### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = ATOH7) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "ATOH7" "atonal homolog 7 (Drosophila)" "10" "q22.2" "unknown" "NG_031934.1" "UD_136085689381" "" "https://www.LOVD.nl/ATOH7" "" "1" "13907" "220202" "609875" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/ATOH7_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2017-07-14 17:30:02" "00006" "2025-11-18 19:31:19" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00003055" "ATOH7" "atonal homolog 7 (Drosophila)" "001" "NM_145178.3" "" "NP_660161.1" "" "" "" "-436" "1083" "459" "69991870" "69990352" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 7 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00356" "MCOP" "anoophthalmia/microphthalmia" "" "" "" "" "" "00006" "2014-03-14 18:41:31" "00006" "2025-11-23 21:29:13" "01478" "-" "hypoplasia, optic nerve, bilateral" "AD" "165550" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04240" "EVR;FEVR" "vitreoretinopathy, exudative (EVR; familial FVER))" "" "" "" "" "" "00006" "2015-04-10 12:38:11" "00006" "2019-07-31 13:55:30" "04367" "PHPVAR" "vitreous, primary, hyperplastic, persistent, autosomal recessive (PHPVAR)" "AR" "221900" "" "" "" "00000" "2015-09-23 10:25:22" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "ATOH7" "04367" ## Individuals ## Do not remove or alter this header ## ## Count = 22 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00265201" "" "" "" "5" "" "03383" "{PMID:Khan 2011:22068589}" "4 generation family, consanguineous, 5 affected" "M" "yes" "Pakistan" "" "0" "" "" "" "MEP57 2298" "00265208" "" "" "" "2" "" "03383" "{PMID:Khan 2011:22068589}" "4 generation family, 2 affected" "M" "yes" "Turkey" "" "0" "" "" "" "NE1 F475" "00265245" "" "" "" "1" "" "03383" "{PMID:Kondo 2016:26933893}" "2 generation family, 1 affected" "M" "no" "Japan" "" "0" "" "lensectomy" "" "7101" "00265251" "" "" "" "1" "" "03383" "{PMID:Kondo 2016:26933893}" "sporadic" "F" "?" "Japan" "" "0" "" "" "" "12001" "00265252" "" "" "" "2" "" "03383" "{PMID:Kondo 2016:26933893}" "2 generation family, 2 affected (F, M), unaffected heterozygous carrier father" "F" "no" "Japan" "" "0" "" "" "" "15402" "00265265" "" "" "" "1" "" "03383" "{PMID:Kondo 2016:26933893}" "sporadic" "M" "?" "Japan" "" "0" "" "" "" "14501" "00265290" "" "" "" "42" "" "03383" "{PMID:Ghiasvand 2011:21441919}" "9 generation consanguineous family, 42 affected" "?" "?" "Iran" "?" "0" "" "" "Kurdish (Iranian)" "10877" "00265301" "" "" "" "1" "" "03383" "{PMID:Prasov 2012:22645276}" "2 generation family, 1 affected - optic nerve aplasia" "F" "no" "" "" "0" "" "" "" "ONA Patient 1" "00265313" "" "" "" "5" "" "03383" "{PMID:Prasov 2012:11527934}" "6 generation family, 5 affected (previously reported in {PMID:Khaliq 2011:11527934})" "-" "yes" "Pakistan" "" "0" "" "" "" "PHPV Patient V-5" "00274319" "" "" "" "1" "" "03383" "{PMID:Macgregor 2010:21441919}{PMID:Prasov 2012:22645276}" "originally described in McGregor" "?" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "ONH Patient 2" "00335201" "" "" "" "1" "" "00000" "{PMID:Keser 2017:28192794}" "" "" "" "Pakistan" "" "0" "" "" "" "NCRNA5" "00335202" "" "" "" "1" "" "00000" "{PMID:Keser 2017:28192794}" "" "" "" "Pakistan" "" "0" "" "" "" "NCRNA6" "00335204" "" "" "" "1" "" "00000" "{PMID:Keser 2017:28192794}" "" "" "" "Pakistan" "" "0" "" "" "" "NCRNA4" "00416616" "" "" "" "1" "" "00000" "{PMID:Macgregor 2010:20395239}" "" "" "" "" "" "0" "" "" "" "?" "00416620" "" "" "" "1" "" "00000" "{PMID:Atac 2020:31696227}" "sibling of 71953" "F" "" "" "" "0" "" "" "" "72005" "00416621" "" "" "" "1" "" "00000" "{PMID:Atac 2020:31696227}" "sibling of 72005" "F" "" "" "" "0" "" "" "" "71953" "00416622" "" "" "" "1" "" "00000" "{PMID:Atac 2020:31696227}" "father of 72005 and 71953" "M" "" "" "" "0" "" "" "" "71965" "00451536" "" "" "" "6" "" "04543" "{PMID:Basharat 2024:38815792}" "6-generation family, 6 affected (2F, 4M)" "F" "yes" "Pakistan" "" "0" "" "" "" "FamBPatVI3" "00451537" "" "" "00451536" "1" "" "04543" "{PMID:Basharat 2024:38815792}" "brother" "M" "yes" "Pakistan" "" "0" "" "" "" "FamBPatVI4" "00451538" "" "" "00451536" "1" "" "04543" "{PMID:Basharat 2024:38815792}" "niece" "F" "yes" "Pakistan" "" "0" "" "" "" "FamBPatVI5" "00469711" "" "" "" "2" "" "00006" "{PMID:Garcia-Montalvo 2014:24689660}" "" "" "" "Mexico" "" "0" "" "" "" "patients" "00469712" "" "" "" "2" "" "00006" "{PMID:Garcia-Montalvo 2014:24689660}" "" "" "" "Mexico" "" "0" "" "" "" "patients" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 23 "{{individualid}}" "{{diseaseid}}" "00265201" "04240" "00265208" "04240" "00265245" "04240" "00265251" "04240" "00265252" "04240" "00265265" "04240" "00265290" "04240" "00265301" "00139" "00265301" "01478" "00265313" "04367" "00274319" "01478" "00335201" "04214" "00335202" "04214" "00335204" "04214" "00416616" "04214" "00416620" "04214" "00416621" "04214" "00416622" "04214" "00451536" "00198" "00451537" "00198" "00451538" "00198" "00469711" "00356" "00469712" "00356" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 00356, 01478, 04214, 04240, 04367 ## Count = 22 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000203029" "04240" "00265201" "03383" "Familial, autosomal recessive" "33y" "familial exudative vitreoretinopathy (HP:0030490), detached retina (HP:0000541), no light perception (HP:0032287), microphthalmia (HP:0000568)" "" "" "" "" "" "" "" "" "" "" "" "0000203034" "04240" "00265208" "03383" "Familial, autosomal recessive" "16y" "familial exudative vitreoretinopathy (HP:0030490), microphthalmia (HP:0000568), detached retina (HP:0000541), small optic nerve (HP:0008058)" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "Norrie-like retinopathy" "" "0000203072" "04240" "00265245" "03383" "Familial" "08y" "familial exudative vitreoretinopathy (HP:0030490), retinal detachment (HP:0000541), bilateral leukocoria (HP:0000555), blindness (HP:0000618)" "00y02m" "00y03m" "leukocoria (HP:0000555)" "" "" "" "" "" "congenital retinal nonattachment (CRNA)" "familial exudative vitreoretinopathy" "" "0000203073" "04240" "00265251" "03383" "Isolated (sporadic)" "01y" "familial exudative vitreoretinopathy (HP:0030490), bilateral falciform retinal folds (HP:0001493)" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" "" "0000203074" "04240" "00265252" "03383" "Familial" "07y" "familial exudative vitreoretinopathy (HP:0030490), syndactyly (HP:0001159), renal failure (HP:0000083) left eye total retinal detachment (HP:0000541)" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" "" "0000203082" "04240" "00265265" "03383" "Familial" "07y" "familial exudative vitreoretinopathy (HP:0030490), bilateral rhegmatogenous retinal detachment (HP:0012230)" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" "" "0000203088" "04240" "00265290" "03383" "Familial, autosomal recessive" "" "nonsyndromic congenital retinal nonattachment (severe subtype of familial exudative vitreoretinopathy; HP:0030490), lack of optic nerve (HP:0008058), leukocoria (HP:0000555)" "" "" "" "" "" "" "" "" "nonsyndromic congenital retinal nonattachment (NCRNA)" "" "" "0000203100" "00139" "00265301" "03383" "Unknown" "08y" "poor sensory integration, auditory processing defects; global developmental delay (HP:0001263); motor delay (HP:0001270); delayed social development (HP:0012434); speech delay (HP:0000750)" "" "" "" "" "" "" "" "" "" "" "" "0000203110" "01478" "00265301" "03383" "Unknown" "08y" "optic nerve aplasia (HP:0012521)" "" "" "" "" "" "" "" "" "optic nerve aplasia" "" "" "0000203111" "04367" "00265313" "03383" "Familial, autosomal recessive" "" "persistent hyperplasia of the primary vitreous (PHPV, HP:0007968), gross nystagmus (HP:0000639)" "" "" "" "" "" "" "" "" "congenital nonsyndromic persistent hyperplasia of the primary vitreous" "" "" "0000252916" "04214" "00335201" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal detachment" "" "0000252917" "04214" "00335202" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal detachment" "" "0000252919" "04214" "00335204" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal detachment" "" "0000308336" "04214" "00416616" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "optic nerve hypoplasia" "" "" "0000308340" "04214" "00416620" "00000" "Familial, autosomal recessive" "7y" "2.5y: esotropia, 4y: myopic astigmatism; 7y: hospital due to unexplained low vision despite corrective glasses and amblyopia treatment; cognitively normal, excellent grades at school; best corrected visual acuity right, left eye, distance: 20/100, 20/200; near: 20/80, 20/100; left microesotropia; refraction: myopic astigmatism; neurological and endocrinological assessment: normal; visual acuity stable during the observation period up to 11y; fundus: bilateral severe optic nerve hypoplasia, signs of foveal hypoplasia and abnormal vessel distribution with tortuosity and drag of the retinal vessels towards the temporal side; no sign of microphthalmia or microcornea; optical coherence tomography: significantly reduced thickness of the retinal nerve fiber layer as well as the ganglion cell and inner plexiform layers; grade 1 foveal hypoplasia with absent extrusion of plexiform layers and a shallow foveal pit; cerebral magnetic resonance imaging: severely hypoplastic optic nerves within small optic nerve sheaths; no abnormalities of midline structures or other brain areasmeasurements right/left eye: total macular volume, mm3: not available/7.53; central macular thickness, um: not available/284; ganglion cell layer and the inner plexiform layer, mm3: not available/not available; retinal nerve fiber layer thickness, um: not available/not available; optic nerve head diameter: not available (hypoplasia)/not available" "" "" "" "" "" "" "" "" "optic nerve hypoplasia" "" "" "0000308341" "04214" "00416621" "00000" "Familial, autosomal recessive" "3y" "2y: esotropia; 3y: reduced visual function; cognitively normal, excellent grades at school during the observation period; best corrected visual acuity right, left eye,near: 20/200, 20/100; orthoptic assessment: right microesotropia with eccentric fixation superior to the presumed foveolar; refraction: hyperopic astigmatism; neurological and endocrinological assessment: normal; visual acuity stable during the observation period up to 6y; fundus: bilateral severe optic nerve hypoplasia, signs of foveal hypoplasia and abnormal vessel distribution with tortuosity and drag of the retinal vessels towards the temporal side; peripheral retina: incomplete vascularization of the far peripheral retina, without visible signs of neovascularization; no sign of microphthalmia or microcornea; optical coherence tomography: significantly reduced thickness of the retinal nerve fiber layer as well as the ganglion cell and inner plexiform layers; grade 2 hypoplasia with absent extrusion of plexiform layers and absent foveal pitmeasurements right/left eye: total macular volume, mm3: 7.28/not available; central macular thickness, um: 278/not available; ganglion cell layer and the inner plexiform layer, mm3: 0.33/not available; retinal nerve fiber layer thickness, um: 28/not available; optic nerve head diameter: not available (hypoplasia)/not available" "" "" "" "" "" "" "" "" "optic nerve hypoplasia" "" "" "0000308342" "04214" "00416622" "00000" "Familial, autosomal recessive" "" "grade 1 foveal hypoplasia with absent extrusion of plexiform layers and a shallow foveal pitmeasurements right/left eye: total macular volume, mm3: 9.32/9.34; central macular thickness, um: 300/302; ganglion cell layer and the inner plexiform layer, mm3: 0.85/0.84; retinal nerve fiber layer thickness, um: 104/104; optic nerve head diameter: 1589 x 1754/1635 x 1819" "" "" "" "" "" "" "" "" "optic nerve hypoplasia" "" "" "0000340211" "00198" "00451536" "04543" "Familial, autosomal recessive" "20y" "no night vision; no perception light; no nystagmus; no corneal haze; no photophobia" "<1y" "" "" "" "" "" "" "" "FEVR" "Leber congenital amaurosis" "" "0000340212" "00198" "00451537" "04543" "Familial, autosomal recessive" "25y" "no night vision; no perception light; no nystagmus; no corneal haze; no photophobia" "<1y" "" "" "" "" "" "" "" "FEVR" "Leber congenital amaurosis" "" "0000340213" "00198" "00451538" "04543" "Familial, autosomal recessive" "17y" "no night vision; no perception light; no nystagmus; no corneal haze; no photophobia" "<1y" "" "" "" "" "" "" "" "FEVR" "Leber congenital amaurosis" "" "0000354863" "00356" "00469711" "00006" "Unknown" "" "microphthalmia-anophthalmia-coloboma" "" "" "" "" "" "" "" "" "" "microphthalmia-anophthalmia-coloboma" "" "0000354864" "00356" "00469712" "00006" "Unknown" "" "microphthalmia-anophthalmia-coloboma" "" "" "" "" "" "" "" "" "" "microphthalmia-anophthalmia-coloboma" "" ## Screenings ## Do not remove or alter this header ## ## Count = 22 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000266321" "00265201" "1" "03383" "03383" "2019-09-13 21:21:45" "" "" "SEQ-NG-I" "DNA" "" "exome sequencing" "0000266331" "00265208" "1" "03383" "03383" "2019-09-14 15:32:05" "00006" "2019-09-16 08:46:39" "PCR;SEQ" "DNA" "" "direct sequencing" "0000266366" "00265245" "1" "03383" "03383" "2019-09-17 21:51:45" "00006" "2019-09-24 21:54:56" "PCR;SEQ" "DNA" "" "direct sequencing" "0000266370" "00265251" "1" "03383" "03383" "2019-09-18 03:28:59" "00006" "2019-09-24 21:57:37" "PCR;SEQ" "DNA" "" "direct sequencing" "0000266371" "00265252" "1" "03383" "03383" "2019-09-18 03:40:50" "00006" "2019-09-24 22:00:23" "PCR;SEQ" "DNA" "" "direct sequencing" "0000266390" "00265265" "1" "03383" "03383" "2019-09-18 16:10:27" "" "" "PCR" "DNA" "" "direct sequencing" "0000266410" "00265290" "1" "03383" "03383" "2019-09-19 11:53:10" "" "" "PCR" "DNA" "" "" "0000266428" "00265301" "1" "03383" "03383" "2019-09-19 20:15:37" "" "" "SEQ-NG-I" "DNA" "" "direct sequencing" "0000266433" "00265313" "1" "03383" "03383" "2019-09-19 21:33:12" "" "" "PCR" "DNA" "" "" "0000275477" "00274319" "1" "03383" "03383" "2019-12-28 22:02:49" "" "" "PCR" "DNA" "" "" "0000336430" "00335201" "1" "00000" "00006" "2021-03-04 13:13:00" "" "" "arraySNP;SEQ-NG" "DNA" "" "gene panel" "0000336431" "00335202" "1" "00000" "00006" "2021-03-04 13:13:00" "" "" "arraySNP;SEQ-NG" "DNA" "" "gene panel" "0000336433" "00335204" "1" "00000" "00006" "2021-03-04 13:13:00" "" "" "arraySNP;SEQ-NG" "DNA" "" "gene panel" "0000417898" "00416616" "1" "00000" "03840" "2022-09-06 15:40:30" "" "" "arraySNP;SEQ" "DNA" "" "" "0000417902" "00416620" "1" "00000" "03840" "2022-09-07 10:25:25" "" "" "SEQ-NG-S;SEQ" "DNA" "" "whole-exome sequencing" "0000417903" "00416621" "1" "00000" "03840" "2022-09-07 10:25:25" "" "" "SEQ-NG-S;SEQ" "DNA" "" "whole-exome sequencing" "0000417904" "00416622" "1" "00000" "03840" "2022-09-07 10:25:25" "" "" "SEQ-NG-S;SEQ" "DNA" "" "whole-exome sequencing" "0000453137" "00451536" "1" "04543" "00006" "2024-06-10 15:00:36" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIPs, WGS" "0000453138" "00451537" "1" "04543" "00006" "2024-06-10 15:00:36" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIPs, WGS" "0000453139" "00451538" "1" "04543" "00006" "2024-06-10 15:00:36" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIPs, WGS" "0000471379" "00469711" "1" "00006" "00006" "2025-11-18 17:16:38" "" "" "SEQ" "DNA" "" "" "0000471380" "00469712" "1" "00006" "00006" "2025-11-18 19:28:28" "" "" "SEQ" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 17 "{{screeningid}}" "{{geneid}}" "0000266331" "ATOH7" "0000266366" "ATOH7" "0000266370" "ATOH7" "0000266371" "ATOH7" "0000266390" "ATOH7" "0000266410" "ATOH7" "0000266428" "ATOH7" "0000266433" "ATOH7" "0000336430" "ATOH7" "0000336431" "ATOH7" "0000336433" "ATOH7" "0000417898" "ATOH7" "0000417902" "ATOH7" "0000417903" "ATOH7" "0000417904" "ATOH7" "0000471379" "ATOH7" "0000471380" "ATOH7" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 32 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000540496" "0" "30" "10" "69991419" "69991419" "subst" "0" "01804" "ATOH7_000002" "g.69991419G>T" "" "" "" "ATOH7(NM_145178.3):c.16C>A (p.(Pro6Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.68231662G>T" "" "likely benign" "" "0000596939" "3" "90" "10" "69991289" "69991289" "subst" "0" "03383" "ATOH7_000003" "g.69991289T>A" "" "{PMID:Khan 2011:22068589}" "" "c.146G>T; p.E49V" "" "Germline" "yes" "" "0" "" "" "g.68231532T>A" "" "pathogenic (recessive)" "" "0000596990" "3" "90" "10" "69991386" "69991386" "del" "0" "03383" "ATOH7_000004" "g.69991386del" "" "{PMID:Khan 2011:22068589}" "" "53delC" "" "Germline" "yes" "" "0" "" "" "g.68231629del" "" "likely pathogenic (recessive)" "" "0000597029" "3" "70" "10" "69991297" "69991320" "del" "0" "03383" "ATOH7_000005" "g.69991297_69991320del" "" "{PMID:Kondo 2016:26933893}, correction in {PMID:Kondo 2018:29851533}" "" "106_129del, 121_144delAGGCGCCTGGCGGCCAACGCGCGC" "" "Germline" "yes" "rs10529471" "0" "" "" "g.68231540_68231563del" "" "likely pathogenic (recessive)" "" "0000597030" "1" "70" "10" "69991297" "69991320" "del" "0" "03383" "ATOH7_000005" "g.69991297_69991320del" "" "{PMID:Kondo 2016:26933893}, correction in {PMID:Kondo 2018:29851533}" "" "106_129del, 121_144delAGGCGCCTGGCGGCCAACGCGCGC" "" "Germline" "?" "rs10529471" "0" "" "" "g.68231540_68231563del" "" "likely pathogenic (recessive)" "" "0000597031" "10" "70" "10" "69991297" "69991320" "del" "0" "03383" "ATOH7_000005" "g.69991297_69991320del" "" "{PMID:Kondo 2016:26933893}, correction in {PMID:Kondo 2018:29851533}" "" "106_129del, 121_144delAGGCGCCTGGCGGCCAACGCGCGC" "" "Germline" "no" "rs10529471" "0" "" "" "g.68231540_68231563del" "" "likely pathogenic (recessive)" "" "0000597056" "1" "70" "10" "69991035" "69991035" "subst" "0" "03383" "ATOH7_000006" "g.69991035C>A" "" "{PMID:Kondo 2016:26933893}" "" "" "" "Germline" "no" "" "0" "" "" "g.68231278C>A" "" "likely pathogenic" "" "0000597095" "1" "30" "10" "69991242" "69991242" "subst" "0.00884096" "03383" "ATOH7_000007" "g.69991242T>C" "20/2190 chromosomes (1000 Genomes)" "{PMID:Prasov 2012:22645276}" "" "" "" "Unknown" "?" "" "0" "" "" "g.68231485T>C" "" "likely benign" "" "0000597097" "3" "90" "10" "69991299" "69991299" "subst" "0" "03383" "ATOH7_000008" "g.69991299T>G" "0/72 controls" "{PMID:Prasov 2012:22645276}" "" "" "" "Germline" "yes" "" "0" "" "" "g.68231542T>G" "" "pathogenic (recessive)" "" "0000612583" "0" "50" "10" "69991229" "69991229" "subst" "1.28611E-5" "01943" "ATOH7_000010" "g.69991229T>C" "" "" "" "ATOH7(NM_145178.3):c.206A>G (p.Q69R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.68231472T>C" "" "VUS" "" "0000622403" "0" "30" "10" "69991039" "69991039" "subst" "3.78065E-5" "01943" "ATOH7_000009" "g.69991039C>T" "" "" "" "ATOH7(NM_145178.3):c.396G>A (p.E132=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.68231282C>T" "" "likely benign" "" "0000629498" "0" "90" "10" "69991296" "69991296" "subst" "0" "03383" "ATOH7_000011" "g.69991296C>T" "" "ATOH7 g.560G>A; p.(Ala47Thr)" "" "" "obsolete nycleotide annotation; heterozygous" "Unknown" "" "rs3858145" "0" "" "" "" "" "likely pathogenic" "" "0000678876" "0" "50" "10" "69991427" "69991427" "subst" "0" "01943" "ATOH7_000012" "g.69991427G>A" "" "" "" "ATOH7(NM_145178.3):c.8C>T (p.S3F), ATOH7(NM_145178.4):c.8C>T (p.(Ser3Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000735805" "3" "90" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Keser 2017:28192794}" "" "6523-bp deletion" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000735806" "3" "90" "10" "0" "0" "" "0" "00000" "CYP2C9_001038" "g.?" "" "{PMID:Keser 2017:28192794}" "" "6523-bp deletion" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000735808" "3" "70" "10" "69991310" "69991310" "subst" "0" "00000" "ATOH7_000013" "g.69991310C>G" "" "{PMID:Keser 2017:28192794}" "" "G125C" "" "Germline" "yes" "" "0" "" "" "g.68231553C>G" "" "likely pathogenic" "" "0000877630" "3" "70" "10" "70007125" "70013647" "del" "0" "03840" "ATOH7_000014" "g.70007125_70013647del" "" "{PMID:Ghiasvand 2011:21441919}" "" "ATOH7 6523bp deletion" "ATOH7 6523bp deletion that spans a remote cis regulatory element 20 kb upstream from ATOH7 (Math5), a bHLH transcription factor gene required for retinal ganglion cell (RGC) and optic nerve development; variant calculated from sequence Fig.4; shadow enhancer deletion affecting expression" "Germline" "yes" "" "0" "" "" "g.68247368_68253890del" "" "likely pathogenic (recessive)" "" "0000877631" "0" "70" "10" "69991242" "69991242" "subst" "0.00884096" "00000" "ATOH7_000007" "g.69991242T>C" "" "{PMID:Macgregor 2010:20395239}" "" "ATOH7 g.614A>G; p.(Arg65Gly)" "obsolete nycleotide annotation; heterozygous" "Unknown" "?" "" "0" "" "" "g.68231485T>C" "" "likely pathogenic" "" "0000877641" "21" "70" "10" "69991260" "69991260" "subst" "0" "00000" "ATOH7_000016" "g.69991260C>T" "" "{PMID:Atac 2020:31696227}" "" "ATOH7 c.175G>A; p.(Ala59Thr)" "heterozygous; decreased protein amounts and significantly enhanced degradation in the presence of E47, a putative bHLH dimerization partner; decreased heterodimerization and DNA-binding of ATOH7 variants, resulting in total loss of transcriptional activation of luciferase reporter gene expression" "Germline" "yes" "" "0" "" "" "g.68231503C>T" "" "likely pathogenic" "" "0000877642" "21" "70" "10" "69991260" "69991260" "subst" "0" "00000" "ATOH7_000016" "g.69991260C>T" "" "{PMID:Atac 2020:31696227}" "" "ATOH7 c.175G>A; p.(Ala59Thr)" "heterozygous; decreased protein amounts and significantly enhanced degradation in the presence of E47, a putative bHLH dimerization partner; decreased heterodimerization and DNA-binding of ATOH7 variants, resulting in total loss of transcriptional activation of luciferase reporter gene expression" "Germline" "yes" "" "0" "" "" "g.68231503C>T" "" "likely pathogenic" "" "0000877643" "0" "70" "10" "69991259" "69991259" "subst" "2.06396E-5" "00000" "ATOH7_000015" "g.69991259G>A" "" "{PMID:Atac 2020:31696227}" "" "ATOH7 c.176C>T; p.(Ala59Val)" "heterozygous; decreased protein amounts and significantly enhanced degradation in the presence of E47, a putative bHLH dimerization partner; decreased heterodimerization and DNA-binding of ATOH7 variants, resulting in total loss of transcriptional activation of luciferase reporter gene expression" "Germline" "yes" "" "0" "" "" "g.68231502G>A" "" "likely pathogenic" "" "0000877644" "11" "70" "10" "69991259" "69991259" "subst" "2.06396E-5" "00000" "ATOH7_000015" "g.69991259G>A" "" "{PMID:Atac 2020:31696227}" "" "ATOH7 c.176C>T; p.(Ala59Val)" "heterozygous; decreased protein amounts and significantly enhanced degradation in the presence of E47, a putative bHLH dimerization partner; decreased heterodimerization and DNA-binding of ATOH7 variants, resulting in total loss of transcriptional activation of luciferase reporter gene expression" "Germline" "yes" "" "0" "" "" "g.68231502G>A" "" "likely pathogenic" "" "0000877646" "11" "70" "10" "69991259" "69991259" "subst" "2.06396E-5" "00000" "ATOH7_000015" "g.69991259G>A" "" "{PMID:Atac 2020:31696227}" "" "ATOH7 c.176C>T; p.(Ala59Val)" "heterozygous; decreased protein amounts and significantly enhanced degradation in the presence of E47, a putative bHLH dimerization partner; decreased heterodimerization and DNA-binding of ATOH7 variants, resulting in total loss of transcriptional activation of luciferase reporter gene expression" "Germline" "yes" "" "0" "" "" "g.68231502G>A" "" "likely pathogenic" "" "0000979088" "0" "50" "10" "69991427" "69991427" "subst" "0" "01804" "ATOH7_000012" "g.69991427G>A" "" "" "" "ATOH7(NM_145178.3):c.8C>T (p.S3F), ATOH7(NM_145178.4):c.8C>T (p.(Ser3Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000987650" "3" "70" "10" "69991344" "69991344" "del" "0" "04543" "ATOH7_000017" "g.69991344del" "" "{PMID:Basharat 2024:38815792}" "" "" "ACMG PVS1, PM2" "Germline" "yes" "" "0" "" "" "g.68231587del" "" "likely pathogenic (recessive)" "ACMG" "0000987651" "3" "70" "10" "69991344" "69991344" "del" "0" "04543" "ATOH7_000017" "g.69991344del" "" "{PMID:Basharat 2024:38815792}" "" "" "ACMG PVS1, PM2" "Germline" "yes" "" "0" "" "" "g.68231587del" "" "likely pathogenic (recessive)" "ACMG" "0000987652" "3" "70" "10" "69991344" "69991344" "del" "0" "04543" "ATOH7_000017" "g.69991344del" "" "{PMID:Basharat 2024:38815792}" "" "" "ACMG PVS1, PM2" "Germline" "yes" "" "0" "" "" "g.68231587del" "" "likely pathogenic (recessive)" "ACMG" "0001037947" "0" "50" "10" "69991251" "69991251" "subst" "0.000149942" "01804" "ATOH7_000018" "g.69991251G>T" "" "" "" "ATOH7(NM_145178.4):c.184C>A (p.(Arg62Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001037948" "0" "50" "10" "69991364" "69991381" "del" "0" "01804" "ATOH7_000019" "g.69991364_69991381del" "" "" "" "ATOH7(NM_145178.4):c.64_81del (p.(Gly22_Gly27del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053563" "0" "50" "10" "69991163" "69991164" "delins" "0" "01804" "ATOH7_000020" "g.69991163_69991164delinsAT" "" "" "" "ATOH7(NM_145178.4):c.271_272delinsAT (p.(Ala91Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001059520" "1" "30" "10" "69991222" "69991222" "subst" "0" "00006" "ATOH7_000021" "g.69991222G>T" "several MAC cases" "{PMID:Garcia-Montalvo 2014:24689660}" "" "" "" "Germline" "" "" "0" "" "" "g.68231465G>T" "" "likely benign" "" "0001059521" "0" "30" "10" "69991177" "69991177" "subst" "0" "00006" "ATOH7_000022" "g.69991177C>T" "" "{PMID:Garcia-Montalvo 2014:24689660}" "" "" "" "Germline" "" "" "0" "" "" "g.68231420C>T" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes ATOH7 ## Count = 32 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000540496" "00003055" "30" "16" "0" "16" "0" "c.16C>A" "r.(?)" "p.(Pro6Thr)" "" "0000596939" "00003055" "90" "146" "0" "146" "0" "c.146A>T" "r.(?)" "p.(Glu49Val)" "" "0000596990" "00003055" "90" "53" "0" "53" "0" "c.53del" "r.(?)" "p.(Pro18Argfs*69)" "" "0000597029" "00003055" "70" "121" "0" "144" "0" "c.121_144del" "r.(?)" "p.(Arg41_Arg48del)" "" "0000597030" "00003055" "70" "121" "0" "144" "0" "c.121_144del" "r.(?)" "p.(Arg41_Arg48del)" "" "0000597031" "00003055" "70" "121" "0" "144" "0" "c.121_144del" "r.(?)" "p.(Arg41_Arg48del)" "" "0000597056" "00003055" "70" "400" "0" "400" "0" "c.400G>T" "r.(?)" "p.(Glu134*)" "" "0000597095" "00003055" "30" "193" "0" "193" "0" "c.193A>G" "r.(?)" "p.(Arg65Gly)" "" "0000597097" "00003055" "90" "136" "0" "136" "0" "c.136A>C" "r.(?)" "p.(Asn46His)" "" "0000612583" "00003055" "50" "206" "0" "206" "0" "c.206A>G" "r.(?)" "p.(Gln69Arg)" "" "0000622403" "00003055" "30" "396" "0" "396" "0" "c.396G>A" "r.(?)" "p.(Glu132=)" "" "0000629498" "00003055" "90" "139" "0" "139" "0" "c.139G>A" "r.(?)" "p.(Ala47Thr)" "" "0000678876" "00003055" "50" "8" "0" "8" "0" "c.8C>T" "r.(?)" "p.(Ser3Phe)" "" "0000735805" "00003055" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000735806" "00003055" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000735808" "00003055" "70" "125" "0" "125" "0" "c.125G>C" "r.(?)" "p.(Arg42Pro)" "" "0000877630" "00003055" "70" "0" "0" "0" "0" "-" "r.?" "p.?" "" "0000877631" "00003055" "70" "193" "0" "193" "0" "c.193A>G" "r.(?)" "p.(Arg65Gly)" "" "0000877641" "00003055" "70" "175" "0" "175" "0" "c.175G>A" "r.(?)" "p.(Ala59Thr)" "" "0000877642" "00003055" "70" "175" "0" "175" "0" "c.175G>A" "r.(?)" "p.(Ala59Thr)" "" "0000877643" "00003055" "70" "176" "0" "176" "0" "c.176C>T" "r.(?)" "p.(Ala59Val)" "" "0000877644" "00003055" "70" "176" "0" "176" "0" "c.176C>T" "r.(?)" "p.(Ala59Val)" "" "0000877646" "00003055" "70" "176" "0" "176" "0" "c.176C>T" "r.(?)" "p.(Ala59Val)" "" "0000979088" "00003055" "50" "8" "0" "8" "0" "c.8C>T" "r.(?)" "p.(Ser3Phe)" "" "0000987650" "00003055" "70" "94" "0" "94" "0" "c.94del" "r.(?)" "p.(Ala32ProfsTer55)" "" "0000987651" "00003055" "70" "94" "0" "94" "0" "c.94del" "r.(?)" "p.(Ala32ProfsTer55)" "" "0000987652" "00003055" "70" "94" "0" "94" "0" "c.94del" "r.(?)" "p.(Ala32ProfsTer55)" "" "0001037947" "00003055" "50" "184" "0" "184" "0" "c.184C>A" "r.(?)" "p.(Arg62Ser)" "" "0001037948" "00003055" "50" "64" "0" "81" "0" "c.64_81del" "r.(?)" "p.(Gly22_Gly27del)" "" "0001053563" "00003055" "50" "271" "0" "272" "0" "c.271_272delinsAT" "r.(?)" "p.(Ala91Ile)" "" "0001059520" "00003055" "30" "213" "0" "213" "0" "c.213C>A" "r.(?)" "p.(Gly71=)" "" "0001059521" "00003055" "30" "258" "0" "258" "0" "c.258G>A" "r.(?)" "p.(Leu86=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 24 "{{screeningid}}" "{{variantid}}" "0000266321" "0000596939" "0000266331" "0000596990" "0000266366" "0000597029" "0000266370" "0000597030" "0000266371" "0000597031" "0000266390" "0000597056" "0000266410" "0000877630" "0000266428" "0000597095" "0000266433" "0000597097" "0000275477" "0000629498" "0000336430" "0000735805" "0000336431" "0000735806" "0000336433" "0000735808" "0000417898" "0000877631" "0000417902" "0000877641" "0000417902" "0000877644" "0000417903" "0000877642" "0000417903" "0000877646" "0000417904" "0000877643" "0000453137" "0000987650" "0000453138" "0000987651" "0000453139" "0000987652" "0000471379" "0001059520" "0000471380" "0001059521"