### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = CBS) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "CBS" "cystathionine-beta-synthase" "21" "q22.3" "no" "LRG_777" "UD_132118673695" "" "https://www.LOVD.nl/CBS" "Cystathionine beta-synthase (CBS) database " "1" "1550" "875" "613381" "1" "1" "1" "1" "For this database we have collaborated with the Kraus lab and their databases for deficiency of cystathionine beta-synthase (CBS) and propionyl CoA carboxylase (PCC). Most data collected derive from the CBS database (Jan P. Kraus, Sarah Venezia & Mirek Janosik) and we refer to the original source for more detailed information.\r\nEstablishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/CBS_codingDNA.html" "1" "" "" "-1" "" "-1" "00002" "2011-04-05 00:00:00" "00006" "2021-04-29 09:48:21" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000046" "CBS" "cystathionine-beta-synthase, transcript variant 1" "003" "NM_000071.2" "" "NP_000062.1" "" "" "" "-245" "2345" "1656" "44496040" "44473301" "00002" "2012-05-11 13:11:56" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01844" "CBSD" "homocystinuria, CBS deficiency (CBSD)" "AR" "236200" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02554" "metabolic syndrome" "metabolic syndrome" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2019-01-15 15:48:08" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04310" "sepsis" "sepsis" "" "" "" "" "" "00006" "2015-08-28 10:02:04" "" "" "05166" "SUD" "death, sudden, unexplained (SUD)" "" "" "" "" "" "00006" "2016-05-19 16:34:23" "00006" "2018-09-11 12:14:13" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "CBS" "00139" "CBS" "01844" ## Individuals ## Do not remove or alter this header ## ## Count = 751 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000034" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00046568" "" "" "" "168" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "group of German disease cases" "" "" "Germany" "" "0" "" "" "European" "" "00046569" "" "" "" "237" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "group of Greek disease cases" "" "" "Greece" "" "0" "" "" "European" "" "00047820" "" "" "" "307" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "control group of 307 individuals" "" "" "" "" "0" "" "" "" "" "00047822" "" "" "" "20" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "German disease cases" "" "" "Germany" "" "0" "" "" "European" "" "00047823" "" "" "" "4" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "German disease cases" "" "" "Germany" "" "0" "" "" "European" "" "00047824" "" "" "" "88" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "German disease cases" "" "" "Germany" "" "0" "" "" "European" "" "00047825" "" "" "" "36" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "German disease cases" "" "" "Germany" "" "0" "" "" "European" "" "00047826" "" "" "" "14" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "German disease cases" "" "" "Germany" "" "0" "" "" "European" "" "00047827" "" "" "" "3" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "German disease cases" "" "" "Germany" "" "0" "" "" "European" "" "00047828" "" "" "" "3" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "German disease cases" "" "" "Germany" "" "0" "" "" "European" "" "00047829" "" "" "" "13" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "Greek disease cases" "" "" "Greece" "" "0" "" "" "European" "" "00047830" "" "" "" "3" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "Greek disease cases" "" "" "Greece" "" "0" "" "" "European" "" "00047831" "" "" "" "2" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "Greek disease cases" "" "" "Greece" "" "0" "" "" "European" "" "00047832" "" "" "" "147" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "Greek disease cases" "" "" "Greece" "" "0" "" "" "European" "" "00047833" "" "" "" "46" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "Greek disease cases" "" "" "Greece" "" "0" "" "" "European" "" "00047834" "" "" "" "22" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "Greek disease cases" "" "" "Greece" "" "0" "" "" "European" "" "00047835" "" "" "" "1" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "Greek disease cases" "" "" "Greece" "" "0" "" "" "European" "" "00047836" "" "" "" "2" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "Greek disease cases" "" "" "Greece" "" "0" "" "" "European" "" "00047837" "" "" "" "1" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "Greek disease cases" "" "" "Greece" "" "0" "" "" "European" "" "00047838" "" "" "" "3" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "control group" "" "" "" "" "0" "" "" "European" "" "00047839" "" "" "" "57" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "control group" "" "" "" "" "0" "" "" "European" "" "00047840" "" "" "" "7" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "control group" "" "" "" "" "0" "" "" "European" "" "00047841" "" "" "" "1" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "control group" "" "" "" "" "0" "" "" "European" "" "00047842" "" "" "" "262" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "control group" "" "" "" "" "0" "" "" "European" "" "00047843" "" "" "" "45" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "control group" "" "" "" "" "0" "" "" "European" "" "00047844" "" "" "" "25" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "control group" "" "" "" "" "0" "" "" "European" "" "00047845" "" "" "" "3" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "control group" "" "" "" "" "0" "" "" "European" "" "00047846" "" "" "" "2" "" "01360" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "control group" "" "" "" "" "0" "" "" "European" "" "00081044" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected parents" "" "" "" "" "0" "" "" "" "" "00181014" "" "" "" "1" "" "02568" "" "" "" "" "" "" "" "" "" "" "" "00210166" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00226126" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" "" "00261361" "" "" "" "1" "" "00006" "{PMID:Kraus 1998:9790750}" "screened 15 controls" "" "" "" "" "0" "" "" "Europe" "controls" "00261363" "" "" "" "1" "" "00006" "{PMID:Chen 1999:10687314}" "" "" "" "Japan" "" "0" "" "" "" "" "00261364" "" "" "" "1" "" "00006" "{PMID:de Franchis 1994:7981678}" "" "" "" "Ireland" "" "0" "" "pyridoxine responsive" "Irish" "PatWC/TC/MC" "00261365" "" "" "" "1" "" "00006" "{PMID:Gallagher 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat005" "00261366" "" "" "" "1" "" "00006" "{PMID:Gallagher 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat245/248 (sibs)" "00261367" "" "" "" "1" "" "00006" "{PMID:de Franchis 1999:10408774}, {PMID:Kraus 1999:10338090}" "" "" "" "Italy" "" "0" "" "not pyridoxine responsive" "" "GT (2241)" "00261368" "" "" "" "1" "" "00006" "{PMID:Kozich 1993:8353501}" "" "F" "" "Ireland;Germany" "" "0" "" "pyridoxine responsive" "activity 0-0.20" "Pat676" "00261369" "" "" "" "1" "" "00006" "{PMID:de Franchis 1999:10408774}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "" "00261370" "" "" "" "1" "" "00006" "{PMID:de Franchis 1999:10408774}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "" "00261371" "" "" "" "1" "" "00006" "{PMID:de Franchis 1999:10408774}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "" "00261372" "" "" "" "1" "" "00006" "{PMID:de Franchis 1999:10408774}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "" "00261373" "" "" "" "1" "" "00006" "CBS mutation database, Sebastio" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "" "00261374" "" "" "" "1" "" "00006" "CBS mutation database, Sebastio" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "" "00261375" "" "" "" "1" "" "00006" "{PMID:Chen 1999:10687314}" "" "" "" "Japan" "" "0" "" "" "" "" "00261376" "" "" "" "1" "" "00006" "CBS mutation database, Shih" "" "" "" "Norway;Ireland;Germany" "" "0" "" "not pyridoxine responsive" "" "" "00261377" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Norway;Ireland;Germany" "" "0" "" "" "" "F13L64" "00261378" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "China" "" "0" "" "not pyridoxine responsive" "" "R600" "00261379" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, R Gordon" "" "" "" "Portugal" "" "0" "" "not pyridoxine responsive" "" "SGo" "00261380" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "" "" "" "Italy" "" "0" "" "partially pyridoxine responsive" "" "Pat1 (LG)" "00261381" "" "" "" "1" "" "00006" "{PMID:Coude 1998:9870207}" "" "" "" "France" "" "0" "" "not pyridoxine responsive" "" "P977" "00261382" "" "" "" "1" "" "00006" "{PMID:Shih 1995:7611293}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat3 (L264)" "00261383" "" "" "" "1" "" "00006" "{PMID:Shih 1995:7611293}" "" "" "" "England" "" "0" "" "pyridoxine responsive" "" "Pat5 (L265)" "00261384" "" "" "" "1" "" "00006" "{PMID:Gordon 1997:10215408}" "" "" "" "England;Wales" "" "0" "" "not pyridoxine responsive" "" "Pat1" "00261385" "" "" "" "1" "" "00006" "{PMID:Dawson 1997:9156316}" "" "" "" "Australia" "" "0" "" "partially pyridoxine responsive" "" "Pat3" "00261386" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, T Ohura" "newborn screening" "" "" "Japan" "" "0" "" "not pyridoxine responsive" "" "TS" "00261387" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "" "" "0" "" "not pyridoxine responsive" "Irish/Italian, Scandinavian" "" "00261388" "" "" "" "1" "" "00006" "CBS mutation database, Shih" "" "" "" "United States" "" "0" "" "not pyridoxine responsive" "African American" "" "00261389" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "partially pyridoxine responsive" "" "MK66" "00261390" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "MC62/JC07" "00261391" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "not pyridoxine responsive" "" "AP67" "00261392" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1995:7635485}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "Pat1" "00261393" "" "" "" "1" "" "00006" "{PMID:Gordon 1997:10215408}" "" "" "" "South Africa" "" "0" "" "not pyridoxine responsive" "" "Pat2" "00261394" "" "" "" "1" "" "00006" "{PMID:Kruger 1995:8528202}" "patient" "" "" "" "" "0" "" "" "" "GM01374" "00261395" "" "" "" "1" "" "00006" "{PMID:Kozich 1997:9266356}" "" "" "" "Slovakia (Slovak Republic)" "" "0" "" "not pyridoxine responsive" "" "Pat428" "00261396" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "AdZ46" "00261397" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, L Kluijtmans" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "S" "00261398" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Canada" "" "0" "" "not pyridoxine responsive" "France;United Kingdom (Great Britain)" "MGL199 (DM)" "00261399" "" "" "" "1" "" "00006" "{PMID:Kruger 1995:8528202}" "father patient" "M" "" "" "" "0" "" "" "" "GM01559" "00261400" "" "" "" "1" "" "00006" "CBS mutation database, Shih" "" "" "" "Puerto Rico" "" "0" "" "not pyridoxine responsive" "" "" "00261401" "" "" "" "1" "" "00006" "{PMID:de Franchis 1994:7981678}" "" "" "" "Ireland" "" "0" "" "pyridoxine responsive" "Irish" "PatWC/TC/MC" "00261402" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "" "" "" "Italy" "" "0" "" "not pyridoxine responsive" "" "Pat2 (ON)" "00261403" "" "" "" "1" "" "00006" "{PMID:Chen 1999:10687314}" "" "" "" "Japan" "" "0" "" "" "" "" "00261404" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Italy" "" "0" "" "not pyridoxine responsive" "" "F542" "00261405" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "" "" "0" "" "not pyridoxine responsive" "Ir, Fr/Engl, Fr" "R510 (1281)" "00261406" "" "" "" "1" "" "00006" "{PMID:Kim 1997:9361025}" "" "F" "" "Norway" "" "0" "" "not pyridoxine responsive" "" "PatN2" "00261407" "" "" "" "1" "" "00006" "{PMID:Kim 1997:9361025}" "" "M" "" "Norway" "" "0" "" "pyridoxine responsive" "" "PatN1" "00261408" "" "" "" "1" "" "00006" "{PMID:Kim 1997:9361025}" "" "M" "" "Norway" "" "0" "" "pyridoxine responsive" "" "PatN9" "00261409" "" "" "" "1" "" "00006" "{PMID:Kim 1997:9361025}" "" "F" "" "Norway" "" "0" "" "pyridoxine responsive" "" "PatN8" "00261410" "" "" "" "1" "" "00006" "{PMID:Kim 1997:9361025}" "" "M" "" "Norway" "" "0" "" "pyridoxine responsive" "" "PatN4a" "00261411" "" "" "" "1" "" "00006" "{PMID:Shih 1995:7611293}" "" "" "" "Poland" "" "0" "" "pyridoxine responsive" "" "Pat2" "00261412" "" "" "" "1" "" "00006" "{PMID:Shih 1995:7611293}" "" "" "" "Germany;Norway" "" "0" "" "pyridoxine responsive" "" "Pat1 (L188)" "00261413" "" "" "" "1" "" "00006" "CBS mutation database, Shih" "" "" "" "" "" "0" "" "pyridoxine responsive" "Jewish" "" "00261414" "" "" "" "1" "" "00006" "{PMID:Shih 1995:7611293}" "" "" "" "" "" "0" "" "pyridoxine responsive" "Jewish-Ashkenazi" "Pat4" "00261415" "" "" "" "1" "" "00006" "{PMID:Kozich and Kraus 1992:1301198}" "" "" "" "Italy;France" "" "0" "" "" "" "not in paper" "00261416" "" "" "" "1" "" "00006" "CBS mutation database, Sebastio" "" "" "" "Italy" "" "0" "" "" "" "" "00261417" "" "" "" "1" "" "00006" "{PMID:Sperandeo 1996:8803779}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Fam1PatHG" "00261418" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "family, 3 affected" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat3a (SS)" "00261419" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "family, 2 affected" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat4a (ML)" "00261420" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "Fam1Pat1/2/3" "00261421" "" "" "" "1" "" "00006" "CBS mutation database, Kluijtmans" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261422" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261423" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261424" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261425" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261426" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261427" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261428" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "partially pyridoxine responsive" "" "" "00261429" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "partially pyridoxine responsive" "" "" "00261430" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261431" "" "" "" "1" "" "00006" "{PMID:Kozich and Kraus 1992:1301198}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "not in paper" "00261432" "" "" "" "1" "" "00006" "{PMID:Kozich and Kraus 1992:1301198}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "not in paper" "00261433" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat10 (SA)" "00261434" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261435" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261436" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "partially pyridoxine responsive" "" "" "00261437" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "partially pyridoxine responsive" "" "" "00261438" "" "" "" "1" "" "00006" "CBS mutation database, Kluijtmans" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261439" "" "" "" "1" "" "00006" "CBS mutation database, Kluijtmans" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261440" "" "" "" "1" "" "00006" "CBS mutation database, Kluijtmans" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261441" "" "" "" "1" "" "00006" "CBS mutation database, Kluijtmans" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261442" "" "" "" "1" "" "00006" "{PMID:Kozich and Kraus 1992:1301198}" "" "" "" "" "" "0" "" "" "" "not in paper" "00261443" "" "" "" "1" "" "00006" "{PMID:Tsai 1997:10462600}" "" "" "" "Italy;Poland" "" "0" "" "pyridoxine responsive" "" "Pat2" "00261444" "" "" "" "1" "" "00006" "{PMID:Tsai 1996:8884070}" "" "" "" "" "" "0" "" "pyridoxine responsive" "" "Pat1" "00261445" "" "" "" "1" "" "00006" "{PMID:Tsai 1996:8884070}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Wales" "Pat4" "00261446" "" "" "" "1" "" "00006" "{PMID:Tsai 1996:8884070}" "" "" "" "" "" "0" "" "pyridoxine responsive" "" "Pat2" "00261447" "" "" "" "1" "" "00006" "{PMID:Tsai 1996:8884070}" "" "" "" "" "" "0" "" "pyridoxine responsive" "" "Pat3" "00261448" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}" "" "M" "" "Czech Republic" "" "0" "" "pyridoxine responsive" "" "Pat21" "00261449" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}" "" "M" "" "Czech Republic" "" "0" "" "pyridoxine responsive" "" "Pat20" "00261450" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, V Kozich" "" "" "" "Hungary" "" "0" "" "pyridoxine responsive" "" "426" "00261451" "" "" "" "1" "" "00006" "{PMID:Kim 1997:9361025}" "" "M" "" "Norway" "" "0" "" "not pyridoxine responsive" "" "PatN7" "00261452" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "pyridoxine responsive" "" "" "00261453" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "pyridoxine responsive" "" "" "00261454" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "pyridoxine responsive" "" "" "00261455" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "pyridoxine responsive" "" "" "00261456" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "pyridoxine responsive" "" "" "00261457" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 1998:9708897}" "" "" "" "Denmark" "" "0" "" "partially pyridoxine responsive" "" "Pat" "00261458" "" "" "" "1" "" "00006" "{PMID:Sperandeo 1995:7564249}" "" "" "" "Spain" "" "0" "" "pyridoxine responsive" "" "Pat1" "00261459" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "Ireland" "" "0" "" "" "Irish" "" "00261460" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "Ireland" "" "0" "" "" "Irish" "" "00261461" "" "" "" "1" "" "00006" "{PMID:Hu 1993:7506602}" "" "" "" "Ireland" "" "0" "" "not pyridoxine responsive" "Irish" "FamIPatL166" "00261462" "" "" "" "1" "" "00006" "{PMID:Hu 1993:7506602}" "" "" "" "Ireland" "" "0" "" "not pyridoxine responsive" "Irish" "FamIPatL198" "00261463" "" "" "" "1" "" "00006" "{PMID:Hu 1993:7506602}" "" "" "" "Ireland" "" "0" "" "not pyridoxine responsive" "Irish" "FamIIIPatL246" "00261464" "" "" "" "1" "" "00006" "{PMID:Hu 1993:7506602}" "" "" "" "Ireland" "" "0" "" "not pyridoxine responsive" "Irish" "FamIIIPatF49" "00261465" "" "" "" "1" "" "00006" "{PMID:Hu 1993:7506602}" "" "" "" "" "" "0" "" "" "German/French, Dutch, Irish, English" "FamVPatL203" "00261466" "" "" "" "1" "" "00006" "{PMID:Hu 1993:7506602}" "" "" "" "" "" "0" "" "" "English, Irish, German/Italian, German" "FamVIPatL215" "00261467" "" "" "" "1" "" "00006" "{PMID:Hu 1993:7506602}" "" "" "" "England;Scotland" "" "0" "" "" "" "FamIVPatL183" "00261468" "" "" "" "1" "" "00006" "{PMID:Hu 1993:7506602}" "" "" "" "Ireland;Ukraine" "" "0" "" "" "Jewish-Ashkenazi" "FamVIIPatL219" "00261469" "" "" "" "1" "" "00006" "{PMID:Hu 1993:7506602}" "" "" "" "Scotland;France" "" "0" "" "" "French/Scottish, French" "FamIIPatL171" "00261470" "" "" "" "1" "" "00006" "CBS mutation database, Gordon" "" "" "" "Ireland" "" "0" "" "not pyridoxine responsive" "Irish" "" "00261471" "" "" "" "1" "" "00006" "CBS mutation database, Gordon" "" "" "" "Ireland" "" "0" "" "not pyridoxine responsive" "Irish" "" "00261472" "" "" "" "1" "" "00006" "{PMID:de Franchis 1999:10408774}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "England" "" "00261473" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat002" "00261474" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat010" "00261475" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat061" "00261476" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat117" "00261477" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat157" "00261478" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat224" "00261479" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat227" "00261480" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat062/239 (sibs)" "00261481" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat216" "00261482" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat215/241 (sibs)" "00261483" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat066/067 (sibs)" "00261484" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat240" "00261485" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat008" "00261486" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat024" "00261487" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat228" "00261488" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat243" "00261489" "" "" "" "1" "" "00006" "{PMID:Gallager 1998:9889017}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat040 (cousin of 245/248" "00261490" "" "" "" "1" "" "00006" "CBS mutation database, Gallagher" "" "" "" "Norway" "" "0" "" "" "" "" "00261491" "" "" "" "1" "" "00006" "CBS mutation database, Shih" "" "" "" "Ireland" "" "0" "" "not pyridoxine responsive" "Irish" "" "00261492" "" "" "" "1" "" "00006" "CBS mutation database, Shih" "" "" "" "Brazil" "" "0" "" "" "Portugal" "" "00261493" "" "" "" "1" "" "00006" "CBS mutation database, Shih" "" "" "" "Brazil" "" "0" "" "" "Portugal" "" "00261494" "" "" "" "1" "" "00006" "CBS mutation database, Shih" "" "" "" "Portugal" "" "0" "" "" "" "" "00261495" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "MGL66" "00261496" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "MGL246" "00261497" "" "" "" "1" "" "00006" "CBS mutation database, Shih" "" "" "" "United States" "" "0" "" "not pyridoxine responsive" "African American" "" "00261498" "" "" "" "1" "" "00006" "CBS mutation database, Shih" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "England" "" "00261499" "" "" "" "1" "" "00006" "CBS mutation database, Gordon" "" "" "" "Australia" "" "0" "" "" "" "" "00261500" "" "" "" "1" "" "00006" "CBS mutation database, Gordon" "" "" "" "Australia" "" "0" "" "" "" "" "00261501" "" "" "" "1" "" "00006" "CBS mutation database, Kruger" "" "" "" "" "" "0" "" "" "" "" "00261502" "" "" "" "1" "" "00006" "CBS mutation database, Kruger" "" "" "" "" "" "0" "" "" "" "" "00261503" "" "" "" "1" "" "00006" "{PMID:Tsai 1997:9232191}" "" "" "" "" "" "0" "" "pyridoxine responsive" "English, Irish, Dutch, German" "Fam (2 sibs)" "00261504" "" "" "" "1" "" "00006" "{PMID:Tsai 1996:8884070}" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "Pat7" "00261505" "" "" "" "1" "" "00006" "{PMID:Tsai 1996:8884070}" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "Pat8" "00261506" "" "" "" "1" "" "00006" "CBS mutation database, Tsai" "" "" "" "" "" "0" "" "" "" "" "00261507" "" "" "" "1" "" "00006" "{PMID:Kim 1997:9361025}" "" "M" "" "Norway" "" "0" "" "not pyridoxine responsive" "" "PatN3" "00261508" "" "" "" "1" "" "00006" "{PMID:Kim 1997:9361025}" "" "F" "" "Norway" "" "0" "" "not pyridoxine responsive" "" "PatN5" "00261509" "" "" "" "1" "" "00006" "{PMID:Kim 1997:9361025}" "" "M" "" "Norway" "" "0" "" "not pyridoxine responsive" "" "PatN10" "00261510" "" "" "" "1" "" "00006" "{PMID:Dawson 1997:9156316}" "" "" "" "Australia" "" "0" "" "" "" "Pat2" "00261511" "" "" "" "1" "" "00006" "{PMID:Kruger 1995:8528202}" "mother patient" "F" "" "" "" "0" "" "" "" "GM01363" "00261512" "" "" "" "1" "" "00006" "{PMID:de Franchis 1999:10408774}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "England" "" "00261513" "" "" "" "1" "" "00006" "{PMID:Coude 1998:9870207}" "" "" "" "" "" "0" "" "pyridoxine responsive" "North African" "Pat7216" "00261514" "" "" "" "1" "" "00006" "{PMID:Coude 1998:9870207}" "" "" "" "" "" "0" "" "pyridoxine responsive" "North African" "Pat7215" "00261515" "" "" "" "1" "" "00006" "{PMID:Dawson 1997:9156316}" "" "" "" "Australia" "" "0" "" "partially pyridoxine responsive" "" "Pat1" "00261516" "" "" "" "1" "" "00006" "{PMID:Coude 1998:9870207}" "" "" "" "Portugal" "" "0" "" "not pyridoxine responsive" "" "Pat3013" "00261517" "" "" "" "1" "" "00006" "{PMID:Castro 2001:11553052}" "" "" "" "Portugal" "" "0" "" "not pyridoxine responsive" "" "PatB" "00261518" "" "" "" "1" "" "00006" "{PMID:Kim 1997:9361025}" "" "F" "" "Norway" "" "0" "" "pyridoxine responsive" "" "PatN6a" "00261519" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "GMV29" "00261520" "" "" "" "1" "" "00006" "{PMID:Kraus 1994:7967489}" "" "" "" "Ireland" "" "0" "" "" "Irish" "Pat?" "00261521" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "JM61" "00261522" "" "" "" "1" "" "00006" "{PMID:Aral 1997:8990018}" "" "" "" "France" "" "0" "" "pyridoxine responsive" "" "Pat465" "00261523" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Lebanon" "" "0" "" "partially pyridoxine responsive" "" "" "00261524" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Lebanon" "" "0" "" "partially pyridoxine responsive" "" "" "00261525" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "not pyridoxine responsive" "" "" "00261526" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "partially pyridoxine responsive" "" "Fam7Pat14/15" "00261527" "" "" "" "1" "" "00006" "{PMID:Maclean 2002:12007221}" "" "M" "" "Denmark" "" "0" "" "not pyridoxine responsive" "" "Pat2" "00261528" "" "" "" "1" "" "00006" "{PMID:Tsai 1997:10462600}" "" "" "" "England;Germany" "" "0" "" "pyridoxine responsive" "" "Pat1" "00261529" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1996:8755636}" "" "" "" "Netherlands" "" "0" "" "partially pyridoxine responsive" "" "Pat" "00261530" "" "" "" "1" "" "00006" "CBS mutation database, Shih" "" "" "" "Venezuela" "" "0" "" "pyridoxine responsive" "" "" "00261531" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "partially pyridoxine responsive" "" "" "00261532" "" "" "" "1" "" "00006" "{PMID:Maclean 2002:12007221}" "" "F" "" "Denmark" "" "0" "" "not pyridoxine responsive" "" "Pat1" "00261533" "" "" "" "1" "" "00006" "{PMID:Maclean 2002:12007221}" "" "F" "" "Denmark" "" "0" "" "not pyridoxine responsive" "" "Pat3" "00261534" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, Coude 1995" "" "" "" "France" "" "0" "" "" "" "" "00261535" "" "" "" "1" "" "00006" "{PMID:Aral 1997:8990018}" "" "" "" "France" "" "0" "" "pyridoxine responsive" "" "Pat325" "00261536" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}" "" "M" "" "Czech Republic" "" "0" "" "pyridoxine responsive" "" "Pat18" "00261537" "" "" "" "1" "" "00006" "{PMID:Coude 1998:9870207}" "" "" "" "" "" "0" "" "not pyridoxine responsive" "North African" "Pat323" "00261538" "" "" "" "1" "" "00006" "{PMID:Chen 1999:10687314}" "" "" "" "Japan" "" "0" "" "" "" "" "00261539" "" "" "" "1" "" "00006" "{PMID:Kozich 1997:9301969}" "" "" "" "Slovakia (Slovak Republic)" "" "0" "" "not pyridoxine responsive" "" "419" "00261540" "" "" "" "1" "" "00006" "{PMID:Kozich 1997:9301969}" "" "" "" "Slovakia (Slovak Republic)" "" "0" "" "not pyridoxine responsive" "" "Pat" "00261541" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "United States" "" "0" "" "not pyridoxine responsive" "African American" "MGL254" "00261542" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Haiti" "" "0" "" "not pyridoxine responsive" "" "MGL217" "00261543" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Brazil" "" "0" "" "" "" "" "00261544" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 1998:9708897}" "" "" "" "Denmark" "" "0" "" "partially pyridoxine responsive" "" "Pat" "00261545" "" "" "" "1" "" "00006" "{PMID:Kozich 1997:9301969}" "" "" "" "" "" "0" "" "not pyridoxine responsive" "Arab" "3149" "00261546" "" "" "" "1" "" "00006" "{PMID:Chen 1999:10687314}" "" "" "" "Japan" "" "0" "" "" "" "" "00261547" "" "" "" "1" "" "00006" "{PMID:Sperandeo 1995:7564249}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "2 carrier brothers" "Pat2" "00261548" "" "" "" "1" "" "00006" "{PMID:Kruger 1995:8528202}" "father patient" "M" "" "" "" "0" "" "" "" "GM01528" "00261549" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "" "M" "" "Slovakia (Slovak Republic)" "" "0" "" "partially pyridoxine responsive" "" "Pat13 (sib15)" "00261550" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}" "" "F" "" "Slovakia (Slovak Republic)" "" "0" "" "partially pyridoxine responsive" "" "Pat15 (sib13)" "00261551" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "" "M" "" "Czech Republic" "" "0" "" "not pyridoxine responsive" "" "Pat4" "00261552" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "" "F" "" "Czech Republic" "" "0" "" "pyridoxine responsive" "" "Pat19" "00261553" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "" "M" "" "Slovakia (Slovak Republic)" "" "0" "" "not pyridoxine responsive" "" "Pat6" "00261554" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, H Koch" "" "" "" "Germany" "" "0" "" "not pyridoxine responsive" "" "CM" "00261555" "" "" "" "1" "" "00006" "{PMID:Kozich and Kraus 1992:1301198}" "" "" "" "" "" "0" "" "pyridoxine responsive" "Jewish" "Pat366" "00261556" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, M Tsai" "" "" "" "" "" "0" "" "pyridoxine responsive" "" "TD" "00261557" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, H Koch" "" "" "" "Germany" "" "0" "" "not pyridoxine responsive" "" "MK66" "00261558" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Austria" "" "0" "" "not pyridoxine responsive" "" "" "00261559" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Turkey" "" "0" "" "not pyridoxine responsive" "" "" "00261560" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Turkey" "" "0" "" "not pyridoxine responsive" "" "" "00261561" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Turkey" "" "0" "" "not pyridoxine responsive" "" "" "00261562" "" "" "" "1" "" "00006" "CBS mutation database, Ben de Wet JM" "" "" "" "South Africa" "" "0" "" "" "black" "" "00261563" "" "" "" "1" "" "00006" "{PMID:Castro 2001:11553052}" "" "" "" "Portugal" "" "0" "" "partially pyridoxine responsive" "" "PatA" "00261564" "" "" "" "1" "" "00006" "{PMID:Castro 2001:11553052}" "" "" "" "Portugal" "" "0" "" "not pyridoxine responsive" "" "PatC" "00261565" "" "" "" "1" "" "00006" "{PMID:Chen 1999:10687314}" "" "" "" "Japan" "" "0" "" "" "" "" "00261566" "" "" "" "1" "" "00006" "CBS mutation database, Ohura" "" "" "" "Japan" "" "0" "" "" "" "" "00261567" "" "" "" "1" "" "00006" "{PMID:Kozich 1997:9301969}" "" "" "" "" "" "0" "" "" "Arab" "PatArab" "00261568" "" "" "" "1" "" "00006" "{PMID:de Franchis 1994:7981678}" "family, 3 affected sibs" "" "" "Ireland" "" "0" "" "pyridoxine responsive" "Irish" "PatTC" "00261569" "" "" "" "1" "" "00006" "{PMID:de Franchis 1994:7981678}" "family, 3 affected sibs" "" "" "Ireland" "" "0" "" "pyridoxine responsive" "Irish" "PatTC" "00261570" "" "" "" "1" "" "00006" "{PMID:Marble 1994:7849717}" "" "" "" "Ireland" "" "0" "" "not pyridoxine responsive" "Irish" "Pat1" "00261571" "" "" "" "1" "" "00006" "{PMID:Kim 1997:9361025}" "" "M" "" "Norway" "" "0" "" "pyridoxine responsive" "" "PatN4b" "00261572" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "" "00261573" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "family, 3 affected" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat3a (SS)" "00261574" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}, {PMID:Sperandeo 1996:8940285}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat12 (CG)" "00261575" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Netherlands" "" "0" "" "partially pyridoxine responsive" "" "" "00261576" "" "" "" "1" "" "00006" "{PMID:Kim 1997:9361025}" "" "M" "" "Norway" "" "0" "" "pyridoxine responsive" "" "PatN6b" "00261577" "" "" "" "1" "" "00006" "{PMID:de Franchis 1999:10408774}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "" "00261578" "" "" "" "1" "" "00006" "{PMID:de Franchis 1999:10408774}, {PMID:Kraus 1999:10338090}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "AnD (sib 2242)" "00261579" "" "" "" "1" "" "00006" "{PMID:de Franchis 1999:10408774}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "England" "Pat3064" "00261580" "" "" "" "1" "" "00006" "CBS mutation database, Gallagher" "" "" "" "Ireland" "" "0" "" "" "Irish" "" "00261581" "" "" "" "1" "" "00006" "{PMID:Chen 1999:10687314}" "" "" "" "Japan" "" "0" "" "" "" "" "00261582" "" "" "" "1" "" "00006" "{PMID:Shih 1995:7611293}" "" "" "" "" "" "0" "" "partially pyridoxine responsive" "German/Polish,French" "Pat7" "00261583" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}" "" "F" "" "Slovakia (Slovak Republic)" "" "0" "" "not pyridoxine responsive" "" "Pat3" "00261584" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}" "" "F" "" "Czech Republic" "" "0" "" "not pyridoxine responsive" "" "Pat1" "00261585" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}" "" "M" "" "Slovakia (Slovak Republic)" "" "0" "" "not pyridoxine responsive" "" "Pat7" "00261586" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}" "" "M" "" "Czech Republic" "" "0" "" "not pyridoxine responsive" "" "Pat8 (sib10)" "00261587" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}" "" "M" "" "Czech Republic" "" "0" "" "not pyridoxine responsive" "" "Pat11" "00261588" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "" "M" "" "Czech Republic" "" "0" "" "not pyridoxine responsive" "" "Pat2" "00261589" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "" "F" "" "Slovakia (Slovak Republic)" "" "0" "" "partially pyridoxine responsive" "" "Pat9" "00261590" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}" "" "M" "" "Slovakia (Slovak Republic)" "" "0" "" "pyridoxine responsive" "" "Pat16 (sib17)" "00261591" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}" "" "F" "" "Czech Republic" "" "0" "" "pyridoxine responsive" "" "Pat17 (sib16)" "00261592" "" "" "" "1" "" "00006" "{PMID:Castro 2001:11553052}" "" "" "" "Portugal" "" "0" "" "partially pyridoxine responsive" "" "PatA" "00261593" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}" "" "M" "" "Czech Republic" "" "0" "" "not pyridoxine responsive" "" "Pat10 (sib8)" "00261594" "" "" "" "1" "" "00006" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "" "M" "" "Slovakia (Slovak Republic)" "" "0" "" "partially pyridoxine responsive" "" "Pat12" "00261595" "" "" "" "1" "" "00006" "{PMID:Maclean 2002:12007221}" "" "F" "" "Denmark" "" "0" "" "not pyridoxine responsive" "" "Pat4" "00261596" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2000:10780316}" "" "" "" "Denmark" "" "0" "" "not pyridoxine responsive" "" "" "00261597" "" "" "" "1" "" "00006" "{PMID:Gat-Yablonski 2000:11013450}" "" "" "" "" "" "0" "" "" "Arab" "" "00261598" "" "" "" "1" "" "00006" "{PMID:Gat-Yablonski 2000:11013450}" "" "" "" "" "" "0" "" "" "Arab" "Pat" "00261599" "" "" "" "1" "" "00006" "{PMID:Kruger 2003:14635102}" "" "" "" "United States" "" "0" "" "not pyridoxine responsive" "African American" "Pat4" "00261600" "" "" "" "1" "" "00006" "{PMID:Kruger 2003:14635102}" "" "" "" "United States" "" "0" "" "pyridoxine responsive" "African American" "Pat5" "00261601" "" "" "" "1" "" "00006" "{PMID:Kruger 2003:14635102}" "" "" "" "United States" "" "0" "" "not pyridoxine responsive" "African American" "pat7" "00261602" "" "" "" "1" "" "00006" "{PMID:Kruger 2003:14635102}" "" "" "" "United States" "" "0" "" "not pyridoxine responsive" "African American" "Pat12" "00261603" "" "" "" "1" "" "00006" "{PMID:Kruger 2003:14635102}" "" "" "" "" "" "0" "" "not pyridoxine responsive" "white" "Pat2" "00261604" "" "" "" "1" "" "00006" "{PMID:Kruger 2003:14635102}" "" "" "" "" "" "0" "" "not pyridoxine responsive" "white" "Pat10" "00261605" "" "" "" "1" "" "00006" "{PMID:Kruger 2003:14635102}" "" "" "" "" "" "0" "" "" "white" "Pat9" "00261606" "" "" "" "1" "" "00006" "{PMID:Kruger 2003:14635102}" "" "" "" "" "" "0" "" "partially pyridoxine responsive" "white" "Pat3" "00261607" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261608" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261609" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261610" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "pyridoxine responsive" "" "" "00261611" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261612" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "" "00261613" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "" "00261614" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261615" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "" "00261616" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "" "00261617" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "" "00261618" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "" "00261619" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261620" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261621" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261622" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261623" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261624" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261625" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261626" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261627" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261628" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261629" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261630" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261631" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261632" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261633" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261634" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261635" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261636" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261637" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261638" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261639" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261640" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261641" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261642" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261643" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "pyridoxine responsive" "" "" "00261644" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "" "00261645" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "" "00261646" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "pyridoxine responsive" "" "" "00261647" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "pyridoxine responsive" "" "" "00261648" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "partially pyridoxine responsive" "" "" "00261649" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "partially pyridoxine responsive" "" "" "00261650" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "" "00261651" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "not pyridoxine responsive" "" "" "00261652" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "pyridoxine responsive" "" "" "00261653" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "pyridoxine responsive" "" "" "00261654" "" "" "" "1" "" "00006" "CBS mutation database, Kraus" "" "" "" "" "" "0" "" "" "" "" "00261655" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261656" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261657" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261658" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261659" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261660" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261661" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261662" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261663" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261664" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261665" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261666" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "Anglo-Celtic" "" "00261667" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261668" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261669" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261670" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261671" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261672" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261673" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261674" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261675" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261676" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261677" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261678" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261679" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261680" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261681" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261682" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261683" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261684" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Portugal" "" "0" "" "not pyridoxine responsive" "" "" "00261685" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Portugal" "" "0" "" "not pyridoxine responsive" "" "" "00261686" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261687" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261688" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "partially pyridoxine responsive" "Anglo-Celtic" "" "00261689" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "partially pyridoxine responsive" "Anglo-Celtic" "" "00261690" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261691" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261692" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261693" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261694" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261695" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Australia" "" "0" "" "" "" "" "00261696" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Australia" "" "0" "" "partially pyridoxine responsive" "" "" "00261697" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261698" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261699" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261700" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat19" "00261701" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Portugal" "" "0" "" "not pyridoxine responsive" "" "Pat18" "00261702" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat05" "00261703" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat05" "00261704" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat08" "00261705" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat07" "00261706" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat15" "00261707" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat03a/b" "00261708" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat03b" "00261709" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat02" "00261710" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Portugal" "" "0" "" "not pyridoxine responsive" "" "Pat16" "00261711" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat13" "00261712" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat09" "00261713" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261714" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261715" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "" "" "0" "" "" "" "" "00261716" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "" "" "0" "" "" "" "" "00261717" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261718" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261719" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261720" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261721" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261722" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261723" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261724" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "partially pyridoxine responsive" "" "" "00261725" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "partially pyridoxine responsive" "" "" "00261726" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "partially pyridoxine responsive" "" "" "00261727" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "partially pyridoxine responsive" "" "" "00261728" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261729" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261730" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261731" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261732" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "partially pyridoxine responsive" "" "" "00261733" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "partially pyridoxine responsive" "" "" "00261734" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Croatia (Hrvatska)" "" "0" "" "" "" "" "00261735" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Croatia (Hrvatska)" "" "0" "" "" "" "" "00261736" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261737" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "not pyridoxine responsive" "Anglo-Celtic" "" "00261738" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "pyridoxine responsive" "Anglo-Celtic" "" "00261739" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Lebanon" "" "0" "" "not pyridoxine responsive" "" "" "00261740" "" "" "" "1" "" "00006" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Lebanon" "" "0" "" "not pyridoxine responsive" "" "" "00261741" "" "" "" "1" "" "00006" "{PMID:Orendae 2004:15146473}" "" "" "" "Poland" "" "0" "" "not pyridoxine responsive" "" "Pat4" "00261742" "" "" "" "1" "" "00006" "{PMID:Orendae 2004:15146473}" "" "" "" "Poland" "" "0" "" "not pyridoxine responsive" "" "Pat1 (sib Pat2)" "00261743" "" "" "" "1" "" "00006" "{PMID:Orendae 2004:15146473}" "" "" "" "Poland" "" "0" "" "not pyridoxine responsive" "" "Pat3" "00261744" "" "" "" "1" "" "00006" "{PMID:Orendae 2004:15146473}" "" "" "" "Poland" "" "0" "" "not pyridoxine responsive" "" "Pat2 (sib Pat1)" "00261745" "" "" "" "1" "" "00006" "{PMID:Orendae 2004:15146473}" "" "" "" "Poland" "" "0" "" "not pyridoxine responsive" "" "Pat5" "00261746" "" "" "" "1" "" "00006" "{PMID:Orendae 2004:15146473}" "" "" "" "Poland" "" "0" "" "not pyridoxine responsive" "" "Pat6" "00261747" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat11" "00261748" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat10" "00261749" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Portugal" "" "0" "" "not pyridoxine responsive" "" "Pat17" "00261750" "" "" "" "1" "" "00006" "{PMID:Urreizti 2003:12815602}" "" "" "" "Spain" "" "0" "" "not pyridoxine responsive" "" "Pat20" "00261751" "" "" "" "1" "" "00006" "{PMID:Kruger 2003:14635102}" "" "" "" "" "" "0" "" "not pyridoxine responsive" "white" "Pat11" "00261752" "" "" "" "1" "" "00006" "{PMID:Kruger 2003:14635102}" "" "" "" "" "" "0" "" "partially pyridoxine responsive" "white" "Pat8" "00261753" "" "" "" "1" "" "00006" "{PMID:Kruger 2003:14635102}" "" "" "" "" "" "0" "" "not pyridoxine responsive" "white" "Pat6" "00261754" "" "" "" "1" "" "00006" "{PMID:Kruger 2003:14635102}" "" "" "" "" "" "0" "" "pyridoxine responsive" "white" "Pat1" "00261755" "" "" "" "1" "" "00006" "CBS mutation database, DAlmeida 2003" "" "" "" "" "" "0" "" "pyridoxine responsive" "South Amerindian" "" "00261756" "" "" "" "1" "" "00006" "CBS mutation database, DAlmeida 2003" "" "" "" "Brazil" "" "0" "" "pyridoxine responsive" "" "" "00261757" "" "" "" "1" "" "00006" "CBS mutation database, DAlmeida 2003" "" "" "" "Portugal" "" "0" "" "not pyridoxine responsive" "" "" "00261758" "" "" "" "1" "" "00006" "CBS mutation database, DAlmeida 2003" "" "" "" "Portugal" "" "0" "" "not pyridoxine responsive" "" "" "00261759" "" "" "" "1" "" "00006" "CBS mutation database, DAlmeida 2003" "" "" "" "Portugal" "" "0" "" "not pyridoxine responsive" "" "" "00261760" "" "" "" "1" "" "00006" "CBS mutation database, DAlmeida 2003" "" "" "" "Brazil" "" "0" "" "not pyridoxine responsive" "" "" "00261761" "" "" "" "1" "" "00006" "{PMID:De Lucca 2004:14972327}" "" "" "" "Venezuela" "" "0" "" "not pyridoxine responsive" "" "Pat5169" "00261762" "" "" "" "1" "" "00006" "{PMID:De Lucca 2004:14972327}" "" "" "" "Venezuela" "" "0" "" "partially pyridoxine responsive" "" "Pat390/1110" "00261763" "" "" "" "1" "" "00006" "{PMID:De Lucca 2004:14972327}" "" "" "" "Portugal" "" "0" "" "" "" "Pat2255/MB" "00261764" "" "" "" "1" "" "00006" "{PMID:De Lucca 2004:14972327}" "" "" "" "Venezuela" "" "0" "" "not pyridoxine responsive" "" "Pat3800" "00261765" "" "" "" "1" "" "00006" "{PMID:De Lucca 2004:14972327}" "" "" "" "Venezuela" "" "0" "" "partially pyridoxine responsive" "indigenous" "Pat2954" "00261766" "" "" "" "1" "" "00006" "CBS mutation database, De Lucca" "" "" "" "Venezuela" "" "0" "" "not pyridoxine responsive" "" "" "00261767" "" "" "" "1" "" "00006" "CBS mutation database, De Lucca" "" "" "" "Venezuela" "" "0" "" "not pyridoxine responsive" "" "" "00261768" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261769" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261770" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261771" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261772" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261773" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261774" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261775" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261776" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261777" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261778" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261779" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261780" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261781" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "France" "" "0" "" "" "" "" "00261782" "" "" "" "1" "" "00006" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "Algeria" "" "0" "" "" "" "" "00261783" "" "" "" "1" "" "00006" "CBS mutation database, Skovby" "" "" "" "Denmark" "" "0" "" "not pyridoxine responsive" "" "" "00261784" "" "" "" "1" "" "00006" "CBS mutation database, Skovby" "" "" "" "Denmark" "" "0" "" "not pyridoxine responsive" "" "" "00261785" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Colombia" "" "0" "" "" "" "Pat53a" "00261786" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Colombia" "" "0" "" "" "" "Pat53b" "00261787" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Colombia" "" "0" "" "not pyridoxine responsive" "" "Pat48" "00261788" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Colombia" "" "0" "" "not pyridoxine responsive" "" "Pat51" "00261789" "" "" "" "1" "" "00006" "{PMID:Bermudez 2006:16470595}" "" "" "" "Colombia" "" "0" "" "not pyridoxine responsive" "" "Pat1" "00261790" "" "" "" "1" "" "00006" "{PMID:Bermudez 2006:16470595}" "" "" "" "Colombia" "" "0" "" "not pyridoxine responsive" "" "9" "00261791" "" "" "" "1" "" "00006" "{PMID:Bermudez 2006:16470595}" "" "" "" "Colombia" "" "0" "" "not pyridoxine responsive" "" "11" "00261792" "" "" "" "1" "" "00006" "{PMID:Bermudez 2006:16470595}" "" "" "" "Colombia" "" "0" "" "not pyridoxine responsive" "" "13" "00261793" "" "" "" "1" "" "00006" "{PMID:Bermudez 2006:16470595}" "" "" "" "Colombia" "" "0" "" "not pyridoxine responsive" "" "16" "00261794" "" "" "" "1" "" "00006" "{PMID:Bermudez 2006:16470595}" "" "" "" "Colombia" "" "0" "" "not pyridoxine responsive" "" "1" "00261795" "" "" "" "1" "" "00006" "{PMID:Bermudez 2006:16470595}" "" "" "" "Colombia" "" "0" "" "not pyridoxine responsive" "" "4" "00261796" "" "" "" "1" "" "00006" "{PMID:Bermudez 2006:16470595}" "" "" "" "Colombia" "" "0" "" "not pyridoxine responsive" "" "5" "00261797" "" "" "" "1" "" "00006" "{PMID:Bermudez 2006:16470595}" "" "" "" "Colombia" "" "0" "" "not pyridoxine responsive" "" "8" "00261798" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Spain" "" "0" "" "" "" "Pat34" "00261799" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Portugal" "" "0" "" "" "" "Pat21a" "00261800" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Portugal" "" "0" "" "" "" "Pat21b" "00261801" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Argentina" "" "0" "" "" "" "Pat22" "00261802" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Argentina" "" "0" "" "" "" "Pat23" "00261803" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Argentina" "" "0" "" "" "" "Pat38" "00261804" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Argentina" "" "0" "" "" "" "Pat64" "00261805" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Brazil" "" "0" "" "" "" "Pat25" "00261806" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Brazil" "" "0" "" "" "" "Pat28" "00261807" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Brazil" "" "0" "" "" "" "Pat30a/b" "00261808" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Brazil" "" "0" "" "" "" "Pat40" "00261809" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Brazil" "" "0" "" "" "" "Pat54" "00261810" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Brazil" "" "0" "" "" "" "Pat63" "00261811" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Brazil" "" "0" "" "" "" "Pat65" "00261812" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Brazil" "" "0" "" "" "" "Pat67" "00261813" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Brazil" "" "0" "" "" "" "Pat41a" "00261814" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Brazil" "" "0" "" "" "" "Pat41b" "00261815" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Brazil" "" "0" "" "" "" "Pat33a" "00261816" "" "" "" "1" "" "00006" "{PMID:Urreizti 2006:16479318}" "" "" "" "Brazil" "" "0" "" "" "" "Pat33b" "00261817" "" "" "" "1" "" "00006" "{PMID:Evangelisti 2008:18280597}" "" "" "" "Italy" "" "0" "" "not pyridoxine responsive" "" "Pat1" "00261818" "" "" "" "1" "" "00006" "{PMID:Evangelisti 2008:18280597}" "" "" "" "Italy" "" "0" "" "not pyridoxine responsive" "" "Pat2" "00261819" "" "" "" "1" "" "00006" "{PMID:Evangelisti 2008:18280597}" "" "" "" "Argentina" "" "0" "" "not pyridoxine responsive" "" "Pat3" "00261820" "" "" "" "1" "" "00006" "{PMID:Evangelisti 2008:18280597}" "" "" "" "Italy" "" "0" "" "not pyridoxine responsive" "" "Pat4" "00261821" "" "" "" "1" "" "00006" "{PMID:Evangelisti 2008:18280597}" "" "" "" "Italy" "" "0" "" "not pyridoxine responsive" "" "Pat5" "00261822" "" "" "" "1" "" "00006" "CBS mutation database, Skovby" "" "" "" "Denmark" "" "0" "" "pyridoxine responsive" "" "" "00261823" "" "" "" "1" "" "00006" "CBS mutation database, Skovby" "" "" "" "Denmark" "" "0" "" "pyridoxine responsive" "" "" "00261824" "" "" "" "1" "" "00006" "CBS mutation database, Skovby" "" "" "" "Denmark" "" "0" "" "not pyridoxine responsive" "" "" "00261825" "" "" "" "1" "" "00006" "CBS mutation database, Skovby" "" "" "" "Denmark" "" "0" "" "not pyridoxine responsive" "" "" "00261826" "" "" "" "1" "" "00006" "{PMID:Lefaucheur 2008:18805305}" "" "" "" "France" "" "0" "" "not pyridoxine responsive" "" "Pat" "00261827" "" "" "" "1" "" "00006" "{PMID:Yokoi 2008:19261122}" "" "F;M" "" "Japan" "" "0" "" "not pyridoxine responsive" "" "Fam (2 sibs)" "00261828" "" "" "" "1" "" "00006" "{PMID:Yokoi 2008:19261122}" "" "F;M" "" "Japan" "" "0" "" "not pyridoxine responsive" "" "Fam (2 sibs)" "00261829" "" "" "" "1" "" "00006" "{PMID:Katsushima 2006:16307898}" "" "" "" "Japan" "" "0" "" "not pyridoxine responsive" "" "Pat1a/b" "00261830" "" "" "" "1" "" "00006" "{PMID:Katsushima 2006:16307898}" "" "" "" "Japan" "" "0" "" "pyridoxine responsive" "" "Pat2" "00261831" "" "" "" "1" "" "00006" "{PMID:Katsushima 2006:16307898}" "newborn screening" "" "" "Japan" "" "0" "" "" "" "Pat3" "00261832" "" "" "" "1" "" "00006" "{PMID:Katsushima 2006:16307898}" "newborn screening" "" "" "Japan" "" "0" "" "not pyridoxine responsive" "" "Pat5" "00261833" "" "" "" "1" "" "00006" "{PMID:Katsushima 2006:16307898}" "newborn screening" "" "" "Japan" "" "0" "" "not pyridoxine responsive" "" "Pat6" "00261834" "" "" "" "1" "" "00006" "{PMID:Katsushima 2006:16307898}" "newborn screening" "" "" "Japan" "" "0" "" "not pyridoxine responsive" "" "Pat7" "00261835" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261836" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261837" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Turkey" "" "0" "" "not pyridoxine responsive" "" "" "00261838" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "partially pyridoxine responsive" "" "" "00261839" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "pyridoxine responsive" "" "" "00261840" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Turkey;Netherlands" "" "0" "" "" "" "" "00261841" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Turkey;Netherlands" "" "0" "" "" "" "" "00261842" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261843" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261844" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "" "" "0" "" "" "" "" "00261845" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "" "" "0" "" "" "" "" "00261846" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Israel" "" "0" "" "" "" "Pat" "00261847" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Israel" "" "0" "" "" "" "Pat" "00261848" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "" "" "0" "" "" "" "" "00261849" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "" "" "0" "" "" "" "" "00261850" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261851" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "" "" "0" "" "" "" "" "00261852" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261853" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Germany" "" "0" "" "" "" "" "00261854" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Poland" "" "0" "" "" "" "" "00261855" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Poland" "" "0" "" "" "" "" "00261856" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Poland" "" "0" "" "" "" "" "00261857" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Poland" "" "0" "" "" "" "" "00261858" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Poland" "" "0" "" "" "" "" "00261859" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Poland" "" "0" "" "" "" "" "00261860" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "" "" "0" "" "" "" "" "00261861" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "" "" "0" "" "" "" "" "00261862" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Turkey" "" "0" "" "" "" "" "00261863" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Turkey" "" "0" "" "" "" "" "00261864" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "" "" "0" "" "" "" "" "00261865" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "" "" "0" "" "" "" "" "00261866" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "" "" "0" "" "" "" "" "00261867" "" "" "" "1" "" "00006" "CBS mutation database, Linnebank" "" "" "" "Brazil" "" "0" "" "" "" "" "00261868" "" "" "" "1" "" "00006" "{PMID:Katsushima 2006:16307898}" "" "" "" "Japan" "" "0" "" "not pyridoxine responsive" "" "Pat8" "00261869" "" "" "" "1" "" "00006" "{PMID:Katsushima 2006:16307898}" "" "" "" "Japan" "" "0" "" "" "" "Pat9" "00261870" "" "" "" "1" "" "00006" "{PMID:Katsushima 2006:16307898}" "newborn screening" "" "" "Japan" "" "0" "" "not pyridoxine responsive" "" "Pat4" "00261871" "" "" "" "1" "" "00006" "{PMID:Katsushima 2006:16307898}" "newborn screening" "" "" "Japan" "" "0" "" "not pyridoxine responsive" "" "Pat10" "00261872" "" "" "" "1" "" "00006" "{PMID:Katsushima 2006:16307898}" "" "" "" "Japan" "" "0" "" "" "" "Pat11" "00261873" "" "" "" "1" "" "00006" "{PMID:Katsushima 2006:16307898}" "newborn screening" "" "" "Japan" "" "0" "" "" "" "Pat12" "00261874" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261875" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261876" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261877" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261878" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261879" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261880" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261881" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261882" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261883" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261884" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261885" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261886" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261887" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261888" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261889" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261890" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261891" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261892" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261893" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261894" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261895" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261896" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261897" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261898" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261899" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261900" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261901" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261902" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261903" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261904" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Spain" "" "0" "" "" "" "" "00261905" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Portugal" "" "0" "" "" "" "" "00261906" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Portugal" "" "0" "" "" "" "" "00261907" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Portugal" "" "0" "" "" "" "" "00261908" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Portugal" "" "0" "" "" "" "" "00261909" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Portugal" "" "0" "" "" "" "" "00261910" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Portugal" "" "0" "" "" "" "" "00261911" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Argentina" "" "0" "" "" "" "" "00261912" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Argentina" "" "0" "" "" "" "" "00261913" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Argentina" "" "0" "" "" "" "" "00261914" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Argentina" "" "0" "" "" "" "" "00261915" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Argentina" "" "0" "" "" "" "" "00261916" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Argentina" "" "0" "" "" "" "" "00261917" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Argentina" "" "0" "" "" "" "" "00261918" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Argentina" "" "0" "" "" "" "" "00261919" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Argentina" "" "0" "" "" "" "" "00261920" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Argentina" "" "0" "" "" "" "" "00261921" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Norway" "" "0" "" "" "" "" "00261922" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "Norway" "" "0" "" "" "" "" "00261923" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "India" "" "0" "" "" "" "" "00261924" "" "" "" "1" "" "00006" "{PMID:Cozar 2011:21520339}" "" "" "" "India" "" "0" "" "" "" "" "00261925" "" "" "" "6" "" "00006" "{PMID:Zschocke 2009:19370759}" "screening 29448 newborns" "" "" "Qatar" "" "0" "" "" "" "neonate1" "00261926" "" "" "" "6" "" "00006" "{PMID:Zschocke 2009:19370759}" "screening 29448 newborns" "" "" "Qatar" "" "0" "" "" "" "neonate2" "00261927" "" "" "" "6" "" "00006" "{PMID:Zschocke 2009:19370759}" "screening 29448 newborns" "" "" "Qatar" "" "0" "" "" "" "neonate3" "00261928" "" "" "" "6" "" "00006" "{PMID:Zschocke 2009:19370759}" "screening 29448 newborns" "" "" "Qatar" "" "0" "" "" "" "neonate4" "00261929" "" "" "" "6" "" "00006" "{PMID:Zschocke 2009:19370759}" "screening 29448 newborns" "" "" "Qatar" "" "0" "" "" "" "neonate5" "00261930" "" "" "" "6" "" "00006" "{PMID:Zschocke 2009:19370759}" "screening 29448 newborns" "" "" "Qatar" "" "0" "" "" "" "neonate6" "00261931" "" "" "" "1" "" "00006" "{PMID:Zschocke 2009:19370759}" "screening 29448 newborns" "" "" "Qatar" "" "0" "" "" "" "neonate7" "00261932" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam1" "00261933" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam2" "00261934" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam3" "00261935" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam4" "00261936" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam5" "00261937" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam6" "00261938" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam7" "00261939" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam8" "00261940" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam9" "00261941" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam10" "00261942" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam11" "00261943" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam12" "00261944" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam13" "00261945" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam14" "00261946" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam15" "00261947" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam16" "00261948" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam17" "00261949" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam18" "00261950" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam19" "00261951" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam20" "00261952" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam21" "00261953" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam22" "00261954" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam23" "00261955" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam24" "00261956" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam25" "00261957" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam26" "00261958" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam27" "00261959" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam28" "00261960" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam29" "00261961" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam30" "00261962" "" "" "" "1" "" "00006" "{PMID:El-Said 2006:16786517}" "" "" "" "Qatar" "" "0" "" "" "" "Fam31" "00261963" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "" "" "" "Sudan" "" "0" "" "not pyridoxine responsive" "" "Fam1" "00261964" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "" "" "" "Saudi Arabia" "" "0" "" "not pyridoxine responsive" "" "" "00261965" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "" "" "" "Saudi Arabia" "" "0" "" "not pyridoxine responsive" "" "" "00261966" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00261967" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00261968" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "" "" "" "Saudi Arabia" "" "0" "" "not pyridoxine responsive" "" "" "00261969" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "" "" "" "Saudi Arabia" "" "0" "" "not pyridoxine responsive" "" "" "00261970" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "newborn screening" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00261971" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "" "" "" "Saudi Arabia" "" "0" "" "not pyridoxine responsive" "" "" "00261972" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00261973" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "" "" "" "Saudi Arabia" "" "0" "" "not pyridoxine responsive" "" "" "00261974" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "" "" "" "Saudi Arabia" "" "0" "" "not pyridoxine responsive" "" "" "00261975" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "" "" "" "Saudi Arabia" "" "0" "" "not pyridoxine responsive" "" "" "00261976" "" "" "" "1" "" "00006" "{PMID:Zaidi 2012:21517828}" "" "" "" "Saudi Arabia" "" "0" "" "not pyridoxine responsive" "" "Fam13" "00261977" "" "" "" "1" "" "00006" "{PMID:Porto 2005:15993874}" "" "" "" "Brazil" "" "0" "" "pyridoxine responsive" "" "Pat260/266/267" "00261978" "" "" "" "1" "" "00006" "{PMID:Porto 2005:15993874}" "" "" "" "Portugal" "" "0" "" "partially pyridoxine responsive" "" "Pat281" "00261979" "" "" "" "1" "" "00006" "{PMID:Porto 2005:15993874}" "" "" "" "Brazil" "" "0" "" "not pyridoxine responsive" "" "Pat251" "00261980" "" "" "" "1" "" "00006" "{PMID:Porto 2005:15993874}" "" "" "" "Brazil" "" "0" "" "not pyridoxine responsive" "" "Pat256" "00261981" "" "" "" "1" "" "00006" "{PMID:Porto 2005:15993874}" "" "" "" "Brazil" "" "0" "" "not pyridoxine responsive" "" "Pat118" "00261982" "" "" "" "1" "" "00006" "{PMID:Lee 2005:16205833}" "newborn screening" "" "" "Korea" "" "0" "" "" "" "Pat1" "00261983" "" "" "" "1" "" "00006" "{PMID:Lee 2005:16205833}" "" "" "" "Korea" "" "0" "" "not pyridoxine responsive" "" "Pat6" "00261984" "" "" "" "1" "" "00006" "{PMID:Lee 2005:16205833}" "" "" "" "Korea" "" "0" "" "not pyridoxine responsive" "" "Pat4" "00261985" "" "" "" "1" "" "00006" "{PMID:Lee 2005:16205833}" "" "" "" "Korea" "" "0" "" "not pyridoxine responsive" "" "Pat5" "00261986" "" "" "" "1" "" "00006" "{PMID:Lee 2005:16205833}" "" "" "" "Korea" "" "0" "" "not pyridoxine responsive" "" "Pat2/3" "00261987" "" "" "" "1" "" "00006" "{PMID:Kozich 1997:9266356}" "" "" "" "Slovakia (Slovak Republic)" "" "0" "" "not pyridoxine responsive" "" "Pat174" "00261988" "" "" "" "1" "" "00006" "{PMID:Kozich 1997:9266356}" "" "" "" "Czech Republic" "" "0" "" "not pyridoxine responsive" "" "Pat405" "00261989" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat13" "00261990" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat14" "00261991" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "not pyridoxine responsive" "" "Pat15" "00261992" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "not pyridoxine responsive" "" "Pat2" "00261993" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat3" "00261994" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat4" "00261995" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "partially pyridoxine responsive" "" "Pat1" "00261996" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat10" "00261997" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat11" "00261998" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat12" "00261999" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat5 (VP)" "00262000" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "not pyridoxine responsive" "" "Pat6" "00262001" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat7" "00262002" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat8" "00262003" "" "" "" "1" "" "00006" "{PMID:de Franchis 1998:9587029}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat9" "00262004" "" "" "" "1" "" "00006" "{PMID:Hu 1993:7506602}" "" "" "" "" "" "0" "" "" "Poland, France, Germany" "FamIXPatL227" "00262005" "" "" "" "1" "" "00006" "{PMID:Hu 1993:7506602}" "" "" "" "Poland" "" "0" "" "" "" "FamVIIIPatL209" "00262006" "" "" "" "1" "" "00006" "{PMID:de Franchis 1999:10408774}, {PMID:Kraus 1999:10338090}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "ArD (2242)" "00262007" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, L Elsas" "newborn screening" "" "" "" "" "0" "" "" "" "4331" "00262008" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "LT" "00262009" "" "" "" "1" "" "00006" "{PMID:Sperandeo 1996:8803779}, {PMID:Kraus 1999:10338090}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Fam2PatLR" "00262010" "" "" "" "1" "" "00006" "{PMID:Kluijtmans 1995:7635485}" "" "" "" "Netherlands" "" "0" "" "pyridoxine responsive" "" "Pat2" "00262011" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat13 (MN)" "00262012" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat3b (SR)" "00262013" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat3c (SG)" "00262014" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat3c (SG)" "00262015" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat4b (MA)" "00262016" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "family, 2 affected" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat6a (DM)" "00262017" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat6b (DA)" "00262018" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "" "Pat8 (QE)" "00262019" "" "" "" "1" "" "00006" "{PMID:Sebastio 1995:7762555}" "" "" "" "Italy" "" "0" "" "not pyridoxine responsive" "" "Pat9 (TG)" "00262020" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, M Coude" "" "" "" "" "" "0" "" "pyridoxine responsive" "" "7215" "00262021" "" "" "" "1" "" "00006" "{PMID:Sperandeo 1995:7564249}" "" "" "" "Italy" "" "0" "" "pyridoxine responsive" "2 carrier brothers" "Pat2" "00262022" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, H Koch" "" "" "" "Germany" "" "0" "" "not pyridoxine responsive" "" "SG (584)" "00262023" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, H Koch" "" "" "" "Germany" "" "0" "" "partially pyridoxine responsive" "" "AO (518)" "00262024" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, H Koch" "" "" "" "Germany" "" "0" "" "not pyridoxine responsive" "" "Boe (599)" "00262025" "" "" "" "1" "" "00006" "{PMID:Kruger 1995:8528202}" "" "" "" "" "" "0" "" "" "" "GM01128" "00262026" "" "" "" "1" "" "00006" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germany" "" "0" "" "" "" "GER-3" "00262027" "" "" "" "1" "" "00006" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germany" "" "0" "" "" "" "GER-11" "00262028" "" "" "" "1" "" "00006" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germany" "" "0" "" "" "" "GER-12" "00262029" "" "" "" "1" "" "00006" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germany" "" "0" "" "" "" "GER-13" "00262030" "" "" "" "1" "" "00006" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germany" "" "0" "" "" "" "GER-16" "00262031" "" "" "" "1" "" "00006" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germany" "" "0" "" "" "" "GER-26" "00262032" "" "" "" "1" "" "00006" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germany" "" "0" "" "" "" "GER-34" "00262033" "" "" "" "1" "" "00006" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germany" "" "0" "" "" "" "GER-35" "00262034" "" "" "" "1" "" "00006" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germany" "" "0" "" "" "" "GER-37" "00262035" "" "" "" "1" "" "00006" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germany" "" "0" "" "" "" "GER-38" "00262036" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, M Gaustadnes" "" "" "" "" "" "0" "" "" "" "EH" "00262037" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, M Gaustadnes" "" "" "" "" "" "0" "" "" "" "MP" "00262038" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, M Gaustadnes" "" "" "" "" "" "0" "" "" "" "PQ" "00262039" "" "" "" "1" "" "00006" "{PMID:Cheng 2007:18194900}" "" "M" "" "" "" "0" "" "" "" "Pat" "00262040" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, H Koch" "" "" "" "Germany" "" "0" "" "pyridoxine responsive" "" "NM" "00262041" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, H Koch" "" "" "" "Germany" "" "0" "" "pyridoxine responsive" "" "MW" "00262042" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, V Kozich" "" "" "" "Hungary" "" "0" "" "pyridoxine responsive" "" "403" "00262043" "" "" "" "1" "" "00006" "{PMID:Kraus 1999:10338090}, V Kozich" "" "" "" "Hungary" "" "0" "" "partially pyridoxine responsive" "" "427" "00262044" "" "" "" "225" "" "00006" "{PMID:Zschocke 2009:19370759}" "screening 29448 newborns" "" "" "Qatar" "" "0" "" "" "" "healthy" "00262045" "" "" "" "14" "" "00006" "{PMID:Zschocke 2009:19370759}" "screening 29448 newborns" "" "" "Qatar" "" "0" "" "" "" "healthy" "00262046" "" "" "" "18" "" "00006" "{PMID:Sperandeo 1996:8940285}" "control" "" "" "Italy" "" "0" "" "" "" "" "00262047" "" "" "" "168" "" "00006" "{PMID:Janosikova 2005:15494741}" "control" "" "" "" "" "0" "" "" "" "" "00262048" "" "" "" "128" "" "00006" "{PMID:Janosikova 2005:15494741}" "control" "" "" "Poland" "" "0" "" "" "" "" "00262049" "" "" "" "159" "" "00006" "{PMID:Sokolova 2001:11748855}" "1284 newborns screened" "" "" "Czech Republic" "" "0" "" "" "" "" "00262050" "" "" "" "8" "" "00006" "{PMID:Sokolova 2001:11748855}" "1284 newborns screened" "" "" "Czech Republic" "" "0" "" "" "" "" "00262051" "" "" "" "1" "" "00006" "{PMID:Sokolova 2001:11748855}" "1284 newborns screened" "" "" "" "" "0" "" "" "Morovia" "" "00262052" "" "" "" "3" "" "00006" "{PMID:Sokolova 2001:11748855}" "biochemical screen 4885000 individuals" "" "" "Czech Republic;Slovenia" "" "0" "" "" "" "" "00262053" "" "" "" "7" "" "00006" "{PMID:Sokolova 2001:11748855}" "biochemical screen 4885000 individuals" "" "" "Czech Republic;Slovenia" "" "0" "" "" "" "" "00262054" "" "" "" "3" "" "00006" "{PMID:Sokolova 2001:11748855}" "biochemical screen 4885000 individuals" "" "" "Czech Republic;Slovenia" "" "0" "" "" "" "" "00262055" "" "" "" "2" "" "00006" "{PMID:Sokolova 2001:11748855}" "biochemical screen 4885000 individuals" "" "" "Czech Republic;Slovenia" "" "0" "" "" "" "" "00262056" "" "" "" "2" "" "00006" "{PMID:Sokolova 2001:11748855}" "biochemical screen 4885000 individuals" "" "" "Czech Republic;Slovenia" "" "0" "" "" "" "" "00262057" "" "" "" "2" "" "00006" "{PMID:Sokolova 2001:11748855}" "biochemical screen 4885000 individuals" "" "" "" "" "0" "" "" "" "" "00262058" "" "" "" "1" "" "00006" "{PMID:Sokolova 2001:11748855}" "biochemical screen 4885000 individuals" "" "" "" "" "0" "" "" "" "" "00262059" "" "" "" "1" "" "00006" "{PMID:Sokolova 2001:11748855}" "biochemical screen 4885000 individuals" "" "" "" "" "0" "" "" "" "" "00262060" "" "" "" "1" "" "00006" "{PMID:Sokolova 2001:11748855}" "biochemical screen 4885000 individuals" "" "" "" "" "0" "" "" "" "" "00262061" "" "" "" "1" "" "00006" "{PMID:Sokolova 2001:11748855}" "biochemical screen 4885000 individuals" "" "" "" "" "0" "" "" "" "" "00293011" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293012" "" "" "" "6" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293013" "" "" "" "250" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293014" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293015" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293016" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295188" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295485" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304877" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00315501" "" "" "" "1" "" "01602" "{PMID:Neubauer 2021:33895855}" "" "M" "" "Switzerland" "19y" "" "" "" "Europe" "SUDS080" "00385510" "" "" "" "1" "" "00000" "{PMID:Lenassi 2020:31848469}" "retrospective analysis" "F" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "17001526" "00414428" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "M" "" "China" "" "0" "" "" "" "WHP95" "00415255" "" "" "" "1" "" "00000" "{PMID:Alfares 2018:30202406}" "" "F" "" "" "" "0" "" "" "" "10" "00451595" "" "" "" "1" "" "04221" "{PMID:Vela-Amieva 2024:39519275}" "" "M" "no" "Mexico" "" "" "" "" "Mexican" "3bINP-046" "00451597" "" "" "" "1" "" "04221" "{PMID:Vela-Amieva 2024:39519275}" "" "M" "no" "Mexico" "" "" "" "" "Mexican" "3bINP-049" "00451647" "" "" "" "1" "" "04221" "{PMID:Vela-Amieva 2024:39519275}" "Familial case (brother affected)" "F" "no" "Mexico" "" "" "" "" "Mexican" "3bINP-087" "00451663" "" "" "" "1" "" "04221" "{PMID:Vela-Amieva 2024:39519275}" "Co-occurrence of two different monogenic diseases." "M" "no" "Mexico" "" "" "" "" "Mexican" "3bINP-109" "00453613" "" "" "" "1" "" "00006" "{PMID:Navarrete 2019:30626930}" "newborn screening" "" "" "Spain" "" "0" "" "" "" "Pat29" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 749 "{{individualid}}" "{{diseaseid}}" "00046568" "04310" "00046569" "04310" "00047820" "00000" "00047822" "04310" "00047823" "04310" "00047824" "04310" "00047825" "04310" "00047826" "04310" "00047827" "04310" "00047828" "04310" "00047829" "04310" "00047830" "04310" "00047831" "04310" "00047832" "04310" "00047833" "04310" "00047834" "04310" "00047835" "04310" "00047836" "04310" "00047837" "04310" "00047838" "00000" "00047839" "00000" "00047840" "00000" "00047841" "00000" "00047842" "00000" "00047843" "00000" "00047844" "00000" "00047845" "00000" "00047846" "00000" "00081044" "01844" "00181014" "01844" "00226126" "00198" "00261361" "00000" "00261363" "01844" "00261364" "01844" "00261365" "01844" "00261366" "01844" "00261367" "01844" "00261368" "01844" "00261369" "01844" "00261370" "01844" "00261371" "01844" "00261372" "01844" "00261373" "01844" "00261374" "01844" "00261375" "01844" "00261376" "01844" "00261377" "01844" "00261378" "01844" "00261379" "01844" "00261380" "01844" "00261381" "01844" "00261382" "01844" "00261383" "01844" "00261384" "01844" "00261385" "01844" "00261386" "01844" "00261387" "01844" "00261388" "01844" "00261389" "01844" "00261390" "01844" "00261391" "01844" "00261392" "01844" "00261393" "01844" "00261394" "01844" "00261395" "01844" "00261396" "01844" "00261397" "01844" "00261398" "01844" "00261399" "01844" "00261400" "01844" "00261401" "01844" "00261402" "01844" "00261403" "01844" "00261404" "01844" "00261405" "01844" "00261406" "01844" "00261407" "01844" "00261408" "01844" "00261409" "01844" "00261410" "01844" "00261411" "01844" "00261412" "01844" "00261413" "01844" "00261414" "01844" "00261415" "01844" "00261416" "01844" "00261417" "01844" "00261418" "01844" "00261419" "01844" "00261420" "01844" "00261421" "01844" "00261422" "01844" "00261423" "01844" "00261424" "01844" "00261425" "01844" "00261426" "01844" "00261427" "01844" "00261428" "01844" "00261429" "01844" "00261430" "01844" "00261431" "01844" "00261432" "01844" "00261433" "01844" "00261434" "01844" "00261435" "01844" "00261436" "01844" "00261437" "01844" "00261438" "01844" "00261439" "01844" "00261440" "01844" "00261441" "01844" "00261442" "01844" "00261443" "01844" "00261444" "01844" "00261445" "01844" "00261446" "01844" "00261447" "01844" "00261448" "01844" "00261449" "01844" "00261450" "01844" "00261451" "01844" "00261452" "01844" "00261453" "01844" "00261454" "01844" "00261455" "01844" "00261456" "01844" "00261457" "01844" "00261458" "01844" "00261459" "01844" "00261460" "01844" "00261461" "01844" "00261462" "01844" "00261463" "01844" "00261464" "01844" "00261465" "01844" "00261466" "01844" "00261467" "01844" "00261468" "01844" "00261469" "01844" "00261470" "01844" "00261471" "01844" "00261472" "01844" "00261473" "01844" "00261474" "01844" "00261475" "01844" "00261476" "01844" "00261477" "01844" "00261478" "01844" "00261479" "01844" "00261480" "01844" "00261481" "01844" "00261482" "01844" "00261483" "01844" "00261484" "01844" "00261485" "01844" "00261486" "01844" "00261487" "01844" "00261488" "01844" "00261489" "01844" "00261490" "01844" "00261491" "01844" "00261492" "01844" "00261493" "01844" "00261494" "01844" "00261495" "01844" "00261496" "01844" "00261497" "01844" "00261498" "01844" "00261499" "01844" "00261500" "01844" "00261501" "01844" "00261502" "01844" "00261503" "01844" "00261504" "01844" "00261505" "01844" "00261506" "01844" "00261507" "01844" "00261508" "01844" "00261509" "01844" "00261510" "01844" "00261511" "01844" "00261512" "01844" "00261513" "01844" "00261514" "01844" "00261515" "01844" "00261516" "01844" "00261517" "01844" "00261518" "01844" "00261519" "01844" "00261520" "01844" "00261521" "01844" "00261522" "01844" "00261523" "01844" "00261524" "01844" "00261525" "01844" "00261526" "01844" "00261527" "01844" "00261528" "01844" "00261529" "01844" "00261530" "01844" "00261531" "01844" "00261532" "01844" "00261533" "01844" "00261534" "01844" "00261535" "01844" "00261536" "01844" "00261537" "01844" "00261538" "01844" "00261539" "01844" "00261540" "01844" "00261541" "01844" "00261542" "01844" "00261543" "01844" "00261544" "01844" "00261545" "01844" "00261546" "01844" "00261547" "01844" "00261548" "01844" "00261549" "01844" "00261550" "01844" "00261551" "01844" "00261552" "01844" "00261553" "01844" "00261554" "01844" "00261555" "01844" "00261556" "01844" "00261557" "01844" "00261558" "01844" "00261559" "01844" "00261560" "01844" "00261561" "01844" "00261562" "01844" "00261563" "01844" "00261564" "01844" "00261565" "01844" "00261566" "01844" "00261567" "01844" "00261568" "01844" "00261569" "01844" "00261570" "01844" "00261571" "01844" "00261572" "01844" "00261573" "01844" "00261574" "01844" "00261575" "01844" "00261576" "01844" "00261577" "01844" "00261578" "01844" "00261579" "01844" "00261580" "01844" "00261581" "01844" "00261582" "01844" "00261583" "01844" "00261584" "01844" "00261585" "01844" "00261586" "01844" "00261587" "01844" "00261588" "01844" "00261589" "01844" "00261590" "01844" "00261591" "01844" "00261592" "01844" "00261593" "01844" "00261594" "01844" "00261595" "01844" "00261596" "01844" "00261597" "01844" "00261598" "01844" "00261599" "01844" "00261600" "01844" "00261601" "01844" "00261602" "01844" "00261603" "01844" "00261604" "01844" "00261605" "01844" "00261606" "01844" "00261607" "01844" "00261608" "01844" "00261609" "01844" "00261610" "01844" "00261611" "01844" "00261612" "01844" "00261613" "01844" "00261614" "01844" "00261615" "01844" "00261616" "01844" "00261617" "01844" "00261618" "01844" "00261619" "01844" "00261620" "01844" "00261621" "01844" "00261622" "01844" "00261623" "01844" "00261624" "01844" "00261625" "01844" "00261626" "01844" "00261627" "01844" "00261628" "01844" "00261629" "01844" "00261630" "01844" "00261631" "01844" "00261632" "01844" "00261633" "01844" "00261634" "01844" "00261635" "01844" "00261636" "01844" "00261637" "01844" "00261638" "01844" "00261639" "01844" "00261640" "01844" "00261641" "01844" "00261642" "01844" "00261643" "01844" "00261644" "01844" "00261645" "01844" "00261646" "01844" "00261647" "01844" "00261648" "01844" "00261649" "01844" "00261650" "01844" "00261651" "01844" "00261652" "01844" "00261653" "01844" "00261654" "01844" "00261655" "01844" "00261656" "01844" "00261657" "01844" "00261658" "01844" "00261659" "01844" "00261660" "01844" "00261661" "01844" "00261662" "01844" "00261663" "01844" "00261664" "01844" "00261665" "01844" "00261666" "01844" "00261667" "01844" "00261668" "01844" "00261669" "01844" "00261670" "01844" "00261671" "01844" "00261672" "01844" "00261673" "01844" "00261674" "01844" "00261675" "01844" "00261676" "01844" "00261677" "01844" "00261678" "01844" "00261679" "01844" "00261680" "01844" "00261681" "01844" "00261682" "01844" "00261683" "01844" "00261684" "01844" "00261685" "01844" "00261686" "01844" "00261687" "01844" "00261688" "01844" "00261689" "01844" "00261690" "01844" "00261691" "01844" "00261692" "01844" "00261693" "01844" "00261694" "01844" "00261695" "01844" "00261696" "01844" "00261697" "01844" "00261698" "01844" "00261699" "01844" "00261700" "01844" "00261701" "01844" "00261702" "01844" "00261703" "01844" "00261704" "01844" "00261705" "01844" "00261706" "01844" "00261707" "01844" "00261708" "01844" "00261709" "01844" "00261710" "01844" "00261711" "01844" "00261712" "01844" "00261713" "01844" "00261714" "01844" "00261715" "01844" "00261716" "01844" "00261717" "01844" "00261718" "01844" "00261719" "01844" "00261720" "01844" "00261721" "01844" "00261722" "01844" "00261723" "01844" "00261724" "01844" "00261725" "01844" "00261726" "01844" "00261727" "01844" "00261728" "01844" "00261729" "01844" "00261730" "01844" "00261731" "01844" "00261732" "01844" "00261733" "01844" "00261734" "01844" "00261735" "01844" "00261736" "01844" "00261737" "01844" "00261738" "01844" "00261739" "01844" "00261740" "01844" "00261741" "01844" "00261742" "01844" "00261743" "01844" "00261744" "01844" "00261745" "01844" "00261746" "01844" "00261747" "01844" "00261748" "01844" "00261749" "01844" "00261750" "01844" "00261751" "01844" "00261752" "01844" "00261753" "01844" "00261754" "01844" "00261755" "01844" "00261756" "01844" "00261757" "01844" "00261758" "01844" "00261759" "01844" "00261760" "01844" "00261761" "01844" "00261762" "01844" "00261763" "01844" "00261764" "01844" "00261765" "01844" "00261766" "01844" "00261767" "01844" "00261768" "01844" "00261769" "01844" "00261770" "01844" "00261771" "01844" "00261772" "01844" "00261773" "01844" "00261774" "01844" "00261775" "01844" "00261776" "01844" "00261777" "01844" "00261778" "01844" "00261779" "01844" "00261780" "01844" "00261781" "01844" "00261782" "01844" "00261783" "01844" "00261784" "01844" "00261785" "01844" "00261786" "01844" "00261787" "01844" "00261788" "01844" "00261789" "01844" "00261790" "01844" "00261791" "01844" "00261792" "01844" "00261793" "01844" "00261794" "01844" "00261795" "01844" "00261796" "01844" "00261797" "01844" "00261798" "01844" "00261799" "01844" "00261800" "01844" "00261801" "01844" "00261802" "01844" "00261803" "01844" "00261804" "01844" "00261805" "01844" "00261806" "01844" "00261807" "01844" "00261808" "01844" "00261809" "01844" "00261810" "01844" "00261811" "01844" "00261812" "01844" "00261813" "01844" "00261814" "01844" "00261815" "01844" "00261816" "01844" "00261817" "01844" "00261818" "01844" "00261819" "01844" "00261820" "01844" "00261821" "01844" "00261822" "01844" "00261823" "01844" "00261824" "01844" "00261825" "01844" "00261826" "01844" "00261827" "01844" "00261828" "01844" "00261829" "01844" "00261830" "01844" "00261831" "01844" "00261832" "01844" "00261833" "01844" "00261834" "01844" "00261835" "01844" "00261836" "01844" "00261837" "01844" "00261838" "01844" "00261839" "01844" "00261840" "01844" "00261841" "01844" "00261842" "01844" "00261843" "01844" "00261844" "01844" "00261845" "01844" "00261846" "01844" "00261847" "01844" "00261848" "01844" "00261849" "01844" "00261850" "01844" "00261851" "01844" "00261852" "01844" "00261853" "01844" "00261854" "01844" "00261855" "01844" "00261856" "01844" "00261857" "01844" "00261858" "01844" "00261859" "01844" "00261860" "01844" "00261861" "01844" "00261862" "01844" "00261863" "01844" "00261864" "01844" "00261865" "01844" "00261866" "01844" "00261867" "01844" "00261868" "01844" "00261869" "01844" "00261870" "01844" "00261871" "01844" "00261872" "01844" "00261873" "01844" "00261874" "01844" "00261875" "01844" "00261876" "01844" "00261877" "01844" "00261878" "01844" "00261879" "01844" "00261880" "01844" "00261881" "01844" "00261882" "01844" "00261883" "01844" "00261884" "01844" "00261885" "01844" "00261886" "01844" "00261887" "01844" "00261888" "01844" "00261889" "01844" "00261890" "01844" "00261891" "01844" "00261892" "01844" "00261893" "01844" "00261894" "01844" "00261895" "01844" "00261896" "01844" "00261897" "01844" "00261898" "01844" "00261899" "01844" "00261900" "01844" "00261901" "01844" "00261902" "01844" "00261903" "01844" "00261904" "01844" "00261905" "01844" "00261906" "01844" "00261907" "01844" "00261908" "01844" "00261909" "01844" "00261910" "01844" "00261911" "01844" "00261912" "01844" "00261913" "01844" "00261914" "01844" "00261915" "01844" "00261916" "01844" "00261917" "01844" "00261918" "01844" "00261919" "01844" "00261920" "01844" "00261921" "01844" "00261922" "01844" "00261923" "01844" "00261924" "01844" "00261925" "01844" "00261926" "01844" "00261927" "01844" "00261928" "01844" "00261929" "01844" "00261930" "01844" "00261931" "01844" "00261932" "01844" "00261933" "01844" "00261934" "01844" "00261935" "01844" "00261936" "01844" "00261937" "01844" "00261938" "01844" "00261939" "01844" "00261940" "01844" "00261941" "01844" "00261942" "01844" "00261943" "01844" "00261944" "01844" "00261945" "01844" "00261946" "01844" "00261947" "01844" "00261948" "01844" "00261949" "01844" "00261950" "01844" "00261951" "01844" "00261952" "01844" "00261953" "01844" "00261954" "01844" "00261955" "01844" "00261956" "01844" "00261957" "01844" "00261958" "01844" "00261959" "01844" "00261960" "01844" "00261961" "01844" "00261962" "01844" "00261963" "01844" "00261964" "01844" "00261965" "01844" "00261966" "01844" "00261967" "01844" "00261968" "01844" "00261969" "01844" "00261970" "01844" "00261971" "01844" "00261972" "01844" "00261973" "01844" "00261974" "01844" "00261975" "01844" "00261976" "01844" "00261977" "01844" "00261978" "01844" "00261979" "01844" "00261980" "01844" "00261981" "01844" "00261982" "01844" "00261983" "01844" "00261984" "01844" "00261985" "01844" "00261986" "01844" "00261987" "01844" "00261988" "01844" "00261989" "01844" "00261990" "01844" "00261991" "01844" "00261992" "01844" "00261993" "01844" "00261994" "01844" "00261995" "01844" "00261996" "01844" "00261997" "01844" "00261998" "01844" "00261999" "01844" "00262000" "01844" "00262001" "01844" "00262002" "01844" "00262003" "01844" "00262004" "01844" "00262005" "01844" "00262006" "01844" "00262007" "01844" "00262008" "01844" "00262009" "01844" "00262010" "01844" "00262011" "01844" "00262012" "01844" "00262013" "01844" "00262014" "01844" "00262015" "01844" "00262016" "01844" "00262017" "01844" "00262018" "01844" "00262019" "01844" "00262020" "01844" "00262021" "01844" "00262022" "01844" "00262023" "01844" "00262024" "01844" "00262025" "01844" "00262026" "01844" "00262027" "01844" "00262028" "01844" "00262029" "01844" "00262030" "01844" "00262031" "01844" "00262032" "01844" "00262033" "01844" "00262034" "01844" "00262035" "01844" "00262036" "01844" "00262037" "01844" "00262038" "01844" "00262039" "01844" "00262040" "01844" "00262041" "01844" "00262042" "01844" "00262043" "01844" "00262044" "00000" "00262045" "00000" "00262046" "00000" "00262047" "00000" "00262048" "00000" "00262049" "00000" "00262050" "00000" "00262051" "00000" "00262052" "00000" "00262053" "00000" "00262054" "00000" "00262055" "00000" "00262056" "00000" "00262057" "00000" "00262058" "00000" "00262059" "00000" "00262060" "00000" "00262061" "00000" "00293011" "00198" "00293012" "00198" "00293013" "00198" "00293014" "00198" "00293015" "00198" "00293016" "00198" "00295188" "00198" "00295485" "00198" "00304877" "00198" "00315501" "05166" "00385510" "04214" "00414428" "00198" "00415255" "04214" "00451595" "01844" "00451597" "01844" "00451647" "01844" "00451663" "01844" "00453613" "02554" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00139, 00198, 01844, 02554, 04214, 04310, 05166 ## Count = 712 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000034689" "04310" "00046568" "" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034692" "04310" "00046569" "" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034694" "04310" "00047822" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034695" "04310" "00047823" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034696" "04310" "00047824" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034697" "04310" "00047825" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034698" "04310" "00047826" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034699" "04310" "00047827" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034700" "04310" "00047828" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034701" "04310" "00047829" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034702" "04310" "00047830" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034703" "04310" "00047831" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034704" "04310" "00047832" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034705" "04310" "00047833" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034706" "04310" "00047834" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034707" "04310" "00047835" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034708" "04310" "00047836" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000034709" "04310" "00047837" "01360" "Unknown" "" "severe sepsis/septic shock" "" "" "" "" "" "" "" "" "" "" "" "0000060613" "01844" "00081044" "01758" "Familial, autosomal recessive" "" "Thrombosis, hyperhomocysteinemic (OMIM:236200)" "" "" "" "" "" "" "" "" "" "" "" "0000143398" "01844" "00181014" "02568" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000158739" "00198" "00210166" "01164" "Unknown" "" "HP:0004904 (Maturity-onset diabetes of the young)" "" "" "" "" "" "" "" "" "" "" "" "0000171240" "00198" "00226126" "01807" "Unknown" "" "Dystonia (HP:0001332); Paroxysmal dyskinesia (HP:0007166)" "" "" "" "" "" "" "" "" "" "" "" "0000199864" "01844" "00261363" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199865" "01844" "00261364" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199866" "01844" "00261365" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199867" "01844" "00261366" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199868" "01844" "00261367" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199869" "01844" "00261368" "00006" "Familial, autosomal recessive" "" "mild; ectopia lentis; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199870" "01844" "00261369" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199871" "01844" "00261370" "00006" "Familial, autosomal recessive" "" "moderate" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199872" "01844" "00261371" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199873" "01844" "00261372" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199874" "01844" "00261373" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199875" "01844" "00261374" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199876" "01844" "00261375" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199877" "01844" "00261376" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199878" "01844" "00261377" "00006" "Familial, autosomal recessive" "" "asymptomatic" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199879" "01844" "00261378" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199880" "01844" "00261379" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199881" "01844" "00261380" "00006" "Familial, autosomal recessive" "" "severe; ectopia lentis; osteoporosis; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199882" "01844" "00261381" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199883" "01844" "00261382" "00006" "Familial, autosomal recessive" "" "asymptomatic" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199884" "01844" "00261383" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199885" "01844" "00261384" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199886" "01844" "00261385" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199887" "01844" "00261386" "00006" "Familial, autosomal recessive" "" "asymptomatic" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199888" "01844" "00261387" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199889" "01844" "00261388" "00006" "Familial, autosomal recessive" "" "no eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199890" "01844" "00261389" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199891" "01844" "00261390" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199892" "01844" "00261391" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199893" "01844" "00261392" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199894" "01844" "00261393" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199895" "01844" "00261394" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199896" "01844" "00261395" "00006" "Familial, autosomal recessive" "" "moderate" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199897" "01844" "00261396" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199898" "01844" "00261397" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199899" "01844" "00261398" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199900" "01844" "00261399" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199901" "01844" "00261400" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199902" "01844" "00261401" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199903" "01844" "00261402" "00006" "Familial, autosomal recessive" "" "moderate; ectopia lentis; osteoporosis; no vascular anomaly; no skeletal involvement, epilepsy" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199904" "01844" "00261403" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199905" "01844" "00261404" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199906" "01844" "00261405" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199907" "01844" "00261406" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199908" "01844" "00261407" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199909" "01844" "00261408" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199910" "01844" "00261409" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199911" "01844" "00261410" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199912" "01844" "00261411" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199913" "01844" "00261412" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199914" "01844" "00261413" "00006" "Familial, autosomal recessive" "" "asymptomatic" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199915" "01844" "00261414" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199916" "01844" "00261415" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199917" "01844" "00261416" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199918" "01844" "00261417" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199919" "01844" "00261418" "00006" "Familial, autosomal recessive" "" "mild; ectopia lentis; osteoporosis; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199920" "01844" "00261419" "00006" "Familial, autosomal recessive" "" "mild; ectopia lentis; osteoporosis; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199921" "01844" "00261420" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199922" "01844" "00261421" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199923" "01844" "00261422" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199924" "01844" "00261423" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199925" "01844" "00261424" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199926" "01844" "00261425" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199927" "01844" "00261426" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199928" "01844" "00261427" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199929" "01844" "00261428" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199930" "01844" "00261429" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199931" "01844" "00261430" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199932" "01844" "00261431" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199933" "01844" "00261432" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199934" "01844" "00261433" "00006" "Familial, autosomal recessive" "" "ectopia lentis; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199935" "01844" "00261434" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199936" "01844" "00261435" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199937" "01844" "00261436" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199938" "01844" "00261437" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199939" "01844" "00261438" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199940" "01844" "00261439" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199941" "01844" "00261440" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199942" "01844" "00261441" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199943" "01844" "00261442" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199944" "01844" "00261443" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199945" "01844" "00261444" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199946" "01844" "00261445" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199947" "01844" "00261446" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199948" "01844" "00261447" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199949" "01844" "00261448" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199950" "01844" "00261449" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199951" "01844" "00261450" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199952" "01844" "00261451" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199953" "01844" "00261452" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199954" "01844" "00261453" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199955" "01844" "00261454" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199956" "01844" "00261455" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199957" "01844" "00261456" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199958" "01844" "00261457" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199959" "01844" "00261458" "00006" "Familial, autosomal recessive" "" "moderate" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199960" "01844" "00261459" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199961" "01844" "00261460" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199962" "01844" "00261461" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199963" "01844" "00261462" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199964" "01844" "00261463" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199965" "01844" "00261464" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199966" "01844" "00261465" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199967" "01844" "00261466" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199968" "01844" "00261467" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199969" "01844" "00261468" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199970" "01844" "00261469" "00006" "Familial, autosomal recessive" "" "asymptomatic" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199971" "01844" "00261470" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199972" "01844" "00261471" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199973" "01844" "00261472" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199974" "01844" "00261473" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199975" "01844" "00261474" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199976" "01844" "00261475" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199977" "01844" "00261476" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199978" "01844" "00261477" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199979" "01844" "00261478" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199980" "01844" "00261479" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199981" "01844" "00261480" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199982" "01844" "00261481" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199983" "01844" "00261482" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199984" "01844" "00261483" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199985" "01844" "00261484" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199986" "01844" "00261485" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199987" "01844" "00261486" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199988" "01844" "00261487" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199989" "01844" "00261488" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199990" "01844" "00261489" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199991" "01844" "00261490" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199992" "01844" "00261491" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199993" "01844" "00261492" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199994" "01844" "00261493" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199995" "01844" "00261494" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199996" "01844" "00261495" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199997" "01844" "00261496" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199998" "01844" "00261497" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000199999" "01844" "00261498" "00006" "Familial, autosomal recessive" "" "asymptomatic" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200000" "01844" "00261499" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200001" "01844" "00261500" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200002" "01844" "00261501" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200003" "01844" "00261502" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200004" "01844" "00261503" "00006" "Familial, autosomal recessive" "" "moderate" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200005" "01844" "00261504" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200006" "01844" "00261505" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200007" "01844" "00261506" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200008" "01844" "00261507" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200009" "01844" "00261508" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200010" "01844" "00261509" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200011" "01844" "00261510" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200012" "01844" "00261511" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200013" "01844" "00261512" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200014" "01844" "00261513" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200015" "01844" "00261514" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200016" "01844" "00261515" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200017" "01844" "00261516" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200018" "01844" "00261517" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200019" "01844" "00261518" "00006" "Familial, autosomal recessive" "" "moderate" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200020" "01844" "00261519" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200021" "01844" "00261520" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200022" "01844" "00261521" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200023" "01844" "00261522" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200024" "01844" "00261523" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200025" "01844" "00261524" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200026" "01844" "00261525" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200027" "01844" "00261526" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200028" "01844" "00261527" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200029" "01844" "00261528" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200030" "01844" "00261529" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200031" "01844" "00261530" "00006" "Familial, autosomal recessive" "" "no eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200032" "01844" "00261531" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200033" "01844" "00261532" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200034" "01844" "00261533" "00006" "Familial, autosomal recessive" "" "moderate; no eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200035" "01844" "00261534" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200036" "01844" "00261535" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200037" "01844" "00261536" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200038" "01844" "00261537" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200039" "01844" "00261538" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200040" "01844" "00261539" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200041" "01844" "00261540" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200042" "01844" "00261541" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200043" "01844" "00261542" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200044" "01844" "00261543" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200045" "01844" "00261544" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200046" "01844" "00261545" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200047" "01844" "00261546" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200048" "01844" "00261547" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200049" "01844" "00261548" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200050" "01844" "00261549" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200051" "01844" "00261550" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200052" "01844" "00261551" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200053" "01844" "00261552" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200054" "01844" "00261553" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200055" "01844" "00261554" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200056" "01844" "00261555" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200057" "01844" "00261556" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200058" "01844" "00261557" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200059" "01844" "00261558" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200060" "01844" "00261559" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200061" "01844" "00261560" "00006" "Familial, autosomal recessive" "" "severe; no eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200062" "01844" "00261561" "00006" "Familial, autosomal recessive" "" "severe; no eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200063" "01844" "00261562" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200064" "01844" "00261563" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200065" "01844" "00261564" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200066" "01844" "00261565" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200067" "01844" "00261566" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200068" "01844" "00261567" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200069" "01844" "00261568" "00006" "Familial, autosomal recessive" "" "severe; no eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200070" "01844" "00261569" "00006" "Familial, autosomal recessive" "" "severe; no eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200071" "01844" "00261570" "00006" "Familial, autosomal recessive" "" "moderate" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200072" "01844" "00261571" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200073" "01844" "00261572" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200074" "01844" "00261573" "00006" "Familial, autosomal recessive" "" "mild; ectopia lentis; osteoporosis; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200075" "01844" "00261574" "00006" "Familial, autosomal recessive" "" "ectopia lentis; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200076" "01844" "00261575" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200077" "01844" "00261576" "00006" "Familial, autosomal recessive" "" "moderate; no eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200078" "01844" "00261577" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200079" "01844" "00261578" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200080" "01844" "00261579" "00006" "Familial, autosomal recessive" "" "asymptomatic" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200081" "01844" "00261580" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200082" "01844" "00261581" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200083" "01844" "00261582" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200084" "01844" "00261583" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200085" "01844" "00261584" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200086" "01844" "00261585" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200087" "01844" "00261586" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200088" "01844" "00261587" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200089" "01844" "00261588" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200090" "01844" "00261589" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200091" "01844" "00261590" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200092" "01844" "00261591" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200093" "01844" "00261592" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200094" "01844" "00261593" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200095" "01844" "00261594" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200096" "01844" "00261595" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200097" "01844" "00261596" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200098" "01844" "00261597" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200099" "01844" "00261598" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200100" "01844" "00261599" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200101" "01844" "00261600" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200102" "01844" "00261601" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200103" "01844" "00261602" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200104" "01844" "00261603" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200105" "01844" "00261604" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200106" "01844" "00261605" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200107" "01844" "00261606" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200108" "01844" "00261607" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200109" "01844" "00261608" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200110" "01844" "00261609" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200111" "01844" "00261610" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200112" "01844" "00261611" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200113" "01844" "00261612" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200114" "01844" "00261613" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200115" "01844" "00261614" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200116" "01844" "00261615" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200117" "01844" "00261616" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200118" "01844" "00261617" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200119" "01844" "00261618" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200120" "01844" "00261619" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200121" "01844" "00261620" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200122" "01844" "00261621" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200123" "01844" "00261622" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200124" "01844" "00261623" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200125" "01844" "00261624" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200126" "01844" "00261625" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200127" "01844" "00261626" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200128" "01844" "00261627" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200129" "01844" "00261628" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200130" "01844" "00261629" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200131" "01844" "00261630" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200132" "01844" "00261631" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200133" "01844" "00261632" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200134" "01844" "00261633" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200135" "01844" "00261634" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200136" "01844" "00261635" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200137" "01844" "00261636" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200138" "01844" "00261637" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200139" "01844" "00261638" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200140" "01844" "00261639" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200141" "01844" "00261640" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200142" "01844" "00261641" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200143" "01844" "00261642" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200144" "01844" "00261643" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200145" "01844" "00261644" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200146" "01844" "00261645" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200147" "01844" "00261646" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200148" "01844" "00261647" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200149" "01844" "00261648" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200150" "01844" "00261649" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200151" "01844" "00261650" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200152" "01844" "00261651" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200153" "01844" "00261652" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200154" "01844" "00261653" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200155" "01844" "00261654" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200156" "01844" "00261655" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200157" "01844" "00261656" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200158" "01844" "00261657" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200159" "01844" "00261658" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200160" "01844" "00261659" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200161" "01844" "00261660" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200162" "01844" "00261661" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200163" "01844" "00261662" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200164" "01844" "00261663" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200165" "01844" "00261664" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200166" "01844" "00261665" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200167" "01844" "00261666" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200168" "01844" "00261667" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200169" "01844" "00261668" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200170" "01844" "00261669" "00006" "Familial, autosomal recessive" "" "no eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200171" "01844" "00261670" "00006" "Familial, autosomal recessive" "" "no eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200172" "01844" "00261671" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200173" "01844" "00261672" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200174" "01844" "00261673" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200175" "01844" "00261674" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200176" "01844" "00261675" "00006" "Familial, autosomal recessive" "" "no eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200177" "01844" "00261676" "00006" "Familial, autosomal recessive" "" "no eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200178" "01844" "00261677" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200179" "01844" "00261678" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200180" "01844" "00261679" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200181" "01844" "00261680" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200182" "01844" "00261681" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200183" "01844" "00261682" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200184" "01844" "00261683" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200185" "01844" "00261684" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200186" "01844" "00261685" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200187" "01844" "00261686" "00006" "Familial, autosomal recessive" "" "moderate" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200188" "01844" "00261687" "00006" "Familial, autosomal recessive" "" "moderate" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200189" "01844" "00261688" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200190" "01844" "00261689" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200191" "01844" "00261690" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200192" "01844" "00261691" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200193" "01844" "00261692" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200194" "01844" "00261693" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200195" "01844" "00261694" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200196" "01844" "00261695" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200197" "01844" "00261696" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200198" "01844" "00261697" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200199" "01844" "00261698" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200200" "01844" "00261699" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200201" "01844" "00261700" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200202" "01844" "00261701" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200203" "01844" "00261702" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200204" "01844" "00261703" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200205" "01844" "00261704" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200206" "01844" "00261705" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200207" "01844" "00261706" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200208" "01844" "00261707" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200209" "01844" "00261708" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200210" "01844" "00261709" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200211" "01844" "00261710" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200212" "01844" "00261711" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200213" "01844" "00261712" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200214" "01844" "00261713" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200215" "01844" "00261714" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200216" "01844" "00261715" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200217" "01844" "00261716" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200218" "01844" "00261717" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200219" "01844" "00261718" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200220" "01844" "00261719" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200221" "01844" "00261720" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200222" "01844" "00261721" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200223" "01844" "00261722" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200224" "01844" "00261723" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200225" "01844" "00261724" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200226" "01844" "00261725" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200227" "01844" "00261726" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200228" "01844" "00261727" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200229" "01844" "00261728" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200230" "01844" "00261729" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200231" "01844" "00261730" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200232" "01844" "00261731" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200233" "01844" "00261732" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200234" "01844" "00261733" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200235" "01844" "00261734" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200236" "01844" "00261735" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200237" "01844" "00261736" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200238" "01844" "00261737" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200239" "01844" "00261738" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200240" "01844" "00261739" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200241" "01844" "00261740" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200242" "01844" "00261741" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200243" "01844" "00261742" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200244" "01844" "00261743" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200245" "01844" "00261744" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200246" "01844" "00261745" "00006" "Familial, autosomal recessive" "" "severe; no eye anomaly; no skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200247" "01844" "00261746" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200248" "01844" "00261747" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200249" "01844" "00261748" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200250" "01844" "00261749" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200251" "01844" "00261750" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200252" "01844" "00261751" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200253" "01844" "00261752" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200254" "01844" "00261753" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200255" "01844" "00261754" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200256" "01844" "00261755" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200257" "01844" "00261756" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200258" "01844" "00261757" "00006" "Familial, autosomal recessive" "" "asymptomatic; no eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200259" "01844" "00261758" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200260" "01844" "00261759" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200261" "01844" "00261760" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200262" "01844" "00261761" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200263" "01844" "00261762" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200264" "01844" "00261763" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200265" "01844" "00261764" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200266" "01844" "00261765" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200267" "01844" "00261766" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200268" "01844" "00261767" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200269" "01844" "00261768" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200270" "01844" "00261769" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200271" "01844" "00261770" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200272" "01844" "00261771" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200273" "01844" "00261772" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200274" "01844" "00261773" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200275" "01844" "00261774" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200276" "01844" "00261775" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200277" "01844" "00261776" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200278" "01844" "00261777" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200279" "01844" "00261778" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200280" "01844" "00261779" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200281" "01844" "00261780" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200282" "01844" "00261781" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200283" "01844" "00261782" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200284" "01844" "00261783" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200285" "01844" "00261784" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200286" "01844" "00261785" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200287" "01844" "00261786" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200288" "01844" "00261787" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200289" "01844" "00261788" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200290" "01844" "00261789" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200291" "01844" "00261790" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200292" "01844" "00261791" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200293" "01844" "00261792" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200294" "01844" "00261793" "00006" "Familial, autosomal recessive" "" "severe; eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200295" "01844" "00261794" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200296" "01844" "00261795" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200297" "01844" "00261796" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200298" "01844" "00261797" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200299" "01844" "00261798" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200300" "01844" "00261799" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200301" "01844" "00261800" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200302" "01844" "00261801" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200303" "01844" "00261802" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200304" "01844" "00261803" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200305" "01844" "00261804" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200306" "01844" "00261805" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200307" "01844" "00261806" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200308" "01844" "00261807" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200309" "01844" "00261808" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200310" "01844" "00261809" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200311" "01844" "00261810" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200312" "01844" "00261811" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200313" "01844" "00261812" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200314" "01844" "00261813" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200315" "01844" "00261814" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200316" "01844" "00261815" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200317" "01844" "00261816" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200318" "01844" "00261817" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200319" "01844" "00261818" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200320" "01844" "00261819" "00006" "Familial, autosomal recessive" "" "no eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200321" "01844" "00261820" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200322" "01844" "00261821" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200323" "01844" "00261822" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200324" "01844" "00261823" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200325" "01844" "00261824" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200326" "01844" "00261825" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200327" "01844" "00261826" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200328" "01844" "00261827" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200329" "01844" "00261828" "00006" "Familial, autosomal recessive" "" "no eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200330" "01844" "00261829" "00006" "Familial, autosomal recessive" "" "no eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200331" "01844" "00261830" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200332" "01844" "00261831" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200333" "01844" "00261832" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200334" "01844" "00261833" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200335" "01844" "00261834" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200336" "01844" "00261835" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200337" "01844" "00261836" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200338" "01844" "00261837" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200339" "01844" "00261838" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200340" "01844" "00261839" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200341" "01844" "00261840" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200342" "01844" "00261841" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200343" "01844" "00261842" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200344" "01844" "00261843" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200345" "01844" "00261844" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200346" "01844" "00261845" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200347" "01844" "00261846" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200348" "01844" "00261847" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200349" "01844" "00261848" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200350" "01844" "00261849" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200351" "01844" "00261850" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200352" "01844" "00261851" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200353" "01844" "00261852" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200354" "01844" "00261853" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200355" "01844" "00261854" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200356" "01844" "00261855" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200357" "01844" "00261856" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200358" "01844" "00261857" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200359" "01844" "00261858" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200360" "01844" "00261859" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200361" "01844" "00261860" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200362" "01844" "00261861" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200363" "01844" "00261862" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200364" "01844" "00261863" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200365" "01844" "00261864" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200366" "01844" "00261865" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200367" "01844" "00261866" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200368" "01844" "00261867" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200369" "01844" "00261868" "00006" "Familial, autosomal recessive" "" "no eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200370" "01844" "00261869" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200371" "01844" "00261870" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200372" "01844" "00261871" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200373" "01844" "00261872" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200374" "01844" "00261873" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200375" "01844" "00261874" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200376" "01844" "00261875" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200377" "01844" "00261876" "00006" "Familial, autosomal recessive" "" "asymptomatic" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200378" "01844" "00261877" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200379" "01844" "00261878" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200380" "01844" "00261879" "00006" "Familial, autosomal recessive" "" "asymptomatic" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200381" "01844" "00261880" "00006" "Familial, autosomal recessive" "" "asymptomatic" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200382" "01844" "00261881" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200383" "01844" "00261882" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200384" "01844" "00261883" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200385" "01844" "00261884" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200386" "01844" "00261885" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200387" "01844" "00261886" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200388" "01844" "00261887" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200389" "01844" "00261888" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200390" "01844" "00261889" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200391" "01844" "00261890" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200392" "01844" "00261891" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200393" "01844" "00261892" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200394" "01844" "00261893" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200395" "01844" "00261894" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200396" "01844" "00261895" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200397" "01844" "00261896" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200398" "01844" "00261897" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200399" "01844" "00261898" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200400" "01844" "00261899" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200401" "01844" "00261900" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200402" "01844" "00261901" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200403" "01844" "00261902" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200404" "01844" "00261903" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200405" "01844" "00261904" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200406" "01844" "00261905" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200407" "01844" "00261906" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200408" "01844" "00261907" "00006" "Familial, autosomal recessive" "" "asymptomatic" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200409" "01844" "00261908" "00006" "Familial, autosomal recessive" "" "asymptomatic" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200410" "01844" "00261909" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200411" "01844" "00261910" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200412" "01844" "00261911" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200413" "01844" "00261912" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200414" "01844" "00261913" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200415" "01844" "00261914" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200416" "01844" "00261915" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200417" "01844" "00261916" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200418" "01844" "00261917" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200419" "01844" "00261918" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200420" "01844" "00261919" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200421" "01844" "00261920" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200422" "01844" "00261921" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200423" "01844" "00261922" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200424" "01844" "00261923" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200425" "01844" "00261924" "00006" "Familial, autosomal recessive" "" "mild" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200426" "01844" "00261925" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200427" "01844" "00261926" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200428" "01844" "00261927" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200429" "01844" "00261928" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200430" "01844" "00261929" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200431" "01844" "00261930" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200432" "01844" "00261931" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200433" "01844" "00261932" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200434" "01844" "00261933" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200435" "01844" "00261934" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200436" "01844" "00261935" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200437" "01844" "00261936" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200438" "01844" "00261937" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200439" "01844" "00261938" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200440" "01844" "00261939" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200441" "01844" "00261940" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200442" "01844" "00261941" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200443" "01844" "00261942" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200444" "01844" "00261943" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200445" "01844" "00261944" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200446" "01844" "00261945" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200447" "01844" "00261946" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200448" "01844" "00261947" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200449" "01844" "00261948" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200450" "01844" "00261949" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200451" "01844" "00261950" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200452" "01844" "00261951" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200453" "01844" "00261952" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200454" "01844" "00261953" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200455" "01844" "00261954" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200456" "01844" "00261955" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200457" "01844" "00261956" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200458" "01844" "00261957" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200459" "01844" "00261958" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200460" "01844" "00261959" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200461" "01844" "00261960" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200462" "01844" "00261961" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200463" "01844" "00261962" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200464" "01844" "00261963" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200465" "01844" "00261964" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200466" "01844" "00261965" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200467" "01844" "00261966" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200468" "01844" "00261967" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200469" "01844" "00261968" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200470" "01844" "00261969" "00006" "Familial, autosomal recessive" "" "no eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200471" "01844" "00261970" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200472" "01844" "00261971" "00006" "Familial, autosomal recessive" "" "no eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200473" "01844" "00261972" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200474" "01844" "00261973" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200475" "01844" "00261974" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200476" "01844" "00261975" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200477" "01844" "00261976" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200478" "01844" "00261977" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200479" "01844" "00261978" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200480" "01844" "00261979" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200481" "01844" "00261980" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200482" "01844" "00261981" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200483" "01844" "00261982" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200484" "01844" "00261983" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200485" "01844" "00261984" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200486" "01844" "00261985" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200487" "01844" "00261986" "00006" "Familial, autosomal recessive" "" "eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200488" "01844" "00261987" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200489" "01844" "00261988" "00006" "Familial, autosomal recessive" "" "severe" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200490" "01844" "00261989" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200491" "01844" "00261990" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200492" "01844" "00261991" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200493" "01844" "00261992" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200494" "01844" "00261993" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200495" "01844" "00261994" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200496" "01844" "00261995" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200497" "01844" "00261996" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200498" "01844" "00261997" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200499" "01844" "00261998" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200500" "01844" "00261999" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200501" "01844" "00262000" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200502" "01844" "00262001" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200503" "01844" "00262002" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200504" "01844" "00262003" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200505" "01844" "00262004" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200506" "01844" "00262005" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200507" "01844" "00262006" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200508" "01844" "00262007" "00006" "Familial, autosomal recessive" "" "asymptomatic" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200509" "01844" "00262008" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200510" "01844" "00262009" "00006" "Familial, autosomal recessive" "" "moderate" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200511" "01844" "00262010" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200512" "01844" "00262011" "00006" "Familial, autosomal recessive" "" "ectopia lentis; osteoporosis; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200513" "01844" "00262012" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200514" "01844" "00262013" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200515" "01844" "00262014" "00006" "Familial, autosomal recessive" "" "mild; no eye anomaly; no skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200516" "01844" "00262015" "00006" "Familial, autosomal recessive" "" "mild; ectopia lentis; osteoporosis; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200517" "01844" "00262016" "00006" "Familial, autosomal recessive" "" "ectopia lentis; osteoporosis; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200518" "01844" "00262017" "00006" "Familial, autosomal recessive" "" "ectopia lentis; osteoporosis; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200519" "01844" "00262018" "00006" "Familial, autosomal recessive" "" "ectopia lentis; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200520" "01844" "00262019" "00006" "Familial, autosomal recessive" "" "ectopia lentis; osteoporosis; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200521" "01844" "00262020" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200522" "01844" "00262021" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200523" "01844" "00262022" "00006" "Familial, autosomal recessive" "" "eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200524" "01844" "00262023" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200525" "01844" "00262024" "00006" "Familial, autosomal recessive" "" "no eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200526" "01844" "00262025" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200527" "01844" "00262026" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200528" "01844" "00262027" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200529" "01844" "00262028" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200530" "01844" "00262029" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200531" "01844" "00262030" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200532" "01844" "00262031" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200533" "01844" "00262032" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200534" "01844" "00262033" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200535" "01844" "00262034" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200536" "01844" "00262035" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200537" "01844" "00262036" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200538" "01844" "00262037" "00006" "Familial, autosomal recessive" "" "moderate; vascular anomaly" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200539" "01844" "00262038" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; no skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200540" "01844" "00262039" "00006" "Familial, autosomal recessive" "" "lenticular subluxation; ; ;" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200541" "01844" "00262040" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200542" "01844" "00262041" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; no skeletal involvement; vascular anomaly; no intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200543" "01844" "00262042" "00006" "Familial, autosomal recessive" "" "mild; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000200544" "01844" "00262043" "00006" "Familial, autosomal recessive" "" "moderate; eye anomaly; skeletal involvement; no vascular anomaly; intellectual diability" "" "" "" "" "" "" "" "" "" "homocystinuria" "" "0000279305" "04214" "00385510" "00000" "Familial, autosomal recessive" "" "" "1y" "" "" "" "" "" "" "" "" "congenital cataracts" "" "0000306263" "00198" "00414428" "00000" "Familial, autosomal recessive" "15y" "" "" "" "" "" "" "" "" "" "Homocystinuria Caused by Cystathionine Beta-Synthase Deficiency" "" "" "0000307053" "04214" "00415255" "00000" "Familial, autosomal recessive" "" "OMIM: 236200; high-arched palate and inguinal hernia" "" "" "" "" "" "" "" "" "Homocystinuria" "" "" "0000322111" "05166" "00315501" "01602" "Unknown" "" "SUD" "" "" "" "" "" "" "" "" "" "" "" "0000340270" "01844" "00451595" "04221" "Familial, autosomal recessive" "" "Moderate intellectual disability, lens subluxation, cerebral ischemia" "02y03m" "07y" "" "" "" "" "" "" "\'Homocystinuria, B6-responsive and nonresponsive types" "Homocystinuria" "" "0000340272" "01844" "00451597" "04221" "Familial, autosomal recessive" "" "Lens subluxation" "" "11y" "" "" "" "" "" "" "Homocystinuria, B6-responsive and nonresponsive types" "Homocystinuria" "" "0000340308" "01844" "00451647" "04221" "Familial, autosomal recessive" "" "Mild intellectual disability, Spasticity, Pectus excavatum, Arachnodactyly" "" "10y" "" "" "" "" "" "" "Homocystinuria, B6-responsive and nonresponsive types" "Homocystinuria" "" "0000340324" "01844" "00451663" "04221" "Familial, autosomal recessive" "" "Mild Intellectual disability, Developmental regression, Seizures. Co-ocurrence with Corneal fleck dystrophy (OMIM: 121850)" "" "04y" "" "" "" "" "" "" "Homocystinuria, B6-responsive and nonresponsive types" "Homocystinuria" "" "0000342270" "02554" "00453613" "00006" "Familial, autosomal recessive" "" "see paper; ..., newborn screening tandem mass spectrometry dried blood spots" "19y" "" "" "" "" "" "" "" "CBSD" "inborn error of metabolism" "" ## Screenings ## Do not remove or alter this header ## ## Count = 751 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000034" "00000034" "1" "00004" "" "2012-05-11 13:18:44" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000046676" "00046568" "1" "01360" "01360" "2015-07-16 09:50:03" "" "" "PCR" "DNA" "blood" "" "0000046678" "00046569" "1" "01360" "01360" "2015-07-16 10:22:51" "" "" "PCR" "DNA" "Blood" "" "0000047937" "00047820" "1" "01360" "00006" "2015-08-28 11:11:39" "00006" "2015-08-28 11:23:33" "PCR" "DNA" "blood" "" "0000047939" "00047822" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047940" "00047823" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047941" "00047824" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047942" "00047825" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047943" "00047826" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047944" "00047827" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047945" "00047828" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047946" "00047829" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047947" "00047830" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047948" "00047831" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047949" "00047832" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047950" "00047833" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047951" "00047834" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047952" "00047835" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047953" "00047836" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047954" "00047837" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047969" "00047838" "1" "01360" "00006" "2015-08-28 11:11:11" "" "" "PCR" "DNA" "blood" "" "0000047971" "00047839" "1" "01360" "00006" "2015-08-28 11:11:12" "" "" "PCR" "DNA" "blood" "" "0000047972" "00047840" "1" "01360" "00006" "2015-08-28 11:11:13" "" "" "PCR" "DNA" "blood" "" "0000047973" "00047841" "1" "01360" "00006" "2015-08-28 11:11:14" "" "" "PCR" "DNA" "blood" "" "0000047974" "00047842" "1" "01360" "00006" "2015-08-28 11:11:15" "" "" "PCR" "DNA" "blood" "" "0000047975" "00047843" "1" "01360" "00006" "2015-08-28 11:11:16" "" "" "PCR" "DNA" "blood" "" "0000047976" "00047844" "1" "01360" "00006" "2015-08-28 11:11:17" "" "" "PCR" "DNA" "blood" "" "0000047977" "00047845" "1" "01360" "00006" "2015-08-28 11:11:18" "" "" "PCR" "DNA" "blood" "" "0000047978" "00047846" "1" "01360" "00006" "2015-08-28 11:11:19" "" "" "PCR" "DNA" "blood" "" "0000081156" "00081044" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000181961" "00181014" "1" "02568" "02568" "2018-09-20 17:45:56" "" "" "SEQ-NG-I" "DNA" "" "" "0000211242" "00210166" "1" "01164" "01164" "2018-12-27 15:47:14" "" "" "SEQ-NG" "DNA" "" "" "0000227198" "00226126" "1" "01807" "01807" "2019-02-27 11:46:10" "" "" "SEQ" "DNA" "" "" "0000262467" "00261361" "1" "00006" "00006" "2019-08-16 13:00:18" "" "" "PCR;SEQ" "DNA" "" "" "0000262469" "00261363" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262470" "00261364" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262471" "00261365" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262472" "00261366" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262473" "00261367" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262474" "00261368" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262475" "00261369" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262476" "00261370" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262477" "00261371" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262478" "00261372" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262479" "00261373" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262480" "00261374" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262481" "00261375" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262482" "00261376" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262483" "00261377" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262484" "00261378" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262485" "00261379" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262486" "00261380" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262487" "00261381" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262488" "00261382" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262489" "00261383" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262490" "00261384" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262491" "00261385" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262492" "00261386" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262493" "00261387" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262494" "00261388" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262495" "00261389" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262496" "00261390" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262497" "00261391" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262498" "00261392" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262499" "00261393" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262500" "00261394" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262501" "00261395" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262502" "00261396" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262503" "00261397" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262504" "00261398" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262505" "00261399" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262506" "00261400" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262507" "00261401" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262508" "00261402" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262509" "00261403" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262510" "00261404" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262511" "00261405" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262512" "00261406" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262513" "00261407" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262514" "00261408" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262515" "00261409" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262516" "00261410" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262517" "00261411" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262518" "00261412" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262519" "00261413" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262520" "00261414" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262521" "00261415" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262522" "00261416" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262523" "00261417" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262524" "00261418" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262525" "00261419" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262526" "00261420" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262527" "00261421" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262528" "00261422" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262529" "00261423" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262530" "00261424" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262531" "00261425" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262532" "00261426" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262533" "00261427" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262534" "00261428" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262535" "00261429" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262536" "00261430" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262537" "00261431" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262538" "00261432" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262539" "00261433" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262540" "00261434" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262541" "00261435" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262542" "00261436" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262543" "00261437" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262544" "00261438" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262545" "00261439" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262546" "00261440" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262547" "00261441" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262548" "00261442" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262549" "00261443" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262550" "00261444" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262551" "00261445" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262552" "00261446" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262553" "00261447" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262554" "00261448" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262555" "00261449" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262556" "00261450" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262557" "00261451" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262558" "00261452" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262559" "00261453" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262560" "00261454" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262561" "00261455" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262562" "00261456" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262563" "00261457" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262564" "00261458" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262565" "00261459" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262566" "00261460" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262567" "00261461" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262568" "00261462" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262569" "00261463" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262570" "00261464" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262571" "00261465" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262572" "00261466" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262573" "00261467" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262574" "00261468" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262575" "00261469" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262576" "00261470" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262577" "00261471" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262578" "00261472" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262579" "00261473" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262580" "00261474" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262581" "00261475" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262582" "00261476" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262583" "00261477" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262584" "00261478" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262585" "00261479" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262586" "00261480" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262587" "00261481" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262588" "00261482" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262589" "00261483" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262590" "00261484" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262591" "00261485" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262592" "00261486" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262593" "00261487" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262594" "00261488" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262595" "00261489" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262596" "00261490" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262597" "00261491" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262598" "00261492" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262599" "00261493" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262600" "00261494" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262601" "00261495" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262602" "00261496" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262603" "00261497" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262604" "00261498" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262605" "00261499" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262606" "00261500" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262607" "00261501" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262608" "00261502" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262609" "00261503" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262610" "00261504" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262611" "00261505" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262612" "00261506" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262613" "00261507" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262614" "00261508" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262615" "00261509" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262616" "00261510" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262617" "00261511" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262618" "00261512" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262619" "00261513" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262620" "00261514" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262621" "00261515" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262622" "00261516" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262623" "00261517" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262624" "00261518" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262625" "00261519" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262626" "00261520" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262627" "00261521" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262628" "00261522" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262629" "00261523" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262630" "00261524" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262631" "00261525" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262632" "00261526" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262633" "00261527" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262634" "00261528" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262635" "00261529" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262636" "00261530" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262637" "00261531" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262638" "00261532" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262639" "00261533" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262640" "00261534" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262641" "00261535" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262642" "00261536" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262643" "00261537" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262644" "00261538" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262645" "00261539" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262646" "00261540" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262647" "00261541" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262648" "00261542" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262649" "00261543" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262650" "00261544" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262651" "00261545" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262652" "00261546" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262653" "00261547" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262654" "00261548" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262655" "00261549" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262656" "00261550" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262657" "00261551" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262658" "00261552" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262659" "00261553" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262660" "00261554" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262661" "00261555" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262662" "00261556" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262663" "00261557" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262664" "00261558" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262665" "00261559" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262666" "00261560" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262667" "00261561" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262668" "00261562" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262669" "00261563" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262670" "00261564" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262671" "00261565" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262672" "00261566" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262673" "00261567" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262674" "00261568" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262675" "00261569" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262676" "00261570" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262677" "00261571" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262678" "00261572" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262679" "00261573" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262680" "00261574" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262681" "00261575" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262682" "00261576" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262683" "00261577" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262684" "00261578" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262685" "00261579" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262686" "00261580" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262687" "00261581" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262688" "00261582" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262689" "00261583" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262690" "00261584" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262691" "00261585" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262692" "00261586" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262693" "00261587" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262694" "00261588" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262695" "00261589" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262696" "00261590" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262697" "00261591" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262698" "00261592" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262699" "00261593" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262700" "00261594" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262701" "00261595" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262702" "00261596" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262703" "00261597" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262704" "00261598" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262705" "00261599" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262706" "00261600" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262707" "00261601" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262708" "00261602" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262709" "00261603" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262710" "00261604" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262711" "00261605" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262712" "00261606" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262713" "00261607" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262714" "00261608" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262715" "00261609" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262716" "00261610" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262717" "00261611" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262718" "00261612" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262719" "00261613" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262720" "00261614" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262721" "00261615" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262722" "00261616" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262723" "00261617" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262724" "00261618" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262725" "00261619" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262726" "00261620" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262727" "00261621" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262728" "00261622" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262729" "00261623" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262730" "00261624" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262731" "00261625" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262732" "00261626" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262733" "00261627" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262734" "00261628" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262735" "00261629" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262736" "00261630" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262737" "00261631" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262738" "00261632" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262739" "00261633" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262740" "00261634" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262741" "00261635" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262742" "00261636" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262743" "00261637" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262744" "00261638" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262745" "00261639" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262746" "00261640" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262747" "00261641" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262748" "00261642" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262749" "00261643" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262750" "00261644" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262751" "00261645" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262752" "00261646" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262753" "00261647" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262754" "00261648" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262755" "00261649" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262756" "00261650" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262757" "00261651" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262758" "00261652" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262759" "00261653" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262760" "00261654" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262761" "00261655" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262762" "00261656" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262763" "00261657" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262764" "00261658" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262765" "00261659" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262766" "00261660" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262767" "00261661" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262768" "00261662" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262769" "00261663" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262770" "00261664" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262771" "00261665" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262772" "00261666" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262773" "00261667" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262774" "00261668" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262775" "00261669" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262776" "00261670" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262777" "00261671" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262778" "00261672" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262779" "00261673" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262780" "00261674" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262781" "00261675" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262782" "00261676" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262783" "00261677" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262784" "00261678" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262785" "00261679" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262786" "00261680" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262787" "00261681" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262788" "00261682" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262789" "00261683" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262790" "00261684" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262791" "00261685" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262792" "00261686" "1" "00006" "00006" "2019-08-16 19:39:24" "" "" "SEQ" "DNA" "" "" "0000262793" "00261687" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262794" "00261688" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262795" "00261689" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262796" "00261690" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262797" "00261691" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262798" "00261692" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262799" "00261693" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262800" "00261694" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262801" "00261695" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262802" "00261696" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262803" "00261697" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262804" "00261698" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262805" "00261699" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262806" "00261700" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262807" "00261701" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262808" "00261702" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262809" "00261703" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262810" "00261704" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262811" "00261705" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262812" "00261706" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262813" "00261707" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262814" "00261708" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262815" "00261709" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262816" "00261710" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262817" "00261711" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262818" "00261712" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262819" "00261713" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262820" "00261714" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262821" "00261715" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262822" "00261716" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262823" "00261717" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262824" "00261718" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262825" "00261719" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262826" "00261720" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262827" "00261721" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262828" "00261722" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262829" "00261723" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262830" "00261724" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262831" "00261725" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262832" "00261726" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262833" "00261727" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262834" "00261728" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262835" "00261729" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262836" "00261730" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262837" "00261731" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262838" "00261732" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262839" "00261733" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262840" "00261734" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262841" "00261735" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262842" "00261736" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262843" "00261737" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262844" "00261738" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262845" "00261739" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262846" "00261740" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262847" "00261741" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262848" "00261742" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262849" "00261743" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262850" "00261744" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262851" "00261745" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262852" "00261746" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262853" "00261747" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262854" "00261748" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262855" "00261749" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262856" "00261750" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262857" "00261751" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262858" "00261752" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262859" "00261753" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262860" "00261754" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262861" "00261755" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262862" "00261756" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262863" "00261757" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262864" "00261758" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262865" "00261759" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262866" "00261760" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262867" "00261761" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262868" "00261762" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262869" "00261763" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262870" "00261764" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262871" "00261765" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262872" "00261766" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262873" "00261767" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262874" "00261768" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262875" "00261769" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262876" "00261770" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262877" "00261771" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262878" "00261772" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262879" "00261773" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262880" "00261774" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262881" "00261775" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262882" "00261776" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262883" "00261777" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262884" "00261778" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262885" "00261779" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262886" "00261780" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262887" "00261781" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262888" "00261782" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262889" "00261783" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262890" "00261784" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262891" "00261785" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262892" "00261786" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262893" "00261787" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262894" "00261788" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262895" "00261789" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262896" "00261790" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262897" "00261791" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262898" "00261792" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262899" "00261793" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262900" "00261794" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262901" "00261795" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262902" "00261796" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262903" "00261797" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262904" "00261798" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262905" "00261799" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262906" "00261800" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262907" "00261801" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262908" "00261802" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262909" "00261803" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262910" "00261804" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262911" "00261805" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262912" "00261806" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262913" "00261807" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262914" "00261808" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262915" "00261809" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262916" "00261810" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262917" "00261811" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262918" "00261812" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262919" "00261813" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262920" "00261814" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262921" "00261815" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262922" "00261816" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262923" "00261817" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262924" "00261818" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262925" "00261819" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262926" "00261820" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000262927" "00261821" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262928" "00261822" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262929" "00261823" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262930" "00261824" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262931" "00261825" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262932" "00261826" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262933" "00261827" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262934" "00261828" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262935" "00261829" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262936" "00261830" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262937" "00261831" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262938" "00261832" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262939" "00261833" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262940" "00261834" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262941" "00261835" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262942" "00261836" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262943" "00261837" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262944" "00261838" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262945" "00261839" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262946" "00261840" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262947" "00261841" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262948" "00261842" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262949" "00261843" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262950" "00261844" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262951" "00261845" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262952" "00261846" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262953" "00261847" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262954" "00261848" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262955" "00261849" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262956" "00261850" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262957" "00261851" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262958" "00261852" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262959" "00261853" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262960" "00261854" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262961" "00261855" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262962" "00261856" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262963" "00261857" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262964" "00261858" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262965" "00261859" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262966" "00261860" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262967" "00261861" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262968" "00261862" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262969" "00261863" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262970" "00261864" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262971" "00261865" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262972" "00261866" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262973" "00261867" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262974" "00261868" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262975" "00261869" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262976" "00261870" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262977" "00261871" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262978" "00261872" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262979" "00261873" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262980" "00261874" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262981" "00261875" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262982" "00261876" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262983" "00261877" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262984" "00261878" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262985" "00261879" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262986" "00261880" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262987" "00261881" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262988" "00261882" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262989" "00261883" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262990" "00261884" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262991" "00261885" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262992" "00261886" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262993" "00261887" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262994" "00261888" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262995" "00261889" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262996" "00261890" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262997" "00261891" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262998" "00261892" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000262999" "00261893" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263000" "00261894" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263001" "00261895" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263002" "00261896" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263003" "00261897" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263004" "00261898" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263005" "00261899" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263006" "00261900" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263007" "00261901" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263008" "00261902" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263009" "00261903" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263010" "00261904" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263011" "00261905" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263012" "00261906" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263013" "00261907" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263014" "00261908" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263015" "00261909" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263016" "00261910" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263017" "00261911" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263018" "00261912" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263019" "00261913" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263020" "00261914" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263021" "00261915" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263022" "00261916" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263023" "00261917" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263024" "00261918" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263025" "00261919" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263026" "00261920" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263027" "00261921" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263028" "00261922" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263029" "00261923" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263030" "00261924" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263031" "00261925" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263032" "00261926" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263033" "00261927" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263034" "00261928" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263035" "00261929" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263036" "00261930" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263037" "00261931" "1" "00006" "00006" "2019-08-16 19:44:48" "" "" "SEQ" "DNA" "" "" "0000263038" "00261932" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263039" "00261933" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263040" "00261934" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263041" "00261935" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263042" "00261936" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263043" "00261937" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263044" "00261938" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263045" "00261939" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263046" "00261940" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263047" "00261941" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263048" "00261942" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263049" "00261943" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263050" "00261944" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263051" "00261945" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263052" "00261946" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263053" "00261947" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263054" "00261948" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263055" "00261949" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263056" "00261950" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263057" "00261951" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263058" "00261952" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263059" "00261953" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263060" "00261954" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263061" "00261955" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263062" "00261956" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263063" "00261957" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263064" "00261958" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263065" "00261959" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263066" "00261960" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263067" "00261961" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263068" "00261962" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263069" "00261963" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263070" "00261964" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263071" "00261965" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263072" "00261966" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263073" "00261967" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263074" "00261968" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263075" "00261969" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263076" "00261970" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263077" "00261971" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263078" "00261972" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263079" "00261973" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263080" "00261974" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263081" "00261975" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263082" "00261976" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263083" "00261977" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263084" "00261978" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263085" "00261979" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263086" "00261980" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263087" "00261981" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263088" "00261982" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263089" "00261983" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263090" "00261984" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263091" "00261985" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263092" "00261986" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263093" "00261987" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263094" "00261988" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263095" "00261989" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263096" "00261990" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263097" "00261991" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263098" "00261992" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263099" "00261993" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263100" "00261994" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263101" "00261995" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263102" "00261996" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263103" "00261997" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263104" "00261998" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263105" "00261999" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263106" "00262000" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263107" "00262001" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263108" "00262002" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263109" "00262003" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263110" "00262004" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263111" "00262005" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263112" "00262006" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263113" "00262007" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263114" "00262008" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263115" "00262009" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000263116" "00262010" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263117" "00262011" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263118" "00262012" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263119" "00262013" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263120" "00262014" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263121" "00262015" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263122" "00262016" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263123" "00262017" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263124" "00262018" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263125" "00262019" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263126" "00262020" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263127" "00262021" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263128" "00262022" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263129" "00262023" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263130" "00262024" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000263131" "00262025" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000263132" "00262026" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263133" "00262027" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263134" "00262028" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263135" "00262029" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263136" "00262030" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263137" "00262031" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263138" "00262032" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263139" "00262033" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263140" "00262034" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263141" "00262035" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263142" "00262036" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263143" "00262037" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263144" "00262038" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263145" "00262039" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263146" "00262040" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263147" "00262041" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263148" "00262042" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263149" "00262043" "1" "00006" "00006" "2019-08-16 20:01:00" "" "" "SEQ" "DNA" "" "" "0000263150" "00262044" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263151" "00262045" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263152" "00262046" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000263153" "00262047" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263154" "00262048" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263155" "00262049" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263156" "00262050" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263157" "00262051" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263158" "00262052" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263159" "00262053" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263160" "00262054" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263161" "00262055" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263162" "00262056" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263163" "00262057" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263164" "00262058" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263165" "00262059" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263166" "00262060" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000263167" "00262061" "1" "00006" "00006" "2019-08-16 20:33:39" "" "" "SEQ" "DNA" "" "" "0000294179" "00293011" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294180" "00293012" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294181" "00293013" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294182" "00293014" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294183" "00293015" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294184" "00293016" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296356" "00295188" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296653" "00295485" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000306006" "00304877" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000316678" "00315501" "1" "01602" "01602" "2020-10-27 16:25:57" "01602" "2023-02-15 09:46:15" "SEQ-NG" "DNA" "" "" "0000386739" "00385510" "1" "00000" "03840" "2021-10-12 17:40:23" "" "" "SEQ-NG" "DNA" "blood" "144 genes panel tested" "0000415708" "00414428" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000416537" "00415255" "1" "00000" "03840" "2022-08-10 20:39:58" "" "" "SEQ-NG" "DNA" "" "exome sequencing done at a commercial CAPaccredited laboratory" "0000453196" "00451595" "1" "04221" "04221" "2024-06-12 18:08:22" "" "" "SEQ-NG-I" "DNA" "gDNA from peripheral blood" "whole exome sequencing" "0000453198" "00451597" "1" "04221" "04221" "2024-06-12 18:36:28" "" "" "SEQ-NG-I" "DNA" "gDNA from peripheral blood" "whole exome sequencing" "0000453251" "00451647" "1" "04221" "04221" "2024-06-20 21:06:25" "" "" "SEQ-NG-I" "DNA" "gDNA from peripheral blood" "whole exome sequencing" "0000453267" "00451663" "1" "04221" "04221" "2024-06-24 04:39:46" "" "" "SEQ-NG-I" "DNA" "gDNA from peripheral blood" "whole exome sequencing" "0000455225" "00453613" "1" "00006" "00006" "2024-09-11 15:27:41" "" "" "SEQ;SEQ-NG" "DNA" "" "119-gene panel" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 749 "{{screeningid}}" "{{geneid}}" "0000000034" "ATP7B" "0000000034" "CBS" "0000000034" "CYP21A2" "0000000034" "DPYD" "0000000034" "ETFB" "0000000034" "GLB1" "0000000034" "GNPTAB" "0000000034" "IGHMBP2" "0000000034" "NHLRC1" "0000000034" "SERPINA1" "0000000034" "SLC26A2" "0000000034" "SMPD1" "0000046676" "CBS" "0000046678" "CBS" "0000047937" "CBS" "0000047939" "CBS" "0000047940" "CBS" "0000047941" "CBS" "0000047942" "CBS" "0000047943" "CBS" "0000047944" "CBS" "0000047945" "CBS" "0000047946" "CBS" "0000047947" "CBS" "0000047948" "CBS" "0000047949" "CBS" "0000047950" "CBS" "0000047951" "CBS" "0000047952" "CBS" "0000047953" "CBS" "0000047954" "CBS" "0000047969" "CBS" "0000047971" "CBS" "0000047972" "CBS" "0000047973" "CBS" "0000047974" "CBS" "0000047975" "CBS" "0000047976" "CBS" "0000047977" "CBS" "0000047978" "CBS" "0000081156" "CBS" "0000181961" "CBS" "0000262467" "CBS" "0000262469" "CBS" "0000262470" "CBS" "0000262471" "CBS" "0000262472" "CBS" "0000262473" "CBS" "0000262474" "CBS" "0000262475" "CBS" "0000262476" "CBS" "0000262477" "CBS" "0000262478" "CBS" "0000262479" "CBS" "0000262480" "CBS" "0000262481" "CBS" "0000262482" "CBS" "0000262483" "CBS" "0000262484" "CBS" "0000262485" "CBS" "0000262486" "CBS" "0000262487" "CBS" "0000262488" "CBS" "0000262489" "CBS" "0000262490" "CBS" "0000262491" "CBS" "0000262492" "CBS" "0000262493" "CBS" "0000262494" "CBS" "0000262495" "CBS" "0000262496" "CBS" "0000262497" "CBS" "0000262498" "CBS" "0000262499" "CBS" "0000262500" "CBS" "0000262501" "CBS" "0000262502" "CBS" "0000262503" "CBS" "0000262504" "CBS" "0000262505" "CBS" "0000262506" "CBS" "0000262507" "CBS" "0000262508" "CBS" "0000262509" "CBS" "0000262510" "CBS" "0000262511" "CBS" "0000262512" "CBS" "0000262513" "CBS" "0000262514" "CBS" "0000262515" "CBS" "0000262516" "CBS" "0000262517" "CBS" "0000262518" "CBS" "0000262519" "CBS" "0000262520" "CBS" "0000262521" "CBS" "0000262522" "CBS" "0000262523" "CBS" "0000262524" "CBS" "0000262525" "CBS" "0000262526" "CBS" "0000262527" "CBS" "0000262528" "CBS" "0000262529" "CBS" "0000262530" "CBS" "0000262531" "CBS" "0000262532" "CBS" "0000262533" "CBS" "0000262534" "CBS" "0000262535" "CBS" "0000262536" "CBS" "0000262537" "CBS" "0000262538" "CBS" "0000262539" "CBS" "0000262540" "CBS" "0000262541" "CBS" "0000262542" "CBS" "0000262543" "CBS" "0000262544" "CBS" "0000262545" "CBS" "0000262546" "CBS" "0000262547" "CBS" "0000262548" "CBS" "0000262549" "CBS" "0000262550" "CBS" "0000262551" "CBS" "0000262552" "CBS" "0000262553" "CBS" "0000262554" "CBS" "0000262555" "CBS" "0000262556" "CBS" "0000262557" "CBS" "0000262558" "CBS" "0000262559" "CBS" "0000262560" "CBS" "0000262561" "CBS" "0000262562" "CBS" "0000262563" "CBS" "0000262564" "CBS" "0000262565" "CBS" "0000262566" "CBS" "0000262567" "CBS" "0000262568" "CBS" "0000262569" "CBS" "0000262570" "CBS" "0000262571" "CBS" "0000262572" "CBS" "0000262573" "CBS" "0000262574" "CBS" "0000262575" "CBS" "0000262576" "CBS" "0000262577" "CBS" "0000262578" "CBS" "0000262579" "CBS" "0000262580" "CBS" "0000262581" "CBS" "0000262582" "CBS" "0000262583" "CBS" "0000262584" "CBS" "0000262585" "CBS" "0000262586" "CBS" "0000262587" "CBS" "0000262588" "CBS" "0000262589" "CBS" "0000262590" "CBS" "0000262591" "CBS" "0000262592" "CBS" "0000262593" "CBS" "0000262594" "CBS" "0000262595" "CBS" "0000262596" "CBS" "0000262597" "CBS" "0000262598" "CBS" "0000262599" "CBS" "0000262600" "CBS" "0000262601" "CBS" "0000262602" "CBS" "0000262603" "CBS" "0000262604" "CBS" "0000262605" "CBS" "0000262606" "CBS" "0000262607" "CBS" "0000262608" "CBS" "0000262609" "CBS" "0000262610" "CBS" "0000262611" "CBS" "0000262612" "CBS" "0000262613" "CBS" "0000262614" "CBS" "0000262615" "CBS" "0000262616" "CBS" "0000262617" "CBS" "0000262618" "CBS" "0000262619" "CBS" "0000262620" "CBS" "0000262621" "CBS" "0000262622" "CBS" "0000262623" "CBS" "0000262624" "CBS" "0000262625" "CBS" "0000262626" "CBS" "0000262627" "CBS" "0000262628" "CBS" "0000262629" "CBS" "0000262630" "CBS" "0000262631" "CBS" "0000262632" "CBS" "0000262633" "CBS" "0000262634" "CBS" "0000262635" "CBS" "0000262636" "CBS" "0000262637" "CBS" "0000262638" "CBS" "0000262639" "CBS" "0000262640" "CBS" "0000262641" "CBS" "0000262642" "CBS" "0000262643" "CBS" "0000262644" "CBS" "0000262645" "CBS" "0000262646" "CBS" "0000262647" "CBS" "0000262648" "CBS" "0000262649" "CBS" "0000262650" "CBS" "0000262651" "CBS" "0000262652" "CBS" "0000262653" "CBS" "0000262654" "CBS" "0000262655" "CBS" "0000262656" "CBS" "0000262657" "CBS" "0000262658" "CBS" "0000262659" "CBS" "0000262660" "CBS" "0000262661" "CBS" "0000262662" "CBS" "0000262663" "CBS" "0000262664" "CBS" "0000262665" "CBS" "0000262666" "CBS" "0000262667" "CBS" "0000262668" "CBS" "0000262669" "CBS" "0000262670" "CBS" "0000262671" "CBS" "0000262672" "CBS" "0000262673" "CBS" "0000262674" "CBS" "0000262675" "CBS" "0000262676" "CBS" "0000262677" "CBS" "0000262678" "CBS" "0000262679" "CBS" "0000262680" "CBS" "0000262681" "CBS" "0000262682" "CBS" "0000262683" "CBS" "0000262684" "CBS" "0000262685" "CBS" "0000262686" "CBS" "0000262687" "CBS" "0000262688" "CBS" "0000262689" "CBS" "0000262690" "CBS" "0000262691" "CBS" "0000262692" "CBS" "0000262693" "CBS" "0000262694" "CBS" "0000262695" "CBS" "0000262696" "CBS" "0000262697" "CBS" "0000262698" "CBS" "0000262699" "CBS" "0000262700" "CBS" "0000262701" "CBS" "0000262702" "CBS" "0000262703" "CBS" "0000262704" "CBS" "0000262705" "CBS" "0000262706" "CBS" "0000262707" "CBS" "0000262708" "CBS" "0000262709" "CBS" "0000262710" "CBS" "0000262711" "CBS" "0000262712" "CBS" "0000262713" "CBS" "0000262714" "CBS" "0000262715" "CBS" "0000262716" "CBS" "0000262717" "CBS" "0000262718" "CBS" "0000262719" "CBS" "0000262720" "CBS" "0000262721" "CBS" "0000262722" "CBS" "0000262723" "CBS" "0000262724" "CBS" "0000262725" "CBS" "0000262726" "CBS" "0000262727" "CBS" "0000262728" "CBS" "0000262729" "CBS" "0000262730" "CBS" "0000262731" "CBS" "0000262732" "CBS" "0000262733" "CBS" "0000262734" "CBS" "0000262735" "CBS" "0000262736" "CBS" "0000262737" "CBS" "0000262738" "CBS" "0000262739" "CBS" "0000262740" "CBS" "0000262741" "CBS" "0000262742" "CBS" "0000262743" "CBS" "0000262744" "CBS" "0000262745" "CBS" "0000262746" "CBS" "0000262747" "CBS" "0000262748" "CBS" "0000262749" "CBS" "0000262750" "CBS" "0000262751" "CBS" "0000262752" "CBS" "0000262753" "CBS" "0000262754" "CBS" "0000262755" "CBS" "0000262756" "CBS" "0000262757" "CBS" "0000262758" "CBS" "0000262759" "CBS" "0000262760" "CBS" "0000262761" "CBS" "0000262762" "CBS" "0000262763" "CBS" "0000262764" "CBS" "0000262765" "CBS" "0000262766" "CBS" "0000262767" "CBS" "0000262768" "CBS" "0000262769" "CBS" "0000262770" "CBS" "0000262771" "CBS" "0000262772" "CBS" "0000262773" "CBS" "0000262774" "CBS" "0000262775" "CBS" "0000262776" "CBS" "0000262777" "CBS" "0000262778" "CBS" "0000262779" "CBS" "0000262780" "CBS" "0000262781" "CBS" "0000262782" "CBS" "0000262783" "CBS" "0000262784" "CBS" "0000262785" "CBS" "0000262786" "CBS" "0000262787" "CBS" "0000262788" "CBS" "0000262789" "CBS" "0000262790" "CBS" "0000262791" "CBS" "0000262792" "CBS" "0000262793" "CBS" "0000262794" "CBS" "0000262795" "CBS" "0000262796" "CBS" "0000262797" "CBS" "0000262798" "CBS" "0000262799" "CBS" "0000262800" "CBS" "0000262801" "CBS" "0000262802" "CBS" "0000262803" "CBS" "0000262804" "CBS" "0000262805" "CBS" "0000262806" "CBS" "0000262807" "CBS" "0000262808" "CBS" "0000262809" "CBS" "0000262810" "CBS" "0000262811" "CBS" "0000262812" "CBS" "0000262813" "CBS" "0000262814" "CBS" "0000262815" "CBS" "0000262816" "CBS" "0000262817" "CBS" "0000262818" "CBS" "0000262819" "CBS" "0000262820" "CBS" "0000262821" "CBS" "0000262822" "CBS" "0000262823" "CBS" "0000262824" "CBS" "0000262825" "CBS" "0000262826" "CBS" "0000262827" "CBS" "0000262828" "CBS" "0000262829" "CBS" "0000262830" "CBS" "0000262831" "CBS" "0000262832" "CBS" "0000262833" "CBS" "0000262834" "CBS" "0000262835" "CBS" "0000262836" "CBS" "0000262837" "CBS" "0000262838" "CBS" "0000262839" "CBS" "0000262840" "CBS" "0000262841" "CBS" "0000262842" "CBS" "0000262843" "CBS" "0000262844" "CBS" "0000262845" "CBS" "0000262846" "CBS" "0000262847" "CBS" "0000262848" "CBS" "0000262849" "CBS" "0000262850" "CBS" "0000262851" "CBS" "0000262852" "CBS" "0000262853" "CBS" "0000262854" "CBS" "0000262855" "CBS" "0000262856" "CBS" "0000262857" "CBS" "0000262858" "CBS" "0000262859" "CBS" "0000262860" "CBS" "0000262861" "CBS" "0000262862" "CBS" "0000262863" "CBS" "0000262864" "CBS" "0000262865" "CBS" "0000262866" "CBS" "0000262867" "CBS" "0000262868" "CBS" "0000262869" "CBS" "0000262870" "CBS" "0000262871" "CBS" "0000262872" "CBS" "0000262873" "CBS" "0000262874" "CBS" "0000262875" "CBS" "0000262876" "CBS" "0000262877" "CBS" "0000262878" "CBS" "0000262879" "CBS" "0000262880" "CBS" "0000262881" "CBS" "0000262882" "CBS" "0000262883" "CBS" "0000262884" "CBS" "0000262885" "CBS" "0000262886" "CBS" "0000262887" "CBS" "0000262888" "CBS" "0000262889" "CBS" "0000262890" "CBS" "0000262891" "CBS" "0000262892" "CBS" "0000262893" "CBS" "0000262894" "CBS" "0000262895" "CBS" "0000262896" "CBS" "0000262897" "CBS" "0000262898" "CBS" "0000262899" "CBS" "0000262900" "CBS" "0000262901" "CBS" "0000262902" "CBS" "0000262903" "CBS" "0000262904" "CBS" "0000262905" "CBS" "0000262906" "CBS" "0000262907" "CBS" "0000262908" "CBS" "0000262909" "CBS" "0000262910" "CBS" "0000262911" "CBS" "0000262912" "CBS" "0000262913" "CBS" "0000262914" "CBS" "0000262915" "CBS" "0000262916" "CBS" "0000262917" "CBS" "0000262918" "CBS" "0000262919" "CBS" "0000262920" "CBS" "0000262921" "CBS" "0000262922" "CBS" "0000262923" "CBS" "0000262924" "CBS" "0000262925" "CBS" "0000262926" "CBS" "0000262927" "CBS" "0000262928" "CBS" "0000262929" "CBS" "0000262930" "CBS" "0000262931" "CBS" "0000262932" "CBS" "0000262933" "CBS" "0000262934" "CBS" "0000262935" "CBS" "0000262936" "CBS" "0000262937" "CBS" "0000262938" "CBS" "0000262939" "CBS" "0000262940" "CBS" "0000262941" "CBS" "0000262942" "CBS" "0000262943" "CBS" "0000262944" "CBS" "0000262945" "CBS" "0000262946" "CBS" "0000262947" "CBS" "0000262948" "CBS" "0000262949" "CBS" "0000262950" "CBS" "0000262951" "CBS" "0000262952" "CBS" "0000262953" "CBS" "0000262954" "CBS" "0000262955" "CBS" "0000262956" "CBS" "0000262957" "CBS" "0000262958" "CBS" "0000262959" "CBS" "0000262960" "CBS" "0000262961" "CBS" "0000262962" "CBS" "0000262963" "CBS" "0000262964" "CBS" "0000262965" "CBS" "0000262966" "CBS" "0000262967" "CBS" "0000262968" "CBS" "0000262969" "CBS" "0000262970" "CBS" "0000262971" "CBS" "0000262972" "CBS" "0000262973" "CBS" "0000262974" "CBS" "0000262975" "CBS" "0000262976" "CBS" "0000262977" "CBS" "0000262978" "CBS" "0000262979" "CBS" "0000262980" "CBS" "0000262981" "CBS" "0000262982" "CBS" "0000262983" "CBS" "0000262984" "CBS" "0000262985" "CBS" "0000262986" "CBS" "0000262987" "CBS" "0000262988" "CBS" "0000262989" "CBS" "0000262990" "CBS" "0000262991" "CBS" "0000262992" "CBS" "0000262993" "CBS" "0000262994" "CBS" "0000262995" "CBS" "0000262996" "CBS" "0000262997" "CBS" "0000262998" "CBS" "0000262999" "CBS" "0000263000" "CBS" "0000263001" "CBS" "0000263002" "CBS" "0000263003" "CBS" "0000263004" "CBS" "0000263005" "CBS" "0000263006" "CBS" "0000263007" "CBS" "0000263008" "CBS" "0000263009" "CBS" "0000263010" "CBS" "0000263011" "CBS" "0000263012" "CBS" "0000263013" "CBS" "0000263014" "CBS" "0000263015" "CBS" "0000263016" "CBS" "0000263017" "CBS" "0000263018" "CBS" "0000263019" "CBS" "0000263020" "CBS" "0000263021" "CBS" "0000263022" "CBS" "0000263023" "CBS" "0000263024" "CBS" "0000263025" "CBS" "0000263026" "CBS" "0000263027" "CBS" "0000263028" "CBS" "0000263029" "CBS" "0000263030" "CBS" "0000263031" "CBS" "0000263032" "CBS" "0000263033" "CBS" "0000263034" "CBS" "0000263035" "CBS" "0000263036" "CBS" "0000263037" "CBS" "0000263038" "CBS" "0000263039" "CBS" "0000263040" "CBS" "0000263041" "CBS" "0000263042" "CBS" "0000263043" "CBS" "0000263044" "CBS" "0000263045" "CBS" "0000263046" "CBS" "0000263047" "CBS" "0000263048" "CBS" "0000263049" "CBS" "0000263050" "CBS" "0000263051" "CBS" "0000263052" "CBS" "0000263053" "CBS" "0000263054" "CBS" "0000263055" "CBS" "0000263056" "CBS" "0000263057" "CBS" "0000263058" "CBS" "0000263059" "CBS" "0000263060" "CBS" "0000263061" "CBS" "0000263062" "CBS" "0000263063" "CBS" "0000263064" "CBS" "0000263065" "CBS" "0000263066" "CBS" "0000263067" "CBS" "0000263068" "CBS" "0000263069" "CBS" "0000263070" "CBS" "0000263071" "CBS" "0000263072" "CBS" "0000263073" "CBS" "0000263074" "CBS" "0000263075" "CBS" "0000263076" "CBS" "0000263077" "CBS" "0000263078" "CBS" "0000263079" "CBS" "0000263080" "CBS" "0000263081" "CBS" "0000263082" "CBS" "0000263083" "CBS" "0000263084" "CBS" "0000263085" "CBS" "0000263086" "CBS" "0000263087" "CBS" "0000263088" "CBS" "0000263089" "CBS" "0000263090" "CBS" "0000263091" "CBS" "0000263092" "CBS" "0000263093" "CBS" "0000263094" "CBS" "0000263095" "CBS" "0000263096" "CBS" "0000263097" "CBS" "0000263098" "CBS" "0000263099" "CBS" "0000263100" "CBS" "0000263101" "CBS" "0000263102" "CBS" "0000263103" "CBS" "0000263104" "CBS" "0000263105" "CBS" "0000263106" "CBS" "0000263107" "CBS" "0000263108" "CBS" "0000263109" "CBS" "0000263110" "CBS" "0000263111" "CBS" "0000263112" "CBS" "0000263113" "CBS" "0000263114" "CBS" "0000263115" "CBS" "0000263116" "CBS" "0000263117" "CBS" "0000263118" "CBS" "0000263119" "CBS" "0000263120" "CBS" "0000263121" "CBS" "0000263122" "CBS" "0000263123" "CBS" "0000263124" "CBS" "0000263125" "CBS" "0000263126" "CBS" "0000263127" "CBS" "0000263128" "CBS" "0000263129" "CBS" "0000263130" "CBS" "0000263131" "CBS" "0000263132" "CBS" "0000263133" "CBS" "0000263134" "CBS" "0000263135" "CBS" "0000263136" "CBS" "0000263137" "CBS" "0000263138" "CBS" "0000263139" "CBS" "0000263140" "CBS" "0000263141" "CBS" "0000263142" "CBS" "0000263143" "CBS" "0000263144" "CBS" "0000263145" "CBS" "0000263146" "CBS" "0000263147" "CBS" "0000263148" "CBS" "0000263149" "CBS" "0000263150" "CBS" "0000263151" "CBS" "0000263152" "CBS" "0000263153" "CBS" "0000263154" "CBS" "0000263155" "CBS" "0000263156" "CBS" "0000263157" "CBS" "0000263158" "CBS" "0000263159" "CBS" "0000263160" "CBS" "0000263161" "CBS" "0000263162" "CBS" "0000263163" "CBS" "0000263164" "CBS" "0000263165" "CBS" "0000263166" "CBS" "0000263167" "CBS" "0000386739" "CBS" "0000415708" "CBS" "0000416537" "CBS" "0000453196" "CBS" "0000453198" "CBS" "0000453251" "CBS" "0000453267" "CBS" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 1114 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000000900" "0" "50" "21" "44488631" "44488631" "subst" "0.00283574" "00002" "CBS_000001" "g.44488631T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.43068521T>G" "" "VUS" "" "0000074526" "3" "30" "21" "44478497" "44478497" "subst" "0" "01360" "CBS_000003" "g.44478497C>T" "2/170 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "rs6586282" "0" "" "" "g.43058387C>T" "" "likely benign" "" "0000074527" "3" "30" "21" "44478582" "44478582" "subst" "0" "01360" "CBS_000002" "g.44478582G>A" "1/170 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "rs34758144" "0" "" "" "g.43058472G>A" "" "likely benign" "" "0000074529" "3" "30" "21" "44478497" "44478497" "subst" "0" "01360" "CBS_000003" "g.44478497C>T" "4/158 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "rs6586282" "0" "" "" "g.43058387C>T" "" "likely benign" "" "0000074530" "3" "30" "21" "44478582" "44478582" "subst" "0" "01360" "CBS_000002" "g.44478582G>A" "2/158 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "rs34758144" "0" "" "" "g.43058472G>A" "" "likely benign" "" "0000076676" "1" "30" "21" "44478582" "44478582" "subst" "0" "" "CBS_000002" "g.44478582G>A" "38/170 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "rs34758144" "0" "" "" "g.43058472G>A" "" "likely benign" "" "0000076678" "1" "70" "21" "44478497" "44478497" "subst" "0" "" "CBS_000003" "g.44478497C>T" "49/170 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "rs6586282" "0" "" "" "g.43058387C>T" "" "likely pathogenic" "" "0000076681" "1" "30" "21" "44478582" "44478582" "subst" "0" "" "CBS_000002" "g.44478582G>A" "40/158 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "rs34758144" "0" "" "" "g.43058472G>A" "" "likely benign" "" "0000076682" "1" "30" "21" "44478497" "44478497" "subst" "0" "" "CBS_000003" "g.44478497C>T" "57/158 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "rs6586282" "0" "" "" "g.43058387C>T" "" "likely benign" "" "0000076684" "3" "30" "21" "44478497" "44478497" "subst" "0" "01360" "CBS_000003" "g.44478497C>T" "8/307 control individuals" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "rs6586282" "0" "" "" "g.43058387C>T" "" "likely benign" "" "0000076685" "1" "30" "21" "44478497" "44478497" "subst" "0" "01360" "CBS_000003" "g.44478497C>T" "72/307 control individuals" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "rs6586282" "0" "" "" "g.43058387C>T" "" "likely benign" "" "0000076686" "3" "30" "21" "44478582" "44478582" "subst" "0" "01360" "CBS_000002" "g.44478582G>A" "3/307 control individuals" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "rs34758144" "0" "" "" "g.43058472G>A" "" "likely benign" "" "0000076687" "1" "30" "21" "44478582" "44478582" "subst" "0" "01360" "CBS_000002" "g.44478582G>A" "29/307 control individuals" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "rs34758144" "0" "" "" "g.43058472G>A" "" "likely benign" "" "0000076689" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000004" "g.(44478216_44478246)[17]" "20/168 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076690" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000004" "g.(44478216_44478246)[17]" "4/168 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076691" "3" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000005" "g.(44478216_44478246)[18]" "88/168 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076692" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000005" "g.(44478216_44478246)[18]" "36/168 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076693" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000005" "g.(44478216_44478246)[18]" "14/168 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076694" "3" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000006" "g.(44478216_44478246)[19]" "3/168 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076695" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000006" "g.(44478216_44478246)[19]" "3/168 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076696" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000004" "g.(44478216_44478246)[17]" "13/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076697" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000004" "g.(44478216_44478246)[17]" "3/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076698" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000004" "g.(44478216_44478246)[17]" "2/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076699" "3" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000005" "g.(44478216_44478246)[18]" "147/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076700" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000005" "g.(44478216_44478246)[18]" "46/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076701" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000005" "g.(44478216_44478246)[18]" "22/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076702" "3" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000006" "g.(44478216_44478246)[19]" "1/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076703" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000006" "g.(44478216_44478246)[19]" "2/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076704" "3" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000008" "g.(44478216_44478246)[21]" "1/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076714" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000005" "g.(44478216_44478246)[18]" "20/168 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076715" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000006" "g.(44478216_44478246)[19]" "4/168 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076716" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000006" "g.(44478216_44478246)[19]" "36/168 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076717" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000008" "g.(44478216_44478246)[21]" "14/168 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076718" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000008" "g.(44478216_44478246)[21]" "3/168 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076719" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000005" "g.(44478216_44478246)[18]" "13/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076720" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000006" "g.(44478216_44478246)[19]" "3/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076721" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000008" "g.(44478216_44478246)[21]" "2/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076722" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000006" "g.(44478216_44478246)[19]" "46/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076723" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000008" "g.(44478216_44478246)[21]" "22/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076724" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000008" "g.(44478216_44478246)[21]" "2/237 cases" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076736" "3" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000004" "g.(44478216_44478246)[17]" "3/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076738" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000004" "g.(44478216_44478246)[17]" "57/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076739" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000004" "g.(44478216_44478246)[17]" "7/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076740" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000004" "g.(44478216_44478246)[17]" "1/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076741" "3" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000005" "g.(44478216_44478246)[18]" "262/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076742" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000005" "g.(44478216_44478246)[18]" "45/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076743" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000005" "g.(44478216_44478246)[18]" "25/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076744" "3" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000006" "g.(44478216_44478246)[19]" "3/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076745" "1" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000006" "g.(44478216_44478246)[19]" "2/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076746" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000005" "g.(44478216_44478246)[18]" "57/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076747" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000006" "g.(44478216_44478246)[19]" "7/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076748" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000008" "g.(44478216_44478246)[21]" "1/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076749" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000006" "g.(44478216_44478246)[19]" "45/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076750" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000008" "g.(44478216_44478246)[21]" "25/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000076751" "2" "30" "21" "44478216" "44478246" "" "0" "01360" "CBS_000008" "g.(44478216_44478246)[21]" "2/405 controls" "{PMID:Sponholz 2016:26508567}, {DOI:Sponholz 2016:10.1038/ejhg.2015.231}" "" "" "" "Germline" "-" "" "0" "" "" "" "" "likely benign" "" "0000130242" "3" "90" "21" "44482421" "44482421" "subst" "0" "01758" "CBS_000009" "g.44482421C>T" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "Germline" "" "" "0" "" "" "g.43062311C>T" "" "pathogenic" "ACMG" "0000264341" "0" "10" "21" "44473980" "44473980" "subst" "0.0779323" "02330" "CBS_000011" "g.44473980G>T" "" "" "" "CBS(NM_000071.3):c.*10C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43053870G>T" "" "benign" "" "0000264342" "0" "30" "21" "44473972" "44473972" "subst" "0.000966881" "02330" "CBS_000010" "g.44473972C>T" "" "" "" "CBS(NM_000071.2):c.*18G>A (p.(=)), CBS(NM_000071.3):c.*18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43053862C>T" "" "likely benign" "" "0000264343" "0" "10" "21" "44480616" "44480616" "subst" "0.33399" "02330" "CBS_000020" "g.44480616G>A" "" "" "" "CBS(NM_000071.2):c.1080C>T (p.A360=), CBS(NM_000071.3):c.1080C>T (p.A360=), LOC102724560(NM_001354006.1):c.1080C>T (p.A360=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43060506G>A" "" "benign" "" "0000264344" "0" "30" "21" "44474003" "44474003" "subst" "0.00156365" "02330" "CBS_000012" "g.44474003C>T" "" "" "" "CBS(NM_000071.2):c.1643G>A (p.(Arg548Gln), p.R548Q), CBS(NM_000071.3):c.1643G>A (p.R548Q), CBS(NM_001321072.1):c.1328G>A (p.R443Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43053893C>T" "" "likely benign" "" "0000264345" "0" "10" "21" "44487891" "44487891" "subst" "0" "02330" "CBS_000028" "g.44487891G>A" "" "" "" "CBS(NM_000071.3):c.316+728C>T, LOC102724560(NM_001354006.1):c.316+728C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43067781G>A" "" "benign" "" "0000264346" "0" "10" "21" "44485590" "44485590" "subst" "0.00587541" "02330" "CBS_000026" "g.44485590C>T" "" "" "" "CBS(NM_000071.2):c.573G>A (p.(Thr191=)), CBS(NM_000071.3):c.573G>A (p.T191=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43065480C>T" "" "benign" "" "0000266508" "0" "10" "21" "44480616" "44480616" "subst" "0.33399" "02325" "CBS_000020" "g.44480616G>A" "" "" "" "CBS(NM_000071.2):c.1080C>T (p.A360=), CBS(NM_000071.3):c.1080C>T (p.A360=), LOC102724560(NM_001354006.1):c.1080C>T (p.A360=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43060506G>A" "" "benign" "" "0000266509" "0" "10" "21" "44475877" "44475877" "subst" "0" "02325" "CBS_000014" "g.44475877C>T" "" "" "" "CBS(NM_000071.3):c.1552+1036G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43055767C>T" "" "benign" "" "0000268051" "0" "10" "21" "44480616" "44480616" "subst" "0.33399" "02329" "CBS_000020" "g.44480616G>A" "" "" "" "CBS(NM_000071.2):c.1080C>T (p.A360=), CBS(NM_000071.3):c.1080C>T (p.A360=), LOC102724560(NM_001354006.1):c.1080C>T (p.A360=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43060506G>A" "" "benign" "" "0000269819" "0" "10" "21" "44480616" "44480616" "subst" "0.33399" "02326" "CBS_000020" "g.44480616G>A" "" "" "" "CBS(NM_000071.2):c.1080C>T (p.A360=), CBS(NM_000071.3):c.1080C>T (p.A360=), LOC102724560(NM_001354006.1):c.1080C>T (p.A360=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43060506G>A" "" "benign" "" "0000269820" "0" "10" "21" "44480544" "44480544" "subst" "0.00621275" "02326" "CBS_000018" "g.44480544G>A" "" "" "" "CBS(NM_000071.2):c.1145+7C>T (p.(=)), CBS(NM_000071.3):c.1145+7C>T, CBS(NM_001321072.1):c.830+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43060434G>A" "" "benign" "" "0000269821" "0" "30" "21" "44479350" "44479350" "subst" "2.03242E-5" "02326" "CBS_000017" "g.44479350C>T" "" "" "" "CBS(NM_000071.2):c.1209G>A (p.T403=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43059240C>T" "" "likely benign" "" "0000269822" "0" "30" "21" "44474003" "44474003" "subst" "0.00156365" "02326" "CBS_000012" "g.44474003C>T" "" "" "" "CBS(NM_000071.2):c.1643G>A (p.(Arg548Gln), p.R548Q), CBS(NM_000071.3):c.1643G>A (p.R548Q), CBS(NM_001321072.1):c.1328G>A (p.R443Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43053893C>T" "" "likely benign" "" "0000269823" "0" "30" "21" "44488631" "44488631" "subst" "0.00283574" "02326" "CBS_000001" "g.44488631T>G" "" "" "" "CBS(NM_000071.2):c.304A>C (p.(Lys102Gln), p.K102Q), CBS(NM_000071.3):c.304A>C (p.K102Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43068521T>G" "" "likely benign" "" "0000269824" "0" "90" "21" "44485763" "44485763" "subst" "0" "02326" "CBS_000027" "g.44485763C>T" "" "" "" "CBS(NM_000071.2):c.494G>A (p.C165Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43065653C>T" "" "pathogenic" "" "0000269825" "0" "10" "21" "44492252" "44492252" "subst" "0.000837674" "02326" "CBS_000030" "g.44492252G>A" "" "" "" "CBS(NM_000071.2):c.52C>T (p.(Arg18Cys), p.R18C), CBS(NM_001178008.2):c.52C>T (p.R18C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43072142G>A" "" "benign" "" "0000269826" "0" "30" "21" "44483202" "44483202" "subst" "0.000266772" "02326" "CBS_000023" "g.44483202G>A" "" "" "" "CBS(NM_000071.2):c.829-14C>T, CBS(NM_000071.3):c.829-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43063092G>A" "" "likely benign" "" "0000272681" "0" "50" "21" "44476925" "44476925" "subst" "0" "01943" "CBS_000015" "g.44476925C>T" "" "" "" "CBS(NM_001321072.1):c.1225G>A (p.E409K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43056815C>T" "" "VUS" "" "0000272682" "0" "30" "21" "44478324" "44478324" "subst" "1.21836E-5" "01943" "CBS_000016" "g.44478324C>T" "" "" "" "CBS(NM_000071.2):c.1398G>A (p.S466=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43058214C>T" "" "likely benign" "" "0000272683" "0" "50" "21" "44474004" "44474004" "subst" "0.000114533" "01943" "CBS_000013" "g.44474004G>A" "" "" "" "CBS(NM_000071.2):c.1642C>T (p.R548W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43053894G>A" "" "VUS" "" "0000328670" "0" "30" "21" "44480544" "44480544" "subst" "0.00621275" "01804" "CBS_000018" "g.44480544G>A" "" "" "" "CBS(NM_000071.2):c.1145+7C>T (p.(=)), CBS(NM_000071.3):c.1145+7C>T, CBS(NM_001321072.1):c.830+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43060434G>A" "" "likely benign" "" "0000328672" "0" "30" "21" "44483217" "44483218" "ins" "0" "01804" "CBS_000022" "g.44483217_44483218insCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAGTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAG" "" "" "" "CBS(NM_000071.2):c.832_833ins68 (p.I278Tfs*16), CBS(NM_000071.2):c.832_833insCTGGGGTGGATCATCCAGGTGGGGCTTTTGCTGGGCTTGAGCCCTGAAGCCGCGCCCTCTGCAGATCA ..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43063107_43063108insCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAGTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAG" "" "likely benign" "" "0000328674" "0" "10" "21" "44485527" "44485527" "subst" "0.0012414" "01804" "CBS_000024" "g.44485527G>A" "" "" "" "CBS(NM_000071.2):c.636C>T (p.(Asn212=)), CBS(NM_001321072.1):c.321C>T (p.N107=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43065417G>A" "" "benign" "" "0000328675" "0" "50" "21" "44485564" "44485564" "subst" "1.63713E-5" "01804" "CBS_000025" "g.44485564G>A" "" "" "" "CBS(NM_000071.2):c.599C>T (p.(Pro200Leu)), CBS(NM_000071.3):c.599C>T (p.P200L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43065454G>A" "" "VUS" "" "0000328676" "0" "30" "21" "44485590" "44485590" "subst" "0.00587541" "01804" "CBS_000026" "g.44485590C>T" "" "" "" "CBS(NM_000071.2):c.573G>A (p.(Thr191=)), CBS(NM_000071.3):c.573G>A (p.T191=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43065480C>T" "" "likely benign" "" "0000328677" "0" "90" "21" "44492094" "44492094" "subst" "4.0864E-6" "01804" "CBS_000029" "g.44492094C>T" "" "" "" "CBS(NM_000071.2):c.209+1G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43071984C>T" "" "pathogenic" "" "0000340097" "0" "30" "21" "44485350" "44485350" "subst" "0.274197" "02327" "CBS_000032" "g.44485350G>A" "" "" "" "CBS(NM_000071.3):c.699C>T (p.Y233=), LOC102724560(NM_001354006.1):c.699C>T (p.Y233=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43065240G>A" "" "likely benign" "" "0000405748" "21" "90" "21" "44484068" "44484068" "subst" "4.10452E-5" "02568" "CBS_000034" "g.44484068G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.43063958G>A" "" "pathogenic" "" "0000405749" "11" "70" "21" "44484035" "44484035" "subst" "0" "02568" "CBS_000033" "g.44484035A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.43063925A>G" "" "likely pathogenic" "" "0000442703" "0" "70" "21" "44480638" "44480638" "subst" "2.99727E-5" "01164" "CBS_000035" "g.44480638G>A" "" "" "" "" "" "Germline" "" "rs121964972" "0" "" "" "g.43060528G>A" "" "likely pathogenic" "ACMG" "0000461250" "1" "50" "21" "44483067" "44483067" "subst" "0" "01807" "CBS_000036" "g.44483067C>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.43062957C>G" "" "VUS" "" "0000461251" "1" "90" "21" "44483114" "44483114" "subst" "0" "01807" "CBS_000037" "g.44483114G>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.43063004G>T" "" "pathogenic" "" "0000570701" "0" "10" "21" "44473980" "44473980" "subst" "0.0779323" "02327" "CBS_000011" "g.44473980G>T" "" "" "" "CBS(NM_000071.3):c.*10C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43053870G>T" "" "benign" "" "0000570702" "0" "50" "21" "44474003" "44474003" "subst" "0.00156365" "01943" "CBS_000012" "g.44474003C>T" "" "" "" "CBS(NM_000071.2):c.1643G>A (p.(Arg548Gln), p.R548Q), CBS(NM_000071.3):c.1643G>A (p.R548Q), CBS(NM_001321072.1):c.1328G>A (p.R443Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43053893C>T" "" "VUS" "" "0000570703" "0" "30" "21" "44476941" "44476941" "subst" "0" "01943" "CBS_000038" "g.44476941G>A" "" "" "" "CBS(NM_000071.3):c.1524C>T (p.F508=), CBS(NM_001321072.1):c.1209C>T (p.F403=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43056831G>A" "" "likely benign" "" "0000570704" "0" "30" "21" "44476986" "44476986" "subst" "0.00035905" "02325" "CBS_000039" "g.44476986C>T" "" "" "" "CBS(NM_001321072.1):c.1164G>A (p.T388=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43056876C>T" "" "likely benign" "" "0000570706" "0" "10" "21" "44478964" "44478964" "subst" "8.10252E-5" "02330" "CBS_000041" "g.44478964C>T" "" "" "" "CBS(NM_000071.2):c.1338G>A (p.(Ala446=)), CBS(NM_000071.3):c.1338G>A (p.A446=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43058854C>T" "" "benign" "" "0000570707" "0" "10" "21" "44479084" "44479084" "subst" "0" "02330" "CBS_000042" "g.44479084G>A" "" "" "" "CBS(NM_000071.3):c.1224-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43058974G>A" "" "benign" "" "0000570708" "0" "30" "21" "44480544" "44480544" "subst" "0.00621275" "01943" "CBS_000018" "g.44480544G>A" "" "" "" "CBS(NM_000071.2):c.1145+7C>T (p.(=)), CBS(NM_000071.3):c.1145+7C>T, CBS(NM_001321072.1):c.830+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43060434G>A" "" "likely benign" "" "0000570709" "0" "30" "21" "44480544" "44480544" "subst" "0.00621275" "02327" "CBS_000018" "g.44480544G>A" "" "" "" "CBS(NM_000071.2):c.1145+7C>T (p.(=)), CBS(NM_000071.3):c.1145+7C>T, CBS(NM_001321072.1):c.830+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43060434G>A" "" "likely benign" "" "0000570713" "0" "90" "21" "44483184" "44483184" "subst" "0" "02330" "CBS_000043" "g.44483184A>G" "" "" "" "CBS(NM_000071.2):c.833T>C (p.(Ile278Thr)), CBS(NM_000071.3):c.833T>C (p.I278T), CBS(NM_001321072.1):c.518T>C (p.I173T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43063074A>G" "" "pathogenic" "" "0000570714" "0" "90" "21" "44483184" "44483184" "subst" "0" "02329" "CBS_000043" "g.44483184A>G" "" "" "" "CBS(NM_000071.2):c.833T>C (p.(Ile278Thr)), CBS(NM_000071.3):c.833T>C (p.I278T), CBS(NM_001321072.1):c.518T>C (p.I173T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43063074A>G" "" "pathogenic" "" "0000570716" "0" "30" "21" "44483200" "44483200" "subst" "0.00692697" "01804" "CBS_000045" "g.44483200G>A" "" "" "" "CBS(NM_000071.2):c.829-12C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43063090G>A" "" "likely benign" "" "0000570717" "0" "30" "21" "44483217" "44483218" "ins" "0" "02330" "CBS_000022" "g.44483217_44483218insCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAGTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAG" "" "" "" "CBS(NM_000071.2):c.832_833ins68 (p.I278Tfs*16), CBS(NM_000071.2):c.832_833insCTGGGGTGGATCATCCAGGTGGGGCTTTTGCTGGGCTTGAGCCCTGAAGCCGCGCCCTCTGCAGATCA ..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43063107_43063108insCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAGTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAG" "" "likely benign" "" "0000570718" "0" "30" "21" "44483217" "44483218" "ins" "0" "02326" "CBS_000022" "g.44483217_44483218insCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAGTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAG" "" "" "" "CBS(NM_000071.2):c.832_833ins68 (p.I278Tfs*16), CBS(NM_000071.2):c.832_833insCTGGGGTGGATCATCCAGGTGGGGCTTTTGCTGGGCTTGAGCCCTGAAGCCGCGCCCTCTGCAGATCA ..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43063107_43063108insCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAGTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAG" "" "likely benign" "" "0000570719" "0" "30" "21" "44483217" "44483218" "ins" "0" "02329" "CBS_000022" "g.44483217_44483218insCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAGTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAG" "" "" "" "CBS(NM_000071.2):c.832_833ins68 (p.I278Tfs*16), CBS(NM_000071.2):c.832_833insCTGGGGTGGATCATCCAGGTGGGGCTTTTGCTGGGCTTGAGCCCTGAAGCCGCGCCCTCTGCAGATCA ..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43063107_43063108insCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAGTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAG" "" "likely benign" "" "0000570720" "0" "90" "21" "44484068" "44484068" "subst" "4.10452E-5" "02327" "CBS_000034" "g.44484068G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43063958G>A" "" "pathogenic" "" "0000570721" "0" "10" "21" "44484111" "44484111" "subst" "5.67151E-5" "02330" "CBS_000046" "g.44484111G>A" "" "" "" "CBS(NM_000071.3):c.737-10C>T, CBS(NM_001321072.1):c.422-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43064001G>A" "" "benign" "" "0000570722" "0" "30" "21" "44485350" "44485350" "subst" "0.274197" "02330" "CBS_000032" "g.44485350G>A" "" "" "" "CBS(NM_000071.3):c.699C>T (p.Y233=), LOC102724560(NM_001354006.1):c.699C>T (p.Y233=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43065240G>A" "" "likely benign" "" "0000570723" "0" "10" "21" "44485350" "44485350" "subst" "0.274197" "02325" "CBS_000032" "g.44485350G>A" "" "" "" "CBS(NM_000071.3):c.699C>T (p.Y233=), LOC102724560(NM_001354006.1):c.699C>T (p.Y233=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43065240G>A" "" "benign" "" "0000570724" "0" "10" "21" "44485350" "44485350" "subst" "0.274197" "02329" "CBS_000032" "g.44485350G>A" "" "" "" "CBS(NM_000071.3):c.699C>T (p.Y233=), LOC102724560(NM_001354006.1):c.699C>T (p.Y233=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43065240G>A" "" "benign" "" "0000570725" "0" "30" "21" "44485388" "44485388" "subst" "4.06164E-6" "01804" "CBS_000047" "g.44485388T>C" "" "" "" "CBS(NM_000071.2):c.667-6A>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43065278T>C" "" "likely benign" "" "0000570726" "0" "10" "21" "44485527" "44485527" "subst" "0.0012414" "01943" "CBS_000024" "g.44485527G>A" "" "" "" "CBS(NM_000071.2):c.636C>T (p.(Asn212=)), CBS(NM_001321072.1):c.321C>T (p.N107=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43065417G>A" "" "benign" "" "0000570727" "0" "10" "21" "44485715" "44485715" "subst" "0.00432295" "02330" "CBS_000048" "g.44485715C>T" "" "" "" "CBS(NM_000071.2):c.531+11G>A (p.(=)), CBS(NM_000071.3):c.531+11G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43065605C>T" "" "benign" "" "0000570728" "0" "30" "21" "44485715" "44485715" "subst" "0.00432295" "02329" "CBS_000048" "g.44485715C>T" "" "" "" "CBS(NM_000071.2):c.531+11G>A (p.(=)), CBS(NM_000071.3):c.531+11G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43065605C>T" "" "likely benign" "" "0000570729" "0" "50" "21" "44486404" "44486404" "subst" "8.95496E-5" "01943" "CBS_000049" "g.44486404C>T" "" "" "" "CBS(NM_000071.3):c.400G>A (p.(Gly134Arg)), CBS(NM_001321072.1):c.85G>A (p.G29R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43066294C>T" "" "VUS" "" "0000570730" "0" "50" "21" "44486423" "44486423" "subst" "0" "01804" "CBS_000050" "g.44486423A>C" "" "" "" "CBS(NM_000071.2):c.381T>G (p.(Ile127Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43066313A>C" "" "VUS" "" "0000570731" "0" "90" "21" "44486479" "44486479" "subst" "1.62801E-5" "02325" "CBS_000051" "g.44486479A>G" "" "" "" "CBS(NM_001321072.1):c.10T>C (p.C4R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43066369A>G" "" "pathogenic" "" "0000570732" "0" "10" "21" "44488631" "44488631" "subst" "0.00283574" "02330" "CBS_000001" "g.44488631T>G" "" "" "" "CBS(NM_000071.2):c.304A>C (p.(Lys102Gln), p.K102Q), CBS(NM_000071.3):c.304A>C (p.K102Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43068521T>G" "" "benign" "" "0000570733" "0" "50" "21" "44492158" "44492158" "subst" "0.000150626" "01943" "CBS_000052" "g.44492158G>A" "" "" "" "CBS(NM_000071.3):c.146C>T (p.(Pro49Leu), p.P49L), CBS(NM_001178008.2):c.146C>T (p.P49L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43072048G>A" "" "VUS" "" "0000570734" "0" "50" "21" "44492171" "44492171" "subst" "0.000659308" "02325" "CBS_000053" "g.44492171G>A" "" "" "" "CBS(NM_001178008.3):c.133C>T (p.R45W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43072061G>A" "" "VUS" "" "0000570735" "0" "10" "21" "44492252" "44492252" "subst" "0.000837674" "01943" "CBS_000030" "g.44492252G>A" "" "" "" "CBS(NM_000071.2):c.52C>T (p.(Arg18Cys), p.R18C), CBS(NM_001178008.2):c.52C>T (p.R18C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43072142G>A" "" "benign" "" "0000592765" "0" "10" "21" "44499284" "44499287" "del" "0" "00006" "CBS_000056" "g.44499284_44499287del" "20/30 chromosomes" "{PMID:Kraus 1998:9790750}" "" "-3469_-3466del -6921TTTC" "" "Germline" "" "" "0" "" "" "g.43079174_43079177del" "" "benign" "" "0000592766" "0" "90" "21" "44488702" "44488702" "subst" "4.06428E-6" "00006" "CBS_000207" "g.44488702G>C" "" "{PMID:de Franchis 1994:7981678}" "" "" "expression cloning in E.coli, CBs activity 0.126-0.609" "In vitro (cloned)" "" "" "0" "" "" "g.43068592G>C" "" "NA" "" "0000592767" "0" "90" "21" "44488629" "44488629" "subst" "4.06266E-6" "00006" "CBS_000201" "g.44488629C>G" "" "{PMID:de Franchis 1994:7981678}" "" "" "expression cloning in E.coli, CBs activity 0.333-0.387" "In vitro (cloned)" "" "" "0" "" "" "g.43068519C>G" "" "NA" "" "0000592768" "0" "90" "21" "44488629" "44488629" "subst" "0" "00006" "CBS_000058" "g.[44488629C>G;44488702G>C]" "" "{PMID:de Franchis 1994:7981678}" "" "" "expression cloning in E.coli, CBs activity 0" "In vitro (cloned)" "" "" "0" "" "" "g.[43068519C>G;43068592G>C]" "" "NA" "" "0000592769" "0" "90" "21" "44492132" "44492132" "subst" "8.15481E-6" "00006" "CBS_000213" "g.44492132G>A" "" "{PMID:de Franchis 1999:10408774}" "" "" "expression cloning in E.coli, CBs activity 0.013" "In vitro (cloned)" "" "" "0" "" "" "g.43072022G>A" "" "NA" "" "0000592770" "0" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:Kozich 1993:8353501}, {PMID:de Franchis 1999:10408774}" "" "" "expression cloning in E.coli, CBs activity 0-0.545" "In vitro (cloned)" "" "" "0" "" "" "g.43066353G>A" "" "NA" "" "0000592771" "0" "90" "21" "44486463" "44486463" "" "0" "00006" "CBS_000057" "g.[44486463G>A;44492132G>A]" "" "{PMID:de Franchis 1999:10408774}" "" "" "expression cloning in E.coli, CBs activity 0.013" "In vitro (cloned)" "" "" "0" "" "" "g.[43066353G>A;43072022G>A]" "" "NA" "" "0000592772" "0" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "{PMID:Marble 1994:7849717}" "" "" "expression cloning in E.coli, CBs activity 0.019" "In vitro (cloned)" "" "" "0" "" "" "g.43066320C>T" "" "NA" "" "0000592773" "0" "90" "21" "44486411" "44486411" "subst" "0" "00006" "CBS_000188" "g.44486411C>G" "" "{PMID:Marble 1994:7849717}" "" "" "expression cloning in E.coli, CBs activity 0" "In vitro (cloned)" "" "" "0" "" "" "g.43066301C>G" "" "NA" "" "0000592774" "0" "90" "21" "44486411" "44486411" "subst" "0" "00006" "CBS_000059" "g.[44486411C>G;44486430C>T]" "" "{PMID:Marble 1994:7849717}" "" "" "expression cloning in E.coli, CBs activity 0.015" "In vitro (cloned)" "" "" "0" "" "" "g.[43066301C>G;43066320C>T]" "" "NA" "" "0000592775" "0" "90" "21" "44486374" "44486374" "subst" "2.85665E-5" "00006" "CBS_000185" "g.44486374C>T" "" "{PMID:Dawson 1997:9156316}" "" "" "expression cloning in E.coli, CBs activity <0.01" "In vitro (cloned)" "" "" "0" "" "" "g.43066264C>T" "" "NA" "" "0000592776" "0" "90" "21" "44478986" "44478986" "subst" "0" "00006" "CBS_000084" "g.44478986C>T" "" "{PMID:Dawson 1997:9156316}" "" "" "expression cloning in E.coli, CBs activity 0.30" "In vitro (cloned)" "" "" "0" "" "" "g.43058876C>T" "" "NA" "" "0000592777" "0" "90" "21" "44478986" "44478986" "" "0" "00006" "CBS_000060" "g.[44478986C>T;44486374C>T]" "" "{PMID:Dawson 1997:9156316}" "" "" "expression cloning in E.coli, CBs activity <0.01" "In vitro (cloned)" "" "" "0" "" "" "g.[43058876C>T;43066264C>T]" "" "NA" "" "0000592778" "0" "90" "21" "44486370" "44486370" "subst" "4.08397E-6" "00006" "CBS_000184" "g.44486370G>A" "" "{PMID:Kozich 1993:8353501}" "" "" "expression cloning in E.coli, CBs activity 0" "In vitro (cloned)" "" "" "0" "" "" "g.43066260G>A" "" "NA" "" "0000592779" "0" "90" "21" "44485801" "44485801" "subst" "0" "00006" "CBS_000178" "g.44485801G>C" "" "Kluijtmans 1998, PhD thesis" "" "" "expression cloning in E.coli, CBs activity 0.003" "In vitro (cloned)" "" "" "0" "" "" "g.43065691G>C" "" "NA" "" "0000592780" "0" "90" "21" "44485763" "44485763" "subst" "0" "00006" "CBS_000027" "g.44485763C>T" "" "Kluijtmans 1998, PhD thesis" "" "" "expression cloning in E.coli, CBs activity 0.013" "In vitro (cloned)" "" "" "0" "" "" "g.43065653C>T" "" "NA" "" "0000592781" "0" "90" "21" "44485624" "44485624" "subst" "0" "00006" "CBS_000161" "g.44485624A>G" "" "Kluijtmans 1998, PhD thesis" "" "" "expression cloning in E.coli, CBs activity 0.03" "In vitro (cloned)" "" "" "0" "" "" "g.43065514A>G" "" "NA" "" "0000592782" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "Kluijtmans 1998, PhD thesis" "" "" "expression cloning in E.coli, CBs activity 0.01" "In vitro (cloned)" "" "" "0" "" "" "g.43065481G>A" "" "NA" "" "0000592783" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kozich and Kraus 1992:1301198}, Kluijtmans 1998, PhD thesis" "" "" "expression cloning in E.coli, CBs activity 0-0.0015" "In vitro (cloned)" "" "" "0" "" "" "g.43063074A>G" "" "NA" "" "0000592784" "0" "90" "21" "44483113" "44483113" "subst" "4.06138E-6" "00006" "CBS_000124" "g.44483113C>T" "" "{PMID:de Franchis 1999:10408774}" "" "" "expression cloning in E.coli, CBs activity 0.039-0.055" "In vitro (cloned)" "" "" "0" "" "" "g.43063003C>T" "" "NA" "" "0000592785" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Hu 1993:7506602}" "" "" "expression cloning in E.coli, CBs activity 0" "In vitro (cloned)" "" "" "0" "" "" "g.43062988C>T" "" "NA" "" "0000592786" "0" "90" "21" "44482468" "44482468" "subst" "4.06732E-6" "00006" "CBS_000116" "g.44482468G>T" "" "{PMID:Dawson 1997:9156316}" "" "" "expression cloning in E.coli, CBs activity <0.01" "In vitro (cloned)" "" "" "0" "" "" "g.43062358G>T" "" "NA" "" "0000592787" "0" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:de Franchis 1999:10408774}" "" "" "expression cloning in E.coli, CBs activity 0" "In vitro (cloned)" "" "" "0" "" "" "g.43062344G>A" "" "NA" "" "0000592788" "0" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "{PMID:Dawson 1997:9156316}" "" "" "expression cloning in E.coli, CBs activity <0.01" "In vitro (cloned)" "" "" "0" "" "" "g.43060528G>A" "" "NA" "" "0000592789" "0" "90" "21" "44476994" "44476994" "" "0" "00006" "CBS_000064" "g.[44476994G>A;44480591G>A]" "" "Kluijtmans 1998, PhD thesis" "" "" "expression cloning in E.coli, CBs activity 0.10" "In vitro (cloned)" "" "" "0" "" "" "g.[43056884G>A;43060481G>A]" "" "NA" "" "0000592790" "0" "90" "21" "44480585" "44480585" "subst" "0" "00006" "CBS_000103" "g.44480585C>T" "" "Kluijtmans 1998, PhD thesis" "" "" "expression cloning in E.coli, CBs activity 0.011" "In vitro (cloned)" "" "" "0" "" "" "g.43060475C>T" "" "NA" "" "0000592791" "0" "50" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:Kluijtmans 1996:8755636}" "" "" "expression cloning in E.coli, CBs activity 0.759" "In vitro (cloned)" "" "" "0" "" "" "g.43058862C>T" "" "NA" "" "0000592792" "0" "90" "21" "44478945" "44479079" "del" "0" "00006" "CBS_000080" "g.44478945_44479079del" "" "{PMID:Kozich and Kraus 1992:1301198}" "" "" "expression cloning in E.coli, CBs activity 0" "In vitro (cloned)" "" "" "0" "" "" "g.43058835_43058969del" "" "NA" "" "0000592794" "0" "90" "21" "44492110" "44492110" "subst" "4.07721E-6" "00006" "CBS_000211" "g.44492110T>C" "" "{PMID:Chen 1999:10687314}" "" "" "" "Germline" "" "" "0" "" "" "g.43072000T>C" "" "pathogenic" "" "0000592795" "11" "90" "21" "44488702" "44488702" "subst" "4.06428E-6" "00006" "CBS_000207" "g.44488702G>C" "" "{PMID:de Franchis 1994:7981678}" "" "" "both 0,5 activity" "Germline" "" "" "0" "" "" "g.43068592G>C" "" "pathogenic" "" "0000592796" "11" "90" "21" "44488629" "44488629" "subst" "4.06266E-6" "00006" "CBS_000201" "g.44488629C>G" "" "{PMID:de Franchis 1994:7981678}" "" "" "both 0,5 activity" "Germline" "" "" "0" "" "" "g.43068519C>G" "" "pathogenic" "" "0000592797" "1" "90" "21" "44488633" "44488633" "subst" "0" "00006" "CBS_000202" "g.44488633A>G" "" "{PMID:Gallagher 1998:9889017}" "" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43068523A>G" "" "pathogenic" "" "0000592798" "3" "90" "21" "44488633" "44488633" "subst" "0" "00006" "CBS_000202" "g.44488633A>G" "" "{PMID:Gallagher 1998:9889017}" "" "" "" "Germline" "" "" "0" "" "" "g.43068523A>G" "" "pathogenic" "" "0000592799" "1" "90" "21" "44492132" "44492132" "subst" "8.15481E-6" "00006" "CBS_000213" "g.44492132G>A" "" "{PMID:de Franchis 1999:10408774}, {PMID:Kraus 1999:10338090}" "" "" "" "Germline" "" "" "0" "" "" "g.43072022G>A" "" "pathogenic" "" "0000592800" "1" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:de Franchis 1999:10408774}, {PMID:Kraus 1999:10338090}" "MaeII+" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000592801" "2" "90" "21" "44486428" "44486428" "subst" "0" "00006" "CBS_000190" "g.44486428T>C" "" "{PMID:de Franchis 1999:10408774}, {PMID:Kraus 1999:10338090}" "" "" "" "Germline" "" "" "0" "" "" "g.43066318T>C" "" "pathogenic" "" "0000592802" "1" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:Kozich 1993:8353501}" "MaeII+" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000592803" "2" "90" "21" "44486370" "44486370" "subst" "4.08397E-6" "00006" "CBS_000184" "g.44486370G>A" "" "{PMID:Kozich 1993:8353501}" "" "" "" "Germline" "" "" "0" "" "" "g.43066260G>A" "" "pathogenic" "" "0000592804" "0" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:de Franchis 1999:10408774}" "MaeII+" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000592805" "0" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:de Franchis 1999:10408774}" "MaeII+" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000592806" "0" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:de Franchis 1999:10408774}" "MaeII+" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000592807" "0" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:de Franchis 1999:10408774}" "MaeII+" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000592808" "1" "90" "21" "44486458" "44486458" "subst" "0" "00006" "CBS_000198" "g.44486458C>T" "" "CBS mutation database, Sebastio" "" "" "" "Germline" "" "" "0" "" "" "g.43066348C>T" "" "pathogenic" "" "0000592809" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Sebastio" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592810" "1" "90" "21" "44486458" "44486458" "subst" "0" "00006" "CBS_000198" "g.44486458C>T" "" "CBS mutation database, Sebastio" "" "" "" "Germline" "" "" "0" "" "" "g.43066348C>T" "" "pathogenic" "" "0000592811" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Sebastio" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592812" "0" "90" "21" "44486458" "44486458" "subst" "0" "00006" "CBS_000198" "g.44486458C>T" "" "{PMID:Chen 1999:10687314}" "" "" "" "Germline" "" "" "0" "" "" "g.43066348C>T" "" "pathogenic" "" "0000592813" "0" "90" "21" "44486443" "44486443" "subst" "1.62633E-5" "00006" "CBS_000196" "g.44486443G>A" "" "CBS mutation database, Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43066333G>A" "" "pathogenic" "" "0000592814" "1" "90" "21" "44486443" "44486443" "subst" "1.62633E-5" "00006" "CBS_000196" "g.44486443G>A" "" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43066333G>A" "" "pathogenic" "" "0000592815" "2" "90" "21" "44484053" "44484053" "subst" "2.04344E-5" "00006" "CBS_000139" "g.44484053G>A" "" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43063943G>A" "" "pathogenic" "" "0000592816" "3" "90" "21" "44486442" "44486442" "subst" "0" "00006" "CBS_000194" "g.44486442C>A" "" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43066332C>A" "" "pathogenic" "" "0000592817" "3" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "{PMID:Kraus 1999:10338090}, R Gordon" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000592818" "3" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "{PMID:Sebastio 1995:7762555}" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000592819" "1" "90" "21" "44486420" "44486420" "subst" "4.06626E-6" "00006" "CBS_000189" "g.44486420C>G" "" "{PMID:Coude 1998:9870207}" "MulI-,FokI-" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43066310C>G" "" "pathogenic" "" "0000592820" "1" "90" "21" "44486389" "44486389" "subst" "3.26041E-5" "00006" "CBS_000187" "g.44486389C>T" "" "{PMID:Shih 1995:7611293}" "" "" "" "Germline" "" "" "0" "" "" "g.43066279C>T" "" "pathogenic" "" "0000592821" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Shih 1995:7611293}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592822" "1" "90" "21" "44486374" "44486374" "subst" "2.85665E-5" "00006" "CBS_000185" "g.44486374C>T" "" "{PMID:Shih 1995:7611293}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43066264C>T" "" "pathogenic" "" "0000592823" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Shih 1995:7611293}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592824" "11" "90" "21" "44486374" "44486374" "subst" "2.85665E-5" "00006" "CBS_000185" "g.44486374C>T" "" "{PMID:Gordon 1997:10215408}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43066264C>T" "" "pathogenic" "" "0000592825" "21" "90" "21" "44492094" "44492094" "subst" "4.0864E-6" "00006" "CBS_000029" "g.44492094C>T" "" "{PMID:Gordon 1997:10215408}" "" "" "" "Germline" "" "" "0" "" "" "g.43071984C>T" "" "pathogenic" "" "0000592826" "1" "90" "21" "44478986" "44478986" "subst" "0" "00006" "CBS_000084" "g.44478986C>T" "" "{PMID:Dawson 1997:9156316}" "EcoRII+;MspI-" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43058876C>T" "" "pathogenic" "" "0000592827" "1" "90" "21" "44486374" "44486374" "subst" "2.85665E-5" "00006" "CBS_000185" "g.44486374C>T" "" "{PMID:Dawson 1997:9156316}" "TaqI-" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43066264C>T" "" "pathogenic" "" "0000592828" "1" "90" "21" "44486362" "44486362" "subst" "1.22715E-5" "00006" "CBS_000183" "g.44486362C>T" "" "{PMID:Kraus 1999:10338090}, T Ohura" "MspI-,BstNI+" "" "" "Germline" "" "" "0" "" "" "g.43066252C>T" "" "pathogenic" "" "0000592829" "2" "90" "21" "44484042" "44484042" "subst" "0" "00006" "CBS_000138" "g.44484042T>C" "" "{PMID:Kraus 1999:10338090}, T Ohura" "" "" "" "Germline" "" "" "0" "" "" "g.43063932T>C" "" "pathogenic" "" "0000592830" "0" "90" "21" "44485570" "44485570" "subst" "0" "00006" "CBS_000158" "g.44485570T>A" "" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43065460T>A" "" "pathogenic" "" "0000592831" "0" "90" "21" "44486353" "44486353" "subst" "1.64037E-5" "00006" "CBS_000180" "g.44486353C>T" "" "CBS mutation database, Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43066243C>T" "" "pathogenic" "" "0000592832" "3" "90" "21" "44485801" "44485801" "subst" "0" "00006" "CBS_000178" "g.44485801G>C" "" "{PMID:Kluijtmans 1999:10364517}" "Sau3AI-" "" "" "Germline" "" "" "0" "" "" "g.43065691G>C" "" "pathogenic" "" "0000592833" "1" "90" "21" "44485801" "44485801" "subst" "0" "00006" "CBS_000178" "g.44485801G>C" "" "{PMID:Kluijtmans 1999:10364517}" "Sau3AI-" "" "" "Germline" "" "" "0" "" "" "g.43065691G>C" "" "pathogenic" "" "0000592834" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592835" "3" "90" "21" "44485763" "44485763" "subst" "0" "00006" "CBS_000027" "g.44485763C>T" "" "{PMID:Kluijtmans 1999:10364517}" "BsoFI-" "" "" "Germline" "" "" "0" "" "" "g.43065653C>T" "" "pathogenic" "" "0000592836" "2" "90" "21" "44480585" "44480585" "subst" "0" "00006" "CBS_000103" "g.44480585C>T" "" "{PMID:Kluijtmans 1995:7635485}" "" "" "" "Germline" "" "" "0" "" "" "g.43060475C>T" "" "pathogenic" "" "0000592837" "1" "90" "21" "44485763" "44485763" "subst" "0" "00006" "CBS_000027" "g.44485763C>T" "" "{PMID:Kluijtmans 1995:7635485}" "BsoFI-" "" "" "Germline" "" "" "0" "" "" "g.43065653C>T" "" "pathogenic" "" "0000592838" "11" "90" "21" "44485763" "44485763" "subst" "0" "00006" "CBS_000027" "g.44485763C>T" "" "{PMID:Gordon 1997:10215408}" "BsoFI-" "" "" "Germline" "" "" "0" "" "" "g.43065653C>T" "" "pathogenic" "" "0000592839" "21" "90" "21" "44474024" "44474027" "dup" "0" "00006" "CBS_000067" "g.44474024_44474027dup" "" "{PMID:Gordon 1997:10215408}" "" "1622insTGGA" "" "Germline" "" "" "0" "" "" "g.43053914_43053917dup" "" "pathogenic" "" "0000592840" "3" "90" "21" "44485755" "44485755" "subst" "0" "00006" "CBS_000171" "g.44485755C>T" "" "{PMID:Kruger 1995:8528202}" "" "" "" "Germline" "" "" "0" "" "" "g.43065645C>T" "" "pathogenic" "" "0000592841" "3" "90" "21" "44485731" "44485731" "subst" "0" "00006" "CBS_000166" "g.44485731C>T" "" "{PMID:Kozich 1997:9266356}" "BstXI+" "" "" "Germline" "" "" "0" "" "" "g.43065621C>T" "" "pathogenic" "" "0000592842" "1" "90" "21" "44485624" "44485624" "subst" "0" "00006" "CBS_000161" "g.44485624A>G" "" "{PMID:Kluijtmans 1999:10364517}" "" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43065514A>G" "" "pathogenic" "" "0000592843" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Kraus 1999:10338090}, L Kluijtmans" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000592844" "1" "90" "21" "44479389" "44479389" "subst" "0" "00006" "CBS_000097" "g.44479389C>T" "" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43059279C>T" "" "pathogenic" "" "0000592845" "2" "90" "21" "44488619" "44488622" "del" "0" "00006" "CBS_000200" "g.44488619_44488622del" "" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43068509_43068512del" "" "pathogenic" "" "0000592846" "1" "90" "21" "44485378" "44485378" "subst" "8.12354E-6" "00006" "CBS_000155" "g.44485378C>T" "" "{PMID:Kruger 1995:8528202}" "" "" "" "Germline" "" "" "0" "" "" "g.43065268C>T" "" "pathogenic" "" "0000592847" "0" "90" "21" "44485349" "44485349" "subst" "8.12196E-6" "00006" "CBS_000147" "g.44485349C>T" "" "CBS mutation database, Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43065239C>T" "" "pathogenic" "" "0000592848" "21" "90" "21" "44485334" "44485334" "subst" "0" "00006" "CBS_000145" "g.44485334C>T" "" "{PMID:de Franchis 1994:7981678}" "" "" "" "Germline" "" "" "0" "" "" "g.43065224C>T" "" "pathogenic" "" "0000592849" "3" "90" "21" "44484068" "44484068" "subst" "4.10452E-5" "00006" "CBS_000034" "g.44484068G>A" "" "{PMID:Sebastio 1995:7762555}" "NlaIII+" "" "" "Germline" "" "" "0" "" "" "g.43063958G>A" "" "pathogenic" "" "0000592850" "0" "90" "21" "44484063" "44484063" "subst" "4.09705E-6" "00006" "CBS_000141" "g.44484063C>T" "" "{PMID:Chen 1999:10687314}" "" "" "" "Germline" "" "" "0" "" "" "g.43063953C>T" "" "pathogenic" "" "0000592851" "3" "90" "21" "44484053" "44484053" "subst" "2.04344E-5" "00006" "CBS_000139" "g.44484053G>A" "" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43063943G>A" "" "pathogenic" "" "0000592852" "1" "90" "21" "44484053" "44484053" "subst" "2.04344E-5" "00006" "CBS_000139" "g.44484053G>A" "" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43063943G>A" "" "pathogenic" "" "0000592853" "2" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Kraus 1999:10338090}, V Shih" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592854" "3" "90" "21" "44484053" "44484053" "subst" "2.04344E-5" "00006" "CBS_000139" "g.44484053G>A" "" "{PMID:Kim 1997:9361025}" "" "" "" "Germline" "" "" "0" "" "" "g.43063943G>A" "" "pathogenic" "" "0000592855" "3" "90" "21" "44484041" "44484041" "subst" "8.17054E-6" "00006" "CBS_000137" "g.44484041C>T" "" "{PMID:Kim 1997:9361025}" "" "" "" "Germline" "" "" "0" "" "" "g.43063931C>T" "" "pathogenic" "" "0000592856" "3" "90" "21" "44484041" "44484041" "subst" "8.17054E-6" "00006" "CBS_000137" "g.44484041C>T" "" "{PMID:Kim 1997:9361025}" "" "" "" "Germline" "" "" "0" "" "" "g.43063931C>T" "" "pathogenic" "" "0000592857" "1" "90" "21" "44484041" "44484041" "subst" "8.17054E-6" "00006" "CBS_000137" "g.44484041C>T" "" "{PMID:Kim 1997:9361025}" "" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063931C>T" "" "pathogenic" "" "0000592858" "3" "90" "21" "44484041" "44484041" "subst" "8.17054E-6" "00006" "CBS_000137" "g.44484041C>T" "" "{PMID:Kim 1997:9361025}" "" "" "" "Germline" "" "" "0" "" "" "g.43063931C>T" "" "pathogenic" "" "0000592859" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Shih 1995:7611293}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592860" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Shih 1995:7611293}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592861" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Shih" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592862" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Shih 1995:7611293}" "BsrI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592863" "1" "90" "21" "44485613" "44485630" "del" "0" "00006" "CBS_000160" "g.44485613_44485630del" "" "{PMID:Shih 1995:7611293}" "" "533del18" "" "Germline" "" "" "0" "" "" "g.43065503_43065520del" "" "pathogenic" "" "0000592864" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kozich and Kraus 1992:1301198}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592865" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Sebastio" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592866" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Sperandeo 1996:8803779}" "BsrI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592867" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Sebastio 1995:7762555}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592868" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Sebastio 1995:7762555}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592869" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Sebastio 1995:7762555}" "BsrI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592870" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592871" "2" "90" "21" "44485763" "44485763" "subst" "0" "00006" "CBS_000027" "g.44485763C>T" "" "{PMID:Kluijtmans 1999:10364517}" "BsoFI-" "" "" "Germline" "" "" "0" "" "" "g.43065653C>T" "" "pathogenic" "" "0000592872" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kluijtmans" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592873" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592874" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592875" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592876" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592877" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592878" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592879" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592880" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592881" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592882" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kozich and Kraus 1992:1301198}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592883" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kozich and Kraus 1992:1301198}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592884" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Sebastio 1995:7762555}" "BsrI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592885" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592886" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592887" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592888" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592889" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kluijtmans" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592890" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kluijtmans" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592891" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kluijtmans" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592892" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kluijtmans" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592893" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kozich and Kraus 1992:1301198}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592894" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Tsai 1997:10462600}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592895" "2" "90" "21" "44480587" "44480587" "subst" "1.236E-5" "00006" "CBS_000104" "g.44480587C>T" "" "{PMID:Tsai 1997:10462600}" "MaeII+" "" "" "Germline" "" "" "0" "" "" "g.43060477C>T" "" "pathogenic" "" "0000592896" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Tsai 1996:8884070}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592897" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Tsai 1996:8884070}" "BsrI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592898" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Tsai 1996:8884070}" "BsrI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592899" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Tsai 1996:8884070}" "BsrI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592900" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Janosik 2001:11359213}" "BsrI+" "" "CBS activity 0.43 nM/mg/h" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592901" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Janosik 2001:11359213}" "BsrI+" "" "CBS activity 0.23 nM/mg/h" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592902" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kraus 1999:10338090}, V Kozich" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592903" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kim 1997:9361025}" "BsrI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592904" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592905" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592906" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592907" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592908" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592909" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Gaustadnes 1998:9708897}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592910" "11" "90" "21" "44483148" "44483148" "subst" "0" "00006" "CBS_000126" "g.44483148G>A" "" "{PMID:Sperandeo 1995:7564249}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43063038G>A" "" "pathogenic" "" "0000592911" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592912" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592913" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Hu 1993:7506602}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592914" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Hu 1993:7506602}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592915" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Hu 1993:7506602}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592916" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Hu 1993:7506602}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592917" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Hu 1993:7506602}" "AluI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592918" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Hu 1993:7506602}" "AluI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592919" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Hu 1993:7506602}" "AluI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592920" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Hu 1993:7506602}" "AluI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592921" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Hu 1993:7506602}" "AluI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592922" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Gordon" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592923" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Gordon" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592924" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:de Franchis 1999:10408774}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592925" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592926" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592927" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592928" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592929" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592930" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592931" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592932" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592933" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592934" "2" "90" "21" "44485365" "44485365" "subst" "8.12269E-6" "00006" "CBS_000151" "g.44485365G>C" "" "{PMID:Gallagher 1998:9889017}" "" "" "" "Germline" "" "" "0" "" "" "g.43065255G>C" "" "pathogenic" "" "0000592935" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592936" "2" "90" "21" "44484053" "44484053" "subst" "2.04344E-5" "00006" "CBS_000139" "g.44484053G>A" "" "{PMID:Gallagher 1998:9889017}" "" "" "" "Germline" "" "" "0" "" "" "g.43063943G>A" "" "pathogenic" "" "0000592937" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592938" "2" "90" "21" "44480633" "44480633" "subst" "0" "00006" "CBS_000108" "g.44480633C>G" "" "{PMID:Gallagher 1998:9889017}" "" "" "" "Germline" "" "" "0" "" "" "g.43060523C>G" "" "pathogenic" "" "0000592939" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592940" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592941" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592942" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592943" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Gallager 1998:9889017}" "" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592944" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gallager 1998:9889017}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592945" "2" "90" "21" "44488633" "44488633" "subst" "0" "00006" "CBS_000202" "g.44488633A>G" "" "{PMID:Gallagher 1998:9889017}" "" "" "" "Germline" "" "" "0" "" "" "g.43068523A>G" "" "pathogenic" "" "0000592946" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Gallagher" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592947" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Shih" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592948" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Shih" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592949" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Shih" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592950" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Shih" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592951" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Kraus 1999:10338090}, V Shih" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592952" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Kraus 1999:10338090}, V Shih" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592953" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Shih" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592954" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Shih" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592955" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Gordon" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592956" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Gordon" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592957" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kruger" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592958" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kruger" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592959" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Tsai 1997:9232191}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592960" "2" "90" "21" "44478943" "44478943" "subst" "0" "00006" "CBS_000079" "g.44478943C>T" "" "{PMID:Tsai 1997:9232191}" "Sau3AI+" "" "" "Germline" "" "" "0" "" "" "g.43058833C>T" "" "pathogenic" "" "0000592961" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Tsai 1996:8884070}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592962" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Tsai 1996:8884070}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592963" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Tsai" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592964" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Kim 1997:9361025}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592965" "2" "90" "21" "44482501" "44482501" "subst" "1.62982E-5" "00006" "CBS_000120" "g.44482501A>G" "" "{PMID:Kim 1997:9361025}" "" "" "" "Germline" "" "" "0" "" "" "g.43062391A>G" "" "pathogenic" "" "0000592966" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Kim 1997:9361025}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592967" "2" "90" "21" "44482501" "44482501" "subst" "1.62982E-5" "00006" "CBS_000120" "g.44482501A>G" "" "{PMID:Kim 1997:9361025}" "" "" "" "Germline" "" "" "0" "" "" "g.43062391A>G" "" "pathogenic" "" "0000592968" "3" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Kim 1997:9361025}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000592969" "1" "90" "21" "44482468" "44482468" "subst" "4.06732E-6" "00006" "CBS_000116" "g.44482468G>T" "" "{PMID:Dawson 1997:9156316}" "HinfI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43062358G>T" "" "pathogenic" "" "0000592970" "1" "90" "21" "44482468" "44482468" "subst" "8.13464E-6" "00006" "CBS_000117" "g.44482468G>A" "" "{PMID:Kruger 1995:8528202}" "" "" "" "Germline" "" "" "0" "" "" "g.43062358G>A" "" "pathogenic" "" "0000592971" "0" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:de Franchis 1999:10408774}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000592972" "3" "90" "21" "44482453" "44482453" "subst" "0" "00006" "CBS_000114" "g.44482453C>T" "" "{PMID:Coude 1998:9870207}" "SphI-" "" "" "Germline" "" "" "0" "" "" "g.43062343C>T" "" "pathogenic" "" "0000592973" "3" "90" "21" "44482453" "44482453" "subst" "0" "00006" "CBS_000114" "g.44482453C>T" "" "{PMID:Coude 1998:9870207}" "SphI-" "" "" "Germline" "" "" "0" "" "" "g.43062343C>T" "" "pathogenic" "" "0000592974" "1" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "{PMID:Dawson 1997:9156316}" "" "" "" "Germline" "" "" "0" "" "" "g.43060528G>A" "" "pathogenic" "" "0000592975" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Dawson 1997:9156316}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592976" "1" "90" "21" "44480636" "44480636" "subst" "0" "00006" "CBS_000109" "g.44480636C>T" "" "{PMID:Coude 1998:9870207}" "" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43060526C>T" "" "pathogenic" "" "0000592977" "3" "90" "21" "44480615" "44480615" "subst" "1.68285E-5" "00006" "CBS_000107" "g.44480615C>T" "" "{PMID:Castro 2001:11553052}" "HhaI-" "" "" "Germline" "" "" "0" "" "" "g.43060505C>T" "" "pathogenic" "" "0000592978" "1" "90" "21" "44480591" "44480591" "subst" "0.00308525" "00006" "CBS_000019" "g.44480591G>A" "" "{PMID:Kim 1997:9361025}" "HhaI-" "" "" "Germline" "" "" "0" "" "" "g.43060481G>A" "" "pathogenic" "" "0000592979" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kim 1997:9361025}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592980" "3" "90" "21" "44480591" "44480591" "subst" "0.00308525" "00006" "CBS_000019" "g.44480591G>A" "" "{PMID:Kluijtmans 1999:10364517}" "HhaI-" "" "" "Germline" "" "" "0" "" "" "g.43060481G>A" "" "pathogenic" "" "0000592981" "3" "90" "21" "44476994" "44476994" "subst" "0" "00006" "CBS_000074" "g.44476994G>A" "" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Germline" "" "" "0" "" "" "g.43056884G>A" "" "pathogenic" "" "0000592982" "3" "90" "21" "44480590" "44480590" "subst" "0" "00006" "CBS_000105" "g.44480590C>T" "" "{PMID:Kraus 1994:7967489}" "" "" "" "Germline" "" "" "0" "" "" "g.43060480C>T" "" "pathogenic" "" "0000592983" "1" "90" "21" "44480585" "44480585" "subst" "0" "00006" "CBS_000103" "g.44480585C>T" "" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Germline" "" "" "0" "" "" "g.43060475C>T" "" "pathogenic" "" "0000592984" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592985" "3" "90" "21" "44479409" "44479409" "subst" "0" "00006" "CBS_000099" "g.44479409T>C" "" "{PMID:Aral 1997:8990018}" "" "" "" "Germline" "" "" "0" "" "" "g.43059299T>C" "" "pathogenic" "" "0000592986" "0" "90" "21" "44479407" "44479407" "subst" "0" "00006" "CBS_000098" "g.44479407C>G" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43059297C>G" "" "pathogenic" "" "0000592987" "0" "90" "21" "44479407" "44479407" "subst" "0" "00006" "CBS_000098" "g.44479407C>G" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43059297C>G" "" "pathogenic" "" "0000592988" "0" "90" "21" "44479386" "44479386" "subst" "0" "00006" "CBS_000096" "g.44479386C>A" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43059276C>A" "" "pathogenic" "" "0000592989" "1" "90" "21" "44479001" "44479001" "subst" "0" "00006" "CBS_000086" "g.44479001G>T" "" "{PMID:Kluijtmans 1999:10364517}" "" "" "" "Germline" "" "" "0" "" "" "g.43058891G>T" "" "pathogenic" "" "0000592990" "2" "90" "21" "44486431" "44486431" "subst" "0" "00006" "CBS_000193" "g.44486431G>A" "" "{PMID:Kluijtmans 1999:10364517}" "AciI-" "" "" "Germline" "" "" "0" "" "" "g.43066321G>A" "" "pathogenic" "" "0000592991" "1" "90" "21" "44478998" "44478998" "subst" "0" "00006" "CBS_000085" "g.44478998A>G" "" "{PMID:Maclean 2002:12007221}" "" "" "" "Germline" "" "" "0" "" "" "g.43058888A>G" "" "pathogenic" "" "0000592992" "2" "90" "21" "44483062" "44483062" "subst" "0" "00006" "CBS_000121" "g.44483062C>T" "" "{PMID:Maclean 2002:12007221}" "" "IVS8+1G>A" "" "Germline" "" "" "0" "" "" "g.43062952C>T" "" "pathogenic" "" "0000592993" "1" "90" "21" "44478986" "44478986" "subst" "0" "00006" "CBS_000084" "g.44478986C>T" "" "{PMID:Tsai 1997:10462600}" "EcoRII+;MspI-" "" "" "Germline" "" "" "0" "" "" "g.43058876C>T" "" "pathogenic" "" "0000592994" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Tsai 1997:10462600}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000592995" "3" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:Kluijtmans 1996:8755636}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000592996" "0" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "CBS mutation database, Shih" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000592997" "0" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "CBS mutation database, Linnebank" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000592998" "1" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:Maclean 2002:12007221}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000592999" "2" "90" "21" "44488682" "44488682" "subst" "4.0623E-6" "00006" "CBS_000206" "g.44488682C>T" "" "{PMID:Maclean 2002:12007221}" "" "" "" "Germline" "" "" "0" "" "" "g.43068572C>T" "" "pathogenic" "" "0000593000" "1" "90" "21" "44478325" "44478325" "subst" "1.21836E-5" "00006" "CBS_000075" "g.44478325G>A" "" "{PMID:Maclean 2002:12007221}" "" "" "" "Germline" "" "" "0" "" "" "g.43058215G>A" "" "pathogenic" "" "0000593001" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Maclean 2002:12007221}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593002" "0" "90" "21" "44474045" "44474045" "subst" "0" "00006" "CBS_000069" "g.44474045A>T" "" "{PMID:Kraus 1999:10338090}, Coude 1995" "" "" "" "Germline" "" "" "0" "" "" "g.43053935A>T" "" "pathogenic" "" "0000593003" "3" "90" "21" "44474030" "44474030" "subst" "4.07442E-6" "00006" "CBS_000068" "g.44474030A>G" "" "{PMID:Aral 1997:8990018}" "" "" "" "Germline" "" "" "0" "" "" "g.43053920A>G" "" "pathogenic" "" "0000593004" "1" "90" "21" "44479076" "44479076" "subst" "0" "00006" "CBS_000090" "g.44479076C>T" "" "{PMID:Janosik 2001:11359213}" "BslI-" "" "CBS activity 0.13 nM/mg/h" "Germline" "" "" "0" "" "" "g.43058966C>T" "" "pathogenic" "" "0000593005" "2" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:Janosik 2001:11359213}" "" "" "CBS activity 0.13 nM/mg/h" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593006" "1" "90" "21" "44479043" "44479043" "subst" "0" "00006" "CBS_000089" "g.44479043G>C" "" "{PMID:Coude 1998:9870207}" "" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43058933G>C" "" "pathogenic" "" "0000593007" "0" "90" "21" "44478981" "44478981" "subst" "0" "00006" "CBS_000083" "g.44478981T>A" "" "{PMID:Chen 1999:10687314}" "" "" "" "Germline" "" "" "0" "" "" "g.43058871T>A" "" "pathogenic" "" "0000593008" "3" "90" "21" "44492290" "44492290" "dup" "0" "00006" "CBS_000218" "g.44492290dup" "" "{PMID:Kozich 1997:9301969}" "" "19insC" "" "Germline" "" "" "0" "" "" "g.43072180dup" "" "pathogenic" "" "0000593009" "1" "90" "21" "44492290" "44492290" "dup" "0" "00006" "CBS_000218" "g.44492290dup" "" "{PMID:Kozich 1997:9301969}" "" "19insC" "" "Germline" "" "" "0" "" "" "g.43072180dup" "" "pathogenic" "" "0000593010" "1" "90" "21" "44486442" "44486442" "subst" "2.43994E-5" "00006" "CBS_000195" "g.44486442C>T" "" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43066332C>T" "" "pathogenic" "" "0000593011" "2" "90" "21" "44486353" "44486353" "subst" "1.64037E-5" "00006" "CBS_000180" "g.44486353C>T" "" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43066243C>T" "" "pathogenic" "" "0000593012" "1" "90" "21" "44485725" "44485806" "del" "0" "00006" "CBS_000062" "g.(44485632_44485725)_(44485806_44486352)del" "" "{PMID:Kraus 1999:10338090}, V Shih" "" "452del80" "" "Germline" "" "" "0" "" "" "g.(43065522_43065615)_(43065696_43066242)del" "" "pathogenic" "" "0000593013" "2" "90" "21" "44480641" "44480641" "subst" "0" "00006" "CBS_000110" "g.44480641C>T" "" "{PMID:Kraus 1999:10338090}, V Shih" "" "" "" "Germline" "" "" "0" "" "" "g.43060531C>T" "" "pathogenic" "" "0000593014" "0" "90" "21" "44492094" "44492094" "subst" "4.0864E-6" "00006" "CBS_000029" "g.44492094C>T" "" "CBS mutation database, Linnebank" "" "IVS1+1G>A" "" "Germline" "" "" "0" "" "" "g.43071984C>T" "" "pathogenic" "" "0000593015" "1" "90" "21" "44485743" "44485764" "del" "0" "00006" "CBS_000169" "g.44485743_44485764del" "" "{PMID:Gaustadnes 1998:9708897}" "" "493del22" "" "Germline" "" "" "0" "" "" "g.43065633_43065654del" "" "pathogenic" "" "0000593016" "3" "90" "21" "44488631" "44488631" "subst" "0.00283574" "00006" "CBS_000001" "g.44488631T>G" "" "{PMID:Kozich 1997:9301969}" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43068521T>G" "" "pathogenic" "" "0000593017" "3" "90" "21" "44485634" "44485662" "del" "0" "00006" "CBS_000162" "g.44485634_44485662del" "" "{PMID:Kozich 1997:9301969}" "" "532-32del30" "" "Germline" "" "" "0" "" "" "g.43065524_43065552del" "" "pathogenic" "" "0000593018" "0" "90" "21" "44482420" "44482506" "del" "0" "00006" "CBS_000063" "g.(44480657_44482420)_(44482506_44483062)del" "" "{PMID:Chen 1999:10687314}" "" "955del85" "" "Germline" "" "" "0" "" "" "g.(43060547_43062310)_(43062396_43062952)del" "" "pathogenic" "" "0000593019" "21" "90" "21" "44479217" "44479265" "del" "0" "00006" "CBS_000092" "g.44479217_44479265del" "" "{PMID:Sperandeo 1995:7564249}" "" "IVS11-89del49" "" "Germline" "" "" "0" "" "" "g.43059107_43059155del" "" "pathogenic" "" "0000593020" "1" "90" "21" "44479335" "44479414" "del" "0" "00006" "CBS_000061" "g.(44479079_44479335)_(44479414_44480550)del" "" "{PMID:Kruger 1995:8528202}" "" "1146del78" "" "Germline" "" "" "0" "" "" "g.(43058969_43059225)_(43059304_43060440)del" "" "pathogenic" "" "0000593021" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "CBS activity 0.03 nM/mg/h" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593022" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "BsrI+" "" "CBS activity 0.03 nM/mg/h" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593023" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Janosik 2001:11359213}" "MspI+" "IVS11-2A>C" "CBS activity 0.00 nM/mg/h" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593024" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Janosik 2001:11359213}" "BsrI+" "" "CBS activity 0.00 nM/mg/h" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593025" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "CBS activity 0.00 nM/mg/h" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593026" "2" "90" "21" "44484009" "44484009" "subst" "8.23981E-6" "00006" "CBS_000134" "g.44484009C>T" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "" "IVS7+1G>A 828ins104" "CBS activity 0.00 nM/mg/h" "Germline" "" "" "0" "" "" "g.43063899C>T" "" "pathogenic" "" "0000593027" "2" "90" "21" "44479198" "44479298" "del" "0" "00006" "CBS_000093" "g.44479198_44479298del" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "" "IVS11+39del99" "CBS activity 0.00 nM/mg/h" "Germline" "" "" "0" "" "" "g.43059088_43059188del" "" "pathogenic" "" "0000593028" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "CBS activity 0.05 nM/mg/h" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593029" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "BsrI+" "" "CBS activity 0.05 nM/mg/h" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593030" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "CBS activity 0.10 nM/mg/h" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593031" "2" "90" "21" "44479076" "44479076" "subst" "0" "00006" "CBS_000090" "g.44479076C>T" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "BslI-" "" "CBS activity 0.10 nM/mg/h" "Germline" "" "" "0" "" "" "g.43058966C>T" "" "pathogenic" "" "0000593032" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Kraus 1999:10338090}, H Koch" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593033" "2" "90" "21" "44484070" "44484099" "del" "0" "00006" "CBS_000142" "g.44484070_44484099del" "" "{PMID:Kraus 1999:10338090}, H Koch" "" "739del30 del aa 247-256" "" "Germline" "" "" "0" "" "" "g.43063960_43063989del" "" "pathogenic" "" "0000593034" "11" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Kozich and Kraus 1992:1301198}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593035" "21" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kozich and Kraus 1992:1301198}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593036" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kraus 1999:10338090}, M Tsai" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593037" "2" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Kraus 1999:10338090}, M Tsai" "MspI+" "" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593038" "0" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Kraus 1999:10338090}, M Tsai" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593039" "3" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Kraus 1999:10338090}, H Koch" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593040" "0" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "CBS mutation database, Linnebank" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593041" "0" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "CBS mutation database, Linnebank" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593042" "0" "90" "21" "44478364" "44478364" "subst" "0" "00006" "CBS_000078" "g.44478364C>G" "" "CBS mutation database, Linnebank" "" "IVS12-1G>C" "" "Germline" "" "" "0" "" "" "g.43058254C>G" "" "pathogenic" "" "0000593043" "0" "90" "21" "44478364" "44478364" "subst" "0" "00006" "CBS_000078" "g.44478364C>G" "" "CBS mutation database, Linnebank" "" "IVS12-1G>C" "" "Germline" "" "" "0" "" "" "g.43058254C>G" "" "pathogenic" "" "0000593044" "0" "90" "21" "44474090" "44474096" "dup" "0" "00006" "CBS_000073" "g.44474090_44474096dup" "" "CBS mutation database, Ben de Wet JM" "" "1559insACCACAG" "" "Germline" "" "" "0" "" "" "g.43053980_43053986dup" "" "pathogenic" "" "0000593045" "1" "90" "21" "44474082" "44474082" "del" "0" "00006" "CBS_000072" "g.44474082del" "" "{PMID:Castro 2001:11553052}" "NciI-" "1566delG" "" "Germline" "" "" "0" "" "" "g.43053972del" "" "pathogenic" "" "0000593046" "3" "90" "21" "44474082" "44474082" "del" "0" "00006" "CBS_000072" "g.44474082del" "" "{PMID:Castro 2001:11553052}" "NciI-" "1566delG" "" "Germline" "" "" "0" "" "" "g.43053972del" "" "pathogenic" "" "0000593047" "0" "90" "21" "44474053" "44474056" "del" "0" "00006" "CBS_000070" "g.44474053_44474056del" "" "{PMID:Chen 1999:10687314}" "" "1590del4" "" "Germline" "" "" "0" "" "" "g.43053943_43053946del" "" "pathogenic" "" "0000593048" "0" "90" "21" "44474053" "44474056" "del" "0" "00006" "CBS_000070" "g.44474053_44474056del" "" "CBS mutation database, Ohura" "" "1591del4" "" "Germline" "" "" "0" "" "" "g.43053943_43053946del" "" "pathogenic" "" "0000593049" "3" "90" "21" "44474001" "44474019" "del" "0" "00006" "CBS_000066" "g.44474001_44474019del" "" "{PMID:Kozich 1997:9301969}" "Sau96I-" "1627del19" "" "Germline" "" "" "0" "" "" "g.43053891_43053909del" "" "pathogenic" "" "0000593050" "11" "90" "21" "44488702" "44488702" "subst" "4.06428E-6" "00006" "CBS_000207" "g.44488702G>C" "" "{PMID:de Franchis 1994:7981678}" "" "" "both 0,5 activity" "Germline" "" "" "0" "" "" "g.43068592G>C" "" "pathogenic" "" "0000593051" "11" "90" "21" "44488629" "44488629" "subst" "4.06266E-6" "00006" "CBS_000201" "g.44488629C>G" "" "{PMID:de Franchis 1994:7981678}" "" "" "both 0,5 activity" "Germline" "" "" "0" "" "" "g.43068519C>G" "" "pathogenic" "" "0000593052" "21" "90" "21" "44485334" "44485334" "subst" "0" "00006" "CBS_000145" "g.44485334C>T" "" "{PMID:de Franchis 1994:7981678}" "" "" "" "Germline" "" "" "0" "" "" "g.43065224C>T" "" "pathogenic" "" "0000593053" "3" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "{PMID:Marble 1994:7849717}" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000593054" "3" "90" "21" "44486411" "44486411" "subst" "0" "00006" "CBS_000188" "g.44486411C>G" "" "{PMID:Marble 1994:7849717}" "" "" "" "Germline" "" "" "0" "" "" "g.43066301C>G" "" "pathogenic" "" "0000593055" "3" "30" "21" "44485804" "44485804" "subst" "0" "00006" "CBS_000179" "g.44485804C>T" "" "{PMID:Marble 1994:7849717}" "" "" "" "Germline" "" "" "0" "" "" "g.43065694C>T" "" "likely benign" "" "0000593056" "3" "90" "21" "44484041" "44484041" "subst" "8.17054E-6" "00006" "CBS_000137" "g.44484041C>T" "" "{PMID:Kim 1997:9361025}" "" "" "" "Germline" "" "" "0" "" "" "g.43063931C>T" "" "pathogenic" "" "0000593057" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593058" "2" "90" "21" "44488673" "44488673" "subst" "0" "00006" "CBS_000203" "g.44488673G>A" "" "{PMID:Sebastio 1995:7762555}" "MnlI+" "" "" "Germline" "" "" "0" "" "" "g.43068563G>A" "" "pathogenic" "" "0000593059" "1" "10" "21" "44483184" "44483185" "ins" "0" "00006" "CBS_000133" "g.44483184_44483185insTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAGCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAG" "" "{PMID:Sebastio 1995:7762555}, {PMID:Sperandeo 1996:8940285}" "BsrI+" "833T>C;844ins68 (insCTGGGGTGGATCATCCAGGTGGGGCTTTTGCTGGGCTTGAGCCCTGAAGCCGCGCCCTCTGCAGATCA)" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "benign" "" "0000593060" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Sperandeo 1996:8940285}" "" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593061" "2" "90" "21" "44483104" "44483104" "subst" "0" "00006" "CBS_000123" "g.44483104C>T" "" "{PMID:Sperandeo 1996:8940285}" "" "" "" "Germline" "" "" "0" "" "" "g.43062994C>T" "" "pathogenic" "" "0000593062" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kluijtmans 1999:10364517}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593063" "1" "90" "21" "44480591" "44480591" "subst" "0.00308525" "00006" "CBS_000019" "g.44480591G>A" "" "{PMID:Kim 1997:9361025}" "HhaI-" "" "" "Germline" "" "" "0" "" "" "g.43060481G>A" "" "pathogenic" "" "0000593064" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kim 1997:9361025}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593065" "0" "90" "21" "44483113" "44483113" "subst" "4.06138E-6" "00006" "CBS_000124" "g.44483113C>T" "" "{PMID:de Franchis 1999:10408774}" "" "" "" "Germline" "" "" "0" "" "" "g.43063003C>T" "" "pathogenic" "" "0000593066" "1" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:de Franchis 1999:10408774}, {PMID:Kraus 1999:10338090}" "MaeII+" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593067" "2" "90" "21" "44483113" "44483113" "subst" "4.06138E-6" "00006" "CBS_000124" "g.44483113C>T" "" "{PMID:de Franchis 1999:10408774}, {PMID:Kraus 1999:10338090}" "" "" "" "Germline" "" "" "0" "" "" "g.43063003C>T" "" "pathogenic" "" "0000593068" "1" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:de Franchis 1999:10408774}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593069" "2" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:de Franchis 1999:10408774}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593070" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Gallagher" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593071" "0" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Chen 1999:10687314}" "-" "" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593072" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Shih 1995:7611293}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593073" "3" "90" "21" "44492290" "44492290" "dup" "0" "00006" "CBS_000218" "g.44492290dup" "" "{PMID:Janosik 2001:11359213}" "" "19insC" "CBS activity 0.46 nM/mg/h" "Germline" "" "" "0" "" "" "g.43072180dup" "" "pathogenic" "" "0000593074" "3" "90" "21" "44485763" "44485763" "subst" "0" "00006" "CBS_000027" "g.44485763C>T" "" "{PMID:Janosik 2001:11359213}" "BsoFI-" "" "CBS activity 0.46 nM/mg/h" "Germline" "" "" "0" "" "" "g.43065653C>T" "" "pathogenic" "" "0000593075" "3" "90" "21" "44485731" "44485731" "subst" "0" "00006" "CBS_000166" "g.44485731C>T" "" "{PMID:Janosik 2001:11359213}" "" "" "CBS activity 0.03 nM/mg/h" "Germline" "" "" "0" "" "" "g.43065621C>T" "" "pathogenic" "" "0000593076" "1" "90" "21" "44488726" "44488726" "subst" "0" "00006" "CBS_000208" "g.44488726C>G" "" "{PMID:Janosik 2001:11359213}" "" "IVS1-1G>C" "" "Germline" "" "" "0" "" "" "g.43068616C>G" "" "pathogenic" "" "0000593077" "2" "90" "21" "44492276" "44492276" "del" "8.32307E-6" "00006" "CBS_000217" "g.44492276del" "" "{PMID:Janosik 2001:11359213}" "" "28delG" "" "Germline" "" "" "0" "" "" "g.43072166del" "" "pathogenic" "" "0000593078" "1" "90" "21" "44492110" "44492110" "subst" "4.07721E-6" "00006" "CBS_000211" "g.44492110T>C" "" "{PMID:Janosik 2001:11359213}" "" "" "CBS activity 0.02 nM/mg/h; no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43072000T>C" "" "pathogenic" "" "0000593079" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "CBS activity 0.00 nM/mg/h" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593080" "2" "90" "21" "44486374" "44486374" "subst" "2.85665E-5" "00006" "CBS_000185" "g.44486374C>T" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "TaqI-" "" "CBS activity 0.00 nM/mg/h" "Germline" "" "" "0" "" "" "g.43066264C>T" "" "pathogenic" "" "0000593081" "2" "90" "21" "44485794" "44485794" "subst" "0" "00006" "CBS_000175" "g.44485794C>T" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "Sau96I+" "" "CBS activity 0.00 nM/mg/h" "Germline" "" "" "0" "" "" "g.43065684C>T" "" "pathogenic" "" "0000593082" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "CBS activity 0.33 nM/mg/h" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593083" "2" "90" "21" "44492290" "44492290" "dup" "0" "00006" "CBS_000218" "g.44492290dup" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "" "19insC" "CBS activity 0.33 nM/mg/h" "Germline" "" "" "0" "" "" "g.43072180dup" "" "pathogenic" "" "0000593084" "2" "90" "21" "44486374" "44486374" "subst" "2.85665E-5" "00006" "CBS_000185" "g.44486374C>T" "" "{PMID:Janosik 2001:11359213}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43066264C>T" "" "pathogenic" "" "0000593085" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Janosik 2001:11359213}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593086" "2" "90" "21" "44485794" "44485794" "subst" "0" "00006" "CBS_000175" "g.44485794C>T" "" "{PMID:Janosik 2001:11359213}" "Sau96I+" "" "" "Germline" "" "" "0" "" "" "g.43065684C>T" "" "pathogenic" "" "0000593087" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Janosik 2001:11359213}" "BsrI+" "" "CBS activity 0.10 nM/mg/h" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593088" "2" "90" "21" "44486374" "44486374" "subst" "2.85665E-5" "00006" "CBS_000185" "g.44486374C>T" "" "{PMID:Janosik 2001:11359213}" "TaqI-" "" "CBS activity 0.10 nM/mg/h" "Germline" "" "" "0" "" "" "g.43066264C>T" "" "pathogenic" "" "0000593089" "2" "90" "21" "44485794" "44485794" "subst" "0" "00006" "CBS_000175" "g.44485794C>T" "" "{PMID:Janosik 2001:11359213}" "Sau96I+" "" "CBS activity 0.10 nM/mg/h" "Germline" "" "" "0" "" "" "g.43065684C>T" "" "pathogenic" "" "0000593090" "2" "90" "21" "44486430" "44486430" "subst" "0" "00006" "CBS_000192" "g.44486430C>G" "" "{PMID:Castro 2001:11553052}" "HpaII+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>G" "" "pathogenic" "" "0000593091" "1" "90" "21" "44488726" "44488726" "subst" "0" "00006" "CBS_000208" "g.44488726C>G" "" "{PMID:Janosik 2001:11359213}" "" "IVS1-1G>C" "CBS activity 0.03 nM/mg/h" "Germline" "" "" "0" "" "" "g.43068616C>G" "" "pathogenic" "" "0000593092" "2" "90" "21" "44492276" "44492276" "del" "8.32307E-6" "00006" "CBS_000217" "g.44492276del" "" "{PMID:Janosik 2001:11359213}" "" "28delG" "CBS activity 0.03 nM/mg/h" "Germline" "" "" "0" "" "" "g.43072166del" "" "pathogenic" "" "0000593093" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Janosik 2001:11359213}, {PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593094" "1" "90" "21" "44479037" "44479037" "subst" "0" "00006" "CBS_000088" "g.44479037G>A" "" "{PMID:Maclean 2002:12007221}" "" "" "" "Germline" "" "" "0" "" "" "g.43058927G>A" "" "pathogenic" "" "0000593095" "2" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:Maclean 2002:12007221}" "" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593096" "0" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:Gaustadnes 2000:10780316}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593097" "0" "90" "21" "44484053" "44484053" "subst" "0" "00006" "CBS_000140" "g.44484053G>C" "" "{PMID:Gat-Yablonski 2000:11013450}" "" "" "" "Germline" "" "" "0" "" "" "g.43063943G>C" "" "pathogenic" "" "0000593098" "3" "90" "21" "44474001" "44474019" "del" "0" "00006" "CBS_000066" "g.44474001_44474019del" "" "{PMID:Gat-Yablonski 2000:11013450}" "" "1627del19;18327del5" "" "Germline" "" "" "0" "" "" "g.43053891_43053909del" "" "pathogenic" "" "0000593099" "3" "10" "21" "44473970" "44473974" "del" "0" "00006" "CBS_000065" "g.44473970_44473974del" "" "{PMID:Gat-Yablonski 2000:11013450}" "" "1627del19;18327del5" "" "Germline" "" "" "0" "" "" "g.43053860_43053864del" "" "benign" "" "0000593100" "3" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "{PMID:Kruger 2003:14635102}" "" "" "" "Germline" "" "" "0" "" "" "g.43060528G>A" "" "pathogenic" "" "0000593101" "1" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "{PMID:Kruger 2003:14635102}" "" "" "" "Germline" "" "" "0" "" "" "g.43060528G>A" "" "pathogenic" "" "0000593102" "2" "90" "21" "44485373" "44485373" "subst" "0" "00006" "CBS_000154" "g.44485373C>T" "" "{PMID:Kruger 2003:14635102}" "" "" "" "Germline" "" "" "0" "" "" "g.43065263C>T" "" "pathogenic" "" "0000593103" "1" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "{PMID:Kruger 2003:14635102}" "" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43060528G>A" "" "pathogenic" "" "0000593104" "1" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "{PMID:Kruger 2003:14635102}" "" "" "" "Germline" "" "" "0" "" "" "g.43060528G>A" "" "pathogenic" "" "0000593105" "2" "90" "21" "44474070" "44474070" "subst" "0" "00006" "CBS_000071" "g.44474070G>T" "" "{PMID:Kruger 2003:14635102}" "" "" "" "Germline" "" "" "0" "" "" "g.43053960G>T" "" "pathogenic" "" "0000593106" "1" "90" "21" "44484102" "44484102" "subst" "8.46303E-6" "00006" "CBS_000143" "g.44484102C>G" "" "{PMID:Kruger 2003:14635102}" "" "IVS6-1G>C" "" "Germline" "" "" "0" "" "" "g.43063992C>G" "" "pathogenic" "" "0000593107" "2" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Kruger 2003:14635102}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593108" "3" "90" "21" "44485366" "44485366" "subst" "0" "00006" "CBS_000153" "g.44485366T>C" "" "{PMID:Kruger 2003:14635102}" "" "" "" "Germline" "" "" "0" "" "" "g.43065256T>C" "" "pathogenic" "" "0000593109" "1" "90" "21" "44480570" "44480570" "subst" "4.09443E-6" "00006" "CBS_000102" "g.44480570C>T" "" "{PMID:Kruger 2003:14635102}" "" "" "" "Germline" "" "" "0" "" "" "g.43060460C>T" "" "pathogenic" "" "0000593110" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kruger 2003:14635102}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593111" "1" "90" "21" "44485358" "44485358" "subst" "0" "00006" "CBS_000149" "g.44485358C>G" "" "{PMID:Kruger 2003:14635102}" "" "" "" "Germline" "" "" "0" "" "" "g.43065248C>G" "" "pathogenic" "" "0000593112" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kruger 2003:14635102}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593113" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593114" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593115" "0" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "CBS mutation database, Kraus" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593116" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593117" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593118" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593119" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593120" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593121" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593122" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593123" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593124" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593125" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593126" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593127" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593128" "0" "90" "21" "44484053" "44484053" "subst" "2.04344E-5" "00006" "CBS_000139" "g.44484053G>A" "" "CBS mutation database, Kraus" "" "" "" "Germline" "" "" "0" "" "" "g.43063943G>A" "" "pathogenic" "" "0000593129" "0" "90" "21" "44484053" "44484053" "subst" "2.04344E-5" "00006" "CBS_000139" "g.44484053G>A" "" "CBS mutation database, Kraus" "" "" "" "Germline" "" "" "0" "" "" "g.43063943G>A" "" "pathogenic" "" "0000593130" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593131" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593132" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593133" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593134" "0" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "CBS mutation database, Kraus" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000593135" "0" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "CBS mutation database, Kraus" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000593136" "0" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "CBS mutation database, Kraus" "MaeII+" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593137" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593138" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593139" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593140" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593141" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593142" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593143" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593144" "0" "90" "21" "44484041" "44484041" "subst" "8.17054E-6" "00006" "CBS_000137" "g.44484041C>T" "" "CBS mutation database, Kraus" "" "" "" "Germline" "" "" "0" "" "" "g.43063931C>T" "" "pathogenic" "" "0000593145" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593146" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593147" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593148" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593149" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593150" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593151" "0" "90" "21" "44486374" "44486374" "subst" "2.85665E-5" "00006" "CBS_000185" "g.44486374C>T" "" "CBS mutation database, Kraus" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43066264C>T" "" "pathogenic" "" "0000593152" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593153" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593154" "0" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "CBS mutation database, Kraus" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000593155" "0" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "CBS mutation database, Kraus" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000593156" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593157" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593158" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Kraus" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593159" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593160" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "CBS mutation database, Kraus" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593161" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gaustadnes 2002:12124992}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593162" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gaustadnes 2002:12124992}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593163" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gaustadnes 2002:12124992}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593164" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gaustadnes 2002:12124992}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593165" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gaustadnes 2002:12124992}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593166" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gaustadnes 2002:12124992}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593167" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gaustadnes 2002:12124992}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593168" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gaustadnes 2002:12124992}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593169" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gaustadnes 2002:12124992}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593170" "0" "90" "21" "44485763" "44485763" "subst" "0" "00006" "CBS_000027" "g.44485763C>T" "" "{PMID:Gaustadnes 2002:12124992}" "BsoFI-" "" "" "Germline" "" "" "0" "" "" "g.43065653C>T" "" "pathogenic" "" "0000593171" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gaustadnes 2002:12124992}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593172" "0" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593173" "0" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Gaustadnes 2002:12124992}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593174" "0" "90" "21" "44485613" "44485630" "del" "0" "00006" "CBS_000160" "g.44485613_44485630del" "" "{PMID:Gaustadnes 2002:12124992}" "" "533del18" "" "Germline" "" "" "0" "" "" "g.43065503_43065520del" "" "pathogenic" "" "0000593175" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Gaustadnes 2002:12124992}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593176" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Gaustadnes 2002:12124992}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593177" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Gaustadnes 2002:12124992}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593178" "0" "90" "21" "44488633" "44488633" "subst" "0" "00006" "CBS_000202" "g.44488633A>G" "" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Germline" "" "" "0" "" "" "g.43068523A>G" "" "pathogenic" "" "0000593179" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Gaustadnes 2002:12124992}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593180" "0" "90" "21" "44486479" "44486479" "subst" "1.62801E-5" "00006" "CBS_000051" "g.44486479A>G" "" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Germline" "" "" "0" "" "" "g.43066369A>G" "" "pathogenic" "" "0000593181" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Gaustadnes 2002:12124992}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593182" "0" "90" "21" "44483062" "44483062" "subst" "0" "00006" "CBS_000121" "g.44483062C>T" "" "{PMID:Gaustadnes 2002:12124992}" "" "IVS8+1G>A" "" "Germline" "" "" "0" "" "" "g.43062952C>T" "" "pathogenic" "" "0000593183" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Gaustadnes 2002:12124992}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593184" "0" "90" "21" "44492093" "44492094" "ins" "0" "00006" "CBS_000210" "g.44492093_44492094insG" "" "{PMID:Gaustadnes 2002:12124992}" "" "IVS1+1insC" "" "Germline" "" "" "0" "" "" "g.43071983_43071984insG" "" "pathogenic" "" "0000593185" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Gaustadnes 2002:12124992}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593186" "0" "90" "21" "44479340" "44479340" "del" "0" "00006" "CBS_000095" "g.44479340del" "" "{PMID:Gaustadnes 2002:12124992}" "" "1221delC" "" "Germline" "" "" "0" "" "" "g.43059230del" "" "pathogenic" "" "0000593187" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Gaustadnes 2002:12124992}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593188" "0" "90" "21" "44482421" "44482421" "subst" "0" "00006" "CBS_000009" "g.44482421C>T" "" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Germline" "" "" "0" "" "" "g.43062311C>T" "" "pathogenic" "" "0000593189" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Gaustadnes 2002:12124992}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593190" "0" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "{PMID:Gaustadnes 2002:12124992}" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000593191" "0" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "{PMID:Gaustadnes 2002:12124992}" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000593192" "0" "90" "21" "44486374" "44486374" "subst" "2.85665E-5" "00006" "CBS_000185" "g.44486374C>T" "" "{PMID:Gaustadnes 2002:12124992}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43066264C>T" "" "pathogenic" "" "0000593193" "0" "90" "21" "44492158" "44492158" "subst" "0.000150626" "00006" "CBS_000052" "g.44492158G>A" "" "{PMID:Gaustadnes 2002:12124992}" "DdeI+" "" "" "Germline" "" "" "0" "" "" "g.43072048G>A" "" "pathogenic" "" "0000593194" "0" "90" "21" "44486374" "44486374" "subst" "2.85665E-5" "00006" "CBS_000185" "g.44486374C>T" "" "{PMID:Gaustadnes 2002:12124992}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43066264C>T" "" "pathogenic" "" "0000593195" "0" "90" "21" "44480585" "44480585" "subst" "0" "00006" "CBS_000103" "g.44480585C>T" "" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Germline" "" "" "0" "" "" "g.43060475C>T" "" "pathogenic" "" "0000593196" "0" "90" "21" "44486374" "44486374" "subst" "2.85665E-5" "00006" "CBS_000185" "g.44486374C>T" "" "{PMID:Gaustadnes 2002:12124992}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43066264C>T" "" "pathogenic" "" "0000593197" "0" "90" "21" "44492094" "44492094" "subst" "4.0864E-6" "00006" "CBS_000029" "g.44492094C>T" "" "{PMID:Gaustadnes 2002:12124992}" "" "IVS1+1G>A" "" "Germline" "" "" "0" "" "" "g.43071984C>T" "" "pathogenic" "" "0000593198" "0" "90" "21" "44486374" "44486374" "subst" "2.85665E-5" "00006" "CBS_000185" "g.44486374C>T" "" "{PMID:Gaustadnes 2002:12124992}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43066264C>T" "" "pathogenic" "" "0000593199" "0" "90" "21" "44478986" "44478986" "subst" "0" "00006" "CBS_000084" "g.44478986C>T" "" "{PMID:Gaustadnes 2002:12124992}" "EcoRII+;MspI-" "" "" "Germline" "" "" "0" "" "" "g.43058876C>T" "" "pathogenic" "" "0000593200" "0" "90" "21" "44483113" "44483113" "subst" "4.06138E-6" "00006" "CBS_000124" "g.44483113C>T" "" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Germline" "" "" "0" "" "" "g.43063003C>T" "" "pathogenic" "" "0000593201" "0" "90" "21" "44486362" "44486362" "dup" "0" "00006" "CBS_000181" "g.44486362dup" "" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Germline" "" "" "0" "" "" "g.43066252dup" "" "pathogenic" "" "0000593202" "0" "90" "21" "44483125" "44483125" "dup" "0" "00006" "CBS_000125" "g.44483125dup" "" "{PMID:Gaustadnes 2002:12124992}" "" "892insC" "" "Germline" "" "" "0" "" "" "g.43063015dup" "" "pathogenic" "" "0000593203" "0" "90" "21" "44485365" "44485365" "subst" "0" "00006" "CBS_000152" "g.44485365G>T" "" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Germline" "" "" "0" "" "" "g.43065255G>T" "" "pathogenic" "" "0000593204" "0" "90" "21" "44479335" "44479335" "subst" "0" "00006" "CBS_000094" "g.44479335C>T" "" "{PMID:Gaustadnes 2002:12124992}" "" "del aa382-407" "" "Germline" "" "" "0" "" "" "g.43059225C>T" "" "pathogenic" "" "0000593205" "0" "90" "21" "44486479" "44486479" "subst" "1.62801E-5" "00006" "CBS_000051" "g.44486479A>G" "" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Germline" "" "" "0" "" "" "g.43066369A>G" "" "pathogenic" "" "0000593206" "3" "90" "21" "44478355" "44478355" "subst" "0" "00006" "CBS_000076" "g.44478355A>G" "" "{PMID:Urreizti 2003:12815602}" "" "" "" "Germline" "" "" "0" "" "" "g.43058245A>G" "" "pathogenic" "" "0000593207" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:Urreizti 2003:12815602}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593208" "2" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:Urreizti 2003:12815602}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593209" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2003:12815602}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593210" "1" "90" "21" "44474082" "44474082" "del" "0" "00006" "CBS_000072" "g.44474082del" "" "{PMID:Urreizti 2003:12815602}" "NciI-" "1566delG" "" "Germline" "" "" "0" "" "" "g.43053972del" "" "pathogenic" "" "0000593211" "1" "90" "21" "44474082" "44474082" "del" "0" "00006" "CBS_000072" "g.44474082del" "" "{PMID:Urreizti 2003:12815602}" "NciI-" "1566delG" "" "Germline" "" "" "0" "" "" "g.43053972del" "" "pathogenic" "" "0000593212" "2" "90" "21" "44480560" "44480560" "subst" "8.18123E-6" "00006" "CBS_000100" "g.44480560C>T" "" "{PMID:Urreizti 2003:12815602}" "" "" "" "Germline" "" "" "0" "" "" "g.43060450C>T" "" "pathogenic" "" "0000593213" "3" "90" "21" "44480650" "44480650" "subst" "0" "00006" "CBS_000111" "g.44480650C>T" "" "{PMID:Urreizti 2003:12815602}" "" "" "" "Germline" "" "" "0" "" "" "g.43060540C>T" "" "pathogenic" "" "0000593214" "1" "90" "21" "44480650" "44480650" "subst" "0" "00006" "CBS_000111" "g.44480650C>T" "" "{PMID:Urreizti 2003:12815602}" "" "" "" "Germline" "" "" "0" "" "" "g.43060540C>T" "" "pathogenic" "" "0000593215" "2" "90" "21" "44492094" "44492094" "subst" "4.0864E-6" "00006" "CBS_000029" "g.44492094C>T" "" "{PMID:Urreizti 2003:12815602}" "" "IVS1+1G>A" "" "Germline" "" "" "0" "" "" "g.43071984C>T" "" "pathogenic" "" "0000593216" "1" "90" "21" "44486431" "44486431" "subst" "0" "00006" "CBS_000193" "g.44486431G>A" "" "{PMID:Urreizti 2003:12815602}" "AciI-" "" "" "Germline" "" "" "0" "" "" "g.43066321G>A" "" "pathogenic" "" "0000593217" "2" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2003:12815602}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593218" "1" "90" "21" "44486431" "44486431" "subst" "0" "00006" "CBS_000193" "g.44486431G>A" "" "{PMID:Urreizti 2003:12815602}" "AciI-" "" "" "Germline" "" "" "0" "" "" "g.43066321G>A" "" "pathogenic" "" "0000593219" "2" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2003:12815602}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593220" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2003:12815602}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593221" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2003:12815602}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593222" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2003:12815602}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593223" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2003:12815602}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593224" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593225" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593226" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593227" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593228" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593229" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593230" "0" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43060528G>A" "" "pathogenic" "" "0000593231" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593232" "0" "90" "21" "44492110" "44492110" "subst" "4.07721E-6" "00006" "CBS_000211" "g.44492110T>C" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43072000T>C" "" "pathogenic" "" "0000593233" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593234" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593235" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593236" "0" "90" "21" "44492094" "44492094" "subst" "4.0864E-6" "00006" "CBS_000029" "g.44492094C>T" "" "CBS mutation database, Linnebank" "" "IVS1+1G>A" "" "Germline" "" "" "0" "" "" "g.43071984C>T" "" "pathogenic" "" "0000593237" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593238" "0" "90" "21" "44484068" "44484068" "subst" "4.10452E-5" "00006" "CBS_000034" "g.44484068G>A" "" "CBS mutation database, Linnebank" "NlaIII+" "" "" "Germline" "" "" "0" "" "" "g.43063958G>A" "" "pathogenic" "" "0000593239" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593240" "0" "90" "21" "44486431" "44486431" "subst" "0" "00006" "CBS_000193" "g.44486431G>A" "" "CBS mutation database, Linnebank" "AciI-" "" "" "Germline" "" "" "0" "" "" "g.43066321G>A" "" "pathogenic" "" "0000593241" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593242" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593243" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593244" "0" "90" "21" "44484068" "44484068" "subst" "4.10452E-5" "00006" "CBS_000034" "g.44484068G>A" "" "CBS mutation database, Linnebank" "NlaIII+" "" "" "Germline" "" "" "0" "" "" "g.43063958G>A" "" "pathogenic" "" "0000593245" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593246" "0" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "CBS mutation database, Linnebank" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593247" "0" "90" "21" "44486479" "44486479" "subst" "1.62801E-5" "00006" "CBS_000051" "g.44486479A>G" "" "{PMID:Gaustadnes 2002:12124992}" "" "" "" "Germline" "" "" "0" "" "" "g.43066369A>G" "" "pathogenic" "" "0000593248" "0" "90" "21" "44485613" "44485630" "del" "0" "00006" "CBS_000160" "g.44485613_44485630del" "" "{PMID:Gaustadnes 2002:12124992}" "" "533del18" "" "Germline" "" "" "0" "" "" "g.43065503_43065520del" "" "pathogenic" "" "0000593249" "0" "90" "21" "44480591" "44480591" "subst" "0.00308525" "00006" "CBS_000019" "g.44480591G>A" "" "{PMID:Gaustadnes 2002:12124992}" "HhaI-" "" "" "Germline" "" "" "0" "" "" "g.43060481G>A" "" "pathogenic" "" "0000593250" "0" "90" "21" "44492290" "44492290" "dup" "0" "00006" "CBS_000218" "g.44492290dup" "" "{PMID:Gaustadnes 2002:12124992}" "" "19insC" "" "Germline" "" "" "0" "" "" "g.43072180dup" "" "pathogenic" "" "0000593251" "0" "90" "21" "44492290" "44492290" "dup" "0" "00006" "CBS_000218" "g.44492290dup" "" "{PMID:Gaustadnes 2002:12124992}" "" "19insC" "" "Germline" "" "" "0" "" "" "g.43072180dup" "" "pathogenic" "" "0000593252" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Orendae 2004:15146473}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593253" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Orendae 2004:15146473}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593254" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Orendae 2004:15146473}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593255" "2" "90" "21" "44486375" "44486375" "subst" "0" "00006" "CBS_000186" "g.44486375G>C" "" "{PMID:Orendae 2004:15146473}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43066265G>C" "" "pathogenic" "" "0000593256" "3" "90" "21" "44485365" "44485365" "subst" "0" "00006" "CBS_000152" "g.44485365G>T" "" "{PMID:Orendae 2004:15146473}" "" "" "" "Germline" "" "" "0" "" "" "g.43065255G>T" "" "pathogenic" "" "0000593257" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Orendae 2004:15146473}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593258" "2" "90" "21" "44486375" "44486375" "subst" "0" "00006" "CBS_000186" "g.44486375G>C" "" "{PMID:Orendae 2004:15146473}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43066265G>C" "" "pathogenic" "" "0000593259" "3" "90" "21" "44486362" "44486362" "subst" "1.22715E-5" "00006" "CBS_000183" "g.44486362C>T" "" "{PMID:Orendae 2004:15146473}" "MspI-,BstNI+" "" "" "Germline" "" "" "0" "" "" "g.43066252C>T" "" "pathogenic" "" "0000593260" "3" "90" "21" "44482420" "44482420" "subst" "0" "00006" "CBS_000112" "g.44482420C>A" "" "{PMID:Orendae 2004:15146473}" "HphI-" "" "" "Germline" "" "" "0" "" "" "g.43062310C>A" "" "pathogenic" "" "0000593261" "3" "90" "21" "44482447" "44482447" "subst" "0" "00006" "CBS_000113" "g.44482447A>G" "" "{PMID:Urreizti 2003:12815602}" "PvuI+" "" "" "Germline" "" "" "0" "" "" "g.43062337A>G" "" "pathogenic" "" "0000593262" "1" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2003:12815602}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593263" "2" "90" "21" "44484014" "44484014" "subst" "0" "00006" "CBS_000135" "g.44484014C>T" "" "{PMID:Urreizti 2003:12815602}" "" "" "" "Germline" "" "" "0" "" "" "g.43063904C>T" "" "pathogenic" "" "0000593264" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2003:12815602}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593265" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2003:12815602}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593266" "3" "90" "21" "44482501" "44482501" "subst" "1.62982E-5" "00006" "CBS_000120" "g.44482501A>G" "" "{PMID:Kruger 2003:14635102}" "" "" "" "Germline" "" "" "0" "" "" "g.43062391A>G" "" "pathogenic" "" "0000593267" "1" "90" "21" "44485358" "44485358" "subst" "0" "00006" "CBS_000149" "g.44485358C>G" "" "{PMID:Kruger 2003:14635102}" "" "" "" "Germline" "" "" "0" "" "" "g.43065248C>G" "" "pathogenic" "" "0000593268" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kruger 2003:14635102}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593269" "1" "90" "21" "44488633" "44488633" "subst" "0" "00006" "CBS_000202" "g.44488633A>G" "" "{PMID:Kruger 2003:14635102}" "" "" "" "Germline" "" "" "0" "" "" "g.43068523A>G" "" "pathogenic" "" "0000593270" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kruger 2003:14635102}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593271" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kruger 2003:14635102}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593272" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, DAlmeida 2003" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593273" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, DAlmeida 2003" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593274" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, DAlmeida 2003" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593275" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, DAlmeida 2003" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593276" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, DAlmeida 2003" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593277" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, DAlmeida 2003" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593278" "1" "90" "21" "44485322" "44485322" "subst" "0" "00006" "CBS_000144" "g.44485322G>A" "" "{PMID:De Lucca 2004:14972327}" "Fnu4HI-" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43065212G>A" "" "pathogenic" "" "0000593279" "3" "90" "21" "44488682" "44488682" "subst" "4.0623E-6" "00006" "CBS_000206" "g.44488682C>T" "" "{PMID:De Lucca 2004:14972327}" "" "" "" "Germline" "" "" "0" "" "" "g.43068572C>T" "" "pathogenic" "" "0000593280" "3" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:De Lucca 2004:14972327}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593281" "3" "90" "21" "44485349" "44485349" "subst" "8.12196E-6" "00006" "CBS_000147" "g.44485349C>T" "" "{PMID:De Lucca 2004:14972327}" "" "" "" "Germline" "" "" "0" "" "" "g.43065239C>T" "" "pathogenic" "" "0000593282" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:De Lucca 2004:14972327}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593283" "0" "90" "21" "44488675" "44488675" "subst" "0" "00006" "CBS_000204" "g.44488675G>T" "" "CBS mutation database, De Lucca" "MslI-" "" "" "Germline" "" "" "0" "" "" "g.43068565G>T" "" "pathogenic" "" "0000593284" "0" "90" "21" "44488682" "44488682" "subst" "4.0623E-6" "00006" "CBS_000206" "g.44488682C>T" "" "CBS mutation database, De Lucca" "" "" "" "Germline" "" "" "0" "" "" "g.43068572C>T" "" "pathogenic" "" "0000593285" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593286" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593287" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593288" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593289" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593290" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593291" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593292" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593293" "0" "90" "21" "44485800" "44485800" "subst" "0" "00006" "CBS_000177" "g.44485800C>T" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "Germline" "" "" "0" "" "" "g.43065690C>T" "" "pathogenic" "" "0000593294" "0" "90" "21" "44485800" "44485800" "subst" "0" "00006" "CBS_000177" "g.44485800C>T" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "Germline" "" "" "0" "" "" "g.43065690C>T" "" "pathogenic" "" "0000593295" "0" "90" "21" "44484014" "44484014" "subst" "0" "00006" "CBS_000135" "g.44484014C>T" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "Germline" "" "" "0" "" "" "g.43063904C>T" "" "pathogenic" "" "0000593296" "0" "90" "21" "44486353" "44486353" "subst" "1.64037E-5" "00006" "CBS_000180" "g.44486353C>T" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "Germline" "" "" "0" "" "" "g.43066243C>T" "" "pathogenic" "" "0000593297" "0" "90" "21" "44486458" "44486458" "subst" "0" "00006" "CBS_000198" "g.44486458C>T" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "Germline" "" "" "0" "" "" "g.43066348C>T" "" "pathogenic" "" "0000593298" "0" "90" "21" "44484053" "44484053" "subst" "2.04344E-5" "00006" "CBS_000139" "g.44484053G>A" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "Germline" "" "" "0" "" "" "g.43063943G>A" "" "pathogenic" "" "0000593299" "3" "90" "21" "44483113" "44483113" "subst" "4.06138E-6" "00006" "CBS_000124" "g.44483113C>T" "" "Redonnet-Vernhet 2005 (abstract J Inherit Metab Dis 28 sup1)" "" "" "" "Germline" "" "" "0" "" "" "g.43063003C>T" "" "pathogenic" "" "0000593300" "0" "90" "21" "44485725" "44485725" "subst" "0" "00006" "CBS_000165" "g.44485725C>T" "" "CBS mutation database, Skovby" "" "IVS4+1G>A" "" "Germline" "" "" "0" "" "" "g.43065615C>T" "" "pathogenic" "" "0000593301" "0" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "CBS mutation database, Skovby" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593302" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593303" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593304" "3" "90" "21" "44486442" "44486442" "subst" "2.43994E-5" "00006" "CBS_000195" "g.44486442C>T" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43066332C>T" "" "pathogenic" "" "0000593305" "1" "90" "21" "44486442" "44486442" "subst" "2.43994E-5" "00006" "CBS_000195" "g.44486442C>T" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43066332C>T" "" "pathogenic" "" "0000593306" "2" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593307" "1" "90" "21" "44483155" "44483155" "subst" "0" "00006" "CBS_000128" "g.44483155C>T" "" "{PMID:Bermudez 2006:16470595}" "" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063045C>T" "" "pathogenic" "" "0000593308" "1" "90" "21" "44486442" "44486442" "subst" "2.43994E-5" "00006" "CBS_000195" "g.44486442C>T" "" "{PMID:Bermudez 2006:16470595}" "" "" "" "Germline" "" "" "0" "" "" "g.43066332C>T" "" "pathogenic" "" "0000593309" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Bermudez 2006:16470595}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593310" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Bermudez 2006:16470595}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593311" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Bermudez 2006:16470595}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593312" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Bermudez 2006:16470595}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593313" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Bermudez 2006:16470595}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593314" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Bermudez 2006:16470595}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593315" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Bermudez 2006:16470595}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593316" "3" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:Urreizti 2006:16479318}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593317" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593318" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593319" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593320" "3" "90" "21" "44485373" "44485373" "subst" "0" "00006" "CBS_000154" "g.44485373C>T" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065263C>T" "" "pathogenic" "" "0000593321" "3" "90" "21" "44486362" "44486362" "subst" "1.22715E-5" "00006" "CBS_000183" "g.44486362C>T" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43066252C>T" "" "pathogenic" "" "0000593322" "1" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593323" "2" "90" "21" "44479016" "44479018" "del" "0" "00006" "CBS_000087" "g.44479016_44479018del" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43058906_43058908del" "" "pathogenic" "" "0000593324" "1" "90" "21" "44492089" "44492098" "del" "0" "00006" "CBS_000209" "g.44492089_44492098del" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "69_70+8del" "" "Germline" "" "" "0" "" "" "g.43071979_43071988del" "" "pathogenic" "" "0000593325" "2" "90" "21" "44484009" "44484009" "subst" "8.23981E-6" "00006" "CBS_000134" "g.44484009C>T" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43063899C>T" "" "pathogenic" "" "0000593326" "3" "90" "21" "44485804" "44485804" "subst" "0" "00006" "CBS_000179" "g.44485804C>T" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065694C>T" "" "pathogenic" "" "0000593327" "1" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593328" "2" "90" "21" "44485740" "44485740" "subst" "0" "00006" "CBS_000168" "g.44485740T>C" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065630T>C" "" "pathogenic" "" "0000593329" "1" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593330" "2" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43060528G>A" "" "pathogenic" "" "0000593331" "1" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593332" "2" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43060528G>A" "" "pathogenic" "" "0000593333" "3" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593334" "3" "90" "21" "44484068" "44484068" "subst" "4.10452E-5" "00006" "CBS_000034" "g.44484068G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43063958G>A" "" "pathogenic" "" "0000593335" "3" "90" "21" "44480560" "44480560" "subst" "8.18123E-6" "00006" "CBS_000100" "g.44480560C>T" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43060450C>T" "" "pathogenic" "" "0000593336" "3" "90" "21" "44482447" "44482447" "subst" "0" "00006" "CBS_000113" "g.44482447A>G" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43062337A>G" "" "pathogenic" "" "0000593337" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593338" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593339" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593340" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Urreizti 2006:16479318}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593341" "1" "90" "21" "44482453" "44482453" "subst" "0" "00006" "CBS_000114" "g.44482453C>T" "" "{PMID:Evangelisti 2008:18280597}" "SphI-" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43062343C>T" "" "pathogenic" "" "0000593342" "1" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Evangelisti 2008:18280597}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593343" "2" "90" "21" "44485788" "44485788" "subst" "0" "00006" "CBS_000173" "g.44485788C>G" "" "{PMID:Evangelisti 2008:18280597}" "" "" "" "Germline" "" "" "0" "" "" "g.43065678C>G" "" "pathogenic" "" "0000593344" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Evangelisti 2008:18280597}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593345" "2" "90" "21" "44479016" "44479018" "del" "0" "00006" "CBS_000087" "g.44479016_44479018del" "" "{PMID:Evangelisti 2008:18280597}" "" "1286_1288delTCA" "" "Germline" "" "" "0" "" "" "g.43058906_43058908del" "" "pathogenic" "" "0000593346" "1" "90" "21" "44478943" "44478943" "subst" "0" "00006" "CBS_000079" "g.44478943C>T" "" "{PMID:Evangelisti 2008:18280597}" "Sau3AI+" "IVS12+1G>A" "" "Germline" "" "" "0" "" "" "g.43058833C>T" "" "pathogenic" "" "0000593347" "2" "90" "21" "44492158" "44492158" "subst" "0.000150626" "00006" "CBS_000052" "g.44492158G>A" "" "{PMID:Evangelisti 2008:18280597}" "DdeI+" "" "" "Germline" "" "" "0" "" "" "g.43072048G>A" "" "pathogenic" "" "0000593348" "1" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "{PMID:Evangelisti 2008:18280597}" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000593349" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Evangelisti 2008:18280597}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593350" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Skovby" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593351" "0" "90" "21" "44480544" "44480544" "subst" "0.00621275" "00006" "CBS_000018" "g.44480544G>A" "" "CBS mutation database, Skovby" "" "IVS10+7C>T" "" "Germline" "" "" "0" "" "" "g.43060434G>A" "" "pathogenic" "" "0000593352" "0" "90" "21" "44485725" "44485725" "subst" "0" "00006" "CBS_000165" "g.44485725C>T" "" "CBS mutation database, Skovby" "" "IVS4+1G>A" "" "Germline" "" "" "0" "" "" "g.43065615C>T" "" "pathogenic" "" "0000593353" "0" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "CBS mutation database, Skovby" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593354" "1" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:Lefaucheur 2008:18805305}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593355" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Lefaucheur 2008:18805305}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593356" "1" "90" "21" "44485355" "44485355" "subst" "0" "00006" "CBS_000148" "g.44485355G>C" "" "{PMID:Yokoi 2008:19261122}" "" "" "" "Germline" "" "" "0" "" "" "g.43065245G>C" "" "pathogenic" "" "0000593357" "2" "90" "21" "44484063" "44484063" "subst" "4.09705E-6" "00006" "CBS_000141" "g.44484063C>T" "" "{PMID:Yokoi 2008:19261122}" "" "" "" "Germline" "" "" "0" "" "" "g.43063953C>T" "" "pathogenic" "" "0000593358" "3" "90" "21" "44478981" "44478981" "subst" "0" "00006" "CBS_000083" "g.44478981T>A" "" "{PMID:Katsushima 2006:16307898}" "" "" "" "Germline" "" "" "0" "" "" "g.43058871T>A" "" "pathogenic" "" "0000593359" "1" "90" "21" "44485355" "44485355" "subst" "0" "00006" "CBS_000148" "g.44485355G>C" "" "{PMID:Katsushima 2006:16307898}" "" "" "" "Germline" "" "" "0" "" "" "g.43065245G>C" "" "pathogenic" "" "0000593360" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Katsushima 2006:16307898}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593361" "1" "90" "21" "44486353" "44486353" "subst" "1.64037E-5" "00006" "CBS_000180" "g.44486353C>T" "" "{PMID:Katsushima 2006:16307898}" "" "" "" "Germline" "" "" "0" "" "" "g.43066243C>T" "" "pathogenic" "" "0000593362" "2" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:Katsushima 2006:16307898}" "MaeII+" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593363" "1" "90" "21" "44474053" "44474056" "del" "0" "00006" "CBS_000070" "g.44474053_44474056del" "" "{PMID:Katsushima 2006:16307898}" "" "1591del4" "" "Germline" "" "" "0" "" "" "g.43053943_43053946del" "" "pathogenic" "" "0000593364" "2" "90" "21" "44478981" "44478981" "subst" "0" "00006" "CBS_000083" "g.44478981T>A" "" "{PMID:Katsushima 2006:16307898}" "" "" "" "Germline" "" "" "0" "" "" "g.43058871T>A" "" "pathogenic" "" "0000593365" "1" "90" "21" "44492201" "44492201" "subst" "4.07634E-6" "00006" "CBS_000216" "g.44492201C>T" "" "{PMID:Katsushima 2006:16307898}" "" "103G>A;129G>A" "" "Germline" "" "" "0" "" "" "g.43072091C>T" "" "pathogenic" "" "0000593366" "1" "90" "21" "44492175" "44492175" "subst" "0" "00006" "CBS_000215" "g.44492175C>T" "" "{PMID:Katsushima 2006:16307898}" "" "103G>A;129G>A" "" "Germline" "" "" "0" "" "" "g.43072065C>T" "" "pathogenic" "" "0000593367" "2" "90" "21" "44485355" "44485355" "subst" "0" "00006" "CBS_000148" "g.44485355G>C" "" "{PMID:Katsushima 2006:16307898}" "" "" "" "Germline" "" "" "0" "" "" "g.43065245G>C" "" "pathogenic" "" "0000593368" "3" "90" "21" "44486442" "44486442" "subst" "2.43994E-5" "00006" "CBS_000195" "g.44486442C>T" "" "{PMID:Katsushima 2006:16307898}" "" "" "" "Germline" "" "" "0" "" "" "g.43066332C>T" "" "pathogenic" "" "0000593369" "0" "90" "21" "44485800" "44485800" "subst" "0" "00006" "CBS_000177" "g.44485800C>T" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43065690C>T" "" "pathogenic" "" "0000593370" "0" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "CBS mutation database, Linnebank" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000593371" "0" "90" "21" "44486353" "44486353" "subst" "1.64037E-5" "00006" "CBS_000180" "g.44486353C>T" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43066243C>T" "" "pathogenic" "" "0000593372" "0" "90" "21" "44482501" "44482501" "subst" "1.62982E-5" "00006" "CBS_000120" "g.44482501A>G" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43062391A>G" "" "pathogenic" "" "0000593373" "0" "90" "21" "44486431" "44486431" "subst" "0" "00006" "CBS_000193" "g.44486431G>A" "" "CBS mutation database, Linnebank" "AciI-" "" "" "Germline" "" "" "0" "" "" "g.43066321G>A" "" "pathogenic" "" "0000593374" "0" "90" "21" "44486443" "44486443" "subst" "0" "00006" "CBS_000197" "g.44486443G>T" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43066333G>T" "" "pathogenic" "" "0000593375" "0" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43060528G>A" "" "pathogenic" "" "0000593376" "0" "90" "21" "44486361" "44486361" "subst" "0" "00006" "CBS_000182" "g.44486361C>T" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43066251C>T" "" "pathogenic" "" "0000593377" "0" "90" "21" "44480636" "44480636" "subst" "0" "00006" "CBS_000109" "g.44480636C>T" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43060526C>T" "" "pathogenic" "" "0000593378" "0" "90" "21" "44492110" "44492110" "subst" "0" "00006" "CBS_000212" "g.44492110T>G" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43072000T>G" "" "pathogenic" "" "0000593379" "0" "90" "21" "44485755" "44485755" "subst" "0" "00006" "CBS_000171" "g.44485755C>T" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43065645C>T" "" "pathogenic" "" "0000593380" "1" "90" "21" "44488631" "44488631" "subst" "0.00283574" "00006" "CBS_000001" "g.44488631T>G" "" "CBS mutation database, Linnebank" "PstI+" "304A>C;IVS4-29del129" "" "Germline" "" "" "0" "" "" "g.43068521T>G" "" "pathogenic" "" "0000593381" "1" "90" "21" "44485533" "44485661" "del" "0" "00006" "CBS_000157" "g.44485533_44485661del" "" "CBS mutation database, Linnebank" "PstI+" "304A>C;IVS4-29del129" "" "Germline" "" "" "0" "" "" "g.43065423_43065551del" "" "pathogenic" "" "0000593382" "1" "90" "21" "44488631" "44488631" "subst" "0.00283574" "00006" "CBS_000001" "g.44488631T>G" "" "CBS mutation database, Linnebank" "PstI+" "304A>C;IVS4-29del129" "" "Germline" "" "" "0" "" "" "g.43068521T>G" "" "pathogenic" "" "0000593383" "1" "90" "21" "44485533" "44485661" "del" "0" "00006" "CBS_000157" "g.44485533_44485661del" "" "CBS mutation database, Linnebank" "PstI+" "304A>C;IVS4-29del129" "" "Germline" "" "" "0" "" "" "g.43065423_43065551del" "" "pathogenic" "" "0000593384" "0" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "CBS mutation database, Linnebank" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593385" "0" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "CBS mutation database, Linnebank" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593386" "0" "90" "21" "44486442" "44486442" "subst" "2.43994E-5" "00006" "CBS_000195" "g.44486442C>T" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43066332C>T" "" "pathogenic" "" "0000593387" "0" "90" "21" "44482447" "44482447" "subst" "0" "00006" "CBS_000113" "g.44482447A>G" "" "CBS mutation database, Linnebank" "PvuI+" "" "" "Germline" "" "" "0" "" "" "g.43062337A>G" "" "pathogenic" "" "0000593388" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593389" "0" "90" "21" "44480614" "44480614" "subst" "0" "00006" "CBS_000106" "g.44480614G>A" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43060504G>A" "" "pathogenic" "" "0000593390" "0" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "CBS mutation database, Linnebank" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593391" "0" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "CBS mutation database, Linnebank" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593392" "0" "90" "21" "44485373" "44485373" "subst" "0" "00006" "CBS_000154" "g.44485373C>T" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43065263C>T" "" "pathogenic" "" "0000593393" "0" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "CBS mutation database, Linnebank" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593394" "0" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "CBS mutation database, Linnebank" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593395" "0" "90" "21" "44483155" "44483155" "subst" "0" "00006" "CBS_000128" "g.44483155C>T" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43063045C>T" "" "pathogenic" "" "0000593396" "0" "90" "21" "44482453" "44482453" "subst" "0" "00006" "CBS_000114" "g.44482453C>T" "" "CBS mutation database, Linnebank" "SphI-" "" "" "Germline" "" "" "0" "" "" "g.43062343C>T" "" "pathogenic" "" "0000593397" "0" "90" "21" "44482453" "44482453" "subst" "0" "00006" "CBS_000114" "g.44482453C>T" "" "CBS mutation database, Linnebank" "SphI-" "" "" "Germline" "" "" "0" "" "" "g.43062343C>T" "" "pathogenic" "" "0000593398" "0" "90" "21" "44483155" "44483155" "subst" "0" "00006" "CBS_000128" "g.44483155C>T" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43063045C>T" "" "pathogenic" "" "0000593399" "0" "90" "21" "44483155" "44483155" "subst" "0" "00006" "CBS_000128" "g.44483155C>T" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43063045C>T" "" "pathogenic" "" "0000593400" "0" "90" "21" "44484068" "44484068" "subst" "4.10452E-5" "00006" "CBS_000034" "g.44484068G>A" "" "CBS mutation database, Linnebank" "NlaIII+" "" "" "Germline" "" "" "0" "" "" "g.43063958G>A" "" "pathogenic" "" "0000593401" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "CBS mutation database, Linnebank" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593402" "0" "90" "21" "44483113" "44483113" "subst" "4.06138E-6" "00006" "CBS_000124" "g.44483113C>T" "" "CBS mutation database, Linnebank" "" "" "" "Germline" "" "" "0" "" "" "g.43063003C>T" "" "pathogenic" "" "0000593403" "0" "90" "21" "44488682" "44488682" "del" "0" "00006" "CBS_000205" "g.44488682del" "" "CBS mutation database, Linnebank" "" "G253del" "" "Germline" "" "" "0" "" "" "g.43068572del" "" "pathogenic" "" "0000593404" "3" "90" "21" "44482421" "44482421" "subst" "0" "00006" "CBS_000009" "g.44482421C>T" "" "{PMID:Katsushima 2006:16307898}" "" "" "" "Germline" "" "" "0" "" "" "g.43062311C>T" "" "pathogenic" "" "0000593405" "1" "90" "21" "44485513" "44485513" "subst" "0" "00006" "CBS_000156" "g.44485513G>A" "" "{PMID:Katsushima 2006:16307898}" "" "" "" "Germline" "" "" "0" "" "" "g.43065403G>A" "" "pathogenic" "" "0000593406" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Katsushima 2006:16307898}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593407" "1" "90" "21" "44486362" "44486362" "subst" "1.22715E-5" "00006" "CBS_000183" "g.44486362C>T" "" "{PMID:Katsushima 2006:16307898}" "" "" "" "Germline" "" "" "0" "" "" "g.43066252C>T" "" "pathogenic" "" "0000593408" "2" "90" "21" "44484042" "44484042" "subst" "0" "00006" "CBS_000138" "g.44484042T>C" "" "{PMID:Katsushima 2006:16307898}" "" "" "" "Germline" "" "" "0" "" "" "g.43063932T>C" "" "pathogenic" "" "0000593409" "3" "90" "21" "44486442" "44486442" "subst" "2.43994E-5" "00006" "CBS_000195" "g.44486442C>T" "" "{PMID:Katsushima 2006:16307898}" "" "" "" "Germline" "" "" "0" "" "" "g.43066332C>T" "" "pathogenic" "" "0000593410" "3" "90" "21" "44486443" "44486443" "subst" "1.62633E-5" "00006" "CBS_000196" "g.44486443G>A" "" "{PMID:Katsushima 2006:16307898}" "" "" "" "Germline" "" "" "0" "" "" "g.43066333G>A" "" "pathogenic" "" "0000593411" "1" "90" "21" "44478981" "44478981" "subst" "0" "00006" "CBS_000083" "g.44478981T>A" "" "{PMID:Katsushima 2006:16307898}" "" "" "" "Germline" "" "" "0" "" "" "g.43058871T>A" "" "pathogenic" "" "0000593412" "2" "90" "21" "44484042" "44484042" "subst" "0" "00006" "CBS_000138" "g.44484042T>C" "" "{PMID:Katsushima 2006:16307898}" "BstNI-" "" "" "Germline" "" "" "0" "" "" "g.43063932T>C" "" "pathogenic" "" "0000593413" "0" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "{PMID:Cozar 2011:21520339}" "" "" "" "Germline" "" "" "0" "" "" "g.43060528G>A" "" "pathogenic" "" "0000593414" "0" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:Cozar 2011:21520339}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593415" "0" "90" "21" "44485564" "44485564" "subst" "1.63713E-5" "00006" "CBS_000025" "g.44485564G>A" "" "{PMID:Cozar 2011:21520339}" "MspI-" "" "" "Germline" "" "" "0" "" "" "g.43065454G>A" "" "pathogenic" "" "0000593416" "0" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "{PMID:Cozar 2011:21520339}" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000593417" "0" "90" "21" "44492158" "44492158" "subst" "0.000150626" "00006" "CBS_000052" "g.44492158G>A" "" "{PMID:Cozar 2011:21520339}" "DdeI+" "" "" "Germline" "" "" "0" "" "" "g.43072048G>A" "" "pathogenic" "" "0000593418" "0" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "{PMID:Cozar 2011:21520339}" "PstI+" "" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000593419" "0" "90" "21" "44492158" "44492158" "subst" "0.000150626" "00006" "CBS_000052" "g.44492158G>A" "" "{PMID:Cozar 2011:21520339}" "DdeI+" "" "" "Germline" "" "" "0" "" "" "g.43072048G>A" "" "pathogenic" "" "0000593420" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Cozar 2011:21520339}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593421" "0" "90" "21" "44483176" "44483176" "subst" "0" "00006" "CBS_000130" "g.44483176C>T" "" "{PMID:Cozar 2011:21520339}" "BamHI-" "" "" "Germline" "" "" "0" "" "" "g.43063066C>T" "" "pathogenic" "" "0000593422" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Cozar 2011:21520339}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593423" "0" "90" "21" "44483176" "44483176" "subst" "0" "00006" "CBS_000130" "g.44483176C>T" "" "{PMID:Cozar 2011:21520339}" "BamHI-" "" "" "Germline" "" "" "0" "" "" "g.43063066C>T" "" "pathogenic" "" "0000593424" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Cozar 2011:21520339}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593425" "0" "90" "21" "44483176" "44483176" "subst" "0" "00006" "CBS_000130" "g.44483176C>T" "" "{PMID:Cozar 2011:21520339}" "BamHI-" "" "" "Germline" "" "" "0" "" "" "g.43063066C>T" "" "pathogenic" "" "0000593426" "0" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "{PMID:Cozar 2011:21520339}" "" "" "" "Germline" "" "" "0" "" "" "g.43060528G>A" "" "pathogenic" "" "0000593427" "0" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:Cozar 2011:21520339}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593428" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Cozar 2011:21520339}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593429" "0" "90" "21" "44486443" "44486443" "subst" "1.62633E-5" "00006" "CBS_000196" "g.44486443G>A" "" "{PMID:Cozar 2011:21520339}" "" "" "" "Germline" "" "" "0" "" "" "g.43066333G>A" "" "pathogenic" "" "0000593430" "0" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:Cozar 2011:21520339}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593431" "0" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:Cozar 2011:21520339}" "TaqI-" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593432" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Cozar 2011:21520339}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593433" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Cozar 2011:21520339}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593434" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Cozar 2011:21520339}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593435" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Cozar 2011:21520339}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593436" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Cozar 2011:21520339}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593437" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000131" "g.44483184A>C" "" "{PMID:Cozar 2011:21520339}" "TspRI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>C" "" "pathogenic" "" "0000593438" "0" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Cozar 2011:21520339}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593439" "0" "90" "21" "44480560" "44480560" "subst" "8.18123E-6" "00006" "CBS_000100" "g.44480560C>T" "" "{PMID:Cozar 2011:21520339}" "" "" "" "Germline" "" "" "0" "" "" "g.43060450C>T" "" "pathogenic" "" "0000593440" "0" "90" "21" "44474082" "44474082" "del" "0" "00006" "CBS_000072" "g.44474082del" "" "{PMID:Cozar 2011:21520339}" "NciI-" "1566delG" "" "Germline" "" "" "0" "" "" "g.43053972del" "" "pathogenic" "" "0000593441" "0" "90" "21" "44474082" "44474082" "del" "0" "00006" "CBS_000072" "g.44474082del" "" "{PMID:Cozar 2011:21520339}" "NciI-" "1566delG" "" "Germline" "" "" "0" "" "" "g.43053972del" "" "pathogenic" "" "0000593442" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Cozar 2011:21520339}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593443" "0" "90" "21" "44484014" "44484014" "subst" "0" "00006" "CBS_000135" "g.44484014C>T" "" "{PMID:Cozar 2011:21520339}" "" "" "" "Germline" "" "" "0" "" "" "g.43063904C>T" "" "pathogenic" "" "0000593444" "0" "90" "21" "44474082" "44474082" "del" "0" "00006" "CBS_000072" "g.44474082del" "" "{PMID:Cozar 2011:21520339}" "NciI-" "1566delG" "" "Germline" "" "" "0" "" "" "g.43053972del" "" "pathogenic" "" "0000593445" "0" "90" "21" "44474082" "44474082" "del" "0" "00006" "CBS_000072" "g.44474082del" "" "{PMID:Cozar 2011:21520339}" "NciI-" "1566delG" "" "Germline" "" "" "0" "" "" "g.43053972del" "" "pathogenic" "" "0000593446" "0" "90" "21" "44474082" "44474082" "del" "0" "00006" "CBS_000072" "g.44474082del" "" "{PMID:Cozar 2011:21520339}" "NciI-" "1566delG" "" "Germline" "" "" "0" "" "" "g.43053972del" "" "pathogenic" "" "0000593447" "0" "90" "21" "44485669" "44485669" "del" "0" "00006" "CBS_000164" "g.44485669del796" "" "{PMID:Cozar 2011:21520339}" "" "IVS4-38del796 (V178GfsX23 )" "Variant Error [EINCONSISTENTLENGTH]: This genomic variant has an error (Length implied by coordinates must equal sequence deletion length). Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.43065559del796" "" "pathogenic" "" "0000593448" "0" "90" "21" "44483151" "44483155" "del" "0" "00006" "CBS_000127" "g.44483151_44483155del" "" "{PMID:Cozar 2011:21520339}" "" "862_866del5" "" "Germline" "" "" "0" "" "" "g.43063041_43063045del" "" "pathogenic" "" "0000593449" "0" "90" "21" "44483151" "44483155" "del" "0" "00006" "CBS_000127" "g.44483151_44483155del" "" "{PMID:Cozar 2011:21520339}" "" "862_866del5" "" "Germline" "" "" "0" "" "" "g.43063041_43063045del" "" "pathogenic" "" "0000593450" "0" "90" "21" "44488682" "44488682" "subst" "4.0623E-6" "00006" "CBS_000206" "g.44488682C>T" "" "{PMID:Cozar 2011:21520339}" "" "" "" "Germline" "" "" "0" "" "" "g.43068572C>T" "" "pathogenic" "" "0000593451" "0" "90" "21" "44485639" "44485646" "del" "0" "00006" "CBS_000163" "g.44485639_44485646del" "" "{PMID:Cozar 2011:21520339}" "" "IVS5-14_-7del8" "" "Germline" "" "" "0" "" "" "g.43065529_43065536del" "" "pathogenic" "" "0000593452" "0" "90" "21" "44488682" "44488682" "subst" "4.0623E-6" "00006" "CBS_000206" "g.44488682C>T" "" "{PMID:Cozar 2011:21520339}" "" "" "" "Germline" "" "" "0" "" "" "g.43068572C>T" "" "pathogenic" "" "0000593453" "0" "90" "21" "44485639" "44485646" "del" "0" "00006" "CBS_000163" "g.44485639_44485646del" "" "{PMID:Cozar 2011:21520339}" "" "IVS5-14_-7del8" "" "Germline" "" "" "0" "" "" "g.43065529_43065536del" "" "pathogenic" "" "0000593454" "0" "90" "21" "44485360" "44485360" "del" "4.06108E-6" "00006" "CBS_000150" "g.44485360del" "" "{PMID:Cozar 2011:21520339}" "MspI+" "689delT" "" "Germline" "" "" "0" "" "" "g.43065250del" "" "pathogenic" "" "0000593455" "0" "90" "21" "44485360" "44485360" "del" "4.06108E-6" "00006" "CBS_000150" "g.44485360del" "" "{PMID:Cozar 2011:21520339}" "MspI+" "689delT" "" "Germline" "" "" "0" "" "" "g.43065250del" "" "pathogenic" "" "0000593456" "0" "90" "21" "44482498" "44482498" "subst" "0" "00006" "CBS_000119" "g.44482498T>A" "" "{PMID:Cozar 2011:21520339}" "Hpy8I-" "" "" "Germline" "" "" "0" "" "" "g.43062388T>A" "" "pathogenic" "" "0000593457" "0" "90" "21" "44478966" "44478966" "subst" "0" "00006" "CBS_000081" "g.44478966C>A" "" "{PMID:Cozar 2011:21520339}" "" "" "" "Germline" "" "" "0" "" "" "g.43058856C>A" "" "pathogenic" "" "0000593458" "0" "90" "21" "44485373" "44485373" "subst" "0" "00006" "CBS_000154" "g.44485373C>T" "" "{PMID:Cozar 2011:21520339}" "" "" "" "Germline" "" "" "0" "" "" "g.43065263C>T" "" "pathogenic" "" "0000593459" "0" "90" "21" "44485373" "44485373" "subst" "0" "00006" "CBS_000154" "g.44485373C>T" "" "{PMID:Cozar 2011:21520339}" "" "" "" "Germline" "" "" "0" "" "" "g.43065263C>T" "" "pathogenic" "" "0000593460" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Cozar 2011:21520339}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593461" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Cozar 2011:21520339}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593462" "0" "90" "21" "44485739" "44485741" "del" "0" "00006" "CBS_000167" "g.44485739_44485741del" "" "{PMID:Cozar 2011:21520339}" "" "518delTGA" "" "Germline" "" "" "0" "" "" "g.43065629_43065631del" "" "pathogenic" "" "0000593463" "0" "90" "21" "44485739" "44485741" "del" "0" "00006" "CBS_000167" "g.44485739_44485741del" "" "{PMID:Cozar 2011:21520339}" "" "518delTGA" "" "Germline" "" "" "0" "" "" "g.43065629_43065631del" "" "pathogenic" "" "0000593464" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "6/29448 newborns" "{PMID:Zschocke 2009:19370759}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593465" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "6/29448 newborns" "{PMID:Zschocke 2009:19370759}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593466" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "6/29448 newborns" "{PMID:Zschocke 2009:19370759}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593467" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "6/29448 newborns" "{PMID:Zschocke 2009:19370759}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593468" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "6/29448 newborns" "{PMID:Zschocke 2009:19370759}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593469" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "6/29448 newborns" "{PMID:Zschocke 2009:19370759}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593470" "3" "90" "21" "44482421" "44482421" "subst" "0" "00006" "CBS_000009" "g.44482421C>T" "1/29448 newborns" "{PMID:Zschocke 2009:19370759}" "" "" "" "Germline" "" "" "0" "" "" "g.43062311C>T" "" "pathogenic" "" "0000593471" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593472" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593473" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593474" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593475" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593476" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593477" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593478" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593479" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593480" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593481" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593482" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593483" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593484" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593485" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593486" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593487" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593488" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593489" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593490" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593491" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593492" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593493" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593494" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593495" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593496" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593497" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593498" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593499" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593500" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593501" "3" "90" "21" "44485349" "44485349" "subst" "8.12196E-6" "00006" "CBS_000147" "g.44485349C>T" "" "{PMID:El-Said 2006:16786517}" "" "" "" "Germline" "" "" "0" "" "" "g.43065239C>T" "" "pathogenic" "" "0000593502" "3" "90" "21" "44484068" "44484068" "subst" "4.10452E-5" "00006" "CBS_000034" "g.44484068G>A" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43063958G>A" "" "pathogenic" "" "0000593503" "3" "90" "21" "44482491" "44482491" "subst" "4.0702E-6" "00006" "CBS_000118" "g.44482491C>T" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43062381C>T" "" "pathogenic" "" "0000593504" "3" "90" "21" "44482491" "44482491" "subst" "4.0702E-6" "00006" "CBS_000118" "g.44482491C>T" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43062381C>T" "" "pathogenic" "" "0000593505" "3" "90" "21" "44482491" "44482491" "subst" "4.0702E-6" "00006" "CBS_000118" "g.44482491C>T" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43062381C>T" "" "pathogenic" "" "0000593506" "3" "90" "21" "44482491" "44482491" "subst" "4.0702E-6" "00006" "CBS_000118" "g.44482491C>T" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43062381C>T" "" "pathogenic" "" "0000593507" "3" "90" "21" "44482491" "44482491" "subst" "4.0702E-6" "00006" "CBS_000118" "g.44482491C>T" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43062381C>T" "" "pathogenic" "" "0000593508" "3" "90" "21" "44482491" "44482491" "subst" "4.0702E-6" "00006" "CBS_000118" "g.44482491C>T" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43062381C>T" "" "pathogenic" "" "0000593509" "3" "90" "21" "44482491" "44482491" "subst" "4.0702E-6" "00006" "CBS_000118" "g.44482491C>T" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43062381C>T" "" "pathogenic" "" "0000593510" "3" "90" "21" "44482491" "44482491" "subst" "4.0702E-6" "00006" "CBS_000118" "g.44482491C>T" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43062381C>T" "" "pathogenic" "" "0000593511" "3" "90" "21" "44482491" "44482491" "subst" "4.0702E-6" "00006" "CBS_000118" "g.44482491C>T" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43062381C>T" "" "pathogenic" "" "0000593512" "3" "90" "21" "44482491" "44482491" "subst" "4.0702E-6" "00006" "CBS_000118" "g.44482491C>T" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43062381C>T" "" "pathogenic" "" "0000593513" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593514" "3" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593515" "3" "90" "21" "44485800" "44485800" "subst" "0" "00006" "CBS_000177" "g.44485800C>T" "" "{PMID:Zaidi 2012:21517828}" "" "" "" "Germline" "" "" "0" "" "" "g.43065690C>T" "" "pathogenic" "" "0000593516" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Porto 2005:15993874}" "BsrI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593517" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Porto 2005:15993874}" "BsrI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593518" "1" "90" "21" "44485754" "44485754" "subst" "0" "00006" "CBS_000170" "g.44485754A>G" "" "{PMID:Porto 2005:15993874}" "" "" "" "Germline" "" "" "0" "" "" "g.43065644A>G" "" "pathogenic" "" "0000593519" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Porto 2005:15993874}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593520" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Porto 2005:15993874}" "FokI+" "" "" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593521" "1" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "00006" "CBS_000159" "g.44485591G>A" "" "{PMID:Porto 2005:15993874}" "FokI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000593522" "0" "10" "21" "44492252" "44492252" "subst" "0.000837674" "00006" "CBS_000030" "g.44492252G>A" "" "{PMID:Lee 2005:16205833}" "" "" "" "Germline" "" "" "0" "" "" "g.43072142G>A" "" "benign" "" "0000593523" "1" "90" "21" "44485796" "44485796" "subst" "0" "00006" "CBS_000176" "g.44485796A>T" "" "{PMID:Lee 2005:16205833}" "" "" "" "Germline" "" "" "0" "" "" "g.43065686A>T" "" "pathogenic" "" "0000593524" "2" "90" "21" "44484068" "44484068" "subst" "4.10452E-5" "00006" "CBS_000034" "g.44484068G>A" "" "{PMID:Lee 2005:16205833}" "" "" "" "Germline" "" "" "0" "" "" "g.43063958G>A" "" "pathogenic" "" "0000593525" "1" "90" "21" "44483155" "44483155" "subst" "0" "00006" "CBS_000128" "g.44483155C>T" "" "{PMID:Lee 2005:16205833}" "" "" "" "Germline" "" "" "0" "" "" "g.43063045C>T" "" "pathogenic" "" "0000593526" "2" "90" "21" "44485349" "44485351" "del" "0" "00006" "CBS_000146" "g.44485349_44485351del" "" "{PMID:Lee 2005:16205833}" "" "700_702delGAC" "" "Germline" "" "" "0" "" "" "g.43065239_43065241del" "" "pathogenic" "" "0000593527" "1" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "" "{PMID:Lee 2005:16205833}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593528" "2" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "{PMID:Lee 2005:16205833}" "" "" "" "Germline" "" "" "0" "" "" "g.43060528G>A" "" "pathogenic" "" "0000593529" "1" "90" "21" "44485793" "44485793" "subst" "0" "00006" "CBS_000174" "g.44485793G>A" "" "{PMID:Lee 2005:16205833}" "" "" "" "Germline" "" "" "0" "" "" "g.43065683G>A" "" "pathogenic" "" "0000593530" "2" "90" "21" "44482421" "44482421" "subst" "0" "00006" "CBS_000009" "g.44482421C>T" "" "{PMID:Lee 2005:16205833}" "" "" "" "Germline" "" "" "0" "" "" "g.43062311C>T" "" "pathogenic" "" "0000593531" "1" "90" "21" "44485349" "44485351" "del" "0" "00006" "CBS_000146" "g.44485349_44485351del" "" "{PMID:Lee 2005:16205833}" "" "700_702delGAC" "" "Germline" "" "" "0" "" "" "g.43065239_43065241del" "" "pathogenic" "" "0000593532" "2" "90" "21" "44484068" "44484068" "subst" "4.10452E-5" "00006" "CBS_000034" "g.44484068G>A" "" "{PMID:Lee 2005:16205833}" "" "" "" "Germline" "" "" "0" "" "" "g.43063958G>A" "" "pathogenic" "" "0000593533" "1" "90" "21" "44479076" "44479076" "subst" "0" "00006" "CBS_000090" "g.44479076C>T" "" "{PMID:Kozich 1997:9266356}" "BSslI-" "" "" "Germline" "" "" "0" "" "" "g.43058966C>T" "" "pathogenic" "" "0000593534" "2" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Kozich 1997:9266356}" "" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593535" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Kozich 1997:9266356}" "" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593536" "2" "90" "21" "44479198" "44479298" "del" "0" "00006" "CBS_000093" "g.44479198_44479298del" "" "{PMID:Kozich 1997:9266356}" "" "1223+37del99" "" "Germline" "" "" "0" "" "" "g.43059088_43059188del" "" "pathogenic" "" "0000593537" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593538" "1" "90" "21" "44483104" "44483104" "subst" "0" "00006" "CBS_000123" "g.44483104C>T" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43062994C>T" "" "pathogenic" "" "0000593539" "2" "10" "21" "44483184" "44483185" "ins" "0" "00006" "CBS_000133" "g.44483184_44483185insTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAGCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAG" "" "{PMID:de Franchis 1998:9587029}" "" "833T>C;844ins68" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "benign" "" "0000593540" "1" "90" "21" "44483148" "44483148" "subst" "0" "00006" "CBS_000126" "g.44483148G>A" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43063038G>A" "" "pathogenic" "" "0000593541" "2" "90" "21" "44486458" "44486458" "subst" "0" "00006" "CBS_000198" "g.44486458C>T" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43066348C>T" "" "pathogenic" "" "0000593542" "1" "90" "21" "44486458" "44486458" "subst" "0" "00006" "CBS_000198" "g.44486458C>T" "" "{PMID:de Franchis 1998:9587029}" "" "" "no var allele 2" "Germline" "" "" "0" "" "" "g.43066348C>T" "" "pathogenic" "" "0000593543" "3" "90" "21" "44484068" "44484068" "subst" "4.10452E-5" "00006" "CBS_000034" "g.44484068G>A" "" "{PMID:de Franchis 1998:9587029}" "" "C770T" "" "Germline" "" "" "0" "" "" "g.43063958G>A" "" "pathogenic" "" "0000593544" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000132" "g.44483184A>T" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43063074A>T" "" "pathogenic" "" "0000593545" "2" "90" "21" "44488673" "44488673" "subst" "0" "00006" "CBS_000203" "g.44488673G>A" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43068563G>A" "" "pathogenic" "" "0000593546" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000132" "g.44483184A>T" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43063074A>T" "" "pathogenic" "" "0000593547" "2" "90" "21" "44486458" "44486458" "subst" "0" "00006" "CBS_000198" "g.44486458C>T" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43066348C>T" "" "pathogenic" "" "0000593548" "3" "90" "21" "44486430" "44486430" "subst" "1.21975E-5" "00006" "CBS_000191" "g.44486430C>T" "" "{PMID:de Franchis 1998:9587029}" "" "G374A" "" "Germline" "" "" "0" "" "" "g.43066320C>T" "" "pathogenic" "" "0000593549" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593550" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:de Franchis 1998:9587029}" "" "" "no var allele 2" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593551" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:de Franchis 1998:9587029}" "" "" "no var allele 2" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593552" "1" "90" "21" "44492158" "44492158" "subst" "0.000150626" "00006" "CBS_000052" "g.44492158G>A" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43072048G>A" "" "pathogenic" "" "0000593553" "2" "90" "21" "44485782" "44485808" "del" "0" "00006" "CBS_000172" "g.44485782_44485808del" "" "{PMID:de Franchis 1998:9587029}" "" "452del27" "" "Germline" "" "" "0" "" "" "g.43065672_43065698del" "" "pathogenic" "" "0000593554" "1" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593555" "1" "90" "21" "44486428" "44486428" "subst" "0" "00006" "CBS_000190" "g.44486428T>C" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43066318T>C" "" "pathogenic" "" "0000593556" "2" "90" "21" "44492132" "44492132" "subst" "8.15481E-6" "00006" "CBS_000213" "g.44492132G>A" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43072022G>A" "" "pathogenic" "" "0000593557" "3" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593558" "1" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593559" "2" "90" "21" "44483113" "44483113" "subst" "4.06138E-6" "00006" "CBS_000124" "g.44483113C>T" "" "{PMID:de Franchis 1998:9587029}" "" "" "" "Germline" "" "" "0" "" "" "g.43063003C>T" "" "pathogenic" "" "0000593560" "1" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:de Franchis 1998:9587029}" "" "" "no var allele 2" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593561" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Hu 1993:7506602}" "BsrI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593562" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Hu 1993:7506602}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593563" "1" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:de Franchis 1999:10408774}, {PMID:Kraus 1999:10338090}" "MaeII+" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593564" "2" "90" "21" "44483113" "44483113" "subst" "4.06138E-6" "00006" "CBS_000124" "g.44483113C>T" "" "{PMID:de Franchis 1999:10408774}, {PMID:Kraus 1999:10338090}" "" "" "" "Germline" "" "" "0" "" "" "g.43063003C>T" "" "pathogenic" "" "0000593565" "1" "90" "21" "44480638" "44480638" "subst" "2.99727E-5" "00006" "CBS_000035" "g.44480638G>A" "" "{PMID:Kraus 1999:10338090}, L Elsas" "" "" "" "Germline" "" "" "0" "" "" "g.43060528G>A" "" "pathogenic" "" "0000593566" "2" "90" "21" "44485373" "44485373" "subst" "0" "00006" "CBS_000154" "g.44485373C>T" "" "{PMID:Kraus 1999:10338090}, L Elsas" "" "" "" "Germline" "" "" "0" "" "" "g.43065263C>T" "" "pathogenic" "" "0000593567" "3" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:Sebastio 1995:7762555}" "MaeII+" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593568" "2" "90" "21" "44486458" "44486458" "subst" "0" "00006" "CBS_000198" "g.44486458C>T" "" "{PMID:Sperandeo 1996:8803779}, {PMID:Kraus 1999:10338090}" "" "" "" "Germline" "" "" "0" "" "" "g.43066348C>T" "" "pathogenic" "" "0000593569" "11" "90" "21" "44483148" "44483148" "subst" "0" "00006" "CBS_000126" "g.44483148G>A" "" "{PMID:Sperandeo 1996:8803779}, {PMID:Kraus 1999:10338090}" "" "" "" "Germline" "" "" "0" "" "" "g.43063038G>A" "" "pathogenic" "" "0000593570" "2" "90" "21" "44480585" "44480585" "subst" "0" "00006" "CBS_000103" "g.44480585C>T" "" "{PMID:Kluijtmans 1995:7635485}" "" "" "" "Germline" "" "" "0" "" "" "g.43060475C>T" "" "pathogenic" "" "0000593571" "1" "90" "21" "44485763" "44485763" "subst" "0" "00006" "CBS_000027" "g.44485763C>T" "" "{PMID:Kluijtmans 1995:7635485}" "BsoFI-" "" "" "Germline" "" "" "0" "" "" "g.43065653C>T" "" "pathogenic" "" "0000593572" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Sebastio 1995:7762555}" "BsrI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593573" "2" "90" "21" "44488673" "44488673" "subst" "0" "00006" "CBS_000203" "g.44488673G>A" "" "{PMID:Sebastio 1995:7762555}" "MnlI+" "" "" "Germline" "" "" "0" "" "" "g.43068563G>A" "" "pathogenic" "" "0000593574" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Sebastio 1995:7762555}" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593575" "2" "90" "21" "44488673" "44488673" "subst" "0" "00006" "CBS_000203" "g.44488673G>A" "" "{PMID:Sebastio 1995:7762555}" "MnlI+" "" "" "Germline" "" "" "0" "" "" "g.43068563G>A" "" "pathogenic" "" "0000593576" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Sebastio 1995:7762555}" "BsrI+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593577" "1" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:Sebastio 1995:7762555}" "MaeII+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593578" "1" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:Sebastio 1995:7762555}" "MaeII+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593579" "1" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:Sebastio 1995:7762555}" "MaeII+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593580" "1" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "" "{PMID:Sebastio 1995:7762555}" "MaeII+" "" "no variant 2nd allele identified" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593581" "3" "90" "21" "44482453" "44482453" "subst" "0" "00006" "CBS_000114" "g.44482453C>T" "" "{PMID:Kraus 1999:10338090}, M Coude" "" "" "" "Germline" "" "" "0" "" "" "g.43062343C>T" "" "pathogenic" "" "0000593582" "21" "90" "21" "44492158" "44492158" "subst" "0.000150626" "00006" "CBS_000052" "g.44492158G>A" "" "{PMID:Sperandeo 1995:7564249}" "" "" "" "Germline" "" "" "0" "" "" "g.43072048G>A" "" "pathogenic" "" "0000593583" "1" "90" "21" "44484030" "44484032" "del" "0" "00006" "CBS_000136" "g.44484030_44484032del" "" "{PMID:Kraus 1999:10338090}, H Koch" "" "808del3" "" "Germline" "" "" "0" "" "" "g.43063920_43063922del" "" "pathogenic" "" "0000593584" "2" "90" "21" "44479386" "44479386" "subst" "0" "00006" "CBS_000096" "g.44479386C>A" "" "{PMID:Kraus 1999:10338090}, H Koch" "" "" "" "Germline" "" "" "0" "" "" "g.43059276C>A" "" "pathogenic" "" "0000593585" "3" "90" "21" "44479407" "44479407" "subst" "0" "00006" "CBS_000098" "g.44479407C>G" "" "{PMID:Kraus 1999:10338090}, H Koch" "" "" "" "Germline" "" "" "0" "" "" "g.43059297C>G" "" "pathogenic" "" "0000593586" "3" "90" "21" "44478364" "44478364" "subst" "0" "00006" "CBS_000078" "g.44478364C>G" "" "{PMID:Kraus 1999:10338090}, H Koch" "" "" "" "Germline" "" "" "0" "" "" "g.43058254C>G" "" "pathogenic" "" "0000593587" "1" "90" "21" "44478361" "44478361" "subst" "0" "00006" "CBS_000077" "g.44478361A>T" "" "{PMID:Kruger 1995:8528202}" "" "" "" "Germline" "" "" "0" "" "" "g.43058251A>T" "" "pathogenic" "" "0000593588" "2" "90" "21" "44483098" "44483098" "subst" "0.000150275" "00006" "CBS_000122" "g.44483098C>T" "" "{PMID:Kruger 1995:8528202}" "" "" "" "Germline" "" "" "0" "" "" "g.43062988C>T" "" "pathogenic" "" "0000593589" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593590" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593591" "3" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593592" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593593" "2" "90" "21" "44484009" "44484009" "subst" "8.23981E-6" "00006" "CBS_000134" "g.44484009C>T" "" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germline" "" "" "0" "" "" "g.43063899C>T" "" "pathogenic" "" "0000593594" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593595" "2" "90" "21" "44486353" "44486353" "subst" "1.64037E-5" "00006" "CBS_000180" "g.44486353C>T" "" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germline" "" "" "0" "" "" "g.43066243C>T" "" "pathogenic" "" "0000593596" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593597" "2" "90" "21" "44484070" "44484099" "del" "0" "00006" "CBS_000142" "g.44484070_44484099del" "" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germline" "" "" "0" "" "" "g.43063960_43063989del" "" "pathogenic" "" "0000593598" "3" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593599" "2" "90" "21" "44480561" "44480561" "subst" "8.18344E-6" "00006" "CBS_000101" "g.44480561G>A" "" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germline" "" "" "0" "" "" "g.43060451G>A" "" "pathogenic" "" "0000593600" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593601" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593602" "2" "90" "21" "44485373" "44485373" "subst" "0" "00006" "CBS_000154" "g.44485373C>T" "" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germline" "" "" "0" "" "" "g.43065263C>T" "" "pathogenic" "" "0000593603" "2" "90" "21" "44483155" "44483155" "subst" "0" "00006" "CBS_000129" "g.44483155C>G" "" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germline" "" "" "0" "" "" "g.43063045C>G" "" "pathogenic" "" "0000593604" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593605" "1" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Linnebank 2004:15365998}" "MspI+" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593606" "2" "90" "21" "44486375" "44486375" "subst" "0" "00006" "CBS_000186" "g.44486375G>C" "" "{PMID:Linnebank 2004:15365998}" "" "" "" "Germline" "" "" "0" "" "" "g.43066265G>C" "" "pathogenic" "" "0000593607" "1" "90" "21" "44488682" "44488682" "subst" "4.0623E-6" "00006" "CBS_000206" "g.44488682C>T" "" "{PMID:Kraus 1999:10338090}, M Gaustadnes" "" "" "" "Germline" "" "" "0" "" "" "g.43068572C>T" "" "pathogenic" "" "0000593608" "2" "90" "21" "44478972" "44478972" "subst" "0.000352649" "00006" "CBS_000082" "g.44478972C>T" "" "{PMID:Kraus 1999:10338090}, M Gaustadnes" "" "" "" "Germline" "" "" "0" "" "" "g.43058862C>T" "" "pathogenic" "" "0000593609" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kraus 1999:10338090}, M Gaustadnes" "" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593610" "2" "90" "21" "44478325" "44478325" "subst" "1.21836E-5" "00006" "CBS_000075" "g.44478325G>A" "" "{PMID:Kraus 1999:10338090}, M Gaustadnes" "" "" "" "Germline" "" "" "0" "" "" "g.43058215G>A" "" "pathogenic" "" "0000593611" "1" "90" "21" "44478998" "44478998" "subst" "0" "00006" "CBS_000085" "g.44478998A>G" "" "{PMID:Kraus 1999:10338090}, M Gaustadnes" "" "" "" "Germline" "" "" "0" "" "" "g.43058888A>G" "" "pathogenic" "" "0000593612" "2" "90" "21" "44483062" "44483062" "subst" "0" "00006" "CBS_000121" "g.44483062C>T" "" "{PMID:Kraus 1999:10338090}, M Gaustadnes" "" "IVS8+1G>A" "" "Germline" "" "" "0" "" "" "g.43062952C>T" "" "pathogenic" "" "0000593613" "3" "90" "21" "44492163" "44492163" "subst" "0" "00006" "CBS_000214" "g.44492163A>T" "" "{PMID:Cheng 2007:18194900}" "" "" "" "Germline" "" "" "0" "" "" "g.43072053A>T" "" "pathogenic" "" "0000593614" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kraus 1999:10338090}, H Koch" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593615" "3" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kraus 1999:10338090}, H Koch" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593616" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kraus 1999:10338090}, V Kozich" "BsrI+" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593617" "2" "90" "21" "44485794" "44485794" "subst" "0" "00006" "CBS_000175" "g.44485794C>T" "" "{PMID:Kraus 1999:10338090}, V Kozich" "" "" "" "Germline" "" "" "0" "" "" "g.43065684C>T" "" "pathogenic" "" "0000593618" "2" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "" "{PMID:Kraus 1999:10338090}, V Kozich" "" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593619" "2" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "" "{PMID:Kraus 1999:10338090}, V Kozich" "" "IVS11-2A>C" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593620" "1" "90" "21" "44482454" "44482454" "subst" "1.628E-5" "00006" "CBS_000115" "g.44482454G>A" "225/29448 newborns" "{PMID:Zschocke 2009:19370759}" "" "" "" "Germline" "" "" "0" "" "" "g.43062344G>A" "" "pathogenic" "" "0000593621" "1" "90" "21" "44485349" "44485349" "subst" "8.12196E-6" "00006" "CBS_000147" "g.44485349C>T" "14/29448 newborns" "{PMID:Zschocke 2009:19370759}" "" "" "" "Germline" "" "" "0" "" "" "g.43065239C>T" "" "pathogenic" "" "0000593622" "1" "10" "21" "44483184" "44483185" "ins" "0" "00006" "CBS_000133" "g.44483184_44483185insTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAGCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAG" "18/239 controls" "{PMID:Sperandeo 1996:8940285}" "BsrI+" "" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "benign" "" "0000593623" "0" "90" "21" "44480616" "44480616" "subst" "0.33399" "00006" "CBS_000020" "g.44480616G>A" "168/400 chroosomes" "{PMID:Janosikova 2005:15494741}" "" "" "" "Germline" "" "" "0" "" "" "g.43060506G>A" "" "pathogenic" "" "0000593624" "0" "90" "21" "44485350" "44485350" "subst" "0.274197" "00006" "CBS_000032" "g.44485350G>A" "128/400 chroosomes" "{PMID:Janosikova 2005:15494741}" "" "" "" "Germline" "" "" "0" "" "" "g.43065240G>A" "" "pathogenic" "" "0000593625" "1" "10" "21" "44483184" "44483185" "ins" "0" "00006" "CBS_000133" "g.44483184_44483185insTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAGCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAG" "159/1284 controls" "{PMID:Sokolova 2001:11748855}" "" "c.[833T>C; 844ins68bp]" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "benign" "" "0000593626" "3" "10" "21" "44483184" "44483185" "ins" "0" "00006" "CBS_000133" "g.44483184_44483185insTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAGCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAG" "8/1284 controls" "{PMID:Sokolova 2001:11748855}" "" "c.[833T>C; 844ins68bp]" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "benign" "" "0000593627" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "1/1424 controls" "{PMID:Sokolova 2001:11748855}" "" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593628" "1" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "4/1144 controls" "{PMID:Sokolova 2001:11748855}" "" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593629" "0" "90" "21" "44483184" "44483184" "subst" "0" "00006" "CBS_000043" "g.44483184A>G" "3/9770000 chromosomes" "{PMID:Sokolova 2001:11748855}" "" "" "" "Germline" "" "" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000593630" "0" "90" "21" "44479080" "44479080" "subst" "8.01335E-5" "00006" "CBS_000091" "g.44479080T>G" "7/9770000 chromosomes" "{PMID:Sokolova 2001:11748855}" "" "" "" "Germline" "" "" "0" "" "" "g.43058970T>G" "" "pathogenic" "" "0000593631" "0" "90" "21" "44492290" "44492290" "dup" "0" "00006" "CBS_000218" "g.44492290dup" "3/9770000 chromosomes" "{PMID:Sokolova 2001:11748855}" "" "" "" "Germline" "" "" "0" "" "" "g.43072180dup" "" "pathogenic" "" "0000593632" "0" "90" "21" "44479076" "44479076" "subst" "0" "00006" "CBS_000090" "g.44479076C>T" "2/9770000 chromosomes" "{PMID:Sokolova 2001:11748855}" "" "" "" "Germline" "" "" "0" "" "" "g.43058966C>T" "" "pathogenic" "" "0000593633" "0" "90" "21" "44485731" "44485731" "subst" "0" "00006" "CBS_000166" "g.44485731C>T" "2/9770000 chromosomes" "{PMID:Sokolova 2001:11748855}" "" "" "" "Germline" "" "" "0" "" "" "g.43065621C>T" "" "pathogenic" "" "0000593634" "1" "90" "21" "44486374" "44486374" "subst" "2.85665E-5" "00006" "CBS_000185" "g.44486374C>T" "2/9770000 chromosomes" "{PMID:Sokolova 2001:11748855}" "" "" "" "Germline" "" "" "0" "" "" "g.43066264C>T" "" "pathogenic" "" "0000593635" "1" "90" "21" "44485794" "44485794" "subst" "0" "00006" "CBS_000175" "g.44485794C>T" "2/9770000 chromosomes" "{PMID:Sokolova 2001:11748855}" "" "" "" "Germline" "" "" "0" "" "" "g.43065684C>T" "" "pathogenic" "" "0000593636" "0" "90" "21" "44488726" "44488726" "subst" "0" "00006" "CBS_000208" "g.44488726C>G" "1/9770000 chromosomes" "{PMID:Sokolova 2001:11748855}" "" "IVS2-1G>C" "" "Germline" "" "" "0" "" "" "g.43068616C>G" "" "pathogenic" "" "0000593637" "0" "90" "21" "44492276" "44492276" "del" "8.32307E-6" "00006" "CBS_000217" "g.44492276del" "1/9770000 chromosomes" "{PMID:Sokolova 2001:11748855}" "" "28delG" "" "Germline" "" "" "0" "" "" "g.43072166del" "" "pathogenic" "" "0000593638" "0" "90" "21" "44486463" "44486463" "subst" "0.000211492" "00006" "CBS_000199" "g.44486463G>A" "1/9770000 chromosomes" "{PMID:Sokolova 2001:11748855}" "" "" "" "Germline" "" "" "0" "" "" "g.43066353G>A" "" "pathogenic" "" "0000593639" "1" "90" "21" "44484009" "44484009" "subst" "8.23981E-6" "00006" "CBS_000134" "g.44484009C>T" "1/9770000 chromosomes" "{PMID:Sokolova 2001:11748855}" "" "[IVS7+1G>A; IVS11+39del99]" "" "Germline" "" "" "0" "" "" "g.43063899C>T" "" "pathogenic" "" "0000618376" "0" "70" "21" "44482468" "44482468" "subst" "4.06732E-6" "02327" "CBS_000116" "g.44482468G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43062358G>T" "" "likely pathogenic" "" "0000618377" "0" "90" "21" "44483184" "44483184" "subst" "0" "02327" "CBS_000043" "g.44483184A>G" "" "" "" "CBS(NM_000071.2):c.833T>C (p.(Ile278Thr)), CBS(NM_000071.3):c.833T>C (p.I278T), CBS(NM_001321072.1):c.518T>C (p.I173T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43063074A>G" "" "pathogenic" "" "0000618378" "0" "50" "21" "44485349" "44485349" "subst" "8.12196E-6" "02327" "CBS_000147" "g.44485349C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43065239C>T" "" "VUS" "" "0000618379" "0" "50" "21" "44492132" "44492132" "subst" "8.15481E-6" "01943" "CBS_000213" "g.44492132G>A" "" "" "" "CBS(NM_001178008.2):c.172C>T (p.R58W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43072022G>A" "" "VUS" "" "0000618380" "0" "70" "21" "44492276" "44492276" "del" "8.32307E-6" "01943" "CBS_000217" "g.44492276del" "" "" "" "CBS(NM_001178008.2):c.28delG (p.V10Wfs*72)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43072166del" "" "likely pathogenic" "" "0000624224" "0" "30" "21" "44485756" "44485756" "subst" "3.88285E-5" "01943" "CBS_000219" "g.44485756G>A" "" "" "" "CBS(NM_000071.3):c.501C>T (p.I167=), CBS(NM_001321072.1):c.186C>T (p.I62=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43065646G>A" "" "likely benign" "" "0000650868" "1" "50" "21" "44480591" "44480591" "subst" "0.00308525" "03575" "CBS_000019" "g.44480591G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs117687681}" "Germline" "" "rs117687681" "0" "" "" "g.43060481G>A" "" "VUS" "" "0000650869" "1" "70" "21" "44480638" "44480638" "subst" "2.99727E-5" "03575" "CBS_000035" "g.44480638G>A" "6/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "6 heterozygous, no homozygous; {DB:CLININrs121964972}" "Germline" "" "rs121964972" "0" "" "" "g.43060528G>A" "" "likely pathogenic" "" "0000650870" "1" "90" "21" "44483184" "44483184" "subst" "0" "03575" "CBS_000043" "g.44483184A>G" "250/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "250 heterozygous; {DB:CLININrs5742905}" "Germline" "" "rs5742905" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000650871" "1" "70" "21" "44484053" "44484053" "subst" "2.04344E-5" "03575" "CBS_000139" "g.44484053G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs149119723}" "Germline" "" "rs149119723" "0" "" "" "g.43063943G>A" "" "likely pathogenic" "" "0000650872" "1" "90" "21" "44485349" "44485349" "subst" "8.12196E-6" "03575" "CBS_000147" "g.44485349C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs773734233}" "Germline" "" "rs773734233" "0" "" "" "g.43065239C>T" "" "pathogenic" "" "0000650873" "1" "90" "21" "44488682" "44488682" "subst" "4.0623E-6" "03575" "CBS_000206" "g.44488682C>T" "1/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs863223435}" "Germline" "" "rs863223435" "0" "" "" "g.43068572C>T" "" "pathogenic" "" "0000653045" "1" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "03575" "CBS_000159" "g.44485591G>A" "2/2788 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs121964973}" "Germline" "" "rs121964973" "0" "" "" "g.43065481G>A" "" "pathogenic" "" "0000653342" "1" "50" "21" "44480629" "44480637" "del" "0" "03575" "CBS_000220" "g.44480629_44480637del" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs863223436}" "Germline" "" "rs863223436" "0" "" "" "g.43060519_43060527del" "" "VUS" "" "0000658835" "0" "30" "21" "44483043" "44483043" "subst" "0.000419559" "02327" "CBS_000221" "g.44483043G>A" "" "" "" "CBS(NM_000071.2):c.954+20C>T (p.(=)), CBS(NM_000071.3):c.954+20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43062933G>A" "" "likely benign" "" "0000658836" "0" "30" "21" "44485303" "44485303" "subst" "0" "01943" "CBS_000222" "g.44485303A>G" "" "" "" "CBS(NM_001321072.1):c.421+10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43065193A>G" "" "likely benign" "" "0000658837" "0" "30" "21" "44485581" "44485581" "subst" "0" "01943" "CBS_000223" "g.44485581A>G" "" "" "" "CBS(NM_001321072.1):c.267T>C (p.N89=), CBSL(NM_001354006.1):c.582T>C (p.N194=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43065471A>G" "" "likely benign" "" "0000669694" "3" "90" "21" "44483184" "44483184" "subst" "0" "03575" "CBS_000043" "g.44483184A>G" "1/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs5742905}" "Germline" "" "rs5742905" "0" "" "" "g.43063074A>G" "" "pathogenic" "" "0000681725" "0" "50" "21" "44476993" "44476993" "subst" "0" "01943" "CBS_000040" "g.44476993C>T" "" "" "" "CBS(NM_001321072.1):c.1157G>A (p.R386H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000681726" "0" "50" "21" "44485794" "44485794" "subst" "0" "01943" "CBS_000175" "g.44485794C>T" "" "" "" "CBS(NM_001321072.1):c.148G>A (p.A50T), CBSL(NM_001354006.1):c.463G>A (p.A155T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000681727" "0" "50" "21" "44488720" "44488720" "subst" "0.00058991" "01804" "CBS_000224" "g.44488720T>A" "" "" "" "CBS(NM_000071.2):c.215A>T (p.(Lys72Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693052" "0" "70" "21" "44482416" "44482416" "subst" "8.2052E-6" "02327" "CBS_000225" "g.44482416C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000693053" "0" "50" "21" "44483130" "44483130" "subst" "0.000243706" "01943" "CBS_000226" "g.44483130G>A" "" "" "" "CBS(NM_001321072.1):c.572C>T (p.T191M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000698840" "0" "70" "21" "44480591" "44480591" "subst" "0.00308525" "01602" "CBS_000019" "g.44480591G>A" "" "{PMID:Neubauer 2021:33895855}" "" "" "" "Unknown" "" "" "" "" "" "" "" "likely pathogenic" "" "0000727923" "0" "90" "21" "44483184" "44483184" "subst" "0" "02325" "CBS_000043" "g.44483184A>G" "" "" "" "CBS(NM_000071.2):c.833T>C (p.(Ile278Thr)), CBS(NM_000071.3):c.833T>C (p.I278T), CBS(NM_001321072.1):c.518T>C (p.I173T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000727924" "0" "30" "21" "44484111" "44484111" "subst" "5.67151E-5" "01943" "CBS_000046" "g.44484111G>A" "" "" "" "CBS(NM_000071.3):c.737-10C>T, CBS(NM_001321072.1):c.422-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727925" "0" "50" "21" "44485564" "44485564" "subst" "1.63713E-5" "02325" "CBS_000025" "g.44485564G>A" "" "" "" "CBS(NM_000071.2):c.599C>T (p.(Pro200Leu)), CBS(NM_000071.3):c.599C>T (p.P200L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727926" "0" "30" "21" "44486408" "44486408" "subst" "3.25614E-5" "01943" "CBS_000227" "g.44486408G>A" "" "" "" "CBS(NM_001321072.1):c.81C>T (p.R27=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727927" "0" "30" "21" "44492095" "44492095" "subst" "4.49413E-5" "01943" "CBS_000228" "g.44492095G>A" "" "" "" "CBS(NM_001178008.2):c.209C>T (p.P70L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809402" "0" "30" "21" "44476986" "44476986" "subst" "0.00035905" "01943" "CBS_000039" "g.44476986C>T" "" "" "" "CBS(NM_001321072.1):c.1164G>A (p.T388=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809403" "0" "70" "21" "44480585" "44480585" "subst" "0" "01943" "CBS_000103" "g.44480585C>T" "" "" "" "CBS(NM_001321072.1):c.796G>A (p.V266M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000809404" "0" "10" "21" "44485590" "44485590" "subst" "0.00587541" "02329" "CBS_000026" "g.44485590C>T" "" "" "" "CBS(NM_000071.2):c.573G>A (p.(Thr191=)), CBS(NM_000071.3):c.573G>A (p.T191=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000814419" "0" "70" "21" "44480591" "44480591" "subst" "0.00308525" "00000" "CBS_000019" "g.44480591G>A" "" "{PMID:Lenassi 2020:31848469}" "" "CBS c.1105C>T p.(Arg369Cys) het" "heterozygous" "Germline" "?" "" "0" "" "" "g.43060481G>A" "" "likely pathogenic" "ACMG" "0000855967" "0" "70" "21" "44482453" "44482453" "subst" "0" "02327" "CBS_000114" "g.44482453C>T" "" "" "" "CBS(NM_000071.3):c.1007G>A (p.(Arg336His), p.R336H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000855968" "0" "30" "21" "44483043" "44483043" "subst" "0.000419559" "02329" "CBS_000221" "g.44483043G>A" "" "" "" "CBS(NM_000071.2):c.954+20C>T (p.(=)), CBS(NM_000071.3):c.954+20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855969" "0" "90" "21" "44483184" "44483184" "subst" "0" "01943" "CBS_000043" "g.44483184A>G" "" "" "" "CBS(NM_000071.2):c.833T>C (p.(Ile278Thr)), CBS(NM_000071.3):c.833T>C (p.I278T), CBS(NM_001321072.1):c.518T>C (p.I173T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000866636" "0" "50" "21" "44479319" "44479319" "subst" "2.85409E-5" "01804" "CBS_000230" "g.44479319C>T" "" "" "" "CBS(NM_000071.2):c.1223+17G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866637" "0" "30" "21" "44479328" "44479328" "subst" "2.44298E-5" "01804" "CBS_000231" "g.44479328G>A" "" "" "" "CBS(NM_000071.2):c.1223+8C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866638" "0" "10" "21" "44480544" "44480544" "subst" "0.00621275" "02329" "CBS_000018" "g.44480544G>A" "" "" "" "CBS(NM_000071.2):c.1145+7C>T (p.(=)), CBS(NM_000071.3):c.1145+7C>T, CBS(NM_001321072.1):c.830+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000866639" "0" "50" "21" "44480624" "44480624" "subst" "9.77218E-5" "01804" "CBS_000232" "g.44480624C>T" "" "" "" "CBS(NM_000071.2):c.1072G>A (p.(Val358Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866640" "0" "30" "21" "44480637" "44480637" "subst" "0.000586091" "01943" "CBS_000233" "g.44480637C>T" "" "" "" "CBS(NM_000071.2):c.1059G>A (p.(Thr353=)), CBS(NM_000071.3):c.1059G>A (p.T353=), CBS(NM_001321072.1):c.744G>A (p.T248=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866641" "0" "30" "21" "44483201" "44483201" "subst" "0.000487809" "01804" "CBS_000234" "g.44483201C>T" "" "" "" "CBS(NM_000071.2):c.829-13G>A (p.(=)), CBS(NM_000071.3):c.829-13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866642" "0" "30" "21" "44485715" "44485715" "subst" "0.00432295" "01804" "CBS_000048" "g.44485715C>T" "" "" "" "CBS(NM_000071.2):c.531+11G>A (p.(=)), CBS(NM_000071.3):c.531+11G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866643" "0" "30" "21" "44486465" "44486465" "subst" "0.000276571" "01804" "CBS_000235" "g.44486465G>A" "" "" "" "CBS(NM_000071.2):c.339C>T (p.(Asn113=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866644" "0" "10" "21" "44488631" "44488631" "subst" "0.00283574" "01804" "CBS_000001" "g.44488631T>G" "" "" "" "CBS(NM_000071.2):c.304A>C (p.(Lys102Gln), p.K102Q), CBS(NM_000071.3):c.304A>C (p.K102Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000866645" "0" "30" "21" "44492252" "44492252" "subst" "0.000837674" "01804" "CBS_000030" "g.44492252G>A" "" "" "" "CBS(NM_000071.2):c.52C>T (p.(Arg18Cys), p.R18C), CBS(NM_001178008.2):c.52C>T (p.R18C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000873572" "0" "70" "21" "44485731" "44485731" "subst" "0" "00000" "CBS_000166" "g.44485731C>T" "195" "{PMID:Sun 2018:30076350}" "" "CBS (NM_001178009.1):c.526G>A(p.E176K)/c.949A>G(p.R317G)" "different transcript: CBS (NM_001178009.1):c.526G>A(p.E176K)" "Germline/De novo (untested)" "?" "" "0" "" "" "g.43065621C>T" "" "likely pathogenic" "" "0000873573" "0" "70" "21" "44483068" "44483068" "subst" "8.12764E-6" "00000" "CBS_000236" "g.44483068T>C" "195" "{PMID:Sun 2018:30076350}" "" "CBS (NM_001178009.1):c.526G>A(p.E176K)/c.949A>G(p.R317G)" "different transcript: CBS (NM_001178009.1):c.949A>G(p.R317G)" "Germline/De novo (untested)" "?" "" "0" "" "" "g.43062958T>C" "" "likely pathogenic" "" "0000874665" "3" "70" "21" "44482421" "44482421" "subst" "0" "00000" "CBS_000009" "g.44482421C>T" "frequency in 1500 in-house samples: 0" "{PMID:Alfares 2018:30202406}" "" "CBS, NM_001178008.1, c.1039G>A, p.Gly347Ser" "homozygous" "Unknown" "?" "" "0" "" "" "g.43062311C>T" "" "likely pathogenic" "ACMG" "0000895479" "0" "30" "21" "44474002" "44474002" "subst" "6.54927E-5" "01804" "CBS_000237" "g.44474002C>G" "" "" "" "CBS(NM_000071.2):c.1644G>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895480" "0" "30" "21" "44474020" "44474020" "subst" "5.70623E-5" "01804" "CBS_000238" "g.44474020G>A" "" "" "" "CBS(NM_000071.2):c.1626C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895481" "0" "30" "21" "44478372" "44478372" "subst" "8.94949E-5" "01804" "CBS_000239" "g.44478372C>T" "" "" "" "CBS(NM_000071.2):c.1359-9G>A (p.(=)), CBS(NM_000071.3):c.1359-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895482" "0" "30" "21" "44478964" "44478964" "subst" "8.10252E-5" "01804" "CBS_000041" "g.44478964C>T" "" "" "" "CBS(NM_000071.2):c.1338G>A (p.(Ala446=)), CBS(NM_000071.3):c.1338G>A (p.A446=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895483" "0" "30" "21" "44479327" "44479327" "subst" "2.44373E-5" "01804" "CBS_000240" "g.44479327C>T" "" "" "" "CBS(NM_000071.2):c.1223+9G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895484" "0" "90" "21" "44482453" "44482453" "subst" "0" "02329" "CBS_000114" "g.44482453C>T" "" "" "" "CBS(NM_000071.3):c.1007G>A (p.(Arg336His), p.R336H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000895485" "0" "30" "21" "44483043" "44483043" "subst" "0.000419559" "01804" "CBS_000221" "g.44483043G>A" "" "" "" "CBS(NM_000071.2):c.954+20C>T (p.(=)), CBS(NM_000071.3):c.954+20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895486" "0" "30" "21" "44483123" "44483123" "subst" "0.000114834" "01804" "CBS_000241" "g.44483123C>T" "" "" "" "CBS(NM_000071.2):c.894G>A (p.(Gln298=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895487" "0" "90" "21" "44483184" "44483184" "subst" "0" "01804" "CBS_000043" "g.44483184A>G" "" "" "" "CBS(NM_000071.2):c.833T>C (p.(Ile278Thr)), CBS(NM_000071.3):c.833T>C (p.I278T), CBS(NM_001321072.1):c.518T>C (p.I173T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000895488" "0" "30" "21" "44483217" "44483218" "ins" "0" "01804" "CBS_000242" "g.44483217_44483218insCCCAGCAAAAGCCCCACCTGGGTGATCCACCCCAGTGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAG" "" "" "" "CBS(NM_000071.2):c.832_833insCTGGGGTGGATCACCCAGGTGGGGCTTTTGCTGGGCTTGAGCCCTGAAGCCGCGCCCTCTGCAGATCA (p.(Ile278Thrfs*16))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895489" "0" "50" "21" "44486409" "44486409" "subst" "8.13809E-6" "01804" "CBS_000243" "g.44486409C>T" "" "" "" "CBS(NM_000071.2):c.395G>A (p.(Arg132His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895490" "0" "10" "21" "44488631" "44488631" "subst" "0.00283574" "02329" "CBS_000001" "g.44488631T>G" "" "" "" "CBS(NM_000071.2):c.304A>C (p.(Lys102Gln), p.K102Q), CBS(NM_000071.3):c.304A>C (p.K102Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000895491" "0" "50" "21" "44492088" "44492088" "subst" "0" "01804" "CBS_000244" "g.44492088G>T" "" "" "" "CBS(NM_000071.2):c.209+7C>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895492" "0" "30" "21" "44492157" "44492157" "subst" "9.36444E-5" "01804" "CBS_000245" "g.44492157C>T" "" "" "" "CBS(NM_000071.2):c.147G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895493" "0" "90" "21" "44492290" "44492290" "dup" "0" "01804" "CBS_000218" "g.44492290dup" "" "" "" "CBS(NM_000071.2):c.19dup (p.(Gln7Profs*30))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000915457" "0" "30" "21" "44478377" "44478377" "subst" "0.000329732" "02329" "CBS_000246" "g.44478377G>A" "" "" "" "CBS(NM_000071.3):c.1359-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915459" "0" "30" "21" "44488288" "44488288" "subst" "0" "02329" "CBS_000247" "g.44488288G>A" "" "" "" "CBS(NM_000071.3):c.316+331C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915460" "0" "90" "21" "44492158" "44492158" "subst" "0.000150626" "02329" "CBS_000052" "g.44492158G>A" "" "" "" "CBS(NM_000071.3):c.146C>T (p.(Pro49Leu), p.P49L), CBS(NM_001178008.2):c.146C>T (p.P49L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000927082" "0" "10" "21" "44478127" "44478157" "del" "0" "02329" "CBS_000248" "g.44478127_44478157del" "" "" "" "CBS(NM_000071.3):c.1467+127_1467+157delGAGCGGTCACCTACAGGCAGCTCAAACAGGT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927083" "0" "30" "21" "44478372" "44478372" "subst" "8.94949E-5" "02329" "CBS_000239" "g.44478372C>T" "" "" "" "CBS(NM_000071.2):c.1359-9G>A (p.(=)), CBS(NM_000071.3):c.1359-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927084" "0" "50" "21" "44485520" "44485520" "subst" "1.63196E-5" "01804" "CBS_000249" "g.44485520G>A" "" "" "" "CBS(NM_000071.2):c.643C>T (p.(Pro215Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931222" "0" "30" "21" "44473972" "44473972" "subst" "0.000966881" "01804" "CBS_000010" "g.44473972C>T" "" "" "" "CBS(NM_000071.2):c.*18G>A (p.(=)), CBS(NM_000071.3):c.*18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000931223" "0" "30" "21" "44474003" "44474003" "subst" "0.00156365" "01804" "CBS_000012" "g.44474003C>T" "" "" "" "CBS(NM_000071.2):c.1643G>A (p.(Arg548Gln), p.R548Q), CBS(NM_000071.3):c.1643G>A (p.R548Q), CBS(NM_001321072.1):c.1328G>A (p.R443Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000931224" "0" "30" "21" "44483201" "44483201" "subst" "0.000487809" "02329" "CBS_000234" "g.44483201C>T" "" "" "" "CBS(NM_000071.2):c.829-13G>A (p.(=)), CBS(NM_000071.3):c.829-13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000931225" "0" "90" "21" "44486463" "44486463" "subst" "0.000211492" "01804" "CBS_000199" "g.44486463G>A" "" "" "" "CBS(NM_000071.2):c.341C>T (p.(Ala114Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000951506" "0" "30" "21" "44474003" "44474003" "subst" "0.00156365" "02329" "CBS_000012" "g.44474003C>T" "" "" "" "CBS(NM_000071.2):c.1643G>A (p.(Arg548Gln), p.R548Q), CBS(NM_000071.3):c.1643G>A (p.R548Q), CBS(NM_001321072.1):c.1328G>A (p.R443Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951507" "0" "30" "21" "44476953" "44476953" "subst" "3.94234E-5" "02329" "CBS_000250" "g.44476953C>T" "" "" "" "CBS(NM_000071.3):c.1512G>A (p.E504=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951508" "0" "90" "21" "44478972" "44478972" "subst" "0.000352649" "01804" "CBS_000082" "g.44478972C>T" "" "" "" "CBS(NM_000071.2):c.1330G>A (p.(Asp444Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000970309" "0" "30" "21" "44477783" "44477783" "subst" "0" "02329" "CBS_000251" "g.44477783C>T" "" "" "" "CBS(NM_000071.3):c.1467+472G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000970310" "0" "30" "21" "44483147" "44483147" "subst" "1.25901E-5" "02329" "CBS_000252" "g.44483147C>T" "" "" "" "CBS(NM_000071.3):c.870G>A (p.P290=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000970311" "0" "30" "21" "44484191" "44484191" "subst" "0" "02329" "CBS_000253" "g.44484191G>A" "" "" "" "CBS(NM_000071.3):c.737-90C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000970312" "0" "90" "21" "44485373" "44485373" "subst" "0" "02329" "CBS_000154" "g.44485373C>T" "" "" "" "CBS(NM_000071.3):c.676G>A (p.A226T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000970313" "0" "30" "21" "44485756" "44485756" "subst" "3.88285E-5" "02329" "CBS_000219" "g.44485756G>A" "" "" "" "CBS(NM_000071.3):c.501C>T (p.I167=), CBS(NM_001321072.1):c.186C>T (p.I62=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983990" "0" "30" "21" "44477136" "44477136" "subst" "0" "02329" "CBS_000255" "g.44477136G>A" "" "" "" "CBS(NM_000071.3):c.1468-139C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983991" "0" "90" "21" "44479022" "44479022" "subst" "0" "01804" "CBS_000256" "g.44479022G>A" "" "" "" "CBS(NM_000071.3):c.1280C>T (p.(Pro427Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000983992" "0" "70" "21" "44480632" "44480632" "subst" "0" "01804" "CBS_000257" "g.44480632G>A" "" "" "" "CBS(NM_000071.3):c.1064C>T (p.(Ala355Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000983993" "0" "30" "21" "44483093" "44483093" "subst" "0.00013407" "01804" "CBS_000258" "g.44483093G>A" "" "" "" "CBS(NM_000071.3):c.924C>T (p.(Tyr308=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983994" "0" "50" "21" "44485553" "44485553" "subst" "4.4978E-5" "01804" "CBS_000259" "g.44485553C>T" "" "" "" "CBS(NM_000071.2):c.610G>A (p.(Val204Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000983995" "0" "30" "21" "44487623" "44487623" "subst" "0" "02329" "CBS_000260" "g.44487623G>T" "" "" "" "CBS(NM_000071.3):c.316+996C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983996" "0" "30" "21" "44488472" "44488472" "subst" "0" "02329" "CBS_000261" "g.44488472A>C" "" "" "" "CBS(NM_000071.3):c.316+147T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000987719" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "04221" "CBS_000159" "g.44485591G>A" "" "" "" "" "Martin-Rivada 2022:35281663, Kalil 2020:33335839, Wen 2020:32769498" "Germline" "yes" "rs121964973" "0" "" "" "g.43065481G>A" "{CV:132}" "pathogenic (recessive)" "ACMG" "0000987722" "3" "90" "21" "44480570" "44480570" "subst" "4.09443E-6" "04221" "CBS_000102" "g.44480570C>T" "" "" "" "" "A direct molecular study performed on the patient\'s sister revealed that she did not present the pathogenic variant in OTC: NM_000531.6:c.803T>C, p.Met268Thr" "Germline" "yes" "rs72558449" "" "" "" "g.38408961T>C" "{CV:97333}" "pathogenic (recessive)" "ACMG" "0000987801" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "04221" "CBS_000159" "g.44485591G>A" "" "" "" "" "Martin-Rvada 2022:35281663, Kalil 2020:33335839, Wen 2020:32769498" "Germline" "yes" "rs121964973" "0" "" "" "g.43065481G>A" "{CV:132}" "pathogenic (recessive)" "ACMG" "0000987828" "3" "90" "21" "44485591" "44485591" "subst" "6.14774E-5" "04221" "CBS_000159" "g.44485591G>A" "" "" "" "" "This pathogenic variant that is responsible of DHomocystinuria, B6-responsive and nonresponsive types (OMIM: 236200) was identified in co-occurrence with the PIKFYVE heterozygous pathogenic variant NM_015040.4:c.853_854del, p.Leu285Phefs*19, causing Corneal fleck dystrophy (OMIM: 121850); Martín-Rivada 2022:35281663, Kalil 2020:33335839, Wen 2020:32769498" "Germline" "yes" "rs121964973" "0" "" "" "g.43065481G>A" "{CV:132}" "pathogenic (recessive)" "ACMG" "0000989117" "0" "90" "21" "44478942" "44478942" "subst" "0" "03779" "CBS_000262" "g.44478942A>T" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "pathogenic" "" "0001005753" "0" "50" "21" "44474013" "44474013" "subst" "0" "01804" "CBS_000263" "g.44474013C>T" "" "" "" "CBS(NM_000071.2):c.1633G>A (p.(Ala545Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005754" "0" "30" "21" "44480637" "44480637" "subst" "0.000586091" "01804" "CBS_000233" "g.44480637C>T" "" "" "" "CBS(NM_000071.2):c.1059G>A (p.(Thr353=)), CBS(NM_000071.3):c.1059G>A (p.T353=), CBS(NM_001321072.1):c.744G>A (p.T248=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005755" "0" "30" "21" "44480637" "44480637" "subst" "0.000586091" "02329" "CBS_000233" "g.44480637C>T" "" "" "" "CBS(NM_000071.2):c.1059G>A (p.(Thr353=)), CBS(NM_000071.3):c.1059G>A (p.T353=), CBS(NM_001321072.1):c.744G>A (p.T248=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005756" "0" "50" "21" "44483166" "44483166" "subst" "0" "01804" "CBS_000264" "g.44483166C>T" "" "" "" "CBS(NM_000071.2):c.851G>A (p.(Gly284Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005757" "0" "50" "21" "44486400" "44486400" "subst" "4.07196E-5" "01804" "CBS_000265" "g.44486400G>A" "" "" "" "CBS(NM_000071.2):c.404C>T (p.(Thr135Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005758" "0" "30" "21" "44488325" "44488325" "subst" "0" "02329" "CBS_000266" "g.44488325C>T" "" "" "" "CBS(NM_000071.3):c.316+294G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001007258" "1" "70" "21" "44484068" "44484068" "subst" "4.10452E-5" "00006" "CBS_000034" "g.44484068G>A" "" "{PMID:Navarrete 2019:30626930}" "" "" "" "Germline" "" "" "0" "" "" "g.43063958G>A" "" "likely pathogenic" "" "0001007381" "2" "70" "21" "44484035" "44484035" "subst" "0" "00006" "CBS_000033" "g.44484035A>G" "" "{PMID:Navarrete 2019:30626930}" "" "" "" "Germline" "" "" "0" "" "" "g.43063925A>G" "" "likely pathogenic" "" "0001015890" "0" "50" "21" "44476981" "44476981" "subst" "7.17725E-5" "01804" "CBS_000267" "g.44476981G>A" "" "" "" "CBS(NM_000071.2):c.1484C>T (p.(Thr495Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015891" "0" "30" "21" "44478929" "44478929" "subst" "0.000119839" "01804" "CBS_000268" "g.44478929G>T" "" "" "" "CBS(NM_000071.2):c.1358+15C>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015892" "0" "10" "21" "44482402" "44482402" "subst" "0.000853514" "02329" "CBS_000269" "g.44482402G>A" "" "" "" "CBS(NM_000071.3):c.1039+19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001015893" "0" "30" "21" "44483055" "44483055" "subst" "0.000488158" "01804" "CBS_000270" "g.44483055C>T" "" "" "" "CBS(NM_000071.2):c.954+8G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015894" "0" "30" "21" "44483202" "44483202" "subst" "0.000266772" "02329" "CBS_000023" "g.44483202G>A" "" "" "" "CBS(NM_000071.2):c.829-14C>T, CBS(NM_000071.3):c.829-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015895" "0" "50" "21" "44485340" "44485340" "subst" "8.12216E-6" "01804" "CBS_000271" "g.44485340C>T" "" "" "" "CBS(NM_000071.2):c.709G>A (p.(Ala237Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015896" "0" "30" "21" "44492276" "44492276" "subst" "0" "01804" "CBS_000272" "g.44492276C>A" "" "" "" "CBS(NM_000071.2):c.28G>T (p.(Val10Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001027343" "0" "30" "21" "44476941" "44476941" "subst" "0" "02329" "CBS_000038" "g.44476941G>A" "" "" "" "CBS(NM_000071.3):c.1524C>T (p.F508=), CBS(NM_001321072.1):c.1209C>T (p.F403=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043595" "0" "30" "21" "44473968" "44473968" "subst" "3.83583E-5" "01804" "CBS_000273" "g.44473968G>A" "" "" "" "CBS(NM_001178009.3):c.*18+4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043596" "0" "90" "21" "44482453" "44482453" "subst" "0" "01804" "CBS_000114" "g.44482453C>T" "" "" "" "CBS(NM_000071.3):c.1007G>A (p.(Arg336His), p.R336H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001043597" "0" "30" "21" "44484000" "44484000" "subst" "0" "01804" "CBS_000274" "g.44484000C>T" "" "" "" "CBS(NM_000071.3):c.828+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043598" "0" "50" "21" "44485308" "44485308" "subst" "4.87337E-5" "01804" "CBS_000275" "g.44485308C>T" "" "" "" "CBS(NM_000071.3):c.736+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043599" "0" "50" "21" "44485618" "44485618" "subst" "2.05201E-5" "01804" "CBS_000276" "g.44485618C>T" "" "" "" "CBS(NM_000071.3):c.545G>A (p.(Arg182Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043600" "0" "30" "21" "44486840" "44486840" "subst" "0" "01804" "CBS_000277" "g.44486840C>T" "" "" "" "CBS(NM_000071.3):c.317-353G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043601" "0" "50" "21" "44488032" "44488032" "subst" "0" "01804" "CBS_000278" "g.44488032G>A" "" "" "" "CBS(NM_001321072.1):c.-144C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043602" "0" "50" "21" "44492141" "44492141" "subst" "0" "01804" "CBS_000279" "g.44492141G>T" "" "" "" "CBS(NM_000071.3):c.163C>A (p.(Gln55Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046796" "0" "70" "21" "44488727" "44488727" "subst" "0" "02327" "CBS_000280" "g.44488727T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001057017" "0" "30" "21" "44485720" "44485720" "subst" "0" "01804" "CBS_000281" "g.44485720A>G" "" "" "" "CBS(NM_000071.3):c.531+6T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001057018" "0" "50" "21" "44486404" "44486404" "subst" "8.95496E-5" "01804" "CBS_000049" "g.44486404C>T" "" "" "" "CBS(NM_000071.3):c.400G>A (p.(Gly134Arg)), CBS(NM_001321072.1):c.85G>A (p.G29R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057019" "0" "90" "21" "44492158" "44492158" "subst" "0.000150626" "01804" "CBS_000052" "g.44492158G>A" "" "" "" "CBS(NM_000071.3):c.146C>T (p.(Pro49Leu), p.P49L), CBS(NM_001178008.2):c.146C>T (p.P49L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes CBS ## Count = 1114 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "{{VariantOnTranscript/Haplotype}}" "0000000900" "00000046" "50" "304" "0" "304" "0" "c.304A>C" "r.(?)" "p.(Lys102Gln)" "4" "" "0000074526" "00000046" "30" "1359" "-134" "1359" "-134" "c.1359-134G>A" "r.(?)" "p.(?)" "14i" "" "0000074527" "00000046" "30" "1359" "-219" "1359" "-219" "c.1359-219C>T" "r.(=)" "p.(=)" "14i" "" "0000074529" "00000046" "30" "1359" "-134" "1359" "-134" "c.1359-134G>A" "r.(=)" "p.(=)" "14i" "" "0000074530" "00000046" "30" "1359" "-219" "1359" "-219" "c.1359-219C>T" "r.(=)" "p.(=)" "14i" "" "0000076676" "00000046" "30" "1359" "-219" "1359" "-219" "c.1359-219C>T" "r.(=)" "p.(=)" "14i" "" "0000076678" "00000046" "70" "1359" "-134" "1359" "-134" "c.1359-134G>A" "r.(?)" "p.(?)" "14i" "" "0000076681" "00000046" "30" "1359" "-219" "1359" "-219" "c.1359-219C>T" "r.(=)" "p.(=)" "14i" "" "0000076682" "00000046" "30" "1359" "-134" "1359" "-134" "c.1359-134G>A" "r.(=)" "p.(=)" "14i" "" "0000076684" "00000046" "30" "1359" "-134" "1359" "-134" "c.1359-134G>A" "r.(=)" "p.(=)" "14i" "" "0000076685" "00000046" "30" "1359" "-134" "1359" "-134" "c.1359-134G>A" "r.(=)" "p.(=)" "14i" "" "0000076686" "00000046" "30" "1359" "-219" "1359" "-219" "c.1359-219C>T" "r.(=)" "p.(=)" "14i" "" "0000076687" "00000046" "70" "1359" "-219" "1359" "-219" "c.1359-219C>T" "r.(=)" "p.(=)" "14i" "" "0000076689" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[17]" "r.(=)" "p.(=)" "15i" "CBS*17;*18" "0000076690" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[17]" "r.(=)" "p.(=)" "15i" "CBS*17;*19" "0000076691" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[18]" "r.(=)" "p.(=)" "15i" "CBS*18;*18" "0000076692" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[18]" "r.(=)" "p.(=)" "15i" "CBS*18;*19" "0000076693" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[18]" "r.(=)" "p.(=)" "15i" "CBS*18;*21" "0000076694" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[19]" "r.(=)" "p.(=)" "15i" "CBS*19;*19" "0000076695" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[19]" "r.(=)" "p.(=)" "15i" "CBS*19;*21" "0000076696" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[17]" "r.(=)" "p.(=)" "15i" "CBS*17;*18" "0000076697" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[17]" "r.(=)" "p.(=)" "15i" "CBS*17;*19" "0000076698" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[17]" "r.(=)" "p.(=)" "15i" "CBS*17;*21" "0000076699" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[18]" "r.(=)" "p.(=)" "15i" "CBS*18;*18" "0000076700" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[18]" "r.(=)" "p.(=)" "15i" "CBS*18;*19" "0000076701" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[18]" "r.(=)" "p.(=)" "15i" "CBS*18;*21" "0000076702" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[19]" "r.(=)" "p.(=)" "15i" "CBS*19;*19" "0000076703" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[19]" "r.(=)" "p.(=)" "15i" "CBS*19;*21" "0000076704" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[21]" "r.(=)" "p.(=)" "15i" "CBS*21;*21" "0000076714" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[18]" "r.(=)" "p.(=)" "15i" "CBS*17;*18" "0000076715" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[19]" "r.(=)" "p.(=)" "15i" "CBS*17;*19" "0000076716" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[19]" "r.(=)" "p.(=)" "15i" "CBS*18;*19" "0000076717" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[21]" "r.(=)" "p.(=)" "15i" "CBS*18;*21" "0000076718" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[21]" "r.(=)" "p.(=)" "15i" "CBS*19;*21" "0000076719" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[18]" "r.(=)" "p.(=)" "15i" "CBS*17;*18" "0000076720" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[19]" "r.(=)" "p.(=)" "15i" "CBS*17;*19" "0000076721" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[21]" "r.(=)" "p.(=)" "15i" "CBS*17;*21" "0000076722" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[19]" "r.(=)" "p.(=)" "15i" "CBS*18;*19" "0000076723" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[21]" "r.(=)" "p.(=)" "15i" "CBS*18;*21" "0000076724" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[21]" "r.(=)" "p.(=)" "15i" "CBS*19;*21" "0000076736" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[17]" "r.(=)" "p.(=)" "15i" "CBS*17;*17" "0000076738" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[17]" "r.(=)" "p.(=)" "15i" "CBS*17;*18" "0000076739" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[17]" "r.(=)" "p.(=)" "15i" "CBS*17;*19" "0000076740" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[17]" "r.(=)" "p.(=)" "15i" "CBS*17;*21" "0000076741" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[18]" "r.(=)" "p.(=)" "15i" "CBS*18;*18" "0000076742" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[18]" "r.(=)" "p.(=)" "15i" "CBS*18;*19" "0000076743" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[18]" "r.(=)" "p.(=)" "15i" "CBS*18;*21" "0000076744" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[19]" "r.(=)" "p.(=)" "15i" "CBS*19;*19" "0000076745" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[19]" "r.(=)" "p.(=)" "15i" "CBS*19;*21" "0000076746" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[18]" "r.(=)" "p.(=)" "15i" "CBS*17;*18" "0000076747" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[19]" "r.(=)" "p.(=)" "15i" "CBS*17;*19" "0000076748" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[21]" "r.(=)" "p.(=)" "15i" "CBS*17;*21" "0000076749" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[19]" "r.(=)" "p.(=)" "15i" "CBS*18;*19" "0000076750" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[21]" "r.(=)" "p.(=)" "15i" "CBS*18;*21" "0000076751" "00000046" "30" "1467" "9" "1467" "39" "c.(1467+9_1467+39)[21]" "r.(=)" "p.(=)" "15i" "CBS*19;*21" "0000130242" "00000046" "90" "1039" "0" "1039" "0" "c.1039G>A" "r.(?)" "p.(Gly347Ser)" "" "" "0000264341" "00000046" "10" "1666" "0" "1666" "0" "c.*10C>A" "r.(=)" "p.(=)" "" "" "0000264342" "00000046" "30" "1674" "0" "1674" "0" "c.*18G>A" "r.(=)" "p.(=)" "" "" "0000264343" "00000046" "10" "1080" "0" "1080" "0" "c.1080C>T" "r.(?)" "p.(Ala360=)" "" "" "0000264344" "00000046" "30" "1643" "0" "1643" "0" "c.1643G>A" "r.(?)" "p.(Arg548Gln)" "" "" "0000264345" "00000046" "10" "316" "728" "316" "728" "c.316+728C>T" "r.(=)" "p.(=)" "" "" "0000264346" "00000046" "10" "573" "0" "573" "0" "c.573G>A" "r.(?)" "p.(Thr191=)" "" "" "0000266508" "00000046" "10" "1080" "0" "1080" "0" "c.1080C>T" "r.(?)" "p.(Ala360=)" "" "" "0000266509" "00000046" "10" "1552" "1036" "1552" "1036" "c.1552+1036G>A" "r.(=)" "p.(=)" "" "" "0000268051" "00000046" "10" "1080" "0" "1080" "0" "c.1080C>T" "r.(?)" "p.(Ala360=)" "" "" "0000269819" "00000046" "10" "1080" "0" "1080" "0" "c.1080C>T" "r.(?)" "p.(Ala360=)" "" "" "0000269820" "00000046" "10" "1145" "7" "1145" "7" "c.1145+7C>T" "r.(=)" "p.(=)" "" "" "0000269821" "00000046" "30" "1209" "0" "1209" "0" "c.1209G>A" "r.(?)" "p.(Thr403=)" "" "" "0000269822" "00000046" "30" "1643" "0" "1643" "0" "c.1643G>A" "r.(?)" "p.(Arg548Gln)" "" "" "0000269823" "00000046" "30" "304" "0" "304" "0" "c.304A>C" "r.(?)" "p.(Lys102Gln)" "" "" "0000269824" "00000046" "90" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.(Cys165Tyr)" "" "" "0000269825" "00000046" "10" "52" "0" "52" "0" "c.52C>T" "r.(?)" "p.(Arg18Cys)" "" "" "0000269826" "00000046" "30" "829" "-14" "829" "-14" "c.829-14C>T" "r.(=)" "p.(=)" "" "" "0000272681" "00000046" "50" "1540" "0" "1540" "0" "c.1540G>A" "r.(?)" "p.(Glu514Lys)" "" "" "0000272682" "00000046" "30" "1398" "0" "1398" "0" "c.1398G>A" "r.(?)" "p.(Ser466=)" "" "" "0000272683" "00000046" "50" "1642" "0" "1642" "0" "c.1642C>T" "r.(?)" "p.(Arg548Trp)" "" "" "0000328670" "00000046" "30" "1145" "7" "1145" "7" "c.1145+7C>T" "r.(=)" "p.(=)" "" "" "0000328672" "00000046" "30" "832" "0" "833" "0" "c.832_833insCTGGGGTGGATCATCCAGGTGGGGCTTTTGCTGGGCTTGAGCCCTGAAGCCGCGCCCTCTGCAGATCA" "r.(?)" "p.(Ile278ThrfsTer16)" "" "" "0000328674" "00000046" "10" "636" "0" "636" "0" "c.636C>T" "r.(?)" "p.(Asn212=)" "" "" "0000328675" "00000046" "50" "599" "0" "599" "0" "c.599C>T" "r.(?)" "p.(Pro200Leu)" "" "" "0000328676" "00000046" "30" "573" "0" "573" "0" "c.573G>A" "r.(?)" "p.(Thr191=)" "" "" "0000328677" "00000046" "90" "209" "1" "209" "1" "c.209+1G>A" "r.spl?" "p.?" "" "" "0000340097" "00000046" "30" "699" "0" "699" "0" "c.699C>T" "r.(?)" "p.(Tyr233=)" "" "" "0000405748" "00000046" "90" "770" "0" "770" "0" "c.770C>T" "r.(?)" "p.(Thr257Met)" "" "" "0000405749" "00000046" "70" "803" "0" "803" "0" "c.803T>C" "r.(?)" "p.(Leu268Pro)" "" "" "0000442703" "00000046" "70" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.Thr353Met" "" "" "0000461250" "00000046" "50" "950" "0" "950" "0" "c.950G>C" "r.(?)" "p.(Arg317Thr)" "" "" "0000461251" "00000046" "90" "903" "0" "903" "0" "c.903C>A" "r.(?)" "p.(Tyr301*)" "" "" "0000570701" "00000046" "10" "1666" "0" "1666" "0" "c.*10C>A" "r.(=)" "p.(=)" "" "" "0000570702" "00000046" "50" "1643" "0" "1643" "0" "c.1643G>A" "r.(?)" "p.(Arg548Gln)" "" "" "0000570703" "00000046" "30" "1524" "0" "1524" "0" "c.1524C>T" "r.(?)" "p.(Phe508=)" "" "" "0000570704" "00000046" "30" "1479" "0" "1479" "0" "c.1479G>A" "r.(?)" "p.(Thr493=)" "" "" "0000570706" "00000046" "10" "1338" "0" "1338" "0" "c.1338G>A" "r.(?)" "p.(Ala446=)" "" "" "0000570707" "00000046" "10" "1224" "-6" "1224" "-6" "c.1224-6C>T" "r.(=)" "p.(=)" "" "" "0000570708" "00000046" "30" "1145" "7" "1145" "7" "c.1145+7C>T" "r.(=)" "p.(=)" "" "" "0000570709" "00000046" "30" "1145" "7" "1145" "7" "c.1145+7C>T" "r.(=)" "p.(=)" "" "" "0000570713" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "" "" "0000570714" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "" "" "0000570716" "00000046" "30" "829" "-12" "829" "-12" "c.829-12C>T" "r.(=)" "p.(=)" "" "" "0000570717" "00000046" "30" "832" "0" "833" "0" "c.832_833insCTGGGGTGGATCATCCAGGTGGGGCTTTTGCTGGGCTTGAGCCCTGAAGCCGCGCCCTCTGCAGATCA" "r.(?)" "p.(Ile278ThrfsTer16)" "" "" "0000570718" "00000046" "30" "832" "0" "833" "0" "c.832_833insCTGGGGTGGATCATCCAGGTGGGGCTTTTGCTGGGCTTGAGCCCTGAAGCCGCGCCCTCTGCAGATCA" "r.(?)" "p.(Ile278ThrfsTer16)" "" "" "0000570719" "00000046" "30" "832" "0" "833" "0" "c.832_833insCTGGGGTGGATCATCCAGGTGGGGCTTTTGCTGGGCTTGAGCCCTGAAGCCGCGCCCTCTGCAGATCA" "r.(?)" "p.(Ile278ThrfsTer16)" "" "" "0000570720" "00000046" "90" "770" "0" "770" "0" "c.770C>T" "r.(?)" "p.(Thr257Met)" "" "" "0000570721" "00000046" "10" "737" "-10" "737" "-10" "c.737-10C>T" "r.(=)" "p.(=)" "" "" "0000570722" "00000046" "30" "699" "0" "699" "0" "c.699C>T" "r.(?)" "p.(Tyr233=)" "" "" "0000570723" "00000046" "10" "699" "0" "699" "0" "c.699C>T" "r.(?)" "p.(Tyr233=)" "" "" "0000570724" "00000046" "10" "699" "0" "699" "0" "c.699C>T" "r.(?)" "p.(Tyr233=)" "" "" "0000570725" "00000046" "30" "667" "-6" "667" "-6" "c.667-6A>G" "r.(=)" "p.(=)" "" "" "0000570726" "00000046" "10" "636" "0" "636" "0" "c.636C>T" "r.(?)" "p.(Asn212=)" "" "" "0000570727" "00000046" "10" "531" "11" "531" "11" "c.531+11G>A" "r.(=)" "p.(=)" "" "" "0000570728" "00000046" "30" "531" "11" "531" "11" "c.531+11G>A" "r.(=)" "p.(=)" "" "" "0000570729" "00000046" "50" "400" "0" "400" "0" "c.400G>A" "r.(?)" "p.(Gly134Arg)" "" "" "0000570730" "00000046" "50" "381" "0" "381" "0" "c.381T>G" "r.(?)" "p.(Ile127Met)" "" "" "0000570731" "00000046" "90" "325" "0" "325" "0" "c.325T>C" "r.(?)" "p.(Cys109Arg)" "" "" "0000570732" "00000046" "10" "304" "0" "304" "0" "c.304A>C" "r.(?)" "p.(Lys102Gln)" "" "" "0000570733" "00000046" "50" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Pro49Leu)" "" "" "0000570734" "00000046" "50" "133" "0" "133" "0" "c.133C>T" "r.(?)" "p.(Arg45Trp)" "" "" "0000570735" "00000046" "10" "52" "0" "52" "0" "c.52C>T" "r.(?)" "p.(Arg18Cys)" "" "" "0000592765" "00000046" "10" "-3469" "0" "-3466" "0" "c.(-3469_-3466del)" "r.(=)" "p.(=)" "_1" "CTTT[5]" "0000592766" "00000046" "90" "233" "0" "233" "0" "c.233C>G" "r.(?)" "p.Pro78Arg" "4" "" "0000592767" "00000046" "90" "306" "0" "306" "0" "c.306G>C" "r.(?)" "p.Lys12Asn" "4" "" "0000592768" "00000046" "90" "233" "0" "233" "0" "c.[233C>G;306G>C]" "-" "p.[Pro78Arg;Lys12Asn]" "4" "" "0000592769" "00000046" "90" "172" "0" "172" "0" "c.172C>T" "r.(?)" "p.Arg58Trp" "3" "" "0000592770" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.Ala114Val" "5" "" "0000592771" "00000046" "90" "172" "0" "172" "0" "c.[172C>T;341C>T]" "-" "p.[Arg58Trp;Ala114Val]" "5" "" "0000592772" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.Arg125Gln" "5" "" "0000592773" "00000046" "90" "393" "0" "393" "0" "c.393G>C" "r.(?)" "p.Glu131Asp" "5" "" "0000592774" "00000046" "90" "374" "0" "374" "0" "c.[374G>A;393G>C]" "-" "p.[Arg125Gln;Glu131Asp]" "5" "" "0000592775" "00000046" "90" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.Glu144Lys" "5" "" "0000592776" "00000046" "90" "1316" "0" "1316" "0" "c.1316G>A" "r.(?)" "p.Arg439Gln" "14" "" "0000592777" "00000046" "90" "430" "0" "430" "0" "c.[430G>A;1316G>A]" "-" "p.[Glu144Lys;Arg439Gln]" "5" "" "0000592778" "00000046" "90" "434" "0" "434" "0" "c.434C>T" "r.(?)" "p.Pro145Leu" "5" "" "0000592779" "00000046" "90" "456" "0" "456" "0" "c.456C>G" "r.(?)" "p.Ile152Met" "6" "" "0000592780" "00000046" "90" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.Cys165Tyr" "6" "" "0000592781" "00000046" "90" "539" "0" "539" "0" "c.539T>C" "r.(?)" "p.Val18Ala" "7" "" "0000592782" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.Thr191Met" "7" "" "0000592783" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.Ile278Thr" "10" "" "0000592784" "00000046" "90" "904" "0" "904" "0" "c.904G>A" "r.(?)" "p.Glu32Lys" "10" "" "0000592785" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.Gly37Ser" "10" "" "0000592786" "00000046" "90" "992" "0" "992" "0" "c.992C>A" "r.(?)" "p.Ala331Glu" "11" "" "0000592787" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.Arg336Cys" "11" "" "0000592788" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.Thr353Met" "12" "" "0000592789" "00000046" "90" "1105" "0" "1105" "0" "c.[1105C>T;1471C>T]" "-" "p.[Arg369Cys;Arg491Cys]" "12" "" "0000592790" "00000046" "90" "1111" "0" "1111" "0" "c.1111G>A" "r.(?)" "p.Val371Met" "12" "" "0000592791" "00000046" "50" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.Asp444Asn" "14" "" "0000592792" "00000046" "90" "1226" "0" "1358" "2" "c.1226_1358+2del" "r.spl?" "p.Trp49_Gly453del" "14" "" "0000592794" "00000046" "90" "194" "0" "194" "0" "c.194A>G" "r.(?)" "p.(His65Arg)" "3" "" "0000592795" "00000046" "90" "233" "0" "233" "0" "c.233C>G" "r.233c>g" "p.Pro78Arg" "4" "" "0000592796" "00000046" "90" "306" "0" "306" "0" "c.306G>C" "r.306g>c" "p.Lys102Asn" "4" "" "0000592797" "00000046" "90" "302" "0" "302" "0" "c.302T>C" "r.(?)" "p.(Leu101Pro)" "4" "" "0000592798" "00000046" "90" "302" "0" "302" "0" "c.302T>C" "r.(?)" "p.(Leu101Pro)" "4" "" "0000592799" "00000046" "90" "172" "0" "172" "0" "c.172C>T" "r.(?)" "p.(Arg58Trp)" "3" "" "0000592800" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "5" "" "0000592801" "00000046" "90" "376" "0" "376" "0" "c.376A>G" "r.(?)" "p.(Met126Val)" "5" "" "0000592802" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "5" "" "0000592803" "00000046" "90" "434" "0" "434" "0" "c.434C>T" "r.(?)" "p.(Pro145Leu)" "5" "" "0000592804" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "5" "" "0000592805" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "5" "" "0000592806" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "5" "" "0000592807" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "5" "" "0000592808" "00000046" "90" "346" "0" "346" "0" "c.346G>A" "r.(?)" "p.(Gly116Arg)" "5" "" "0000592809" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592810" "00000046" "90" "346" "0" "346" "0" "c.346G>A" "r.(?)" "p.(Gly116Arg)" "5" "" "0000592811" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592812" "00000046" "90" "346" "0" "346" "0" "c.346G>A" "r.(?)" "p.(Gly116Arg)" "5" "" "0000592813" "00000046" "90" "361" "0" "361" "0" "c.361C>T" "r.(?)" "p.(Arg121Cys)" "5" "" "0000592814" "00000046" "90" "361" "0" "361" "0" "c.361C>T" "r.(?)" "p.(Arg121Cys)" "5" "" "0000592815" "00000046" "90" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Thr262Met)" "9" "" "0000592816" "00000046" "90" "362" "0" "362" "0" "c.362G>T" "r.(?)" "p.(Arg121Leu)" "5" "" "0000592817" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "5" "" "0000592818" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "5" "" "0000592819" "00000046" "90" "384" "0" "384" "0" "c.384G>C" "r.(?)" "p.(Glu128Asp)" "5" "" "0000592820" "00000046" "90" "415" "0" "415" "0" "c.415G>A" "r.(?)" "p.(Gly139Arg)" "5" "" "0000592821" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592822" "00000046" "90" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Glu144Lys)" "5" "" "0000592823" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592824" "00000046" "90" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Glu144Lys)" "5" "" "0000592825" "00000046" "90" "209" "1" "209" "1" "c.209+1G>A" "r.[-8_209del,153_209del]" "p.?" "3i" "" "0000592826" "00000046" "90" "1316" "0" "1316" "0" "c.1316G>A" "r.(?)" "p.(Arg439Gln)" "14" "" "0000592827" "00000046" "90" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Glu144Lys)" "5" "" "0000592828" "00000046" "90" "442" "0" "442" "0" "c.442G>A" "r.(?)" "p.(Gly148Arg)" "5" "" "0000592829" "00000046" "90" "796" "0" "796" "0" "c.796A>G" "r.(?)" "p.(Arg266Gly)" "9" "" "0000592830" "00000046" "90" "593" "0" "593" "0" "c.593A>T" "r.(?)" "p.(Asp198Val)" "7" "" "0000592831" "00000046" "90" "451" "0" "451" "0" "c.451G>A" "r.spl?" "p.(Gly151Arg)" "5" "" "0000592832" "00000046" "90" "456" "0" "456" "0" "c.456C>G" "r.(?)" "p.(Ile152Met)" "6" "" "0000592833" "00000046" "90" "456" "0" "456" "0" "c.456C>G" "r.(?)" "p.(Ile152Met)" "6" "" "0000592834" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592835" "00000046" "90" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.(Cys165Tyr)" "6" "" "0000592836" "00000046" "90" "1111" "0" "1111" "0" "c.1111G>A" "r.(?)" "p.(Val371Met)" "12" "" "0000592837" "00000046" "90" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.(Cys165Tyr)" "6" "" "0000592838" "00000046" "90" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.(Cys165Tyr)" "6" "" "0000592839" "00000046" "90" "1619" "0" "1622" "0" "c.1619_1622dup" "r.1619_1622dup" "p.(Phe542GlufsTer37)" "17" "" "0000592840" "00000046" "90" "502" "0" "502" "0" "c.502G>A" "r.(?)" "p.(Val168Met)" "6" "" "0000592841" "00000046" "90" "526" "0" "526" "0" "c.526G>A" "r.(?)" "p.(Glu176Lys)" "6" "" "0000592842" "00000046" "90" "539" "0" "539" "0" "c.539T>C" "r.(?)" "p.(Val180Ala)" "7" "" "0000592843" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000592844" "00000046" "90" "1170" "0" "1170" "0" "c.1170G>A" "r.(?)" "p.(Trp390*)" "13" "" "0000592845" "00000046" "90" "313" "0" "316" "0" "c.313_316del" "r.(?)" "p.(Leu105Trpfs*13)" "4" "" "0000592846" "00000046" "90" "671" "0" "671" "0" "c.671G>A" "r.(?)" "p.(Arg224His)" "8" "" "0000592847" "00000046" "90" "700" "0" "700" "0" "c.700G>A" "r.(?)" "p.(Asp234Asn)" "8" "" "0000592848" "00000046" "90" "715" "0" "715" "0" "c.715G>A" "r.715g>a" "p.Glu239Lys" "8" "" "0000592849" "00000046" "90" "770" "0" "770" "0" "c.770C>T" "r.(?)" "p.(Thr257Met)" "9" "" "0000592850" "00000046" "90" "775" "0" "775" "0" "c.775G>A" "r.(?)" "p.(Gly259Ser)" "9" "" "0000592851" "00000046" "90" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Thr262Met)" "9" "" "0000592852" "00000046" "90" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Thr262Met)" "9" "" "0000592853" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592854" "00000046" "90" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Thr262Met)" "9" "" "0000592855" "00000046" "90" "797" "0" "797" "0" "c.797G>A" "r.(?)" "p.(Arg266Lys)" "9" "" "0000592856" "00000046" "90" "797" "0" "797" "0" "c.797G>A" "r.(?)" "p.(Arg266Lys)" "9" "" "0000592857" "00000046" "90" "797" "0" "797" "0" "c.797G>A" "r.(?)" "p.(Arg266Lys)" "9" "" "0000592858" "00000046" "90" "797" "0" "797" "0" "c.797G>A" "r.(?)" "p.(Arg266Lys)" "9" "" "0000592859" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592860" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592861" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592862" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592863" "00000046" "90" "536" "0" "553" "0" "c.536_553del" "r.(?)" "p.(Asp179_Leu184del)" "7" "" "0000592864" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592865" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592866" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592867" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592868" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592869" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592870" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592871" "00000046" "90" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.(Cys165Tyr)" "6" "" "0000592872" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592873" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592874" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592875" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592876" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592877" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592878" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592879" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592880" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592881" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592882" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592883" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592884" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592885" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592886" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592887" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592888" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592889" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592890" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592891" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592892" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592893" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592894" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592895" "00000046" "90" "1109" "0" "1109" "0" "c.1109G>A" "r.(?)" "p.(Cys370Tyr)" "12" "" "0000592896" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592897" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592898" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592899" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592900" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592901" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592902" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592903" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592904" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592905" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592906" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592907" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592908" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592909" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592910" "00000046" "90" "869" "0" "869" "0" "c.869C>T" "r.(?)" "p.(Pro290Leu)" "10" "" "0000592911" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592912" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592913" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592914" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592915" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592916" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592917" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592918" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592919" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592920" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592921" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592922" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592923" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592924" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592925" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592926" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592927" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592928" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592929" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592930" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592931" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592932" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592933" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592934" "00000046" "90" "684" "0" "684" "0" "c.684C>G" "r.(?)" "p.(Asn228Lys)" "8" "" "0000592935" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592936" "00000046" "90" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Thr262Met)" "9" "" "0000592937" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592938" "00000046" "90" "1063" "0" "1063" "0" "c.1063G>C" "r.(?)" "p.(Ala355Pro)" "12" "" "0000592939" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592940" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592941" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592942" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592943" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592944" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592945" "00000046" "90" "302" "0" "302" "0" "c.302T>C" "r.(?)" "p.(Leu101Pro)" "4" "" "0000592946" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592947" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592948" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592949" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592950" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592951" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592952" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592953" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592954" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592955" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592956" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592957" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592958" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592959" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.919g>a" "p.Gly307Ser" "10" "" "0000592960" "00000046" "90" "1358" "1" "1358" "1" "c.1358+1G>A" "r.[1224_1358del,1146_1358del]" "p.?" "14i" "" "0000592961" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592962" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592963" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592964" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592965" "00000046" "90" "959" "0" "959" "0" "c.959T>C" "r.(?)" "p.(Val320Ala)" "11" "" "0000592966" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592967" "00000046" "90" "959" "0" "959" "0" "c.959T>C" "r.(?)" "p.(Val320Ala)" "11" "" "0000592968" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000592969" "00000046" "90" "992" "0" "992" "0" "c.992C>A" "r.(?)" "p.(Ala331Glu)" "11" "" "0000592970" "00000046" "90" "992" "0" "992" "0" "c.992C>T" "r.(?)" "p.(Ala331Val)" "11" "" "0000592971" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "11" "" "0000592972" "00000046" "90" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336His)" "11" "" "0000592973" "00000046" "90" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336His)" "11" "" "0000592974" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "12" "" "0000592975" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592976" "00000046" "90" "1060" "0" "1060" "0" "c.1060G>A" "r.(?)" "p.(Val354Met)" "12" "" "0000592977" "00000046" "90" "1081" "0" "1081" "0" "c.1081G>A" "r.(?)" "p.(Ala361Thr)" "12" "" "0000592978" "00000046" "90" "1105" "0" "1105" "0" "c.1105C>T" "r.(?)" "p.(Arg369Cys)" "12" "" "0000592979" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592980" "00000046" "90" "1105" "0" "1105" "0" "c.1105C>T" "r.(?)" "p.(Arg369Cys)" "12" "" "0000592981" "00000046" "90" "1471" "0" "1471" "0" "c.1471C>T" "r.(?)" "p.(Arg491Cys)" "16" "" "0000592982" "00000046" "90" "1106" "0" "1106" "0" "c.1106G>A" "r.(?)" "p.(Arg369His)" "12" "" "0000592983" "00000046" "90" "1111" "0" "1111" "0" "c.1111G>A" "r.(?)" "p.(Val371Met)" "12" "" "0000592984" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592985" "00000046" "90" "1150" "0" "1150" "0" "c.1150A>G" "r.(?)" "p.(Lys384Glu)" "13" "" "0000592986" "00000046" "90" "1152" "0" "1152" "0" "c.1152G>C" "r.(?)" "p.(Lys384Asn)" "13" "" "0000592987" "00000046" "90" "1152" "0" "1152" "0" "c.1152G>C" "r.(?)" "p.(Lys384Asn)" "13" "" "0000592988" "00000046" "90" "1173" "0" "1173" "0" "c.1173G>T" "r.(?)" "p.(Met391Ile)" "13" "" "0000592989" "00000046" "90" "1301" "0" "1301" "0" "c.1301C>A" "r.(?)" "p.(Thr434Asn)" "14" "" "0000592990" "00000046" "90" "373" "0" "373" "0" "c.373C>T" "r.(?)" "p.(Arg125Trp)" "5" "" "0000592991" "00000046" "90" "1304" "0" "1304" "0" "c.1304T>C" "r.(?)" "p.(Ile435Thr)" "14" "" "0000592992" "00000046" "90" "954" "1" "954" "1" "c.954+1G>A" "r.829_954del" "p.?" "10i" "" "0000592993" "00000046" "90" "1316" "0" "1316" "0" "c.1316G>A" "r.(?)" "p.(Arg439Gln)" "14" "" "0000592994" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000592995" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.1330G>A" "p.Asp444Asn" "14" "" "0000592996" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000592997" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000592998" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000592999" "00000046" "90" "253" "0" "253" "0" "c.253G>A" "r.(?)" "p.(Gly85Arg)" "4" "" "0000593000" "00000046" "90" "1397" "0" "1397" "0" "c.1397C>T" "r.(?)" "p.(Ser466Leu)" "15" "" "0000593001" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593002" "00000046" "90" "1601" "0" "1601" "0" "c.1601T>A" "r.(?)" "p.(Val534Asp)" "17" "" "0000593003" "00000046" "90" "1616" "0" "1616" "0" "c.1616T>C" "r.(?)" "p.(Leu539Ser)" "17" "" "0000593004" "00000046" "90" "1226" "0" "1226" "0" "c.1226G>A" "r.(?)" "p.(Trp409*)" "14" "" "0000593005" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "5" "" "0000593006" "00000046" "90" "1259" "0" "1259" "0" "c.1259C>G" "r.(?)" "p.(Ser420*)" "14" "" "0000593007" "00000046" "90" "1321" "0" "1321" "0" "c.1321A>T" "r.(?)" "p.(Lys441*)" "14" "" "0000593008" "00000046" "90" "19" "0" "19" "0" "c.19dup" "r.(?)" "p.(Gln7Profs*30)" "3" "" "0000593009" "00000046" "90" "19" "0" "19" "0" "c.19dup" "r.(?)" "p.(Gln7Profs*30)" "3" "" "0000593010" "00000046" "90" "362" "0" "362" "0" "c.362G>A" "r.(?)" "p.(Arg121His)" "5" "" "0000593011" "00000046" "90" "451" "0" "451" "0" "c.451G>A" "r.spl?" "p.(Gly151Arg)" "5" "" "0000593012" "00000046" "90" "452" "-1" "531" "1" "c.(451+1_452-1)_(531+1_532-1)del" "r.452_531del" "p.?" "5i_6i" "" "0000593013" "00000046" "90" "1055" "0" "1055" "0" "c.1055G>A" "r.(?)" "p.(Ser352Asn)" "12" "" "0000593014" "00000046" "90" "209" "1" "209" "1" "c.209+1G>A" "r.[153_209del,-8_209del]" "p.?" "3i" "" "0000593015" "00000046" "90" "493" "0" "514" "0" "c.493_514del" "r.(?)" "p.(Cys165Argfs*2)" "6" "" "0000593016" "00000046" "90" "304" "0" "304" "0" "c.304A>C" "r.(?)" "p.(Lys102Gln)" "4" "" "0000593017" "00000046" "90" "532" "-30" "532" "-2" "c.532-30_532-2del" "r.spl" "p.?" "6i" "" "0000593018" "00000046" "90" "955" "-1" "1039" "1" "c.(954+1_955-1)_(1039+1_1040-1)del" "r.955_1039del" "p.?" "10i_11i" "" "0000593019" "00000046" "90" "1223" "123" "1224" "-87" "c.1223+123_1224-87del" "r.spl?" "p.(=)" "13i" "" "0000593020" "00000046" "90" "1146" "-1" "1223" "1" "c.(1145+1_1146-1)_(1223+1_1224-1)del" "r.1146_1223del" "p.?" "12i_13i" "" "0000593021" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593022" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593023" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593024" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593025" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593026" "00000046" "90" "828" "1" "828" "1" "c.828+1G>A" "r.spl" "p.?" "9i" "" "0000593027" "00000046" "90" "1223" "38" "1224" "-120" "c.1223+38_1224-120del" "r.spl?" "p.(=)" "13i" "" "0000593028" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593029" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593030" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593031" "00000046" "90" "1226" "0" "1226" "0" "c.1226G>A" "r.(?)" "p.(Trp409*)" "14" "" "0000593032" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.1224_1358del" "p.Trp409_Gly453del" "13i" "" "0000593033" "00000046" "90" "740" "0" "769" "0" "c.740_769del" "r.(?)" "p.(Lys247_Gly256del)" "9" "" "0000593034" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593035" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593036" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593037" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593038" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593039" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593040" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593041" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593042" "00000046" "90" "1359" "-1" "1359" "-1" "c.1359-1G>C" "r.1359_1467del" "p.?" "14i" "" "0000593043" "00000046" "90" "1359" "-1" "1359" "-1" "c.1359-1G>C" "r.1359_1467del" "p.?" "14i" "" "0000593044" "00000046" "90" "1553" "0" "1559" "0" "c.1553_1559dup" "r.spl?" "p.(Ser520Argfs*21)" "17" "" "0000593045" "00000046" "90" "1566" "0" "1566" "0" "c.1566del" "r.(?)" "p.(Lys523Serfs*18)" "17" "" "0000593046" "00000046" "90" "1566" "0" "1566" "0" "c.1566del" "r.(?)" "p.(Lys523Serfs*18)" "17" "" "0000593047" "00000046" "90" "1591" "0" "1594" "0" "c.1591_1594del" "r.(?)" "p.(Phe531Glyfs*9)" "17" "" "0000593048" "00000046" "90" "1591" "0" "1594" "0" "c.1591_1594del" "r.(?)" "p.(Phe531Glyfs*9)" "17" "" "0000593049" "00000046" "90" "1627" "0" "1645" "0" "c.1627_1645del" "r.(?)" "p.(Val543Thrfs*26)" "17" "" "0000593050" "00000046" "90" "233" "0" "233" "0" "c.233C>G" "r.233c>g" "p.Pro78Arg" "4" "" "0000593051" "00000046" "90" "306" "0" "306" "0" "c.306G>C" "r.306g>c" "p.Lys102Asn" "4" "" "0000593052" "00000046" "90" "715" "0" "715" "0" "c.715G>A" "r.715g>a" "p.Glu239Lys" "8" "" "0000593053" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.374g>a" "p.Arg125Gln" "5" "" "0000593054" "00000046" "90" "393" "0" "393" "0" "c.393G>C" "r.393g>c" "p.Glu131Asp" "5" "" "0000593055" "00000046" "30" "453" "0" "453" "0" "c.453G>A" "r.453g>a" "p.Pro145=" "6" "" "0000593056" "00000046" "90" "797" "0" "797" "0" "c.797G>A" "r.(?)" "p.(Arg266Lys)" "9" "" "0000593057" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593058" "00000046" "90" "262" "0" "262" "0" "c.262C>T" "r.(?)" "p.(Pro88Ser)" "4" "" "0000593059" "00000046" "10" "832" "0" "833" "0" "c.832_833ins[C;834_844;ATCCAGGT;829-44_829-31;G;829-29_832]" "r.=" "p.=" "10" "" "0000593060" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.833u>c" "p.Ile278Thr" "10" "" "0000593061" "00000046" "90" "913" "0" "913" "0" "c.913G>A" "r.913g>a" "p.Gly305Arg" "10" "" "0000593062" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593063" "00000046" "90" "1105" "0" "1105" "0" "c.1105C>T" "r.(?)" "p.(Arg369Cys)" "12" "" "0000593064" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593065" "00000046" "90" "904" "0" "904" "0" "c.904G>A" "r.(?)" "p.(Glu302Lys)" "10" "" "0000593066" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "5" "" "0000593067" "00000046" "90" "904" "0" "904" "0" "c.904G>A" "r.(?)" "p.(Glu302Lys)" "10" "" "0000593068" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "11" "" "0000593069" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593070" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593071" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.[-8_209del,153_209del]" "p.?" "13i" "" "0000593072" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593073" "00000046" "90" "19" "0" "19" "0" "c.19dup" "r.(?)" "p.(Gln7Profs*30)" "3" "" "0000593074" "00000046" "90" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.(Cys165Tyr)" "6" "" "0000593075" "00000046" "90" "526" "0" "526" "0" "c.526G>A" "r.(?)" "p.(Glu176Lys)" "6" "" "0000593076" "00000046" "90" "210" "-1" "210" "-1" "c.210-1G>C" "r.spl" "p.?" "3i" "" "0000593077" "00000046" "90" "28" "0" "28" "0" "c.28del" "r.(?)" "p.(Val10Trpfs*72)" "3" "" "0000593078" "00000046" "90" "194" "0" "194" "0" "c.194A>G" "r.(?)" "p.(His65Arg)" "3" "" "0000593079" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593080" "00000046" "90" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Glu144Lys)" "5" "" "0000593081" "00000046" "90" "463" "0" "463" "0" "c.463G>A" "r.(?)" "p.(Ala155Thr)" "6" "" "0000593082" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593083" "00000046" "90" "19" "0" "19" "0" "c.19dup" "r.(?)" "p.(Gln7Profs*30)" "3" "" "0000593084" "00000046" "90" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Glu144Lys)" "5" "" "0000593085" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593086" "00000046" "90" "463" "0" "463" "0" "c.463G>A" "r.(?)" "p.(Ala155Thr)" "6" "" "0000593087" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593088" "00000046" "90" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Glu144Lys)" "5" "" "0000593089" "00000046" "90" "463" "0" "463" "0" "c.463G>A" "r.(?)" "p.(Ala155Thr)" "6" "" "0000593090" "00000046" "90" "374" "0" "374" "0" "c.374G>C" "r.(?)" "p.(Arg125Pro)" "5" "" "0000593091" "00000046" "90" "210" "-1" "210" "-1" "c.210-1G>C" "r.spl" "p.?" "3i" "" "0000593092" "00000046" "90" "28" "0" "28" "0" "c.28del" "r.(?)" "p.(Val10Trpfs*72)" "3" "" "0000593093" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593094" "00000046" "90" "1265" "0" "1265" "0" "c.1265C>T" "r.(?)" "p.(Pro422Leu)" "14" "" "0000593095" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000593096" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000593097" "00000046" "90" "785" "0" "785" "0" "c.785C>G" "r.(?)" "p.(Thr262Arg)" "9" "" "0000593098" "00000046" "90" "1627" "0" "1645" "0" "c.1627_1645del" "r.(?)" "p.(Val543Thrfs*26)" "17" "" "0000593099" "00000046" "10" "1676" "0" "1680" "0" "c.*20_*24del" "r.(?)" "p.(=)" "17" "" "0000593100" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "12" "" "0000593101" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "12" "" "0000593102" "00000046" "90" "676" "0" "676" "0" "c.676G>A" "r.(?)" "p.(Ala226Thr)" "8" "" "0000593103" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "12" "" "0000593104" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "12" "" "0000593105" "00000046" "90" "1576" "0" "1576" "0" "c.1576C>A" "r.(?)" "p.(Gln526Lys)" "17" "" "0000593106" "00000046" "90" "737" "-1" "737" "-1" "c.737-1G>C" "r.spl" "p.?" "8i" "" "0000593107" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593108" "00000046" "90" "683" "0" "683" "0" "c.683A>G" "r.(?)" "p.(Asn228Ser)" "8" "" "0000593109" "00000046" "90" "1126" "0" "1126" "0" "c.1126G>A" "r.(?)" "p.(Asp376Asn)" "12" "" "0000593110" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593111" "00000046" "90" "691" "0" "691" "0" "c.691G>C" "r.(?)" "p.(Ala231Pro)" "8" "" "0000593112" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593113" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593114" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593115" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000593116" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593117" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593118" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593119" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593120" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593121" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593122" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593123" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593124" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593125" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593126" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593127" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593128" "00000046" "90" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Thr262Met)" "9" "" "0000593129" "00000046" "90" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Thr262Met)" "9" "" "0000593130" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593131" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593132" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593133" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593134" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "5" "" "0000593135" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "5" "" "0000593136" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "5" "" "0000593137" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593138" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593139" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Pro290Leu)" "10" "" "0000593140" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593141" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593142" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593143" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593144" "00000046" "90" "797" "0" "797" "0" "c.797G>A" "r.(?)" "p.(Arg266Lys)" "9" "" "0000593145" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593146" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593147" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593148" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593149" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593150" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593151" "00000046" "90" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Glu144Lys)" "5" "" "0000593152" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593153" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593154" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "5" "" "0000593155" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "5" "" "0000593156" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593157" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593158" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593159" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593160" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593161" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593162" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593163" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593164" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593165" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593166" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593167" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593168" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593169" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593170" "00000046" "90" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.(Cys165Tyr)" "6" "" "0000593171" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593172" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "11" "" "0000593173" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593174" "00000046" "90" "536" "0" "553" "0" "c.536_553del" "r.(?)" "p.(Asp179_Leu184del)" "7" "" "0000593175" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593176" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593177" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593178" "00000046" "90" "302" "0" "302" "0" "c.302T>C" "r.(?)" "p.(Leu101Pro)" "4" "" "0000593179" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593180" "00000046" "90" "325" "0" "325" "0" "c.325T>C" "r.(?)" "p.(Cys109Arg)" "5" "" "0000593181" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593182" "00000046" "90" "954" "1" "954" "1" "c.954+1G>A" "r.829_954del" "p.?" "10i" "" "0000593183" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593184" "00000046" "90" "209" "1" "209" "2" "c.209+1_209+2insC" "r.spl" "p.?" "3i" "" "0000593185" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593186" "00000046" "90" "1221" "0" "1221" "0" "c.1221del" "r.(?)" "p.(Trp408Glyfs*16)" "13" "" "0000593187" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593188" "00000046" "90" "1039" "0" "1039" "0" "c.1039G>A" "r.spl?" "p.(Gly347Ser)" "11" "" "0000593189" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593190" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "5" "" "0000593191" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "5" "" "0000593192" "00000046" "90" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Glu144Lys)" "5" "" "0000593193" "00000046" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Pro49Leu)" "3" "" "0000593194" "00000046" "90" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Glu144Lys)" "5" "" "0000593195" "00000046" "90" "1111" "0" "1111" "0" "c.1111G>A" "r.(?)" "p.(Val371Met)" "12" "" "0000593196" "00000046" "90" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Glu144Lys)" "5" "" "0000593197" "00000046" "90" "209" "1" "209" "1" "c.209+1G>A" "r.[153_209del,-8_209del]" "p.?" "3i" "" "0000593198" "00000046" "90" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Glu144Lys)" "5" "" "0000593199" "00000046" "90" "1316" "0" "1316" "0" "c.1316G>A" "r.(?)" "p.(Arg439Gln)" "14" "" "0000593200" "00000046" "90" "904" "0" "904" "0" "c.904G>A" "r.(?)" "p.(Glu302Lys)" "10" "" "0000593201" "00000046" "90" "444" "0" "444" "0" "c.444dup" "r.(?)" "p.(Asn149Glufs*39)" "5" "" "0000593202" "00000046" "90" "892" "0" "892" "0" "c.892dup" "r.(?)" "p.(Gln298Profs*32)" "10" "" "0000593203" "00000046" "90" "684" "0" "684" "0" "c.684C>A" "r.(?)" "p.(Asn228Lys)" "8" "" "0000593204" "00000046" "90" "1223" "1" "1223" "1" "c.1223+1G>A" "r.spl?" "p.?" "13i" "" "0000593205" "00000046" "90" "325" "0" "325" "0" "c.325T>C" "r.(?)" "p.(Cys109Arg)" "5" "" "0000593206" "00000046" "90" "1367" "0" "1367" "0" "c.1367T>C" "r.(?)" "p.(Leu456Pro)" "15" "" "0000593207" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "11" "" "0000593208" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "11" "" "0000593209" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593210" "00000046" "90" "1566" "0" "1566" "0" "c.1566del" "r.(?)" "p.(Lys523Serfs*18)" "17" "" "0000593211" "00000046" "90" "1566" "0" "1566" "0" "c.1566del" "r.(?)" "p.(Lys523Serfs*18)" "17" "" "0000593212" "00000046" "90" "1136" "0" "1136" "0" "c.1136G>A" "r.(?)" "p.(Arg379Gln)" "12" "" "0000593213" "00000046" "90" "1046" "0" "1046" "0" "c.1046G>A" "r.(?)" "p.(Ser349Asn)" "12" "" "0000593214" "00000046" "90" "1046" "0" "1046" "0" "c.1046G>A" "r.(?)" "p.(Ser349Asn)" "12" "" "0000593215" "00000046" "90" "209" "1" "209" "1" "c.209+1G>A" "r.[153_209del,-8_209del]" "p.?" "3i" "" "0000593216" "00000046" "90" "373" "0" "373" "0" "c.373C>T" "r.(?)" "p.(Arg125Trp)" "5" "" "0000593217" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593218" "00000046" "90" "373" "0" "373" "0" "c.373C>T" "r.(?)" "p.(Arg125Trp)" "5" "" "0000593219" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593220" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593221" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593222" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593223" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593224" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593225" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593226" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593227" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593228" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593229" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593230" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "12" "" "0000593231" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593232" "00000046" "90" "194" "0" "194" "0" "c.194A>G" "r.(?)" "p.(His65Arg)" "3" "" "0000593233" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593234" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593235" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593236" "00000046" "90" "209" "1" "209" "1" "c.209+1G>A" "r.[153_209del,-8_209del]" "p.?" "3i" "" "0000593237" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593238" "00000046" "90" "770" "0" "770" "0" "c.770C>T" "r.(?)" "p.(Thr257Met)" "9" "" "0000593239" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593240" "00000046" "90" "373" "0" "373" "0" "c.373C>T" "r.(?)" "p.(Arg125Trp)" "5" "" "0000593241" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593242" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593243" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593244" "00000046" "90" "770" "0" "770" "0" "c.770C>T" "r.(?)" "p.(Thr257Met)" "9" "" "0000593245" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593246" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593247" "00000046" "90" "325" "0" "325" "0" "c.325T>C" "r.(?)" "p.(Cys109Arg)" "5" "" "0000593248" "00000046" "90" "536" "0" "553" "0" "c.536_553del" "r.(?)" "p.(Asp179_Leu184del)" "7" "" "0000593249" "00000046" "90" "1105" "0" "1105" "0" "c.1105C>T" "r.(?)" "p.(Arg369Cys)" "12" "" "0000593250" "00000046" "90" "19" "0" "19" "0" "c.19dup" "r.(?)" "p.(Gln7Profs*30)" "3" "" "0000593251" "00000046" "90" "19" "0" "19" "0" "c.19dup" "r.(?)" "p.(Gln7Profs*30)" "3" "" "0000593252" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.1224_1358del" "p.Trp409_Gly453del" "13i" "" "0000593253" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593254" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.1224_1358del" "p.Trp409_Gly453del" "13i" "" "0000593255" "00000046" "90" "429" "0" "429" "0" "c.429C>G" "r.(?)" "p.(Ile143Met)" "5" "" "0000593256" "00000046" "90" "684" "0" "684" "0" "c.684C>A" "r.(?)" "p.(Asn228Lys)" "8" "" "0000593257" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.1224_1358del" "p.Trp409_Gly453del" "13i" "" "0000593258" "00000046" "90" "429" "0" "429" "0" "c.429C>G" "r.(?)" "p.(Ile143Met)" "5" "" "0000593259" "00000046" "90" "442" "0" "442" "0" "c.442G>A" "r.(?)" "p.(Gly148Arg)" "5" "" "0000593260" "00000046" "90" "1039" "1" "1039" "1" "c.1039+1G>T" "r.955_1039del" "p.?" "11i" "" "0000593261" "00000046" "90" "1013" "0" "1013" "0" "c.1013T>C" "r.(?)" "p.(Leu338Pro)" "11" "" "0000593262" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593263" "00000046" "90" "824" "0" "824" "0" "c.824G>A" "r.(?)" "p.(Cys275Tyr)" "9" "" "0000593264" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593265" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593266" "00000046" "90" "959" "0" "959" "0" "c.959T>C" "r.(?)" "p.(Val320Ala)" "11" "" "0000593267" "00000046" "90" "691" "0" "691" "0" "c.691G>C" "r.(?)" "p.(Ala231Pro)" "8" "" "0000593268" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593269" "00000046" "90" "302" "0" "302" "0" "c.302T>C" "r.(?)" "p.(Leu101Pro)" "4" "" "0000593270" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593271" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593272" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593273" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593274" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593275" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593276" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593277" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593278" "00000046" "90" "727" "0" "727" "0" "c.727C>T" "r.(?)" "p.(Gln243*)" "8" "" "0000593279" "00000046" "90" "253" "0" "253" "0" "c.253G>A" "r.(?)" "p.(Gly85Arg)" "4" "" "0000593280" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000593281" "00000046" "90" "700" "0" "700" "0" "c.700G>A" "r.(?)" "p.(Asp234Asn)" "8" "" "0000593282" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593283" "00000046" "90" "260" "0" "260" "0" "c.260C>A" "r.(?)" "p.(Thr87Asn)" "4" "" "0000593284" "00000046" "90" "253" "0" "253" "0" "c.253G>A" "r.(?)" "p.(Gly85Arg)" "4" "" "0000593285" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593286" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593287" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593288" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593289" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593290" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593291" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593292" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593293" "00000046" "90" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Gly153Arg)" "6" "" "0000593294" "00000046" "90" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Gly153Arg)" "6" "" "0000593295" "00000046" "90" "824" "0" "824" "0" "c.824G>A" "r.(?)" "p.(Cys275Tyr)" "9" "" "0000593296" "00000046" "90" "451" "0" "451" "0" "c.451G>A" "r.spl?" "p.(Gly151Arg)" "5" "" "0000593297" "00000046" "90" "346" "0" "346" "0" "c.346G>A" "r.(?)" "p.(Gly116Arg)" "5" "" "0000593298" "00000046" "90" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Thr262Met)" "9" "" "0000593299" "00000046" "90" "904" "0" "904" "0" "c.904G>A" "r.(?)" "p.(Glu302Lys)" "10" "" "0000593300" "00000046" "90" "531" "1" "531" "1" "c.531+1G>A" "r.spl" "p.?" "6i" "" "0000593301" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000593302" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593303" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593304" "00000046" "90" "362" "0" "362" "0" "c.362G>A" "r.(?)" "p.(Arg121His)" "5" "" "0000593305" "00000046" "90" "362" "0" "362" "0" "c.362G>A" "r.(?)" "p.(Arg121His)" "5" "" "0000593306" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593307" "00000046" "90" "862" "0" "862" "0" "c.862G>A" "r.(?)" "p.(Ala288Thr)" "10" "" "0000593308" "00000046" "90" "362" "0" "362" "0" "c.362G>A" "r.(?)" "p.(Arg121His)" "5" "" "0000593309" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593310" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593311" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593312" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593313" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593314" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593315" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593316" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000593317" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593318" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593319" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593320" "00000046" "90" "676" "0" "676" "0" "c.676G>A" "r.(?)" "p.(Ala226Thr)" "8" "" "0000593321" "00000046" "90" "442" "0" "442" "0" "c.442G>A" "r.(?)" "p.(Gly148Arg)" "5" "" "0000593322" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "5" "" "0000593323" "00000046" "90" "1286" "0" "1288" "0" "c.1286_1288del" "r.(?)" "p.(Ile429del)" "14" "" "0000593324" "00000046" "90" "208" "0" "209" "8" "c.208_209+8del" "r.spl" "p.0?" "3_3i" "" "0000593325" "00000046" "90" "828" "1" "828" "1" "c.828+1G>A" "r.spl" "p.?" "9i" "" "0000593326" "00000046" "90" "453" "0" "453" "0" "c.453G>A" "r.(?)" "p.(Pro145=)" "6" "" "0000593327" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593328" "00000046" "90" "517" "0" "517" "0" "c.517A>G" "r.(?)" "p.(Met173Val)" "6" "" "0000593329" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593330" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "12" "" "0000593331" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593332" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "12" "" "0000593333" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000593334" "00000046" "90" "770" "0" "770" "0" "c.770C>T" "r.(?)" "p.(Thr257Met)" "9" "" "0000593335" "00000046" "90" "1136" "0" "1136" "0" "c.1136G>A" "r.(?)" "p.(Arg379Gln)" "12" "" "0000593336" "00000046" "90" "1013" "0" "1013" "0" "c.1013T>C" "r.(?)" "p.(Leu338Pro)" "11" "" "0000593337" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593338" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593339" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593340" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593341" "00000046" "90" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336His)" "11" "" "0000593342" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.(?)" "p.(Gly307Ser)" "10" "" "0000593343" "00000046" "90" "469" "0" "469" "0" "c.469G>C" "r.(?)" "p.(Ala157Pro)" "6" "" "0000593344" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593345" "00000046" "90" "1286" "0" "1288" "0" "c.1286_1288del" "r.(?)" "p.(Ile429del)" "14" "" "0000593346" "00000046" "90" "1358" "1" "1358" "1" "c.1358+1G>A" "r.1224_1358del" "p.?" "14i" "" "0000593347" "00000046" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Pro49Leu)" "3" "" "0000593348" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "5" "" "0000593349" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593350" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593351" "00000046" "90" "1145" "7" "1145" "7" "c.1145+7C>T" "r.spl?" "p.(?)" "12i" "" "0000593352" "00000046" "90" "531" "1" "531" "1" "c.531+1G>A" "r.spl" "p.?" "6i" "" "0000593353" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000593354" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000593355" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593356" "00000046" "90" "694" "0" "694" "0" "c.694C>G" "r.(?)" "p.(His232Asp)" "8" "" "0000593357" "00000046" "90" "775" "0" "775" "0" "c.775G>A" "r.(?)" "p.(Gly259Ser)" "9" "" "0000593358" "00000046" "90" "1321" "0" "1321" "0" "c.1321A>T" "r.(?)" "p.(Lys441*)" "14" "" "0000593359" "00000046" "90" "694" "0" "694" "0" "c.694C>G" "r.(?)" "p.(His232Asp)" "8" "" "0000593360" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593361" "00000046" "90" "451" "0" "451" "0" "c.451G>A" "r.spl?" "p.(Gly151Arg)" "5" "" "0000593362" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "5" "" "0000593363" "00000046" "90" "1591" "0" "1594" "0" "c.1591_1594del" "r.(?)" "p.(Phe531Glyfs*9)" "17" "" "0000593364" "00000046" "90" "1321" "0" "1321" "0" "c.1321A>T" "r.(?)" "p.(Lys441*)" "14" "" "0000593365" "00000046" "90" "103" "0" "103" "0" "c.103G>A" "r.(?)" "p.(Asp35Asn)" "3" "" "0000593366" "00000046" "90" "129" "0" "129" "0" "c.129G>A" "r.(?)" "p.(Trp43*)" "3" "" "0000593367" "00000046" "90" "694" "0" "694" "0" "c.694C>G" "r.(?)" "p.(His232Asp)" "8" "" "0000593368" "00000046" "90" "362" "0" "362" "0" "c.362G>A" "r.(?)" "p.(Arg121His)" "5" "" "0000593369" "00000046" "90" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Gly153Arg)" "6" "" "0000593370" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "5" "" "0000593371" "00000046" "90" "451" "0" "451" "0" "c.451G>A" "r.spl?" "p.(Gly151Arg)" "5" "" "0000593372" "00000046" "90" "959" "0" "959" "0" "c.959T>C" "r.(?)" "p.(Val320Ala)" "11" "" "0000593373" "00000046" "90" "373" "0" "373" "0" "c.373C>T" "r.(?)" "p.(Arg125Trp)" "5" "" "0000593374" "00000046" "90" "361" "0" "361" "0" "c.361C>A" "r.(?)" "p.(Arg121Ser)" "5" "" "0000593375" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "12" "" "0000593376" "00000046" "90" "443" "0" "443" "0" "c.443G>A" "r.(?)" "p.(Gly148Glu)" "5" "" "0000593377" "00000046" "90" "1060" "0" "1060" "0" "c.1060G>A" "r.(?)" "p.(Val354Met)" "12" "" "0000593378" "00000046" "90" "194" "0" "194" "0" "c.194A>C" "r.(?)" "p.(His65Pro)" "3" "" "0000593379" "00000046" "90" "502" "0" "502" "0" "c.502G>A" "r.(?)" "p.(Val168Met)" "6" "" "0000593380" "00000046" "90" "304" "0" "304" "0" "c.304A>C" "r.(?)" "p.(Lys102Gln)" "4" "" "0000593381" "00000046" "90" "532" "-29" "631" "0" "c.532-29_631del" "r.532_666del" "p.?" "6i" "" "0000593382" "00000046" "90" "304" "0" "304" "0" "c.304A>C" "r.(?)" "p.(Lys102Gln)" "4" "" "0000593383" "00000046" "90" "532" "-29" "631" "0" "c.532-29_631del" "r.532_666del" "p.?" "6i" "" "0000593384" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593385" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593386" "00000046" "90" "362" "0" "362" "0" "c.362G>A" "r.(?)" "p.(Arg121His)" "5" "" "0000593387" "00000046" "90" "1013" "0" "1013" "0" "c.1013T>C" "r.(?)" "p.(Leu338Pro)" "11" "" "0000593388" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593389" "00000046" "90" "1082" "0" "1082" "0" "c.1082C>T" "r.(?)" "p.Ala361Val)" "12" "" "0000593390" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593391" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593392" "00000046" "90" "676" "0" "676" "0" "c.676G>A" "r.(?)" "p.(Ala226Thr)" "8" "" "0000593393" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593394" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593395" "00000046" "90" "862" "0" "862" "0" "c.862G>A" "r.(?)" "p.(Ala288Thr)" "10" "" "0000593396" "00000046" "90" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336His)" "11" "" "0000593397" "00000046" "90" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336His)" "11" "" "0000593398" "00000046" "90" "862" "0" "862" "0" "c.862G>A" "r.(?)" "p.(Ala288Thr)" "10" "" "0000593399" "00000046" "90" "862" "0" "862" "0" "c.862G>A" "r.(?)" "p.(Ala288Thr)" "10" "" "0000593400" "00000046" "90" "770" "0" "770" "0" "c.770C>T" "r.(?)" "p.(Thr257Met)" "9" "" "0000593401" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593402" "00000046" "90" "904" "0" "904" "0" "c.904G>A" "r.(?)" "p.(Glu302Lys)" "10" "" "0000593403" "00000046" "90" "256" "0" "256" "0" "c.256del" "r.(?)" "p.(Asp86Thrfs*16)" "4" "" "0000593404" "00000046" "90" "1039" "0" "1039" "0" "c.1039G>A" "r.spl?" "p.(Gly347Ser)" "11" "" "0000593405" "00000046" "90" "650" "0" "650" "0" "c.650C>T" "r.(?)" "p.(Ser217Phe)" "7" "" "0000593406" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593407" "00000046" "90" "442" "0" "442" "0" "c.442G>A" "r.(?)" "p.(Gly148Arg)" "5" "" "0000593408" "00000046" "90" "796" "0" "796" "0" "c.796A>G" "r.(?)" "p.(Arg266Gly)" "9" "" "0000593409" "00000046" "90" "362" "0" "362" "0" "c.362G>A" "r.(?)" "p.(Arg121His)" "5" "" "0000593410" "00000046" "90" "361" "0" "361" "0" "c.361C>T" "r.(?)" "p.(Arg121Cys)" "5" "" "0000593411" "00000046" "90" "1321" "0" "1321" "0" "c.1321A>T" "r.(?)" "p.(Lys441*)" "14" "" "0000593412" "00000046" "90" "796" "0" "796" "0" "c.796A>G" "r.(?)" "p.(Arg266Gly)" "9" "" "0000593413" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "12" "" "0000593414" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000593415" "00000046" "90" "599" "0" "599" "0" "c.599C>T" "r.(?)" "p.(Pro200Leu)" "7" "" "0000593416" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "5" "" "0000593417" "00000046" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Pro49Leu)" "3" "" "0000593418" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "5" "" "0000593419" "00000046" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Pro49Leu)" "3" "" "0000593420" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593421" "00000046" "90" "841" "0" "841" "0" "c.841G>A" "r.(?)" "p.(Asp281Asn)" "10" "" "0000593422" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593423" "00000046" "90" "841" "0" "841" "0" "c.841G>A" "r.(?)" "p.(Asp281Asn)" "10" "" "0000593424" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593425" "00000046" "90" "841" "0" "841" "0" "c.841G>A" "r.(?)" "p.(Asp281Asn)" "10" "" "0000593426" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "12" "" "0000593427" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000593428" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593429" "00000046" "90" "361" "0" "361" "0" "c.361C>T" "r.(?)" "p.(Arg121Cys)" "5" "" "0000593430" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000593431" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "14" "" "0000593432" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593433" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593434" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593435" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593436" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593437" "00000046" "90" "833" "0" "833" "0" "c.833T>G" "r.(?)" "p.(Ile278Ser)" "10" "" "0000593438" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000593439" "00000046" "90" "1136" "0" "1136" "0" "c.1136G>A" "r.(?)" "p.(Arg379Gln)" "12" "" "0000593440" "00000046" "90" "1566" "0" "1566" "0" "c.1566del" "r.(?)" "p.(Lys523Serfs*18)" "17" "" "0000593441" "00000046" "90" "1566" "0" "1566" "0" "c.1566del" "r.(?)" "p.(Lys523Serfs*18)" "17" "" "0000593442" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593443" "00000046" "90" "824" "0" "824" "0" "c.824G>A" "r.(?)" "p.(Cys275Tyr)" "9" "" "0000593444" "00000046" "90" "1566" "0" "1566" "0" "c.1566del" "r.(?)" "p.(Lys523Serfs*18)" "17" "" "0000593445" "00000046" "90" "1566" "0" "1566" "0" "c.1566del" "r.(?)" "p.(Lys523Serfs*18)" "17" "" "0000593446" "00000046" "90" "1566" "0" "1566" "0" "c.1566del" "r.(?)" "p.(Lys523Serfs*18)" "17" "" "0000593447" "00000046" "90" "532" "-38" "532" "-38" "c.532-38del796" "r.spl" "p.?" "6i_8i" "" "0000593448" "00000046" "90" "864" "0" "868" "0" "c.864_868del" "r.(?)" "p.(Glu289Glyfs*39)" "10" "" "0000593449" "00000046" "90" "864" "0" "868" "0" "c.864_868del" "r.(?)" "p.(Glu289Glyfs*39)" "10" "" "0000593450" "00000046" "90" "253" "0" "253" "0" "c.253G>A" "r.(?)" "p.(Gly85Arg)" "4" "" "0000593451" "00000046" "90" "532" "-14" "532" "-7" "c.532-14_532-7del" "r.spl?" "p.(?)" "6i" "" "0000593452" "00000046" "90" "253" "0" "253" "0" "c.253G>A" "r.(?)" "p.(Gly85Arg)" "4" "" "0000593453" "00000046" "90" "532" "-14" "532" "-7" "c.532-14_532-7del" "r.spl?" "p.(?)" "6i" "" "0000593454" "00000046" "90" "689" "0" "689" "0" "c.689del" "r.(?)" "p.(Leu230Argfs*39)" "8" "" "0000593455" "00000046" "90" "689" "0" "689" "0" "c.689del" "r.(?)" "p.(Leu230Argfs*39)" "8" "" "0000593456" "00000046" "90" "962" "0" "962" "0" "c.962A>T" "r.(?)" "p.(Asp321Val)" "11" "" "0000593457" "00000046" "90" "1336" "0" "1336" "0" "c.1336G>T" "r.(?)" "p.(Ala446Ser)" "14" "" "0000593458" "00000046" "90" "676" "0" "676" "0" "c.676G>A" "r.(?)" "p.(Ala226Thr)" "8" "" "0000593459" "00000046" "90" "676" "0" "676" "0" "c.676G>A" "r.(?)" "p.(Ala226Thr)" "8" "" "0000593460" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593461" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593462" "00000046" "90" "518" "0" "520" "0" "c.518_520del" "r.(?)" "p.(Met173del)" "6" "" "0000593463" "00000046" "90" "518" "0" "520" "0" "c.518_520del" "r.(?)" "p.(Met173del)" "6" "" "0000593464" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "11" "" "0000593465" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "11" "" "0000593466" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "11" "" "0000593467" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "11" "" "0000593468" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "11" "" "0000593469" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "11" "" "0000593470" "00000046" "90" "1039" "0" "1039" "0" "c.1039G>A" "r.spl?" "p.(Gly347Ser)" "11" "" "0000593471" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593472" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593473" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593474" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593475" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593476" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593477" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593478" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593479" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593480" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593481" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593482" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593483" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593484" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593485" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593486" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593487" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593488" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593489" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593490" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593491" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593492" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593493" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593494" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593495" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593496" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593497" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593498" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593499" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593500" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593501" "00000046" "90" "700" "0" "700" "0" "c.700G>A" "r.(?)" "p.(Asp234Asn)" "?" "" "0000593502" "00000046" "90" "770" "0" "770" "0" "c.770C>T" "r.(?)" "p.(Thr257Met)" "?" "" "0000593503" "00000046" "90" "969" "0" "969" "0" "c.969G>A" "r.(?)" "p.(Trp323*)" "?" "" "0000593504" "00000046" "90" "969" "0" "969" "0" "c.969G>A" "r.(?)" "p.(Trp323*)" "?" "" "0000593505" "00000046" "90" "969" "0" "969" "0" "c.969G>A" "r.(?)" "p.(Trp323*)" "?" "" "0000593506" "00000046" "90" "969" "0" "969" "0" "c.969G>A" "r.(?)" "p.(Trp323*)" "?" "" "0000593507" "00000046" "90" "969" "0" "969" "0" "c.969G>A" "r.(?)" "p.(Trp323*)" "?" "" "0000593508" "00000046" "90" "969" "0" "969" "0" "c.969G>A" "r.(?)" "p.(Trp323*)" "?" "" "0000593509" "00000046" "90" "969" "0" "969" "0" "c.969G>A" "r.(?)" "p.(Trp323*)" "?" "" "0000593510" "00000046" "90" "969" "0" "969" "0" "c.969G>A" "r.(?)" "p.(Trp323*)" "?" "" "0000593511" "00000046" "90" "969" "0" "969" "0" "c.969G>A" "r.(?)" "p.(Trp323*)" "?" "" "0000593512" "00000046" "90" "969" "0" "969" "0" "c.969G>A" "r.(?)" "p.(Trp323*)" "?" "" "0000593513" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593514" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593515" "00000046" "90" "457" "0" "457" "0" "c.457G>A" "r.(?)" "p.(Gly153Arg)" "?" "" "0000593516" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593517" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593518" "00000046" "90" "503" "0" "503" "0" "c.503T>C" "r.(?)" "p.(Val168Ala)" "?" "" "0000593519" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593520" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "?" "" "0000593521" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "?" "" "0000593522" "00000046" "10" "52" "0" "52" "0" "c.52C>T" "r.(?)" "p.(Arg18Cys)" "?" "" "0000593523" "00000046" "90" "461" "0" "461" "0" "c.461T>A" "r.(?)" "p.(Leu154Gln)" "?" "" "0000593524" "00000046" "90" "770" "0" "770" "0" "c.770C>T" "r.(?)" "p.(Thr257Met)" "?" "" "0000593525" "00000046" "90" "862" "0" "862" "0" "c.862G>A" "r.(?)" "p.(Ala288Thr)" "?" "" "0000593526" "00000046" "90" "700" "0" "702" "0" "c.700_702del" "r.(?)" "p.(Asp234del)" "?" "" "0000593527" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "?" "" "0000593528" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "?" "" "0000593529" "00000046" "90" "464" "0" "464" "0" "c.464C>T" "r.(?)" "p.(Ala155Val)" "?" "" "0000593530" "00000046" "90" "1039" "0" "1039" "0" "c.1039G>A" "r.spl?" "p.(Gly347Ser)" "?" "" "0000593531" "00000046" "90" "700" "0" "702" "0" "c.700_702del" "r.(?)" "p.(Asp234del)" "?" "" "0000593532" "00000046" "90" "770" "0" "770" "0" "c.770C>T" "r.(?)" "p.(Thr257Met)" "?" "" "0000593533" "00000046" "90" "1226" "0" "1226" "0" "c.1226G>A" "r.(?)" "p.(Trp409*)" "?" "" "0000593534" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "?" "" "0000593535" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "?" "" "0000593536" "00000046" "90" "1223" "38" "1224" "-120" "c.1223+38_1224-120del" "r.spl?" "p.(=)" "?" "" "0000593537" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593538" "00000046" "90" "913" "0" "913" "0" "c.913G>A" "r.(?)" "p.(Gly305Arg)" "?" "" "0000593539" "00000046" "10" "832" "0" "833" "0" "c.832_833ins[C;834_844;ATCCAGGT;829-44_829-31;G;829-29_832]" "r.(=)" "p.(=)" "10" "" "0000593540" "00000046" "90" "869" "0" "869" "0" "c.869C>T" "r.(?)" "p.(Pro290Leu)" "?" "" "0000593541" "00000046" "90" "346" "0" "346" "0" "c.346G>A" "r.(?)" "p.(Gly116Arg)" "?" "" "0000593542" "00000046" "90" "346" "0" "346" "0" "c.346G>A" "r.(?)" "p.(Gly116Arg)" "?" "" "0000593543" "00000046" "90" "770" "0" "770" "0" "c.770C>T" "r.(?)" "p.(Thr257Met)" "?" "" "0000593544" "00000046" "90" "833" "0" "833" "0" "c.833T>A" "r.(?)" "p.(Ile278Asn)" "?" "" "0000593545" "00000046" "90" "262" "0" "262" "0" "c.262C>T" "r.(?)" "p.(Pro88Ser)" "?" "" "0000593546" "00000046" "90" "833" "0" "833" "0" "c.833T>A" "r.(?)" "p.(Ile278Asn)" "?" "" "0000593547" "00000046" "90" "346" "0" "346" "0" "c.346G>A" "r.(?)" "p.(Gly116Arg)" "?" "" "0000593548" "00000046" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Arg125Gln)" "?" "" "0000593549" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593550" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593551" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593552" "00000046" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Pro49Leu)" "?" "" "0000593553" "00000046" "90" "452" "0" "478" "0" "c.452_478del" "r.(?)" "p.(Gly151_Ala159del)" "?" "" "0000593554" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "?" "" "0000593555" "00000046" "90" "376" "0" "376" "0" "c.376A>G" "r.(?)" "p.(Met126Val)" "?" "" "0000593556" "00000046" "90" "172" "0" "172" "0" "c.172C>T" "r.(?)" "p.(Arg58Trp)" "?" "" "0000593557" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "?" "" "0000593558" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "?" "" "0000593559" "00000046" "90" "904" "0" "904" "0" "c.904G>A" "r.(?)" "p.(Glu302Lys)" "?" "" "0000593560" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "?" "" "0000593561" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593562" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593563" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "?" "" "0000593564" "00000046" "90" "904" "0" "904" "0" "c.904G>A" "r.(?)" "p.(Glu302Lys)" "?" "" "0000593565" "00000046" "90" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "?" "" "0000593566" "00000046" "90" "676" "0" "676" "0" "c.676G>A" "r.(?)" "p.(Ala226Thr)" "?" "" "0000593567" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "?" "" "0000593568" "00000046" "90" "346" "0" "346" "0" "c.346G>A" "r.346g>a" "p.Gly116Arg" "?" "" "0000593569" "00000046" "90" "869" "0" "869" "0" "c.869C>T" "r.869c>u" "p.Pro290Leu" "?" "" "0000593570" "00000046" "90" "1111" "0" "1111" "0" "c.1111G>A" "r.(?)" "p.(Val371Met)" "?" "" "0000593571" "00000046" "90" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.(Cys165Tyr)" "?" "" "0000593572" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593573" "00000046" "90" "262" "0" "262" "0" "c.262C>T" "r.(?)" "p.(Pro88Ser)" "?" "" "0000593574" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593575" "00000046" "90" "262" "0" "262" "0" "c.262C>T" "r.(?)" "p.(Pro88Ser)" "?" "" "0000593576" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593577" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "?" "" "0000593578" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "?" "" "0000593579" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "?" "" "0000593580" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "?" "" "0000593581" "00000046" "90" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336His)" "?" "" "0000593582" "00000046" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Pro49Leu)" "?" "" "0000593583" "00000046" "90" "808" "0" "810" "0" "c.808_810del" "r.(?)" "p.(Glu270del)" "?" "" "0000593584" "00000046" "90" "1173" "0" "1173" "0" "c.1173G>T" "r.(?)" "p.(Met391Ile)" "?" "" "0000593585" "00000046" "90" "1152" "0" "1152" "0" "c.1152G>C" "r.(?)" "p.(Lys384Asn)" "?" "" "0000593586" "00000046" "90" "1359" "-1" "1359" "-1" "c.1359-1G>C" "r.1359_1467del" "p.?" "?" "" "0000593587" "00000046" "90" "1361" "0" "1361" "0" "c.1361T>A" "r.1361u>a" "p.Val454Glu" "?" "" "0000593588" "00000046" "90" "919" "0" "919" "0" "c.919G>A" "r.919g>a" "p.Gly307Ser" "?" "" "0000593589" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "?" "" "0000593590" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593591" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "?" "" "0000593592" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "?" "" "0000593593" "00000046" "90" "828" "1" "828" "1" "c.828+1G>A" "r.spl" "p.?" "?" "" "0000593594" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "?" "" "0000593595" "00000046" "90" "451" "0" "451" "0" "c.451G>A" "r.spl?" "p.(Gly151Arg)" "?" "" "0000593596" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "?" "" "0000593597" "00000046" "90" "740" "0" "769" "0" "c.740_769del" "r.(?)" "p.(Lys247_Gly256del)" "?" "" "0000593598" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "?" "" "0000593599" "00000046" "90" "1135" "0" "1135" "0" "c.1135C>T" "r.(?)" "p.(Arg379Trp)" "?" "" "0000593600" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "?" "" "0000593601" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "?" "" "0000593602" "00000046" "90" "676" "0" "676" "0" "c.676G>A" "r.(?)" "p.(Ala226Thr)" "?" "" "0000593603" "00000046" "90" "862" "0" "862" "0" "c.862G>C" "r.(?)" "p.(Ala288Pro)" "?" "" "0000593604" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "?" "" "0000593605" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "?" "" "0000593606" "00000046" "90" "429" "0" "429" "0" "c.429C>G" "r.(?)" "p.(Ile143Met)" "?" "" "0000593607" "00000046" "90" "253" "0" "253" "0" "c.253G>A" "r.(?)" "p.(Gly85Arg)" "?" "" "0000593608" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "?" "" "0000593609" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593610" "00000046" "90" "1397" "0" "1397" "0" "c.1397C>T" "r.(?)" "p.(Ser466Leu)" "?" "" "0000593611" "00000046" "90" "1304" "0" "1304" "0" "c.1304T>C" "r.(?)" "p.(Ile435Thr)" "?" "" "0000593612" "00000046" "90" "954" "1" "954" "1" "c.954+1G>A" "r.spl" "p.?" "?" "" "0000593613" "00000046" "90" "141" "0" "141" "0" "c.141T>A" "r.(?)" "p.(Asp47Glu)" "?" "" "0000593614" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593615" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593616" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593617" "00000046" "90" "463" "0" "463" "0" "c.463G>A" "r.(?)" "p.(Ala155Thr)" "?" "" "0000593618" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "?" "" "0000593619" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "?" "" "0000593620" "00000046" "90" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Cys)" "11" "" "0000593621" "00000046" "90" "700" "0" "700" "0" "c.700G>A" "r.(?)" "p.(Asp234Asn)" "8" "" "0000593622" "00000046" "10" "832" "0" "833" "0" "c.832_833ins[C;834_844;ATCCAGGT;829-44_829-31;G;829-29_832]" "r.=" "p.=" "10" "" "0000593623" "00000046" "90" "1080" "0" "1080" "0" "c.1080C>T" "r.(?)" "p.(Ala360=)" "12" "" "0000593624" "00000046" "90" "699" "0" "699" "0" "c.699C>T" "r.(?)" "p.(Tyr233=)" "8" "" "0000593625" "00000046" "10" "832" "0" "833" "0" "c.832_833ins[C;834_844;ATCCAGGT;829-44_829-31;G;829-29_832]" "r.(=)" "p.(=)" "10" "" "0000593626" "00000046" "10" "832" "0" "833" "0" "c.832_833ins[C;834_844;ATCCAGGT;829-44_829-31;G;829-29_832]" "r.(=)" "p.(=)" "10" "" "0000593627" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593628" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593629" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "10" "" "0000593630" "00000046" "90" "1224" "-2" "1224" "-2" "c.1224-2A>C" "r.(1224_1358del)" "p.(Trp409_Gly453del)" "13i" "" "0000593631" "00000046" "90" "19" "0" "19" "0" "c.19dup" "r.(?)" "p.(Gln7Profs*30)" "3" "" "0000593632" "00000046" "90" "1226" "0" "1226" "0" "c.1226G>A" "r.(?)" "p.(Trp409*)" "14" "" "0000593633" "00000046" "90" "526" "0" "526" "0" "c.526G>A" "r.(?)" "p.(Glu176Lys)" "6" "" "0000593634" "00000046" "90" "430" "0" "430" "0" "c.430G>A" "r.(?)" "p.(Glu144Lys)" "5" "" "0000593635" "00000046" "90" "463" "0" "463" "0" "c.463G>A" "r.(?)" "p.(Ala155Thr)" "6" "" "0000593636" "00000046" "90" "210" "-1" "210" "-1" "c.210-1G>C" "r.spl" "p.?" "3i" "" "0000593637" "00000046" "90" "28" "0" "28" "0" "c.28del" "r.(?)" "p.(Val10Trpfs*72)" "3" "" "0000593638" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "5" "" "0000593639" "00000046" "90" "828" "1" "828" "1" "c.828+1G>A" "r.spl" "p.?" "9i" "" "0000618376" "00000046" "70" "992" "0" "992" "0" "c.992C>A" "r.(?)" "p.(Ala331Glu)" "" "" "0000618377" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "" "" "0000618378" "00000046" "50" "700" "0" "700" "0" "c.700G>A" "r.(?)" "p.(Asp234Asn)" "" "" "0000618379" "00000046" "50" "172" "0" "172" "0" "c.172C>T" "r.(?)" "p.(Arg58Trp)" "" "" "0000618380" "00000046" "70" "28" "0" "28" "0" "c.28del" "r.(?)" "p.(Val10TrpfsTer72)" "" "" "0000624224" "00000046" "30" "501" "0" "501" "0" "c.501C>T" "r.(?)" "p.(Ile167=)" "" "" "0000650868" "00000046" "50" "1105" "0" "1105" "0" "c.1105C>T" "r.(?)" "p.(Arg369Cys)" "" "" "0000650869" "00000046" "70" "1058" "0" "1058" "0" "c.1058C>T" "r.(?)" "p.(Thr353Met)" "" "" "0000650870" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "" "" "0000650871" "00000046" "70" "785" "0" "785" "0" "c.785C>T" "r.(?)" "p.(Thr262Met)" "" "" "0000650872" "00000046" "90" "700" "0" "700" "0" "c.700G>A" "r.(?)" "p.(Asp234Asn)" "" "" "0000650873" "00000046" "90" "253" "0" "253" "0" "c.253G>A" "r.(?)" "p.(Gly85Arg)" "" "" "0000653045" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "" "" "0000653342" "00000046" "50" "1061" "0" "1069" "0" "c.1061_1069del" "r.(?)" "p.(Val354_Val356del)" "" "" "0000658835" "00000046" "30" "954" "20" "954" "20" "c.954+20C>T" "r.(=)" "p.(=)" "" "" "0000658836" "00000046" "30" "736" "10" "736" "10" "c.736+10T>C" "r.(=)" "p.(=)" "" "" "0000658837" "00000046" "30" "582" "0" "582" "0" "c.582T>C" "r.(?)" "p.(Asn194=)" "" "" "0000669694" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "" "" "0000681725" "00000046" "50" "1472" "0" "1472" "0" "c.1472G>A" "r.(?)" "p.(Arg491His)" "" "" "0000681726" "00000046" "50" "463" "0" "463" "0" "c.463G>A" "r.(?)" "p.(Ala155Thr)" "" "" "0000681727" "00000046" "50" "215" "0" "215" "0" "c.215A>T" "r.(?)" "p.(Lys72Ile)" "" "" "0000693052" "00000046" "70" "1039" "5" "1039" "5" "c.1039+5G>C" "r.spl?" "p.?" "" "" "0000693053" "00000046" "50" "887" "0" "887" "0" "c.887C>T" "r.(?)" "p.(Thr296Met)" "" "" "0000698840" "00000046" "70" "1105" "0" "1105" "0" "c.1105C>T" "r.(?)" "p.(Arg369Cys)" "" "" "0000727923" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "" "" "0000727924" "00000046" "30" "737" "-10" "737" "-10" "c.737-10C>T" "r.(=)" "p.(=)" "" "" "0000727925" "00000046" "50" "599" "0" "599" "0" "c.599C>T" "r.(?)" "p.(Pro200Leu)" "" "" "0000727926" "00000046" "30" "396" "0" "396" "0" "c.396C>T" "r.(?)" "p.(Arg132=)" "" "" "0000727927" "00000046" "30" "209" "0" "209" "0" "c.209C>T" "r.(?)" "p.(Pro70Leu)" "" "" "0000809402" "00000046" "30" "1479" "0" "1479" "0" "c.1479G>A" "r.(?)" "p.(Thr493=)" "" "" "0000809403" "00000046" "70" "1111" "0" "1111" "0" "c.1111G>A" "r.(?)" "p.(Val371Met)" "" "" "0000809404" "00000046" "10" "573" "0" "573" "0" "c.573G>A" "r.(?)" "p.(Thr191=)" "" "" "0000814419" "00000046" "70" "1105" "0" "1105" "0" "c.1105C>T" "r.(?)" "p.(Arg369Cys)" "" "" "0000855967" "00000046" "70" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336His)" "" "" "0000855968" "00000046" "30" "954" "20" "954" "20" "c.954+20C>T" "r.(=)" "p.(=)" "" "" "0000855969" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "" "" "0000866636" "00000046" "50" "1223" "17" "1223" "17" "c.1223+17G>A" "r.(=)" "p.(=)" "" "" "0000866637" "00000046" "30" "1223" "8" "1223" "8" "c.1223+8C>T" "r.(=)" "p.(=)" "" "" "0000866638" "00000046" "10" "1145" "7" "1145" "7" "c.1145+7C>T" "r.(=)" "p.(=)" "" "" "0000866639" "00000046" "50" "1072" "0" "1072" "0" "c.1072G>A" "r.(?)" "p.(Val358Met)" "" "" "0000866640" "00000046" "30" "1059" "0" "1059" "0" "c.1059G>A" "r.(?)" "p.(Thr353=)" "" "" "0000866641" "00000046" "30" "829" "-13" "829" "-13" "c.829-13G>A" "r.(=)" "p.(=)" "" "" "0000866642" "00000046" "30" "531" "11" "531" "11" "c.531+11G>A" "r.(=)" "p.(=)" "" "" "0000866643" "00000046" "30" "339" "0" "339" "0" "c.339C>T" "r.(?)" "p.(Asn113=)" "" "" "0000866644" "00000046" "10" "304" "0" "304" "0" "c.304A>C" "r.(?)" "p.(Lys102Gln)" "" "" "0000866645" "00000046" "30" "52" "0" "52" "0" "c.52C>T" "r.(?)" "p.(Arg18Cys)" "" "" "0000873572" "00000046" "70" "526" "0" "526" "0" "c.526G>A" "r.(?)" "p.(Glu176Lys)" "" "" "0000873573" "00000046" "70" "949" "0" "949" "0" "c.949A>G" "r.(?)" "p.(Arg317Gly)" "" "" "0000874665" "00000046" "70" "1039" "0" "1039" "0" "c.1039G>A" "r.(?)" "p.(Gly347Ser)" "" "" "0000895479" "00000046" "30" "1644" "0" "1644" "0" "c.1644G>C" "r.(?)" "p.(Arg548=)" "" "" "0000895480" "00000046" "30" "1626" "0" "1626" "0" "c.1626C>T" "r.(?)" "p.(Phe542=)" "" "" "0000895481" "00000046" "30" "1359" "-9" "1359" "-9" "c.1359-9G>A" "r.(=)" "p.(=)" "" "" "0000895482" "00000046" "30" "1338" "0" "1338" "0" "c.1338G>A" "r.(?)" "p.(Ala446=)" "" "" "0000895483" "00000046" "30" "1223" "9" "1223" "9" "c.1223+9G>A" "r.(=)" "p.(=)" "" "" "0000895484" "00000046" "90" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336His)" "" "" "0000895485" "00000046" "30" "954" "20" "954" "20" "c.954+20C>T" "r.(=)" "p.(=)" "" "" "0000895486" "00000046" "30" "894" "0" "894" "0" "c.894G>A" "r.(?)" "p.(Gln298=)" "" "" "0000895487" "00000046" "90" "833" "0" "833" "0" "c.833T>C" "r.(?)" "p.(Ile278Thr)" "" "" "0000895488" "00000046" "30" "832" "0" "833" "0" "c.832_833insCTGGGGTGGATCACCCAGGTGGGGCTTTTGCTGGGCTTGAGCCCTGAAGCCGCGCCCTCTGCAGATCA" "r.(?)" "p.(Ile278Thrfs*16)" "" "" "0000895489" "00000046" "50" "395" "0" "395" "0" "c.395G>A" "r.(?)" "p.(Arg132His)" "" "" "0000895490" "00000046" "10" "304" "0" "304" "0" "c.304A>C" "r.(?)" "p.(Lys102Gln)" "" "" "0000895491" "00000046" "50" "209" "7" "209" "7" "c.209+7C>A" "r.(=)" "p.(=)" "" "" "0000895492" "00000046" "30" "147" "0" "147" "0" "c.147G>A" "r.(?)" "p.(Pro49=)" "" "" "0000895493" "00000046" "90" "19" "0" "19" "0" "c.19dup" "r.(?)" "p.(Gln7Profs*30)" "" "" "0000915457" "00000046" "30" "1359" "-14" "1359" "-14" "c.1359-14C>T" "r.(=)" "p.(=)" "" "" "0000915459" "00000046" "30" "316" "331" "316" "331" "c.316+331C>T" "r.(=)" "p.(=)" "" "" "0000915460" "00000046" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Pro49Leu)" "" "" "0000927082" "00000046" "10" "1467" "127" "1467" "157" "c.1467+127_1467+157del" "r.(=)" "p.(=)" "" "" "0000927083" "00000046" "30" "1359" "-9" "1359" "-9" "c.1359-9G>A" "r.(=)" "p.(=)" "" "" "0000927084" "00000046" "50" "643" "0" "643" "0" "c.643C>T" "r.(?)" "p.(Pro215Ser)" "" "" "0000931222" "00000046" "30" "1674" "0" "1674" "0" "c.*18G>A" "r.(=)" "p.(=)" "" "" "0000931223" "00000046" "30" "1643" "0" "1643" "0" "c.1643G>A" "r.(?)" "p.(Arg548Gln)" "" "" "0000931224" "00000046" "30" "829" "-13" "829" "-13" "c.829-13G>A" "r.(=)" "p.(=)" "" "" "0000931225" "00000046" "90" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Ala114Val)" "" "" "0000951506" "00000046" "30" "1643" "0" "1643" "0" "c.1643G>A" "r.(?)" "p.(Arg548Gln)" "" "" "0000951507" "00000046" "30" "1512" "0" "1512" "0" "c.1512G>A" "r.(?)" "p.(=)" "" "" "0000951508" "00000046" "90" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Asp444Asn)" "" "" "0000970309" "00000046" "30" "1467" "472" "1467" "472" "c.1467+472G>A" "r.(=)" "p.(=)" "" "" "0000970310" "00000046" "30" "870" "0" "870" "0" "c.870G>A" "r.(?)" "p.(=)" "" "" "0000970311" "00000046" "30" "737" "-90" "737" "-90" "c.737-90C>T" "r.(=)" "p.(=)" "" "" "0000970312" "00000046" "90" "676" "0" "676" "0" "c.676G>A" "r.(?)" "p.(Ala226Thr)" "" "" "0000970313" "00000046" "30" "501" "0" "501" "0" "c.501C>T" "r.(?)" "p.(Ile167=)" "" "" "0000983990" "00000046" "30" "1468" "-139" "1468" "-139" "c.1468-139C>T" "r.(=)" "p.(=)" "" "" "0000983991" "00000046" "90" "1280" "0" "1280" "0" "c.1280C>T" "r.(?)" "p.(Pro427Leu)" "" "" "0000983992" "00000046" "70" "1064" "0" "1064" "0" "c.1064C>T" "r.(?)" "p.(Ala355Val)" "" "" "0000983993" "00000046" "30" "924" "0" "924" "0" "c.924C>T" "r.(?)" "p.(=)" "" "" "0000983994" "00000046" "50" "610" "0" "610" "0" "c.610G>A" "r.(?)" "p.(Val204Met)" "" "" "0000983995" "00000046" "30" "316" "996" "316" "996" "c.316+996C>A" "r.(=)" "p.(=)" "" "" "0000983996" "00000046" "30" "316" "147" "316" "147" "c.316+147T>G" "r.(=)" "p.(=)" "" "" "0000987719" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000987722" "00000046" "90" "1126" "0" "1126" "0" "c.1126G>A" "r.(?)" "p.(Asp376Asn)" "12" "" "0000987801" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000987828" "00000046" "90" "572" "0" "572" "0" "c.572C>T" "r.(?)" "p.(Thr191Met)" "7" "" "0000989117" "00000046" "90" "1358" "2" "1358" "2" "c.1358+2T>A" "r.(?)" "p.(?)" "" "" "0001005753" "00000046" "50" "1633" "0" "1633" "0" "c.1633G>A" "r.(?)" "p.(Ala545Thr)" "" "" "0001005754" "00000046" "30" "1059" "0" "1059" "0" "c.1059G>A" "r.(?)" "p.(Thr353=)" "" "" "0001005755" "00000046" "30" "1059" "0" "1059" "0" "c.1059G>A" "r.(?)" "p.(Thr353=)" "" "" "0001005756" "00000046" "50" "851" "0" "851" "0" "c.851G>A" "r.(?)" "p.(Gly284Glu)" "" "" "0001005757" "00000046" "50" "404" "0" "404" "0" "c.404C>T" "r.(?)" "p.(Thr135Met)" "" "" "0001005758" "00000046" "30" "316" "294" "316" "294" "c.316+294G>A" "r.(=)" "p.(=)" "" "" "0001007258" "00000046" "70" "770" "0" "770" "0" "c.770C>T" "r.(?)" "p.(Thr257Met)" "" "" "0001007381" "00000046" "70" "803" "0" "803" "0" "c.803T>C" "r.(?)" "p.(Leu268Pro)" "9" "" "0001015890" "00000046" "50" "1484" "0" "1484" "0" "c.1484C>T" "r.(?)" "p.(Thr495Met)" "" "" "0001015891" "00000046" "30" "1358" "15" "1358" "15" "c.1358+15C>A" "r.(=)" "p.(=)" "" "" "0001015892" "00000046" "10" "1039" "19" "1039" "19" "c.1039+19C>T" "r.(=)" "p.(=)" "" "" "0001015893" "00000046" "30" "954" "8" "954" "8" "c.954+8G>A" "r.(=)" "p.(=)" "" "" "0001015894" "00000046" "30" "829" "-14" "829" "-14" "c.829-14C>T" "r.(=)" "p.(=)" "" "" "0001015895" "00000046" "50" "709" "0" "709" "0" "c.709G>A" "r.(?)" "p.(Ala237Thr)" "" "" "0001015896" "00000046" "30" "28" "0" "28" "0" "c.28G>T" "r.(?)" "p.(Val10Leu)" "" "" "0001027343" "00000046" "30" "1524" "0" "1524" "0" "c.1524C>T" "r.(?)" "p.(Phe508=)" "" "" "0001043595" "00000046" "30" "1678" "0" "1678" "0" "c.*22C>T" "r.(=)" "p.(=)" "" "" "0001043596" "00000046" "90" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336His)" "" "" "0001043597" "00000046" "30" "828" "10" "828" "10" "c.828+10G>A" "r.(=)" "p.(=)" "" "" "0001043598" "00000046" "50" "736" "5" "736" "5" "c.736+5G>A" "r.spl?" "p.?" "" "" "0001043599" "00000046" "50" "545" "0" "545" "0" "c.545G>A" "r.(?)" "p.(Arg182Gln)" "" "" "0001043600" "00000046" "30" "317" "-353" "317" "-353" "c.317-353G>A" "r.(=)" "p.(=)" "" "" "0001043601" "00000046" "50" "316" "587" "316" "587" "c.316+587C>T" "r.(=)" "p.(=)" "" "" "0001043602" "00000046" "50" "163" "0" "163" "0" "c.163C>A" "r.(?)" "p.(Gln55Lys)" "" "" "0001046796" "00000046" "70" "210" "-2" "210" "-2" "c.210-2A>G" "r.spl?" "p.?" "" "" "0001057017" "00000046" "30" "531" "6" "531" "6" "c.531+6T>C" "r.(=)" "p.(=)" "" "" "0001057018" "00000046" "50" "400" "0" "400" "0" "c.400G>A" "r.(?)" "p.(Gly134Arg)" "" "" "0001057019" "00000046" "90" "146" "0" "146" "0" "c.146C>T" "r.(?)" "p.(Pro49Leu)" "" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 928 "{{screeningid}}" "{{variantid}}" "0000000034" "0000000900" "0000046676" "0000074526" "0000046676" "0000074527" "0000046676" "0000076676" "0000046676" "0000076678" "0000046678" "0000074529" "0000046678" "0000074530" "0000046678" "0000076681" "0000046678" "0000076682" "0000047937" "0000076684" "0000047937" "0000076685" "0000047937" "0000076686" "0000047937" "0000076687" "0000047939" "0000076689" "0000047939" "0000076714" "0000047940" "0000076690" "0000047940" "0000076715" "0000047941" "0000076691" "0000047942" "0000076692" "0000047942" "0000076716" "0000047943" "0000076693" "0000047943" "0000076717" "0000047944" "0000076694" "0000047945" "0000076695" "0000047945" "0000076718" "0000047946" "0000076696" "0000047946" "0000076719" "0000047947" "0000076697" "0000047947" "0000076720" "0000047948" "0000076698" "0000047948" "0000076721" "0000047949" "0000076699" "0000047950" "0000076700" "0000047950" "0000076722" "0000047951" "0000076701" "0000047951" "0000076723" "0000047952" "0000076702" "0000047953" "0000076703" "0000047953" "0000076724" "0000047954" "0000076704" "0000047969" "0000076736" "0000047971" "0000076738" "0000047971" "0000076746" "0000047972" "0000076739" "0000047972" "0000076747" "0000047973" "0000076740" "0000047973" "0000076748" "0000047974" "0000076741" "0000047975" "0000076742" "0000047975" "0000076749" "0000047976" "0000076743" "0000047976" "0000076750" "0000047977" "0000076744" "0000047978" "0000076745" "0000047978" "0000076751" "0000081156" "0000130242" "0000181961" "0000405748" "0000181961" "0000405749" "0000211242" "0000442703" "0000227198" "0000461250" "0000227198" "0000461251" "0000262467" "0000592765" "0000262469" "0000592794" "0000262470" "0000592795" "0000262470" "0000592796" "0000262471" "0000592797" "0000262472" "0000592798" "0000262473" "0000592799" "0000262473" "0000592800" "0000262473" "0000592801" "0000262474" "0000592802" "0000262474" "0000592803" "0000262475" "0000592804" "0000262476" "0000592805" "0000262477" "0000592806" "0000262478" "0000592807" "0000262479" "0000592808" "0000262479" "0000592809" "0000262480" "0000592810" "0000262480" "0000592811" "0000262481" "0000592812" "0000262482" "0000592813" "0000262483" "0000592814" "0000262483" "0000592815" "0000262484" "0000592816" "0000262485" "0000592817" "0000262486" "0000592818" "0000262487" "0000592819" "0000262488" "0000592820" "0000262488" "0000592821" "0000262489" "0000592822" "0000262489" "0000592823" "0000262490" "0000592824" "0000262490" "0000592825" "0000262491" "0000592826" "0000262491" "0000592827" "0000262492" "0000592828" "0000262492" "0000592829" "0000262493" "0000592830" "0000262494" "0000592831" "0000262495" "0000592832" "0000262496" "0000592833" "0000262496" "0000592834" "0000262497" "0000592835" "0000262498" "0000592836" "0000262498" "0000592837" "0000262499" "0000592838" "0000262499" "0000592839" "0000262500" "0000592840" "0000262501" "0000592841" "0000262502" "0000592842" "0000262503" "0000592843" "0000262504" "0000592844" "0000262504" "0000592845" "0000262505" "0000592846" "0000262506" "0000592847" "0000262507" "0000592848" "0000262508" "0000592849" "0000262509" "0000592850" "0000262510" "0000592851" "0000262511" "0000592852" "0000262511" "0000592853" "0000262512" "0000592854" "0000262513" "0000592855" "0000262514" "0000592856" "0000262515" "0000592857" "0000262516" "0000592858" "0000262517" "0000592859" "0000262518" "0000592860" "0000262519" "0000592861" "0000262520" "0000592862" "0000262520" "0000592863" "0000262521" "0000592864" "0000262522" "0000592865" "0000262523" "0000592866" "0000262524" "0000592867" "0000262524" "0000592868" "0000262525" "0000592869" "0000262526" "0000592870" "0000262526" "0000592871" "0000262527" "0000592872" "0000262528" "0000592873" "0000262529" "0000592874" "0000262530" "0000592875" "0000262531" "0000592876" "0000262532" "0000592877" "0000262533" "0000592878" "0000262534" "0000592879" "0000262535" "0000592880" "0000262536" "0000592881" "0000262537" "0000592882" "0000262538" "0000592883" "0000262539" "0000592884" "0000262540" "0000592885" "0000262541" "0000592886" "0000262542" "0000592887" "0000262543" "0000592888" "0000262544" "0000592889" "0000262545" "0000592890" "0000262546" "0000592891" "0000262547" "0000592892" "0000262548" "0000592893" "0000262549" "0000592894" "0000262549" "0000592895" "0000262550" "0000592896" "0000262551" "0000592897" "0000262552" "0000592898" "0000262553" "0000592899" "0000262554" "0000592900" "0000262555" "0000592901" "0000262556" "0000592902" "0000262557" "0000592903" "0000262558" "0000592904" "0000262559" "0000592905" "0000262560" "0000592906" "0000262561" "0000592907" "0000262562" "0000592908" "0000262563" "0000592909" "0000262564" "0000592910" "0000262565" "0000592911" "0000262566" "0000592912" "0000262567" "0000592913" "0000262568" "0000592914" "0000262569" "0000592915" "0000262570" "0000592916" "0000262571" "0000592917" "0000262572" "0000592918" "0000262573" "0000592919" "0000262574" "0000592920" "0000262575" "0000592921" "0000262576" "0000592922" "0000262577" "0000592923" "0000262578" "0000592924" "0000262579" "0000592925" "0000262580" "0000592926" "0000262581" "0000592927" "0000262582" "0000592928" "0000262583" "0000592929" "0000262584" "0000592930" "0000262585" "0000592931" "0000262586" "0000592932" "0000262587" "0000592933" "0000262587" "0000592934" "0000262588" "0000592935" "0000262588" "0000592936" "0000262589" "0000592937" "0000262589" "0000592938" "0000262590" "0000592939" "0000262591" "0000592940" "0000262592" "0000592941" "0000262593" "0000592942" "0000262594" "0000592943" "0000262595" "0000592944" "0000262595" "0000592945" "0000262596" "0000592946" "0000262597" "0000592947" "0000262598" "0000592948" "0000262599" "0000592949" "0000262600" "0000592950" "0000262601" "0000592951" "0000262602" "0000592952" "0000262603" "0000592953" "0000262604" "0000592954" "0000262605" "0000592955" "0000262606" "0000592956" "0000262607" "0000592957" "0000262608" "0000592958" "0000262609" "0000592959" "0000262609" "0000592960" "0000262610" "0000592961" "0000262611" "0000592962" "0000262612" "0000592963" "0000262613" "0000592964" "0000262613" "0000592965" "0000262614" "0000592966" "0000262614" "0000592967" "0000262615" "0000592968" "0000262616" "0000592969" "0000262617" "0000592970" "0000262618" "0000592971" "0000262619" "0000592972" "0000262620" "0000592973" "0000262621" "0000592974" "0000262621" "0000592975" "0000262622" "0000592976" "0000262623" "0000592977" "0000262624" "0000592978" "0000262624" "0000592979" "0000262625" "0000592980" "0000262625" "0000592981" "0000262626" "0000592982" "0000262627" "0000592983" "0000262627" "0000592984" "0000262628" "0000592985" "0000262629" "0000592986" "0000262630" "0000592987" "0000262631" "0000592988" "0000262632" "0000592989" "0000262632" "0000592990" "0000262633" "0000592991" "0000262633" "0000592992" "0000262634" "0000592993" "0000262634" "0000592994" "0000262635" "0000592995" "0000262636" "0000592996" "0000262637" "0000592997" "0000262638" "0000592998" "0000262638" "0000592999" "0000262639" "0000593000" "0000262639" "0000593001" "0000262640" "0000593002" "0000262641" "0000593003" "0000262642" "0000593004" "0000262642" "0000593005" "0000262643" "0000593006" "0000262644" "0000593007" "0000262645" "0000593008" "0000262646" "0000593009" "0000262647" "0000593010" "0000262647" "0000593011" "0000262648" "0000593012" "0000262648" "0000593013" "0000262649" "0000593014" "0000262650" "0000593015" "0000262651" "0000593016" "0000262651" "0000593017" "0000262652" "0000593018" "0000262653" "0000593019" "0000262654" "0000593020" "0000262655" "0000593021" "0000262655" "0000593022" "0000262656" "0000593023" "0000262656" "0000593024" "0000262657" "0000593025" "0000262657" "0000593026" "0000262657" "0000593027" "0000262658" "0000593028" "0000262658" "0000593029" "0000262659" "0000593030" "0000262659" "0000593031" "0000262660" "0000593032" "0000262660" "0000593033" "0000262661" "0000593034" "0000262661" "0000593035" "0000262662" "0000593036" "0000262662" "0000593037" "0000262662" "0000593038" "0000262663" "0000593039" "0000262664" "0000593040" "0000262665" "0000593041" "0000262666" "0000593042" "0000262667" "0000593043" "0000262668" "0000593044" "0000262669" "0000593045" "0000262670" "0000593046" "0000262671" "0000593047" "0000262672" "0000593048" "0000262673" "0000593049" "0000262674" "0000593050" "0000262674" "0000593051" "0000262675" "0000593052" "0000262676" "0000593053" "0000262676" "0000593054" "0000262676" "0000593055" "0000262677" "0000593056" "0000262678" "0000593057" "0000262679" "0000593058" "0000262680" "0000593059" "0000262680" "0000593060" "0000262680" "0000593061" "0000262681" "0000593062" "0000262682" "0000593063" "0000262682" "0000593064" "0000262683" "0000593065" "0000262684" "0000593066" "0000262684" "0000593067" "0000262685" "0000593068" "0000262685" "0000593069" "0000262686" "0000593070" "0000262687" "0000593071" "0000262688" "0000593072" "0000262689" "0000593073" "0000262690" "0000593074" "0000262691" "0000593075" "0000262692" "0000593076" "0000262692" "0000593077" "0000262693" "0000593078" "0000262694" "0000593079" "0000262694" "0000593080" "0000262694" "0000593081" "0000262695" "0000593082" "0000262695" "0000593083" "0000262696" "0000593084" "0000262696" "0000593085" "0000262696" "0000593086" "0000262697" "0000593087" "0000262697" "0000593088" "0000262697" "0000593089" "0000262698" "0000593090" "0000262699" "0000593091" "0000262699" "0000593092" "0000262700" "0000593093" "0000262701" "0000593094" "0000262701" "0000593095" "0000262702" "0000593096" "0000262703" "0000593097" "0000262704" "0000593098" "0000262704" "0000593099" "0000262705" "0000593100" "0000262706" "0000593101" "0000262706" "0000593102" "0000262707" "0000593103" "0000262708" "0000593104" "0000262708" "0000593105" "0000262709" "0000593106" "0000262709" "0000593107" "0000262710" "0000593108" "0000262711" "0000593109" "0000262711" "0000593110" "0000262712" "0000593111" "0000262712" "0000593112" "0000262713" "0000593113" "0000262714" "0000593114" "0000262715" "0000593115" "0000262716" "0000593116" "0000262717" "0000593117" "0000262718" "0000593118" "0000262719" "0000593119" "0000262720" "0000593120" "0000262721" "0000593121" "0000262722" "0000593122" "0000262723" "0000593123" "0000262724" "0000593124" "0000262725" "0000593125" "0000262726" "0000593126" "0000262727" "0000593127" "0000262728" "0000593128" "0000262729" "0000593129" "0000262730" "0000593130" "0000262731" "0000593131" "0000262732" "0000593132" "0000262733" "0000593133" "0000262734" "0000593134" "0000262735" "0000593135" "0000262736" "0000593136" "0000262737" "0000593137" "0000262738" "0000593138" "0000262739" "0000593139" "0000262740" "0000593140" "0000262741" "0000593141" "0000262742" "0000593142" "0000262743" "0000593143" "0000262744" "0000593144" "0000262745" "0000593145" "0000262746" "0000593146" "0000262747" "0000593147" "0000262748" "0000593148" "0000262749" "0000593149" "0000262750" "0000593150" "0000262751" "0000593151" "0000262752" "0000593152" "0000262753" "0000593153" "0000262754" "0000593154" "0000262755" "0000593155" "0000262756" "0000593156" "0000262757" "0000593157" "0000262758" "0000593158" "0000262759" "0000593159" "0000262760" "0000593160" "0000262761" "0000593161" "0000262762" "0000593162" "0000262763" "0000593163" "0000262764" "0000593164" "0000262765" "0000593165" "0000262766" "0000593166" "0000262767" "0000593167" "0000262768" "0000593168" "0000262769" "0000593169" "0000262770" "0000593170" "0000262771" "0000593171" "0000262772" "0000593172" "0000262773" "0000593173" "0000262774" "0000593174" "0000262775" "0000593175" "0000262776" "0000593176" "0000262777" "0000593177" "0000262778" "0000593178" "0000262779" "0000593179" "0000262780" "0000593180" "0000262781" "0000593181" "0000262782" "0000593182" "0000262783" "0000593183" "0000262784" "0000593184" "0000262785" "0000593185" "0000262786" "0000593186" "0000262787" "0000593187" "0000262788" "0000593188" "0000262789" "0000593189" "0000262790" "0000593190" "0000262791" "0000593191" "0000262792" "0000593192" "0000262793" "0000593193" "0000262794" "0000593194" "0000262795" "0000593195" "0000262796" "0000593196" "0000262797" "0000593197" "0000262798" "0000593198" "0000262799" "0000593199" "0000262800" "0000593200" "0000262801" "0000593201" "0000262802" "0000593202" "0000262803" "0000593203" "0000262804" "0000593204" "0000262805" "0000593205" "0000262806" "0000593206" "0000262807" "0000593207" "0000262808" "0000593208" "0000262808" "0000593209" "0000262809" "0000593210" "0000262810" "0000593211" "0000262810" "0000593212" "0000262811" "0000593213" "0000262812" "0000593214" "0000262812" "0000593215" "0000262813" "0000593216" "0000262813" "0000593217" "0000262814" "0000593218" "0000262814" "0000593219" "0000262815" "0000593220" "0000262816" "0000593221" "0000262817" "0000593222" "0000262818" "0000593223" "0000262819" "0000593224" "0000262820" "0000593225" "0000262821" "0000593226" "0000262822" "0000593227" "0000262823" "0000593228" "0000262824" "0000593229" "0000262825" "0000593230" "0000262826" "0000593231" "0000262827" "0000593232" "0000262828" "0000593233" "0000262829" "0000593234" "0000262830" "0000593235" "0000262831" "0000593236" "0000262832" "0000593237" "0000262833" "0000593238" "0000262834" "0000593239" "0000262835" "0000593240" "0000262836" "0000593241" "0000262837" "0000593242" "0000262838" "0000593243" "0000262839" "0000593244" "0000262840" "0000593245" "0000262841" "0000593246" "0000262842" "0000593247" "0000262843" "0000593248" "0000262844" "0000593249" "0000262845" "0000593250" "0000262846" "0000593251" "0000262847" "0000593252" "0000262847" "0000593253" "0000262848" "0000593254" "0000262848" "0000593255" "0000262849" "0000593256" "0000262850" "0000593257" "0000262850" "0000593258" "0000262851" "0000593259" "0000262852" "0000593260" "0000262853" "0000593261" "0000262854" "0000593262" "0000262854" "0000593263" "0000262855" "0000593264" "0000262856" "0000593265" "0000262857" "0000593266" "0000262858" "0000593267" "0000262858" "0000593268" "0000262859" "0000593269" "0000262859" "0000593270" "0000262860" "0000593271" "0000262861" "0000593272" "0000262862" "0000593273" "0000262863" "0000593274" "0000262864" "0000593275" "0000262865" "0000593276" "0000262866" "0000593277" "0000262867" "0000593278" "0000262868" "0000593279" "0000262869" "0000593280" "0000262870" "0000593281" "0000262871" "0000593282" "0000262872" "0000593283" "0000262873" "0000593284" "0000262874" "0000593285" "0000262875" "0000593286" "0000262876" "0000593287" "0000262877" "0000593288" "0000262878" "0000593289" "0000262879" "0000593290" "0000262880" "0000593291" "0000262881" "0000593292" "0000262882" "0000593293" "0000262883" "0000593294" "0000262884" "0000593295" "0000262885" "0000593296" "0000262886" "0000593297" "0000262887" "0000593298" "0000262888" "0000593299" "0000262889" "0000593300" "0000262890" "0000593301" "0000262891" "0000593302" "0000262892" "0000593303" "0000262893" "0000593304" "0000262894" "0000593305" "0000262894" "0000593306" "0000262895" "0000593307" "0000262896" "0000593308" "0000262897" "0000593309" "0000262898" "0000593310" "0000262899" "0000593311" "0000262900" "0000593312" "0000262901" "0000593313" "0000262902" "0000593314" "0000262903" "0000593315" "0000262904" "0000593316" "0000262904" "0000593317" "0000262905" "0000593318" "0000262906" "0000593319" "0000262907" "0000593320" "0000262908" "0000593321" "0000262909" "0000593322" "0000262909" "0000593323" "0000262910" "0000593324" "0000262910" "0000593325" "0000262911" "0000593326" "0000262912" "0000593327" "0000262912" "0000593328" "0000262913" "0000593329" "0000262913" "0000593330" "0000262914" "0000593331" "0000262914" "0000593332" "0000262915" "0000593333" "0000262916" "0000593334" "0000262917" "0000593335" "0000262918" "0000593336" "0000262919" "0000593337" "0000262920" "0000593338" "0000262921" "0000593339" "0000262922" "0000593340" "0000262923" "0000593341" "0000262924" "0000593342" "0000262924" "0000593343" "0000262925" "0000593344" "0000262925" "0000593345" "0000262926" "0000593346" "0000262926" "0000593347" "0000262927" "0000593348" "0000262927" "0000593349" "0000262928" "0000593350" "0000262929" "0000593351" "0000262930" "0000593352" "0000262931" "0000593353" "0000262932" "0000593354" "0000262932" "0000593355" "0000262933" "0000593356" "0000262934" "0000593357" "0000262935" "0000593358" "0000262936" "0000593359" "0000262936" "0000593360" "0000262937" "0000593361" "0000262937" "0000593362" "0000262938" "0000593363" "0000262938" "0000593364" "0000262939" "0000593365" "0000262939" "0000593366" "0000262939" "0000593367" "0000262940" "0000593368" "0000262941" "0000593369" "0000262942" "0000593370" "0000262943" "0000593371" "0000262944" "0000593372" "0000262945" "0000593373" "0000262946" "0000593374" "0000262947" "0000593375" "0000262948" "0000593376" "0000262949" "0000593377" "0000262950" "0000593378" "0000262951" "0000593379" "0000262952" "0000593380" "0000262952" "0000593381" "0000262953" "0000593382" "0000262953" "0000593383" "0000262954" "0000593384" "0000262955" "0000593385" "0000262956" "0000593386" "0000262957" "0000593387" "0000262958" "0000593388" "0000262959" "0000593389" "0000262960" "0000593390" "0000262961" "0000593391" "0000262962" "0000593392" "0000262963" "0000593393" "0000262964" "0000593394" "0000262965" "0000593395" "0000262966" "0000593396" "0000262967" "0000593397" "0000262968" "0000593398" "0000262969" "0000593399" "0000262970" "0000593400" "0000262971" "0000593401" "0000262972" "0000593402" "0000262973" "0000593403" "0000262974" "0000593404" "0000262975" "0000593405" "0000262975" "0000593406" "0000262976" "0000593407" "0000262976" "0000593408" "0000262977" "0000593409" "0000262978" "0000593410" "0000262979" "0000593411" "0000262979" "0000593412" "0000262980" "0000593413" "0000262981" "0000593414" "0000262982" "0000593415" "0000262983" "0000593416" "0000262984" "0000593417" "0000262985" "0000593418" "0000262986" "0000593419" "0000262987" "0000593420" "0000262988" "0000593421" "0000262989" "0000593422" "0000262990" "0000593423" "0000262991" "0000593424" "0000262992" "0000593425" "0000262993" "0000593426" "0000262994" "0000593427" "0000262995" "0000593428" "0000262996" "0000593429" "0000262997" "0000593430" "0000262998" "0000593431" "0000262999" "0000593432" "0000263000" "0000593433" "0000263001" "0000593434" "0000263002" "0000593435" "0000263003" "0000593436" "0000263004" "0000593437" "0000263005" "0000593438" "0000263006" "0000593439" "0000263007" "0000593440" "0000263008" "0000593441" "0000263009" "0000593442" "0000263010" "0000593443" "0000263011" "0000593444" "0000263012" "0000593445" "0000263013" "0000593446" "0000263014" "0000593447" "0000263015" "0000593448" "0000263016" "0000593449" "0000263017" "0000593450" "0000263018" "0000593451" "0000263019" "0000593452" "0000263020" "0000593453" "0000263021" "0000593454" "0000263022" "0000593455" "0000263023" "0000593456" "0000263024" "0000593457" "0000263025" "0000593458" "0000263026" "0000593459" "0000263027" "0000593460" "0000263028" "0000593461" "0000263029" "0000593462" "0000263030" "0000593463" "0000263031" "0000593464" "0000263032" "0000593465" "0000263033" "0000593466" "0000263034" "0000593467" "0000263035" "0000593468" "0000263036" "0000593469" "0000263037" "0000593470" "0000263038" "0000593471" "0000263039" "0000593472" "0000263040" "0000593473" "0000263041" "0000593474" "0000263042" "0000593475" "0000263043" "0000593476" "0000263044" "0000593477" "0000263045" "0000593478" "0000263046" "0000593479" "0000263047" "0000593480" "0000263048" "0000593481" "0000263049" "0000593482" "0000263050" "0000593483" "0000263051" "0000593484" "0000263052" "0000593485" "0000263053" "0000593486" "0000263054" "0000593487" "0000263055" "0000593488" "0000263056" "0000593489" "0000263057" "0000593490" "0000263058" "0000593491" "0000263059" "0000593492" "0000263060" "0000593493" "0000263061" "0000593494" "0000263062" "0000593495" "0000263063" "0000593496" "0000263064" "0000593497" "0000263065" "0000593498" "0000263066" "0000593499" "0000263067" "0000593500" "0000263068" "0000593501" "0000263069" "0000593502" "0000263070" "0000593503" "0000263071" "0000593504" "0000263072" "0000593505" "0000263073" "0000593506" "0000263074" "0000593507" "0000263075" "0000593508" "0000263076" "0000593509" "0000263077" "0000593510" "0000263078" "0000593511" "0000263079" "0000593512" "0000263080" "0000593513" "0000263081" "0000593514" "0000263082" "0000593515" "0000263083" "0000593516" "0000263084" "0000593517" "0000263085" "0000593518" "0000263085" "0000593519" "0000263086" "0000593520" "0000263087" "0000593521" "0000263088" "0000593522" "0000263088" "0000593523" "0000263088" "0000593524" "0000263089" "0000593525" "0000263089" "0000593526" "0000263090" "0000593527" "0000263090" "0000593528" "0000263091" "0000593529" "0000263091" "0000593530" "0000263092" "0000593531" "0000263092" "0000593532" "0000263093" "0000593533" "0000263093" "0000593534" "0000263094" "0000593535" "0000263094" "0000593536" "0000263095" "0000593537" "0000263095" "0000593538" "0000263095" "0000593539" "0000263096" "0000593540" "0000263096" "0000593541" "0000263097" "0000593542" "0000263098" "0000593543" "0000263099" "0000593544" "0000263099" "0000593545" "0000263100" "0000593546" "0000263100" "0000593547" "0000263101" "0000593548" "0000263102" "0000593549" "0000263103" "0000593550" "0000263104" "0000593551" "0000263105" "0000593552" "0000263105" "0000593553" "0000263106" "0000593554" "0000263106" "0000593555" "0000263106" "0000593556" "0000263107" "0000593557" "0000263108" "0000593558" "0000263108" "0000593559" "0000263109" "0000593560" "0000263110" "0000593561" "0000263111" "0000593562" "0000263112" "0000593563" "0000263112" "0000593564" "0000263113" "0000593565" "0000263113" "0000593566" "0000263114" "0000593567" "0000263115" "0000593568" "0000263115" "0000593569" "0000263116" "0000593570" "0000263116" "0000593571" "0000263117" "0000593572" "0000263118" "0000593573" "0000263119" "0000593574" "0000263120" "0000593575" "0000263121" "0000593576" "0000263122" "0000593577" "0000263123" "0000593578" "0000263124" "0000593579" "0000263125" "0000593580" "0000263126" "0000593581" "0000263127" "0000593582" "0000263128" "0000593583" "0000263128" "0000593584" "0000263129" "0000593585" "0000263130" "0000593586" "0000263131" "0000593587" "0000263131" "0000593588" "0000263132" "0000593589" "0000263132" "0000593590" "0000263133" "0000593591" "0000263134" "0000593592" "0000263134" "0000593593" "0000263135" "0000593594" "0000263135" "0000593595" "0000263136" "0000593596" "0000263136" "0000593597" "0000263137" "0000593598" "0000263138" "0000593599" "0000263138" "0000593600" "0000263139" "0000593601" "0000263139" "0000593602" "0000263140" "0000593603" "0000263140" "0000593604" "0000263141" "0000593605" "0000263141" "0000593606" "0000263142" "0000593607" "0000263142" "0000593608" "0000263143" "0000593609" "0000263143" "0000593610" "0000263144" "0000593611" "0000263144" "0000593612" "0000263145" "0000593613" "0000263146" "0000593614" "0000263147" "0000593615" "0000263148" "0000593616" "0000263148" "0000593617" "0000263149" "0000593618" "0000263149" "0000593619" "0000263150" "0000593620" "0000263151" "0000593621" "0000263152" "0000593622" "0000263153" "0000593623" "0000263154" "0000593624" "0000263155" "0000593625" "0000263156" "0000593626" "0000263157" "0000593627" "0000263157" "0000593628" "0000263158" "0000593629" "0000263159" "0000593630" "0000263160" "0000593631" "0000263161" "0000593632" "0000263162" "0000593633" "0000263163" "0000593634" "0000263163" "0000593635" "0000263164" "0000593636" "0000263165" "0000593637" "0000263166" "0000593638" "0000263167" "0000593639" "0000294179" "0000650868" "0000294180" "0000650869" "0000294181" "0000650870" "0000294182" "0000650871" "0000294183" "0000650872" "0000294184" "0000650873" "0000296356" "0000653045" "0000296653" "0000653342" "0000306006" "0000669694" "0000316678" "0000698840" "0000386739" "0000814419" "0000415708" "0000873572" "0000415708" "0000873573" "0000416537" "0000874665" "0000453196" "0000987719" "0000453198" "0000987722" "0000453251" "0000987801" "0000453267" "0000987828" "0000455225" "0001007258" "0000455225" "0001007381"