### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = BCAP31) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "BCAP31" "B-cell receptor-associated protein 31" "X" "q28" "unknown" "NG_023231.1" "UD_132118700547" "" "https://www.LOVD.nl/BCAP31" "" "1" "16695" "10134" "300398" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/BCAP31_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2012-09-13 00:00:00" "00006" "2020-07-03 08:44:00" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00025975" "BCAP31" "transcript variant 4" "001" "NM_001256447.1" "" "NP_001243376.1" "" "" "RefSeq select" "-457" "1186" "741" "152990201" "152965947" "00006" "2025-01-25 17:03:34" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00187" "MRX;IDX" "mental retardation, X-linked (MRX, intellectual disability (IDX))" "" "" "" "X-linked" "" "00006" "2013-09-05 15:56:47" "00006" "2018-12-18 09:23:21" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02157" "DDCH" "deafness, dystonia, cerebral hypomyelination (DDCH, deletion syndrome, chromosome Xq28)" "XLR" "300475" "" "X-linked recessive" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "BCAP31" "02157" ## Individuals ## Do not remove or alter this header ## ## Count = 36 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00183137" "" "" "" "2" "" "00006" "{PMID:Hu 2016:25644381}" "family, 2 affected, 1 unaffected heterozygous carrier female" "M" "" "" "" "0" "" "" "" "25644381-FamAU29" "00207886" "" "" "" "1" "" "00006" "{PMID:Lionel 2018:28771251}" "" "M" "" "Canada" "" "0" "" "" "" "28771251-Pat33" "00305878" "" "" "" "1" "" "02998" "" "" "" "" "" "" "0" "" "" "" "" "00314696" "" "" "" "1" "" "01362" "Whalen et al (submitted)" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "Fam14P15" "00314697" "" "" "" "1" "" "01362" "Whalen et al (submitted)" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "Fam14P16" "00314698" "" "" "" "1" "" "01362" "Whalen et al (submitted)" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "Fam14P17" "00314699" "" "" "" "1" "" "01362" "Whalen et al (submitted)" "" "F" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "Fam14P18" "00314857" "" "" "" "1" "" "01362" "Whalen et al (submitted)" "" "M" "no" "Australia" "" "0" "" "" "" "Fam14P14" "00314917" "" "" "" "2" "" "00006" "{PMID:Cacciagli 2013:24011989}" "3-generation family, 2 affected brothers, unaffected carrier mother" "M" "" "France" "24y" "0" "" "" "" "Fam1PatIII2" "00314918" "" "" "00314917" "1" "" "00006" "{PMID:Cacciagli 2013:24011989}" "brother" "M" "" "France" "13y" "0" "" "" "" "Fam1PatIII3" "00314919" "" "" "" "4" "" "00006" "{PMID:Cacciagli 2013:24011989}" "4-generation family, 4 affected (4M), 3 unaffected carrier females" "M" "" "France" "7m" "0" "" "" "" "Fam2PatIII5" "00314920" "" "" "00314919" "1" "" "00006" "{PMID:Cacciagli 2013:24011989}" "" "M" "" "France" "1y" "0" "" "" "" "Fam2PatIII6" "00314921" "" "" "00314919" "1" "" "00006" "{PMID:Cacciagli 2013:24011989}" "" "M" "" "France" "2y" "0" "" "" "" "Fam2PatIII7" "00314922" "" "" "00314919" "1" "" "00006" "{PMID:Cacciagli 2013:24011989}" "" "M" "" "France" ">13y" "0" "" "" "" "Fam2PatIV1" "00314923" "" "" "" "1" "" "00006" "{PMID:Cacciagli 2013:24011989}" "3-generation family, 1 affected (M), 3 unaffected carrier females" "M" "" "France" "3y" "0" "" "" "" "Fam3PatIII1" "00314924" "" "" "" "1" "" "00006" "{PMID:Osaka 2012:22472424}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "Japan" "" "0" "" "" "" "patient" "00314925" "" "" "" "1" "" "00006" "{PMID:Vittal 2015:30713915}" "4-generation family, 2 affected brothers, 2 unaffected carrier females" "M" "" "Italy" "" "0" "" "" "" "FamPatIV1/2" "00314926" "" "" "" "1" "" "00006" "{PMID:Albanyan 2017:28332767}" "2-generation family, 1 affected, carrier mother" "M" "" "Canada" "" "0" "" "" "" "patient" "00314927" "" "" "" "1" "" "00006" "{PMID:Rinaldi 2020:31330203}" "" "M" "no" "Belgium" "" "0" "" "" "" "patient" "00314928" "" "" "" "1" "" "00006" "{PMID:Shimizu 2020:31953925}" "" "M" "no" "Japan" "" "0" "" "" "" "patient" "00314929" "" "" "" "1" "" "00006" "{PMID:Kao 2020:32652807}" "" "F" "no" "Taiwan" "" "0" "" "" "" "patient" "00315922" "" "" "" "1" "" "00059" "Whalen et al. submitted" "" "M" "no" "New Zealand" "" "0" "" "" "" "Fam1Pat1" "00315923" "" "" "" "1" "" "00059" "Whalen et al. submitted" "" "M" "no" "Italy" "" "" "" "" "" "P2-Family2" "00315924" "" "" "" "1" "" "00059" "Whalen et al. submitted" "" "M" "no" "Italy" "" "" "" "" "" "P3-Family2" "00315925" "" "" "" "1" "" "00059" "Whalen et al. submitted" "" "M" "no" "United States" "" "" "" "" "" "P4-Family3" "00315926" "" "" "" "1" "" "00059" "Whalen et al. submitted" "" "M" "no" "Australia" "" "" "" "" "" "P5-Family4" "00315927" "" "" "" "1" "" "00059" "Whalen et al. submitted" "" "M" "no" "United States" "" "" "" "" "" "P6-Family5" "00315928" "" "" "" "1" "" "00059" "Whalen et al. submitted" "" "M" "no" "United Kingdom (Great Britain)" "" "" "" "" "" "P7-Family6" "00315929" "" "" "" "1" "" "00059" "Whalen et al. submitted" "" "M" "no" "United Kingdom (Great Britain)" "" "" "" "" "" "P8-Family7" "00315930" "" "" "" "1" "" "00059" "Whalen et al. submitted" "" "M" "no" "Israel" "" "" "" "" "" "P9-Family8" "00315931" "" "" "" "1" "" "00059" "Whalen et al. submitted" "" "M" "no" "Canada" "" "" "" "" "" "P10-Family9" "00315932" "" "" "" "1" "" "00059" "Whalen et al. submitted" "" "M" "no" "United States" "" "" "" "" "" "P11-Family10" "00315934" "" "" "" "1" "" "00059" "Whalen et al. submitted" "" "F" "no" "France" "" "" "" "" "" "P13-Family12" "00317967" "" "" "" "1" "" "00059" "Whalen et al. submitted" "" "M" "no" "United States" "" "0" "" "" "" "P12-Family11" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 36 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00000209" "01157" "00183137" "00187" "00207886" "00198" "00305878" "02157" "00314696" "00198" "00314697" "00198" "00314698" "00198" "00314699" "00198" "00314857" "00139" "00314917" "00198" "00314918" "00198" "00314919" "00198" "00314920" "00198" "00314921" "00198" "00314922" "00198" "00314923" "00198" "00314924" "00198" "00314925" "00198" "00314926" "00198" "00314927" "00198" "00314928" "00198" "00314929" "00198" "00315922" "00139" "00315923" "00139" "00315924" "00139" "00315925" "00139" "00315926" "00139" "00315927" "00139" "00315928" "00139" "00315929" "00139" "00315930" "00139" "00315931" "00139" "00315932" "00139" "00315934" "00139" "00317967" "00139" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00187, 00198, 01157, 02157 ## Count = 35 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "" "3w" "" "" "" "" "" "" "" "" "" "0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "" "07y04m" "" "" "" "" "" "" "" "" "" "0000143891" "00187" "00183137" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "mental retardation" "" "0000155670" "00198" "00207886" "00006" "Familial, X-linked" "" "Global developmental delay; deafness; chorea; spasticity" "" "" "" "" "" "" "" "" "" "DDCH" "" "" "0000231725" "02157" "00305878" "02998" "Familial, X-linked" "" "deafness, dystonia, central hypomyelination, refractory seizure, and fluctuating liver function impairment" "" "" "" "" "" "" "" "" "" "" "" "" "0000238498" "00198" "00314696" "01362" "Familial, X-linked" "" "severe intellectual disability (HP:0010864), late onset seizures (HP:0001250), dysarthria (HP:0001260), conductive hearing loss (HP:0000405)" "" "" "" "" "" "" "" "" "" "" "" "" "0000238499" "00198" "00314697" "01362" "Familial, X-linked" "" "severe intellectual disability (HP:0010864), dysarthria (HP:0001260)" "" "" "" "" "" "" "" "" "" "" "" "" "0000238500" "00198" "00314699" "01362" "Familial, X-linked" "" "late onset seizures (HP:0001250) plus drop attacks (HP:0010819), delayed speech (HP:0000750), dysarthria (HP:0001260), ataxia" "" "" "" "" "" "" "" "" "" "" "" "" "0000238501" "00198" "00314698" "01362" "Familial, X-linked" "" "mild intellectual disability (HP:0001256), dysarthria (HP:0001260), mild ataxia" "" "" "" "" "" "" "" "" "" "" "" "" "0000238615" "00139" "00314857" "01362" "Familial, X-linked" "" "Speech disorder\r\nSensorineural hearing loss (SNHL)" "" "" "" "" "" "" "" "" "" "" "mild ID" "" "0000238675" "00198" "00314917" "00006" "Familial, X-linked recessive" "22y" "severe intellectual disability; onset congenital; 1y-deafness; facial dysmorphism; no motor milestones; no cognitive problems; congenital strabismus; dystonia; 4y-seizures; pyramidal signs, quadriplegia, unexplained episodic fever, aggressiveness; failure to thrive, intrauterine growth delay, weight -7 SD, height -8 SD; microcephaly (-5 SD)" "" "" "" "" "" "" "" "" "" "DDCH" "" "" "0000238676" "00198" "00314918" "00006" "Familial, X-linked recessive" "11y" "severe intellectual disability; onset congenital; 1y-deafness; facial dysmorphism; no motor milestones; no cognitive problems; congenital strabismus, abnormal eye movements; dystonia; seizures; pyramidal signs, quadriplegia, unexplained episodic fever; failure to thrive, intrauterine growth delay, weight -6 SD, height -5 SD; microcephaly (-5 SD); MRI brain 11y-periventricular hypomyelination; atrophy cerebral cortex, atrophy cerebellum" "" "" "" "" "" "" "" "" "" "DDCH" "" "" "0000238677" "00198" "00314919" "00006" "Familial, X-linked recessive" "" "severe intellectual disability; onset congenital; no motor milestones; no cognitive problems" "" "" "" "" "" "" "" "" "" "DDCH" "" "" "0000238678" "00198" "00314920" "00006" "Familial, X-linked recessive" "10m" "severe intellectual disability; onset 6w; 1y-deafness; facial dysmorphism; no motor milestones; no cognitive problems; optic atrophy; dystonia; no seizures; pyramidal signs, quadriplegia; failure to thrive" "" "" "" "" "" "" "" "" "" "DDCH" "" "" "0000238679" "00198" "00314921" "00006" "Familial, X-linked recessive" "12m" "severe intellectual disability; onset 6w; 1y-deafness; facial dysmorphism; motor development 12m-head control; no cognitive problems; congenital strabismus; dystonia; no seizures; pyramidal signs, quadriplegia; failure to thrive" "" "" "" "" "" "" "" "" "" "DDCH" "" "" "0000238680" "00198" "00314922" "00006" "Familial, X-linked recessive" "13y" "severe intellectual disability; onset congenital; 6w-normal hearing, 7m-hearing loss (7m 70 db, 3y 0 db); facial dysmorphism; motor development 6m-head control, 5y-sitting, 8y-autonomous wheelchair; simple sign language and scribbling; congenital strabismus, optic atrophy; 10m-dystonia; 8y-seizures; pyramidal signs, paraplegia, unexplained episodic fever, hyperactivity; failure to thrive, intrauterine growth delay; <3y-weight -3 SD, height -3 SD; >3y-weight -2 SD, height -2 SD; 2m-microcephaly (-3 SD), 2y-microcephaly (-2 SD); MRI brain 5.6y-periventricular hypomyelination; no atrophy" "" "" "" "" "" "" "" "" "" "DDCH" "" "" "0000238681" "00198" "00314923" "00006" "Familial, X-linked recessive" "3y" "severe intellectual disability; onset congenital; 5m-deafness (8m 20 db); mild facial dysmorphism; motor development 1y-head control, 1.5y-lost head control; no cognitive problems; congenital strabismus; 6m-dystonia; no seizures; pyramidal signs, quadriplegia, unexplained episodic fever; failure to thrive, 1d-weight normal, height normal; >1y-weight -2 SD, height -2 SD; <6m-microcephaly (02 SD), >6m-microcephaly (-3 SD); MRI brain 2.5y-diffuse hypomyelination; atrophy corpus callosum, atrophy frontal lobe, atrophy white matter" "" "" "" "" "" "" "" "" "" "DDCH" "" "" "0000238682" "00198" "00314924" "00006" "Isolated (sporadic)" "06y" "see paper; severe dystonia, profound intellectual disability, profound developmental disability, liver disease, sensorineural deafness, ..." "" "" "" "" "" "" "" "" "" "DDCH" "" "" "0000238683" "00198" "00314925" "00006" "Familial, X-linked recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "DDCH" "" "" "0000238684" "00198" "00314926" "00006" "Familial, X-linked recessive" "04y06m" "see paper; sensorineural hearing loss, generalized dystonia, and choreoathetosis, ..." "" "" "" "" "" "" "" "" "" "DDCH" "" "" "0000238685" "00198" "00314927" "00006" "Isolated (sporadic)" "03y" "see paper; severe developmental delay, failure to thrive, hearing loss, dyskinetic movements, ..." "" "" "" "" "" "" "" "" "" "DDCH" "dyskinetic cerebral palsy" "" "0000238686" "00198" "00314928" "00006" "Isolated (sporadic)" "08y" "see paper; ..." "" "" "" "" "" "" "" "" "" "DDCH" "" "" "0000238687" "00198" "00314929" "00006" "Isolated (sporadic)" "05y" "see paper; deafness, dystonia, central hypomyelination, refractory seizure, fluctuating liver function impairment, progressive deterioration with febrile episodes, ...; 5y-deceased" "" "" "" "" "" "" "" "" "" "DDCH" "" "" "0000239669" "00139" "00315923" "00059" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Severe ID" "Severe ID" "" "0000239670" "00139" "00315924" "00059" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Severe ID" "Severe ID" "" "0000239671" "00139" "00315925" "00059" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Severe ID" "Severe ID" "" "0000239672" "00139" "00315926" "00059" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Severe ID" "Severe ID" "" "0000239673" "00139" "00315927" "00059" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Severe ID" "Severe ID" "" "0000239674" "00139" "00315928" "00059" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Severe ID" "Severe ID" "" "0000239675" "00139" "00315929" "00059" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Severe ID" "Severe ID" "" "0000239676" "00139" "00315930" "00059" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Severe ID" "Severe ID" "" "0000239677" "00139" "00315931" "00059" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Severe ID" "Severe ID" "" "0000239678" "00139" "00315932" "00059" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Severe ID" "Severe ID" "" "0000239680" "00139" "00315934" "00059" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Severe ID" "Severe ID" "" "0000241751" "00139" "00317967" "00059" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Severe ID" "Severe ID" "" ## Screenings ## Do not remove or alter this header ## ## Count = 36 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000000210" "00000209" "1" "00037" "00001" "2012-09-13 12:09:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000184095" "00183137" "1" "00006" "00006" "2018-10-14 12:07:53" "" "" "SEQ;SEQ-NG" "DNA" "" "WES-X chromosome" "0000208928" "00207886" "1" "00006" "00006" "2018-12-02 17:52:50" "" "" "SEQ" "DNA" "" "WGS" "0000307008" "00305878" "1" "02998" "02998" "2020-07-02 15:26:03" "" "" "SEQ-NG" "DNA" "" "" "0000315869" "00314696" "1" "01362" "01362" "2020-10-14 07:04:10" "01362" "2020-10-14 07:42:29" "PCR" "DNA" "blood" "" "0000315870" "00314697" "1" "01362" "01362" "2020-10-14 07:29:00" "01362" "2020-10-14 07:42:52" "PCR" "DNA" "blood" "" "0000315871" "00314698" "1" "01362" "01362" "2020-10-14 07:34:11" "" "" "PCR" "DNA" "blood" "" "0000315872" "00314699" "1" "01362" "01362" "2020-10-14 07:39:53" "" "" "PCR" "DNA" "blood" "" "0000316031" "00314857" "1" "01362" "01362" "2020-10-20 06:07:38" "" "" "PCR" "DNA" "blood" "" "0000316091" "00314917" "1" "00006" "00006" "2020-10-20 19:02:47" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000316092" "00314918" "1" "00006" "00006" "2020-10-20 19:02:47" "" "" "SEQ" "DNA" "" "" "0000316093" "00314919" "1" "00006" "00006" "2020-10-20 19:02:47" "" "" "SEQ" "DNA" "" "" "0000316094" "00314920" "1" "00006" "00006" "2020-10-20 19:02:47" "" "" "SEQ" "DNA" "" "" "0000316095" "00314921" "1" "00006" "00006" "2020-10-20 19:02:47" "" "" "SEQ" "DNA" "" "" "0000316096" "00314922" "1" "00006" "00006" "2020-10-20 19:02:47" "" "" "SEQ" "DNA" "" "" "0000316097" "00314923" "1" "00006" "00006" "2020-10-20 19:02:47" "" "" "SEQ" "DNA" "" "" "0000316098" "00314924" "1" "00006" "00006" "2020-10-20 19:14:29" "" "" "PCR;PCRlr;RT-PCR;SEQ" "DNA" "" "" "0000316099" "00314925" "1" "00006" "00006" "2020-10-20 19:46:05" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000316100" "00314926" "1" "00006" "00006" "2020-10-20 19:52:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000316101" "00314927" "1" "00006" "00006" "2020-10-20 19:57:11" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000316102" "00314928" "1" "00006" "00006" "2020-10-20 20:32:29" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000316103" "00314929" "1" "00006" "00006" "2020-10-20 20:38:30" "00006" "2020-10-20 20:54:44" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WGS" "0000317104" "00315922" "1" "00059" "00059" "2020-10-30 10:54:16" "" "" "?" "DNA" "" "" "0000317105" "00315923" "1" "00059" "00059" "2020-10-30 10:58:12" "" "" "?" "DNA" "" "" "0000317106" "00315924" "1" "00059" "00059" "2020-10-30 11:05:05" "" "" "?" "DNA" "" "" "0000317107" "00315925" "1" "00059" "00059" "2020-10-30 11:08:41" "" "" "?" "DNA" "" "" "0000317108" "00315926" "1" "00059" "00059" "2020-10-30 11:12:01" "" "" "?" "DNA" "" "" "0000317109" "00315927" "1" "00059" "00059" "2020-10-30 11:14:29" "" "" "?" "DNA" "" "" "0000317110" "00315928" "1" "00059" "00059" "2020-10-30 11:16:28" "" "" "?" "DNA" "" "" "0000317111" "00315929" "1" "00059" "00059" "2020-10-30 11:18:31" "" "" "?" "DNA" "" "" "0000317112" "00315930" "1" "00059" "00059" "2020-10-30 11:20:25" "" "" "?" "DNA" "" "" "0000317113" "00315931" "1" "00059" "00059" "2020-10-30 11:22:40" "" "" "?" "DNA" "" "" "0000317114" "00315932" "1" "00059" "00059" "2020-10-30 11:24:30" "" "" "?" "DNA" "" "" "0000317116" "00315934" "1" "00059" "00059" "2020-10-30 11:29:07" "" "" "?" "DNA" "" "" "0000319149" "00317967" "1" "00059" "00059" "2020-11-04 16:07:47" "" "" "?" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 34 "{{screeningid}}" "{{geneid}}" "0000184095" "MECP2" "0000208928" "BCAP31" "0000315869" "BCAP31" "0000315870" "BCAP31" "0000315871" "BCAP31" "0000315872" "BCAP31" "0000316031" "BCAP31" "0000316091" "BCAP31" "0000316092" "BCAP31" "0000316093" "BCAP31" "0000316094" "BCAP31" "0000316095" "BCAP31" "0000316096" "BCAP31" "0000316097" "BCAP31" "0000316098" "BCAP31" "0000316098" "SLC6A8" "0000316099" "BCAP31" "0000316100" "BCAP31" "0000316101" "BCAP31" "0000316102" "BCAP31" "0000316103" "BCAP31" "0000317104" "BCAP31" "0000317105" "BCAP31" "0000317106" "BCAP31" "0000317107" "BCAP31" "0000317108" "BCAP31" "0000317109" "BCAP31" "0000317110" "BCAP31" "0000317111" "BCAP31" "0000317112" "BCAP31" "0000317113" "BCAP31" "0000317114" "BCAP31" "0000317116" "BCAP31" "0000319149" "BCAP31" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 143 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000008013" "20" "50" "X" "152989830" "152989830" "subst" "0" "00037" "BCAP31_000001" "g.152989830A>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.153724375A>C" "" "VUS" "" "0000015980" "20" "50" "X" "152989830" "152989830" "subst" "0" "00037" "BCAP31_000001" "g.152989830A>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.153724375A>C" "" "VUS" "" "0000261719" "0" "30" "X" "152991087" "152991087" "subst" "0" "01943" "ABCD1_000065" "g.152991087C>A" "" "" "" "ABCD1(NM_000033.3):c.366C>A (p.I122=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725632C>A" "" "likely benign" "" "0000261720" "0" "30" "X" "152991113" "152991113" "subst" "7.57722E-5" "01943" "ABCD1_000066" "g.152991113G>T" "" "" "" "ABCD1(NM_000033.3):c.392G>T (p.G131V, p.(Gly131Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725658G>T" "" "likely benign" "" "0000261721" "0" "50" "X" "152991283" "152991283" "subst" "2.8058E-5" "01943" "ABCD1_000067" "g.152991283G>A" "" "" "" "ABCD1(NM_000033.3):c.562G>A (p.G188R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725828G>A" "" "VUS" "" "0000261722" "0" "30" "X" "152991478" "152991478" "subst" "0.000815887" "01943" "ABCD1_000069" "g.152991478C>G" "" "" "" "ABCD1(NM_000033.3):c.757C>G (p.L253V, p.(Leu253Val)), ABCD1(NM_000033.4):c.757C>G (p.L253V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153726023C>G" "" "likely benign" "" "0000261723" "0" "30" "X" "152991570" "152991570" "subst" "0" "01943" "ABCD1_000070" "g.152991570C>T" "" "" "" "ABCD1(NM_000033.3):c.849C>T (p.H283=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153726115C>T" "" "likely benign" "" "0000263622" "0" "50" "X" "152981108" "152981108" "subst" "2.23751E-5" "01943" "BCAP31_000007" "g.152981108G>A" "" "" "" "BCAP31(NM_001139441.1):c.230C>T (p.T77M), BCAP31(NM_001139457.2):c.431C>T (p.T144M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153715653G>A" "" "VUS" "" "0000263623" "0" "50" "X" "152981084" "152981084" "subst" "0" "01943" "BCAP31_000006" "g.152981084T>C" "" "" "" "BCAP31(NM_001139457.2):c.455A>G (p.N152S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153715629T>C" "" "VUS" "" "0000263624" "0" "30" "X" "152969530" "152969530" "subst" "5.63199E-6" "01943" "BCAP31_000004" "g.152969530T>A" "" "" "" "BCAP31(NM_001139441.1):c.361A>T (p.(Thr121Ser)), BCAP31(NM_001139457.2):c.562A>T (p.T188S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153704075T>A" "" "likely benign" "" "0000263625" "0" "30" "X" "152969508" "152969508" "subst" "0.0013793" "01943" "BCAP31_000003" "g.152969508G>A" "" "" "" "BCAP31(NM_001139441.1):c.383C>T (p.(Thr128Met)), BCAP31(NM_001139457.2):c.584C>T (p.T195M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153704053G>A" "" "likely benign" "" "0000263626" "0" "50" "X" "152967502" "152967502" "subst" "0" "01943" "BCAP31_000002" "g.152967502T>A" "" "" "" "BCAP31(NM_001139457.2):c.863A>T (p.K288M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153702047T>A" "" "VUS" "" "0000336038" "0" "30" "X" "152969508" "152969508" "subst" "0.0013793" "01804" "BCAP31_000003" "g.152969508G>A" "" "" "" "BCAP31(NM_001139441.1):c.383C>T (p.(Thr128Met)), BCAP31(NM_001139457.2):c.584C>T (p.T195M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153704053G>A" "" "likely benign" "" "0000336040" "0" "50" "X" "152986404" "152986404" "subst" "1.68092E-5" "01804" "BCAP31_000008" "g.152986404C>T" "" "" "" "BCAP31(NM_001139441.1):c.116G>A (p.(Arg39Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153720949C>T" "" "VUS" "" "0000336041" "0" "50" "X" "152988966" "152988966" "subst" "0" "01804" "BCAP31_000009" "g.152988966C>T" "" "" "" "BCAP31(NM_001139457.2):c.154G>A (p.(Ala52Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153723511C>T" "" "VUS" "" "0000336042" "0" "50" "X" "152988981" "152988981" "subst" "0.000435993" "01804" "BCAP31_000010" "g.152988981G>A" "" "" "" "BCAP31(NM_001139457.2):c.139C>T (p.H47Y, p.(His47Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153723526G>A" "" "VUS" "" "0000336043" "0" "30" "X" "152989463" "152989463" "subst" "0.0105117" "01804" "BCAP31_000011" "g.152989463G>T" "" "" "" "BCAP31(NM_001139441.1):c.-45+8C>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153724008G>T" "" "likely benign" "" "0000336044" "0" "30" "X" "152990761" "152990761" "subst" "7.29253E-5" "01804" "ABCD1_000063" "g.152990761A>G" "" "" "" "ABCD1(NM_000033.3):c.40A>G (p.T14A, p.(Thr14Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725306A>G" "" "likely benign" "" "0000336047" "0" "30" "X" "152991478" "152991478" "subst" "0.000815887" "01804" "ABCD1_000069" "g.152991478C>G" "" "" "" "ABCD1(NM_000033.3):c.757C>G (p.L253V, p.(Leu253Val)), ABCD1(NM_000033.4):c.757C>G (p.L253V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153726023C>G" "" "likely benign" "" "0000336048" "0" "30" "X" "152994682" "152994682" "subst" "0.000252779" "01804" "ABCD1_000071" "g.152994682C>T" "" "" "" "ABCD1(NM_000033.3):c.901-5C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153729227C>T" "" "likely benign" "" "0000337265" "0" "70" "X" "152994682" "152994682" "subst" "0" "02327" "ABCD1_000104" "g.152994682C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153729227C>A" "" "likely pathogenic" "" "0000339481" "0" "50" "X" "152991021" "152991021" "subst" "1.40933E-5" "02327" "ABCD1_000095" "g.152991021C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725566C>G" "" "VUS" "" "0000341167" "0" "50" "X" "152991143" "152991143" "subst" "0" "02327" "ABCD1_000097" "g.152991143C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725688C>A" "" "VUS" "" "0000341789" "0" "50" "X" "152991080" "152991080" "subst" "0" "02327" "ABCD1_000096" "g.152991080G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725625G>A" "" "VUS" "" "0000342039" "0" "50" "X" "152991214" "152991214" "subst" "1.68406E-5" "02327" "ABCD1_000098" "g.152991214C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725759C>T" "" "VUS" "" "0000342523" "0" "50" "X" "152991559" "152991559" "subst" "0" "02327" "ABCD1_000101" "g.152991559C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153726104C>T" "" "VUS" "" "0000343467" "0" "50" "X" "152990987" "152990987" "subst" "0" "02327" "ABCD1_000092" "g.152990987G>A" "" "" "" "ABCD1(NM_000033.4):c.266G>A (p.R89Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725532G>A" "" "VUS" "" "0000344608" "0" "90" "X" "152991250" "152991250" "subst" "0" "02327" "ABCD1_000099" "g.152991250C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725795C>T" "" "pathogenic" "" "0000345966" "0" "70" "X" "152991613" "152991613" "subst" "0" "02327" "ABCD1_000103" "g.152991613G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153726158G>A" "" "likely pathogenic" "" "0000346439" "0" "50" "X" "152991569" "152991569" "subst" "0" "02327" "ABCD1_000102" "g.152991569A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153726114A>G" "" "VUS" "" "0000346537" "0" "70" "X" "152991011" "152991011" "subst" "0" "02327" "ABCD1_000093" "g.152991011A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725556A>C" "" "likely pathogenic" "" "0000347680" "0" "90" "X" "152990722" "152990722" "subst" "0" "02327" "ABCD1_000089" "g.152990722A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725267A>G" "" "pathogenic" "" "0000349228" "0" "70" "X" "152991014" "152991014" "subst" "0" "02327" "ABCD1_000094" "g.152991014C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725559C>G" "" "likely pathogenic" "" "0000350640" "0" "30" "X" "152990929" "152990929" "subst" "0" "02327" "ABCD1_000091" "g.152990929G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725474G>C" "" "likely benign" "" "0000408064" "21" "90" "X" "152710806" "153609906" "dup" "0" "00006" "MECP2_002820" "g.152710806_153609906dup" "" "{PMID:Hu 2016:25644381}" "" "MECP2" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000438963" "20" "90" "X" "152981003" "152981006" "dup" "0" "00006" "BCAP31_000012" "g.152981003_152981006dup" "" "{PMID:Lionel 2018:28771251}" "" "332_335dupTGCT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.153715548_153715551dup" "" "pathogenic" "" "0000574310" "0" "30" "X" "152966420" "152966420" "subst" "3.52674E-5" "01943" "BCAP31_000013" "g.152966420T>A" "" "" "" "BCAP31(NM_001139457.2):c.914A>T (p.D305V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153700965T>A" "" "likely benign" "" "0000574311" "0" "30" "X" "152969498" "152969498" "subst" "0" "01943" "BCAP31_000014" "g.152969498G>A" "" "" "" "BCAP31(NM_001139457.2):c.594C>T (p.A198=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153704043G>A" "" "likely benign" "" "0000574312" "0" "30" "X" "152969530" "152969530" "subst" "5.63199E-6" "01804" "BCAP31_000004" "g.152969530T>A" "" "" "" "BCAP31(NM_001139441.1):c.361A>T (p.(Thr121Ser)), BCAP31(NM_001139457.2):c.562A>T (p.T188S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153704075T>A" "" "likely benign" "" "0000574313" "0" "50" "X" "152969538" "152969538" "subst" "0" "01943" "BCAP31_000015" "g.152969538C>T" "" "" "" "BCAP31(NM_001139457.2):c.554G>A (p.R185H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153704083C>T" "" "VUS" "" "0000574314" "0" "50" "X" "152988711" "152988713" "del" "0" "01943" "BCAP31_000016" "g.152988711_152988713del" "" "" "" "BCAP31(NM_001139457.2):c.190_192delTCT (p.S65del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153723256_153723258del" "" "VUS" "" "0000574315" "0" "30" "X" "152988981" "152988981" "subst" "0.000435993" "01943" "BCAP31_000010" "g.152988981G>A" "" "" "" "BCAP31(NM_001139457.2):c.139C>T (p.H47Y, p.(His47Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153723526G>A" "" "likely benign" "" "0000574316" "0" "50" "X" "152990752" "152990752" "subst" "0" "01943" "BCAP31_000017" "g.152990752C>G" "" "" "" "ABCD1(NM_000033.3):c.31C>G (p.R11G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725297C>G" "" "VUS" "" "0000574317" "0" "30" "X" "152990759" "152990759" "subst" "0.00203237" "02330" "BCAP31_000018" "g.152990759A>C" "" "" "" "ABCD1(NM_000033.3):c.38A>C (p.N13T, p.(Asn13Thr)), ABCD1(NM_000033.4):c.38A>C (p.N13T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725304A>C" "" "likely benign" "" "0000574318" "0" "30" "X" "152990759" "152990759" "subst" "0.00203237" "01943" "BCAP31_000018" "g.152990759A>C" "" "" "" "ABCD1(NM_000033.3):c.38A>C (p.N13T, p.(Asn13Thr)), ABCD1(NM_000033.4):c.38A>C (p.N13T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725304A>C" "" "likely benign" "" "0000574319" "0" "30" "X" "152990759" "152990759" "subst" "0.00203237" "01804" "BCAP31_000018" "g.152990759A>C" "" "" "" "ABCD1(NM_000033.3):c.38A>C (p.N13T, p.(Asn13Thr)), ABCD1(NM_000033.4):c.38A>C (p.N13T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725304A>C" "" "likely benign" "" "0000574320" "0" "30" "X" "152990759" "152990759" "subst" "0.00203237" "02325" "BCAP31_000018" "g.152990759A>C" "" "" "" "ABCD1(NM_000033.3):c.38A>C (p.N13T, p.(Asn13Thr)), ABCD1(NM_000033.4):c.38A>C (p.N13T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725304A>C" "" "likely benign" "" "0000574321" "0" "30" "X" "152991018" "152991018" "subst" "0" "01943" "BCAP31_000019" "g.152991018C>T" "" "" "" "ABCD1(NM_000033.3):c.297C>T (p.A99=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725563C>T" "" "likely benign" "" "0000574322" "0" "90" "X" "152991058" "152991058" "subst" "6.32323E-6" "01943" "BCAP31_000020" "g.152991058C>T" "" "" "" "ABCD1(NM_000033.3):c.337C>T (p.R113C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725603C>T" "" "pathogenic" "" "0000574324" "0" "50" "X" "152991113" "152991113" "subst" "7.57722E-5" "01804" "ABCD1_000066" "g.152991113G>T" "" "" "" "ABCD1(NM_000033.3):c.392G>T (p.G131V, p.(Gly131Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725658G>T" "" "VUS" "" "0000574325" "0" "90" "X" "152991175" "152991175" "subst" "0" "02327" "BCAP31_000021" "g.152991175C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725720C>T" "" "pathogenic" "" "0000574326" "0" "30" "X" "152991195" "152991195" "subst" "0" "01943" "BCAP31_000022" "g.152991195G>A" "" "" "" "ABCD1(NM_000033.3):c.474G>A (p.L158=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725740G>A" "" "likely benign" "" "0000574327" "0" "30" "X" "152991196" "152991196" "subst" "5.62028E-6" "01943" "BCAP31_000023" "g.152991196G>A" "" "" "" "ABCD1(NM_000033.3):c.475G>A (p.A159T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725741G>A" "" "likely benign" "" "0000574328" "0" "90" "X" "152991380" "152991380" "subst" "0" "02327" "ABCD1_000043" "g.152991380T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725925T>C" "" "pathogenic" "" "0000574329" "0" "30" "X" "152991428" "152991428" "subst" "0.00140902" "02325" "BCAP31_000024" "g.152991428G>A" "" "" "" "ABCD1(NM_000033.3):c.707G>A (p.(Arg236His)), ABCD1(NM_000033.4):c.707G>A (p.R236H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725973G>A" "" "likely benign" "" "0000574330" "0" "50" "X" "152991617" "152991617" "subst" "0" "01943" "BCAP31_000025" "g.152991617A>G" "" "" "" "ABCD1(NM_000033.3):c.896A>G (p.H299R, p.(His299Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153726162A>G" "" "VUS" "" "0000574331" "0" "30" "X" "152994671" "152994671" "subst" "0.00776529" "02330" "BCAP31_000026" "g.152994671C>T" "" "" "" "ABCD1(NM_000033.3):c.901-16C>T (p.(=)), ABCD1(NM_000033.4):c.901-16C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153729216C>T" "" "likely benign" "" "0000574332" "0" "30" "X" "152994671" "152994671" "subst" "0.00776529" "01804" "BCAP31_000026" "g.152994671C>T" "" "" "" "ABCD1(NM_000033.3):c.901-16C>T (p.(=)), ABCD1(NM_000033.4):c.901-16C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153729216C>T" "" "likely benign" "" "0000574333" "0" "30" "X" "152994833" "152994833" "subst" "0.000930587" "01804" "BCAP31_000027" "g.152994833C>A" "" "" "" "ABCD1(NM_000033.3):c.1047C>A (p.(Val349=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153729378C>A" "" "likely benign" "" "0000619166" "0" "50" "X" "152966406" "152966406" "subst" "1.75422E-5" "01943" "BCAP31_000028" "g.152966406T>C" "" "" "" "BCAP31(NM_001139457.2):c.928A>G (p.K310E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153700951T>C" "" "VUS" "" "0000619167" "0" "30" "X" "152966415" "152966415" "subst" "0" "01943" "BCAP31_000029" "g.152966415G>A" "" "" "" "BCAP31(NM_001139457.2):c.919C>T (p.P307S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153700960G>A" "" "likely benign" "" "0000619168" "0" "50" "X" "152968411" "152968411" "subst" "0" "01943" "BCAP31_000030" "g.152968411C>T" "" "" "" "BCAP31(NM_001139457.2):c.781G>A (p.E261K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153702956C>T" "" "VUS" "" "0000619169" "0" "30" "X" "152986328" "152986328" "subst" "0.000826823" "01943" "BCAP31_000031" "g.152986328G>A" "" "" "" "BCAP31(NM_001139457.2):c.393C>T (p.I131=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153720873G>A" "" "likely benign" "" "0000619170" "0" "30" "X" "152988604" "152988604" "subst" "5.64525E-5" "01943" "BCAP31_000032" "g.152988604A>G" "" "" "" "BCAP31(NM_001139457.2):c.293+4T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153723149A>G" "" "likely benign" "" "0000619171" "0" "30" "X" "152988711" "152988713" "del" "0" "02325" "BCAP31_000016" "g.152988711_152988713del" "" "" "" "BCAP31(NM_001139457.2):c.190_192delTCT (p.S65del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153723256_153723258del" "" "likely benign" "" "0000619172" "0" "90" "X" "152991035" "152991035" "subst" "0" "02327" "BCAP31_000033" "g.152991035C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725580C>T" "" "pathogenic" "" "0000619173" "0" "30" "X" "152991282" "152991282" "subst" "1.12238E-5" "01943" "BCAP31_000034" "g.152991282C>T" "" "" "" "ABCD1(NM_000033.3):c.561C>T (p.D187=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725827C>T" "" "likely benign" "" "0000624487" "0" "30" "X" "152991478" "152991478" "subst" "0.000815887" "02325" "ABCD1_000069" "g.152991478C>G" "" "" "" "ABCD1(NM_000033.3):c.757C>G (p.L253V, p.(Leu253Val)), ABCD1(NM_000033.4):c.757C>G (p.L253V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153726023C>G" "" "likely benign" "" "0000659150" "0" "90" "X" "152969476" "152969476" "subst" "0" "02327" "BCAP31_000035" "g.152969476G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153704021G>A" "" "pathogenic" "" "0000659151" "0" "30" "X" "152969507" "152969507" "subst" "0.000644622" "01943" "BCAP31_000036" "g.152969507C>T" "" "" "" "BCAP31(NM_001139441.1):c.384G>A (p.T128=), BCAP31(NM_001139457.2):c.585G>A (p.T195=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153704052C>T" "" "likely benign" "" "0000659152" "0" "90" "X" "152991286" "152991286" "del" "0" "02325" "BCAP31_000037" "g.152991286del" "" "" "" "ABCD1(NM_000033.4):c.565delC (p.R189Gfs*9)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.153725831del" "" "pathogenic" "" "0000670905" "0" "90" "X" "152988608" "152988608" "subst" "0" "02998" "BCAP31_000038" "g.152988608C>T" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.153723153C>T" "" "pathogenic" "ACMG" "0000682209" "0" "30" "X" "152990761" "152990761" "subst" "7.29253E-5" "01943" "ABCD1_000063" "g.152990761A>G" "" "" "" "ABCD1(NM_000033.3):c.40A>G (p.T14A, p.(Thr14Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682210" "0" "30" "X" "152990762" "152990762" "subst" "0.00036398" "01943" "ABCD1_000064" "g.152990762C>G" "" "" "" "ABCD1(NM_000033.3):c.41C>G (p.T14R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682211" "0" "30" "X" "152990970" "152990970" "subst" "0.000403045" "01943" "ABCD1_000128" "g.152990970C>T" "" "" "" "ABCD1(NM_000033.3):c.249C>T (p.F83=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682212" "0" "50" "X" "152991463" "152991463" "subst" "3.48127E-5" "01943" "ABCD1_000129" "g.152991463G>A" "" "" "" "ABCD1(NM_000033.3):c.742G>A (p.G248S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693426" "0" "30" "X" "152990757" "152990757" "subst" "0" "01943" "ABCD1_000133" "g.152990757G>A" "" "" "" "ABCD1(NM_000033.3):c.36G>A (p.G12=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693427" "0" "90" "X" "152991564" "152991564" "subst" "0" "02327" "ABCD1_000134" "g.152991564C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000697971" "20" "70" "X" "152986383" "152986383" "subst" "0" "01362" "BCAP31_000040" "g.152986383G>T" "" "" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.153720928G>T" "" "likely pathogenic" "ACMG" "0000697972" "0" "70" "X" "152986383" "152986383" "subst" "0" "01362" "BCAP31_000040" "g.152986383G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000697973" "0" "70" "X" "152986383" "152986383" "subst" "0" "01362" "BCAP31_000040" "g.152986383G>T" "" "" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000697974" "0" "70" "X" "152986383" "152986383" "subst" "0" "01362" "BCAP31_000040" "g.152986383G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "" "0000698157" "0" "70" "X" "152988653" "152988653" "subst" "0" "01362" "BCAP31_000047" "g.152988653A>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "likely pathogenic" "ACMG" "0000698230" "21" "90" "X" "152981146" "152981146" "subst" "0" "00006" "BCAP31_000048" "g.152981146T>C" "" "{PMID:Cacciagli 2013:24011989}" "" "194-2A>G" "" "Germline" "" "" "0" "" "" "g.153715691T>C" "" "pathogenic (recessive)" "" "0000698231" "21" "90" "X" "152981146" "152981146" "subst" "0" "00006" "BCAP31_000048" "g.152981146T>C" "" "{PMID:Cacciagli 2013:24011989}" "" "194-2A>G" "" "Germline" "" "" "0" "" "" "g.153715691T>C" "" "pathogenic (recessive)" "" "0000698232" "21" "90" "X" "152961800" "152967144" "del" "0" "00006" "BCAP31_000041" "g.152961800_152967144del" "" "{PMID:Cacciagli 2013:24011989}" "" "del ex8" "SLC6A8 transcript level 0.46" "Germline" "" "" "0" "" "" "g.153696345_153701689del" "" "pathogenic (recessive)" "" "0000698233" "21" "90" "X" "152961800" "152967144" "del" "0" "00006" "BCAP31_000041" "g.152961800_152967144del" "" "{PMID:Cacciagli 2013:24011989}" "" "del ex8" "" "Germline" "" "" "0" "" "" "g.153696345_153701689del" "" "pathogenic (recessive)" "" "0000698234" "21" "90" "X" "152961800" "152967144" "del" "0" "00006" "BCAP31_000041" "g.152961800_152967144del" "" "{PMID:Cacciagli 2013:24011989}" "" "del ex8" "" "Germline" "" "" "0" "" "" "g.153696345_153701689del" "" "pathogenic (recessive)" "" "0000698235" "21" "90" "X" "152961800" "152967144" "del" "0" "00006" "BCAP31_000041" "g.152961800_152967144del" "" "{PMID:Cacciagli 2013:24011989}" "" "del ex8" "" "Germline" "" "" "0" "" "" "g.153696345_153701689del" "" "pathogenic (recessive)" "" "0000698236" "21" "90" "X" "152986423" "152986423" "subst" "0" "00006" "BCAP31_000045" "g.152986423G>A" "" "{PMID:Cacciagli 2013:24011989}" "" "97C>T" "" "Germline" "" "" "0" "" "" "g.153720968G>A" "" "pathogenic (recessive)" "" "0000698237" "20" "90" "X" "152958460" "152977354" "del" "0" "00006" "BCAP31_000042" "g.152958460_152977354del" "" "{PMID:Osaka 2012:22472424}" "" "" "" "De novo" "" "" "0" "" "" "g.153693005_153711899del" "" "pathogenic (recessive)" "" "0000698238" "21" "90" "X" "152988635" "152988640" "del" "0" "00006" "BCAP31_000043" "g.152988635_152988640del" "" "{PMID:Vittal 2015:30713915}" "" "261_266delGCTTCT" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000698239" "21" "90" "X" "152981003" "152981006" "dup" "0" "00006" "BCAP31_000012" "g.152981003_152981006dup" "" "{PMID:Albanyan 2017:28332767}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000698240" "20" "90" "X" "152966412" "152966424" "del" "0" "00006" "BCAP31_000044" "g.152966412_152966424del" "" "{PMID:Rinaldi 2020:31330203}" "" "709_721del" "" "De novo" "" "" "0" "" "" "g.153700957_153700969del" "" "pathogenic (recessive)" "" "0000698241" "0" "90" "X" "152986423" "152986423" "subst" "0" "00006" "BCAP31_000045" "g.152986423G>A" "" "{PMID:Shimizu 2020:31953925}" "" "97C>T" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000698242" "1" "90" "X" "152988608" "152988608" "subst" "0" "00006" "BCAP31_000038" "g.152988608C>T" "" "{PMID:Kao 2020:32652807}" "" "" "ACMG criteria PS2, PS3, PM2, PP3, PP4" "De novo" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000698243" "2" "90" "X" "152965947" "152989556" "" "0" "00006" "BCAP31_000046" "g.(152965947_152989556)=" "" "{PMID:Kao 2020:32652807}" "" "" "allel not expressed due to non-random X-inactivation" "Somatic" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000699287" "21" "70" "X" "152988697" "152988697" "subst" "0" "00059" "BCAP31_000049" "g.152988697C>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.153723242C>G" "" "likely pathogenic" "ACMG" "0000699288" "21" "70" "X" "152988607" "152988607" "subst" "0" "00059" "BCAP31_000059" "g.152988607C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.153723152C>T" "" "likely pathogenic" "ACMG" "0000699289" "21" "70" "X" "152988607" "152988607" "subst" "0" "00059" "BCAP31_000059" "g.152988607C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.153723152C>T" "" "likely pathogenic" "ACMG" "0000699290" "21" "70" "X" "152969425" "152969425" "subst" "0" "00059" "BCAP31_000058" "g.152969425G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.153703970G>A" "" "likely pathogenic" "ACMG" "0000699291" "0" "70" "X" "152969528" "152969529" "del" "0" "00059" "BCAP31_000053" "g.152969528_152969529del" "" "" "" "chrX:152969524TGA>T" "" "De novo" "" "" "0" "" "" "g.153704073_153704074del" "" "likely pathogenic" "ACMG" "0000699292" "21" "70" "X" "152969446" "152969446" "subst" "0" "00059" "BCAP31_000057" "g.152969446T>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.153703991T>A" "" "likely pathogenic" "ACMG" "0000699293" "21" "70" "X" "152967501" "152967501" "dup" "0" "00059" "BCAP31_000056" "g.152967501dup" "" "" "" "chrX:152967499T>TC" "" "Germline" "" "" "0" "" "" "g.153702047dup" "" "likely pathogenic" "ACMG" "0000699294" "21" "70" "X" "152967461" "152967461" "subst" "0" "00059" "BCAP31_000055" "g.152967461C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.153702006C>T" "" "likely pathogenic" "ACMG" "0000699295" "21" "70" "X" "152966401" "152966404" "del" "0" "00059" "BCAP31_000054" "g.152966401_152966404del" "" "" "" "chrX:152966396TCTTC>T" "" "Germline" "" "" "0" "" "" "g.153700946_153700949del" "" "likely pathogenic" "ACMG" "0000699296" "21" "70" "X" "152969528" "152969529" "del" "0" "00059" "BCAP31_000053" "g.152969528_152969529del" "" "" "" "chrX:152969524TGA>T" "" "Germline" "" "" "0" "" "" "g.153704073_153704074del" "" "likely pathogenic" "ACMG" "0000699297" "21" "70" "X" "152966388" "152966428" "del" "0" "00059" "BCAP31_000052" "g.152966388_152966428del" "" "" "" "chrX:GGCCCTTACTCTTCCTTCTTGTCCATGGGACCATCTACTGCA>G" "" "Germline" "" "" "0" "" "" "g.153700933_153700973del" "" "likely pathogenic" "ACMG" "0000699299" "0" "70" "X" "152969508" "152969511" "dup" "0" "00059" "BCAP31_000051" "g.152969508_152969511dup" "" "" "" "chrX:152969507C>CGTGG" "" "Unknown" "" "" "0" "" "" "g.153704053_153704056dup" "" "likely pathogenic" "ACMG" "0000701794" "21" "70" "X" "152982315" "152988064" "del" "0" "00059" "BCAP31_000060" "g.152982315_152988064del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.153716860_153722609del" "" "likely pathogenic" "ACMG" "0000728562" "0" "50" "X" "152969541" "152969541" "subst" "0" "02325" "BCAP31_000061" "g.152969541C>T" "" "" "" "BCAP31(NM_001139441.1):c.350G>A (p.R117K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728563" "0" "30" "X" "152990979" "152990979" "subst" "0.000863491" "01943" "ABCD1_000135" "g.152990979C>T" "" "" "" "ABCD1(NM_000033.3):c.258C>T (p.V86=, p.(Val86=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728564" "0" "70" "X" "152991167" "152991167" "subst" "0" "02327" "ABCD1_000057" "g.152991167G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000728565" "0" "50" "X" "152991425" "152991425" "subst" "0" "02327" "ABCD1_000136" "g.152991425C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728566" "0" "50" "X" "152991452" "152991452" "subst" "1.15505E-5" "01943" "ABCD1_000137" "g.152991452C>T" "" "" "" "ABCD1(NM_000033.3):c.731C>T (p.S244L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728567" "0" "90" "X" "152991572" "152991572" "subst" "0" "02327" "ABCD1_000138" "g.152991572C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000810053" "0" "30" "X" "152968380" "152968380" "subst" "0" "01943" "BCAP31_000062" "g.152968380C>T" "" "" "" "BCAP31(NM_001139457.2):c.802+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810054" "0" "50" "X" "152991293" "152991293" "subst" "1.1231E-5" "01943" "ABCD1_000146" "g.152991293G>A" "" "" "" "ABCD1(NM_000033.3):c.572G>A (p.R191H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000810055" "0" "50" "X" "152991541" "152991541" "subst" "0" "02327" "ABCD1_000147" "g.152991541C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000810056" "0" "30" "X" "152994833" "152994833" "subst" "0" "01943" "ABCD1_000148" "g.152994833C>T" "" "" "" "ABCD1(NM_000033.3):c.1047C>T (p.V349=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856415" "0" "30" "X" "152968381" "152968381" "subst" "0.000936595" "01943" "BCAP31_000063" "g.152968381G>A" "" "" "" "BCAP31(NM_001139457.2):c.802+9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856416" "0" "30" "X" "152969549" "152969549" "subst" "0" "02325" "BCAP31_000039" "g.152969549G>A" "" "" "" "BCAP31(NM_001139441.1):c.342C>T (p.F114=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856417" "0" "50" "X" "152981108" "152981108" "subst" "2.23751E-5" "02325" "BCAP31_000007" "g.152981108G>A" "" "" "" "BCAP31(NM_001139441.1):c.230C>T (p.T77M), BCAP31(NM_001139457.2):c.431C>T (p.T144M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000867161" "0" "30" "X" "152990837" "152990837" "subst" "0" "01943" "ABCD1_000152" "g.152990837G>T" "" "" "" "ABCD1(NM_000033.3):c.116G>T (p.C39F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000867162" "0" "30" "X" "152990979" "152990979" "subst" "0.000863491" "01804" "ABCD1_000135" "g.152990979C>T" "" "" "" "ABCD1(NM_000033.3):c.258C>T (p.V86=, p.(Val86=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000867163" "0" "50" "X" "152991428" "152991428" "subst" "0.00140902" "01804" "BCAP31_000024" "g.152991428G>A" "" "" "" "ABCD1(NM_000033.3):c.707G>A (p.(Arg236His)), ABCD1(NM_000033.4):c.707G>A (p.R236H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000867164" "0" "70" "X" "152991517" "152991517" "subst" "0" "02327" "ABCD1_000045" "g.152991517G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000867165" "0" "30" "X" "152994677" "152994677" "subst" "0.00339836" "01804" "ABCD1_000153" "g.152994677C>T" "" "" "" "ABCD1(NM_000033.3):c.901-10C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895979" "0" "70" "X" "152991601" "152991601" "subst" "0" "02325" "ABCD1_000165" "g.152991601G>A" "" "" "" "ABCD1(NM_000033.4):c.880G>A (p.A294T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000915627" "0" "30" "X" "152991160" "152991160" "subst" "1.13327E-5" "01804" "ABCD1_000168" "g.152991160G>A" "" "" "" "ABCD1(NM_000033.3):c.439G>A (p.(Val147Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915628" "0" "70" "X" "152991421" "152991421" "subst" "0" "02327" "ABCD1_000169" "g.152991421C>T" "" "" "" "ABCD1(NM_000033.4):c.700C>T (p.R234C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000915629" "0" "70" "X" "152991421" "152991421" "subst" "0" "02329" "ABCD1_000169" "g.152991421C>T" "" "" "" "ABCD1(NM_000033.4):c.700C>T (p.R234C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000951700" "0" "30" "X" "152990759" "152990759" "subst" "0.00203237" "02326" "BCAP31_000018" "g.152990759A>C" "" "" "" "ABCD1(NM_000033.3):c.38A>C (p.N13T, p.(Asn13Thr)), ABCD1(NM_000033.4):c.38A>C (p.N13T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951701" "0" "30" "X" "152990995" "152990995" "subst" "0.000116749" "02327" "ABCD1_000171" "g.152990995G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000970857" "0" "50" "X" "152990987" "152990987" "subst" "0" "02325" "ABCD1_000092" "g.152990987G>A" "" "" "" "ABCD1(NM_000033.4):c.266G>A (p.R89Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000970859" "0" "30" "X" "152991478" "152991478" "subst" "0.000815887" "02326" "ABCD1_000069" "g.152991478C>G" "" "" "" "ABCD1(NM_000033.3):c.757C>G (p.L253V, p.(Leu253Val)), ABCD1(NM_000033.4):c.757C>G (p.L253V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000970860" "0" "30" "X" "152991616" "152991616" "subst" "9.85934E-5" "02325" "ABCD1_000177" "g.152991616C>T" "" "" "" "ABCD1(NM_000033.4):c.895C>T (p.H299Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006524" "0" "50" "X" "152990899" "152990899" "subst" "0" "01804" "ABCD1_000180" "g.152990899G>C" "" "" "" "ABCD1(NM_000033.3):c.178G>C (p.(Val60Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006525" "0" "30" "X" "152991077" "152991077" "subst" "0" "01804" "ABCD1_000181" "g.152991077C>T" "" "" "" "ABCD1(NM_000033.3):c.356C>T (p.(Ala119Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006526" "0" "50" "X" "152991617" "152991617" "subst" "0" "01804" "BCAP31_000025" "g.152991617A>G" "" "" "" "ABCD1(NM_000033.3):c.896A>G (p.H299R, p.(His299Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015996" "0" "30" "X" "152969507" "152969507" "subst" "0.000644622" "02325" "BCAP31_000036" "g.152969507C>T" "" "" "" "BCAP31(NM_001139441.1):c.384G>A (p.T128=), BCAP31(NM_001139457.2):c.585G>A (p.T195=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044183" "0" "30" "X" "152991417" "152991417" "subst" "0.00145739" "01804" "ABCD1_000183" "g.152991417G>T" "" "" "" "ABCD1(NM_000033.3):c.696G>T (p.(Ala232=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001067808" "0" "50" "X" "152991469" "152991469" "subst" "0" "02325" "ABCD1_000186" "g.152991469G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes BCAP31 ## Count = 143 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000008013" "00025975" "50" "-86" "0" "-86" "0" "c.-86T>G" "r.(=)" "p.(=)" "" "0000015980" "00025975" "50" "-86" "0" "-86" "0" "c.-86T>G" "r.(=)" "p.(=)" "" "0000261719" "00025975" "30" "-1343" "0" "-1343" "0" "c.-1343G>T" "r.(?)" "p.(=)" "" "0000261720" "00025975" "30" "-1369" "0" "-1369" "0" "c.-1369C>A" "r.(?)" "p.(=)" "" "0000261721" "00025975" "50" "-1539" "0" "-1539" "0" "c.-1539C>T" "r.(?)" "p.(=)" "" "0000261722" "00025975" "30" "-1734" "0" "-1734" "0" "c.-1734G>C" "r.(?)" "p.(=)" "" "0000261723" "00025975" "30" "-1826" "0" "-1826" "0" "c.-1826G>A" "r.(?)" "p.(=)" "" "0000263622" "00025975" "50" "230" "0" "230" "0" "c.230C>T" "r.(?)" "p.(Thr77Met)" "" "0000263623" "00025975" "50" "254" "0" "254" "0" "c.254A>G" "r.(?)" "p.(Asn85Ser)" "" "0000263624" "00025975" "30" "361" "0" "361" "0" "c.361A>T" "r.(?)" "p.(Thr121Ser)" "" "0000263625" "00025975" "30" "383" "0" "383" "0" "c.383C>T" "r.(?)" "p.(Thr128Met)" "" "0000263626" "00025975" "50" "662" "0" "662" "0" "c.662A>T" "r.(?)" "p.(Lys221Met)" "" "0000336038" "00025975" "30" "383" "0" "383" "0" "c.383C>T" "r.(?)" "p.(Thr128Met)" "" "0000336040" "00025975" "50" "116" "0" "116" "0" "c.116G>A" "r.(?)" "p.(Arg39Gln)" "" "0000336041" "00025975" "50" "-44" "-223" "-44" "-223" "c.-44-223G>A" "r.(=)" "p.(=)" "" "0000336042" "00025975" "50" "-44" "-238" "-44" "-238" "c.-44-238C>T" "r.(=)" "p.(=)" "" "0000336043" "00025975" "30" "-45" "326" "-45" "326" "c.-45+326C>A" "r.(=)" "p.(=)" "" "0000336044" "00025975" "30" "-1017" "0" "-1017" "0" "c.-1017T>C" "r.(?)" "p.(=)" "" "0000336047" "00025975" "30" "-1734" "0" "-1734" "0" "c.-1734G>C" "r.(?)" "p.(=)" "" "0000336048" "00025975" "30" "-4938" "0" "-4938" "0" "c.-4938G>A" "r.(?)" "p.(=)" "" "0000337265" "00025975" "70" "-4938" "0" "-4938" "0" "c.-4938G>T" "r.(?)" "p.(=)" "" "0000339481" "00025975" "50" "-1277" "0" "-1277" "0" "c.-1277G>C" "r.(?)" "p.(=)" "" "0000341167" "00025975" "50" "-1399" "0" "-1399" "0" "c.-1399G>T" "r.(?)" "p.(=)" "" "0000341789" "00025975" "50" "-1336" "0" "-1336" "0" "c.-1336C>T" "r.(?)" "p.(=)" "" "0000342039" "00025975" "50" "-1470" "0" "-1470" "0" "c.-1470G>A" "r.(?)" "p.(=)" "" "0000342523" "00025975" "50" "-1815" "0" "-1815" "0" "c.-1815G>A" "r.(?)" "p.(=)" "" "0000343467" "00025975" "50" "-1243" "0" "-1243" "0" "c.-1243C>T" "r.(?)" "p.(=)" "" "0000344608" "00025975" "90" "-1506" "0" "-1506" "0" "c.-1506G>A" "r.(?)" "p.(=)" "" "0000345966" "00025975" "70" "-1869" "0" "-1869" "0" "c.-1869C>T" "r.(?)" "p.(=)" "" "0000346439" "00025975" "50" "-1825" "0" "-1825" "0" "c.-1825T>C" "r.(?)" "p.(=)" "" "0000346537" "00025975" "70" "-1267" "0" "-1267" "0" "c.-1267T>G" "r.(?)" "p.(=)" "" "0000347680" "00025975" "90" "-978" "0" "-978" "0" "c.-978T>C" "r.(?)" "p.(=)" "" "0000349228" "00025975" "70" "-1270" "0" "-1270" "0" "c.-1270G>C" "r.(?)" "p.(=)" "" "0000350640" "00025975" "30" "-1185" "0" "-1185" "0" "c.-1185C>G" "r.(?)" "p.(=)" "" "0000408064" "00025975" "90" "-457" "-619705" "1186" "255141" "c.-620162_*255586dup" "r.0?" "p.0?" "" "0000438963" "00025975" "90" "332" "0" "335" "0" "c.332_335dup" "r.(?)" "p.(Ser113Alafs*6)" "" "0000574310" "00025975" "30" "713" "0" "713" "0" "c.713A>T" "r.(?)" "p.(Asp238Val)" "" "0000574311" "00025975" "30" "393" "0" "393" "0" "c.393C>T" "r.(?)" "p.(Ala131=)" "" "0000574312" "00025975" "30" "361" "0" "361" "0" "c.361A>T" "r.(?)" "p.(Thr121Ser)" "" "0000574313" "00025975" "50" "353" "0" "353" "0" "c.353G>A" "r.(?)" "p.(Arg118His)" "" "0000574314" "00025975" "50" "-12" "0" "-10" "0" "c.-12_-10del" "r.(?)" "p.(=)" "" "0000574315" "00025975" "30" "-44" "-238" "-44" "-238" "c.-44-238C>T" "r.(=)" "p.(=)" "" "0000574316" "00025975" "50" "-1008" "0" "-1008" "0" "c.-1008G>C" "r.(?)" "p.(=)" "" "0000574317" "00025975" "30" "-1015" "0" "-1015" "0" "c.-1015T>G" "r.(?)" "p.(=)" "" "0000574318" "00025975" "30" "-1015" "0" "-1015" "0" "c.-1015T>G" "r.(?)" "p.(=)" "" "0000574319" "00025975" "30" "-1015" "0" "-1015" "0" "c.-1015T>G" "r.(?)" "p.(=)" "" "0000574320" "00025975" "30" "-1015" "0" "-1015" "0" "c.-1015T>G" "r.(?)" "p.(=)" "" "0000574321" "00025975" "30" "-1274" "0" "-1274" "0" "c.-1274G>A" "r.(?)" "p.(=)" "" "0000574322" "00025975" "90" "-1314" "0" "-1314" "0" "c.-1314G>A" "r.(?)" "p.(=)" "" "0000574324" "00025975" "50" "-1369" "0" "-1369" "0" "c.-1369C>A" "r.(?)" "p.(=)" "" "0000574325" "00025975" "90" "-1431" "0" "-1431" "0" "c.-1431G>A" "r.(?)" "p.(=)" "" "0000574326" "00025975" "30" "-1451" "0" "-1451" "0" "c.-1451C>T" "r.(?)" "p.(=)" "" "0000574327" "00025975" "30" "-1452" "0" "-1452" "0" "c.-1452C>T" "r.(?)" "p.(=)" "" "0000574328" "00025975" "90" "-1636" "0" "-1636" "0" "c.-1636A>G" "r.(?)" "p.(=)" "" "0000574329" "00025975" "30" "-1684" "0" "-1684" "0" "c.-1684C>T" "r.(?)" "p.(=)" "" "0000574330" "00025975" "50" "-1873" "0" "-1873" "0" "c.-1873T>C" "r.(?)" "p.(=)" "" "0000574331" "00025975" "30" "-4927" "0" "-4927" "0" "c.-4927G>A" "r.(?)" "p.(=)" "" "0000574332" "00025975" "30" "-4927" "0" "-4927" "0" "c.-4927G>A" "r.(?)" "p.(=)" "" "0000574333" "00025975" "30" "-5089" "0" "-5089" "0" "c.-5089G>T" "r.(?)" "p.(=)" "" "0000619166" "00025975" "50" "727" "0" "727" "0" "c.727A>G" "r.(?)" "p.(Lys243Glu)" "" "0000619167" "00025975" "30" "718" "0" "718" "0" "c.718C>T" "r.(?)" "p.(Pro240Ser)" "" "0000619168" "00025975" "50" "580" "0" "580" "0" "c.580G>A" "r.(?)" "p.(Glu194Lys)" "" "0000619169" "00025975" "30" "192" "0" "192" "0" "c.192C>T" "r.(?)" "p.(Ile64=)" "" "0000619170" "00025975" "30" "92" "4" "92" "4" "c.92+4T>C" "r.spl?" "p.?" "" "0000619171" "00025975" "30" "-12" "0" "-10" "0" "c.-12_-10del" "r.(?)" "p.(=)" "" "0000619172" "00025975" "90" "-1291" "0" "-1291" "0" "c.-1291G>A" "r.(?)" "p.(=)" "" "0000619173" "00025975" "30" "-1538" "0" "-1538" "0" "c.-1538G>A" "r.(?)" "p.(=)" "" "0000624487" "00025975" "30" "-1734" "0" "-1734" "0" "c.-1734G>C" "r.(?)" "p.(=)" "" "0000659150" "00025975" "90" "415" "0" "415" "0" "c.415C>T" "r.(?)" "p.(Gln139Ter)" "" "0000659151" "00025975" "30" "384" "0" "384" "0" "c.384G>A" "r.(?)" "p.(Thr128=)" "" "0000659152" "00025975" "90" "-1542" "0" "-1542" "0" "c.-1542del" "r.(?)" "p.(=)" "" "0000670905" "00025975" "90" "92" "0" "92" "0" "c.92G>A" "r.(?)" "p.(Arg31Lys)" "" "0000682209" "00025975" "30" "-1017" "0" "-1017" "0" "c.-1017T>C" "r.(?)" "p.(=)" "" "0000682210" "00025975" "30" "-1018" "0" "-1018" "0" "c.-1018G>C" "r.(?)" "p.(=)" "" "0000682211" "00025975" "30" "-1226" "0" "-1226" "0" "c.-1226G>A" "r.(?)" "p.(=)" "" "0000682212" "00025975" "50" "-1719" "0" "-1719" "0" "c.-1719C>T" "r.(?)" "p.(=)" "" "0000693426" "00025975" "30" "-1013" "0" "-1013" "0" "c.-1013C>T" "r.(?)" "p.(=)" "" "0000693427" "00025975" "90" "-1820" "0" "-1820" "0" "c.-1820G>T" "r.(?)" "p.(=)" "" "0000697971" "00025975" "70" "137" "0" "137" "0" "c.137C>A" "r.(?)" "p.(Ser46Tyr)" "" "0000697972" "00025975" "70" "137" "0" "137" "0" "c.137C>A" "r.(?)" "p.(Ser46Tyr)" "" "0000697973" "00025975" "70" "137" "0" "137" "0" "c.137C>A" "r.(?)" "p.(Ser46Tyr)" "" "0000697974" "00025975" "70" "137" "0" "137" "0" "c.137C>A" "r.(?)" "p.(Ser46Tyr)" "" "0000698157" "00025975" "70" "47" "0" "47" "0" "c.47T>A" "r.(?)" "p.(Val16Asp)" "" "0000698230" "00025975" "90" "194" "-2" "194" "-2" "c.194-2A>G" "r.193_194ins[194-41_194-3;gg]" "p.?" "" "0000698231" "00025975" "90" "194" "-2" "194" "-2" "c.194-2A>G" "r.193_194ins[194-41_194-3;gg]" "p.?" "" "0000698232" "00025975" "90" "" "0" "" "0" "c.702+318_*445{0}" "r.?" "p.?" "" "0000698233" "00025975" "90" "" "0" "" "0" "c.702+318_*445{0}" "r.?" "p.?" "" "0000698234" "00025975" "90" "" "0" "" "0" "c.702+318_*445{0}" "r.?" "p.?" "" "0000698235" "00025975" "90" "" "0" "" "0" "c.702+318_*445{0}" "r.?" "p.?" "" "0000698236" "00025975" "90" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Gln33*)" "" "0000698237" "00025975" "90" "" "0" "" "0" "c.341+3643_*445{0}" "r.?" "p.?" "" "0000698238" "00025975" "90" "60" "0" "65" "0" "c.60_65del" "r.(?)" "p.(Leu20_Leu22delinsPhe)" "" "0000698239" "00025975" "90" "332" "0" "335" "0" "c.332_335dup" "r.(?)" "p.(Ser113Alafs*6)" "" "0000698240" "00025975" "90" "709" "0" "721" "0" "c.709_721del" "r.(?)" "p.(Val237Trpfs*69)" "" "0000698241" "00025975" "90" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Gln33*)" "" "0000698242" "00025975" "90" "92" "0" "92" "0" "c.92G>A" "r.[-44_92del,292_292ins92+1_92+110]" "p.[0,?]" "" "0000698243" "00025975" "90" "" "0" "" "0" "c.-457_*445=" "r.0" "p.0" "" "0000699287" "00025975" "70" "3" "0" "3" "0" "c.3G>C" "r.(?)" "p.0?" "" "0000699288" "00025975" "70" "92" "1" "92" "1" "c.92+1G>A" "r.spl" "p.?" "" "0000699289" "00025975" "70" "92" "1" "92" "1" "c.92+1G>A" "r.spl" "p.?" "" "0000699290" "00025975" "70" "466" "0" "466" "0" "c.466C>T" "r.(?)" "p.(Gln156*)" "" "0000699291" "00025975" "70" "365" "0" "366" "0" "c.365_366del" "r.(?)" "p.(Leu122Hisfs*12)" "" "0000699292" "00025975" "70" "445" "0" "445" "0" "c.445A>T" "r.(?)" "p.(Lys149*)" "" "0000699293" "00025975" "70" "664" "0" "664" "0" "c.664dup" "r.(?)" "p.(Glu222Glyfs*47)" "" "0000699294" "00025975" "70" "702" "1" "702" "1" "c.702+1G>A" "r.spl" "p.?" "" "0000699295" "00025975" "70" "733" "0" "736" "0" "c.733_736del" "r.(?)" "p.(Glu245Serfs*64)" "" "0000699296" "00025975" "70" "365" "0" "366" "0" "c.365_366del" "r.(?)" "p.(Leu122Hisfs*12)" "" "0000699297" "00025975" "70" "" "0" "" "0" "c.705_*4del" "r.(?)" "p.(Ala236_Glu246delinsSerPheLeuProCysLeuGlnLeuAlaSerThrTrpHisValProAlaAlaSer)" "" "0000699299" "00025975" "70" "380" "0" "383" "0" "c.380_383dup" "r.(?)" "p.(Leu129Hisfs*7)" "" "0000701794" "00025975" "70" "92" "545" "194" "-1172" "c.92+545_194-1172del" "r.(?)" "p.(Trp32Cysfs*9)" "" "0000728562" "00025975" "50" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117Lys)" "" "0000728563" "00025975" "30" "-1235" "0" "-1235" "0" "c.-1235G>A" "r.(?)" "p.(=)" "" "0000728564" "00025975" "70" "-1423" "0" "-1423" "0" "c.-1423C>T" "r.(?)" "p.(=)" "" "0000728565" "00025975" "50" "-1681" "0" "-1681" "0" "c.-1681G>A" "r.(?)" "p.(=)" "" "0000728566" "00025975" "50" "-1708" "0" "-1708" "0" "c.-1708G>A" "r.(?)" "p.(=)" "" "0000728567" "00025975" "90" "-1828" "0" "-1828" "0" "c.-1828G>T" "r.(?)" "p.(=)" "" "0000810053" "00025975" "30" "601" "10" "601" "10" "c.601+10G>A" "r.(=)" "p.(=)" "" "0000810054" "00025975" "50" "-1549" "0" "-1549" "0" "c.-1549C>T" "r.(?)" "p.(=)" "" "0000810055" "00025975" "50" "-1797" "0" "-1797" "0" "c.-1797G>A" "r.(?)" "p.(=)" "" "0000810056" "00025975" "30" "-5089" "0" "-5089" "0" "c.-5089G>A" "r.(?)" "p.(=)" "" "0000856415" "00025975" "30" "601" "9" "601" "9" "c.601+9C>T" "r.(=)" "p.(=)" "" "0000856416" "00025975" "30" "342" "0" "342" "0" "c.342C>T" "r.(?)" "p.(Phe114=)" "" "0000856417" "00025975" "50" "230" "0" "230" "0" "c.230C>T" "r.(?)" "p.(Thr77Met)" "" "0000867161" "00025975" "30" "-1093" "0" "-1093" "0" "c.-1093C>A" "r.(?)" "p.(=)" "" "0000867162" "00025975" "30" "-1235" "0" "-1235" "0" "c.-1235G>A" "r.(?)" "p.(=)" "" "0000867163" "00025975" "50" "-1684" "0" "-1684" "0" "c.-1684C>T" "r.(?)" "p.(=)" "" "0000867164" "00025975" "70" "-1773" "0" "-1773" "0" "c.-1773C>T" "r.(?)" "p.(=)" "" "0000867165" "00025975" "30" "-4933" "0" "-4933" "0" "c.-4933G>A" "r.(?)" "p.(=)" "" "0000895979" "00025975" "70" "-1857" "0" "-1857" "0" "c.-1857C>T" "r.(?)" "p.(=)" "" "0000915627" "00025975" "30" "-1416" "0" "-1416" "0" "c.-1416C>T" "r.(?)" "p.(=)" "" "0000915628" "00025975" "70" "-1677" "0" "-1677" "0" "c.-1677G>A" "r.(?)" "p.(=)" "" "0000915629" "00025975" "70" "-1677" "0" "-1677" "0" "c.-1677G>A" "r.(?)" "p.(=)" "" "0000951700" "00025975" "30" "-1015" "0" "-1015" "0" "c.-1015T>G" "r.(?)" "p.(=)" "" "0000951701" "00025975" "30" "-1251" "0" "-1251" "0" "c.-1251C>T" "r.(?)" "p.(=)" "" "0000970857" "00025975" "50" "-1243" "0" "-1243" "0" "c.-1243C>T" "r.(?)" "p.(=)" "" "0000970859" "00025975" "30" "-1734" "0" "-1734" "0" "c.-1734G>C" "r.(?)" "p.(=)" "" "0000970860" "00025975" "30" "-1872" "0" "-1872" "0" "c.-1872G>A" "r.(?)" "p.(=)" "" "0001006524" "00025975" "50" "-1155" "0" "-1155" "0" "c.-1155C>G" "r.(?)" "p.(=)" "" "0001006525" "00025975" "30" "-1333" "0" "-1333" "0" "c.-1333G>A" "r.(?)" "p.(=)" "" "0001006526" "00025975" "50" "-1873" "0" "-1873" "0" "c.-1873T>C" "r.(?)" "p.(=)" "" "0001015996" "00025975" "30" "384" "0" "384" "0" "c.384G>A" "r.(?)" "p.(Thr128=)" "" "0001044183" "00025975" "30" "-1673" "0" "-1673" "0" "c.-1673C>A" "r.(?)" "p.(=)" "" "0001067808" "00025975" "50" "-1725" "0" "-1725" "0" "c.-1725C>T" "r.(?)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 37 "{{screeningid}}" "{{variantid}}" "0000000209" "0000008013" "0000000210" "0000015980" "0000184095" "0000408064" "0000208928" "0000438963" "0000307008" "0000670905" "0000315869" "0000697971" "0000315870" "0000697972" "0000315871" "0000697973" "0000315872" "0000697974" "0000316031" "0000698157" "0000316091" "0000698230" "0000316092" "0000698231" "0000316093" "0000698232" "0000316094" "0000698233" "0000316095" "0000698234" "0000316096" "0000698235" "0000316097" "0000698236" "0000316098" "0000698237" "0000316099" "0000698238" "0000316100" "0000698239" "0000316101" "0000698240" "0000316102" "0000698241" "0000316103" "0000698242" "0000316103" "0000698243" "0000317104" "0000699287" "0000317105" "0000699288" "0000317106" "0000699289" "0000317107" "0000699290" "0000317108" "0000699291" "0000317109" "0000699292" "0000317110" "0000699293" "0000317111" "0000699294" "0000317112" "0000699295" "0000317113" "0000699296" "0000317114" "0000699297" "0000317116" "0000699299" "0000319149" "0000701794"