693}" "phenotype unrelated to RP78, causative variant identified" "" "" "" "" "0" "" "" "" "PatB" "00299645" "" "" "" "1" "" "00006" "{PMID:Arno 2017:28132693}" "phenotype unrelated to RP78, causative variant not identified" "" "" "" "" "0" "" "" "" "PatC" "00299646" "" "" "" "1" "" "00006" "{PMID:Arno 2017:28132693}" "phenotype unrelated to RP78, causative variant identified" "" "" "" "" "0" "" "" "" "PatD" "00390164" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G005994" "00390165" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G006006" "00447568" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "MISC-298" "00450704" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "DNA15-06673" "00467801" "" "" "" "1" "" "00006" "{PMID:Charng 2016:27435318}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "" "yes" "Saudi Arabia" "" "0" "" "" "" "Fam005PatBAB6682" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 12 "{{individualid}}" "{{diseaseid}}" "00299640" "04214" "00299641" "04214" "00299642" "04214" "00299643" "00198" "00299644" "00198" "00299645" "00198" "00299646" "00198" "00390164" "04214" "00390165" "04214" "00447568" "00198" "00450704" "04249" "00467801" "05611" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 04214, 04249, 05611, 05723 ## Count = 8 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000226950" "04214" "00299640" "00006" "Familial, autosomal recessive" "37y" "see paper; ..., 20y-reduced acuity (HP:0007663), mild nyctalopia (HP:0000662), blind spots (HP:0000575); irregular peripheral pigment (HP:0007703), pale discs (HP:0000543), cystoid macular edema (HP:0011505), vitreous opacities (HP:0007648), attenuated sheathed vessels (HP:0007843), peripheral retinal exudate (HP:0001147); 30y-subnormal PERG, rod specific ERG markedly subnormal, bright flash subnormal with unusual bifid b waves, cone specific delayed and subnormal, profound rod>cone dysfunction; 29y-colour vision Ishihara R 17/17 L 13/17; 36y-octopus visual fields central 20-30 degrees retained on R, 30-50 degrees on L;37y 24-2 central scotomas, fields constricted to 15 degrees each eye; presenting VA logMAR (Snellen) R 0.3 (20/40), L 0.18 (20/30); latest VA logMAR R 0.6 (20/80), L 0.6 (20/80); latest refractive error, dioptres R 0/-0.50x100, L +1.00/-0.75x110" "20y" "" "" "" "" "" "" "" "RP78" "retinitis pigmentosa" "" "0000226951" "04214" "00299641" "00006" "Familial, autosomal recessive" "51y" "see paper; ..., 29y-photopsia (HP:0030786), slightly reduced acuity (HP:0007663), mild nyctalopia (HP:0000662); irregular pigmented lesions in periphery(HP:0007703), pale discs (HP:0000543), cystoid macular edema (HP:0011505), peripheral telangiectasia (HP:0007763) with some retinal edema (HP:0020120) and vitreous cells (HP:0004327), possible para-arteriolar sparing; 29y-ERG no identifiable responses other than a minimal, delayed response to 30Hz flicker (PERG, EOG and ERG tested), severe photoreceptor dysfunction; 29y-colour vision Ishihara 15/15 each eye; 29y-Goldmann visual fields ring scotoma at 30 degrees, binocular Esterman age 36: central 20 degrees only retained; presenting VA logMAR (Snellen) R 0.48 (20/60), L 0.3 (20/40); latest VA logMAR R 1.8 (20/1250), L 1.5 (20/630); latest refractive error, dioptres R -1.00/-1.00x5, L +0.75/-1.00x90" "29y" "" "" "" "" "" "" "" "RP78" "retinitis pigmentosa" "" "0000226952" "04214" "00299642" "00006" "Familial, autosomal recessive" "38y" "see paper; ..., 30y-photopsia (HP:0030786), nyctalopia (HP:0000662), field defect; irregular pigmented lesions in periphery (HP:0007703), foveal/parafoveal cysts (HP:?); 30y-PERG borderline on R, subnormal on L, undetectable rod ERG, abnormal cone ERG, severe rod>cone dysfunction; 33y-colour vision Ishihara R 21/23 L 3/23; 36y-fields to confrontation less than 30 degrees; presenting VA logMAR (Snellen) R 0.18 (20/30), L 0.48 (20/60); latest VA logMAR R 0.18 (20/30), L 0.8 (20/125); latest refractive error, dioptres R +2.25/-1.00x5, L +2.00/-1.50x165" "30y" "" "" "" "" "" "" "" "RP78" "retinitis pigmentosa" "" "0000283702" "04214" "00390164" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283703" "04214" "00390165" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000336767" "00198" "00447568" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "eye diseaes" "" "0000339759" "04249" "00450704" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000352954" "05611" "00467801" "00006" "Familial, autosomal recessive" "" "developmental delay, microcephaly, cortical malformation, thin corpus callosum, ventricular septal defect, patent foramen ovale, anteriorly placed anus, skin macules" "" "" "" "" "" "" "" "" "" "neurodevelopmental disorder" "" ## Screenings ## Do not remove or alter this header ## ## Count = 12 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000300750" "00299640" "1" "00006" "00006" "2020-04-18 08:53:03" "00006" "2020-04-18 08:55:30" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000300751" "00299641" "1" "00006" "00006" "2020-04-18 08:53:03" "00006" "2020-04-18 09:16:58" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WGS" "0000300752" "00299642" "1" "00006" "00006" "2020-04-18 08:53:03" "00006" "2020-04-18 09:16:30" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000300753" "00299643" "1" "00006" "00006" "2020-04-18 10:10:42" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000300754" "00299644" "1" "00006" "00006" "2020-04-18 10:10:42" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000300755" "00299645" "1" "00006" "00006" "2020-04-18 10:10:42" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000300756" "00299646" "1" "00006" "00006" "2020-04-18 10:10:42" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000391405" "00390164" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391406" "00390165" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000449145" "00447568" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000452302" "00450704" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000469467" "00467801" "1" "00006" "00006" "2025-10-30 10:25:01" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 9 "{{screeningid}}" "{{geneid}}" "0000300750" "ARHGEF18" "0000300751" "ARHGEF18" "0000300752" "ARHGEF18" "0000300753" "ARHGEF18" "0000300754" "ARHGEF18" "0000300755" "ARHGEF18" "0000300756" "ARHGEF18" "0000391405" "ARHGEF18" "0000391406" "ARHGEF18" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 92 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000568769" "0" "30" "19" "7504871" "7504871" "subst" "0.00143194" "01943" "ARHGEF18_000001" "g.7504871T>A" "" "" "" "ARHGEF18(NM_001130955.2):c.-118T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7439985T>A" "" "likely benign" "" "0000568770" "0" "30" "19" "7504940" "7504940" "subst" "0" "01943" "ARHGEF18_000002" "g.7504940C>A" "" "" "" "ARHGEF18(NM_001130955.2):c.-49C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7440054C>A" "" "likely benign" "" "0000568771" "0" "30" "19" "7504957" "7504957" "subst" "0.000502089" "01943" "ARHGEF18_000003" "g.7504957C>G" "" "" "" "ARHGEF18(NM_001130955.2):c.-32C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7440071C>G" "" "likely benign" "" "0000568772" "0" "50" "19" "7505169" "7505169" "subst" "4.48793E-5" "02330" "ARHGEF18_000004" "g.7505169G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.181G>A (p.G61R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7440283G>A" "" "VUS" "" "0000568773" "0" "50" "19" "7505185" "7505185" "subst" "6.79361E-5" "01943" "ARHGEF18_000005" "g.7505185C>T" "" "" "" "ARHGEF18(NM_001130955.2):c.197C>T (p.P66L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7440299C>T" "" "VUS" "" "0000568774" "0" "50" "19" "7505268" "7505268" "subst" "0" "01943" "ARHGEF18_000006" "g.7505268G>T" "" "" "" "ARHGEF18(NM_001130955.2):c.280G>T (p.D94Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7440382G>T" "" "VUS" "" "0000568775" "0" "30" "19" "7505367" "7505367" "subst" "0.00127007" "02330" "ARHGEF18_000007" "g.7505367G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.379G>A (p.G127R), ARHGEF18(NM_001367823.1):c.1105G>A (p.G369R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7440481G>A" "" "likely benign" "" "0000568776" "0" "10" "19" "7509115" "7509115" "subst" "0.000250209" "02330" "ARHGEF18_000008" "g.7509115C>T" "" "" "" "ARHGEF18(NM_001130955.2):c.660C>T (p.H220=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7444229C>T" "" "benign" "" "0000568777" "0" "50" "19" "7509120" "7509120" "subst" "0.000704733" "01943" "ARHGEF18_000009" "g.7509120G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.665G>A (p.R222Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7444234G>A" "" "VUS" "" "0000568778" "0" "50" "19" "7512016" "7512016" "subst" "0.00246867" "02330" "ARHGEF18_000010" "g.7512016C>G" "" "" "" "ARHGEF18(NM_001130955.2):c.973C>G (p.L325V), ARHGEF18(NM_001367823.1):c.1699C>G (p.L567V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7447130C>G" "" "VUS" "" "0000568779" "0" "10" "19" "7512075" "7512075" "dup" "0" "02330" "ARHGEF18_000011" "g.7512075dup" "" "" "" "ARHGEF18(NM_001130955.2):c.1011+21dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7447189dup" "" "benign" "" "0000568780" "0" "10" "19" "7516024" "7516024" "subst" "0.000203178" "02330" "ARHGEF18_000012" "g.7516024C>G" "" "" "" "ARHGEF18(NM_001130955.2):c.1012-11C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7451138C>G" "" "benign" "" "0000568781" "0" "30" "19" "7521274" "7521274" "subst" "2.84243E-5" "01943" "ARHGEF18_000013" "g.7521274C>T" "" "" "" "ARHGEF18(NM_001130955.2):c.1440C>T (p.Y480=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7456388C>T" "" "likely benign" "" "0000568782" "0" "30" "19" "7524887" "7524887" "subst" "0.000354951" "02330" "ARHGEF18_000014" "g.7524887G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.1726+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7460001G>A" "" "likely benign" "" "0000568783" "0" "10" "19" "7527105" "7527105" "subst" "4.06246E-5" "02330" "ARHGEF18_000015" "g.7527105G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.1794G>A (p.E598=), ARHGEF18(NM_001367823.1):c.2520G>A (p.E840=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7462219G>A" "" "benign" "" "0000568784" "0" "10" "19" "7528744" "7528744" "subst" "0.000369669" "02330" "ARHGEF18_000016" "g.7528744C>T" "" "" "" "ARHGEF18(NM_001130955.2):c.1950C>T (p.S650=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7463858C>T" "" "benign" "" "0000568785" "0" "10" "19" "7528777" "7528777" "subst" "0.00152982" "02330" "ARHGEF18_000017" "g.7528777C>T" "" "" "" "ARHGEF18(NM_001130955.2):c.1983C>T (p.S661=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7463891C>T" "" "benign" "" "0000568786" "0" "10" "19" "7529516" "7529516" "subst" "0.000581249" "02330" "ARHGEF18_000018" "g.7529516C>T" "" "" "" "ARHGEF18(NM_001130955.2):c.2118C>T (p.S706=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7464630C>T" "" "benign" "" "0000568787" "0" "30" "19" "7531856" "7531856" "subst" "0.000646373" "02330" "ARHGEF18_000019" "g.7531856C>T" "" "" "" "ARHGEF18(NM_001130955.2):c.2231C>T (p.S744L), ARHGEF18(NM_001367823.1):c.2957C>T (p.S986L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7466970C>T" "" "likely benign" "" "0000568788" "0" "30" "19" "7532208" "7532208" "subst" "0.000476169" "02330" "ARHGEF18_000020" "g.7532208C>A" "" "" "" "ARHGEF18(NM_001130955.2):c.2392C>A (p.Q798K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7467322C>A" "" "likely benign" "" "0000568789" "0" "10" "19" "7532258" "7532258" "subst" "0.000347107" "02330" "ARHGEF18_000021" "g.7532258G>C" "" "" "" "ARHGEF18(NM_001130955.2):c.2442G>C (p.L814=), ARHGEF18(NM_001367823.1):c.3168G>C (p.L1056=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7467372G>C" "" "benign" "" "0000568790" "0" "50" "19" "7533786" "7533786" "subst" "0.00156278" "02330" "ARHGEF18_000022" "g.7533786G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.2830G>A (p.G944S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7468900G>A" "" "VUS" "" "0000568791" "0" "50" "19" "7533811" "7533811" "subst" "0.000239444" "01943" "ARHGEF18_000023" "g.7533811G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.2855G>A (p.R952H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7468925G>A" "" "VUS" "" "0000568792" "0" "50" "19" "7533829" "7533829" "subst" "0.000149122" "02330" "ARHGEF18_000024" "g.7533829G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.2873G>A (p.R958Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7468943G>A" "" "VUS" "" "0000568793" "0" "30" "19" "7533891" "7533891" "subst" "0.00318078" "01943" "ARHGEF18_000025" "g.7533891G>A" "" "" "" "ARHGEF18(NM_001367823.1):c.3661G>A (p.A1221T), ARHGEF18(NM_015318.3):c.2623G>A (p.A875T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7469005G>A" "" "likely benign" "" "0000568794" "0" "50" "19" "7535080" "7535080" "subst" "0.0002422" "02330" "ARHGEF18_000026" "g.7535080G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.3256G>A (p.G1086R), ARHGEF18(NM_001367823.1):c.3982G>A (p.G1328R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7470194G>A" "" "VUS" "" "0000617935" "0" "30" "19" "7532417" "7532417" "subst" "0" "01943" "ARHGEF18_000027" "g.7532417G>T" "" "" "" "ARHGEF18(NM_001130955.2):c.2601G>T (p.L867=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7467531G>T" "" "likely benign" "" "0000617936" "0" "30" "19" "7533786" "7533786" "subst" "0.00156278" "01943" "ARHGEF18_000022" "g.7533786G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.2830G>A (p.G944S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7468900G>A" "" "likely benign" "" "0000617937" "0" "50" "19" "7534862" "7534862" "subst" "8.1324E-6" "01943" "ARHGEF18_000029" "g.7534862G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.3134G>A (p.R1045H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7469976G>A" "" "VUS" "" "0000617938" "0" "30" "19" "7535080" "7535080" "subst" "0.0002422" "01943" "ARHGEF18_000026" "g.7535080G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.3256G>A (p.G1086R), ARHGEF18(NM_001367823.1):c.3982G>A (p.G1328R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7470194G>A" "" "likely benign" "" "0000624103" "0" "30" "19" "7533981" "7533981" "subst" "0" "01943" "ARHGEF18_000028" "g.7533981G>A" "" "" "" "ARHGEF18(NM_001367823.1):c.3751G>A (p.G1251S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.7469095G>A" "" "likely benign" "" "0000663559" "11" "90" "19" "7509101" "7509101" "subst" "0" "00006" "ARHGEF18_000030" "g.7509101A>G" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "" "0" "" "" "g.7444215A>G" "" "pathogenic (recessive)" "" "0000663560" "1" "90" "19" "7532286" "7532286" "subst" "0" "00006" "ARHGEF18_000032" "g.7532286G>T" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "" "0" "" "" "g.7467400G>T" "" "pathogenic (recessive)" "" "0000663561" "3" "90" "19" "7521294" "7521294" "subst" "0" "00006" "ARHGEF18_000034" "g.7521294G>A" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "" "0" "" "" "g.7456408G>A" "" "pathogenic (recessive)" "" "0000663562" "21" "90" "19" "7527145" "7527145" "subst" "0" "00006" "ARHGEF18_000031" "g.7527145C>T" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "" "0" "" "" "g.7462259C>T" "" "pathogenic (recessive)" "" "0000663563" "2" "90" "19" "7532392" "7532415" "del" "0" "00006" "ARHGEF18_000033" "g.7532392_7532415del" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "" "0" "" "" "g.7467506_7467529del" "" "pathogenic (recessive)" "" "0000663564" "3" "70" "19" "7505169" "7505169" "subst" "4.48793E-5" "00006" "ARHGEF18_000004" "g.7505169G>A" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "rs375852625" "0" "" "" "g.7440283G>A" "" "VUS" "" "0000663565" "3" "70" "19" "7516147" "7516147" "subst" "0.000118146" "00006" "ARHGEF18_000035" "g.7516147C>T" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "rs200483329" "0" "" "" "g.7451261C>T" "" "VUS" "" "0000663566" "1" "50" "19" "7505332" "7505332" "subst" "0.002354" "00006" "ARHGEF18_000037" "g.7505332C>A" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "rs28489511" "0" "" "" "g.7440446C>A" "" "VUS" "" "0000663567" "3" "70" "19" "7516071" "7516071" "subst" "0.000154332" "00006" "ARHGEF18_000036" "g.7516071G>A" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "rs368588291" "0" "" "" "g.7451185G>A" "" "VUS" "" "0000663568" "2" "30" "19" "7506936" "7506936" "subst" "0.00210074" "00006" "ARHGEF18_000038" "g.7506936A>T" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "rs74497723" "0" "" "" "g.7442050A>T" "" "VUS" "" "0000692911" "0" "50" "19" "7505367" "7505367" "subst" "0.00127007" "01943" "ARHGEF18_000007" "g.7505367G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.379G>A (p.G127R), ARHGEF18(NM_001367823.1):c.1105G>A (p.G369R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000692912" "0" "30" "19" "7506800" "7506800" "subst" "0.000410249" "01943" "ARHGEF18_000039" "g.7506800C>T" "" "" "" "ARHGEF18(NM_001367823.1):c.1222C>T (p.P408S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000692913" "0" "30" "19" "7527105" "7527105" "subst" "4.06246E-5" "01943" "ARHGEF18_000015" "g.7527105G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.1794G>A (p.E598=), ARHGEF18(NM_001367823.1):c.2520G>A (p.E840=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727573" "0" "50" "19" "7524884" "7524884" "subst" "2.40978E-5" "01943" "ARHGEF18_000040" "g.7524884A>T" "" "" "" "ARHGEF18(NM_001367823.1):c.2452+4A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727574" "0" "30" "19" "7527126" "7527126" "subst" "4.06534E-6" "01943" "ARHGEF18_000041" "g.7527126C>G" "" "" "" "ARHGEF18(NM_015318.3):c.1503C>G (p.L501=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727575" "0" "30" "19" "7527195" "7527195" "subst" "0.0020686" "01943" "ARHGEF18_000042" "g.7527195A>G" "" "" "" "ARHGEF18(NM_001367823.1):c.2610A>G (p.L870=), ARHGEF18(NM_015318.3):c.1572A>G (p.L524=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727576" "0" "50" "19" "7534864" "7534864" "subst" "2.43944E-5" "01943" "ARHGEF18_000043" "g.7534864C>T" "" "" "" "ARHGEF18(NM_001130955.2):c.3136C>T (p.R1046C), ARHGEF18(NM_001367823.1):c.3862C>T (p.R1288C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727577" "0" "30" "19" "7535106" "7535106" "subst" "2.10926E-5" "01943" "ARHGEF18_000044" "g.7535106C>G" "" "" "" "ARHGEF18(NM_001367823.1):c.4008C>G (p.P1336=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809098" "0" "50" "19" "7437716" "7437716" "subst" "0.000301114" "01943" "ARHGEF18_000045" "g.7437716C>T" "" "" "" "ARHGEF18(NM_001367823.1):c.34C>T (p.R12W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809099" "0" "50" "19" "7441568" "7441568" "subst" "0" "01943" "ARHGEF18_000046" "g.7441568G>A" "" "" "" "ARHGEF18(NM_001367823.1):c.466G>A (p.V156I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809100" "0" "30" "19" "7506632" "7506632" "subst" "0.000101524" "02330" "ARHGEF18_000047" "g.7506632C>T" "" "" "" "ARHGEF18(NM_001367823.1):c.1200C>T (p.T400=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809101" "0" "30" "19" "7506665" "7506665" "subst" "4.062E-5" "02330" "ARHGEF18_000048" "g.7506665C>T" "" "" "" "ARHGEF18(NM_001367823.1):c.1219+14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809102" "0" "30" "19" "7506856" "7506856" "subst" "0" "01943" "ARHGEF18_000049" "g.7506856T>C" "" "" "" "ARHGEF18(NM_001130955.2):c.552T>C (p.A184=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809103" "0" "30" "19" "7506958" "7506958" "subst" "0.00240361" "02330" "ARHGEF18_000050" "g.7506958G>A" "" "" "" "ARHGEF18(NM_001367823.1):c.1360+20G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809104" "0" "50" "19" "7509332" "7509332" "subst" "0.000700682" "01943" "ARHGEF18_000051" "g.7509332G>A" "" "" "" "ARHGEF18(NM_001367823.1):c.1603G>A (p.V535I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809105" "0" "50" "19" "7518469" "7518469" "subst" "3.65794E-5" "01943" "ARHGEF18_000052" "g.7518469G>A" "" "" "" "ARHGEF18(NM_015318.3):c.934G>A (p.A312T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809106" "0" "50" "19" "7518584" "7518584" "subst" "0.000408398" "01943" "ARHGEF18_000053" "g.7518584C>T" "" "" "" "ARHGEF18(NM_001367823.1):c.2087C>T (p.T696I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809107" "0" "30" "19" "7527216" "7527216" "subst" "0.0066799" "02330" "ARHGEF18_000054" "g.7527216C>T" "" "" "" "ARHGEF18(NM_001367823.1):c.2631C>T (p.S877=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809108" "0" "70" "19" "7531803" "7531803" "subst" "8.12526E-6" "02330" "ARHGEF18_000055" "g.7531803G>T" "" "" "" "ARHGEF18(NM_001367823.1):c.2905-1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000809109" "0" "50" "19" "7534850" "7534850" "subst" "0" "01943" "ARHGEF18_000056" "g.7534850C>A" "" "" "" "ARHGEF18(NM_001367823.1):c.3848C>A (p.T1283N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809110" "0" "30" "19" "7535079" "7535079" "subst" "3.75028E-5" "01943" "ARHGEF18_000057" "g.7535079C>T" "" "" "" "ARHGEF18(NM_001367823.1):c.3981C>T (p.A1327=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000821154" "0" "70" "19" "7527145" "7527145" "subst" "0" "00000" "ARHGEF18_000031" "g.7527145C>T" "" "{PMID:Turro 2020:32581362}" "" "ARHGEF18 c.1996C>T, p.Arg666Ter" "heterozygous, different transcript, NM_001130955.1:c.1996C>T, p.Arg666Ter" "Germline/De novo (untested)" "?" "" "0" "" "" "g.7462259C>T" "" "likely pathogenic" "" "0000821155" "0" "70" "19" "7532286" "7532286" "subst" "0" "00000" "ARHGEF18_000032" "g.7532286G>T" "" "{PMID:Turro 2020:32581362}" "" "ARHGEF18 c.2632G>T, p.Glu878Ter" "heterozygous, different transcript, NM_001130955.1:c.2632G>T, p.Glu878Ter" "Germline/De novo (untested)" "?" "" "0" "" "" "g.7467400G>T" "" "likely pathogenic" "" "0000821523" "0" "70" "19" "7509101" "7509101" "subst" "0" "00000" "ARHGEF18_000030" "g.7509101A>G" "" "{PMID:Turro 2020:32581362}" "" "ARHGEF18 c.808A>G, p.Thr270Ala" "heterozygous, different transcript, NM_001130955.1:c.808A>G, p.Thr270Ala" "Germline/De novo (untested)" "?" "" "0" "" "" "g.7444215A>G" "" "likely pathogenic" "" "0000821524" "0" "70" "19" "7532392" "7532415" "del" "0" "00000" "ARHGEF18_000033" "g.7532392_7532415del" "" "{PMID:Turro 2020:32581362}" "" "ARHGEF18 c.2738_2761delGGCTGGAGCAGGAGCGGGCCGAGC, p.Arg913_Glu920del" "heterozygous, different transcript, NM_001130955.1: c.2738_2761delGGCTGGAGCAGGAGCGGGCCGAGC, p.Arg913_Glu920del" "Germline/De novo (untested)" "?" "" "0" "" "" "g.7467506_7467529del" "" "likely pathogenic" "" "0000855732" "0" "50" "19" "7447761" "7447761" "subst" "0.00067981" "01943" "ARHGEF18_000059" "g.7447761T>C" "" "" "" "ARHGEF18(NM_001367823.1):c.806T>C (p.V269A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855733" "0" "50" "19" "7516046" "7516046" "subst" "0" "01943" "ARHGEF18_000060" "g.7516046C>G" "" "" "" "ARHGEF18(NM_001367823.1):c.1749C>G (p.N583K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855734" "0" "50" "19" "7531856" "7531856" "subst" "0.000646373" "01943" "ARHGEF18_000019" "g.7531856C>T" "" "" "" "ARHGEF18(NM_001130955.2):c.2231C>T (p.S744L), ARHGEF18(NM_001367823.1):c.2957C>T (p.S986L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866347" "0" "50" "19" "7437728" "7437728" "subst" "0" "01943" "ARHGEF18_000058" "g.7437728A>C" "" "" "" "ARHGEF18(NM_001367823.1):c.46A>C (p.S16R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866348" "0" "30" "19" "7506800" "7506800" "subst" "0.000410249" "02330" "ARHGEF18_000039" "g.7506800C>T" "" "" "" "ARHGEF18(NM_001367823.1):c.1222C>T (p.P408S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866349" "0" "50" "19" "7518524" "7518524" "subst" "0.000154912" "01943" "ARHGEF18_000061" "g.7518524G>A" "" "" "" "ARHGEF18(NM_001367823.1):c.2027G>A (p.R676H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866350" "0" "90" "19" "7527037" "7527037" "subst" "8.12823E-6" "01943" "ARHGEF18_000062" "g.7527037G>A" "" "" "" "ARHGEF18(NM_015318.3):c.1415-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000866351" "0" "30" "19" "7528758" "7528758" "subst" "0.000189211" "01943" "ARHGEF18_000063" "g.7528758C>T" "" "" "" "ARHGEF18(NM_015318.3):c.1652C>T (p.A551V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866352" "0" "30" "19" "7532258" "7532258" "subst" "0.000347107" "01943" "ARHGEF18_000021" "g.7532258G>C" "" "" "" "ARHGEF18(NM_001130955.2):c.2442G>C (p.L814=), ARHGEF18(NM_001367823.1):c.3168G>C (p.L1056=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866353" "0" "30" "19" "7534013" "7534013" "subst" "0.000766354" "02330" "ARHGEF18_000064" "g.7534013C>T" "" "" "" "ARHGEF18(NM_001367823.1):c.3783C>T (p.S1261=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866354" "0" "30" "19" "7534013" "7534013" "subst" "0.000766354" "01943" "ARHGEF18_000064" "g.7534013C>T" "" "" "" "ARHGEF18(NM_001367823.1):c.3783C>T (p.S1261=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895188" "0" "30" "19" "7528750" "7528750" "subst" "0" "02330" "ARHGEF18_000065" "g.7528750C>T" "" "" "" "ARHGEF18(NM_001367823.1):c.2682C>T (p.N894=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895189" "0" "30" "19" "7532411" "7532411" "subst" "0.000476565" "02330" "ARHGEF18_000066" "g.7532411C>G" "" "" "" "ARHGEF18(NM_001367823.1):c.3321C>G (p.A1107=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000931130" "0" "30" "19" "7527207" "7527207" "subst" "0.000506023" "02330" "ARHGEF18_000067" "g.7527207G>A" "" "" "" "ARHGEF18(NM_001367823.1):c.2622G>A (p.S874=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951378" "0" "30" "19" "7437954" "7437954" "subst" "0.00310078" "02330" "ARHGEF18_000068" "g.7437954G>A" "" "" "" "ARHGEF18(NM_001367823.1):c.272G>A (p.R91Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951379" "0" "30" "19" "7527195" "7527195" "subst" "0.0020686" "02330" "ARHGEF18_000042" "g.7527195A>G" "" "" "" "ARHGEF18(NM_001367823.1):c.2610A>G (p.L870=), ARHGEF18(NM_015318.3):c.1572A>G (p.L524=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000959347" "0" "50" "19" "7516137" "7516137" "subst" "0.000195266" "00006" "ARHGEF18_000069" "g.7516137A>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, BP4" "Germline" "" "" "0" "" "" "g.7451251A>C" "" "VUS" "ACMG" "0000959348" "0" "50" "19" "7518584" "7518584" "subst" "0.000408398" "00006" "ARHGEF18_000053" "g.7518584C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.7453698C>T" "" "VUS" "ACMG" "0000983697" "0" "30" "19" "7533891" "7533891" "subst" "0.00318078" "02330" "ARHGEF18_000025" "g.7533891G>A" "" "" "" "ARHGEF18(NM_001367823.1):c.3661G>A (p.A1221T), ARHGEF18(NM_015318.3):c.2623G>A (p.A875T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000986858" "1" "50" "19" "7524884" "7524884" "subst" "2.40978E-5" "04405" "ARHGEF18_000040" "g.7524884A>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "c.1414+4A>T" "carries likely causative variants in more than one gene" "Germline" "" "" "0" "" "" "g.7459998A>T" "" "VUS" "ACMG" "0000986860" "2" "50" "19" "7535080" "7535080" "subst" "0.0002422" "04405" "ARHGEF18_000026" "g.7535080G>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "c.2944G>A" "carries likely causative variants in more than one gene" "Germline" "" "" "0" "" "" "g.7470194G>A" "" "VUS" "ACMG" "0001005213" "0" "50" "19" "7509332" "7509332" "subst" "0.000700682" "02327" "ARHGEF18_000051" "g.7509332G>A" "" "" "" "ARHGEF18(NM_001367823.1):c.1603G>A (p.V535I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005214" "0" "50" "19" "7532444" "7532444" "subst" "4.65712E-5" "02327" "ARHGEF18_000070" "g.7532444C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043227" "0" "50" "19" "7447761" "7447761" "subst" "0.00067981" "02325" "ARHGEF18_000059" "g.7447761T>C" "" "" "" "ARHGEF18(NM_001367823.1):c.806T>C (p.V269A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043228" "0" "50" "19" "7523505" "7523505" "subst" "0.000170585" "02325" "ARHGEF18_000071" "g.7523505G>A" "" "" "" "ARHGEF18(NM_001130955.2):c.1563G>A (p.M521I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001049784" "3" "50" "19" "7516147" "7516147" "subst" "0.000118146" "00006" "ARHGEF18_000035" "g.7516147C>T" "" "{PMID:Charng 2016:27435318}" "" "" "ACMG PP3" "Germline" "" "" "0" "" "" "g.7451261C>T" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes ARHGEF18 ## Count = 194 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000568769" "00002823" "30" "-71" "-359" "-71" "-359" "c.-71-359T>A" "r.(=)" "p.(=)" "" "0000568769" "00025503" "30" "45" "0" "45" "0" "c.45T>A" "r.(?)" "p.(Ala15=)" "" "0000568770" "00002823" "30" "-71" "-290" "-71" "-290" "c.-71-290C>A" "r.(=)" "p.(=)" "" "0000568770" "00025503" "30" "114" "0" "114" "0" "c.114C>A" "r.(?)" "p.(Gly38=)" "" "0000568771" "00002823" "30" "-71" "-273" "-71" "-273" "c.-71-273C>G" "r.(=)" "p.(=)" "" "0000568771" "00025503" "30" "131" "0" "131" "0" "c.131C>G" "r.(?)" "p.(Ala44Gly)" "" "0000568772" "00002823" "50" "-71" "-61" "-71" "-61" "c.-71-61G>A" "r.(=)" "p.(=)" "" "0000568772" "00025503" "50" "343" "0" "343" "0" "c.343G>A" "r.(?)" "p.(Gly115Arg)" "" "0000568773" "00002823" "50" "-71" "-45" "-71" "-45" "c.-71-45C>T" "r.(=)" "p.(=)" "" "0000568773" "00025503" "50" "359" "0" "359" "0" "c.359C>T" "r.(?)" "p.(Pro120Leu)" "" "0000568774" "00002823" "50" "-33" "0" "-33" "0" "c.-33G>T" "r.(?)" "p.(=)" "" "0000568774" "00025503" "50" "442" "0" "442" "0" "c.442G>T" "r.(?)" "p.(Asp148Tyr)" "" "0000568775" "00002823" "30" "67" "0" "67" "0" "c.67G>A" "r.(?)" "p.(Gly23Arg)" "" "0000568775" "00025503" "30" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Gly181Arg)" "" "0000568776" "00002823" "10" "348" "0" "348" "0" "c.348C>T" "r.(?)" "p.(His116=)" "" "0000568776" "00025503" "10" "822" "0" "822" "0" "c.822C>T" "r.(?)" "p.(His274=)" "" "0000568777" "00002823" "50" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118Gln)" "" "0000568777" "00025503" "50" "827" "0" "827" "0" "c.827G>A" "r.(?)" "p.(Arg276Gln)" "" "0000568778" "00002823" "50" "661" "0" "661" "0" "c.661C>G" "r.(?)" "p.(Leu221Val)" "" "0000568778" "00025503" "50" "1135" "0" "1135" "0" "c.1135C>G" "r.(?)" "p.(Leu379Val)" "" "0000568779" "00002823" "10" "699" "21" "699" "21" "c.699+21dup" "r.(=)" "p.(=)" "" "0000568779" "00025503" "10" "1173" "21" "1173" "21" "c.1173+21dup" "r.(=)" "p.(=)" "" "0000568780" "00002823" "10" "700" "-11" "700" "-11" "c.700-11C>G" "r.(=)" "p.(=)" "" "0000568780" "00025503" "10" "1174" "-11" "1174" "-11" "c.1174-11C>G" "r.(=)" "p.(=)" "" "0000568781" "00002823" "30" "1128" "0" "1128" "0" "c.1128C>T" "r.(?)" "p.(Tyr376=)" "" "0000568781" "00025503" "30" "1602" "0" "1602" "0" "c.1602C>T" "r.(?)" "p.(Tyr534=)" "" "0000568782" "00002823" "30" "1414" "7" "1414" "7" "c.1414+7G>A" "r.(=)" "p.(=)" "" "0000568782" "00025503" "30" "1888" "7" "1888" "7" "c.1888+7G>A" "r.(=)" "p.(=)" "" "0000568783" "00002823" "10" "1482" "0" "1482" "0" "c.1482G>A" "r.(?)" "p.(Glu494=)" "" "0000568783" "00025503" "10" "1956" "0" "1956" "0" "c.1956G>A" "r.(?)" "p.(Glu652=)" "" "0000568784" "00002823" "10" "1638" "0" "1638" "0" "c.1638C>T" "r.(?)" "p.(Ser546=)" "" "0000568784" "00025503" "10" "2112" "0" "2112" "0" "c.2112C>T" "r.(?)" "p.(Ser704=)" "" "0000568785" "00002823" "10" "1671" "0" "1671" "0" "c.1671C>T" "r.(?)" "p.(Ser557=)" "" "0000568785" "00025503" "10" "2145" "0" "2145" "0" "c.2145C>T" "r.(?)" "p.(Ser715=)" "" "0000568786" "00002823" "10" "1806" "0" "1806" "0" "c.1806C>T" "r.(?)" "p.(Ser602=)" "" "0000568786" "00025503" "10" "2280" "0" "2280" "0" "c.2280C>T" "r.(?)" "p.(Ser760=)" "" "0000568787" "00002823" "30" "1919" "0" "1919" "0" "c.1919C>T" "r.(?)" "p.(Ser640Leu)" "" "0000568787" "00025503" "30" "2393" "0" "2393" "0" "c.2393C>T" "r.(?)" "p.(Ser798Leu)" "" "0000568788" "00002823" "30" "2080" "0" "2080" "0" "c.2080C>A" "r.(?)" "p.(Gln694Lys)" "" "0000568788" "00025503" "30" "2554" "0" "2554" "0" "c.2554C>A" "r.(?)" "p.(Gln852Lys)" "" "0000568789" "00002823" "10" "2130" "0" "2130" "0" "c.2130G>C" "r.(?)" "p.(Leu710=)" "" "0000568789" "00025503" "10" "2604" "0" "2604" "0" "c.2604G>C" "r.(?)" "p.(Leu868=)" "" "0000568790" "00002823" "50" "2518" "0" "2518" "0" "c.2518G>A" "r.(?)" "p.(Gly840Ser)" "" "0000568790" "00025503" "50" "2992" "0" "2992" "0" "c.2992G>A" "r.(?)" "p.(Gly998Ser)" "" "0000568791" "00002823" "50" "2543" "0" "2543" "0" "c.2543G>A" "r.(?)" "p.(Arg848His)" "" "0000568791" "00025503" "50" "3017" "0" "3017" "0" "c.3017G>A" "r.(?)" "p.(Arg1006His)" "" "0000568792" "00002823" "50" "2561" "0" "2561" "0" "c.2561G>A" "r.(?)" "p.(Arg854Gln)" "" "0000568792" "00025503" "50" "3035" "0" "3035" "0" "c.3035G>A" "r.(?)" "p.(Arg1012Gln)" "" "0000568793" "00002823" "30" "2623" "0" "2623" "0" "c.2623G>A" "r.(?)" "p.(Ala875Thr)" "" "0000568793" "00025503" "30" "3097" "0" "3097" "0" "c.3097G>A" "r.(?)" "p.(Ala1033Thr)" "" "0000568794" "00002823" "50" "2944" "0" "2944" "0" "c.2944G>A" "r.(?)" "p.(Gly982Arg)" "" "0000568794" "00025503" "50" "3418" "0" "3418" "0" "c.3418G>A" "r.(?)" "p.(Gly1140Arg)" "" "0000617935" "00002823" "30" "2289" "0" "2289" "0" "c.2289G>T" "r.(?)" "p.(Leu763=)" "" "0000617935" "00025503" "30" "2763" "0" "2763" "0" "c.2763G>T" "r.(?)" "p.(Leu921=)" "" "0000617936" "00002823" "30" "2518" "0" "2518" "0" "c.2518G>A" "r.(?)" "p.(Gly840Ser)" "" "0000617936" "00025503" "30" "2992" "0" "2992" "0" "c.2992G>A" "r.(?)" "p.(Gly998Ser)" "" "0000617937" "00002823" "50" "2822" "0" "2822" "0" "c.2822G>A" "r.(?)" "p.(Arg941His)" "" "0000617937" "00025503" "50" "3296" "0" "3296" "0" "c.3296G>A" "r.(?)" "p.(Arg1099His)" "" "0000617938" "00002823" "30" "2944" "0" "2944" "0" "c.2944G>A" "r.(?)" "p.(Gly982Arg)" "" "0000617938" "00025503" "30" "3418" "0" "3418" "0" "c.3418G>A" "r.(?)" "p.(Gly1140Arg)" "" "0000624103" "00002823" "30" "2713" "0" "2713" "0" "c.2713G>A" "r.(?)" "p.(Gly905Ser)" "" "0000624103" "00025503" "30" "3187" "0" "3187" "0" "c.3187G>A" "r.(?)" "p.(Gly1063Ser)" "" "0000663559" "00002823" "90" "334" "0" "334" "0" "c.334A>G" "r.(?)" "p.(Thr112Ala)" "" "0000663559" "00025503" "90" "808" "0" "808" "0" "c.808A>G" "r.(?)" "p.(Thr270Ala)" "" "0000663560" "00002823" "90" "2158" "0" "2158" "0" "c.2158G>T" "r.2158g>u" "p.Glu720*" "" "0000663560" "00025503" "90" "2632" "0" "2632" "0" "c.2632G>T" "r.(?)" "p.(Glu878*)" "" "0000663561" "00002823" "90" "1143" "5" "1143" "5" "c.1143+5G>A" "r.[1067_1143del,=]" "p.[Asp356Gly*37,=]" "" "0000663561" "00025503" "90" "1617" "5" "1617" "5" "c.1617+5G>A" "r.[1541_1617del,=]" "p.[Asp540Gly*37,=]" "" "0000663562" "00002823" "90" "1522" "0" "1522" "0" "c.1522C>T" "r.(?)" "p.(Arg508*)" "" "0000663562" "00025503" "90" "1996" "0" "1996" "0" "c.1996C>T" "r.(?)" "p.(Arg666*)" "" "0000663563" "00002823" "90" "2264" "0" "2287" "0" "c.2264_2287del" "r.2264_2287del" "p.Arg755_Glu762del" "" "0000663563" "00025503" "90" "2738" "0" "2761" "0" "c.2738_2761del" "r.(?)" "p.(Arg913_Glu920del)" "" "0000663564" "00002823" "70" "-71" "-61" "-71" "-61" "c.-71-61G>A" "r.(?)" "p.(=)" "" "0000663564" "00025503" "70" "343" "0" "343" "0" "c.343G>A" "r.(?)" "p.(Gly115Arg)" "" "0000663565" "00002823" "50" "812" "0" "812" "0" "c.812C>T" "r.(?)" "p.(Thr271Met)" "" "0000663565" "00025503" "70" "1286" "0" "1286" "0" "c.1286C>T" "r.(?)" "p.(Thr429Met)" "" "0000663566" "00002823" "50" "32" "0" "32" "0" "c.32C>A" "r.(?)" "p.(Pro11Gln)" "" "0000663566" "00025503" "30" "506" "0" "506" "0" "c.506C>A" "r.(?)" "p.(Pro169Gln)" "" "0000663567" "00002823" "70" "736" "0" "736" "0" "c.736G>A" "r.(?)" "p.(Val246Met)" "" "0000663567" "00025503" "70" "1210" "0" "1210" "0" "c.1210G>A" "r.(?)" "p.(Val404Met)" "" "0000663568" "00002823" "30" "320" "0" "320" "0" "c.320A>T" "r.(?)" "p.(Tyr107Phe)" "" "0000663568" "00025503" "30" "794" "0" "794" "0" "c.794A>T" "r.(?)" "p.(Tyr265Phe)" "" "0000692911" "00002823" "50" "67" "0" "67" "0" "c.67G>A" "r.(?)" "p.(Gly23Arg)" "" "0000692911" "00025503" "50" "541" "0" "541" "0" "c.541G>A" "r.(?)" "p.(Gly181Arg)" "" "0000692912" "00002823" "30" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Pro62Ser)" "" "0000692912" "00025503" "30" "658" "0" "658" "0" "c.658C>T" "r.(?)" "p.(Pro220Ser)" "" "0000692913" "00002823" "30" "1482" "0" "1482" "0" "c.1482G>A" "r.(?)" "p.(Glu494=)" "" "0000692913" "00025503" "30" "1956" "0" "1956" "0" "c.1956G>A" "r.(?)" "p.(Glu652=)" "" "0000727573" "00002823" "50" "1414" "4" "1414" "4" "c.1414+4A>T" "r.spl?" "p.?" "" "0000727573" "00025503" "50" "1888" "4" "1888" "4" "c.1888+4A>T" "r.spl?" "p.?" "" "0000727574" "00002823" "30" "1503" "0" "1503" "0" "c.1503C>G" "r.(?)" "p.(Leu501=)" "" "0000727574" "00025503" "30" "1977" "0" "1977" "0" "c.1977C>G" "r.(?)" "p.(Leu659=)" "" "0000727575" "00002823" "30" "1572" "0" "1572" "0" "c.1572A>G" "r.(?)" "p.(Leu524=)" "" "0000727575" "00025503" "30" "2046" "0" "2046" "0" "c.2046A>G" "r.(?)" "p.(Leu682=)" "" "0000727576" "00002823" "50" "2824" "0" "2824" "0" "c.2824C>T" "r.(?)" "p.(Arg942Cys)" "" "0000727576" "00025503" "50" "3298" "0" "3298" "0" "c.3298C>T" "r.(?)" "p.(Arg1100Cys)" "" "0000727577" "00002823" "30" "2970" "0" "2970" "0" "c.2970C>G" "r.(?)" "p.(Pro990=)" "" "0000727577" "00025503" "30" "3444" "0" "3444" "0" "c.3444C>G" "r.(?)" "p.(Pro1148=)" "" "0000809098" "00002823" "50" "-22489" "0" "-22489" "0" "c.-22489C>T" "r.(?)" "p.(=)" "" "0000809098" "00025503" "50" "-67111" "0" "-67111" "0" "c.-67111C>T" "r.(?)" "p.(=)" "" "0000809099" "00002823" "50" "-18637" "0" "-18637" "0" "c.-18637G>A" "r.(?)" "p.(=)" "" "0000809099" "00025503" "50" "-63259" "0" "-63259" "0" "c.-63259G>A" "r.(?)" "p.(=)" "" "0000809100" "00002823" "30" "162" "0" "162" "0" "c.162C>T" "r.(?)" "p.(Thr54=)" "" "0000809100" "00025503" "30" "636" "0" "636" "0" "c.636C>T" "r.(?)" "p.(Thr212=)" "" "0000809101" "00002823" "30" "181" "14" "181" "14" "c.181+14C>T" "r.(=)" "p.(=)" "" "0000809101" "00025503" "30" "655" "14" "655" "14" "c.655+14C>T" "r.(=)" "p.(=)" "" "0000809102" "00002823" "30" "240" "0" "240" "0" "c.240T>C" "r.(?)" "p.(Ala80=)" "" "0000809102" "00025503" "30" "714" "0" "714" "0" "c.714T>C" "r.(?)" "p.(Ala238=)" "" "0000809103" "00002823" "30" "322" "20" "322" "20" "c.322+20G>A" "r.(=)" "p.(=)" "" "0000809103" "00025503" "30" "796" "20" "796" "20" "c.796+20G>A" "r.(=)" "p.(=)" "" "0000809104" "00002823" "50" "565" "0" "565" "0" "c.565G>A" "r.(?)" "p.(Val189Ile)" "" "0000809104" "00025503" "50" "1039" "0" "1039" "0" "c.1039G>A" "r.(?)" "p.(Val347Ile)" "" "0000809105" "00002823" "50" "934" "0" "934" "0" "c.934G>A" "r.(?)" "p.(Ala312Thr)" "" "0000809105" "00025503" "50" "1408" "0" "1408" "0" "c.1408G>A" "r.(?)" "p.(Ala470Thr)" "" "0000809106" "00002823" "50" "1049" "0" "1049" "0" "c.1049C>T" "r.(?)" "p.(Thr350Ile)" "" "0000809106" "00025503" "50" "1523" "0" "1523" "0" "c.1523C>T" "r.(?)" "p.(Thr508Ile)" "" "0000809107" "00002823" "30" "1593" "0" "1593" "0" "c.1593C>T" "r.(?)" "p.(Ser531=)" "" "0000809107" "00025503" "30" "2067" "0" "2067" "0" "c.2067C>T" "r.(?)" "p.(Ser689=)" "" "0000809108" "00002823" "70" "1867" "-1" "1867" "-1" "c.1867-1G>T" "r.spl?" "p.?" "" "0000809108" "00025503" "70" "2341" "-1" "2341" "-1" "c.2341-1G>T" "r.spl?" "p.?" "" "0000809109" "00002823" "50" "2810" "0" "2810" "0" "c.2810C>A" "r.(?)" "p.(Thr937Asn)" "" "0000809109" "00025503" "50" "3284" "0" "3284" "0" "c.3284C>A" "r.(?)" "p.(Thr1095Asn)" "" "0000809110" "00002823" "30" "2943" "0" "2943" "0" "c.2943C>T" "r.(?)" "p.(Ala981=)" "" "0000809110" "00025503" "30" "3417" "0" "3417" "0" "c.3417C>T" "r.(?)" "p.(Ala1139=)" "" "0000821154" "00002823" "70" "1522" "0" "1522" "0" "c.1522C>T" "r.(?)" "p.(Arg508*)" "" "0000821154" "00025503" "70" "1996" "0" "1996" "0" "c.1996C>T" "r.(?)" "p.(Arg666*)" "" "0000821155" "00002823" "70" "2158" "0" "2158" "0" "c.2158G>T" "r.(?)" "p.(Glu720*)" "" "0000821155" "00025503" "70" "2632" "0" "2632" "0" "c.2632G>T" "r.(?)" "p.(Glu878*)" "" "0000821523" "00002823" "70" "334" "0" "334" "0" "c.334A>G" "r.(?)" "p.(Thr112Ala)" "" "0000821523" "00025503" "70" "808" "0" "808" "0" "c.808A>G" "r.(?)" "p.(Thr270Ala)" "" "0000821524" "00002823" "70" "2264" "0" "2287" "0" "c.2264_2287del" "r.(?)" "p.(Arg755_Glu762del)" "" "0000821524" "00025503" "70" "2738" "0" "2761" "0" "c.2738_2761del" "r.(?)" "p.(Arg913_Glu920del)" "" "0000855732" "00002823" "50" "-12444" "0" "-12444" "0" "c.-12444T>C" "r.(?)" "p.(=)" "" "0000855732" "00025503" "50" "-57066" "0" "-57066" "0" "c.-57066T>C" "r.(?)" "p.(=)" "" "0000855732" "00026037" "50" "806" "0" "806" "0" "c.806T>C" "r.(?)" "p.(Val269Ala)" "" "0000855733" "00002823" "50" "711" "0" "711" "0" "c.711C>G" "r.(?)" "p.(Asn237Lys)" "" "0000855733" "00025503" "50" "1185" "0" "1185" "0" "c.1185C>G" "r.(?)" "p.(Asn395Lys)" "" "0000855733" "00026037" "50" "1749" "0" "1749" "0" "c.1749C>G" "r.(?)" "p.(Asn583Lys)" "" "0000855734" "00002823" "50" "1919" "0" "1919" "0" "c.1919C>T" "r.(?)" "p.(Ser640Leu)" "" "0000855734" "00025503" "50" "2393" "0" "2393" "0" "c.2393C>T" "r.(?)" "p.(Ser798Leu)" "" "0000866347" "00002823" "50" "-22477" "0" "-22477" "0" "c.-22477A>C" "r.(?)" "p.(=)" "" "0000866347" "00025503" "50" "-67099" "0" "-67099" "0" "c.-67099A>C" "r.(?)" "p.(=)" "" "0000866347" "00026037" "50" "46" "0" "46" "0" "c.46A>C" "r.(?)" "p.(Ser16Arg)" "" "0000866348" "00002823" "30" "184" "0" "184" "0" "c.184C>T" "r.(?)" "p.(Pro62Ser)" "" "0000866348" "00025503" "30" "658" "0" "658" "0" "c.658C>T" "r.(?)" "p.(Pro220Ser)" "" "0000866349" "00002823" "50" "989" "0" "989" "0" "c.989G>A" "r.(?)" "p.(Arg330His)" "" "0000866349" "00025503" "50" "1463" "0" "1463" "0" "c.1463G>A" "r.(?)" "p.(Arg488His)" "" "0000866349" "00026037" "50" "2027" "0" "2027" "0" "c.2027G>A" "r.(?)" "p.(Arg676His)" "" "0000866350" "00002823" "90" "1415" "-1" "1415" "-1" "c.1415-1G>A" "r.spl?" "p.?" "" "0000866350" "00025503" "90" "1889" "-1" "1889" "-1" "c.1889-1G>A" "r.spl?" "p.?" "" "0000866350" "00026037" "90" "2453" "-1" "2453" "-1" "c.2453-1G>A" "r.spl?" "p.?" "" "0000866351" "00002823" "30" "1652" "0" "1652" "0" "c.1652C>T" "r.(?)" "p.(Ala551Val)" "" "0000866351" "00025503" "30" "2126" "0" "2126" "0" "c.2126C>T" "r.(?)" "p.(Ala709Val)" "" "0000866351" "00026037" "30" "2690" "0" "2690" "0" "c.2690C>T" "r.(?)" "p.(Ala897Val)" "" "0000866352" "00002823" "30" "2130" "0" "2130" "0" "c.2130G>C" "r.(?)" "p.(Leu710=)" "" "0000866352" "00025503" "30" "2604" "0" "2604" "0" "c.2604G>C" "r.(?)" "p.(Leu868=)" "" "0000866353" "00002823" "30" "2745" "0" "2745" "0" "c.2745C>T" "r.(?)" "p.(Ser915=)" "" "0000866353" "00025503" "30" "3219" "0" "3219" "0" "c.3219C>T" "r.(?)" "p.(Ser1073=)" "" "0000866353" "00026037" "30" "3783" "0" "3783" "0" "c.3783C>T" "r.(?)" "p.(Ser1261=)" "" "0000866354" "00002823" "30" "2745" "0" "2745" "0" "c.2745C>T" "r.(?)" "p.(Ser915=)" "" "0000866354" "00025503" "30" "3219" "0" "3219" "0" "c.3219C>T" "r.(?)" "p.(Ser1073=)" "" "0000866354" "00026037" "30" "3783" "0" "3783" "0" "c.3783C>T" "r.(?)" "p.(Ser1261=)" "" "0000895188" "00002823" "30" "1644" "0" "1644" "0" "c.1644C>T" "r.(?)" "p.(Asn548=)" "" "0000895188" "00025503" "30" "2118" "0" "2118" "0" "c.2118C>T" "r.(?)" "p.(Asn706=)" "" "0000895188" "00026037" "30" "2682" "0" "2682" "0" "c.2682C>T" "r.(?)" "p.(Asn894=)" "" "0000895189" "00002823" "30" "2283" "0" "2283" "0" "c.2283C>G" "r.(?)" "p.(Ala761=)" "" "0000895189" "00025503" "30" "2757" "0" "2757" "0" "c.2757C>G" "r.(?)" "p.(Ala919=)" "" "0000895189" "00026037" "30" "3321" "0" "3321" "0" "c.3321C>G" "r.(?)" "p.(Ala1107=)" "" "0000931130" "00002823" "30" "1584" "0" "1584" "0" "c.1584G>A" "r.(?)" "p.(=)" "" "0000931130" "00025503" "30" "2058" "0" "2058" "0" "c.2058G>A" "r.(?)" "p.(=)" "" "0000931130" "00026037" "30" "2622" "0" "2622" "0" "c.2622G>A" "r.(?)" "p.(Ser874=)" "" "0000951378" "00002823" "30" "-22251" "0" "-22251" "0" "c.-22251G>A" "r.(?)" "p.(=)" "" "0000951378" "00025503" "30" "-66873" "0" "-66873" "0" "c.-66873G>A" "r.(?)" "p.(=)" "" "0000951378" "00026037" "30" "272" "0" "272" "0" "c.272G>A" "r.(?)" "p.(Arg91Gln)" "" "0000951379" "00002823" "30" "1572" "0" "1572" "0" "c.1572A>G" "r.(?)" "p.(Leu524=)" "" "0000951379" "00025503" "30" "2046" "0" "2046" "0" "c.2046A>G" "r.(?)" "p.(Leu682=)" "" "0000959347" "00025503" "50" "1276" "0" "1276" "0" "c.1276A>C" "r.(?)" "p.(Ile426Leu)" "" "0000959348" "00025503" "50" "1523" "0" "1523" "0" "c.1523C>T" "r.(?)" "p.(Thr508Ile)" "" "0000983697" "00002823" "30" "2623" "0" "2623" "0" "c.2623G>A" "r.(?)" "p.(Ala875Thr)" "" "0000983697" "00025503" "30" "3097" "0" "3097" "0" "c.3097G>A" "r.(?)" "p.(Ala1033Thr)" "" "0000986858" "00025503" "50" "1888" "4" "1888" "4" "c.1888+4A>T" "r.spl" "p.?" "" "0000986860" "00025503" "50" "3418" "0" "3418" "0" "c.3418G>A" "r.(?)" "p.(Gly1140Arg)" "" "0001005213" "00002823" "50" "565" "0" "565" "0" "c.565G>A" "r.(?)" "p.(Val189Ile)" "" "0001005213" "00025503" "50" "1039" "0" "1039" "0" "c.1039G>A" "r.(?)" "p.(Val347Ile)" "" "0001005214" "00002823" "50" "2316" "0" "2316" "0" "c.2316C>G" "r.(?)" "p.(His772Gln)" "" "0001005214" "00025503" "50" "2790" "0" "2790" "0" "c.2790C>G" "r.(?)" "p.(His930Gln)" "" "0001005214" "00026037" "50" "3354" "0" "3354" "0" "c.3354C>G" "r.(?)" "p.(His1118Gln)" "" "0001043227" "00002823" "50" "-12444" "0" "-12444" "0" "c.-12444T>C" "r.(?)" "p.(=)" "" "0001043227" "00025503" "50" "-57066" "0" "-57066" "0" "c.-57066T>C" "r.(?)" "p.(=)" "" "0001043227" "00026037" "50" "806" "0" "806" "0" "c.806T>C" "r.(?)" "p.(Val269Ala)" "" "0001043228" "00002823" "50" "1251" "0" "1251" "0" "c.1251G>A" "r.(?)" "p.(Met417Ile)" "" "0001043228" "00025503" "50" "1725" "0" "1725" "0" "c.1725G>A" "r.(?)" "p.(Met575Ile)" "" "0001043228" "00026037" "50" "2289" "0" "2289" "0" "c.2289G>A" "r.(?)" "p.(Met763Ile)" "" "0001049784" "00025503" "50" "812" "0" "812" "0" "c.812C>T" "r.(?)" "p.(Thr271Met)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 19 "{{screeningid}}" "{{variantid}}" "0000300750" "0000663559" "0000300750" "0000663562" "0000300751" "0000663560" "0000300751" "0000663563" "0000300752" "0000663561" "0000300753" "0000663564" "0000300754" "0000663565" "0000300755" "0000663566" "0000300755" "0000663568" "0000300756" "0000663567" "0000391405" "0000821154" "0000391405" "0000821523" "0000391406" "0000821155" "0000391406" "0000821524" "0000449145" "0000959347" "0000449145" "0000959348" "0000452302" "0000986858" "0000452302" "0000986860" "0000469467" "0001049784"