### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = CACNA1B)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"CACNA1B"	"calcium channel, voltage-dependent, N type, alpha 1B subunit"	"9"	"q34"	"unknown"	"NC_000009.11"	"UD_134753577841"	""	"http://www.LOVD.nl/CACNA1B"	""	"1"	"1389"	"774"	"601012"	"1"	"1"	"1"	"1"	""	""	"g"	"http://databases.lovd.nl/shared/refseq/CACNA1B_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00000"	"2012-09-13 00:00:00"	"00006"	"2015-01-24 17:48:11"	"00000"	"2026-01-20 18:57:21"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00001375"	"CACNA1B"	"transcript variant 1"	"001"	"NM_000718.3"	""	"NP_000709.1"	""	""	""	"-145"	"9645"	"7020"	"140772241"	"141019076"	"00000"	"2012-09-13 13:29:42"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 8
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00128"	"CF"	"cystic fibrosis (CF)"	"AR"	"219700"	""	""	""	"00006"	"2013-05-14 09:22:43"	"00006"	"2021-12-10 21:51:32"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00668"	"KLEFS"	"Kleefstra syndrome (KLEFS)"	""	""	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"01157"	"CHTE"	"Hypothyroidism, central, testicular enlargement (CHTE)"	"XLR"	"300888"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"01451"	"DYT11"	"dystonia, myoclonic, type 11 (DYT11)"	"AD"	"159900"	""	"myoclonic jerks affecting mostly proximal muscles; dystonia, usually torticollis or writer\'s cramp, observed in most patients, occasionally the only symptom; onset usually first or second decade; symptoms often respond to alcohol, patients may have psychiatric abnormalities"	"maternal inheritance most without clinical symptoms"	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"04389"	"DYT23"	"dystonia?, type 23 (DYT-23)"	""	"614860"	""	""	""	"00000"	"2015-09-23 10:25:22"	"00006"	"2021-12-10 21:51:32"
"05611"	"NDD"	"neurodevelopmental disorder (NDD)"	""	""	""	""	""	"00006"	"2019-06-19 12:27:20"	"00006"	"2024-12-13 11:12:21"
"06831"	"NEDNEH"	"Neurodevelopmental disorder with seizures and nonepileptic hyperkinetic movements"	"AR"	"618497"	""	""	""	"00006"	"2021-12-10 23:20:41"	""	""


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}"	"{{diseaseid}}"
"CACNA1B"	"04389"
"CACNA1B"	"06831"


## Individuals ## Do not remove or alter this header ##
## Count = 9
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00000208"	""	""	""	"1"	""	"00037"	"{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}"	""	"M"	"no"	"Netherlands"	""	"0"	""	""	""	""
"00029649"	""	""	""	"5"	""	"00006"	"{PMID:Groen 2015:25296916}"	"4-generation famil, 5 affecteds (4F, 1M)"	""	"no"	"Netherlands"	""	"0"	""	""	""	""
"00052115"	""	""	""	"1"	""	"00006"	"{PMID:Kleefstra 2006:16826528}, {PMID:Kleefstra 2006:10.1086/505693}"	""	""	""	"(Netherlands)"	""	"0"	""	""	""	""
"00052123"	""	""	""	"1"	""	"00006"	"{PMID:Kleefstra 2009:19264732}, {PMID:Kleefstra 2009:10.1136/jmg.2008.062950}"	""	"M"	""	""	""	"0"	""	""	""	""
"00296397"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00303374"	""	""	""	"1"	""	"01164"	""	""	"M"	""	""	""	"0"	""	""	""	""
"00309663"	""	""	""	"1"	""	"01164"	""	""	"M"	""	""	""	"0"	""	""	""	""
"00418593"	""	""	""	"4"	""	"00006"	"{PMID:Bertoli-Avella 2022:34952832}"	"4-generation family, 4 affected (3F, M), unaffected heterozygous carrier parents/relatives"	"F"	"yes"	"Oman"	""	"0"	""	""	""	"Fam1PatIV1"
"00428193"	""	""	""	"1"	""	"00006"	"Wiel 2023, {DOI:Wiel 2023:10.1016/j.ajhg.2022.12.001}"	""	""	""	""	""	"0"	""	""	""	""


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 9
"{{individualid}}"	"{{diseaseid}}"
"00000208"	"01157"
"00029649"	"01451"
"00052115"	"00668"
"00052123"	"00668"
"00296397"	"00198"
"00303374"	"00198"
"00309663"	"00198"
"00418593"	"00128"
"00428193"	"05611"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00128, 00198, 00668, 01157, 01451, 04389, 05611, 06831
## Count = 8
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Birth/Gestational_age_wk}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Intellectual_dis/HPO_0001249}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000025672"	"01451"	"00029649"	"00006"	"Familial, autosomal dominant"	""	"see paper; cervical/axial dystonia at\r\nrest, writer’s cramp, action-induced foot dystonia with walking, myoclonic jerks legs/arms, increasing with action, positive effect of alcohol on jerks, complaints of hyperventilation or panic attacks; high-frequency continuous myoclonus legs while standing, causing unsteadiness; 3/5 cases cardiac arrhythmias, attacks of painful cramps upper/lower limbs"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000038734"	"00668"	"00052115"	"00006"	"Isolated (sporadic)"	"36y"	"9q subtelomeric deletion syndrome; obesity, no microcephaly, brachycephaly, flat face, midface hypoplasia, coarse facies, hypertelorism, synophrys, no downslant palpebral fissures, upslant palpebral fissures, no arched eyebrows, short nose, anteverted nostrils, no carp mouth/tented lip, macroglossia/tongue protrusion, no natal teeth, thick/everted lower lip, pointed chin/prognathism, malformed ears, brachydactyly, no simian crease, normal genitals, no cardiac anomaly, no anal atresia, no alopecia, no depigmentation, no renal cysts, no hydronephrosis, behavioral problems, no sleep disturbances, no hearing loss, hypotonia, seizures"	""	""	""	""	""	""	"severe"	""	""	""	""	""	""
"0000038742"	"00668"	"00052123"	"00006"	"Isolated (sporadic)"	"04y"	"9q subtelomeric deletion syndrome; childhood hypotonia, facial dysmorphism; ventricular septum defect aortic coarctation, no epilepsy, micropenis, cryptorchidism, vesico-ureteral reflux, hearing loss inguinal, peri-umbilical and epigastric hernia, MRI-mildly dilated ventricles, reduction in white matter volume; frustration and tantrums; severely delayed; speech only few words, uses signing and picture cards"	""	"weight 3200 (25th), OFC 33cm (2nd)"	""	""	""	""	""	""	""	""	""	""	""
"0000038983"	"01157"	"00000208"	"00006"	"Familial, X-linked recessive"	""	"central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)"	""	""	"3w"	""	""	""	""	""	""	""	""	""	""
"0000223811"	"00198"	"00296397"	"01164"	"Unknown"	""	"Abnormality of nervous system physiology (HP:0012638); Dystonia (HP:0001332); Tremor (HP:0001337); Head tremor (HP:0002346); Hand tremor (HP:0002378); Torticollis (HP:0000473)"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000230450"	"00198"	"00303374"	"01164"	"Unknown"	""	"Morphological abnormality of the gastrointestinal tract (HP:0012718); Memory impairment (HP:0002354); Intellectual disability (HP:0001249)"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000234982"	"00198"	"00309663"	"01164"	"Unknown"	""	"Choreoathetosis (HP:0001266); Abnormality of movement (HP:0100022)"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000309929"	"00128"	"00418593"	"00006"	"Familial, autosomal recessive"	""	"failure to thrive, weight below 5th percentile; no dysmorphism; normal motor development; normal mental development; no neurological abnormalities; recurrent lower respiratory tract infections; chronic coughing, exertional dyspnea, basal crackles, bronchial wall thickening, hilar lymphadenopathy mild bronchiectasis, fibrotic bands; no immunological abnormalities; no gastroenteric abnormalities; no cardiovascular abnormalities, ECG normal"	"14d"	""	""	""	""	""	""	""	""	""	""	"cystic fibrosis, primary ciliary dyskinesia"	""


## Screenings ## Do not remove or alter this header ##
## Count = 9
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000000209"	"00000208"	"1"	"00037"	"00001"	"2012-09-13 12:02:03"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000029692"	"00029649"	"1"	"00006"	"00006"	"2015-01-24 17:58:59"	"00006"	"2015-01-24 18:35:12"	"SEQ;SEQ-NG"	"DNA"	""	""
"0000052063"	"00052115"	"1"	"00006"	"00006"	"2015-10-16 10:20:45"	""	""	"FISH;MLPA;PCR"	"DNA"	""	""
"0000052071"	"00052123"	"1"	"00006"	"00006"	"2015-10-16 12:32:42"	""	""	"MLPA"	"DNA"	""	""
"0000297508"	"00296397"	"1"	"01164"	"01164"	"2020-04-06 09:48:14"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000304500"	"00303374"	"1"	"01164"	"01164"	"2020-06-11 10:24:01"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000310808"	"00309663"	"1"	"01164"	"01164"	"2020-08-31 11:16:01"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000419888"	"00418593"	"1"	"00006"	"00006"	"2022-10-01 10:38:21"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000429604"	"00428193"	"1"	"00006"	"00006"	"2022-12-23 14:15:36"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 6
"{{screeningid}}"	"{{geneid}}"
"0000029692"	"CACNA1B"
"0000029692"	"SPTAN1"
"0000029692"	"VPS13D"
"0000052063"	"CACNA1B"
"0000052063"	"EHMT1"
"0000052071"	"EHMT1"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 160
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000004787"	"3"	"50"	"9"	"141016262"	"141016262"	"subst"	"0.900392"	"00037"	"CACNA1B_000001"	"g.141016262T>G"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.138121810T>G"	""	"VUS"	""
"0000053074"	"1"	"90"	"9"	"140952560"	"140952560"	"subst"	"0.000422335"	"00006"	"CACNA1B_000002"	"g.140952560G>A"	""	"{PMID:Groen 2015:25296916}"	""	""	"not in 1520 control chromosomes; mapped by linkage"	"Germline"	"yes"	"rs184841813"	"0"	""	""	"g.138058108G>A"	""	"pathogenic"	""
"0000053077"	"0"	"90"	"9"	"140952560"	"140952560"	"subst"	"0.000422335"	"00006"	"CACNA1B_000002"	"g.140952560G>A"	""	"{PMID:Groen 2015:25296916}"	""	""	"tsA201 cell line expression cloning; unaltered ion selectivity, voltage-dependent activation/voltage-dependent inactivation; single-channel patch recordings showed open CaV2.2 channels carriy less current"	"In vitro (cloned)"	"-"	""	"0"	""	""	"g.138058108G>A"	""	"NA"	""
"0000081503"	"0"	"90"	"9"	"140500096"	"140811883"	""	"0"	"00006"	"EHMT1_000000"	"g.(140484665_140500096)_(140811883_140852139)del"	"1/23 cases"	"{PMID:Kleefstra 2006:16826528}, {PMID:Kleefstra 2006:10.1086/505693}"	""	""	"380kb deletion incl. ARRDC1, C9ORF37, EHMT1 and AK128414 (not deleted ZMYND19-ex1, CACNA1B-ex11)"	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000081511"	"0"	"90"	"9"	"137970000"	"141020000"	""	"0"	"00006"	"EHMT1_000000"	"g.(?_137970000)_(141020000_141040000)del"	""	"{PMID:Kleefstra 2009:19264732}, {PMID:Kleefstra 2009:10.1136/jmg.2008.062950}"	""	""	"3.1Mb deletion from OLFM1 to CACNA1B"	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000249381"	"0"	"30"	"9"	"140870366"	"140870366"	"subst"	"0.00026474"	"02325"	"CACNA1B_000014"	"g.140870366A>G"	""	""	""	"CACNA1B(NM_000718.4):c.1551A>G (p.A517=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137975914A>G"	""	"likely benign"	""
"0000249429"	"0"	"30"	"9"	"141016441"	"141016441"	"subst"	"0.00192676"	"02325"	"CACNA1B_000035"	"g.141016441A>G"	""	""	""	"CACNA1B(NM_000718.4):c.7010A>G (p.H2337R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138121989A>G"	""	"likely benign"	""
"0000249448"	"0"	"30"	"9"	"140772650"	"140772650"	"subst"	"0"	"02325"	"CACNA1B_000003"	"g.140772650A>G"	""	""	""	"CACNA1B(NM_000718.4):c.265A>G (p.K89E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137878198A>G"	""	"likely benign"	""
"0000249794"	"0"	"50"	"9"	"141013123"	"141013123"	"subst"	"0"	"02325"	"CACNA1B_000028"	"g.141013123A>G"	""	""	""	"CACNA1B(NM_000718.4):c.5933A>G (p.Q1978R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138118671A>G"	""	"VUS"	""
"0000254462"	"0"	"30"	"9"	"140852095"	"140852095"	"subst"	"3.45764E-5"	"01943"	"CACNA1B_000011"	"g.140852095A>G"	""	""	""	"CACNA1B(NM_000718.3):c.1289A>G (p.H430R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137957643A>G"	""	"likely benign"	""
"0000266400"	"0"	"10"	"9"	"140846813"	"140846813"	"subst"	"0.00115335"	"02325"	"CACNA1B_000009"	"g.140846813C>T"	""	""	""	"CACNA1B(NM_000718.4):c.1054C>T (p.L352=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137952361C>T"	""	"benign"	""
"0000266401"	"0"	"30"	"9"	"140850264"	"140850264"	"subst"	"0"	"02325"	"CACNA1B_000010"	"g.140850264G>A"	""	""	""	"CACNA1B(NM_000718.4):c.1185G>A (p.A395=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137955812G>A"	""	"likely benign"	""
"0000266402"	"0"	"50"	"9"	"140865949"	"140865949"	"subst"	"0"	"02325"	"CACNA1B_000012"	"g.140865949G>A"	""	""	""	"CACNA1B(NM_000718.4):c.1448G>A (p.S483N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137971497G>A"	""	"VUS"	""
"0000266403"	"0"	"50"	"9"	"140865972"	"140865972"	"subst"	"2.03487E-5"	"02325"	"CACNA1B_000013"	"g.140865972G>A"	""	""	""	"CACNA1B(NM_000718.3):c.1471G>A (p.(Val491Met)), CACNA1B(NM_000718.4):c.1471G>A (p.V491M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137971520G>A"	""	"VUS"	""
"0000266404"	"0"	"30"	"9"	"140878715"	"140878715"	"subst"	"0.000115775"	"02325"	"CACNA1B_000016"	"g.140878715C>T"	""	""	""	"CACNA1B(NM_000718.4):c.1769+13C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137984263C>T"	""	"likely benign"	""
"0000266405"	"0"	"30"	"9"	"140904458"	"140904458"	"subst"	"0.00560916"	"02325"	"CACNA1B_000017"	"g.140904458C>A"	""	""	""	"CACNA1B(NM_000718.3):c.2093-4C>A (p.?), CACNA1B(NM_000718.4):c.2093-4C>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138010006C>A"	""	"likely benign"	""
"0000266406"	"0"	"50"	"9"	"140917580"	"140917580"	"subst"	"6.96789E-5"	"02325"	"CACNA1B_000018"	"g.140917580G>C"	""	""	""	"CACNA1B(NM_000718.4):c.2385G>C (p.E795D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138023128G>C"	""	"VUS"	""
"0000266407"	"0"	"10"	"9"	"140918120"	"140918120"	"subst"	"0.00667418"	"02325"	"CACNA1B_000020"	"g.140918120G>C"	""	""	""	"CACNA1B(NM_000718.4):c.2925G>C (p.P975=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138023668G>C"	""	"benign"	""
"0000266408"	"0"	"30"	"9"	"140772415"	"140772415"	"subst"	"0"	"02325"	"CACNA1B_000037"	"g.140772415C>T"	""	""	""	"CACNA1B(NM_000718.3):c.30C>T (p.G10=), CACNA1B(NM_000718.4):c.30C>T (p.G10=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137877963C>T"	""	"likely benign"	""
"0000266409"	"0"	"30"	"9"	"140919617"	"140919617"	"subst"	"8.5681E-5"	"02325"	"CACNA1B_000021"	"g.140919617C>G"	""	""	""	"CACNA1B(NM_000718.4):c.3279C>G (p.V1093=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138025165C>G"	""	"likely benign"	""
"0000266410"	"0"	"30"	"9"	"140952606"	"140952606"	"subst"	"0.000905562"	"02325"	"CACNA1B_000022"	"g.140952606C>T"	""	""	""	"CACNA1B(NM_000718.3):c.4212C>T (p.P1404=), CACNA1B(NM_000718.4):c.4212C>T (p.P1404=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138058154C>T"	""	"likely benign"	""
"0000266411"	"0"	"10"	"9"	"140952712"	"140952712"	"subst"	"0.00267136"	"02325"	"CACNA1B_000023"	"g.140952712C>T"	""	""	""	"CACNA1B(NM_000718.3):c.4308+10C>T, CACNA1B(NM_000718.4):c.4308+10C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138058260C>T"	""	"benign"	""
"0000266412"	"0"	"30"	"9"	"140953202"	"140953202"	"subst"	"0.00205575"	"02325"	"CACNA1B_000024"	"g.140953202G>A"	""	""	""	"CACNA1B(NM_000718.4):c.4473+17G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138058750G>A"	""	"likely benign"	""
"0000266413"	"0"	"30"	"9"	"140968509"	"140968509"	"subst"	"0.00289559"	"02325"	"CACNA1B_000025"	"g.140968509C>T"	""	""	""	"CACNA1B(NM_000718.3):c.4848C>T (p.I1616=), CACNA1B(NM_000718.4):c.4848C>T (p.I1616=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138074057C>T"	""	"likely benign"	""
"0000266414"	"0"	"30"	"9"	"140972575"	"140972575"	"subst"	"0.000585952"	"02325"	"CACNA1B_000026"	"g.140972575G>A"	""	""	""	"CACNA1B(NM_000718.3):c.4959G>A (p.T1653=), CACNA1B(NM_000718.4):c.4959G>A (p.T1653=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138078123G>A"	""	"likely benign"	""
"0000266415"	"0"	"10"	"9"	"140777306"	"140777306"	"subst"	"0"	"02325"	"CACNA1B_000005"	"g.140777306C>G"	""	""	""	"CACNA1B(NM_000718.4):c.501C>G (p.(Asn167Lys), p.N167K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137882854C>G"	""	"benign"	""
"0000266416"	"0"	"30"	"9"	"141006875"	"141006875"	"subst"	"4.4673E-5"	"02325"	"CACNA1B_000027"	"g.141006875C>T"	""	""	""	"CACNA1B(NM_000718.4):c.5454C>T (p.D1818=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138112423C>T"	""	"likely benign"	""
"0000266417"	"0"	"50"	"9"	"141014762"	"141014762"	"subst"	"0"	"02325"	"CACNA1B_000029"	"g.141014762G>T"	""	""	""	"CACNA1B(NM_000718.4):c.6176G>T (p.R2059L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138120310G>T"	""	"VUS"	""
"0000266418"	"0"	"30"	"9"	"141014778"	"141014778"	"subst"	"0.00041445"	"02325"	"CACNA1B_000030"	"g.141014778G>A"	""	""	""	"CACNA1B(NM_000718.4):c.6192G>A (p.(Gln2064=), p.Q2064=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138120326G>A"	""	"likely benign"	""
"0000266419"	"0"	"50"	"9"	"141015210"	"141015210"	"subst"	"0.000197241"	"02325"	"CACNA1B_000031"	"g.141015210G>A"	""	""	""	"CACNA1B(NM_000718.4):c.6366G>A (p.S2122=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138120758G>A"	""	"VUS"	""
"0000266420"	"0"	"50"	"9"	"141015253"	"141015253"	"subst"	"1.90239E-5"	"02325"	"CACNA1B_000032"	"g.141015253G>A"	""	""	""	"CACNA1B(NM_000718.4):c.6409G>A (p.E2137K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138120801G>A"	""	"VUS"	""
"0000266421"	"0"	"30"	"9"	"141016155"	"141016155"	"subst"	"0.000871392"	"02325"	"CACNA1B_000033"	"g.141016155G>C"	""	""	""	"CACNA1B(NM_000718.4):c.6724G>C (p.D2242H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138121703G>C"	""	"likely benign"	""
"0000266422"	"0"	"50"	"9"	"140772464"	"140772464"	"subst"	"0"	"02325"	"CACNA1B_000038"	"g.140772464G>T"	""	""	""	"CACNA1B(NM_000718.3):c.79G>T (p.G27C), CACNA1B(NM_000718.4):c.79G>T (p.G27C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137878012G>T"	""	"VUS"	""
"0000266423"	"0"	"30"	"9"	"140811748"	"140811748"	"subst"	"0.000536817"	"02325"	"CACNA1B_000006"	"g.140811748C>T"	""	""	""	"CACNA1B(NM_000718.4):c.831C>T (p.C277=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137917296C>T"	""	"likely benign"	""
"0000266424"	"0"	"10"	"9"	"140772477"	"140772477"	"subst"	"0"	"02325"	"CACNA1B_000039"	"g.140772477G>T"	""	""	""	"CACNA1B(NM_000718.4):c.92G>T (p.G31V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137878025G>T"	""	"benign"	""
"0000266425"	"0"	"30"	"9"	"140846715"	"140846715"	"subst"	"0.00975645"	"02325"	"CACNA1B_000008"	"g.140846715C>G"	""	""	""	"CACNA1B(NM_000718.4):c.967-11C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137952263C>G"	""	"likely benign"	""
"0000266426"	"0"	"10"	"9"	"140846706"	"140846706"	"subst"	"0.00195835"	"02325"	"CACNA1B_000007"	"g.140846706C>T"	""	""	""	"CACNA1B(NM_000718.4):c.967-20C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137952254C>T"	""	"benign"	""
"0000266427"	"0"	"30"	"9"	"140772484"	"140772484"	"subst"	"0"	"02325"	"CACNA1B_000040"	"g.140772484T>G"	""	""	""	"CACNA1B(NM_000718.4):c.99T>G (p.G33=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137878032T>G"	""	"likely benign"	""
"0000272446"	"0"	"50"	"9"	"140870443"	"140870443"	"subst"	"0"	"01943"	"CACNA1B_000015"	"g.140870443G>C"	""	""	""	"CACNA1B(NM_000718.3):c.1628G>C (p.R543P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137975991G>C"	""	"VUS"	""
"0000272447"	"0"	"30"	"9"	"140772403"	"140772403"	"subst"	"0"	"01943"	"CACNA1B_000036"	"g.140772403C>T"	""	""	""	"CACNA1B(NM_000718.3):c.18C>T (p.D6=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137877951C>T"	""	"likely benign"	""
"0000272448"	"0"	"30"	"9"	"140772670"	"140772672"	"del"	"0"	"01943"	"CACNA1B_000004"	"g.140772670_140772672del"	""	""	""	"CACNA1B(NM_000718.3):c.284+1_284+3delATA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137878218_137878220del"	""	"likely benign"	""
"0000272449"	"0"	"50"	"9"	"140918119"	"140918119"	"subst"	"4.03088E-5"	"01943"	"CACNA1B_000019"	"g.140918119C>A"	""	""	""	"CACNA1B(NM_000718.3):c.2924C>A (p.P975Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138023667C>A"	""	"VUS"	""
"0000272450"	"0"	"30"	"9"	"140772415"	"140772415"	"subst"	"0"	"01943"	"CACNA1B_000037"	"g.140772415C>T"	""	""	""	"CACNA1B(NM_000718.3):c.30C>T (p.G10=), CACNA1B(NM_000718.4):c.30C>T (p.G10=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.137877963C>T"	""	"likely benign"	""
"0000272451"	"0"	"30"	"9"	"140952606"	"140952606"	"subst"	"0.000905562"	"01943"	"CACNA1B_000022"	"g.140952606C>T"	""	""	""	"CACNA1B(NM_000718.3):c.4212C>T (p.P1404=), CACNA1B(NM_000718.4):c.4212C>T (p.P1404=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138058154C>T"	""	"likely benign"	""
"0000272452"	"0"	"10"	"9"	"140952712"	"140952712"	"subst"	"0.00267136"	"01943"	"CACNA1B_000023"	"g.140952712C>T"	""	""	""	"CACNA1B(NM_000718.3):c.4308+10C>T, CACNA1B(NM_000718.4):c.4308+10C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138058260C>T"	""	"benign"	""
"0000272453"	"0"	"50"	"9"	"141016320"	"141016320"	"subst"	"0.00171198"	"01943"	"CACNA1B_000034"	"g.141016320G>A"	""	""	""	"CACNA1B(NM_000718.3):c.6889G>A (p.V2297M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.138121868G>A"	""	"VUS"	""
"0000537641"	"0"	"50"	"9"	"140772464"	"140772464"	"subst"	"0"	"01943"	"CACNA1B_000038"	"g.140772464G>T"	""	""	""	"CACNA1B(NM_000718.3):c.79G>T (p.G27C), CACNA1B(NM_000718.4):c.79G>T (p.G27C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137878012G>T"	""	"VUS"	""
"0000537642"	"0"	"50"	"9"	"140772477"	"140772477"	"subst"	"0"	"02325"	"CACNA1B_000041"	"g.140772477G>A"	""	""	""	"CACNA1B(NM_000718.4):c.92G>A (p.G31D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137878025G>A"	""	"VUS"	""
"0000537643"	"0"	"30"	"9"	"140772551"	"140772571"	"dup"	"0"	"02325"	"CACNA1B_000042"	"g.140772551_140772571dup"	""	""	""	"CACNA1B(NM_000718.3):c.166_186dupATGGCGCTGTACAACCCCATC (p.(Met56_Ile62dup)), CACNA1B(NM_000718.4):c.166_186dupATGGCGCTGTACAACCCCATC (p.M56_I62dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137878099_137878119dup"	""	"likely benign"	""
"0000537644"	"0"	"50"	"9"	"140772613"	"140772613"	"subst"	"0"	"01943"	"CACNA1B_000043"	"g.140772613C>G"	""	""	""	"CACNA1B(NM_000718.3):c.228C>G (p.F76L), CACNA1B(NM_000718.4):c.228C>G (p.F76L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137878161C>G"	""	"VUS"	""
"0000537645"	"0"	"10"	"9"	"140772613"	"140772613"	"subst"	"0"	"02325"	"CACNA1B_000043"	"g.140772613C>G"	""	""	""	"CACNA1B(NM_000718.3):c.228C>G (p.F76L), CACNA1B(NM_000718.4):c.228C>G (p.F76L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137878161C>G"	""	"benign"	""
"0000537648"	"0"	"10"	"9"	"140773612"	"140773613"	"ins"	"0"	"02325"	"CACNA1B_000045"	"g.140773612_140773613insACGACACGGAGCCCTATTTCATCGGGATCTTTTGCTTCGAGGCAGGGATCAAAATCATCGCTCTGGGCTT"	""	""	""	"CACNA1B(NM_000718.4):c.390+1_390+2ins70"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137879160_137879161insACGACACGGAGCCCTATTTCATCGGGATCTTTTGCTTCGAGGCAGGGATCAAAATCATCGCTCTGGGCTT"	""	"benign"	""
"0000537649"	"0"	"30"	"9"	"140777204"	"140777204"	"subst"	"1.21825E-5"	"01943"	"CACNA1B_000046"	"g.140777204G>A"	""	""	""	"CACNA1B(NM_000718.3):c.399G>A (p.T133=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137882752G>A"	""	"likely benign"	""
"0000537650"	"0"	"30"	"9"	"140777324"	"140777324"	"subst"	"0.000203057"	"01943"	"CACNA1B_000047"	"g.140777324C>T"	""	""	""	"CACNA1B(NM_000718.3):c.519C>T (p.V173=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137882872C>T"	""	"likely benign"	""
"0000537651"	"0"	"30"	"9"	"140846718"	"140846718"	"subst"	"0.00303008"	"01943"	"CACNA1B_000048"	"g.140846718G>A"	""	""	""	"CACNA1B(NM_000718.3):c.967-8G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137952266G>A"	""	"likely benign"	""
"0000537652"	"0"	"30"	"9"	"140850143"	"140850143"	"subst"	"0"	"01943"	"CACNA1B_000049"	"g.140850143A>G"	""	""	""	"CACNA1B(NM_000718.3):c.1071-7A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137955691A>G"	""	"likely benign"	""
"0000537653"	"0"	"50"	"9"	"140850222"	"140850222"	"subst"	"0"	"02325"	"CACNA1B_000050"	"g.140850222C>G"	""	""	""	"CACNA1B(NM_000718.4):c.1143C>G (p.I381M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137955770C>G"	""	"VUS"	""
"0000537654"	"0"	"30"	"9"	"140850261"	"140850261"	"subst"	"0"	"01943"	"CACNA1B_000051"	"g.140850261G>A"	""	""	""	"CACNA1B(NM_000718.3):c.1182G>A (p.K394=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137955809G>A"	""	"likely benign"	""
"0000537655"	"0"	"50"	"9"	"140866021"	"140866021"	"subst"	"4.09336E-6"	"02325"	"CACNA1B_000052"	"g.140866021C>T"	""	""	""	"CACNA1B(NM_000718.4):c.1520C>T (p.P507L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137971569C>T"	""	"VUS"	""
"0000537656"	"0"	"70"	"9"	"140870473"	"140870473"	"subst"	"0"	"01943"	"CACNA1B_000053"	"g.140870473T>C"	""	""	""	"CACNA1B(NM_000718.3):c.1656+2T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.137976021T>C"	""	"likely pathogenic"	""
"0000537657"	"0"	"30"	"9"	"140917781"	"140917781"	"subst"	"0"	"01943"	"CACNA1B_000054"	"g.140917781G>A"	""	""	""	"CACNA1B(NM_000718.3):c.2586G>A (p.A862=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138023329G>A"	""	"likely benign"	""
"0000537658"	"0"	"50"	"9"	"140917858"	"140917863"	"dup"	"0"	"01943"	"CACNA1B_000055"	"g.140917858_140917863dup"	""	""	""	"CACNA1B(NM_000718.3):c.2663_2668dupCGCACC (p.P888_H889dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138023406_138023411dup"	""	"VUS"	""
"0000537659"	"0"	"10"	"9"	"140918081"	"140918081"	"subst"	"0.000275841"	"01943"	"CACNA1B_000056"	"g.140918081C>A"	""	""	""	"CACNA1B(NM_000718.3):c.2886C>A (p.P962=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138023629C>A"	""	"benign"	""
"0000537660"	"0"	"10"	"9"	"140918181"	"140918195"	"del"	"0.21561"	"02325"	"CACNA1B_000057"	"g.140918181_140918195del"	""	""	""	"CACNA1B(NM_000718.4):c.2986_3000delACCACGGAGAAGGAG (p.T996_E1000del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138023729_138023743del"	""	"benign"	""
"0000537661"	"0"	"10"	"9"	"140919617"	"140919617"	"subst"	"0.0009939"	"01943"	"CACNA1B_000058"	"g.140919617C>T"	""	""	""	"CACNA1B(NM_000718.3):c.3279C>T (p.V1093=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138025165C>T"	""	"benign"	""
"0000537662"	"0"	"30"	"9"	"140941398"	"140941398"	"subst"	"8.13279E-6"	"02325"	"CACNA1B_000059"	"g.140941398C>T"	""	""	""	"CACNA1B(NM_000718.4):c.3456C>T (p.F1152=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138046946C>T"	""	"likely benign"	""
"0000537663"	"0"	"30"	"9"	"140952259"	"140952259"	"subst"	"0.000167264"	"01943"	"CACNA1B_000060"	"g.140952259C>T"	""	""	""	"CACNA1B(NM_000718.3):c.4044C>T (p.Y1348=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138057807C>T"	""	"likely benign"	""
"0000537664"	"0"	"50"	"9"	"140968504"	"140968504"	"subst"	"0"	"01943"	"CACNA1B_000061"	"g.140968504A>G"	""	""	""	"CACNA1B(NM_000718.3):c.4843A>G (p.I1615V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138074052A>G"	""	"VUS"	""
"0000537665"	"0"	"30"	"9"	"140968509"	"140968509"	"subst"	"0.00289559"	"01943"	"CACNA1B_000025"	"g.140968509C>T"	""	""	""	"CACNA1B(NM_000718.3):c.4848C>T (p.I1616=), CACNA1B(NM_000718.4):c.4848C>T (p.I1616=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138074057C>T"	""	"likely benign"	""
"0000537666"	"0"	"30"	"9"	"140972578"	"140972578"	"subst"	"9.35309E-5"	"02325"	"CACNA1B_000062"	"g.140972578G>A"	""	""	""	"CACNA1B(NM_000718.4):c.4962G>A (p.G1654=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138078126G>A"	""	"likely benign"	""
"0000537667"	"0"	"30"	"9"	"140991002"	"140991002"	"subst"	"3.66071E-5"	"01943"	"CACNA1B_000063"	"g.140991002C>T"	""	""	""	"CACNA1B(NM_000718.3):c.5161C>T (p.L1721=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138096550C>T"	""	"likely benign"	""
"0000537668"	"0"	"30"	"9"	"141014681"	"141014681"	"subst"	"0.000291888"	"01943"	"CACNA1B_000064"	"g.141014681C>G"	""	""	""	"CACNA1B(NM_000718.3):c.6095C>G (p.T2032S), CACNA1B(NM_000718.4):c.6095C>G (p.T2032S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138120229C>G"	""	"likely benign"	""
"0000537669"	"0"	"30"	"9"	"141014733"	"141014733"	"subst"	"0.000756004"	"01943"	"CACNA1B_000065"	"g.141014733G>A"	""	""	""	"CACNA1B(NM_000718.3):c.6147G>A (p.S2049=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138120281G>A"	""	"likely benign"	""
"0000537670"	"0"	"30"	"9"	"141015126"	"141015126"	"subst"	"8.70944E-6"	"01943"	"CACNA1B_000066"	"g.141015126G>A"	""	""	""	"CACNA1B(NM_000718.3):c.6282G>A (p.G2094=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138120674G>A"	""	"likely benign"	""
"0000612042"	"0"	"30"	"9"	"140938277"	"140938277"	"subst"	"0.000332998"	"01943"	"CACNA1B_000068"	"g.140938277C>T"	""	""	""	"CACNA1B(NM_000718.3):c.3338C>T (p.A1113V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138043825C>T"	""	"likely benign"	""
"0000612043"	"0"	"50"	"9"	"141015982"	"141015982"	"subst"	"5.42211E-5"	"01943"	"CACNA1B_000070"	"g.141015982G>A"	""	""	""	"CACNA1B(NM_000718.3):c.6551G>A (p.R2184H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138121530G>A"	""	"VUS"	""
"0000612044"	"0"	"30"	"9"	"141016140"	"141016140"	"subst"	"0.000199537"	"01943"	"CACNA1B_000071"	"g.141016140G>A"	""	""	""	"CACNA1B(NM_000718.3):c.6709G>A (p.A2237T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138121688G>A"	""	"likely benign"	""
"0000612045"	"0"	"50"	"9"	"141016381"	"141016381"	"subst"	"6.18955E-5"	"02325"	"CACNA1B_000072"	"g.141016381C>T"	""	""	""	"CACNA1B(NM_000718.4):c.6950C>T (p.T2317I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138121929C>T"	""	"VUS"	""
"0000622240"	"0"	"30"	"9"	"140919416"	"140919416"	"subst"	"0"	"01943"	"CACNA1B_000067"	"g.140919416C>G"	""	""	""	"CACNA1B(NM_000718.3):c.3078C>G (p.H1026Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138024964C>G"	""	"likely benign"	""
"0000622241"	"0"	"50"	"9"	"140953085"	"140953085"	"subst"	"0.000162534"	"01943"	"CACNA1B_000069"	"g.140953085A>C"	""	""	""	"CACNA1B(NM_000718.3):c.4373A>C (p.Q1458P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138058633A>C"	""	"VUS"	""
"0000656318"	"0"	"30"	"9"	"141015091"	"141015091"	"subst"	"0"	"01943"	"CACNA1B_000073"	"g.141015091A>G"	""	""	""	"CACNA1B(NM_000718.3):c.6247A>G (p.S2083G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.138120639A>G"	""	"likely benign"	""
"0000660110"	"0"	"50"	"9"	"140972648"	"140972648"	"subst"	"1.62442E-5"	"01164"	"CACNA1B_000074"	"g.140972648G>A"	""	""	""	""	"ACMG grading: PM1,PM2,PP3"	"Germline"	""	"rs201516369"	"0"	""	""	"g.138078196G>A"	""	"VUS"	"ACMG"
"0000667947"	"0"	"50"	"9"	"141016169"	"141016169"	"subst"	"0.000554125"	"01164"	"CACNA1B_000076"	"g.141016169G>C"	""	""	""	""	"ACMG grading: BS1"	"Germline"	""	"rs200222038"	"0"	""	""	""	""	"VUS"	"ACMG"
"0000667948"	"0"	"50"	"9"	"140907621"	"140907621"	"subst"	"4.08584E-6"	"01164"	"CACNA1B_000075"	"g.140907621C>T"	""	""	""	""	"ACMG grading: PM2,PP3"	"Germline"	""	""	"0"	""	""	""	""	"VUS"	"ACMG"
"0000678633"	"0"	"30"	"9"	"140972647"	"140972647"	"subst"	"0.00133211"	"01943"	"CACNA1B_000077"	"g.140972647C>T"	""	""	""	"CACNA1B(NM_000718.3):c.5031C>T (p.T1677=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000678634"	"0"	"50"	"9"	"141012489"	"141012489"	"subst"	"0.000307713"	"02325"	"CACNA1B_000078"	"g.141012489C>T"	""	""	""	"CACNA1B(NM_000718.4):c.5869C>T (p.R1957C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000678635"	"0"	"30"	"9"	"141013155"	"141013155"	"subst"	"0.00017498"	"01943"	"CACNA1B_000079"	"g.141013155C>G"	""	""	""	"CACNA1B(NM_000718.3):c.5965C>G (p.P1989A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000678636"	"0"	"30"	"9"	"141015251"	"141015251"	"subst"	"0"	"02325"	"CACNA1B_000080"	"g.141015251G>A"	""	""	""	"CACNA1B(NM_000718.4):c.6407G>A (p.R2136H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000678637"	"0"	"50"	"9"	"141016024"	"141016024"	"subst"	"8.26952E-5"	"01943"	"CACNA1B_000081"	"g.141016024G>A"	""	""	""	"CACNA1B(NM_000718.3):c.6593G>A (p.R2198H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000685824"	"0"	"50"	"9"	"141016155"	"141016155"	"subst"	"0.000871392"	"01164"	"CACNA1B_000033"	"g.141016155G>C"	""	""	""	""	"ACMG grading: PM2,PP3\r\n2y old male"	"Germline"	""	"rs79400016"	"0"	""	""	""	""	"VUS"	"ACMG"
"0000685826"	"0"	"50"	"9"	"140917911"	"140917911"	"subst"	"0"	"01164"	"CACNA1B_000082"	"g.140917911C>T"	""	""	""	""	"ACMG grading: PM2,PP3\r\n2y old male"	"Germline"	""	""	"0"	""	""	""	""	"VUS"	"ACMG"
"0000690493"	"0"	"50"	"9"	"141015209"	"141015209"	"subst"	"4.08497E-5"	"02325"	"CACNA1B_000083"	"g.141015209C>T"	""	""	""	"CACNA1B(NM_000718.4):c.6365C>T (p.S2122L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000722445"	"0"	"30"	"9"	"140773612"	"140773613"	"ins"	"0"	"02325"	"CACNA1B_000084"	"g.140773612_140773613insACGACACGGAGCCCTATTTCATCGGGATCTTTTGCTTCGAGGCAGGGATCAAAATCATCGCTC"	""	""	""	"CACNA1B(NM_000718.4):c.390+1_390+2ins63"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000722446"	"0"	"50"	"9"	"140850187"	"140850187"	"subst"	"0"	"02325"	"CACNA1B_000085"	"g.140850187C>T"	""	""	""	"CACNA1B(NM_000718.4):c.1108C>T (p.R370C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000722447"	"0"	"30"	"9"	"140917824"	"140917824"	"subst"	"0"	"01943"	"CACNA1B_000086"	"g.140917824G>C"	""	""	""	"CACNA1B(NM_000718.3):c.2629G>C (p.G877R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000722448"	"0"	"30"	"9"	"140953645"	"140953645"	"subst"	"0.000115157"	"01943"	"CACNA1B_000087"	"g.140953645C>T"	""	""	""	"CACNA1B(NM_000718.3):c.4584+4C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000722449"	"0"	"50"	"9"	"140968475"	"140968475"	"subst"	"0"	"02329"	"CACNA1B_000088"	"g.140968475T>C"	""	""	""	"CACNA1B(NM_000718.3):c.4814T>C (p.L1605P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000722450"	"0"	"30"	"9"	"141012464"	"141012464"	"subst"	"0"	"01943"	"CACNA1B_000089"	"g.141012464C>G"	""	""	""	"CACNA1B(NM_000718.3):c.5844C>G (p.P1948=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000804032"	"0"	"30"	"9"	"140878640"	"140878640"	"subst"	"0"	"01943"	"CACNA1B_000090"	"g.140878640A>G"	""	""	""	"CACNA1B(NM_000718.3):c.1707A>G (p.G569=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000804033"	"0"	"50"	"9"	"140917855"	"140917860"	"del"	"0"	"01943"	"CACNA1B_000091"	"g.140917855_140917860del"	""	""	""	"CACNA1B(NM_000718.3):c.2660_2665delGGCCGC (p.R887_P888del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000804034"	"0"	"50"	"9"	"140919592"	"140919592"	"subst"	"4.11462E-5"	"01943"	"CACNA1B_000092"	"g.140919592C>T"	""	""	""	"CACNA1B(NM_000718.3):c.3254C>T (p.T1085M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000804035"	"0"	"30"	"9"	"140953202"	"140953202"	"subst"	"0.00205575"	"02326"	"CACNA1B_000024"	"g.140953202G>A"	""	""	""	"CACNA1B(NM_000718.4):c.4473+17G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000804036"	"0"	"30"	"9"	"140972575"	"140972575"	"subst"	"0.000585952"	"01943"	"CACNA1B_000026"	"g.140972575G>A"	""	""	""	"CACNA1B(NM_000718.3):c.4959G>A (p.T1653=), CACNA1B(NM_000718.4):c.4959G>A (p.T1653=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000852211"	"0"	"30"	"9"	"141012545"	"141012545"	"dup"	"0"	"02326"	"CACNA1B_000097"	"g.141012545dup"	""	""	""	"CACNA1B(NM_000718.4):c.5913+12dupC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000852212"	"0"	"30"	"9"	"141014681"	"141014681"	"subst"	"0.000291888"	"02326"	"CACNA1B_000064"	"g.141014681C>G"	""	""	""	"CACNA1B(NM_000718.3):c.6095C>G (p.T2032S), CACNA1B(NM_000718.4):c.6095C>G (p.T2032S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000861587"	"0"	"30"	"9"	"140772448"	"140772448"	"subst"	"0"	"01943"	"CACNA1B_000093"	"g.140772448C>T"	""	""	""	"CACNA1B(NM_000718.3):c.63C>T (p.A21=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000861588"	"0"	"50"	"9"	"140772638"	"140772638"	"subst"	"0"	"01943"	"CACNA1B_000094"	"g.140772638C>T"	""	""	""	"CACNA1B(NM_000718.3):c.253C>T (p.R85C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000861589"	"0"	"30"	"9"	"140918150"	"140918150"	"subst"	"0"	"01943"	"CACNA1B_000095"	"g.140918150G>A"	""	""	""	"CACNA1B(NM_000718.3):c.2955G>A (p.A985=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000861590"	"0"	"50"	"9"	"141006876"	"141006876"	"subst"	"0.000190877"	"01943"	"CACNA1B_000096"	"g.141006876G>A"	""	""	""	"CACNA1B(NM_000718.3):c.5455G>A (p.A1819T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000861591"	"0"	"50"	"9"	"141014793"	"141014793"	"subst"	"0"	"01943"	"CACNA1B_000098"	"g.141014793G>T"	""	""	""	"CACNA1B(NM_000718.3):c.6207G>T (p.K2069N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000880134"	"3"	"50"	"9"	"141015116"	"141015116"	"subst"	"0"	"00006"	"CACNA1B_000099"	"g.141015116C>T"	""	"{PMID:Bertoli-Avella 2022:34952832}"	""	""	""	"Germline"	""	"rs746163681"	"0"	""	""	""	""	"VUS"	""
"0000888767"	"0"	"30"	"9"	"140968449"	"140968449"	"subst"	"3.68255E-5"	"02325"	"CACNA1B_000100"	"g.140968449G>A"	""	""	""	"CACNA1B(NM_000718.4):c.4792-4G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000909186"	"0"	"50"	"9"	"140878675"	"140878675"	"subst"	"0"	"00006"	"CACNA1B_000101"	"g.140878675G>A"	""	"Wiel 2023, {DOI:Wiel 2023:10.1016/j.ajhg.2022.12.001}"	""	""	"gene predicted as candidate involved in neurodevelopmental dealy"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.137984223G>A"	""	"VUS (!)"	""
"0000913135"	"0"	"30"	"9"	"141016262"	"141016262"	"subst"	"1.62632E-5"	"02326"	"CACNA1B_000102"	"g.141016262T>A"	""	""	""	"CACNA1B(NM_000718.4):c.6831T>A (p.T2277=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000965334"	"0"	"10"	"9"	"140777306"	"140777306"	"subst"	"0"	"02326"	"CACNA1B_000005"	"g.140777306C>G"	""	""	""	"CACNA1B(NM_000718.4):c.501C>G (p.(Asn167Lys), p.N167K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000965335"	"0"	"30"	"9"	"140901275"	"140901275"	"subst"	"4.06517E-6"	"02325"	"CACNA1B_000103"	"g.140901275C>T"	""	""	""	"CACNA1B(NM_000718.4):c.2031C>T (p.G677=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000978614"	"0"	"50"	"9"	"140772393"	"140772393"	"subst"	"0"	"01804"	"CACNA1B_000104"	"g.140772393G>A"	""	""	""	"CACNA1B(NM_000718.4):c.8G>A (p.(Arg3His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000978615"	"0"	"50"	"9"	"140811755"	"140811755"	"subst"	"1.2191E-5"	"01804"	"CACNA1B_000105"	"g.140811755G>A"	""	""	""	"CACNA1B(NM_000718.4):c.838G>A (p.(Asp280Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000978616"	"0"	"30"	"9"	"140811893"	"140811893"	"subst"	"4.12048E-5"	"01804"	"CACNA1B_000106"	"g.140811893G>A"	""	""	""	"CACNA1B(NM_000718.4):c.966+10G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000978617"	"0"	"30"	"9"	"140851285"	"140851285"	"subst"	"0"	"01804"	"CACNA1B_000107"	"g.140851285T>C"	""	""	""	"CACNA1B(NM_000718.4):c.1243+6T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000978618"	"0"	"50"	"9"	"140865895"	"140865895"	"subst"	"2.44762E-5"	"01804"	"CACNA1B_000108"	"g.140865895G>A"	""	""	""	"CACNA1B(NM_000718.4):c.1394G>A (p.(Arg465Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000978619"	"0"	"30"	"9"	"140968449"	"140968449"	"subst"	"3.68255E-5"	"01804"	"CACNA1B_000100"	"g.140968449G>A"	""	""	""	"CACNA1B(NM_000718.4):c.4792-4G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000978620"	"0"	"30"	"9"	"141014611"	"141014611"	"subst"	"0.000480012"	"01804"	"CACNA1B_000109"	"g.141014611C>T"	""	""	""	"CACNA1B(NM_000718.4):c.6031-6C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000978621"	"0"	"30"	"9"	"141014828"	"141014828"	"subst"	"0"	"01804"	"CACNA1B_000110"	"g.141014828C>T"	""	""	""	"CACNA1B(NM_000718.4):c.6238+4C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000978622"	"0"	"50"	"9"	"141016295"	"141016295"	"subst"	"0"	"01804"	"CACNA1B_000111"	"g.141016295G>A"	""	""	""	"CACNA1B(NM_001243812.2):c.6677G>A (p.(Arg2226Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000997757"	"0"	"50"	"9"	"140772395"	"140772395"	"subst"	"0"	"01804"	"CACNA1B_000112"	"g.140772395T>A"	""	""	""	"CACNA1B(NM_000718.3):c.10T>A (p.(Phe4Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000997758"	"0"	"30"	"9"	"140772551"	"140772571"	"dup"	"0"	"01804"	"CACNA1B_000042"	"g.140772551_140772571dup"	""	""	""	"CACNA1B(NM_000718.3):c.166_186dupATGGCGCTGTACAACCCCATC (p.(Met56_Ile62dup)), CACNA1B(NM_000718.4):c.166_186dupATGGCGCTGTACAACCCCATC (p.M56_I62dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000997759"	"0"	"50"	"9"	"140807697"	"140807697"	"subst"	"0"	"01804"	"CACNA1B_000113"	"g.140807697C>T"	""	""	""	"CACNA1B(NM_000718.3):c.596C>T (p.(Pro199Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000997760"	"0"	"50"	"9"	"140846786"	"140846786"	"subst"	"0"	"01804"	"CACNA1B_000114"	"g.140846786G>A"	""	""	""	"CACNA1B(NM_000718.3):c.1027G>A (p.(Gly343Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000997761"	"0"	"50"	"9"	"140852115"	"140852115"	"subst"	"0"	"01804"	"CACNA1B_000115"	"g.140852115C>T"	""	""	""	"CACNA1B(NM_000718.3):c.1309C>T (p.(Arg437Trp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000997762"	"0"	"30"	"9"	"140852116"	"140852116"	"subst"	"0"	"01804"	"CACNA1B_000116"	"g.140852116G>T"	""	""	""	"CACNA1B(NM_000718.3):c.1310G>T (p.(Arg437Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000997763"	"0"	"50"	"9"	"140865972"	"140865972"	"subst"	"2.03487E-5"	"01804"	"CACNA1B_000013"	"g.140865972G>A"	""	""	""	"CACNA1B(NM_000718.3):c.1471G>A (p.(Val491Met)), CACNA1B(NM_000718.4):c.1471G>A (p.V491M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000997764"	"0"	"50"	"9"	"140870474"	"140870474"	"subst"	"0"	"01804"	"CACNA1B_000117"	"g.140870474G>C"	""	""	""	"CACNA1B(NM_000718.3):c.1656+3G>C (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000997765"	"0"	"30"	"9"	"140904458"	"140904458"	"subst"	"0.00560916"	"01804"	"CACNA1B_000017"	"g.140904458C>A"	""	""	""	"CACNA1B(NM_000718.3):c.2093-4C>A (p.?), CACNA1B(NM_000718.4):c.2093-4C>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000997766"	"0"	"50"	"9"	"140907660"	"140907660"	"subst"	"0"	"01804"	"CACNA1B_000118"	"g.140907660T>G"	""	""	""	"CACNA1B(NM_000718.3):c.2240T>G (p.(Met747Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000997767"	"0"	"50"	"9"	"140917876"	"140917876"	"subst"	"0.00142653"	"01804"	"CACNA1B_000119"	"g.140917876A>T"	""	""	""	"CACNA1B(NM_000718.3):c.2681A>T (p.(Lys894Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000997768"	"0"	"30"	"9"	"140918146"	"140918146"	"subst"	"0"	"01804"	"CACNA1B_000120"	"g.140918146A>C"	""	""	""	"CACNA1B(NM_000718.3):c.2951A>C (p.(Lys984Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000997769"	"0"	"30"	"9"	"140952560"	"140952560"	"subst"	"0.000422335"	"01804"	"CACNA1B_000002"	"g.140952560G>A"	""	""	""	"CACNA1B(NM_000718.3):c.4166G>A (p.(Arg1389His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000997770"	"0"	"50"	"9"	"140953169"	"140953176"	"del"	"0"	"01804"	"CACNA1B_000121"	"g.140953169_140953176del"	""	""	""	"CACNA1B(NM_000718.3):c.4457_4464delTGGTGCTG (p.(Val1486fs))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000997771"	"0"	"90"	"9"	"140991018"	"140991018"	"subst"	"0"	"01804"	"CACNA1B_000122"	"g.140991018T>A"	""	""	""	"CACNA1B(NM_000718.3):c.5177T>A (p.(Leu1726*))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000997772"	"0"	"30"	"9"	"141000229"	"141000229"	"subst"	"0"	"01804"	"CACNA1B_000123"	"g.141000229C>T"	""	""	""	"CACNA1B(NM_000718.3):c.5398C>T (p.(Arg1800Trp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000997773"	"0"	"30"	"9"	"141012490"	"141012490"	"subst"	"3.41134E-5"	"01804"	"CACNA1B_000124"	"g.141012490G>A"	""	""	""	"CACNA1B(NM_000718.3):c.5870G>A (p.(Arg1957His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000997774"	"0"	"30"	"9"	"141014740"	"141014740"	"subst"	"0"	"01804"	"CACNA1B_000125"	"g.141014740C>T"	""	""	""	"CACNA1B(NM_000718.3):c.6154C>T (p.(His2052Tyr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000997775"	"0"	"50"	"9"	"141014744"	"141014749"	"del"	"0"	"01804"	"CACNA1B_000126"	"g.141014744_141014749del"	""	""	""	"CACNA1B(NM_000718.3):c.6158_6163delACCACC (p.(His2053_His2054del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000997776"	"0"	"50"	"9"	"141015221"	"141015221"	"subst"	"1.33989E-5"	"01804"	"CACNA1B_000127"	"g.141015221G>A"	""	""	""	"CACNA1B(NM_000718.3):c.6377G>A (p.(Arg2126His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001025648"	"0"	"50"	"9"	"140881266"	"140881266"	"subst"	"0"	"02325"	"CACNA1B_000128"	"g.140881266A>G"	""	""	""	"CACNA1B(NM_000718.4):c.1934A>G (p.N645S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001037408"	"0"	"50"	"9"	"140772403"	"140772403"	"subst"	"0"	"01804"	"CACNA1B_000129"	"g.140772403C>A"	""	""	""	"CACNA1B(NM_000718.4):c.18C>A (p.(Asp6Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001037409"	"0"	"50"	"9"	"140777253"	"140777253"	"subst"	"5.27996E-5"	"01804"	"CACNA1B_000130"	"g.140777253A>G"	""	""	""	"CACNA1B(NM_000718.4):c.448A>G (p.(Ile150Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001037410"	"0"	"30"	"9"	"140777306"	"140777306"	"subst"	"0"	"01804"	"CACNA1B_000005"	"g.140777306C>G"	""	""	""	"CACNA1B(NM_000718.4):c.501C>G (p.(Asn167Lys), p.N167K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001037411"	"0"	"50"	"9"	"140865852"	"140865852"	"subst"	"2.87895E-5"	"01804"	"CACNA1B_000131"	"g.140865852G>A"	""	""	""	"CACNA1B(NM_000718.4):c.1351G>A (p.(Ala451Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001037412"	"0"	"50"	"9"	"140917995"	"140917995"	"subst"	"0"	"01804"	"CACNA1B_000132"	"g.140917995C>G"	""	""	""	"CACNA1B(NM_000718.4):c.2800C>G (p.(Arg934Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001037413"	"0"	"30"	"9"	"141014778"	"141014778"	"subst"	"0.00041445"	"01804"	"CACNA1B_000030"	"g.141014778G>A"	""	""	""	"CACNA1B(NM_000718.4):c.6192G>A (p.(Gln2064=), p.Q2064=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001046192"	"0"	"10"	"9"	"141000201"	"141000201"	"subst"	"0.00169557"	"02326"	"CACNA1B_000133"	"g.141000201C>T"	""	""	""	"CACNA1B(NM_000718.4):c.5370C>T (p.H1790=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001046193"	"0"	"30"	"9"	"141014730"	"141014730"	"subst"	"0.0011417"	"02326"	"CACNA1B_000134"	"g.141014730G>A"	""	""	""	"CACNA1B(NM_000718.4):c.6144G>A (p.S2048=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001046194"	"0"	"30"	"9"	"141016155"	"141016155"	"subst"	"0.000871392"	"02326"	"CACNA1B_000033"	"g.141016155G>C"	""	""	""	"CACNA1B(NM_000718.4):c.6724G>C (p.D2242H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001053488"	"0"	"50"	"9"	"140865849"	"140865849"	"subst"	"4.95311E-5"	"01804"	"CACNA1B_000135"	"g.140865849C>T"	""	""	""	"CACNA1B(NM_000718.4):c.1348C>T (p.(Arg450Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001053489"	"0"	"50"	"9"	"140943679"	"140943679"	"subst"	"0"	"01804"	"CACNA1B_000136"	"g.140943679C>G"	""	""	""	"CACNA1B(NM_000718.4):c.3622C>G (p.(Leu1208Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001053490"	"0"	"50"	"9"	"140948358"	"140948358"	"subst"	"4.46693E-5"	"01804"	"CACNA1B_000137"	"g.140948358A>G"	""	""	""	"CACNA1B(NM_000718.4):c.3868A>G (p.(Met1290Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001053491"	"0"	"50"	"9"	"141016023"	"141016023"	"subst"	"0"	"01804"	"CACNA1B_000138"	"g.141016023C>T"	""	""	""	"CACNA1B(NM_000718.4):c.6592C>T (p.(Arg2198Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001065187"	"0"	"50"	"9"	"141016353"	"141016353"	"subst"	"4.48939E-5"	"02325"	"CACNA1B_000139"	"g.141016353C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes CACNA1B
## Count = 160
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000004787"	"00001375"	"50"	"6831"	"0"	"6831"	"0"	"c.6831T>G"	"r.(?)"	"p.(=)"	""
"0000053074"	"00001375"	"90"	"4166"	"0"	"4166"	"0"	"c.4166G>A"	"r.(?)"	"p.(Arg1389His)"	"28"
"0000053077"	"00001375"	"90"	"4166"	"0"	"4166"	"0"	"c.4166G>A"	"r.(?)"	"p.Arg1389His"	"28"
"0000081503"	"00001375"	"90"	"-145"	"0"	"996"	"1"	"c.(?_-145)_(996+1_1334-1)del"	"r.0?"	"p.0?"	"_1_6"
"0000081511"	"00001375"	"90"	"0"	"0"	"0"	"0"	"c.0"	"r.0"	"p.0"	"_1_47_"
"0000249381"	"00001375"	"30"	"1551"	"0"	"1551"	"0"	"c.1551A>G"	"r.(?)"	"p.(Ala517=)"	""
"0000249429"	"00001375"	"30"	"7010"	"0"	"7010"	"0"	"c.7010A>G"	"r.(?)"	"p.(His2337Arg)"	""
"0000249448"	"00001375"	"30"	"265"	"0"	"265"	"0"	"c.265A>G"	"r.(?)"	"p.(Lys89Glu)"	""
"0000249794"	"00001375"	"50"	"5933"	"0"	"5933"	"0"	"c.5933A>G"	"r.(?)"	"p.(Gln1978Arg)"	""
"0000254462"	"00001375"	"30"	"1289"	"0"	"1289"	"0"	"c.1289A>G"	"r.(?)"	"p.(His430Arg)"	""
"0000266400"	"00001375"	"10"	"1054"	"0"	"1054"	"0"	"c.1054C>T"	"r.(?)"	"p.(Leu352=)"	""
"0000266401"	"00001375"	"30"	"1185"	"0"	"1185"	"0"	"c.1185G>A"	"r.(?)"	"p.(Ala395=)"	""
"0000266402"	"00001375"	"50"	"1448"	"0"	"1448"	"0"	"c.1448G>A"	"r.(?)"	"p.(Ser483Asn)"	""
"0000266403"	"00001375"	"50"	"1471"	"0"	"1471"	"0"	"c.1471G>A"	"r.(?)"	"p.(Val491Met)"	""
"0000266404"	"00001375"	"30"	"1769"	"13"	"1769"	"13"	"c.1769+13C>T"	"r.(=)"	"p.(=)"	""
"0000266405"	"00001375"	"30"	"2093"	"-4"	"2093"	"-4"	"c.2093-4C>A"	"r.spl?"	"p.?"	""
"0000266406"	"00001375"	"50"	"2385"	"0"	"2385"	"0"	"c.2385G>C"	"r.(?)"	"p.(Glu795Asp)"	""
"0000266407"	"00001375"	"10"	"2925"	"0"	"2925"	"0"	"c.2925G>C"	"r.(?)"	"p.(Pro975=)"	""
"0000266408"	"00001375"	"30"	"30"	"0"	"30"	"0"	"c.30C>T"	"r.(?)"	"p.(Gly10=)"	""
"0000266409"	"00001375"	"30"	"3279"	"0"	"3279"	"0"	"c.3279C>G"	"r.(?)"	"p.(Val1093=)"	""
"0000266410"	"00001375"	"30"	"4212"	"0"	"4212"	"0"	"c.4212C>T"	"r.(?)"	"p.(Pro1404=)"	""
"0000266411"	"00001375"	"10"	"4308"	"10"	"4308"	"10"	"c.4308+10C>T"	"r.(=)"	"p.(=)"	""
"0000266412"	"00001375"	"30"	"4473"	"17"	"4473"	"17"	"c.4473+17G>A"	"r.(=)"	"p.(=)"	""
"0000266413"	"00001375"	"30"	"4848"	"0"	"4848"	"0"	"c.4848C>T"	"r.(?)"	"p.(Ile1616=)"	""
"0000266414"	"00001375"	"30"	"4959"	"0"	"4959"	"0"	"c.4959G>A"	"r.(?)"	"p.(Thr1653=)"	""
"0000266415"	"00001375"	"10"	"501"	"0"	"501"	"0"	"c.501C>G"	"r.(?)"	"p.(Asn167Lys)"	""
"0000266416"	"00001375"	"30"	"5454"	"0"	"5454"	"0"	"c.5454C>T"	"r.(?)"	"p.(Asp1818=)"	""
"0000266417"	"00001375"	"50"	"6176"	"0"	"6176"	"0"	"c.6176G>T"	"r.(?)"	"p.(Arg2059Leu)"	""
"0000266418"	"00001375"	"30"	"6192"	"0"	"6192"	"0"	"c.6192G>A"	"r.(?)"	"p.(Gln2064=)"	""
"0000266419"	"00001375"	"50"	"6366"	"0"	"6366"	"0"	"c.6366G>A"	"r.(?)"	"p.(Ser2122=)"	""
"0000266420"	"00001375"	"50"	"6409"	"0"	"6409"	"0"	"c.6409G>A"	"r.(?)"	"p.(Glu2137Lys)"	""
"0000266421"	"00001375"	"30"	"6724"	"0"	"6724"	"0"	"c.6724G>C"	"r.(?)"	"p.(Asp2242His)"	""
"0000266422"	"00001375"	"50"	"79"	"0"	"79"	"0"	"c.79G>T"	"r.(?)"	"p.(Gly27Cys)"	""
"0000266423"	"00001375"	"30"	"831"	"0"	"831"	"0"	"c.831C>T"	"r.(?)"	"p.(Cys277=)"	""
"0000266424"	"00001375"	"10"	"92"	"0"	"92"	"0"	"c.92G>T"	"r.(?)"	"p.(Gly31Val)"	""
"0000266425"	"00001375"	"30"	"967"	"-11"	"967"	"-11"	"c.967-11C>G"	"r.(=)"	"p.(=)"	""
"0000266426"	"00001375"	"10"	"967"	"-20"	"967"	"-20"	"c.967-20C>T"	"r.(=)"	"p.(=)"	""
"0000266427"	"00001375"	"30"	"99"	"0"	"99"	"0"	"c.99T>G"	"r.(?)"	"p.(Gly33=)"	""
"0000272446"	"00001375"	"50"	"1628"	"0"	"1628"	"0"	"c.1628G>C"	"r.(?)"	"p.(Arg543Pro)"	""
"0000272447"	"00001375"	"30"	"18"	"0"	"18"	"0"	"c.18C>T"	"r.(?)"	"p.(Asp6=)"	""
"0000272448"	"00001375"	"30"	"284"	"1"	"284"	"3"	"c.284+1_284+3del"	"r.spl?"	"p.?"	""
"0000272449"	"00001375"	"50"	"2924"	"0"	"2924"	"0"	"c.2924C>A"	"r.(?)"	"p.(Pro975Gln)"	""
"0000272450"	"00001375"	"30"	"30"	"0"	"30"	"0"	"c.30C>T"	"r.(?)"	"p.(Gly10=)"	""
"0000272451"	"00001375"	"30"	"4212"	"0"	"4212"	"0"	"c.4212C>T"	"r.(?)"	"p.(Pro1404=)"	""
"0000272452"	"00001375"	"10"	"4308"	"10"	"4308"	"10"	"c.4308+10C>T"	"r.(=)"	"p.(=)"	""
"0000272453"	"00001375"	"50"	"6889"	"0"	"6889"	"0"	"c.6889G>A"	"r.(?)"	"p.(Val2297Met)"	""
"0000537641"	"00001375"	"50"	"79"	"0"	"79"	"0"	"c.79G>T"	"r.(?)"	"p.(Gly27Cys)"	""
"0000537642"	"00001375"	"50"	"92"	"0"	"92"	"0"	"c.92G>A"	"r.(?)"	"p.(Gly31Asp)"	""
"0000537643"	"00001375"	"30"	"166"	"0"	"186"	"0"	"c.166_186dup"	"r.(?)"	"p.(Met56_Ile62dup)"	""
"0000537644"	"00001375"	"50"	"228"	"0"	"228"	"0"	"c.228C>G"	"r.(?)"	"p.(Phe76Leu)"	""
"0000537645"	"00001375"	"10"	"228"	"0"	"228"	"0"	"c.228C>G"	"r.(?)"	"p.(Phe76Leu)"	""
"0000537648"	"00001375"	"10"	"390"	"1"	"390"	"2"	"c.390+1_390+2insACGACACGGAGCCCTATTTCATCGGGATCTTTTGCTTCGAGGCAGGGATCAAAATCATCGCTCTGGGCTT"	"r.spl?"	"p.?"	""
"0000537649"	"00001375"	"30"	"399"	"0"	"399"	"0"	"c.399G>A"	"r.(?)"	"p.(Thr133=)"	""
"0000537650"	"00001375"	"30"	"519"	"0"	"519"	"0"	"c.519C>T"	"r.(?)"	"p.(Val173=)"	""
"0000537651"	"00001375"	"30"	"967"	"-8"	"967"	"-8"	"c.967-8G>A"	"r.(=)"	"p.(=)"	""
"0000537652"	"00001375"	"30"	"1071"	"-7"	"1071"	"-7"	"c.1071-7A>G"	"r.(=)"	"p.(=)"	""
"0000537653"	"00001375"	"50"	"1143"	"0"	"1143"	"0"	"c.1143C>G"	"r.(?)"	"p.(Ile381Met)"	""
"0000537654"	"00001375"	"30"	"1182"	"0"	"1182"	"0"	"c.1182G>A"	"r.(?)"	"p.(Lys394=)"	""
"0000537655"	"00001375"	"50"	"1520"	"0"	"1520"	"0"	"c.1520C>T"	"r.(?)"	"p.(Pro507Leu)"	""
"0000537656"	"00001375"	"70"	"1656"	"2"	"1656"	"2"	"c.1656+2T>C"	"r.spl?"	"p.?"	""
"0000537657"	"00001375"	"30"	"2586"	"0"	"2586"	"0"	"c.2586G>A"	"r.(?)"	"p.(Ala862=)"	""
"0000537658"	"00001375"	"50"	"2663"	"0"	"2668"	"0"	"c.2663_2668dup"	"r.(?)"	"p.(Pro888_His889dup)"	""
"0000537659"	"00001375"	"10"	"2886"	"0"	"2886"	"0"	"c.2886C>A"	"r.(?)"	"p.(Pro962=)"	""
"0000537660"	"00001375"	"10"	"2986"	"0"	"3000"	"0"	"c.2986_3000del"	"r.(?)"	"p.(Thr996_Glu1000del)"	""
"0000537661"	"00001375"	"10"	"3279"	"0"	"3279"	"0"	"c.3279C>T"	"r.(?)"	"p.(Val1093=)"	""
"0000537662"	"00001375"	"30"	"3456"	"0"	"3456"	"0"	"c.3456C>T"	"r.(?)"	"p.(Phe1152=)"	""
"0000537663"	"00001375"	"30"	"4044"	"0"	"4044"	"0"	"c.4044C>T"	"r.(?)"	"p.(Tyr1348=)"	""
"0000537664"	"00001375"	"50"	"4843"	"0"	"4843"	"0"	"c.4843A>G"	"r.(?)"	"p.(Ile1615Val)"	""
"0000537665"	"00001375"	"30"	"4848"	"0"	"4848"	"0"	"c.4848C>T"	"r.(?)"	"p.(Ile1616=)"	""
"0000537666"	"00001375"	"30"	"4962"	"0"	"4962"	"0"	"c.4962G>A"	"r.(?)"	"p.(Gly1654=)"	""
"0000537667"	"00001375"	"30"	"5161"	"0"	"5161"	"0"	"c.5161C>T"	"r.(?)"	"p.(Leu1721=)"	""
"0000537668"	"00001375"	"30"	"6095"	"0"	"6095"	"0"	"c.6095C>G"	"r.(?)"	"p.(Thr2032Ser)"	""
"0000537669"	"00001375"	"30"	"6147"	"0"	"6147"	"0"	"c.6147G>A"	"r.(?)"	"p.(Ser2049=)"	""
"0000537670"	"00001375"	"30"	"6282"	"0"	"6282"	"0"	"c.6282G>A"	"r.(?)"	"p.(Gly2094=)"	""
"0000612042"	"00001375"	"30"	"3338"	"0"	"3338"	"0"	"c.3338C>T"	"r.(?)"	"p.(Ala1113Val)"	""
"0000612043"	"00001375"	"50"	"6551"	"0"	"6551"	"0"	"c.6551G>A"	"r.(?)"	"p.(Arg2184His)"	""
"0000612044"	"00001375"	"30"	"6709"	"0"	"6709"	"0"	"c.6709G>A"	"r.(?)"	"p.(Ala2237Thr)"	""
"0000612045"	"00001375"	"50"	"6950"	"0"	"6950"	"0"	"c.6950C>T"	"r.(?)"	"p.(Thr2317Ile)"	""
"0000622240"	"00001375"	"30"	"3078"	"0"	"3078"	"0"	"c.3078C>G"	"r.(?)"	"p.(His1026Gln)"	""
"0000622241"	"00001375"	"50"	"4373"	"0"	"4373"	"0"	"c.4373A>C"	"r.(?)"	"p.(Gln1458Pro)"	""
"0000656318"	"00001375"	"30"	"6247"	"0"	"6247"	"0"	"c.6247A>G"	"r.(?)"	"p.(Ser2083Gly)"	""
"0000660110"	"00001375"	"50"	"5032"	"0"	"5032"	"0"	"c.5032G>A"	"r.(?)"	"p.(Glu1678Lys)"	""
"0000667947"	"00001375"	"50"	"6738"	"0"	"6738"	"0"	"c.6738G>C"	"r.(?)"	"p.(Gln2246His)"	""
"0000667948"	"00001375"	"50"	"2201"	"0"	"2201"	"0"	"c.2201C>T"	"r.(?)"	"p.(Ala734Val)"	""
"0000678633"	"00001375"	"30"	"5031"	"0"	"5031"	"0"	"c.5031C>T"	"r.(?)"	"p.(Thr1677=)"	""
"0000678634"	"00001375"	"50"	"5869"	"0"	"5869"	"0"	"c.5869C>T"	"r.(?)"	"p.(Arg1957Cys)"	""
"0000678635"	"00001375"	"30"	"5965"	"0"	"5965"	"0"	"c.5965C>G"	"r.(?)"	"p.(Pro1989Ala)"	""
"0000678636"	"00001375"	"30"	"6407"	"0"	"6407"	"0"	"c.6407G>A"	"r.(?)"	"p.(Arg2136His)"	""
"0000678637"	"00001375"	"50"	"6593"	"0"	"6593"	"0"	"c.6593G>A"	"r.(?)"	"p.(Arg2198His)"	""
"0000685824"	"00001375"	"50"	"6724"	"0"	"6724"	"0"	"c.6724G>C"	"r.(?)"	"p.(Asp2242His)"	""
"0000685826"	"00001375"	"50"	"2716"	"0"	"2716"	"0"	"c.2716C>T"	"r.(?)"	"p.(Arg906Cys)"	""
"0000690493"	"00001375"	"50"	"6365"	"0"	"6365"	"0"	"c.6365C>T"	"r.(?)"	"p.(Ser2122Leu)"	""
"0000722445"	"00001375"	"30"	"390"	"1"	"390"	"2"	"c.390+1_390+2insACGACACGGAGCCCTATTTCATCGGGATCTTTTGCTTCGAGGCAGGGATCAAAATCATCGCTC"	"r.spl?"	"p.?"	""
"0000722446"	"00001375"	"50"	"1108"	"0"	"1108"	"0"	"c.1108C>T"	"r.(?)"	"p.(Arg370Cys)"	""
"0000722447"	"00001375"	"30"	"2629"	"0"	"2629"	"0"	"c.2629G>C"	"r.(?)"	"p.(Gly877Arg)"	""
"0000722448"	"00001375"	"30"	"4584"	"4"	"4584"	"4"	"c.4584+4C>T"	"r.spl?"	"p.?"	""
"0000722449"	"00001375"	"50"	"4814"	"0"	"4814"	"0"	"c.4814T>C"	"r.(?)"	"p.(Leu1605Pro)"	""
"0000722450"	"00001375"	"30"	"5844"	"0"	"5844"	"0"	"c.5844C>G"	"r.(?)"	"p.(Pro1948=)"	""
"0000804032"	"00001375"	"30"	"1707"	"0"	"1707"	"0"	"c.1707A>G"	"r.(?)"	"p.(Gly569=)"	""
"0000804033"	"00001375"	"50"	"2660"	"0"	"2665"	"0"	"c.2660_2665del"	"r.(?)"	"p.(Arg887_Pro888del)"	""
"0000804034"	"00001375"	"50"	"3254"	"0"	"3254"	"0"	"c.3254C>T"	"r.(?)"	"p.(Thr1085Met)"	""
"0000804035"	"00001375"	"30"	"4473"	"17"	"4473"	"17"	"c.4473+17G>A"	"r.(=)"	"p.(=)"	""
"0000804036"	"00001375"	"30"	"4959"	"0"	"4959"	"0"	"c.4959G>A"	"r.(?)"	"p.(Thr1653=)"	""
"0000852211"	"00001375"	"30"	"5913"	"12"	"5913"	"12"	"c.5913+12dup"	"r.(=)"	"p.(=)"	""
"0000852212"	"00001375"	"30"	"6095"	"0"	"6095"	"0"	"c.6095C>G"	"r.(?)"	"p.(Thr2032Ser)"	""
"0000861587"	"00001375"	"30"	"63"	"0"	"63"	"0"	"c.63C>T"	"r.(?)"	"p.(Ala21=)"	""
"0000861588"	"00001375"	"50"	"253"	"0"	"253"	"0"	"c.253C>T"	"r.(?)"	"p.(Arg85Cys)"	""
"0000861589"	"00001375"	"30"	"2955"	"0"	"2955"	"0"	"c.2955G>A"	"r.(?)"	"p.(Ala985=)"	""
"0000861590"	"00001375"	"50"	"5455"	"0"	"5455"	"0"	"c.5455G>A"	"r.(?)"	"p.(Ala1819Thr)"	""
"0000861591"	"00001375"	"50"	"6207"	"0"	"6207"	"0"	"c.6207G>T"	"r.(?)"	"p.(Lys2069Asn)"	""
"0000880134"	"00001375"	"50"	"6272"	"0"	"6272"	"0"	"c.6272C>T"	"r.(?)"	"p.(Pro2091Leu)"	""
"0000888767"	"00001375"	"30"	"4792"	"-4"	"4792"	"-4"	"c.4792-4G>A"	"r.spl?"	"p.?"	""
"0000909186"	"00001375"	"50"	"1742"	"0"	"1742"	"0"	"c.1742G>A"	"r.(?)"	"p.(Arg581His)"	""
"0000913135"	"00001375"	"30"	"6831"	"0"	"6831"	"0"	"c.6831T>A"	"r.(?)"	"p.(Thr2277=)"	""
"0000965334"	"00001375"	"10"	"501"	"0"	"501"	"0"	"c.501C>G"	"r.(?)"	"p.(Asn167Lys)"	""
"0000965335"	"00001375"	"30"	"2031"	"0"	"2031"	"0"	"c.2031C>T"	"r.(?)"	"p.(=)"	""
"0000978614"	"00001375"	"50"	"8"	"0"	"8"	"0"	"c.8G>A"	"r.(?)"	"p.(Arg3His)"	""
"0000978615"	"00001375"	"50"	"838"	"0"	"838"	"0"	"c.838G>A"	"r.(?)"	"p.(Asp280Asn)"	""
"0000978616"	"00001375"	"30"	"966"	"10"	"966"	"10"	"c.966+10G>A"	"r.(=)"	"p.(=)"	""
"0000978617"	"00001375"	"30"	"1243"	"6"	"1243"	"6"	"c.1243+6T>C"	"r.(=)"	"p.(=)"	""
"0000978618"	"00001375"	"50"	"1394"	"0"	"1394"	"0"	"c.1394G>A"	"r.(?)"	"p.(Arg465Gln)"	""
"0000978619"	"00001375"	"30"	"4792"	"-4"	"4792"	"-4"	"c.4792-4G>A"	"r.spl?"	"p.?"	""
"0000978620"	"00001375"	"30"	"6031"	"-6"	"6031"	"-6"	"c.6031-6C>T"	"r.(=)"	"p.(=)"	""
"0000978621"	"00001375"	"30"	"6238"	"4"	"6238"	"4"	"c.6238+4C>T"	"r.spl?"	"p.?"	""
"0000978622"	"00001375"	"50"	"6864"	"0"	"6864"	"0"	"c.6864G>A"	"r.(?)"	"p.(=)"	""
"0000997757"	"00001375"	"50"	"10"	"0"	"10"	"0"	"c.10T>A"	"r.(?)"	"p.(Phe4Ile)"	""
"0000997758"	"00001375"	"30"	"166"	"0"	"186"	"0"	"c.166_186dup"	"r.(?)"	"p.(Met56_Ile62dup)"	""
"0000997759"	"00001375"	"50"	"596"	"0"	"596"	"0"	"c.596C>T"	"r.(?)"	"p.(Pro199Leu)"	""
"0000997760"	"00001375"	"50"	"1027"	"0"	"1027"	"0"	"c.1027G>A"	"r.(?)"	"p.(Gly343Ser)"	""
"0000997761"	"00001375"	"50"	"1309"	"0"	"1309"	"0"	"c.1309C>T"	"r.(?)"	"p.(Arg437Trp)"	""
"0000997762"	"00001375"	"30"	"1310"	"0"	"1310"	"0"	"c.1310G>T"	"r.(?)"	"p.(Arg437Leu)"	""
"0000997763"	"00001375"	"50"	"1471"	"0"	"1471"	"0"	"c.1471G>A"	"r.(?)"	"p.(Val491Met)"	""
"0000997764"	"00001375"	"50"	"1656"	"3"	"1656"	"3"	"c.1656+3G>C"	"r.spl?"	"p.?"	""
"0000997765"	"00001375"	"30"	"2093"	"-4"	"2093"	"-4"	"c.2093-4C>A"	"r.spl?"	"p.?"	""
"0000997766"	"00001375"	"50"	"2240"	"0"	"2240"	"0"	"c.2240T>G"	"r.(?)"	"p.(Met747Arg)"	""
"0000997767"	"00001375"	"50"	"2681"	"0"	"2681"	"0"	"c.2681A>T"	"r.(?)"	"p.(Lys894Met)"	""
"0000997768"	"00001375"	"30"	"2951"	"0"	"2951"	"0"	"c.2951A>C"	"r.(?)"	"p.(Lys984Thr)"	""
"0000997769"	"00001375"	"30"	"4166"	"0"	"4166"	"0"	"c.4166G>A"	"r.(?)"	"p.(Arg1389His)"	""
"0000997770"	"00001375"	"50"	"4457"	"0"	"4464"	"0"	"c.4457_4464del"	"r.(?)"	"p.(Val1486Aspfs*6)"	""
"0000997771"	"00001375"	"90"	"5177"	"0"	"5177"	"0"	"c.5177T>A"	"r.(?)"	"p.(Leu1726*)"	""
"0000997772"	"00001375"	"30"	"5398"	"0"	"5398"	"0"	"c.5398C>T"	"r.(?)"	"p.(Arg1800Trp)"	""
"0000997773"	"00001375"	"30"	"5870"	"0"	"5870"	"0"	"c.5870G>A"	"r.(?)"	"p.(Arg1957His)"	""
"0000997774"	"00001375"	"30"	"6154"	"0"	"6154"	"0"	"c.6154C>T"	"r.(?)"	"p.(His2052Tyr)"	""
"0000997775"	"00001375"	"50"	"6158"	"0"	"6163"	"0"	"c.6158_6163del"	"r.(?)"	"p.(His2053_His2054del)"	""
"0000997776"	"00001375"	"50"	"6377"	"0"	"6377"	"0"	"c.6377G>A"	"r.(?)"	"p.(Arg2126His)"	""
"0001025648"	"00001375"	"50"	"1934"	"0"	"1934"	"0"	"c.1934A>G"	"r.(?)"	"p.(Asn645Ser)"	""
"0001037408"	"00001375"	"50"	"18"	"0"	"18"	"0"	"c.18C>A"	"r.(?)"	"p.(Asp6Glu)"	""
"0001037409"	"00001375"	"50"	"448"	"0"	"448"	"0"	"c.448A>G"	"r.(?)"	"p.(Ile150Val)"	""
"0001037410"	"00001375"	"30"	"501"	"0"	"501"	"0"	"c.501C>G"	"r.(?)"	"p.(Asn167Lys)"	""
"0001037411"	"00001375"	"50"	"1351"	"0"	"1351"	"0"	"c.1351G>A"	"r.(?)"	"p.(Ala451Thr)"	""
"0001037412"	"00001375"	"50"	"2800"	"0"	"2800"	"0"	"c.2800C>G"	"r.(?)"	"p.(Arg934Gly)"	""
"0001037413"	"00001375"	"30"	"6192"	"0"	"6192"	"0"	"c.6192G>A"	"r.(?)"	"p.(Gln2064=)"	""
"0001046192"	"00001375"	"10"	"5370"	"0"	"5370"	"0"	"c.5370C>T"	"r.(?)"	"p.(=)"	""
"0001046193"	"00001375"	"30"	"6144"	"0"	"6144"	"0"	"c.6144G>A"	"r.(?)"	"p.(=)"	""
"0001046194"	"00001375"	"30"	"6724"	"0"	"6724"	"0"	"c.6724G>C"	"r.(?)"	"p.(Asp2242His)"	""
"0001053488"	"00001375"	"50"	"1348"	"0"	"1348"	"0"	"c.1348C>T"	"r.(?)"	"p.(Arg450Cys)"	""
"0001053489"	"00001375"	"50"	"3622"	"0"	"3622"	"0"	"c.3622C>G"	"r.(?)"	"p.(Leu1208Val)"	""
"0001053490"	"00001375"	"50"	"3868"	"0"	"3868"	"0"	"c.3868A>G"	"r.(?)"	"p.(Met1290Val)"	""
"0001053491"	"00001375"	"50"	"6592"	"0"	"6592"	"0"	"c.6592C>T"	"r.(?)"	"p.(Arg2198Cys)"	""
"0001065187"	"00001375"	"50"	"6922"	"0"	"6922"	"0"	"c.6922C>T"	"r.(?)"	"p.(Arg2308Cys)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 11
"{{screeningid}}"	"{{variantid}}"
"0000000209"	"0000004787"
"0000029692"	"0000053074"
"0000052063"	"0000081503"
"0000052071"	"0000081511"
"0000297508"	"0000660110"
"0000304500"	"0000667947"
"0000304500"	"0000667948"
"0000310808"	"0000685824"
"0000310808"	"0000685826"
"0000419888"	"0000880134"
"0000429604"	"0000909186"