### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = ARID2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "ARID2" "AT rich interactive domain 2 (ARID, RFX-like)" "12" "q13.11" "unknown" "NC_000012.11" "UD_132319610630" "" "https://www.LOVD.nl/ARID2" "" "1" "18037" "196528" "609539" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/ARID2_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2012-09-13 00:00:00" "00006" "2021-04-15 08:40:35" "00000" "2026-03-23 10:26:03" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001654" "ARID2" "AT rich interactive domain 2 (ARID, RFX-like)" "001" "NM_152641.2" "" "NP_689854.2" "" "" "" "1" "8466" "5508" "46123620" "46301819" "00000" "2012-09-13 13:44:39" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00156" "CSS" "Coffin-Siris syndrome (CSS)" "" "" "" "" "" "00001" "2013-06-27 15:22:30" "00006" "2021-12-10 21:51:32" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "03381" "cancer, gastric" "cancer, gastric (Neoplasm of stomach)" "" "613659" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2017-07-14 15:28:09" "05387" "CSS6" "Coffin-Siris syndrome, type 6 (CSS6)" "AD" "617808" "" "autosomal dominant" "" "00006" "2018-02-01 14:03:00" "00006" "2021-12-10 21:51:32" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "06886" "hypophosphatemia" "hypophosphatemia" "" "" "" "" "" "00006" "2021-12-18 20:30:38" "00006" "2026-04-26 13:37:16" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "ARID2" "00156" "ARID2" "05387" ## Individuals ## Do not remove or alter this header ## ## Count = 56 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00104036" "" "" "" "1" "" "00587" "{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}" "54 patients from 53 families with genetically unexplained diffuse-type and intestinal-type gastric cancer" "" "" "" "" "0" "" "" "" "Vogelaar-759A" "00174068" "" "" "" "1" "" "00008" "{PMID:Bramswig 2017:28124119}" "" "" "" "" "" "0" "" "" "" "Ind1" "00174069" "" "" "" "1" "" "00008" "{PMID:Bramswig 2017:28124119}" "" "" "" "" "" "0" "" "" "" "Ind2" "00174070" "" "" "" "1" "" "00008" "{PMID:Shang L 2015:26238514}" "" "F" "" "" "" "0" "" "" "" "1" "00174071" "" "" "" "1" "" "00008" "{PMID:Shang L 2015:26238514}" "" "F" "" "" "" "0" "" "" "" "2" "00174072" "" "" "" "1" "" "00008" "{PMID:Shang L 2015:26238514}" "" "M" "" "" "" "0" "" "" "" "3" "00174073" "" "" "" "1" "" "00008" "{PMID:Shang L 2015:26238514}" "" "F" "" "" "" "0" "" "" "" "4" "00290699" "" "" "" "8" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00290700" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00362197" "" "" "" "1" "" "00006" "{PMID:Van Paemel 2017:28884947}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Belgium" "" "0" "" "" "" "patient" "00377148" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "180573" "00390711" "" "" "" "1" "" "00006" "{PMID:Kang 2021:33051312}" "no family history" "F" "" "Korea" "" "0" "" "" "" "patient" "00390712" "" "" "" "1" "" "00006" "{PMID:Failla 2008:18412123}" "no family history" "M" "" "Italy" "" "0" "" "" "" "patient" "00390713" "" "" "" "1" "" "00006" "{PMID:Tonoki 1998:9482650}" "no family history" "M" "" "Japan" "" "0" "" "" "" "patient" "00390714" "" "" "" "1" "" "00006" "Gallego 2000 (Int Pediatr 15: 37)" "no family history" "M" "" "" "" "0" "" "" "" "patient" "00390715" "" "" "" "2" "" "00006" "{PMID:Yatsenko 2009:19938085}" "2-generation family, 2 affected sibs" "F" "" "United States" "" "0" "" "" "" "FamPat1" "00390716" "" "" "00390715" "1" "" "00006" "{PMID:Yatsenko 2009:19938085}" "sister" "F" "" "United States" "" "0" "" "" "" "FamPat2" "00390717" "" "" "" "1" "" "00006" "{PMID:Weng 2018:30155906}" "" "F" "" "China" "" "0" "" "" "" "patient" "00390718" "" "" "" "1" "" "00006" "{PMID:Gazdagh 2019:29698805}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat1" "00390719" "" "" "" "1" "" "00006" "{PMID:Gazdagh 2019:29698805}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat2" "00390720" "" "" "" "1" "" "00006" "{PMID:Gazdagh 2019:29698805}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat3" "00390721" "" "" "" "1" "" "00006" "{PMID:Gazdagh 2019:29698805}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat4" "00390722" "" "" "" "1" "" "00006" "{PMID:Gazdagh 2019:29698805}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat5" "00390723" "" "" "" "1" "" "00006" "{PMID:Gazdagh 2019:29698805}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat6" "00390724" "" "" "" "1" "" "00006" "{PMID:Gazdagh 2019:29698805}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat7" "00390725" "" "" "" "1" "" "00006" "{PMID:Khazanchi 2019:30838730}" "" "M" "" "United States" "" "0" "" "" "" "patient" "00397335" "" "" "" "1" "" "00006" "{PMID:Gu 2018:29901142}" "" "" "" "China" "" "0" "" "" "" "" "00420924" "" "" "" "1" "" "01164" "" "" "F" "?" "Syria" "" "0" "" "" "" "207566" "00434734" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat76" "00434735" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat77" "00434736" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat78" "00434737" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat79" "00434738" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat80" "00434739" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat81" "00434740" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat82" "00434741" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "" "" "" "" "0" "" "" "" "Pat83" "00447914" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "Pat1" "00447915" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "Pat2" "00447916" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat3" "00447917" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected" "M" "" "" "" "0" "" "" "" "Pat4" "00447918" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected" "F" "" "" "" "0" "" "" "" "Pat5" "00447919" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat6" "00447920" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Pat7" "00447921" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "Pat8" "00447922" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected" "M" "" "" "" "0" "" "" "" "Pat9" "00447923" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected" "F" "" "" "" "0" "" "" "" "Pat10" "00447924" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected" "F" "" "" "" "0" "" "" "" "Pat11" "00447925" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected" "M" "" "" "" "0" "" "" "" "Pat12" "00447926" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected" "F" "" "" "" "0" "" "" "" "Pat13" "00447927" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "Pat14" "00447928" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected" "M" "" "" "" "0" "" "" "" "Pat15" "00447929" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected" "F" "" "" "" "0" "" "" "" "Pat16" "00447930" "" "" "" "1" "" "00006" "{PMID:Schrier Vergano 2024:38243407}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "Pat17" "00448196" "" "" "" "1" "" "00006" "{PMID:Poli 2024:38177409}" "" "M" "" "Chile" "" "0" "" "" "" "Pat2" "00472182" "" "" "" "2" "" "01482" "" "" "F" "no" "China" "-" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 56 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00104036" "03381" "00174068" "00156" "00174069" "00156" "00174070" "00139" "00174071" "00139" "00174072" "00139" "00174073" "00139" "00290699" "00198" "00290700" "00198" "00362197" "00139" "00377148" "05387" "00390711" "05611" "00390712" "05611" "00390713" "05611" "00390714" "05611" "00390715" "05611" "00390716" "05611" "00390717" "05611" "00390718" "05611" "00390719" "05611" "00390720" "05611" "00390721" "05611" "00390722" "05611" "00390723" "05611" "00390724" "05611" "00390725" "05611" "00397335" "06886" "00420924" "05387" "00434734" "05611" "00434735" "05611" "00434736" "05611" "00434737" "05611" "00434738" "05611" "00434739" "05611" "00434740" "05611" "00434741" "05611" "00447914" "00156" "00447915" "00156" "00447916" "00156" "00447917" "00156" "00447918" "00156" "00447919" "00156" "00447920" "00156" "00447921" "00156" "00447922" "00156" "00447923" "00156" "00447924" "00156" "00447925" "00156" "00447926" "00156" "00447927" "00156" "00447928" "00156" "00447929" "00156" "00447930" "00156" "00448196" "00198" "00472182" "05387" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00156, 00198, 01157, 03381, 05387, 05611, 06886 ## Count = 53 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "3w" "" "" "" "" "" "" "" "" "" "0000081970" "03381" "00104036" "00587" "Unknown" "" "diffuse-type or intestinal-type gastric cancer" "" "" "" "" "" "" "" "" "" "" "" "0000257611" "00139" "00362197" "00006" "Isolated (sporadic)" "04y" "see paper; ..., short stature, hypotonia, decreased scalp hair, no body hirsutism; coarse facies, no thick eyebrows, no prominent eyelashes, no flat nasal bridge, no short nose, no anteverted nares, broad nasal tip, wide nasal base, no thick alae nasi, prominent philtrum, no wide mouth, micrognathia, retrognathia, no low set ears, downslanting palpebral fissure, no highly arched palate, high forehead, thick upper lip vermilion, thick lower lip vermilion; small nails on 5th digit, clinodactyly, delayed bone age, brachydactyly; cognitive delay; attention deficit hyperactivity disorder, sensitivity to loud noise; strabismus, no myopia, hypermetropia, no ptosis" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000272312" "05387" "00377148" "01164" "Isolated (sporadic)" "12y" "Abnormality of body height, Abnormality of the face, Downslanted palpebral fissures, Global developmental delay, Growth delay, Abnormal foot morphology, Pes cavus, Abnormal facial shape, Curly hair, Short stature, Abnormality of hair texture, Abnormality of higher mental function, Thyrotoxicosis with diffuse goiter, Neurodevelopmental delay, Cognitive impairment, Graves disease, Slanting of the palpebral fissure" "" "" "" "" "" "" "" "" "" "" "" "0000284192" "00139" "00174070" "00006" "Familial, autosomal dominant" "15y" "intrauterine growth retardation (weight 5th percentile, height unknown); short stature (<5th percentile); developmental delay; micrognathia or retrognathia, low set or posteriorly rotated ears, epicanthal folds, down slanting palpebral fissures, highly arched palate, and frontal bossing; no cardiac defects; Wormian bones, kyphoscoliosis; normal skin; Hypotonia, ADHD, anxiety" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000284193" "00139" "00174071" "00006" "Familial, autosomal dominant" "8y" "no intrauterine growth retardation ( weight 25-50 percentile, height 50th percentile); no short stature (10th percentile); developmental delay; micrognathia or retrognathia, low set or posteriorly rotated ears, epicanthal folds, down slanting palpebral fissures, highly arched palate, and frontal bossing, cleft palate; Atrial septal defect; ADHD, aggressive, diaphragmatic eventration" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000284194" "00139" "00174072" "00006" "Familial, autosomal dominant" "6y" "no intrauterine growth retardation (weight 25th percentile, height 50th percentile); no short stature (10th percentile); developmental delay; plagiocephaly; micrognathia or retrognathia, low set or posteriorly rotated ears, epicanthal folds, down slanting palpebral fissures, highly arched palate, frontal bossing; no cardiac defects; mild prominence ventricles, sulci, small arachnoid cyst; affinity for water, sensitive to loud noises, GERD" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000284195" "00139" "00174073" "00006" "Familial, autosomal dominant" "8y" "no intrauterine growth retardation (weight 20-25 percentile, height unknown); short stature (<5th percentile); developmental delay; plagiocephaly; micrognathia or retrognathia, low set or posteriorly rotated ears, epicanthal folds, down slanting palpebral fissures, highly arched palate, frontal bossing; mild pectus excavatum; no cardiac defects; wormian bones; Mild periventricular white mmatter signals; Hypotonia, ADHD, tics, GERD" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000284196" "00156" "00174068" "00006" "Familial, autosomal dominant" "7y" "short stature (-2.14 SD); developmental delay; slightly coarse features, tall forehead, hypertelorism, depressed nasal root and short nose, prominent and long philtrum, and thin upper lip; nail hypoplasia of fifth finger and toe nails, small hands with tapering fingers, small feet, single palmar crease; Wide inner and outer cerebrospinal fluid spaces, dorsal vermis hypoplasia, wide cisterna magna (Dandy–Walker formation), thin corpus callosum; Hypotonia, Seizure, inguinal hernia" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000284197" "00156" "00174069" "00006" "Familial, autosomal dominant" "22m" "no intrauterine growth retardation; short stature (-2.2 SD); developmental delay; difficulties tracking moving target with jerky eye movements, repeated loss of fixation; slightly coarse features, midface hypoplasia, normal spacing of eyes, horizontal palpebral fissures, small, upturned nose, Cupid’s bow, full lower lip; tapering fingers, small nails, bilateral clinodactyly 5th finger; Mild hypotonia, umbilical hernia" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000284199" "05611" "00390711" "00006" "Familial, autosomal dominant" "5y8m" "intrauterine growth retardation; short stature (-3.68 SD); mild developmental delay; microcephaly; strabismus, myopia; Horizontal palpebral fissure, hypertelorism, epicanthal folds, high arched palate, low-set ears; low posterior hair line; no abnormalities chest; Ventricular septal defect; Bilateral simian crease; sparse hair, ichthyosis; Juvenile rheumatoid arthritis" "" "" "" "" "" "" "" "" "" "Noonan-related disorder" "" "0000284200" "05611" "00390712" "00006" "Familial, autosomal dominant" "12y" "intrauterine growth retardation; short stature (-2 SD); moderate developmental delay; microbrachycephaly; strabismus, myopia, Duane anomaly; Horizontal palpebral fissures, broad nose, long philtrum, low set ears, high arched palate; webbed neck, low posterior hair line; widely-spaced nipples; cryptorchidism; Bilateral 5th finger clinodactyly, single palmar crease, multiple epiphyseal dysplasia; hyperkeratotic skin; Sensorineural hearing loss" "" "" "" "" "" "" "" "" "" "Noonan-related disorder" "" "0000284201" "05611" "00390713" "00006" "Familial, autosomal dominant" "2y" "intrauterine growth retardation; short stature (<-3 SD); severe developmental delay; microcephaly; strabismus, blepharoptosis; Bilateral ptosis, hypertelorism, down slanting palpebral fissures, epicanthus, long philtrum, micrognathia, high-arched palate, cleft palate, low-set ears; Short, webbing, low posterior hair line; widely-spaced nipples, pectus excavatum; no cardiac defects; cryptorchidism; Socliosis, bilateral 5th finger clinodactyly, overlapping 2nd and 3rd toes; normal skin; Sensorineural hearing loss" "" "" "" "" "" "" "" "" "" "Noonan syndrome" "" "0000284202" "05611" "00390714" "00006" "Familial, autosomal dominant" "20m" "no intrauterine growth retardation; short stature (-3 SD); developmental delay; prominent metopic ridge; strabismus, myopia, congenital fibrosis of the extraocular muscles; Broad forehead, Upslanting palpebral fissures, short-broad nose with anteverted nostril, small mouth, low-set ears, high arched palate; widely-spaced nipples; no cryptorchidism; Bilateral 5th finger clinodactyly, syndactyly of 2nd and 3rd toes; normal skin" "" "" "" "" "" "" "" "" "" "Noonan-related disorder" "" "0000284203" "05611" "00390715" "00006" "Familial, autosomal dominant" "25m" "no intrauterine growth retardation; short stature (-2.2 SD); moderate developmental delay; relative macrocephaly, prominent forehead; strabismus, myopia; Hypertelorism, downslanting palpebral fissures, bilateral ptosis, sparse eyebrows, low and posteriorly rotated ears, mild micrognathia; Short, webbing, low posterior hair line; widely-spaced nipples; Pulmonic stenosis; Cubitus valgus, mild scoliosis, brachydactyly with hyperlaxity of joints, overlapping1st and 2nd toes; multiple nevi; Bifid renal pelvis with vesicoureteral reflux" "" "" "" "" "" "" "" "" "" "Noonan syndrome" "" "0000284204" "05611" "00390716" "00006" "Familial, autosomal dominant" "4m15d" "no intrauterine growth retardation; no short stature (10-25th centile); mild developmental delay; relative macrocephaly, prominent forehead; Astigmatism, myopia; Hypertelorism, ptosis, downslanting palpebral fissures, high-arched palate, thick lips, micrognathia, low-set and posteriorly rotated ears,; short neck, webbing, low posterior hair line; widely-spaced nipples, pectus excavatum; no cardiac defects; Cubitus valgus, hyperlax fingers; normal skin; Celiac disease" "" "" "" "" "" "" "" "" "" "Noonan syndrome" "" "0000284205" "05611" "00390717" "00006" "Familial, autosomal dominant" "3m" "no intrauterine growth retardation (weight 50-75th percentile, height <3rd percentile); short stature( < 3rd percentile); developmental delay; microcephaly; blue sclera; upslanting palpebral fissures, large, low‐set ears, a broad nasal bridge with anteverted nares, downturned corners of the mouth; short neck; widely spaced nipples; Atrial septal defect; fifth finger clinodactyly, small hands and feet" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000284206" "05611" "00390718" "00006" "Familial, autosomal dominant" "4y6m" "intrauterine growth retardation (-4.0 SD); short stature (-3.6 SD); developmental delay; normocephaly; thin upper lip, micrognathia, low set ear; Laryngomalacia, feeding difficulty, vomiting in early infancy" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000284207" "05611" "00390719" "00006" "Familial, autosomal dominant" "2y" "intrauterine growth retardation (-0.53 SD); short stature (-2.4SD); developmental delay; normocephaly, plagiocephaly; protruding ears, thin upper lip vermilion, downturned corners of the mouth; generalised hypotonia, joint hypermobility, mildly elevated creatine kinase levels, severe feeding difficulties" "" "" "" "" "" "" "" "" "" "myotonic dystrophy" "" "0000284208" "05611" "00390720" "00006" "Familial, autosomal dominant" "6y10m" "no intrauterine growth retardation; short stature (-2.0 SD); developmental delay; relative macrocephaly,; strabismus; high broad forehead, down-slanting palpebral fissures, slightly low-set posteriorly rotated ears; hypoplastic nails (especially digits 3,4 and 5); mildly dysmorphic corpus callosum (curved with thin elongated splenium), delayed myelination" "" "" "" "" "" "" "" "" "" "PTEN mutation, RASopathy" "" "0000284209" "05611" "00390721" "00006" "Familial, autosomal dominant" "8y" "no intrauterine growth retardation; short stature (-1.37SD); developmental delay; normocephaly; micrognathia; webbed neck; hypoplastic finger nails and short toes, multiple epiphyseal dysplasia, Wormian bones; increased nuchal translucency on antenatal ultrasound scans" "" "" "" "" "" "" "" "" "" "Noonan syndrome, Pallister-Killian syndrome and Smith-Lemli-Opitz syndrome" "" "0000284210" "05611" "00390722" "00006" "Familial, autosomal dominant" "15y6m" "intrauterine growth retardation (-2.2 SD); short stature (-2.0 SD); developmental delay; myopia, hypermetropia, ptosis; thick eyebrows, prominent eyelashes, flat nasal bridge, short nose, broad nasal root and tip, anteverted nares, thick alae nasi, broad philtrum, high and broad forehead and slightly posteriorly rotated ears; mild 5th finger clinodactyly, small nails on his 2nd toes, mild joint laxity; feeding difficulties" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000284211" "05611" "00390723" "00006" "Familial, autosomal dominant" "18y" "no intrauterine growth retardation (-1.16 SD); no short stature (+0.74 SD); developmental delay; normocephaly; myopia; coarse face, low anterior hairline, thick eyebrows, broad nasal tip, thick vermilion of the lower lip and micrognathia,; joint hypermobility; pas cavus" "" "" "" "" "" "" "" "" "" "Fragile X-syndrome" "" "0000284212" "05611" "00390724" "00006" "Familial, autosomal dominant" "23y" "intrauterine growth retardation (-2.0 SD); no short stature (-1.0 SD); developmental delay; downslanting palpebral fissures, low-set and posteriorly rotated ears, narrow and high palate, small chin; mild pectus carinatum; arachnodactyly, hypoplastic toenails, hyperkyphosis of the thoracic spine, hyperlordosis lumbar spine; cerebral sinus thrombosis; hypotonia, laryngeal web, delayed puberty, cerebral sinus thrombosis, anxiety" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000284213" "05611" "00390725" "00006" "Familial, autosomal dominant" "8y11m" "no intrauterine growth retardation (38w, 2.863kg); short stature (<5th percentile); developmental delay; ptosis, myopia, astigmatism, significant photophobia; coarse facies, frontal bossing, downslanting palpebral fissures, flat nasal bridge, broad nose, thick anteverted alae nasi, macrosomia, thin upper vermillion, thick lower vermillion, long and prominent philtrum, gingival hyperplasia with broad central maxillary incisors with crowded an irregular mandibular teeth, low set ear; fifth digit clinodactyly and persistent fetal finger/toe pads, nail hypoplasia of toes 3, 4, 5. shortened long bones; hypo-pigmentary anomalies, hyper-pigmentary anomalies; feeding problmes required a gastrostomy, ADHD" "" "" "" "" "" "" "" "" "" "Williams syndrome" "" "0000312164" "05387" "00420924" "01164" "Isolated (sporadic)" "06y" "Intellectual disability, mild, Lateral ventricular asymmetry, Impaired social interactions" "" "" "" "" "" "" "" "" "" "" "" "0000324983" "05611" "00434734" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "CSS6" "neurodevelopmental dealy" "" "0000324984" "05611" "00434735" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS6" "neurodevelopmental dealy" "" "0000324985" "05611" "00434736" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS6" "neurodevelopmental dealy" "" "0000324986" "05611" "00434737" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CSS6" "neurodevelopmental dealy" "" "0000324987" "05611" "00434738" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "CSS6" "neurodevelopmental dealy" "" "0000324988" "05611" "00434739" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "CSS6" "neurodevelopmental dealy" "" "0000324989" "05611" "00434740" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "CSS6" "neurodevelopmental dealy" "" "0000324990" "05611" "00434741" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "CSS6" "neurodevelopmental dealy" "" "0000337106" "00156" "00447914" "00006" "Isolated (sporadic)" "8y6m" "see paper; ..., no prenatal findings, birth 39w, weight 3.062 kg (25%), length 50.8 cm (50%); feeding difficulties, tube feeding (discontinued), GE reflux; no congenital heart disease; no seizures; MRI brain intracranial white matter loss, areas of T2 hyperintensity and pallor within the supratentorial white matter; restless leg syndrome, hemiparetic cerebral palsy; autism; speech apraxia; intermittent exotropia; astigmatism; no hearing loss; tracheomalacia; laryngomalacia; no cleft lip/palate; tonsillectomy/adenoidectomy; obstructive sleep apnea (resolved); frequent fractures, normal bone density; short stature (7y4m-19th); no 5th digit anomalies; asthma, sacral dimple; 4y-hx of traumatic brain injury; iron deficiency anemia" "" "2y4m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337107" "00156" "00447915" "00006" "Isolated (sporadic)" "8y" "see paper; ..., polyhydramnios, birth 39w+3, weight 3.3 kg (25th–50th%), length 48.3 cm (25th%); feeding difficulties, tube feeding (discontinued); no congenital heart disease; hypotonia; no seizures; MRI brain normal; autism; 18m-walk; 12m-first words; myopia; tympanostomy tubes; no cleft lip/palate; hip dysplasia; short stature (6y5m-2%); growth hormone supplementation; clinodactyly;" "" "2y4m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337108" "00156" "00447916" "00006" "Isolated (sporadic)" "8y" "see paper; ..., intra-uterine growth retardation, birth 36w+3, weight 1.6 kg (<10th%), length 40.6 cm (<10th%); feeding difficulties, tube feeding, GE reflux, celiac; congenital heart disease, PFO; hypotonia; no seizures; MRI brain normal; ADHD; <26m-walk; 24m-first words; moderate intellectual disability; amblyopia, strabismus; myopia/presbyopia/astigmatism; conductive hearing loss; tympanostomy tubes; no cleft lip/palate; hip dysplasia; short stature (4y8m-2%);" "" "2y10m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337109" "00156" "00447917" "00006" "Unknown" "7y" "see paper; ..., no prenatal findings, weight 2.86 kg, length 48.5 cm; feeding difficulties, no tube feeding, no GE reflux; no congenital heart disease; hypotonia; no seizures; MRI brain normal; 23m-walk; <13m-first words; no strabismus; no myopia, no presbyopia, no astigmatism; no retinal abnormalities; no hearing loss; laryngomalacia; no cleft lip/palate; short stature (21m-<5th); no 5th digit anomalies;" "" "1y10m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337110" "00156" "00447918" "00006" "Unknown" "15y6m" "see paper; ..., no prenatal findings, birth 38w+5, weight 3.04 kg (~45th%), length 47.6 cm (25th–50th%); feeding difficulties, no tube feeding; no seizures; MRI brain ectopic posterior pituitary; ADHD; 18m-walk; 12m-first words; mild intellectual disability; amblyopia; astigmatism; conductive hearing loss; tympanostomy tubes; no cleft lip/palate; genitourinary reflux, misplaced ureter; growth hormone supplementation;" "" "11y3m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337111" "00156" "00447919" "00006" "Isolated (sporadic)" "9y6m" "see paper; ..., no prenatal findings, birth 39w, weight 3.1 kg (25th–50th%), length 48.5 cm (50th%); feeding difficulties; hypotonia; no seizures; nystagmus, amblyopia; sensorineuronal hearing loss; no cleft lip/palate; prescribed AFOs; torticollis;" "" "4y6m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337112" "00156" "00447920" "00006" "Isolated (sporadic)" "10y6m" "see paper; ..., prenatal cystic hygroma noted, length; no congenital heart disease; hypotonia; no seizures; restless sleep; ADHD; 18m-walk; 18m-first words; strabismus; no cleft lip/palate; recurrent UTIs; short stature (7y-3rd); anxiety" "" "6y4m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337113" "00156" "00447921" "00006" "Isolated (sporadic)" "12y" "see paper; ..., prenatal luid around heart, kidneys, birth 38w, weight 2.95 kg (25th–50th%), length 48.5 cm (50th%); feeding difficulties, GE reflux, failure to thrive; hypotonia; no seizures; MRI brain arachnoid cysts; ADHD; 2y4m-walk; 18m-first words; conductive hearing loss; no cleft lip/palate; tonsillectomy, adenoidectomy; prescribed AFOs; short stature (8y6m-<1%); delayed tooth eruption; IgA deficiency; severe eczema" "" "8y4m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337114" "00156" "00447922" "00006" "Unknown" "6y6m" "see paper; ..., birth 41w, weight 2.8 kg (10th%–25th%),; no congenital heart disease; hypotonia; no seizures; MRI brain normal; no autism; 33m-walk; 6y-first words; mild hyperopia, strabismus; no cleft lip/palate; coxa valga significantly delayed bone age (3-6m at 2y7m); genitourinary reflux; short stature; 5th digit anomalies;" "" "2y3m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337115" "00156" "00447923" "00006" "Unknown" "6y" "see paper; ..., birth 41w, weight 3.5 kg (50th–75th%),; feeding difficulties, gastritis, failure to thrive, constipation; no congenital heart disease; no seizures; MRI brain increased T2 signal periatrial regions, thin posterior corpus callosum (?PVL); ADHD; 19m-walk; 3y-first words; mild intellectual disability; strabismus; no hearing loss; no cleft lip/palate; prescribed AFOs; torticollis; short stature (32m-25%); sacral dimple" "" "2y6m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337116" "00156" "00447924" "00006" "Unknown" "8y6m" "see paper; ..., weight 3.1 kg,; feeding difficulties, GE reflux, on thickened feeds (resolved); no congenital heart disease; hypotonia; MRI brain normal; ADHD; 30m-walk; 54m-first words; strabismus; astigmatism; laryngomalacia; no cleft lip/palate; tracheomalacia, tympanostomy tubes; hip dysplasia; torticollis, plagiocephaly; short stature (9y-<1%);" "" "5y3m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337117" "00156" "00447925" "00006" "Unknown" "3y6m" "see paper; ..., birth 39w+5, weight 2.9 kg (25th–30th%), length 48 cm (40th–50th%); feeding difficulties, slow weight gain, deep penetration on swallow study, on thickened feeds; no congenital heart disease; no hypotonia; no seizures; 19m-walk; 20m-first words; no strabismus; no myopia, no presbyopia, no astigmatism; no hearing loss; no cleft lip/palate; tonsillectomy/adenoidectomy; laryngeal cleft; no hip dysplasia; no scoliosis; hydrocoele; short stature (14m-5th-10th); small umbilical hernia; sascral dimple" "" "1y3m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337118" "00156" "00447926" "00006" "Unknown" "12y" "see paper; ..., birth 38w, weight 2.5 kg (10th–25th%), length 47.5 cm (25th–50th%); feeding difficulties, GE reflux, IBS; congenital heart disease, mitral thickening; autism, ADHD; 20m-walk; 18m-first words; strabismus; no hearing loss; tonsillectomy/adenoidectomy; no short stature; no growth hormone supplementation; 5th digit anomalies;" "" "" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337119" "00156" "00447927" "00006" "Isolated (sporadic)" "16y" "see paper; ..., twin gestation, IVF, birth 34w, weight 1.93 kg (25th–50th%),; no congenital heart disease; no seizures; MRI brain cerebellar vermian hypoplasia, mild generalized ventricular and CSF space prominence; cerebral palsy; ADHD; 27m-walk; >3y-first words; mild intellectual disability; strabismus, alternating exotropia; conversion insufficiency, palsy binocular eye movement; no hearing loss; no laryngomalacia; no cleft lip/palate; no tonsillectomy/adenoidectomy; no hip dysplasia; no scoliosis; no short stature; no growth hormone supplementation; no 5th digit anomalies; umbilical hernia, lateralized overgrowth" "" "15y" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337120" "00156" "00447928" "00006" "Unknown" "1y" "see paper; ..., egg donation, weight 3 kg, length 49 cm; feeding difficulties; no congenital heart disease; no seizures; 18m-walk; no strabismus; ptosis; genitourinary reflux; short stature; sacral dimple; high-riding anus; low blood zinc; growth hormone deficiency" "" "2m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337121" "00156" "00447929" "00006" "Unknown" "4y6m" "see paper; ..., weight 3.15 kg, length 50.1 cm; congenital heart disease, PDA/PFO; 18m-walk; 19m-first words; strabismus; astigmatism; tonsillectomy/adenoidectomy; no 5th digit anomalies;" "" "20m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337122" "00156" "00447930" "00006" "Isolated (sporadic)" "8y6m" "see paper; ..., birth 41w, weight 3.73 kg (75th–90th%), length 52 cm (~80th%); feeding difficulties, GE reflux; congenital heart disease, miildly dilated aortic root; hypotonia; seizures; MRI brain mild prominence of CSF spaces; ADHD; 31m-walk; 30m-first words; no strabismus; no myopia, no presbyopia, no astigmatism; no retinal abnormalities; blocked tear ducts; no hearing loss; hip dysplasia; scoliosis; extra vertebrae; genitourinary reflux; short stature; thin scalp hair; pitting to nails; delayed bone age" "" "6y10m" "" "" "" "" "" "" "CSS6" "Coffin-Siris Syndrome" "" "0000337406" "00198" "00448196" "00006" "Isolated (sporadic)" "25y" "intellectual disability; autism spectrum disorder; macrocephaly; minor facial anomalies; myopia; limbs anomalies; scoliosis" "" "" "" "" "" "" "" "" "" "rare disorder" "" "0000356991" "05387" "00472182" "01482" "Familial, autosomal dominant" "" "retrognathia, coarse facial features, a short philtrum, a prominent forehead, low-set and posteriorly rotated ears, a broad nasal tip, downslanting palpebral fissures, and intermittent exotropia;Pathological diagnosis: Consistent with non-specific cirrhotic pathological changes." "7" "" "" "" "" "" "" "" "CSS6" "Coffin-Siris syndrome," "" ## Screenings ## Do not remove or alter this header ## ## Count = 56 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000104507" "00104036" "1" "00587" "00006" "2017-04-28 08:15:46" "" "" "SEQ-NG" "DNA" "" "" "0000174958" "00174068" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000174959" "00174069" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000174960" "00174070" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000174961" "00174071" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000174962" "00174072" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000174963" "00174073" "1" "00008" "00008" "2018-08-07 16:25:57" "" "" "SEQ" "DNA" "" "" "0000291867" "00290699" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000291868" "00290700" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000363426" "00362197" "1" "00006" "00006" "2021-04-15 19:26:49" "" "" "arraySNP" "DNA" "" "" "0000378353" "00377148" "1" "01164" "01164" "2021-07-12 13:41:26" "" "" "SEQ-NG-I" "DNA" "" "" "0000391952" "00390711" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "arrayCGH" "DNA" "" "" "0000391953" "00390712" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "arrayCGH" "DNA" "" "" "0000391954" "00390713" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "microscope" "DNA" "" "" "0000391955" "00390714" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "microscope;arrayCGH" "DNA" "" "" "0000391956" "00390715" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "microscope;arrayCGH" "DNA" "" "" "0000391957" "00390716" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "microscope;arrayCGH" "DNA" "" "" "0000391958" "00390717" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "microscope;arrayCGH" "DNA" "" "" "0000391959" "00390718" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "arrayCGH" "DNA" "" "" "0000391960" "00390719" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000391961" "00390720" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000391962" "00390721" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000391963" "00390722" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000391964" "00390723" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000391965" "00390724" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "arrayCGH" "DNA" "" "" "0000391966" "00390725" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000398575" "00397335" "1" "00006" "00006" "2021-12-20 15:11:17" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000422235" "00420924" "1" "01164" "01164" "2022-11-03 13:04:39" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000436206" "00434734" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436207" "00434735" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436208" "00434736" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436209" "00434737" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436210" "00434738" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436211" "00434739" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436212" "00434740" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000436213" "00434741" "1" "00006" "00006" "2023-04-07 12:06:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000449485" "00447914" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "SEQ-NG" "DNA" "" "" "0000449486" "00447915" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "SEQ-NG" "DNA" "" "WES" "0000449487" "00447916" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "SEQ-NG" "DNA" "" "WES" "0000449488" "00447917" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "arrayCGH" "DNA" "" "" "0000449489" "00447918" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "arrayCGH" "DNA" "" "" "0000449490" "00447919" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "SEQ-NG" "DNA" "" "WES" "0000449491" "00447920" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "SEQ-NG" "DNA" "" "WES" "0000449492" "00447921" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "SEQ-NG" "DNA" "" "WES" "0000449493" "00447922" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "arrayCGH" "DNA" "" "" "0000449494" "00447923" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "SEQ-NG" "DNA" "" "WES" "0000449495" "00447924" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "SEQ-NG" "DNA" "" "WES" "0000449496" "00447925" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "arrayCGH" "DNA" "" "" "0000449497" "00447926" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "arrayCGH" "DNA" "" "" "0000449498" "00447927" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "SEQ-NG" "DNA" "" "WES" "0000449499" "00447928" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "arrayCGH" "DNA" "" "" "0000449500" "00447929" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000449501" "00447930" "1" "00006" "00006" "2024-02-01 16:08:19" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449771" "00448196" "1" "00006" "00006" "2024-02-22 17:47:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000473852" "00472182" "1" "01482" "01482" "2026-01-14 03:37:46" "" "" "-" "DNA" "peripheral blood" "WES via chip capture high-throughput sequencing" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 9 "{{screeningid}}" "{{geneid}}" "0000174958" "ARID2" "0000174959" "ARID2" "0000174960" "ARID2" "0000174961" "ARID2" "0000174962" "ARID2" "0000174963" "ARID2" "0000363426" "ARID2" "0000378353" "ARID2" "0000422235" "ARID2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 137 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000005135" "0" "50" "12" "46289948" "46289948" "subst" "0" "00037" "ARID2_000001" "g.46289948G>A" "" "" "" "" "" "Germline" "" "" "" "" "" "g.45896165G>A" "" "VUS" "" "0000169248" "0" "70" "12" "46287247" "46287247" "subst" "0" "00587" "ARID2_000002" "g.46287247A>T" "" "{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}" "" "NM_152641.3(ARID2):c.5192A>T p.(Lys1731Met)" "variant could not be associated with disease phenotype" "Germline" "" "" "0" "" "" "g.45893464A>T" "" "likely pathogenic" "" "0000261063" "0" "90" "12" "46244361" "46244361" "subst" "0" "02326" "ARID2_000004" "g.46244361C>T" "" "" "" "ARID2(NM_152641.4):c.2455C>T (p.Q819*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45850578C>T" "" "pathogenic" "" "0000262956" "0" "50" "12" "46246491" "46246491" "subst" "0.000207504" "01943" "ARID2_000005" "g.46246491G>A" "" "" "" "ARID2(NM_152641.3):c.4585G>A (p.G1529R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45852708G>A" "" "VUS" "" "0000339004" "0" "70" "12" "46245720" "46245720" "subst" "0" "02327" "ARID2_000009" "g.46245720C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45851937C>T" "" "likely pathogenic" "" "0000342502" "0" "70" "12" "46230571" "46230571" "subst" "0" "02327" "ARID2_000006" "g.46230571C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45836788C>T" "" "likely pathogenic" "" "0000394825" "1" "70" "12" "46245317" "46245318" "del" "0" "00008" "ARID2_000013" "g.46245317_46245318del" "" "{PMID:Bramswig 2017:28124119}" "" "" "" "De novo" "" "" "0" "" "" "g.45851534_45851535del" "" "likely pathogenic" "" "0000394826" "1" "70" "12" "46123890" "46123890" "del" "0" "00008" "ARID2_000010" "g.46123890del" "" "{PMID:Bramswig 2017:28124119}" "" "156delC" "" "De novo" "" "" "0" "" "" "g.45730107del" "" "likely pathogenic" "" "0000394827" "1" "70" "12" "46244442" "46244442" "del" "0" "00008" "ARID2_000012" "g.46244442del" "" "{PMID:Shang L 2015:26238514}" "" "p.(Val846Leufs*3)" "Refseq reported:hg19" "De novo" "" "" "0" "" "" "g.45850659del" "" "likely pathogenic" "" "0000394828" "1" "50" "12" "46231108" "46231108" "subst" "0" "00008" "ARID2_000011" "g.46231108T>A" "" "{PMID:Shang L 2015:26238514}" "" "" "Refseq reported:hg19" "Unknown" "" "" "0" "" "" "g.45837325T>A" "" "likely pathogenic" "" "0000394829" "1" "70" "12" "46246347" "46246347" "del" "0" "00008" "ARID2_000015" "g.46246347del" "" "{PMID:Shang L 2015:26238514}" "" "" "Refseq reported:hg19" "De novo" "" "" "0" "" "" "g.45852564del" "" "likely pathogenic" "" "0000394830" "1" "50" "12" "46246224" "46246224" "subst" "0" "00008" "ARID2_000014" "g.46246224C>T" "" "{PMID:Shang L 2015:26238514}" "" "" "Refseq reported:hg19" "De novo" "" "" "0" "" "" "g.45852441C>T" "" "likely pathogenic" "" "0000548131" "0" "70" "12" "46123843" "46123844" "del" "0" "02329" "ARID2_000017" "g.46123843_46123844del" "" "" "" "ARID2(NM_152641.4):c.109_110delAT (p.I37Pfs*28)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45730060_45730061del" "" "likely pathogenic" "" "0000548132" "0" "90" "12" "46123843" "46123843" "del" "0" "02325" "ARID2_000016" "g.46123843del" "" "" "" "ARID2(NM_152641.4):c.109delA (p.I37Sfs*21)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45730060del" "" "pathogenic" "" "0000548135" "0" "50" "12" "46231310" "46231310" "subst" "8.14273E-6" "01943" "ARID2_000019" "g.46231310G>A" "" "" "" "ARID2(NM_152641.2):c.1150G>A (p.(Ala384Thr)), ARID2(NM_152641.3):c.1150G>A (p.A384T), ARID2(NM_152641.4):c.1150G>A (p.A384T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45837527G>A" "" "VUS" "" "0000548137" "0" "70" "12" "46243903" "46243906" "dup" "0" "02329" "ARID2_000021" "g.46243903_46243906dup" "" "" "" "ARID2(NM_152641.4):c.1997_2000dupAAAT (p.M667Ifs*41)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45850120_45850123dup" "" "likely pathogenic" "" "0000548138" "0" "50" "12" "46243954" "46243954" "subst" "4.06319E-6" "01804" "ARID2_000022" "g.46243954G>A" "" "" "" "ARID2(NM_152641.2):c.2048G>A (p.(Arg683Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45850171G>A" "" "VUS" "" "0000548140" "0" "50" "12" "46244173" "46244173" "subst" "8.15554E-6" "01943" "ARID2_000024" "g.46244173T>C" "" "" "" "ARID2(NM_152641.3):c.2267T>C (p.V756A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45850390T>C" "" "VUS" "" "0000548141" "0" "10" "12" "46244670" "46244670" "subst" "0.00189705" "01943" "ARID2_000025" "g.46244670A>G" "" "" "" "ARID2(NM_152641.3):c.2764A>G (p.T922A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45850887A>G" "" "benign" "" "0000548143" "0" "90" "12" "46285646" "46285646" "subst" "0" "02327" "ARID2_000026" "g.46285646G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45891863G>A" "" "pathogenic" "" "0000614147" "0" "70" "12" "46245122" "46245122" "del" "0" "02327" "ARID2_000027" "g.46245122del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45851339del" "" "likely pathogenic" "" "0000622886" "0" "30" "12" "46246052" "46246052" "subst" "0.000928437" "01943" "ARID2_000028" "g.46246052C>T" "" "" "" "ARID2(NM_152641.3):c.4146C>T (p.S1382=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45852269C>T" "" "likely benign" "" "0000622887" "0" "30" "12" "46246129" "46246129" "subst" "8.13696E-6" "01943" "ARID2_000029" "g.46246129A>G" "" "" "" "ARID2(NM_152641.2):c.4223A>G (p.(Lys1408Arg)), ARID2(NM_152641.3):c.4223A>G (p.K1408R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45852346A>G" "" "likely benign" "" "0000622888" "0" "50" "12" "46246146" "46246146" "subst" "0" "02325" "ARID2_000030" "g.46246146A>G" "" "" "" "ARID2(NM_152641.4):c.4240A>G (p.R1414G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45852363A>G" "" "VUS" "" "0000622889" "0" "50" "12" "46285676" "46285676" "subst" "4.06418E-6" "01943" "ARID2_000031" "g.46285676G>A" "" "" "" "ARID2(NM_152641.3):c.5036G>A (p.R1679Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45891893G>A" "" "VUS" "" "0000648556" "1" "50" "12" "46246206" "46246206" "subst" "0.00626179" "03575" "ARID2_000032" "g.46246206G>T" "8/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "no interpretation available; 8 heterozygous, no homozygous; {DB:CLININrs150136669}" "Germline" "" "rs150136669" "0" "" "" "g.45852423G>T" "" "VUS" "" "0000648557" "1" "90" "12" "46246347" "46246347" "del" "0" "03575" "ARID2_000033" "g.46246347del" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs796052241}" "Germline" "" "rs796052241" "0" "" "" "g.45852564del" "" "pathogenic" "" "0000679527" "0" "90" "12" "46245191" "46245192" "ins" "0" "02325" "ARID2_000034" "g.46245191_46245192insAT" "" "" "" "ARID2(NM_152641.4):c.3285_3286insAT (p.Q1096Ifs*61)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000679528" "0" "90" "12" "46245457" "46245457" "del" "0" "02330" "ARID2_000035" "g.46245457del" "" "" "" "ARID2(NM_152641.4):c.3551delC (p.P1184Lfs*4)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000679529" "0" "30" "12" "46245887" "46245887" "subst" "7.74145E-5" "01943" "ARID2_000036" "g.46245887A>G" "" "" "" "ARID2(NM_152641.3):c.3981A>G (p.S1327=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000679530" "0" "30" "12" "46285585" "46285585" "subst" "0.00109338" "01943" "ARID2_000037" "g.46285585G>C" "" "" "" "ARID2(NM_152641.3):c.4945G>C (p.V1649L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000691336" "0" "30" "12" "46123914" "46123914" "subst" "0.000600372" "01943" "ARID2_000038" "g.46123914C>T" "" "" "" "ARID2(NM_152641.3):c.180C>T (p.F60=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000691337" "0" "50" "12" "46246489" "46246489" "subst" "0" "01943" "ARID2_000039" "g.46246489C>T" "" "" "" "ARID2(NM_152641.3):c.4583C>T (p.A1528V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724032" "0" "50" "12" "46230739" "46230759" "del" "0" "02329" "ARID2_000018" "g.46230739_46230759del" "" "" "" "ARID2(NM_152641.4):c.988_1008delTTAGGCCTTGACACATTAGGA (p.L330_G336del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724033" "0" "30" "12" "46245344" "46245344" "subst" "0.0002684" "01943" "ARID2_000040" "g.46245344G>A" "" "" "" "ARID2(NM_152641.3):c.3438G>A (p.S1146=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724034" "0" "90" "12" "46245457" "46245457" "del" "0" "02329" "ARID2_000035" "g.46245457del" "" "" "" "ARID2(NM_152641.4):c.3551delC (p.P1184Lfs*4)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000724035" "0" "50" "12" "46246396" "46246396" "subst" "0" "01943" "ARID2_000041" "g.46246396C>T" "" "" "" "ARID2(NM_152641.3):c.4490C>T (p.P1497L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000764080" "0" "90" "12" "46125066" "46230365" "del" "0" "00006" "ARID2_000042" "g.(46123921_46125066)_(46230365_46230371)del" "" "{PMID:Van Paemel 2017:28884947}" "" "del ex3-5" "105kb deletion" "De novo" "" "" "0" "" "hg19 12q12(46125066–46230365)x1" "" "" "pathogenic (dominant)" "" "0000791105" "0" "70" "12" "46245240" "46245240" "subst" "0" "01164" "ARID2_000043" "g.46245240C>T" "" "" "" "" "ACMG: PVS1, PM2_SUP" "Germline/De novo (untested)" "?" "" "" "" "" "" "" "likely pathogenic (dominant)" "ACMG" "0000805712" "0" "30" "12" "46242730" "46242730" "subst" "0.000138855" "01943" "ARID2_000044" "g.46242730A>C" "" "" "" "ARID2(NM_152641.3):c.1692A>C (p.S564=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000822020" "0" "90" "12" "43005992" "46669000" "del" "0" "00006" "ARID2_000046" "g.(?_43005992)_(46669000_?)del" "" "{PMID:Kang 2021:33051312}" "" "" "3.7Mb deletion 12q12-13.11" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000822021" "0" "90" "12" "43000000" "47000000" "del" "0" "00006" "ARID2_000046" "g.(42000000_43000000)_(47000000_48000000)del" "" "{PMID:Failla 2008:18412123}" "" "" "4.5 Mb 12q12 deletion" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000822022" "0" "90" "12" "46400000" "49100001" "del" "0" "00006" "ARID2_000046" "g.(38200001_46400000)_(49100001_51500000)del" "" "{PMID:Tonoki 1998:9482650}" "" "46,XY,del(12)(q12q13.12" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000822023" "0" "90" "12" "38200000" "46400001" "del" "0" "00006" "ARID2_000046" "g.(35800001_38200000)_(46400001_54900000)del" "" "Gallego 2000 (Int Pediatr 15: 37)" "" "del 12q11-q13" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000822025" "0" "90" "12" "14944107" "32111585" "del" "0" "00006" "ARID2_000045" "g.(14839182_14944107)_(32111585_32162327)del;(46081883_46238593)ins[(14839182_14944107)_(32111585_32162327)inv]" "" "{PMID:Yatsenko 2009:19938085}" "" "46,XX,ins(12)(q12p11.1p13.1)mat" "maternal karyotype 46,XX,ins(12)(q12p11.1p13.1)[25]/46,XX[25]" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000822026" "0" "90" "12" "43418911" "46601627" "del" "0" "00006" "ARID2_000046" "g.(43000000_43418911)_(46601627_47000000)del" "" "{PMID:Weng 2018:30155906}" "" "46,XX,t(12;14)(q12;q24)" "3.18‐Mb deletion 12q12" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000822027" "0" "90" "12" "46013532" "46260030" "del" "0" "00006" "ARID2_000047" "g.(?_46013532)_(46260030_?)del" "" "{PMID:Gazdagh 2019:29698805}" "" "" "246,499bp deletion at 12q12" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000822028" "0" "90" "12" "46231318" "46231318" "dup" "0" "00006" "ARID2_000050" "g.46231318dup" "" "{PMID:Gazdagh 2019:29698805}" "" "" "" "De novo" "" "" "0" "" "" "g.45837535dup" "" "pathogenic (dominant)" "" "0000822029" "0" "90" "12" "46205315" "46205315" "subst" "0" "00006" "ARID2_000049" "g.46205315C>G" "" "{PMID:Gazdagh 2019:29698805}" "" "" "" "De novo" "" "" "0" "" "" "g.45811532C>G" "" "pathogenic (dominant)" "" "0000822030" "0" "90" "12" "46246350" "46246350" "subst" "0" "00006" "ARID2_000053" "g.46246350C>T" "" "{PMID:Gazdagh 2019:29698805}" "" "" "" "De novo" "" "" "0" "" "" "g.45852567C>T" "" "pathogenic (dominant)" "" "0000822031" "0" "90" "12" "46246593" "46246596" "dup" "0" "00006" "ARID2_000054" "g.46246593_46246596dup" "" "{PMID:Gazdagh 2019:29698805}" "" "" "" "De novo" "" "" "0" "" "" "g.45852810_45852813dup" "" "pathogenic (dominant)" "" "0000822032" "0" "90" "12" "46244551" "46244552" "ins" "0" "00006" "ARID2_000052" "g.46244551_46244552insCT" "" "{PMID:Gazdagh 2019:29698805}" "" "" "" "De novo" "" "" "0" "" "" "g.45850768_45850769insCT" "" "pathogenic (dominant)" "" "0000822033" "0" "90" "12" "46189641" "47575801" "del" "0" "00006" "ARID2_000048" "g.(?_46189641)_(47575801_?)del" "" "{PMID:Gazdagh 2019:29698805}" "" "" "1.39 Mb deletion at 12q12-13.11" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000822034" "0" "90" "12" "46231422" "46231425" "dup" "0" "00006" "ARID2_000051" "g.46231422_46231425dup" "" "{PMID:Khazanchi 2019:30838730}" "" "1262_1265dupTGCT" "" "De novo" "" "" "0" "" "" "g.45837639_45837642dup" "" "pathogenic (dominant)" "" "0000822035" "0" "90" "12" "14944107" "32111585" "del" "0" "00006" "ARID2_000045" "g.(14839182_14944107)_(32111585_32162327)del;(46081883_46238593)ins[(14839182_14944107)_(32111585_32162327)inv]" "" "{PMID:Yatsenko 2009:19938085}" "" "46,XX,ins(12)(q12p11.1p13.1)mat" "maternal karyotype 46,XX,ins(12)(q12p11.1p13.1)[25]/46,XX[25]; FISH breakpoint hg18 BP1 (14,730,449-14,835,374), BP3 (32,002,852–32,053,594), BP2 (44,368,150-44,524,860)" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000830789" "0" "50" "12" "46245462" "46245462" "subst" "0" "00006" "ARID2_000055" "g.46245462A>G" "" "{PMID:Gu 2018:29901142}" "" "" "" "Germline" "" "" "0" "" "" "g.45851679A>G" "" "VUS" "" "0000853399" "0" "70" "12" "46125095" "46125095" "dup" "0" "02327" "ARID2_000056" "g.46125095dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000853400" "0" "50" "12" "46244253" "46244253" "subst" "0" "02325" "ARID2_000057" "g.46244253A>T" "" "" "" "ARID2(NM_152641.4):c.2347A>T (p.I783F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000890561" "0" "50" "12" "46246202" "46246202" "subst" "0" "02325" "ARID2_000059" "g.46246202G>C" "" "" "" "ARID2(NM_152641.4):c.4296G>C (p.Q1432H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000890562" "0" "70" "12" "46287279" "46287279" "dup" "0" "02327" "ARID2_000060" "g.46287279dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000897187" "0" "50" "12" "46254710" "46254710" "subst" "0" "01164" "ARID2_000058" "g.46254710T>A" "" "" "" "" "ACMG: PS2_MOD, PP3_MOD, PM2_SUP; confirmed de novo in trio exome" "De novo" "-" "" "" "" "" "" "" "VUS (!)" "ACMG" "0000913840" "0" "50" "12" "46211600" "46211600" "subst" "0" "02325" "ARID2_000061" "g.46211600A>G" "" "" "" "ARID2(NM_152641.4):c.566A>G (p.H189R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000913841" "0" "30" "12" "46233253" "46233253" "subst" "0.000676325" "02325" "ARID2_000062" "g.46233253C>G" "" "" "" "ARID2(NM_152641.4):c.1472C>G (p.T491S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913842" "0" "50" "12" "46244872" "46244872" "subst" "0" "02325" "ARID2_000063" "g.46244872C>G" "" "" "" "ARID2(NM_152641.4):c.2966C>G (p.S989W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000922565" "0" "90" "12" "46123890" "46123891" "del" "0" "00006" "ARID2_000064" "g.46123890_46123891del" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PVS1, PS2, PM2, PP4" "De novo" "" "" "0" "" "" "g.45730107_45730108del" "" "pathogenic (dominant)" "ACMG" "0000922566" "0" "70" "12" "46230571" "46230571" "subst" "0" "00006" "ARID2_000006" "g.46230571C>T" "" "{PMID:Chen 2022:34906496}" "" "" "0.13 mosaic; ACMG PVS1, PM2, PP4" "Somatic" "" "" "0" "" "" "g.45836788C>T" "" "likely pathogenic (dominant)" "ACMG" "0000922567" "0" "90" "12" "46231422" "46231425" "dup" "0" "00006" "ARID2_000051" "g.46231422_46231425dup" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PVS1, PS1, PS2, PM2, PP4" "Germline/De novo (untested)" "" "" "0" "" "" "g.45837639_45837642dup" "" "pathogenic (dominant)" "ACMG" "0000922568" "0" "70" "12" "46231444" "46231448" "del" "0" "00006" "ARID2_000065" "g.46231444_46231448del" "" "{PMID:Chen 2022:34906496}" "" "" "variant not maternal; ACMG PVS1, PM2, PP4" "Germline/De novo (untested)" "" "" "0" "" "" "g.45837661_45837665del" "" "likely pathogenic (dominant)" "ACMG" "0000922569" "0" "90" "12" "46240721" "46240721" "subst" "0" "00006" "ARID2_000066" "g.46240721G>A" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PVS1, PS2, PM2, PP4" "De novo" "" "" "0" "" "" "g.45846938G>A" "" "pathogenic (dominant)" "ACMG" "0000922570" "0" "90" "12" "46244364" "46244364" "subst" "0" "00006" "ARID2_000067" "g.46244364C>T" "" "{PMID:Chen 2022:34906496}" "" "" "0.19 mosaic; ACMG PVS1, PS2, PM2, PP4" "Somatic" "" "" "0" "" "" "g.45850581C>T" "" "pathogenic (dominant)" "ACMG" "0000922571" "0" "70" "12" "46244734" "46244734" "subst" "0" "00006" "ARID2_000068" "g.46244734T>G" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PS2, PM2, PP4" "De novo" "" "" "0" "" "" "g.45850951T>G" "" "likely pathogenic (dominant)" "ACMG" "0000922572" "0" "90" "12" "46285666" "46285666" "subst" "0" "00006" "ARID2_000069" "g.46285666C>T" "" "{PMID:Chen 2022:34906496}" "" "" "ACMG PVS1, PS2, PM2, PP4" "De novo" "" "" "0" "" "" "g.45891883C>T" "" "pathogenic (dominant)" "ACMG" "0000925630" "0" "90" "12" "46211513" "46211514" "ins" "0" "02325" "ARID2_000070" "g.46211513_46211514insC" "" "" "" "ARID2(NM_152641.4):c.479_480insC (p.K160Nfs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000925631" "0" "90" "12" "46211515" "46211517" "del" "0" "02325" "ARID2_000071" "g.46211515_46211517del" "" "" "" "ARID2(NM_152641.4):c.481_483delTTG (p.L161del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000927879" "0" "90" "12" "46245000" "46245000" "subst" "0" "03779" "ARID2_000072" "g.46245000C>T" "" "" "" "" "" "Unknown" "" "rs2138169007" "0" "" "" "" "" "pathogenic" "" "0000930091" "0" "30" "12" "46240639" "46240639" "subst" "0.000188769" "02325" "ARID2_000073" "g.46240639C>G" "" "" "" "ARID2(NM_152641.4):c.1499C>G (p.A500G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000959701" "0" "90" "12" "46244778" "46244778" "subst" "0" "00006" "ARID2_000081" "g.46244778C>T" "" "{PMID:Schrier Vergano 2024:38243407}" "" "" "" "De novo" "" "" "0" "" "" "g.45850995C>T" "" "pathogenic (dominant)" "" "0000959702" "0" "90" "12" "46125050" "46125050" "del" "0" "00006" "ARID2_000076" "g.46125050del" "" "{PMID:Schrier Vergano 2024:38243407}" "" "237delC" "" "De novo" "" "" "0" "" "" "g.45731267del" "" "pathogenic (dominant)" "" "0000959703" "0" "90" "12" "46287446" "46287446" "subst" "0" "00006" "ARID2_000074" "g.46287446C>T" "" "{PMID:Schrier Vergano 2024:38243407}" "" "" "carries pathogenic GNAS variant, microdeletion chr10 incl. CTNNA3 (maternally inherited) associated with asthma" "De novo" "" "" "0" "" "" "g.45893663C>T" "" "pathogenic (dominant)" "" "0000959704" "0" "70" "12" "46123489" "46301819" "del" "0" "00006" "ARID2_000075" "g.(?_46123489)_(46301819_?)del" "" "{PMID:Schrier Vergano 2024:38243407}" "" "36kb deletion 12q12" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_45729706)_(45908036_?)del" "" "likely pathogenic (dominant)" "" "0000959705" "0" "90" "12" "46123489" "46301819" "del" "0" "00006" "ARID2_000075" "g.(?_46123489)_(46301819_?)del" "" "{PMID:Schrier Vergano 2024:38243407}" "" "179kb deletion 12q12" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_45729706)_(45908036_?)del" "" "pathogenic (dominant)" "" "0000959706" "0" "90" "12" "46205331" "46205331" "del" "0" "00006" "ARID2_000077" "g.46205331del" "" "{PMID:Schrier Vergano 2024:38243407}" "" "415delT" "" "De novo" "" "" "0" "" "" "g.45811548del" "" "pathogenic (dominant)" "" "0000959707" "0" "90" "12" "46231359" "46231359" "del" "0" "00006" "ARID2_000078" "g.46231359del" "" "{PMID:Schrier Vergano 2024:38243407}" "" "1199delA" "" "De novo" "" "" "0" "" "" "g.45837576del" "" "pathogenic (dominant)" "" "0000959708" "0" "90" "12" "46287315" "46287315" "subst" "0" "00006" "ARID2_000084" "g.46287315C>T" "" "{PMID:Schrier Vergano 2024:38243407}" "" "" "" "De novo" "" "" "0" "" "" "g.45893532C>T" "" "pathogenic (dominant)" "" "0000959709" "0" "90" "12" "46123489" "46301819" "del" "0" "00006" "ARID2_000075" "g.(?_46123489)_(46301819_?)del" "" "{PMID:Schrier Vergano 2024:38243407}" "" "2.9Mb del 12q12-12q13.11" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_45729706)_(45908036_?)del" "" "pathogenic (dominant)" "" "0000959710" "0" "90" "12" "46233113" "46233113" "del" "0" "00006" "ARID2_000079" "g.46233113del" "" "{PMID:Schrier Vergano 2024:38243407}" "" "1332delC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.45839330del" "" "pathogenic (dominant)" "" "0000959711" "0" "90" "12" "46244720" "46244721" "del" "0" "00006" "ARID2_000080" "g.46244720_46244721del" "" "{PMID:Schrier Vergano 2024:38243407}" "" "2814_2851delTT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.45850937_45850938del" "" "pathogenic (dominant)" "" "0000959712" "0" "90" "12" "46123489" "46301819" "del" "0" "00006" "ARID2_000075" "g.(?_46123489)_(46301819_?)del" "" "{PMID:Schrier Vergano 2024:38243407}" "" "630kbdel 12q12-12q13.11" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_45729706)_(45908036_?)del" "" "pathogenic (dominant)" "" "0000959713" "0" "90" "12" "46123489" "46301819" "del" "0" "00006" "ARID2_000075" "g.(?_46123489)_(46301819_?)del" "" "{PMID:Schrier Vergano 2024:38243407}" "" "94kb del 12q12" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_45729706)_(45908036_?)del" "" "pathogenic (dominant)" "" "0000959714" "0" "90" "12" "46245585" "46245585" "subst" "4.06964E-6" "00006" "ARID2_000082" "g.46245585C>T" "" "{PMID:Schrier Vergano 2024:38243407}" "" "3680C>T" "" "De novo" "" "" "0" "" "" "g.45851802C>T" "" "pathogenic (dominant)" "" "0000959715" "0" "70" "12" "46123489" "46301819" "del" "0" "00006" "ARID2_000075" "g.(?_46123489)_(46301819_?)del" "" "{PMID:Schrier Vergano 2024:38243407}" "" "deletion 12q12" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(?_45729706)_(45908036_?)del" "" "likely pathogenic (dominant)" "" "0000959716" "0" "70" "12" "46285802" "46285802" "subst" "0" "00006" "ARID2_000045" "g.46285802C>G" "" "{PMID:Schrier Vergano 2024:38243407}" "" "5070C>G (Ser1602*)" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.45892019C>G" "" "likely pathogenic (dominant)" "" "0000959717" "0" "90" "12" "46246161" "46246162" "del" "0" "00006" "ARID2_000083" "g.46246161_46246162del" "" "{PMID:Schrier Vergano 2024:38243407}" "" "" "" "De novo" "" "" "0" "" "" "g.45852378_45852379del" "" "pathogenic (dominant)" "" "0000960254" "0" "70" "12" "46243393" "46243394" "del" "0" "00006" "ARID2_000085" "g.46243393_46243394del" "" "{PMID:Poli 2024:38177409}" "" "1746_1747delAG" "" "De novo" "" "" "0" "" "" "g.45849610_45849611del" "" "likely pathogenic (dominant)" "" "0000980256" "0" "30" "12" "46160701" "46160701" "subst" "0" "01804" "ARID2_000086" "g.46160701A>C" "" "" "" "ARID2(NM_152641.4):c.284+35604A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000980257" "0" "30" "12" "46211674" "46211674" "subst" "0" "01804" "ARID2_000087" "g.46211674A>G" "" "" "" "ARID2(NM_152641.4):c.637+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000980258" "0" "30" "12" "46215276" "46215276" "subst" "0" "01804" "ARID2_000088" "g.46215276T>A" "" "" "" "ARID2(NM_152641.4):c.705+6T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000980259" "0" "30" "12" "46215425" "46215425" "subst" "0" "01804" "ARID2_000089" "g.46215425G>A" "" "" "" "ARID2(NM_152641.4):c.705+155G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000980260" "0" "90" "12" "46287509" "46287509" "subst" "0" "02327" "ARID2_000090" "g.46287509G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001000005" "0" "30" "12" "46123668" "46123668" "subst" "0" "01804" "ARID2_000091" "g.46123668C>T" "" "" "" "ARID2(NM_152641.2):c.49C>T (p.(Leu17Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000006" "0" "30" "12" "46123866" "46123866" "subst" "0" "01804" "ARID2_000092" "g.46123866G>C" "" "" "" "ARID2(NM_152641.2):c.132G>C (p.(Glu44Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000007" "0" "30" "12" "46205286" "46205286" "subst" "3.25113E-5" "01804" "ARID2_000093" "g.46205286A>G" "" "" "" "ARID2(NM_152641.2):c.370A>G (p.(Ile124Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000008" "0" "30" "12" "46211495" "46211495" "subst" "1.22184E-5" "01804" "ARID2_000094" "g.46211495C>T" "" "" "" "ARID2(NM_152641.2):c.461C>T (p.(Ser154Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000009" "0" "30" "12" "46215259" "46215259" "subst" "0" "01804" "ARID2_000095" "g.46215259G>A" "" "" "" "ARID2(NM_152641.2):c.694G>A (p.(Asp232Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000010" "0" "30" "12" "46230589" "46230589" "subst" "0" "01804" "ARID2_000096" "g.46230589G>A" "" "" "" "ARID2(NM_152641.2):c.838G>A (p.(Asp280Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000011" "0" "50" "12" "46231194" "46231194" "subst" "0" "01804" "ARID2_000097" "g.46231194A>T" "" "" "" "ARID2(NM_152641.2):c.1114A>T (p.(Met372Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000012" "0" "30" "12" "46231310" "46231310" "subst" "8.14273E-6" "01804" "ARID2_000019" "g.46231310G>A" "" "" "" "ARID2(NM_152641.2):c.1150G>A (p.(Ala384Thr)), ARID2(NM_152641.3):c.1150G>A (p.A384T), ARID2(NM_152641.4):c.1150G>A (p.A384T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000013" "0" "50" "12" "46231310" "46231310" "subst" "8.14273E-6" "02325" "ARID2_000019" "g.46231310G>A" "" "" "" "ARID2(NM_152641.2):c.1150G>A (p.(Ala384Thr)), ARID2(NM_152641.3):c.1150G>A (p.A384T), ARID2(NM_152641.4):c.1150G>A (p.A384T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000014" "0" "30" "12" "46233116" "46233116" "subst" "1.67265E-5" "01804" "ARID2_000098" "g.46233116G>A" "" "" "" "ARID2(NM_152641.2):c.1335G>A (p.(Met445Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000015" "0" "50" "12" "46242731" "46242731" "subst" "1.63305E-5" "02325" "ARID2_000099" "g.46242731A>G" "" "" "" "ARID2(NM_152641.4):c.1693A>G (p.T565A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000016" "0" "50" "12" "46244356" "46244356" "subst" "8.14153E-6" "01804" "ARID2_000100" "g.46244356A>C" "" "" "" "ARID2(NM_152641.2):c.2450A>C (p.(Gln817Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000017" "0" "30" "12" "46244718" "46244718" "subst" "4.06167E-6" "01804" "ARID2_000101" "g.46244718A>G" "" "" "" "ARID2(NM_152641.2):c.2812A>G (p.(Thr938Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000018" "0" "30" "12" "46244928" "46244928" "subst" "0" "01804" "ARID2_000102" "g.46244928T>C" "" "" "" "ARID2(NM_152641.2):c.3022T>C (p.(Ser1008Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000019" "0" "50" "12" "46245111" "46245113" "del" "0" "01804" "ARID2_000103" "g.46245111_46245113del" "" "" "" "ARID2(NM_152641.2):c.3205_3207delGGT (p.(Gly1069del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000020" "0" "30" "12" "46245237" "46245237" "subst" "0" "01804" "ARID2_000104" "g.46245237G>T" "" "" "" "ARID2(NM_152641.2):c.3331G>T (p.(Val1111Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000021" "0" "30" "12" "46245483" "46245483" "subst" "4.47664E-5" "01804" "ARID2_000105" "g.46245483A>G" "" "" "" "ARID2(NM_152641.2):c.3577A>G (p.(Thr1193Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000022" "0" "30" "12" "46246129" "46246129" "subst" "8.13696E-6" "01804" "ARID2_000029" "g.46246129A>G" "" "" "" "ARID2(NM_152641.2):c.4223A>G (p.(Lys1408Arg)), ARID2(NM_152641.3):c.4223A>G (p.K1408R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000023" "0" "30" "12" "46246233" "46246233" "subst" "4.8794E-5" "01804" "ARID2_000106" "g.46246233A>G" "" "" "" "ARID2(NM_152641.2):c.4327A>G (p.(Ser1443Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000024" "0" "30" "12" "46246302" "46246302" "subst" "4.88087E-5" "01804" "ARID2_000107" "g.46246302A>G" "" "" "" "ARID2(NM_152641.2):c.4396A>G (p.(Ser1466Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000025" "0" "30" "12" "46246380" "46246380" "subst" "0" "01804" "ARID2_000108" "g.46246380A>G" "" "" "" "ARID2(NM_152641.2):c.4474A>G (p.(Lys1492Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000026" "0" "30" "12" "46254587" "46254587" "subst" "4.64416E-6" "01804" "ARID2_000109" "g.46254587A>G" "" "" "" "ARID2(NM_152641.2):c.4777A>G (p.(Thr1593Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000027" "0" "50" "12" "46287324" "46287324" "subst" "2.03446E-5" "01804" "ARID2_000110" "g.46287324A>T" "" "" "" "ARID2(NM_152641.2):c.5269A>T (p.(Thr1757Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000028" "0" "30" "12" "46287418" "46287418" "subst" "0" "01804" "ARID2_000111" "g.46287418A>C" "" "" "" "ARID2(NM_152641.2):c.5277A>C (p.(Glu1759Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000029" "0" "50" "12" "46298745" "46298745" "subst" "0" "01804" "ARID2_000112" "g.46298745T>A" "" "" "" "ARID2(NM_152641.2):c.5392T>A (p.(Ser1798Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001016068" "0" "70" "12" "46244572" "46244572" "subst" "0" "03779" "ARID2_000113" "g.46244572C>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs1943534179" "0" "" "" "" "" "likely pathogenic" "" "0001039227" "0" "30" "12" "46204808" "46204808" "subst" "0" "01804" "ARID2_000114" "g.46204808C>T" "" "" "" "ARID2(NM_152641.4):c.285-393C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039228" "0" "30" "12" "46231741" "46231741" "subst" "0" "01804" "ARID2_000115" "g.46231741A>G" "" "" "" "ARID2(NM_152641.4):c.1330+251A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039229" "0" "30" "12" "46233520" "46233520" "subst" "0" "01804" "ARID2_000116" "g.46233520T>C" "" "" "" "ARID2(NM_152641.4):c.1498+241T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039230" "0" "30" "12" "46271356" "46271356" "subst" "0" "01804" "ARID2_000117" "g.46271356G>A" "" "" "" "ARID2(NM_152641.4):c.4923-14207G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046377" "0" "50" "12" "46244284" "46244284" "subst" "0" "02325" "ARID2_000118" "g.46244284A>G" "" "" "" "ARID2(NM_152641.4):c.2378A>G (p.Q793R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001054282" "0" "30" "12" "46205333" "46205333" "subst" "0" "01804" "ARID2_000119" "g.46205333G>A" "" "" "" "ARID2(NM_152641.4):c.417G>A (p.(Ser139=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001054283" "0" "30" "12" "46242761" "46242761" "subst" "4.15607E-6" "01804" "ARID2_000120" "g.46242761C>T" "" "" "" "ARID2(NM_152641.4):c.1715+8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001054284" "0" "30" "12" "46287280" "46287280" "subst" "2.8446E-5" "01804" "ARID2_000121" "g.46287280T>C" "" "" "" "ARID2(NM_152641.4):c.5225T>C (p.(Met1742Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001062781" "21" "90" "12" "46246677" "46246677" "subst" "0" "01482" "ARID2_000122" "g.46246677C>T" "" "" "" "" "" "Germline" "no" "" "0" "" "" "g.45852894C>T" "" "pathogenic" "" "0001065723" "0" "50" "12" "46243502" "46243502" "subst" "0" "02325" "ARID2_000123" "g.46243502A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001065724" "0" "30" "12" "46246688" "46246688" "subst" "3.25327E-5" "01804" "ARID2_000124" "g.46246688T>C" "" "" "" "ARID2(NM_152641.4):c.4773+9T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001071174" "0" "50" "12" "46211473" "46211473" "subst" "0" "03779" "ARID2_000125" "g.46211473G>A" "" "" "" "" "" "Unknown" "" "rs2138092359" "0" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes ARID2 ## Count = 137 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000005135" "00001654" "50" "5363" "2444" "5363" "2444" "c.5363+2444G>A" "r.(=)" "p.(=)" "" "0000169248" "00001654" "00" "5192" "0" "5192" "0" "c.5192A>T" "r.(?)" "p.(Lys1731Met)" "" "0000261063" "00001654" "90" "2455" "0" "2455" "0" "c.2455C>T" "r.(?)" "p.(Gln819Ter)" "" "0000262956" "00001654" "50" "4585" "0" "4585" "0" "c.4585G>A" "r.(?)" "p.(Gly1529Arg)" "" "0000339004" "00001654" "70" "3814" "0" "3814" "0" "c.3814C>T" "r.(?)" "p.(Arg1272Ter)" "" "0000342502" "00001654" "70" "820" "0" "820" "0" "c.820C>T" "r.(?)" "p.(Arg274Ter)" "" "0000394825" "00001654" "70" "3411" "0" "3412" "0" "c.3411_3412del" "r.(?)" "p.(Gly1139Serfs*20)" "12" "0000394826" "00001654" "70" "156" "0" "156" "0" "c.156del" "r.(?)" "p.(Arg53Glufs*5)" "5" "0000394827" "00001654" "70" "2536" "0" "2536" "0" "c.2536del" "r.(?)" "p.(Val846LeufsTer3)" "10" "0000394828" "00001654" "50" "1028" "0" "1028" "0" "c.1028T>A" "r.(?)" "p.(Leu343*)" "6" "0000394829" "00001654" "70" "4441" "0" "4441" "0" "c.4441del" "r.(?)" "p.(His1481Ilefs*4)" "12" "0000394830" "00001654" "50" "4318" "0" "4318" "0" "c.4318C>T" "r.(?)" "p.(Gln1440*)" "12" "0000548131" "00001654" "70" "109" "0" "110" "0" "c.109_110del" "r.(?)" "p.(Ile37ProfsTer28)" "" "0000548132" "00001654" "90" "109" "0" "109" "0" "c.109del" "r.(?)" "p.(Ile37SerfsTer21)" "" "0000548135" "00001654" "50" "1150" "0" "1150" "0" "c.1150G>A" "r.(?)" "p.(Ala384Thr)" "" "0000548137" "00001654" "70" "1997" "0" "2000" "0" "c.1997_2000dup" "r.(?)" "p.(Met667IlefsTer41)" "" "0000548138" "00001654" "50" "2048" "0" "2048" "0" "c.2048G>A" "r.(?)" "p.(Arg683Lys)" "" "0000548140" "00001654" "50" "2267" "0" "2267" "0" "c.2267T>C" "r.(?)" "p.(Val756Ala)" "" "0000548141" "00001654" "10" "2764" "0" "2764" "0" "c.2764A>G" "r.(?)" "p.(Thr922Ala)" "" "0000548143" "00001654" "90" "5006" "0" "5006" "0" "c.5006G>A" "r.(?)" "p.(Trp1669Ter)" "" "0000614147" "00001654" "70" "3216" "0" "3216" "0" "c.3216del" "r.(?)" "p.(Pro1073GlnfsTer83)" "" "0000622886" "00001654" "30" "4146" "0" "4146" "0" "c.4146C>T" "r.(?)" "p.(Ser1382=)" "" "0000622887" "00001654" "30" "4223" "0" "4223" "0" "c.4223A>G" "r.(?)" "p.(Lys1408Arg)" "" "0000622888" "00001654" "50" "4240" "0" "4240" "0" "c.4240A>G" "r.(?)" "p.(Arg1414Gly)" "" "0000622889" "00001654" "50" "5036" "0" "5036" "0" "c.5036G>A" "r.(?)" "p.(Arg1679Gln)" "" "0000648556" "00001654" "50" "4300" "0" "4300" "0" "c.4300G>T" "r.(?)" "p.(Ala1434Ser)" "" "0000648557" "00001654" "90" "4441" "0" "4441" "0" "c.4441del" "r.(?)" "p.(His1481Ilefs*4)" "" "0000679527" "00001654" "90" "3285" "0" "3286" "0" "c.3285_3286insAT" "r.(?)" "p.(Gln1096IlefsTer61)" "" "0000679528" "00001654" "90" "3551" "0" "3551" "0" "c.3551del" "r.(?)" "p.(Pro1184LeufsTer4)" "" "0000679529" "00001654" "30" "3981" "0" "3981" "0" "c.3981A>G" "r.(?)" "p.(Ser1327=)" "" "0000679530" "00001654" "30" "4945" "0" "4945" "0" "c.4945G>C" "r.(?)" "p.(Val1649Leu)" "" "0000691336" "00001654" "30" "180" "0" "180" "0" "c.180C>T" "r.(?)" "p.(Phe60=)" "" "0000691337" "00001654" "50" "4583" "0" "4583" "0" "c.4583C>T" "r.(?)" "p.(Ala1528Val)" "" "0000724032" "00001654" "50" "988" "0" "1008" "0" "c.988_1008del" "r.(?)" "p.(Leu330_Gly336del)" "" "0000724033" "00001654" "30" "3438" "0" "3438" "0" "c.3438G>A" "r.(?)" "p.(Ser1146=)" "" "0000724034" "00001654" "90" "3551" "0" "3551" "0" "c.3551del" "r.(?)" "p.(Pro1184LeufsTer4)" "" "0000724035" "00001654" "50" "4490" "0" "4490" "0" "c.4490C>T" "r.(?)" "p.(Pro1497Leu)" "" "0000764080" "00001654" "90" "0" "0" "0" "0" "c.(186+1_253)_(706-7-1)_706del" "r.?" "p.?" "2i_5i" "0000791105" "00001654" "70" "3334" "0" "3334" "0" "c.3334C>T" "r.(?)" "p.(Gln1112*)" "" "0000805712" "00001654" "30" "1692" "0" "1692" "0" "c.1692A>C" "r.(?)" "p.(Ser564=)" "" "0000822020" "00001654" "90" "" "0" "" "0" "c.-1_*2958{0}" "r.0" "p.0" "_1_21_" "0000822021" "00001654" "90" "" "0" "" "0" "c.-1_*2958{0}" "r.0" "p.0" "_1_21_" "0000822022" "00001654" "90" "" "0" "" "0" "c.-1_*2958{0}" "r.0" "p.0" "_1_21_" "0000822023" "00001654" "90" "" "0" "" "0" "c.-1_*2958{0}" "r.0" "p.0" "_1_21_" "0000822025" "00001654" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000822026" "00001654" "90" "" "0" "" "0" "c.-1_*2958{0}" "r.0" "p.0" "_1_21_" "0000822027" "00001654" "90" "" "0" "" "0" "c.-1_(4922+5298_?){0}" "r.0" "p.0" "_1_16i_" "0000822028" "00001654" "90" "1158" "0" "1158" "0" "c.1158dup" "r.(?)" "p.(Asn387Ter)" "" "0000822029" "00001654" "90" "399" "0" "399" "0" "c.399C>G" "r.(?)" "p.(Tyr133Ter)" "" "0000822030" "00001654" "90" "4444" "0" "4444" "0" "c.4444C>T" "r.(?)" "p.(Gln1482Ter)" "" "0000822031" "00001654" "90" "4687" "0" "4690" "0" "c.4687_4690dup" "r.(?)" "p.(Thr1564LysfsTer5)" "" "0000822032" "00001654" "90" "2645" "0" "2646" "0" "c.2645_2646insCT" "r.(?)" "p.(Val883LeufsTer10)" "" "0000822033" "00001654" "90" "" "0" "" "0" "c.(?_285-15560)_*2958{0}" "r.?" "p.?" "_3i_21_" "0000822034" "00001654" "90" "1262" "0" "1265" "0" "c.1262_1265dup" "r.(?)" "p.(Tyr423AlafsTer39)" "" "0000822035" "00001654" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000830789" "00001654" "50" "3556" "0" "3556" "0" "c.3556A>G" "r.(?)" "p.(Thr1186Ala)" "15" "0000853399" "00001654" "70" "282" "0" "282" "0" "c.282dup" "r.(?)" "p.(Arg95Alafs*16)" "" "0000853400" "00001654" "50" "2347" "0" "2347" "0" "c.2347A>T" "r.(?)" "p.(Ile783Phe)" "" "0000890561" "00001654" "50" "4296" "0" "4296" "0" "c.4296G>C" "r.(?)" "p.(Gln1432His)" "" "0000890562" "00001654" "70" "5224" "0" "5224" "0" "c.5224dup" "r.(?)" "p.(Met1742Asnfs*18)" "" "0000897187" "00001654" "50" "4900" "0" "4900" "0" "c.4900T>A" "r.(?)" "p.(Cys1634Ser)" "" "0000913840" "00001654" "50" "566" "0" "566" "0" "c.566A>G" "r.(?)" "p.(His189Arg)" "" "0000913841" "00001654" "30" "1472" "0" "1472" "0" "c.1472C>G" "r.(?)" "p.(Thr491Ser)" "" "0000913842" "00001654" "50" "2966" "0" "2966" "0" "c.2966C>G" "r.(?)" "p.(Ser989Trp)" "" "0000922565" "00001654" "90" "156" "0" "157" "0" "c.156_157del" "r.(?)" "p.(Arg53SerfsTer12)" "2" "0000922566" "00001654" "70" "820" "0" "820" "0" "c.820C>T" "r.(?)" "p.(Arg274Ter)" "8" "0000922567" "00001654" "90" "1262" "0" "1265" "0" "c.1262_1265dup" "r.(?)" "p.(Tyr423AlafsTer39)" "10" "0000922568" "00001654" "70" "1284" "0" "1288" "0" "c.1284_1288del" "r.(?)" "p.(Met428IlefsTer31)" "10" "0000922569" "00001654" "90" "1580" "1" "1580" "1" "c.1580+1G>A" "r.spl" "p.?" "12i" "0000922570" "00001654" "90" "2458" "0" "2458" "0" "c.2458C>T" "r.(?)" "p.(Gln820Ter)" "15" "0000922571" "00001654" "70" "2828" "0" "2828" "0" "c.2828T>G" "r.(?)" "p.(Ile943Ser)" "15" "0000922572" "00001654" "90" "5026" "0" "5026" "0" "c.5026C>T" "r.(?)" "p.(Gln1676Ter)" "17" "0000925630" "00001654" "90" "479" "0" "480" "0" "c.479_480insC" "r.(?)" "p.(Lys160Asnfs*13)" "" "0000925631" "00001654" "90" "481" "0" "483" "0" "c.481_483del" "r.(?)" "p.(Leu161del)" "" "0000927879" "00001654" "90" "3094" "0" "3094" "0" "c.3094C>T" "r.(?)" "p.(Gln1032Ter)" "" "0000930091" "00001654" "30" "1499" "0" "1499" "0" "c.1499C>G" "r.(?)" "p.(Ala500Gly)" "" "0000959701" "00001654" "90" "2872" "0" "2872" "0" "c.2872C>T" "r.(?)" "p.(Gln958Ter)" "" "0000959702" "00001654" "90" "237" "0" "237" "0" "c.237del" "r.(?)" "p.(Arg80GlufsTer10)" "" "0000959703" "00001654" "90" "5305" "0" "5305" "0" "c.5305C>T" "r.(?)" "p.(Arg1769Ter)" "" "0000959704" "00001654" "70" "" "0" "" "0" "c.-131_*2958{0}" "r.0?" "p.0?" "_1_21_" "0000959705" "00001654" "90" "" "0" "" "0" "c.-131_*2958{0}" "r.0?" "p.0?" "_1_21_" "0000959706" "00001654" "90" "415" "0" "415" "0" "c.415del" "r.(?)" "p.(Ser139ArgfsTer76)" "" "0000959707" "00001654" "90" "1199" "0" "1199" "0" "c.1199del" "r.(?)" "p.(Tyr400SerfsTer16)" "" "0000959708" "00001654" "90" "5260" "0" "5260" "0" "c.5260C>T" "r.(?)" "p.(Arg1754Ter)" "" "0000959709" "00001654" "90" "" "0" "" "0" "c.-131_*2958{0}" "r.0?" "p.0?" "_1_21_" "0000959710" "00001654" "90" "1332" "0" "1332" "0" "c.1332del" "r.(?)" "p.(Asp444GlufsTer3)" "" "0000959711" "00001654" "90" "2814" "0" "2815" "0" "c.2814_2815del" "r.(?)" "p.(Tyr939CysfsTer11)" "" "0000959712" "00001654" "90" "" "0" "" "0" "c.-131_*2958{0}" "r.0?" "p.0?" "_1_21_" "0000959713" "00001654" "90" "" "0" "" "0" "c.-131_*2958{0}" "r.0?" "p.0?" "_1_21_" "0000959714" "00001654" "90" "3679" "0" "3679" "0" "c.3679C>T" "r.(?)" "p.(Gln1227Ter)" "" "0000959715" "00001654" "70" "" "0" "" "0" "c.-131_*2958{0}" "r.0?" "p.0?" "_1_21_" "0000959716" "00001654" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "" "0000959717" "00001654" "90" "4255" "0" "4256" "0" "c.4255_4256del" "r.(?)" "p.(Pro1419CysfsTer24)" "" "0000960254" "00001654" "70" "1746" "0" "1747" "0" "c.1746_1747del" "r.(?)" "p.(Arg582SerfsTer6)" "" "0000980256" "00001654" "30" "284" "35604" "284" "35604" "c.284+35604A>C" "r.(=)" "p.(=)" "" "0000980257" "00001654" "30" "637" "3" "637" "3" "c.637+3A>G" "r.spl?" "p.?" "" "0000980258" "00001654" "30" "705" "6" "705" "6" "c.705+6T>A" "r.(=)" "p.(=)" "" "0000980259" "00001654" "30" "705" "155" "705" "155" "c.705+155G>A" "r.(=)" "p.(=)" "" "0000980260" "00001654" "90" "5363" "5" "5363" "5" "c.5363+5G>A" "r.spl?" "p.?" "" "0001000005" "00001654" "30" "49" "0" "49" "0" "c.49C>T" "r.(?)" "p.(Leu17Phe)" "" "0001000006" "00001654" "30" "132" "0" "132" "0" "c.132G>C" "r.(?)" "p.(Glu44Asp)" "" "0001000007" "00001654" "30" "370" "0" "370" "0" "c.370A>G" "r.(?)" "p.(Ile124Val)" "" "0001000008" "00001654" "30" "461" "0" "461" "0" "c.461C>T" "r.(?)" "p.(Ser154Leu)" "" "0001000009" "00001654" "30" "694" "0" "694" "0" "c.694G>A" "r.(?)" "p.(Asp232Asn)" "" "0001000010" "00001654" "30" "838" "0" "838" "0" "c.838G>A" "r.(?)" "p.(Asp280Asn)" "" "0001000011" "00001654" "50" "1114" "0" "1114" "0" "c.1114A>T" "r.(?)" "p.(Met372Leu)" "" "0001000012" "00001654" "30" "1150" "0" "1150" "0" "c.1150G>A" "r.(?)" "p.(Ala384Thr)" "" "0001000013" "00001654" "50" "1150" "0" "1150" "0" "c.1150G>A" "r.(?)" "p.(Ala384Thr)" "" "0001000014" "00001654" "30" "1335" "0" "1335" "0" "c.1335G>A" "r.(?)" "p.(Met445Ile)" "" "0001000015" "00001654" "50" "1693" "0" "1693" "0" "c.1693A>G" "r.(?)" "p.(Thr565Ala)" "" "0001000016" "00001654" "50" "2450" "0" "2450" "0" "c.2450A>C" "r.(?)" "p.(Gln817Pro)" "" "0001000017" "00001654" "30" "2812" "0" "2812" "0" "c.2812A>G" "r.(?)" "p.(Thr938Ala)" "" "0001000018" "00001654" "30" "3022" "0" "3022" "0" "c.3022T>C" "r.(?)" "p.(Ser1008Pro)" "" "0001000019" "00001654" "50" "3205" "0" "3207" "0" "c.3205_3207del" "r.(?)" "p.(Gly1069del)" "" "0001000020" "00001654" "30" "3331" "0" "3331" "0" "c.3331G>T" "r.(?)" "p.(Val1111Leu)" "" "0001000021" "00001654" "30" "3577" "0" "3577" "0" "c.3577A>G" "r.(?)" "p.(Thr1193Ala)" "" "0001000022" "00001654" "30" "4223" "0" "4223" "0" "c.4223A>G" "r.(?)" "p.(Lys1408Arg)" "" "0001000023" "00001654" "30" "4327" "0" "4327" "0" "c.4327A>G" "r.(?)" "p.(Ser1443Gly)" "" "0001000024" "00001654" "30" "4396" "0" "4396" "0" "c.4396A>G" "r.(?)" "p.(Ser1466Gly)" "" "0001000025" "00001654" "30" "4474" "0" "4474" "0" "c.4474A>G" "r.(?)" "p.(Lys1492Glu)" "" "0001000026" "00001654" "30" "4777" "0" "4777" "0" "c.4777A>G" "r.(?)" "p.(Thr1593Ala)" "" "0001000027" "00001654" "50" "5269" "0" "5269" "0" "c.5269A>T" "r.(?)" "p.(Thr1757Ser)" "" "0001000028" "00001654" "30" "5277" "0" "5277" "0" "c.5277A>C" "r.(?)" "p.(Glu1759Asp)" "" "0001000029" "00001654" "50" "5392" "0" "5392" "0" "c.5392T>A" "r.(?)" "p.(Ser1798Thr)" "" "0001016068" "00001654" "70" "2666" "0" "2666" "0" "c.2666C>A" "r.(?)" "p.(Ser889Ter)" "" "0001039227" "00001654" "30" "285" "-393" "285" "-393" "c.285-393C>T" "r.(=)" "p.(=)" "" "0001039228" "00001654" "30" "1330" "251" "1330" "251" "c.1330+251A>G" "r.(=)" "p.(=)" "" "0001039229" "00001654" "30" "1498" "241" "1498" "241" "c.1498+241T>C" "r.(=)" "p.(=)" "" "0001039230" "00001654" "30" "4923" "-14207" "4923" "-14207" "c.4923-14207G>A" "r.(=)" "p.(=)" "" "0001046377" "00001654" "50" "2378" "0" "2378" "0" "c.2378A>G" "r.(?)" "p.(Gln793Arg)" "" "0001054282" "00001654" "30" "417" "0" "417" "0" "c.417G>A" "r.(?)" "p.(=)" "" "0001054283" "00001654" "30" "1715" "8" "1715" "8" "c.1715+8C>T" "r.(=)" "p.(=)" "" "0001054284" "00001654" "30" "5225" "0" "5225" "0" "c.5225T>C" "r.(?)" "p.(Met1742Thr)" "" "0001062781" "00001654" "90" "4771" "0" "4771" "0" "c.4771C>T" "r.(4771C>T)" "p.(Gln1591Ter)" "15" "0001065723" "00001654" "50" "1855" "0" "1855" "0" "c.1855A>C" "r.(?)" "p.(Thr619Pro)" "" "0001065724" "00001654" "30" "4773" "9" "4773" "9" "c.4773+9T>C" "r.(=)" "p.(=)" "" "0001071174" "00001654" "50" "439" "0" "439" "0" "c.439G>A" "r.(?)" "p.(Gly147Arg)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 56 "{{screeningid}}" "{{variantid}}" "0000000209" "0000005135" "0000104507" "0000169248" "0000174958" "0000394825" "0000174959" "0000394826" "0000174960" "0000394827" "0000174961" "0000394828" "0000174962" "0000394829" "0000174963" "0000394830" "0000291867" "0000648556" "0000291868" "0000648557" "0000363426" "0000764080" "0000378353" "0000791105" "0000391952" "0000822020" "0000391953" "0000822021" "0000391954" "0000822022" "0000391955" "0000822023" "0000391956" "0000822035" "0000391957" "0000822025" "0000391958" "0000822026" "0000391959" "0000822027" "0000391960" "0000822028" "0000391961" "0000822029" "0000391962" "0000822030" "0000391963" "0000822031" "0000391964" "0000822032" "0000391965" "0000822033" "0000391966" "0000822034" "0000398575" "0000830789" "0000422235" "0000897187" "0000436206" "0000922565" "0000436207" "0000922566" "0000436208" "0000922567" "0000436209" "0000922568" "0000436210" "0000922569" "0000436211" "0000922570" "0000436212" "0000922571" "0000436213" "0000922572" "0000449485" "0000959701" "0000449486" "0000959702" "0000449487" "0000959703" "0000449488" "0000959704" "0000449489" "0000959705" "0000449490" "0000959706" "0000449491" "0000959707" "0000449492" "0000959708" "0000449493" "0000959709" "0000449494" "0000959710" "0000449495" "0000959711" "0000449496" "0000959712" "0000449497" "0000959713" "0000449498" "0000959714" "0000449499" "0000959715" "0000449500" "0000959716" "0000449501" "0000959717" "0000449771" "0000960254" "0000473852" "0001062781"