### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = BBS2)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"BBS2" "Bardet-Biedl syndrome 2" "16" "q21" "unknown" "NG_009312.2" "UD_132118794927" "" "https://www.LOVD.nl/BBS2" "" "1" "967" "583" "606151" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases.Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/BBS2_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00001" "2012-03-28 00:00:00" "00006" "2020-01-26 20:40:47" "00006" "2026-08-03 15:19:31"
## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00003289" "BBS2" "Bardet-Biedl syndrome 2" "001" "NM_031885.3" "" "NP_114091.3" "" "" "" "-234" "2580" "2166" "56554008" "56518259" "" "0000-00-00 00:00:00" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 13
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" ""
"00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26"
"00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49"
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"04210" "LCA" "Leber congenital amaurosis (LCA)" "" "" "" "" "" "00006" "2015-02-27 18:57:11" "" ""
"04211" "RPar" "retinitis pigmentosa, autosomal recessive (RPar)" "" "" "" "" "" "00006" "2015-02-27 18:58:57" "" ""
"04212" "BBS" "Bardet-Biedl syndrome (BBS)" "" "" "" "" "" "00006" "2015-02-27 19:01:43" "" ""
"04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26"
"04376" "BBS2" "Bardet-Biedl syndrome, type 2 (BBS-2)" "AR" "615981" "" "" "" "00000" "2015-09-23 10:25:22" "00006" "2021-12-10 21:51:32"
"05378" "BMD/DMD" "dystrophinopathy (BMD or DMD)" "" "" "" "" "" "00006" "2018-01-13 20:18:25" "00006" "2019-03-26 16:49:54"
"05578" "MKS" "Meckel syndrome (MKS, Meckel-Gruber syndrome)" "" "" "" "" "" "00006" "2019-02-22 22:26:27" "00006" "2021-12-10 21:51:32"
"05686" "RP74" "retinitis pigmentosa, type 74 (RP74)" "AR" "616562" "" "" "" "00006" "2020-01-26 20:40:20" "" ""
"06892" "NPHP" "nephronophthisis" "" "" "" "" "" "00006" "2022-01-23 12:29:57" "" ""
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 4
"{{geneid}}" "{{diseaseid}}"
"BBS2" "00139"
"BBS2" "04214"
"BBS2" "04376"
"BBS2" "05686"
## Individuals ## Do not remove or alter this header ##
## Count = 280
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00000025" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" ""
"00001819" "" "" "" "1" "" "00102" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00016611" "" "" "" "1" "" "00552" "" "" "" "" "" "" "0" "" "" "" ""
"00050437" "" "" "" "2" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, affected sibling(s)" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" ""
"00095923" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "61014"
"00104994" "" "" "" "1" "" "01244" "{PMID:de Castro-Miró 2016:28005958}" "" "M" "yes" "Spain" "" "0" "" "" "" "A18.1"
"00155385" "" "" "" "1" "" "01243" "Sharon, submitted" "" "F" "no" "Israel" "" "0" "" "" "Jewish-Ashkenazi" ""
"00155386" "" "" "" "3" "" "01243" "{PMID:Shevach 2015:25541840}, {PMID:Kimchi 2018:29276052}, {PMID:Sharon 2019:31456290}" "" "M" "no" "Israel" "" "0" "" "" "Jewish-Ashkenazi" ""
"00155387" "" "" "" "2" "" "01243" "{PMID:Shevach 2015:25541840}, {PMID:Kimchi 2018:29276052}, {PMID:Sharon 2019:31456290}" "2-generation family, 2 affected brothers, unaffected parents" "M" "no" "Israel" "" "0" "" "" "Jewish-Ashkenazi" "FamMOL0970"
"00155388" "" "" "" "3" "" "01243" "{PMID:Shevach 2015:25541840}" "3-generation family, 3 affected (F, 2M), unaffected parents" "M" "no" "Israel" "" "0" "" "" "Morocco;Jewish" "FamMOL0369"
"00165196" "" "" "" "1" "" "01741" "" "" "" "" "" "" "0" "" "" "" ""
"00233354" "" "" "" "7" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233355" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233356" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233357" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233358" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233359" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233360" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233361" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233362" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233363" "" "" "" "19" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233364" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233365" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233366" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233367" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233368" "" "" "" "600" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233369" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233370" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233371" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233788" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233789" "" "" "" "207" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00233790" "" "" "" "1203" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" ""
"00269968" "" "" "" "1" "" "01848" "{PMID:Karali 2019:31877679}, {DOI:Karali 2019:10.3390/ijms21010086}" "" "" "" "Italy" "" "0" "" "" "" "Fam4P5"
"00276084" "" "" "" "2" "" "00006" "{PMID:Shevach 2015:25541840}" "2-generation family, 2 affected (F, M), unaffected heterozygous carrier parents" "F;M" "yes" "United Kingdom (Great Britain)" "" "0" "" "" "Jewish-Ashkenazi" "FamGB"
"00276085" "" "" "" "1" "" "00006" "{PMID:Shevach 2015:25541840}" "2-generation family, 1 affected, unaffected parents" "M" "" "Israel" "" "0" "" "" "Jewish-Ashkenazi" "FamMOL0714"
"00276086" "" "" "" "1" "" "00006" "{PMID:Shevach 2015:25541840}" "2-generation family, 1 affected, unaffected parents" "F" "" "Israel" "" "0" "" "" "Jewish-Ashkenazi" "FamRD158"
"00291493" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00299641" "" "" "" "1" "" "00006" "{PMID:Arno 2017:28132693}" "2-generation family, 1 affeted" "M" "" "" "" "0" "" "" "" "FamGC3626Pat2"
"00308478" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" ""
"00308479" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" ""
"00308480" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" ""
"00308600" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 homozygous patient" "" "" "Norway" "" "0" "" "" "" ""
"00308958" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" ""
"00308959" "" "" "" "3" "" "00004" "{PMID:Sharon 2019:31456290}" "3 IRD families" "" "" "Israel" "" "0" "" "" "" ""
"00308960" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" ""
"00308962" "" "" "" "2" "" "00004" "{PMID:Sharon 2019:31456290}" "2 IRD families" "" "" "Israel" "" "0" "" "" "" ""
"00308963" "" "" "" "3" "" "00004" "{PMID:Sharon 2019:31456290}" "3 IRD families" "" "" "Israel" "" "0" "" "" "" ""
"00308964" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" ""
"00325432" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "" "" "Mexico" "" "0" "" "" "" "2007"
"00331733" "" "" "" "1" "" "00000" "{PMID:Sanchez-Navarro 2018:29588463}" "" "" "" "Spain" "" "0" "" "" "" "RP-2167"
"00334084" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "F" "" "(United States)" "" "0" "" "" "" "613"
"00334085" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "F" "" "(United States)" "" "0" "" "" "" "614"
"00334086" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "615"
"00334087" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "616"
"00335259" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "patient" "" "" "Spain" "" "0" "" "" "" "Pat51"
"00358803" "" "" "" "1" "" "00000" "{PMID:Lindstrand 2016:27486776}" "" "M" "yes" "United States" "" "0" "" "" "" "KK047-05"
"00358807" "" "" "" "1" "" "00000" "{PMID:Lindstrand 2016:27486776}" "" "M" "no" "United States" "" "0" "" "" "" "AR800-03"
"00358809" "" "" "" "1" "" "00000" "{PMID:Lindstrand 2016:27486776}" "" "M" "yes" "United States" "" "0" "" "" "" "RC2-0311"
"00358975" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case30806"
"00359383" "" "" "" "1" "" "00000" "{PMID:Bravo-Gil 2016:27032803}" "see paper" "" "" "Spain" "" "0" "" "" "" "449"
"00363432" "" "" "" "1" "" "00000" "{PMID:Ece Solmaz 2015:26518167}" "patient" "" "" "Turkey" "" "0" "" "" "" "Pat8"
"00363434" "" "" "" "1" "" "00000" "{PMID:Ece Solmaz 2015:26518167}" "patient" "" "" "Turkey" "" "0" "" "" "" "Pat10"
"00363624" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "10DG1111"
"00363710" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "12DG1870"
"00363731" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "13DG0522"
"00372518" "" "" "" "1" "" "00006" "{PMID:Xu 2015:25999675}" "2-generation family, 1 affected, unaffected carrier parents" "F" "" "China" "" "0" "" "" "" "RP237"
"00372519" "" "" "" "1" "" "00006" "{PMID:Xu 2015:25999675}" "2-generation family, 1 affected, unaffected carrier parents" "M" "" "China" "" "0" "" "" "" "RP240"
"00373490" "" "" "" "2" "" "00000" "{PMID:Liu 2015:25611614}" "family, 2 affected" "F" "" "China" "" "0" "" "" "" "RH1-PatV1"
"00373491" "" "" "00373490" "1" "" "00000" "{PMID:Liu 2015:25611614}" "" "M" "" "China" "" "0" "" "" "" "RH1-PatV2"
"00373877" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-297-650"
"00373886" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-420-894"
"00375442" "" "" "" "1" "" "00000" "{PMID:Watson 2014:25133751}" "family" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "MA11"
"00379354" "" "" "" "1" "" "00000" "{PMID:Harville-2010:19797195}" "" "" "yes" "Turkey" "" "0" "" "" "" ""
"00379355" "" "" "" "1" "" "00000" "{PMID:Harville-2010:19797195}" "" "" "yes" "Pakistan" "" "0" "" "" "" ""
"00380352" "" "" "" "1" "" "00000" "{PMID:M\'hamdi_2014:23432027}" "" "M" "yes" "Tunisia" "" "0" "" "" "Tunisian" ""
"00380354" "" "" "" "1" "" "00000" "{PMID:M\'hamdi_2014:23432027}" "" "F" "yes" "Tunisia" "" "0" "" "" "Tunisian" ""
"00381726" "" "" "" "1" "" "00000" "{PMID:Wang-2014:24154662}" "" "" "no" "" "" "0" "" "" "" ""
"00382489" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "351"
"00382490" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "352"
"00382491" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "353"
"00382492" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "354"
"00382493" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "355"
"00382881" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "" "" "" "" "" "0" "" "" "" ""
"00382882" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "" "" "" "" "" "0" "" "" "" ""
"00382883" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "" "" "" "" "" "0" "" "" "" ""
"00382884" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "homozygous by descent BBS1" "" "" "" "" "0" "" "" "" ""
"00382885" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "" "" "" "" "" "0" "" "" "" ""
"00382886" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "homozygous by descent BBS4" "" "" "" "" "0" "" "" "" ""
"00382887" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "BBS2-linkage" "" "" "" "" "0" "" "" "" ""
"00382888" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "one BBS2 mutation but excluded genetically from the BBS2 locus; Unknown 2nd allele" "" "" "" "" "0" "" "" "" ""
"00382889" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "one BBS2 mutation but excluded genetically from the BBS2 locus; Unknown 2nd allele" "" "" "" "" "0" "" "" "" ""
"00382890" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "one BBS2 mutation but excluded genetically from the BBS2 locus; 2nd and 3rd allele BBS1" "" "" "" "" "0" "" "" "" ""
"00382891" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "one BBS2 mutation but excluded genetically from the BBS2 locus; 2nd and 3rd allele BBS1" "" "" "" "" "0" "" "" "" ""
"00382892" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "one BBS2 mutation but excluded genetically from the BBS2 locus; 2nd and 3rd allele BBS1" "" "" "" "" "0" "" "" "" ""
"00382893" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "one BBS2 mutation but excluded genetically from the BBS2 locus; 2nd and 3rd allele BBS3" "" "" "" "" "0" "" "" "" ""
"00382894" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "" "" "" "" "" "0" "" "" "" ""
"00382895" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "" "" "" "" "" "0" "" "" "" ""
"00382896" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "" "" "" "" "" "0" "" "" "" ""
"00382897" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "two BBS2 mutations found in unaffected individuals; 3rd allele unmapped" "" "" "" "" "0" "" "" "" ""
"00382898" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "two BBS2 mutations found in unaffected individuals" "" "" "" "" "0" "" "" "" ""
"00382899" "" "" "" "1" "" "00000" "{PMID:Katsanis-2001:11567139}" "two BBS2 mutations found in unaffected individuals; homozygous by descent BBS4" "" "" "" "" "0" "" "" "" ""
"00383100" "" "" "" "1" "" "00000" "{PMID:Anasagasti-2013:24416769}" "" "" "" "Spain" "" "0" "" "" "" ""
"00383110" "" "" "" "1" "" "00000" "{PMID:Hichri-2005:15770229}" "" "" "" "France" "" "0" "" "" "white" ""
"00383129" "" "" "" "1" "" "00000" "{PMID:Laurier-2006:16823392}" "" "F" "yes" "Lebanon" "" "0" "" "" "Muslim Sunni" ""
"00383130" "" "" "" "1" "" "00000" "{PMID:Laurier-2006:16823392}" "" "F" "yes" "Lebanon" "" "0" "" "" "Muslim Sunni" ""
"00383137" "" "" "" "1" "" "00000" "{PMID:Sathya Priya-2015:24400638}" "" "" "" "" "" "0" "" "" "" ""
"00383147" "" "" "" "1" "" "00000" "{PMID:Sathya Priya-2015:24400638}" "" "" "" "" "" "0" "" "" "" ""
"00383150" "" "" "" "1" "" "00000" "{PMID:Sathya Priya-2015:24400638}" "" "" "" "" "" "0" "" "" "" ""
"00383197" "" "" "" "1" "" "00000" "{PMID:Bin-2009:19402160}" "" "" "" "" "" "0" "" "" "Russian" ""
"00383222" "" "" "" "1" "" "00000" "{PMID:Muller-2010:20177705}, Katsanis 2001" "" "" "" "" "" "0" "" "" "Australia" ""
"00383223" "" "" "" "1" "" "00000" "{PMID:Muller-2010:20177705}, Beales unpublished" "" "" "" "" "" "0" "" "" "white" ""
"00383224" "" "" "" "2" "" "00000" "{PMID:Muller-2010:20177705}, {PMID:Stoetzel 2006:16582908}" "" "" "" "" "" "0" "" "" "Lebanese" ""
"00383225" "" "" "" "1" "" "00000" "{PMID:Muller-2010:20177705}" "" "" "" "" "" "0" "" "" "white" ""
"00383226" "" "" "" "2" "" "00000" "{PMID:Muller-2010:20177705}" "" "" "" "" "" "0" "" "" "Africa" ""
"00383227" "" "" "" "4" "" "00000" "{PMID:Muller-2010:20177705}" "" "" "" "" "" "0" "" "" "Turkish" ""
"00383228" "" "" "" "1" "" "00000" "{PMID:Muller-2010:20177705}" "" "" "" "" "" "0" "" "" "Marocco" ""
"00383284" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "F" "" "" "" "0" "" "" "" ""
"00383286" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "M" "" "" "" "0" "" "" "" ""
"00383289" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "" "" "" "" "0" "" "" "" ""
"00383292" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "" "" "" "" "0" "" "" "" ""
"00383296" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "M" "" "" "" "0" "" "" "" ""
"00383297" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "M" "" "" "" "0" "" "" "" ""
"00383299" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "" "" "" "" "0" "" "" "" ""
"00383300" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "F" "" "" "" "0" "" "" "" ""
"00383301" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "M" "" "" "" "0" "" "" "" ""
"00383304" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "" "" "" "" "0" "" "" "" ""
"00383307" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "" "" "" "" "0" "" "" "" ""
"00383308" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "" "" "" "" "0" "" "" "" ""
"00383309" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "" "" "" "" "0" "" "" "" ""
"00383310" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "" "" "" "" "0" "" "" "" ""
"00383311" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "" "" "" "" "0" "" "" "" ""
"00383312" "" "" "" "1" "" "00000" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "" "" "" "" "0" "" "" "" ""
"00383331" "" "" "" "1" "" "00000" "{PMID:Badano-2003:12837689}" "" "F" "no" "" "" "0" "" "" "northern European" ""
"00383332" "" "" "" "1" "" "00000" "{PMID:Badano-2003:12837689}" "" "M" "no" "" "" "0" "" "" "northern European" ""
"00383334" "" "" "" "1" "" "00000" "{PMID:Badano-2003:12837689}" "" "F" "no" "" "" "0" "" "" "northern Italy" ""
"00383335" "" "" "" "1" "" "00000" "{PMID:Badano-2003:12837689}" "" "M" "no" "" "" "0" "" "" "northern Italy" ""
"00383336" "" "" "" "1" "" "00000" "{PMID:Hoskins-2003:12872256}" "" "" "" "" "" "0" "" "" "" ""
"00383338" "" "" "" "1" "" "00000" "{PMID:Hoskins-2003:12872256}" "" "" "" "" "" "0" "" "" "" ""
"00383341" "" "" "" "1" "" "00000" "{PMID:Hoskins-2003:12872256}" "" "" "" "" "" "0" "" "" "" ""
"00383348" "" "" "" "1" "" "00000" "{PMID:Hoskins-2003:12872256}" "" "" "" "" "" "0" "" "" "" ""
"00383349" "" "" "" "1" "" "00000" "{PMID:Hoskins-2003:12872256}" "" "" "" "" "" "0" "" "" "" ""
"00383358" "" "" "" "1" "" "00000" "{PMID:Fauser-2003:12920096}" "" "" "no" "" "" "0" "" "" "European" ""
"00383359" "" "" "" "1" "" "00000" "{PMID:Fauser-2003:12920096}" "" "" "no" "" "" "0" "" "" "European" ""
"00383365" "" "" "" "1" "" "00000" "{PMID:Eichers-2009:15224652}, Beales 2003" "" "" "" "" "" "0" "" "" "" ""
"00383368" "" "" "" "1" "" "00000" "{PMID:Eichers-2009:15224652}, Beales 2003" "" "" "" "" "" "0" "" "" "" ""
"00383369" "" "" "" "1" "" "00000" "{PMID:Eichers-2009:15224652}, Beales 2003" "" "" "" "" "" "0" "" "" "" ""
"00383370" "" "" "" "1" "" "00000" "{PMID:Eichers-2009:15224652}, Katsanis 2001" "" "" "" "" "" "0" "" "" "" ""
"00383371" "" "" "" "1" "" "00000" "{PMID:Eichers-2009:15224652}, Katsanis 2001" "" "" "" "" "" "0" "" "" "" ""
"00383372" "" "" "" "1" "" "00000" "{PMID:Eichers-2009:15224652}, Katsanis 2001" "" "" "" "" "" "0" "" "" "" ""
"00383373" "" "" "" "1" "" "00000" "{PMID:Eichers-2009:15224652}, Badano 2003" "one unaffected sibling and the unaffected mother of this BBS patient carry one mutant BBS2 allele and two mutant BBS4 alleles." "F" "" "" "" "0" "" "" "" ""
"00383374" "" "" "" "1" "" "00000" "{PMID:Eichers-2009:15224652}, Katsanis 2002" "" "" "" "" "" "0" "" "" "" ""
"00383376" "" "" "" "1" "" "00000" "{PMID:Eichers-2009:15224652}, Fauser 2003" "" "" "" "" "" "0" "" "" "" ""
"00383377" "" "" "" "1" "" "00000" "{PMID:Eichers-2009:15224652}, Fauser 2003" "" "" "" "" "" "0" "" "" "" ""
"00383409" "" "" "" "1" "" "00000" "{PMID:Khan 2019:31725702}" "" "M" "" "" "" "0" "" "" "" ""
"00383652" "" "" "" "1" "" "00000" "{PMID:Manara 2019:31196119}" "" "M" "" "" "" "0" "" "" "" "1"
"00383655" "" "" "" "1" "" "00000" "{PMID:Manara 2019:31196119}" "" "F" "" "" "" "0" "" "" "" "4"
"00383662" "" "" "" "1" "" "00000" "{PMID:Manara 2019:31196119}" "" "M" "" "" "" "0" "" "" "" "11"
"00383993" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1464"
"00384082" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2162"
"00384183" "" "" "" "1" "" "00000" "{PMID:Tayebi 2019:30820146}" "" "" "" "Iran" "" "0" "" "" "" "066568"
"00384184" "" "" "" "1" "" "00000" "{PMID:Tayebi 2019:30820146}" "" "" "" "Iran" "" "0" "" "" "" "066574"
"00384250" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "13160"
"00384260" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "13258"
"00384295" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "13506"
"00384296" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "13507"
"00384638" "" "" "" "1" "" "00000" "{PMID:Atmis 2019:31951329}" "" "F" "" "Turkey" "" "0" "" "" "" "1"
"00384732" "" "" "" "1" "" "00000" "{PMID:Billingsley-2010:20472660}" "" "F" "" "" "" "0" "" "" "Canadian Native Indian (Dene)" ""
"00384733" "" "" "" "1" "" "00000" "{PMID:Billingsley-2010:20472660}" "" "" "" "" "" "0" "" "" "Canadian Native Indian (Dene)" ""
"00384812" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2012:22353939}, Abu-Safieh 2010" "" "" "yes" "Saudi Arabia" "" "0" "" "" "Arab" ""
"00384813" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2012:22353939}, Abu-Safieh 2010" "5 unaffected siblings screened" "" "yes" "Saudi Arabia" "" "0" "" "" "Arab" ""
"00384829" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2012:22353939}" "3 unaffected siblings screened" "" "yes" "Saudi Arabia" "" "0" "" "" "Arab" ""
"00384832" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2012:22353939}" "2 unaffected siblings screened" "" "yes" "Saudi Arabia" "" "0" "" "" "Arab" ""
"00384833" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2012:22353939}" "2 unaffected siblings screened" "" "yes" "Saudi Arabia" "" "0" "" "" "Arab" ""
"00384836" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2012:22353939}, Stoetzel 2006" "3 unaffected siblings screened" "" "yes" "Saudi Arabia" "" "0" "" "" "Arab" ""
"00384839" "" "" "" "1" "" "00000" "{PMID:Abu-Safieh-2012:22353939}" "" "" "yes" "Saudi Arabia" "" "0" "" "" "Arab" ""
"00385025" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19400"
"00385153" "" "" "" "1" "" "00000" "{PMID:Jiman 2020:31836858}" "" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "37"
"00385178" "" "" "" "1" "" "00000" "{PMID:Chen-2011:21642631}" "" "" "" "" "" "0" "" "" "white" ""
"00385183" "" "" "" "1" "" "00000" "{PMID:Chen-2011:21642631}" "" "" "" "" "" "0" "" "" "white" ""
"00385213" "" "" "" "1" "" "00000" "{PMID:Chen-2011:21642631}" "" "" "" "" "" "0" "" "" "white" ""
"00385214" "" "" "" "1" "" "00000" "{PMID:Chen-2011:21642631}" "" "" "" "" "" "0" "" "" "Tunisian" ""
"00385215" "" "" "" "1" "" "00000" "{PMID:Chen-2011:21642631}" "" "" "" "" "" "0" "" "" "white" ""
"00385216" "" "" "" "1" "" "00000" "{PMID:Chen-2011:21642631}" "" "" "" "" "" "0" "" "" "Pakistani" ""
"00385224" "" "" "" "1" "" "00000" "{PMID:Redin-2012:22773737}" "" "" "" "India" "" "0" "" "" "" ""
"00385234" "" "" "" "1" "" "00000" "{PMID:Redin-2012:22773737}" "" "" "" "Algeria" "" "0" "" "" "" ""
"00385238" "" "" "" "1" "" "00000" "{PMID:Redin-2012:22773737}" "" "" "" "Turkey" "" "0" "" "" "" ""
"00385263" "" "" "" "1" "" "00000" "{PMID:Schaefer-2011:21044901}" "" "" "" "France" "" "0" "" "" "french" ""
"00385281" "" "" "" "1" "" "00000" "{PMID:M\'hamdi-2014:23432027}" "" "F" "yes" "Tunisia" "" "0" "" "" "Tunisian" ""
"00385282" "" "" "" "1" "" "00000" "{PMID:M\'hamdi-2014:23432027}" "" "M" "yes" "Tunisia" "" "0" "" "" "Tunisian" ""
"00385300" "" "" "" "1" "" "00000" "{PMID:Imhoff-2011:20876674}" "" "" "" "" "" "0" "" "" "white" ""
"00385331" "" "" "" "1" "" "00000" "{PMID:Deveault-2011:21344540}" "" "M" "" "" "" "0" "" "" "Ghanian" ""
"00385332" "" "" "" "1" "" "00000" "{PMID:Deveault-2011:21344540}" "novel" "" "" "" "" "0" "" "" "white" ""
"00385333" "" "" "" "1" "" "00000" "{PMID:Deveault-2011:21344540}" "" "" "" "" "" "0" "" "" "English/Scottish/Irish/German/Icelandic" ""
"00385334" "" "" "" "1" "" "00000" "{PMID:Deveault-2011:21344540}" "" "F" "" "" "" "0" "" "" "English/Irish/Scottish" ""
"00385335" "" "" "" "1" "" "00000" "{PMID:Deveault-2011:21344540}" "novel" "M" "" "" "" "0" "" "" "white" ""
"00385336" "" "" "" "1" "" "00000" "{PMID:Deveault-2011:21344540}" "" "F" "" "" "" "0" "" "" "Russian" ""
"00385337" "" "" "" "1" "" "00000" "{PMID:Deveault-2011:21344540}" "" "M" "" "" "" "0" "" "" "white" ""
"00385338" "" "" "" "1" "" "00000" "{PMID:Deveault-2011:21344540}" "" "" "" "" "" "0" "" "" "Italian" ""
"00385339" "" "" "" "1" "" "00000" "{PMID:Deveault-2011:21344540}" "novel" "F" "" "" "" "0" "" "" "Mexican" ""
"00385340" "" "" "" "1" "" "00000" "{PMID:Deveault-2011:21344540}" "" "M" "" "" "" "0" "" "" "English/Irish/Scottish" ""
"00385341" "" "" "" "1" "" "00000" "{PMID:Deveault-2011:21344540}" "" "" "" "" "" "0" "" "" "German/Italian" ""
"00385380" "" "" "" "1" "" "00000" "{PMID:Deveault-2011:21344540}" "" "F" "" "" "" "0" "" "" "white" ""
"00385445" "" "" "" "1" "" "00006" "{PMID:Takenouchi 2017:28374938}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "no" "Japan" "" "0" "" "" "" "patient"
"00385554" "" "" "" "1" "" "00000" "{PMID:Janssen-2011:21052717}" "" "" "" "" "" "0" "" "" "Northern-Europe" "A1155-II1"
"00385555" "" "" "" "1" "" "00000" "{PMID:Janssen-2011:21052717}" "" "" "" "United States" "" "0" "" "" "" "A1885-II1"
"00385556" "" "" "" "1" "" "00000" "{PMID:Janssen-2011:21052717}" "" "" "" "United States" "" "0" "" "" "" "A2296-II1"
"00385561" "" "" "" "1" "" "00000" "{PMID:Janssen-2011:21052717}" "" "" "" "Turkey" "" "0" "" "" "" "A3436-II1"
"00385563" "" "" "" "1" "" "00000" "{PMID:Janssen-2011:21052717}" "" "" "" "" "" "0" "" "" "Northern-Europe" "AR124(A2832)-3"
"00385564" "" "" "" "1" "" "00000" "{PMID:Janssen-2011:21052717}" "" "" "" "" "" "0" "" "" "" "AR124(A2832)-4"
"00385578" "" "" "" "1" "" "00000" "{PMID:Janssen-2011:21052717}" "" "" "" "" "" "0" "" "" "Northern-Europe" "AR724(A2866)-5"
"00385579" "" "" "" "1" "" "00000" "{PMID:Janssen-2011:21052717}" "" "" "" "" "" "0" "" "" "Northern-Europe" "AR839(A2874)-4"
"00385582" "" "" "" "1" "" "00000" "{PMID:Janssen-2011:21052717}" "" "" "" "" "" "0" "" "" "Northern-Europe" "AR850(A2878)-3"
"00385583" "" "" "" "1" "" "00000" "{PMID:Janssen-2011:21052717}" "" "" "" "" "" "0" "" "" "Northern-Europe" "AR850(A2878)-4"
"00385595" "" "" "" "1" "" "00000" "{PMID:Janssen-2011:21052717}" "" "" "" "Turkey" "" "0" "" "" "" "PB236(A2010)-II1"
"00385617" "" "" "" "4" "" "00000" "{PMID:de Castro-Miró-2014:24516651}" "" "M" "" "" "" "0" "" "" "" "83RE"
"00385618" "" "" "" "1" "" "00000" "{PMID:Xing-2014:24608809}" "" "" "" "" "" "0" "" "" "" "WZ039-II:3"
"00385635" "" "" "" "1" "" "00000" "{PMID:Lindstrand-2014:24746959}" "" "M" "" "" "" "0" "" "" "Latino" "RC2-03"
"00385708" "" "" "" "1" "" "00000" "{PMID:Dan 2020:31960602}" "" "M" "?" "China" "" "0" "" "" "" "28"
"00385936" "" "" "" "1" "" "00000" "{PMID:Fattahi-2014:24849935}" "" "" "yes" "" "" "0" "" "" "Fars" ""
"00385939" "" "" "" "1" "" "00000" "{PMID:Fattahi-2014:24849935}" "" "" "yes" "" "" "0" "" "" "Zaboli" ""
"00385943" "" "" "" "1" "" "00000" "{PMID:Fattahi-2014:24849935}" "" "" "yes" "" "" "0" "" "" "Afghan" ""
"00385944" "" "" "" "1" "" "00000" "{PMID:Fattahi-2014:24849935}" "" "" "yes" "" "" "0" "" "" "Fars" ""
"00386212" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-167, proband" "F" "" "Spain" "" "0" "" "" "" "RPN-333"
"00386228" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "?" "" "Spain" "" "0" "" "" "" "RPN-407"
"00386694" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI1322_002472"
"00386860" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI786_001531"
"00387548" "" "" "" "1" "" "00000" "{PMID:Knopp 2015:26003401}" "" "F" "yes" "" "" "0" "" "" "" ""
"00387598" "" "" "" "1" "" "00000" "{PMID:Hirano 2015:26325687}" "" "M" "no" "Japan" "" "0" "" "" "Japanese" ""
"00388042" "" "" "" "1" "" "00000" "{PMID:Esposito 2017:28143435}" "" "" "" "Italy" "" "0" "" "" "" "P.8"
"00388043" "" "" "" "1" "" "00000" "{PMID:Esposito 2017:28143435}" "" "" "" "Italy" "" "0" "" "" "" "P.9"
"00388044" "" "" "" "1" "" "00000" "{PMID:Esposito 2017:28143435}" "" "" "" "Italy" "" "0" "" "" "" "P.10"
"00388045" "" "" "" "1" "" "00000" "{PMID:Esposito 2017:28143435}" "" "" "" "Italy" "" "0" "" "" "" "P.11"
"00388046" "" "" "" "1" "" "00000" "{PMID:Esposito 2017:28143435}" "" "" "" "Italy" "" "0" "" "" "" "P.12"
"00388493" "" "" "" "1" "" "00000" "{PMID:Ellingsford 2018:29074561}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "15010966"
"00388531" "" "" "" "1" "" "00000" "{PMID:Hirano 2020:32451492}" "" "M" "no" "Japan" "" "0" "" "" "" "6"
"00388833" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 53, Bardet-Biedl syndrome, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "117"
"00389617" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 379, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "901"
"00391375" "" "" "" "1" "" "00000" "{PMID:Méjécase 2020:3278337" "" "?" "" "United Arab Emirates" "" "0" "" "" "" "43"
"00392309" "" "" "" "1" "" "00000" "{PMID:Huang 2021:33520300}" "Family A, proband" "M" "no" "China" "" "0" "" "" "" "IV:10"
"00392310" "" "" "" "1" "" "00000" "{PMID:Huang 2021:33520300}" "Family A, proband" "F" "no" "China" "" "0" "" "" "" "IV:1"
"00392311" "" "" "" "1" "" "00000" "{PMID:Huang 2021:33520300}" "Family A, proband" "F" "no" "China" "" "0" "" "" "" "IV:2"
"00392312" "" "" "" "1" "" "00000" "{PMID:Huang 2021:33520300}" "Family A, proband" "F" "no" "China" "" "0" "" "" "" "IV:3"
"00392663" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "155"
"00392766" "" "" "" "1" "" "00000" "{PMID:Meng 2021:33777945}" "" "M" "no" "China" "" "0" "" "" "" "F1-II:1"
"00392767" "" "" "" "1" "" "00000" "{PMID:Meng 2021:33777945}" "" "M" "yes" "China" "" "0" "" "" "" "F2-II:1"
"00392768" "" "" "" "1" "" "00000" "{PMID:Meng 2021:33777945}" "" "F" "yes" "China" "" "0" "" "" "" "F2-II:2"
"00392769" "" "" "" "1" "" "00000" "{PMID:Meng 2021:33777945}" "" "M" "no" "China" "" "0" "" "" "" "F3-II:1"
"00392770" "" "" "" "1" "" "00000" "{PMID:Meng 2021:33777945}" "" "M" "no" "China" "" "0" "" "" "" "F3-II:2"
"00392771" "" "" "" "1" "" "00000" "{PMID:Meng 2021:33777945}" "" "F" "no" "China" "" "0" "" "" "" "F4-II:1"
"00392772" "" "" "" "1" "" "00000" "{PMID:Meng 2021:33777945}" "" "M" "no" "China" "" "0" "" "" "" "F5-II:1"
"00394478" "" "" "" "1" "" "00000" "{PMID:Jeziorny-2020:33138063}" "" "M" "" "" "" "0" "" "" "" ""
"00395026" "" "" "" "1" "" "00000" "{PMID:Zacchia 2021:33964006}" "" "M" "" "(Italy)" "" "0" "" "" "" "K29"
"00395034" "" "" "" "1" "" "00000" "{PMID:Zacchia 2021:33964006}" "" "M" "" "(Italy)" "" "0" "" "" "" "K50"
"00395580" "" "" "" "1" "" "00000" "{PMID:Perea-Romero 2021:34448047}" "" "" "" "Spain" "" "0" "" "" "" "RP-1219"
"00395585" "" "" "" "1" "" "00000" "{PMID:Perea-Romero 2021:34448047}" "" "" "" "Spain" "" "0" "" "" "" "RP-1483"
"00396565" "" "" "" "1" "" "00000" "{PMID:Mary 2019:30614526}" "Fetus: term at 30 gestation weeks" "F" "" "France" "" "0" "" "" "" ""
"00399797" "" "" "" "1" "" "00006" "{PMID:Tang 2022:33323469}, {DOI:Tang 2022:10.1136/jmedgenet-2020-107184}" "" "" "" "China" "" "0" "" "" "" "341"
"00404268" "" "" "" "2" "" "00006" "{PMID:Alvarez-Satta 2017:28502102}" "2-generation family, affected father/child" "" "" "Spain" "" "0" "" "" "" ""
"00412474" "" "" "" "1" "" "00000" "{PMID:Katagiri 2020:31997113}" "" "F" "no" "Japan" "" "0" "" "" "Japanese" "KCi001-A"
"00412486" "" "" "" "1" "" "00000" "{PMID:Delvallee 2021:33169370}" "" "" "" "France" "" "0" "" "" "" "H.II.1"
"00414399" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "F" "" "China" "" "0" "" "" "" "WHP66"
"00414400" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "?" "" "China" "" "0" "" "" "" "WHP67"
"00418348" "" "" "" "1" "" "00000" "{PMID:Katsanis 2002:12016587}" "family KK021" "" "" "" "" "0" "" "" "Saudi Arabian" "KK021"
"00418640" "" "" "" "1" "" "00006" "{PMID:Smaoui 2006:16877420}" "" "" "yes" "Tunisia" "" "0" "" "" "" "Fam57008"
"00418644" "" "" "" "1" "" "00006" "{PMID:Smaoui 2006:16877420}" "" "" "yes" "Tunisia" "" "0" "" "" "" "Fam57018"
"00418656" "" "" "" "1" "" "00006" "{PMID:Smaoui 2006:16877420}" "" "" "yes" "Tunisia" "" "0" "" "" "" ""
"00419522" "" "" "" "1" "" "02300" "{PMID:Marinakis 2021:34008892}" "" "F" "" "Greece" "" "0" "" "" "" "9141"
"00426656" "" "" "" "1" "" "00000" "{PMID:Heon 2005:15690372}" "10 affected individuals from the family mapped to the BBS2 locus" "" "" "" "" "0" "" "" "" "?"
"00429907" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00430032" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00447023" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "BBS-35"
"00480654" "" "" "" "1" "" "00006" "{PMID:Kostoulas 2026:42212615}" "analysis 276 unrelated individuals (carrier screening)" "" "" "Greece" "" "0" "" "" "" ""
"00482403" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" ""
"00482404" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" ""
"00482405" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" ""
"00482406" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" ""
"00482407" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" ""
"00482408" "" "" "" "1" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" ""
"00482409" "" "" "" "3" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" ""
"00482410" "" "" "" "2" "" "00006" "{PMID:Liu 2026:41932824}" "carrier screening 3748 individuals (2087F, 1661M)" "" "" "China" "" "0" "" "" "" ""
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 279
"{{individualid}}" "{{diseaseid}}"
"00000025" "05378"
"00001819" "00112"
"00050437" "00198"
"00095923" "04211"
"00104994" "04214"
"00155385" "04214"
"00155386" "04214"
"00155387" "04214"
"00155388" "04214"
"00165196" "04212"
"00233354" "04214"
"00233355" "04214"
"00233356" "04214"
"00233357" "04214"
"00233358" "04214"
"00233359" "04214"
"00233360" "04214"
"00233361" "04214"
"00233362" "04214"
"00233363" "04214"
"00233364" "04214"
"00233365" "04214"
"00233366" "04214"
"00233367" "04214"
"00233368" "04214"
"00233369" "04214"
"00233370" "04214"
"00233371" "04214"
"00233788" "04214"
"00233789" "04214"
"00233790" "04214"
"00269968" "04214"
"00276084" "04214"
"00276085" "04214"
"00276086" "04214"
"00291493" "00198"
"00299641" "04214"
"00308478" "04214"
"00308479" "04214"
"00308480" "04214"
"00308600" "04214"
"00308958" "04214"
"00308959" "04214"
"00308960" "04214"
"00308962" "04214"
"00308963" "04214"
"00308964" "04214"
"00325432" "04214"
"00331733" "04214"
"00334084" "04214"
"00334085" "04214"
"00334086" "04214"
"00334087" "04214"
"00335259" "04214"
"00358803" "04212"
"00358807" "04212"
"00358809" "04212"
"00358975" "04214"
"00359383" "04214"
"00363432" "04214"
"00363434" "04214"
"00363624" "04214"
"00363710" "04214"
"00363731" "04214"
"00372518" "04214"
"00372519" "04214"
"00373490" "04214"
"00373491" "04214"
"00373877" "04214"
"00373886" "04214"
"00375442" "04214"
"00379354" "04214"
"00379355" "04214"
"00380352" "04214"
"00380354" "04214"
"00381726" "04214"
"00382489" "04214"
"00382490" "04214"
"00382491" "04214"
"00382492" "04214"
"00382493" "04214"
"00382881" "04214"
"00382882" "04214"
"00382883" "04214"
"00382884" "04214"
"00382885" "04214"
"00382886" "04214"
"00382887" "04214"
"00382888" "04214"
"00382889" "04214"
"00382890" "04214"
"00382891" "04214"
"00382892" "04214"
"00382893" "04214"
"00382894" "04214"
"00382895" "04214"
"00382896" "04214"
"00382897" "04214"
"00382898" "04214"
"00382899" "04214"
"00383100" "04214"
"00383110" "04214"
"00383129" "04214"
"00383130" "04214"
"00383137" "04214"
"00383147" "04214"
"00383150" "04214"
"00383197" "04214"
"00383222" "04214"
"00383223" "04214"
"00383224" "04214"
"00383225" "04214"
"00383226" "04214"
"00383227" "04214"
"00383228" "04214"
"00383284" "04214"
"00383286" "04214"
"00383289" "04214"
"00383292" "04214"
"00383296" "04214"
"00383297" "04214"
"00383299" "04214"
"00383300" "04214"
"00383301" "04214"
"00383304" "04214"
"00383307" "04214"
"00383308" "04214"
"00383309" "04214"
"00383310" "04214"
"00383311" "04214"
"00383312" "04214"
"00383331" "04214"
"00383332" "04214"
"00383334" "04214"
"00383335" "04214"
"00383336" "04214"
"00383338" "04214"
"00383341" "04214"
"00383348" "04214"
"00383349" "04214"
"00383358" "04214"
"00383359" "04214"
"00383365" "04214"
"00383368" "04214"
"00383369" "04214"
"00383370" "04214"
"00383371" "04214"
"00383372" "04214"
"00383373" "04214"
"00383374" "04214"
"00383376" "04214"
"00383377" "04214"
"00383409" "04214"
"00383652" "04214"
"00383655" "04214"
"00383662" "04214"
"00383993" "04214"
"00384082" "04214"
"00384183" "04214"
"00384184" "04214"
"00384250" "04214"
"00384260" "04214"
"00384295" "04214"
"00384296" "04214"
"00384638" "04214"
"00384732" "04214"
"00384733" "04214"
"00384812" "04214"
"00384813" "04214"
"00384829" "04214"
"00384832" "04214"
"00384833" "04214"
"00384836" "04214"
"00384839" "04214"
"00385025" "04214"
"00385153" "04214"
"00385178" "04214"
"00385183" "04214"
"00385213" "04214"
"00385214" "04214"
"00385215" "04214"
"00385216" "04214"
"00385224" "04214"
"00385234" "04214"
"00385238" "04214"
"00385263" "04214"
"00385281" "04214"
"00385282" "04214"
"00385300" "04214"
"00385331" "04214"
"00385332" "04214"
"00385333" "04214"
"00385334" "04214"
"00385335" "04214"
"00385336" "04214"
"00385337" "04214"
"00385338" "04214"
"00385339" "04214"
"00385340" "04214"
"00385341" "04214"
"00385380" "04214"
"00385445" "05578"
"00385554" "04214"
"00385555" "04214"
"00385556" "04214"
"00385561" "04214"
"00385563" "04214"
"00385564" "04214"
"00385578" "04214"
"00385579" "04214"
"00385582" "04214"
"00385583" "04214"
"00385595" "04214"
"00385617" "04214"
"00385618" "04214"
"00385635" "04214"
"00385708" "04214"
"00385936" "04214"
"00385939" "04214"
"00385943" "04214"
"00385944" "04214"
"00386212" "04214"
"00386228" "04214"
"00386694" "04214"
"00386860" "04214"
"00387548" "04214"
"00387598" "04214"
"00388042" "04214"
"00388043" "04214"
"00388044" "04214"
"00388045" "04214"
"00388046" "04214"
"00388493" "04214"
"00388531" "04214"
"00388833" "04214"
"00389617" "04214"
"00391375" "04214"
"00392309" "04214"
"00392310" "04214"
"00392311" "04214"
"00392312" "04214"
"00392663" "04214"
"00392766" "04214"
"00392767" "04214"
"00392768" "04214"
"00392769" "04214"
"00392770" "04214"
"00392771" "04214"
"00392772" "04214"
"00394478" "04214"
"00395026" "04214"
"00395034" "04214"
"00395580" "04214"
"00395585" "04214"
"00396565" "04214"
"00399797" "06892"
"00404268" "04212"
"00412474" "04214"
"00412486" "04214"
"00414399" "00198"
"00414400" "00198"
"00418348" "04212"
"00418640" "04212"
"00418644" "04212"
"00418656" "04212"
"00419522" "00198"
"00426656" "04212"
"00429907" "04210"
"00430032" "00112"
"00447023" "00198"
"00480654" "00000"
"00482403" "00000"
"00482404" "00000"
"00482405" "00000"
"00482406" "00000"
"00482407" "00000"
"00482408" "00000"
"00482409" "00000"
"00482410" "00000"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00000, 00112, 00139, 00198, 04210, 04211, 04212, 04214, 04376, 05378, 05578, 05686, 06892
## Count = 240
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000037049" "00198" "00050437" "00006" "Unknown" "" "obesity, global developmental delay, enlarged kidneys, renal cysts, abnormal electroretinogram" "" "" "" "" "" "" "" "" "" ""
"0000074212" "04211" "00095923" "01769" "Familial, autosomal recessive" "" "Progressive RP" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000082885" "04214" "00104994" "01244" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000127885" "04214" "00155385" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000127886" "04214" "00155386" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000127887" "04214" "00155387" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000127888" "04214" "00155388" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000207763" "04214" "00269968" "01848" "Familial, autosomal recessive" "20y" "pericentral RP, incidental diagnosis, pericentral field loss" "15y" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000210679" "04214" "00276084" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "RP74" "retinitis pigmentosa" ""
"0000210680" "04214" "00276085" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "RP74" "retinitis pigmentosa" ""
"0000210681" "04214" "00276086" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "RP74" "retinitis pigmentosa" ""
"0000226951" "04214" "00299641" "00006" "Familial, autosomal recessive" "51y" "see paper; ..., 29y-photopsia (HP:0030786), slightly reduced acuity (HP:0007663), mild nyctalopia (HP:0000662); irregular pigmented lesions in periphery(HP:0007703), pale discs (HP:0000543), cystoid macular edema (HP:0011505), peripheral telangiectasia (HP:0007763) with some retinal edema (HP:0020120) and vitreous cells (HP:0004327), possible para-arteriolar sparing; 29y-ERG no identifiable responses other than a minimal, delayed response to 30Hz flicker (PERG, EOG and ERG tested), severe photoreceptor dysfunction; 29y-colour vision Ishihara 15/15 each eye; 29y-Goldmann visual fields ring scotoma at 30 degrees, binocular Esterman age 36: central 20 degrees only retained; presenting VA logMAR (Snellen) R 0.48 (20/60), L 0.3 (20/40); latest VA logMAR R 1.8 (20/1250), L 1.5 (20/630); latest refractive error, dioptres R -1.00/-1.00x5, L +0.75/-1.00x90" "29y" "" "" "" "" "" "" "RP78" "retinitis pigmentosa" ""
"0000233906" "04214" "00308478" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000233907" "04214" "00308479" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000233908" "04214" "00308480" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000234028" "04214" "00308600" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000234278" "04214" "00308958" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "cone–rod dystrophy" ""
"0000234279" "04214" "00308959" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234280" "04214" "00308960" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234282" "04214" "00308962" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000234283" "04214" "00308963" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "BBS" ""
"0000234284" "04214" "00308964" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000243919" "04214" "00325432" "00006" "Familial, autosomal recessive" "" "syndromic retinal dystrophy" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000249925" "04214" "00331733" "00000" "Familial, autosomal recessive" "" "cone-rod dystrophy, obesity, polydactyly, brachydactyly, psychomotor, learning delay, behaviour disorder" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" ""
"0000252269" "04214" "00334084" "00000" "Familial, autosomal recessive" "42y" "clinical category IB2" "" "" "" "" "" "" "" "" "Bardet Biedl syndrome" ""
"0000252270" "04214" "00334085" "00000" "Familial, autosomal recessive" "20y" "clinical category IB2" "" "" "" "" "" "" "" "" "Bardet Biedl syndrome" ""
"0000252271" "04214" "00334086" "00000" "Familial, autosomal recessive" "22y" "clinical category IB2" "" "" "" "" "" "" "" "" "Bardet Biedl syndrome" ""
"0000252272" "04214" "00334087" "00000" "Familial, autosomal recessive" "11y" "clinical category IB2" "" "" "" "" "" "" "" "" "Bardet Biedl syndrome" ""
"0000252974" "04214" "00335259" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000254018" "04212" "00358803" "00000" "Unknown" "9y" "see paper; ..." "" "" "" "" "" "" "" "" "Bardet-Biedl Syndrome" ""
"0000254022" "04212" "00358807" "00000" "Unknown" "5y" "see paper; ..." "" "" "" "" "" "" "" "" "Bardet-Biedl Syndrome" ""
"0000254024" "04212" "00358809" "00000" "Unknown" "6y" "see paper; ..." "" "" "" "" "" "" "" "" "Bardet-Biedl Syndrome" ""
"0000254273" "04214" "00358975" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" ""
"0000254654" "04214" "00359383" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "retinal disease" ""
"0000258793" "04214" "00363432" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "Bardet Biedl syndrome" ""
"0000258795" "04214" "00363434" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "Bardet Biedl syndrome" ""
"0000258974" "04214" "00363624" "00000" "Isolated (sporadic)" "" "non-syndromic" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" ""
"0000259060" "04214" "00363710" "00000" "Isolated (sporadic)" "" "syndromic" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" ""
"0000259081" "04214" "00363731" "00000" "Isolated (sporadic)" "" "syndromic" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" ""
"0000267833" "04214" "00372518" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000267834" "04214" "00372519" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "retinal dystrophy" ""
"0000268766" "04214" "00373490" "00000" "Familial, autosomal recessive" "18y" "see paper; ..." "10y" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" ""
"0000268767" "04214" "00373491" "00000" "Familial, autosomal recessive" "14y" "see paper; ..." "9y" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" ""
"0000269086" "04214" "00373877" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "ciliopathy" ""
"0000269095" "04214" "00373886" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000270656" "04214" "00375442" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000273227" "04214" "00379354" "00000" "Familial, autosomal recessive" "" "Retinitis pigmentosa, polydactyly, obesity, renal anomalies" "" "" "" "" "" "" "" "" "Bardete Biedl syndrome" ""
"0000273228" "04214" "00379355" "00000" "Familial, autosomal recessive" "" "Retinitis pigmentosa, polydactyly, obesity" "" "" "" "" "" "" "" "" "Bardete Biedl syndrome" ""
"0000274203" "04214" "00380352" "00000" "Familial, autosomal recessive" "6y" "Anemia, arterial hypertension. Retinitis pigmentaria" "" "" "" "" "" "" "" "" "BardetBiedl syndrome" ""
"0000274205" "04214" "00380354" "00000" "Familial, autosomal recessive" "8y" "retinitis pigmentaria" "" "" "" "" "" "" "" "" "BardetBiedl syndrome" ""
"0000275568" "04214" "00381726" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa Simplex" ""
"0000276338" "04214" "00382489" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276339" "04214" "00382490" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276340" "04214" "00382491" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276341" "04214" "00382492" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Generalized retinal dystrophy (non-syndromic)" ""
"0000276342" "04214" "00382493" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000276737" "04214" "00382881" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD)" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276738" "04214" "00382882" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD), developmental delay (Dev) and renal malformations (Ren)" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276739" "04214" "00382883" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD) and renal malformations (Ren)" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276740" "04214" "00382884" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD), developmental delay (Dev) and renal malformations (Ren)" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276741" "04214" "00382885" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD), developmental delay (Dev) and renal malformations (Ren)" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276742" "04214" "00382886" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD), developmental delay (Dev), gonadal and renal malformations" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276743" "04214" "00382887" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD), developmental delay (Dev), gonadal and renal malformations" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276744" "04214" "00382888" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD), developmental delay (Dev), gonadal and renal malformations" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276745" "04214" "00382889" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD), developmental delay (Dev), gonadal and renal malformations" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276746" "04214" "00382890" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD), gonadal and renal malformations" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276747" "04214" "00382891" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD), developmental delay (Dev) and renal malformations (Ren)" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276748" "04214" "00382892" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD)" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276749" "04214" "00382893" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD), developmental delay (Dev) and gonadal malformations" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276750" "04214" "00382894" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD), developmental delay (Dev), gonadal and renal malformations" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276751" "04214" "00382895" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD), developmental delay (Dev), gonadal and renal malformations" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276752" "04214" "00382896" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD), developmental delay (Dev), gonadal and renal malformations" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276753" "04214" "00382897" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD) and gonadal malformations" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276754" "04214" "00382898" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa (RP), obesity (Ob), polydactyly (PD) and renal malformations (Ren)" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276755" "04214" "00382899" "00000" "Familial, autosomal recessive" "" "obesity (Ob), polydactyly (PD), developmental delay (Dev)" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276890" "04214" "00383100" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" ""
"0000276900" "04214" "00383110" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000276919" "04214" "00383129" "00000" "Familial, autosomal recessive" "23y" "Polydactyly hands feet, cognitive impairment" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276920" "04214" "00383130" "00000" "Familial, autosomal recessive" "18y" "Polydactyly hands feet, cognitive impairment" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276927" "04214" "00383137" "00000" "Familial, autosomal recessive" "" "obesity, polydactyly, learning disability" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276937" "04214" "00383147" "00000" "Familial, autosomal recessive" "" "obesity, polydactyly, hypogonadism" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276940" "04214" "00383150" "00000" "Familial, autosomal recessive" "" "obesity" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000276984" "04214" "00383197" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277009" "04214" "00383222" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277010" "04214" "00383223" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277011" "04214" "00383224" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277012" "04214" "00383225" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277013" "04214" "00383226" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277014" "04214" "00383227" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277015" "04214" "00383228" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277069" "04214" "00383284" "00000" "Familial, autosomal recessive" "6y" "RP, retinitis pigmentosa; PAP, postaxial polydactyly" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277071" "04214" "00383286" "00000" "Familial, autosomal recessive" "5y" "RP, retinitis pigmentosa; PAP, postaxial polydactyly; MR, mental retardation; Renal, both structurally and functionally renal anomalies" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277074" "04214" "00383289" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277077" "04214" "00383292" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277081" "04214" "00383296" "00000" "Familial, autosomal recessive" "10y" "RP, retinitis pigmentosa; PAP, postaxial polydactyly; MR, mental retardation" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277082" "04214" "00383297" "00000" "Familial, autosomal recessive" "9y" "RP, retinitis pigmentosa; PAP, postaxial polydactyly; Hypogenitalism" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277084" "04214" "00383299" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277085" "04214" "00383300" "00000" "Familial, autosomal recessive" "19y" "RP, retinitis pigmentosa; PAP, postaxial polydactyly; MR, mental retardation; Renal, both structurally and functionally renal anomalies" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277086" "04214" "00383301" "00000" "Familial, autosomal recessive" "1y" "RP, retinitis pigmentosa; PAP, postaxial polydactyly; MR, mental retardation; Hypogenitalism" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277089" "04214" "00383304" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277092" "04214" "00383307" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277093" "04214" "00383308" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277094" "04214" "00383309" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277095" "04214" "00383310" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277096" "04214" "00383311" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277097" "04214" "00383312" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277116" "04214" "00383331" "00000" "Familial, autosomal recessive" "32y" "" "17y" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277117" "04214" "00383332" "00000" "Familial, autosomal recessive" "35y" "" "13y" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277119" "04214" "00383334" "00000" "Familial, autosomal recessive" "20y" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277120" "04214" "00383335" "00000" "Familial, autosomal recessive" "18y" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277121" "04214" "00383336" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277123" "04214" "00383338" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277126" "04214" "00383341" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277133" "04214" "00383348" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277134" "04214" "00383349" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277143" "04214" "00383358" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277144" "04214" "00383359" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277150" "04214" "00383365" "00000" "Complex" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277153" "04214" "00383368" "00000" "Complex" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277154" "04214" "00383369" "00000" "Complex" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277155" "04214" "00383370" "00000" "Complex" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277156" "04214" "00383371" "00000" "Complex" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277157" "04214" "00383372" "00000" "Complex" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277158" "04214" "00383373" "00000" "Complex" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277159" "04214" "00383374" "00000" "Complex" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277161" "04214" "00383376" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277162" "04214" "00383377" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000277194" "04214" "00383409" "00000" "Familial, autosomal recessive" "" "" "8y" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" ""
"0000277437" "04214" "00383652" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Bardet–Biedl syndro" ""
"0000277440" "04214" "00383655" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Bardet–Biedl syndro" ""
"0000277447" "04214" "00383662" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Bardet–Biedl syndro" ""
"0000277778" "04214" "00383993" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277867" "04214" "00384082" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277968" "04214" "00384183" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000277969" "04214" "00384184" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000278035" "04214" "00384250" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000278045" "04214" "00384260" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000278080" "04214" "00384295" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Congenital cataract" ""
"0000278081" "04214" "00384296" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Congenital cataract" ""
"0000278428" "04214" "00384638" "00000" "Familial, autosomal recessive" "12y1m" "Hematocolpos, increased renal echogenicity and lobulated kidney, polydactyly, brachydactyly, retinitis pigmentosa" "" "1m" "" "" "" "" "" "Bardet-Biedl syndrome" "Bardet-Biedl syndrome" ""
"0000278515" "04214" "00384732" "00000" "Familial, autosomal recessive" "4y" "weight anomalies, digit anomaly" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000278516" "04214" "00384733" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000278595" "04214" "00384812" "00000" "Familial, autosomal recessive" "" "obesity, mental retardation, renal disease, polydactyly, typical facies, hypogenitalism" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" ""
"0000278596" "04214" "00384813" "00000" "Familial, autosomal recessive" "" "obesity, mental retardation, polydactyly, deafness, typical facies, hypogenitalism" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" ""
"0000278612" "04214" "00384829" "00000" "Familial, autosomal recessive" "" "obesity, learning disabilities, polydactyly, aopy, hypogenitalism" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" ""
"0000278615" "04214" "00384832" "00000" "Familial, autosomal recessive" "" "obesity, polydactyly, hydrometrocolpos" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" ""
"0000278616" "04214" "00384833" "00000" "Familial, autosomal recessive" "" "obesity, polydactyly, hydrometrocolpos" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" ""
"0000278619" "04214" "00384836" "00000" "Familial, autosomal recessive" "" "obesity, mental retardation, renal disease, polydactyly, hypogenitalism" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" ""
"0000278622" "04214" "00384839" "00000" "Familial, autosomal recessive" "" "obesity, mental retardation, polydactyly, deafness," "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" ""
"0000278809" "04214" "00385025" "00000" "Isolated (sporadic)" "23y" "nyctalopia, no nystagmus, no oculodigital sign, best corrected visual acuity right/left eye: LP/LP" "5y" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" ""
"0000278949" "04214" "00385153" "00000" "Familial, autosomal recessive" "11y6m" "HP:0000548 Cone/cone-rod dystrophy; HP:0010442 Polydactyly; HP:0001249 Intellectual disability; HP:0001263 Global developmental delay; HP:0000750 Delayed speech and language development; HP:0001999 Abnormal facial shape;" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" "Bardet-Biedl syndrome" ""
"0000278974" "04214" "00385178" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000278979" "04214" "00385183" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279009" "04214" "00385213" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279010" "04214" "00385214" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279011" "04214" "00385215" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279012" "04214" "00385216" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279020" "04214" "00385224" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279030" "04214" "00385234" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279034" "04214" "00385238" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279059" "04214" "00385263" "00000" "Familial, autosomal recessive" "" "Polydactyly, heart malformation, hydrometrocolpos, bilateral, hydrometrocolpos, hydronephrosis, abdominal occlusion" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279077" "04214" "00385281" "00000" "Familial, autosomal recessive" "8y" "obesity, retinitis pigmentosa, polydactyly, mental retardation" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279078" "04214" "00385282" "00000" "Familial, autosomal recessive" "6y" "obesity, retinitis pigmentosa, polydactyly, hypogenitalism,mental retardation, anemia HTA" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279096" "04214" "00385300" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279127" "04214" "00385331" "00000" "Familial, autosomal recessive" "30y1m" "retinal dystrophy, weight anomaly, digit anomaly, renal structure anomaly, Liver fx" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279128" "04214" "00385332" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279129" "04214" "00385333" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279130" "04214" "00385334" "00000" "Familial, autosomal recessive" "23y4m" "retinal dystrophy, weight anomaly, digit anomaly, cognitive impairement, developmental delay, developmental delay, developmental delay, Scoliosis, HBP, Diabetes, DislipidemiaHyperphagia, Depression, OCD" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279131" "04214" "00385335" "00000" "Familial, autosomal recessive" "20y1m" "retinal dystrophy, weight anomaly, digit anomaly, developmental delay, developmental delay, developmental delay, Liver fx, DislipidemiaHigh arched palate" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279132" "04214" "00385336" "00000" "Familial, autosomal recessive" "7y" "weight anomaly, digit anomaly, cognitive impairement, cognitive impairement, developmental delay, developmental delay, developmental delay, renal structure anomaly, Vaginal atresia," "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279133" "04214" "00385337" "00000" "Familial, autosomal recessive" "2y11m" "retinal dystrophy, weight anomaly, digit anomaly, cognitive impairement, developmental delay, developmental delay, developmental delay, renal structure anomaly, AsthmaCryptochidism" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279134" "04214" "00385338" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279135" "04214" "00385339" "00000" "Familial, autosomal recessive" "16y10m" "retinal dystrophy, weight anomaly, digit anomaly, renal structure anomaly, Heart anomaly, HBP" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279136" "04214" "00385340" "00000" "Familial, autosomal recessive" "23y5m" "retinal dystrophy, weight anomaly, digit anomaly, developmental delay, developmental delay, developmental delay, Scoliosis" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279137" "04214" "00385341" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279176" "04214" "00385380" "00000" "Familial, autosomal recessive" "4y" "showedbilateraldiffuse cystic renal dysplasia with a relatively well-preserved nephrogenesis and an expanded medulla with dilated dysplastic collecting ducts" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome (BBS)" ""
"0000279240" "05578" "00385445" "00006" "Familial, autosomal recessive" "05y" "see paper; ..., hydrocephalus, occipital encephalocele; born 37w1d, weight 3,954 grams (+4.2SD), length 52.0 cm (+2.5SD), OFC 46.0 cm (+11SD); soon after birth placement ventricularperitoneal shunt for severe hydrocephalus; neonatal period exhibited frequent apneic spells, both obstructive and central components; frequency apneic spells (treated with bidirectional positive airway pressure) increased during infancy; ECG no epileptogenic activities; 5y-poor growth, weight 7.6 kg (−4.0SD), height 85 cm (−4.9SD), severe intellectual disability, no intelligible words, distinctive facies, widely spaced eyes, esotropia, tall ears, depressed nasal bridge, post-axial polydactyly both hands, T1-weighted MRI brain occipital encephalocele, severe hydrocephalus, abdominal ultrasound showed multicystic lesions kidney, ultrasound no intrahepatic fibrosis, no hepatic dysfunction on blood tests" "<00y00m01d" "" "" "" "" "" "" "MKS6" "Meckel-Gruber syndrome" ""
"0000279349" "04214" "00385554" "00000" "Familial, autosomal recessive" "" "renal anomalies, ASD" "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279350" "04214" "00385555" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa, renal anomalies, " "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279351" "04214" "00385556" "00000" "Familial, autosomal recessive" "" "postaxial polydactyly, renal anomalies, ASD,IVS-AZ,SI" "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279356" "04214" "00385561" "00000" "Familial, autosomal recessive" "" "postaxial polydactyly, obesity, renal anomalies, " "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279358" "04214" "00385563" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa, postaxial polydactyly, obesity, renal anomalies, DD" "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279359" "04214" "00385564" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa, postaxial polydactyly, obesity, renal anomalies, DD" "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279373" "04214" "00385578" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa, postaxial polydactyly, renal anomalies, BCU,HMC,MD" "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279374" "04214" "00385579" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa, postaxial polydactyly, obesity, CHD,MD,NSM,SD,SI" "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279377" "04214" "00385582" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa, postaxial polydactyly, obesity, hypogonadism, renal anomalies, AST,DD,MC,SD,SYN" "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279378" "04214" "00385583" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa, postaxial polydactyly, obesity, hypogonadism, renal anomalies, AST,DD,MC,SD,SYN" "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279390" "04214" "00385595" "00000" "Familial, autosomal recessive" "" "Retinitis pigmentosa, postaxial polydactyly, obesity, renal anomalies" "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279412" "04214" "00385617" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" ""
"0000279413" "04214" "00385618" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa, obesity, polydactyly, typical fundus of bone-spicule hyperpigmentation and attenuated arteries." "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000279430" "04214" "00385635" "00000" "Familial, autosomal recessive" "" "retinitis pigmentosa, polydactyly, hypogonadism, developmental delay, nephronophthisis" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000279521" "04214" "00385708" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" ""
"0000279737" "04214" "00385936" "00000" "Familial, autosomal recessive" "" "obesity, rp, night blindness, mild learning disability, polydactyly feet, renal anomaly,speech disorder," "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279740" "04214" "00385939" "00000" "Familial, autosomal recessive" "" "obesity, rodcone dystrophy, cataract, strabismus, Moderate learning disability, polydactyly hand, polydactyly feet," "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279744" "04214" "00385943" "00000" "Familial, autosomal recessive" "" "obesity, myopia, mild learning disability, polydactyly hand, polydactyly feet, renal anomaly,IUGR-Hyperactivity, astigmatism" "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000279745" "04214" "00385944" "00000" "Familial, autosomal recessive" "" "obesity, rp, mild learning disability, polydactyly hand, polydactyly feet, hypogonadisma, Cryptorchidism, brachydactyly" "" "" "" "" "" "" "" "" "BardetBiedl syndrome (BBS)" ""
"0000280015" "04214" "00386212" "00000" "Familial, autosomal recessive" "53y" "" "" "6y" "" "" "" "" "" "achromatopsia" "" ""
"0000280031" "04214" "00386228" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000280494" "04214" "00386694" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000280660" "04214" "00386860" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000281111" "04214" "00387548" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" ""
"0000281161" "04214" "00387598" "00000" "Familial, autosomal recessive" "" "" "2y" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" ""
"0000281637" "04214" "00388042" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000281638" "04214" "00388043" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000281639" "04214" "00388044" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000281640" "04214" "00388045" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000281641" "04214" "00388046" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000282045" "04214" "00388493" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" ""
"0000282072" "04214" "00388531" "00000" "Familial, autosomal recessive" "2y" "intellectual disability, rod-cone dystrophy, obesity, hypogonadism, polydactyly, BMI: 25.6, epilepsy" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" "Bardet-Biedl syndrome" ""
"0000282374" "04214" "00388833" "00000" "Familial, autosomal recessive" "25y" "age at genetic diagnosis mentioned" "" "21y" "" "" "" "" "" "Bardet-Biedl syndrome" "" ""
"0000283158" "04214" "00389617" "00000" "Familial, autosomal recessive" "8y" "age at genetic diagnosis mentioned" "" "7y" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" ""
"0000284815" "04214" "00391375" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome 2 (615981)" "Bardet-Biedl syndrome 2 (615981)" ""
"0000285585" "04214" "00392309" "00000" "Familial, autosomal recessive" "2y" "uncorrected visual acuity right/left eye: not available, BMI: 26.5, nystagmus, polydactyly, genital anomalies, renal anomalies" "" "" "" "" "" "" "" "Bardet-Biedl Syndrome" "Bardet-Biedl Syndrome" ""
"0000285586" "04214" "00392310" "00000" "Familial, autosomal recessive" "20y" "uncorrected visual acuity right/left eye: no light perception, BMI: 28, nystagmus, polydactyly, genital anomalies, renal anomalies" "" "" "" "" "" "" "" "Bardet-Biedl Syndrome" "Bardet-Biedl Syndrome" ""
"0000285587" "04214" "00392311" "00000" "Familial, autosomal recessive" "18y" "uncorrected visual acuity right/left eye: no light perception, BMI: 41.9, nystagmus, polydactyly, genital anomalies, renal anomalies" "" "" "" "" "" "" "" "Bardet-Biedl Syndrome" "Bardet-Biedl Syndrome" ""
"0000285588" "04214" "00392312" "00000" "Familial, autosomal recessive" "16y" "uncorrected visual acuity right/left eye: counting fingers 1.5m/counting fingers 2m, BMI: 30.2, nystagmus, polydactyly, genital anomalies, renal anomalies" "" "" "" "" "" "" "" "Bardet-Biedl Syndrome" "Bardet-Biedl Syndrome" ""
"0000285910" "04214" "00392663" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" ""
"0000286012" "04214" "00392766" "00000" "Familial, autosomal recessive" "21y" "BMI: 33.2, polydactyly, intellectual disability, no gonadal abnormalities, no renal abnormalities, hearing loss, tooth abnormalities, short stature, no cardiac abnormalities, blood sugar normal, blood pressure normal, lipid levels normal, nystagmus, cataract, best corrected visual acuity right/left eye: counting fingers/hand movement, fundus: macular atrophy, optic disk pallor, osteocyte cell-like pigment deposition, pattern visual evoked potential: unrecordable, flash visual evoked potential: severely reduced amplitude, mild delay, full-field flash electroretinography: unrecordable, multifocal electroretinography: unrecordable" "0m" "" "" "" "" "" "" "Bardet-Biedl Syndrome" "Bardet-Biedl Syndrome" ""
"0000286013" "04214" "00392767" "00000" "Familial, autosomal recessive" "13y" "Epilepsy, dorsal hemangioma, BMI: 19.53, no polydactyly, intellectual disability, no gonadal abnormalities, no renal abnormalities, no hearing loss, tooth abnormalities, normal height, no cardiac abnormalities, blood sugar normal, blood pressure normal, lipid levels normal, strabismus, best corrected visual acuity right/left eye: 0.05/0.2, fundus: macular atrophy, optic disk pallor, osteocyte cell-like pigment deposition, pattern visual evoked potential: severely decreased amplitude and moderate delay peak time, flash visual evoked potential: moderately reduced amplitude, mild delay, full-field flash electroretinography: unrecordable, multifocal electroretinography: unrecordable" "0m" "" "" "" "" "" "" "Bardet-Biedl Syndrome" "Bardet-Biedl Syndrome" ""
"0000286014" "04214" "00392768" "00000" "Familial, autosomal recessive" "19y" "BMI: 24.44, polydactyly, no intellectual disability, ovarian dysplasia, no renal abnormalities, no hearing loss, no tooth abnormalities, short stature, no cardiac abnormalities, blood sugar normal, blood pressure normal, lipid levels normal, nystagmus, strabismus, best corrected visual acuity right/left eye: 0.05/0.1, fundus: macular atrophy, optic disk pallor, osteocyte cell-like pigment deposition, pattern visual evoked potential: unrecordable, flash visual evoked potential: moderately reduced amplitude, mild delay, full-field flash electroretinography: unrecordable, multifocal electroretinography: unrecordable" "<5y" "" "" "" "" "" "" "Bardet-Biedl Syndrome" "Bardet-Biedl Syndrome" ""
"0000286015" "04214" "00392769" "00000" "Familial, autosomal recessive" "30y" "Epilepsy, dorsal hemangioma, BMI: 26.72, no polydactyly, no intellectual disability, external genital dysplasia, no renal abnormalities, hearing loss, no tooth abnormalities, normal height, no cardiac abnormalities, blood sugar normal, blood pressure normal, lipid levels normal–, best corrected visual acuity right/left eye: 0.02/0.01, fundus: macular atrophy, optic disk pallor, osteocyte cell-like pigment deposition, pattern visual evoked potential: unrecordable, flash visual evoked potential: moderately reduced amplitude, mild delay, full-field flash electroretinography: partial residual rod response, multifocal electroretinography: unrecordab" "0m" "" "" "" "" "" "" "Bardet-Biedl Syndrome" "Bardet-Biedl Syndrome" ""
"0000286016" "04214" "00392770" "00000" "Familial, autosomal recessive" "29y" "BMI: 29.05, no polydactyly, no intellectual disability, external genital dysplasia, no renal abnormalities, hearing loss, no tooth abnormalities, normal height, high sinus heart rate, blood sugar normal, blood pressure slightly elevated, lipid levels normal–, best corrected visual acuity right/left eye: light perception/light perception, fundus: macular atrophy, optic disk pallor, osteocyte cell-like pigment deposition, pattern visual evoked potential: unrecordable, flash visual evoked potential: severely reduced amplitude, without delay, full-field flash electroretinography: unrecordable, multifocal electroretinography: unrecordab" "0m" "" "" "" "" "" "" "Bardet-Biedl Syndrome" "Bardet-Biedl Syndrome" ""
"0000286017" "04214" "00392771" "00000" "Familial, autosomal recessive" "37y" "BMI: 28.76, no polydactyly, no intellectual disability, no gonadal abnormalities, no renal abnormalities, no hearing loss, tooth abnormalities, normal height, no cardiac abnormalities, blood sugar normal, blood pressure slightly elevated, lipid levels normal, cataract, best corrected visual acuity right/left eye: hand movement/hand movement, fundus: choroid sclerosis, retinal pigment epithelium atrophy, optic disk pallor, pattern visual evoked potential: –, flash visual evoked potential: –, full-field flash electroretinography: unrecordable, multifocal electroretinography: unrecord" "0m" "" "" "" "" "" "" "Bardet-Biedl Syndrome" "Bardet-Biedl Syndrome" ""
"0000286018" "04214" "00392772" "00000" "Familial, autosomal recessive" "26y" "BMI: 32.3, polydactyly, no intellectual disabilityno datano datano data, tooth abnormalities, short statureno datano datano datano data, cataract, best corrected visual acuity right/left eye: 0.05/0.05, fundus: macular atrophy, optic disk pallor, osteocyte cell-like pigment deposition, pattern visual evoked potential: unrecordable, flash visual evoked potential: –, full-field flash electroretinography: unrecordable, multifocal electroretinography: unrecordab" "0m" "" "" "" "" "" "" "Bardet-Biedl Syndrome" "Bardet-Biedl Syndrome" ""
"0000287681" "04214" "00394478" "00000" "Familial, autosomal recessive" "" "hepatic steatosis, dyslipidemia, scoliosis" "" "" "" "" "" "" "" "" "BardetBiedl Syndrome" ""
"0000288226" "04214" "00395026" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" "" ""
"0000288234" "04214" "00395034" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" "" ""
"0000288778" "04214" "00395580" "00000" "Familial, autosomal recessive" "" "early onset rod-cone dystrophy, dyschromatopsia, obesity, abnormality of the endocrine system, global developmental delay, intellectual disability, specific learning disability, abnormality of the kidney, asthma, brachydactyly syndrome, postaxial hand and foot polydactyly, talipes equinovarus, hypogonadism, abnormal facial shape, nevus" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" "Bardet-Biedl-like syndrome" ""
"0000288783" "04214" "00395585" "00000" "Familial, autosomal recessive" "" "astigmatism, early onset rod-cone dystrophy, myopia, photophobia, precocious puberty in females, asthma, postaxial hand and foot polydactyly, asymmetry of the thorax, narrow palate, low-set ears, delayed eruption of teeth" "" "" "" "" "" "" "" "" "Bardet-Biedl-like syndrome" ""
"0000289726" "04214" "00396565" "00000" "Familial, autosomal recessive" "" "polydactyly, postaxial, lower limbs, upper limbs, kidney abnormality, enlarged kidneys, hyperechogenic kidneys, renal cysts, hepatic anomaly" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" ""
"0000304476" "04214" "00412474" "00000" "Familial, autosomal recessive" "9y" "best corrected visual acuity (refraction) right/left eye: 0.6 (logMAR BCVA, 0.22 spherical-1.75 diopters [D] cylinder - 1.75 D axis 170deg) / 0.4 (logMAR BCVA, 0.40 spherical - 1.75 D cylinder - 1.25 D axis 15deg); no nystagmus or abnormality in anterior segments and media; funduscopy: nearly normal fundus appearance except for chorioretinal atrophic changes inferior to the optic disks and pseudopapillary edema in both eyes; fundus autofluorescence: extended macular hypo-autofluorescence with surrounding hyperautofluorescent lesions in both eyes; no apparent retinal degeneration in the periphery, but macular abnormalities including hyperautofluorescence at the fovea, mild attenuation of retinal arteriolar vessels; B-scan optical coherence tomography through the fovea: thinning of the outer retinal layers with complete disappearance of the ellipsoid zone and foveal thickness thinning in both eyes; through the optic disk - elevation of the retinal structure on hyper-reflective tissue at the nasal optic disk area in both eyes; full field electroretinogram: non-recordable responses in rod (dark adapted 0.01) electroretinogram, a non-recordable response of the right eye and an extremely decreased and delayed a-wave of the left eye in dark adapted 3.0 electroretinogram, non-recordable responses in light-adapted cone electroretinogram, and extremely decreased responses in light adapted 30 Hz flicker electroretinogram, compatible with a severe form of rod-cone dystrophy; visual field (Goldmann perimetry): preserved peripheral visual fields with V-4e isopters but restricted I-4e visual fields; best corrected visual acuity right/left eye 11y: 0.4 (logMAR BCVA, 0.40)/0.3 (logMAR BCVA, 0.52), no apparent progression in funduscopy, optical coherence tomography, and Goldmann perimetry findings; systemic findings: 10y10m hospital admission to further investigate the possibility of BBS; medical history: postaxial polydactyly/hexadactyly in the right hand at birth (surgically removed); height, weight, body mass index (BMI), and percentile BMI: 146.4 cm (+ 0.56 SD), 56.8 kg (+ 2.59 SD), 26.5 kg/m2, 97th percentile, respectively; high-arched palate and malalignment; bone age: 11.7 years by the Tanner-Whitehouse method standardized for Japanese children; development of her breasts and pubic hair: Tanner stage II and I, respectively; laboratory data including complete blood count and biochemistry: normal; overt insulin resistance, but no diabetes mellitus; gonadotropin-releasing hormone test: pubertal responses of luteinizing hormone and follicle-stimulating hormone ; ultrasonography: neither heart disease nor renal anomaly presen; intelligence test using WISCIV: developmental delay based on Full-Scale Intelligence Quotient (FSIQ), Verbal Comprehension Index (VCI), Perceptual Reasoning Index (PRI), Working Memory Index (WMI), and Processing Speed Index (PSI) scores of 81, 90, 74, 103, and 76, respectively (normal range of each index: 85-115).;learning disabilities based on DSM-5 (Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition) criteria" "" "" "poor visual acuity" "" "" "" "" "Bardet-Biedl syndrome" "" ""
"0000304488" "04214" "00412486" "00000" "Familial, autosomal recessive" "" "sensorineural features: retinal dystrophy; abnormalities of the hands and feet: postaxial polydactyly; obesity; no intellectual disability; no learning difficulty; no speech delay; no slow ideation; no motor development delay; urogenital anomalies" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" "" ""
"0000306234" "00198" "00414399" "00000" "Familial, autosomal recessive" "11y" "" "" "" "" "" "" "" "" "Bardet-Biedl Syndrome 2" "" ""
"0000306235" "00198" "00414400" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "Bardet-Biedl Syndrome 2" "" ""
"0000309717" "04212" "00418348" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" "" ""
"0000310803" "00198" "00419522" "02300" "Familial, autosomal recessive" "7y" "" "" "" "" "" "" "" "" "" "congenital/syndromic abnormality" ""
"0000317811" "04212" "00426656" "00000" "Familial, autosomal recessive" "" "whole family description: the youngest child examined, 4y: visual acuity: 6/50 (0.92 logMAR) in both eyes, constricted visual field; mixed rod-cone electroretinogram amplitude: 11% of normal; intrafamilial variability thought to reflect the different stages of the disease due to the different ages of participants; retinitis pigmentosa progressed with age; surface retinal wrinkling mostly around the vessels in older patients; no significant bone spicule-like pigmentation including a 37y individual with visual acuity was reduced to questionable light perception - pigment clumping, a large exotropia and posterior subcapsular cataracts; no significant refractive errors in the family; electroretinograms recorded from two affected individuals, ages 4 and 17y: older child showed nonrecordable responses confirming advanced photoreceptor degeneration, younger child, the amplitude of the mixed rod-cone response and cone response: reduced in comparison with aged matched control data, but recordable at 60 and 45 mV, respectively" "" "" "" "" "" "" "" "Bardet-Biedl syndrome (BBS)" "" ""
"0000320779" "04210" "00429907" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320904" "00112" "00430032" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" ""
"0000336222" "00198" "00447023" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Bardet-Biedl syndrome" ""
## Screenings ## Do not remove or alter this header ##
## Count = 280
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000000025" "00000025" "1" "00004" "" "2012-05-11 13:18:41" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" ""
"0000001622" "00001819" "1" "00102" "00102" "2013-08-08 23:06:02" "" "" "SEQ-NG-I" "DNA" "" ""
"0000016564" "00016611" "1" "00552" "00552" "2014-05-23 13:39:52" "" "" "SEQ-NG-I" "DNA" "" ""
"0000050382" "00050437" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" ""
"0000096326" "00095923" "1" "01769" "01769" "2017-01-25 20:04:19" "" "" "SEQ" "DNA" "WBC" ""
"0000105467" "00104994" "1" "01244" "01244" "2017-06-14 16:03:45" "" "" "SEQ-NG-I" "DNA" "Whole blood" ""
"0000156250" "00155385" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" ""
"0000156251" "00155386" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" ""
"0000156252" "00155387" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" ""
"0000156253" "00155388" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" ""
"0000166071" "00165196" "1" "01741" "01741" "2018-06-29 12:31:15" "" "" "SEQ" "DNA" "" ""
"0000234453" "00233354" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234454" "00233355" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234455" "00233356" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234456" "00233357" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234457" "00233358" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234458" "00233359" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234459" "00233360" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234460" "00233361" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234461" "00233362" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234462" "00233363" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234463" "00233364" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234464" "00233365" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234465" "00233366" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234466" "00233367" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234467" "00233368" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234468" "00233369" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234469" "00233370" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234470" "00233371" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234887" "00233788" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234888" "00233789" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000234889" "00233790" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" ""
"0000271121" "00269968" "1" "01848" "01848" "2019-12-11 07:35:37" "" "" "SEQ-NG" "DNA" "" ""
"0000277228" "00276084" "1" "00006" "00006" "2020-01-26 21:01:34" "" "" "SEQ" "DNA" "" ""
"0000277229" "00276085" "1" "00006" "00006" "2020-01-26 21:07:24" "" "" "SEQ" "DNA" "" ""
"0000277230" "00276086" "1" "00006" "00006" "2020-01-26 21:12:02" "" "" "SEQ" "DNA" "" ""
"0000292661" "00291493" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000300751" "00299641" "1" "00006" "00006" "2020-04-18 08:53:03" "00006" "2020-04-18 09:16:58" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WGS"
"0000309623" "00308478" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000309624" "00308479" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000309625" "00308480" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000309745" "00308600" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" ""
"0000310103" "00308958" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310104" "00308959" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310105" "00308960" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310107" "00308962" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310108" "00308963" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000310109" "00308964" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000326643" "00325432" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel"
"0000332952" "00331733" "1" "00000" "00006" "2021-02-13 09:57:26" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000335310" "00334084" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335311" "00334085" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335312" "00334086" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335313" "00334087" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000336488" "00335259" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel"
"0000360033" "00358803" "1" "00000" "00006" "2021-03-12 18:57:14" "" "" "arrayCGH;PCRlr;SEQ-NG" "DNA" "" ""
"0000360037" "00358807" "1" "00000" "00006" "2021-03-12 18:57:14" "" "" "arrayCGH;PCRlr;SEQ-NG" "DNA" "" ""
"0000360039" "00358809" "1" "00000" "00006" "2021-03-12 18:57:14" "" "" "arrayCGH;PCRlr;SEQ-NG" "DNA" "" ""
"0000360212" "00358975" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES"
"0000360625" "00359383" "1" "00000" "00006" "2021-03-19 18:50:51" "" "" "SEQ-NG" "DNA" "" "64-gene panel"
"0000364660" "00363432" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364662" "00363434" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364852" "00363624" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364938" "00363710" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364959" "00363731" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000373751" "00372518" "1" "00006" "00006" "2021-05-08 11:27:52" "" "" "SEQ-NG" "DNA" "" ""
"0000373752" "00372519" "1" "00006" "00006" "2021-05-08 11:34:03" "" "" "SEQ-NG" "DNA" "" ""
"0000374725" "00373490" "1" "00000" "00006" "2021-05-14 19:24:06" "" "" "SEQ-NG" "DNA" "" "316-gene panel"
"0000374726" "00373491" "1" "00000" "00006" "2021-05-14 19:24:06" "" "" "SEQ-NG" "DNA" "" "316-gene panel"
"0000375109" "00373877" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel"
"0000375118" "00373886" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel"
"0000376639" "00375442" "1" "00000" "00006" "2021-06-04 11:16:10" "" "" "SEQ-NG" "DNA" "" "162-gene panel"
"0000380554" "00379354" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" ""
"0000380555" "00379355" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" ""
"0000381566" "00380352" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000381568" "00380354" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000382942" "00381726" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "PCR;SEQ-NG" "DNA" "blood or a saliva sample" ""
"0000383703" "00382489" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383704" "00382490" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383705" "00382491" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383706" "00382492" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383707" "00382493" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000384097" "00382881" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384098" "00382882" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384099" "00382883" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384100" "00382884" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384101" "00382885" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384102" "00382886" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384103" "00382887" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384104" "00382888" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384105" "00382889" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384106" "00382890" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384107" "00382891" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384108" "00382892" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384109" "00382893" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384110" "00382894" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384111" "00382895" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384112" "00382896" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384113" "00382897" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384114" "00382898" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384115" "00382899" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" ""
"0000384324" "00383100" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "SEQ" "DNA" "blood" ""
"0000384334" "00383110" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "SEQ" "DNA" "blood" ""
"0000384353" "00383129" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "microsat;SEQ" "DNA" "blood" "Whole-genome scan microsatellite analysis"
"0000384354" "00383130" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "microsat;SEQ" "DNA" "blood" "Whole-genome scan microsatellite analysis"
"0000384361" "00383137" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "arraySNP;PCR" "DNA;RNA" "blood" ""
"0000384371" "00383147" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "arraySNP;PCR" "DNA;RNA" "blood" ""
"0000384374" "00383150" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "arraySNP;PCR" "DNA;RNA" "blood" ""
"0000384421" "00383197" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "SEQ;RT-PCR" "DNA;RNA" "" ""
"0000384446" "00383222" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "?" "DNA" "blood" "ASPER microarray"
"0000384447" "00383223" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "?" "DNA" "blood" "ASPER microarray"
"0000384448" "00383224" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "arraySNP;SEQ" "DNA" "blood" ""
"0000384449" "00383225" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "DHPLC;SEQ" "DNA" "blood" ""
"0000384450" "00383226" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "microsat;SEQ" "DNA" "blood" ""
"0000384451" "00383227" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "microsat;SEQ" "DNA" "blood" ""
"0000384452" "00383228" "1" "00000" "00008" "2021-09-28 01:33:29" "" "" "arraySNP;SEQ" "DNA" "blood" ""
"0000384508" "00383284" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384510" "00383286" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384513" "00383289" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384516" "00383292" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384520" "00383296" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384521" "00383297" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384523" "00383299" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384524" "00383300" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384525" "00383301" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384528" "00383304" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384531" "00383307" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384532" "00383308" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384533" "00383309" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384534" "00383310" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384535" "00383311" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384536" "00383312" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "DHPLC;arraySNP;RT-PCR" "DNA;RNA" "blood" ""
"0000384555" "00383331" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "PCR" "DNA" "blood" ""
"0000384556" "00383332" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "PCR" "DNA" "blood" ""
"0000384558" "00383334" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "PCR" "DNA" "blood" ""
"0000384559" "00383335" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "PCR" "DNA" "blood" ""
"0000384560" "00383336" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "PCR;SEQ;HD" "DNA" "blood" ""
"0000384562" "00383338" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "PCR;SEQ;HD" "DNA" "blood" ""
"0000384565" "00383341" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "PCR;SEQ;HD" "DNA" "blood" ""
"0000384572" "00383348" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "PCR;SEQ;HD" "DNA" "blood" ""
"0000384573" "00383349" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "PCR;SEQ;HD" "DNA" "blood" ""
"0000384582" "00383358" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "PCR;SEQ" "DNA" "blood" ""
"0000384583" "00383359" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "PCR;SEQ" "DNA" "blood" ""
"0000384589" "00383365" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "?" "DNA" "" ""
"0000384592" "00383368" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "?" "DNA" "" ""
"0000384593" "00383369" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "?" "DNA" "" ""
"0000384594" "00383370" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "?" "DNA" "" ""
"0000384595" "00383371" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "?" "DNA" "" ""
"0000384596" "00383372" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "?" "DNA" "" ""
"0000384597" "00383373" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "?" "DNA" "" ""
"0000384598" "00383374" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "?" "DNA" "" ""
"0000384600" "00383376" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "?" "DNA" "" ""
"0000384601" "00383377" "1" "00000" "00008" "2021-09-29 07:02:49" "" "" "?" "DNA" "" ""
"0000384634" "00383409" "1" "00000" "03840" "2021-09-29 09:58:40" "" "" "?" "DNA" "" "retrospective study"
"0000384877" "00383652" "1" "00000" "03840" "2021-09-29 12:18:14" "" "" "SEQ-NG;SEQ" "DNA" "blood;saliva" "panel containing 18 BBS genes"
"0000384880" "00383655" "1" "00000" "03840" "2021-09-29 12:18:14" "" "" "SEQ-NG;SEQ" "DNA" "blood;saliva" "panel containing 18 BBS genes"
"0000384887" "00383662" "1" "00000" "03840" "2021-09-29 12:18:14" "" "" "SEQ-NG;SEQ" "DNA" "blood;saliva" "panel containing 18 BBS genes"
"0000385218" "00383993" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" ""
"0000385307" "00384082" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" ""
"0000385408" "00384183" "1" "00000" "03840" "2021-09-29 13:14:43" "" "" "SEQ-NG-I" "DNA" "blood" "108-gene panel targeted resequencing using MIPs library prep"
"0000385409" "00384184" "1" "00000" "03840" "2021-09-29 13:14:43" "" "" "SEQ-NG-I" "DNA" "blood" "108-gene panel targeted resequencing using MIPs library prep"
"0000385475" "00384250" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385485" "00384260" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385520" "00384295" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385521" "00384296" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385866" "00384638" "1" "00000" "03840" "2021-10-04 14:30:22" "" "" "SEQ-NG" "DNA" "" "BBS related genes panel; retrospective analysis"
"0000385958" "00384732" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "SEQ" "DNA" "blood" ""
"0000385959" "00384733" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "SEQ" "DNA" "blood" ""
"0000386038" "00384812" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySNP;SEQ;RT-PCR" "DNA;RNA" "blood" ""
"0000386039" "00384813" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySNP;SEQ;RT-PCR" "DNA;RNA" "blood" ""
"0000386055" "00384829" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySNP;SEQ;RT-PCR" "DNA;RNA" "blood" ""
"0000386058" "00384832" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySNP;SEQ;RT-PCR" "DNA;RNA" "blood" ""
"0000386059" "00384833" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySNP;SEQ;RT-PCR" "DNA;RNA" "blood" ""
"0000386062" "00384836" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySNP;SEQ;RT-PCR" "DNA;RNA" "blood" ""
"0000386065" "00384839" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySNP;SEQ;RT-PCR" "DNA;RNA" "blood" ""
"0000386254" "00385025" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing"
"0000386382" "00385153" "1" "00000" "03840" "2021-10-08 17:29:22" "" "" "SEQ-NG-I" "DNA" "" "176 genes panel"
"0000386407" "00385178" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "blood" ""
"0000386412" "00385183" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "blood" ""
"0000386442" "00385213" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "blood" ""
"0000386443" "00385214" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "blood" ""
"0000386444" "00385215" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "blood" ""
"0000386445" "00385216" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "blood" ""
"0000386453" "00385224" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "blood" ""
"0000386463" "00385234" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "arrayCNV;SEQ" "DNA" "blood" ""
"0000386467" "00385238" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "arrayCNV;SEQ" "DNA" "blood" ""
"0000386492" "00385263" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" ""
"0000386510" "00385281" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" "targeted exon capture strategy"
"0000386511" "00385282" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "SEQ" "DNA" "" "targeted exon capture strategy"
"0000386529" "00385300" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "PCR" "DNA" "" ""
"0000386560" "00385331" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "PCR" "DNA" "" ""
"0000386561" "00385332" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "PCR" "DNA" "" ""
"0000386562" "00385333" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "PCR" "DNA" "" ""
"0000386563" "00385334" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "PCR" "DNA" "" ""
"0000386564" "00385335" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "PCR" "DNA" "" ""
"0000386565" "00385336" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "PCR" "DNA" "" ""
"0000386566" "00385337" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "PCR" "DNA" "" ""
"0000386567" "00385338" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "PCR" "DNA" "" ""
"0000386568" "00385339" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "PCR" "DNA" "" ""
"0000386569" "00385340" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "PCR" "DNA" "" ""
"0000386570" "00385341" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "PCR" "DNA" "" ""
"0000386609" "00385380" "1" "00000" "00008" "2021-10-09 03:44:00" "" "" "PCR;SEQ" "DNA" "" ""
"0000386674" "00385445" "1" "00006" "00006" "2021-10-11 17:17:11" "" "" "PCRlr;SEQ" "DNA" "" ""
"0000386783" "00385554" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "SEQ;HD" "DNA" "" "SEQ or HD"
"0000386784" "00385555" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "SEQ;HD" "DNA" "" "SEQ or HD"
"0000386785" "00385556" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "SEQ;HD" "DNA" "" "SEQ or HD"
"0000386790" "00385561" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "SEQ;HD" "DNA" "" "SEQ or HD"
"0000386792" "00385563" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "SEQ;HD" "DNA" "" "SEQ or HD"
"0000386793" "00385564" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "SEQ;HD" "DNA" "" "SEQ or HD"
"0000386807" "00385578" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "SEQ;HD" "DNA" "" "SEQ or HD"
"0000386808" "00385579" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "SEQ;HD" "DNA" "" "SEQ or HD"
"0000386811" "00385582" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "SEQ;HD" "DNA" "" "SEQ or HD"
"0000386812" "00385583" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "SEQ;HD" "DNA" "" "SEQ or HD"
"0000386824" "00385595" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "SEQ" "DNA" "" ""
"0000386846" "00385617" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "arraySNP" "DNA" "" "RD-xip"
"0000386847" "00385618" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "SEQ-NG" "DNA" "" "TES"
"0000386864" "00385635" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "arrayCGH;SEQ;TaqMan" "DNA" "" ""
"0000386936" "00385708" "1" "00000" "03840" "2021-10-14 15:38:02" "" "" "SEQ-NG" "DNA" "blood" "Panel 2 containing 316 genes"
"0000387164" "00385936" "1" "00000" "00008" "2021-10-19 12:24:34" "" "" "SEQ" "DNA" "blood" ""
"0000387167" "00385939" "1" "00000" "00008" "2021-10-19 12:24:34" "" "" "SEQ" "DNA" "blood" ""
"0000387171" "00385943" "1" "00000" "00008" "2021-10-19 12:24:34" "" "" "SEQ" "DNA" "blood" ""
"0000387172" "00385944" "1" "00000" "00008" "2021-10-19 12:24:34" "" "" "SEQ" "DNA" "blood" ""
"0000387441" "00386212" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000387457" "00386228" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000387922" "00386694" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" ""
"0000388088" "00386860" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" ""
"0000388774" "00387548" "1" "00000" "00008" "2021-10-29 21:32:58" "" "" "arraySNP;SEQ-NG;PCR" "DNA" "blood" ""
"0000388824" "00387598" "1" "00000" "00008" "2021-10-29 21:32:58" "" "" "SEQ;PCR" "DNA;RNA" "blood" ""
"0000389281" "00388042" "1" "00000" "00008" "2021-11-02 00:52:48" "00008" "2021-11-04 08:55:19" "arraySNP" "DNA" "blood" "BBS-ALMS1 mutation array"
"0000389282" "00388043" "1" "00000" "00008" "2021-11-02 00:52:48" "00008" "2021-11-04 08:55:19" "arraySNP" "DNA" "blood" "BBS-ALMS1 mutation array"
"0000389283" "00388044" "1" "00000" "00008" "2021-11-02 00:52:48" "00008" "2021-11-04 08:55:19" "arraySNP" "DNA" "blood" "BBS-ALMS1 mutation array"
"0000389284" "00388045" "1" "00000" "00008" "2021-11-02 00:52:48" "00008" "2021-11-04 08:55:19" "arraySNP" "DNA" "blood" "BBS-ALMS1 mutation array"
"0000389285" "00388046" "1" "00000" "00008" "2021-11-02 00:52:48" "00008" "2021-11-04 08:55:19" "arraySNP" "DNA" "blood" "BBS-ALMS1 mutation array"
"0000389734" "00388493" "1" "00000" "00008" "2021-11-04 08:27:28" "" "" "SEQ-NG" "DNA" "" "CNV gene panel next-generation sequencing"
"0000389773" "00388531" "1" "00000" "03840" "2021-11-04 13:39:46" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "whole exome sequencing"
"0000390076" "00388833" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper"
"0000390860" "00389617" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper"
"0000392617" "00391375" "1" "00000" "03840" "2021-11-15 18:02:17" "" "" "SEQ-NG" "DNA" "" "retrospective case note review, targeted gene panel testing"
"0000393551" "00392309" "1" "00000" "03840" "2021-11-22 14:12:46" "" "" "SEQ-NG" "DNA" "blood" "whole exome sequencing"
"0000393552" "00392310" "1" "00000" "03840" "2021-11-22 14:12:46" "" "" "SEQ-NG" "DNA" "blood" "whole exome sequencing"
"0000393553" "00392311" "1" "00000" "03840" "2021-11-22 14:12:46" "" "" "SEQ-NG" "DNA" "blood" "whole exome sequencing"
"0000393554" "00392312" "1" "00000" "03840" "2021-11-22 14:12:46" "" "" "SEQ-NG" "DNA" "blood" "whole exome sequencing"
"0000393910" "00392663" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing"
"0000394013" "00392766" "1" "00000" "03840" "2021-11-24 15:01:28" "" "" "SEQ-NG-I" "DNA" "blood" "131 known inherited retinal disease genes"
"0000394014" "00392767" "1" "00000" "03840" "2021-11-24 15:01:28" "" "" "SEQ-NG-I" "DNA" "blood" "131 known inherited retinal disease genes"
"0000394015" "00392768" "1" "00000" "03840" "2021-11-24 15:01:28" "" "" "SEQ-NG-I" "DNA" "blood" "131 known inherited retinal disease genes"
"0000394016" "00392769" "1" "00000" "03840" "2021-11-24 15:01:28" "" "" "SEQ-NG-I" "DNA" "blood" "131 known inherited retinal disease genes"
"0000394017" "00392770" "1" "00000" "03840" "2021-11-24 15:01:28" "" "" "SEQ-NG-I" "DNA" "blood" "131 known inherited retinal disease genes"
"0000394018" "00392771" "1" "00000" "03840" "2021-11-24 15:01:28" "" "" "SEQ-NG-I" "DNA" "blood" "131 known inherited retinal disease genes"
"0000394019" "00392772" "1" "00000" "03840" "2021-11-24 15:01:28" "" "" "SEQ-NG-I" "DNA" "blood" "131 known inherited retinal disease genes"
"0000395725" "00394478" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ-NG" "DNA" "blood" ""
"0000396272" "00395026" "1" "00000" "03840" "2021-12-03 13:19:14" "" "" "SEQ-NG" "DNA" "blood" "115 genes causing different inherited kidney diseases"
"0000396280" "00395034" "1" "00000" "03840" "2021-12-03 13:19:14" "" "" "SEQ-NG" "DNA" "blood" "115 genes causing different inherited kidney diseases"
"0000396818" "00395580" "1" "00000" "03840" "2021-12-08 14:12:08" "" "" "?" "DNA" "" "clinical exome sequencing"
"0000396823" "00395585" "1" "00000" "03840" "2021-12-08 14:12:08" "" "" "?" "DNA" "" "clinical exome sequencing"
"0000397808" "00396565" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ" "DNA" "" ""
"0000401040" "00399797" "1" "00006" "00006" "2022-01-23 12:37:08" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000405506" "00404268" "1" "00006" "00006" "2022-02-28 07:49:03" "" "" "SEQ" "DNA" "" ""
"0000413744" "00412474" "1" "00000" "03840" "2022-06-29 12:08:57" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole-exome sequencing"
"0000413756" "00412486" "1" "00000" "03840" "2022-06-29 13:33:34" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole-exome sequencing"
"0000415679" "00414399" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000415680" "00414400" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000419643" "00418348" "1" "00000" "03840" "2022-09-28 16:46:28" "" "" "STR;SEQ" "DNA" "blood" ""
"0000419935" "00418640" "1" "00006" "00006" "2022-10-03 15:19:00" "" "" "SEQ" "DNA" "" ""
"0000419938" "00418644" "1" "00006" "00006" "2022-10-03 15:24:50" "" "" "SEQ" "DNA" "" ""
"0000419950" "00418656" "1" "00006" "00006" "2022-10-03 16:24:08" "" "" "SEQ" "DNA" "" ""
"0000420826" "00419522" "1" "02300" "00006" "2022-10-20 16:24:48" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000427976" "00426656" "1" "00000" "03840" "2022-12-02 13:36:51" "" "" "?" "DNA" "" ""
"0000431320" "00429907" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431445" "00430032" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000448600" "00447023" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000482300" "00480654" "1" "00006" "00006" "2026-07-06 14:19:51" "" "" "SEQ-NG" "DNA" "" "WES"
"0000484051" "00482403" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel"
"0000484052" "00482404" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel"
"0000484053" "00482405" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel"
"0000484054" "00482406" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel"
"0000484055" "00482407" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel"
"0000484056" "00482408" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel"
"0000484057" "00482409" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel"
"0000484058" "00482410" "1" "00006" "00006" "2026-08-03 15:06:46" "" "" "SEQ;SEQ-NG" "DNA" "" "334-gene panel"
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 302
"{{screeningid}}" "{{geneid}}"
"0000000025" "AMPD1"
"0000000025" "ATP7B"
"0000000025" "ATR"
"0000000025" "CBS"
"0000000025" "CFTR"
"0000000025" "CYP21A2"
"0000000025" "ETFB"
"0000000025" "GLB1"
"0000000025" "HBB"
"0000000025" "IGHMBP2"
"0000000025" "NPHS1"
"0000000025" "PAH"
"0000000025" "SERPINA1"
"0000000025" "SLC26A2"
"0000050382" "BBS2"
"0000096326" "BBS2"
"0000156250" "BBS2"
"0000156251" "BBS2"
"0000156252" "BBS2"
"0000156253" "BBS2"
"0000166071" "BBS2"
"0000234453" "BBS2"
"0000234454" "BBS2"
"0000234455" "BBS2"
"0000234456" "BBS2"
"0000234457" "BBS2"
"0000234458" "BBS2"
"0000234459" "BBS2"
"0000234460" "BBS2"
"0000234461" "BBS2"
"0000234462" "BBS2"
"0000234463" "BBS2"
"0000234464" "BBS2"
"0000234465" "BBS2"
"0000234466" "BBS2"
"0000234467" "BBS2"
"0000234468" "BBS2"
"0000234469" "BBS2"
"0000234470" "BBS2"
"0000234887" "BBS2"
"0000234888" "BBS2"
"0000234889" "BBS2"
"0000277228" "BBS2"
"0000277229" "BBS2"
"0000277230" "BBS2"
"0000300751" "ARHGEF18"
"0000309623" "BBS2"
"0000309624" "BBS2"
"0000309625" "BBS2"
"0000309745" "BBS2"
"0000310103" "BBS2"
"0000310104" "BBS2"
"0000310105" "BBS2"
"0000310107" "BBS2"
"0000310108" "BBS2"
"0000310109" "BBS2"
"0000326643" "BBS2"
"0000332952" "BBS2"
"0000335310" "BBS2"
"0000335311" "BBS2"
"0000335312" "BBS2"
"0000335313" "BBS2"
"0000336488" "BBS2"
"0000360033" "BBS2"
"0000360037" "BBS2"
"0000360037" "BBS4"
"0000360037" "MKKS"
"0000360039" "BBS2"
"0000360039" "NPHP1"
"0000364660" "BBS2"
"0000364662" "BBS2"
"0000364852" "BBS2"
"0000364938" "BBS2"
"0000364959" "BBS2"
"0000373751" "BBS2"
"0000373752" "BBS2"
"0000374725" "BBS2"
"0000374726" "BBS2"
"0000375109" "BBS2"
"0000375118" "BBS2"
"0000376639" "BBS2"
"0000380554" "ARL6"
"0000380554" "BBS1"
"0000380554" "BBS10"
"0000380554" "BBS12"
"0000380554" "BBS2"
"0000380554" "BBS4"
"0000380554" "BBS5"
"0000380554" "BBS7"
"0000380554" "BBS9"
"0000380554" "MKKS"
"0000380554" "TRIM32"
"0000380554" "TTC8"
"0000380555" "ARL6"
"0000380555" "BBS1"
"0000380555" "BBS10"
"0000380555" "BBS12"
"0000380555" "BBS2"
"0000380555" "BBS4"
"0000380555" "BBS5"
"0000380555" "BBS7"
"0000380555" "BBS9"
"0000380555" "MKKS"
"0000380555" "TRIM32"
"0000380555" "TTC8"
"0000381566" "MKS1"
"0000381568" "BBS2"
"0000382942" "BBS2"
"0000383703" "BBS2"
"0000383704" "BBS2"
"0000383705" "BBS2"
"0000383706" "BBS2"
"0000383707" "BBS2"
"0000384097" "BBS2"
"0000384098" "BBS2"
"0000384099" "BBS2"
"0000384100" "BBS2"
"0000384101" "BBS2"
"0000384102" "BBS2"
"0000384103" "BBS2"
"0000384104" "BBS2"
"0000384105" "BBS2"
"0000384106" "BBS2"
"0000384107" "BBS2"
"0000384108" "BBS2"
"0000384109" "BBS2"
"0000384110" "MKKS"
"0000384111" "BBS2"
"0000384112" "MKKS"
"0000384113" "BBS2"
"0000384114" "BBS2"
"0000384115" "BBS2"
"0000384324" "BBS12"
"0000384334" "BBS2"
"0000384353" "BBS2"
"0000384354" "BBS2"
"0000384361" "BBS2"
"0000384371" "BBS2"
"0000384374" "BBS2"
"0000384421" "BBS1"
"0000384421" "BBS2"
"0000384421" "BBS7"
"0000384421" "TTC8"
"0000384446" "BBS2"
"0000384447" "BBS2"
"0000384448" "BBS2"
"0000384449" "BBS7"
"0000384450" "BBS2"
"0000384451" "BBS2"
"0000384452" "BBS2"
"0000384508" "BBS10"
"0000384510" "MKKS"
"0000384513" "BBS2"
"0000384516" "BBS2"
"0000384520" "MKKS"
"0000384521" "BBS2"
"0000384523" "BBS2"
"0000384524" "BBS12"
"0000384525" "BBS12"
"0000384528" "BBS2"
"0000384531" "BBS2"
"0000384532" "BBS2"
"0000384533" "BBS2"
"0000384534" "BBS2"
"0000384535" "BBS2"
"0000384536" "BBS2"
"0000384555" "BBS1"
"0000384556" "BBS1"
"0000384558" "BBS2"
"0000384559" "BBS2"
"0000384560" "BBS2"
"0000384562" "BBS2"
"0000384565" "BBS2"
"0000384572" "BBS2"
"0000384573" "BBS2"
"0000384582" "BBS2"
"0000384583" "BBS2"
"0000384589" "BBS1"
"0000384592" "BBS2"
"0000384593" "BBS2"
"0000384594" "BBS2"
"0000384595" "BBS2"
"0000384596" "BBS2"
"0000384597" "BBS4"
"0000384598" "MKKS"
"0000384600" "BBS2"
"0000384601" "BBS2"
"0000384634" "BBS2"
"0000384877" "BBS2"
"0000384880" "BBS2"
"0000384887" "BBS4"
"0000385218" "BBS2"
"0000385307" "BBS2"
"0000385408" "BBS2"
"0000385409" "BBS2"
"0000385475" "BBS2"
"0000385485" "BBS2"
"0000385520" "BBS2"
"0000385521" "BBS2"
"0000385866" "BBS2"
"0000385958" "BBS12"
"0000385959" "BBS12"
"0000386038" "BBS4"
"0000386039" "BBS1"
"0000386055" "BBS2"
"0000386058" "BBS12"
"0000386059" "BBS12"
"0000386062" "BBS10"
"0000386065" "BBS4"
"0000386254" "BBS2"
"0000386382" "BBS2"
"0000386407" "BBS1"
"0000386412" "BBS2"
"0000386442" "BBS2"
"0000386443" "BBS2"
"0000386444" "BBS2"
"0000386445" "BBS2"
"0000386453" "BBS2"
"0000386463" "BBS2"
"0000386467" "BBS2"
"0000386492" "BBS2"
"0000386510" "BBS2"
"0000386511" "BBS2"
"0000386529" "BBS2"
"0000386560" "BBS7"
"0000386561" "BBS4"
"0000386562" "BBS2"
"0000386563" "BBS2"
"0000386564" "BBS2"
"0000386565" "BBS2"
"0000386566" "BBS1"
"0000386567" "BBS2"
"0000386568" "BBS2"
"0000386569" "BBS2"
"0000386570" "BBS2"
"0000386609" "BBS4"
"0000386674" "CC2D2A"
"0000386783" "BBS2"
"0000386784" "BBS2"
"0000386785" "BBS2"
"0000386790" "BBS2"
"0000386792" "BBS2"
"0000386793" "BBS2"
"0000386807" "BBS2"
"0000386808" "BBS2"
"0000386811" "BBS2"
"0000386812" "BBS2"
"0000386824" "BBS2"
"0000386846" "RD3"
"0000386847" "BBS2"
"0000386864" "BBS2"
"0000386936" "BBS2"
"0000387164" "BBS2"
"0000387167" "BBS2"
"0000387171" "BBS2"
"0000387172" "BBS2"
"0000387441" "CNGB3"
"0000387457" "BBS2"
"0000387922" "BBS2"
"0000388088" "BBS2"
"0000388774" "BBS2"
"0000388824" "BBS2"
"0000389281" "BBS2"
"0000389282" "BBS2"
"0000389283" "BBS2"
"0000389284" "BBS2"
"0000389285" "BBS10"
"0000389734" "BBS2"
"0000389773" "BBS2"
"0000390076" "BBS2"
"0000390860" "BBS2"
"0000392617" "BBS2"
"0000393551" "BBS2"
"0000393552" "BBS2"
"0000393553" "BBS2"
"0000393554" "BBS2"
"0000393910" "BBS2"
"0000394013" "BBS2"
"0000394014" "BBS2"
"0000394015" "BBS2"
"0000394016" "BBS2"
"0000394017" "BBS2"
"0000394018" "BBS2"
"0000394019" "BBS2"
"0000395725" "BBS2"
"0000396272" "BBS2"
"0000396280" "BBS2"
"0000396818" "BBS2"
"0000396823" "BBS2"
"0000397808" "BBS2"
"0000405506" "BBS2"
"0000413744" "BBS1"
"0000413756" "BBS1"
"0000415679" "BBS2"
"0000415680" "BBS2"
"0000419643" "BBS4"
"0000419935" "BBS2"
"0000419938" "BBS2"
"0000419950" "BBS2"
"0000427976" "BBS2"
"0000431320" "BBS2"
"0000431445" "BBS2"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 464
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000019535" "0" "55" "16" "56545071" "56545071" "subst" "4.06385E-6" "00102" "BBS2_000060" "g.56545071C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.56511159C>T" "" "VUS" ""
"0000036432" "3" "55" "16" "56530894" "56530894" "subst" "0.000117773" "00552" "BBS2_000022" "g.56530894C>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.56496982C>G" "" "VUS" ""
"0000079362" "11" "90" "16" "56545126" "56545126" "subst" "0" "00006" "BBS2_000061" "g.56545126C>T" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "Germline" "" "" "0" "" "" "g.56511214C>T" "" "pathogenic" ""
"0000079654" "21" "90" "16" "56548535" "56548535" "subst" "2.43685E-5" "00006" "BBS2_000036" "g.56548535G>A" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "Germline" "" "" "0" "" "" "g.56514623G>A" "" "pathogenic" ""
"0000158319" "3" "90" "16" "56534926" "56534926" "subst" "1.62433E-5" "01769" "BBS2_000024" "g.56534926G>A" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "" "" "g.56501014G>A" "" "pathogenic" ""
"0000170885" "3" "70" "16" "56548376" "56548376" "subst" "8.12387E-6" "01244" "BBS2_000062" "g.56548376A>G" "" "{PMID:de Castro-Miró 2016:28005958}" "" "" "" "Germline" "" "" "0" "" "" "g.56514464A>G" "" "VUS" "ACMG"
"0000247370" "0" "10" "16" "56545188" "56545188" "subst" "1.21965E-5" "02330" "BBS2_000082" "g.56545188A>G" "" "" "" "BBS2(NM_031885.3):c.354T>C (p.D118=), BBS2(NM_031885.5):c.354T>C (p.D118=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56511276A>G" "" "benign" ""
"0000254259" "0" "30" "16" "56535380" "56535380" "subst" "0.000925866" "01943" "BBS2_000073" "g.56535380A>G" "" "" "" "BBS2(NM_031885.3):c.1110T>C (p.A370=), BBS2(NM_031885.5):c.1110T>C (p.A370=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56501468A>G" "" "likely benign" ""
"0000256308" "0" "50" "16" "56540114" "56540114" "subst" "0" "01943" "BBS2_000079" "g.56540114A>C" "" "" "" "BBS2(NM_031885.3):c.635T>G (p.M212R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56506202A>C" "" "VUS" ""
"0000258596" "0" "10" "16" "56535386" "56535386" "subst" "0.000170554" "02330" "BBS2_000074" "g.56535386G>A" "" "" "" "BBS2(NM_031885.5):c.1104C>T (p.N368=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56501474G>A" "" "benign" ""
"0000258597" "0" "10" "16" "56533795" "56533795" "subst" "0.00224583" "02330" "BBS2_000070" "g.56533795C>T" "" "" "" "BBS2(NM_031885.3):c.1422G>A (p.S474=), BBS2(NM_031885.5):c.1422G>A (p.S474=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56499883C>T" "" "benign" ""
"0000258598" "0" "50" "16" "56533763" "56533763" "subst" "9.34033E-5" "02330" "BBS2_000069" "g.56533763G>A" "" "" "" "BBS2(NM_031885.5):c.1454C>T (p.A485V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56499851G>A" "" "VUS" ""
"0000258599" "0" "10" "16" "56518760" "56518760" "subst" "0.00147524" "02330" "BBS2_000063" "g.56518760C>T" "" "" "" "BBS2(NM_031885.5):c.2079G>A (p.Q693=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56484848C>T" "" "benign" ""
"0000258600" "0" "30" "16" "56536740" "56536740" "subst" "0.00406511" "02330" "BBS2_000078" "g.56536740T>C" "" "" "" "BBS2(NM_031885.3):c.805-20A>G (p.(=)), BBS2(NM_031885.5):c.805-20A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56502828T>C" "" "likely benign" ""
"0000259231" "0" "10" "16" "56548501" "56548501" "subst" "0.994128" "02325" "BBS2_000084" "g.56548501C>T" "" "" "" "BBS2(NM_031885.3):c.209G>A (p.S70N), BBS2(NM_031885.5):c.209G>A (p.(Ser70Asn), p.S70N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56514589C>T" "" "benign" ""
"0000259789" "0" "90" "16" "56536711" "56536711" "subst" "1.21893E-5" "02325" "BBS2_000077" "g.56536711G>A" "" "" "" "BBS2(NM_031885.5):c.814C>T (p.R272*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56502799G>A" "" "pathogenic" ""
"0000261406" "0" "10" "16" "56533706" "56533706" "subst" "0.00486923" "02326" "BBS2_000068" "g.56533706G>A" "" "" "" "BBS2(NM_031885.3):c.1511C>T (p.A504V, p.(Ala504Val)), BBS2(NM_031885.5):c.1511C>T (p.A504V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56499794G>A" "" "benign" ""
"0000261407" "0" "10" "16" "56532346" "56532346" "subst" "0.00895579" "02326" "BBS2_000067" "g.56532346T>C" "" "" "" "BBS2(NM_031885.3):c.1659+3A>G, BBS2(NM_031885.5):c.1659+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56498434T>C" "" "benign" ""
"0000261408" "0" "10" "16" "56548501" "56548501" "subst" "0.994128" "02326" "BBS2_000084" "g.56548501C>T" "" "" "" "BBS2(NM_031885.3):c.209G>A (p.S70N), BBS2(NM_031885.5):c.209G>A (p.(Ser70Asn), p.S70N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56514589C>T" "" "benign" ""
"0000261409" "0" "30" "16" "56536740" "56536740" "subst" "0.00406511" "02326" "BBS2_000078" "g.56536740T>C" "" "" "" "BBS2(NM_031885.3):c.805-20A>G (p.(=)), BBS2(NM_031885.5):c.805-20A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56502828T>C" "" "likely benign" ""
"0000261410" "0" "30" "16" "56536660" "56536660" "subst" "0.00886243" "02326" "BBS2_000076" "g.56536660T>C" "" "" "" "BBS2(NM_031885.5):c.865A>G (p.I289V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56502748T>C" "" "likely benign" ""
"0000263575" "0" "30" "16" "56535333" "56535333" "subst" "0.000215214" "01943" "BBS2_000072" "g.56535333G>A" "" "" "" "BBS2(NM_031885.3):c.1157C>T (p.T386M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56501421G>A" "" "likely benign" ""
"0000263576" "0" "30" "16" "56533804" "56533804" "subst" "0.0140064" "01943" "BBS2_000071" "g.56533804T>G" "" "" "" "BBS2(NM_031885.3):c.1413A>C (p.V471=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56499892T>G" "" "likely benign" ""
"0000263577" "0" "30" "16" "56533795" "56533795" "subst" "0.00224583" "01943" "BBS2_000070" "g.56533795C>T" "" "" "" "BBS2(NM_031885.3):c.1422G>A (p.S474=), BBS2(NM_031885.5):c.1422G>A (p.S474=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56499883C>T" "" "likely benign" ""
"0000263578" "0" "10" "16" "56533706" "56533706" "subst" "0.00486923" "01943" "BBS2_000068" "g.56533706G>A" "" "" "" "BBS2(NM_031885.3):c.1511C>T (p.A504V, p.(Ala504Val)), BBS2(NM_031885.5):c.1511C>T (p.A504V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56499794G>A" "" "benign" ""
"0000263579" "0" "10" "16" "56532346" "56532346" "subst" "0.00895579" "01943" "BBS2_000067" "g.56532346T>C" "" "" "" "BBS2(NM_031885.3):c.1659+3A>G, BBS2(NM_031885.5):c.1659+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56498434T>C" "" "benign" ""
"0000263580" "0" "10" "16" "56548501" "56548501" "subst" "0.994128" "01943" "BBS2_000084" "g.56548501C>T" "" "" "" "BBS2(NM_031885.3):c.209G>A (p.S70N), BBS2(NM_031885.5):c.209G>A (p.(Ser70Asn), p.S70N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56514589C>T" "" "benign" ""
"0000263581" "0" "50" "16" "56536339" "56536339" "subst" "0.000113741" "01943" "BBS2_000075" "g.56536339T>A" "" "" "" "BBS2(NM_031885.3):c.970A>T (p.M324L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56502427T>A" "" "VUS" ""
"0000324799" "0" "50" "16" "56519604" "56519604" "subst" "3.65818E-5" "01804" "BBS2_000064" "g.56519604C>G" "" "" "" "BBS2(NM_031885.3):c.1957G>C (p.(Asp653His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56485692C>G" "" "VUS" ""
"0000324801" "0" "50" "16" "56545141" "56545141" "subst" "3.24939E-5" "01804" "BBS2_000081" "g.56545141G>C" "" "" "" "BBS2(NM_031885.3):c.401C>G (p.(Pro134Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56511229G>C" "" "VUS" ""
"0000338403" "0" "10" "16" "56553814" "56553814" "subst" "0.0678708" "02327" "BBS2_000091" "g.56553814A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56519902A>G" "" "benign" ""
"0000338404" "0" "10" "16" "56553816" "56553816" "subst" "0.0677756" "02327" "BBS2_000092" "g.56553816A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56519904A>C" "" "benign" ""
"0000338405" "0" "10" "16" "56553999" "56553999" "subst" "0" "02327" "BBS2_000093" "g.56553999G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56520087G>A" "" "benign" ""
"0000338406" "0" "10" "16" "56554092" "56554092" "subst" "0" "02327" "OGFOD1_000019" "g.56554092G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56520180G>C" "" "benign" ""
"0000340245" "0" "10" "16" "56554118" "56554118" "subst" "0" "02327" "OGFOD1_000020" "g.56554118T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56520206T>C" "" "benign" ""
"0000342348" "0" "90" "16" "56540049" "56540049" "subst" "2.84548E-5" "02327" "BBS2_000088" "g.56540049G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56506137G>A" "" "pathogenic" ""
"0000342499" "0" "90" "16" "56536711" "56536711" "subst" "1.21893E-5" "02327" "BBS2_000077" "g.56536711G>A" "" "" "" "BBS2(NM_031885.5):c.814C>T (p.R272*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56502799G>A" "" "pathogenic" ""
"0000342506" "0" "90" "16" "56536702" "56536702" "subst" "0.00020312" "02327" "BBS2_000087" "g.56536702G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56502790G>A" "" "pathogenic" ""
"0000346561" "0" "10" "16" "56545175" "56545175" "subst" "0.213698" "02327" "BBS2_000089" "g.56545175T>C" "" "" "" "BBS2(NM_031885.3):c.367A>G (p.I123V), BBS2(NM_031885.5):c.367A>G (p.I123V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56511263T>C" "" "benign" ""
"0000347537" "0" "50" "16" "56536276" "56536276" "subst" "4.06217E-6" "02327" "BBS2_000086" "g.56536276T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56502364T>G" "" "VUS" ""
"0000347707" "0" "90" "16" "56553773" "56553773" "subst" "0" "02327" "BBS2_000090" "g.56553773A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56519861A>C" "" "pathogenic" ""
"0000349146" "0" "10" "16" "56548501" "56548501" "subst" "0.994128" "02327" "BBS2_000084" "g.56548501C>T" "" "" "" "BBS2(NM_031885.3):c.209G>A (p.S70N), BBS2(NM_031885.5):c.209G>A (p.(Ser70Asn), p.S70N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.56514589C>T" "" "benign" ""
"0000358172" "3" "90" "16" "56530894" "56530894" "subst" "0.000117773" "01243" "BBS2_000022" "g.56530894C>G" "" "{PMID:Shevach 2015:25541840}" "" "" "" "Germline" "" "" "0" "" "" "g.56496982C>G" "" "pathogenic (recessive)" ""
"0000358173" "0" "90" "16" "56530894" "56530894" "subst" "0.000117773" "01243" "BBS2_000022" "g.56530894C>G" "" "{PMID:Shevach 2015:25541840}, {PMID:Kimchi 2018:29276052}, {PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "g.56496982C>G" "" "pathogenic (recessive)" ""
"0000358174" "3" "90" "16" "56548399" "56548399" "subst" "4.46722E-5" "01243" "BBS2_000094" "g.56548399T>G" "" "{PMID:Shevach 2015:25541840}, {PMID:Kimchi 2018:29276052}, {PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "g.56514487T>G" "" "pathogenic (recessive)" ""
"0000358175" "0" "90" "16" "56545141" "56545141" "subst" "3.24939E-5" "01243" "BBS2_000081" "g.56545141G>C" "" "{PMID:Shevach 2015:25541840}" "" "" "" "Germline" "" "" "0" "" "" "g.56511229G>C" "" "pathogenic (recessive)" ""
"0000358412" "0" "90" "16" "56548399" "56548399" "subst" "4.46722E-5" "01243" "BBS2_000094" "g.56548399T>G" "" "{PMID:Shevach 2015:25541840}, {PMID:Kimchi 2018:29276052}, {PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "g.56514487T>G" "" "pathogenic (recessive)" ""
"0000358413" "0" "90" "16" "56553677" "56553677" "subst" "8.20789E-6" "01243" "BBS2_000095" "g.56553677G>T" "" "{PMID:Shevach 2015:25541840}" "" "" "" "Germline" "" "" "0" "" "" "g.56519765G>T" "" "pathogenic (recessive)" ""
"0000369938" "0" "90" "16" "56530965" "56530966" "del" "0" "01741" "BBS2_000096" "g.56530965_56530966del" "" "" "" "1824_1825delGA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.56497053_56497054del" "" "pathogenic" ""
"0000477161" "0" "50" "16" "56519627" "56519627" "subst" "8.1322E-6" "02591" "BBS2_000097" "g.56519627A>G" "7/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs757737589" "0" "" "" "g.56485715A>G" "" "VUS" ""
"0000477162" "0" "50" "16" "56530901" "56530901" "subst" "0" "02591" "BBS2_000098" "g.56530901C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.56496989C>T" "" "VUS" ""
"0000477163" "0" "90" "16" "56531779" "56531779" "subst" "4.10799E-6" "02591" "BBS2_000099" "g.56531779G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs370581600" "0" "" "" "g.56497867G>A" "" "pathogenic" ""
"0000477164" "0" "50" "16" "56532410" "56532410" "subst" "8.12434E-6" "02591" "BBS2_000100" "g.56532410A>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.56498498A>T" "" "VUS" ""
"0000477165" "0" "50" "16" "56533731" "56533731" "subst" "6.09147E-5" "02591" "BBS2_000101" "g.56533731T>C" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs549070573" "0" "" "" "g.56499819T>C" "" "VUS" ""
"0000477166" "0" "90" "16" "56534887" "56534887" "subst" "0" "02591" "BBS2_000102" "g.56534887C>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.56500975C>A" "" "pathogenic" ""
"0000477167" "0" "50" "16" "56535270" "56535270" "subst" "1.21819E-5" "02591" "BBS2_000103" "g.56535270G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.56501358G>A" "" "VUS" ""
"0000477168" "3" "90" "16" "56536366" "56536366" "subst" "1.62532E-5" "02591" "BBS2_000104" "g.56536366G>A" "1/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs121908178" "0" "" "" "g.56502454G>A" "" "pathogenic" ""
"0000477169" "0" "50" "16" "56536614" "56536614" "subst" "0" "02591" "BBS2_000105" "g.56536614T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.56502702T>C" "" "VUS" ""
"0000477170" "0" "10" "16" "56536660" "56536660" "subst" "0.00886243" "02591" "BBS2_000076" "g.56536660T>C" "19/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs150384293" "0" "" "" "g.56502748T>C" "" "benign" ""
"0000477171" "0" "50" "16" "56536701" "56536701" "subst" "8.12414E-6" "02591" "BBS2_000106" "g.56536701C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs150572808" "0" "" "" "g.56502789C>T" "" "VUS" ""
"0000477172" "0" "90" "16" "56536711" "56536711" "subst" "1.21893E-5" "02591" "BBS2_000077" "g.56536711G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs764164384" "0" "" "" "g.56502799G>A" "" "pathogenic" ""
"0000477173" "0" "90" "16" "56539874" "56539874" "subst" "0" "02591" "BBS2_000107" "g.56539874C>T" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.56505962C>T" "" "pathogenic" ""
"0000477174" "0" "50" "16" "56545135" "56545135" "subst" "8.12401E-6" "02591" "BBS2_000108" "g.56545135G>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs373166163" "0" "" "" "g.56511223G>T" "" "VUS" ""
"0000477175" "0" "10" "16" "56545175" "56545175" "subst" "0.213698" "02591" "BBS2_000089" "g.56545175T>C" "600/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs11373" "0" "" "" "g.56511263T>C" "" "benign" ""
"0000477176" "0" "50" "16" "56548501" "56548501" "subst" "0.994128" "02591" "BBS2_000084" "g.56548501C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Germline" "" "rs4784677" "0" "" "" "" "" "VUS" ""
"0000477177" "0" "50" "16" "56553689" "56553689" "subst" "2.04814E-5" "02591" "BBS2_000109" "g.56553689G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs771211831" "0" "" "" "g.56519777G>A" "" "VUS" ""
"0000477178" "0" "50" "16" "56553774" "56553774" "subst" "1.63499E-5" "02591" "BBS2_000110" "g.56553774T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs753338961" "0" "" "" "g.56519862T>C" "" "VUS" ""
"0000477595" "3" "10" "16" "56536660" "56536660" "subst" "0.00886243" "02591" "BBS2_000076" "g.56536660T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs150384293" "0" "" "" "g.56502748T>C" "" "benign" ""
"0000477596" "3" "10" "16" "56545175" "56545175" "subst" "0.213698" "02591" "BBS2_000089" "g.56545175T>C" "207/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs11373" "0" "" "" "g.56511263T>C" "" "benign" ""
"0000477597" "3" "50" "16" "56548501" "56548501" "subst" "0.994128" "02591" "BBS2_000084" "g.56548501C>T" "1203/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "Variant Error [EMISMATCH/EREF]: This transcript variant does not match the reference sequence. Please fix this entry and then remove this message." "Germline" "" "rs4784677" "0" "" "" "" "" "VUS" ""
"0000558486" "0" "30" "16" "56518688" "56518688" "subst" "0" "01943" "OGFOD1_000003" "g.56518688C>T" "" "" "" "BBS2(NM_031885.3):c.2151G>A (p.G717=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56484776C>T" "" "likely benign" ""
"0000558489" "0" "50" "16" "56519579" "56519579" "subst" "3.65726E-5" "02325" "OGFOD1_000006" "g.56519579C>T" "" "" "" "BBS2(NM_031885.5):c.1982G>A (p.R661H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56485667C>T" "" "VUS" ""
"0000558491" "0" "50" "16" "56530981" "56530981" "subst" "1.21855E-5" "01943" "OGFOD1_000008" "g.56530981T>C" "" "" "" "BBS2(NM_031885.3):c.1808A>G (p.Y603C, p.(Tyr603Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56497069T>C" "" "VUS" ""
"0000558492" "0" "30" "16" "56530981" "56530981" "subst" "1.21855E-5" "01804" "OGFOD1_000008" "g.56530981T>C" "" "" "" "BBS2(NM_031885.3):c.1808A>G (p.Y603C, p.(Tyr603Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56497069T>C" "" "likely benign" ""
"0000558493" "0" "50" "16" "56531770" "56531770" "subst" "4.50425E-5" "01943" "OGFOD1_000009" "g.56531770A>G" "" "" "" "BBS2(NM_031885.3):c.1682T>C (p.I561T), BBS2(NM_031885.5):c.1682T>C (p.(Ile561Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56497858A>G" "" "VUS" ""
"0000558494" "0" "50" "16" "56533694" "56533694" "subst" "0.000178686" "02330" "OGFOD1_000010" "g.56533694T>G" "" "" "" "BBS2(NM_031885.3):c.1523A>C (p.Q508P), BBS2(NM_031885.5):c.1523A>C (p.Q508P, p.(Gln508Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56499782T>G" "" "VUS" ""
"0000558496" "0" "30" "16" "56533706" "56533706" "subst" "0.00486923" "01804" "BBS2_000068" "g.56533706G>A" "" "" "" "BBS2(NM_031885.3):c.1511C>T (p.A504V, p.(Ala504Val)), BBS2(NM_031885.5):c.1511C>T (p.A504V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56499794G>A" "" "likely benign" ""
"0000558498" "0" "30" "16" "56533830" "56533830" "subst" "4.06114E-6" "02330" "OGFOD1_000011" "g.56533830T>C" "" "" "" "BBS2(NM_031885.5):c.1398-11A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56499918T>C" "" "likely benign" ""
"0000558499" "0" "30" "16" "56534783" "56534783" "subst" "0.000881268" "01943" "OGFOD1_000012" "g.56534783G>A" "" "" "" "BBS2(NM_031885.3):c.1380C>T (p.F460=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56500871G>A" "" "likely benign" ""
"0000558500" "0" "10" "16" "56535356" "56535356" "subst" "0.000905547" "02330" "OGFOD1_000013" "g.56535356T>C" "" "" "" "BBS2(NM_031885.3):c.1134A>G (p.P378=), BBS2(NM_031885.5):c.1134A>G (p.P378=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56501444T>C" "" "benign" ""
"0000558501" "0" "10" "16" "56535356" "56535356" "subst" "0.000905547" "02326" "OGFOD1_000013" "g.56535356T>C" "" "" "" "BBS2(NM_031885.3):c.1134A>G (p.P378=), BBS2(NM_031885.5):c.1134A>G (p.P378=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56501444T>C" "" "benign" ""
"0000558502" "0" "10" "16" "56536376" "56536376" "subst" "2.03216E-5" "02330" "OGFOD1_000014" "g.56536376G>C" "" "" "" "BBS2(NM_031885.5):c.941-8C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56502464G>C" "" "benign" ""
"0000558503" "0" "30" "16" "56536580" "56536580" "subst" "0" "02330" "OGFOD1_000015" "g.56536580T>C" "" "" "" "BBS2(NM_031885.5):c.940+5A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56502668T>C" "" "likely benign" ""
"0000558506" "0" "10" "16" "56543857" "56543857" "subst" "0.00410239" "01943" "OGFOD1_000017" "g.56543857G>T" "" "" "" "BBS2(NM_031885.3):c.612+12C>A, BBS2(NM_031885.5):c.612+12C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56509945G>T" "" "benign" ""
"0000558507" "0" "10" "16" "56543857" "56543857" "subst" "0.00410239" "02326" "OGFOD1_000017" "g.56543857G>T" "" "" "" "BBS2(NM_031885.3):c.612+12C>A, BBS2(NM_031885.5):c.612+12C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56509945G>T" "" "benign" ""
"0000558508" "0" "30" "16" "56544760" "56544760" "subst" "0" "02330" "OGFOD1_000018" "g.56544760C>A" "" "" "" "BBS2(NM_031885.5):c.534+11G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56510848C>A" "" "likely benign" ""
"0000558509" "0" "10" "16" "56544843" "56544843" "subst" "0.000527906" "02330" "BBS2_000080" "g.56544843A>G" "" "" "" "BBS2(NM_031885.3):c.472-10T>C, BBS2(NM_031885.5):c.472-10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56510931A>G" "" "benign" ""
"0000558510" "0" "10" "16" "56545175" "56545175" "subst" "0.213698" "01943" "BBS2_000089" "g.56545175T>C" "" "" "" "BBS2(NM_031885.3):c.367A>G (p.I123V), BBS2(NM_031885.5):c.367A>G (p.I123V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56511263T>C" "" "benign" ""
"0000558511" "0" "10" "16" "56545175" "56545175" "subst" "0.213698" "02325" "BBS2_000089" "g.56545175T>C" "" "" "" "BBS2(NM_031885.3):c.367A>G (p.I123V), BBS2(NM_031885.5):c.367A>G (p.I123V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56511263T>C" "" "benign" ""
"0000623491" "0" "30" "16" "56531002" "56531002" "subst" "5.28116E-5" "02330" "OGFOD1_000021" "g.56531002T>C" "" "" "" "BBS2(NM_031885.5):c.1798-11A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56497090T>C" "" "likely benign" ""
"0000624990" "3" "70" "16" "56545141" "56545141" "subst" "3.24939E-5" "01848" "BBS2_000081" "g.56545141G>C" "" "{PMID:Karali 2019:31877679}, {DOI:Karali 2019:10.3390/ijms21010086}" "" "" "" "Germline" "" "" "0" "" "" "g.56511229G>C" "" "likely pathogenic (recessive)" "ACMG"
"0000631994" "3" "90" "16" "56530894" "56530894" "subst" "0.000117773" "00006" "BBS2_000022" "g.56530894C>G" "" "{PMID:Shevach 2015:25541840}" "" "" "" "Germline" "yes" "" "0" "" "" "g.56496982C>G" "" "pathogenic (recessive)" ""
"0000631995" "11" "90" "16" "56530894" "56530894" "subst" "0.000117773" "00006" "BBS2_000022" "g.56530894C>G" "" "{PMID:Shevach 2015:25541840}" "" "" "" "Germline" "" "" "0" "" "" "g.56496982C>G" "" "pathogenic (recessive)" ""
"0000631996" "1" "90" "16" "56530894" "56530894" "subst" "0.000117773" "00006" "BBS2_000022" "g.56530894C>G" "" "{PMID:Shevach 2015:25541840}" "" "" "" "Germline" "" "" "0" "" "" "g.56496982C>G" "" "pathogenic (recessive)" ""
"0000631997" "2" "90" "16" "56553677" "56553677" "subst" "8.20789E-6" "00006" "BBS2_000095" "g.56553677G>T" "" "{PMID:Shevach 2015:25541840}" "" "" "" "Germline" "" "" "0" "" "" "g.56519765G>T" "" "pathogenic (recessive)" ""
"0000649350" "1" "70" "16" "56536294" "56536294" "subst" "0" "03575" "BBS2_000111" "g.56536294G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs193922710}" "Germline" "" "rs193922710" "0" "" "" "g.56502382G>A" "" "likely pathogenic" ""
"0000657872" "0" "90" "16" "56530925" "56530925" "subst" "2.84326E-5" "02327" "OGFOD1_000022" "g.56530925G>A" "" "" "" "BBS2(NM_031885.3):c.1864C>T (p.R622*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56497013G>A" "" "pathogenic" ""
"0000657873" "0" "50" "16" "56534782" "56534782" "subst" "5.27975E-5" "01943" "OGFOD1_000023" "g.56534782C>T" "" "" "" "BBS2(NM_031885.3):c.1381G>A (p.V461M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56500870C>T" "" "VUS" ""
"0000657874" "0" "50" "16" "56536315" "56536315" "subst" "8.1248E-6" "01943" "OGFOD1_000024" "g.56536315T>A" "" "" "" "BBS2(NM_031885.3):c.994A>T (p.S332C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56502403T>A" "" "VUS" ""
"0000657875" "0" "50" "16" "56540039" "56540039" "subst" "8.12902E-6" "01943" "OGFOD1_000025" "g.56540039C>T" "" "" "" "BBS2(NM_031885.3):c.710G>A (p.R237K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.56506127C>T" "" "VUS" ""
"0000663591" "1" "50" "16" "56534932" "56534932" "subst" "0" "00006" "BBS2_000112" "g.56534932T>C" "" "{PMID:Arno 2017:28132693}" "" "" "heterozygous variant only, does not fit phenotype" "Germline" "" "" "0" "" "" "g.56501020T>C" "" "VUS" ""
"0000680605" "0" "10" "16" "56533795" "56533795" "subst" "0.00224583" "02326" "BBS2_000070" "g.56533795C>T" "" "" "" "BBS2(NM_031885.3):c.1422G>A (p.S474=), BBS2(NM_031885.5):c.1422G>A (p.S474=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000680606" "0" "30" "16" "56544843" "56544843" "subst" "0.000527906" "02326" "BBS2_000080" "g.56544843A>G" "" "" "" "BBS2(NM_031885.3):c.472-10T>C, BBS2(NM_031885.5):c.472-10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000680607" "0" "30" "16" "56548383" "56548383" "subst" "1.62466E-5" "01943" "OGFOD1_000026" "g.56548383C>T" "" "" "" "BBS2(NM_031885.3):c.327G>A (p.S109=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000684496" "1" "70" "16" "56548501" "56548501" "subst" "0" "00004" "BBS2_000114" "g.56548501T>C" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000684497" "1" "70" "16" "56536702" "56536702" "subst" "0.00020312" "00004" "BBS2_000087" "g.56536702G>A" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000684498" "1" "70" "16" "56530925" "56530925" "subst" "2.84326E-5" "00004" "OGFOD1_000022" "g.56530925G>A" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000684618" "3" "70" "16" "56548501" "56548501" "subst" "0" "00004" "BBS2_000114" "g.56548501T>C" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000685014" "0" "90" "16" "56530894" "56530894" "subst" "0.000117773" "00004" "BBS2_000022" "g.56530894C>G" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000685015" "0" "90" "16" "56530894" "56530894" "subst" "0.000117773" "00004" "BBS2_000022" "g.56530894C>G" "3/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000685016" "0" "70" "16" "56545141" "56545141" "subst" "3.24939E-5" "00004" "BBS2_000081" "g.56545141G>C" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000685018" "0" "90" "16" "56548399" "56548399" "subst" "4.46722E-5" "00004" "BBS2_000094" "g.56548399T>G" "3/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000685019" "0" "90" "16" "56548486" "56548486" "subst" "4.06101E-6" "00004" "BBS2_000113" "g.56548486A>C" "3/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000685020" "0" "70" "16" "56553677" "56553677" "subst" "8.20789E-6" "00004" "BBS2_000095" "g.56553677G>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000710235" "1" "50" "16" "56548567" "56548567" "subst" "8.12651E-6" "00006" "BBS2_000115" "g.56548567C>T" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.56514655C>T" "" "VUS" ""
"0000725847" "0" "90" "16" "56519575" "56519575" "dup" "0" "02329" "OGFOD1_000005" "g.56519575dup" "" "" "" "BBS2(NM_031885.5):c.1986dupT (p.N663*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000725848" "0" "90" "16" "56519630" "56519630" "dup" "0" "02330" "OGFOD1_000007" "g.56519630dup" "" "" "" "BBS2(NM_031885.5):c.1931dupA (p.Y644*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000725849" "0" "50" "16" "56530910" "56530910" "subst" "5.68625E-5" "01943" "OGFOD1_000027" "g.56530910C>T" "" "" "" "BBS2(NM_031885.3):c.1879G>A (p.G627R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000725850" "0" "50" "16" "56531786" "56531786" "subst" "4.11882E-5" "01943" "BBS2_000066" "g.56531786T>C" "" "" "" "BBS2(NM_031885.3):c.1666A>G (p.I556V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000725852" "0" "50" "16" "56543881" "56543881" "subst" "0" "01943" "OGFOD1_000028" "g.56543881C>A" "" "" "" "BBS2(NM_031885.3):c.600G>T (p.M200I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000725853" "0" "50" "16" "56548526" "56548526" "subst" "8.12262E-6" "01943" "OGFOD1_000029" "g.56548526G>C" "" "" "" "BBS2(NM_031885.3):c.184C>G (p.L62V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000730339" "1" "90" "16" "56545071" "56545071" "subst" "4.06385E-6" "00000" "BBS2_000060" "g.56545071C>T" "" "{PMID:Sanchez-Navarro 2018:29588463}" "" "" "" "Germline" "" "" "0" "" "" "g.56511159C>T" "" "pathogenic (recessive)" ""
"0000730359" "2" "90" "16" "56534926" "56534926" "subst" "1.62433E-5" "00000" "BBS2_000024" "g.56534926G>A" "" "{PMID:Sanchez-Navarro 2018:29588463}" "" "" "" "Germline" "" "" "0" "" "" "g.56501014G>A" "" "pathogenic (recessive)" ""
"0000730372" "0" "50" "11" "68705674" "68705674" "subst" "0.263666" "00002" "IGHMBP2_000003" "g.68705674C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.68938206C>A" "" "VUS" ""
"0000733319" "1" "70" "16" "56544783" "56544783" "subst" "1.21826E-5" "00000" "BBS2_000117" "g.56544783A>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.56510871A>T" "" "likely pathogenic" ""
"0000733320" "3" "70" "16" "56540031" "56540031" "subst" "0" "00000" "BBS2_000116" "g.56540031C>A" "" "{PMID:Stone 2017:28559085}" "" "IVS6+1G>T" "" "Germline" "" "" "0" "" "" "g.56506119C>A" "" "likely pathogenic" ""
"0000733321" "1" "70" "16" "56553703" "56553703" "subst" "4.50126E-5" "00000" "BBS2_000119" "g.56553703G>C" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.56519791G>C" "" "likely pathogenic" ""
"0000733322" "1" "70" "16" "56548592" "56548592" "subst" "0" "00000" "BBS2_000118" "g.56548592C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.56514680C>A" "" "likely pathogenic" ""
"0000733707" "2" "70" "16" "56536702" "56536702" "subst" "0.00020312" "00000" "BBS2_000087" "g.56536702G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.56502790G>A" "" "likely pathogenic" ""
"0000733708" "2" "70" "16" "56530894" "56530894" "subst" "0.000117773" "00000" "BBS2_000022" "g.56530894C>G" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.56496982C>G" "" "likely pathogenic" ""
"0000733709" "2" "70" "16" "56536711" "56536711" "subst" "1.21893E-5" "00000" "BBS2_000077" "g.56536711G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.56502799G>A" "" "likely pathogenic" ""
"0000735884" "1" "70" "16" "56535306" "56535314" "del" "0" "02485" "BBS2_000120" "g.56535306_56535314del" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.56501394_56501402del" "" "likely pathogenic" ""
"0000735951" "2" "70" "16" "56535315" "56535315" "subst" "0" "02485" "BBS2_000121" "g.56535315C>T" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.56501403C>T" "" "likely pathogenic" ""
"0000759683" "3" "90" "16" "56529927" "56538196" "del" "0" "00000" "BBS2_000122" "g.56529927_56538196del" "" "{PMID:Lindstrand 2016:27486776}" "" "del exon8_15 56529926-56538197del" "8,271 bp deletion, no homology" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000759701" "3" "50" "16" "56545175" "56545175" "subst" "0.213698" "00000" "BBS2_000089" "g.56545175T>C" "" "{PMID:Lindstrand 2016:27486776}" "" "" "hypomorph" "Germline" "" "" "0" "" "" "g.56511263T>C" "" "VUS" ""
"0000759705" "3" "50" "16" "56545175" "56545175" "subst" "0.213698" "00000" "BBS2_000089" "g.56545175T>C" "" "{PMID:Lindstrand 2016:27486776}" "" "" "hypomorph" "Germline" "" "" "0" "" "" "g.56511263T>C" "" "VUS" ""
"0000759939" "1" "90" "16" "56534926" "56534926" "subst" "1.62433E-5" "00000" "BBS2_000024" "g.56534926G>A" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.56501014G>A" "" "pathogenic (recessive)" ""
"0000759960" "2" "90" "16" "56548469" "56548469" "subst" "8.12216E-6" "00000" "BBS2_000125" "g.56548469C>A" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.56514557C>A" "" "pathogenic (recessive)" ""
"0000760667" "1" "90" "16" "56531672" "56531672" "subst" "8.13445E-6" "00000" "BBS2_000123" "g.56531672G>A" "" "{PMID:Bravo-Gil 2016:27032803}" "" "" "" "Germline" "" "" "0" "" "" "g.56497760G>A" "" "pathogenic" ""
"0000760684" "2" "90" "16" "56545070" "56545070" "subst" "0" "00000" "BBS2_000124" "g.56545070C>T" "" "{PMID:Bravo-Gil 2016:27032803}" "" "" "" "Germline" "" "" "0" "" "" "g.56511158C>T" "" "pathogenic" ""
"0000765535" "3" "90" "16" "56548448" "56548448" "del" "0" "00000" "BBS2_000127" "g.56548448del" "" "{PMID:Ece Solmaz 2015:26518167}" "" "263delG" "" "Germline" "" "" "0" "" "" "g.56514536del" "" "pathogenic (recessive)" ""
"0000765537" "3" "90" "16" "56548448" "56548448" "del" "0" "00000" "BBS2_000127" "g.56548448del" "" "{PMID:Ece Solmaz 2015:26518167}" "" "263delG" "" "Germline" "" "" "0" "" "" "g.56514536del" "" "pathogenic (recessive)" ""
"0000765794" "0" "70" "16" "56536366" "56536366" "subst" "1.62532E-5" "00000" "BBS2_000104" "g.56536366G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.56502454G>A" "" "likely pathogenic" ""
"0000765880" "0" "70" "16" "56544797" "56544797" "subst" "0" "00000" "BBS2_000126" "g.56544797C>T" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.56510885C>T" "" "likely pathogenic" ""
"0000765901" "0" "70" "16" "56540049" "56540049" "subst" "2.84548E-5" "00000" "BBS2_000088" "g.56540049G>A" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.56506137G>A" "" "likely pathogenic" ""
"0000783988" "1" "90" "16" "56536626" "56536626" "subst" "4.06144E-6" "00006" "BBS2_000128" "g.56536626T>C" "1/314 cases" "{PMID:Xu 2015:25999675}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000783989" "2" "90" "16" "56530975" "56530975" "subst" "4.062E-6" "00006" "BBS2_000129" "g.56530975G>C" "1/314 cases" "{PMID:Xu 2015:25999675}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000783991" "3" "90" "16" "56518732" "56518732" "subst" "3.6564E-5" "00006" "BBS2_000130" "g.56518732G>A" "1/314 cases" "{PMID:Xu 2015:25999675}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000785550" "3" "90" "16" "56534926" "56534926" "subst" "1.62433E-5" "00000" "BBS2_000024" "g.56534926G>A" "" "{PMID:Liu 2015:25611614}" "" "" "" "Germline" "" "" "0" "" "" "g.56501014G>A" "" "pathogenic (recessive)" ""
"0000785551" "3" "90" "16" "56534926" "56534926" "subst" "1.62433E-5" "00000" "BBS2_000024" "g.56534926G>A" "" "{PMID:Liu 2015:25611614}" "" "" "" "Germline" "" "" "0" "" "" "g.56501014G>A" "" "pathogenic (recessive)" ""
"0000786404" "1" "90" "16" "56530894" "56530894" "subst" "2.03057E-5" "00000" "BBS2_000131" "g.56530894C>T" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.56496982C>T" "" "pathogenic (recessive)" ""
"0000786413" "1" "90" "16" "56530894" "56530894" "subst" "0.000117773" "00000" "BBS2_000022" "g.56530894C>G" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.56496982C>G" "" "pathogenic (recessive)" ""
"0000786474" "2" "90" "16" "56553703" "56553703" "subst" "4.50126E-5" "00000" "BBS2_000119" "g.56553703G>C" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.56519791G>C" "" "pathogenic (recessive)" ""
"0000786478" "2" "90" "16" "56548399" "56548399" "subst" "4.46722E-5" "00000" "BBS2_000094" "g.56548399T>G" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.56514487T>G" "" "pathogenic (recessive)" ""
"0000788532" "3" "90" "16" "56530894" "56530894" "subst" "0.000117773" "00000" "BBS2_000022" "g.56530894C>G" "" "{PMID:Watson 2014:25133751}" "" "" "" "Germline" "" "" "0" "" "" "g.56496982C>G" "" "pathogenic" ""
"0000793697" "3" "90" "16" "56553707" "56553707" "subst" "0" "00000" "BBS2_000132" "g.56553707C>G" "0/90 ethnically matched controls" "{PMID:Harville-2010:19797195}" "" "68G/C (R23P)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000793698" "3" "90" "16" "56534926" "56534926" "subst" "1.62433E-5" "00000" "BBS2_000024" "g.56534926G>A" "0/90 ethnically matched controls" "{PMID:Harville-2010:19797195}" "" "1237C/T (R413X)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000795030" "3" "90" "16" "56548360" "56548360" "subst" "0" "00000" "BBS2_000134" "g.56548360C>T" "" "{PMID:M\'hamdi 2014:23432027}" "" "c.345 +5G >A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000795033" "3" "90" "16" "56543916" "56543916" "subst" "8.12783E-6" "00000" "BBS2_000133" "g.56543916G>A" "" "{PMID:M\'hamdi 2014:23432027}" "" "c.565C >T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000796916" "3" "90" "16" "56545071" "56545071" "subst" "4.06385E-6" "00000" "BBS2_000060" "g.56545071C>T" "" "{PMID:Wang-2014:24154662}" "" "c.471G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000797940" "0" "90" "16" "56534873" "56534873" "dup" "0" "00000" "BBS2_000136" "g.56534873dup" "" "{PMID:Jespersgaar 2019:30718709}" "" "BBS2 c.1290dupA, p.(His431Thrfs*43)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.56500961dup" "" "pathogenic" "ACMG"
"0000797941" "0" "90" "16" "56540090" "56540090" "del" "0" "00000" "BBS2_000138" "g.56540090del" "" "{PMID:Jespersgaar 2019:30718709}" "" "BBS2 c.661del, p.(Leu221Phefs*25), MYO7A c.3289C>T, p.(Gln1097*)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.56506178del" "" "pathogenic" "ACMG"
"0000797942" "0" "90" "16" "56540090" "56540090" "del" "0" "00000" "BBS2_000138" "g.56540090del" "" "{PMID:Jespersgaar 2019:30718709}" "" "BBS2 c.661del, p.(Leu221Phefs*25)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.56506178del" "" "pathogenic" "ACMG"
"0000797943" "0" "70" "16" "56540103" "56540103" "subst" "1.21976E-5" "00000" "BBS2_000139" "g.56540103G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "BBS2 c.646C>T, p.(Arg216*)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.56506191G>A" "" "likely pathogenic" "ACMG"
"0000797944" "0" "90" "16" "56553703" "56553703" "subst" "4.50126E-5" "00000" "BBS2_000119" "g.56553703G>C" "" "{PMID:Jespersgaar 2019:30718709}" "" "BBS2 c.72C>G, p.(Tyr24*)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.56519791G>C" "" "pathogenic" "ACMG"
"0000798530" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Katsanis-2001:11567139}" "" "R634P" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798531" "0" "70" "16" "56548399" "56548399" "subst" "4.46722E-5" "00000" "BBS2_000094" "g.56548399T>G" "" "{PMID:Katsanis-2001:11567139}" "" "D104A" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798532" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "0/192 ethnically matched control chromosomes" "{PMID:Katsanis-2001:11567139}" "" "R275X" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798533" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Katsanis-2001:11567139}" "" "Y24X" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798534" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Katsanis-2001:11567139}" "" "D170fsX171" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798535" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Katsanis-2001:11567139}" "" "C210fsX246" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798536" "3" "70" "16" "56536366" "56536366" "subst" "1.62532E-5" "00000" "BBS2_000104" "g.56536366G>A" "" "{PMID:Katsanis-2001:11567139}" "" "R315W" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798537" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Katsanis-2001:11567139}" "" "Y24X" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798538" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Katsanis-2001:11567139}" "" "Q59X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798539" "0" "70" "16" "56554009" "56554009" "subst" "0" "00000" "BBS2_000142" "g.56554009C>G" "" "{PMID:Katsanis-2001:11567139}" "" "IVS1-1G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798540" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Katsanis-2001:11567139}" "" "R275X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798541" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "0/192 ethnically matched control chromosomes" "{PMID:Katsanis-2001:11567139}" "" "V158fsX200" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798542" "0" "70" "16" "56548399" "56548399" "subst" "4.46722E-5" "00000" "BBS2_000094" "g.56548399T>G" "" "{PMID:Katsanis-2001:11567139}" "" "D104A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798543" "0" "70" "16" "56544770" "56544770" "subst" "0" "00000" "BBS2_000140" "g.56544770C>G" "" "{PMID:Katsanis-2001:11567139}" "" "IVS4+1G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798545" "0" "70" "16" "56548501" "56548501" "subst" "0" "00000" "BBS2_000114" "g.56548501T>C" "" "{PMID:Katsanis-2001:11567139}" "" "N70S" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798546" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Katsanis-2001:11567139}" "" "R216X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798548" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Katsanis-2001:11567139}" "" "L168fsX170" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798550" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Katsanis-2001:11567139}" "" "Y24X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798551" "0" "70" "16" "56536365" "56536365" "subst" "0" "00000" "BBS2_000137" "g.56536365C>T" "" "{PMID:Katsanis-2001:11567139}" "" "R315Q" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798552" "0" "70" "16" "56553657" "56553657" "subst" "0" "00000" "BBS2_000141" "g.56553657C>G" "" "{PMID:Katsanis-2001:11567139}" "" "IVS1+1G>C (R315Q)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798553" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Katsanis-2001:11567139}" "" "Q59X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798555" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Katsanis-2001:11567139}" "" "Y24X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000798556" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Katsanis-2001:11567139}" "" "T560I" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000807453" "0" "50" "16" "56530895" "56530896" "ins" "0" "01943" "OGFOD1_000031" "g.56530895_56530896insCTG" "" "" "" "BBS2(NM_031885.3):c.1894_1895insAGC (p.A631_R632insQ)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000807454" "0" "30" "16" "56543962" "56543964" "del" "8.13471E-6" "02330" "OGFOD1_000032" "g.56543962_56543964del" "" "" "" "BBS2(NM_031885.5):c.535-16_535-14delGAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000807455" "0" "50" "16" "56544822" "56544822" "subst" "0" "01943" "OGFOD1_000033" "g.56544822G>T" "" "" "" "BBS2(NM_031885.3):c.483C>A (p.D161E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000810936" "0" "10" "16" "56545175" "56545175" "subst" "0.213698" "00000" "BBS2_000089" "g.56545175T>C" "0.26" "{PMID:Anasagasti-2013:24416769}" "" "p.Ile123Val" "" "Germline" "yes" "rs11373" "0" "" "" "" "" "benign (recessive)" ""
"0000810949" "0" "50" "16" "56540121" "56540122" "del" "8.13782E-6" "00000" "BBS2_000143" "g.56540121_56540122del" "" "{PMID:Hichri-2005:15770229}" "" "c.627delTT" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000810950" "0" "50" "16" "56545140" "56545140" "del" "4.06167E-6" "00000" "BBS2_000145" "g.56545140del" "" "{PMID:Hichri-2005:15770229}" "" "c.402delT" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000810971" "3" "90" "16" "56545126" "56545126" "subst" "0" "00000" "BBS2_000144" "g.56545126C>A" "" "{PMID:Laurier-2006:16823392}" "" "G139V" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000810972" "3" "90" "16" "56545126" "56545126" "subst" "0" "00000" "BBS2_000144" "g.56545126C>A" "" "{PMID:Laurier-2006:16823392}" "" "G139V" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000810980" "3" "70" "16" "56545175" "56545175" "subst" "0.213698" "00000" "BBS2_000089" "g.56545175T>C" "" "{PMID:Sathya Priya-2015:24400638}" "" "c.376A>G" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000810990" "3" "70" "16" "56545175" "56545175" "subst" "0.213698" "00000" "BBS2_000089" "g.56545175T>C" "" "{PMID:Sathya Priya-2015:24400638}" "" "c.376A>G" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000810994" "3" "70" "16" "56548501" "56548501" "subst" "0.994128" "00000" "BBS2_000084" "g.56548501C>T" "" "{PMID:Sathya Priya-2015:24400638}" "" "c.209G>A" "Disease associated polymorphisms" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811058" "0" "90" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Bin-2009:19402160}" "" "p.[D104A]+[R632P]" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811059" "0" "90" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Bin-2009:19402160}" "" "p.[D104A]+[R632P]" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811104" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Muller-2010:20177705}, Katsanis 2001" "" "Y24X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811105" "0" "70" "16" "56548444" "56548444" "subst" "0.000430471" "00000" "BBS2_000165" "g.56548444T>C" "" "{PMID:Muller-2010:20177705}, Beales unpublished" "" "c.266A>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811106" "3" "70" "16" "56545126" "56545126" "subst" "0" "00000" "BBS2_000144" "g.56545126C>A" "" "{PMID:Muller-2010:20177705}, {PMID:Stoetzel 2006:16582908}" "" "c.416G>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811108" "1" "70" "16" "56544801" "56544801" "del" "0" "00000" "BBS2_000163" "g.56544801del" "" "{PMID:Muller-2010:20177705}" "" "c.504delG" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811109" "2" "90" "16" "56536605" "56536605" "subst" "0" "00000" "BBS2_000157" "g.56536605C>T" "" "{PMID:Muller-2010:20177705}" "" "c.920G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811110" "3" "90" "16" "56540087" "56540087" "subst" "0" "00000" "BBS2_000160" "g.56540087A>G" "" "{PMID:Muller-2010:20177705}" "" "c.662T>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811111" "3" "90" "16" "56536585" "56536585" "del" "0" "00000" "BBS2_000156" "g.56536585del" "" "{PMID:Muller-2010:20177705}" "" "c.940delA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811112" "3" "90" "16" "56535264" "56536721" "del" "0" "00000" "BBS2_000150" "g.56535264_56536721del" "" "{PMID:Muller-2010:20177705}" "" "Del 8+9+10" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811205" "3" "70" "16" "56540088" "56540088" "del" "2.43865E-5" "00000" "BBS2_000138" "g.56540088del" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.661delC (p.F221fsX25)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811209" "0" "70" "16" "56540103" "56540103" "subst" "1.21976E-5" "00000" "BBS2_000139" "g.56540103G>A" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.646C>T (p.R216X)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811210" "0" "70" "16" "56540088" "56540088" "del" "2.43865E-5" "00000" "BBS2_000138" "g.56540088del" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.661delC (p.F221fsX25)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811213" "0" "70" "16" "56540103" "56540103" "subst" "1.21976E-5" "00000" "BBS2_000139" "g.56540103G>A" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.646C>T (p.R216X)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811214" "0" "70" "16" "56531747" "56531747" "subst" "0" "00000" "BBS2_000148" "g.56531747G>A" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.1707C>T (p.Q569X)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811218" "3" "70" "16" "56531747" "56531747" "subst" "0" "00000" "BBS2_000148" "g.56531747G>A" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.1707C>T (p.Q569X)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811224" "0" "70" "16" "56540103" "56540103" "subst" "1.21976E-5" "00000" "BBS2_000139" "g.56540103G>A" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.646C>T (p.R216X)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811225" "0" "70" "16" "56553703" "56553703" "subst" "4.50126E-5" "00000" "BBS2_000119" "g.56553703G>C" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.72G>C (p.Y24X)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811226" "0" "50" "16" "56530904" "56530904" "subst" "3.65524E-5" "00000" "BBS2_000147" "g.56530904C>T" "0/100 ethnically matched control chromosomes" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "BBS2: c.1885G>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000811230" "3" "70" "16" "56536711" "56536711" "subst" "1.21893E-5" "00000" "BBS2_000077" "g.56536711G>A" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.814C>T (p.A272X)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811232" "0" "70" "16" "56540088" "56540088" "del" "2.43865E-5" "00000" "BBS2_000138" "g.56540088del" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.661delC (p.F221fsX25)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811233" "0" "70" "16" "56531747" "56531747" "subst" "0" "00000" "BBS2_000148" "g.56531747G>A" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.1707C>T (p.Q569X)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811235" "3" "70" "16" "56548432" "56548454" "dup" "0" "00000" "BBS2_000164" "g.56548432_56548454dup" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.256_278dup (p.V94SfsX8)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811239" "0" "70" "16" "56540103" "56540103" "subst" "1.21976E-5" "00000" "BBS2_000139" "g.56540103G>A" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.646C>T (p.R216X)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811240" "0" "70" "16" "56553703" "56553703" "subst" "4.50126E-5" "00000" "BBS2_000119" "g.56553703G>C" "" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.72G>C (p.Y24X)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811243" "0" "10" "16" "56553816" "56553816" "subst" "0.0677756" "00000" "BBS2_000092" "g.56553816A>C" "0.07" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "-42T>G" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000811244" "0" "10" "16" "56553814" "56553814" "subst" "0.0678708" "00000" "BBS2_000091" "g.56553814A>G" "0.07" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "-40T>C" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000811245" "0" "10" "16" "56540170" "56540170" "subst" "0" "00000" "BBS2_000161" "g.56540170C>T" "0.05" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.613-3>G>A" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000811246" "0" "10" "16" "56539882" "56539882" "subst" "0" "00000" "BBS2_000159" "g.56539882T>C" "0.01" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.804-20A>G" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000811247" "0" "10" "16" "56533795" "56533795" "subst" "0.00224583" "00000" "BBS2_000070" "g.56533795C>T" "0.01" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.1422G>A" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000811248" "0" "10" "16" "56532365" "56532365" "subst" "0" "00000" "BBS2_000149" "g.56532365A>G" "0.02" "{PMID:Duelund Hjortshoj-2010:20120035}" "" "c.1528+115T>C" "" "Germline" "" "" "0" "" "" "" "" "benign" ""
"0000811271" "10" "70" "16" "56536263" "56536263" "subst" "1.62475E-5" "00000" "BBS2_000153" "g.56536263A>C" "0/192 ethnically matched control chromosomes" "{PMID:Badano-2003:12837689}" "" "L349W" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811273" "10" "70" "16" "56536263" "56536263" "subst" "1.62475E-5" "00000" "BBS2_000153" "g.56536263A>C" "0/192 ethnically matched control chromosomes" "{PMID:Badano-2003:12837689}" "" "L349W" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811275" "3" "90" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Badano-2003:12837689}" "" "R275X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811276" "3" "90" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Badano-2003:12837689}" "" "R275X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811278" "3" "90" "16" "56544793" "56544794" "del" "0" "00000" "BBS2_000162" "g.56544793_56544794delAA" "" "{PMID:Hoskins-2003:12872256}" "" "c.511_512delTT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811280" "0" "90" "16" "56536702" "56536702" "subst" "0.00020312" "00000" "BBS2_000087" "g.56536702G>A" "" "{PMID:Hoskins-2003:12872256}" "" "c.823C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811283" "0" "90" "16" "56536263" "56536263" "subst" "1.62475E-5" "00000" "BBS2_000153" "g.56536263A>C" "" "{PMID:Hoskins-2003:12872256}" "" "c.1046T>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811290" "0" "90" "16" "56544783" "56544783" "subst" "1.21826E-5" "00000" "BBS2_000117" "g.56544783A>T" "" "{PMID:Hoskins-2003:12872256}" "" "c.522T>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811291" "0" "90" "16" "56536740" "56536740" "subst" "0.00406511" "00000" "BBS2_000078" "g.56536740T>C" "" "{PMID:Hoskins-2003:12872256}" "" "c.805-20A>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811304" "0" "90" "16" "56534926" "56534926" "subst" "1.62433E-5" "00000" "BBS2_000024" "g.56534926G>A" "0/60 controls" "{PMID:Fauser-2003:12920096}" "" "R413X" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811306" "0" "90" "16" "56519633" "56519633" "subst" "4.06669E-5" "00000" "BBS2_000146" "g.56519633C>T" "" "{PMID:Fauser-2003:12920096}" "" "1928G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000811319" "0" "70" "16" "56536263" "56536263" "subst" "1.62475E-5" "00000" "BBS2_000153" "g.56536263A>C" "" "{PMID:Eichers-2009:15224652}, Beales 2003" "" "L349W" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811323" "0" "70" "16" "56553657" "56553657" "subst" "0" "00000" "BBS2_000141" "g.56553657C>G" "" "{PMID:Eichers-2009:15224652}, Beales 2003" "" "IVS1+1G>C/R315Q" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811324" "3" "70" "16" "56536365" "56536365" "subst" "0" "00000" "BBS2_000137" "g.56536365C>T" "" "{PMID:Eichers-2009:15224652}, Beales 2003" "" "R315Q" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811326" "0" "70" "16" "56553703" "56553703" "subst" "4.50126E-5" "00000" "BBS2_000119" "g.56553703G>C" "" "{PMID:Eichers-2009:15224652}, Beales 2003" "" "Y24X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811327" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Eichers-2009:15224652}, Katsanis 2001" "" "Q59X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811329" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Eichers-2009:15224652}, Katsanis 2001" "" "I168fsX170" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811330" "0" "70" "16" "56540103" "56540103" "subst" "1.21976E-5" "00000" "BBS2_000139" "g.56540103G>A" "" "{PMID:Eichers-2009:15224652}, Katsanis 2001" "" "R216X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811332" "3" "70" "16" "56553703" "56553703" "subst" "4.50126E-5" "00000" "BBS2_000119" "g.56553703G>C" "" "{PMID:Eichers-2009:15224652}, Katsanis 2001" "" "Y24X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811334" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Eichers-2009:15224652}, Katsanis 2001" "" "R275X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811335" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Eichers-2009:15224652}, Badano 2003" "" "R275X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811338" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Eichers-2009:15224652}, Katsanis 2002" "" "T560I" "four mutant alleles are potentially necessary for disease pathogenesis." "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" ""
"0000811340" "0" "70" "16" "56548501" "56548501" "subst" "0" "00000" "BBS2_000114" "g.56548501T>C" "" "{PMID:Eichers-2009:15224652}, Katsanis 2001" "" "N70S" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811343" "0" "70" "16" "56534926" "56534926" "subst" "1.62433E-5" "00000" "BBS2_000024" "g.56534926G>A" "" "{PMID:Eichers-2009:15224652}, Fauser 2003" "" "R413X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811345" "0" "70" "16" "56519633" "56519633" "subst" "4.06669E-5" "00000" "BBS2_000146" "g.56519633C>T" "" "{PMID:Eichers-2009:15224652}, Fauser 2003" "" "R643H" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000811392" "3" "70" "16" "56536294" "56536294" "subst" "0" "00000" "BBS2_000111" "g.56536294G>A" "" "{PMID:Khan 2019:31725702}" "" "Allele 1 c.1015C>T (p.Arg339*), Allele 2 c.1015C>T (p.Arg339*)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.56502382G>A" "" "likely pathogenic" ""
"0000811696" "0" "90" "16" "56536294" "56536294" "subst" "0" "00000" "BBS2_000111" "g.56536294G>A" "" "{PMID:Manara 2019:31196119}" "" "BBS2 c.1015C>T, p.(Arg339*)" "heterozygous" "Germline" "" "rs193922710" "0" "" "" "g.56502382G>A" "" "pathogenic" "ACMG"
"0000811699" "3" "90" "16" "56536711" "56536711" "subst" "1.21893E-5" "00000" "BBS2_000077" "g.56536711G>A" "" "{PMID:Manara 2019:31196119}" "" "BBS2 c.814C>T, p.(Arg272*)" "homozygous" "Germline" "?" "" "0" "" "" "g.56502799G>A" "" "pathogenic" "ACMG"
"0000811708" "0" "90" "16" "56536247" "56536247" "subst" "0" "00000" "BBS2_000152" "g.56536247G>C" "" "{PMID:Manara 2019:31196119}" "" "BBS2 c.1062C>G, p.(Asn354Lys)" "heterozygous" "Germline" "?" "" "0" "" "" "g.56502335G>C" "" "pathogenic" "ACMG"
"0000811719" "0" "50" "16" "56536323" "56536323" "subst" "3.65613E-5" "00000" "BBS2_000154" "g.56536323A>G" "" "{PMID:Manara 2019:31196119}" "" "BBS2 c.986T>C, p.(Met329Thr)" "heterozygous" "Germline" "?" "rs201146063" "0" "" "" "g.56502411A>G" "" "VUS" "ACMG"
"0000812144" "0" "70" "16" "56536369" "56536369" "subst" "4.06293E-6" "00000" "BBS2_000155" "g.56536369C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "BBS2 IVS8 c.941-1G>T p.(?), Ex.9 c.943C>T p.(Arg315Trp)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.56502457C>A" "" "likely pathogenic" ""
"0000812145" "0" "70" "16" "56536366" "56536366" "subst" "1.62532E-5" "00000" "BBS2_000104" "g.56536366G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "BBS2 IVS8 c.941-1G>T p.(?), Ex.9 c.943C>T p.(Arg315Trp)" "compound heterozygous" "De novo" "yes" "" "0" "" "" "g.56502454G>A" "" "likely pathogenic" ""
"0000812289" "3" "70" "16" "56535265" "56535265" "subst" "0" "00000" "BBS2_000151" "g.56535265C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "BBS2 Ex.10 c.1225G>T p.(Asp409Tyr), Ex.10 c.1225G>T p.(Asp409Tyr)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.56501353C>A" "" "likely pathogenic" ""
"0000812453" "0" "70" "16" "56531747" "56531747" "subst" "0" "00000" "BBS2_000148" "g.56531747G>A" "" "{PMID:Tayebi 2019:30820146}" "" "c.1705C>T, p.(Gln569*)" "Compound heterozygous" "Germline" "yes" "" "0" "" "" "g.56497835G>A" "" "likely pathogenic" ""
"0000812454" "0" "70" "16" "56553657" "56553657" "subst" "0" "00000" "BBS2_000167" "g.56553657C>A" "" "{PMID:Tayebi 2019:30820146}" "" "c.117+1G>T, p.?" "Compound heterozygous" "Germline" "yes" "" "0" "" "" "g.56519745C>A" "" "likely pathogenic" ""
"0000812455" "3" "70" "16" "56548486" "56548486" "subst" "4.06101E-6" "00000" "BBS2_000113" "g.56548486A>C" "" "{PMID:Tayebi 2019:30820146}" "" "c.224T>G, p.(Val75Gly)" "Homozygous" "Germline" "yes" "" "0" "" "" "g.56514574A>C" "" "likely pathogenic" ""
"0000812538" "3" "90" "16" "56544770" "56544770" "subst" "9.74738E-5" "00000" "BBS2_000104" "g.56544770C>A" "" "{PMID:Wang 2019:31106028}" "" "c.534+1C>A, p.?" "error in annotation: c.534+1C>A instead of G>T, Homozygous" "Germline" "yes" "" "0" "" "" "g.56510858C>A" "" "pathogenic" ""
"0000812549" "3" "70" "16" "56548462" "56548462" "subst" "0" "00000" "BBS2_000166" "g.56548462A>C" "" "{PMID:Wang 2019:31106028}" "" "c.248A>C, p.(Leu83Trp)" "Homozygous" "Germline" "yes" "" "0" "" "" "g.56514550A>C" "" "likely pathogenic" ""
"0000812596" "0" "70" "16" "56536654" "56536654" "subst" "0.000105603" "00000" "BBS2_000158" "g.56536654C>T" "" "{PMID:Wang 2019:31106028}" "" "c.871C>T, p.(Gly291Ser)" "error in annotation: c.871C>T instead of G>A, Heterozygous" "Germline" "?" "" "0" "" "" "g.56502742C>T" "" "likely pathogenic" ""
"0000812597" "0" "90" "16" "56544770" "56544770" "subst" "9.74738E-5" "00000" "BBS2_000104" "g.56544770C>A" "" "{PMID:Wang 2019:31106028}" "" "c.534+1C>A, p.?" "error in annotation: c.534+1C>A instead of G>T, Heterozygous" "Germline" "?" "" "0" "" "" "g.56510858C>A" "" "pathogenic" ""
"0000813032" "3" "70" "16" "56548448" "56548448" "del" "0" "00000" "BBS2_000127" "g.56548448del" "" "{PMID:Atmis 2019:31951329}" "" "BBS2 p.Gyl88Alafs*6 (c.263delG) Homozygous" "Homozygous" "Germline" "?" "" "0" "" "" "g.56514536del" "" "likely pathogenic" ""
"0000813167" "0" "50" "16" "56545168" "56545168" "subst" "0" "00000" "BBS2_000183" "g.56545168A>C" "" "{PMID:Billingsley-2010:20472660}" "" "[L125R]+[=];" "normal 2nd chromosome" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813170" "3" "50" "16" "56545168" "56545168" "subst" "0" "00000" "BBS2_000183" "g.56545168A>C" "" "{PMID:Billingsley-2010:20472660}" "" "[L125R]+[L125R];" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813270" "0" "50" "16" "56539982" "56539982" "subst" "0.0598068" "00000" "BBS2_000176" "g.56539982C>T" "" "{PMID:Abu-Safieh-2012:22353939}, Abu-Safieh 2010" "" "c.[718-34G>A(;)1080+149G>A]" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813271" "0" "50" "16" "56536080" "56536080" "subst" "0" "00000" "BBS2_000171" "g.56536080C>T" "" "{PMID:Abu-Safieh-2012:22353939}, Abu-Safieh 2010" "" "c.[718-34G>A(;)1080+149G>A]" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813274" "0" "50" "16" "56536489" "56536489" "subst" "0" "00000" "BBS2_000173" "g.56536489A>T" "" "{PMID:Abu-Safieh-2012:22353939}, Abu-Safieh 2010" "" "c.940+96T>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813301" "3" "30" "16" "56535283" "56535283" "subst" "6.90294E-5" "00000" "BBS2_000170" "g.56535283G>A" "0/96 ethnically matched controls" "{PMID:Abu-Safieh-2012:22353939}" "" "c.1207C>T p.(Arg403Cys)" "" "Germline" "" "" "0" "" "" "" "" "likely benign" ""
"0000813309" "0" "50" "16" "56543761" "56543761" "subst" "0" "00000" "BBS2_000179" "g.56543761A>G" "" "{PMID:Abu-Safieh-2012:22353939}" "" "c.612+108T>C" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813315" "0" "50" "16" "56543761" "56543761" "subst" "0" "00000" "BBS2_000179" "g.56543761A>G" "" "{PMID:Abu-Safieh-2012:22353939}" "" "c.612+108T>C" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813322" "0" "50" "16" "56535283" "56535283" "subst" "6.90294E-5" "00000" "BBS2_000170" "g.56535283G>A" "" "{PMID:Abu-Safieh-2012:22353939}, Stoetzel 2006" "" "c.1207C>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813331" "0" "50" "16" "56536549" "56536549" "subst" "0" "00000" "BBS2_000174" "g.56536549C>T" "" "{PMID:Abu-Safieh-2012:22353939}" "" "c.940+36G>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813661" "0" "90" "16" "56536294" "56536294" "subst" "0" "00000" "BBS2_000111" "g.56536294G>A" "" "{PMID:Xu 2020:31630094}" "" "BBS2 NM_031885: g.17902C>T, c.1015C>T, p.R339X" "" "Unknown" "?" "" "0" "" "" "g.56502382G>A" "" "pathogenic" "ACMG"
"0000813754" "0" "70" "16" "56553696" "56553696" "subst" "0" "00000" "BBS2_000185" "g.56553696T>G" "" "{PMID:Xu 2020:31630094}" "" "BBS2 NM_031885: g.500A>C, c.79A>C, p.T27P" "" "Unknown" "?" "" "0" "" "" "g.56519784T>G" "" "likely pathogenic" "ACMG"
"0000813875" "3" "70" "16" "56534926" "56534926" "subst" "1.62433E-5" "00000" "BBS2_000024" "g.56534926G>A" "" "{PMID:Jiman 2020:31836858}" "" "BBS2;NM_031885.3;;c.[1237C>T];[1237C>T]p.[(Arg413*)];[(Arg413*)]" "homozygous" "Unknown" "?" "" "0" "" "" "g.56501014G>A" "" "likely pathogenic" ""
"0000813907" "0" "70" "16" "56532346" "56532346" "subst" "0.00895579" "00000" "BBS2_000067" "g.56532346T>C" "" "{PMID:Chen-2011:21642631}" "" "c.1659+3A>G" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813917" "0" "90" "16" "56548399" "56548399" "subst" "4.46722E-5" "00000" "BBS2_000094" "g.56548399T>G" "" "{PMID:Chen-2011:21642631}" "" "c.311A>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000813918" "0" "90" "16" "56530894" "56530894" "subst" "0.000117773" "00000" "BBS2_000022" "g.56530894C>G" "" "{PMID:Chen-2011:21642631}" "" "c.1895G>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000813961" "0" "90" "16" "56548399" "56548399" "subst" "4.46722E-5" "00000" "BBS2_000094" "g.56548399T>G" "" "{PMID:Chen-2011:21642631}" "" "c.311A>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000813962" "0" "70" "16" "56536702" "56536702" "subst" "0.00020312" "00000" "BBS2_000087" "g.56536702G>A" "" "{PMID:Chen-2011:21642631}" "" "c.823C>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813963" "3" "70" "16" "56543916" "56543916" "subst" "8.12783E-6" "00000" "BBS2_000133" "g.56543916G>A" "" "{PMID:Chen-2011:21642631}" "" "c.565C>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813964" "3" "70" "16" "56536702" "56536702" "subst" "0.00020312" "00000" "BBS2_000087" "g.56536702G>A" "" "{PMID:Chen-2011:21642631}" "" "c.823C>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813965" "3" "70" "16" "56532350" "56532350" "subst" "0" "00000" "BBS2_000169" "g.56532350G>A" "" "{PMID:Chen-2011:21642631}" "" "c.1658C>T" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000813974" "3" "90" "16" "56519569" "56519569" "del" "0" "00000" "BBS2_000168" "g.56519569del" "" "{PMID:Redin-2012:22773737}" "" "c.[1992del" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000813994" "3" "90" "16" "56536711" "56536711" "subst" "1.21893E-5" "00000" "BBS2_000077" "g.56536711G>A" "" "{PMID:Redin-2012:22773737}" "" "c.[814C>T];[814C>T]" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814000" "3" "90" "16" "56540123" "56540123" "subst" "0" "00000" "BBS2_000178" "g.56540123A>G" "" "{PMID:Redin-2012:22773737}" "" "c.[626T>C];[626T>C]" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000814038" "20" "70" "16" "56545140" "56545140" "del" "0" "00000" "BBS2_000182" "g.56545140delA" "" "{PMID:Schaefer-2011:21044901}" "" "c.402delT" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814039" "10" "70" "16" "56540121" "56540122" "del" "0" "00000" "BBS2_000177" "g.56540121_56540122delAA" "" "{PMID:Schaefer-2011:21044901}" "" "c.627_628delTT" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814057" "3" "90" "16" "56543916" "56543916" "subst" "8.12783E-6" "00000" "BBS2_000133" "g.56543916G>A" "" "{PMID:M\'hamdi-2014:23432027}" "" "c.565C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000814058" "3" "90" "16" "56548360" "56548360" "subst" "0" "00000" "BBS2_000134" "g.56548360C>T" "" "{PMID:M\'hamdi-2014:23432027}" "" "c.345+5G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000814095" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Imhoff-2011:20876674}" "" "[p.G81C]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814096" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Imhoff-2011:20876674}" "" "[p.L536L]" "normal 2nd chromosome" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814146" "1" "70" "16" "56548399" "56548399" "subst" "4.46722E-5" "00000" "BBS2_000094" "g.56548399T>G" "" "{PMID:Deveault-2011:21344540}" "" "[p.G539D];[p.P632FfsX7]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814147" "1" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Deveault-2011:21344540}" "" "[p.L88R];[p.N461KfsX10]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814150" "2" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Deveault-2011:21344540}" "" "[p.I330T];[p.R483X]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814151" "2" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Deveault-2011:21344540}" "" "[p.M242RfsX83];[p.M390R]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814152" "2" "70" "16" "56518732" "56518732" "subst" "3.6564E-5" "00000" "BBS2_000130" "g.56518732G>A" "" "{PMID:Deveault-2011:21344540}" "" "[p.M390R];[p.L505PfsX52]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814153" "2" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Deveault-2011:21344540}" "" "[p.M390R];[p.L505PfsX52]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814154" "2" "70" "16" "56536359" "56536359" "subst" "0" "00000" "BBS2_000172" "g.56536359T>C" "" "{PMID:Deveault-2011:21344540}" "" "[p.M390R];[c.951+2T>C]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814155" "2" "70" "16" "56530925" "56530925" "subst" "2.84326E-5" "00000" "OGFOD1_000022" "g.56530925G>A" "" "{PMID:Deveault-2011:21344540}" "" "[p.D104A];[p.R632P]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814156" "2" "70" "16" "56545136" "56545136" "subst" "0" "00000" "BBS2_000181" "g.56545136C>G" "" "{PMID:Deveault-2011:21344540}" "" "[p.R622X];[p.A136P]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814158" "2" "70" "16" "56532350" "56532350" "subst" "0" "00000" "BBS2_000169" "g.56532350G>A" "" "{PMID:Deveault-2011:21344540}" "" "[p.G63R];[IVS6+2T>C]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814159" "2" "70" "16" "56536604" "56536604" "subst" "0" "00000" "BBS2_000175" "g.56536604G>C" "" "{PMID:Deveault-2011:21344540}" "" "[p.G63R];[IVS6+2T>C]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814160" "2" "70" "16" "56548469" "56548469" "subst" "8.12216E-6" "00000" "BBS2_000125" "g.56548469C>A" "" "{PMID:Deveault-2011:21344540}" "" "[p.R238EfsX59];[p.S374X]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814161" "2" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Deveault-2011:21344540}" "" "[p.G162fsX4];[p.I334fsX1]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814162" "2" "70" "16" "56553658" "56553658" "subst" "8.20371E-6" "00000" "BBS2_000184" "g.56553658C>T" "" "{PMID:Deveault-2011:21344540}" "" "[p.C91W];[p.V707XfsX1]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814163" "2" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Deveault-2011:21344540}" "" "[p.C91LfsX5];[p.E104KfsX7]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814164" "2" "70" "16" "56545071" "56545071" "subst" "0" "00000" "BBS2_000180" "g.56545071C>A" "" "{PMID:Deveault-2011:21344540}" "" "[p.C91W];[p.A474MfsX10]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814239" "0" "70" "16" "56545168" "56545168" "subst" "0" "00000" "BBS2_000183" "g.56545168A>C" "" "{PMID:Deveault-2011:21344540}" "" "M390R/E384X" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814345" "0" "50" "16" "56519627" "56519627" "subst" "8.1322E-6" "00006" "BBS2_000097" "g.56519627A>G" "" "{PMID:Takenouchi 2017:28374938}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000814511" "3" "90" "16" "56536362" "56536362" "subst" "0" "00000" "BBS2_000189" "g.56536362C>T" "0.036" "{PMID:Janssen-2011:21052717}" "" "c.947G>A(H)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814512" "0" "90" "16" "56536702" "56536702" "subst" "0.00020312" "00000" "BBS2_000087" "g.56536702G>A" "0.147" "{PMID:Janssen-2011:21052717}" "" "c.823C>T(h)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814513" "0" "90" "16" "56530894" "56530894" "subst" "0.000117773" "00000" "BBS2_000022" "g.56530894C>G" "0.01" "{PMID:Janssen-2011:21052717}" "" "c.1895G>C(h)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814514" "3" "90" "16" "56536702" "56536702" "subst" "0.00020312" "00000" "BBS2_000087" "g.56536702G>A" "0.147" "{PMID:Janssen-2011:21052717}" "" "c.823C>T(H)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814520" "0" "90" "16" "56536585" "56536585" "del" "0" "00000" "BBS2_000156" "g.56536585del" "0.009" "{PMID:Janssen-2011:21052717}" "" "c.940delA(h)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814521" "0" "90" "16" "56540030" "56540030" "" "0" "00000" "CRYM_000000" "g.56540030?" "0.008" "{PMID:Janssen-2011:21052717}" "" "c.IVS6+2(h)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814524" "0" "90" "16" "56544834" "56544834" "del" "0" "00000" "BBS2_000191" "g.56544834delC" "0.011" "{PMID:Janssen-2011:21052717}" "" "c.IVS3-1delG(h)" "Family AR124 (A2832) has previously been published for this heterozygous change in BBS2 (p.V158fsX43) by Katsanis et al. 2001" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814525" "0" "90" "16" "56534792" "56534792" "del" "0" "00000" "BBS2_000188" "g.56534792del" "" "{PMID:Janssen-2011:21052717}" "" "c.1371delG(h)" "Family AR124 (A2832) has previously been published for this heterozygous change in BBS2 (p.V158fsX43) by Katsanis et al. 2002" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814552" "0" "90" "16" "56548535" "56548535" "subst" "2.43685E-5" "00000" "BBS2_000036" "g.56548535G>A" "0.009" "{PMID:Janssen-2011:21052717}" "" "c.175C>T(h)" "Family AR724 (A2866) has previously been published for this heterozygous change in BBS2 (p.Q59X) by Katsanis et al. 2001" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814553" "0" "90" "16" "56553703" "56553703" "subst" "4.50126E-5" "00000" "BBS2_000119" "g.56553703G>C" "" "{PMID:Janssen-2011:21052717}" "" "c.72C>G(h)" "Family AR724 (A2866) has previously been published for this heterozygous change in BBS2 (p.Q59X) by Katsanis et al. 2001" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814554" "0" "90" "16" "56533779" "56533779" "subst" "2.03065E-5" "00000" "BBS2_000187" "g.56533779G>A" "0.036" "{PMID:Janssen-2011:21052717}" "" "c.1438C>T(h)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814555" "0" "90" "16" "56534926" "56534926" "subst" "1.62433E-5" "00000" "BBS2_000024" "g.56534926G>A" "0.018" "{PMID:Janssen-2011:21052717}" "" "c.1237C>T(h)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814560" "0" "90" "16" "56553703" "56553703" "subst" "4.50126E-5" "00000" "BBS2_000119" "g.56553703G>C" "0.007" "{PMID:Janssen-2011:21052717}" "" "c.72C>G(h)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814561" "0" "90" "16" "56544801" "56544801" "del" "0" "00000" "BBS2_000163" "g.56544801del" "0.007" "{PMID:Janssen-2011:21052717}" "" "c.504delG(h)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814562" "0" "90" "16" "56553703" "56553703" "subst" "4.50126E-5" "00000" "BBS2_000119" "g.56553703G>C" "0.007" "{PMID:Janssen-2011:21052717}" "" "c.72C>G(h)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814563" "0" "90" "16" "56544801" "56544801" "del" "0" "00000" "BBS2_000163" "g.56544801del" "0.007" "{PMID:Janssen-2011:21052717}" "" "c.504delG(h)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814579" "0" "70" "16" "56530898" "56530898" "subst" "2.43677E-5" "00000" "BBS2_000186" "g.56530898C>T" "2% ; absent in 96 controls" "{PMID:Janssen-2011:21052717}" "" "c.1891G>A(h)" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814624" "3" "90" "16" "56543918" "56543918" "del" "8.12803E-6" "00000" "BBS2_000190" "g.56543918del" "" "{PMID:Xing-2014:24608809}" "" "c.563delT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814625" "3" "90" "16" "56533779" "56533779" "subst" "2.03065E-5" "00000" "BBS2_000187" "g.56533779G>A" "" "{PMID:Xing-2014:24608809}" "" "c.1438C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000814654" "3" "70" "16" "56545175" "56545175" "subst" "0.213698" "00000" "BBS2_000089" "g.56545175T>C" "" "{PMID:Lindstrand-2014:24746959}" "" "c.367A>G(p.Ile123Val);hom" "Putative second-site modulato" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000814759" "0" "90" "16" "56543918" "56543918" "del" "8.12803E-6" "00000" "BBS2_000190" "g.56543918del" "" "{PMID:Dan 2020:31960602}" "" "BBS2 c.563delT, p.(Ile188Thrfs*13)" "heterozygous" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.56510006del" "" "pathogenic" "ACMG"
"0000814800" "0" "90" "16" "56534926" "56534926" "subst" "1.62433E-5" "00000" "BBS2_000024" "g.56534926G>A" "" "{PMID:Dan 2020:31960602}" "" "BBS2 c.1237C>T, p.(Arg413*)" "heterozygous" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.56501014G>A" "" "pathogenic" "ACMG"
"0000815037" "3" "90" "16" "56536306" "56536306" "subst" "0" "00000" "BBS2_000194" "g.56536306G>A" "" "{PMID:Fattahi 2014:24849935}" "" "c.1003C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000815040" "3" "90" "16" "56545071" "56545071" "subst" "0" "00000" "BBS2_000196" "g.56545071C>G" "" "{PMID:Fattahi 2014:24849935}" "" "c.471G>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000815041" "0" "90" "16" "56544834" "56544834" "subst" "0" "00000" "BBS2_000195" "g.56544834C>G" "" "{PMID:Fattahi 2014:24849935}" "" "(IVS3dsG-C-1)Splicing" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000815045" "3" "90" "16" "56548432" "56548454" "dup" "0" "00000" "BBS2_000164" "g.56548432_56548454dup" "" "{PMID:Fattahi 2014:24849935}" "" "c.256_278dup23" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000815046" "3" "90" "16" "56530878" "56530878" "subst" "0" "00000" "BBS2_000192" "g.56530878C>A" "" "{PMID:Fattahi 2014:24849935}" "" "c.1910+1G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000815341" "0" "50" "16" "56533763" "56533763" "subst" "9.34033E-5" "00000" "BBS2_000069" "g.56533763G>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "BBS2:NM_031885 c.C1454T, p.A485V" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.56499851G>A" "" "VUS" "ACMG"
"0000815472" "0" "70" "16" "56535293" "56535293" "del" "4.06058E-6" "00000" "BBS2_000193" "g.56535293del" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "BBS2:NM_031885 c.1197delT, p.H399fs" "heterozygous, individual solved, variant non-causal" "Germline" "?" "" "0" "" "" "g.56501381del" "" "likely pathogenic" "ACMG"
"0000816080" "0" "50" "16" "56536582" "56536582" "subst" "0" "00000" "BBS2_000198" "g.56536582T>G" "" "{PMID:Zampaglione 2020:32037395}" "" "BBS2 c.940+3A>C" "heterozygous" "Unknown" "?" "" "0" "" "" "g.56502670T>G" "" "VUS" ""
"0000816246" "0" "90" "16" "56530894" "56530894" "subst" "0.000117773" "00000" "BBS2_000022" "g.56530894C>G" "" "{PMID:Zampaglione 2020:32037395}" "" "BBS2 c.1895G>C, p.Arg632Pro" "Conflicting in silico model predictions, heterozygous" "Unknown" "?" "" "0" "" "" "g.56496982C>G" "" "pathogenic" ""
"0000816411" "0" "50" "16" "56536674" "56536674" "subst" "0" "00000" "BBS2_000199" "g.56536674T>A" "" "{PMID:Zampaglione 2020:32037395}" "" "c.851A>T, p.Asn284Ile" "heterozygous" "Unknown" "?" "" "0" "" "" "g.56502762T>A" "" "VUS" ""
"0000816531" "0" "90" "16" "56548399" "56548399" "subst" "4.46722E-5" "00000" "BBS2_000094" "g.56548399T>G" "" "{PMID:Zampaglione 2020:32037395}" "" "c.311A>C, p.Asp104Ala" "heterozygous" "Unknown" "?" "" "0" "" "" "g.56514487T>G" "" "pathogenic" ""
"0000817532" "3" "70" "16" "56532480" "56532480" "subst" "0" "00000" "BBS2_000197" "g.56532480C>A" "" "{PMID:Knopp 2015:26003401}" "" "p.Val510Phe" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000817585" "0" "90" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Hirano 2015:26325687}" "" "p.R413X;p.R480X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000817586" "0" "90" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Hirano 2015:26325687}" "" "p.R413X;p.R480X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000818208" "0" "90" "16" "56553691" "56553691" "del" "0" "00000" "BBS2_000204" "g.56553691delG" "" "{PMID:Esposito 2017:28143435}" "" "c.84delC/c.1059dupT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000818209" "0" "90" "16" "56536250" "56536250" "dup" "0" "00000" "BBS2_000201" "g.56536250dup" "" "{PMID:Esposito 2017:28143435}" "" "c.84delC/c.1059dupT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000818210" "3" "90" "16" "56548485" "56548485" "subst" "0" "00000" "BBS2_000203" "g.56548485A>C" "" "{PMID:Esposito 2017:28143435}" "" "c.225T>G/c.225T>G (p.V75G)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000818211" "0" "90" "16" "56518695" "56518695" "subst" "2.0313E-5" "00000" "BBS2_000200" "g.56518695C>T" "" "{PMID:Esposito 2017:28143435}" "" "c.2144G>A/N (p.R715Q)" "normal 2nd chromosome" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000818212" "0" "90" "16" "56536323" "56536323" "subst" "3.65613E-5" "00000" "BBS2_000154" "g.56536323A>G" "" "{PMID:Esposito 2017:28143435}" "" "c.986T>C/N (p. M329T)" "normal 2nd chromosome" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000818215" "0" "90" "16" "0" "0" "del" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Esposito 2017:28143435}" "" "c.535-79_90del/N" "normal 2nd chromosome" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000818968" "1" "70" "16" "56544770" "56545197" "del" "0" "00000" "BBS2_000202" "g.(56543947_56544770)_(56545197_56548364)del" "" "{PMID:Ellingsford 2018:29074561}" "" "chr16:56544766–56545201" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000819017" "1" "70" "16" "56534926" "56534926" "subst" "1.62433E-5" "00000" "BBS2_000024" "g.56534926G>A" "" "{PMID:Hirano 2020:32451492}" "" "BBS2 p.R413X, p.R480X" "no c. position written in publication, probable position given - RCV000411465.4" "Germline" "?" "" "0" "" "" "g.56501014G>A" "" "likely pathogenic" ""
"0000819029" "2" "70" "16" "56533779" "56533779" "subst" "2.03065E-5" "00000" "BBS2_000187" "g.56533779G>A" "" "{PMID:Hirano 2020:32451492}" "" "BBS2 p.R413X, p.R480X" "no c. position written in publication, probable position given - RCV000794157.4" "Germline" "?" "" "0" "" "" "g.56499867G>A" "" "likely pathogenic" ""
"0000819421" "1" "70" "16" "56536366" "56536366" "subst" "1.62532E-5" "00000" "BBS2_000104" "g.56536366G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "BBS2, variant 1: c.943C>T/p.R315W, variant 2: c.943C>T/p.R315W" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.56502454G>A" "" "likely pathogenic" ""
"0000820205" "1" "70" "16" "56545129" "56545129" "subst" "0" "00000" "BBS2_000205" "g.56545129A>C" "" "{PMID:Weisschuh 2020:32531858}" "" "BBS2, variant 1: c.413T>G/p.I138S, variant 2: c.413T>G/p.I138S" "possibly solved, homozygous" "Unknown" "?" "" "0" "" "" "g.56511217A>C" "" "likely pathogenic" ""
"0000822960" "3" "70" "16" "56553658" "56553658" "subst" "8.20371E-6" "00000" "BBS2_000184" "g.56553658C>T" "" "{PMID:Méjécase 2020:32783370}" "" "BBS2 c.117G>A p.(Lys39;)" "homozygous" "Unknown" "?" "" "0" "" "" "g.56519746C>T" "" "likely pathogenic" ""
"0000824324" "11" "70" "16" "56548475" "56548475" "subst" "0" "00000" "BBS2_000209" "g.56548475T>G" "" "{PMID:Huang 2021:33520300}" "" "BBS2 c.235T>G, p.(T79P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.56514563T>G" "" "likely pathogenic" ""
"0000824325" "11" "70" "16" "56548475" "56548475" "subst" "0" "00000" "BBS2_000209" "g.56548475T>G" "" "{PMID:Huang 2021:33520300}" "" "BBS2 c.235T>G, p.(T79P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.56514563T>G" "" "likely pathogenic" ""
"0000824326" "11" "70" "16" "56548475" "56548475" "subst" "0" "00000" "BBS2_000209" "g.56548475T>G" "" "{PMID:Huang 2021:33520300}" "" "BBS2 c.235T>G, p.(T79P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.56514563T>G" "" "likely pathogenic" ""
"0000824327" "11" "70" "16" "56548475" "56548475" "subst" "0" "00000" "BBS2_000209" "g.56548475T>G" "" "{PMID:Huang 2021:33520300}" "" "BBS2 c.235T>G, p.(T79P)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.56514563T>G" "" "likely pathogenic" ""
"0000824328" "21" "70" "16" "56544770" "56544770" "subst" "9.74738E-5" "00000" "BBS2_000104" "g.56544770C>A" "" "{PMID:Huang 2021:33520300}" "" "BBS2 c.534+1G>T" "heterozygous" "Germline" "yes" "" "0" "" "" "g.56510858C>A" "" "likely pathogenic" ""
"0000824329" "21" "70" "16" "56544770" "56544770" "subst" "9.74738E-5" "00000" "BBS2_000104" "g.56544770C>A" "" "{PMID:Huang 2021:33520300}" "" "BBS2 c.534+1G>T" "heterozygous" "Germline" "yes" "" "0" "" "" "g.56510858C>A" "" "likely pathogenic" ""
"0000824330" "21" "70" "16" "56544770" "56544770" "subst" "9.74738E-5" "00000" "BBS2_000104" "g.56544770C>A" "" "{PMID:Huang 2021:33520300}" "" "BBS2 c.534+1G>T" "heterozygous" "Germline" "yes" "" "0" "" "" "g.56510858C>A" "" "likely pathogenic" ""
"0000824331" "21" "70" "16" "56544770" "56544770" "subst" "9.74738E-5" "00000" "BBS2_000104" "g.56544770C>A" "" "{PMID:Huang 2021:33520300}" "" "BBS2 c.534+1G>T" "heterozygous" "Germline" "yes" "" "0" "" "" "g.56510858C>A" "" "likely pathogenic" ""
"0000824732" "0" "50" "16" "56553774" "56553774" "subst" "1.63499E-5" "00000" "BBS2_000110" "g.56553774T>C" "" "{PMID:Ma 2021:33691693}" "" "BBS2 c.A1G, p.M1V" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.56519862T>C" "" "VUS" "ACMG"
"0000824802" "0" "90" "16" "56530975" "56530975" "subst" "4.062E-6" "00000" "BBS2_000129" "g.56530975G>C" "" "{PMID:Ma 2021:33691693}" "" "BBS2 c.C1814G, p.S605X" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.56497063G>C" "" "pathogenic" "ACMG"
"0000824907" "11" "90" "16" "56519501" "56519501" "subst" "0" "00000" "BBS2_000206" "g.56519501C>G" "" "{PMID:Meng 2021:33777945}" "" "BBS2 c.2059 + 1G > C" "heterozygous" "Germline" "yes" "" "0" "" "" "g.56485589C>G" "" "pathogenic" "ACMG"
"0000824908" "3" "50" "16" "56553696" "56553696" "subst" "0" "00000" "BBS2_000185" "g.56553696T>G" "" "{PMID:Meng 2021:33777945}" "" "BBS2 c.79A > C, p.T27P" "homozygous" "Germline" "yes" "" "0" "" "" "g.56519784T>G" "" "VUS" "ACMG"
"0000824909" "3" "50" "16" "56553696" "56553696" "subst" "0" "00000" "BBS2_000185" "g.56553696T>G" "" "{PMID:Meng 2021:33777945}" "" "BBS2 c.79A > C, p.T27P" "homozygous" "Germline" "yes" "" "0" "" "" "g.56519784T>G" "" "VUS" "ACMG"
"0000824910" "11" "90" "16" "56544770" "56544770" "subst" "9.74738E-5" "00000" "BBS2_000104" "g.56544770C>A" "" "{PMID:Meng 2021:33777945}" "" "BBS2 c.534 + 1G > T" "heterozygous" "Germline" "yes" "rs773862084" "0" "" "" "g.56510858C>A" "" "pathogenic" "ACMG"
"0000824911" "11" "90" "16" "56544770" "56544770" "subst" "9.74738E-5" "00000" "BBS2_000104" "g.56544770C>A" "" "{PMID:Meng 2021:33777945}" "" "BBS2 c.534 + 1G > T" "heterozygous" "Germline" "yes" "rs773862084" "0" "" "" "g.56510858C>A" "" "pathogenic" "ACMG"
"0000824912" "0" "90" "16" "56536365" "56536365" "subst" "0" "00000" "BBS2_000137" "g.56536365C>T" "" "{PMID:Meng 2021:33777945}" "" "BBS2 c.944G > A, p.R315Q" "heterozygous" "Germline" "yes" "rs544773389" "0" "" "" "g.56502453C>T" "" "pathogenic" "ACMG"
"0000824913" "21" "90" "16" "56519501" "56519501" "subst" "0" "00000" "BBS2_000207" "g.56519501C>A" "" "{PMID:Meng 2021:33777945}" "" "BBS2 c.2059 + 1G > T" "heterozygous" "Germline" "yes" "" "0" "" "" "g.56485589C>A" "" "pathogenic" "ACMG"
"0000824919" "21" "90" "16" "56543918" "56543918" "del" "8.12803E-6" "00000" "BBS2_000190" "g.56543918del" "" "{PMID:Meng 2021:33777945}" "" "BBS2 c.563delT, p.I188Tfs*13" "heterozygous" "Germline" "yes" "rs1367927635" "0" "" "" "g.56510006del" "" "pathogenic" "ACMG"
"0000824920" "21" "50" "16" "56534885" "56534885" "subst" "0" "00000" "BBS2_000208" "g.56534885T>C" "" "{PMID:Meng 2021:33777945}" "" "BBS2 c.1278A > G, p.E426E" "heterozygous" "Germline" "yes" "" "0" "" "" "g.56500973T>C" "" "VUS" "ACMG"
"0000824921" "21" "50" "16" "56534885" "56534885" "subst" "0" "00000" "BBS2_000208" "g.56534885T>C" "" "{PMID:Meng 2021:33777945}" "" "BBS2 c.1278A > G, p.E426E" "heterozygous" "Germline" "yes" "" "0" "" "" "g.56500973T>C" "" "VUS" "ACMG"
"0000824922" "0" "90" "16" "56536294" "56536294" "subst" "0" "00000" "BBS2_000111" "g.56536294G>A" "" "{PMID:Meng 2021:33777945}" "" "BBS2 c.1015C > T, p.R339*" "heterozygous" "Germline" "yes" "rs193922710" "0" "" "" "g.56502382G>A" "" "pathogenic" "ACMG"
"0000824923" "11" "90" "16" "56544770" "56544770" "subst" "9.74738E-5" "00000" "BBS2_000104" "g.56544770C>A" "" "{PMID:Meng 2021:33777945}" "" "BBS2 c.534 + 1G > T" "heterozygous" "Germline" "yes" "rs773862084" "0" "" "" "g.56510858C>A" "" "pathogenic" "ACMG"
"0000827125" "0" "50" "16" "56534782" "56534782" "subst" "5.27975E-5" "00000" "OGFOD1_000023" "g.56534782C>T" "" "{PMID:Jeziorny-2020:33138063}" "" "c.1381G>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000827841" "0" "50" "16" "56531713" "56531713" "subst" "0" "00000" "BBS2_000210" "g.56531713A>C" "" "{PMID:Zacchia 2021:33964006}" "" "BBS2 c.T1739G, p.L580R" "heterozygous; unsolved" "Unknown" "?" "" "0" "" "" "g.56497801A>C" "" "VUS" "ACMG"
"0000827849" "0" "50" "16" "56533706" "56533706" "subst" "0.00486923" "00000" "BBS2_000068" "g.56533706G>A" "" "{PMID:Zacchia 2021:33964006}" "" "BBS2 c.C1511T, p.A504V" "heterozygous; unsolved" "Unknown" "?" "" "0" "" "" "g.56499794G>A" "" "VUS" "ACMG"
"0000828503" "3" "90" "16" "56543916" "56543916" "subst" "8.12783E-6" "00000" "BBS2_000133" "g.56543916G>A" "" "{PMID:Perea-Romero 2021:34448047}" "" "BBS2, c.565C>T, p.Arg189*, homozygous" "" "Germline" "yes" "" "0" "" "" "g.56510004G>A" "" "pathogenic" "ACMG"
"0000828510" "0" "90" "16" "56543916" "56543916" "subst" "8.12783E-6" "00000" "BBS2_000133" "g.56543916G>A" "" "{PMID:Perea-Romero 2021:34448047}" "" "BBS2, c.565C>T, p.Arg189*, heterozygous" "" "Unknown" "?" "" "0" "" "" "g.56510004G>A" "" "pathogenic" "ACMG"
"0000830018" "1" "90" "16" "56544783" "56544783" "subst" "1.21826E-5" "00000" "BBS2_000117" "g.56544783A>T" "" "{PMID:Mary-2019:30614526}" "" "c.[522T>A];[522T>A]" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000830019" "2" "90" "16" "56544783" "56544783" "subst" "1.21826E-5" "00000" "BBS2_000117" "g.56544783A>T" "" "{PMID:Mary-2019:30614526}" "" "c.[522T>A];[522T>A]" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000834083" "1" "90" "16" "56533820" "56533820" "subst" "0" "00006" "BBS2_000211" "g.56533820C>T" "" "{PMID:Tang 2022:33323469}, {DOI:Tang 2022:10.1136/jmedgenet-2020-107184}" "" "c.1398-1(IVS11)G>A" "" "Germline" "" "" "0" "" "" "g.56499908C>T" "" "pathogenic" "ACMG"
"0000834143" "1" "50" "16" "56539887" "56539887" "subst" "0" "00006" "BBS2_000212" "g.56539887A>C" "" "{PMID:Tang 2022:33323469}, {DOI:Tang 2022:10.1136/jmedgenet-2020-107184}" "" "c.779(exon7)T>G" "" "Germline" "" "" "0" "" "" "g.56505975A>C" "" "VUS" "ACMG"
"0000841598" "0" "70" "16" "56548444" "56548444" "subst" "0.000430471" "00006" "BBS2_000165" "g.56548444T>C" "" "{PMID:Alvarez-Satta 2017:28502102}" "" "" "expression cloning mini-gene splicing assay shows no effect on splicing" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000854551" "0" "50" "16" "56531666" "56531666" "subst" "8.13253E-6" "01943" "OGFOD1_000034" "g.56531666C>T" "" "" "" "BBS2(NM_031885.3):c.1786G>A (p.V596M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000854552" "0" "50" "16" "56533694" "56533694" "subst" "0.000178686" "01943" "OGFOD1_000010" "g.56533694T>G" "" "" "" "BBS2(NM_031885.3):c.1523A>C (p.Q508P), BBS2(NM_031885.5):c.1523A>C (p.Q508P, p.(Gln508Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000854553" "0" "30" "16" "56535356" "56535356" "subst" "0.000905547" "01943" "OGFOD1_000013" "g.56535356T>C" "" "" "" "BBS2(NM_031885.3):c.1134A>G (p.P378=), BBS2(NM_031885.5):c.1134A>G (p.P378=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000854554" "0" "50" "16" "56536263" "56536263" "subst" "1.62475E-5" "02327" "BBS2_000153" "g.56536263A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000854555" "0" "30" "16" "56545188" "56545188" "subst" "1.21965E-5" "01943" "BBS2_000082" "g.56545188A>G" "" "" "" "BBS2(NM_031885.3):c.354T>C (p.D118=), BBS2(NM_031885.5):c.354T>C (p.D118=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000864848" "0" "10" "16" "56518760" "56518760" "subst" "0.00147524" "02326" "BBS2_000063" "g.56518760C>T" "" "" "" "BBS2(NM_031885.5):c.2079G>A (p.Q693=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000864849" "0" "30" "16" "56535319" "56535319" "subst" "0" "02326" "OGFOD1_000035" "g.56535319G>A" "" "" "" "BBS2(NM_031885.5):c.1171C>T (p.L391=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000864850" "0" "30" "16" "56535380" "56535380" "subst" "0.000925866" "02326" "BBS2_000073" "g.56535380A>G" "" "" "" "BBS2(NM_031885.3):c.1110T>C (p.A370=), BBS2(NM_031885.5):c.1110T>C (p.A370=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000864851" "0" "30" "16" "56536740" "56536740" "subst" "0.00406511" "01804" "BBS2_000078" "g.56536740T>C" "" "" "" "BBS2(NM_031885.3):c.805-20A>G (p.(=)), BBS2(NM_031885.5):c.805-20A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000864852" "0" "30" "16" "56544843" "56544843" "subst" "0.000527906" "01943" "BBS2_000080" "g.56544843A>G" "" "" "" "BBS2(NM_031885.3):c.472-10T>C, BBS2(NM_031885.5):c.472-10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000864853" "0" "50" "16" "56545120" "56545120" "subst" "0.000138096" "01943" "OGFOD1_000036" "g.56545120T>C" "" "" "" "BBS2(NM_031885.3):c.422A>G (p.N141S), BBS2(NM_031885.5):c.422A>G (p.(Asn141Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000871266" "11" "50" "16" "56535370" "56535370" "subst" "4.06081E-5" "00000" "BBS2_000213" "g.56535370G>A" "" "{PMID:Katagiri 2020:31997113}" "" "BBS2 c.1120C>T, p.R374W" "compound heterozygous" "Germline" "yes" "rs143607562" "0" "" "" "g.56501458G>A" "" "VUS" ""
"0000871293" "0" "70" "11" "56553703" "56553703" "subst" "0" "00000" "BBS2_000119" "g.56553703G>C" "" "{PMID:Delvallee 2021:33169370}" "" "BBS2 c.72C>T, p.Tyr24*" "error in annotation, should be C>G; compound heterozygous" "Germline" "yes" "" "0" "" "" "g.56519791G>C" "" "pathogenic (recessive)" ""
"0000871294" "0" "70" "11" "56548535" "56548535" "subst" "0" "00000" "BBS2_000036" "g.56548535G>A" "" "{PMID:Delvallee 2021:33169370}" "" "BBS2 c.175C>T, p.Gln59*" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.56514623G>A" "" "pathogenic (recessive)" ""
"0000873531" "0" "70" "16" "56536366" "56536366" "subst" "1.62532E-5" "00000" "BBS2_000104" "g.56536366G>A" "166" "{PMID:Sun 2018:30076350}" "" "BBS2 (NM_031885.3):c.943C>T(p.R315W)/c.534+1G>T" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.56502454G>A" "" "likely pathogenic" ""
"0000873532" "0" "70" "16" "56544770" "56544770" "subst" "9.74738E-5" "00000" "BBS2_000104" "g.56544770C>A" "166" "{PMID:Sun 2018:30076350}" "" "BBS2 (NM_031885.3):c.943C>T(p.R315W)/c.534+1G>T" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.56510858C>A" "" "likely pathogenic" ""
"0000873533" "0" "70" "16" "56540102" "56540102" "subst" "4.06573E-6" "00000" "BBS2_000214" "g.56540102C>G" "167" "{PMID:Sun 2018:30076350}" "" "BBS2(NM_031885.3)c.647G>C (p.R216P)/c.534+1G>T" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.56506190C>G" "" "likely pathogenic" ""
"0000873534" "0" "70" "16" "56544770" "56544770" "subst" "9.74738E-5" "00000" "BBS2_000104" "g.56544770C>A" "167" "{PMID:Sun 2018:30076350}" "" "BBS2(NM_031885.3)c.647G>C (p.R216P)/c.534+1G>T" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.56510858C>A" "" "likely pathogenic" ""
"0000879743" "3" "50" "16" "56531779" "56531779" "subst" "4.10799E-6" "00000" "BBS2_000099" "g.56531779G>A" "0/192 control chromosomes" "{PMID:Katsanis 2002:12016587}" "" "BBS4 T558I" "no nucleotide annotation, extrapolated from protein, sequence and databases; homozygous; mother also homozygous, this is likely a benign variant not contributing to the disease" "Germline" "no" "" "0" "" "" "g.56497867G>A" "" "VUS" ""
"0000880161" "3" "90" "16" "56543916" "56543916" "subst" "8.12783E-6" "00006" "BBS2_000133" "g.56543916G>A" "" "{PMID:Smaoui 2006:16877420}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000880162" "3" "90" "16" "56543916" "56543916" "subst" "8.12783E-6" "00006" "BBS2_000133" "g.56543916G>A" "" "{PMID:Smaoui 2006:16877420}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000880174" "0" "10" "16" "56545175" "56545175" "subst" "0.213698" "00006" "BBS2_000089" "g.56545175T>C" "4/19 families BBS" "{PMID:Smaoui 2006:16877420}" "" "" "" "Germline" "" "rs3177663" "0" "" "" "g.56511263T>C" "" "benign" ""
"0000881185" "3" "70" "16" "56553677" "56553677" "subst" "8.20789E-6" "02300" "BBS2_000095" "g.56553677G>T" "" "{PMID:Marinakis 2021:34008892}" "" "" "ACMG PM2, PP3, PP5" "Germline" "" "rs797045155" "0" "" "" "g.56519765G>T" "" "likely pathogenic (recessive)" "ACMG"
"0000893063" "0" "90" "16" "56531672" "56531672" "subst" "8.13445E-6" "02325" "BBS2_000123" "g.56531672G>A" "" "" "" "BBS2(NM_031885.5):c.1780C>T (p.R594*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000893064" "0" "30" "16" "56535427" "56535427" "subst" "0.000398018" "02326" "OGFOD1_000037" "g.56535427C>A" "" "" "" "BBS2(NM_031885.5):c.1081-18G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000893065" "0" "10" "16" "56536660" "56536660" "subst" "0.00886243" "02327" "BBS2_000076" "g.56536660T>C" "" "" "" "BBS2(NM_031885.5):c.865A>G (p.I289V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000893066" "0" "50" "16" "56539868" "56539868" "subst" "4.06369E-6" "02327" "OGFOD1_000038" "g.56539868A>T" "" "" "" "BBS2(NM_031885.5):c.798T>A (p.(Asn266Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000905558" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Heon 2005:15690372}" "" "BBS2 I234V" "homozygous; no nucleotide annotation, could not be extrapolated from protein and databases, as no known transcripts contain Ile in the position 234" "Germline" "yes" "" "0" "" "" "g.?" "" "likely pathogenic" ""
"0000914645" "0" "30" "16" "56548639" "56548639" "subst" "0.00482357" "02325" "OGFOD1_000039" "g.56548639A>C" "" "" "" "BBS2(NM_031885.5):c.118-47T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000916412" "3" "70" "16" "56519577" "56519577" "del" "0" "04436" "BBS2_000215" "g.56519577del" "" "{PMID:Panneman 2023:36819107}" "" "c.1984del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000916605" "1" "90" "16" "56545141" "56545141" "subst" "3.24939E-5" "04436" "BBS2_000081" "g.56545141G>C" "" "{PMID:Panneman 2023:36819107}" "" "c.401C>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916606" "2" "50" "16" "56540066" "56540066" "subst" "0" "04436" "BBS2_000216" "g.56540066A>T" "" "{PMID:Panneman 2023:36819107}" "" "c.683T>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000930620" "0" "90" "16" "56532462" "56532462" "subst" "0" "02329" "OGFOD1_000040" "g.56532462G>A" "" "" "" "BBS2(NM_031885.5):c.1546C>T (p.Q516*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000930621" "0" "90" "16" "56540122" "56540123" "del" "0" "02329" "BBS2_000143" "g.56540122_56540123del" "" "" "" "BBS2(NM_031885.5):c.627_628delTT (p.C210Sfs*20)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000950681" "0" "30" "16" "56545188" "56545188" "subst" "1.21965E-5" "02326" "BBS2_000082" "g.56545188A>G" "" "" "" "BBS2(NM_031885.3):c.354T>C (p.D118=), BBS2(NM_031885.5):c.354T>C (p.D118=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000958086" "0" "70" "16" "56530894" "56530894" "subst" "0.000117773" "00006" "BBS2_000022" "g.56530894C>G" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PP5_STRONG" "Germline" "" "" "0" "" "" "g.56496982C>G" "" "likely pathogenic (recessive)" "ACMG"
"0000958470" "0" "90" "16" "56540090" "56540090" "del" "0" "00006" "BBS2_000138" "g.56540090del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.56506178del" "" "pathogenic (recessive)" "ACMG"
"0000968405" "0" "30" "16" "56534839" "56534839" "subst" "0" "01804" "OGFOD1_000041" "g.56534839A>G" "" "" "" "BBS2(NM_031885.3):c.1324T>C (p.(Cys442Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000968406" "0" "90" "16" "56534926" "56534926" "subst" "1.62433E-5" "02327" "BBS2_000024" "g.56534926G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000981948" "0" "50" "16" "56531770" "56531770" "subst" "4.50425E-5" "01804" "OGFOD1_000009" "g.56531770A>G" "" "" "" "BBS2(NM_031885.3):c.1682T>C (p.I561T), BBS2(NM_031885.5):c.1682T>C (p.(Ile561Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000981949" "0" "50" "16" "56532393" "56532393" "subst" "1.62504E-5" "01804" "OGFOD1_000042" "g.56532393G>A" "" "" "" "BBS2(NM_031885.5):c.1615C>T (p.(Arg539Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000981950" "0" "50" "16" "56533694" "56533694" "subst" "0.000178686" "01804" "OGFOD1_000010" "g.56533694T>G" "" "" "" "BBS2(NM_031885.3):c.1523A>C (p.Q508P), BBS2(NM_031885.5):c.1523A>C (p.Q508P, p.(Gln508Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000981951" "0" "50" "16" "56548456" "56548456" "subst" "0" "01804" "OGFOD1_000043" "g.56548456G>A" "" "" "" "BBS2(NM_031885.5):c.254C>T (p.(Pro85Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001002431" "0" "30" "16" "56535380" "56535380" "subst" "0.000925866" "02330" "BBS2_000073" "g.56535380A>G" "" "" "" "BBS2(NM_031885.3):c.1110T>C (p.A370=), BBS2(NM_031885.5):c.1110T>C (p.A370=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001026722" "0" "70" "16" "56530925" "56530925" "subst" "2.84326E-5" "01943" "OGFOD1_000022" "g.56530925G>A" "" "" "" "BBS2(NM_031885.3):c.1864C>T (p.R622*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0001041201" "0" "50" "16" "56533685" "56533685" "subst" "4.87369E-5" "01804" "OGFOD1_000044" "g.56533685C>G" "" "" "" "BBS2(NM_031885.5):c.1527+5G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001041202" "0" "30" "16" "56536580" "56536580" "subst" "0" "01804" "OGFOD1_000015" "g.56536580T>C" "" "" "" "BBS2(NM_031885.5):c.940+5A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001041203" "0" "70" "16" "56543868" "56543868" "subst" "0" "01804" "OGFOD1_000045" "g.56543868C>T" "" "" "" "BBS2(NM_031885.5):c.612+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0001041204" "0" "90" "16" "56545140" "56545140" "del" "4.06167E-6" "01804" "BBS2_000145" "g.56545140del" "" "" "" "BBS2(NM_031885.5):c.402del (p.(Ala136Argfs*65))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0001055598" "0" "70" "16" "56536365" "56536365" "subst" "0" "01804" "BBS2_000137" "g.56536365C>T" "" "" "" "BBS2(NM_031885.5):c.944G>A (p.(Arg315Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0001055599" "0" "50" "16" "56539879" "56539879" "subst" "0" "01804" "OGFOD1_000046" "g.56539879C>T" "" "" "" "BBS2(NM_031885.5):c.787G>A (p.(Gly263Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001055600" "0" "50" "16" "56543915" "56543915" "subst" "8.12711E-6" "01804" "OGFOD1_000047" "g.56543915C>T" "" "" "" "BBS2(NM_031885.5):c.566G>A (p.(Arg189Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001055601" "0" "50" "16" "56545072" "56545072" "subst" "8.94149E-5" "01804" "OGFOD1_000048" "g.56545072G>A" "" "" "" "BBS2(NM_031885.5):c.470C>T (p.(Thr157Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001055602" "0" "50" "16" "56545120" "56545120" "subst" "0.000138096" "01804" "OGFOD1_000036" "g.56545120T>C" "" "" "" "BBS2(NM_031885.3):c.422A>G (p.N141S), BBS2(NM_031885.5):c.422A>G (p.(Asn141Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001055603" "0" "10" "16" "56548501" "56548501" "subst" "0.994128" "01804" "BBS2_000084" "g.56548501C>T" "" "" "" "BBS2(NM_031885.3):c.209G>A (p.S70N), BBS2(NM_031885.5):c.209G>A (p.(Ser70Asn), p.S70N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0001066499" "0" "50" "16" "56539868" "56539868" "subst" "4.06369E-6" "01804" "OGFOD1_000038" "g.56539868A>T" "" "" "" "BBS2(NM_031885.5):c.798T>A (p.(Asn266Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001079444" "0" "90" "16" "56553677" "56553677" "subst" "8.20789E-6" "00006" "BBS2_000095" "g.56553677G>T" "1/276 unrelated individuals" "{PMID:Kostoulas 2026:42212615}" "" "" "" "Germline" "" "rs797045155" "0" "" "" "g.56519765G>T" "" "pathogenic" ""
"0001081770" "1" "70" "16" "56536250" "56536250" "dup" "0" "00006" "BBS2_000201" "g.56536250dup" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "1059dupT" "" "Germline" "" "" "0" "" "" "g.56502338dup" "" "likely pathogenic" ""
"0001081771" "1" "70" "16" "56548570" "56548571" "del" "0" "00006" "chr16_007681" "g.56548570_56548571del" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "141_142delAC" "" "Germline" "" "" "0" "" "" "g.56514658_56514659del" "" "likely pathogenic" ""
"0001081772" "1" "70" "16" "56531734" "56531734" "subst" "0" "00006" "chr16_007682" "g.56531734G>T" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "" "" "Germline" "" "" "0" "" "" "g.56497822G>T" "" "likely pathogenic" ""
"0001081773" "1" "70" "16" "56548482" "56548515" "del" "0" "00006" "chr16_007683" "g.56548482_56548515del" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "198_231delTTCTCTTCTCAGCATTAACCAGGCAGTCAGCTGT" "" "Germline" "" "" "0" "" "" "g.56514570_56514603del" "" "likely pathogenic" ""
"0001081774" "1" "70" "16" "56519501" "56519501" "subst" "0" "00006" "BBS2_000207" "g.56519501C>A" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "" "" "Germline" "" "" "0" "" "" "g.56485589C>A" "" "likely pathogenic" ""
"0001081775" "1" "70" "16" "56548427" "56548428" "del" "0" "00006" "chr16_007684" "g.56548427_56548428del" "1/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "284_285delGG" "" "Germline" "" "" "0" "" "" "g.56514515_56514516del" "" "likely pathogenic" ""
"0001081776" "1" "70" "16" "56543918" "56543918" "del" "8.12803E-6" "00006" "BBS2_000190" "g.56543918del" "3/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "563delT" "" "Germline" "" "" "0" "" "" "g.56510006del" "" "likely pathogenic" ""
"0001081777" "1" "70" "16" "56540049" "56540049" "subst" "2.84548E-5" "00006" "BBS2_000088" "g.56540049G>A" "2/7496 chromosomes" "{PMID:Liu 2026:41932824}" "" "" "" "Germline" "" "" "0" "" "" "g.56506137G>A" "" "likely pathogenic" ""
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes BBS2
## Count = 464
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}"
"0000019535" "00003289" "95" "471" "0" "471" "0" "c.471G>A" "r.(spl?)" "p.(?)" "3"
"0000036432" "00003289" "55" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" "15"
"0000079362" "00003289" "00" "416" "0" "416" "0" "c.416G>A" "r.(?)" "p.(Gly139Asp)" ""
"0000079654" "00003289" "00" "175" "0" "175" "0" "c.175C>T" "r.(?)" "p.(Gln59*)" ""
"0000158319" "00003289" "90" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413*)" "11"
"0000170885" "00003289" "70" "334" "0" "334" "0" "c.334T>C" "r.(?)" "p.(Phe112Leu)" "2"
"0000247370" "00003289" "10" "354" "0" "354" "0" "c.354T>C" "r.(?)" "p.(Asp118=)" ""
"0000254259" "00003289" "30" "1110" "0" "1110" "0" "c.1110T>C" "r.(?)" "p.(Ala370=)" ""
"0000256308" "00003289" "50" "635" "0" "635" "0" "c.635T>G" "r.(?)" "p.(Met212Arg)" ""
"0000258596" "00003289" "10" "1104" "0" "1104" "0" "c.1104C>T" "r.(?)" "p.(Asn368=)" ""
"0000258597" "00003289" "10" "1422" "0" "1422" "0" "c.1422G>A" "r.(?)" "p.(Ser474=)" ""
"0000258598" "00003289" "50" "1454" "0" "1454" "0" "c.1454C>T" "r.(?)" "p.(Ala485Val)" ""
"0000258599" "00003289" "10" "2079" "0" "2079" "0" "c.2079G>A" "r.(?)" "p.(Gln693=)" ""
"0000258600" "00003289" "30" "805" "-20" "805" "-20" "c.805-20A>G" "r.(=)" "p.(=)" ""
"0000259231" "00003289" "10" "209" "0" "209" "0" "c.209=" "r.(=)" "p.(Asn70=)" ""
"0000259789" "00003289" "90" "814" "0" "814" "0" "c.814C>T" "r.(?)" "p.(Arg272Ter)" ""
"0000261406" "00003289" "10" "1511" "0" "1511" "0" "c.1511C>T" "r.(?)" "p.(Ala504Val)" ""
"0000261407" "00003289" "10" "1659" "3" "1659" "3" "c.1659+3A>G" "r.spl?" "p.?" ""
"0000261408" "00003289" "10" "209" "0" "209" "0" "c.209=" "r.(=)" "p.(Asn70=)" ""
"0000261409" "00003289" "30" "805" "-20" "805" "-20" "c.805-20A>G" "r.(=)" "p.(=)" ""
"0000261410" "00003289" "30" "865" "0" "865" "0" "c.865A>G" "r.(?)" "p.(Ile289Val)" ""
"0000263575" "00003289" "30" "1157" "0" "1157" "0" "c.1157C>T" "r.(?)" "p.(Thr386Met)" ""
"0000263576" "00003289" "30" "1413" "0" "1413" "0" "c.1413A>C" "r.(?)" "p.(Val471=)" ""
"0000263577" "00003289" "30" "1422" "0" "1422" "0" "c.1422G>A" "r.(?)" "p.(Ser474=)" ""
"0000263578" "00003289" "10" "1511" "0" "1511" "0" "c.1511C>T" "r.(?)" "p.(Ala504Val)" ""
"0000263579" "00003289" "10" "1659" "3" "1659" "3" "c.1659+3A>G" "r.spl?" "p.?" ""
"0000263580" "00003289" "10" "209" "0" "209" "0" "c.209=" "r.(=)" "p.(Asn70=)" ""
"0000263581" "00003289" "50" "970" "0" "970" "0" "c.970A>T" "r.(?)" "p.(Met324Leu)" ""
"0000324799" "00003289" "50" "1957" "0" "1957" "0" "c.1957G>C" "r.(?)" "p.(Asp653His)" ""
"0000324801" "00003289" "50" "401" "0" "401" "0" "c.401C>G" "r.(?)" "p.(Pro134Arg)" ""
"0000338403" "00003289" "10" "-40" "0" "-40" "0" "c.-40T>C" "r.(?)" "p.(=)" ""
"0000338404" "00003289" "10" "-42" "0" "-42" "0" "c.-42T>G" "r.(?)" "p.(=)" ""
"0000338405" "00003289" "10" "-225" "0" "-225" "0" "c.-225C>T" "r.(?)" "p.(=)" ""
"0000338406" "00003289" "10" "-318" "0" "-318" "0" "c.-318C>G" "r.(?)" "p.(=)" ""
"0000340245" "00003289" "10" "-344" "0" "-344" "0" "c.-344A>G" "r.(?)" "p.(=)" ""
"0000342348" "00003289" "90" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234Ter)" ""
"0000342499" "00003289" "90" "814" "0" "814" "0" "c.814C>T" "r.(?)" "p.(Arg272Ter)" ""
"0000342506" "00003289" "90" "823" "0" "823" "0" "c.823C>T" "r.(?)" "p.(Arg275Ter)" ""
"0000346561" "00003289" "10" "367" "0" "367" "0" "c.367A>G" "r.(?)" "p.(Ile123Val)" ""
"0000347537" "00003289" "50" "1033" "0" "1033" "0" "c.1033A>C" "r.(?)" "p.(Lys345Gln)" ""
"0000347707" "00003289" "90" "2" "0" "2" "0" "c.2T>G" "r.(?)" "p.(Met1?)" ""
"0000349146" "00003289" "10" "209" "0" "209" "0" "c.209=" "r.(=)" "p.(Asn70=)" ""
"0000358172" "00003289" "90" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" "16"
"0000358173" "00003289" "90" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" "16"
"0000358174" "00003289" "90" "311" "0" "311" "0" "c.311A>C" "r.(?)" "p.(Asp104Ala)" "3"
"0000358175" "00003289" "90" "401" "0" "401" "0" "c.401C>G" "r.(?)" "p.(Pro134Arg)" "4"
"0000358412" "00003289" "90" "311" "0" "311" "0" "c.311A>C" "r.(?)" "p.(Asp104Ala)" "3"
"0000358413" "00003289" "90" "98" "0" "98" "0" "c.98C>A" "r.(?)" "p.(Ala33Asp)" "2"
"0000369938" "00003289" "90" "1824" "0" "1825" "0" "c.1824_1825del" "r.(?)" "p.(Lys609Alafs*4)" ""
"0000477161" "00003289" "50" "1934" "0" "1934" "0" "c.1934T>C" "r.(?)" "p.(Met645Thr)" ""
"0000477162" "00003289" "50" "1888" "0" "1888" "0" "c.1888G>A" "r.(?)" "p.(Asp630Asn)" ""
"0000477163" "00003289" "90" "1673" "0" "1673" "0" "c.1673C>T" "r.(?)" "p.(Thr558Ile)" ""
"0000477164" "00003289" "50" "1598" "0" "1598" "0" "c.1598T>A" "r.(?)" "p.(Val533Glu)" ""
"0000477165" "00003289" "50" "1486" "0" "1486" "0" "c.1486A>G" "r.(?)" "p.(Ile496Val)" ""
"0000477166" "00003289" "90" "1276" "0" "1276" "0" "c.1276G>T" "r.(?)" "p.(Glu426*)" ""
"0000477167" "00003289" "50" "1220" "0" "1220" "0" "c.1220C>T" "r.(?)" "p.(Ser407Phe)" ""
"0000477168" "00003289" "90" "943" "0" "943" "0" "c.943C>T" "r.(?)" "p.(Arg315Trp)" ""
"0000477169" "00003289" "50" "911" "0" "911" "0" "c.911A>G" "r.(?)" "p.(Gln304Arg)" ""
"0000477170" "00003289" "10" "865" "0" "865" "0" "c.865A>G" "r.(?)" "p.(Ile289Val)" ""
"0000477171" "00003289" "50" "824" "0" "824" "0" "c.824G>A" "r.(?)" "p.(Arg275Gln)" ""
"0000477172" "00003289" "90" "814" "0" "814" "0" "c.814C>T" "r.(?)" "p.(Arg272*)" ""
"0000477173" "00003289" "90" "792" "0" "792" "0" "c.792G>A" "r.(?)" "p.(Trp264*)" ""
"0000477174" "00003289" "50" "407" "0" "407" "0" "c.407C>A" "r.(?)" "p.(Ala136Glu)" ""
"0000477175" "00003289" "10" "367" "0" "367" "0" "c.367A>G" "r.(?)" "p.(Ile123Val)" ""
"0000477176" "00003289" "50" "209" "0" "209" "0" "c.209G>A" "r.(?)" "p.(Ser70Asn)" ""
"0000477177" "00003289" "50" "86" "0" "86" "0" "c.86C>T" "r.(?)" "p.(Pro29Leu)" ""
"0000477178" "00003289" "50" "1" "0" "1" "0" "c.1A>G" "r.(?)" "p.(Met1?)" ""
"0000477595" "00003289" "10" "865" "0" "865" "0" "c.865A>G" "r.(?)" "p.(Ile289Val)" ""
"0000477596" "00003289" "10" "367" "0" "367" "0" "c.367A>G" "r.(?)" "p.(Ile123Val)" ""
"0000477597" "00003289" "50" "209" "0" "209" "0" "c.209G>A" "r.(?)" "p.(Ser70Asn)" ""
"0000558486" "00003289" "30" "2151" "0" "2151" "0" "c.2151G>A" "r.(?)" "p.(Gly717=)" ""
"0000558489" "00003289" "50" "1982" "0" "1982" "0" "c.1982G>A" "r.(?)" "p.(Arg661His)" ""
"0000558491" "00003289" "50" "1808" "0" "1808" "0" "c.1808A>G" "r.(?)" "p.(Tyr603Cys)" ""
"0000558492" "00003289" "30" "1808" "0" "1808" "0" "c.1808A>G" "r.(?)" "p.(Tyr603Cys)" ""
"0000558493" "00003289" "50" "1682" "0" "1682" "0" "c.1682T>C" "r.(?)" "p.(Ile561Thr)" ""
"0000558494" "00003289" "50" "1523" "0" "1523" "0" "c.1523A>C" "r.(?)" "p.(Gln508Pro)" ""
"0000558496" "00003289" "30" "1511" "0" "1511" "0" "c.1511C>T" "r.(?)" "p.(Ala504Val)" ""
"0000558498" "00003289" "30" "1398" "-11" "1398" "-11" "c.1398-11A>G" "r.(=)" "p.(=)" ""
"0000558499" "00003289" "30" "1380" "0" "1380" "0" "c.1380C>T" "r.(?)" "p.(Phe460=)" ""
"0000558500" "00003289" "10" "1134" "0" "1134" "0" "c.1134A>G" "r.(?)" "p.(Pro378=)" ""
"0000558501" "00003289" "10" "1134" "0" "1134" "0" "c.1134A>G" "r.(?)" "p.(Pro378=)" ""
"0000558502" "00003289" "10" "941" "-8" "941" "-8" "c.941-8C>G" "r.(=)" "p.(=)" ""
"0000558503" "00003289" "30" "940" "5" "940" "5" "c.940+5A>G" "r.spl?" "p.?" ""
"0000558506" "00003289" "10" "612" "12" "612" "12" "c.612+12C>A" "r.(=)" "p.(=)" ""
"0000558507" "00003289" "10" "612" "12" "612" "12" "c.612+12C>A" "r.(=)" "p.(=)" ""
"0000558508" "00003289" "30" "534" "11" "534" "11" "c.534+11G>T" "r.(=)" "p.(=)" ""
"0000558509" "00003289" "10" "472" "-10" "472" "-10" "c.472-10T>C" "r.(=)" "p.(=)" ""
"0000558510" "00003289" "10" "367" "0" "367" "0" "c.367A>G" "r.(?)" "p.(Ile123Val)" ""
"0000558511" "00003289" "10" "367" "0" "367" "0" "c.367A>G" "r.(?)" "p.(Ile123Val)" ""
"0000623491" "00003289" "30" "1798" "-11" "1798" "-11" "c.1798-11A>G" "r.(=)" "p.(=)" ""
"0000624990" "00003289" "70" "401" "0" "401" "0" "c.401C>G" "r.(?)" "p.(Pro134Arg)" ""
"0000631994" "00003289" "90" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" ""
"0000631995" "00003289" "90" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" ""
"0000631996" "00003289" "90" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" ""
"0000631997" "00003289" "90" "98" "0" "98" "0" "c.98C>A" "r.(?)" "p.(Ala33Asp)" ""
"0000649350" "00003289" "70" "1015" "0" "1015" "0" "c.1015C>T" "r.(?)" "p.(Arg339*)" ""
"0000657872" "00003289" "90" "1864" "0" "1864" "0" "c.1864C>T" "r.(?)" "p.(Arg622Ter)" ""
"0000657873" "00003289" "50" "1381" "0" "1381" "0" "c.1381G>A" "r.(?)" "p.(Val461Met)" ""
"0000657874" "00003289" "50" "994" "0" "994" "0" "c.994A>T" "r.(?)" "p.(Ser332Cys)" ""
"0000657875" "00003289" "50" "710" "0" "710" "0" "c.710G>A" "r.(?)" "p.(Arg237Lys)" ""
"0000663591" "00003289" "50" "1231" "0" "1231" "0" "c.1231A>G" "r.(?)" "p.(Ile411Val)" ""
"0000680605" "00003289" "10" "1422" "0" "1422" "0" "c.1422G>A" "r.(?)" "p.(Ser474=)" ""
"0000680606" "00003289" "30" "472" "-10" "472" "-10" "c.472-10T>C" "r.(=)" "p.(=)" ""
"0000680607" "00003289" "30" "327" "0" "327" "0" "c.327G>A" "r.(?)" "p.(Ser109=)" ""
"0000684496" "00003289" "70" "209" "0" "209" "0" "c.209A>G" "r.(?)" "p.(Asn70Ser)" ""
"0000684497" "00003289" "70" "823" "0" "823" "0" "c.823C>T" "r.(?)" "p.(Arg275*)" ""
"0000684498" "00003289" "70" "1864" "0" "1864" "0" "c.1864C>T" "r.(?)" "p.(Arg622*)" ""
"0000684618" "00003289" "70" "209" "0" "209" "0" "c.209A>G" "r.(?)" "p.(Asn70Ser)" ""
"0000685014" "00003289" "90" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" ""
"0000685015" "00003289" "90" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" ""
"0000685016" "00003289" "70" "401" "0" "401" "0" "c.401C>G" "r.(?)" "p.(Pro134Arg)" ""
"0000685018" "00003289" "90" "311" "0" "311" "0" "c.311A>C" "r.(?)" "p.(Asp104Ala)" ""
"0000685019" "00003289" "90" "224" "0" "224" "0" "c.224T>G" "r.(?)" "p.(Val75Gly)" ""
"0000685020" "00003289" "70" "98" "0" "98" "0" "c.98C>A" "r.(?)" "p.(Ala33Asp)" ""
"0000710235" "00003289" "50" "143" "0" "143" "0" "c.143G>A" "r.(?)" "p.(Arg48Gln)" ""
"0000725847" "00003289" "90" "1986" "0" "1986" "0" "c.1986dup" "r.(?)" "p.(Asn663Ter)" ""
"0000725848" "00003289" "90" "1931" "0" "1931" "0" "c.1931dup" "r.(?)" "p.(Tyr644Ter)" ""
"0000725849" "00003289" "50" "1879" "0" "1879" "0" "c.1879G>A" "r.(?)" "p.(Gly627Arg)" ""
"0000725850" "00003289" "50" "1666" "0" "1666" "0" "c.1666A>G" "r.(?)" "p.(Ile556Val)" ""
"0000725852" "00003289" "50" "600" "0" "600" "0" "c.600G>T" "r.(?)" "p.(Met200Ile)" ""
"0000725853" "00003289" "50" "184" "0" "184" "0" "c.184C>G" "r.(?)" "p.(Leu62Val)" ""
"0000730339" "00003289" "90" "471" "0" "471" "0" "c.471G>A" "r.spl" "p.?" ""
"0000730359" "00003289" "90" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413*)" ""
"0000730372" "00003289" "90" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413*)" ""
"0000733319" "00003289" "70" "522" "0" "522" "0" "c.522T>A" "r.(?)" "p.(Asp174Glu)" ""
"0000733320" "00003289" "70" "717" "1" "717" "1" "c.717+1G>T" "r.spl" "p.?" ""
"0000733321" "00003289" "70" "72" "0" "72" "0" "c.72C>G" "r.(?)" "p.(Tyr24*)" ""
"0000733322" "00003289" "70" "118" "0" "118" "0" "c.118G>T" "r.(?)" "p.(Val40Phe)" ""
"0000733707" "00003289" "70" "823" "0" "823" "0" "c.823C>T" "r.(?)" "p.(Arg275*)" ""
"0000733708" "00003289" "70" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" ""
"0000733709" "00003289" "70" "814" "0" "814" "0" "c.814C>T" "r.(?)" "p.(Arg272*)" ""
"0000735884" "00003289" "70" "1176" "0" "1184" "0" "c.1176_1184del" "r.(?)" "p.(Asn393_Thr395del)" ""
"0000735951" "00003289" "70" "1175" "0" "1175" "0" "c.1175G>A" "r.(?)" "p.(Gly392Glu)" ""
"0000759683" "00003289" "90" "805" "-1476" "1910" "952" "c.805-1476_1910+952del" "r.(?)" "p.(Val269Glufs*12)" ""
"0000759701" "00003289" "50" "367" "0" "367" "0" "c.367A>G" "r.(?)" "p.(Ile123Val)" ""
"0000759705" "00003289" "50" "367" "0" "367" "0" "c.367A>G" "r.(?)" "p.(Ile123Val)" ""
"0000759939" "00003289" "90" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413*)" ""
"0000759960" "00003289" "90" "241" "0" "241" "0" "c.241G>T" "r.(?)" "p.(Gly81Cys)" ""
"0000760667" "00003289" "90" "1780" "0" "1780" "0" "c.1780C>T" "r.(?)" "p.(Arg594Ter)" ""
"0000760684" "00003289" "90" "471" "1" "471" "1" "c.471+1G>A" "r.spl" "p.?" ""
"0000765535" "00003289" "90" "263" "0" "263" "0" "c.263del" "r.(?)" "p.(Gly88AlafsTer6)" ""
"0000765537" "00003289" "90" "263" "0" "263" "0" "c.263del" "r.(?)" "p.(Gly88AlafsTer6)" ""
"0000765794" "00003289" "70" "943" "0" "943" "0" "c.943C>T" "r.(?)" "p.(Arg315Trp)" ""
"0000765880" "00003289" "70" "508" "0" "508" "0" "c.508G>A" "r.(?)" "p.(Asp170Asn)" ""
"0000765901" "00003289" "70" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234Ter)" ""
"0000783988" "00003289" "90" "899" "0" "899" "0" "c.899A>G" "r.(?)" "p.(Asp300Gly)" ""
"0000783989" "00003289" "90" "1814" "0" "1814" "0" "c.1814C>G" "r.(?)" "p.(Ser605*)" ""
"0000783991" "00003289" "90" "2107" "0" "2107" "0" "c.2107C>T" "r.(?)" "p.(Arg703*)" ""
"0000785550" "00003289" "90" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413Ter)" ""
"0000785551" "00003289" "90" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413Ter)" ""
"0000786404" "00003289" "90" "1895" "0" "1895" "0" "c.1895G>A" "r.(?)" "p.(Arg632His)" ""
"0000786413" "00003289" "90" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" ""
"0000786474" "00003289" "90" "72" "0" "72" "0" "c.72C>G" "r.(?)" "p.(Tyr24Ter)" ""
"0000786478" "00003289" "90" "311" "0" "311" "0" "c.311A>C" "r.(?)" "p.(Asp104Ala)" ""
"0000788532" "00003289" "90" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" ""
"0000793697" "00003289" "90" "68" "0" "68" "0" "c.68G>C" "r.(?)" "p.(Arg23Pro)" "1"
"0000793698" "00003289" "90" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413*)" "11"
"0000795030" "00003289" "90" "345" "5" "345" "5" "c.345+5G>A" "r.spl?" "p.?" "2i"
"0000795033" "00003289" "90" "565" "0" "565" "0" "c.565C>T" "r.(?)" "p.(Arg189*)" "5"
"0000796916" "00003289" "90" "471" "0" "471" "0" "c.471G>A" "r.(=)" "p.(=)" "3"
"0000797940" "00003289" "90" "1290" "0" "1290" "0" "c.1290dup" "r.(?)" "p.(His431Thrfs*43)" ""
"0000797941" "00003289" "90" "661" "0" "661" "0" "c.661del" "r.(?)" "p.(Leu221Phefs*25)" ""
"0000797942" "00003289" "90" "661" "0" "661" "0" "c.661del" "r.(?)" "p.(Leu221Phefs*25)" ""
"0000797943" "00003289" "70" "646" "0" "646" "0" "c.646C>T" "r.(?)" "p.(Arg216*)" ""
"0000797944" "00003289" "90" "72" "0" "72" "0" "c.72C>G" "r.(?)" "p.(Tyr24*)" ""
"0000798530" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798531" "00003289" "70" "311" "0" "311" "0" "c.311A>C" "r.(?)" "p.(Asp104Ala)" "2"
"0000798532" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798533" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798534" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798535" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798536" "00003289" "70" "943" "0" "943" "0" "c.943C>T" "r.(?)" "p.(Arg315Trp)" "9"
"0000798537" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798538" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798539" "00003289" "70" "-234" "-1" "-234" "-1" "c.-234-1G>C" "r.(?)" "p.?" "1"
"0000798540" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798541" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798542" "00003289" "70" "311" "0" "311" "0" "c.311A>C" "r.(?)" "p.(Asp104Ala)" "2"
"0000798543" "00003289" "70" "534" "1" "534" "1" "c.534+1G>C" "r.spl?" "p.?" "4i"
"0000798545" "00003289" "70" "209" "0" "209" "0" "c.209A>G" "r.(?)" "p.(Asn70Ser)" "2"
"0000798546" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798548" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798550" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798551" "00003289" "70" "944" "0" "944" "0" "c.944G>A" "r.(?)" "p.(Arg315Gln)" "9"
"0000798552" "00003289" "70" "117" "1" "117" "1" "c.117+1G>C" "r.spl?" "p.?" "1i"
"0000798553" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798555" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000798556" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000807453" "00003289" "50" "1894" "0" "1895" "0" "c.1894_1895insAGC" "r.(?)" "p.(Ala631_Arg632insGln)" ""
"0000807454" "00003289" "30" "535" "-16" "535" "-14" "c.535-16_535-14del" "r.(=)" "p.(=)" ""
"0000807455" "00003289" "50" "483" "0" "483" "0" "c.483C>A" "r.(?)" "p.(Asp161Glu)" ""
"0000810936" "00003289" "10" "367" "0" "367" "0" "c.367A>G" "r.(?)" "p.(Ile123Val)" "3"
"0000810949" "00003289" "50" "627" "0" "628" "0" "c.627_628del" "r.(?)" "p.(Cys210Serfs*20)" "6"
"0000810950" "00003289" "50" "402" "0" "402" "0" "c.402del" "r.(?)" "p.(Ala136Argfs*65)" "3"
"0000810971" "00003289" "90" "416" "0" "416" "0" "c.416G>T" "r.(?)" "p.(Gly139Val)" "3"
"0000810972" "00003289" "90" "416" "0" "416" "0" "c.416G>T" "r.(?)" "p.(Gly139Val)" "3"
"0000810980" "00003289" "70" "367" "0" "367" "0" "c.367A>G" "r.(?)" "p.(Ile123Val)" "3"
"0000810990" "00003289" "70" "367" "0" "367" "0" "c.367A>G" "r.(?)" "p.(Ile123Val)" "3"
"0000810994" "00003289" "70" "209" "0" "209" "0" "c.209G>A" "r.(?)" "p.(Ser70Asn)" "2"
"0000811058" "00003289" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000811059" "00003289" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000811104" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000811105" "00003289" "70" "266" "0" "266" "0" "c.266A>G" "r.(?)" "p.(Tyr89Cys)" "2"
"0000811106" "00003289" "70" "416" "0" "416" "0" "c.416G>T" "r.(?)" "p.(Gly139Val)" "3"
"0000811108" "00003289" "70" "504" "0" "504" "0" "c.504del" "r.(?)" "p.(Leu168Phefs*33)" "4"
"0000811109" "00003289" "90" "920" "0" "920" "0" "c.920G>A" "r.(?)" "p.(Cys307Tyr)" "8"
"0000811110" "00003289" "90" "662" "0" "662" "0" "c.662T>C" "r.(?)" "p.(Leu221Pro)" "6"
"0000811111" "00003289" "90" "940" "0" "940" "0" "c.940del" "r.(?)" "p.(Ile314Serfs*11)" "8"
"0000811112" "00003289" "90" "805" "-1" "1225" "1" "c.(?_805-1)_(1225+1_?)del" "r.spl?" "p.?" "7i_10i"
"0000811205" "00003289" "70" "661" "0" "661" "0" "c.661del" "r.(?)" "p.(Leu221Phefs*25)" "6"
"0000811209" "00003289" "70" "646" "0" "646" "0" "c.646C>T" "r.(?)" "p.(Arg216*)" "6"
"0000811210" "00003289" "70" "661" "0" "661" "0" "c.661del" "r.(?)" "p.(Leu221Phefs*25)" "6"
"0000811213" "00003289" "70" "646" "0" "646" "0" "c.646C>T" "r.(?)" "p.(Arg216*)" "6"
"0000811214" "00003289" "70" "1705" "0" "1705" "0" "c.1705C>T" "r.(?)" "p.(Gln569*)" "14"
"0000811218" "00003289" "70" "1705" "0" "1705" "0" "c.1705C>T" "r.(?)" "p.(Gln569*)" "14"
"0000811224" "00003289" "70" "646" "0" "646" "0" "c.646C>T" "r.(?)" "p.(Arg216*)" "6"
"0000811225" "00003289" "70" "72" "0" "72" "0" "c.72C>G" "r.(?)" "p.(Tyr24*)" "1"
"0000811226" "00003289" "50" "1885" "0" "1885" "0" "c.1885G>A" "r.(?)" "p.(Glu629Lys)" "15"
"0000811230" "00003289" "70" "814" "0" "814" "0" "c.814C>T" "r.(?)" "p.(Arg272*)" "8"
"0000811232" "00003289" "70" "661" "0" "661" "0" "c.661del" "r.(?)" "p.(Leu221Phefs*25)" "6"
"0000811233" "00003289" "70" "1705" "0" "1705" "0" "c.1705C>T" "r.(?)" "p.(Gln569*)" "14"
"0000811235" "00003289" "70" "256" "0" "278" "0" "c.256_278dup" "r.(?)" "p.(Val94Serfs*8)" "2"
"0000811239" "00003289" "70" "646" "0" "646" "0" "c.646C>T" "r.(?)" "p.(Arg216*)" "6"
"0000811240" "00003289" "70" "72" "0" "72" "0" "c.72C>G" "r.(?)" "p.(Tyr24*)" "1"
"0000811243" "00003289" "10" "-42" "0" "-42" "0" "c.-42T>G" "r.(=)" "p.(=)" "1"
"0000811244" "00003289" "10" "-40" "0" "-40" "0" "c.-40T>C" "r.(=)" "p.(=)" "1"
"0000811245" "00003289" "10" "613" "-34" "613" "-34" "c.613-34G>A" "r.spl?" "p.?" "5i"
"0000811246" "00003289" "10" "804" "-20" "804" "-20" "c.804-20A>G" "r.spl?" "p.?" "7"
"0000811247" "00003289" "10" "1422" "0" "1422" "0" "c.1422G>A" "r.(=)" "p.(=)" "12"
"0000811248" "00003289" "10" "1528" "115" "1528" "115" "c.1528+115T>C" "r.spl?" "p.?" "13"
"0000811271" "00003289" "70" "1046" "0" "1046" "0" "c.1046T>G" "r.(?)" "p.(Leu349Trp)" "9"
"0000811273" "00003289" "70" "1046" "0" "1046" "0" "c.1046T>G" "r.(?)" "p.(Leu349Trp)" "9"
"0000811275" "00003289" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000811276" "00003289" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000811278" "00003289" "90" "511" "0" "512" "0" "c.511_512delTT" "r.(?)" "p.(Phe171*)" "4"
"0000811280" "00003289" "90" "823" "0" "823" "0" "c.823C>T" "r.(?)" "p.(Arg275*)" "8"
"0000811283" "00003289" "90" "1046" "0" "1046" "0" "c.1046T>G" "r.(?)" "p.(Leu349Trp)" "9"
"0000811290" "00003289" "90" "522" "0" "522" "0" "c.522T>A" "r.(?)" "p.(Asp174Glu)" "4"
"0000811291" "00003289" "90" "805" "-20" "805" "-20" "c.805-20A>G" "r.(=)" "p.(=)" "7i"
"0000811304" "00003289" "90" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413*)" "11"
"0000811306" "00003289" "90" "1928" "0" "1928" "0" "c.1928G>A" "r.(?)" "p.(Arg643His)" "16"
"0000811319" "00003289" "70" "1046" "0" "1046" "0" "c.1046T>G" "r.(?)" "p.(Leu349Trp)" "9"
"0000811323" "00003289" "70" "117" "1" "117" "1" "c.117+1G>C" "r.spl?" "p.?" "1i"
"0000811324" "00003289" "70" "944" "0" "944" "0" "c.944G>A" "r.(?)" "p.(Arg315Gln)" "9"
"0000811326" "00003289" "70" "72" "0" "72" "0" "c.72C>G" "r.(?)" "p.(Tyr24*)" "1"
"0000811327" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000811329" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000811330" "00003289" "70" "646" "0" "646" "0" "c.646C>T" "r.(?)" "p.(Arg216*)" "6"
"0000811332" "00003289" "70" "72" "0" "72" "0" "c.72C>G" "r.(?)" "p.(Tyr24*)" "1"
"0000811334" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000811335" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000811338" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000811340" "00003289" "70" "209" "0" "209" "0" "c.209A>G" "r.(?)" "p.(Asn70Ser)" "2"
"0000811343" "00003289" "70" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413*)" "11"
"0000811345" "00003289" "70" "1928" "0" "1928" "0" "c.1928G>A" "r.(?)" "p.(Arg643His)" "16"
"0000811392" "00003289" "70" "1015" "0" "1015" "0" "c.1015C>T" "r.(?)" "p.(Arg339*)" ""
"0000811696" "00003289" "90" "1015" "0" "1015" "0" "c.1015C>T" "c.1015C>T" "p.(Arg339*)" "9"
"0000811699" "00003289" "90" "814" "0" "814" "0" "c.814C>T" "c.814C>T" "p.(Arg272*)" "8"
"0000811708" "00003289" "90" "1062" "0" "1062" "0" "c.1062C>G" "c.1062C>G" "p.(Asn354Lys)" "9"
"0000811719" "00003289" "50" "986" "0" "986" "0" "c.986T>C" "c.986T>C" "p.(Met329Thr)" "9"
"0000812144" "00003289" "70" "941" "-1" "941" "-1" "c.941-1G>T" "r.(?)" "p.(?)" "8i"
"0000812145" "00003289" "70" "943" "0" "943" "0" "c.943C>T" "r.(?)" "p.(Arg315Trp)" "9"
"0000812289" "00003289" "70" "1225" "0" "1225" "0" "c.1225G>T" "r.(?)" "p.(Asp409Tyr)" "10"
"0000812453" "00003289" "70" "1705" "0" "1705" "0" "c.1705C>T" "r.(?)" "p.(Gln569*)" "14"
"0000812454" "00003289" "70" "117" "1" "117" "1" "c.117+1G>T" "r.spl" "p.(?)" "1i"
"0000812455" "00003289" "70" "224" "0" "224" "0" "c.224T>G" "r.(?)" "p.(Val75Gly)" "2"
"0000812538" "00003289" "90" "534" "1" "534" "1" "c.534+1G>T" "r.spl" "p.(?)" ""
"0000812549" "00003289" "70" "248" "0" "248" "0" "c.248T>G" "r.(?)" "p.(Leu83Trp)" ""
"0000812596" "00003289" "70" "871" "0" "871" "0" "c.871G>A" "r.(?)" "p.(Gly291Ser)" ""
"0000812597" "00003289" "90" "534" "1" "534" "1" "c.534+1G>T" "r.spl" "p.(?)" ""
"0000813032" "00003289" "70" "263" "0" "263" "0" "c.263del" "r.(?)" "p.(Gly88Alafs*6)" ""
"0000813167" "00003289" "50" "374" "0" "374" "0" "c.374T>G" "r.(?)" "p.(Leu125Arg)" "3"
"0000813170" "00003289" "50" "374" "0" "374" "0" "c.374T>G" "r.(?)" "p.(Leu125Arg)" "3"
"0000813270" "00003289" "50" "718" "-34" "718" "-34" "c.718-34G>A" "r.(=)" "p.(=)" "6i"
"0000813271" "00003289" "50" "1080" "149" "1080" "149" "c.1080+149G>A" "r.(=)" "p.(=)" "9i"
"0000813274" "00003289" "50" "940" "96" "940" "96" "c.940+96T>A" "r.(=)" "p.(=)" "8i"
"0000813301" "00003289" "30" "1207" "0" "1207" "0" "c.1207C>T" "r.(?)" "p.(Arg403Cys)" "10"
"0000813309" "00003289" "50" "612" "108" "612" "108" "c.612+108T>C" "r.(=)" "p.(=)" "5i"
"0000813315" "00003289" "50" "612" "108" "612" "108" "c.612+108T>C" "r.(=)" "p.(=)" "5i"
"0000813322" "00003289" "50" "1207" "0" "1207" "0" "c.1207C>T" "r.(?)" "p.(Arg403Cys)" "10"
"0000813331" "00003289" "50" "940" "36" "940" "36" "c.940+36G>A" "r.(=)" "p.(=)" "8i"
"0000813661" "00003289" "90" "1015" "0" "1015" "0" "c.1015C>T" "r.(?)" "p.(Arg339*)" ""
"0000813754" "00003289" "70" "79" "0" "79" "0" "c.79A>C" "r.(?)" "p.(Thr27Pro)" ""
"0000813875" "00003289" "70" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413*)" ""
"0000813907" "00003289" "70" "1659" "3" "1659" "3" "c.1659+3A>G" "r.spl?" "p.?" "13i"
"0000813917" "00003289" "90" "311" "0" "311" "0" "c.311A>C" "r.(?)" "p.(Asp104Ala)" "2"
"0000813918" "00003289" "90" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" "15"
"0000813961" "00003289" "90" "311" "0" "311" "0" "c.311A>C" "r.(?)" "p.(Asp104Ala)" "2"
"0000813962" "00003289" "70" "823" "0" "823" "0" "c.823C>T" "r.(?)" "p.(Arg275*)" "8"
"0000813963" "00003289" "70" "565" "0" "565" "0" "c.565C>T" "r.(?)" "p.(Arg189*)" "5"
"0000813964" "00003289" "70" "823" "0" "823" "0" "c.823C>T" "r.(?)" "p.(Arg275*)" "8"
"0000813965" "00003289" "70" "1658" "0" "1658" "0" "c.1658C>T" "r.(?)" "p.?" "13"
"0000813974" "00003289" "90" "1992" "0" "1992" "0" "c.1992del" "r.(?)" "p.(His665Thrfs*11)" "16"
"0000813994" "00003289" "90" "814" "0" "814" "0" "c.814C>T" "r.(?)" "p.(Arg272*)" "8"
"0000814000" "00003289" "90" "626" "0" "626" "0" "c.626T>C" "r.(?)" "p.(Leu209Pro)" "6"
"0000814038" "00003289" "70" "402" "0" "402" "0" "c.402delT" "r.(?)" "p.(Ala136Argfs*65)" "3"
"0000814039" "00003289" "70" "627" "0" "628" "0" "c.627_628delTT" "r.(?)" "p.(Cys210Serfs*20)" "6"
"0000814057" "00003289" "90" "565" "0" "565" "0" "c.565C>T" "r.(?)" "p.(Arg189*)" "5"
"0000814058" "00003289" "90" "345" "5" "345" "5" "c.345+5G>A" "r.spl?" "p.?" "2i"
"0000814095" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000814096" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000814146" "00003289" "70" "311" "0" "311" "0" "c.311A>C" "r.(?)" "p.(Asp104Ala)" "2"
"0000814147" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000814150" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000814151" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000814152" "00003289" "70" "2107" "0" "2107" "0" "c.2107C>T" "r.(?)" "p.(Arg703*)" "17"
"0000814153" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000814154" "00003289" "70" "950" "0" "950" "0" "c.950A>G" "r.(?)" "p.(Tyr317Cys)" "9"
"0000814155" "00003289" "70" "1864" "0" "1864" "0" "c.1864C>T" "r.(?)" "p.(Arg622*)" "15"
"0000814156" "00003289" "70" "406" "0" "406" "0" "c.406G>C" "r.(?)" "p.(Ala136Pro)" "3"
"0000814158" "00003289" "70" "1658" "0" "1658" "0" "c.1658C>T" "r.(?)" "p.?" "13"
"0000814159" "00003289" "70" "921" "0" "921" "0" "c.921C>G" "r.(?)" "p.(Cys307Trp)" "8"
"0000814160" "00003289" "70" "241" "0" "241" "0" "c.241G>T" "r.(?)" "p.(Gly81Cys)" "2"
"0000814161" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000814162" "00003289" "70" "117" "0" "117" "0" "c.117G>A" "r.(=)" "p.(=)" "1"
"0000814163" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000814164" "00003289" "70" "471" "0" "471" "0" "c.471G>T" "r.(=)" "p.(=)" "3"
"0000814239" "00003289" "70" "374" "0" "374" "0" "c.374T>G" "r.(?)" "p.(Leu125Arg)" "3"
"0000814345" "00003289" "50" "1934" "0" "1934" "0" "c.1934T>C" "r.(?)" "p.(Met645Thr)" ""
"0000814511" "00003289" "90" "947" "0" "947" "0" "c.947G>A" "r.(?)" "p.(Gly316Asp)" "9"
"0000814512" "00003289" "90" "823" "0" "823" "0" "c.823C>T" "r.(?)" "p.(Arg275*)" "8"
"0000814513" "00003289" "90" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" "15"
"0000814514" "00003289" "90" "823" "0" "823" "0" "c.823C>T" "r.(?)" "p.(Arg275*)" "8"
"0000814520" "00003289" "90" "940" "0" "940" "0" "c.940del" "r.(?)" "p.(Ile314Serfs*11)" "8"
"0000814521" "00003289" "90" "0" "0" "0" "0" "c.?" "r.spl?" "p.?" "6i"
"0000814524" "00003289" "90" "472" "-1" "472" "-1" "c.472-1delG" "r.(=)" "p.(=)" "3i"
"0000814525" "00003289" "90" "1371" "0" "1371" "0" "c.1371del" "r.(?)" "p.(Lys458Argfs*29)" "11"
"0000814552" "00003289" "90" "175" "0" "175" "0" "c.175C>T" "r.(?)" "p.(Gln59*)" "2"
"0000814553" "00003289" "90" "72" "0" "72" "0" "c.72C>G" "r.(?)" "p.(Tyr24*)" "1"
"0000814554" "00003289" "90" "1438" "0" "1438" "0" "c.1438C>T" "r.(?)" "p.(Arg480*)" "12"
"0000814555" "00003289" "90" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413*)" "11"
"0000814560" "00003289" "90" "72" "0" "72" "0" "c.72C>G" "r.(?)" "p.(Tyr24*)" "1"
"0000814561" "00003289" "90" "504" "0" "504" "0" "c.504del" "r.(?)" "p.(Leu168Phefs*33)" "4"
"0000814562" "00003289" "90" "72" "0" "72" "0" "c.72C>G" "r.(?)" "p.(Tyr24*)" "1"
"0000814563" "00003289" "90" "504" "0" "504" "0" "c.504del" "r.(?)" "p.(Leu168Phefs*33)" "4"
"0000814579" "00003289" "70" "1891" "0" "1891" "0" "c.1891G>A" "r.(?)" "p.(Ala631Thr)" "15"
"0000814624" "00003289" "90" "563" "0" "563" "0" "c.563del" "r.(?)" "p.(Ile188Thrfs*13)" "5"
"0000814625" "00003289" "90" "1438" "0" "1438" "0" "c.1438C>T" "r.(?)" "p.(Arg480*)" "12"
"0000814654" "00003289" "70" "367" "0" "367" "0" "c.367A>G" "r.(?)" "p.(Ile123Val)" "3"
"0000814759" "00003289" "90" "563" "0" "563" "0" "c.563del" "r.(?)" "p.(Ile188Thrfs*13)" "5"
"0000814800" "00003289" "90" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413*)" "11"
"0000815037" "00003289" "90" "1003" "0" "1003" "0" "c.1003C>T" "r.(?)" "p.(Gln335*)" "9"
"0000815040" "00003289" "90" "471" "0" "471" "0" "c.471G>C" "r.(=)" "p.(=)" "3"
"0000815041" "00003289" "90" "472" "-1" "472" "-1" "c.472-1G>C" "r.spl?" "p.?" "3i"
"0000815045" "00003289" "90" "256" "0" "278" "0" "c.256_278dup" "r.(?)" "p.(Val94Serfs*8)" "2"
"0000815046" "00003289" "90" "1910" "1" "1910" "1" "c.1910+1G>T" "r.spl?" "p.?" "15i"
"0000815341" "00003289" "50" "1454" "0" "1454" "0" "c.1454C>T" "r.(?)" "p.(Ala485Val)" ""
"0000815472" "00003289" "70" "1197" "0" "1197" "0" "c.1197del" "r.(?)" "p.(His399Glnfs*18)" ""
"0000816080" "00003289" "50" "940" "3" "940" "3" "c.940+3A>C" "r.spl?" "p.(?)" ""
"0000816246" "00003289" "90" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" ""
"0000816411" "00003289" "50" "851" "0" "851" "0" "c.851A>T" "r.(?)" "p.(Asn284Ile)" ""
"0000816531" "00003289" "90" "311" "0" "311" "0" "c.311A>C" "r.(?)" "p.(Asp104Ala)" ""
"0000817532" "00003289" "70" "1528" "0" "1528" "0" "c.1528G>T" "r.(?)" "p.(Val510Phe)" "13"
"0000817585" "00003289" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.R413*" ""
"0000817586" "00003289" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.(R48*)" ""
"0000818208" "00003289" "90" "84" "0" "84" "0" "c.84delC" "r.(?)" "p.(Pro29Argfs*50)" "1"
"0000818209" "00003289" "90" "1059" "0" "1059" "0" "c.1059dup" "r.(?)" "p.(Asn354*)" "9"
"0000818210" "00003289" "90" "225" "0" "225" "0" "c.225T>G" "r.(?)" "p.V75G)" "2"
"0000818211" "00003289" "90" "2144" "0" "2144" "0" "c.2144G>A" "r.(?)" "p.(Arg715Gln)" "17"
"0000818212" "00003289" "90" "986" "0" "986" "0" "c.986T>C" "r.(?)" "p.(Met329Thr)" "9"
"0000818215" "00003289" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000818968" "00003289" "70" "346" "-1" "534" "1" "c.(345+1_346-1)_(534+1_535-1)del" "r.?" "p.?" "2i_4i"
"0000819017" "00003289" "70" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413*)" ""
"0000819029" "00003289" "70" "1438" "0" "1438" "0" "c.1438C>T" "r.(?)" "p.(Arg480*)" ""
"0000819421" "00003289" "70" "943" "0" "943" "0" "c.943C>T" "r.(?)" "p.(Arg315Trp)" ""
"0000820205" "00003289" "70" "413" "0" "413" "0" "c.413T>G" "r.(?)" "p.(Ile138Ser)" ""
"0000822960" "00003289" "70" "117" "0" "117" "0" "c.117G>A" "r.spl" "p.(Lys39=)" ""
"0000824324" "00003289" "70" "235" "0" "235" "0" "c.235A>C" "r.(?)" "p.(Thr79Pro)" ""
"0000824325" "00003289" "70" "235" "0" "235" "0" "c.235A>C" "r.(?)" "p.(Thr79Pro)" ""
"0000824326" "00003289" "70" "235" "0" "235" "0" "c.235A>C" "r.(?)" "p.(Thr79Pro)" ""
"0000824327" "00003289" "70" "235" "0" "235" "0" "c.235A>C" "r.(?)" "p.(Thr79Pro)" ""
"0000824328" "00003289" "70" "534" "1" "534" "1" "c.534+1G>T" "r.spl" "p.?" ""
"0000824329" "00003289" "70" "534" "1" "534" "1" "c.534+1G>T" "r.spl" "p.?" ""
"0000824330" "00003289" "70" "534" "1" "534" "1" "c.534+1G>T" "r.spl" "p.?" ""
"0000824331" "00003289" "70" "534" "1" "534" "1" "c.534+1G>T" "r.spl" "p.?" ""
"0000824732" "00003289" "50" "1" "0" "1" "0" "c.1A>G" "r.(?)" "p.(Met1?)" ""
"0000824802" "00003289" "90" "1814" "0" "1814" "0" "c.1814C>G" "r.(?)" "p.(Ser605Ter)" ""
"0000824907" "00003289" "90" "2059" "1" "2059" "1" "c.2059+1G>C" "r.spl" "p.?" "16i"
"0000824908" "00003289" "50" "79" "0" "79" "0" "c.79A>C" "r.(?)" "p.(Thr27Pro)" "1"
"0000824909" "00003289" "50" "79" "0" "79" "0" "c.79A>C" "r.(?)" "p.(Thr27Pro)" "1"
"0000824910" "00003289" "90" "534" "1" "534" "1" "c.534+1G>T" "r.spl" "p.?" "4i"
"0000824911" "00003289" "90" "534" "1" "534" "1" "c.534+1G>T" "r.spl" "p.?" "4i"
"0000824912" "00003289" "90" "944" "0" "944" "0" "c.944G>A" "r.(?)" "p.(Arg315Gln)" "9"
"0000824913" "00003289" "90" "2059" "1" "2059" "1" "c.2059+1G>T" "r.spl" "p.?" "16i"
"0000824919" "00003289" "90" "563" "0" "563" "0" "c.563del" "r.(?)" "p.(Ile188Thrfs*13)" "5"
"0000824920" "00003289" "50" "1278" "0" "1278" "0" "c.1278A>G" "r.spl?" "p.(Glu426=)" "11"
"0000824921" "00003289" "50" "1278" "0" "1278" "0" "c.1278A>G" "r.spl?" "p.(Glu426=)" "11"
"0000824922" "00003289" "90" "1015" "0" "1015" "0" "c.1015C>T" "r.(?)" "p.(Arg339*)" "9"
"0000824923" "00003289" "90" "534" "1" "534" "1" "c.534+1G>T" "r.spl" "p.?" "4i"
"0000827125" "00003289" "50" "1381" "0" "1381" "0" "c.1381G>A" "r.(?)" "p.(Val461Met)" "11"
"0000827841" "00003289" "50" "1739" "0" "1739" "0" "c.1739T>G" "r.(?)" "p.(Leu580Arg)" ""
"0000827849" "00003289" "50" "1511" "0" "1511" "0" "c.1511C>T" "r.(?)" "p.(Ala504Val)" ""
"0000828503" "00003289" "90" "565" "0" "565" "0" "c.565C>T" "r.(?)" "p.(Arg189*)" ""
"0000828510" "00003289" "90" "565" "0" "565" "0" "c.565C>T" "r.(?)" "p.(Arg189*)" ""
"0000830018" "00003289" "90" "522" "0" "522" "0" "c.522T>A" "r.(?)" "p.(Asp174Glu)" "4"
"0000830019" "00003289" "90" "522" "0" "522" "0" "c.522T>A" "r.(?)" "p.(Asp174Glu)" "4"
"0000834083" "00003289" "90" "1398" "-1" "1398" "-1" "c.1398-1G>A" "r.spl" "p.?" "11i"
"0000834143" "00003289" "50" "779" "0" "779" "0" "c.779T>G" "r.(?)" "p.(Leu260Arg)" "7"
"0000841598" "00003289" "70" "266" "0" "266" "0" "c.266A>G" "r.(=)" "p.(Tyr89Cys)" ""
"0000854551" "00003289" "50" "1786" "0" "1786" "0" "c.1786G>A" "r.(?)" "p.(Val596Met)" ""
"0000854552" "00003289" "50" "1523" "0" "1523" "0" "c.1523A>C" "r.(?)" "p.(Gln508Pro)" ""
"0000854553" "00003289" "30" "1134" "0" "1134" "0" "c.1134A>G" "r.(?)" "p.(Pro378=)" ""
"0000854554" "00003289" "50" "1046" "0" "1046" "0" "c.1046T>G" "r.(?)" "p.(Leu349Trp)" ""
"0000854555" "00003289" "30" "354" "0" "354" "0" "c.354T>C" "r.(?)" "p.(Asp118=)" ""
"0000864848" "00003289" "10" "2079" "0" "2079" "0" "c.2079G>A" "r.(?)" "p.(Gln693=)" ""
"0000864849" "00003289" "30" "1171" "0" "1171" "0" "c.1171C>T" "r.(?)" "p.(Leu391=)" ""
"0000864850" "00003289" "30" "1110" "0" "1110" "0" "c.1110T>C" "r.(?)" "p.(Ala370=)" ""
"0000864851" "00003289" "30" "805" "-20" "805" "-20" "c.805-20A>G" "r.(=)" "p.(=)" ""
"0000864852" "00003289" "30" "472" "-10" "472" "-10" "c.472-10T>C" "r.(=)" "p.(=)" ""
"0000864853" "00003289" "50" "422" "0" "422" "0" "c.422A>G" "r.(?)" "p.(Asn141Ser)" ""
"0000871266" "00003289" "50" "1120" "0" "1120" "0" "c.1120C>T" "r.(?)" "p.(Arg374Trp)" "10"
"0000871293" "00003289" "70" "72" "0" "72" "0" "c.72C>G" "r.(?)" "p.(Tyr24*)" ""
"0000871294" "00003289" "70" "175" "0" "175" "0" "c.175C>T" "r.(?)" "p.(Gln59*)" ""
"0000873531" "00003289" "70" "943" "0" "943" "0" "c.943C>T" "r.(?)" "p.(Arg315Trp)" ""
"0000873532" "00003289" "70" "534" "1" "534" "1" "c.534+1G>T" "r.(?)" "p.(?)" ""
"0000873533" "00003289" "70" "647" "0" "647" "0" "c.647G>C" "r.(?)" "p.(Arg216Pro)" ""
"0000873534" "00003289" "70" "534" "1" "534" "1" "c.534+1G>T" "r.(?)" "p.(?)" ""
"0000879743" "00003289" "50" "1673" "0" "1673" "0" "c.1673C>T" "r.(?)" "p.(Thr558Ile)" ""
"0000880161" "00003289" "90" "565" "0" "565" "0" "c.565C>T" "r.(?)" "p.(Arg189*)" ""
"0000880162" "00003289" "90" "565" "0" "565" "0" "c.565C>T" "r.(?)" "p.(Arg189*)" ""
"0000880174" "00003289" "10" "367" "0" "367" "0" "c.367A>G" "r.(?)" "p.(Ile123Val)" ""
"0000881185" "00003289" "70" "98" "0" "98" "0" "c.98C>A" "r.(?)" "p.(Ala33Asp)" ""
"0000893063" "00003289" "90" "1780" "0" "1780" "0" "c.1780C>T" "r.(?)" "p.(Arg594*)" ""
"0000893064" "00003289" "30" "1081" "-18" "1081" "-18" "c.1081-18G>T" "r.(=)" "p.(=)" ""
"0000893065" "00003289" "10" "865" "0" "865" "0" "c.865A>G" "r.(?)" "p.(Ile289Val)" ""
"0000893066" "00003289" "50" "798" "0" "798" "0" "c.798T>A" "r.(?)" "p.(Asn266Lys)" ""
"0000905558" "00003289" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000914645" "00003289" "30" "118" "-47" "118" "-47" "c.118-47T>G" "r.(=)" "p.(=)" ""
"0000916412" "00003289" "70" "1984" "0" "1984" "0" "c.1984del" "r.(?)" "p.(Cys662Valfs*14)" "16"
"0000916605" "00003289" "90" "401" "0" "401" "0" "c.401C>G" "r.(?)" "p.(Pro134Arg)" "3"
"0000916606" "00003289" "50" "683" "0" "683" "0" "c.683T>A" "r.(?)" "p.(Val228Asp)" "6"
"0000930620" "00003289" "90" "1546" "0" "1546" "0" "c.1546C>T" "r.(?)" "p.(Gln516*)" ""
"0000930621" "00003289" "90" "627" "0" "628" "0" "c.627_628del" "r.(?)" "p.(Cys210Serfs*20)" ""
"0000950681" "00003289" "30" "354" "0" "354" "0" "c.354T>C" "r.(?)" "p.(Asp118=)" ""
"0000958086" "00003289" "70" "1895" "0" "1895" "0" "c.1895G>C" "r.(?)" "p.(Arg632Pro)" ""
"0000958470" "00003289" "90" "661" "0" "661" "0" "c.661del" "r.(?)" "p.(Leu221PhefsTer25)" ""
"0000968405" "00003289" "30" "1324" "0" "1324" "0" "c.1324T>C" "r.(?)" "p.(Cys442Arg)" ""
"0000968406" "00003289" "90" "1237" "0" "1237" "0" "c.1237C>T" "r.(?)" "p.(Arg413*)" ""
"0000981948" "00003289" "50" "1682" "0" "1682" "0" "c.1682T>C" "r.(?)" "p.(Ile561Thr)" ""
"0000981949" "00003289" "50" "1615" "0" "1615" "0" "c.1615C>T" "r.(?)" "p.(Arg539Trp)" ""
"0000981950" "00003289" "50" "1523" "0" "1523" "0" "c.1523A>C" "r.(?)" "p.(Gln508Pro)" ""
"0000981951" "00003289" "50" "254" "0" "254" "0" "c.254C>T" "r.(?)" "p.(Pro85Leu)" ""
"0001002431" "00003289" "30" "1110" "0" "1110" "0" "c.1110T>C" "r.(?)" "p.(Ala370=)" ""
"0001026722" "00003289" "70" "1864" "0" "1864" "0" "c.1864C>T" "r.(?)" "p.(Arg622Ter)" ""
"0001041201" "00003289" "50" "1527" "5" "1527" "5" "c.1527+5G>C" "r.spl?" "p.?" ""
"0001041202" "00003289" "30" "940" "5" "940" "5" "c.940+5A>G" "r.spl?" "p.?" ""
"0001041203" "00003289" "70" "612" "1" "612" "1" "c.612+1G>A" "r.spl?" "p.?" ""
"0001041204" "00003289" "90" "402" "0" "402" "0" "c.402del" "r.(?)" "p.(Ala136Argfs*65)" ""
"0001055598" "00003289" "70" "944" "0" "944" "0" "c.944G>A" "r.(?)" "p.(Arg315Gln)" ""
"0001055599" "00003289" "50" "787" "0" "787" "0" "c.787G>A" "r.(?)" "p.(Gly263Ser)" ""
"0001055600" "00003289" "50" "566" "0" "566" "0" "c.566G>A" "r.(?)" "p.(Arg189Gln)" ""
"0001055601" "00003289" "50" "470" "0" "470" "0" "c.470C>T" "r.(?)" "p.(Thr157Met)" ""
"0001055602" "00003289" "50" "422" "0" "422" "0" "c.422A>G" "r.(?)" "p.(Asn141Ser)" ""
"0001055603" "00003289" "10" "209" "0" "209" "0" "c.209=" "r.(=)" "p.(Asn70=)" ""
"0001066499" "00003289" "50" "798" "0" "798" "0" "c.798T>A" "r.(?)" "p.(Asn266Lys)" ""
"0001079444" "00003289" "90" "98" "0" "98" "0" "c.98C>A" "r.(?)" "p.(Ala33Asp)" ""
"0001081770" "00003289" "70" "1059" "0" "1059" "0" "c.1059dup" "r.(?)" "p.(Asn354Ter)" "9"
"0001081771" "00003289" "70" "141" "0" "142" "0" "c.141_142del" "r.(?)" "p.(Arg48GlufsTer17)" "2"
"0001081772" "00003289" "70" "1718" "0" "1718" "0" "c.1718C>A" "r.(?)" "p.(Ser573Ter)" "14"
"0001081773" "00003289" "70" "198" "0" "231" "0" "c.198_231del" "r.(?)" "p.(Ser67Ter)" "2"
"0001081774" "00003289" "70" "2059" "1" "2059" "1" "c.2059+1G>T" "r.spl" "p.?" ""
"0001081775" "00003289" "70" "284" "0" "285" "0" "c.284_285del" "r.(?)" "p.(Gly95AspfsTer4)" "2"
"0001081776" "00003289" "70" "563" "0" "563" "0" "c.563del" "r.(?)" "p.(Ile188ThrfsTer13)" "5"
"0001081777" "00003289" "70" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234Ter)" "6"
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 354
"{{screeningid}}" "{{variantid}}"
"0000000025" "0000730372"
"0000001622" "0000019535"
"0000016564" "0000036432"
"0000050382" "0000079362"
"0000050382" "0000079654"
"0000096326" "0000158319"
"0000105467" "0000170885"
"0000156250" "0000358172"
"0000156251" "0000358173"
"0000156251" "0000358412"
"0000156252" "0000358174"
"0000156253" "0000358175"
"0000156253" "0000358413"
"0000166071" "0000369938"
"0000234453" "0000477161"
"0000234454" "0000477162"
"0000234455" "0000477163"
"0000234456" "0000477164"
"0000234457" "0000477165"
"0000234458" "0000477166"
"0000234459" "0000477167"
"0000234460" "0000477168"
"0000234461" "0000477169"
"0000234462" "0000477170"
"0000234463" "0000477171"
"0000234464" "0000477172"
"0000234465" "0000477173"
"0000234466" "0000477174"
"0000234467" "0000477175"
"0000234468" "0000477176"
"0000234469" "0000477177"
"0000234470" "0000477178"
"0000234887" "0000477595"
"0000234888" "0000477596"
"0000234889" "0000477597"
"0000271121" "0000624990"
"0000277228" "0000631994"
"0000277229" "0000631995"
"0000277230" "0000631996"
"0000277230" "0000631997"
"0000292661" "0000649350"
"0000300751" "0000663591"
"0000309623" "0000684496"
"0000309624" "0000684497"
"0000309625" "0000684498"
"0000309745" "0000684618"
"0000310103" "0000685014"
"0000310104" "0000685015"
"0000310105" "0000685016"
"0000310107" "0000685018"
"0000310108" "0000685019"
"0000310109" "0000685020"
"0000326643" "0000710235"
"0000332952" "0000730339"
"0000332952" "0000730359"
"0000335310" "0000733319"
"0000335310" "0000733707"
"0000335311" "0000733320"
"0000335312" "0000733321"
"0000335312" "0000733708"
"0000335313" "0000733322"
"0000335313" "0000733709"
"0000336488" "0000735884"
"0000336488" "0000735951"
"0000360033" "0000759683"
"0000360037" "0000759701"
"0000360039" "0000759705"
"0000360212" "0000759939"
"0000360212" "0000759960"
"0000360625" "0000760667"
"0000360625" "0000760684"
"0000364660" "0000765535"
"0000364662" "0000765537"
"0000364852" "0000765794"
"0000364938" "0000765880"
"0000364959" "0000765901"
"0000373751" "0000783988"
"0000373751" "0000783989"
"0000373752" "0000783991"
"0000374725" "0000785550"
"0000374726" "0000785551"
"0000375109" "0000786404"
"0000375109" "0000786474"
"0000375118" "0000786413"
"0000375118" "0000786478"
"0000376639" "0000788532"
"0000380554" "0000793697"
"0000380555" "0000793698"
"0000381566" "0000795030"
"0000381568" "0000795033"
"0000382942" "0000796916"
"0000383703" "0000797940"
"0000383704" "0000797941"
"0000383705" "0000797942"
"0000383706" "0000797943"
"0000383707" "0000797944"
"0000384097" "0000798530"
"0000384097" "0000798531"
"0000384098" "0000798532"
"0000384099" "0000798533"
"0000384100" "0000798534"
"0000384101" "0000798535"
"0000384102" "0000798536"
"0000384103" "0000798537"
"0000384104" "0000798538"
"0000384105" "0000798539"
"0000384106" "0000798540"
"0000384107" "0000798541"
"0000384108" "0000798542"
"0000384109" "0000798543"
"0000384110" "0000798545"
"0000384111" "0000798546"
"0000384111" "0000798548"
"0000384112" "0000798550"
"0000384113" "0000798551"
"0000384113" "0000798552"
"0000384114" "0000798553"
"0000384114" "0000798555"
"0000384115" "0000798556"
"0000384324" "0000810936"
"0000384334" "0000810949"
"0000384334" "0000810950"
"0000384353" "0000810971"
"0000384354" "0000810972"
"0000384361" "0000810980"
"0000384371" "0000810990"
"0000384374" "0000810994"
"0000384421" "0000811058"
"0000384421" "0000811059"
"0000384446" "0000811104"
"0000384447" "0000811105"
"0000384448" "0000811106"
"0000384449" "0000811108"
"0000384449" "0000811109"
"0000384450" "0000811110"
"0000384451" "0000811111"
"0000384452" "0000811112"
"0000384508" "0000811205"
"0000384510" "0000811209"
"0000384510" "0000811210"
"0000384513" "0000811213"
"0000384513" "0000811214"
"0000384516" "0000811218"
"0000384520" "0000811224"
"0000384520" "0000811225"
"0000384521" "0000811226"
"0000384523" "0000811230"
"0000384524" "0000811232"
"0000384524" "0000811233"
"0000384525" "0000811235"
"0000384528" "0000811239"
"0000384528" "0000811240"
"0000384531" "0000811243"
"0000384532" "0000811244"
"0000384533" "0000811245"
"0000384534" "0000811246"
"0000384535" "0000811247"
"0000384536" "0000811248"
"0000384555" "0000811271"
"0000384556" "0000811273"
"0000384558" "0000811275"
"0000384559" "0000811276"
"0000384560" "0000811278"
"0000384562" "0000811280"
"0000384565" "0000811283"
"0000384572" "0000811290"
"0000384573" "0000811291"
"0000384582" "0000811304"
"0000384583" "0000811306"
"0000384589" "0000811319"
"0000384592" "0000811323"
"0000384592" "0000811324"
"0000384593" "0000811326"
"0000384593" "0000811327"
"0000384594" "0000811329"
"0000384594" "0000811330"
"0000384595" "0000811332"
"0000384596" "0000811334"
"0000384596" "0000811335"
"0000384597" "0000811338"
"0000384598" "0000811340"
"0000384600" "0000811343"
"0000384601" "0000811345"
"0000384634" "0000811392"
"0000384877" "0000811696"
"0000384877" "0000811708"
"0000384880" "0000811699"
"0000384887" "0000811719"
"0000385218" "0000812144"
"0000385218" "0000812145"
"0000385307" "0000812289"
"0000385408" "0000812453"
"0000385408" "0000812454"
"0000385409" "0000812455"
"0000385475" "0000812538"
"0000385485" "0000812549"
"0000385520" "0000812596"
"0000385521" "0000812597"
"0000385866" "0000813032"
"0000385958" "0000813167"
"0000385959" "0000813170"
"0000386038" "0000813270"
"0000386038" "0000813271"
"0000386039" "0000813274"
"0000386055" "0000813301"
"0000386058" "0000813309"
"0000386059" "0000813315"
"0000386062" "0000813322"
"0000386065" "0000813331"
"0000386254" "0000813661"
"0000386254" "0000813754"
"0000386382" "0000813875"
"0000386407" "0000813907"
"0000386412" "0000813917"
"0000386412" "0000813918"
"0000386442" "0000813961"
"0000386442" "0000813962"
"0000386443" "0000813963"
"0000386444" "0000813964"
"0000386445" "0000813965"
"0000386453" "0000813974"
"0000386463" "0000813994"
"0000386467" "0000814000"
"0000386492" "0000814038"
"0000386492" "0000814039"
"0000386510" "0000814057"
"0000386511" "0000814058"
"0000386529" "0000814095"
"0000386529" "0000814096"
"0000386560" "0000814146"
"0000386560" "0000814147"
"0000386561" "0000814150"
"0000386562" "0000814151"
"0000386563" "0000814152"
"0000386563" "0000814153"
"0000386564" "0000814154"
"0000386565" "0000814155"
"0000386565" "0000814156"
"0000386566" "0000814158"
"0000386567" "0000814159"
"0000386567" "0000814160"
"0000386568" "0000814161"
"0000386569" "0000814162"
"0000386569" "0000814163"
"0000386570" "0000814164"
"0000386609" "0000814239"
"0000386674" "0000814345"
"0000386783" "0000814511"
"0000386784" "0000814512"
"0000386784" "0000814513"
"0000386785" "0000814514"
"0000386790" "0000814520"
"0000386790" "0000814521"
"0000386792" "0000814524"
"0000386793" "0000814525"
"0000386807" "0000814552"
"0000386807" "0000814553"
"0000386808" "0000814554"
"0000386808" "0000814555"
"0000386811" "0000814560"
"0000386811" "0000814561"
"0000386812" "0000814562"
"0000386812" "0000814563"
"0000386824" "0000814579"
"0000386846" "0000814624"
"0000386847" "0000814625"
"0000386864" "0000814654"
"0000386936" "0000814759"
"0000386936" "0000814800"
"0000387164" "0000815037"
"0000387167" "0000815040"
"0000387167" "0000815041"
"0000387171" "0000815045"
"0000387172" "0000815046"
"0000387441" "0000815472"
"0000387457" "0000815341"
"0000387922" "0000816080"
"0000387922" "0000816411"
"0000388088" "0000816246"
"0000388088" "0000816531"
"0000388774" "0000817532"
"0000388824" "0000817585"
"0000388824" "0000817586"
"0000389281" "0000818208"
"0000389281" "0000818209"
"0000389282" "0000818210"
"0000389283" "0000818211"
"0000389284" "0000818212"
"0000389285" "0000818215"
"0000389734" "0000818968"
"0000389773" "0000819017"
"0000389773" "0000819029"
"0000390076" "0000819421"
"0000390860" "0000820205"
"0000392617" "0000822960"
"0000393551" "0000824324"
"0000393551" "0000824328"
"0000393552" "0000824325"
"0000393552" "0000824329"
"0000393553" "0000824326"
"0000393553" "0000824330"
"0000393554" "0000824327"
"0000393554" "0000824331"
"0000393910" "0000824732"
"0000393910" "0000824802"
"0000394013" "0000824907"
"0000394013" "0000824919"
"0000394014" "0000824908"
"0000394015" "0000824909"
"0000394016" "0000824910"
"0000394016" "0000824920"
"0000394017" "0000824911"
"0000394017" "0000824921"
"0000394018" "0000824912"
"0000394018" "0000824922"
"0000394019" "0000824913"
"0000394019" "0000824923"
"0000395725" "0000827125"
"0000396272" "0000827841"
"0000396280" "0000827849"
"0000396818" "0000828503"
"0000396823" "0000828510"
"0000397808" "0000830018"
"0000397808" "0000830019"
"0000401040" "0000834083"
"0000401040" "0000834143"
"0000405506" "0000841598"
"0000413744" "0000871266"
"0000413756" "0000871293"
"0000413756" "0000871294"
"0000415679" "0000873531"
"0000415679" "0000873532"
"0000415680" "0000873533"
"0000415680" "0000873534"
"0000419643" "0000879743"
"0000419935" "0000880161"
"0000419938" "0000880162"
"0000419950" "0000880174"
"0000420826" "0000881185"
"0000427976" "0000905558"
"0000431320" "0000916412"
"0000431445" "0000916605"
"0000431445" "0000916606"
"0000448600" "0000958086"
"0000448600" "0000958470"
"0000482300" "0001079444"
"0000484051" "0001081770"
"0000484052" "0001081771"
"0000484053" "0001081772"
"0000484054" "0001081773"
"0000484055" "0001081774"
"0000484056" "0001081775"
"0000484057" "0001081776"
"0000484058" "0001081777"