### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = AUTS2)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"AUTS2"	"autism susceptibility candidate 2"	"7"	"p13"	"unknown"	"NG_034133.1"	"UD_132464935347"	""	"https://www.LOVD.nl/AUTS2"	""	"1"	"14262"	"26053"	"607270"	"1"	"1"	"1"	"1"	"Establishment of this gene variant database (LSDB) was supported by the <a href=\'http://www.LUMC.nl\' target=\'_blank\'>Leiden University Medical Center (LUMC)</a>, Leiden, Nederland. We gratefully acknowledge the work of <b>Erik Sistermans</b> acting as curator of this database until mid 2021."	""	"g"	"http://databases.lovd.nl/shared/refseq/AUTS2_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00001"	"2013-05-03 00:00:00"	"00006"	"2021-09-09 15:19:55"	"00000"	"2025-05-05 21:14:00"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00023941"	"AUTS2"	"transcript variant 1"	"001"	"NM_015570.2"	""	"NP_056385.1"	""	""	""	"-735"	"5683"	"3780"	"69063905"	"70257885"	"00006"	"2014-03-29 00:32:55"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 10
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00000"	"Healthy/Control"	"Healthy individual / control"	""	""	""	""	""	"00000"	"2012-07-26 17:29:43"	""	""
"00138"	"autism"	"autism"	""	"209850"	""	""	""	"00084"	"2013-06-04 18:17:33"	"00006"	"2015-12-08 23:54:35"
"00139"	"ID"	"intellectual disability (ID)"	""	""	""	""	""	"00084"	"2013-06-04 18:18:07"	"00006"	"2015-02-09 10:02:49"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00212"	"SCZD"	"schizophrenia (SCZD)"	"AD"	"181500"	""	""	""	"00006"	"2013-09-24 21:08:12"	"00006"	"2021-12-10 21:51:32"
"03945"	"SLI"	"language impairment, specific (SLI)"	""	""	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2019-02-14 16:21:51"
"04098"	"MRD26"	"mental retardation, autosomal dominant, type 26 (MRD26)"	"AD"	"615834"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2020-04-02 10:32:38"
"05162"	"DD"	"developmental delay (DD)"	""	""	""	""	""	"00006"	"2016-05-10 21:15:54"	"00006"	"2020-05-25 13:52:33"
"05533"	"MR;ID"	"mental retardation (MR, intellectual disability (ID))"	""	""	""	""	""	"00006"	"2018-12-18 09:22:07"	""	""
"05611"	"NDD"	"neurodevelopmental disorder (NDD)"	""	""	""	""	""	"00006"	"2019-06-19 12:27:20"	"00006"	"2024-12-13 11:12:21"


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}"	"{{diseaseid}}"
"AUTS2"	"00139"
"AUTS2"	"04098"


## Individuals ## Do not remove or alter this header ##
## Count = 55
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00016365"	""	""	""	"1"	""	"00682"	""	"patient 1 (Gea Beunders, et al., 2014)"	"M"	"no"	"Netherlands"	">24y"	"0"	""	""	"white"	""
"00016366"	""	""	""	"1"	""	"00682"	""	"proband 2 in Beunders et al. 2014"	"M"	"no"	"Belgium"	">20y"	"0"	"20y"	""	"white"	""
"00017713"	""	""	""	"1"	""	"00006"	"{PMID:Beunders 2013:23332918}"	"WTCCC2 birth cohort"	"?"	"?"	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	""
"00017714"	""	""	""	"1"	""	"00006"	"{PMID:Beunders 2013:23332918}"	"WTCCC2 birth cohort"	"?"	"?"	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	""
"00017715"	""	""	""	"1"	""	"00006"	"{PMID:Beunders 2013:23332918}"	"UK Blood Service collection"	"?"	"?"	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	""
"00017716"	""	""	""	"1"	""	"00006"	"{PMID:Beunders 2013:23332918}"	"UK Blood Service collection"	"?"	"?"	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	""
"00017717"	""	""	""	"1"	""	"00006"	"{PMID:Beunders 2013:23332918}"	"SAGE controls"	"?"	"?"	"(United States)"	""	"0"	""	""	""	""
"00017718"	""	""	""	"1"	""	"00006"	"{PMID:Beunders 2013:23332918}"	"SAGE controls"	"?"	"?"	"(United States)"	""	"0"	""	""	""	""
"00017719"	""	""	""	"1"	""	"00006"	"{PMID:Beunders 2013:23332918}"	"SAGE controls"	"?"	"?"	"(United States)"	""	"0"	""	""	""	""
"00017720"	""	""	""	"1"	""	"00006"	"{PMID:Beunders 2013:23332918}"	"Ottawa Heart Institute (OHI) controls"	"?"	"?"	"(Canada)"	""	"0"	""	""	""	""
"00017721"	""	""	""	"1"	""	"00006"	"{PMID:Beunders 2013:23332918}"	"Ottawa Heart Institute (OHI) controls"	"?"	"?"	"(Canada)"	""	"0"	""	""	""	""
"00050545"	""	""	""	"1"	""	"00006"	"{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}"	"family, 1 affected"	"F"	""	"United Kingdom (Great Britain)"	""	"0"	"Decipher"	""	""	""
"00144509"	""	""	""	"1"	""	"01807"	""	""	"M"	""	"(Germany)"	""	"0"	""	""	""	""
"00294492"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00294493"	""	""	""	"97"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00294494"	""	""	""	"31"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00296007"	""	""	""	"1"	""	"03288"	""	""	"M"	"no"	"Italy"	"09y"	"0"	""	""	""	"0708"
"00305168"	""	""	""	"2"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00331314"	""	""	""	"1"	""	"01164"	""	""	"M"	""	"Germany"	""	"0"	""	""	""	"171071"
"00384514"	""	""	""	"1"	""	"04165"	"{PMID:Sanchez-Jimeno 2021:34573342}"	""	""	""	"Spain"	""	"0"	""	""	""	"RM-1003"
"00384515"	""	""	""	"1"	""	"04165"	"{PMID:Sanchez-Jimeno 2021:34573342}"	""	""	""	"Spain"	""	"0"	""	""	""	"RM-299"
"00384516"	""	""	""	"1"	""	"04165"	"{PMID:Sanchez-Jimeno 2021:34573342}"	""	""	""	"Spain"	""	"0"	""	""	""	"RM-1935"
"00384517"	""	""	""	"1"	""	"04165"	"{PMID:Sanchez-Jimeno 2021:34573342}"	""	""	""	"Spain"	""	"0"	""	""	""	"RM-1513"
"00384518"	""	""	""	"1"	""	"04165"	"{PMID:Sanchez-Jimeno 2021:34573342}"	""	""	""	"Spain"	""	"0"	""	""	""	"RM-519"
"00386912"	""	""	""	"1"	""	"04165"	"{PMID:McCarthy et al., 2014:24776741}"	""	"F"	""	""	""	"0"	""	""	""	"trio 58"
"00386913"	""	""	""	"1"	""	"04165"	"{PMID:Brunet et al., 2021:33619735}"	""	"F"	""	""	""	"0"	""	""	""	"10"
"00386920"	""	""	""	"1"	""	"04165"	"{PMID:Stojanovic et al 2020:31623504}"	""	"M"	""	"Serbia"	""	"0"	""	""	""	"1"
"00386921"	""	""	""	"1"	""	"04165"	"{PMID:Turner 2019:31785789}"	""	"M"	""	""	""	"0"	""	""	""	"DDD4K.00364"
"00386922"	""	""	""	"1"	""	"04165"	"{PMID:Turner 2019:31785789}"	""	"F"	""	""	""	"0"	""	""	""	"DDD4K.02496"
"00386924"	""	""	""	"1"	""	"04165"	"{PMID:Turner 2019:31785789}"	""	"F"	""	""	""	"0"	""	""	""	"DDD4K.02444"
"00386929"	""	""	""	"1"	""	"04165"	"{PMID:Monies et al 2019: 31130284}"	""	"F"	"no"	"Saudi Arabia"	""	"0"	""	""	""	"UPN-1267"
"00386930"	""	""	""	"1"	""	"04165"	"{PMID:Monies et al 2019: 31130284}"	""	"M"	"?"	"Saudi Arabia"	""	"0"	""	""	""	"UPN-1272"
"00386931"	""	""	""	"1"	""	"04165"	"{PMID:Beunders 2013: 23332918}"	""	"M"	""	""	""	"0"	""	""	""	""
"00386932"	""	""	""	"1"	""	"00006"	"{PMID:Chen 2017:28440294}"	"family, proband and 2 affected sibs, unaffected parents"	"M"	""	"Netherlands"	""	"0"	""	""	""	"FamAPatIII1(Pat19)"
"00386933"	""	""	""	"1"	""	"04165"	"{PMID:Beunders 2013: 23332918}"	""	"F"	""	""	""	"0"	""	""	""	""
"00386934"	""	""	""	"1"	""	"04165"	"{PMID:Beunders 2013: 23332918}"	""	"M"	""	""	""	"0"	""	""	""	""
"00386936"	""	""	""	"1"	""	"04165"	"{PMID:Beunders 2013: 23332918}"	""	"F"	""	""	""	"0"	""	""	""	""
"00386937"	""	""	""	"1"	""	"04165"	"{PMID:Beunders 2013: 23332918}"	""	"F"	""	""	""	"0"	""	""	""	""
"00386940"	""	""	""	"1"	""	"04165"	"{PMID:Beunders 2013: 23332918}"	""	"F"	""	""	""	"0"	""	""	""	""
"00387426"	""	""	""	"1"	""	"04165"	"{PMID:Beunders 2013: 23332918}"	""	"M"	""	""	""	"0"	""	""	""	""
"00387432"	""	""	""	"1"	""	"04165"	"{PMID:Beunders 2013: 23332918}"	""	"M"	""	""	""	"0"	""	""	""	""
"00387433"	""	""	""	"1"	""	"04165"	"{PMID:Beunders 2013: 23332918}"	""	"F"	""	""	""	"0"	""	""	""	""
"00387434"	""	""	""	"1"	""	"04165"	"{PMID:Beunders 2013: 23332918}"	""	"F"	""	""	""	"0"	""	""	""	""
"00387436"	""	""	""	"1"	""	"04165"	"{PMID:Beunders 2013: 23332918}"	""	"F"	""	""	""	"0"	""	""	""	""
"00387439"	""	""	""	"1"	""	"04165"	"{PMID:Beunders 2013: 23332918}"	""	"F"	""	""	""	"0"	""	""	""	""
"00387440"	""	""	""	"1"	""	"04165"	"{PMID:Beunders 2013: 23332918}"	""	"M"	""	""	""	"0"	""	""	""	""
"00388186"	""	""	""	"1"	""	"04165"	"{PMID:Amarillo 2014:24459036}"	""	"F"	""	"(United States)"	""	"0"	""	""	""	""
"00388187"	""	""	""	"1"	""	"04165"	"{PMID:Nagamani 2014:22872102}"	""	"F"	""	"(United States)"	""	"0"	""	""	""	""
"00388188"	""	""	""	"1"	""	"04165"	"{PMID:Nagamani 2014:22872102}"	""	"F"	""	"(United States)"	""	"0"	""	""	""	""
"00388189"	""	""	""	"3"	""	"04165"	"{PMID:Nagamani 2014:22872102}"	""	"F"	""	"(United States)"	""	"0"	""	""	""	""
"00388190"	""	""	""	"1"	""	"04165"	"{PMID:Jolley 2013:23650183}"	""	"M"	""	"(Australia)"	""	"0"	""	""	""	""
"00388514"	""	""	""	"1"	""	"00006"	"{PMID:Leppa 2016:27569545}"	""	""	""	""	""	"0"	""	""	""	""
"00435318"	""	""	""	"1"	""	"01164"	""	""	"M"	"no"	"? (unknown)"	""	"0"	""	""	""	"261901"
"00456673"	""	""	""	"1"	""	"01164"	""	""	"M"	"no"	"Germany"	""	"0"	""	""	""	"309110"
"00458042"	""	""	""	"1"	""	"03544"	""	""	"F"	"-"	"- (not applicable)"	""	"0"	""	""	"white"	""


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 55
"{{individualid}}"	"{{diseaseid}}"
"00016365"	"00139"
"00016366"	"00139"
"00017713"	"00000"
"00017714"	"00000"
"00017715"	"00000"
"00017716"	"00000"
"00017717"	"00000"
"00017718"	"00000"
"00017719"	"00000"
"00017720"	"00000"
"00017721"	"00000"
"00050545"	"00198"
"00144509"	"00198"
"00294492"	"00198"
"00294493"	"00198"
"00294494"	"00198"
"00296007"	"05611"
"00305168"	"00198"
"00331314"	"05533"
"00384514"	"05611"
"00384515"	"05611"
"00384516"	"05611"
"00384517"	"05611"
"00384518"	"05611"
"00386912"	"00212"
"00386913"	"05611"
"00386920"	"00139"
"00386921"	"05611"
"00386922"	"05611"
"00386924"	"05611"
"00386929"	"05611"
"00386930"	"05611"
"00386931"	"04098"
"00386932"	"03945"
"00386933"	"04098"
"00386934"	"04098"
"00386936"	"04098"
"00386937"	"04098"
"00386940"	"04098"
"00387426"	"04098"
"00387432"	"04098"
"00387433"	"04098"
"00387434"	"04098"
"00387436"	"04098"
"00387439"	"04098"
"00387440"	"04098"
"00388186"	"05611"
"00388187"	"05162"
"00388188"	"05162"
"00388189"	"05162"
"00388190"	"05162"
"00388514"	"00138"
"00435318"	"04098"
"00456673"	"04098"
"00458042"	"05611"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00000, 00138, 00139, 00198, 00212, 03945, 04098, 05162, 05533, 05611
## Count = 39
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Birth/Gestational_age_wk}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000014964"	"00139"	"00016365"	"00682"	"Isolated (sporadic)"	"24y"	"low birth weight <p3\r\nmicrocephaly <p2\r\nfeeding difficulties\r\nNeurodevelopmental disorders\r\nintellectual disability/ development delay\r\nautism/autistic behavior\r\nsound sensitivity\r\nhyperactivity/ ADHD\r\nptosis\r\nprominent nasal tip\r\nshort filtrum\r\nmicrognatia"	""	""	""	""	""	""	""	""	""	""	""	""
"0000037157"	"00198"	"00050545"	"00006"	"Isolated (sporadic)"	""	"plagiocephaly, global developmental delay, microcephaly, abnormality of the pinna, abnormality of the nasolacrimal system, abnormality of the palpebral fissures, facial asymmetry"	""	""	""	""	""	""	""	""	""	""	""	""
"0000117247"	"00198"	"00144509"	"01807"	"Unknown"	""	"Global developmental delay (HP:0001263); Tall stature (HP:0000098); Nasal speech (HP:0001611)"	""	""	""	""	""	""	""	""	""	""	""	""
"0000223474"	"05611"	"00296007"	"03288"	"Isolated (sporadic)"	"09y"	"Global developmental delay, absent speech, craniofacial anomalies"	"?"	""	"09y"	""	""	""	""	""	""	"Neurodevelopmental disorder"	"Neurodevelopmental disorder"	""
"0000249506"	"05533"	"00331314"	"01164"	"Unknown"	"01y"	"(+) Cryptorchidism,(+) Hypertelorism,(+) High forehead,(+) Downslanted palpebral fissures,(+) Delayed speech and language development,(+) Single transverse palmar crease,(+) Global developmental delay"	""	""	""	""	""	""	""	""	""	""	""	""
"0000278299"	"05611"	"00384514"	"04165"	"Isolated (sporadic)"	"5y5m"	"no low birth weight; short stature; microcephaly; no feeding difficulties; global developmental delay/intellectual disability; autism spectrum disorders/autistic features; no sound sensitivity; hyperactivity/attention deficit/hyperactivity disorder; no generalized hypotonia; no structural brain anomaly; no cerebral palsy, spasticity, high muscle tone; no kyphosis/scoliosis; no arthrogryposis/shallow palmar creases; no tight heel cords; no hernia umbilicalis; no patent foramen ovale/autism spectrum disorders; no highly arched eyebrows; no hypertelorism; no proptosis; no short palpebral fissures; no upslanting palpebral fissures; no ptosis; no epicanthal fold; no strabismus; no prominent nasal tip; no anteverted nares; no deep and/or broad nasal bridge; no short and/or upturned philtrum; no micrognathia/retrognatia; no low-set ears; no earpit; no narrow mouth; 2 CAL spots"	""	""	""	""	""	""	""	""	""	"MRD26"	"developmental delay and inattention"	""
"0000278300"	"05611"	"00384515"	"04165"	"Isolated (sporadic)"	"12y1m"	"no low birth weight; no short stature; no microcephaly; no feeding difficulties; no global developmental delay/intellectual disability; autism spectrum disorders/autistic features; no sound sensitivity; hyperactivity/attention deficit/hyperactivity disorder; no generalized hypotonia; no structural brain anomaly; no cerebral palsy, spasticity, high muscle tone; no kyphosis/scoliosis; no arthrogryposis/shallow palmar creases; no tight heel cords; no hernia umbilicalis; no patent foramen ovale/autism spectrum disorders; no highly arched eyebrows; no hypertelorism; no proptosis; no short palpebral fissures; no upslanting palpebral fissures; no ptosis; no epicanthal fold; no strabismus; no prominent nasal tip; no anteverted nares; no deep and/or broad nasal bridge; no short and/or upturned philtrum; no micrognathia/retrognatia; no low-set ears; no earpit; no narrow mouth; oppositional defiant disorder, aggressiveness, tics;2 CAL spots"	""	""	""	""	""	""	""	""	""	"MRD26"	"behavioral problems, attention deficit/hyperactivity disorder"	""
"0000278301"	"05611"	"00384516"	"04165"	"Isolated (sporadic)"	"16m"	"no low birth weight; short stature; no microcephaly; feeding difficulties; global developmental delay/intellectual disability; generalized hypotonia; no structural brain anomaly; cerebral palsy, spasticity, high muscle tone; no kyphosis/scoliosis; no arthrogryposis/shallow palmar creases; no tight heel cords; no hernia umbilicalis; patent foramen ovale; no highly arched eyebrows; no hypertelorism; no proptosis; short palpebral fissures; no upslanting palpebral fissures; no ptosis; no epicanthal fold; strabismus; no prominent nasal tip; no anteverted nares; no deep and/or broad nasal bridge; no short and/or upturned philtrum; no micrognathia/retrognatia; no low-set ears; no earpit; no narrow mouth; narrow and downslanting palpebral fissures, short nose, dentition delay, hypermetropy, dysphagia, sleep disorder"	""	""	""	""	""	""	""	""	""	"MRD26"	"global developmental delay, hypotonia, failure to thrive"	""
"0000278302"	"05611"	"00384517"	"04165"	"Isolated (sporadic)"	"7y6m"	"no low birth weight; no short stature; microcephaly; no feeding difficulties; global developmental delay/intellectual disability; autism spectrum disorders/autistic features; no sound sensitivity; hyperactivity/attention deficit/hyperactivity disorder; no generalized hypotonia; no structural brain anomaly; no cerebral palsy, spasticity, high muscle tone; no kyphosis/scoliosis; no arthrogryposis/shallow palmar creases; tight heel cords; no hernia umbilicalis; no patent foramen ovale/autism spectrum disorders; no highly arched eyebrows; no hypertelorism; no proptosis; no short palpebral fissures; no upslanting palpebral fissures; ptosis; no epicanthal fold; no strabismus; no prominent nasal tip; no anteverted nares; no deep and/or broad nasal bridge; no short and/or upturned philtrum; no micrognathia/retrognatia; low-set ears; no earpit; no narrow mouth; dolicocephaly, peculiar helix, prognathism, clubfoot"	""	""	""	""	""	""	""	""	""	"MRD26"	"microcephaly, attention deficit/hyperactivity disorder"	""
"0000278303"	"05611"	"00384518"	"04165"	"Isolated (sporadic)"	"10y7m"	"no low birth weight; short stature; microcephaly; feeding difficulties; global developmental delay/intellectual disability; autism spectrum disorders/autistic features; sound sensitivity; hyperactivity/attention deficit/hyperactivity disorder; generalized hypotonia; no structural brain anomaly; no cerebral palsy, spasticity, high muscle tone; no kyphosis/scoliosis; no arthrogryposis/shallow palmar creases; no tight heel cords; no hernia umbilicalis; no patent foramen ovale/autism spectrum disorders; highly arched eyebrows; no hypertelorism; no proptosis; no short palpebral fissures; no upslanting palpebral fissures; ptosis; no epicanthal fold; no strabismus; prominent nasal tip; no anteverted nares; no deep and/or broad nasal bridge; no short and/or upturned philtrum; no micrognathia/retrognatia; no low-set ears; no earpit; no narrow mouth; 2 CAL spots"	""	""	""	""	""	""	""	""	""	"MRD26"	"cognitive delay, attention deficit/hyperactivity disorder symptoms, motor stereotypies"	""
"0000280712"	"00212"	"00386912"	"04165"	"Isolated (sporadic)"	""	"Delayed developmental milestones and had supported schooling for secondary education and received support for learning disability. Diagnosed with treatment-resistant schizophrenia following a prolonged episode of psychosis with persecutory delusions, auditory hallucinations, bizarre behavior and self-neglect. Failed to respond to therapeutic trials of at least 2 antipsychotic medications, but has made a good functional recovery with Clozapine."	"15y"	""	""	""	""	""	""	""	""	""	"Schizophrenia"	""
"0000280713"	"05611"	"00386913"	"04165"	"Isolated (sporadic)"	""	"Neurodevelopmental disorder plus associated conditions"	""	""	"06y"	""	""	""	""	""	""	""	"Neurodevelopmental disorder"	""
"0000280720"	"00139"	"00386920"	"04165"	"Isolated (sporadic)"	""	"ID, abnormal facial shape, pes equinovarus, campodactyly. diaphragmatic hernia, ptosis"	""	""	""	""	""	""	""	""	""	""	""	""
"0000280721"	"05611"	"00386921"	"04165"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	"Developmental Disorder"	""
"0000280723"	"05611"	"00386924"	"04165"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	"Developmental Disorder"	""
"0000280728"	"05611"	"00386929"	"04165"	"Unknown"	"03y03m"	"Microcephaly, Intellectual disability, white matter changes and hypotonia"	""	""	""	""	""	""	""	""	""	""	""	""
"0000280729"	"05611"	"00386930"	"04165"	"Unknown"	"07y"	"Fine/Gross motor delay, Speech delay, Intellectual disability, Autism spectrum disorder, Autistic features, ADHD"	""	""	""	""	""	""	""	""	""	""	""	""
"0000280730"	"04098"	"00386931"	"04165"	"Isolated (sporadic)"	"03y"	"mild intellectual disability"	""	""	""	""	""	""	""	""	""	""	""	""
"0000280731"	"03945"	"00386932"	"00006"	"Unknown"	""	"see paper; ..., all affected specific language impairment, special educational needs"	""	""	""	""	""	""	""	""	""	""	"specific language impairment"	""
"0000280732"	"04098"	"00386933"	"04165"	"Unknown"	"03y"	"Intellectual disability/developmental delay, structural brain anomaly, cerebral palsy/spasticity, white matter abnormalities, ptosis, strabismus"	""	""	""	""	""	""	""	""	""	""	""	""
"0000280733"	"04098"	"00386934"	"04165"	"Unknown"	"02y06m"	"low birth weight, short stature, microcephaly, intellectual disability / developmental delay, autistic behavior, strabismus"	""	""	""	""	""	""	""	""	""	""	""	""
"0000280735"	"04098"	"00386936"	"04165"	"Familial, autosomal dominant"	"02y04m"	"microcephaly, intellectual disability / developmental delay, proptosis, short palpebral fissures, narrow mouth, plachiocephaly, brachycephaly, facial asymmetry, prominent forehead, unilateral cleft lip, patent foramen ovale / atrial septum defect"	""	""	""	""	""	""	""	""	""	""	""	""
"0000280736"	"04098"	"00386937"	"04165"	"Isolated (sporadic)"	"01y07m"	"microcephaly, feeding difficulties, intellectual disability / developmental delay, autism,generalized hypotonia, highly arched eyebrows, short palpebral fissures, epicathal fold, deep/broad nasal bridge, short/upturned philtrum, narrow mouth"	""	""	""	""	""	""	""	""	""	""	""	""
"0000280737"	"04098"	"00386940"	"04165"	"Familial, autosomal dominant"	"02y03m"	"low birth weight, short stature, microcephaly, feeding difficulties, mild intellectual disability, highly arched eyebrows, hypertelorism, proptosis, short palpebral fissures, ptosis, strabismus, prominent nasal tip, short/upturned philtrum, micro/retrognathia, low set ears, narrow mouth, low columella"	""	""	""	""	""	""	""	""	""	""	""	""
"0000280989"	"04098"	"00387426"	"04165"	"Unknown"	"05y06m"	"short stature, microcephaly, intellectual disability/developmental delay, hyperactivity/ADHD, cerebral palsy/spasticity, epicanthal fold, downslant, deep/broad nasal bridge, narrow mouth, tight heel cords"	""	""	""	""	""	""	""	""	""	""	""	""
"0000280995"	"04098"	"00387432"	"04165"	"Isolated (sporadic)"	"00y11m"	"short stature, microcephaly, intellectual disability/developmental delay, cerebral palsy/spasticity, hypertelorism, epicanthal fold, micro/retrognathia, low set ears, large hands and feet"	""	""	""	""	""	""	""	""	""	""	""	""
"0000280996"	"04098"	"00387433"	"04165"	"Unknown"	"32y"	"short stature, microcephaly, feeding difficulties, moderate intellectual disability/developmental delay, autism, generalized hypotonia, highly arched eyebrows, hypertelorism, proptosis, short and upslanting palpebral fissures, ptosis, strabismus, prominent nasal tip, anteverted nares, deep/broad nasal bridge, short/upturned philtrum, micro/retrognathia, low set ears, narrow mouth, short forehead, kyphosis/scoliosis, arthrogryposis/shallow palmar creases"	""	""	""	""	""	""	""	""	""	""	""	""
"0000280997"	"04098"	"00387434"	"04165"	"Isolated (sporadic)"	"02y01m"	"low birth weight, short stature, microcephaly, mild to moderate ID/developmental delay, cerebral palsy/spasticity, hyperintense signal periventricular white matter, epicanthal fold, strabismus, prominent nasal tip, anteverted nares, ear pit, narrow mouth, mild kyphosis/scoliosis, tight heel cords, hernia umbilicalis/inguinalis, sacral dimple"	""	""	""	""	""	""	""	""	""	""	""	""
"0000280999"	"04098"	"00387436"	"04165"	"Unknown"	"01y11m"	"short stature, microcephaly, mild intellectual disability/developmental delay, generalized hypotonia, cerebral palsy/spasticity, highly arched eyebrows, proptosis, epicanthal fold, metopic synostosis"	""	""	""	""	""	""	""	""	""	""	""	""
"0000281002"	"04098"	"00387439"	"04165"	"Isolated (sporadic)"	"07y02m"	"premature birth, low birth weight, feeding difficulties, intellectual disability/developmental delay, autism, generalized hypotonia, intraventricular hemorrhage, cerebral palsy/spasticity, hypertelorism, tight heel cords"	""	""	""	""	""	""	""	""	""	""	""	""
"0000281003"	"04098"	"00387440"	"04165"	"Unknown"	"05y07m"	"short stature, microcephaly, feeding difficulties, severe intellectual disability/developmental delay, autism, almost no speech, generalized hypotonia, cerebral palsy/spasticity, ataxic gait, highly arched eyebrows, hypertelorism, proptosis, ptosis, epicanthal fold, deep/broad nasal bridge, short/upturned philtrum, micro/retrognathia, narrow mouth, prominent lips, hernia umbilicalis/inguinalis"	""	""	""	""	""	""	""	""	""	""	""	""
"0000281779"	"05611"	"00388186"	"04165"	"Isolated (sporadic)"	"04y06m"	"severe speech and language disorder, history of tonic-clonic movements, pes planus with eversion of the feet"	""	""	""	""	""	""	""	""	""	""	""	""
"0000281780"	"05162"	"00388187"	"04165"	"Isolated (sporadic)"	"10y"	"developmental delay, dysmorphic features, campodactyly, mild scoliosis of thoracic spine, atrial septal defect"	""	""	""	""	""	""	""	""	""	""	""	""
"0000281781"	"05162"	"00388188"	"04165"	"Unknown"	"03y"	"global developmental delay (without dysmorphic features)"	""	""	""	""	""	""	""	""	""	""	""	""
"0000281782"	"05162"	"00388189"	"04165"	"Familial, autosomal dominant"	"10y"	"developmental delay, mild to moderate ID, autism spectrum disorder, microcephaly, radio-ulnar synostosis, dysmorphic features including triangular facies and mid-face hypoplasia"	""	""	""	""	""	""	""	""	""	""	""	""
"0000281783"	"05162"	"00388190"	"04165"	"Isolated (sporadic)"	"13y"	"developmental delay (DD), intellectual disability (ID), short stature, feeding difficulties, ptosis, mild dysmorphism"	""	""	""	""	""	""	""	""	""	""	""	""
"0000325514"	"04098"	"00435318"	"01164"	"Unknown"	"02y"	"Autism, Global developmental delay, Small for gestational age, Esodeviation, Delayed speech and language development"	""	""	""	""	""	""	""	""	""	""	""	""
"0000345181"	"04098"	"00456673"	"01164"	"Isolated (sporadic)"	"06y"	"Intellectual disability, Short attention span, Expressive language delay, Axial hypotonia, Delayed gross motor development, Gait imbalance, Incoordination, Neurodevelopmental delay"	""	""	""	""	""	""	""	""	""	""	""	""
"0000346491"	"05611"	"00458042"	"03544"	"Isolated (sporadic)"	""	"HP:0002342, HP:0000252, HP:0000750"	""	""	""	""	""	""	""	""	""	"MRD26"	"complex neurodevelopmental disorder"	""


## Screenings ## Do not remove or alter this header ##
## Count = 55
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000016303"	"00016365"	"1"	"00682"	"00682"	"2014-03-25 22:21:30"	"00006"	"2014-06-27 14:57:54"	"SEQ-NG"	"DNA"	"blood"	""
"0000016304"	"00016366"	"1"	"00682"	"00682"	"2014-03-26 21:52:30"	"00006"	"2014-06-27 16:51:34"	"arraySNP"	"DNA"	"blood"	""
"0000017695"	"00017713"	"1"	"00006"	"00006"	"2014-06-27 15:23:15"	""	""	"arraySNP"	"DNA"	""	""
"0000017696"	"00017714"	"1"	"00006"	"00006"	"2014-06-27 15:53:50"	""	""	"arraySNP"	"DNA"	""	""
"0000017697"	"00017715"	"1"	"00006"	"00006"	"2014-06-27 15:53:50"	""	""	"arraySNP"	"DNA"	""	""
"0000017698"	"00017716"	"1"	"00006"	"00006"	"2014-06-27 15:53:50"	""	""	"arraySNP"	"DNA"	""	""
"0000017699"	"00017717"	"1"	"00006"	"00006"	"2014-06-27 15:53:50"	""	""	"arraySNP"	"DNA"	""	""
"0000017700"	"00017718"	"1"	"00006"	"00006"	"2014-06-27 15:53:50"	""	""	"arraySNP"	"DNA"	""	""
"0000017701"	"00017719"	"1"	"00006"	"00006"	"2014-06-27 15:53:50"	""	""	"arraySNP"	"DNA"	""	""
"0000017702"	"00017720"	"1"	"00006"	"00006"	"2014-06-27 15:53:50"	""	""	"arraySNP"	"DNA"	""	""
"0000017703"	"00017721"	"1"	"00006"	"00006"	"2014-06-27 15:53:50"	""	""	"arraySNP"	"DNA"	""	""
"0000050490"	"00050545"	"1"	"00006"	"00006"	"2015-09-27 16:16:40"	""	""	"SEQ;SEQ-NG-I"	"DNA"	""	""
"0000145366"	"00144509"	"0"	"01807"	"01807"	"2017-12-15 14:21:17"	""	""	"SEQ"	"DNA"	""	""
"0000295660"	"00294492"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000295661"	"00294493"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000295662"	"00294494"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000297178"	"00296007"	"1"	"03288"	"03288"	"2020-04-02 09:56:45"	""	""	"SEQ-NG"	"DNA"	"Blood"	""
"0000306297"	"00305168"	"1"	"03575"	"00006"	"2020-06-24 11:55:42"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000332533"	"00331314"	"1"	"01164"	"01164"	"2021-02-11 15:27:27"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000385739"	"00384514"	"1"	"04165"	"00006"	"2021-09-29 14:45:41"	""	""	"arrayCGH"	"DNA"	""	"aCGX 60K platform (CGXTM, PerkinElmer)"
"0000385740"	"00384515"	"1"	"04165"	"00006"	"2021-09-29 14:45:41"	""	""	"arrayCGH"	"DNA"	""	"aCGX 60K platform (CGXTM, PerkinElmer)"
"0000385741"	"00384516"	"1"	"04165"	"00006"	"2021-09-29 14:45:41"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES (Clinical Exome Solution v2, Sophia Genetics)"
"0000385742"	"00384517"	"1"	"04165"	"00006"	"2021-09-29 14:45:41"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES (Clinical Exome Solution v2, Sophia Genetics)"
"0000385743"	"00384518"	"1"	"04165"	"00006"	"2021-09-29 14:45:41"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES (Clinical Exome Solution v2, Sophia Genetics)"
"0000388140"	"00386912"	"1"	"04165"	"04165"	"2021-10-26 13:46:46"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000388141"	"00386913"	"1"	"04165"	"04165"	"2021-10-26 15:46:55"	""	""	"SEQ-NG"	"DNA"	""	""
"0000388148"	"00386920"	"1"	"04165"	"04165"	"2021-10-26 17:31:27"	""	""	"SEQ-NG"	"DNA"	""	""
"0000388149"	"00386921"	"1"	"04165"	"04165"	"2021-10-26 18:02:07"	""	""	"SEQ-NG"	"DNA"	""	""
"0000388150"	"00386922"	"1"	"04165"	"04165"	"2021-10-26 18:33:50"	""	""	"SEQ-NG"	"DNA"	""	""
"0000388152"	"00386924"	"1"	"04165"	"04165"	"2021-10-26 18:45:57"	""	""	"SEQ-NG"	"DNA"	""	""
"0000388157"	"00386929"	"1"	"04165"	"04165"	"2021-10-27 11:07:34"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000388158"	"00386930"	"1"	"04165"	"04165"	"2021-10-27 11:29:19"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000388159"	"00386931"	"1"	"04165"	"04165"	"2021-10-27 14:11:52"	""	""	"arrayCGH"	"DNA"	""	""
"0000388160"	"00386932"	"1"	"00006"	"00006"	"2021-10-27 14:14:34"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000388161"	"00386933"	"1"	"04165"	"04165"	"2021-10-27 14:56:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000388162"	"00386934"	"1"	"04165"	"04165"	"2021-10-27 15:22:30"	""	""	"arrayCGH"	"DNA"	""	""
"0000388163"	"00386936"	"1"	"04165"	"04165"	"2021-10-27 15:55:33"	""	""	"arrayCGH"	"DNA"	""	""
"0000388164"	"00386937"	"1"	"04165"	"04165"	"2021-10-27 16:06:48"	""	""	"arrayCGH"	"DNA"	""	""
"0000388167"	"00386940"	"1"	"04165"	"04165"	"2021-10-27 16:19:11"	""	""	"arrayCGH"	"DNA"	""	""
"0000388652"	"00387426"	"1"	"04165"	"04165"	"2021-10-29 11:22:13"	""	""	"arrayCGH"	"DNA"	""	""
"0000388658"	"00387432"	"1"	"04165"	"04165"	"2021-10-29 12:19:47"	""	""	"arrayCGH"	"DNA"	""	""
"0000388659"	"00387433"	"1"	"04165"	"04165"	"2021-10-29 12:27:01"	""	""	"arrayCGH"	"DNA"	""	""
"0000388660"	"00387434"	"1"	"04165"	"04165"	"2021-10-29 12:38:02"	""	""	"arrayCGH"	"DNA"	""	""
"0000388662"	"00387436"	"1"	"04165"	"04165"	"2021-10-29 12:44:45"	""	""	"arrayCGH"	"DNA"	""	""
"0000388665"	"00387439"	"1"	"04165"	"04165"	"2021-10-29 12:53:44"	""	""	"arrayCGH"	"DNA"	""	""
"0000388666"	"00387440"	"1"	"04165"	"04165"	"2021-10-29 13:00:04"	""	""	"arrayCGH"	"DNA"	""	""
"0000389425"	"00388186"	"1"	"04165"	"04165"	"2021-11-02 14:00:10"	""	""	"arrayCNV"	"DNA"	""	""
"0000389426"	"00388187"	"1"	"04165"	"04165"	"2021-11-02 16:06:39"	""	""	"arrayCGH"	"DNA"	""	""
"0000389427"	"00388188"	"1"	"04165"	"04165"	"2021-11-02 16:18:22"	""	""	"arrayCGH"	"DNA"	""	""
"0000389428"	"00388189"	"1"	"04165"	"04165"	"2021-11-02 16:27:15"	""	""	"arrayCGH"	"DNA"	""	""
"0000389429"	"00388190"	"1"	"04165"	"04165"	"2021-11-02 17:17:36"	""	""	"arrayCGH"	"DNA"	""	""
"0000389756"	"00388514"	"1"	"00006"	"00006"	"2021-11-04 09:11:44"	""	""	"arraySNP"	"DNA"	""	""
"0000436798"	"00435318"	"1"	"01164"	"01164"	"2023-06-29 17:40:43"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000458290"	"00456673"	"1"	"01164"	"01164"	"2024-10-28 16:42:00"	""	""	"SEQ-NG-I"	"DNA"	"Blood"	""
"0000459660"	"00458042"	"1"	"03544"	"03544"	"2024-11-26 11:00:15"	""	""	"SEQ-NG-I"	"DNA"	"peripheral blood"	"CES"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 17
"{{screeningid}}"	"{{geneid}}"
"0000016303"	"AUTS2"
"0000016304"	"AUTS2"
"0000017695"	"AUTS2"
"0000017696"	"AUTS2"
"0000017697"	"AUTS2"
"0000017698"	"AUTS2"
"0000017699"	"AUTS2"
"0000017700"	"AUTS2"
"0000017701"	"AUTS2"
"0000017702"	"AUTS2"
"0000017703"	"AUTS2"
"0000050490"	"AUTS2"
"0000297178"	"AUTS2"
"0000332533"	"AUTS2"
"0000332533"	"FOXP1"
"0000436798"	"AUTS2"
"0000458290"	"AUTS2"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 208
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000036093"	"0"	"70"	"7"	"70227970"	"70227971"	"del"	"0"	"00682"	"AUTS2_000001"	"g.70227970_70227971del"	""	""	""	""	""	"De novo"	"-"	""	"0"	""	""	"g.70762984_70762985del"	""	"likely pathogenic"	""
"0000036095"	"0"	"90"	"7"	"69991859"	"70221259"	"del"	"0"	"00682"	"AUTS2_000002"	"g.(69985843_69991859)_(70221259_70228020)del"	""	""	""	"arr 7q11.22(69,985,843x2,69,991,859-70,221,259x1,70,228,020x2)dn (hg19, build 37)"	""	"De novo"	""	""	"0"	""	""	"g.(70520857_70526873)_(70756273_70763034)del"	""	"pathogenic"	""
"0000037768"	"0"	"30"	"7"	"70027562"	"70139324"	"del"	"0"	"00006"	"AUTS2_000003"	"g.70027562_70139324del"	""	"{PMID:Beunders 2013:23332918}"	""	"hg18 69665498_69777260del"	""	"Unknown"	"-"	""	"0"	""	""	"g.70562576_70674338del"	""	"likely benign"	""
"0000037770"	"0"	"30"	"7"	"69690641"	"69831366"	"del"	"0"	"00006"	"AUTS2_000005"	"g.69690641_69831366del"	""	"{PMID:Beunders 2013:23332918}"	""	"hg18 69328576_69469301del"	""	"Unknown"	"-"	""	"0"	""	""	"g.70225655_70366380del"	""	"likely benign"	""
"0000037771"	"0"	"30"	"7"	"69429736"	"69557030"	"del"	"0"	"00006"	"AUTS2_000006"	"g.69429736_69557030del"	""	"{PMID:Beunders 2013:23332918}"	""	"hg18 69067672_69194966del"	""	"Unknown"	"-"	""	"0"	""	""	"g.69964750_70092044del"	""	"likely benign"	""
"0000037772"	"0"	"30"	"7"	"69402762"	"69482646"	"del"	"0"	"00006"	"AUTS2_000007"	"g.69402762_69482646del"	""	"{PMID:Beunders 2013:23332918}"	""	"hg18 69040697_69120581del"	""	"Unknown"	"-"	""	"0"	""	""	"g.69937776_70017660del"	""	"likely benign"	""
"0000037773"	"0"	"30"	"7"	"70020162"	"70055828"	"del"	"0"	"00006"	"AUTS2_000008"	"g.70020162_70055828del"	""	"{PMID:Beunders 2013:23332918}"	""	"hg18 69658096_69693762del"	""	"Unknown"	"-"	""	"0"	""	""	"g.70555176_70590842del"	""	"likely benign"	""
"0000037774"	"0"	"30"	"7"	"70184786"	"70223194"	"del"	"0"	"00006"	"AUTS2_000009"	"g.70184786_70223194del"	""	"{PMID:Beunders 2013:23332918}"	""	"hg18 69822721_69861129del"	""	"Unknown"	"-"	""	"0"	""	""	"g.70719800_70758208del"	""	"likely benign"	""
"0000037775"	"0"	"30"	"7"	"70188336"	"70224743"	"del"	"0"	"00006"	"AUTS2_000010"	"g.70188336_70224743del"	""	"{PMID:Beunders 2013:23332918}"	""	"hg18 69826272_69862679del"	""	"Unknown"	"-"	""	"0"	""	""	"g.70723350_70759757del"	""	"likely benign"	""
"0000037777"	"0"	"30"	"7"	"69219931"	"69254240"	"del"	"0"	"00006"	"AUTS2_000012"	"g.(?_69219931)_(69254240_?)del"	""	"{PMID:Beunders 2013:23332918}"	""	"hg18 68857867_68892176del"	""	"Germline/De novo (untested)"	"-"	""	"0"	""	""	"g.(?_69754945)_(69789254_?)del"	""	"likely benign"	""
"0000037778"	"0"	"30"	"7"	"69648212"	"69752142"	"del"	"0"	"00006"	"AUTS2_000013"	"g.69648212_69752142del"	""	"{PMID:Beunders 2013:23332918}"	""	"hg18 69286147_69390077del"	""	"Unknown"	"-"	""	"0"	""	""	"g.70183226_70287156del"	""	"likely benign"	""
"0000079470"	"0"	"90"	"7"	"70228089"	"70228089"	"subst"	"0"	"00006"	"AUTS2_000014"	"g.70228089C>T"	""	"{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.70763103C>T"	""	"pathogenic"	""
"0000236479"	"0"	"70"	"7"	"70228278"	"70228278"	"subst"	"0"	"01807"	"AUTS2_000015"	"g.70228278C>T"	""	""	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.70763292C>T"	""	"likely pathogenic"	""
"0000251397"	"0"	"10"	"7"	"70229548"	"70229548"	"subst"	"0"	"02326"	"AUTS2_000031"	"g.70229548A>G"	""	""	""	"AUTS2(NM_015570.4):c.1215-190A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70764562A>G"	""	"benign"	""
"0000251398"	"0"	"10"	"7"	"70238882"	"70238882"	"subst"	"0"	"02326"	"AUTS2_000042"	"g.70238882A>G"	""	""	""	"AUTS2(NM_015570.4):c.1831-132A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70773896A>G"	""	"benign"	""
"0000252149"	"0"	"30"	"7"	"69583253"	"69583253"	"del"	"0"	"02326"	"AUTS2_000026"	"g.69583253del"	""	""	""	"AUTS2(NM_001127231.3):c.624+34delA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70118267del"	""	"likely benign"	""
"0000252150"	"0"	"30"	"7"	"70232795"	"70232795"	"subst"	"0"	"02326"	"AUTS2_000039"	"g.70232795A>T"	""	""	""	"AUTS2(NM_015570.4):c.1690-215A>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70767809A>T"	""	"likely benign"	""
"0000255969"	"0"	"50"	"7"	"70255246"	"70255246"	"subst"	"0"	"01943"	"AUTS2_000053"	"g.70255246A>G"	""	""	""	"AUTS2(NM_015570.2):c.3044A>G (p.H1015R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70790260A>G"	""	"VUS"	""
"0000256530"	"0"	"50"	"7"	"69364317"	"69364317"	"subst"	"1.62655E-5"	"01943"	"AUTS2_000019"	"g.69364317A>T"	""	""	""	"AUTS2(NM_001127232.2):c.355A>T (p.T119S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.69899331A>T"	""	"VUS"	""
"0000259210"	"0"	"10"	"7"	"70228175"	"70228175"	"subst"	"0.00160863"	"02325"	"AUTS2_000030"	"g.70228175G>A"	""	""	""	"AUTS2(NM_015570.4):c.1062G>A (p.P354=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70763189G>A"	""	"benign"	""
"0000259211"	"0"	"10"	"7"	"69583252"	"69583253"	"del"	"0"	"02325"	"AUTS2_000023"	"g.69583252_69583253del"	""	""	""	"AUTS2(NM_001127231.3):c.624+33_624+34delAA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70118266_70118267del"	""	"benign"	""
"0000259212"	"0"	"10"	"7"	"69583251"	"69583253"	"del"	"0"	"02325"	"AUTS2_000025"	"g.69583251_69583253del"	""	""	""	"AUTS2(NM_001127231.3):c.624+32_624+34delAAA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70118265_70118267del"	""	"benign"	""
"0000259570"	"0"	"30"	"7"	"70254986"	"70254986"	"subst"	"0.00338205"	"02325"	"AUTS2_000052"	"g.70254986C>T"	""	""	""	"AUTS2(NM_001127231.2):c.2712C>T (p.A904=), AUTS2(NM_015570.4):c.2784C>T (p.A928=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70790000C>T"	""	"likely benign"	""
"0000259571"	"0"	"30"	"7"	"70255600"	"70255602"	"del"	"0"	"02325"	"AUTS2_000058"	"g.70255600_70255602del"	""	""	""	"AUTS2(NM_001127231.2):c.3326_3328delACC (p.H1109del), AUTS2(NM_001127231.3):c.3326_3328delACC (p.H1109del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70790614_70790616del"	""	"likely benign"	""
"0000261331"	"0"	"30"	"7"	"70229813"	"70229813"	"subst"	"0"	"02326"	"AUTS2_000032"	"g.70229813G>C"	""	""	""	"AUTS2(NM_001127231.3):c.1290G>C (p.P430=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70764827G>C"	""	"likely benign"	""
"0000261332"	"0"	"10"	"7"	"70230273"	"70230273"	"subst"	"0"	"02326"	"AUTS2_000036"	"g.70230273C>G"	""	""	""	"AUTS2(NM_015570.4):c.1468+282C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70765287C>G"	""	"benign"	""
"0000261333"	"0"	"10"	"7"	"70230074"	"70230074"	"subst"	"0"	"02326"	"AUTS2_000034"	"g.70230074G>T"	""	""	""	"AUTS2(NM_015570.4):c.1468+83G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70765088G>T"	""	"benign"	""
"0000261334"	"0"	"10"	"7"	"70230089"	"70230089"	"subst"	"0"	"02326"	"AUTS2_000035"	"g.70230089C>T"	""	""	""	"AUTS2(NM_015570.4):c.1468+98C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70765103C>T"	""	"benign"	""
"0000261335"	"0"	"10"	"7"	"70240520"	"70240520"	"subst"	"0"	"02326"	"AUTS2_000047"	"g.70240520T>C"	""	""	""	"AUTS2(NM_015570.4):c.1932+148T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70775534T>C"	""	"benign"	""
"0000261336"	"0"	"30"	"7"	"70251173"	"70251173"	"subst"	"0"	"02326"	"AUTS2_000049"	"g.70251173G>A"	""	""	""	"AUTS2(NM_015570.4):c.2308+149G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70786187G>A"	""	"likely benign"	""
"0000261337"	"0"	"30"	"7"	"69064964"	"69064964"	"del"	"0"	"02326"	"AUTS2_000017"	"g.69064964del"	""	""	""	"AUTS2(NM_015570.4):c.309+16delC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.69599978del"	""	"likely benign"	""
"0000261339"	"0"	"90"	"7"	"69364416"	"69364416"	"subst"	"0"	"02326"	"AUTS2_000020"	"g.69364416C>T"	""	""	""	"AUTS2(NM_001127231.3):c.454C>T (p.R152*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.69899430C>T"	""	"pathogenic"	""
"0000261340"	"0"	"50"	"7"	"69583176"	"69583176"	"subst"	"0.000225713"	"02326"	"AUTS2_000021"	"g.69583176C>T"	""	""	""	"AUTS2(NM_001127231.2):c.581C>T (p.S194F), AUTS2(NM_015570.4):c.581C>T (p.S194F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70118190C>T"	""	"VUS"	""
"0000261341"	"0"	"10"	"7"	"69583230"	"69583230"	"subst"	"0"	"02326"	"AUTS2_000022"	"g.69583230G>A"	""	""	""	"AUTS2(NM_015570.4):c.624+11G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70118244G>A"	""	"benign"	""
"0000261342"	"0"	"30"	"7"	"69583253"	"69583253"	"dup"	"0"	"02326"	"AUTS2_000024"	"g.69583253dup"	""	""	""	"AUTS2(NM_001127231.3):c.624+34dupA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70118267dup"	""	"likely benign"	""
"0000261343"	"0"	"10"	"7"	"70194298"	"70194298"	"subst"	"0"	"02326"	"AUTS2_000027"	"g.70194298C>G"	""	""	""	"AUTS2(NM_015570.4):c.742+30692C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70729312C>G"	""	"benign"	""
"0000263457"	"0"	"30"	"7"	"70252256"	"70252256"	"subst"	"1.21827E-5"	"01943"	"AUTS2_000050"	"g.70252256C>T"	""	""	""	"AUTS2(NM_015570.2):c.2370C>T (p.H790=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70787270C>T"	""	"likely benign"	""
"0000263458"	"0"	"30"	"7"	"70255370"	"70255370"	"subst"	"1.6342E-5"	"01943"	"AUTS2_000054"	"g.70255370G>A"	""	""	""	"AUTS2(NM_015570.2):c.3168G>A (p.P1056=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70790384G>A"	""	"likely benign"	""
"0000263460"	"0"	"30"	"7"	"70255781"	"70255781"	"subst"	"0"	"01943"	"AUTS2_000060"	"g.70255781C>T"	""	""	""	"AUTS2(NM_015570.2):c.3579C>T (p.H1193=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70790795C>T"	""	"likely benign"	""
"0000263461"	"0"	"50"	"7"	"69583176"	"69583176"	"subst"	"0.000225713"	"01943"	"AUTS2_000021"	"g.69583176C>T"	""	""	""	"AUTS2(NM_001127231.2):c.581C>T (p.S194F), AUTS2(NM_015570.4):c.581C>T (p.S194F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70118190C>T"	""	"VUS"	""
"0000331594"	"0"	"50"	"7"	"69064650"	"69064650"	"subst"	"0.0034296"	"01804"	"AUTS2_000016"	"g.69064650C>T"	""	""	""	"AUTS2(NM_001127231.1):c.11C>T (p.(Pro4Leu)), AUTS2(NM_001127231.2):c.11C>T (p.P4L), AUTS2(NM_001127231.3):c.11C>T (p.P4L), AUTS2(NM_015570.4):c.11C..."	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.69599664C>T"	""	"VUS"	""
"0000331595"	"0"	"50"	"7"	"70228096"	"70228096"	"subst"	"0"	"01804"	"AUTS2_000028"	"g.70228096C>T"	""	""	""	"AUTS2(NM_001127231.1):c.983C>T (p.(Thr328Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70763110C>T"	""	"VUS"	""
"0000331596"	"0"	"50"	"7"	"70228140"	"70228140"	"subst"	"0"	"01804"	"AUTS2_000029"	"g.70228140C>T"	""	""	""	"AUTS2(NM_015570.2):c.1027C>T (p.(Gln343Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70763154C>T"	""	"VUS"	""
"0000331599"	"0"	"50"	"7"	"70231114"	"70231114"	"subst"	"0"	"01804"	"AUTS2_000038"	"g.70231114C>T"	""	""	""	"AUTS2(NM_015570.2):c.1483C>T (p.(Arg495Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70766128C>T"	""	"VUS"	""
"0000331601"	"0"	"50"	"7"	"70236542"	"70236542"	"subst"	"0"	"01804"	"AUTS2_000041"	"g.70236542A>G"	""	""	""	"AUTS2(NM_015570.2):c.1742A>G (p.(His581Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70771556A>G"	""	"VUS"	""
"0000331602"	"0"	"50"	"7"	"70239014"	"70239014"	"subst"	"0"	"01804"	"AUTS2_000043"	"g.70239014A>G"	""	""	""	"AUTS2(NM_015570.2):c.1831A>G (p.(Thr611Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70774028A>G"	""	"VUS"	""
"0000331604"	"0"	"50"	"7"	"70239026"	"70239026"	"subst"	"0"	"01804"	"AUTS2_000045"	"g.70239026A>G"	""	""	""	"AUTS2(NM_015570.2):c.1843A>G (p.(Ile615Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70774040A>G"	""	"VUS"	""
"0000331605"	"0"	"50"	"7"	"70239029"	"70239029"	"subst"	"3.24892E-5"	"01804"	"AUTS2_000046"	"g.70239029G>A"	""	""	""	"AUTS2(NM_015570.2):c.1846G>A (p.(Asp616Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70774043G>A"	""	"VUS"	""
"0000331606"	"0"	"50"	"7"	"70249991"	"70249991"	"subst"	"8.1217E-6"	"01804"	"AUTS2_000048"	"g.70249991C>T"	""	""	""	"AUTS2(NM_015570.2):c.2210C>T (p.(Pro737Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70785005C>T"	""	"VUS"	""
"0000331607"	"0"	"50"	"7"	"70252269"	"70252269"	"subst"	"4.06101E-6"	"01804"	"AUTS2_000051"	"g.70252269C>T"	""	""	""	"AUTS2(NM_015570.2):c.2383C>T (p.(Arg795Trp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70787283C>T"	""	"VUS"	""
"0000331609"	"0"	"50"	"7"	"70255600"	"70255602"	"dup"	"0"	"01804"	"AUTS2_000057"	"g.70255600_70255602dup"	""	""	""	"AUTS2(NM_001127231.1):c.3302_3303insCCA (p.(Ser1101_His1102insHis)), AUTS2(NM_001127231.3):c.3326_3328dupACC (p.H1109dup), AUTS2(NM_015570.2):c.339..."	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70790614_70790616dup"	""	"VUS"	""
"0000339146"	"0"	"50"	"7"	"69583176"	"69583176"	"subst"	"0.000225713"	"02327"	"AUTS2_000021"	"g.69583176C>T"	""	""	""	"AUTS2(NM_001127231.2):c.581C>T (p.S194F), AUTS2(NM_015570.4):c.581C>T (p.S194F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70118190C>T"	""	"VUS"	""
"0000343372"	"0"	"50"	"7"	"70252270"	"70252270"	"subst"	"1.62443E-5"	"02327"	"AUTS2_000064"	"g.70252270G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70787284G>A"	""	"VUS"	""
"0000348569"	"0"	"50"	"7"	"70249991"	"70249991"	"subst"	"8.1217E-6"	"02327"	"AUTS2_000048"	"g.70249991C>T"	""	""	""	"AUTS2(NM_015570.2):c.2210C>T (p.(Pro737Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70785005C>T"	""	"VUS"	""
"0000350150"	"0"	"70"	"7"	"69064820"	"69064820"	"subst"	"0"	"02327"	"AUTS2_000061"	"g.69064820A>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.69599834A>T"	""	"likely pathogenic"	""
"0000532490"	"0"	"10"	"7"	"69064650"	"69064650"	"subst"	"0.0034296"	"02325"	"AUTS2_000016"	"g.69064650C>T"	""	""	""	"AUTS2(NM_001127231.1):c.11C>T (p.(Pro4Leu)), AUTS2(NM_001127231.2):c.11C>T (p.P4L), AUTS2(NM_001127231.3):c.11C>T (p.P4L), AUTS2(NM_015570.4):c.11C..."	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.69599664C>T"	""	"benign"	""
"0000532491"	"0"	"50"	"7"	"69064806"	"69064806"	"subst"	"1.28063E-5"	"01943"	"AUTS2_000065"	"g.69064806A>G"	""	""	""	"AUTS2(NM_001127231.2):c.167A>G (p.K56R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.69599820A>G"	""	"VUS"	""
"0000532492"	"0"	"30"	"7"	"69364347"	"69364347"	"subst"	"0.00151242"	"02326"	"AUTS2_000066"	"g.69364347C>G"	""	""	""	"AUTS2(NM_001127231.2):c.385C>G (p.L129V), AUTS2(NM_015570.4):c.385C>G (p.L129V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.69899361C>G"	""	"likely benign"	""
"0000532493"	"0"	"30"	"7"	"69583206"	"69583206"	"subst"	"0.00161697"	"01943"	"AUTS2_000067"	"g.69583206A>G"	""	""	""	"AUTS2(NM_001127231.2):c.611A>G (p.E204G), AUTS2(NM_015570.4):c.611A>G (p.E204G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70118220A>G"	""	"likely benign"	""
"0000532495"	"0"	"30"	"7"	"69599638"	"69599638"	"subst"	"0"	"02326"	"AUTS2_000068"	"g.69599638A>C"	""	""	""	"AUTS2(NM_015570.4):c.660+81A>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70134652A>C"	""	"likely benign"	""
"0000532496"	"0"	"30"	"7"	"69900780"	"69900780"	"dup"	"0"	"01804"	"AUTS2_000069"	"g.69900780dup"	""	""	""	"AUTS2(NM_001127231.1):c.690+6_690+7insC (p.(=)), AUTS2(NM_015570.4):c.690+13dupC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70435794dup"	""	"likely benign"	""
"0000532497"	"0"	"30"	"7"	"70227859"	"70227859"	"subst"	"2.84523E-5"	"01943"	"AUTS2_000070"	"g.70227859C>A"	""	""	""	"AUTS2(NM_001127231.2):c.746C>A (p.P249Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70762873C>A"	""	"likely benign"	""
"0000532498"	"0"	"90"	"7"	"70228230"	"70228230"	"subst"	"0"	"02327"	"AUTS2_000071"	"g.70228230C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70763244C>T"	""	"pathogenic"	""
"0000532500"	"0"	"50"	"7"	"70231225"	"70231230"	"del"	"0"	"01943"	"AUTS2_000073"	"g.70231225_70231230del"	""	""	""	"AUTS2(NM_001127231.2):c.1594_1599delCAGCAC (p.Q532_H533del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70766239_70766244del"	""	"VUS"	""
"0000532501"	"0"	"70"	"7"	"70231228"	"70231228"	"subst"	"0"	"01804"	"AUTS2_000074"	"g.70231228C>T"	""	""	""	"AUTS2(NM_015570.2):c.1597C>T (p.(His533Tyr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70766242C>T"	""	"likely pathogenic"	""
"0000532502"	"0"	"30"	"7"	"70231233"	"70231233"	"subst"	"8.206E-6"	"01943"	"AUTS2_000075"	"g.70231233C>G"	""	""	""	"AUTS2(NM_001127231.2):c.1602C>G (p.T534=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70766247C>G"	""	"likely benign"	""
"0000532503"	"0"	"30"	"7"	"70236574"	"70236574"	"subst"	"0.00287545"	"01804"	"AUTS2_000076"	"g.70236574C>G"	""	""	""	"AUTS2(NM_001127231.1):c.1774C>G (p.(Pro592Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70771588C>G"	""	"likely benign"	""
"0000532505"	"0"	"30"	"7"	"70250967"	"70250967"	"subst"	"0.000154305"	"01804"	"AUTS2_000078"	"g.70250967A>C"	""	""	""	"AUTS2(NM_001127231.1):c.2179A>C (p.(Thr727Pro)), AUTS2(NM_001127231.2):c.2179A>C (p.T727P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70785981A>C"	""	"likely benign"	""
"0000532506"	"0"	"30"	"7"	"70254826"	"70254826"	"subst"	"8.12269E-6"	"01804"	"AUTS2_000079"	"g.70254826A>G"	""	""	""	"AUTS2(NM_001127231.1):c.2552A>G (p.(Gln851Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70789840A>G"	""	"likely benign"	""
"0000532507"	"0"	"50"	"7"	"70254972"	"70254972"	"subst"	"0"	"01804"	"AUTS2_000080"	"g.70254972C>G"	""	""	""	"AUTS2(NM_001127231.1):c.2698C>G (p.(His900Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70789986C>G"	""	"VUS"	""
"0000532508"	"0"	"30"	"7"	"70254986"	"70254986"	"subst"	"0.00338205"	"01943"	"AUTS2_000052"	"g.70254986C>T"	""	""	""	"AUTS2(NM_001127231.2):c.2712C>T (p.A904=), AUTS2(NM_015570.4):c.2784C>T (p.A928=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790000C>T"	""	"likely benign"	""
"0000532509"	"0"	"30"	"7"	"70254988"	"70254988"	"subst"	"5.17467E-5"	"01804"	"AUTS2_000081"	"g.70254988C>G"	""	""	""	"AUTS2(NM_001127231.1):c.2714C>G (p.(Ala905Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790002C>G"	""	"likely benign"	""
"0000532510"	"0"	"30"	"7"	"70255022"	"70255022"	"subst"	"0.000919178"	"01943"	"AUTS2_000082"	"g.70255022G>C"	""	""	""	"AUTS2(NM_001127231.2):c.2748G>C (p.P916=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790036G>C"	""	"likely benign"	""
"0000532512"	"0"	"30"	"7"	"70255057"	"70255057"	"subst"	"6.30683E-5"	"01943"	"AUTS2_000084"	"g.70255057C>A"	""	""	""	"AUTS2(NM_001127231.3):c.2783C>A (p.A928D), AUTS2(NM_015570.2):c.2855C>A (p.A952D), AUTS2(NM_015570.4):c.2855C>A (p.(Ala952Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790071C>A"	""	"likely benign"	""
"0000532513"	"0"	"50"	"7"	"70255057"	"70255057"	"subst"	"6.30683E-5"	"02325"	"AUTS2_000084"	"g.70255057C>A"	""	""	""	"AUTS2(NM_001127231.3):c.2783C>A (p.A928D), AUTS2(NM_015570.2):c.2855C>A (p.A952D), AUTS2(NM_015570.4):c.2855C>A (p.(Ala952Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790071C>A"	""	"VUS"	""
"0000532514"	"0"	"50"	"7"	"70255352"	"70255352"	"subst"	"0"	"01943"	"AUTS2_000085"	"g.70255352G>A"	""	""	""	"AUTS2(NM_001127231.2):c.3078G>A (p.M1026I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790366G>A"	""	"VUS"	""
"0000532516"	"0"	"10"	"7"	"70255597"	"70255602"	"dup"	"0"	"02325"	"AUTS2_000087"	"g.70255597_70255602dup"	""	""	""	"AUTS2(NM_015570.4):c.3395_3400dupACCACC (p.H1132_H1133dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790611_70790616dup"	""	"benign"	""
"0000532517"	"0"	"30"	"7"	"70255600"	"70255602"	"dup"	"0"	"02326"	"AUTS2_000057"	"g.70255600_70255602dup"	""	""	""	"AUTS2(NM_001127231.1):c.3302_3303insCCA (p.(Ser1101_His1102insHis)), AUTS2(NM_001127231.3):c.3326_3328dupACC (p.H1109dup), AUTS2(NM_015570.2):c.339..."	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790614_70790616dup"	""	"likely benign"	""
"0000532519"	"0"	"10"	"7"	"70255600"	"70255602"	"dup"	"0"	"01943"	"AUTS2_000057"	"g.70255600_70255602dup"	""	""	""	"AUTS2(NM_001127231.1):c.3302_3303insCCA (p.(Ser1101_His1102insHis)), AUTS2(NM_001127231.3):c.3326_3328dupACC (p.H1109dup), AUTS2(NM_015570.2):c.339..."	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790614_70790616dup"	""	"benign"	""
"0000532520"	"0"	"10"	"7"	"70255639"	"70255639"	"subst"	"0.00937136"	"02325"	"AUTS2_000088"	"g.70255639G>T"	""	""	""	"AUTS2(NM_015570.4):c.3437G>T (p.G1146V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790653G>T"	""	"benign"	""
"0000532521"	"0"	"10"	"7"	"70255639"	"70255639"	"subst"	"0.00937136"	"02326"	"AUTS2_000088"	"g.70255639G>T"	""	""	""	"AUTS2(NM_015570.4):c.3437G>T (p.G1146V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790653G>T"	""	"benign"	""
"0000532522"	"0"	"30"	"7"	"70255810"	"70255810"	"subst"	"0"	"01943"	"AUTS2_000089"	"g.70255810A>G"	""	""	""	"AUTS2(NM_001127231.2):c.3536A>G (p.N1179S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790824A>G"	""	"likely benign"	""
"0000532523"	"0"	"30"	"7"	"70255872"	"70255872"	"subst"	"0"	"02327"	"AUTS2_000090"	"g.70255872A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790886A>G"	""	"likely benign"	""
"0000532524"	"0"	"30"	"7"	"70255956"	"70255956"	"subst"	"0.000472703"	"01804"	"AUTS2_000091"	"g.70255956A>G"	""	""	""	"AUTS2(NM_001127231.1):c.3682A>G (p.(Thr1228Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790970A>G"	""	"likely benign"	""
"0000611176"	"0"	"50"	"7"	"70255026"	"70255026"	"subst"	"0"	"02327"	"AUTS2_000093"	"g.70255026C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70790040C>G"	""	"VUS"	""
"0000621918"	"0"	"30"	"7"	"70227965"	"70227965"	"subst"	"3.24844E-5"	"01943"	"AUTS2_000092"	"g.70227965T>C"	""	""	""	"AUTS2(NM_001127231.2):c.852T>C (p.C284=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70762979T>C"	""	"likely benign"	""
"0000652349"	"1"	"30"	"7"	"69583206"	"69583206"	"subst"	"0.00161697"	"03575"	"AUTS2_000067"	"g.69583206A>G"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs149961458}"	"Germline"	""	"rs149961458"	"0"	""	""	"g.70118220A>G"	""	"likely benign"	""
"0000652350"	"1"	"30"	"7"	"70236574"	"70236574"	"subst"	"0.00287545"	"03575"	"AUTS2_000076"	"g.70236574C>G"	"97/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"97 heterozygous; {DB:CLININrs199756061}"	"Germline"	""	"rs199756061"	"0"	""	""	"g.70771588C>G"	""	"likely benign"	""
"0000652351"	"1"	"30"	"7"	"70255639"	"70255639"	"subst"	"0.00937136"	"03575"	"AUTS2_000088"	"g.70255639G>T"	"31/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"31 heterozygous, no homozygous; {DB:CLININrs150926322}"	"Germline"	""	"rs150926322"	"0"	""	""	"g.70790653G>T"	""	"likely benign"	""
"0000655871"	"0"	"50"	"7"	"69064914"	"69064914"	"subst"	"0"	"02325"	"AUTS2_000094"	"g.69064914C>G"	""	""	""	"AUTS2(NM_015570.4):c.275C>G (p.A92G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.69599928C>G"	""	"VUS"	""
"0000655872"	"0"	"50"	"7"	"70231234"	"70231257"	"del"	"0"	"01943"	"AUTS2_000063"	"g.70231234_70231257del"	""	""	""	"AUTS2(NM_001127231.2):c.1603_1626delCACCAGCACACGCACCAGCACACC (p.H535_T542del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.70766248_70766271del"	""	"VUS"	""
"0000659804"	"0"	"70"	"7"	"70231234"	"70231257"	"del"	"0"	"03288"	"AUTS2_000063"	"g.70231234_70231257del"	""	""	""	""	""	"De novo"	"yes"	""	"0"	""	""	"g.70766248_70766271del"	""	"likely pathogenic (dominant)"	""
"0000669985"	"3"	"30"	"7"	"70236574"	"70236574"	"subst"	"0.00287545"	"03575"	"AUTS2_000076"	"g.70236574C>G"	"2/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"2 homozygous; {DB:CLININrs199756061}"	"Germline"	""	"rs199756061"	"0"	""	""	"g.70771588C>G"	""	"likely benign"	""
"0000678156"	"0"	"30"	"7"	"69064650"	"69064650"	"subst"	"0.0034296"	"01943"	"AUTS2_000016"	"g.69064650C>T"	""	""	""	"AUTS2(NM_001127231.1):c.11C>T (p.(Pro4Leu)), AUTS2(NM_001127231.2):c.11C>T (p.P4L), AUTS2(NM_001127231.3):c.11C>T (p.P4L), AUTS2(NM_015570.4):c.11C..."	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000678157"	"0"	"30"	"7"	"70252211"	"70252211"	"subst"	"3.65553E-5"	"01943"	"AUTS2_000096"	"g.70252211C>T"	""	""	""	"AUTS2(NM_001127231.2):c.2253C>T (p.F751=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70787225C>T"	""	"likely benign"	""
"0000678158"	"0"	"50"	"7"	"70254892"	"70254892"	"subst"	"0"	"01943"	"AUTS2_000097"	"g.70254892A>G"	""	""	""	"AUTS2(NM_001127231.2):c.2618A>G (p.H873R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70789906A>G"	""	"VUS"	""
"0000678159"	"0"	"50"	"7"	"70255446"	"70255446"	"subst"	"0"	"01943"	"AUTS2_000098"	"g.70255446C>T"	""	""	""	"AUTS2(NM_001127231.2):c.3172C>T (p.L1058F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70790460C>T"	""	"VUS"	""
"0000678160"	"0"	"50"	"7"	"70255543"	"70255543"	"subst"	"3.22272E-5"	"01943"	"AUTS2_000099"	"g.70255543G>A"	""	""	""	"AUTS2(NM_001127231.2):c.3269G>A (p.R1090H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70790557G>A"	""	"VUS"	""
"0000678161"	"0"	"50"	"7"	"70255714"	"70255714"	"subst"	"0"	"01804"	"AUTS2_000100"	"g.70255714A>G"	""	""	""	"AUTS2(NM_015570.2):c.3512A>G (p.(His1171Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70790728A>G"	""	"VUS"	""
"0000678162"	"0"	"30"	"7"	"70255904"	"70255904"	"subst"	"0"	"01943"	"AUTS2_000101"	"g.70255904C>G"	""	""	""	"AUTS2(NM_001127231.2):c.3630C>G (p.P1210=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70790918C>G"	""	"likely benign"	""
"0000690057"	"0"	"30"	"7"	"69364347"	"69364347"	"subst"	"0.00151242"	"01943"	"AUTS2_000066"	"g.69364347C>G"	""	""	""	"AUTS2(NM_001127231.2):c.385C>G (p.L129V), AUTS2(NM_015570.4):c.385C>G (p.L129V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000690058"	"0"	"30"	"7"	"70254770"	"70254770"	"subst"	"0"	"01943"	"AUTS2_000102"	"g.70254770A>G"	""	""	""	"AUTS2(NM_001127231.2):c.2496A>G (p.S832=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70789784A>G"	""	"likely benign"	""
"0000721525"	"0"	"50"	"7"	"69364299"	"69364299"	"subst"	"4.0703E-6"	"02329"	"AUTS2_000018"	"g.69364299C>T"	""	""	""	"AUTS2(NM_001127231.3):c.337C>T (p.R113C), AUTS2(NM_015570.4):c.337C>T (p.(Arg113Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000721526"	"0"	"90"	"7"	"70229987"	"70229990"	"del"	"0"	"02329"	"AUTS2_000105"	"g.70229987_70229990del"	""	""	""	"AUTS2(NM_001127231.3):c.1464_1467delCTCA (p.Y488*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70765001_70765004del"	""	"pathogenic"	""
"0000721527"	"0"	"30"	"7"	"70255600"	"70255602"	"del"	"0"	"01943"	"AUTS2_000058"	"g.70255600_70255602del"	""	""	""	"AUTS2(NM_001127231.2):c.3326_3328delACC (p.H1109del), AUTS2(NM_001127231.3):c.3326_3328delACC (p.H1109del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000729815"	"0"	"50"	"7"	"70255730"	"70255730"	"subst"	"0"	"01164"	"AUTS2_000104"	"g.70255730C>G"	""	""	""	""	"ACMG: PM2_sup, BP4: class 3"	"Germline"	"?"	""	"0"	""	""	"g.70790744C>G"	""	"VUS"	"ACMG"
"0000803223"	"0"	"30"	"7"	"69064768"	"69064768"	"subst"	"0"	"01943"	"AUTS2_000106"	"g.69064768C>G"	""	""	""	"AUTS2(NM_001127231.2):c.129C>G (p.T43=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.69599782C>G"	""	"likely benign"	""
"0000803224"	"0"	"30"	"7"	"69583204"	"69583204"	"subst"	"0"	"01943"	"AUTS2_000107"	"g.69583204G>T"	""	""	""	"AUTS2(NM_001127231.2):c.609G>T (p.R203=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70118218G>T"	""	"likely benign"	""
"0000803225"	"0"	"30"	"7"	"70228064"	"70228064"	"subst"	"0"	"01943"	"AUTS2_000108"	"g.70228064T>G"	""	""	""	"AUTS2(NM_001127231.2):c.951T>G (p.A317=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70763078T>G"	""	"likely benign"	""
"0000803226"	"0"	"30"	"7"	"70231263"	"70231263"	"subst"	"0.00391709"	"01943"	"AUTS2_000095"	"g.70231263G>A"	""	""	""	"AUTS2(NM_001127231.2):c.1632G>A (p.T544=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000803227"	"0"	"50"	"7"	"70231264"	"70231264"	"subst"	"8.2089E-6"	"01943"	"AUTS2_000109"	"g.70231264C>G"	""	""	""	"AUTS2(NM_001127231.2):c.1633C>G (p.P545A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70766278C>G"	""	"VUS"	""
"0000803228"	"0"	"30"	"7"	"70233053"	"70233053"	"subst"	"0"	"01943"	"AUTS2_000110"	"g.70233053G>A"	""	""	""	"AUTS2(NM_001127231.2):c.1733G>A (p.S578N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70768067G>A"	""	"likely benign"	""
"0000803229"	"0"	"50"	"7"	"70246664"	"70246664"	"subst"	"7.30935E-5"	"01943"	"AUTS2_000111"	"g.70246664C>T"	""	""	""	"AUTS2(NM_001127231.2):c.1996C>T (p.P666S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70781678C>T"	""	"VUS"	""
"0000803230"	"0"	"50"	"7"	"70255257"	"70255257"	"subst"	"0"	"02325"	"AUTS2_000112"	"g.70255257C>G"	""	""	""	"AUTS2(NM_015570.4):c.3055C>G (p.L1019V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.70790271C>G"	""	"VUS"	""
"0000812857"	"0"	"90"	"7"	"67767963"	"69320956"	"dup"	"0"	"04165"	"AUTS2_000113"	"g.(?_67767963)_(69320956_?)dup"	""	"{PMID:Sanchez-Jimeno 2021:34573342}"	""	"arr[hg19] 7q11.22 (67767963_69320956) × 3"	""	"De novo"	""	""	"0"	""	""	"g.(?_68302976)_(69855970_?)dup"	""	"pathogenic (dominant)"	""
"0000812858"	"0"	"90"	"7"	"69564262"	"69592731"	"del"	"0"	"04165"	"AUTS2_000114"	"g.(?_69564262)_(69592731_?)del"	""	"{PMID:Sanchez-Jimeno 2021:34573342}"	""	"arr[hg19] 7q11.22 (69564262-69592731) × 1"	""	"De novo"	""	""	"0"	""	""	"g.(?_70099276)_(70127745_?)del"	""	"pathogenic (dominant)"	""
"0000812859"	"0"	"90"	"7"	"70228040"	"70228041"	"delins"	"0"	"04165"	"AUTS2_000115"	"g.70228040_70228041delinsAT"	""	"{PMID:Sanchez-Jimeno 2021:34573342}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.70763054_70763055delinsAT"	""	"pathogenic (dominant)"	""
"0000812860"	"0"	"90"	"7"	"70229821"	"70229821"	"del"	"0"	"04165"	"AUTS2_000062"	"g.70229821del"	""	"{PMID:Sanchez-Jimeno 2021:34573342}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.70764835del"	""	"pathogenic (dominant)"	""
"0000812861"	"0"	"90"	"7"	"70250971"	"70250971"	"del"	"0"	"04165"	"AUTS2_000116"	"g.70250971del"	""	"{PMID:Sanchez-Jimeno 2021:34573342}"	""	"c.2183del (Gly728Alafs*2)"	"variant description corrected in consultation with authors"	"De novo"	""	""	"0"	""	""	"g.70785985del"	""	"pathogenic (dominant)"	""
"0000816545"	"0"	"77"	"7"	"69364416"	"69364416"	"subst"	"0"	"04165"	"AUTS2_000020"	"g.69364416C>T"	""	"{PMID:McCarthy et al., 2014:24776741}"	""	"NM_001127231:c.454C>T, p.(Arg152*)"	""	"De novo"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000816547"	"0"	"77"	"7"	"69064692"	"69064692"	"subst"	"0"	"04165"	"AUTS2_000117"	"g.69064692C>A"	""	"{PMID:Zhao et al., 2021:33100332}"	""	""	"Heterozygous variant was observed in the product of conception after a spontaneous abortion at gestational week 8 and 3/7"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.69599706C>A"	""	"likely pathogenic"	"ACMG"
"0000816548"	"0"	"77"	"7"	"70231235"	"70231235"	"subst"	"0"	"04165"	"AUTS2_000118"	"g.70231235A>C"	""	"{PMID:Brunet et al., 2021:33619735}"	""	""	""	"De novo"	"-"	""	"0"	""	""	"g.70766249A>C"	""	"likely pathogenic"	"ACMG"
"0000816549"	"0"	"77"	"7"	"70231235"	"70231235"	"subst"	"0"	"04165"	"AUTS2_000118"	"g.70231235A>C"	""	"{PMID:Zech et al., 2020: 33098801}"	""	""	"infancy-onset segmental dystonia with coexisting non-movement disorder-related neurological symptoms"	"De novo"	""	""	"0"	""	""	"g.70766249A>C"	""	"likely pathogenic (dominant)"	"ACMG"
"0000816570"	"0"	"77"	"7"	"70228059"	"70228059"	"subst"	"0"	"04165"	"AUTS2_000119"	"g.70228059C>T"	""	"{PMID:Zech et al., 2020: 33098801}"	""	""	"childhood-onset dystonia, interpreted as an expansion of the neurodevelopmental clinical spectrum previously associated with this gene"	"De novo"	""	""	"0"	""	""	"g.70763073C>T"	""	"likely pathogenic"	"ACMG"
"0000816571"	"0"	"77"	"7"	"70163607"	"70163607"	"subst"	"0"	"04165"	"AUTS2_000120"	"g.70163607G>A"	""	"{PMID:Stojanovic et al 2020:31623504}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.70698621G>A"	""	"likely pathogenic"	"ACMG"
"0000816576"	"0"	"99"	"7"	"70228059"	"70228059"	"subst"	"0"	"04165"	"AUTS2_000119"	"g.70228059C>T"	""	"{PMID:Turner 2019:31785789}"	""	"chr7(hg19):g.70228059C>T"	""	"De novo"	""	""	"0"	""	""	"g.70763073C>T"	""	"pathogenic"	""
"0000816577"	"0"	"99"	"7"	"69364338"	"69364338"	"subst"	"0"	"04165"	"AUTS2_000121"	"g.69364338C>T"	""	"{PMID:Turner 2019:31785789}"	""	"chr7(hg19):g.69364338C>T"	""	"De novo"	""	""	"0"	""	""	"g.69899352C>T"	""	"pathogenic"	""
"0000816578"	"0"	"77"	"7"	"70246679"	"70246679"	"del"	"0"	"04165"	"AUTS2_000122"	"g.70246679del"	""	"{PMID:Turner 2019:31785789}"	""	"chr7(hg19): g.70246678 TC>T"	""	"De novo"	""	""	"0"	""	""	"g.70781693del"	""	"likely pathogenic"	""
"0000816590"	"0"	"55"	"7"	"70255711"	"70255711"	"subst"	"0"	"04165"	"AUTS2_000123"	"g.70255711T>C"	""	"{PMID:Monies et al 2019: 31130284}"	""	"NM_001127231.2:c.3437T>C:p.Val1146Ala"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.70790725T>C"	""	"VUS"	"ACMG"
"0000816592"	"0"	"55"	"7"	"70254753"	"70254753"	"subst"	"0"	"04165"	"AUTS2_000124"	"g.70254753C>G"	""	"{PMID:Monies et al 2019: 31130284}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.70789767C>G"	""	"VUS"	"ACMG"
"0000816593"	"0"	"55"	"7"	"69364311"	"69364311"	"subst"	"0.000130157"	"04165"	"AUTS2_000125"	"g.69364311C>T"	""	"{PMID:Chen et al., 2017: 28440294}"	""	"AUTS2:NM_001127231:exon2:c.C349T:p.R117C"	"Variant inherited from unaffected mother, found in proband and two sibs all affected with specific language impairment and special educational needs."	"Germline"	"no"	"rs142957106"	"0"	""	""	"g.69899325C>T"	""	"VUS"	""
"0000816600"	"11"	"55"	"7"	"69269039"	"69415743"	"del"	"0"	"04165"	"AUTS2_000126"	"g.(69252436_69269039)_(69415743_69433016)del"	""	"{PMID:Beunders 2013: 23332918}"	""	"hg18, minimal breakpoints: chr7:68,906,975-69,053,679, maximal breakpoints: chr7:68,890,372-69,070,952"	"In-frame deletion of exon 2 associated with very mild ID and no other features (severity score 1/31). Inherited from unaffected father where the variant occurred de novo."	"Germline"	"no"	""	"0"	""	""	"g.(69787450_69804053)_(69950757_69968030)del"	""	"likely pathogenic"	""
"0000816604"	"0"	"77"	"7"	"69520507"	"69613695"	"del"	"0"	"04165"	"AUTS2_000127"	"g.(69509779_69520507)_(69613695_69619108)del"	""	"{PMID:Beunders 2013: 23332918}"	""	"hg18 minimal breakpoint: chr7:69,158,443-69,251,631, maximal breakpoint: chr7:69,147,715-69,257,044"	"in-frame deletion of exons 3 and 4"	"Unknown"	""	""	"0"	""	""	"g.(70044793_70055521)_(70148709_70154122)del"	""	"likely pathogenic"	""
"0000816605"	"0"	"77"	"7"	"69548318"	"69769275"	"del"	"0"	"04165"	"AUTS2_000128"	"g.(69542332_69548318)_(69769275_69775751)del"	""	"{PMID:Beunders 2013: 23332918}"	""	"hg18 minimal breakpoints: chr7:69,186,254-69,407,211, maximal breakpoints: chr7:69,180,268-69,413,687"	"in-frame deletion of exon 3 and 4"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(70077346_70083332)_(70304289_70310765)del"	""	"likely pathogenic"	""
"0000816606"	"0"	"77"	"7"	"69573462"	"69625402"	"del"	"0"	"04165"	"AUTS2_000129"	"g.(69571110_69573462)_(69625402_69626627)del"	""	"{PMID:Beunders 2013: 23332918}"	""	"hg18, minimal del chr7:69,211,398-69,263,338, maximal chr7:69,209,046-69,264,563"	""	"Germline"	"yes"	""	"0"	""	""	"g.(70106124_70108476)_(70160416_70161641)del"	""	"likely pathogenic"	""
"0000816611"	"0"	"77"	"7"	"67425685"	"69683428"	"del"	"0"	"04165"	"AUTS2_000130"	"g.(67363642_67425685)_(69683428_69684963)del"	""	"{PMID:Beunders 2013: 23332918}"	""	"hg18, minimal del chr7:67,063,120-69,321,364, maximal chr7:67,001,077-69,322,899"	""	"De novo"	""	""	"0"	""	""	"g.(67898655_67960698)_(70218442_70219977)del"	""	"likely pathogenic"	""
"0000816612"	"21"	"77"	"7"	"69840168"	"70189223"	"del"	"0"	"04165"	"AUTS2_000131"	"g.(69837848_69840168)_(70189223_70189312)del"	""	"{PMID:Beunders 2013: 23332918}"	""	"hg18, minimal del: chr7:69,478,104-69,827,159, maximal chr7:69,475,784-69,827,248"	""	"Germline"	"yes"	""	"0"	""	""	"g.(70372862_70375182)_(70724237_70724326)del"	""	"likely pathogenic"	""
"0000817382"	"0"	"77"	"7"	"69974648"	"70189959"	"del"	"0"	"04165"	"AUTS2_000132"	"g.(69910871_69974648)_(70189959_70257734)del"	""	"{PMID:Beunders 2013: 23332918}"	""	""	"hg18 minimal del chr7:69,612,584-69,827,895, maximal chr7:69,548,807-69,895,670"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.(70445885_70509662)_(70724973_70792748)del"	""	"likely pathogenic"	""
"0000817383"	"0"	"77"	"7"	"70015772"	"70192291"	"del"	"0"	"04165"	"AUTS2_000133"	"g.(70015617_70015772)_(70192291_70192626)del"	""	"{PMID:Beunders 2013: 23332918}"	""	"hg18 minimal del chr7:69,653,708-69,830,227, maximal del chr7:69,653,553-69,830,562"	""	"De novo"	""	""	"0"	""	""	"g.(70550631_70550786)_(70727305_70727640)del"	""	"likely pathogenic"	""
"0000817384"	"0"	"77"	"7"	"69974648"	"70220746"	"del"	"0"	"04165"	"AUTS2_000134"	"g.(69958576_69974648)_(70220746_70240310)del"	""	"{PMID:Beunders 2013: 23332918}"	""	"hg18 minimal del chr7:69,612,584-69,858,682, maximal chr7:69,596,512-69,878,246"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(70493590_70509662)_(70755760_70775324)del"	""	"likely pathogenic"	""
"0000817386"	"0"	"77"	"7"	"69907025"	"70231649"	"del"	"0"	"04165"	"AUTS2_000135"	"g.(69906318_69907025)_(70231649_70236919)del"	""	"{PMID:Beunders 2013: 23332918}"	""	"hg18 minimal del chr7:69,544,961-69,869,585, maximal chr7:69,544,254-69,874,855"	""	"De novo"	""	""	"0"	""	""	"g.(70441332_70442039)_(70766663_70771933)del"	""	"likely pathogenic"	""
"0000817388"	"0"	"99"	"7"	"70055042"	"70254444"	"del"	"0"	"04165"	"AUTS2_000136"	"g.(70054987_70055042)_(70254444_70254544)del"	""	""	""	"hg18 minimal del chr7:69,692,978-69,892,380, maximal chr7:69,692,923-69,892,480"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(70590001_70590056)_(70789458_70789558)del"	""	"pathogenic"	""
"0000817390"	"0"	"99"	"7"	"70204489"	"70257794"	"del"	"0"	"04165"	"AUTS2_000137"	"g.(70189959_70204489)_(70257794_70264803)del"	""	"{PMID:Beunders 2013: 23332918}"	""	"hg18 minimal del chr7:69,842,425-69,895,730, maximal chr7:69,827,895-69,902,739"	""	"De novo"	""	""	"0"	""	""	"g.(70724973_70739503)_(70792808_70799817)del"	""	"pathogenic"	""
"0000817391"	"0"	"99"	"7"	"70217766"	"70419818"	"del"	"0"	"04165"	"AUTS2_000138"	"g.(70217682_70217766)_(70419818_70421644)del"	""	"{PMID:Beunders 2013: 23332918}"	""	"hg18 minimal del chr7:69,855,702-70,057,754, maximal chr7:69,855,618-70,059,580"	"This deletion also affects 2 adjacent genes WBSCR17 and CALN1. Not maternal (father unavailable for testing)."	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(70752696_70752780)_(70954832_70956658)del"	""	"pathogenic"	""
"0000818484"	"0"	"77"	"7"	"0"	"0"	""	"0"	"04165"	"AUTS2_000139"	"g.(70133502_70135261)_(70197584-70201195)del"	""	"{PMID:Amarillo 2014:24459036}"	""	"arr[hg19] 7q11.22(70,135,261– 70,197,584)x1"	""	"De novo"	""	""	"0"	""	""	"g.(70668516_70670275)_(70732598_70736209)del"	""	"likely pathogenic"	""
"0000818485"	"0"	"99"	"7"	"70112953"	"70246371"	"del"	"0"	"04165"	"AUTS2_000140"	"g.(?_70112953)_(70246371_?)del"	""	"{PMID:Nagamani 2014:22872102}"	""	"hg18 del chr7:69750889–69884307"	""	"De novo"	""	""	"0"	""	""	"g.(?_70647967)_(70781385_?)del"	""	"likely pathogenic"	""
"0000818486"	"0"	"99"	"7"	"69931182"	"70249796"	"del"	"0"	"04165"	"AUTS2_000141"	"g.(?_69931182)_(70249796_?)del"	""	"{PMID:Nagamani 2014:22872102}"	""	"hg18 del chr7:69569118–69887732"	"not maternal (father unavailable for testing)"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.(?_70466196)_(70784810_?)del"	""	"pathogenic"	""
"0000818487"	"0"	"77"	"7"	"69812977"	"69992395"	"dup"	"0"	"04165"	"AUTS2_000142"	"g.(?_69812977)_(69992395_?)dup"	""	"{PMID:Nagamani 2014:22872102}"	""	"hg18 duplication chr7:69450913–69630331"	""	"Germline"	"yes"	""	"0"	""	""	"g.(?_70347991)_(70527409_?)dup"	""	"likely pathogenic (dominant)"	""
"0000818488"	"0"	"77"	"7"	"69433047"	"70115632"	"del"	"0"	"04165"	"AUTS2_000143"	"g.(69383681_69433047)_(70115632_70189930)del"	""	"{PMID:Jolley 2013:23650183}"	""	"hg18 del minimum 69,070,983–69,753,568, maximum 69,021,617–69,827,866"	""	"De novo"	""	""	"0"	""	""	"g.(69918695_69968061)_(70650646_70724944)del"	""	"likely pathogenic"	""
"0000818626"	"0"	"77"	"7"	"69450234"	"69638393"	"del"	"0"	"04165"	"AUTS2_000144"	"g.69450234_69638393del"	""	"{PMID:Leppa 2016:27569545}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.69985248_70173407del"	"{CV-RCV:000225635.1}"	"VUS"	""
"0000851652"	"0"	"30"	"7"	"69583206"	"69583206"	"subst"	"0.00161697"	"02325"	"AUTS2_000067"	"g.69583206A>G"	""	""	""	"AUTS2(NM_001127231.2):c.611A>G (p.E204G), AUTS2(NM_015570.4):c.611A>G (p.E204G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000851653"	"0"	"10"	"7"	"69583253"	"69583253"	"del"	"0"	"02325"	"AUTS2_000026"	"g.69583253del"	""	""	""	"AUTS2(NM_001127231.3):c.624+34delA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000851654"	"0"	"30"	"7"	"70228055"	"70228055"	"subst"	"0.00114983"	"01943"	"AUTS2_000145"	"g.70228055A>G"	""	""	""	"AUTS2(NM_001127231.2):c.942A>G (p.Q314=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000851655"	"0"	"70"	"7"	"70231114"	"70231114"	"subst"	"0"	"02327"	"AUTS2_000038"	"g.70231114C>T"	""	""	""	"AUTS2(NM_015570.2):c.1483C>T (p.(Arg495Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000851656"	"0"	"90"	"7"	"70231260"	"70231260"	"del"	"0"	"02327"	"AUTS2_000146"	"g.70231260del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000851657"	"0"	"30"	"7"	"70250967"	"70250967"	"subst"	"0.000154305"	"01943"	"AUTS2_000078"	"g.70250967A>C"	""	""	""	"AUTS2(NM_001127231.1):c.2179A>C (p.(Thr727Pro)), AUTS2(NM_001127231.2):c.2179A>C (p.T727P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000851658"	"0"	"50"	"7"	"70255594"	"70255602"	"del"	"0"	"01943"	"AUTS2_000149"	"g.70255594_70255602del"	""	""	""	"AUTS2(NM_001127231.2):c.3320_3328delACCACCACC (p.H1107_H1109del), AUTS2(NM_015570.2):c.3392_3400delACCACCACC (p.H1131_H1133del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000860892"	"0"	"50"	"7"	"69364338"	"69364338"	"subst"	"0"	"02329"	"AUTS2_000121"	"g.69364338C>T"	""	""	""	"AUTS2(NM_001127231.3):c.376C>T (p.R126*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000860893"	"0"	"30"	"7"	"70255496"	"70255496"	"subst"	"1.26081E-5"	"01943"	"AUTS2_000147"	"g.70255496C>T"	""	""	""	"AUTS2(NM_001127231.2):c.3222C>T (p.N1074=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000860894"	"0"	"50"	"7"	"70255576"	"70255578"	"dup"	"0"	"01943"	"AUTS2_000148"	"g.70255576_70255578dup"	""	""	""	"AUTS2(NM_001127231.2):c.3302_3304dupGCC (p.S1101_H1102insR), AUTS2(NM_015570.4):c.3374_3376dup (p.(Ser1125_His1126insArg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000860895"	"0"	"50"	"7"	"70255917"	"70255917"	"subst"	"5.25718E-6"	"01804"	"AUTS2_000150"	"g.70255917C>A"	""	""	""	"AUTS2(NM_015570.2):c.3715C>A (p.(Pro1239Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000887960"	"0"	"50"	"7"	"70229907"	"70229907"	"subst"	"8.21362E-6"	"02325"	"AUTS2_000151"	"g.70229907C>T"	""	""	""	"AUTS2(NM_015570.4):c.1384C>T (p.P462S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000887961"	"0"	"30"	"7"	"70233005"	"70233005"	"subst"	"1.6439E-5"	"02325"	"AUTS2_000152"	"g.70233005T>C"	""	""	""	"AUTS2(NM_015570.4):c.1690-5T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000887962"	"0"	"50"	"7"	"70254861"	"70254863"	"del"	"0"	"02329"	"AUTS2_000153"	"g.70254861_70254863del"	""	""	""	"AUTS2(NM_001127231.3):c.2587_2589delAAG (p.K863del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000909330"	"0"	"90"	"7"	"70228328"	"70228328"	"subst"	"0"	"03779"	"AUTS2_000154"	"g.70228328G>A"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000909331"	"0"	"70"	"7"	"70228328"	"70228328"	"subst"	"0"	"03779"	"AUTS2_000154"	"g.70228328G>A"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000912787"	"0"	"50"	"7"	"70250953"	"70250953"	"subst"	"1.62427E-5"	"02329"	"AUTS2_000155"	"g.70250953G>A"	""	""	""	"AUTS2(NM_001127231.3):c.2165G>A (p.R722Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000924749"	"0"	"50"	"7"	"70254753"	"70254753"	"subst"	"0"	"02325"	"AUTS2_000124"	"g.70254753C>G"	""	""	""	"AUTS2(NM_015570.4):c.2551C>G (p.H851D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927937"	"0"	"70"	"7"	"70252278"	"70252278"	"subst"	"0"	"01164"	"AUTS2_000156"	"g.70252278C>T"	""	""	""	""	"ACMG: PVS1, PS2_SUP, PM2_SUP"	"De novo"	"-"	""	""	""	""	"g.70787292C>T"	"VCV001194595.5"	"pathogenic (dominant)"	"ACMG"
"0000929373"	"0"	"50"	"7"	"69064745"	"69064745"	"subst"	"0"	"02325"	"AUTS2_000157"	"g.69064745G>C"	""	""	""	"AUTS2(NM_015570.4):c.106G>C (p.G36R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000964653"	"0"	"50"	"7"	"69064650"	"69064650"	"subst"	"0.0034296"	"02326"	"AUTS2_000016"	"g.69064650C>T"	""	""	""	"AUTS2(NM_001127231.1):c.11C>T (p.(Pro4Leu)), AUTS2(NM_001127231.2):c.11C>T (p.P4L), AUTS2(NM_001127231.3):c.11C>T (p.P4L), AUTS2(NM_015570.4):c.11C..."	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000964660"	"0"	"50"	"7"	"70254903"	"70254903"	"subst"	"0"	"02325"	"AUTS2_000159"	"g.70254903C>T"	""	""	""	"AUTS2(NM_015570.4):c.2701C>T (p.R901C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000977810"	"0"	"50"	"7"	"69271088"	"69271088"	"subst"	"0"	"01804"	"AUTS2_000160"	"g.69271088G>T"	""	""	""	"AUTS2(NM_015570.4):c.310-93184G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000977811"	"0"	"30"	"7"	"69508553"	"69508553"	"subst"	"0"	"01804"	"AUTS2_000161"	"g.69508553T>C"	""	""	""	"AUTS2(NM_015570.4):c.523-74565T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000977812"	"0"	"30"	"7"	"69538390"	"69538390"	"subst"	"0"	"01804"	"AUTS2_000162"	"g.69538390G>A"	""	""	""	"AUTS2(NM_015570.4):c.523-44728G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000977813"	"0"	"50"	"7"	"69722674"	"69722674"	"subst"	"0"	"01804"	"AUTS2_000163"	"g.69722674G>C"	""	""	""	"AUTS2(NM_015570.4):c.660+123117G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000977814"	"0"	"30"	"7"	"70163546"	"70163546"	"subst"	"0"	"01804"	"AUTS2_000164"	"g.70163546G>C"	""	""	""	"AUTS2(NM_015570.4):c.691-9G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000977815"	"0"	"30"	"7"	"70228257"	"70228257"	"subst"	"8.20197E-6"	"01804"	"AUTS2_000165"	"g.70228257C>T"	""	""	""	"AUTS2(NM_015570.4):c.1144C>T (p.(Pro382Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000977816"	"0"	"30"	"7"	"70229770"	"70229770"	"subst"	"0.000157147"	"01804"	"AUTS2_000166"	"g.70229770A>G"	""	""	""	"AUTS2(NM_015570.4):c.1247A>G (p.(Gln416Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000977817"	"0"	"30"	"7"	"70239007"	"70239007"	"subst"	"1.21871E-5"	"01804"	"AUTS2_000167"	"g.70239007T>C"	""	""	""	"AUTS2(NM_015570.4):c.1831-7T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000977818"	"0"	"30"	"7"	"70239042"	"70239042"	"subst"	"3.24884E-5"	"01804"	"AUTS2_000168"	"g.70239042G>A"	""	""	""	"AUTS2(NM_015570.4):c.1859G>A (p.(Arg620Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000977819"	"0"	"50"	"7"	"70242116"	"70242116"	"subst"	"0"	"01804"	"AUTS2_000169"	"g.70242116G>A"	""	""	""	"AUTS2(NM_015570.4):c.1960G>A (p.(Val654Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000977820"	"0"	"30"	"7"	"70255057"	"70255057"	"subst"	"6.30683E-5"	"01804"	"AUTS2_000084"	"g.70255057C>A"	""	""	""	"AUTS2(NM_001127231.3):c.2783C>A (p.A928D), AUTS2(NM_015570.2):c.2855C>A (p.A952D), AUTS2(NM_015570.4):c.2855C>A (p.(Ala952Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000977821"	"0"	"50"	"7"	"70255288"	"70255288"	"subst"	"0"	"01804"	"AUTS2_000170"	"g.70255288C>T"	""	""	""	"AUTS2(NM_015570.4):c.3086C>T (p.(Thr1029Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000977822"	"0"	"70"	"7"	"70255365"	"70255365"	"dup"	"0"	"01804"	"AUTS2_000171"	"g.70255365dup"	""	""	""	"AUTS2(NM_015570.4):c.3163dup (p.(Leu1055Profs*29))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000977823"	"0"	"30"	"7"	"70255597"	"70255602"	"del"	"0"	"01804"	"AUTS2_000172"	"g.70255597_70255602del"	""	""	""	"AUTS2(NM_015570.4):c.3395_3400del (p.(His1132_His1133del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000996626"	"0"	"90"	"7"	"70228059"	"70228059"	"subst"	"0"	"02326"	"AUTS2_000119"	"g.70228059C>T"	""	""	""	"AUTS2(NM_015570.4):c.946C>T (p.R316*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000996627"	"0"	"50"	"7"	"70229818"	"70229818"	"subst"	"0.000219579"	"02325"	"AUTS2_000173"	"g.70229818C>A"	""	""	""	"AUTS2(NM_015570.4):c.1295C>A (p.P432H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001012927"	"0"	"70"	"7"	"69064761"	"69064761"	"del"	"0"	"01164"	"AUTS2_000174"	"g.69064761del"	""	""	""	""	"ACMG: PVS1_STR, PS2_SUP, PM2_SUP (LoF in first exon, in-frame ATG at Met92; variant confirmed de novo)"	"De novo"	"-"	""	"0"	""	""	"g.69599775del"	""	"likely pathogenic (dominant)"	"ACMG"
"0001014378"	"0"	"30"	"7"	"69900780"	"69900780"	"dup"	"0"	"02325"	"AUTS2_000069"	"g.69900780dup"	""	""	""	"AUTS2(NM_001127231.1):c.690+6_690+7insC (p.(=)), AUTS2(NM_015570.4):c.690+13dupC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001017751"	"0"	"70"	"7"	"70228328"	"70228328"	"subst"	"0"	"03544"	"AUTS2_000175"	"g.70228328G>T"	""	""	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.70763342G>T"	"{CV:3381755}"	"likely pathogenic"	"ACMG"
"0001029686"	"0"	"30"	"7"	"70228044"	"70228044"	"subst"	"0"	"03779"	"AUTS2_000176"	"g.70228044A>G"	""	""	""	""	""	"CLASSIFICATION record"	""	"rs1302553938"	"0"	""	""	""	""	"likely benign"	""
"0001029993"	"0"	"70"	"7"	"70228230"	"70228230"	"subst"	"0"	"03779"	"AUTS2_000071"	"g.70228230C>T"	""	""	""	""	""	"Unknown"	""	"rs2129557010"	"0"	""	""	""	""	"likely pathogenic"	""
"0001036487"	"0"	"30"	"7"	"69064757"	"69064757"	"subst"	"2.1964E-5"	"01804"	"AUTS2_000177"	"g.69064757G>A"	""	""	""	"AUTS2(NM_015570.4):c.118G>A (p.(Ala40Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001036488"	"0"	"50"	"7"	"69064874"	"69064874"	"subst"	"0"	"01804"	"AUTS2_000178"	"g.69064874G>A"	""	""	""	"AUTS2(NM_015570.4):c.235G>A (p.(Glu79Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001036489"	"0"	"30"	"7"	"69206607"	"69206607"	"subst"	"0"	"01804"	"AUTS2_000179"	"g.69206607A>T"	""	""	""	"AUTS2(NM_015570.4):c.309+141659A>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001036490"	"0"	"30"	"7"	"69344985"	"69344985"	"subst"	"0"	"01804"	"AUTS2_000180"	"g.69344985A>G"	""	""	""	"AUTS2(NM_015570.4):c.310-19287A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001036491"	"0"	"50"	"7"	"69364299"	"69364299"	"subst"	"4.0703E-6"	"01804"	"AUTS2_000018"	"g.69364299C>T"	""	""	""	"AUTS2(NM_001127231.3):c.337C>T (p.R113C), AUTS2(NM_015570.4):c.337C>T (p.(Arg113Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001036492"	"0"	"30"	"7"	"69643074"	"69643074"	"subst"	"0"	"01804"	"AUTS2_000181"	"g.69643074G>A"	""	""	""	"AUTS2(NM_015570.4):c.660+43517G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001036493"	"0"	"30"	"7"	"69696746"	"69696746"	"subst"	"0"	"01804"	"AUTS2_000182"	"g.69696746G>T"	""	""	""	"AUTS2(NM_015570.4):c.660+97189G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001036494"	"0"	"30"	"7"	"69722397"	"69722397"	"subst"	"0"	"01804"	"AUTS2_000183"	"g.69722397G>A"	""	""	""	"AUTS2(NM_015570.4):c.660+122840G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001036495"	"0"	"30"	"7"	"69906384"	"69906385"	"ins"	"0"	"01804"	"AUTS2_000184"	"g.69906384_69906385insA"	""	""	""	"AUTS2(NM_015570.4):c.690+5617_690+5618insA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001036496"	"0"	"30"	"7"	"69983392"	"69983392"	"subst"	"0"	"01804"	"AUTS2_000185"	"g.69983392G>A"	""	""	""	"AUTS2(NM_015570.4):c.690+82625G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001036497"	"0"	"30"	"7"	"70159322"	"70159323"	"dup"	"0"	"01804"	"AUTS2_000186"	"g.70159322_70159323dup"	""	""	""	"AUTS2(NM_015570.4):c.691-4233_691-4232dup"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001036498"	"0"	"30"	"7"	"70218928"	"70218928"	"subst"	"0"	"01804"	"AUTS2_000187"	"g.70218928G>A"	""	""	""	"AUTS2(NM_015570.4):c.743-8928G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001036499"	"0"	"50"	"7"	"70255096"	"70255096"	"subst"	"0"	"01804"	"AUTS2_000188"	"g.70255096G>C"	""	""	""	"AUTS2(NM_015570.4):c.2894G>C (p.(Arg965Pro))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001036500"	"0"	"30"	"7"	"70255576"	"70255578"	"dup"	"0"	"01804"	"AUTS2_000148"	"g.70255576_70255578dup"	""	""	""	"AUTS2(NM_001127231.2):c.3302_3304dupGCC (p.S1101_H1102insR), AUTS2(NM_015570.4):c.3374_3376dup (p.(Ser1125_His1126insArg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001036501"	"0"	"50"	"7"	"70255594"	"70255602"	"dup"	"0"	"01804"	"AUTS2_000189"	"g.70255594_70255602dup"	""	""	""	"AUTS2(NM_015570.4):c.3392_3400dup (p.(His1131_His1133dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes AUTS2
## Count = 208
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000036093"	"00023941"	"70"	"857"	"0"	"858"	"0"	"c.857_858del"	"r.(?)"	"p.(Lys286Argfs*5)"	"7"
"0000036095"	"00023941"	"90"	"690"	"91092"	"743"	"-6597"	"c.(690+85076_690+91092)_(743-6597_907)del"	"r.?"	"p.(Lys230Ilefs*4)"	"5i_6i"
"0000037768"	"00023941"	"30"	"690"	"126795"	"691"	"-24231"	"c.(690+1_690+126795)_(691-24231_691-1)del"	"r.?"	"p.?"	"5i"
"0000037770"	"00023941"	"35"	"660"	"1"	"660"	"91083"	"c.(660+1_660+91083)_(661-69373_660-1)del"	"r.?"	"p.?"	"4i"
"0000037771"	"00023941"	"35"	"522"	"65252"	"523"	"-26088"	"c.(522+1_522+65252)_(523-26088_523-1)del"	"r.?"	"p.?"	"2i"
"0000037772"	"00023941"	"35"	"522"	"38277"	"523"	"-100473"	"c.(522+1_522+38277)_(523-100473_523-1)del"	"r.?"	"p.?"	"2i"
"0000037773"	"00023941"	"35"	"690"	"119393"	"691"	"-107729"	"c.(690+1_690+119393)_(691-107729_691-1)del"	"r.?"	"p.?"	"5i"
"0000037774"	"00023941"	"30"	"742"	"21179"	"743"	"-4663"	"c.(741+1_742+21179)_(743-4663_743-1)del"	"r.?"	"p.?"	"6i"
"0000037775"	"00023941"	"35"	"742"	"24730"	"743"	"-3113"	"c.(742+1_742+24730)_(743-3113_743-1)del"	"r.?"	"p.?"	"6i"
"0000037777"	"00023941"	"30"	"310"	"-144340"	"310"	"-110032"	"c.(309+1_310-144340)_(310-110032_310-1)del"	"r.?"	"p.?"	"1i"
"0000037778"	"00023941"	"30"	"660"	"48654"	"661"	"-148597"	"c.(660+1_660+48654)_(661-148597_661-1)del"	"r.?"	"p.?"	"4i"
"0000079470"	"00023941"	"00"	"976"	"0"	"976"	"0"	"c.976C>T"	"r.(?)"	"p.(Gln326*)"	""
"0000236479"	"00023941"	"70"	"1165"	"0"	"1165"	"0"	"c.1165C>T"	"r.(?)"	"p.(Gln389*)"	"7"
"0000251397"	"00023941"	"10"	"1215"	"-190"	"1215"	"-190"	"c.1215-190A>G"	"r.(=)"	"p.(=)"	""
"0000251398"	"00023941"	"10"	"1831"	"-132"	"1831"	"-132"	"c.1831-132A>G"	"r.(=)"	"p.(=)"	""
"0000252149"	"00023941"	"30"	"624"	"34"	"624"	"34"	"c.624+34del"	"r.(=)"	"p.(=)"	""
"0000252150"	"00023941"	"30"	"1690"	"-215"	"1690"	"-215"	"c.1690-215A>T"	"r.(=)"	"p.(=)"	""
"0000255969"	"00023941"	"50"	"3044"	"0"	"3044"	"0"	"c.3044A>G"	"r.(?)"	"p.(His1015Arg)"	""
"0000256530"	"00023941"	"50"	"355"	"0"	"355"	"0"	"c.355A>T"	"r.(?)"	"p.(Thr119Ser)"	""
"0000259210"	"00023941"	"10"	"1062"	"0"	"1062"	"0"	"c.1062G>A"	"r.(?)"	"p.(=)"	""
"0000259211"	"00023941"	"10"	"624"	"33"	"624"	"34"	"c.624+33_624+34del"	"r.(=)"	"p.(=)"	""
"0000259212"	"00023941"	"10"	"624"	"32"	"624"	"34"	"c.624+32_624+34del"	"r.(=)"	"p.(=)"	""
"0000259570"	"00023941"	"30"	"2784"	"0"	"2784"	"0"	"c.2784C>T"	"r.(?)"	"p.(=)"	""
"0000259571"	"00023941"	"30"	"3398"	"0"	"3400"	"0"	"c.3398_3400del"	"r.(?)"	"p.(His1133del)"	""
"0000261331"	"00023941"	"30"	"1290"	"0"	"1290"	"0"	"c.1290G>C"	"r.(?)"	"p.(=)"	""
"0000261332"	"00023941"	"10"	"1468"	"282"	"1468"	"282"	"c.1468+282C>G"	"r.(=)"	"p.(=)"	""
"0000261333"	"00023941"	"10"	"1468"	"83"	"1468"	"83"	"c.1468+83G>T"	"r.(=)"	"p.(=)"	""
"0000261334"	"00023941"	"10"	"1468"	"98"	"1468"	"98"	"c.1468+98C>T"	"r.(=)"	"p.(=)"	""
"0000261335"	"00023941"	"10"	"1932"	"148"	"1932"	"148"	"c.1932+148T>C"	"r.(=)"	"p.(=)"	""
"0000261336"	"00023941"	"30"	"2308"	"149"	"2308"	"149"	"c.2308+149G>A"	"r.(=)"	"p.(=)"	""
"0000261337"	"00023941"	"30"	"309"	"16"	"309"	"16"	"c.309+16del"	"r.(=)"	"p.(=)"	""
"0000261339"	"00023941"	"90"	"454"	"0"	"454"	"0"	"c.454C>T"	"r.(?)"	"p.(Arg152*)"	""
"0000261340"	"00023941"	"50"	"581"	"0"	"581"	"0"	"c.581C>T"	"r.(?)"	"p.(Ser194Phe)"	""
"0000261341"	"00023941"	"10"	"624"	"11"	"624"	"11"	"c.624+11G>A"	"r.(=)"	"p.(=)"	""
"0000261342"	"00023941"	"30"	"624"	"34"	"624"	"34"	"c.624+34dup"	"r.(=)"	"p.(=)"	""
"0000261343"	"00023941"	"10"	"742"	"30692"	"742"	"30692"	"c.742+30692C>G"	"r.(=)"	"p.(=)"	""
"0000263457"	"00023941"	"30"	"2370"	"0"	"2370"	"0"	"c.2370C>T"	"r.(?)"	"p.(=)"	""
"0000263458"	"00023941"	"30"	"3168"	"0"	"3168"	"0"	"c.3168G>A"	"r.(?)"	"p.(=)"	""
"0000263460"	"00023941"	"30"	"3579"	"0"	"3579"	"0"	"c.3579C>T"	"r.(?)"	"p.(=)"	""
"0000263461"	"00023941"	"50"	"581"	"0"	"581"	"0"	"c.581C>T"	"r.(?)"	"p.(Ser194Phe)"	""
"0000331594"	"00023941"	"50"	"11"	"0"	"11"	"0"	"c.11C>T"	"r.(?)"	"p.(Pro4Leu)"	""
"0000331595"	"00023941"	"50"	"983"	"0"	"983"	"0"	"c.983C>T"	"r.(?)"	"p.(Thr328Ile)"	""
"0000331596"	"00023941"	"50"	"1027"	"0"	"1027"	"0"	"c.1027C>T"	"r.(?)"	"p.(Gln343*)"	""
"0000331599"	"00023941"	"50"	"1483"	"0"	"1483"	"0"	"c.1483C>T"	"r.(?)"	"p.(Arg495*)"	""
"0000331601"	"00023941"	"50"	"1742"	"0"	"1742"	"0"	"c.1742A>G"	"r.(?)"	"p.(His581Arg)"	""
"0000331602"	"00023941"	"50"	"1831"	"0"	"1831"	"0"	"c.1831A>G"	"r.(?)"	"p.(Thr611Ala)"	""
"0000331604"	"00023941"	"50"	"1843"	"0"	"1843"	"0"	"c.1843A>G"	"r.(?)"	"p.(Ile615Val)"	""
"0000331605"	"00023941"	"50"	"1846"	"0"	"1846"	"0"	"c.1846G>A"	"r.(?)"	"p.(Asp616Asn)"	""
"0000331606"	"00023941"	"50"	"2210"	"0"	"2210"	"0"	"c.2210C>T"	"r.(?)"	"p.(Pro737Leu)"	""
"0000331607"	"00023941"	"50"	"2383"	"0"	"2383"	"0"	"c.2383C>T"	"r.(?)"	"p.(Arg795Trp)"	""
"0000331609"	"00023941"	"50"	"3398"	"0"	"3400"	"0"	"c.3398_3400dup"	"r.(?)"	"p.(His1133dup)"	""
"0000339146"	"00023941"	"50"	"581"	"0"	"581"	"0"	"c.581C>T"	"r.(?)"	"p.(Ser194Phe)"	""
"0000343372"	"00023941"	"50"	"2384"	"0"	"2384"	"0"	"c.2384G>A"	"r.(?)"	"p.(Arg795Gln)"	""
"0000348569"	"00023941"	"50"	"2210"	"0"	"2210"	"0"	"c.2210C>T"	"r.(?)"	"p.(Pro737Leu)"	""
"0000350150"	"00023941"	"70"	"181"	"0"	"181"	"0"	"c.181A>T"	"r.(?)"	"p.(Lys61*)"	""
"0000532490"	"00023941"	"10"	"11"	"0"	"11"	"0"	"c.11C>T"	"r.(?)"	"p.(Pro4Leu)"	""
"0000532491"	"00023941"	"50"	"167"	"0"	"167"	"0"	"c.167A>G"	"r.(?)"	"p.(Lys56Arg)"	""
"0000532492"	"00023941"	"30"	"385"	"0"	"385"	"0"	"c.385C>G"	"r.(?)"	"p.(Leu129Val)"	""
"0000532493"	"00023941"	"30"	"611"	"0"	"611"	"0"	"c.611A>G"	"r.(?)"	"p.(Glu204Gly)"	""
"0000532495"	"00023941"	"30"	"660"	"81"	"660"	"81"	"c.660+81A>C"	"r.(=)"	"p.(=)"	""
"0000532496"	"00023941"	"30"	"690"	"13"	"690"	"13"	"c.690+13dup"	"r.(=)"	"p.(=)"	""
"0000532497"	"00023941"	"30"	"746"	"0"	"746"	"0"	"c.746C>A"	"r.(?)"	"p.(Pro249Gln)"	""
"0000532498"	"00023941"	"90"	"1117"	"0"	"1117"	"0"	"c.1117C>T"	"r.(?)"	"p.(Gln373*)"	""
"0000532500"	"00023941"	"50"	"1594"	"0"	"1599"	"0"	"c.1594_1599del"	"r.(?)"	"p.(Gln532_His533del)"	""
"0000532501"	"00023941"	"70"	"1597"	"0"	"1597"	"0"	"c.1597C>T"	"r.(?)"	"p.(His533Tyr)"	""
"0000532502"	"00023941"	"30"	"1602"	"0"	"1602"	"0"	"c.1602C>G"	"r.(?)"	"p.(=)"	""
"0000532503"	"00023941"	"30"	"1774"	"0"	"1774"	"0"	"c.1774C>G"	"r.(?)"	"p.(Pro592Ala)"	""
"0000532505"	"00023941"	"30"	"2251"	"0"	"2251"	"0"	"c.2251A>C"	"r.(?)"	"p.(Thr751Pro)"	""
"0000532506"	"00023941"	"30"	"2624"	"0"	"2624"	"0"	"c.2624A>G"	"r.(?)"	"p.(Gln875Arg)"	""
"0000532507"	"00023941"	"50"	"2770"	"0"	"2770"	"0"	"c.2770C>G"	"r.(?)"	"p.(His924Asp)"	""
"0000532508"	"00023941"	"30"	"2784"	"0"	"2784"	"0"	"c.2784C>T"	"r.(?)"	"p.(=)"	""
"0000532509"	"00023941"	"30"	"2786"	"0"	"2786"	"0"	"c.2786C>G"	"r.(?)"	"p.(Ala929Gly)"	""
"0000532510"	"00023941"	"30"	"2820"	"0"	"2820"	"0"	"c.2820G>C"	"r.(?)"	"p.(=)"	""
"0000532512"	"00023941"	"30"	"2855"	"0"	"2855"	"0"	"c.2855C>A"	"r.(?)"	"p.(Ala952Asp)"	""
"0000532513"	"00023941"	"50"	"2855"	"0"	"2855"	"0"	"c.2855C>A"	"r.(?)"	"p.(Ala952Asp)"	""
"0000532514"	"00023941"	"50"	"3150"	"0"	"3150"	"0"	"c.3150G>A"	"r.(?)"	"p.(Met1050Ile)"	""
"0000532516"	"00023941"	"10"	"3395"	"0"	"3400"	"0"	"c.3395_3400dup"	"r.(?)"	"p.(His1132_His1133dup)"	""
"0000532517"	"00023941"	"30"	"3398"	"0"	"3400"	"0"	"c.3398_3400dup"	"r.(?)"	"p.(His1133dup)"	""
"0000532519"	"00023941"	"10"	"3398"	"0"	"3400"	"0"	"c.3398_3400dup"	"r.(?)"	"p.(His1133dup)"	""
"0000532520"	"00023941"	"10"	"3437"	"0"	"3437"	"0"	"c.3437G>T"	"r.(?)"	"p.(Gly1146Val)"	""
"0000532521"	"00023941"	"10"	"3437"	"0"	"3437"	"0"	"c.3437G>T"	"r.(?)"	"p.(Gly1146Val)"	""
"0000532522"	"00023941"	"30"	"3608"	"0"	"3608"	"0"	"c.3608A>G"	"r.(?)"	"p.(Asn1203Ser)"	""
"0000532523"	"00023941"	"30"	"3670"	"0"	"3670"	"0"	"c.3670A>G"	"r.(?)"	"p.(Ile1224Val)"	""
"0000532524"	"00023941"	"30"	"3754"	"0"	"3754"	"0"	"c.3754A>G"	"r.(?)"	"p.(Thr1252Ala)"	""
"0000611176"	"00023941"	"50"	"2824"	"0"	"2824"	"0"	"c.2824C>G"	"r.(?)"	"p.(Pro942Ala)"	""
"0000621918"	"00023941"	"30"	"852"	"0"	"852"	"0"	"c.852T>C"	"r.(?)"	"p.(=)"	""
"0000652349"	"00023941"	"30"	"611"	"0"	"611"	"0"	"c.611A>G"	"r.(?)"	"p.(Glu204Gly)"	""
"0000652350"	"00023941"	"30"	"1774"	"0"	"1774"	"0"	"c.1774C>G"	"r.(?)"	"p.(Pro592Ala)"	""
"0000652351"	"00023941"	"30"	"3437"	"0"	"3437"	"0"	"c.3437G>T"	"r.(?)"	"p.(Gly1146Val)"	""
"0000655871"	"00023941"	"50"	"275"	"0"	"275"	"0"	"c.275C>G"	"r.(?)"	"p.(Ala92Gly)"	""
"0000655872"	"00023941"	"50"	"1603"	"0"	"1626"	"0"	"c.1603_1626del"	"r.(?)"	"p.(His535_Thr542del)"	""
"0000659804"	"00023941"	"70"	"1603"	"0"	"1626"	"0"	"c.1603_1626del"	"r.(?)"	"p.(His535_Thr542del)"	"9"
"0000669985"	"00023941"	"30"	"1774"	"0"	"1774"	"0"	"c.1774C>G"	"r.(?)"	"p.(Pro592Ala)"	""
"0000678156"	"00023941"	"30"	"11"	"0"	"11"	"0"	"c.11C>T"	"r.(?)"	"p.(Pro4Leu)"	""
"0000678157"	"00023941"	"30"	"2325"	"0"	"2325"	"0"	"c.2325C>T"	"r.(?)"	"p.(=)"	""
"0000678158"	"00023941"	"50"	"2690"	"0"	"2690"	"0"	"c.2690A>G"	"r.(?)"	"p.(His897Arg)"	""
"0000678159"	"00023941"	"50"	"3244"	"0"	"3244"	"0"	"c.3244C>T"	"r.(?)"	"p.(Leu1082Phe)"	""
"0000678160"	"00023941"	"50"	"3341"	"0"	"3341"	"0"	"c.3341G>A"	"r.(?)"	"p.(Arg1114His)"	""
"0000678161"	"00023941"	"50"	"3512"	"0"	"3512"	"0"	"c.3512A>G"	"r.(?)"	"p.(His1171Arg)"	""
"0000678162"	"00023941"	"30"	"3702"	"0"	"3702"	"0"	"c.3702C>G"	"r.(?)"	"p.(=)"	""
"0000690057"	"00023941"	"30"	"385"	"0"	"385"	"0"	"c.385C>G"	"r.(?)"	"p.(Leu129Val)"	""
"0000690058"	"00023941"	"30"	"2568"	"0"	"2568"	"0"	"c.2568A>G"	"r.(?)"	"p.(=)"	""
"0000721525"	"00023941"	"50"	"337"	"0"	"337"	"0"	"c.337C>T"	"r.(?)"	"p.(Arg113Cys)"	""
"0000721526"	"00023941"	"90"	"1464"	"0"	"1467"	"0"	"c.1464_1467del"	"r.(?)"	"p.(Tyr488*)"	""
"0000721527"	"00023941"	"30"	"3398"	"0"	"3400"	"0"	"c.3398_3400del"	"r.(?)"	"p.(His1133del)"	""
"0000729815"	"00023941"	"50"	"3528"	"0"	"3528"	"0"	"c.3528C>G"	"r.(?)"	"p.(Asp1176Glu)"	""
"0000803223"	"00023941"	"30"	"129"	"0"	"129"	"0"	"c.129C>G"	"r.(?)"	"p.(=)"	""
"0000803224"	"00023941"	"30"	"609"	"0"	"609"	"0"	"c.609G>T"	"r.(?)"	"p.(=)"	""
"0000803225"	"00023941"	"30"	"951"	"0"	"951"	"0"	"c.951T>G"	"r.(?)"	"p.(=)"	""
"0000803226"	"00023941"	"30"	"1632"	"0"	"1632"	"0"	"c.1632G>A"	"r.(?)"	"p.(=)"	""
"0000803227"	"00023941"	"50"	"1633"	"0"	"1633"	"0"	"c.1633C>G"	"r.(?)"	"p.(Pro545Ala)"	""
"0000803228"	"00023941"	"30"	"1733"	"0"	"1733"	"0"	"c.1733G>A"	"r.(?)"	"p.(Ser578Asn)"	""
"0000803229"	"00023941"	"50"	"2068"	"0"	"2068"	"0"	"c.2068C>T"	"r.(?)"	"p.(Pro690Ser)"	""
"0000803230"	"00023941"	"50"	"3055"	"0"	"3055"	"0"	"c.3055C>G"	"r.(?)"	"p.(Leu1019Val)"	""
"0000812857"	"00023941"	"90"	"0"	"0"	"0"	"0"	"c.-735_(310-43316_?){2}"	"r.?"	"p.?"	"_1_1i"
"0000812858"	"00023941"	"90"	"523"	"-18856"	"625"	"-6791"	"c.(?_523-18856)_(625-6791_?)del"	"r.0?"	"p.0?"	"2i_3i"
"0000812859"	"00023941"	"90"	"927"	"0"	"928"	"0"	"c.927_928delinsAT"	"r.(?)"	"p.(Gln310*)"	"7"
"0000812860"	"00023941"	"90"	"1298"	"0"	"1298"	"0"	"c.1298del"	"r.(?)"	"p.(Leu433Profs*40)"	"8"
"0000812861"	"00023941"	"90"	"2255"	"0"	"2255"	"0"	"c.2255del"	"r.(?)"	"p.(Gly752Alafs*2)"	"17"
"0000816545"	"00023941"	"77"	"454"	"0"	"454"	"0"	"c.454C>T"	"r.(?)"	"p.(Arg152*)"	""
"0000816547"	"00023941"	"77"	"53"	"0"	"53"	"0"	"c.53C>A"	"r.(?)"	"p.(Ser18*)"	""
"0000816548"	"00023941"	"77"	"1604"	"0"	"1604"	"0"	"c.1604A>C"	"r.(?)"	"p.(His535Pro)"	""
"0000816549"	"00023941"	"77"	"1604"	"0"	"1604"	"0"	"c.1604A>C"	"r.(?)"	"p.(His535Pro)"	""
"0000816570"	"00023941"	"77"	"946"	"0"	"946"	"0"	"c.946C>T"	"r.(?)"	"p.(Arg316*)"	""
"0000816571"	"00023941"	"77"	"742"	"1"	"742"	"1"	"c.742+1G>A"	"r.spl?"	"p.?"	""
"0000816576"	"00023941"	"99"	"946"	"0"	"946"	"0"	"c.946C>T"	"r.(?)"	"p.(Arg316*)"	""
"0000816577"	"00023941"	"99"	"376"	"0"	"376"	"0"	"c.376C>T"	"r.(?)"	"p.(Arg126*)"	""
"0000816578"	"00023941"	"77"	"2083"	"0"	"2083"	"0"	"c.2083del"	"r.(?)"	"p.(Leu695Phefs*47)"	""
"0000816590"	"00023941"	"55"	"3509"	"0"	"3509"	"0"	"c.3509T>C"	"r.(?)"	"p.(Val1170Ala)"	""
"0000816592"	"00023941"	"55"	"2551"	"0"	"2551"	"0"	"c.2551C>G"	"r.(?)"	"p.(His851Asp)"	""
"0000816593"	"00023941"	"55"	"349"	"0"	"349"	"0"	"c.349C>T"	"r.(?)"	"p.(Arg117Cys)"	""
"0000816600"	"00023941"	"55"	"310"	"-95233"	"522"	"51259"	"c.(310-111836_310-95233)_(522+51259_522+68532)del"	"r.?"	"p.?"	"1i_2i"
"0000816604"	"00023941"	"77"	"523"	"-62611"	"660"	"14138"	"c.(523-73339_523-62611)_(660+14138_660+19551)del"	"r.?"	"p.?"	"2i_4i"
"0000816605"	"00023941"	"77"	"523"	"-12008"	"661"	"-131463"	"c.(523-40786_523-12008)_(661-131463_661-124987)del"	"r.?"	"p.?"	"2i_4i"
"0000816606"	"00023941"	"77"	"523"	"-9656"	"660"	"25845"	"c.(523-12008_523-9656)_(660+25845_660+27070)del"	"r.?"	"p.?"	"2i_4i"
"0000816611"	"00023941"	"77"	"0"	"0"	"0"	"0"	"c.-735_(660+83871_660+85406){0}"	"r.0?"	"p.0?"	"_1_4i"
"0000816612"	"00023941"	"77"	"661"	"-60570"	"742"	"25617"	"c.(661-62890_661-60570)_(742+25617_742+25706)del"	"r.?"	"p.?"	"4i_6i"
"0000817382"	"00023941"	"77"	"690"	"73881"	"742"	"26353"	"c.(690+10104_690+73881)_(742+26353_*1752)del"	"r.?"	"p.0?"	"5i_6i"
"0000817383"	"00023941"	"77"	"690"	"115005"	"742"	"28685"	"c.(690+114850_690+115005)_(742+28685_742+29020)del"	"r.?"	"p.0?"	"5i_6i"
"0000817384"	"00023941"	"77"	"690"	"73881"	"743"	"-7110"	"c.(690+57809_690+73881)_(743-7110_1903-33)del"	"r.?"	"p.0?"	"5i_9i"
"0000817386"	"00023941"	"77"	"690"	"6258"	"1689"	"329"	"c.(690+5551_690+6258)_(1689+329_1830+289)del"	"r.?"	"p.?"	""
"0000817388"	"00023941"	"99"	"691"	"-108513"	"2532"	"-290"	"c.(691-108568_691-108513)_(2532-290_2532-190)del"	"r.?"	"p.0?"	"5i_18i"
"0000817390"	"00023941"	"99"	"743"	"-23367"	"5592"	"0"	"c.(742+26353_743-23367)_(*1812_*1903)del"	"r.?"	"p.0?"	""
"0000817391"	"00023941"	"99"	"0"	"0"	"0"	"0"	"c.(743-10174_743-10090)_*1903{0}"	"r.?"	"p.0?"	"6i_19_"
"0000818484"	"00023941"	"77"	"691"	"-28294"	"743"	"-30272"	"c.(691-30053_691-28294)_(743-30272_743-26661)del"	"r.?"	"p.?"	"5i_6i"
"0000818485"	"00023941"	"99"	"691"	"-50602"	"2005"	"-230"	"c.(?_691-50602)_(2005-230_?)del"	"r.?"	"p.?"	"5i_14i"
"0000818486"	"00023941"	"99"	"690"	"30415"	"2147"	"-132"	"c.(?_690+30415)_(2147-132_?)del"	"r.?"	"p.0?"	"5i_15i"
"0000818487"	"00023941"	"77"	"661"	"-87761"	"690"	"91628"	"c.(?_661-87761)_(690+91628_?)dup"	"r.?"	"p.?"	"4i_5i"
"0000818488"	"00023941"	"77"	"522"	"68563"	"691"	"-47923"	"c.(522+19197_522+68563)_(691-47923_742+26324)del"	"r.?"	"p.0?"	"2i_5i or 2i_6i"
"0000818626"	"00023941"	"77"	"522"	"85750"	"660"	"38836"	"c.522+85750_660+38836del"	"r.?"	"p.?"	"2i_4i"
"0000851652"	"00023941"	"30"	"611"	"0"	"611"	"0"	"c.611A>G"	"r.(?)"	"p.(Glu204Gly)"	""
"0000851653"	"00023941"	"10"	"624"	"34"	"624"	"34"	"c.624+34del"	"r.(=)"	"p.(=)"	""
"0000851654"	"00023941"	"30"	"942"	"0"	"942"	"0"	"c.942A>G"	"r.(?)"	"p.(=)"	""
"0000851655"	"00023941"	"70"	"1483"	"0"	"1483"	"0"	"c.1483C>T"	"r.(?)"	"p.(Arg495*)"	""
"0000851656"	"00023941"	"90"	"1629"	"0"	"1629"	"0"	"c.1629del"	"r.(?)"	"p.(Phe543Leufs*51)"	""
"0000851657"	"00023941"	"30"	"2251"	"0"	"2251"	"0"	"c.2251A>C"	"r.(?)"	"p.(Thr751Pro)"	""
"0000851658"	"00023941"	"50"	"3392"	"0"	"3400"	"0"	"c.3392_3400del"	"r.(?)"	"p.(His1131_His1133del)"	""
"0000860892"	"00023941"	"50"	"376"	"0"	"376"	"0"	"c.376C>T"	"r.(?)"	"p.(Arg126*)"	""
"0000860893"	"00023941"	"30"	"3294"	"0"	"3294"	"0"	"c.3294C>T"	"r.(?)"	"p.(=)"	""
"0000860894"	"00023941"	"50"	"3374"	"0"	"3376"	"0"	"c.3374_3376dup"	"r.(?)"	"p.(Ser1125_His1126insArg)"	""
"0000860895"	"00023941"	"50"	"3715"	"0"	"3715"	"0"	"c.3715C>A"	"r.(?)"	"p.(Pro1239Thr)"	""
"0000887960"	"00023941"	"50"	"1384"	"0"	"1384"	"0"	"c.1384C>T"	"r.(?)"	"p.(Pro462Ser)"	""
"0000887961"	"00023941"	"30"	"1690"	"-5"	"1690"	"-5"	"c.1690-5T>C"	"r.spl?"	"p.?"	""
"0000887962"	"00023941"	"50"	"2659"	"0"	"2661"	"0"	"c.2659_2661del"	"r.(?)"	"p.(Lys887del)"	""
"0000909330"	"00023941"	"90"	"1214"	"1"	"1214"	"1"	"c.1214+1G>A"	"r.(?)"	"p.(?)"	""
"0000909331"	"00023941"	"70"	"1214"	"1"	"1214"	"1"	"c.1214+1G>A"	"r.(?)"	"p.(?)"	""
"0000912787"	"00023941"	"50"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Arg746Gln)"	""
"0000924749"	"00023941"	"50"	"2551"	"0"	"2551"	"0"	"c.2551C>G"	"r.(?)"	"p.(His851Asp)"	""
"0000927937"	"00023941"	"70"	"2392"	"0"	"2392"	"0"	"c.2392C>T"	"r.(?)"	"p.(Arg798*)"	""
"0000929373"	"00023941"	"50"	"106"	"0"	"106"	"0"	"c.106G>C"	"r.(?)"	"p.(Gly36Arg)"	""
"0000964653"	"00023941"	"50"	"11"	"0"	"11"	"0"	"c.11C>T"	"r.(?)"	"p.(Pro4Leu)"	""
"0000964660"	"00023941"	"50"	"2701"	"0"	"2701"	"0"	"c.2701C>T"	"r.(?)"	"p.(Arg901Cys)"	""
"0000977810"	"00023941"	"50"	"310"	"-93184"	"310"	"-93184"	"c.310-93184G>T"	"r.(=)"	"p.(=)"	""
"0000977811"	"00023941"	"30"	"523"	"-74565"	"523"	"-74565"	"c.523-74565T>C"	"r.(=)"	"p.(=)"	""
"0000977812"	"00023941"	"30"	"523"	"-44728"	"523"	"-44728"	"c.523-44728G>A"	"r.(=)"	"p.(=)"	""
"0000977813"	"00023941"	"50"	"660"	"123117"	"660"	"123117"	"c.660+123117G>C"	"r.(=)"	"p.(=)"	""
"0000977814"	"00023941"	"30"	"691"	"-9"	"691"	"-9"	"c.691-9G>C"	"r.(=)"	"p.(=)"	""
"0000977815"	"00023941"	"30"	"1144"	"0"	"1144"	"0"	"c.1144C>T"	"r.(?)"	"p.(Pro382Ser)"	""
"0000977816"	"00023941"	"30"	"1247"	"0"	"1247"	"0"	"c.1247A>G"	"r.(?)"	"p.(Gln416Arg)"	""
"0000977817"	"00023941"	"30"	"1831"	"-7"	"1831"	"-7"	"c.1831-7T>C"	"r.(=)"	"p.(=)"	""
"0000977818"	"00023941"	"30"	"1859"	"0"	"1859"	"0"	"c.1859G>A"	"r.(?)"	"p.(Arg620Gln)"	""
"0000977819"	"00023941"	"50"	"1960"	"0"	"1960"	"0"	"c.1960G>A"	"r.(?)"	"p.(Val654Ile)"	""
"0000977820"	"00023941"	"30"	"2855"	"0"	"2855"	"0"	"c.2855C>A"	"r.(?)"	"p.(Ala952Asp)"	""
"0000977821"	"00023941"	"50"	"3086"	"0"	"3086"	"0"	"c.3086C>T"	"r.(?)"	"p.(Thr1029Met)"	""
"0000977822"	"00023941"	"70"	"3163"	"0"	"3163"	"0"	"c.3163dup"	"r.(?)"	"p.(Leu1055Profs*29)"	""
"0000977823"	"00023941"	"30"	"3395"	"0"	"3400"	"0"	"c.3395_3400del"	"r.(?)"	"p.(His1132_His1133del)"	""
"0000996626"	"00023941"	"90"	"946"	"0"	"946"	"0"	"c.946C>T"	"r.(?)"	"p.(Arg316*)"	""
"0000996627"	"00023941"	"50"	"1295"	"0"	"1295"	"0"	"c.1295C>A"	"r.(?)"	"p.(Pro432His)"	""
"0001012927"	"00023941"	"70"	"122"	"0"	"122"	"0"	"c.122del"	"r.(?)"	"p.(Gly41Alafs*53)"	"1"
"0001014378"	"00023941"	"30"	"690"	"13"	"690"	"13"	"c.690+13dup"	"r.(=)"	"p.(=)"	""
"0001017751"	"00023941"	"70"	"1214"	"1"	"1214"	"1"	"c.1214+1G>T"	"r.spl"	"p.?"	""
"0001029686"	"00023941"	"30"	"931"	"0"	"931"	"0"	"c.931A>G"	"r.(?)"	"p.(Thr311Ala)"	""
"0001029993"	"00023941"	"70"	"1117"	"0"	"1117"	"0"	"c.1117C>T"	"r.(?)"	"p.(Gln373Ter)"	""
"0001036487"	"00023941"	"30"	"118"	"0"	"118"	"0"	"c.118G>A"	"r.(?)"	"p.(Ala40Thr)"	""
"0001036488"	"00023941"	"50"	"235"	"0"	"235"	"0"	"c.235G>A"	"r.(?)"	"p.(Glu79Lys)"	""
"0001036489"	"00023941"	"30"	"309"	"141659"	"309"	"141659"	"c.309+141659A>T"	"r.(=)"	"p.(=)"	""
"0001036490"	"00023941"	"30"	"310"	"-19287"	"310"	"-19287"	"c.310-19287A>G"	"r.(=)"	"p.(=)"	""
"0001036491"	"00023941"	"50"	"337"	"0"	"337"	"0"	"c.337C>T"	"r.(?)"	"p.(Arg113Cys)"	""
"0001036492"	"00023941"	"30"	"660"	"43517"	"660"	"43517"	"c.660+43517G>A"	"r.(=)"	"p.(=)"	""
"0001036493"	"00023941"	"30"	"660"	"97189"	"660"	"97189"	"c.660+97189G>T"	"r.(=)"	"p.(=)"	""
"0001036494"	"00023941"	"30"	"660"	"122840"	"660"	"122840"	"c.660+122840G>A"	"r.(=)"	"p.(=)"	""
"0001036495"	"00023941"	"30"	"690"	"5617"	"690"	"5618"	"c.690+5617_690+5618insA"	"r.(=)"	"p.(=)"	""
"0001036496"	"00023941"	"30"	"690"	"82625"	"690"	"82625"	"c.690+82625G>A"	"r.(=)"	"p.(=)"	""
"0001036497"	"00023941"	"30"	"691"	"-4233"	"691"	"-4232"	"c.691-4233_691-4232dup"	"r.(=)"	"p.(=)"	""
"0001036498"	"00023941"	"30"	"743"	"-8928"	"743"	"-8928"	"c.743-8928G>A"	"r.(=)"	"p.(=)"	""
"0001036499"	"00023941"	"50"	"2894"	"0"	"2894"	"0"	"c.2894G>C"	"r.(?)"	"p.(Arg965Pro)"	""
"0001036500"	"00023941"	"30"	"3374"	"0"	"3376"	"0"	"c.3374_3376dup"	"r.(?)"	"p.(Ser1125_His1126insArg)"	""
"0001036501"	"00023941"	"50"	"3392"	"0"	"3400"	"0"	"c.3392_3400dup"	"r.(?)"	"p.(His1131_His1133dup)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 55
"{{screeningid}}"	"{{variantid}}"
"0000016303"	"0000036093"
"0000016304"	"0000036095"
"0000017695"	"0000037768"
"0000017696"	"0000037777"
"0000017697"	"0000037770"
"0000017698"	"0000037771"
"0000017699"	"0000037772"
"0000017700"	"0000037773"
"0000017701"	"0000037774"
"0000017702"	"0000037775"
"0000017703"	"0000037778"
"0000050490"	"0000079470"
"0000145366"	"0000236479"
"0000295660"	"0000652349"
"0000295661"	"0000652350"
"0000295662"	"0000652351"
"0000297178"	"0000659804"
"0000306297"	"0000669985"
"0000332533"	"0000729815"
"0000385739"	"0000812857"
"0000385740"	"0000812858"
"0000385741"	"0000812859"
"0000385742"	"0000812860"
"0000385743"	"0000812861"
"0000388140"	"0000816545"
"0000388141"	"0000816548"
"0000388148"	"0000816571"
"0000388149"	"0000816576"
"0000388150"	"0000816577"
"0000388152"	"0000816578"
"0000388157"	"0000816590"
"0000388158"	"0000816592"
"0000388159"	"0000816600"
"0000388160"	"0000816593"
"0000388161"	"0000816604"
"0000388162"	"0000816605"
"0000388163"	"0000816606"
"0000388164"	"0000816611"
"0000388167"	"0000816612"
"0000388652"	"0000817382"
"0000388658"	"0000817383"
"0000388659"	"0000817384"
"0000388660"	"0000817386"
"0000388662"	"0000817388"
"0000388665"	"0000817390"
"0000388666"	"0000817391"
"0000389425"	"0000818484"
"0000389426"	"0000818485"
"0000389427"	"0000818486"
"0000389428"	"0000818487"
"0000389429"	"0000818488"
"0000389756"	"0000818626"
"0000436798"	"0000927937"
"0000458290"	"0001012927"
"0000459660"	"0001017751"