### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = CDKL5) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "CDKL5" "cyclin-dependent kinase-like 5" "X" "p22" "unknown" "NG_008475.1" "UD_132118353676" "" "https://www.LOVD.nl/CDKL5" "" "1" "11411" "6792" "300203" "1" "1" "1" "1" "Change to MANE transcript.\r\nAlias STK9.\r\nEstablishment of the database was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "https://databases.lovd.nl/shared/refseq/CDKL5_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2009-03-06 00:00:00" "00006" "2021-12-10 17:48:29" "00006" "2025-11-13 13:04:16" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001567" "CDKL5" "transcript variant I" "001" "NM_003159.2" "" "NP_003150.1" "" "" "" "-253" "3178" "3093" "18443725" "18671749" "00000" "2012-09-13 13:40:14" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 15 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00065" "Rett syndrome" "Rett syndrome, congenital variant" "AD" "613454" "" "" "" "00008" "2012-10-31 14:44:58" "00006" "2022-05-30 12:45:18" "00067" "DEE2" "encephalopathy, developmental and epileptic, type 2" "XLD" "300672" "" "" "" "00008" "2012-10-31 15:28:07" "00006" "2024-02-02 17:34:51" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00187" "MRX;IDX" "mental retardation, X-linked (MRX, intellectual disability (IDX))" "" "" "" "X-linked" "" "00006" "2013-09-05 15:56:47" "00006" "2018-12-18 09:23:21" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00230" "AS" "Angelman syndrome (AS)" "AD" "105830" "" "" "" "00006" "2013-10-09 19:24:15" "00006" "2021-12-10 21:51:32" "00344" "EE" "encephalopathy, epileptic (EE)" "" "" "" "" "" "00006" "2014-03-12 21:57:45" "00006" "2015-12-07 07:11:25" "00841" "EIEE" "encephalopathy, epileptic, early infantile (EIEE)" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2015-02-20 16:58:56" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02262" "RS1" "retinoschisis, type 1, X-linked" "XLR" "312700" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2024-12-19 09:25:40" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04270" "epilepsy" "epilepsy" "" "" "" "" "" "00006" "2015-05-14 16:00:06" "00006" "2017-09-07 14:25:59" "05533" "MR;ID" "mental retardation (MR, intellectual disability (ID))" "" "" "" "" "" "00006" "2018-12-18 09:22:07" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "06906" "DEE" "encephalopathy, developmental and epileptic" "" "" "" "" "" "00006" "2022-04-07 09:24:23" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "CDKL5" "00067" "CDKL5" "00139" "CDKL5" "00230" ## Individuals ## Do not remove or alter this header ## ## Count = 688 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000102" "" "" "" "1" "" "00004" "{PMID:Almomani 2011:21102627}" "" "" "" "" "" "" "" "" "" "" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00035146" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035147" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035148" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035149" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035150" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035151" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035152" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035153" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035154" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035155" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035156" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035157" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035158" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035159" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035160" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035161" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035162" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00050639" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00081063" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected non-carrier parents" "" "" "" "" "0" "" "" "" "" "00081085" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected non-carrier parents" "" "" "" "" "0" "" "" "" "" "00087273" "" "" "" "2" "" "00006" "{PMID:Huopaniemi 2000:11013441}" "family, 2 affected sibs" "M" "no" "Denmark" "" "0" "" "" "" "FamRS315" "00114879" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377263-Pat?" "00114880" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377264-Pat?" "00114881" "" "" "" "16" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "?" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377265-Pat?" "00114882" "" "" "" "11" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377266-Pat?" "00114883" "" "" "" "1" "" "00485" "" "" "" "" "Germany" "" "0" "" "" "" "" "00114884" "" "" "" "8" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377267-Pat?" "00114885" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377268-Pat?" "00114886" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377269-Pat?" "00114887" "" "" "" "1" "" "01989" "" "" "F" "" "Greece" "" "0" "" "" "" "" "00114888" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377270-Pat?" "00114889" "" "" "" "1" "" "00485" "" "" "" "" "Germany" "" "0" "" "" "" "" "00114890" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "?" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377271-Pat?" "00114891" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "?" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377272-Pat?" "00114892" "" "" "" "1" "" "00485" "" "" "" "" "Germany" "" "0" "" "" "" "" "00114893" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377273-Pat?" "00114894" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377274-Pat?" "00114895" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "?" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377275-Pat?" "00114896" "" "" "" "1" "" "00485" "" "" "" "" "Germany" "" "0" "" "" "" "" "00114897" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377276-Pat?" "00114898" "" "" "" "1" "" "00485" "" "" "" "" "Germany" "" "0" "" "" "" "" "00114899" "" "" "" "1" "" "00485" "" "" "" "" "Germany" "" "0" "" "" "" "" "00114900" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377277-Pat?" "00114901" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377278-Pat?" "00114902" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "unrelated girls" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377279-Pat?" "00114903" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "unrelated girls" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377280-Pat?" "00114904" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377281-Pat?" "00114905" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377282-Pat?" "00114906" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377283-Pat?" "00114907" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "family, affected twin girls and an affected brother" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377284-Pat?" "00114908" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377285-Pat?" "00114909" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "monozygotic twins" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377286-Pat?" "00114910" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "monozygotic twins" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377287-Pat?" "00114911" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377288-Pat?" "00114912" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377289-Pat?" "00114913" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377290-Pat?" "00114914" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377291-Pat?" "00114915" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377292-Pat?" "00114916" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377293-Pat?" "00114917" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377294-Pat?" "00114918" "" "" "" "3" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377295-Pat?" "00114919" "" "" "" "1" "" "00485" "" "" "" "" "Germany" "" "0" "" "" "" "" "00114920" "" "" "" "1" "" "00485" "" "" "" "" "Germany" "" "0" "" "" "" "" "00114921" "" "" "" "1" "" "00485" "" "" "" "" "Germany" "" "0" "" "" "" "" "00114922" "" "" "" "1" "" "00485" "" "" "" "" "Germany" "" "0" "" "" "" "" "00114923" "" "" "" "1" "" "00485" "" "" "" "" "Germany" "" "0" "" "" "" "" "00114924" "" "" "" "5" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377296-Pat?" "00114925" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377297-Pat?" "00114926" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377298-Pat?" "00114927" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377299-Pat?" "00114928" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377300-Pat?" "00114929" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377301-Pat?" "00114930" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377302-Pat?" "00114931" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377303-Pat?" "00114932" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "family, affected twin girls and an affected brother" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377304-Pat?" "00114933" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377305-Pat?" "00114934" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377306-Pat?" "00114935" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377307-Pat?" "00114936" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "-" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377308-Pat?" "00114937" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377309-Pat?" "00114938" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "family, affected twin girls and an affected brother" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377310-Pat?" "00114939" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377311-Pat?" "00114940" "" "" "" "1" "" "01982" "" "hypotonia, development delay" "F" "" "Brazil" "" "0" "" "" "" "" "00114941" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377312-Pat?" "00114942" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377313-Pat?" "00114943" "" "" "" "2" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377314-Pat?" "00114944" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377315-Pat?" "00114945" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377316-Pat?" "00114947" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377318-Pat?" "00114955" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377326-Pat?" "00114956" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377327-Pat?" "00114957" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377328-Pat?" "00114958" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377329-Pat?" "00114959" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377330-Pat?" "00114960" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377331-Pat?" "00114961" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377332-Pat?" "00114962" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377333-Pat?" "00114963" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377334-Pat?" "00114964" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377335-Pat?" "00114965" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "F" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377336-Pat?" "00114966" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377337-Pat?" "00114967" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377338-Pat?" "00114968" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377339-Pat?" "00114969" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377340-Pat?" "00114970" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377341-Pat?" "00114971" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "?" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377342-Pat?" "00114972" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377343-Pat?" "00114973" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377344-Pat?" "00132118" "" "" "" "1" "" "00006" "Kucinskas, ASHG2017, P1110" "" "" "" "Lithuania" "" "0" "" "" "" "Pat1" "00132786" "" "" "" "1" "" "02302" "" "" "" "" "Spain" "" "0" "" "" "" "47" "00177004" "" "" "" "1" "" "02552" "" "" "M" "no" "Macedonia" "" "0" "" "" "" "72404" "00209017" "" "" "" "1" "" "00006" "{PMID:Lionel 2018:28771251}" "" "F" "" "Canada" "" "0" "" "" "" "28771251-Pat29" "00274191" "" "" "" "1" "" "00006" "{PMID:Pronicka 2016:27290639}" "no family history" "M" "" "Poland" "" "0" "" "" "" "Pat65" "00295000" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295001" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295002" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295003" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295004" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295005" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295007" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295008" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295009" "" "" "" "31" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00303126" "" "" "" "1" "" "00006" "{PMID:Carvill 2013:23708187}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "T20819" "00303127" "" "" "" "1" "" "00006" "{PMID:Carvill 2013:23708187}" "2-generation family, 1 affected, unaffected carrier mother" "M" "" "" "" "0" "" "" "" "T22724" "00303128" "" "" "" "1" "" "00006" "{PMID:Carvill 2013:23708187}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "T22954" "00303129" "" "" "" "1" "" "00006" "{PMID:Carvill 2013:23708187}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "T897" "00303130" "" "" "" "1" "" "00006" "{PMID:Carvill 2013:23708187}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "T23057" "00303131" "" "" "" "1" "" "00006" "{PMID:Carvill 2013:23708187}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "T23951" "00303132" "" "" "" "1" "" "00006" "{PMID:Carvill 2013:23708187}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "T23234" "00303133" "" "" "" "1" "" "00006" "{PMID:Carvill 2013:23708187}" "2-generation family, 1 affected, unaffected parents" "M" "" "" "" "0" "" "" "" "T24139" "00303147" "" "" "" "1" "" "00006" "{PMID:Carvill 2013:23708187}" "" "" "" "" "" "0" "" "" "" "T22652" "00303148" "" "" "" "1" "" "00006" "{PMID:Carvill 2013:23708187}" "" "" "" "" "" "0" "" "" "" "T17329" "00305288" "" "" "" "13" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00305971" "" "" "" "1" "" "00006" "{PMID:Johannesen 2020:32427350}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat2" "00305972" "" "" "" "1" "" "00006" "{PMID:Johannesen 2020:32427350}" "" "F" "" "Denmark" "" "0" "" "" "" "Pat3" "00309546" "" "" "" "1" "" "00006" "{PMID:Sanchis-Juan 2018:30526634}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat4" "00309892" "" "" "" "1" "" "03771" "" "" "F" "no" "Slovakia (Slovak Republic)" "" "" "" "" "" "" "00309893" "" "" "" "1" "" "03771" "" "" "F" "no" "Slovakia (Slovak Republic)" "" "" "" "" "" "" "00309894" "" "" "" "1" "" "03771" "" "" "F" "no" "Slovakia (Slovak Republic)" "" "" "" "" "" "" "00309895" "" "" "" "1" "" "03771" "" "" "M" "no" "Slovakia (Slovak Republic)" "" "" "" "" "" "" "00309896" "" "" "" "1" "" "03771" "" "" "M" "no" "Slovakia (Slovak Republic)" "" "" "" "" "" "" "00309897" "" "" "" "1" "" "03771" "" "" "M" "no" "Slovakia (Slovak Republic)" "" "" "" "" "" "" "00313780" "" "" "" "1" "" "00778" "" "" "F" "no" "Italy" "" "0" "" "" "" "" "00320171" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00361487" "" "" "" "1" "" "00006" "{PMID:Anazi 2017:27431290}" "simplex case" "M" "no" "Saudi Arabia" "" "0" "" "" "" "11DG2132" "00361582" "" "" "" "1" "" "00006" "{PMID:Anazi 2017:27431290}" "simplex case" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "13DG1051" "00374238" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-488" "00374287" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-2427" "00374681" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-2964" "00374682" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-3975" "00374683" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-5296" "00374684" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-2466" "00388727" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 6, retinoschisis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "11" "00388758" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 22, retinoschisis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "42" "00388765" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 26, retinoschisis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "49" "00388766" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 26, retinoschisis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "50" "00388779" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 32, retinoschisis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "63" "00388784" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 33, retinoschisis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "68" "00388787" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 35, retinoschisis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "71" "00388788" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 36, retinoschisis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "72" "00388790" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 37, retinoschisis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "74" "00388898" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 69, retinoschisis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "182" "00388905" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 71, retinoschisis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "189" "00388910" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 72, retinoschisis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "194" "00388919" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 73, retinoschisis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "203" "00388962" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 84, unclassified / mixed, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "246" "00388963" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 84, unclassified / mixed, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "247" "00391384" "" "" "" "1" "" "00000" "{PMID:Méjécase 2020:3278337" "" "?" "" "United Arab Emirates" "" "0" "" "" "" "52" "00391385" "" "" "" "1" "" "00000" "{PMID:Méjécase 2020:3278337" "" "?" "" "United Arab Emirates" "" "0" "" "" "" "53" "00391505" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "" "" "New Zealand" "" "0" "" "" "white" "3" "00391508" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "" "" "New Zealand" "" "0" "" "" "white" "4" "00391509" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "" "" "New Zealand" "" "0" "" "" "white" "5" "00391510" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "" "" "New Zealand" "" "0" "" "" "white" "6" "00391511" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "" "" "New Zealand" "" "0" "" "" "Middle Eastern" "7" "00391512" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "" "" "New Zealand" "" "0" "" "" "white" "8" "00391513" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "" "" "New Zealand" "" "0" "" "" "white" "9" "00391514" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "" "" "New Zealand" "" "0" "" "" "white" "10" "00391515" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "" "" "New Zealand" "" "0" "" "" "white" "11" "00391516" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "" "" "New Zealand" "" "0" "" "" "Indian" "12" "00395926" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F087" "00395927" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F210" "00395952" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F215" "00395989" "" "" "" "1" "" "00000" "{PMID:Vijayasarathy 2010:20809529}" "" "M" "" "(United States)" "" "0" "" "" "" "5" "00395990" "" "" "" "1" "" "00000" "{PMID:Vijayasarathy 2010:20809529}" "" "M" "" "(United States)" "" "0" "" "" "" "6" "00395991" "" "" "" "1" "" "00000" "{PMID:Vijayasarathy 2010:20809529}" "" "M" "" "(United States)" "" "0" "" "" "" "7" "00395992" "" "" "" "1" "" "00000" "{PMID:Vijayasarathy 2010:20809529}" "" "M" "" "(United States)" "" "0" "" "" "" "8" "00395993" "" "" "" "1" "" "00000" "{PMID:Vijayasarathy 2010:20809529}" "" "M" "" "(United States)" "" "0" "" "" "" "9" "00395994" "" "" "" "1" "" "00000" "{PMID:Vijayasarathy 2010:20809529}" "" "M" "" "(United States)" "" "0" "" "" "" "10" "00395995" "" "" "" "1" "" "00000" "{PMID:Vijayasarathy 2010:20809529}" "" "M" "" "(United States)" "" "0" "" "" "" "11" "00395996" "" "" "" "1" "" "00000" "{PMID:Vijayasarathy 2010:20809529}" "" "M" "" "(United States)" "" "0" "" "" "" "12" "00396002" "" "" "" "1" "" "00000" "{PMID:Xu 2011:21701876}" "Family A, individual II-1" "M" "" "China" "" "0" "" "" "" "II-1" "00396003" "" "" "" "1" "" "00000" "{PMID:Xu 2011:21701876}" "Family B, individual II-1" "M" "" "China" "" "0" "" "" "" "II-1" "00396004" "" "" "" "1" "" "00000" "{PMID:Xu 2011:21701876}" "Family C, individual III-1" "M" "" "China" "" "0" "" "" "" "III-1" "00396005" "" "" "" "1" "" "00000" "{PMID:Xu 2011:21701876}" "Family C, individual II-2" "M" "" "China" "" "0" "" "" "" "II-2" "00396006" "" "" "" "1" "" "00000" "{PMID:Xu 2011:21701876}" "Family D, individual IV-1" "M" "" "China" "" "0" "" "" "" "IV-1" "00396007" "" "" "" "1" "" "00000" "{PMID:Xu 2011:21701876}" "Family D, individual II-1" "M" "" "China" "" "0" "" "" "" "II-1" "00396008" "" "" "" "1" "" "00000" "{PMID:Xu 2011:21701876}" "Family E, individual III-1" "M" "" "China" "" "0" "" "" "" "III-1" "00396009" "" "" "" "1" "" "00000" "{PMID:Xu 2011:21701876}" "Family F, individual III-1" "M" "" "China" "" "0" "" "" "" "III-1" "00396020" "" "" "" "1" "" "00000" "{PMID:Armanda-Maresca 2011:21836411}" "" "?" "" "Spain" "" "0" "" "" "" "F119" "00396021" "" "" "" "1" "" "00000" "{PMID:Duncan 2011:22110067}" "" "?" "" "United States" "" "0" "" "" "" "1" "00396022" "" "" "" "1" "" "00000" "{PMID:Duncan 2011:22110067}" "" "?" "" "United States" "" "0" "" "" "" "2" "00396036" "" "" "" "1" "" "00000" "{PMID:Yi 2012:22245991}" "" "M" "" "China" "" "0" "" "" "" "QT221" "00396037" "" "" "" "1" "" "00000" "{PMID:Yi 2012:22245991}" "" "M" "" "China" "" "0" "" "" "" "QT232" "00396038" "" "" "" "1" "" "00000" "{PMID:Yi 2012:22245991}" "" "M" "" "China" "" "0" "" "" "" "QT653" "00396039" "" "" "" "1" "" "00000" "{PMID:Yi 2012:22245991}" "" "M" "" "China" "" "0" "" "" "" "MD015" "00396040" "" "" "" "1" "" "00000" "{PMID:Yi 2012:22245991}" "" "M" "" "China" "" "0" "" "" "" "RP006" "00396041" "" "" "" "1" "" "00000" "{PMID:Yi 2012:22245991}" "" "M" "" "China" "" "0" "" "" "" "MD030" "00396042" "" "" "" "1" "" "00000" "{PMID:Yi 2012:22245991}" "" "M" "" "China" "" "0" "" "" "" "QT212" "00396043" "" "" "" "1" "" "00000" "{PMID:Yi 2012:22245991}" "" "M" "" "China" "" "0" "" "" "" "QT417" "00396044" "" "" "" "1" "" "00000" "{PMID:Yi 2012:22245991}" "" "M" "" "China" "" "0" "" "" "" "QT848" "00396045" "" "" "" "1" "" "00000" "{PMID:Yi 2012:22245991}" "" "M" "" "China" "" "0" "" "" "" "QT911" "00396046" "" "" "" "1" "" "00000" "{PMID:Yi 2012:22245991}" "" "M" "" "China" "" "0" "" "" "" "QT219" "00396047" "" "" "" "1" "" "00000" "{PMID:Yi 2012:22245991}" "" "M" "" "China" "" "0" "" "" "" "QT758" "00396050" "" "" "" "1" "" "00000" "{PMID:Skorczyk 2012:23288992}" "" "M" "" "Poland" "" "0" "" "" "" "3" "00396051" "" "" "" "1" "" "00000" "{PMID:Skorczyk 2012:23288992}" "" "M" "" "Poland" "" "0" "" "" "" "4" "00396052" "" "" "" "1" "" "00000" "{PMID:Skorczyk 2012:23288992}" "" "M" "" "Poland" "" "0" "" "" "" "5" "00396053" "" "" "" "1" "" "00000" "{PMID:Skorczyk 2012:23288992}" "" "M" "" "Poland" "" "0" "" "" "" "6" "00396054" "" "" "" "1" "" "00000" "{PMID:Skorczyk 2012:23288992}" "" "M" "" "Poland" "" "0" "" "" "" "7" "00396055" "" "" "" "1" "" "00000" "{PMID:Skorczyk 2012:23288992}" "" "M" "" "Poland" "" "0" "" "" "" "8" "00396056" "" "" "" "1" "" "00000" "{PMID:Skorczyk 2012:23288992}" "" "M" "" "Poland" "" "0" "" "" "" "9" "00396057" "" "" "" "1" "" "00000" "{PMID:Skorczyk 2012:23288992}" "" "M" "" "Poland" "" "0" "" "" "" "10" "00396062" "" "" "" "1" "" "00000" "{PMID:Sergeev 2013:23847049}" "patient ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "1" "00396063" "" "" "" "7" "" "00000" "{PMID:Sergeev 2013:23847049}" "7 patients, ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "2" "00396064" "" "" "" "2" "" "00000" "{PMID:Sergeev 2013:23847049}" "2 patients, ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "3" "00396065" "" "" "" "1" "" "00000" "{PMID:Sergeev 2013:23847049}" "patient ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "4" "00396066" "" "" "" "2" "" "00000" "{PMID:Sergeev 2013:23847049}" "2 patients, ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "5" "00396067" "" "" "" "2" "" "00000" "{PMID:Sergeev 2013:23847049}" "2 patients, ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "6" "00396068" "" "" "" "1" "" "00000" "{PMID:Sergeev 2013:23847049}" "patient ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "7" "00396069" "" "" "" "1" "" "00000" "{PMID:Sergeev 2013:23847049}" "patient ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "8" "00396070" "" "" "" "1" "" "00000" "{PMID:Sergeev 2013:23847049}" "patient ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "9" "00396071" "" "" "" "1" "" "00000" "{PMID:Sergeev 2013:23847049}" "patient ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "10" "00396072" "" "" "" "1" "" "00000" "{PMID:Sergeev 2013:23847049}" "patient ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "11" "00396073" "" "" "" "1" "" "00000" "{PMID:Sergeev 2013:23847049}" "patient ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "12" "00396078" "" "" "" "1" "" "00000" "{PMID:Sergeev 2013:23847049}" "patient ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "17" "00396082" "" "" "" "1" "" "00000" "{PMID:Sergeev 2013:23847049}" "patient ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "21" "00396083" "" "" "" "1" "" "00000" "{PMID:Sergeev 2013:23847049}" "patient ID ascribed consecutively (no ID in the paper)" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "22" "00396085" "" "" "" "1" "" "00000" "{PMID:Chu 2013:23568735}" "Family 1, proband (only from abstract)" "M" "" "China" "" "0" "" "" "" "1" "00396086" "" "" "" "1" "" "00000" "{PMID:Chu 2013:23568735}" "Family 2, proband (only from abstract)" "M" "" "China" "" "0" "" "" "" "2" "00396089" "" "" "" "1" "" "00000" "{PMID:Chen 2014:24505212}" "" "M" "" "China" "" "0" "" "" "" "113001" "00396090" "" "" "" "1" "" "00000" "{PMID:Chen 2014:24505212}" "" "M" "" "China" "" "0" "" "" "" "113010" "00396091" "" "" "" "1" "" "00000" "{PMID:Chen 2014:24505212}" "" "M" "" "China" "" "0" "" "" "" "113020" "00396095" "" "" "" "1" "" "00000" "{PMID:Chen 2014:24505212}" "" "M" "" "China" "" "0" "" "" "" "113060" "00396096" "" "" "" "1" "" "00000" "{PMID:Chen 2014:24505212}" "" "M" "" "China" "" "0" "" "" "" "113070" "00396097" "" "" "" "1" "" "00000" "{PMID:Chen 2014:24505212}" "" "M" "" "China" "" "0" "" "" "" "113080" "00396099" "" "" "" "1" "" "00000" "{PMID:Chen 2014:24505212}" "" "M" "" "China" "" "0" "" "" "" "113100" "00396100" "" "" "" "1" "" "00000" "{PMID:Chen 2014:24505212}" "" "M" "" "China" "" "0" "" "" "" "113110" "00396101" "" "" "" "1" "" "00000" "{PMID:Chen 2014:24505212}" "" "M" "" "China" "" "0" "" "" "" "113120" "00396102" "" "" "" "1" "" "00000" "{PMID:Chen 2014:24505212}" "" "M" "" "China" "" "0" "" "" "" "113140" "00396103" "" "" "" "1" "" "00000" "{PMID:Chen 2014:24505212}" "" "M" "" "China" "" "0" "" "" "" "113150" "00396104" "" "" "" "1" "" "00000" "{PMID:Chen 2014:24505212}" "" "M" "" "China" "" "0" "" "" "" "113160" "00396111" "" "" "" "7" "" "00000" "{PMID:Gliem 2014:25054456}" "4-generation family, 6 affected males, 1 affected female, 7 unaffected carrier females" "F" "" "(Germany)" "" "0" "" "" "Turkish" "FamPatII2" "00396112" "" "" "00396111" "1" "" "00000" "{PMID:Gliem 2014:25054456}" "proband (son)" "M" "" "(Germany)" "" "0" "" "" "Turkish" "FamPatIII4" "00396113" "" "" "00396111" "1" "" "00000" "{PMID:Gliem 2014:25054456}" "brother" "M" "" "(Germany)" "" "0" "" "" "Turkish" "FamPatIII5" "00396114" "" "" "00396111" "1" "" "00000" "{PMID:Gliem 2014:25054456}" "proband\'s brother\'s son" "M" "" "(Germany)" "" "0" "" "" "Turkish" "FamPatIV3" "00396115" "" "" "00396111" "1" "" "00000" "{PMID:Gliem 2014:25054456}" "proband\'s brother\'s son" "M" "" "(Germany)" "" "0" "" "" "Turkish" "FamPatIV4" "00396116" "" "" "" "1" "" "00000" "{PMID:Huang 2014:25168411}" "Single Chinese family: proband" "M" "" "China" "" "0" "" "" "" "III.1" "00396117" "" "" "" "1" "" "00000" "{PMID:Huang 2014:25168411}" "Single Chinese family: proband\'s brother" "M" "" "China" "" "0" "" "" "" "III.2" "00396118" "" "" "" "1" "" "00000" "{PMID:Ulinska 2014:25799783}" "Single Polish family: proband" "M" "" "Poland" "" "0" "" "" "" "" "00396119" "" "" "" "1" "" "00000" "{PMID:Ulinska 2014:25799783}" "Single Polish family: proband�s sister 3\'s son 1" "M" "" "Poland" "" "0" "" "" "" "" "00396120" "" "" "" "1" "" "00000" "{PMID:Ulinska 2014:25799783}" "Single Polish family: proband�s sister 3\'s son 2" "M" "" "Poland" "" "0" "" "" "" "" "00396124" "" "" "" "1" "" "00000" "{PMID:Khan 2001:11738458}" "" "M" "" "(United States)" "" "0" "" "" "" "104" "00396125" "" "" "" "1" "" "00000" "{PMID:Khan 2001:11738458}" "brother of 106" "M" "" "(United States)" "" "0" "" "" "" "105" "00396126" "" "" "" "1" "" "00000" "{PMID:Khan 2001:11738458}" "brother of 105" "M" "" "(United States)" "" "0" "" "" "" "106" "00396127" "" "" "" "1" "" "00000" "{PMID:Khan 2001:11738458}" "" "M" "" "(United States)" "" "0" "" "" "" "107" "00396128" "" "" "" "1" "" "00000" "{PMID:Khan 2001:11738458}" "" "M" "" "(United States)" "" "0" "" "" "" "108" "00396129" "" "" "" "1" "" "00000" "{PMID:Khan 2001:11738458}" "" "M" "" "(United States)" "" "0" "" "" "" "109" "00396130" "" "" "" "1" "" "00000" "{PMID:Khan 2001:11738458}" "" "M" "" "(United States)" "" "0" "" "" "" "110" "00396131" "" "" "" "1" "" "00000" "{PMID:Khan 2001:11738458}" "" "M" "" "(United States)" "" "0" "" "" "" "111" "00396133" "" "" "" "1" "" "00000" "{PMID:Akeo 2015:26356828}" "proband" "M" "" "Japan" "" "0" "" "" "" "1" "00396134" "" "" "" "1" "" "00000" "{PMID:Akeo 2015:26356828}" "proband\'s brother" "M" "" "Japan" "" "0" "" "" "" "2" "00396135" "" "" "" "1" "" "00000" "{PMID:Vazquez-Alfageme 2016:26791414}" "proband" "M" "" "Spain" "" "0" "" "" "" "1" "00396141" "" "" "" "1" "" "00000" "{PMID:Sadaka 2016:27246168}" "proband" "M" "" "United States" "" "0" "" "extensive retinectomy and silicone oil tamponade; dorzolamide 2 % twice per day" "African-American" "IV-3" "00396142" "" "" "" "1" "" "00000" "{PMID:Galantuomo 2016:27932860}" "proband" "M" "" "Italy" "" "0" "" "375 mg acetazolamide daily for 3 months; then 2% dorzolamide collyrium" "" "IV-2" "00396143" "" "" "" "1" "" "00000" "{PMID:Galantuomo 2016:27932860}" "proband\'s brother" "M" "" "Italy" "" "0" "" "375 mg acetazolamide daily for 3 months; no further treatment" "" "IV-3" "00396148" "" "" "" "1" "" "00000" "{PMID:Murro 2017:28235399}" "monozygotic twin of Twin B" "M" "" "" "" "0" "" "" "" "Twin-A" "00396149" "" "" "" "1" "" "00000" "{PMID:Murro 2017:28235399}" "monozygotic twin of Twin A" "M" "" "" "" "0" "" "" "" "Twin-B" "00396150" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "1" "00396151" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "2" "00396152" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "3" "00396153" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "4" "00396154" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "5" "00396155" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "6" "00396156" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "7" "00396157" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "8" "00396158" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "9" "00396159" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "10" "00396160" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "11" "00396161" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "12" "00396162" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "14" "00396163" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "15" "00396164" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "16" "00396165" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "17" "00396166" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "18" "00396167" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "19" "00396168" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "20" "00396169" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "21" "00396170" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "22" "00396171" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "23" "00396172" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "24" "00396173" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "25" "00396174" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "26" "00396175" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "27" "00396176" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "28" "00396177" "" "" "" "1" "" "00000" "{PMID:Hu 2017:28272453}" "" "M" "" "" "" "0" "" "" "" "29" "00396351" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "7" "00396353" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "9" "00396354" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "10" "00396355" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "11" "00396356" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "12" "00396357" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "13" "00396358" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "14" "00396359" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "15" "00396360" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "16" "00396361" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "17" "00396362" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "18" "00396363" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "19" "00396364" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "20" "00396365" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "21" "00396366" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "22" "00396367" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "23" "00396368" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "24" "00396369" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "25" "00396370" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "26" "00396371" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "27" "00396372" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "28" "00396373" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "29" "00396374" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "30" "00396375" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "31" "00396376" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "32" "00396377" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "33" "00396378" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "34" "00396379" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "35" "00396380" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "36" "00396381" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "37" "00396382" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "38" "00396383" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "39" "00396384" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "40" "00396385" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "41" "00396386" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "42" "00396387" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "43" "00396388" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "44" "00396389" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "45" "00396390" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "46" "00396391" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "47" "00396392" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "48" "00396393" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "49" "00396394" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "50" "00396395" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "51" "00396396" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "52" "00396397" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "53" "00396398" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "54" "00396399" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "55" "00396400" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "56" "00396401" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "57" "00396402" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "58" "00396403" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "59" "00396404" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "60" "00396405" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "61" "00396406" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "62" "00396407" "" "" "" "1" "" "00000" "{PMID:Fahim 2017:28348004}" "no patient numbers in paper, consecutive numbers given" "M" "" "" "" "0" "" "" "" "63" "00396431" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family A, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396432" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family B, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396433" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family C, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396434" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family D, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396435" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family E, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396436" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family F, patient I-2" "M" "" "Taiwan" "" "0" "" "" "" "I-2" "00396437" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family F, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396438" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family G, patient I-1" "M" "" "Taiwan" "" "0" "" "" "" "I-1" "00396439" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family G, patient III-2" "M" "" "Taiwan" "" "0" "" "" "" "III-2" "00396440" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family G, patient III-3" "M" "" "Taiwan" "" "0" "" "" "" "III-3" "00396441" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family G, patient III-6" "M" "" "Taiwan" "" "0" "" "" "" "III-6" "00396442" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family H, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396443" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family I, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396444" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family J, patient II-2" "M" "" "Taiwan" "" "0" "" "" "" "II-2" "00396445" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family J, patient II-5" "M" "" "Taiwan" "" "0" "" "" "" "II-5" "00396446" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family K, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396447" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family L, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396448" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family M, patient II-3" "M" "" "Taiwan" "" "0" "" "" "" "II-3" "00396449" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family M, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396450" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family N, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396451" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family O, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396452" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family P, patient II-1" "M" "" "Taiwan" "" "0" "" "" "" "II-1" "00396453" "" "" "" "1" "" "00000" "{PMID:Wang 2015:25999676}" "Family P, patient II-2" "M" "" "Taiwan" "" "0" "" "" "" "II-2" "00396489" "" "" "" "1" "" "00000" "{PMID:Dockery 2017:29099798}" "no patient numbers in the paper, consecutive numbers given" "?" "" "Ireland" "" "0" "" "" "" "22" "00396490" "" "" "" "1" "" "00000" "{PMID:Dockery 2017:29099798}" "no patient numbers in the paper, consecutive numbers given" "?" "" "Ireland" "" "0" "" "" "" "23" "00396660" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family unknown, patient Subject_KA" "M" "" "France" "" "0" "" "" "" "Subject_KA" "00396661" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F3741, patient CIC07454" "M" "" "France" "" "0" "" "" "" "CIC07454" "00396662" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F3741, patient CIC06716" "M" "" "France" "" "0" "" "" "" "CIC06716" "00396663" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F3741, patient CIC07873" "M" "" "France" "" "0" "" "" "" "CIC07873" "00396664" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F94, patient CIC00121" "M" "" "France" "" "0" "" "" "" "CIC00121" "00396665" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F4060, patient CIC07365" "M" "" "France" "" "0" "" "" "" "CIC07365" "00396666" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F4717, patient CIC08376" "M" "" "France" "" "0" "" "" "" "CIC08376" "00396667" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F511, patient CIC00789" "M" "" "France" "" "0" "" "" "" "CIC00789" "00396668" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F5222, patient CIC09138" "M" "" "France" "" "0" "" "" "" "CIC09138" "00396669" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family unknown, patient CIC05162" "M" "" "France" "" "0" "" "" "" "CIC05162" "00396670" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family unknown, patient CIC05163" "M" "" "France" "" "0" "" "" "" "CIC05163" "00396671" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F442, patient CIC00650" "M" "" "France" "" "0" "" "" "" "CIC00650" "00396672" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F442, patient CIC04991" "M" "" "France" "" "0" "" "" "" "CIC04991" "00396673" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F4111, patient CIC07437" "M" "" "France" "" "0" "" "" "" "CIC07437" "00396674" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F4111, patient CIC08483" "M" "" "France" "" "0" "" "" "" "CIC08483" "00396675" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F4111, patient CIC07437\'s_cousin_1" "M" "" "France" "" "0" "" "" "" "CIC07437\'s_cousin_1" "00396676" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F4111, patient CIC07437\'s_cousin_2" "M" "" "France" "" "0" "" "" "" "CIC07437\'s_cousin_2" "00396677" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F442, patient CIC04991" "M" "" "France" "" "0" "" "" "" "CIC04991" "00396682" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F3175, patient CIC06042" "M" "" "France" "" "0" "" "" "" "CIC06042" "00396683" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family unknown, patient CIC09774" "M" "" "France" "" "0" "" "" "" "CIC09774" "00396684" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F816, patient CIC01352" "M" "" "France" "" "0" "" "" "" "CIC01352" "00396685" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F68, patient CIC00091" "M" "" "France" "" "0" "" "" "" "CIC00091" "00396686" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F5227, patient CIC09147" "M" "" "France" "" "0" "" "" "" "CIC09147" "00396687" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F4870, patient CIC08603" "M" "" "France" "" "0" "" "" "" "CIC08603" "00396688" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F2068, patient CIC04314" "M" "" "France" "" "0" "" "" "" "CIC04314" "00396689" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family unknown, patient Subject_VT" "M" "" "France" "" "0" "" "" "" "Subject_VT" "00396690" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F3448, patient CIC06469" "M" "" "France" "" "0" "" "" "" "CIC06469" "00396692" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F2628, patient CIC05647" "M" "" "France" "" "0" "" "" "" "CIC05647" "00396693" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F2628, patient CIC05191" "M" "" "France" "" "0" "" "" "" "CIC05191" "00396694" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F5283, patient CIC09220" "M" "" "France" "" "0" "" "" "" "CIC09220" "00396695" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F1761, patient CIC03863" "M" "" "France" "" "0" "" "" "" "CIC03863" "00396696" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F1761, patient CIC03864" "M" "" "France" "" "0" "" "" "" "CIC03864" "00396697" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F3451, patient Subject_ML" "M" "" "France" "" "0" "" "" "" "Subject_ML" "00396698" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F3451, patient CIC06475" "M" "" "France" "" "0" "" "" "" "CIC06475" "00396699" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F5727, patient CIC10049" "M" "" "France" "" "0" "" "" "" "CIC10049" "00396700" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F152, patient CIC00209" "M" "" "France" "" "0" "" "" "" "CIC00209" "00396701" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F152, patient CIC00209\'s_cousin" "M" "" "France" "" "0" "" "" "" "CIC00209\'s_cousin" "00396702" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F2868, patient CIC05596" "M" "" "France" "" "0" "" "" "" "CIC05596" "00396703" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F2200, patient CIC04516" "M" "" "France" "" "0" "" "" "" "CIC04516" "00396704" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F3852, patient CIC07009" "M" "" "France" "" "0" "" "" "" "CIC07009" "00396705" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F1919, patient CIC04102" "M" "" "France" "" "0" "" "" "" "CIC04102" "00396706" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family F4873, patient CIC08607" "M" "" "France" "" "0" "" "" "" "CIC08607" "00396707" "" "" "" "1" "" "00000" "{PMID:Ores 2018:29739629}" "Family unknown, patient subject_BA" "M" "" "France" "" "0" "" "" "" "subject_BA" "00396725" "" "" "" "1" "" "00000" "{PMID:Piermarocchi 2017:28811895}" "" "M" "" "Italy" "" "0" "" "" "" "101" "00396727" "" "" "" "1" "" "00000" "{PMID:Abalem 2018:29902095}" "" "M" "" "United States" "" "0" "" "Dorzolamide 1%" "" "Pat1" "00396729" "" "" "" "1" "" "00000" "{PMID:Abalem 2018:29902095}" "" "M" "" "United States" "" "0" "" "Dorzolamide 1%" "" "Pat3" "00396730" "" "" "" "2" "" "00000" "{PMID:Lee 2019:30215241}" "proband, brother of 2" "M" "" "United States" "" "0" "" "" "" "FamPatII1" "00396731" "" "" "00396730" "1" "" "00000" "{PMID:Lee 2019:30215241}" "brother" "M" "" "United States" "" "0" "" "" "" "FamPatII2" "00396732" "" "" "" "14" "" "00000" "{PMID:Stephenson 2018:30419843}" "5-generation family, 14 affected (14M), proband" "M" "" "Ireland" "" "0" "" "" "" "FamPatII1" "00396733" "" "" "00396732" "1" "" "00000" "{PMID:Stephenson 2018:30419843}" "brother 1 of proband" "M" "" "Ireland" "" "0" "" "" "" "FamPatII2" "00396734" "" "" "00396732" "1" "" "00000" "{PMID:Stephenson 2018:30419843}" "brother 2 of proband" "M" "" "Ireland" "" "0" "" "" "" "FamPatII3" "00396735" "" "" "00396732" "1" "" "00000" "{PMID:Stephenson 2018:30419843}" "brother 3 of proband" "M" "" "Ireland" "" "0" "" "" "" "FamPatII4" "00396736" "" "" "00396732" "1" "" "00000" "{PMID:Stephenson 2018:30419843}" "brother 4 of proband" "M" "" "Ireland" "" "0" "" "" "" "FamPatII5" "00396737" "" "" "00396732" "1" "" "00000" "{PMID:Stephenson 2018:30419843}" "proband\'s maternal cousin 1" "M" "" "Ireland" "" "0" "" "" "" "FamPatII6" "00396738" "" "" "00396732" "1" "" "00000" "{PMID:Stephenson 2018:30419843}" "proband\'s maternal cousin 2" "M" "" "Ireland" "" "0" "" "" "" "FamPatII7" "00396739" "" "" "00396732" "1" "" "00000" "{PMID:Stephenson 2018:30419843}" "brother 1 of proband\'s grandson (son 1 of daughter)" "M" "" "Ireland" "" "0" "" "" "" "FamPatIV3" "00396740" "" "" "00396732" "1" "" "00000" "{PMID:Stephenson 2018:30419843}" "brother 1 of proband\'s grandson (son 2 of daughter)" "M" "" "Ireland" "" "0" "" "" "" "FamPatIV4" "00396741" "" "" "" "1" "" "00000" "{PMID:Strupaite 2018:30450322}" "" "M" "" "Ireland" "" "0" "" "" "" "II:1" "00396743" "" "" "" "1" "" "00000" "{PMID:Strupaite 2018:30450322}" "" "M" "" "Ireland" "" "0" "" "" "" "II:3" "00396746" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-020" "00396747" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-013" "00396748" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "KEC-004" "00396749" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-006" "00396750" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "KEC-013" "00396751" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-311" "00396752" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-325" "00396753" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-326" "00396754" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-310" "00396755" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-319" "00396756" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-321" "00396757" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-014" "00396758" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "KEC-007" "00396761" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-005" "00396762" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-314" "00396763" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "KEC-011" "00396764" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "KEC-012" "00396765" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "KEC-014" "00396766" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "KEC-018" "00396767" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-003*" "00396768" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-004*" "00396769" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-312" "00396770" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-318" "00396771" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-011" "00396772" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "KEC-015" "00396773" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-009" "00396774" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "KEC-002" "00396775" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "KEC-003" "00396776" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-309" "00396777" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-306" "00396778" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-010" "00396782" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-315�" "00396783" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-320" "00396784" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-322�" "00396785" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-015" "00396786" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "KEC-001" "00396787" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-001" "00396788" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-007�" "00396789" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-008�" "00396790" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-018�" "00396791" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-019�" "00396792" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-303" "00396793" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-301" "00396794" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "KEC-017" "00396795" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "CEI-002" "00396798" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "KEC-010" "00396799" "" "" "" "1" "" "00000" "{PMID:Pennesi 2018:30551202}" "" "M" "" "United States" "" "0" "" "" "" "RFS-323" "00396801" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F1, patient P1" "M" "" "India" "" "0" "" "" "" "P1" "00396802" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F2, patient P2" "M" "" "India" "" "0" "" "" "" "P2" "00396803" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F3, patient P3" "M" "" "India" "" "0" "" "" "" "P3" "00396804" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F3, patient P4" "M" "" "India" "" "0" "" "" "" "P4" "00396805" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F4, patient P5" "M" "" "India" "" "0" "" "" "" "P5" "00396806" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F5, patient P6" "M" "" "India" "" "0" "" "" "" "P6" "00396807" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F6, patient P7" "M" "" "India" "" "0" "" "" "" "P7" "00396808" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F7, patient P8" "M" "" "India" "" "0" "" "" "" "P8" "00396809" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F8, patient P9" "M" "" "India" "" "0" "" "" "" "P9" "00396810" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F8, patient P10" "M" "" "India" "" "0" "" "" "" "P10" "00396811" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F9, patient P11" "M" "" "India" "" "0" "" "" "" "P11" "00396812" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F10, patient P12" "M" "" "India" "" "0" "" "" "" "P12" "00396813" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F11, patient P13" "M" "" "India" "" "0" "" "" "" "P13" "00396814" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F12, patient P14" "M" "" "India" "" "0" "" "" "" "P14" "00396815" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F12, patient P15" "M" "" "India" "" "0" "" "" "" "P15" "00396816" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F13, patient P16" "M" "" "India" "" "0" "" "" "" "P16" "00396817" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F14, patient P17" "M" "" "India" "" "0" "" "" "" "P17" "00396818" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F15, patient P18" "M" "" "India" "" "0" "" "" "" "P18" "00396819" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F16, patient P19" "M" "" "India" "" "0" "" "" "" "P19" "00396820" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F17, patient P20" "M" "" "India" "" "0" "" "" "" "P20" "00396821" "" "" "" "1" "" "00000" "{PMID:Sudha 2018:29851975}" "Family F18, patient P21" "M" "" "India" "" "0" "" "" "" "P21" "00396874" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 10, patient J0381, proband" "M" "" "Japan" "" "0" "" "" "" "J0381" "00396875" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 11, patient J0673, proband" "M" "" "Japan" "" "0" "" "" "" "J0673" "00396876" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 12, patient J1033, proband" "M" "" "Japan" "" "0" "" "" "" "J1033" "00396877" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 13, patient J1062, proband" "M" "" "Japan" "" "0" "" "" "" "J1062" "00396878" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 14, patient RS04-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS04-1" "00396879" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 14, patient RS04-1, sibling" "M" "" "Japan" "" "0" "" "" "" "RS04-1" "00396880" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 15, patient KINKI-113, proband" "M" "" "Japan" "" "0" "" "" "" "KINKI-113" "00396881" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 16, patient NMSCHH011-01, sibling" "M" "" "Japan" "" "0" "" "" "" "NMSCHH011-01" "00396882" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 16, patient NMSCHH011-02, proband" "M" "" "Japan" "" "0" "" "" "" "NMSCHH011-02" "00396883" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 17, patient RS12-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS12-1" "00396884" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 18, patient J0256, proband" "M" "" "Japan" "" "0" "" "" "" "J0256" "00396885" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 19, patient J1224, proband" "M" "" "Japan" "" "0" "" "" "" "J1224" "00396886" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 20, patient Teik1051, proband" "M" "" "Japan" "" "0" "" "" "" "Teik1051" "00396887" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 21, patient Teik1103, proband" "M" "" "Japan" "" "0" "" "" "" "Teik1103" "00396888" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 22, patient KINKI-107-1, proband" "M" "" "Japan" "" "0" "" "" "" "KINKI-107-1" "00396889" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 22, patient KINKI-107-2, sibling" "M" "" "Japan" "" "0" "" "" "" "KINKI-107-2" "00396890" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 23, patient RS21-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS21-1" "00396891" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 24, patient RS16-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS16-1" "00396892" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 25, patient RS17-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS17-1" "00396893" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 26, patient RS31-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS31-1" "00396894" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 26, patient RS31-2, sibling" "M" "" "Japan" "" "0" "" "" "" "RS31-2" "00396895" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 27, patient Teik1153, proband" "M" "" "Japan" "" "0" "" "" "" "Teik1153" "00396896" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 28, patient J1330, proband" "M" "" "Japan" "" "0" "" "" "" "J1330" "00396897" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 29, patient RS23-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS23-1" "00396898" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 29, patient RS23-2, sibling" "M" "" "Japan" "" "0" "" "" "" "RS23-2" "00396899" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 30, patient RS08-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS08-1" "00396900" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 31, patient MIYA003-1, proband" "M" "" "Japan" "" "0" "" "" "" "MIYA003-1" "00396901" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 31, patient MIYA003-2, sibling" "M" "" "Japan" "" "0" "" "" "" "MIYA003-2" "00396902" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 32, patient RS18-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS18-1" "00396903" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 33, patient J0690, proband" "M" "" "Japan" "" "0" "" "" "" "J0690" "00396904" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 34, patient J0852, proband" "M" "" "Japan" "" "0" "" "" "" "J0852" "00396905" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 35, patient MIE52, proband" "M" "" "Japan" "" "0" "" "" "" "MIE52" "00396906" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 36, patient J0892, proband" "M" "" "Japan" "" "0" "" "" "" "J0892" "00396907" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 37, patient NHO1025, proband" "M" "" "Japan" "" "0" "" "" "" "NHO1025" "00396908" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 38, patient RS25-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS25-1" "00396909" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 39, patient RS26-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS26-1" "00396910" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 40, patient RS27-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS27-1" "00396911" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 41, patient J1461, proband" "M" "" "Japan" "" "0" "" "" "" "J1461" "00396912" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 42, patient KIN, proband" "M" "" "Japan" "" "0" "" "" "" "KIN" "00396913" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 43, patient RS07-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS07-1" "00396914" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 44, patient MIE49, proband" "M" "" "Japan" "" "0" "" "" "" "MIE49" "00396915" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 45, patient RS32-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS32-1" "00396916" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 46, patient RS10-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS10-1" "00396917" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 47, patient RS19-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS19-1" "00396918" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 48, patient RS15-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS15-1" "00396919" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 49, patient NTMC218, proband" "M" "" "Japan" "" "0" "" "" "" "NTMC218" "00396920" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 50, patient RS29-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS29-1" "00396921" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 51, patient J0903, proband" "M" "" "Japan" "" "0" "" "" "" "J0903" "00396922" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 52, patient J0371, proband" "M" "" "Japan" "" "0" "" "" "" "J0371" "00396923" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 53, patient J0640, proband" "M" "" "Japan" "" "0" "" "" "" "J0640" "00396924" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 54, patient RS06-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS06-1" "00396925" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 55, patient RS05-1, proband" "M" "" "Japan" "" "0" "" "" "" "RS05-1" "00396926" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 56, patient MIYA020-1, proband" "M" "" "Japan" "" "0" "" "" "" "MIYA020-1" "00396927" "" "" "" "1" "" "00000" "{PMID:Kondo 2019:30652005}" "Family 56, patient MIYA020-2, sibling" "M" "" "Japan" "" "0" "" "" "" "MIYA020-2" "00397004" "" "" "" "1" "" "00000" "{PMID:Selvan 2018:31238476}" "proband" "M" "" "India" "" "0" "" "" "" "1" "00397045" "" "" "" "1" "" "00000" "{PMID:Smith 2020:32124668}" "proband 1" "M" "" "United States" "" "0" "" "" "Guatemalan" "1" "00397046" "" "" "" "1" "" "00000" "{PMID:Smith 2020:32124668}" "proband 1\'s uncle" "M" "" "United States" "" "0" "" "" "Guatemalan" "1" "00397047" "" "" "" "1" "" "00000" "{PMID:Smith 2020:32124668}" "proband 2" "M" "" "United States" "" "0" "" "" "Guatemalan" "1" "00397055" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "8" "00397056" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "9" "00397057" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "10" "00397058" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "11" "00397059" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "12" "00397060" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "13" "00397061" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "14" "00397062" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "15" "00397063" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "16" "00397064" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "17" "00397065" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "18" "00397066" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "19" "00397067" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "20" "00397068" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "21" "00397069" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "22" "00397070" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "23" "00397071" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "24" "00397072" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "25" "00397073" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "26" "00397074" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "27" "00397075" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "28" "00397076" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "29" "00397077" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "30" "00397078" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "31" "00397079" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "32" "00397080" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "33" "00397081" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "34" "00397082" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "35" "00397083" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "36" "00397084" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "37" "00397085" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "38" "00397086" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "39" "00397087" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "40" "00397088" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "41" "00397089" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "42" "00397090" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "43" "00397091" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "44" "00397092" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "45" "00397093" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "46" "00397094" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "47" "00397095" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "48" "00397096" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "49" "00397097" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "50" "00397098" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "51" "00397099" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "52" "00397100" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "53" "00397101" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "54" "00397102" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "55" "00397103" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "56" "00397104" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "57" "00397105" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "58" "00397106" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "59" "00397107" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "60" "00397108" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "61" "00397109" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "62" "00397110" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "63" "00397111" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "64" "00397112" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "65" "00397113" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "66" "00397114" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "67" "00397115" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "68" "00397116" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "69" "00397117" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "70" "00397118" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "71" "00397119" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "72" "00397120" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "73" "00397121" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "74" "00397122" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "75" "00397123" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "76" "00397124" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "77" "00397125" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "78" "00397126" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "79" "00397127" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "80" "00397128" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "81" "00397129" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "82" "00397130" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "83" "00397131" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "84" "00397132" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "85" "00397133" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "86" "00397134" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "87" "00397135" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "88" "00397136" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "89" "00397137" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "90" "00397138" "" "" "" "1" "" "00000" "{PMID:Chen 2020:32300273}" "no patient numbering in the paper, numbers given consecutively; actual number in table does not match number of patients in text (91 vs 90)" "M" "" "China" "" "0" "" "" "" "91" "00403013" "" "" "" "1" "" "01164" "" "" "F" "no" "Germany" "" "0" "" "" "" "192344" "00408447" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "38-46 (12 patients in 9 families)" "?" "" "Finland" "" "0" "" "" "" "Family 38" "00408448" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "38-46 (12 patients in 9 families)" "?" "" "Finland" "" "0" "" "" "" "Family 39" "00408449" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "38-46 (12 patients in 9 families)" "?" "" "Finland" "" "0" "" "" "" "Family 40" "00408450" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "38-46 (12 patients in 9 families)" "?" "" "Finland" "" "0" "" "" "" "Family 41" "00408451" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "38-46 (12 patients in 9 families)" "?" "" "Finland" "" "0" "" "" "" "Family 42" "00408452" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "38-46 (12 patients in 9 families)" "?" "" "Finland" "" "0" "" "" "" "Family 43" "00408453" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "38-46 (12 patients in 9 families)" "?" "" "Finland" "" "0" "" "" "" "Family 44" "00408454" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "38-46 (12 patients in 9 families)" "?" "" "Finland" "" "0" "" "" "" "Family 45" "00408455" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "38-46 (12 patients in 9 families)" "?" "" "Finland" "" "0" "" "" "" "Family 46" "00408456" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "47-51 (5 patients in 5 families)" "?" "" "Finland" "" "0" "" "" "" "Family 47" "00408457" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "47-51 (5 patients in 5 families)" "?" "" "Finland" "" "0" "" "" "" "Family 48" "00408458" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "47-51 (5 patients in 5 families)" "?" "" "Finland" "" "0" "" "" "" "Family 49" "00408459" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "47-51 (5 patients in 5 families)" "?" "" "Finland" "" "0" "" "" "" "Family 50" "00408460" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "47-51 (5 patients in 5 families)" "?" "" "Finland" "" "0" "" "" "" "Family 51" "00408461" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "Family 52, invidivual a" "?" "" "Finland" "" "0" "" "" "" "52a" "00408462" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "Family 52, invidivual b" "?" "" "Finland" "" "0" "" "" "" "52b" "00412358" "" "" "" "1" "" "00006" "{PMID:Halvardson 2016:27334371}" "" "F" "" "Sweden" "" "0" "" "" "" "Fam2" "00420446" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F087" "00420521" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F210" "00420525" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F215" "00426951" "" "" "" "1" "" "00000" "{PMID:Zhu 2022:35456422}" "family 55, individual 64" "M" "" "" "" "0" "" "" "" "55_64" "00426952" "" "" "" "1" "" "00000" "{PMID:Zhu 2022:35456422}" "family 55, individual 65" "M" "" "" "" "0" "" "" "" "55_65" "00426953" "" "" "" "1" "" "00000" "{PMID:Zhu 2022:35456422}" "family 55, individual 66" "M" "" "" "" "0" "" "" "" "55_66" "00427811" "" "" "" "1" "" "00006" "{PMID:Veeramah 2013:23647072}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "United States" "" "0" "" "" "" "PatA" "00438616" "" "" "" "1" "" "00006" "{PMID:Hamdan 2017:29100083}" "WGS analysis 197 individuals with unexplained DEE (unaffected parents)" "" "" "Canada" "" "0" "" "pharmaco-resistant seizures" "" "HSC0089" "00438683" "" "" "" "1" "" "00006" "{PMID:Hamdan 2017:29100083}" "WGS analysis 197 individuals with unexplained DEE (unaffected parents)" "" "" "Canada" "" "0" "" "pharmaco-resistant seizures" "" "HSJ0681" "00440463" "" "" "" "1" "" "00006" "{PMID:Nambot 2018:29095811}" "" "" "" "France" "" "0" "" "" "" "PED3650.1" "00447939" "" "" "" "1" "" "00006" "{PMID:Ostrander 2018:30109124}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "United States" "" "0" "" "" "" "Pat7" "00458038" "" "" "" "1" "" "03544" "" "" "F" "-" "- (not applicable)" "" "" "" "" "" "" "00468737" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00468738" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 679 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00035147" "00198" "00035148" "00198" "00035149" "00198" "00035150" "00198" "00035151" "00198" "00035152" "00198" "00035155" "00198" "00035158" "00198" "00035159" "00198" "00050639" "00198" "00081063" "00067" "00081085" "00067" "00087273" "02262" "00114879" "00065" "00114880" "00067" "00114881" "00187" "00114882" "00198" "00114883" "00198" "00114884" "00067" "00114885" "00065" "00114886" "00067" "00114887" "00065" "00114888" "00067" "00114889" "00198" "00114890" "00187" "00114891" "00187" "00114892" "00198" "00114893" "00067" "00114894" "00198" "00114895" "00187" "00114896" "00198" "00114897" "00067" "00114898" "00198" "00114899" "00198" "00114900" "00067" "00114901" "00067" "00114902" "00067" "00114903" "00067" "00114904" "00067" "00114905" "00230" "00114906" "00067" "00114907" "00067" "00114908" "00067" "00114909" "00067" "00114910" "00067" "00114911" "00067" "00114912" "00067" "00114913" "00067" "00114914" "00198" "00114915" "00198" "00114916" "00067" "00114917" "00065" "00114918" "00067" "00114919" "00198" "00114920" "00187" "00114921" "00198" "00114922" "00187" "00114923" "00198" "00114924" "00198" "00114925" "00067" "00114926" "00067" "00114927" "00065" "00114928" "00065" "00114929" "00065" "00114930" "00067" "00114931" "00067" "00114932" "00067" "00114933" "00065" "00114934" "00198" "00114935" "00067" "00114936" "00198" "00114937" "00067" "00114938" "00067" "00114939" "00067" "00114940" "00067" "00114941" "00067" "00114942" "00067" "00114943" "00198" "00114944" "00067" "00114945" "00067" "00114947" "00067" "00114955" "00067" "00114956" "00065" "00114957" "00067" "00114958" "00067" "00114959" "00067" "00114960" "00065" "00114961" "00065" "00114962" "00065" "00114963" "00067" "00114964" "00067" "00114965" "00067" "00114966" "00067" "00114967" "00198" "00114968" "00067" "00114969" "00198" "00114970" "00198" "00114971" "00187" "00114972" "00067" "00114973" "00065" "00132118" "02262" "00132786" "00344" "00177004" "00344" "00209017" "05533" "00274191" "00198" "00295000" "00198" "00295001" "00198" "00295002" "00198" "00295003" "00198" "00295004" "00198" "00295005" "00198" "00295007" "00198" "00295008" "00198" "00295009" "00198" "00303126" "00344" "00303127" "00344" "00303128" "00344" "00303129" "00344" "00303130" "00344" "00303131" "00344" "00303132" "00344" "00303133" "00344" "00303147" "00344" "00303148" "00344" "00305288" "00198" "00305971" "04270" "00305972" "04270" "00309546" "00198" "00309892" "00067" "00309893" "00067" "00309894" "00067" "00309895" "00067" "00309896" "00067" "00309897" "00067" "00313780" "00067" "00320171" "00198" "00361487" "00139" "00361582" "00139" "00374238" "00198" "00374287" "00198" "00374681" "00198" "00374682" "00198" "00374683" "00198" "00374684" "00198" "00388727" "04214" "00388758" "04214" "00388765" "04214" "00388766" "04214" "00388779" "04214" "00388784" "04214" "00388787" "04214" "00388788" "04214" "00388790" "04214" "00388898" "04214" "00388905" "04214" "00388910" "04214" "00388919" "04214" "00388962" "04214" "00388963" "04214" "00391384" "04214" "00391385" "04214" "00391505" "04214" "00391508" "04214" "00391509" "04214" "00391510" "04214" "00391511" "04214" "00391512" "04214" "00391513" "04214" "00391514" "04214" "00391515" "04214" "00391516" "04214" "00395926" "04214" "00395927" "04214" "00395952" "04214" "00395989" "04214" "00395990" "04214" "00395991" "04214" "00395992" "04214" "00395993" "04214" "00395994" "04214" "00395995" "04214" "00395996" "04214" "00396002" "04214" "00396003" "04214" "00396004" "04214" "00396005" "04214" "00396006" "04214" "00396007" "04214" "00396008" "04214" "00396009" "04214" "00396020" "04214" "00396021" "04214" "00396022" "04214" "00396036" "04214" "00396037" "04214" "00396038" "04214" "00396039" "04214" "00396040" "04214" "00396041" "04214" "00396042" "04214" "00396043" "04214" "00396044" "04214" "00396045" "04214" "00396046" "04214" "00396047" "04214" "00396050" "04214" "00396051" "04214" "00396052" "04214" "00396053" "04214" "00396054" "04214" "00396055" "04214" "00396056" "04214" "00396057" "04214" "00396062" "04214" "00396063" "04214" "00396064" "04214" "00396065" "04214" "00396066" "04214" "00396067" "04214" "00396068" "04214" "00396069" "04214" "00396070" "04214" "00396071" "04214" "00396072" "04214" "00396073" "04214" "00396078" "04214" "00396082" "04214" "00396083" "04214" "00396085" "04214" "00396086" "04214" "00396089" "04214" "00396090" "04214" "00396091" "04214" "00396095" "04214" "00396096" "04214" "00396097" "04214" "00396099" "04214" "00396100" "04214" "00396101" "04214" "00396102" "04214" "00396103" "04214" "00396104" "04214" "00396111" "04214" "00396112" "04214" "00396113" "04214" "00396114" "04214" "00396115" "04214" "00396116" "04214" "00396117" "04214" "00396118" "04214" "00396119" "04214" "00396120" "04214" "00396124" "04214" "00396125" "04214" "00396126" "04214" "00396127" "04214" "00396128" "04214" "00396129" "04214" "00396130" "04214" "00396131" "04214" "00396133" "04214" "00396134" "04214" "00396135" "04214" "00396141" "04214" "00396142" "04214" "00396143" "04214" "00396148" "04214" "00396149" "04214" "00396150" "04214" "00396151" "04214" "00396152" "04214" "00396153" "04214" "00396154" "04214" "00396155" "04214" "00396156" "04214" "00396157" "04214" "00396158" "04214" "00396159" "04214" "00396160" "04214" "00396161" "04214" "00396162" "04214" "00396163" "04214" "00396164" "04214" "00396165" "04214" "00396166" "04214" "00396167" "04214" "00396168" "04214" "00396169" "04214" "00396170" "04214" "00396171" "04214" "00396172" "04214" "00396173" "04214" "00396174" "04214" "00396175" "04214" "00396176" "04214" "00396177" "04214" "00396351" "04214" "00396353" "04214" "00396354" "04214" "00396355" "04214" "00396356" "04214" "00396357" "04214" "00396358" "04214" "00396359" "04214" "00396360" "04214" "00396361" "04214" "00396362" "04214" "00396363" "04214" "00396364" "04214" "00396365" "04214" "00396366" "04214" "00396367" "04214" "00396368" "04214" "00396369" "04214" "00396370" "04214" "00396371" "04214" "00396372" "04214" "00396373" "04214" "00396374" "04214" "00396375" "04214" "00396376" "04214" "00396377" "04214" "00396378" "04214" "00396379" "04214" "00396380" "04214" "00396381" "04214" "00396382" "04214" "00396383" "04214" "00396384" "04214" "00396385" "04214" "00396386" "04214" "00396387" "04214" "00396388" "04214" "00396389" "04214" "00396390" "04214" "00396391" "04214" "00396392" "04214" "00396393" "04214" "00396394" "04214" "00396395" "04214" "00396396" "04214" "00396397" "04214" "00396398" "04214" "00396399" "04214" "00396400" "04214" "00396401" "04214" "00396402" "04214" "00396403" "04214" "00396404" "04214" "00396405" "04214" "00396406" "04214" "00396407" "04214" "00396431" "04214" "00396432" "04214" "00396433" "04214" "00396434" "04214" "00396435" "04214" "00396436" "04214" "00396437" "04214" "00396438" "04214" "00396439" "04214" "00396440" "04214" "00396441" "04214" "00396442" "04214" "00396443" "04214" "00396444" "04214" "00396445" "04214" "00396446" "04214" "00396447" "04214" "00396448" "04214" "00396449" "04214" "00396450" "04214" "00396451" "04214" "00396452" "04214" "00396453" "04214" "00396489" "04214" "00396490" "04214" "00396660" "04214" "00396661" "04214" "00396662" "04214" "00396663" "04214" "00396664" "04214" "00396665" "04214" "00396666" "04214" "00396667" "04214" "00396668" "04214" "00396669" "04214" "00396670" "04214" "00396671" "04214" "00396672" "04214" "00396673" "04214" "00396674" "04214" "00396675" "04214" "00396676" "04214" "00396677" "04214" "00396682" "04214" "00396683" "04214" "00396684" "04214" "00396685" "04214" "00396686" "04214" "00396687" "04214" "00396688" "04214" "00396689" "04214" "00396690" "04214" "00396692" "04214" "00396693" "04214" "00396694" "04214" "00396695" "04214" "00396696" "04214" "00396697" "04214" "00396698" "04214" "00396699" "04214" "00396700" "04214" "00396701" "04214" "00396702" "04214" "00396703" "04214" "00396704" "04214" "00396705" "04214" "00396706" "04214" "00396707" "04214" "00396725" "04214" "00396727" "04214" "00396729" "04214" "00396730" "04214" "00396731" "04214" "00396732" "04214" "00396733" "04214" "00396734" "04214" "00396735" "04214" "00396736" "04214" "00396737" "04214" "00396738" "04214" "00396739" "04214" "00396740" "04214" "00396741" "04214" "00396743" "04214" "00396746" "04214" "00396747" "04214" "00396748" "04214" "00396749" "04214" "00396750" "04214" "00396751" "04214" "00396752" "04214" "00396753" "04214" "00396754" "04214" "00396755" "04214" "00396756" "04214" "00396757" "04214" "00396758" "04214" "00396761" "04214" "00396762" "04214" "00396763" "04214" "00396764" "04214" "00396765" "04214" "00396766" "04214" "00396767" "04214" "00396768" "04214" "00396769" "04214" "00396770" "04214" "00396771" "04214" "00396772" "04214" "00396773" "04214" "00396774" "04214" "00396775" "04214" "00396776" "04214" "00396777" "04214" "00396778" "04214" "00396782" "04214" "00396783" "04214" "00396784" "04214" "00396785" "04214" "00396786" "04214" "00396787" "04214" "00396788" "04214" "00396789" "04214" "00396790" "04214" "00396791" "04214" "00396792" "04214" "00396793" "04214" "00396794" "04214" "00396795" "04214" "00396798" "04214" "00396799" "04214" "00396801" "04214" "00396802" "04214" "00396803" "04214" "00396804" "04214" "00396805" "04214" "00396806" "04214" "00396807" "04214" "00396808" "04214" "00396809" "04214" "00396810" "04214" "00396811" "04214" "00396812" "04214" "00396813" "04214" "00396814" "04214" "00396815" "04214" "00396816" "04214" "00396817" "04214" "00396818" "04214" "00396819" "04214" "00396820" "04214" "00396821" "04214" "00396874" "04214" "00396875" "04214" "00396876" "04214" "00396877" "04214" "00396878" "04214" "00396879" "04214" "00396880" "04214" "00396881" "04214" "00396882" "04214" "00396883" "04214" "00396884" "04214" "00396885" "04214" "00396886" "04214" "00396887" "04214" "00396888" "04214" "00396889" "04214" "00396890" "04214" "00396891" "04214" "00396892" "04214" "00396893" "04214" "00396894" "04214" "00396895" "04214" "00396896" "04214" "00396897" "04214" "00396898" "04214" "00396899" "04214" "00396900" "04214" "00396901" "04214" "00396902" "04214" "00396903" "04214" "00396904" "04214" "00396905" "04214" "00396906" "04214" "00396907" "04214" "00396908" "04214" "00396909" "04214" "00396910" "04214" "00396911" "04214" "00396912" "04214" "00396913" "04214" "00396914" "04214" "00396915" "04214" "00396916" "04214" "00396917" "04214" "00396918" "04214" "00396919" "04214" "00396920" "04214" "00396921" "04214" "00396922" "04214" "00396923" "04214" "00396924" "04214" "00396925" "04214" "00396926" "04214" "00396927" "04214" "00397004" "04214" "00397045" "04214" "00397046" "04214" "00397047" "04214" "00397055" "04214" "00397056" "04214" "00397057" "04214" "00397058" "04214" "00397059" "04214" "00397060" "04214" "00397061" "04214" "00397062" "04214" "00397063" "04214" "00397064" "04214" "00397065" "04214" "00397066" "04214" "00397067" "04214" "00397068" "04214" "00397069" "04214" "00397070" "04214" "00397071" "04214" "00397072" "04214" "00397073" "04214" "00397074" "04214" "00397075" "04214" "00397076" "04214" "00397077" "04214" "00397078" "04214" "00397079" "04214" "00397080" "04214" "00397081" "04214" "00397082" "04214" "00397083" "04214" "00397084" "04214" "00397085" "04214" "00397086" "04214" "00397087" "04214" "00397088" "04214" "00397089" "04214" "00397090" "04214" "00397091" "04214" "00397092" "04214" "00397093" "04214" "00397094" "04214" "00397095" "04214" "00397096" "04214" "00397097" "04214" "00397098" "04214" "00397099" "04214" "00397100" "04214" "00397101" "04214" "00397102" "04214" "00397103" "04214" "00397104" "04214" "00397105" "04214" "00397106" "04214" "00397107" "04214" "00397108" "04214" "00397109" "04214" "00397110" "04214" "00397111" "04214" "00397112" "04214" "00397113" "04214" "00397114" "04214" "00397115" "04214" "00397116" "04214" "00397117" "04214" "00397118" "04214" "00397119" "04214" "00397120" "04214" "00397121" "04214" "00397122" "04214" "00397123" "04214" "00397124" "04214" "00397125" "04214" "00397126" "04214" "00397127" "04214" "00397128" "04214" "00397129" "04214" "00397130" "04214" "00397131" "04214" "00397132" "04214" "00397133" "04214" "00397134" "04214" "00397135" "04214" "00397136" "04214" "00397137" "04214" "00397138" "04214" "00403013" "00067" "00408447" "04214" "00408448" "04214" "00408449" "04214" "00408450" "04214" "00408451" "04214" "00408452" "04214" "00408453" "04214" "00408454" "04214" "00408455" "04214" "00408456" "04214" "00408457" "04214" "00408458" "04214" "00408459" "04214" "00408460" "04214" "00408461" "04214" "00408462" "04214" "00412358" "05611" "00420446" "04214" "00420521" "04214" "00420525" "04214" "00426951" "04214" "00426952" "04214" "00426953" "04214" "00427811" "00344" "00438616" "06906" "00438683" "06906" "00440463" "00198" "00447939" "00841" "00458038" "05611" "00468737" "00198" "00468738" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00065, 00067, 00139, 00187, 00198, 00230, 00344, 00841, 01157, 02262, 04214, 04270, 05533, 05611, 06906 ## Count = 665 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Intellectual_dis/HPO_0001249}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000037251" "00198" "00050639" "00006" "Isolated (sporadic)" "" "abnormality of prenatal development or birth, oral cleft, seizures, congenital visual impairment, global developmental delay, wide nasal bridge, bilateral microphthalmos, upslanted palpebral fissure" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "" "3w" "" "" "" "" "" "" "" "" "" "" "0000060632" "00067" "00081063" "01758" "Isolated (sporadic)" "" "Epileptic encephalopathy, early infantile, 2 (OMIM:300672)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000060654" "00067" "00081085" "01758" "Isolated (sporadic)" "" "Epileptic encephalopathy, early infantile, 2 (OMIM:300672)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000066810" "02262" "00087273" "00006" "Familial, X-linked recessive" "" "typical X-linked juvenile retinoschisis; one patient had undergone asphyxia during neonatal age, suffers from mild hemiplegia, epilepsy, scar in one hemispheres" "" "" "" "" "" "" "" "" "" "" "RS1" "retinoschisis" "" "0000090361" "00067" "00114904" "01533" "Unknown" "" "severe mental retardation, microcephaly, diffuse hypotonia, hyperreflexia, no language, numerous refractory seizures, stereotypical movement hands; 5y-precocious puberty; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090362" "00230" "00114905" "01533" "Unknown" "" "absence of speech, severe developmental delay, ataxic gait, hypermotoric behavior, easily excitable personality (uplifted hand-flapping), microcephaly, intractable seizures, brachycephaly, wide mouth, widely dispersed teeth, progressive prognathism; Angelman syndrome" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090363" "00067" "00114906" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090364" "00067" "00114908" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090365" "00065" "00114879" "01533" "Unknown" "" "Rett syndrome?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090366" "00067" "00114880" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090367" "00067" "00114888" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090368" "00067" "00114897" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090369" "00067" "00114900" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090370" "00067" "00114901" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090371" "00067" "00114902" "01533" "Unknown" "" "EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090372" "00067" "00114903" "01533" "Unknown" "" "EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090373" "00067" "00114907" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090374" "00067" "00114909" "01533" "Unknown" "" "infantile spasms, severe psychomotor retardation, stereotypic hand movements, mood swings, episodes of hyperventilation.; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090375" "00067" "00114910" "01533" "Unknown" "" "infantile spasms, severe psychomotor retardation, stereotypic hand movements, mood swings, episodes of hyperventilation.; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090376" "00067" "00114911" "01533" "Unknown" "" "Rett syndrome (variant), infantile seizures, acquired microcephaly, hand apraxia, generalized hypotonia, stereotypic hand motions; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090377" "00067" "00114912" "01533" "Unknown" "" "Rett syndrome, variant, infantile spasms; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090378" "00067" "00114913" "01533" "Unknown" "" "refractory epilepsy; encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090379" "00198" "00114914" "01533" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090380" "00198" "00114915" "01533" "Unknown" "" "in vitro" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090381" "00065" "00114917" "01533" "Unknown" "" "Rett syndrome?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090382" "00067" "00114918" "01533" "Unknown" "" "EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090383" "00067" "00114916" "01533" "Unknown" "" "8m-psychomotor regression, coincided with onset seizures; loss of speech, ataxia, progression of refractory seizures; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090384" "00198" "00114924" "01533" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090385" "00067" "00114926" "01533" "Unknown" "" "encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090386" "00065" "00114927" "01533" "Unknown" "" "Rett syndrome, variant, infantile spasms; Rett syndrome?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090387" "00065" "00114928" "01533" "Unknown" "" "Rett syndrome?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090388" "00065" "00114929" "01533" "Unknown" "" "Rett syndrome?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090389" "00067" "00114925" "01533" "Unknown" "" "2m-onset seizures; mild dysmorphic features incl. high sloping forehead, hypotelorism, epicanthus, broad nasal bridge, high palate, large anteverted ears; profound mental retardation, refractory epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090390" "00067" "00114930" "01533" "Unknown" "" "refractory epilepsy; encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090391" "00067" "00114931" "01533" "Unknown" "" "early epilepsy; encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090392" "00065" "00114933" "01533" "Unknown" "" "Rett syndrome?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090393" "00198" "00114934" "01533" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090394" "00067" "00114935" "01533" "Unknown" "" "refractory epilepsy; encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090395" "00198" "00114936" "01533" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090396" "00067" "00114937" "01533" "Unknown" "" "early epilepsy; encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090397" "00067" "00114939" "01533" "Unknown" "" "early epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090398" "00067" "00114941" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090399" "00067" "00114932" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090400" "00067" "00114942" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090401" "00198" "00114943" "01533" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090402" "00067" "00114944" "01533" "Unknown" "" "encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090403" "00067" "00114945" "01533" "Unknown" "" "early epilepsy; encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090410" "00067" "00114938" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090413" "00067" "00114955" "01533" "Unknown" "" "early epilepsy; encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090414" "00065" "00114956" "01533" "Unknown" "" "Rett syndrome, variant, infantile spasms; Rett syndrome?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090415" "00067" "00114958" "01533" "Unknown" "" "refractory epilepsy; encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090416" "00067" "00114959" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090417" "00065" "00114960" "01533" "Unknown" "" "Rett syndrome, variant, infantile spasms; Rett syndrome?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090418" "00065" "00114961" "01533" "Unknown" "" "Rett syndrome, atypical; Rett syndrome?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090419" "00065" "00114962" "01533" "Unknown" "" "Rett syndrome?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090420" "00067" "00114963" "01533" "Unknown" "" "early epilepsy; encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090421" "00067" "00114947" "01533" "Unknown" "" "Rett syndrome, atypical; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090422" "00067" "00114964" "01533" "Unknown" "" "early epilepsy; encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090423" "00067" "00114966" "01533" "Unknown" "" "early epilepsy; encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090424" "00198" "00114967" "01533" "Unknown" "" "infantile spasms; ?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090425" "00067" "00114968" "01533" "Unknown" "" "early epilepsy; encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090426" "00198" "00114969" "01533" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090427" "00198" "00114970" "01533" "Unknown" "" "infantile spasms; ?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090428" "00067" "00114972" "01533" "Unknown" "" "early epilepsy; encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090429" "00065" "00114973" "01533" "Unknown" "" "Rett syndrome, variant, infantile spasms; Rett syndrome?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090430" "00067" "00114957" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090431" "00198" "00114882" "01533" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090432" "00067" "00114884" "01533" "Unknown" "" "EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090433" "00065" "00114885" "01533" "Unknown" "" "Rett syndrome?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090434" "00067" "00114886" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090435" "00067" "00114965" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090436" "00067" "00114893" "01533" "Unknown" "" "epilepsy; EIEE2" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090437" "00198" "00114894" "01533" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090438" "00198" "00114919" "00485" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090439" "00187" "00114920" "00485" "Unknown" "" "most severe retardation, hypotonia, epiliptic and non-epiliptic myoclonia, as well as other seizures; MRX" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090440" "00198" "00114921" "00485" "Unknown" "" "no clinic; ?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090441" "00187" "00114922" "00485" "Unknown" "" "epilepsy, hepatomegalie, developmental retardation; MRX" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090442" "00198" "00114923" "00485" "Unknown" "" "no clinic; ?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090443" "00198" "00114883" "00485" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090444" "00198" "00114889" "00485" "Unknown" "" "severe infantile epilepsy; ?" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090445" "00198" "00114892" "00485" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090446" "00198" "00114896" "00485" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090447" "00198" "00114898" "00485" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090448" "00198" "00114899" "00485" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090449" "00067" "00114940" "01982" "Unknown" "" "Epiletic encephalopathy, Infantile Spasms; CDKL5 related encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000090450" "00065" "00114887" "01989" "Unknown" "08y?" "Rett syndrome" "02y?" "" "" "" "" "" "" "" "" "" "" "" "" "0000104311" "02262" "00132118" "00006" "Familial, X-linked recessive" "09y" "infantile; reading difficulties, never had full vision; 0.4/0.4 BCVA R/L (LogMAR)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000141822" "00344" "00177004" "02552" "Familial, X-linked dominant" "" "HP:0000639\r\nHP:0000817\r\nHP:0000297\r\nHP:0008936\r\nHP:0000486\r\nHP:0001285\r\nHP:0003781\r\nHP:0002015\r\nHP:0002705" "00y01m" "" "" "" "" "" "" "" "" "" "" "" "" "0000156031" "00198" "00035147" "01164" "Unknown" "" "developmental delay, epilepsy" "" "" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000156032" "00198" "00035148" "01164" "Unknown" "" "severe mental handicap, epilepsy" "" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000156033" "00198" "00035149" "01164" "Unknown" "" "therapy-reistent epilepsy, mental handicap" "" "" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000156034" "00198" "00035150" "01164" "Unknown" "" "suspected genetic predisposition, epilepsy at the early infancy, severe developmental delay, therapy-reistent epilepsy, Hypsarrhythmie partiell" "" "" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000156035" "00198" "00035151" "01164" "Unknown" "" "early childhood epilepsies, stereotypies" "" "" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000156036" "00198" "00035152" "01164" "Unknown" "" "epileptic encephalopathy since the first year of life" "" "" "" "" "" "" "" "" "" "" "" "epileptic encephalopathy" "" "0000156037" "00198" "00035155" "01164" "Unknown" "" "severe early childhood epilepsy with fits" "" "" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000156038" "00198" "00035158" "01164" "Unknown" "" "epileptic encepahlopathy, developmental delay" "" "" "" "" "" "" "" "" "" "" "" "epileptic encepahlopathy, developmental delay" "" "0000156039" "00198" "00035159" "01164" "Unknown" "" "severe early childhood epilepsy with fits" "" "" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000157622" "05533" "00209017" "00006" "Familial, X-linked" "" "Epilepsy, autism spectrum disorder, intellectual disability, and ketotic hypoglycemiaa" "" "" "" "" "" "" "" "" "" "" "EIEE-2" "intellectual disability" "" "0000209136" "00198" "00274191" "00006" "Familial, X-linked dominant" "" "neonatal onset; involvement basal ganglia; mitochondrial disease criteria score 4; muscle biopsy" "0d" "" "" "" "" "" "" "" "" "" "" "expected mitochondrial disorder" "" "0000230210" "00344" "00303126" "00006" "Isolated (sporadic)" "" "early onset epileptic encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "epileptic encephalopathy" "" "0000230211" "00344" "00303127" "00006" "Familial, X-linked dominant" "" "epileptic encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "epileptic encephalopathy" "" "0000230212" "00344" "00303128" "00006" "Isolated (sporadic)" "" "early onset epileptic encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "epileptic encephalopathy" "" "0000230213" "00344" "00303129" "00006" "Isolated (sporadic)" "" "infantile spasms" "" "" "" "" "" "" "" "" "" "" "" "epileptic encephalopathy" "" "0000230214" "00344" "00303130" "00006" "Isolated (sporadic)" "" "infantile spasms" "" "" "" "" "" "" "" "" "" "" "" "epileptic encephalopathy" "" "0000230215" "00344" "00303131" "00006" "Isolated (sporadic)" "" "early onset epileptic encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "epileptic encephalopathy" "" "0000230216" "00344" "00303132" "00006" "Isolated (sporadic)" "" "epileptic encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "epileptic encephalopathy" "" "0000230217" "00344" "00303133" "00006" "Unknown" "" "early onset epileptic encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "epileptic encephalopathy" "" "0000230231" "00344" "00303147" "00006" "Unknown" "" "epileptic encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "epileptic encephalopathy" "" "0000230232" "00344" "00303148" "00006" "Unknown" "" "epileptic encephalopathy" "" "" "" "" "" "" "" "" "" "" "" "epileptic encephalopathy" "" "0000231817" "04270" "00305971" "00006" "Unknown" "28y" "" "" "" "" "" "" "" "" "" "" "" "" "developmental and epileptic encephalopathy" "" "0000231818" "04270" "00305972" "00006" "Unknown" "32y" "" "" "" "" "" "" "" "" "" "" "" "developmental and epileptic encephalopathy" "Lennox Gastaut syndrome" "" "0000234865" "00198" "00309546" "00006" "Familial, autosomal recessive" "1d" "see paper; ..., hypoxic-ischemic encephalopathy grade 2, birth asphyxia; fetal distress;iIntrauterine hypoxia" "" "" "" "" "" "" "" "" "" "" "" "foetal bradycardia" "" "0000235210" "00067" "00309892" "03771" "Unknown" "00y02m" "" "00y02m" "" "" "Epileptic spasms" "" "" "" "" "" "" "" "Epileptic spasms" "" "0000235211" "00067" "00309893" "03771" "Isolated (sporadic)" "" "" "00y02m" "" "01y" "Epileptic spasms" "" "" "" "" "" "" "CDKL5 disorder" "Epileptic spasms" "" "0000235212" "00067" "00309894" "03771" "Isolated (sporadic)" "00y00m14d" "" "00y00m14d" "" "01y" "Epileptic spasms" "" "" "" "" "" "" "CDKL5 disorder" "Generalised motoric mainly tonic-clonic and myoclonic seizures" "" "0000235213" "00067" "00309895" "03771" "Isolated (sporadic)" "00y03m" "" "00y03m" "" "01y" "Epileptic spasms" "" "" "" "" "" "" "CDKL5 disorder" "West syndrome" "" "0000235214" "00067" "00309896" "03771" "Isolated (sporadic)" "00y02m" "" "00y02m" "" "01y" "Epileptic spasms" "" "" "" "" "" "" "CDKL5 disorder" "West syndrome" "" "0000235215" "00067" "00309897" "03771" "Isolated (sporadic)" "00y08m" "" "00y08m" "" "01y" "Epileptic spasms" "" "" "" "" "" "" "CDKL5 disorder" "West syndrome" "" "0000238102" "00067" "00313780" "00778" "Isolated (sporadic)" "24y" "HP:0011344(Severe global developmental delay)\r\nHP:0010864 (Intellectual disability, severe)\r\nHP:0000252 (Microcephaly)\r\nHP:0000733 (Stereotypy)\r\nHP:0001251 (Ataxia)\r\nHP:0002883 (Hyperventilation)\r\nHP:0000490 (Deep set eyes)\r\nHP:0000426 (Prominent nasal bridge)\r\nHP:0000154 (Wide mouth)\r\nHP:0012471 (Thick vermilion border)\r\nHP:0000347 (Micrognathia)\r\nHP:0000687 (Widely spaced teeth)" "00y02m" "" "25y" "HP:0001250(Seizure)" "" "" "" "" "" "" "CDKL5-related atypical Rett syndrome" "Epileptic encephalopathy" "" "0000242217" "00198" "00320171" "01807" "Unknown" "" "Seizure (HP:0001250); Myoclonus (HP:0001336); Epileptic encephalopathy (HP:0200134)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000256892" "00139" "00361487" "00006" "Isolated (sporadic)" "0y5m" "syndromic; intellectual disability, hearing impairment and microtia" "" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000256987" "00139" "00361582" "00006" "Isolated (sporadic)" "4y" "syndromic; global developmental delay, overgrowth, macrocephaly, dysmorphism" "" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000269448" "00198" "00374238" "00006" "Familial, X-linked" "" "Global developmental delay, seizures, poor eye contact, autistic traits, microcephaly, short nose and short philtrum" "" "" "" "" "" "" "" "" "" "" "" "microcephaly, autism spectrum disorder" "" "0000269497" "00198" "00374287" "00006" "Familial, X-linked" "" "Neuroregression, global developmental delay, autistic features and mild dysmorphism." "" "" "" "" "" "" "" "" "" "" "" "epilepsy, autism spectrum disorder" "" "0000269891" "00198" "00374681" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000269892" "00198" "00374682" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000269893" "00198" "00374683" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000269894" "00198" "00374684" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000282268" "04214" "00388727" "00000" "Familial, X-linked" "34y" "age at genetic diagnosis mentioned" "" "" "32y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000282299" "04214" "00388758" "00000" "Familial, X-linked" "13y" "age at genetic diagnosis mentioned" "" "" "6y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000282306" "04214" "00388765" "00000" "Familial, X-linked" "21y" "age at genetic diagnosis mentioned" "" "" "17y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000282307" "04214" "00388766" "00000" "Familial, X-linked" "11y" "age at genetic diagnosis mentioned" "" "" "8y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000282320" "04214" "00388779" "00000" "Familial, X-linked" "12y" "age at genetic diagnosis mentioned" "" "" "10y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000282325" "04214" "00388784" "00000" "Familial, X-linked" "30y" "age at genetic diagnosis mentioned" "" "" "26y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000282328" "04214" "00388787" "00000" "Familial, X-linked" "55y" "age at genetic diagnosis mentioned" "" "" "53y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000282329" "04214" "00388788" "00000" "Familial, X-linked" "9y" "age at genetic diagnosis mentioned" "" "" "7y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000282331" "04214" "00388790" "00000" "Familial, X-linked" "7y" "age at genetic diagnosis mentioned" "" "" "6y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000282439" "04214" "00388898" "00000" "Familial, X-linked" "63y" "age at genetic diagnosis mentioned" "" "" "61y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000282446" "04214" "00388905" "00000" "Familial, X-linked" "33y" "age at genetic diagnosis mentioned" "" "" "32y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000282451" "04214" "00388910" "00000" "Familial, X-linked" "30y" "age at genetic diagnosis mentioned" "" "" "30y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000282460" "04214" "00388919" "00000" "Familial, X-linked" "17y" "age at genetic diagnosis mentioned" "" "" "16y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000282503" "04214" "00388962" "00000" "Familial, X-linked dominant" "59y" "age at genetic diagnosis mentioned" "" "" "54y" "" "" "" "" "" "" "" "unclassified / mixed" "" "" "0000282504" "04214" "00388963" "00000" "Familial, X-linked dominant" "28y" "age at genetic diagnosis mentioned" "" "" "22y" "" "" "" "" "" "" "" "unclassified / mixed" "" "" "0000284824" "04214" "00391384" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "Retinoschisis (312700)" "Retinoschisis (312700)" "" "0000284825" "04214" "00391385" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "Retinoschisis (312700)" "Retinoschisis (312700)" "" "0000284841" "04214" "00391505" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "0000284844" "04214" "00391508" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "0000284845" "04214" "00391509" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "0000284846" "04214" "00391510" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "0000284847" "04214" "00391511" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "0000284848" "04214" "00391512" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "0000284849" "04214" "00391513" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "0000284850" "04214" "00391514" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "0000284851" "04214" "00391515" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "0000284852" "04214" "00391516" "00000" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "0000289088" "04214" "00395926" "00000" "Unknown" "19y7m" "" "2y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289089" "04214" "00395927" "00000" "Unknown" "3y7m" "" "2y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289114" "04214" "00395952" "00000" "Unknown" "8y11m" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289151" "04214" "00395989" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289152" "04214" "00395990" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289153" "04214" "00395991" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289154" "04214" "00395992" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289155" "04214" "00395993" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289156" "04214" "00395994" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289157" "04214" "00395995" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289158" "04214" "00395996" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289165" "04214" "00396002" "00000" "Familial, X-linked recessive" "44y" "Electroretinography: electronegative both eyes, fundoscopy: foveal and peripheral schisis, fundoscopy: foveal atrophy both eyes, best corrected visual acuity: 20/200 both eyes" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289166" "04214" "00396003" "00000" "Familial, X-linked recessive" "8y" "Electroretinography: electronegative both eyes, fundoscopy: foveal schisis both eyes, best corrected visual acuity: 20/60 right eye; 20/50 left eye" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289167" "04214" "00396004" "00000" "Familial, X-linked recessive" "10y" "Electroretinography: electronegative both eyes, fundoscopy: foveal schisis both eyes, best corrected visual acuity: 20/25 both eyes" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289168" "04214" "00396005" "00000" "Familial, X-linked recessive" "34y" "Electroretinography: nonrecordable, fundoscopy: foveal and peripheral schisis both eyes, best corrected visual acuity: hand movement right eye; 20/300 left eye" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289169" "04214" "00396006" "00000" "Familial, X-linked recessive" "8y" "Electroretinography: electronegative both eyes, fundoscopy: foveal and peripheral schisis both eyes, best corrected visual acuity: 20/250 right eye; 20/100 left eye" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289170" "04214" "00396007" "00000" "Familial, X-linked recessive" "45y" "Electroretinography: nonrecordable, fundoscopy: foveal and peripheral schisis both eyes, best corrected visual acuity: 20/300 right eye; 20/100 left eye" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289171" "04214" "00396008" "00000" "Familial, X-linked recessive" "6y" "Electroretinography: electronegative both eyes, fundoscopy: foveal and peripheral schisis both eyes, best corrected visual acuity: 20/400 right eye; 20/100 left eye" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289172" "04214" "00396009" "00000" "Familial, X-linked recessive" "2y" "Electroretinography: electronegative both eyes, fundoscopy: foveal and peripheral schisis both eyes, best corrected visual acuity: 20/25right eye; 20/200 left eye" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289183" "04214" "00396020" "00000" "Familial, X-linked recessive" "" "schisis elevation involving the macula with the inferior schisis touching the lens, ERG showed b-wave amplitude reduction" "" "" "3m" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289184" "04214" "00396021" "00000" "Familial, X-linked recessive" "14y" "best corrected visual acuity: right eye 20/50, left eye 20/32-2, kinetic perimetry: constriction to 40deg nasally right eye, 50deg left eye to V4e targ" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289185" "04214" "00396022" "00000" "Familial, X-linked recessive" "29y" "best corrected visual acuity: right eye 20/50-1, left eye 20/63, kinetic perimetry: Full to V4e and I4e right eye, constricted to 40deg nasally to V4e target" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289198" "04214" "00396036" "00000" "Familial, X-linked recessive" "19y" "best-corrected visual acuity right/left eye: 0.1/0.2, macular retinoschisis, peripheral pigmental disorder" "<5y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289199" "04214" "00396037" "00000" "Familial, X-linked recessive" "18y" "best-corrected visual acuity right/left eye: 0.4/0.2, macular retinoschisis, peripheral retinal degeneration" "8y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289200" "04214" "00396038" "00000" "Familial, X-linked recessive" "5y" "best-corrected visual acuity right/left eye: 0.3/0.7, macular retinoschisis, peripheral retinoschisis, retinal hole, electroretinography: ratio of b wave amplitude to a wave amplitude reduced" "3y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289201" "04214" "00396039" "00000" "Familial, X-linked recessive" "" "best-corrected visual acuity right/left eye: 0.2/0.3, pigmental disorder, blunted foveal reflex," "7y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289202" "04214" "00396040" "00000" "Familial, X-linked recessive" "5y" "best-corrected visual acuity right/left eye: finger counting/0.03, pigmental disorder, blunted foveal reflex, blunted foveal reflex, electroretinography: ratio of b wave amplitude to a wave amplitude reduced" "4y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289203" "04214" "00396041" "00000" "Familial, X-linked recessive" "6y" "best-corrected visual acuity right/left eye: 0.3/finger counting, macular retinoschisis, peripheral retinoschisis, strabismus, electroretinography: ratio of b wave amplitude to a wave amplitude reduced" "5y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289204" "04214" "00396042" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289205" "04214" "00396043" "00000" "Familial, X-linked recessive" "12y" "best-corrected visual acuity right/left eye: 0.3/0.03, no macular changes, peripheral retinoschisis, retinal hole" "<5y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289206" "04214" "00396044" "00000" "Familial, X-linked recessive" "21y" "best-corrected visual acuity right/left eye: 0.6/0.4, macular retinoschisis, No, electroretinography: ratio of b wave amplitude to a wave amplitude reduced" "<5y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289207" "04214" "00396045" "00000" "Familial, X-linked recessive" "22y" "best-corrected visual acuity right/left eye: 0.2/0.4, macular retinoschisis, peripheral retinoschisis, strabismus" "<5y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289208" "04214" "00396046" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289209" "04214" "00396047" "00000" "Familial, X-linked recessive" "9y" "best-corrected visual acuity right/left eye: 0.4/0.3, macular retinoschisis, peripheral retinoschisis, optical coherence tomography: retinoschisis" "6y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289212" "04214" "00396050" "00000" "Familial, X-linked recessive" "1y" "best corrected visual acuity right/left eye: 0.1/0.3, wheel-like cystic formation, optical coherence tomography: intraretinal spaces, cysts, electroretinography: scotopic b-wave decreased" "" "" "" "strabismus, reduced visual acuity" "" "" "" "" "" "" "retinoschisis" "" "" "0000289213" "04214" "00396051" "00000" "Familial, X-linked recessive" "7y" "best corrected visual acuity right/left eye: 0.4/0.4, wheel-like cystic formation, optical coherence tomography: intraretinal spaces, cysts, electroretinography: scotopic b-wave decreased" "" "" "" "reduced visual acuity" "" "" "" "" "" "" "retinoschisis" "" "" "0000289214" "04214" "00396052" "00000" "Familial, X-linked recessive" "10y" "best corrected visual acuity right/left eye: 0.3/0.4, no macular reflex, pigment deposits, optical coherence tomography: intraretinal spaces, cysts, electroretinography: scotopic b-wave decreased, vitreal floaters" "" "" "" "reduced visual acuity" "" "" "" "" "" "" "retinoschisis" "" "" "0000289215" "04214" "00396053" "00000" "Familial, X-linked recessive" "7y" "best corrected visual acuity right/left eye: 0.8/0.2, pigment deposits, optical coherence tomography: intraretinal spaces, cysts, electroretinography: scotopic b-wave decreased, hyperopic astigmatism" "" "" "" "reduced visual acuity" "" "" "" "" "" "" "retinoschisis" "" "" "0000289216" "04214" "00396054" "00000" "Familial, X-linked recessive" "3y" "best corrected visual acuity right/left eye: 0.1/0.1, wheel-like cystic formation, optical coherence tomography: intraretinal spaces, cysts, electroretinography: not available, initial disgnosis: cystoid macular edema" "" "" "" "reduced visual acuity" "" "" "" "" "" "" "retinoschisis" "" "" "0000289217" "04214" "00396055" "00000" "Familial, X-linked recessive" "6y" "best corrected visual acuity right/left eye: 0.5/0.6, wheel-like cystic formation, optical coherence tomography: intraretinal spaces, cysts, electroretinography: scotopic b-wave decreased, initial disgnosis: CME; central scotoma" "" "" "" "reduced visual acuity" "" "" "" "" "" "" "retinoschisis" "" "" "0000289218" "04214" "00396056" "00000" "Familial, X-linked recessive" "11y" "best corrected visual acuity right/left eye: 1.0/0.6, wheel-like cystic formation, optical coherence tomography: intraretinal spaces, cysts, electroretinography: nonspecific (hemorrhage), vitreoretinal proliferation, floaters" "" "" "" "vitreous hemorrhage" "" "" "" "" "" "" "retinoschisis" "" "" "0000289219" "04214" "00396057" "00000" "Familial, X-linked recessive" "6y" "best corrected visual acuity right/left eye: 0.4/0.1, no macular reflex, optical coherence tomography: intraretinal spaces, cysts, electroretinography: scotopic b-wave decreased, retinoschisis of lower retina quadrants" "" "" "" "reduced visual acuity" "" "" "" "" "" "" "retinoschisis" "" "" "0000289224" "04214" "00396062" "00000" "Familial, X-linked recessive" "" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289225" "04214" "00396063" "00000" "Familial, X-linked recessive" "" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289226" "04214" "00396064" "00000" "Familial, X-linked recessive" "" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289227" "04214" "00396065" "00000" "Familial, X-linked recessive" "" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289228" "04214" "00396066" "00000" "Familial, X-linked recessive" "" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289229" "04214" "00396067" "00000" "Familial, X-linked recessive" "" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289230" "04214" "00396068" "00000" "Familial, X-linked recessive" "" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289231" "04214" "00396069" "00000" "Familial, X-linked recessive" "" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289232" "04214" "00396070" "00000" "Familial, X-linked recessive" "" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289233" "04214" "00396071" "00000" "Familial, X-linked recessive" "" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289234" "04214" "00396072" "00000" "Familial, X-linked recessive" "" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289235" "04214" "00396073" "00000" "Familial, X-linked recessive" "" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289240" "04214" "00396078" "00000" "Familial, X-linked recessive" "35y" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289244" "04214" "00396082" "00000" "Familial, X-linked recessive" "49y" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289245" "04214" "00396083" "00000" "Familial, X-linked recessive" "55y" "" "" "" "" "strabismus" "" "" "" "" "" "" "retinoschisis" "" "" "0000289247" "04214" "00396085" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289248" "04214" "00396086" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289251" "04214" "00396089" "00000" "Familial, X-linked recessive" "15y" "best corrected visual acuity right/left eye: 0.1/0.1, both eyes: macular retinoschisis, both eyes: peripheral retinoschisis" "<5y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289252" "04214" "00396090" "00000" "Familial, X-linked recessive" "6y" "best corrected visual acuity right/left eye: 0.4/0.5, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis" "4y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289253" "04214" "00396091" "00000" "Familial, X-linked recessive" "24y" "best corrected visual acuity right/left eye: 0.1/0.05, both eyes: macular retinoschisis, right eye: peripheral retinoschisis, left eye: unknown, cataract (both eyes), exotropia and retinal detachment (left eye)" "8y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289257" "04214" "00396095" "00000" "Familial, X-linked recessive" "5y" "best corrected visual acuity right/left eye: 0.2/0.1, both eyes: macular retinoschisis, both eyes: peripheral retinoschisis" "5y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289258" "04214" "00396096" "00000" "Familial, X-linked recessive" "5y" "best corrected visual acuity right/left eye: 0.2/0.1, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis" "3y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289259" "04214" "00396097" "00000" "Familial, X-linked recessive" "34y" "best corrected visual acuity right/left eye: 0.2/0.2, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis" "<5y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289261" "04214" "00396099" "00000" "Familial, X-linked recessive" "6y" "best corrected visual acuity right/left eye: 0.05/1,left eye: peripheral retinoschisis, right eye: unknown, exotropia and vitreous hemorrhage (right eye), electroretinography: b-wave reduced" "6y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289262" "04214" "00396100" "00000" "Familial, X-linked recessive" "41y" "best corrected visual acuity right/left eye: 0.3/0.15, both eyes:macular atrophy, both eyes: no peripheral retinoschisis" "<5y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289263" "04214" "00396101" "00000" "Familial, X-linked recessive" "9y" "best corrected visual acuity right/left eye: 0.1/0.2, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis" "8y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289264" "04214" "00396102" "00000" "Familial, X-linked recessive" "7y" "best corrected visual acuity right/left eye: 0.3/0.2, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis" "<5y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289265" "04214" "00396103" "00000" "Familial, X-linked recessive" "4y" "best corrected visual acuity right/left eye: 0.02/0.4, both eyes: macular retinoschisis, both eyes: no peripheral retinoschisis" "4y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289266" "04214" "00396104" "00000" "Familial, X-linked recessive" "27y" "best corrected visual acuity right/left eye: 0.06/0.06, both eyes: macular retinoschisis, large activity, both eyes: no peripheral retinoschisis and nystagmus, electroretinography: b-wave reduced" "<5y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289275" "04214" "00396111" "00000" "Familial, X-linked recessive" "59y" "best-corrected visual acuity right/left eye: hand movement/hand movement; reduced visual ability in childhood, which deteriorated further in early life, stable for at least 25 years. Seven years earlier, cryotherapy was performed elsewhere for suspected bilateral Coats disease. Funduscopy: the macular retina appeared atrophic, hyperpigmentary changes and chorioretinal scarring towards the periphery. Fundus autofluorescence: a mottled reduced signal of the central retina, a ring of increased AF at 1 to 2 disc diameters from the foveal center, and a virtually absent AF signal within areas of chorioretinal scarring. Optical coherence tomography: retinal thinning and a reduced contrast between different retinal layers" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289276" "04214" "00396112" "00000" "Familial, X-linked recessive" "36y" "best-corrected visual acuity right/left eye: 0.4/0.4; long-standing moderately reduced visual acuity, funduscopy: macular retinal pigment epithelium irregularities, some yellow�white spots, and a slightly wrinkled appearing reflex of the internal limiting membrane, periphery and retinal vesselsnormal. Fundus autofluorescence: increased foveal signal and a ring of increased AF at about 2 disc diameters eccentricity, macular pigment distribution was abnormal with a relatively reduced density in the foveal center; optical coherence tomography: macular thinning mainly resulting from thinning of the photoreceptor layer with loss of the two hyperreflective bands that are commonly referred to represent the external limiting membrane and the ellipsoid zone. The ring of enhanced AF correlated with the loss of these two hyperreflective bands. Electroretinography: reduced scotopic and photopic responses and a reduced a/b ratio" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289277" "04214" "00396113" "00000" "Familial, X-linked recessive" "45y" "best-corrected visual acuity right/left eye: 0.05/0.05; early-onset low visual acuity with further deterioration within the last decades, Funduscopy: discreet macular spoke-wheel pattern well recognizable on fundus autofluorescence, with areas of enhanced and reduced AF signal resulting from displaced macular pigment, optical coherence tomography: splitting of retinal layers, electroretinography: reduced photopic and scotopic and amplitudes, and a reduced a/b ratio in the dark adapted maximum responses" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289278" "04214" "00396114" "00000" "Familial, X-linked recessive" "21y" "best-corrected visual acuity right/left eye: 0.3/0.5; reduced visual acuity since childhood, marked central and peripheral schisis, central pigment mottling, and enhanced foveal fundus autofluorescence, optical coherence tomography: subtle intraretinal cavities, electroretinography: similar to older family members (reduced photopic and scotopic and amplitudes, and a reduced a/b ratio in the dark adapted maximum responses)" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289279" "04214" "00396115" "00000" "Familial, X-linked recessive" "23y" "best-corrected visual acuity right/left eye: 0.6/0.4; reduced visual acuity since childhood, minimal central irregularities on funduscopy and fundus autofluorescence imaging; optical coherence tomography: subtle intraretinal cavities, electroretinography: similar to older family members (reduced photopic and scotopic and amplitudes, and a reduced a/b ratio in the dark adapted maximum responses)" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289283" "04214" "00396116" "00000" "Familial, X-linked recessive" "7y" "characteristic phenotype of XLRS: stellate cystic changes of the region of the retina, a splitting of the neurosensory retina, and visual deterioration, temporal retinal detachment, visual acuity had gradually decreased since 5 years old" "5y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289284" "04214" "00396117" "00000" "Familial, X-linked recessive" "8m" "eyes could not follow moving objects; anemia" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289285" "04214" "00396118" "00000" "Familial, X-linked recessive" "37y" "Best corrected visual acuity right/left eye: 0.4/0.7, funduscopy: retinal blurring in the macula with discrete edema, resembling the �cartwheel� sign, optical coherence tomography: intraretinal schisis cysts, electroretinography: reduced b-wave amplitude" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289286" "04214" "00396119" "00000" "Familial, X-linked recessive" "9y" "Best corrected visual acuity right/left eye: 0.5/0.4, optical coherence tomography: edema, electroretinography: electronegative record" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289287" "04214" "00396120" "00000" "Familial, X-linked recessive" "6y" "Best corrected visual acuity right/left eye: 0.5/0.5, optical coherence tomography: edema, electroretinography: electronegative record" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289291" "04214" "00396124" "00000" "Familial, X-linked recessive" "14y" "visual acuity: 0.52, visual field not affected by schisis" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289292" "04214" "00396125" "00000" "Familial, X-linked recessive" "28y" "visual acuity: 0.49, visual field affected by schisis" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289293" "04214" "00396126" "00000" "Familial, X-linked recessive" "26y" "visual acuity: 0.46, visual field affected by schisis" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289294" "04214" "00396127" "00000" "Familial, X-linked recessive" "20y" "visual acuity: 0.43, visual field not affected by schisis" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289295" "04214" "00396128" "00000" "Familial, X-linked recessive" "31y" "visual acuity: 0.6, visual field affected by schisis" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289296" "04214" "00396129" "00000" "Familial, X-linked recessive" "11y" "visual acuity: 0.12, visual field affected by schisis" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289297" "04214" "00396130" "00000" "Familial, X-linked recessive" "32y" "visual acuity: 0.62, visual field affected by schisis" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289298" "04214" "00396131" "00000" "Familial, X-linked recessive" "20y" "visual acuity: 0.37, visual field affected by schisis" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289299" "04214" "00396133" "00000" "Familial, X-linked recessive" "42y" "Best corrected visual acuity right/left eye: 0.15/0.3 in the. Funduscopy: bilateral spoke wheel-appearing maculopathy. Spectral-domain optical coherence tomography: foveoschisis in the left eye, adaptive optics: left eye showed spoke wheel retinal folds thinner than those in fundus photographs. Follow-up: foveal thickness in the and the number of retinal folds in the AO images were reduced, full-field electroretinography: amplitudes reduced in the fovea and also in the peripheral areas in both eyes; Goldmann visual field: central scotomas in both eyes" "" "" "30y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289300" "04214" "00396134" "00000" "Familial, X-linked recessive" "" "bilateral central atrophy without foveoschisis in the fundus photographs and spectral-domain optical coherence tomography images" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289301" "04214" "00396135" "00000" "Familial, X-linked recessive" "17y" "Funduscopy: bilateral spoke-wheel pattern in the macular area and peripheral schisis with large holes in the inferotemporal quadrant of both eyes; Mizuo-Nakamura phenomenon in the peripheral retina; Spectral Domain Optic Coherence Tomography: retinal cysts in the foveal area and extended up to the vascular arcades. Electroretinogram: negative" "17y" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289307" "04214" "00396141" "00000" "Familial, X-linked recessive" "8m" "very bullous anterior retinal elevations, posterior retinal corrugations, and cystic foveae that appeared to represent severe XLRS with bilateral chronic rhegmatogenous retinal detachments and macular holes" "" "" "" "poor visual behavior" "" "" "" "" "" "" "retinoschisis" "" "" "0000289308" "04214" "00396142" "00000" "Familial, X-linked recessive" "18y" "decrease in visual acuity, stellate-shaped cavities in the macular region on the retinal exam, electroretinography: decrease in the b-wave amplitude; response to the treatment: the appearance of macular thickening was limited by sustained therapy with topical CAI, avoiding the return to the pretreatment levels" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289309" "04214" "00396143" "00000" "Familial, X-linked recessive" "20y" "decrease in visual acuity, stellate-shaped cavities in the macular region on the retinal exam, electroretinography: decrease in the b-wave amplitude; response to the treatment: initial improvement in cystoid macular edema was not associated with visual acuity changes (during therapy with oral acetazolamide), followed by a marked rebound effect after cessation of the therapy" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289314" "04214" "00396148" "00000" "Familial, X-linked recessive" "3m" "funduscopy: right eye - severe schisis reaching the posterior pole and preventing visualization of the fovea, left eye the inferior schisis was complicated by an intra-retinal haemorrhage; optical coherence tomography: right eye the bullous elevated schisis prevented foveal visualization, left eye: macular schisis with intraretinal separation in different retinal layers (intraretinal cysts could be seen in the inner nuclear, outer plexiform and outer nuclear layer), extending beyond the foveal area; electroretinography: absence of the b-wave and a nearly normal a-wave" "3m" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289315" "04214" "00396149" "00000" "Familial, X-linked recessive" "3m" "funduscopy: right eye - severe bullous peripheral schisis with pre-retinal and intra-retinal haemorrhages, left eye schisis from the inferior quadrant shrouding to the posterior pole; optical coherence tomography: both eyes - macular schisis with intraretinal separation in different retinal layers (intraretinal cysts could be seen in the inner nuclear, outer plexiform and outer nuclear layer), extending beyond the foveal area; electroretinography: absence of the b-wave and a nearly normal a-wave" "3m" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289316" "04214" "00396150" "00000" "Familial, X-linked recessive" "7y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289317" "04214" "00396151" "00000" "Isolated (sporadic)" "10y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289318" "04214" "00396152" "00000" "Familial, X-linked recessive" "3y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289319" "04214" "00396153" "00000" "Isolated (sporadic)" "10y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289320" "04214" "00396154" "00000" "Familial, X-linked recessive" "4y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289321" "04214" "00396155" "00000" "Isolated (sporadic)" "6y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289322" "04214" "00396156" "00000" "Isolated (sporadic)" "8y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289323" "04214" "00396157" "00000" "Familial, X-linked recessive" "3y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289324" "04214" "00396158" "00000" "Isolated (sporadic)" "6y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289325" "04214" "00396159" "00000" "Isolated (sporadic)" "6y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289326" "04214" "00396160" "00000" "Isolated (sporadic)" "5y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289327" "04214" "00396161" "00000" "Familial, X-linked recessive" "38y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289328" "04214" "00396162" "00000" "Isolated (sporadic)" "11y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289329" "04214" "00396163" "00000" "Isolated (sporadic)" "3y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289330" "04214" "00396164" "00000" "Isolated (sporadic)" "7y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289331" "04214" "00396165" "00000" "Isolated (sporadic)" "5y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289332" "04214" "00396166" "00000" "Isolated (sporadic)" "25y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289333" "04214" "00396167" "00000" "Isolated (sporadic)" "11y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289334" "04214" "00396168" "00000" "Familial, X-linked recessive" "3y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289335" "04214" "00396169" "00000" "Isolated (sporadic)" "8y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289336" "04214" "00396170" "00000" "Familial, X-linked recessive" "7y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289337" "04214" "00396171" "00000" "Isolated (sporadic)" "8y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289338" "04214" "00396172" "00000" "Familial, X-linked recessive" "10y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289339" "04214" "00396173" "00000" "Isolated (sporadic)" "7m" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289340" "04214" "00396174" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289341" "04214" "00396175" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289342" "04214" "00396176" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289343" "04214" "00396177" "00000" "Isolated (sporadic)" "10y" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289513" "04214" "00396351" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289515" "04214" "00396353" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289516" "04214" "00396354" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289517" "04214" "00396355" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289518" "04214" "00396356" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289519" "04214" "00396357" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289520" "04214" "00396358" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289521" "04214" "00396359" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289522" "04214" "00396360" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289523" "04214" "00396361" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289524" "04214" "00396362" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289525" "04214" "00396363" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289526" "04214" "00396364" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289527" "04214" "00396365" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289528" "04214" "00396366" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289529" "04214" "00396367" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289530" "04214" "00396368" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289531" "04214" "00396369" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289532" "04214" "00396370" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289533" "04214" "00396371" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289534" "04214" "00396372" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289535" "04214" "00396373" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289536" "04214" "00396374" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289537" "04214" "00396375" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289538" "04214" "00396376" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289539" "04214" "00396377" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289540" "04214" "00396378" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289541" "04214" "00396379" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289542" "04214" "00396380" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289543" "04214" "00396381" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289544" "04214" "00396382" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289545" "04214" "00396383" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289546" "04214" "00396384" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289547" "04214" "00396385" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289548" "04214" "00396386" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289549" "04214" "00396387" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289550" "04214" "00396388" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289551" "04214" "00396389" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289552" "04214" "00396390" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289553" "04214" "00396391" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289554" "04214" "00396392" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289555" "04214" "00396393" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289556" "04214" "00396394" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289557" "04214" "00396395" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289558" "04214" "00396396" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289559" "04214" "00396397" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289560" "04214" "00396398" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289561" "04214" "00396399" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289562" "04214" "00396400" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289563" "04214" "00396401" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289564" "04214" "00396402" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289565" "04214" "00396403" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289566" "04214" "00396404" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289567" "04214" "00396405" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289568" "04214" "00396406" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289569" "04214" "00396407" "00000" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289593" "04214" "00396431" "00000" "Familial, X-linked recessive" "" "best-corrected visual acuity (right ; left eye): 20/200 ; 20/200, macular schisis, no peripheral retinoschisis, no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio:" "" "" "58y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289594" "04214" "00396432" "00000" "Familial, X-linked recessive" "" "best-corrected visual acuity (right ; left eye): 20160; 20/ 60, macular schisis, peripheral retinoschisis, vitreous hemorrhage right eye, no retinal detachment, electroretinography scotopic max b/a ratio: >l" "" "" "18y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289595" "04214" "00396433" "00000" "Familial, X-linked recessive" "" "best-corrected visual acuity (right ; left eye): 20/200 ; 20/200, macular schisis, right eye retinal pigment epithelium atrophy, peripheral retinoschisis right eye, no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: l" "" "" "52y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289599" "04214" "00396437" "00000" "Familial, X-linked recessive" "" "best-corrected visual acuity (right ; left eye): 20/200 ; 20/200, macular schisis, peripheral retinoschisis right eye, no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: l" "" "" "18y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289602" "04214" "00396440" "00000" "Familial, X-linked recessive" "" "best-corrected visual acuity (right ; left eye): light perception ; 20/60, macular schisis, peripheral retinoschisis left eye, no vitreous hemorrhage, Phthisis after surgery for severe proliferative vitreoretinopathy right eye, electroretinography scotopic max b/a ratio: l, normal" "" "" "11y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289610" "04214" "00396448" "00000" "Familial, X-linked recessive" "" "best-corrected visual acuity (right ; left eye): light perception; 20/300, macular schisis, no peripheral retinoschisis, left eye, no vitreous hemorrhage, Coats\'-like appearance right eye, electroretinography scotopic max b/a ratio: not tested" "" "" "4y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289611" "04214" "00396449" "00000" "Familial, X-linked recessive" "" "best-corrected visual acuity (right ; left eye): no light perception; 20/300, macular schisis left eye, peripheral retinoschisis left eye, vitreous hemorrhage left eye, retinal detachment left eye, phthisis right eye, electroretinography scotopic max b/a ratio: not tested" "" "" "7y" "" "" "" "" "" "" "" "retinoschisis" "" "" "0000289612" "04214" "00396450" "00000" "Familial, X-linked recessive" "" "best-corrected visual acuity (right ; left eye): 20/200 ; 20/60, macular schisis, right eye retinal pigment epithelium atrophy, no peripheral retinoschisis, no vitreous hemorrhage, no retinal detachment, electroretinography scotopic max b/a ratio: T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.18653169G>T" "" "VUS" "" "0000062335" "1" "50" "X" "18664136" "18664136" "subst" "0" "01164" "CDKL5_000081" "g.18664136G>A" "" "" "" "" "PolyPhen: benign, MutTaster: benign" "Germline" "" "" "0" "" "" "g.18646016G>A" "" "VUS" "" "0000062336" "1" "50" "X" "18627590" "18627590" "subst" "0" "01164" "CDKL5_000077" "g.18627590A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.18609470A>G" "" "VUS" "" "0000062337" "1" "50" "X" "18600038" "18600038" "subst" "0" "01164" "CDKL5_000086" "g.18600038G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.18581918G>T" "" "VUS" "" "0000062338" "1" "50" "X" "18613412" "18613412" "subst" "0" "01164" "CDKL5_000073" "g.18613412G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.18595292G>A" "" "VUS" "" "0000062339" "1" "90" "X" "18622434" "18622434" "subst" "0" "01164" "CDKL5_000074" "g.18622434C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.18604314C>T" "" "pathogenic" "" "0000062340" "1" "90" "X" "18631301" "18631301" "del" "0" "01164" "CDKL5_000078" "g.18631301del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.18613181del" "" "pathogenic" "" "0000062341" "1" "90" "X" "18622666" "18622666" "del" "0" "01164" "CDKL5_000075" "g.18622666del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.18604546del" "" "pathogenic" "" "0000062342" "1" "50" "X" "18643358" "18643358" "subst" "1.68694E-5" "01164" "CDKL5_000080" "g.18643358G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.18625238G>A" "" "VUS" "" "0000062343" "1" "90" "X" "18643248" "18643248" "del" "0" "01164" "CDKL5_000079" "g.18643248del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.18625128del" "" "pathogenic" "" "0000062344" "1" "50" "X" "18606202" "18606202" "subst" "0" "01164" "CDKL5_000071" "g.18606202G>A" "" "" "" "" "Polyphen: pat.; found in Mosaik constellation" "Germline" "" "" "0" "" "" "g.18588082G>A" "" "VUS" "" "0000062345" "1" "10" "X" "18460331" "18460331" "subst" "0" "01164" "CDKL5_000082" "g.18460331G>C" "" "" "" "" "Seg.analysis" "Germline" "" "" "0" "" "" "g.18442211G>C" "" "benign" "" "0000062346" "1" "50" "X" "18600056" "18600056" "subst" "0" "01164" "CDKL5_000087" "g.18600056A>G" "" "" "" "" "Polyphen: possibly damaging (PSIC:0,572)" "Germline" "" "" "0" "" "" "g.18581936A>G" "" "VUS" "" "0000062347" "1" "90" "X" "18622692" "18622692" "subst" "0" "01164" "CDKL5_000076" "g.18622692C>T" "" "" "" "" "" "Germline" "" "rs267608643" "0" "" "" "g.18604572C>T" "" "pathogenic" "" "0000062348" "1" "50" "X" "18606202" "18606202" "subst" "0" "01164" "CDKL5_000072" "g.18606202G>T" "" "" "" "" "Polyphen: pat.; found in Mosaik constellation" "Germline" "" "" "0" "" "" "g.18588082G>T" "" "VUS" "" "0000062349" "1" "50" "X" "18602383" "18602383" "subst" "0" "01164" "CDKL5_000084" "g.18602383G>A" "" "" "" "" "PolyPhen-2: prob.dam. 1,00 / Mut.Tast: disease causing / loss of 5\'-splice site)" "Germline" "" "" "0" "" "" "g.18584263G>A" "" "VUS" "" "0000062350" "1" "50" "X" "18582642" "18582642" "subst" "0" "01164" "CDKL5_000085" "g.18582642G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.18564522G>A" "" "VUS" "" "0000062351" "1" "50" "X" "18602302" "18602302" "subst" "0" "01164" "CDKL5_000083" "g.18602302T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.18584182T>C" "" "VUS" "" "0000079564" "0" "90" "X" "18582601" "18582601" "subst" "0" "00006" "CDKL5_000088" "g.18582601C>T" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "De novo" "" "" "0" "" "" "g.18564481C>T" "" "pathogenic" "" "0000130261" "0" "70" "X" "18582616" "18582616" "subst" "0" "01758" "CDKL5_000089" "g.18582616C>A" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "De novo" "" "" "0" "" "" "g.18564496C>A" "" "likely pathogenic" "ACMG" "0000130283" "0" "70" "X" "18616614" "18616614" "subst" "0" "01758" "CDKL5_000070" "g.18616614C>A" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "De novo" "" "" "0" "" "" "g.18598494C>A" "" "likely pathogenic" "ACMG" "0000140783" "21" "90" "X" "18674772" "18779695" "del" "0" "00006" "RS1_000123" "g.(18665453_18674772)_(18779695_18797127)del" "" "{PMID:Huopaniemi:11013441}" "" "" "136 kb deletion from PPEF intron 9 to RS1 intron 3 also involving CDKL5 (STK9)" "Germline" "yes" "" "0" "" "" "g.(18647333_18656652)_(18761577_18779009)del" "" "pathogenic (recessive)" "" "0000184789" "1" "10" "X" "18582659" "18582659" "subst" "0" "01533" "CDKL5_000012" "g.18582659A>G" "" "{PMID:Tao 2004:15499549}" "" "144+17A>G" "conserved haplotype 1/32 patients, 2/267 control X-chromosomes" "Germline" "" "" "0" "" "" "g.18564539A>G" "" "benign" "" "0000184790" "1" "10" "X" "18671574" "18671574" "subst" "0.00422294" "01533" "CDKL5_000004" "g.18671574C>T" "" "{PMID:Tao 2004:15499549}" "" "H1001H" "conserved haplotype 1/32 patients, 2/267 control X-chromosomes" "Germline" "" "" "0" "" "" "g.18653454C>T" "" "benign" "" "0000184791" "1" "10" "X" "18671655" "18671655" "subst" "0" "01533" "CDKL5_000005" "g.18671655G>T" "" "{PMID:Tao 2004:15499549}" "" "T1028T" "conserved haplotype 1/32 patients, 2/267 control X-chromosomes" "Germline" "" "" "0" "" "" "g.18653535G>T" "" "benign" "" "0000184792" "1" "10" "X" "18638082" "18638082" "subst" "0.0313058" "01533" "CDKL5_000002" "g.18638082A>C" "" "{PMID:Tao 2004:15499549}" "" "" "in 5/32 patients and 3/96 control X-chromosomes" "Germline" "" "" "0" "" "" "g.18619962A>C" "" "benign" "" "0000184793" "1" "10" "X" "21861340" "21861340" "subst" "0" "01533" "CDKL5_000063" "g.21861340T>G" "" "{PMID:Russo 2009:19241098}" "" "" "" "Germline" "" "" "0" "" "" "g.21843222T>G" "" "benign" "" "0000184794" "1" "10" "X" "21861384" "21861385" "del" "0" "01533" "CDKL5_000059" "g.21861384_21861385del" "" "{PMID:Russo 2009:19241098}" "" "145+28ins/delAT" "" "Germline" "" "" "0" "" "" "g.21843266_21843267del" "" "benign" "" "0000184795" "1" "10" "X" "21863415" "21863415" "subst" "0" "01533" "CDKL5_000017" "g.21863415C>T" "" "{PMID:Russo 2009:19241098}" "" "" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "benign" "" "0000184796" "1" "10" "X" "18606055" "18606055" "subst" "0.0322602" "01533" "CDKL5_000021" "g.18606055C>G" "" "{PMID:Russo 2009:19241098}" "" "554-19C>G" "" "Germline" "" "" "0" "" "" "g.18587935C>G" "" "benign" "" "0000184797" "1" "10" "X" "18627111" "18627111" "subst" "0" "01533" "CDKL5_000035" "g.18627111G>A" "" "{PMID:Russo 2009:19241098}" "" "" "" "Germline" "" "" "0" "" "" "g.18608991G>A" "" "benign" "" "0000184798" "1" "10" "X" "18638082" "18638082" "subst" "0.0313058" "01533" "CDKL5_000002" "g.18638082A>C" "" "{PMID:Russo 2009:19241098}" "" "" "" "Germline" "" "" "0" "" "" "g.18619962A>C" "" "benign" "" "0000184799" "1" "10" "X" "18671574" "18671574" "subst" "0.00422294" "01533" "CDKL5_000004" "g.18671574C>T" "" "{PMID:Russo 2009:19241098}" "" "H1001H" "" "Germline" "" "" "0" "" "" "g.18653454C>T" "" "benign" "" "0000184800" "1" "10" "X" "21902267" "21902267" "subst" "0" "01533" "CDKL5_000040" "g.21902267C>T" "" "{PMID:Russo 2009:19241098}" "" "" "Variant Error [EREF/EINVALIDBOUNDARY]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "benign" "" "0000184801" "1" "10" "X" "18671655" "18671655" "subst" "0" "01533" "CDKL5_000005" "g.18671655G>T" "" "{PMID:Russo 2009:19241098}" "" "T1028T" "" "Germline" "" "" "0" "" "" "g.18653535G>T" "" "benign" "" "0000184802" "1" "10" "X" "18582659" "18582659" "subst" "0" "00485" "CDKL5_000012" "g.18582659A>G" "" "" "" "144+17A>G" "" "Germline" "" "" "0" "" "" "g.18564539A>G" "" "benign" "" "0000184803" "1" "10" "X" "18638082" "18638082" "subst" "0.0313058" "00485" "CDKL5_000002" "g.18638082A>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.18619962A>C" "" "benign" "" "0000184804" "1" "10" "X" "18671574" "18671574" "subst" "0.00422294" "00485" "CDKL5_000004" "g.18671574C>T" "" "" "" "H1001H" "" "Germline" "" "" "0" "" "" "g.18653454C>T" "" "benign" "" "0000184805" "1" "10" "X" "18671655" "18671655" "subst" "0" "00485" "CDKL5_000005" "g.18671655G>T" "" "" "" "T1028T" "" "Germline" "" "" "0" "" "" "g.18653535G>T" "" "benign" "" "0000184806" "1" "10" "X" "21900903" "21900903" "subst" "0" "00485" "CDKL5_000061" "g.21900903A>G" "0.01" "" "" "" "Variant Error [EREF/ERANGE]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "benign" "" "0000184807" "1" "10" "X" "21900904" "21900904" "subst" "0" "00485" "CDKL5_000062" "g.21900904T>A" "0.01" "" "" "" "Variant Error [EREF/ERANGE]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "benign" "" "0000184808" "1" "30" "X" "18671574" "18671574" "subst" "0.00422294" "00124" "CDKL5_000004" "g.18671574C>T" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "H1001H" "found once" "Germline" "" "" "0" "" "" "g.18653454C>T" "" "likely benign" "" "0000184809" "1" "30" "X" "18671655" "18671655" "subst" "0.00414692" "00124" "CDKL5_000005" "g.18671655G>A" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "T1028T" "found once" "Germline" "" "" "0" "" "" "g.18653535G>A" "" "likely benign" "" "0000184810" "1" "50" "X" "18631319" "18631319" "subst" "2.79844E-5" "00124" "CDKL5_000001" "g.18631319A>G" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "" "found once" "Germline" "" "" "0" "" "" "g.18613199A>G" "" "VUS" "" "0000184811" "1" "50" "X" "18668572" "18668572" "subst" "5.59337E-6" "00124" "CDKL5_000003" "g.18668572C>T" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "" "found once" "Germline" "" "" "0" "" "" "g.18650452C>T" "" "VUS" "" "0000184812" "1" "50" "X" "18638082" "18638082" "subst" "0.0313058" "00124" "CDKL5_000002" "g.18638082A>C" "16/208 cases" "{PMID:Tarpey 2009:19377476}" "" "" "recurrent, found 16 times" "Germline" "" "" "0" "" "" "g.18619962A>C" "" "VUS" "" "0000184813" "1" "50" "X" "18606055" "18606055" "subst" "0.0322602" "01533" "CDKL5_000021" "g.18606055C>G" "" "{PMID:Archer 2006:16611748}" "" "IVS8-19C>G" "unclassified variant" "Germline" "" "" "0" "" "" "g.18587935C>G" "" "VUS" "" "0000184814" "1" "50" "X" "18606055" "18606055" "subst" "0.0322602" "01533" "CDKL5_000021" "g.18606055C>G" "" "{PMID:Archer 2006:16611748}" "" "IVS8-19C>G" "unclassified variant" "Germline" "" "" "0" "" "" "g.18587935C>G" "" "VUS" "" "0000184815" "1" "50" "X" "0" "0" "" "0" "01533" "CDKL5_000027" "g.?" "" "{PMID:Archer 2006:16611748}" "" "IVS11-42_50del9bp" "unclassified variant" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000184816" "1" "50" "X" "18643249" "18643249" "subst" "0" "01533" "CDKL5_000039" "g.18643249T>C" "" "{PMID:Archer 2006:16611748}" "" "" "unclassified variant" "Germline" "" "" "0" "" "" "g.18625129T>C" "" "VUS" "" "0000184817" "1" "50" "X" "21861384" "21861385" "del" "0" "00485" "CDKL5_000059" "g.21861384_21861385del" "" "" "" "145+27_28delAT" "unclassified variant" "Germline" "" "" "0" "" "" "g.21843266_21843267del" "" "VUS" "" "0000184818" "1" "50" "X" "21861384" "21861385" "del" "0" "00485" "CDKL5_000059" "g.21861384_21861385del" "" "" "" "145+27_28delAT" "unclassified variant" "Germline" "" "" "0" "" "" "g.21843266_21843267del" "" "VUS" "" "0000184819" "1" "50" "X" "21861384" "21861385" "del" "0" "00485" "CDKL5_000059" "g.21861384_21861385del" "" "" "" "145+27_28delAT" "unclassified variant" "Germline" "" "" "0" "" "" "g.21843266_21843267del" "" "VUS" "" "0000184820" "1" "50" "X" "21861384" "21861385" "del" "0" "00485" "CDKL5_000059" "g.21861384_21861385del" "" "" "" "145+27_28delAT" "unclassified variant" "Germline" "" "" "0" "" "" "g.21843266_21843267del" "" "VUS" "" "0000184821" "1" "50" "X" "18646727" "18646727" "subst" "0" "00485" "CDKL5_000060" "g.18646727G>A" "" "" "" "" "unclassified variant" "Germline" "" "" "0" "" "" "g.18628607G>A" "" "VUS" "" "0000184822" "0" "50" "X" "21871500" "21871500" "dup" "0" "01982" "CDKL5_000065" "g.21871500dup" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.21853382dup" "" "VUS" "" "0000184823" "0" "70" "X" "18646524" "18646524" "del" "0" "01989" "CDKL5_000066" "g.18646524del" "" "" "" "2530delC" "further investigation in process" "Germline" "" "" "0" "" "" "g.18628404del" "" "likely pathogenic" "" "0000184824" "0" "90" "X" "18582616" "18582616" "subst" "0" "01533" "CDKL5_000008" "g.18582616C>T" "" "{PMID:Rosas-Vargas 2008:17993579}; {OMIM300203:0009}" "" "" "expression cloning protein mislocalized cytoplasm, does not reach nucleus" "Germline" "" "" "0" "" "" "g.18564496C>T" "" "pathogenic" "" "0000184825" "1" "90" "X" "18622692" "18622692" "subst" "0" "01533" "CDKL5_000029" "g.18622692C>T" "" "{PMID:Russo 2009:19241098}" "" "" "non-sense mediated mRNA decay" "De novo" "" "" "0" "" "" "g.18604572C>T" "" "pathogenic" "" "0000184826" "1" "90" "X" "18646494" "18646494" "subst" "0" "01533" "CDKL5_000045" "g.18646494C>T" "" "{PMID:Nectoux:16813600}; {OMIM300203:0007}" "" "" "variant transcript undergoes nonsense-mediated decay" "De novo" "" "" "0" "" "" "g.18628374C>T" "" "pathogenic" "" "0000184827" "1" "90" "X" "21857692" "21861312" "del" "0" "01533" "CDKL5_000041" "g.21857692_21861312del" "" "{PMID:Russo 2009:19241098}" "" "delex1-2" "" "Germline" "" "" "0" "" "" "g.21839574_21843194del" "" "pathogenic" "" "0000184828" "1" "90" "X" "18525282" "18525282" "del" "0" "01533" "CDKL5_000009" "g.18525282del" "" "{PMID:Bahi-Buisson:18790821}" "" "" "" "Germline" "" "" "0" "" "" "g.18507162del" "" "pathogenic" "" "0000184829" "1" "90" "X" "18582616" "18582616" "subst" "0" "01533" "CDKL5_000008" "g.18582616C>T" "" "{PMID:Rosas-Vargas 2008:17993579}; {OMIM300203:0009}" "" "" "" "Germline" "" "" "0" "" "" "g.18564496C>T" "" "pathogenic" "" "0000184830" "1" "90" "X" "18582616" "18582616" "subst" "0" "01533" "CDKL5_000008" "g.18582616C>T" "" "{PMID:Rosas-Vargas 2008:17993579}; {OMIM300203:0009}" "" "" "" "Germline" "" "" "0" "" "" "g.18564496C>T" "" "pathogenic" "" "0000184831" "1" "90" "X" "18582644" "18582644" "subst" "0" "01533" "CDKL5_000042" "g.18582644T>C" "" "{PMID:Russo 2009:19241098}" "" "" "" "De novo" "" "" "0" "" "" "g.18564524T>C" "" "pathogenic" "" "0000184832" "1" "90" "X" "21861375" "21861378" "del" "0" "01533" "CDKL5_000057" "g.21861375_21861378del" "" "{PMID:Scala 2005:15689447}; {OMIM300203:0005}" "" "163_166delGAAA" "" "Germline" "" "" "0" "" "" "g.21843257_21843260del" "" "pathogenic" "" "0000184833" "1" "90" "X" "21861387" "21861387" "subst" "0" "01533" "CDKL5_000046" "g.21861387C>T" "" "{PMID:Archer 2006:16611748}" "" "" "" "Germline" "" "" "0" "" "" "g.21843269C>T" "" "pathogenic" "" "0000184834" "1" "90" "X" "21861396" "21861396" "del" "0" "01533" "CDKL5_000010" "g.21861396del" "" "{PMID:Weaving 2004:15492925}; {OMIM300203:0001}" "" "" "" "Germline" "" "" "0" "" "" "g.21843278del" "" "pathogenic" "" "0000184835" "1" "90" "X" "21861396" "21861396" "del" "0" "01533" "CDKL5_000010" "g.21861396del" "" "{PMID:Weaving 2004:15492925}; {OMIM300203:0001}" "" "" "" "Germline" "" "" "0" "" "" "g.21843278del" "" "pathogenic" "" "0000184836" "1" "90" "X" "21861396" "21861396" "del" "0" "01533" "CDKL5_000010" "g.21861396del" "" "{PMID:Weaving 2004:15492925}; {OMIM300203:0001}" "" "" "" "Germline" "" "" "0" "" "" "g.21843278del" "" "pathogenic" "" "0000184837" "1" "90" "X" "21861406" "21861406" "subst" "0" "01533" "CDKL5_000011" "g.21861406G>A" "" "{PMID:Rosas-Vargas 2008:17993579}" "" "" "" "Germline" "" "" "0" "" "" "g.21843288G>A" "" "pathogenic" "" "0000184838" "1" "90" "X" "21861427" "21861427" "subst" "0" "01533" "CDKL5_000064" "g.21861427T>A" "" "{PMID:Evans:16015284}" "" "" "" "Germline" "" "" "0" "" "" "g.21843309T>A" "" "pathogenic" "" "0000184839" "1" "90" "X" "21861427" "21861427" "subst" "0" "01533" "CDKL5_000043" "g.21861427T>C" "" "{PMID:Russo 2009:19241098}" "" "" "" "De novo" "" "" "0" "" "" "g.21843309T>C" "" "pathogenic" "" "0000184840" "1" "90" "X" "21861427" "21861427" "subst" "0" "01533" "CDKL5_000043" "g.21861427T>C" "" "{PMID:Saletti:19396824}; {OMIM300203:0010}" "" "" "" "De novo" "" "" "0" "" "" "g.21843309T>C" "" "pathogenic" "" "0000184841" "1" "90" "X" "21861428" "21861428" "subst" "0" "01533" "CDKL5_000013" "g.21861428T>A" "" "{PMID:Li:17089071}" "" "" "" "Germline" "" "" "0" "" "" "g.21843310T>A" "" "pathogenic" "" "0000184842" "1" "90" "X" "18593557" "18593560" "del" "0" "01533" "CDKL5_000014" "g.18593557_18593560del" "" "{PMID:Bahi-Buisson:18790821}" "" "" "" "Germline" "" "" "0" "" "" "g.18575437_18575440del" "" "pathogenic" "" "0000184843" "1" "90" "X" "18598037" "18598037" "subst" "0" "01533" "CDKL5_000015" "g.18598037C>T" "" "{PMID:Bahi-Buisson:18266744}" "" "" "" "Germline" "" "" "0" "" "" "g.18579917C>T" "" "pathogenic" "" "0000184844" "1" "90" "X" "18598065" "18598065" "subst" "0" "01533" "CDKL5_000016" "g.18598065A>G" "" "{PMID:Russo 2009:19241098}" "" "" "" "Somatic" "" "" "0" "" "" "g.18579945A>G" "" "pathogenic" "" "0000184845" "1" "90" "X" "18600010" "18600010" "subst" "0" "01533" "CDKL5_000050" "g.18600010G>T" "" "{PMID:Archer 2006:16611748}; {OMIM300203:0008}" "" "IVS6-1G>T" "" "Germline" "" "" "0" "" "" "g.18581890G>T" "" "pathogenic" "" "0000184846" "1" "90" "X" "21863489" "21863489" "subst" "0" "01533" "CDKL5_000018" "g.21863489T>A" "" "{PMID:Bahi-Buisson:18790821}" "" "" "" "Germline" "" "" "0" "" "" "g.21845371T>A" "" "pathogenic" "" "0000184847" "0" "90" "X" "18600062" "18600062" "subst" "0" "01533" "CDKL5_000006" "g.18600062G>T" "" "" "" "" "" "Germline" "" "rs61748405" "0" "" "" "g.18581942G>T" "" "pathogenic" "" "0000184848" "1" "90" "X" "18600062" "18600062" "subst" "0" "01533" "CDKL5_000006" "g.18600062G>T" "" "{PMID:Tao 2004:15499549}; {OMIM300203:0003}" "" "" "" "Germline" "" "" "0" "" "" "g.18581942G>T" "" "pathogenic" "" "0000184849" "0" "90" "X" "18602444" "18602444" "subst" "0" "01533" "CDKL5_000007" "g.18602444A>T" "" "" "" "" "" "Germline" "" "rs61749700" "0" "" "" "g.18584324A>T" "" "pathogenic" "" "0000184850" "1" "90" "X" "18602444" "18602444" "subst" "0" "01533" "CDKL5_000007" "g.18602444A>T" "" "{PMID:Tao 2004:15499549}; {OMIM300203:0004}" "" "" "" "Germline" "" "" "0" "" "" "g.18584324A>T" "" "pathogenic" "" "0000184851" "1" "90" "X" "18602444" "18602444" "subst" "0" "01533" "CDKL5_000007" "g.18602444A>T" "" "{PMID:Tao 2004:15499549}; {OMIM300203:0004}" "" "" "" "Germline" "" "" "0" "" "" "g.18584324A>T" "" "pathogenic" "" "0000184852" "1" "90" "X" "18602451" "18602451" "subst" "0" "01533" "CDKL5_000019" "g.18602451C>T" "" "{PMID:Nemos:19793311}" "" "" "" "Germline" "" "" "0" "" "" "g.18584331C>T" "" "pathogenic" "" "0000184853" "1" "90" "X" "18602452" "18602452" "subst" "0" "01533" "CDKL5_000020" "g.18602452G>C" "" "{PMID:Elia:18809835}" "" "" "" "Germline" "" "" "0" "" "" "g.18584332G>C" "" "pathogenic" "" "0000184854" "1" "90" "X" "18602458" "18602458" "subst" "0" "01533" "CDKL5_000048" "g.18602458C>T" "" "{PMID:Archer 2006:16611748}" "" "" "" "Germline" "" "" "0" "" "" "g.18584338C>T" "" "pathogenic" "" "0000184855" "1" "90" "X" "21871610" "21871610" "subst" "0" "01533" "CDKL5_000022" "g.21871610T>C" "" "{PMID:Rosas-Vargas 2008:17993579}" "" "" "" "Germline" "" "" "0" "" "" "g.21853492T>C" "" "pathogenic" "" "0000184856" "1" "90" "X" "0" "0" "" "0" "01533" "CDKL5_000049" "g.?" "" "{PMID:Archer 2006:16611748}" "" "del678_691ins683_673" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000184857" "1" "90" "X" "18606199" "18606199" "subst" "0" "01533" "CDKL5_000023" "g.18606199T>G" "" "{PMID:Nemos:19793311}" "" "" "" "Germline" "" "" "0" "" "" "g.18588079T>G" "" "pathogenic" "" "0000184866" "1" "90" "X" "18613524" "18613525" "del" "0" "01533" "CDKL5_000024" "g.18613524_18613525del" "" "{PMID:Bahi-Buisson:18266744}" "" "" "" "Germline" "" "" "0" "" "" "g.18595404_18595405del" "" "pathogenic" "" "0000184867" "1" "90" "X" "21887665" "21887674" "del" "0" "01533" "CDKL5_000025" "g.21887665_21887674del" "" "{PMID:Mari:15917271}" "" "838_847delTTGGACCCAG" "" "Germline" "" "" "0" "" "" "g.21869547_21869556del" "" "pathogenic" "" "0000184868" "1" "90" "X" "21887689" "21887689" "subst" "5.59409E-6" "01533" "CDKL5_000053" "g.21887689C>T" "" "{PMID:Elia:18809835}; {OMIM300203:0011}" "" "" "" "De novo" "" "" "0" "" "" "g.21869571C>T" "" "pathogenic" "" "0000184869" "1" "90" "X" "18616620" "18616620" "dup" "0" "01533" "CDKL5_000026" "g.18616620dup" "" "{PMID:Bahi-Buisson:18790821}" "" "" "" "Germline" "" "" "0" "" "" "g.18598500dup" "" "pathogenic" "" "0000184870" "1" "90" "X" "18616628" "18616628" "subst" "0" "01533" "CDKL5_000054" "g.18616628G>A" "" "{PMID:Elia:18809835}; {OMIM300203:0012}" "" "" "" "De novo" "" "" "0" "" "" "g.18598508G>A" "" "pathogenic" "" "0000184871" "1" "90" "X" "21887728" "21887729" "dup" "0" "01533" "CDKL5_000055" "g.21887728_21887729dup" "" "{PMID:Russo 2009:19241098}; {OMIM300203:0013}" "" "902_903dupGA" "" "De novo" "" "" "0" "" "" "g.21869610_21869611dup" "" "pathogenic" "" "0000184872" "1" "90" "X" "21896165" "21896165" "subst" "0" "01533" "CDKL5_000051" "g.21896165A>G" "" "{PMID:Archer 2006:16611748}" "" "IVS11-2A>G" "" "Germline" "" "" "0" "" "" "g.21878047A>G" "" "pathogenic" "" "0000184873" "1" "90" "X" "21896745" "21896745" "subst" "0" "01533" "CDKL5_000028" "g.21896745A>C" "" "{PMID:Sprovieri:19253388}" "" "" "" "Germline" "" "" "0" "" "" "g.21878627A>C" "" "pathogenic" "" "0000184874" "1" "90" "X" "18622692" "18622692" "subst" "0" "01533" "CDKL5_000029" "g.18622692C>T" "" "{PMID:Pintaudi 2008:18063413}" "" "" "" "Germline" "" "" "0" "" "" "g.18604572C>T" "" "pathogenic" "" "0000184875" "1" "90" "X" "18622719" "18622719" "subst" "0" "01533" "CDKL5_000030" "g.18622719C>T" "" "{PMID:Sartori:19161156}" "" "" "" "Germline" "" "" "0" "" "" "g.18604599C>T" "" "pathogenic" "" "0000184876" "1" "90" "X" "21901106" "21901107" "dup" "0" "01533" "CDKL5_000031" "g.21901106_21901107dup" "" "{PMID:Bahi-Buisson:18266744}" "" "1892_1893dupTA" "" "Germline" "" "" "0" "" "" "g.21882988_21882989dup" "" "pathogenic" "" "0000184877" "1" "90" "X" "18622355" "18622355" "dup" "0" "01533" "CDKL5_000032" "g.18622355dup" "" "{PMID:Bahi-Buisson:18266744}" "" "" "" "Germline" "" "" "0" "" "" "g.18604235dup" "" "pathogenic" "" "0000184878" "1" "90" "X" "18627002" "18627002" "del" "0" "01533" "CDKL5_000033" "g.18627002del" "" "{PMID:Bahi-Buisson:18790821}" "" "" "" "Germline" "" "" "0" "" "" "g.18608882del" "" "pathogenic" "" "0000184879" "1" "90" "X" "21901258" "21901258" "delins" "0" "01533" "CDKL5_000034" "g.21901258delinsGCGTCACAATAAAATAT" "" "{PMID:Bahi-Buisson:18266744}" "" "" "" "Germline" "" "" "0" "" "" "g.21883140delinsGCGTCACAATAAAATAT" "" "pathogenic" "" "0000184880" "1" "90" "X" "18627586" "18627586" "del" "0" "01533" "CDKL5_000056" "g.18627586del" "" "{PMID:Weaving 2004:15492925}; {OMIM300203:0002}" "" "" "" "Germline" "" "" "0" "" "" "g.18609466del" "" "pathogenic" "" "0000184881" "1" "90" "X" "18627690" "18627690" "subst" "0" "01533" "CDKL5_000036" "g.18627690G>A" "" "{PMID:Bahi-Buisson:18790821}" "" "" "" "Germline" "" "" "0" "" "" "g.18609570G>A" "" "pathogenic" "" "0000184882" "1" "90" "X" "21901538" "21901539" "del" "0" "01533" "CDKL5_000037" "g.21901538_21901539del" "" "{PMID:Bahi-Buisson:18266744}" "" "2325_2326delGA" "" "Germline" "" "" "0" "" "" "g.21883420_21883421del" "" "pathogenic" "" "0000184883" "1" "90" "X" "18638053" "18638053" "del" "0" "01533" "CDKL5_000038" "g.18638053del" "" "{PMID:Mari:15917271}" "" "" "" "Germline" "" "" "0" "" "" "g.18619933del" "" "pathogenic" "" "0000184884" "1" "90" "X" "21901577" "21901581" "del" "0" "01533" "CDKL5_000047" "g.21901577_21901581del" "" "{PMID:Archer 2006:16611748}" "" "2363_2367delAGAAA" "" "Germline" "" "" "0" "" "" "g.21883459_21883463del" "" "pathogenic" "" "0000184885" "1" "90" "X" "18638091" "18638091" "subst" "0" "01533" "CDKL5_000044" "g.18638091G>A" "" "{PMID:Russo 2009:19241098}" "" "" "" "Germline" "" "" "0" "" "" "g.18619971G>A" "" "pathogenic" "" "0000184886" "1" "90" "X" "21901591" "21901591" "subst" "0" "01533" "CDKL5_000052" "g.21901591G>A" "" "{PMID:Archer 2006:16611748}" "" "IVS16+1G>A" "" "Germline" "" "" "0" "" "" "g.21883473G>A" "" "pathogenic" "" "0000184887" "1" "90" "X" "21901848" "21901849" "del" "0" "01533" "CDKL5_000058" "g.21901848_21901849del" "" "{PMID:Scala 2005:15689447}; {OMIM300203:0006}" "" "2635_2636delCT" "" "Germline" "" "" "0" "" "" "g.21883730_21883731del" "" "pathogenic" "" "0000222143" "1" "90" "X" "18662650" "18662650" "subst" "0" "00006" "RS1_000056" "g.18662650C>T" "" "Kucinskas, ASHG2017, P1110" "" "" "" "Germline" "" "" "0" "" "" "g.18644530C>T" "" "pathogenic" "" "0000222860" "0" "70" "X" "18593504" "18593504" "subst" "0" "02302" "CDKL5_000090" "g.18593504G>C" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.18575384G>C" "" "likely pathogenic" "" "0000251144" "0" "10" "X" "18638082" "18638082" "subst" "0.0313058" "02326" "CDKL5_000002" "g.18638082A>C" "" "" "" "CDKL5(NM_003159.2):c.2372A>C (p.Q791P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18619962A>C" "" "benign" "" "0000251671" "0" "10" "X" "18528854" "18528854" "subst" "0" "02326" "CDKL5_000092" "g.18528854A>G" "" "" "" "CDKL5(NM_001037343.1):c.65-86A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18510734A>G" "" "benign" "" "0000251672" "0" "10" "X" "18597865" "18597865" "del" "0" "02326" "CDKL5_000097" "g.18597865del" "" "" "" "CDKL5(NM_001037343.1):c.283-103delA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18579745del" "" "benign" "" "0000251673" "0" "10" "X" "18613320" "18613320" "del" "0" "02326" "CDKL5_000104" "g.18613320del" "" "" "" "CDKL5(NM_001037343.1):c.745-148delA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18595200del" "" "benign" "" "0000251983" "0" "30" "X" "18616642" "18616642" "subst" "3.91918E-5" "02326" "CDKL5_000107" "g.18616642A>G" "" "" "" "CDKL5(NM_003159.2):c.886A>G (p.T296A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18598522A>G" "" "likely benign" "" "0000252352" "0" "30" "X" "18593629" "18593629" "subst" "2.81229E-5" "02326" "CDKL5_000132" "g.18593629A>G" "" "" "" "CDKL5(NM_001037343.1):c.282+19A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18575509A>G" "" "likely benign" "" "0000252353" "0" "30" "X" "18643383" "18643383" "subst" "1.69104E-5" "02326" "CDKL5_000120" "g.18643383A>G" "" "" "" "CDKL5(NM_003159.2):c.2496+16A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18625263A>G" "" "likely benign" "" "0000255501" "0" "90" "X" "18622758" "18622758" "subst" "0" "01943" "CDKL5_000116" "g.18622758A>T" "" "" "" "CDKL5(NM_003159.2):c.1714A>T (p.K572*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18604638A>T" "" "pathogenic" "" "0000256167" "0" "50" "X" "18622075" "18622075" "subst" "0" "01943" "CDKL5_000108" "g.18622075A>G" "" "" "" "CDKL5(NM_003159.2):c.1031A>G (p.K344R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18603955A>G" "" "VUS" "" "0000264494" "0" "90" "X" "18660225" "18660225" "del" "0" "02330" "RS1_000205" "g.18660225del" "" "" "" "CDKL5(NM_003159.3):c.2714-3902delG, RS1(NM_000330.4):c.579delC (p.I194Sfs*43)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18642105del" "" "pathogenic" "" "0000264495" "0" "10" "X" "18665379" "18665379" "subst" "0.00164457" "02330" "RS1_000215" "g.18665379C>T" "" "" "" "CDKL5(NM_003159.3):c.2797+1169C>T, RS1(NM_000330.4):c.258G>A (p.P86=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18647259C>T" "" "benign" "" "0000266614" "0" "30" "X" "18582590" "18582590" "subst" "2.84714E-5" "02325" "CDKL5_000093" "g.18582590C>T" "" "" "" "CDKL5(NM_001037343.1):c.100-7C>T, CDKL5(NM_003159.3):c.100-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18564470C>T" "" "likely benign" "" "0000266615" "0" "90" "X" "18622719" "18622719" "subst" "0" "02325" "CDKL5_000030" "g.18622719C>T" "" "" "" "CDKL5(NM_003159.3):c.1675C>T (p.R559*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18604599C>T" "" "pathogenic" "" "0000266616" "0" "30" "X" "18671574" "18671574" "subst" "0.00422294" "02325" "CDKL5_000004" "g.18671574C>T" "" "" "" "CDKL5(NM_003159.2):c.3003C>T (p.H1001=), CDKL5(NM_003159.3):c.3003C>T (p.H1001=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18653454C>T" "" "likely benign" "" "0000266617" "0" "30" "X" "18671655" "18671655" "subst" "0.00414692" "02325" "CDKL5_000005" "g.18671655G>A" "" "" "" "CDKL5(NM_003159.2):c.3084G>A (p.T1028=), CDKL5(NM_003159.3):c.3084G>A (p.T1028=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18653535G>A" "" "likely benign" "" "0000266618" "0" "90" "X" "18598089" "18598089" "subst" "0" "02325" "CDKL5_000098" "g.18598089G>T" "" "" "" "CDKL5(NM_003159.3):c.403+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18579969G>T" "" "pathogenic" "" "0000269908" "0" "10" "X" "18525050" "18525050" "subst" "0" "02326" "CDKL5_000091" "g.18525050T>C" "" "" "" "CDKL5(NM_001037343.1):c.-162-5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18506930T>C" "" "benign" "" "0000269909" "0" "30" "X" "18582590" "18582590" "subst" "2.84714E-5" "02326" "CDKL5_000093" "g.18582590C>T" "" "" "" "CDKL5(NM_001037343.1):c.100-7C>T, CDKL5(NM_003159.3):c.100-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18564470C>T" "" "likely benign" "" "0000269910" "0" "10" "X" "18622374" "18622374" "subst" "0.000173596" "02326" "CDKL5_000110" "g.18622374C>T" "" "" "" "CDKL5(NM_001037343.1):c.1330C>T (p.R444C), CDKL5(NM_001323289.1):c.1330C>T (p.R444C), CDKL5(NM_003159.3):c.1330C>T (p.R444C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18604254C>T" "" "benign" "" "0000269911" "0" "30" "X" "18622376" "18622376" "subst" "0.000515178" "02326" "CDKL5_000112" "g.18622376C>T" "" "" "" "CDKL5(NM_001037343.1):c.1332C>T (p.R444=), CDKL5(NM_001323289.1):c.1332C>T (p.R444=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18604256C>T" "" "likely benign" "" "0000269913" "0" "30" "X" "18622657" "18622657" "subst" "5.5997E-6" "02326" "CDKL5_000115" "g.18622657C>T" "" "" "" "CDKL5(NM_001037343.1):c.1613C>T (p.T538M), CDKL5(NM_003159.2):c.1613C>T (p.T538M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18604537C>T" "" "likely benign" "" "0000269914" "0" "10" "X" "18646594" "18646594" "subst" "0" "02326" "CDKL5_000121" "g.18646594C>A" "" "" "" "CDKL5(NM_001037343.1):c.2600C>A (p.T867N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18628474C>A" "" "benign" "" "0000269915" "0" "10" "X" "18664282" "18664282" "del" "0" "02326" "RS1_000214" "g.18664282del" "" "" "" "CDKL5(NM_001037343.1):c.2797+72delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18646162del" "" "benign" "" "0000269916" "0" "10" "X" "18668587" "18668587" "subst" "0" "02326" "RS1_000216" "g.18668587G>A" "" "" "" "CDKL5(NM_003159.2):c.2855G>A (p.R952Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18650467G>A" "" "benign" "" "0000269917" "0" "10" "X" "18671566" "18671566" "subst" "0.00823338" "02326" "RS1_000217" "g.18671566G>A" "" "" "" "CDKL5(NM_001037343.1):c.2995G>A (p.(Val999Met), p.V999M), CDKL5(NM_003159.2):c.2995G>A (p.V999M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18653446G>A" "" "benign" "" "0000269918" "0" "10" "X" "18671574" "18671574" "subst" "0.00422294" "02326" "CDKL5_000004" "g.18671574C>T" "" "" "" "CDKL5(NM_003159.2):c.3003C>T (p.H1001=), CDKL5(NM_003159.3):c.3003C>T (p.H1001=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18653454C>T" "" "benign" "" "0000269919" "0" "10" "X" "18671655" "18671655" "subst" "0.00414692" "02326" "CDKL5_000005" "g.18671655G>A" "" "" "" "CDKL5(NM_003159.2):c.3084G>A (p.T1028=), CDKL5(NM_003159.3):c.3084G>A (p.T1028=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18653535G>A" "" "benign" "" "0000269920" "0" "10" "X" "18599995" "18599995" "del" "0" "02326" "CDKL5_000099" "g.18599995del" "" "" "" "CDKL5(NM_001037343.1):c.404-16delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18581875del" "" "benign" "" "0000269921" "0" "90" "X" "18602433" "18602433" "subst" "0" "02326" "CDKL5_000100" "g.18602433G>T" "" "" "" "CDKL5(NM_001037343.1):c.514G>T (p.V172F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18584313G>T" "" "pathogenic" "" "0000269922" "0" "70" "X" "18602452" "18602452" "subst" "0" "02326" "CDKL5_000101" "g.18602452G>A" "" "" "" "CDKL5(NM_001037343.1):c.533G>A (p.R178Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18584332G>A" "" "likely pathogenic" "" "0000269923" "0" "90" "X" "18602452" "18602452" "subst" "0" "02326" "CDKL5_000020" "g.18602452G>C" "" "" "" "CDKL5(NM_001037343.1):c.533G>C (p.R178P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18584332G>C" "" "pathogenic" "" "0000269924" "0" "10" "X" "18606055" "18606055" "subst" "0.0322602" "02326" "CDKL5_000021" "g.18606055C>G" "" "" "" "CDKL5(NM_003159.2):c.555-19C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18587935C>G" "" "benign" "" "0000269925" "0" "90" "X" "18606106" "18606106" "subst" "0" "02326" "CDKL5_000102" "g.18606106C>T" "" "" "" "CDKL5(NM_001037343.1):c.587C>T (p.(Ser196Leu), p.S196L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18587986C>T" "" "pathogenic" "" "0000269926" "0" "30" "X" "18606122" "18606122" "subst" "1.68002E-5" "02326" "CDKL5_000103" "g.18606122T>C" "" "" "" "CDKL5(NM_001037343.1):c.603T>C (p.L201=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18588002T>C" "" "likely benign" "" "0000269927" "0" "10" "X" "18616447" "18616447" "del" "0" "02326" "CDKL5_000106" "g.18616447del" "" "" "" "CDKL5(NM_001037343.1):c.826-135delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18598327del" "" "benign" "" "0000273057" "0" "10" "X" "18582669" "18582670" "del" "0" "01943" "CDKL5_000059" "g.18582669_18582670del" "" "" "" "CDKL5(NM_003159.2):c.145+27_145+28delAT, CDKL5(NM_003159.3):c.145+27_145+28delAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18564549_18564550del" "" "benign" "" "0000273058" "0" "10" "X" "18622657" "18622657" "subst" "5.5997E-6" "01943" "CDKL5_000115" "g.18622657C>T" "" "" "" "CDKL5(NM_001037343.1):c.1613C>T (p.T538M), CDKL5(NM_003159.2):c.1613C>T (p.T538M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18604537C>T" "" "benign" "" "0000273059" "0" "90" "X" "18626930" "18626930" "subst" "0" "01943" "CDKL5_000118" "g.18626930G>T" "" "" "" "CDKL5(NM_003159.2):c.1945-1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18608810G>T" "" "pathogenic" "" "0000273060" "0" "30" "X" "18646607" "18646607" "subst" "0" "01943" "CDKL5_000122" "g.18646607C>T" "" "" "" "CDKL5(NM_001323289.1):c.2613C>T (p.F871=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18628487C>T" "" "likely benign" "" "0000273061" "0" "10" "X" "18671566" "18671566" "subst" "0.00823338" "01943" "RS1_000217" "g.18671566G>A" "" "" "" "CDKL5(NM_001037343.1):c.2995G>A (p.(Val999Met), p.V999M), CDKL5(NM_003159.2):c.2995G>A (p.V999M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18653446G>A" "" "benign" "" "0000273062" "0" "30" "X" "18671655" "18671655" "subst" "0.00414692" "01943" "CDKL5_000005" "g.18671655G>A" "" "" "" "CDKL5(NM_003159.2):c.3084G>A (p.T1028=), CDKL5(NM_003159.3):c.3084G>A (p.T1028=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18653535G>A" "" "likely benign" "" "0000273063" "0" "10" "X" "18606055" "18606055" "subst" "0.0322602" "01943" "CDKL5_000021" "g.18606055C>G" "" "" "" "CDKL5(NM_003159.2):c.555-19C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18587935C>G" "" "benign" "" "0000307382" "0" "10" "X" "18660251" "18660251" "subst" "0.00194966" "01943" "RS1_000213" "g.18660251G>A" "" "" "" "CDKL5(NM_003159.3):c.2714-3876G>A, RS1(NM_000330.3):c.548C>T (p.T183I, p.(Thr183Ile)), RS1(NM_000330.4):c.548C>T (p.T183I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18642131G>A" "" "benign" "" "0000333319" "0" "50" "X" "18593567" "18593567" "subst" "5.60853E-6" "01804" "CDKL5_000096" "g.18593567G>T" "" "" "" "CDKL5(NM_001037343.1):c.239G>T (p.(Arg80Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18575447G>T" "" "VUS" "" "0000333320" "0" "50" "X" "18622291" "18622292" "del" "0" "01804" "CDKL5_000109" "g.18622291_18622292del" "" "" "" "CDKL5(NM_003159.2):c.1245_1246del (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18604171_18604172del" "" "VUS" "" "0000333321" "0" "50" "X" "18622375" "18622375" "subst" "5.60114E-6" "01804" "CDKL5_000111" "g.18622375G>A" "" "" "" "CDKL5(NM_001037343.1):c.1331G>A (p.(Arg444His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18604255G>A" "" "VUS" "" "0000333322" "0" "50" "X" "18622383" "18622383" "subst" "5.60077E-6" "01804" "CDKL5_000113" "g.18622383T>C" "" "" "" "CDKL5(NM_001037343.1):c.1339T>C (p.(Phe447Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18604263T>C" "" "VUS" "" "0000333323" "0" "50" "X" "18622430" "18622430" "subst" "1.12313E-5" "01804" "CDKL5_000114" "g.18622430A>C" "" "" "" "CDKL5(NM_001037343.1):c.1386A>C (p.(Glu462Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18604310A>C" "" "VUS" "" "0000333326" "0" "50" "X" "18646629" "18646630" "del" "0" "01804" "CDKL5_000058" "g.18646629_18646630del" "" "" "" "CDKL5(NM_001037343.1):c.2635_2636del (p.(Leu879GlufsTer30))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18628509_18628510del" "" "VUS" "" "0000333328" "0" "30" "X" "18690182" "18690182" "subst" "0.00181198" "01804" "RS1_000219" "g.18690182G>C" "" "" "" "RS1(NM_000330.3):c.7C>G (p.(Arg3Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18672062G>C" "" "likely benign" "" "0000337397" "0" "90" "X" "18602474" "18602474" "subst" "0" "02327" "CDKL5_000127" "g.18602474G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18584354G>A" "" "pathogenic" "" "0000342908" "0" "10" "X" "18622374" "18622374" "subst" "0.000173596" "02327" "CDKL5_000110" "g.18622374C>T" "" "" "" "CDKL5(NM_001037343.1):c.1330C>T (p.R444C), CDKL5(NM_001323289.1):c.1330C>T (p.R444C), CDKL5(NM_003159.3):c.1330C>T (p.R444C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18604254C>T" "" "benign" "" "0000343547" "0" "90" "X" "18602452" "18602452" "subst" "0" "02327" "CDKL5_000101" "g.18602452G>A" "" "" "" "CDKL5(NM_001037343.1):c.533G>A (p.R178Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18584332G>A" "" "pathogenic" "" "0000343905" "0" "90" "X" "18598074" "18598074" "subst" "0" "02327" "CDKL5_000125" "g.18598074A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18579954A>T" "" "pathogenic" "" "0000344551" "0" "90" "X" "18662656" "18662656" "del" "0" "02327" "RS1_000222" "g.18662656del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18644536del" "" "pathogenic" "" "0000344974" "0" "10" "X" "18638082" "18638082" "subst" "0.0313058" "02327" "CDKL5_000002" "g.18638082A>C" "" "" "" "CDKL5(NM_003159.2):c.2372A>C (p.Q791P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18619962A>C" "" "benign" "" "0000345645" "0" "90" "X" "18665312" "18665312" "subst" "1.68157E-5" "02327" "RS1_000006" "g.18665312C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18647192C>G" "" "pathogenic" "" "0000345858" "0" "70" "X" "18525275" "18525275" "subst" "0" "02327" "CDKL5_000123" "g.18525275G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18507155G>A" "" "likely pathogenic" "" "0000346259" "0" "50" "X" "18665416" "18665416" "subst" "0" "02327" "RS1_000031" "g.18665416C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18647296C>A" "" "VUS" "" "0000346351" "0" "10" "X" "18671574" "18671574" "subst" "0.00422294" "02327" "CDKL5_000004" "g.18671574C>T" "" "" "" "CDKL5(NM_003159.2):c.3003C>T (p.H1001=), CDKL5(NM_003159.3):c.3003C>T (p.H1001=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18653454C>T" "" "benign" "" "0000347264" "0" "50" "X" "18622930" "18622930" "subst" "0" "02327" "CDKL5_000131" "g.18622930T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18604810T>C" "" "VUS" "" "0000348268" "0" "90" "X" "18660191" "18660191" "subst" "0" "02327" "RS1_000220" "g.18660191G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18642071G>C" "" "pathogenic" "" "0000348814" "0" "90" "X" "18606106" "18606106" "subst" "0" "02327" "CDKL5_000102" "g.18606106C>T" "" "" "" "CDKL5(NM_001037343.1):c.587C>T (p.(Ser196Leu), p.S196L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18587986C>T" "" "pathogenic" "" "0000349044" "0" "50" "X" "18622486" "18622486" "subst" "0" "02327" "CDKL5_000129" "g.18622486C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18604366C>T" "" "VUS" "" "0000349239" "0" "10" "X" "18671655" "18671655" "subst" "0.00414692" "02327" "CDKL5_000005" "g.18671655G>A" "" "" "" "CDKL5(NM_003159.2):c.3084G>A (p.T1028=), CDKL5(NM_003159.3):c.3084G>A (p.T1028=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18653535G>A" "" "benign" "" "0000350988" "0" "90" "X" "18593612" "18593612" "subst" "0" "02327" "CDKL5_000124" "g.18593612T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18575492T>G" "" "pathogenic" "" "0000350989" "0" "90" "X" "18602382" "18602382" "subst" "0" "02327" "CDKL5_000126" "g.18602382G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.18584262G>A" "" "pathogenic" "" "0000400771" "0" "90" "X" "18593613" "18593616" "del" "0" "02552" "CDKL5_000133" "g.18593613_18593616del" "" "{PMID:Papuc 2019:30552426}" "" "" "" "De novo" "" "" "0" "" "" "g.18575493_18575496del" "" "pathogenic" "" "0000441232" "0" "90" "X" "18646629" "18646630" "del" "0" "00006" "CDKL5_000058" "g.18646629_18646630del" "" "{PMID:Lionel 2018:28771251}" "" "2635_2636delCT" "" "Unknown" "" "" "0" "" "" "g.18628509_18628510del" "" "pathogenic" "" "0000575131" "0" "30" "X" "18582659" "18582659" "subst" "0" "02325" "CDKL5_000012" "g.18582659A>G" "" "" "" "CDKL5(NM_003159.2):c.145+17A>G, CDKL5(NM_003159.3):c.145+17A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18564539A>G" "" "likely benign" "" "0000575132" "0" "10" "X" "18582659" "18582659" "subst" "0" "02326" "CDKL5_000012" "g.18582659A>G" "" "" "" "CDKL5(NM_003159.2):c.145+17A>G, CDKL5(NM_003159.3):c.145+17A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18564539A>G" "" "benign" "" "0000575136" "0" "30" "X" "18582669" "18582670" "dup" "0" "02326" "RS1_000226" "g.18582669_18582670dup" "" "" "" "CDKL5(NM_001037343.1):c.145+27_145+28dupAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18564549_18564550dup" "" "likely benign" "" "0000575137" "0" "50" "X" "18593522" "18593522" "subst" "1.68293E-5" "02325" "CDKL5_000011" "g.18593522G>A" "" "" "" "CDKL5(NM_001323289.2):c.194G>A (p.R65Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18575402G>A" "" "VUS" "" "0000575138" "0" "90" "X" "18593605" "18593605" "subst" "0" "02329" "RS1_000227" "g.18593605G>T" "" "" "" "CDKL5(NM_003159.3):c.277G>T (p.E93*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18575485G>T" "" "pathogenic" "" "0000575139" "0" "50" "X" "18600043" "18600043" "subst" "0" "02329" "RS1_000228" "g.18600043A>C" "" "" "" "CDKL5(NM_003159.3):c.436A>C (p.N146H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18581923A>C" "" "VUS" "" "0000575140" "0" "30" "X" "18602374" "18602374" "subst" "8.97067E-5" "01943" "RS1_000229" "g.18602374A>G" "" "" "" "CDKL5(NM_001323289.1):c.464-9A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18584254A>G" "" "likely benign" "" "0000575141" "0" "90" "X" "18602454" "18602454" "subst" "0" "02326" "RS1_000230" "g.18602454T>A" "" "" "" "CDKL5(NM_001037343.1):c.535T>A (p.S179T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18584334T>A" "" "pathogenic" "" "0000575142" "0" "30" "X" "18622138" "18622138" "subst" "1.11893E-5" "02327" "RS1_000231" "g.18622138G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18604018G>A" "" "likely benign" "" "0000575143" "0" "30" "X" "18622162" "18622162" "subst" "5.595E-6" "02326" "RS1_000232" "g.18622162G>C" "" "" "" "CDKL5(NM_001037343.1):c.1118G>C (p.G373A), CDKL5(NM_003159.3):c.1118G>C (p.G373A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18604042G>C" "" "likely benign" "" "0000575144" "0" "30" "X" "18622179" "18622179" "subst" "0" "01804" "RS1_000233" "g.18622179C>G" "" "" "" "CDKL5(NM_001037343.1):c.1135C>G (p.(Leu379Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18604059C>G" "" "likely benign" "" "0000575145" "0" "50" "X" "18622374" "18622374" "subst" "0.000173596" "01943" "CDKL5_000110" "g.18622374C>T" "" "" "" "CDKL5(NM_001037343.1):c.1330C>T (p.R444C), CDKL5(NM_001323289.1):c.1330C>T (p.R444C), CDKL5(NM_003159.3):c.1330C>T (p.R444C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18604254C>T" "" "VUS" "" "0000575146" "0" "30" "X" "18622374" "18622374" "subst" "0.000173596" "02325" "CDKL5_000110" "g.18622374C>T" "" "" "" "CDKL5(NM_001037343.1):c.1330C>T (p.R444C), CDKL5(NM_001323289.1):c.1330C>T (p.R444C), CDKL5(NM_003159.3):c.1330C>T (p.R444C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18604254C>T" "" "likely benign" "" "0000575148" "0" "10" "X" "18622663" "18622663" "subst" "0" "01943" "RS1_000234" "g.18622663C>G" "" "" "" "CDKL5(NM_001323289.1):c.1619C>G (p.T540S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18604543C>G" "" "benign" "" "0000575149" "0" "90" "X" "18622941" "18622941" "subst" "0" "02327" "RS1_000235" "g.18622941C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18604821C>T" "" "pathogenic" "" "0000575150" "0" "30" "X" "18627035" "18627035" "subst" "1.1257E-5" "01943" "RS1_000236" "g.18627035A>G" "" "" "" "CDKL5(NM_001323289.1):c.2046+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18608915A>G" "" "likely benign" "" "0000575151" "0" "30" "X" "18631276" "18631276" "subst" "0.000151824" "01943" "RS1_000237" "g.18631276A>T" "" "" "" "CDKL5(NM_001323289.1):c.2157A>T (p.P719=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18613156A>T" "" "likely benign" "" "0000575152" "0" "50" "X" "18631355" "18631355" "subst" "0" "02329" "RS1_000238" "g.18631355G>A" "" "" "" "CDKL5(NM_003159.3):c.2236G>A (p.G746R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18613235G>A" "" "VUS" "" "0000575154" "0" "10" "X" "18646756" "18646756" "subst" "0" "01943" "RS1_000240" "g.18646756C>T" "" "" "" "CDKL5(NM_001323289.1):c.2762C>T (p.T921I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18628636C>T" "" "benign" "" "0000575155" "0" "30" "X" "18660223" "18660223" "subst" "0.000835956" "02330" "RS1_000166" "g.18660223G>A" "" "" "" "CDKL5(NM_003159.3):c.2714-3904G>A, RS1(NM_000330.4):c.576C>T (p.P192=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18642103G>A" "" "likely benign" "" "0000575156" "0" "70" "X" "18662644" "18662644" "subst" "0" "02330" "RS1_000058" "g.18662644T>A" "" "" "" "RS1(NM_000330.4):c.428A>T (p.D143V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18644524T>A" "" "likely pathogenic" "" "0000575157" "0" "70" "X" "18665306" "18665306" "subst" "0" "02327" "RS1_000241" "g.18665306C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18647186C>G" "" "likely pathogenic" "" "0000575158" "0" "90" "X" "18665332" "18665332" "subst" "0" "02327" "RS1_000036" "g.18665332C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18647212C>T" "" "pathogenic" "" "0000575159" "0" "50" "X" "18668629" "18668629" "subst" "5.59359E-6" "01943" "RS1_000242" "g.18668629T>C" "" "" "" "CDKL5(NM_003159.2):c.2897T>C (p.V966A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18650509T>C" "" "VUS" "" "0000575160" "0" "10" "X" "18671566" "18671566" "subst" "0.00823338" "01804" "RS1_000217" "g.18671566G>A" "" "" "" "CDKL5(NM_001037343.1):c.2995G>A (p.(Val999Met), p.V999M), CDKL5(NM_003159.2):c.2995G>A (p.V999M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18653446G>A" "" "benign" "" "0000575161" "0" "50" "X" "18690134" "18690134" "subst" "0" "02327" "RS1_000243" "g.18690134T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18672014T>C" "" "VUS" "" "0000575162" "0" "30" "X" "18690145" "18690145" "subst" "0" "01804" "RS1_000244" "g.18690145C>T" "" "" "" "RS1(NM_000330.3):c.44G>A (p.(Gly15Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18672025C>T" "" "likely benign" "" "0000619373" "0" "30" "X" "18528981" "18528981" "subst" "0" "01804" "RS1_000245" "g.18528981A>G" "" "" "" "CDKL5(NM_001037343.1):c.99+7A>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18510861A>G" "" "likely benign" "" "0000619376" "0" "90" "X" "18622459" "18622460" "del" "0" "01943" "RS1_000247" "g.18622459_18622460del" "" "" "" "CDKL5(NM_001323289.1):c.1415_1416delCA (p.T472Nfs*6)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18604339_18604340del" "" "pathogenic" "" "0000619377" "0" "50" "X" "18668644" "18668644" "subst" "0" "01943" "RS1_000251" "g.18668644G>A" "" "" "" "CDKL5(NM_003159.2):c.2912G>A (p.G971D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18650524G>A" "" "VUS" "" "0000624540" "0" "10" "X" "18622376" "18622376" "subst" "0.000515178" "01943" "CDKL5_000112" "g.18622376C>T" "" "" "" "CDKL5(NM_001037343.1):c.1332C>T (p.R444=), CDKL5(NM_001323289.1):c.1332C>T (p.R444=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18604256C>T" "" "benign" "" "0000624541" "0" "30" "X" "18622910" "18622910" "subst" "0" "01943" "RS1_000248" "g.18622910C>T" "" "" "" "CDKL5(NM_001323289.1):c.1866C>T (p.A622=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18604790C>T" "" "likely benign" "" "0000624542" "0" "30" "X" "18627008" "18627008" "subst" "0.000515611" "02326" "RS1_000249" "g.18627008C>G" "" "" "" "CDKL5(NM_001037343.1):c.2022C>G (p.S674=), CDKL5(NM_001323289.1):c.2022C>G (p.S674=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18608888C>G" "" "likely benign" "" "0000624543" "0" "30" "X" "18643364" "18643364" "subst" "0" "01943" "RS1_000250" "g.18643364C>T" "" "" "" "CDKL5(NM_001323289.1):c.2493C>T (p.T831=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18625244C>T" "" "likely benign" "" "0000624544" "0" "10" "X" "18660251" "18660251" "subst" "0.00194966" "02330" "RS1_000213" "g.18660251G>A" "" "" "" "CDKL5(NM_003159.3):c.2714-3876G>A, RS1(NM_000330.3):c.548C>T (p.T183I, p.(Thr183Ile)), RS1(NM_000330.4):c.548C>T (p.T183I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18642131G>A" "" "benign" "" "0000624545" "0" "90" "X" "18665423" "18665423" "subst" "1.67844E-5" "01943" "RS1_000029" "g.18665423C>T" "" "" "" "RS1(NM_000330.3):c.214G>A (p.E72K), RS1(NM_000330.4):c.214G>A (p.E72K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18647303C>T" "" "pathogenic" "" "0000629310" "21" "90" "X" "18622986" "18622986" "subst" "0" "00006" "CDKL5_000134" "g.18622986C>T" "1/113 cases" "{PMID:Pronicka 2016:27290639}" "" "" "" "Germline" "" "" "0" "" "" "g.18604866C>T" "" "pathogenic (dominant)" "" "0000652857" "1" "90" "X" "18593473" "18593473" "subst" "0" "03575" "CDKL5_000135" "g.18593473G>A" "1/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs587783399}" "Germline" "" "rs587783399" "0" "" "" "g.18575353G>A" "" "pathogenic" "" "0000652858" "1" "90" "X" "18593548" "18593548" "subst" "0" "03575" "CDKL5_000136" "g.18593548G>T" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs587783073}" "Germline" "" "rs587783073" "0" "" "" "g.18575428G>T" "" "pathogenic" "" "0000652859" "1" "90" "X" "18593578" "18593578" "subst" "0" "03575" "CDKL5_000137" "g.18593578A>T" "1/2767 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs587783074}" "Germline" "" "rs587783074" "0" "" "" "g.18575458A>T" "" "pathogenic" "" "0000652860" "1" "90" "X" "18598085" "18598085" "subst" "0" "03575" "CDKL5_000138" "g.18598085C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs267608472}" "Germline" "" "rs267608472" "0" "" "" "g.18579965C>T" "" "pathogenic" "" "0000652861" "1" "70" "X" "18600008" "18600008" "subst" "0" "03575" "CDKL5_000139" "g.18600008C>A" "1/2773 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs587783079}" "Germline" "" "rs587783079" "0" "" "" "g.18581888C>A" "" "likely pathogenic" "" "0000652862" "1" "90" "X" "18600009" "18600009" "subst" "0" "03575" "CDKL5_000140" "g.18600009A>G" "2/2747 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs587783080}" "Germline" "" "rs587783080" "0" "" "" "g.18581889A>G" "" "pathogenic" "" "0000652864" "1" "90" "X" "18600056" "18600056" "subst" "0" "03575" "CDKL5_000087" "g.18600056A>G" "1/2720 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs587783083}" "Germline" "" "rs587783083" "0" "" "" "g.18581936A>G" "" "pathogenic" "" "0000652865" "1" "90" "X" "18606096" "18606096" "subst" "0" "03575" "CDKL5_000141" "g.18606096G>A" "1/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs587783086}" "Germline" "" "rs587783086" "0" "" "" "g.18587976G>A" "" "pathogenic" "" "0000652866" "1" "10" "X" "18638082" "18638082" "subst" "0.0313058" "03575" "CDKL5_000002" "g.18638082A>C" "31/2782 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "31 heterozygous; {DB:CLININrs35478150}" "Germline" "" "rs35478150" "0" "" "" "g.18619962A>C" "" "benign" "" "0000659233" "0" "90" "X" "18622886" "18622886" "subst" "0" "02327" "RS1_000253" "g.18622886T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.18604766T>A" "" "pathogenic" "" "0000667679" "0" "90" "X" "18602381" "18602381" "subst" "0" "00006" "CDKL5_000143" "g.18602381A>G" "" "{PMID:Carvill 2013:23708187}" "" "" "" "De novo" "" "" "0" "" "" "g.18584261A>G" "" "pathogenic (dominant)" "" "0000667680" "21" "90" "X" "18600040" "18600040" "subst" "0" "00006" "CDKL5_000142" "g.18600040C>T" "" "{PMID:Carvill 2013:23708187}" "" "" "" "Germline" "" "" "0" "" "" "g.18581920C>T" "" "pathogenic (dominant)" "" "0000667681" "0" "90" "X" "18602464" "18602464" "subst" "0" "00006" "CDKL5_000144" "g.18602464T>C" "" "{PMID:Carvill 2013:23708187}" "" "" "" "De novo" "" "" "0" "" "" "g.18584344T>C" "" "pathogenic (dominant)" "" "0000667682" "0" "90" "X" "18646558" "18646558" "subst" "0" "00006" "CDKL5_000148" "g.18646558C>G" "" "{PMID:Carvill 2013:23708187}" "" "" "" "De novo" "" "" "0" "" "" "g.18628438C>G" "" "pathogenic (dominant)" "" "0000667683" "0" "90" "X" "18622969" "18622969" "del" "0" "00006" "CDKL5_000147" "g.18622969del" "" "{PMID:Carvill 2013:23708187}" "" "1926delT (Leu642Argfs*16)" "" "De novo" "" "" "0" "" "" "g.18604849del" "" "pathogenic (dominant)" "" "0000667684" "0" "90" "X" "18602452" "18602452" "subst" "0" "00006" "CDKL5_000101" "g.18602452G>A" "" "{PMID:Carvill 2013:23708187}" "" "" "" "De novo" "" "" "0" "" "" "g.18584332G>A" "" "pathogenic (dominant)" "" "0000667685" "0" "90" "X" "18606139" "18606139" "subst" "0" "00006" "CDKL5_000145" "g.18606139G>A" "" "{PMID:Carvill 2013:23708187}" "" "" "" "De novo" "" "" "0" "" "" "g.18588019G>A" "" "pathogenic (dominant)" "" "0000667686" "0" "70" "X" "18622969" "18622969" "del" "0" "00006" "CDKL5_000147" "g.18622969del" "" "{PMID:Carvill 2013:23708187}" "" "1926delT (Leu642Argfs*16)" "parents unavailable" "Germline/De novo (untested)" "" "" "0" "" "" "g.18604849del" "" "likely pathogenic (dominant)" "" "0000667700" "0" "50" "X" "18622785" "18622785" "subst" "0" "00006" "CDKL5_000146" "g.18622785C>T" "" "{PMID:Carvill 2013:23708187}" "" "" "parents unavailable" "Germline/De novo (untested)" "" "" "0" "" "" "g.18604665C>T" "" "VUS" "" "0000667701" "0" "50" "X" "18646566" "18646566" "subst" "3.91589E-5" "00006" "CDKL5_000149" "g.18646566C>T" "" "{PMID:Carvill 2013:23708187}" "" "" "parents unavailable" "Germline/De novo (untested)" "" "" "0" "" "" "g.18628446C>T" "" "VUS" "" "0000670105" "0" "10" "X" "18638082" "18638082" "subst" "0.0313058" "03575" "CDKL5_000002" "g.18638082A>C" "13/2782 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "13 homozygous; {DB:CLININrs35478150}" "Germline" "" "rs35478150" "0" "" "" "g.18619962A>C" "" "benign" "" "0000673666" "0" "70" "X" "18582616" "18582616" "subst" "0" "00006" "CDKL5_000008" "g.18582616C>T" "" "{PMID:Johannesen 2020:32427350}" "" "" "ACMG PS1, PM1, PM2, PP2, PP3" "Germline/De novo (untested)" "" "" "0" "" "" "g.18564496C>T" "" "likely pathogenic" "ACMG" "0000673667" "0" "70" "X" "18600057" "18600057" "subst" "0" "00006" "CDKL5_000150" "g.18600057A>C" "" "{PMID:Johannesen 2020:32427350}" "" "" "ACMG PM1, PM2, PM5, PP2, PP3" "Germline/De novo (untested)" "" "" "0" "" "" "g.18581937A>C" "" "likely pathogenic" "ACMG" "0000682318" "0" "30" "X" "18622046" "18622046" "subst" "0.000112" "02326" "RS1_000254" "g.18622046T>C" "" "" "" "CDKL5(NM_001037343.1):c.1002T>C (p.A334=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682319" "0" "30" "X" "18627044" "18627044" "del" "0.0002147" "02326" "RS1_000255" "g.18627044del" "" "" "" "CDKL5(NM_001037343.1):c.2046+12delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682320" "0" "30" "X" "18660251" "18660251" "subst" "0.00194966" "01804" "RS1_000213" "g.18660251G>A" "" "" "" "CDKL5(NM_003159.3):c.2714-3876G>A, RS1(NM_000330.3):c.548C>T (p.T183I, p.(Thr183Ile)), RS1(NM_000330.4):c.548C>T (p.T183I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682321" "0" "30" "X" "18668599" "18668599" "subst" "3.91536E-5" "01943" "RS1_000256" "g.18668599G>A" "" "" "" "CDKL5(NM_003159.2):c.2867G>A (p.R956H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682322" "0" "30" "X" "18668711" "18668711" "subst" "0" "01943" "RS1_000257" "g.18668711C>T" "" "" "" "CDKL5(NM_003159.2):c.2979C>T (p.S993=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682323" "0" "50" "X" "18690152" "18690152" "subst" "5.59268E-6" "01943" "RS1_000258" "g.18690152G>A" "" "" "" "RS1(NM_000330.3):c.37C>T (p.L13F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000685631" "1" "50" "X" "0" "0" "" "0" "00006" "USP9X_000005" "g.?" "" "{PMID:Sanchis-Juan 2018:30526634}" "" "" "" "De novo" "" "" "0" "" "" "" "" "VUS" "" "0000686212" "0" "50" "X" "18622608" "18622608" "subst" "1.11918E-5" "03771" "CDKL5_000154" "g.18622608T>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.18604488T>G" "" "VUS" "" "0000686214" "0" "70" "X" "18631396" "18631396" "subst" "0" "03771" "CDKL5_000155" "g.18631396G>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.18613276G>A" "" "pathogenic" "ACMG" "0000686215" "0" "90" "X" "18638088" "18638088" "subst" "0" "03771" "CDKL5_000156" "g.18638088T>A" "" "" "" "" "" "De novo" "" "rs1602292181" "0" "" "" "g.18619968T>A" "" "pathogenic" "ACMG" "0000686216" "20" "90" "X" "18598059" "18598059" "subst" "0" "03771" "CDKL5_000152" "g.18598059G>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.18579939G>A" "" "pathogenic" "ACMG" "0000686217" "20" "70" "X" "18593506" "18593506" "subst" "0" "03771" "CDKL5_000151" "g.18593506G>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.18575386G>A" "" "likely pathogenic" "ACMG" "0000686218" "20" "90" "X" "18622291" "18622292" "del" "0" "03771" "CDKL5_000153" "g.18622291_18622292del" "" "" "" "1247_1248delAG" "" "De novo" "" "rs786204967" "0" "" "" "g.18604171_18604172del" "" "pathogenic" "ACMG" "0000693509" "0" "30" "X" "18622811" "18622811" "subst" "0.000280089" "02326" "RS1_000262" "g.18622811C>T" "" "" "" "CDKL5(NM_001323289.2):c.1767C>T (p.H589=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000696947" "0" "90" "X" "18622147" "18622147" "dup" "0" "00778" "CDKL5_000157" "g.18622147dup" "" "" "" "1103dupA" "" "De novo" "yes" "" "0" "" "" "g.18604027dup" "" "pathogenic (dominant)" "ACMG" "0000704185" "0" "90" "X" "18598043" "18598052" "del" "0" "01807" "CDKL5_000158" "g.18598043_18598052del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.18579923_18579932del" "" "pathogenic" "" "0000728731" "0" "30" "X" "18597954" "18597954" "subst" "0.00011231" "02326" "RS1_000264" "g.18597954T>C" "" "" "" "CDKL5(NM_001323289.2):c.283-14T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728732" "0" "50" "X" "18622881" "18622881" "subst" "0" "01943" "CDKL5_000117" "g.18622881A>T" "" "" "" "CDKL5(NM_001323289.1):c.1837A>T (p.M613L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728733" "0" "30" "X" "18643279" "18643279" "subst" "1.12243E-5" "01943" "RS1_000265" "g.18643279C>T" "" "" "" "CDKL5(NM_001323289.1):c.2408C>T (p.T803M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728734" "0" "90" "X" "18646572" "18646572" "subst" "0" "02329" "RS1_000239" "g.18646572C>T" "" "" "" "CDKL5(NM_003159.3):c.2578C>T (p.Q860*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000728735" "0" "90" "X" "18665423" "18665423" "subst" "1.67844E-5" "02330" "RS1_000029" "g.18665423C>T" "" "" "" "RS1(NM_000330.3):c.214G>A (p.E72K), RS1(NM_000330.4):c.214G>A (p.E72K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000728736" "0" "90" "X" "18665423" "18665423" "subst" "1.67844E-5" "02327" "RS1_000029" "g.18665423C>T" "" "" "" "RS1(NM_000330.3):c.214G>A (p.E72K), RS1(NM_000330.4):c.214G>A (p.E72K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000728737" "0" "30" "X" "18668531" "18668531" "subst" "0" "01943" "RS1_000266" "g.18668531A>G" "" "" "" "CDKL5(NM_003159.2):c.2799A>G (p.G933=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728738" "0" "30" "X" "18668577" "18668577" "subst" "1.11868E-5" "01943" "RS1_000267" "g.18668577G>A" "" "" "" "CDKL5(NM_003159.2):c.2845G>A (p.V949I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728739" "0" "30" "X" "18668631" "18668631" "subst" "5.59356E-6" "01943" "RS1_000268" "g.18668631C>G" "" "" "" "CDKL5(NM_003159.2):c.2899C>G (p.L967V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728740" "0" "30" "X" "18671654" "18671654" "subst" "2.25785E-5" "01943" "RS1_000269" "g.18671654C>T" "" "" "" "CDKL5(NM_003159.2):c.3083C>T (p.T1028M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728741" "0" "50" "X" "18674870" "18674870" "subst" "1.67964E-5" "01943" "RS1_000270" "g.18674870G>A" "" "" "" "RS1(NM_000330.3):c.87C>T (p.G29=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000763089" "1" "90" "X" "18668586" "18668586" "subst" "0.000190173" "00006" "CDKL5_000159" "g.18668586C>T" "" "{PMID:Anazi 2017:27431290}" "" "" "ACMG PVS1, PS2" "De novo" "" "" "0" "" "" "g.18650466C>T" "" "pathogenic" "ACMG" "0000763184" "1" "90" "X" "18668586" "18668586" "subst" "0.000190173" "00006" "CDKL5_000159" "g.18668586C>T" "" "{PMID:Anazi 2017:27431290}" "" "" "ACMG PVS1, PS4, PS1, PS2" "De novo" "" "" "0" "" "" "g.18650466C>T" "" "pathogenic" "ACMG" "0000786783" "0" "70" "X" "18622886" "18622886" "subst" "0" "00006" "RS1_000253" "g.18622886T>A" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.18604766T>A" "" "likely pathogenic" "" "0000787226" "1" "50" "X" "18602436" "18602436" "subst" "0" "00006" "CDKL5_000160" "g.18602436G>C" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.18584316G>C" "" "VUS" "" "0000787227" "0" "50" "X" "18622881" "18622881" "subst" "0" "00006" "CDKL5_000161" "g.18622881A>C" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.18604761A>C" "" "VUS" "" "0000787228" "0" "50" "X" "18631388" "18631388" "subst" "1.12009E-5" "00006" "CDKL5_000162" "g.18631388G>A" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "rs758383464" "0" "" "" "g.18613268G>A" "" "VUS" "" "0000787229" "0" "50" "X" "18668628" "18668628" "subst" "3.35631E-5" "00006" "CDKL5_000163" "g.18668628G>A" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "rs747799506" "0" "" "" "g.18650508G>A" "{CV-RCV:000194778.1}" "VUS" "" "0000787467" "0" "50" "X" "18668628" "18668628" "subst" "3.35631E-5" "00000" "CDKL5_000163" "g.18668628G>A" "" "0" "" "" "" "Germline" "" "rs747799506" "0" "" "" "g.18650508G>A" "{CV-RCV:000194778.1}" "VUS" "" "0000810204" "0" "30" "X" "18593508" "18593508" "subst" "0.000729509" "01943" "RS1_000281" "g.18593508G>A" "" "" "" "CDKL5(NM_001323289.1):c.180G>A (p.E60=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810205" "0" "30" "X" "18622124" "18622124" "subst" "1.11897E-5" "01943" "RS1_000282" "g.18622124C>T" "" "" "" "CDKL5(NM_001323289.1):c.1080C>T (p.L360=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810206" "0" "30" "X" "18622224" "18622224" "subst" "0" "01943" "RS1_000283" "g.18622224A>G" "" "" "" "CDKL5(NM_001323289.1):c.1180A>G (p.S394G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810207" "0" "30" "X" "18622382" "18622382" "subst" "0.000100811" "01943" "RS1_000284" "g.18622382A>T" "" "" "" "CDKL5(NM_001323289.1):c.1338A>T (p.S446=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810208" "0" "30" "X" "18643280" "18643280" "subst" "0.000314335" "01943" "RS1_000285" "g.18643280G>A" "" "" "" "CDKL5(NM_001323289.1):c.2409G>A (p.T803=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810209" "0" "30" "X" "18643293" "18643293" "subst" "5.6129E-6" "01943" "RS1_000286" "g.18643293A>G" "" "" "" "CDKL5(NM_001323289.1):c.2422A>G (p.I808V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810210" "0" "90" "X" "18660191" "18660191" "subst" "0" "02327" "RS1_000077" "g.18660191G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000810211" "0" "30" "X" "18660283" "18660283" "subst" "5.63447E-6" "01943" "RS1_000287" "g.18660283A>G" "" "" "" "RS1(NM_000330.3):c.523-7T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810212" "0" "50" "X" "18662681" "18662681" "subst" "0" "02329" "RS1_000223" "g.18662681T>C" "" "" "" "RS1(NM_000330.3):c.391A>G (p.K131E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000810213" "0" "30" "X" "18664229" "18664229" "subst" "6.81095E-5" "02326" "RS1_000288" "g.18664229A>G" "" "" "" "CDKL5(NM_003159.2):c.2797+19A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810214" "0" "70" "X" "18690186" "18690186" "subst" "0" "02327" "RS1_000289" "g.18690186C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000819315" "1" "70" "X" "18662654" "18662654" "subst" "0" "00000" "RS1_000052" "g.18662654C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.418G>A/p.G140R" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.18644534C>T" "" "likely pathogenic" "" "0000819346" "1" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.304C>T/p.R102W" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000819353" "1" "70" "X" "18660240" "18660240" "subst" "0" "00000" "RS1_000193" "g.18660240G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.559C>T/p.Q187*" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.18642120G>A" "" "likely pathogenic" "" "0000819354" "1" "70" "X" "18660240" "18660240" "subst" "0" "00000" "RS1_000193" "g.18660240G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.559C>T/p.Q187*" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.18642120G>A" "" "likely pathogenic" "" "0000819367" "1" "70" "X" "18662706" "18662706" "subst" "0" "00000" "RS1_000297" "g.18662706C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.366G>A/p.W122*" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.18644586C>T" "" "likely pathogenic" "" "0000819372" "1" "70" "X" "18665431" "18665438" "dup" "0" "00000" "RS1_000299" "g.18665431_18665438dup" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.199_206dup/p.G70Sfs*59" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.18647311_18647318dup" "" "likely pathogenic" "" "0000819375" "1" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.305G>A/p.R102Q" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000819376" "1" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.214G>A/p.E72K" "solved, hemizygous" "Germline" "yes" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000819378" "1" "70" "X" "18660209" "18660209" "subst" "5.6062E-6" "00000" "RS1_000072" "g.18660209C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.590G>A/p.R197H" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.18642089C>T" "" "likely pathogenic" "" "0000819486" "1" "70" "X" "18665453" "18665453" "subst" "0" "00000" "RS1_000025" "g.18665453C>G" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.185-1G>C/p.?" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.18647333C>G" "" "likely pathogenic" "" "0000819493" "1" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.305G>A/p.R102Q" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000819498" "1" "70" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000055" "g.18662651G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.421C>T/p.R141C" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.18644531G>A" "" "likely pathogenic" "" "0000819507" "1" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.214G>A/p.E72K" "solved, hemizygous" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000819550" "1" "70" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000055" "g.18662651G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.421C>T/p.R141C" "solved, hemizygous" "Germline" "yes" "" "0" "" "" "g.18644531G>A" "" "likely pathogenic" "" "0000819551" "1" "70" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000055" "g.18662651G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "RS1, variant 1: c.421C>T/p.R141C" "solved, hemizygous" "Germline" "yes" "" "0" "" "" "g.18644531G>A" "" "likely pathogenic" "" "0000822969" "20" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Méjécase 2020:32783370}" "" "RS1 c.30SG>A p.(Arg102Gln)" "hemizygous" "Unknown" "?" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000822970" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Méjécase 2020:32783370}" "" "RS1 c.304C>T p.(Arg102Trp)" "hemizygous" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000823182" "21" "50" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Hull 2020:32856788}" "" "RS1 nucleotide 1, protein 1:c.214G>A, p.Glu72Lys" "hemizygous, ACMG unclassified - no access to supplementary table 2" "Germline" "yes" "" "0" "" "" "g.18647303C>T" "" "VUS" "" "0000823185" "21" "50" "X" "18662743" "18662743" "subst" "0" "00000" "RS1_000039" "g.18662743C>T" "" "{PMID:Hull 2020:32856788}" "" "RS1 nucleotide 1, protein 1:c.329G>A, p.Cys110Tyr" "hemizygous, ACMG unclassified - no access to supplementary table 2" "Germline" "yes" "" "0" "" "" "g.18644623C>T" "" "VUS" "" "0000823186" "20" "50" "X" "18662743" "18662743" "subst" "0" "00000" "RS1_000039" "g.18662743C>T" "" "{PMID:Hull 2020:32856788}" "" "RS1 nucleotide 1, protein 1:c.329G>A, p.Cys110Tyr" "hemizygous, ACMG unclassified - no access to supplementary table 2" "Germline" "yes" "" "0" "" "" "g.18644623C>T" "" "VUS" "" "0000823187" "20" "50" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000055" "g.18662651G>A" "" "{PMID:Hull 2020:32856788}" "" "RS1 nucleotide 1, protein 1:c.421C>T, p.Arg141Cys" "hemizygous, ACMG unclassified - no access to supplementary table 2" "Germline" "yes" "" "0" "" "" "g.18644531G>A" "" "VUS" "" "0000823188" "20" "50" "X" "18662646" "18662646" "subst" "0" "00000" "RS1_000114" "g.18662646A>C" "" "{PMID:Hull 2020:32856788}" "" "RS1 nucleotide 1, protein 1:c.426T>G, p.Cys142Trp" "hemizygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.18644526A>C" "" "VUS" "" "0000823189" "20" "50" "X" "18662574" "18662574" "subst" "0" "00000" "RS1_000302" "g.18662574G>T" "" "{PMID:Hull 2020:32856788}" "" "RS1 nucleotide 1, protein 1:c.498C>A, p.Tyr166*" "hemizygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.18644454G>T" "" "VUS" "" "0000823190" "20" "50" "X" "18662549" "18662549" "subst" "0" "00000" "RS1_000148" "g.18662549C>T" "" "{PMID:Hull 2020:32856788}" "" "RS1 nucleotide 1, protein 1:c.522+1G>A, p.?" "hemizygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.18644429C>T" "" "VUS" "" "0000823191" "20" "50" "X" "18660225" "18660225" "subst" "0" "00000" "RS1_000143" "g.18660225G>C" "" "{PMID:Hull 2020:32856788}" "" "RS1 nucleotide 1, protein 1:c.574C>G, p.Pro192Ala" "hemizygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.18642105G>C" "" "VUS" "" "0000823192" "20" "50" "X" "18660225" "18660225" "dup" "0" "00000" "RS1_000070" "g.18660225dup" "" "{PMID:Hull 2020:32856788}" "" "RS1 nucleotide 1, protein 1:c.579dupC, p.Ile194Hisfsext51" "error in annotation: c.579dup causes p.(Ile194Hisfs*70) and not p.(Ile194Hisfsext51), hemizygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.18642105dup" "" "VUS" "" "0000823193" "20" "50" "X" "18660174" "18660174" "subst" "0" "00000" "RS1_000080" "g.18660174G>A" "" "{PMID:Hull 2020:32856788}" "" "RS1 nucleotide 1, protein 1:c.625C>T, p.Arg209Cys" "hemizygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.18642054G>A" "" "VUS" "" "0000828911" "20" "70" "X" "18665361" "18665361" "subst" "0" "00000" "RS1_000091" "g.18665361C>G" "" "{PMID:Chen 2021:43360855}" "" "RS1 c.[276G>C];[0], V1: c.276G>C, (p.Trp92Cys)" "hemizygous" "Unknown" "?" "" "0" "" "" "g.18647241C>G" "" "likely pathogenic" "ACMG" "0000828912" "20" "70" "X" "18660201" "18660201" "subst" "0" "00000" "RS1_000074" "g.18660201G>A" "" "{PMID:Chen 2021:43360855}" "" "RS1 c.[598C>T];[0], V1: c.598C>T, (p.Arg200Cys)" "hemizygous" "Unknown" "?" "" "0" "" "" "g.18642081G>A" "" "likely pathogenic" "ACMG" "0000828937" "20" "90" "X" "18665393" "18665394" "del" "0" "00000" "RS1_000318" "g.18665393_18665394del" "" "{PMID:Chen 2021:43360855}" "" "RS1 c.[244_245del];[0], V1: c.244_245delAC, (p.Thr82LeufsTer3)" "hemizygous" "Unknown" "?" "" "0" "" "" "g.18647273_18647274del" "" "pathogenic" "ACMG" "0000829083" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Vijayasarathy 2010:20809529}" "" "RS1 c.214G>A, p.Glu72Lys" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000829084" "20" "70" "X" "18665361" "18665361" "subst" "0" "00000" "RS1_000091" "g.18665361C>G" "" "{PMID:Vijayasarathy 2010:20809529}" "" "RS1 c.276G>C, p.Trp92Cys" "" "Unknown" "?" "" "0" "" "" "g.18647241C>G" "" "likely pathogenic" "" "0000829085" "20" "70" "X" "18665349" "18665349" "subst" "0" "00000" "RS1_000317" "g.18665349C>G" "" "{PMID:Vijayasarathy 2010:20809529}" "" "RS1 c.286G>C, p.Trp96Cys" "error in annotation: p.Trp96Cys is caused by c.288G>C, not c.286G>C" "Unknown" "?" "" "0" "" "" "g.18647229C>G" "" "likely pathogenic" "" "0000829086" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Vijayasarathy 2010:20809529}" "" "RS1 c.304C>T, p.Arg102Trp" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000829087" "20" "70" "X" "18660264" "18660264" "subst" "0" "00000" "RS1_000192" "g.18660264T>C" "" "{PMID:Vijayasarathy 2010:20809529}" "" "RS1 c.535A>G, p.Asn179Asp" "" "Unknown" "?" "" "0" "" "" "g.18642144T>C" "" "likely pathogenic" "" "0000829088" "20" "70" "X" "18660225" "18660225" "subst" "0" "00000" "RS1_000007" "g.18660225G>A" "" "{PMID:Vijayasarathy 2010:20809529}" "" "RS1 c.574C>T, p.Pro192Ser" "" "Unknown" "?" "" "0" "" "" "g.18642105G>A" "" "likely pathogenic" "" "0000829089" "20" "70" "X" "18660201" "18660201" "subst" "0" "00000" "RS1_000074" "g.18660201G>A" "" "{PMID:Vijayasarathy 2010:20809529}" "" "RS1 c.598C>T, p.Arg200Cys" "" "Unknown" "?" "" "0" "" "" "g.18642081G>A" "" "likely pathogenic" "" "0000829090" "20" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Vijayasarathy 2010:20809529}" "" "RS1 c.673C>T, p.Arg213Trp" "error in annotation: p.Arg213Trp is caused by c.637C>T, not c.673C>T" "Unknown" "?" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000829098" "20" "70" "X" "18662736" "18662736" "subst" "0" "00000" "RS1_000316" "g.18662736C>T" "" "{PMID:Xu 2011:21701876}" "" "RS1 c.336G>A, p.(Trp112Ter)" "coding DNA change extrapolated: only protein changes given in the publication" "Germline" "yes" "" "0" "" "" "g.18644616C>T" "" "likely pathogenic" "" "0000829099" "20" "70" "X" "18662672" "18662672" "subst" "0" "00000" "RS1_000314" "g.18662672A>G" "" "{PMID:Xu 2011:21701876}" "" "RS1 c.400T>C, p.(Ser134Pro)" "coding DNA change extrapolated: only protein changes given in the publication" "Germline" "yes" "" "0" "" "" "g.18644552A>G" "" "likely pathogenic" "" "0000829100" "20" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Xu 2011:21701876}" "" "RS1 c.637C>T, p.(Arg213Trp)" "coding DNA change extrapolated: only protein changes given in the publication" "Germline" "yes" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000829101" "20" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Xu 2011:21701876}" "" "RS1 c.637C>T, p.(Arg213Trp)" "coding DNA change extrapolated: only protein changes given in the publication" "Germline" "yes" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000829102" "20" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Xu 2011:21701876}" "" "RS1 c.637C>T, p.(Arg213Trp)" "coding DNA change extrapolated: only protein changes given in the publication" "Germline" "yes" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000829103" "20" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Xu 2011:21701876}" "" "RS1 c.637C>T, p.(Arg213Trp)" "coding DNA change extrapolated: only protein changes given in the publication" "Germline" "yes" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000829104" "20" "70" "X" "18660200" "18660200" "subst" "0" "00000" "RS1_000075" "g.18660200C>T" "" "{PMID:Xu 2011:21701876}" "" "RS1 c.599G>A, p.(Arg200His)" "coding DNA change extrapolated: only protein changes given in the publication" "Germline" "yes" "" "0" "" "" "g.18642080C>T" "" "likely pathogenic" "" "0000829105" "20" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Xu 2011:21701876}" "" "RS1 c.305G>A, p.(Arg102Gln)" "coding DNA change extrapolated: only protein changes given in the publication" "Germline" "yes" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000829116" "0" "70" "X" "18662611" "18662611" "subst" "0" "00000" "RS1_000125" "g.18662611T>C" "" "{PMID:Armanda-Maresca 2011:21836411}" "" "RS1, p.Gln154Arg" "DNA change extrapolated, only protein variant in publication" "Unknown" "?" "" "0" "" "" "g.18644491T>C" "" "likely pathogenic" "ACMG" "0000829117" "0" "70" "X" "18660173" "18660173" "subst" "0" "00000" "RS1_000310" "g.18660173C>G" "" "{PMID:Duncan 2011:22110067}" "" "c.626G>C; p.Arg209Pro" "" "Unknown" "?" "" "0" "" "" "g.18642053C>G" "" "likely pathogenic" "" "0000829118" "0" "70" "X" "18660225" "18660225" "dup" "0" "00000" "RS1_000070" "g.18660225dup" "" "{PMID:Duncan 2011:22110067}" "" "c.579dupC; p.Ile194Hisfs" "" "Unknown" "?" "" "0" "" "" "g.18642105dup" "" "likely pathogenic" "" "0000829210" "0" "90" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Yi 2012:22245991}" "" "RS1 214G>A, Glu72Lys" "" "Germline" "?" "" "0" "" "" "g.18647303C>T" "" "pathogenic" "" "0000829211" "0" "90" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Yi 2012:22245991}" "" "RS1 214G>A, Glu72Lys" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "pathogenic" "" "0000829212" "0" "90" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Yi 2012:22245991}" "" "RS1 214G>A, Glu72Lys" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "pathogenic" "" "0000829213" "0" "90" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Yi 2012:22245991}" "" "RS1 304C>T, Arg102Trp" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "pathogenic" "" "0000829214" "0" "90" "X" "18662636" "18662636" "subst" "0" "00000" "RS1_000059" "g.18662636C>T" "" "{PMID:Yi 2012:22245991}" "" "RS1 436G>A, Glu146Lys" "" "Unknown" "?" "" "0" "" "" "g.18644516C>T" "" "pathogenic" "" "0000829215" "0" "90" "X" "18660268" "18660268" "subst" "0" "00000" "RS1_000312" "g.18660268A>C" "" "{PMID:Yi 2012:22245991}" "" "RS1 531T>G, Tyr177X" "" "Unknown" "?" "" "0" "" "" "g.18642148A>C" "" "pathogenic" "" "0000829216" "0" "90" "X" "18660255" "18660255" "subst" "5.62066E-6" "00000" "RS1_000067" "g.18660255G>A" "" "{PMID:Yi 2012:22245991}" "" "RS1 544C>T, Arg182Cys" "" "Unknown" "?" "" "0" "" "" "g.18642135G>A" "" "pathogenic" "" "0000829217" "0" "90" "X" "18660255" "18660255" "subst" "5.62066E-6" "00000" "RS1_000067" "g.18660255G>A" "" "{PMID:Yi 2012:22245991}" "" "RS1 544C>T, Arg182Cys" "" "Unknown" "?" "" "0" "" "" "g.18642135G>A" "" "pathogenic" "" "0000829218" "0" "90" "X" "18660200" "18660200" "subst" "0" "00000" "RS1_000075" "g.18660200C>T" "" "{PMID:Yi 2012:22245991}" "" "RS1 599G>A, Arg200His" "" "Unknown" "?" "" "0" "" "" "g.18642080C>T" "" "pathogenic" "" "0000829219" "0" "90" "X" "18660192" "18660192" "subst" "0" "00000" "RS1_000311" "g.18660192G>C" "" "{PMID:Yi 2012:22245991}" "" "RS1 607C>G, Pro203Ala" "" "Unknown" "?" "" "0" "" "" "g.18642072G>C" "" "pathogenic" "" "0000829220" "0" "90" "X" "18660155" "18660155" "subst" "0" "00000" "RS1_000177" "g.18660155T>A" "" "{PMID:Yi 2012:22245991}" "" "RS1 644A>T, Glu215Val" "" "Unknown" "?" "" "0" "" "" "g.18642035T>A" "" "pathogenic" "" "0000829221" "0" "90" "X" "18660131" "18660131" "subst" "0" "00000" "RS1_000309" "g.18660131C>T" "" "{PMID:Yi 2012:22245991}" "" "RS1 668G>A, Cys223Tyr" "" "Unknown" "?" "" "0" "" "" "g.18642011C>T" "" "pathogenic" "" "0000829241" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Skorczyk 2012:23288992}" "" "RS1 c.214G>A (p.Glu72Lys)" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000829242" "20" "70" "X" "18665419" "18665419" "subst" "0" "00000" "RS1_000319" "g.18665419G>T" "" "{PMID:Skorczyk 2012:23288992}" "" "RS1 c.218C>A (p.Ser73*)" "" "Unknown" "?" "" "0" "" "" "g.18647299G>T" "" "likely pathogenic" "" "0000829243" "20" "70" "X" "18665419" "18665419" "subst" "0" "00000" "RS1_000319" "g.18665419G>T" "" "{PMID:Skorczyk 2012:23288992}" "" "RS1 c.218C>A (p.Ser73*)" "" "Unknown" "?" "" "0" "" "" "g.18647299G>T" "" "likely pathogenic" "" "0000829244" "20" "70" "X" "18665419" "18665419" "subst" "0" "00000" "RS1_000319" "g.18665419G>T" "" "{PMID:Skorczyk 2012:23288992}" "" "RS1 c.218C>A (p.Ser73*)" "" "Unknown" "?" "" "0" "" "" "g.18647299G>T" "" "likely pathogenic" "" "0000829245" "20" "70" "X" "18662718" "18662719" "del" "0" "00000" "RS1_000315" "g.18662718_18662719del" "" "{PMID:Skorczyk 2012:23288992}" "" "RS1 c.354_355delCA (p.Asp118Glufs*)" "" "Unknown" "?" "" "0" "" "" "g.18644598_18644599del" "" "likely pathogenic" "" "0000829246" "20" "70" "X" "18662621" "18662621" "subst" "0" "00000" "RS1_000313" "g.18662621A>T" "" "{PMID:Skorczyk 2012:23288992}" "" "RS1 c.451T>A (p.Tyr151Asp)" "" "Unknown" "?" "" "0" "" "" "g.18644501A>T" "" "likely pathogenic" "" "0000829247" "20" "70" "X" "18662549" "18662549" "subst" "0" "00000" "RS1_000064" "g.18662549C>A" "" "{PMID:Skorczyk 2012:23288992}" "" "RS1 c.522+1G>T" "" "Unknown" "?" "" "0" "" "" "g.18644429C>A" "" "likely pathogenic" "" "0000829248" "20" "70" "X" "18660173" "18660173" "subst" "0" "00000" "RS1_000178" "g.18660173C>A" "" "{PMID:Skorczyk 2012:23288992}" "" "RS1 c.626G>T (p.Arg209Leu)" "" "Unknown" "?" "" "0" "" "" "g.18642053C>A" "" "likely pathogenic" "" "0000829273" "20" "70" "X" "18665431" "18665431" "subst" "0" "00000" "RS1_000161" "g.18665431A>G" "" "{PMID:Sergeev 2013:23847049}" "" "L69P" "predicted severe, no RS1 secretion; variant extrapolated from protein change" "Unknown" "?" "" "0" "" "" "g.18647311A>G" "" "likely pathogenic" "" "0000829274" "20" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Sergeev 2013:23847049}" "" "R102E (arginine to glutamic acid)" "predicted severe, no RS1 secretion" "Germline/De novo (untested)" "?" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000829275" "20" "70" "X" "18665312" "18665312" "subst" "1.68157E-5" "00000" "RS1_000006" "g.18665312C>G" "" "{PMID:Sergeev 2013:23847049}" "" "G109R" "predicted severe, no RS1 secretion; variant extrapolated from protein change" "Unknown" "?" "" "0" "" "" "g.18647192C>G" "" "likely pathogenic" "" "0000829276" "20" "70" "X" "18665312" "18665312" "subst" "0" "00000" "RS1_000104" "g.18665312C>A" "" "{PMID:Sergeev 2013:23847049}" "" "G109W" "predicted severe, no RS1 secretion; variant extrapolated from protein change" "Unknown" "?" "" "0" "" "" "g.18647192C>A" "" "likely pathogenic" "" "0000829277" "20" "70" "X" "18662743" "18662743" "subst" "0" "00000" "RS1_000039" "g.18662743C>T" "" "{PMID:Sergeev 2013:23847049}" "" "C110Y" "predicted severe, no RS1 secretion; variant extrapolated from protein change" "Unknown" "?" "" "0" "" "" "g.18644623C>T" "" "likely pathogenic" "" "0000829278" "20" "70" "X" "18662653" "18662653" "subst" "0" "00000" "RS1_000053" "g.18662653C>T" "" "{PMID:Sergeev 2013:23847049}" "" "G140E" "predicted mild, reduced RS1 secretion; variant extrapolated from protein change" "Unknown" "?" "" "0" "" "" "g.18644533C>T" "" "likely pathogenic" "" "0000829279" "20" "70" "X" "18662570" "18662570" "subst" "0" "00000" "RS1_000344" "g.18662570C>G" "" "{PMID:Sergeev 2013:23847049}" "" "D168H" "predicted mild, reduced RS1 secretion; variant extrapolated from protein change" "Unknown" "?" "" "0" "" "" "g.18644450C>G" "" "likely pathogenic" "" "0000829280" "20" "70" "X" "18660245" "18660245" "subst" "0" "00000" "RS1_000098" "g.18660245G>T" "" "{PMID:Sergeev 2013:23847049}" "" "T185K" "predicted mild, reduced RS1 secretion; variant extrapolated from protein change" "Unknown" "?" "" "0" "" "" "g.18642125G>T" "" "likely pathogenic" "" "0000829281" "20" "70" "X" "18660227" "18660227" "subst" "0" "00000" "RS1_000336" "g.18660227C>G" "" "{PMID:Sergeev 2013:23847049}" "" "R191P" "predicted severe, no RS1 secretion; variant extrapolated from protein change" "Unknown" "?" "" "0" "" "" "g.18642107C>G" "" "likely pathogenic" "" "0000829282" "20" "70" "X" "18660209" "18660209" "subst" "5.6062E-6" "00000" "RS1_000072" "g.18660209C>T" "" "{PMID:Sergeev 2013:23847049}" "" "R197H" "predicted severe, no RS1 secretion; variant extrapolated from protein change" "Unknown" "?" "" "0" "" "" "g.18642089C>T" "" "likely pathogenic" "" "0000829283" "20" "70" "X" "18660152" "18660152" "subst" "0" "00000" "RS1_000083" "g.18660152A>G" "" "{PMID:Sergeev 2013:23847049}" "" "L216P" "predicted severe, no RS1 secretion; variant extrapolated from protein change" "Unknown" "?" "" "0" "" "" "g.18642032A>G" "" "likely pathogenic" "" "0000829284" "20" "70" "X" "18662656" "18662656" "del" "0" "00000" "RS1_000051" "g.18662656del" "" "{PMID:Sergeev 2013:23847049}" "" "Deletion 416delA in exon 5" "" "Unknown" "?" "" "0" "" "" "g.18644536del" "" "likely pathogenic" "" "0000829289" "20" "70" "X" "18660225" "18660225" "dup" "0" "00000" "RS1_000070" "g.18660225dup" "" "{PMID:Sergeev 2013:23847049}" "" "Insertion c.579insC" "error in annotation, variant c.579insC is c.579dupC and causes p.(Ile194Hisfs*70) and not p.(His194fs*263)" "Unknown" "?" "" "0" "" "" "g.18642105dup" "" "likely pathogenic" "" "0000829293" "20" "70" "X" "18660225" "18660225" "dup" "0" "00000" "RS1_000070" "g.18660225dup" "" "{PMID:Sergeev 2013:23847049}" "" "Duplication 579dupC" "error in annotation, variant c.579insC is c.579dupC and causes p.(Ile194Hisfs*70) and not p.(His194fs*263)" "Unknown" "?" "" "0" "" "" "g.18642105dup" "" "likely pathogenic" "" "0000829294" "20" "70" "X" "18662656" "18662656" "del" "0" "00000" "RS1_000051" "g.18662656del" "" "{PMID:Sergeev 2013:23847049}" "" "Deletion 416delA in exon 5" "" "Unknown" "?" "" "0" "" "" "g.18644536del" "" "likely pathogenic" "" "0000829296" "20" "70" "X" "18660227" "18660227" "del" "0" "00000" "RS1_000141" "g.18660227del" "" "{PMID:Chu 2013:23568735}" "" "c.573delG, p.Pro192fs" "mutation based on abstract (article in Chinese). Error in annotation, c.573delG causes p.(Ile194SerfsTer43) and not p.(Pro192fs)" "Germline" "yes" "" "0" "" "" "g.18642107del" "" "likely pathogenic" "" "0000829297" "20" "70" "X" "18660173" "18660173" "subst" "0" "00000" "RS1_000009" "g.18660173C>T" "" "{PMID:Chu 2013:23568735}" "" "c.626G>A, p.Arg209His" "mutation based on abstract (article in Chinese)" "Germline" "yes" "" "0" "" "" "g.18642053C>T" "" "likely pathogenic" "" "0000829300" "0" "70" "X" "18662702" "18662702" "subst" "0" "00000" "RS1_000367" "g.18662702G>A" "" "{PMID:Chen 2014:24505212}" "" "c.370C>T, p.Q124X" "" "Germline" "yes" "" "0" "" "" "g.18644582G>A" "" "likely pathogenic" "" "0000829301" "0" "70" "X" "18662742" "18662742" "del" "0" "00000" "RS1_000370" "g.18662742del" "" "{PMID:Chen 2014:24505212}" "" "c.330delT, p.C110fs+15X" "error in annotation, variant causes a stop after 16 and not 15 amino acids" "Germline" "yes" "" "0" "" "" "g.18644622del" "" "likely pathogenic" "" "0000829302" "0" "70" "X" "18660218" "18660218" "subst" "0" "00000" "RS1_000195" "g.18660218A>T" "" "{PMID:Chen 2014:24505212}" "" "c.581T>A, p.I194N" "" "Germline" "yes" "" "0" "" "" "g.18642098A>T" "" "likely pathogenic" "" "0000829306" "0" "70" "X" "18660161" "18660161" "subst" "0" "00000" "RS1_000092" "g.18660161C>T" "" "{PMID:Chen 2014:24505212}" "" "c.638G>A, p.R213Q" "" "Germline" "yes" "" "0" "" "" "g.18642041C>T" "" "likely pathogenic" "" "0000829307" "0" "70" "X" "18660221" "18660221" "subst" "0" "00000" "RS1_000008" "g.18660221G>A" "" "{PMID:Chen 2014:24505212}" "" "c.578C>T, p.P193L" "" "Germline" "yes" "" "0" "" "" "g.18642101G>A" "" "likely pathogenic" "" "0000829308" "0" "70" "X" "18660200" "18660200" "subst" "0" "00000" "RS1_000075" "g.18660200C>T" "" "{PMID:Chen 2014:24505212}" "" "c.599G>A, p.R200H" "" "Germline" "yes" "" "0" "" "" "g.18642080C>T" "" "likely pathogenic" "" "0000829310" "0" "70" "X" "18662576" "18662576" "subst" "0" "00000" "RS1_000346" "g.18662576A>G" "" "{PMID:Chen 2014:24505212}" "" "c.496T>C, p.Y166H" "" "Germline" "yes" "" "0" "" "" "g.18644456A>G" "" "likely pathogenic" "" "0000829311" "0" "70" "X" "18662621" "18662621" "subst" "0" "00000" "RS1_000354" "g.18662621A>G" "" "{PMID:Chen 2014:24505212}" "" "c.451T>C, p.Y151H" "" "Germline" "yes" "" "0" "" "" "g.18644501A>G" "" "likely pathogenic" "" "0000829312" "0" "70" "X" "18662573" "18662573" "subst" "0" "00000" "RS1_000345" "g.18662573T>C" "" "{PMID:Chen 2014:24505212}" "" "c.499A>G, p.K167E" "" "Germline" "yes" "" "0" "" "" "g.18644453T>C" "" "likely pathogenic" "" "0000829313" "0" "70" "X" "18665429" "18665429" "subst" "0" "00000" "RS1_000028" "g.18665429C>T" "" "{PMID:Chen 2014:24505212}" "" "c.208G>A, p.G70S" "" "Germline" "yes" "" "0" "" "" "g.18647309C>T" "" "likely pathogenic" "" "0000829314" "0" "70" "X" "18662698" "18662701" "del" "0" "00000" "RS1_000045" "g.18662698_18662701del" "" "{PMID:Chen 2014:24505212}" "" "c.375_378delAGAT, p.I125fs+1X" "error in annotation, variant causes p.(Asp126*) and not p.(Ile125fs*1)" "Germline" "yes" "" "0" "" "" "g.18644578_18644581del" "" "likely pathogenic" "" "0000829315" "0" "70" "X" "18662584" "18662584" "del" "0" "00000" "RS1_000165" "g.18662584del" "" "{PMID:Chen 2014:24505212}" "" "c.489delG, p.W163fsX" "" "Germline" "yes" "" "0" "" "" "g.18644464del" "" "likely pathogenic" "" "0000829322" "3" "70" "X" "18665344" "18665344" "subst" "0" "00000" "RS1_000102" "g.18665344G>T" "" "{PMID:Gliem 2014:25054456}" "" "c.293C>A (p.Ala98Glu)" "homozygous female from consanguineous marriage of an affected father and a carrier mother" "Germline" "yes" "" "0" "" "" "g.18647224G>T" "" "likely pathogenic" "" "0000829323" "21" "70" "X" "18665344" "18665344" "subst" "0" "00000" "RS1_000102" "g.18665344G>T" "" "{PMID:Gliem 2014:25054456}" "" "c.293C>A (p.Ala98Glu)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647224G>T" "" "likely pathogenic" "" "0000829324" "21" "70" "X" "18665344" "18665344" "subst" "0" "00000" "RS1_000102" "g.18665344G>T" "" "{PMID:Gliem 2014:25054456}" "" "c.293C>A (p.Ala98Glu)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647224G>T" "" "likely pathogenic" "" "0000829325" "21" "70" "X" "18665344" "18665344" "subst" "0" "00000" "RS1_000102" "g.18665344G>T" "" "{PMID:Gliem 2014:25054456}" "" "c.293C>A (p.Ala98Glu)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647224G>T" "" "likely pathogenic" "" "0000829326" "21" "70" "X" "18665344" "18665344" "subst" "0" "00000" "RS1_000102" "g.18665344G>T" "" "{PMID:Gliem 2014:25054456}" "" "c.293C>A (p.Ala98Glu)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647224G>T" "" "likely pathogenic" "" "0000829327" "21" "70" "X" "18665430" "18665431" "del" "0" "00000" "RS1_000390" "g.18665430_18665431del" "" "{PMID:Huang 2014:25168411}" "" "c.206-207delTG in the RS1 gene (p.L69fs16X)" "" "Germline" "yes" "" "0" "" "" "g.18647310_18647311del" "" "likely pathogenic" "" "0000829328" "21" "70" "X" "18665430" "18665431" "del" "0" "00000" "RS1_000390" "g.18665430_18665431del" "" "{PMID:Huang 2014:25168411}" "" "c.206-207delTG in the RS1 gene (p.L69fs16X)" "" "Germline" "yes" "" "0" "" "" "g.18647310_18647311del" "" "likely pathogenic" "" "0000829329" "21" "70" "X" "18660210" "18660210" "subst" "0" "00000" "RS1_000071" "g.18660210G>A" "" "{PMID:Ulinska 2014:25799783}" "" "c.589C>T, p.Arg197Cys" "" "Germline" "yes" "" "0" "" "" "g.18642090G>A" "" "likely pathogenic" "" "0000829330" "21" "70" "X" "18660210" "18660210" "subst" "0" "00000" "RS1_000071" "g.18660210G>A" "" "{PMID:Ulinska 2014:25799783}" "" "c.589C>T, p.Arg197Cys" "" "Germline" "yes" "" "0" "" "" "g.18642090G>A" "" "likely pathogenic" "" "0000829331" "21" "70" "X" "18660210" "18660210" "subst" "0" "00000" "RS1_000071" "g.18660210G>A" "" "{PMID:Ulinska 2014:25799783}" "" "c.589C>T, p.Arg197Cys" "" "Germline" "yes" "" "0" "" "" "g.18642090G>A" "" "likely pathogenic" "" "0000829335" "20" "70" "X" "18665429" "18665429" "subst" "0" "00000" "RS1_000111" "g.18665429C>G" "" "{PMID:Khan 2001:11738458}" "" "X4, 208 G to C (G70R)" "" "Unknown" "?" "" "0" "" "" "g.18647309C>G" "" "likely pathogenic" "" "0000829336" "20" "70" "X" "18665351" "18665351" "subst" "0" "00000" "RS1_000003" "g.18665351A>G" "" "{PMID:Khan 2001:11738458}" "" "X4, 286 T to C (W96R)" "" "Unknown" "?" "" "0" "" "" "g.18647231A>G" "" "likely pathogenic" "" "0000829337" "20" "70" "X" "18665351" "18665351" "subst" "0" "00000" "RS1_000003" "g.18665351A>G" "" "{PMID:Khan 2001:11738458}" "" "X4, 286 T to C (W96R)" "" "Unknown" "?" "" "0" "" "" "g.18647231A>G" "" "likely pathogenic" "" "0000829338" "20" "70" "X" "18662735" "18662735" "subst" "0" "00000" "RS1_000043" "g.18662735G>A" "" "{PMID:Khan 2001:11738458}" "" "X5, 337 C to T (L113F)" "" "Unknown" "?" "" "0" "" "" "g.18644615G>A" "" "likely pathogenic" "" "0000829339" "20" "70" "X" "18660225" "18660225" "dup" "0" "00000" "RS1_000070" "g.18660225dup" "" "{PMID:Khan 2001:11738458}" "" "X6, 579insC" "" "Unknown" "?" "" "0" "" "" "g.18642105dup" "" "likely pathogenic" "" "0000829340" "20" "70" "X" "18660203" "18660203" "subst" "0" "00000" "RS1_000073" "g.18660203A>G" "" "{PMID:Khan 2001:11738458}" "" "X6, 596 T to C (I199T)" "" "Unknown" "?" "" "0" "" "" "g.18642083A>G" "" "likely pathogenic" "" "0000829341" "20" "70" "X" "18660191" "18660191" "subst" "0" "00000" "RS1_000077" "g.18660191G>A" "" "{PMID:Khan 2001:11738458}" "" "X6, 608 C to T (P203L)" "" "Unknown" "?" "" "0" "" "" "g.18642071G>A" "" "likely pathogenic" "" "0000829342" "20" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Khan 2001:11738458}" "" "X6, 637 C to T (R213W)" "" "Unknown" "?" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000829344" "20" "70" "X" "18660191" "18660191" "subst" "0" "00000" "RS1_000077" "g.18660191G>A" "" "{PMID:Akeo 2015:26356828}" "" "RS1 c.608 C>T, (P203L)" "" "Germline" "yes" "" "0" "" "" "g.18642071G>A" "" "likely pathogenic" "" "0000829345" "20" "70" "X" "18660191" "18660191" "subst" "0" "00000" "RS1_000077" "g.18660191G>A" "" "{PMID:Akeo 2015:26356828}" "" "RS1 c.608 C>T, (P203L)" "" "Germline" "yes" "" "0" "" "" "g.18642071G>A" "" "likely pathogenic" "" "0000829346" "20" "70" "X" "18662577" "18662609" "del" "0" "00000" "RS1_000347" "g.18662577_18662609del" "" "{PMID:Vazquez-Alfageme 2016:26791414}" "" "RS1 c.467_499GGACCGATGAGCGCCTGAACTGGATTTACTACA, (RTDERLNWIYY - p.R156_Y166del)" "" "Unknown" "?" "" "0" "" "" "g.18644457_18644489del" "" "likely pathogenic" "" "0000829354" "20" "70" "X" "18660209" "18660209" "subst" "5.6062E-6" "00000" "RS1_000072" "g.18660209C>T" "" "{PMID:Sadaka 2016:27246168}" "" "R197H" "no coding DNA change given: extrapolation from protein change" "Germline" "yes" "" "0" "" "" "g.18642089C>T" "" "likely pathogenic" "" "0000829355" "20" "70" "X" "18660210" "18660210" "subst" "0" "00000" "RS1_000071" "g.18660210G>A" "" "{PMID:Galantuomo 2016:27932860}" "" "c.589C>T (p.Arg197Cys)" "" "Germline" "yes" "" "0" "" "" "g.18642090G>A" "" "likely pathogenic" "" "0000829356" "20" "70" "X" "18660210" "18660210" "subst" "0" "00000" "RS1_000071" "g.18660210G>A" "" "{PMID:Galantuomo 2016:27932860}" "" "c.589C>T (p.Arg197Cys)" "" "Germline" "yes" "" "0" "" "" "g.18642090G>A" "" "likely pathogenic" "" "0000829361" "20" "70" "X" "18665349" "18665349" "subst" "0" "00000" "RS1_000147" "g.18665349C>T" "" "{PMID:Murro 2017:28235399}" "" "c.288G > A (p.Trp96Ter)" "" "Germline" "yes" "" "0" "" "" "g.18647229C>T" "" "likely pathogenic" "" "0000829362" "20" "70" "X" "18665349" "18665349" "subst" "0" "00000" "RS1_000147" "g.18665349C>T" "" "{PMID:Murro 2017:28235399}" "" "c.288G > A (p.Trp96Ter)" "" "Germline" "yes" "" "0" "" "" "g.18647229C>T" "" "likely pathogenic" "" "0000829363" "21" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Hu 2017:28272453}" "" "c.305G>A p.Arg102Gln" "" "Germline" "yes" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000829364" "21" "70" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000055" "g.18662651G>A" "" "{PMID:Hu 2017:28272453}" "" "c.421C>T p.Arg102Cys" "" "Germline" "yes" "" "0" "" "" "g.18644531G>A" "" "likely pathogenic" "" "0000829365" "21" "70" "X" "18665366" "18665366" "subst" "0" "00000" "RS1_000383" "g.18665366C>A" "" "{PMID:Hu 2017:28272453}" "" "c.271G>T p.Gly91Cys" "" "Germline" "yes" "" "0" "" "" "g.18647246C>A" "" "likely pathogenic" "" "0000829366" "21" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000376" "g.18665332C>G" "" "{PMID:Hu 2017:28272453}" "" "c.305G>C p.Arg102Pro" "" "Germline" "yes" "" "0" "" "" "g.18647212C>G" "" "likely pathogenic" "" "0000829367" "21" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Hu 2017:28272453}" "" "c.214G>A p.Glu72Lys" "" "Germline" "yes" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000829368" "21" "70" "X" "18665311" "18665311" "subst" "0" "00000" "RS1_000095" "g.18665311C>T" "" "{PMID:Hu 2017:28272453}" "" "c.326G>A p.Gly109Glu" "" "Germline" "yes" "" "0" "" "" "g.18647191C>T" "" "likely pathogenic" "" "0000829369" "21" "70" "X" "18660110" "18660110" "subst" "0" "00000" "RS1_000325" "g.18660110A>G" "" "{PMID:Hu 2017:28272453}" "" "c.675+14C>T" "error in annotation 675 is the last nucleotide of the last exon and the nucleotide in position *14 is T and not C; should probably be T>C" "Germline" "yes" "" "0" "" "" "g.18641990A>G" "" "likely pathogenic" "" "0000829370" "21" "70" "X" "18660173" "18660173" "subst" "0" "00000" "RS1_000009" "g.18660173C>T" "" "{PMID:Hu 2017:28272453}" "" "c.626G>A p.Arg209His" "" "Germline" "yes" "" "0" "" "" "g.18642053C>T" "" "likely pathogenic" "" "0000829371" "21" "70" "X" "18665443" "18665443" "subst" "0" "00000" "RS1_000394" "g.18665443T>C" "" "{PMID:Hu 2017:28272453}" "" "c.194A>G p.Tyr65Cys" "" "Germline" "yes" "" "0" "" "" "g.18647323T>C" "" "likely pathogenic" "" "0000829372" "21" "70" "X" "18660174" "18660174" "subst" "0" "00000" "RS1_000080" "g.18660174G>A" "" "{PMID:Hu 2017:28272453}" "" "c.625C>T p.Arg209Cys" "" "Germline" "yes" "" "0" "" "" "g.18642054G>A" "" "likely pathogenic" "" "0000829373" "21" "70" "X" "18660173" "18660173" "subst" "0" "00000" "RS1_000009" "g.18660173C>T" "" "{PMID:Hu 2017:28272453}" "" "c.626G>A p.Arg209His" "" "Germline" "yes" "" "0" "" "" "g.18642053C>T" "" "likely pathogenic" "" "0000829374" "21" "70" "X" "18665356" "18665358" "del" "0" "00000" "RS1_000379" "g.18665356_18665358del" "" "{PMID:Hu 2017:28272453}" "" "c.282-284del p.95del" "error in annotation, deleted residue not mentioned" "Germline" "yes" "" "0" "" "" "g.18647236_18647238del" "" "likely pathogenic" "" "0000829375" "21" "70" "X" "18665361" "18665361" "subst" "0" "00000" "RS1_000381" "g.18665361C>A" "" "{PMID:Hu 2017:28272453}" "" "c.276G>T p.Trp92Cys" "" "Germline" "yes" "" "0" "" "" "g.18647241C>A" "" "likely pathogenic" "" "0000829376" "21" "70" "X" "18665359" "18665359" "subst" "0" "00000" "RS1_000260" "g.18665359T>C" "" "{PMID:Hu 2017:28272453}" "" "c.278A>G p.Tyr93Cys" "" "Germline" "yes" "" "0" "" "" "g.18647239T>C" "" "likely pathogenic" "" "0000829377" "21" "70" "X" "18665421" "18665421" "subst" "0" "00000" "RS1_000389" "g.18665421C>A" "" "{PMID:Hu 2017:28272453}" "" "c.216G>T p.Glu72Asp" "" "Germline" "yes" "" "0" "" "" "g.18647301C>A" "" "likely pathogenic" "" "0000829378" "21" "70" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000055" "g.18662651G>A" "" "{PMID:Hu 2017:28272453}" "" "c.421C>T p.Arg141Gly" "error in annotation, p.(Arg141Gly) is caused by c.421C>G and not c.421C>T (which causes p.(Arg141Cys), also present in databases)" "Germline" "yes" "" "0" "" "" "g.18644531G>A" "" "likely pathogenic" "" "0000829379" "21" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Hu 2017:28272453}" "" "c.637C>T p.Arg213Trp" "" "Germline" "yes" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000829380" "21" "70" "X" "18660174" "18660174" "subst" "0" "00000" "RS1_000080" "g.18660174G>A" "" "{PMID:Hu 2017:28272453}" "" "c.625C>T p.Arg209Cys" "" "Germline" "yes" "" "0" "" "" "g.18642054G>A" "" "likely pathogenic" "" "0000829381" "21" "70" "X" "18660255" "18660255" "subst" "5.62066E-6" "00000" "RS1_000067" "g.18660255G>A" "" "{PMID:Hu 2017:28272453}" "" "c.544C>T p.Arg182Cys" "" "Germline" "yes" "" "0" "" "" "g.18642135G>A" "" "likely pathogenic" "" "0000829382" "21" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Hu 2017:28272453}" "" "c.305G>A p.Arg102Gln" "" "Germline" "yes" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000829383" "21" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Hu 2017:28272453}" "" "c.214G>A p.Glu72Lys" "" "Germline" "yes" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000829384" "21" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Hu 2017:28272453}" "" "c.305G>A p.Arg102Gln" "" "Germline" "yes" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000829385" "21" "70" "X" "18665416" "18665416" "subst" "0" "00000" "RS1_000031" "g.18665416C>A" "" "{PMID:Hu 2017:28272453}" "" "c.221G>T p.Gly74Val" "" "Germline" "yes" "" "0" "" "" "g.18647296C>A" "" "likely pathogenic" "" "0000829386" "21" "70" "X" "18660210" "18660210" "subst" "0" "00000" "RS1_000071" "g.18660210G>A" "" "{PMID:Hu 2017:28272453}" "" "c.589C>T p.Glu72Asp" "error in annotation, p.(Glu72Asp) is caused by c.216G>T and not c.589C>T (which causesp.(Arg197Cys), also present in databases); probably a switch with the next patient no.26, who carries c.216G>T" "Germline" "yes" "" "0" "" "" "g.18642090G>A" "" "likely pathogenic" "" "0000829387" "21" "70" "X" "18665421" "18665421" "subst" "0" "00000" "RS1_000389" "g.18665421C>A" "" "{PMID:Hu 2017:28272453}" "" "c.216G>T p.Arg209Cys" "error in annotation, p.(Arg209Cys) is caused by c.625C>T and not c.216G>T (which causes p.(Glu72Asp), erroneously written in patient 25)" "Germline" "yes" "" "0" "" "" "g.18647301C>A" "" "likely pathogenic" "" "0000829388" "21" "70" "X" "18660278" "18660278" "subst" "0" "00000" "RS1_000065" "g.18660278T>C" "" "{PMID:Hu 2017:28272453}" "" "c.523-2A>G" "" "Germline" "yes" "" "0" "" "" "g.18642158T>C" "" "likely pathogenic" "" "0000829389" "21" "70" "X" "18662654" "18662654" "subst" "0" "00000" "RS1_000052" "g.18662654C>T" "" "{PMID:Hu 2017:28272453}" "" "c.418G>A p.Gly140Arg" "" "Germline" "yes" "" "0" "" "" "g.18644534C>T" "" "likely pathogenic" "" "0000829390" "21" "70" "X" "18665419" "18665419" "del" "0" "00000" "RS1_000387" "g.18665419del" "" "{PMID:Hu 2017:28272453}" "" "c.218delC p.Ser73Ter" "" "Germline" "yes" "" "0" "" "" "g.18647299del" "" "likely pathogenic" "" "0000829640" "20" "70" "X" "18665453" "18665453" "subst" "0" "00000" "RS1_000397" "g.18665453C>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.185-1G>A, p.?" "" "Unknown" "?" "" "0" "" "" "g.18647333C>T" "" "likely pathogenic" "" "0000829642" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.214G>A, p.(Glu72Lys)" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000829643" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.214G>A, p.(Glu72Lys)" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000829644" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.214G>A, p.(Glu72Lys)" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000829645" "20" "70" "X" "18665423" "18665423" "subst" "0" "00000" "RS1_000124" "g.18665423C>G" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.214G>C, p.(Glu72Gln)" "" "Unknown" "?" "" "0" "" "" "g.18647303C>G" "" "likely pathogenic" "" "0000829646" "20" "70" "X" "18665423" "18665423" "subst" "0" "00000" "RS1_000124" "g.18665423C>G" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.214G>C, p.(Glu72Gln)" "" "Unknown" "?" "" "0" "" "" "g.18647303C>G" "" "likely pathogenic" "" "0000829647" "20" "70" "X" "18665398" "18665398" "subst" "0" "00000" "RS1_000385" "g.18665398T>G" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.239A>C, p.(Gln80Pro)" "" "Unknown" "?" "" "0" "" "" "g.18647278T>G" "" "likely pathogenic" "" "0000829648" "20" "70" "X" "18665395" "18665395" "subst" "0" "00000" "RS1_000146" "g.18665395A>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.242T>A, p.(Ile81Asn)" "" "Unknown" "?" "" "0" "" "" "g.18647275A>T" "" "likely pathogenic" "" "0000829649" "20" "70" "X" "18665361" "18665361" "subst" "0" "00000" "RS1_000091" "g.18665361C>G" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.276G>C, p.(Trp92Cys)" "" "Unknown" "?" "" "0" "" "" "g.18647241C>G" "" "likely pathogenic" "" "0000829650" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.304C>T, p.(Arg102Trp)" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000829651" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.304C>T, p.(Arg102Trp)" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000829652" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.304C>T, p.(Arg102Trp)" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000829653" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.304C>T, p.(Arg102Trp)" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000829654" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.304C>T, p.(Arg102Trp)" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000829655" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.304C>T, p.(Arg102Trp)" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000829656" "20" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.305G>A, p.(Arg102Gln)" "" "Unknown" "?" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000829657" "20" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.305G>A, p.(Arg102Gln)" "" "Unknown" "?" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000829658" "20" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.305G>A, p.(Arg102Gln)" "" "Unknown" "?" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000829659" "20" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.305G>A, p.(Arg102Gln)" "" "Unknown" "?" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000829660" "20" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.305G>A, p.(Arg102Gln)" "" "Unknown" "?" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000829661" "20" "70" "X" "18665320" "18665320" "subst" "0" "00000" "RS1_000374" "g.18665320T>G" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.317A>C, p.(Gln106Pro)" "" "Unknown" "?" "" "0" "" "" "g.18647200T>G" "" "likely pathogenic" "" "0000829662" "20" "70" "X" "18665312" "18665312" "subst" "1.68157E-5" "00000" "RS1_000006" "g.18665312C>G" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.325G>C, p.(G109R)" "" "Unknown" "?" "" "0" "" "" "g.18647192C>G" "" "likely pathogenic" "" "0000829663" "20" "70" "X" "18665312" "18665312" "subst" "0" "00000" "RS1_000104" "g.18665312C>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.325G>T, p.(G109W)" "" "Unknown" "?" "" "0" "" "" "g.18647192C>A" "" "likely pathogenic" "" "0000829664" "20" "70" "X" "18665311" "18665311" "subst" "0" "00000" "RS1_000133" "g.18665311C>G" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.326G>C, p.(Gly109Ala)" "" "Unknown" "?" "" "0" "" "" "g.18647191C>G" "" "likely pathogenic" "" "0000829665" "20" "70" "X" "18662743" "18662743" "subst" "0" "00000" "RS1_000039" "g.18662743C>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.329G>A, p.(Cys110Tyr)" "" "Unknown" "?" "" "0" "" "" "g.18644623C>T" "" "likely pathogenic" "" "0000829666" "20" "70" "X" "18662743" "18662743" "subst" "0" "00000" "RS1_000039" "g.18662743C>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.329G>A, p.(Cys110Tyr)" "" "Unknown" "?" "" "0" "" "" "g.18644623C>T" "" "likely pathogenic" "" "0000829667" "20" "70" "X" "18662735" "18662735" "subst" "0" "00000" "RS1_000043" "g.18662735G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.337C>T, p.(Leu113Phe)" "" "Unknown" "?" "" "0" "" "" "g.18644615G>A" "" "likely pathogenic" "" "0000829668" "20" "70" "X" "18662694" "18662694" "del" "0" "00000" "RS1_000365" "g.18662694del" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.378delT, p.(Leu127Ter)" "" "Unknown" "?" "" "0" "" "" "g.18644574del" "" "likely pathogenic" "" "0000829669" "20" "70" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000055" "g.18662651G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.421C>T, p.(R141C)" "" "Unknown" "?" "" "0" "" "" "g.18644531G>A" "" "likely pathogenic" "" "0000829670" "20" "70" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000055" "g.18662651G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.421C>T, p.(R141C)" "" "Unknown" "?" "" "0" "" "" "g.18644531G>A" "" "likely pathogenic" "" "0000829671" "20" "70" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000055" "g.18662651G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.421C>T, p.(R141C)" "" "Unknown" "?" "" "0" "" "" "g.18644531G>A" "" "likely pathogenic" "" "0000829672" "20" "70" "X" "18662637" "18662637" "dup" "0" "00000" "RS1_000357" "g.18662637dup" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.435dupT, p.(Glu146fs)" "" "Unknown" "?" "" "0" "" "" "g.18644517dup" "" "likely pathogenic" "" "0000829673" "20" "70" "X" "18662576" "18662576" "subst" "0" "00000" "RS1_000346" "g.18662576A>G" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.496T>C, p.(Tyr166His)" "" "Unknown" "?" "" "0" "" "" "g.18644456A>G" "" "likely pathogenic" "" "0000829674" "20" "70" "X" "18662564" "18662564" "subst" "0" "00000" "RS1_000342" "g.18662564T>G" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.508A>C, p.(Thr170Pro)" "" "Unknown" "?" "" "0" "" "" "g.18644444T>G" "" "likely pathogenic" "" "0000829675" "20" "70" "X" "18660273" "18660273" "subst" "0" "00000" "RS1_000338" "g.18660273A>G" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.526T>C, p.(Phe176Val)" "error in annotation, c.526T>C causes p.(Phe176Leu) and not p.(Phe176Val)" "Unknown" "?" "" "0" "" "" "g.18642153A>G" "" "likely pathogenic" "" "0000829676" "20" "70" "X" "18660245" "18660245" "subst" "0" "00000" "RS1_000098" "g.18660245G>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.554C>A, p.(Thr185Lys)" "" "Unknown" "?" "" "0" "" "" "g.18642125G>T" "" "likely pathogenic" "" "0000829677" "20" "70" "X" "18660245" "18660245" "subst" "0" "00000" "RS1_000098" "g.18660245G>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.554C>A, p.(Thr185Lys)" "" "Unknown" "?" "" "0" "" "" "g.18642125G>T" "" "likely pathogenic" "" "0000829678" "20" "70" "X" "18660225" "18660225" "subst" "0" "00000" "RS1_000007" "g.18660225G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.574C>T, p.(Pro192Ser)" "" "Unknown" "?" "" "0" "" "" "g.18642105G>A" "" "likely pathogenic" "" "0000829679" "20" "70" "X" "18660225" "18660225" "subst" "0" "00000" "RS1_000007" "g.18660225G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.574C>T, p.(Pro192Ser)" "" "Unknown" "?" "" "0" "" "" "g.18642105G>A" "" "likely pathogenic" "" "0000829680" "20" "70" "X" "18660225" "18660225" "subst" "0" "00000" "RS1_000007" "g.18660225G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.574C>T, p.(Pro192Ser)" "" "Unknown" "?" "" "0" "" "" "g.18642105G>A" "" "likely pathogenic" "" "0000829681" "20" "70" "X" "18660225" "18660225" "subst" "0" "00000" "RS1_000007" "g.18660225G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.574C>T, p.(Pro192Ser)" "" "Unknown" "?" "" "0" "" "" "g.18642105G>A" "" "likely pathogenic" "" "0000829682" "20" "70" "X" "18660225" "18660225" "subst" "0" "00000" "RS1_000007" "g.18660225G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.574C>T, p.(Pro192Ser)" "" "Unknown" "?" "" "0" "" "" "g.18642105G>A" "" "likely pathogenic" "" "0000829683" "20" "70" "X" "18660224" "18660224" "subst" "0" "00000" "RS1_000159" "g.18660224G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.575C>T, p.(Pro192Leu)" "" "Unknown" "?" "" "0" "" "" "g.18642104G>A" "" "likely pathogenic" "" "0000829684" "20" "70" "X" "18660225" "18660225" "dup" "0" "00000" "RS1_000070" "g.18660225dup" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.579dupC, p.(Ile194fs)" "" "Unknown" "?" "" "0" "" "" "g.18642105dup" "" "likely pathogenic" "" "0000829685" "20" "70" "X" "18660225" "18660225" "dup" "0" "00000" "RS1_000070" "g.18660225dup" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.579dupC, p.(Ile194fs)" "" "Unknown" "?" "" "0" "" "" "g.18642105dup" "" "likely pathogenic" "" "0000829686" "20" "70" "X" "18660225" "18660225" "dup" "0" "00000" "RS1_000070" "g.18660225dup" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.579dupC, p.(Ile194fs)" "" "Unknown" "?" "" "0" "" "" "g.18642105dup" "" "likely pathogenic" "" "0000829687" "20" "70" "X" "18660210" "18660210" "subst" "0" "00000" "RS1_000071" "g.18660210G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.589C>T, p.(Arg197Cys)" "" "Unknown" "?" "" "0" "" "" "g.18642090G>A" "" "likely pathogenic" "" "0000829688" "20" "70" "X" "18660203" "18660203" "subst" "0" "00000" "RS1_000073" "g.18660203A>G" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.596T>C, p.(Ile199Thr)" "" "Unknown" "?" "" "0" "" "" "g.18642083A>G" "" "likely pathogenic" "" "0000829689" "20" "70" "X" "18660201" "18660201" "subst" "0" "00000" "RS1_000074" "g.18660201G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.598C>T, p.(Arg200Cys)" "" "Unknown" "?" "" "0" "" "" "g.18642081G>A" "" "likely pathogenic" "" "0000829690" "20" "70" "X" "18660201" "18660201" "subst" "0" "00000" "RS1_000074" "g.18660201G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.598C>T, p.(Arg200Cys)" "" "Unknown" "?" "" "0" "" "" "g.18642081G>A" "" "likely pathogenic" "" "0000829691" "20" "70" "X" "18660201" "18660201" "subst" "0" "00000" "RS1_000074" "g.18660201G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.598C>T, p.(Arg200Cys)" "" "Unknown" "?" "" "0" "" "" "g.18642081G>A" "" "likely pathogenic" "" "0000829692" "20" "70" "X" "18660201" "18660201" "subst" "0" "00000" "RS1_000074" "g.18660201G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.598C>T, p.(Arg200Cys)" "" "Unknown" "?" "" "0" "" "" "g.18642081G>A" "" "likely pathogenic" "" "0000829693" "20" "70" "X" "18660200" "18660200" "subst" "0" "00000" "RS1_000075" "g.18660200C>T" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.599G>A, p.(Arg200His)" "" "Unknown" "?" "" "0" "" "" "g.18642080C>T" "" "likely pathogenic" "" "0000829694" "20" "70" "X" "18660191" "18660191" "subst" "0" "00000" "RS1_000077" "g.18660191G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.608C>T, p.(P203L)" "" "Unknown" "?" "" "0" "" "" "g.18642071G>A" "" "likely pathogenic" "" "0000829695" "20" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.637C>T, p.(Arg213Trp)" "" "Unknown" "?" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000829696" "20" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Fahim 2017:28348004}" "" "RS1 c.637C>T, p.(Arg213Trp)" "" "Unknown" "?" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000829734" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.304C>T, p.(Arg102Trp)" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000829735" "20" "70" "X" "18662614" "18662614" "subst" "0" "00000" "RS1_000352" "g.18662614A>G" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.458T>C, p.(Val153Ala)" "" "Germline" "?" "" "0" "" "" "g.18644494A>G" "" "likely pathogenic" "" "0000829736" "20" "70" "X" "18662737" "18662737" "subst" "0" "00000" "RS1_000306" "g.18662737C>G" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.335G>C, p.(Trp112Ser)" "" "Unknown" "?" "" "0" "" "" "g.18644617C>G" "" "likely pathogenic" "" "0000829737" "20" "70" "X" "18662662" "18662745" "del" "0" "00000" "RS1_000361" "g.18662662_18662745del" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.327_410del, p.(Cys110_Leu137del)" "" "Germline" "?" "" "0" "" "" "g.18644542_18644625del" "" "likely pathogenic" "" "0000829738" "20" "70" "X" "18662584" "18662584" "subst" "0" "00000" "RS1_000349" "g.18662584C>T" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.488G>A, p.(Trp163Ter)" "" "Germline" "?" "" "0" "" "" "g.18644464C>T" "" "likely pathogenic" "" "0000829739" "20" "70" "X" "18660268" "18660268" "subst" "0" "00000" "RS1_000312" "g.18660268A>C" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.531T>G, p.(Tyr177Ter)" "" "Germline" "?" "" "0" "" "" "g.18642148A>C" "" "likely pathogenic" "" "0000829740" "20" "70" "X" "18660268" "18660268" "subst" "0" "00000" "RS1_000312" "g.18660268A>C" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.531T>G, p.(Tyr177Ter)" "" "Germline" "?" "" "0" "" "" "g.18642148A>C" "" "likely pathogenic" "" "0000829741" "20" "70" "X" "18660268" "18660268" "subst" "0" "00000" "RS1_000312" "g.18660268A>C" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.531T>G, p.(Tyr177Ter)" "" "Germline" "?" "" "0" "" "" "g.18642148A>C" "" "likely pathogenic" "" "0000829742" "20" "70" "X" "18660268" "18660268" "subst" "0" "00000" "RS1_000312" "g.18660268A>C" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.531T>G, p.(Tyr177Ter)" "" "Germline" "?" "" "0" "" "" "g.18642148A>C" "" "likely pathogenic" "" "0000829743" "20" "70" "X" "18660268" "18660268" "subst" "0" "00000" "RS1_000312" "g.18660268A>C" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.531T>G, p.(Tyr177Ter)" "" "Germline" "?" "" "0" "" "" "g.18642148A>C" "" "likely pathogenic" "" "0000829744" "20" "70" "X" "18660268" "18660268" "subst" "0" "00000" "RS1_000312" "g.18660268A>C" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.531T>G, p.(Tyr177Ter)" "" "Germline" "?" "" "0" "" "" "g.18642148A>C" "" "likely pathogenic" "" "0000829745" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.214G>A, p.(Glu72Lys)" "" "Germline" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000829746" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.304C>T, p.(Arg102Trp)" "" "Germline" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000829747" "20" "70" "X" "18662611" "18662611" "subst" "0" "00000" "RS1_000351" "g.18662611T>G" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.461A>C, p.(Gln154Pro)" "" "Germline" "?" "" "0" "" "" "g.18644491T>G" "" "likely pathogenic" "" "0000829748" "20" "70" "X" "18662611" "18662611" "subst" "0" "00000" "RS1_000351" "g.18662611T>G" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.461A>C, p.(Gln154Pro)" "" "Germline" "?" "" "0" "" "" "g.18644491T>G" "" "likely pathogenic" "" "0000829749" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.304C>T, p.(Arg102Trp)" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000829750" "20" "70" "X" "18662584" "18662584" "subst" "0" "00000" "RS1_000349" "g.18662584C>T" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.488G>A, p.(Trp163Ter)" "" "Unknown" "?" "" "0" "" "" "g.18644464C>T" "" "likely pathogenic" "" "0000829751" "20" "70" "X" "18660268" "18660268" "subst" "0" "00000" "RS1_000312" "g.18660268A>C" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.531T>G, p.(Tyr177Ter)" "" "Germline" "?" "" "0" "" "" "g.18642148A>C" "" "likely pathogenic" "" "0000829752" "20" "70" "X" "18660268" "18660268" "subst" "0" "00000" "RS1_000312" "g.18660268A>C" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.531T>G, p.(Tyr177Ter)" "" "Germline" "?" "" "0" "" "" "g.18642148A>C" "" "likely pathogenic" "" "0000829753" "20" "70" "X" "18660173" "18660173" "subst" "0" "00000" "RS1_000009" "g.18660173C>T" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.626G>A, p.(Arg209His)" "" "Unknown" "?" "" "0" "" "" "g.18642053C>T" "" "likely pathogenic" "" "0000829754" "20" "70" "X" "18660268" "18660268" "subst" "0" "00000" "RS1_000312" "g.18660268A>C" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.531T>G, p.(Tyr177Ter)" "" "Unknown" "?" "" "0" "" "" "g.18642148A>C" "" "likely pathogenic" "" "0000829755" "20" "70" "X" "18660268" "18660268" "subst" "0" "00000" "RS1_000312" "g.18660268A>C" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.531T>G, p.(Tyr177Ter)" "" "Germline" "?" "" "0" "" "" "g.18642148A>C" "" "likely pathogenic" "" "0000829756" "20" "70" "X" "18660268" "18660268" "subst" "0" "00000" "RS1_000312" "g.18660268A>C" "" "{PMID:Wang 2015:25999676}" "" "RS1 c.531T>G, p.(Tyr177Ter)" "" "Germline" "?" "" "0" "" "" "g.18642148A>C" "" "likely pathogenic" "" "0000829800" "20" "70" "X" "18662656" "18662656" "del" "0" "00000" "RS1_000051" "g.18662656del" "" "{PMID:Dockery 2017:29099798}" "" "RS1 c.416delA, p.Gln139fs" "only novel variants described in detail in the paper; original cohort contained over 750 patients from over 520 pedigrees," "Germline" "yes" "" "0" "" "" "g.18644536del" "" "likely pathogenic" "" "0000829801" "20" "70" "X" "18665310" "18665310" "subst" "0" "00000" "RS1_000038" "g.18665310C>T" "" "{PMID:Dockery 2017:29099798}" "" "RS1 c.326+1G>A, p.?" "only novel variants described in detail in the paper; original cohort contained over 750 patients from over 520 pedigrees," "Germline" "yes" "" "0" "" "" "g.18647190C>T" "" "likely pathogenic" "" "0000830086" "20" "70" "X" "18665450" "18665450" "subst" "0" "00000" "RS1_000395" "g.18665450A>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.187T>A, p.(Cys63Ser)" "" "Unknown" "?" "" "0" "" "" "g.18647330A>T" "" "likely pathogenic" "" "0000830087" "20" "70" "X" "18665431" "18665431" "subst" "0" "00000" "RS1_000391" "g.18665431A>C" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.206T>G, p.(Leu69Arg)" "" "Unknown" "?" "" "0" "" "" "g.18647311A>C" "" "likely pathogenic" "" "0000830088" "20" "70" "X" "18665431" "18665431" "subst" "0" "00000" "RS1_000391" "g.18665431A>C" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.206T>G, p.(Leu69Arg)" "" "Unknown" "?" "" "0" "" "" "g.18647311A>C" "" "likely pathogenic" "" "0000830089" "20" "70" "X" "18665431" "18665431" "subst" "0" "00000" "RS1_000391" "g.18665431A>C" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.206T>G, p.(Leu69Arg)" "" "Unknown" "?" "" "0" "" "" "g.18647311A>C" "" "likely pathogenic" "" "0000830090" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.214G>A, p.(Glu72Lys)" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830091" "20" "70" "X" "18665419" "18665419" "subst" "0" "00000" "RS1_000319" "g.18665419G>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.218C>A, p.(Ser73*)" "" "Unknown" "?" "" "0" "" "" "g.18647299G>T" "" "likely pathogenic" "" "0000830092" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.214G>A, p.(Glu72Lys)" "error in annotation, c.214G>A causes p.Glu72Lys and not p.Glu75Lys" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830093" "20" "70" "X" "18665361" "18665361" "subst" "0" "00000" "RS1_000382" "g.18665361C>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.276G>A, p.(Trp92*)" "" "Unknown" "?" "" "0" "" "" "g.18647241C>T" "" "likely pathogenic" "" "0000830094" "20" "70" "X" "18665361" "18665361" "subst" "0" "00000" "RS1_000382" "g.18665361C>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.276G>A, p.(Trp92*)" "" "Unknown" "?" "" "0" "" "" "g.18647241C>T" "" "likely pathogenic" "" "0000830095" "20" "70" "X" "18665349" "18665349" "subst" "0" "00000" "RS1_000147" "g.18665349C>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.288G>A, p.(Trp96*)" "" "Unknown" "?" "" "0" "" "" "g.18647229C>T" "" "likely pathogenic" "" "0000830096" "20" "70" "X" "18665349" "18665349" "subst" "0" "00000" "RS1_000147" "g.18665349C>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.288G>A, p.(Trp96*)" "" "Unknown" "?" "" "0" "" "" "g.18647229C>T" "" "likely pathogenic" "" "0000830097" "20" "70" "X" "18665312" "18665312" "subst" "1.68157E-5" "00000" "RS1_000006" "g.18665312C>G" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.325G>C, p.(Gly109Arg)" "" "Unknown" "?" "" "0" "" "" "g.18647192C>G" "" "likely pathogenic" "" "0000830098" "20" "70" "X" "18665312" "18665312" "subst" "1.68157E-5" "00000" "RS1_000006" "g.18665312C>G" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.325G>C, p.(Gly109Arg)" "" "Unknown" "?" "" "0" "" "" "g.18647192C>G" "" "likely pathogenic" "" "0000830099" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.304C>T, p.(Arg102Trp)" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000830100" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.304C>T, p.(Arg102Trp)" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000830101" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.304C>T, p.(Arg102Trp)" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000830102" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.304C>T, p.(Arg102Trp)" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000830103" "20" "70" "X" "18665312" "18665312" "subst" "1.68157E-5" "00000" "RS1_000006" "g.18665312C>G" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.325G>C, p.(Gly109Arg)" "" "Unknown" "?" "" "0" "" "" "g.18647192C>G" "" "likely pathogenic" "" "0000830108" "20" "70" "X" "18662736" "18662736" "subst" "0" "00000" "RS1_000316" "g.18662736C>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.336G>A, p.(Trp112*)" "" "Unknown" "?" "" "0" "" "" "g.18644616C>T" "" "likely pathogenic" "" "0000830109" "20" "70" "X" "18662698" "18662698" "subst" "0" "00000" "RS1_000202" "g.18662698A>C" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.374T>G, p.(Ile125Arg)" "" "Unknown" "?" "" "0" "" "" "g.18644578A>C" "" "likely pathogenic" "" "0000830110" "20" "70" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000055" "g.18662651G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.421C>T, p.(Arg141Cys)" "" "Unknown" "?" "" "0" "" "" "g.18644531G>A" "" "likely pathogenic" "" "0000830111" "20" "70" "X" "18662650" "18662650" "subst" "0" "00000" "RS1_000056" "g.18662650C>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.422G>A, p.(Arg141His)" "" "Unknown" "?" "" "0" "" "" "g.18644530C>T" "" "likely pathogenic" "" "0000830112" "20" "70" "X" "18662650" "18662650" "subst" "0" "00000" "RS1_000056" "g.18662650C>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.422G>A, p.(Arg141His)" "" "Unknown" "?" "" "0" "" "" "g.18644530C>T" "" "likely pathogenic" "" "0000830113" "20" "70" "X" "18662614" "18662614" "del" "0" "00000" "RS1_000353" "g.18662614del" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.458del, p.(Val153Glyfs*9)" "" "Unknown" "?" "" "0" "" "" "g.18644494del" "" "likely pathogenic" "" "0000830114" "20" "70" "X" "18662648" "18662648" "subst" "0" "00000" "CDKL5_000164" "g.18662648A>G" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.424C>T, p.(Cys142Arg)" "error in annotation, p.Cys142Arg is caused by c.424T>C and not c.424C>T (variant reference (C) does not agree with reference sequence (T))" "Unknown" "?" "" "0" "" "" "g.18644528A>G" "" "likely pathogenic" "" "0000830115" "20" "70" "X" "18662611" "18662611" "subst" "0" "00000" "RS1_000125" "g.18662611T>C" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.461A>G, p.(Gln154Arg)" "" "Unknown" "?" "" "0" "" "" "g.18644491T>C" "" "likely pathogenic" "" "0000830116" "20" "70" "X" "18660264" "18660264" "subst" "0" "00000" "RS1_000192" "g.18660264T>C" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.535A>G, p.(Asn179Asp)" "" "Unknown" "?" "" "0" "" "" "g.18642144T>C" "" "likely pathogenic" "" "0000830118" "20" "70" "X" "18660222" "18660222" "subst" "0" "00000" "RS1_000106" "g.18660222G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.577C>T, p.(Pro193Ser)" "" "Unknown" "?" "" "0" "" "" "g.18642102G>A" "" "likely pathogenic" "" "0000830119" "20" "70" "X" "18660222" "18660222" "subst" "0" "00000" "RS1_000106" "g.18660222G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.577C>T, p.(Pro193Ser)" "" "Unknown" "?" "" "0" "" "" "g.18642102G>A" "" "likely pathogenic" "" "0000830120" "20" "70" "X" "18660218" "18660218" "subst" "0" "00000" "RS1_000334" "g.18660218A>C" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.581T>G, p.(Ile194Ser)" "" "Unknown" "?" "" "0" "" "" "g.18642098A>C" "" "likely pathogenic" "" "0000830121" "20" "70" "X" "18660209" "18660209" "subst" "5.6062E-6" "00000" "RS1_000072" "g.18660209C>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.590G>A, p.(Arg197His)" "" "Unknown" "?" "" "0" "" "" "g.18642089C>T" "" "likely pathogenic" "" "0000830122" "20" "70" "X" "18660209" "18660209" "subst" "5.6062E-6" "00000" "RS1_000072" "g.18660209C>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.590G>A, p.(Arg197His)" "" "Unknown" "?" "" "0" "" "" "g.18642089C>T" "" "likely pathogenic" "" "0000830123" "20" "70" "X" "18660210" "18660210" "subst" "0" "00000" "RS1_000071" "g.18660210G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.589C>T, p.(Arg197Cys)" "" "Unknown" "?" "" "0" "" "" "g.18642090G>A" "" "likely pathogenic" "" "0000830124" "20" "70" "X" "18660210" "18660210" "subst" "0" "00000" "RS1_000071" "g.18660210G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.589C>T, p.(Arg197Cys)" "" "Unknown" "?" "" "0" "" "" "g.18642090G>A" "" "likely pathogenic" "" "0000830125" "20" "70" "X" "18660201" "18660201" "subst" "0" "00000" "RS1_000074" "g.18660201G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.598C>T, p.(Arg200Cys)" "" "Unknown" "?" "" "0" "" "" "g.18642081G>A" "" "likely pathogenic" "" "0000830126" "20" "70" "X" "18660191" "18660191" "subst" "0" "00000" "RS1_000077" "g.18660191G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.608C>T, p.(Pro203Leu)" "" "Unknown" "?" "" "0" "" "" "g.18642071G>A" "" "likely pathogenic" "" "0000830127" "20" "70" "X" "18660191" "18660191" "subst" "0" "00000" "RS1_000077" "g.18660191G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.608C>T, p.(Pro203Leu)" "" "Unknown" "?" "" "0" "" "" "g.18642071G>A" "" "likely pathogenic" "" "0000830128" "20" "70" "X" "18660191" "18660191" "subst" "0" "00000" "RS1_000077" "g.18660191G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.608C>T, p.(Pro203Leu)" "" "Unknown" "?" "" "0" "" "" "g.18642071G>A" "" "likely pathogenic" "" "0000830129" "20" "70" "X" "18660174" "18660174" "subst" "0" "00000" "RS1_000080" "g.18660174G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.625C>T, p.(Arg209Cys)" "" "Unknown" "?" "" "0" "" "" "g.18642054G>A" "" "likely pathogenic" "" "0000830130" "20" "70" "X" "18660167" "18660167" "subst" "0" "00000" "RS1_000329" "g.18660167G>T" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.632C>A, p.(Ala211Asp)" "" "Unknown" "?" "" "0" "" "" "g.18642047G>T" "" "likely pathogenic" "" "0000830131" "20" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.637C>T, p.(Arg213Trp)" "" "Unknown" "?" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000830132" "20" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.637C>T, p.(Arg213Trp)" "" "Unknown" "?" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000830133" "20" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Ores 2018:29739629}" "" "RS1 c.637C>T, p.(Arg213Trp)" "" "Unknown" "?" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000830155" "20" "70" "X" "18660164" "18660164" "subst" "0" "00000" "RS1_000328" "g.18660164A>T" "" "{PMID:Piermarocchi 2017:28811895}" "" "RS1 c.635A>T, p.(lle212Asn)" "error in annotation, p.(lle212Asn) is caused by c.635T>A and not c.635A>T (variant reference (A) does not agree with reference sequence (T))" "Germline" "yes" "" "0" "" "" "g.18642044A>T" "" "likely pathogenic" "" "0000830156" "20" "70" "X" "18660164" "18660164" "subst" "0" "00000" "RS1_000328" "g.18660164A>T" "" "{PMID:Piermarocchi 2017:28811895}" "" "RS1 c.635A>T, p.(lle212Asn)" "error in annotation, p.(lle212Asn) is caused by c.635T>A and not c.635A>T (variant reference (A) does not agree with reference sequence (T))" "Germline" "yes" "" "0" "" "" "g.18642044A>T" "" "likely pathogenic" "" "0000830157" "20" "70" "X" "18665351" "18665351" "subst" "0" "00000" "RS1_000003" "g.18665351A>G" "" "{PMID:Abalem 2018:29902095}" "" "c.286T>C (p.W96R)" "" "Unknown" "?" "" "0" "" "" "g.18647231A>G" "" "likely pathogenic" "" "0000830159" "20" "70" "X" "18665429" "18665429" "subst" "0" "00000" "RS1_000028" "g.18665429C>T" "" "{PMID:Abalem 2018:29902095}" "" "c. 208 G>A (p.G70S)" "" "Unknown" "?" "" "0" "" "" "g.18647309C>T" "" "likely pathogenic" "" "0000830160" "20" "70" "X" "18662710" "18662710" "del" "0" "00000" "RS1_000368" "g.18662710del" "" "{PMID:Lee 2019:30215241}" "" "c.362delA (p.Gln121ArgfsTer5)" "" "Germline" "yes" "" "0" "" "" "g.18644590del" "" "likely pathogenic" "" "0000830161" "20" "70" "X" "18662710" "18662710" "del" "0" "00000" "RS1_000368" "g.18662710del" "" "{PMID:Lee 2019:30215241}" "" "c.362delA (p.Gln121ArgfsTer5)" "" "Germline" "yes" "" "0" "" "" "g.18644590del" "" "likely pathogenic" "" "0000830162" "20" "90" "X" "18662659" "18662659" "subst" "0" "00000" "RS1_000274" "g.18662659G>T" "" "{PMID:Stephenson 2018:30419843}" "" "RS1 c.413C>A , p.(Thr138Asn)" "" "Germline" "yes" "" "0" "" "" "g.18644539G>T" "" "pathogenic" "" "0000830163" "20" "90" "X" "18662659" "18662659" "subst" "0" "00000" "RS1_000274" "g.18662659G>T" "" "{PMID:Stephenson 2018:30419843}" "" "RS1 c.413C>A , p.(Thr138Asn)" "" "Germline" "yes" "" "0" "" "" "g.18644539G>T" "" "pathogenic" "" "0000830164" "20" "90" "X" "18662659" "18662659" "subst" "0" "00000" "RS1_000274" "g.18662659G>T" "" "{PMID:Stephenson 2018:30419843}" "" "RS1 c.413C>A , p.(Thr138Asn)" "" "Germline" "yes" "" "0" "" "" "g.18644539G>T" "" "pathogenic" "" "0000830165" "20" "90" "X" "18662659" "18662659" "subst" "0" "00000" "RS1_000274" "g.18662659G>T" "" "{PMID:Stephenson 2018:30419843}" "" "RS1 c.413C>A , p.(Thr138Asn)" "" "Germline" "yes" "" "0" "" "" "g.18644539G>T" "" "pathogenic" "" "0000830166" "20" "90" "X" "18662659" "18662659" "subst" "0" "00000" "RS1_000274" "g.18662659G>T" "" "{PMID:Stephenson 2018:30419843}" "" "RS1 c.413C>A , p.(Thr138Asn)" "" "Germline" "yes" "" "0" "" "" "g.18644539G>T" "" "pathogenic" "" "0000830167" "20" "90" "X" "18662659" "18662659" "subst" "0" "00000" "RS1_000274" "g.18662659G>T" "" "{PMID:Stephenson 2018:30419843}" "" "RS1 c.413C>A , p.(Thr138Asn)" "" "Germline" "yes" "" "0" "" "" "g.18644539G>T" "" "pathogenic" "" "0000830168" "20" "90" "X" "18662659" "18662659" "subst" "0" "00000" "RS1_000274" "g.18662659G>T" "" "{PMID:Stephenson 2018:30419843}" "" "RS1 c.413C>A , p.(Thr138Asn)" "" "Germline" "yes" "" "0" "" "" "g.18644539G>T" "" "pathogenic" "" "0000830169" "20" "90" "X" "18662659" "18662659" "subst" "0" "00000" "RS1_000274" "g.18662659G>T" "" "{PMID:Stephenson 2018:30419843}" "" "RS1 c.413C>A , p.(Thr138Asn)" "" "Germline" "yes" "" "0" "" "" "g.18644539G>T" "" "pathogenic" "" "0000830170" "20" "90" "X" "18662659" "18662659" "subst" "0" "00000" "RS1_000274" "g.18662659G>T" "" "{PMID:Stephenson 2018:30419843}" "" "RS1 c.413C>A , p.(Thr138Asn)" "" "Germline" "yes" "" "0" "" "" "g.18644539G>T" "" "pathogenic" "" "0000830171" "21" "90" "X" "18660200" "18660200" "subst" "0" "00000" "RS1_000212" "g.18660200C>A" "" "{PMID:Strupaite 2018:30450322}" "" "RS1 c.599G>T, (p.R200L)" "" "Germline" "yes" "" "0" "" "" "g.18642080C>A" "" "pathogenic" "" "0000830173" "21" "90" "X" "18662650" "18662650" "subst" "0" "00000" "RS1_000056" "g.18662650C>T" "" "{PMID:Strupaite 2018:30450322}" "" "RS1 c.422G>A, (p.R141H)" "" "Germline" "yes" "" "0" "" "" "g.18644530C>T" "" "pathogenic" "" "0000830196" "20" "70" "X" "18665434" "18665434" "subst" "0" "00000" "RS1_000392" "g.18665434G>C" "" "{PMID:Pennesi 2018:30551202}" "" "c.203C>G, pPro68Arg" "" "Unknown" "?" "" "0" "" "" "g.18647314G>C" "" "likely pathogenic" "" "0000830197" "20" "70" "X" "18665429" "18665429" "subst" "0" "00000" "RS1_000028" "g.18665429C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.208G>A, p.Gly70Ser" "" "Unknown" "?" "" "0" "" "" "g.18647309C>T" "" "likely pathogenic" "" "0000830198" "20" "70" "X" "18665429" "18665429" "subst" "0" "00000" "RS1_000028" "g.18665429C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.208G>A, p.Gly70Ser" "" "Unknown" "?" "" "0" "" "" "g.18647309C>T" "" "likely pathogenic" "" "0000830199" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.214G>A, p.Glu72Lys" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830200" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.214G>A, p.Glu72Lys" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830201" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.214G>A, p.Glu72Lys" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830202" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.214G>A, p.Glu72Lys" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830203" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.214G>A, p.Glu72Lys" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830204" "20" "70" "X" "18665371" "18665371" "subst" "0" "00000" "RS1_000033" "g.18665371T>C" "" "{PMID:Pennesi 2018:30551202}" "" "c.266A>G, p.Tyr89Cys" "" "Unknown" "?" "" "0" "" "" "g.18647251T>C" "" "likely pathogenic" "" "0000830205" "20" "70" "X" "18665359" "18665359" "subst" "0" "00000" "RS1_000380" "g.18665359T>G" "" "{PMID:Pennesi 2018:30551202}" "" "c.278A>C, p.Tyr93Cys" "error in annotation: c.278A>C causes p.Tyr93Ser and not p.Tyr93Cys" "Unknown" "?" "" "0" "" "" "g.18647239T>G" "" "likely pathogenic" "" "0000830206" "20" "70" "X" "18665359" "18665359" "subst" "0" "00000" "RS1_000380" "g.18665359T>G" "" "{PMID:Pennesi 2018:30551202}" "" "c.278A>C, p.Tyr93Cys" "error in annotation: c.278A>C causes p.Tyr93Ser and not p.Tyr93Cys" "Unknown" "?" "" "0" "" "" "g.18647239T>G" "" "likely pathogenic" "" "0000830207" "20" "70" "X" "18665351" "18665351" "subst" "0" "00000" "RS1_000003" "g.18665351A>G" "" "{PMID:Pennesi 2018:30551202}" "" "c.286T>C, p.Tryp96Arg" "" "Unknown" "?" "" "0" "" "" "g.18647231A>G" "" "likely pathogenic" "" "0000830208" "20" "70" "X" "18665351" "18665351" "subst" "0" "00000" "RS1_000003" "g.18665351A>G" "" "{PMID:Pennesi 2018:30551202}" "" "c.286T>C, p.Tryp96Arg" "" "Unknown" "?" "" "0" "" "" "g.18647231A>G" "" "likely pathogenic" "" "0000830211" "20" "70" "X" "18665417" "18665417" "dup" "0" "00000" "RS1_000386" "g.18665417dup" "" "{PMID:Pennesi 2018:30551202}" "" "c.223dupG, p.Glu75Gly*85" "error in annotation: c.223dupG, p.Glu75Glyfs* causes termination codon to appear after 11 and not 85 amino acids" "Unknown" "?" "" "0" "" "" "g.18647297dup" "" "likely pathogenic" "" "0000830212" "20" "70" "X" "18662553" "18662553" "del" "0" "00000" "RS1_000191" "g.18662553del" "" "{PMID:Pennesi 2018:30551202}" "" "c.520delC, p.Arg174Gly" "error in annotation: c.520delC causes p.Arg174Glyfs*63 and not p.Arg174Gly" "Unknown" "?" "" "0" "" "" "g.18644433del" "" "likely pathogenic" "" "0000830213" "20" "70" "X" "18665351" "18665351" "subst" "0" "00000" "RS1_000003" "g.18665351A>G" "" "{PMID:Pennesi 2018:30551202}" "" "c.286T>C, p.Tryp96Arg" "" "Unknown" "?" "" "0" "" "" "g.18647231A>G" "" "likely pathogenic" "" "0000830214" "20" "70" "X" "18665351" "18665351" "subst" "0" "00000" "RS1_000003" "g.18665351A>G" "" "{PMID:Pennesi 2018:30551202}" "" "c.286T>C, p.Tryp96Arg" "" "Unknown" "?" "" "0" "" "" "g.18647231A>G" "" "likely pathogenic" "" "0000830215" "20" "70" "X" "18665351" "18665351" "subst" "0" "00000" "RS1_000003" "g.18665351A>G" "" "{PMID:Pennesi 2018:30551202}" "" "c.286T>C, p.Tryp96Arg" "" "Unknown" "?" "" "0" "" "" "g.18647231A>G" "" "likely pathogenic" "" "0000830216" "20" "70" "X" "18665351" "18665351" "subst" "0" "00000" "RS1_000003" "g.18665351A>G" "" "{PMID:Pennesi 2018:30551202}" "" "c.286T>C, p.Tryp96Arg" "" "Unknown" "?" "" "0" "" "" "g.18647231A>G" "" "likely pathogenic" "" "0000830217" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Pennesi 2018:30551202}" "" "c.304C>T, p.Arg102Trp" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000830218" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Pennesi 2018:30551202}" "" "c.304C>T, p.Arg102Trp" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000830219" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Pennesi 2018:30551202}" "" "c.304C>T, p.Arg102Trp" "" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000830220" "20" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.305G>A, p.Arg102Gln" "" "Unknown" "?" "" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000830221" "20" "70" "X" "18665312" "18665312" "subst" "1.68157E-5" "00000" "RS1_000006" "g.18665312C>G" "" "{PMID:Pennesi 2018:30551202}" "" "p.325G>C, p.Gly109Arg" "error in annotation \"\"p.\"\" instead of \"\"c\"\"" "Unknown" "?" "" "0" "" "" "g.18647192C>G" "" "likely pathogenic" "" "0000830222" "20" "70" "X" "18665312" "18665312" "subst" "1.68157E-5" "00000" "RS1_000006" "g.18665312C>G" "" "{PMID:Pennesi 2018:30551202}" "" "p.325G>C, p.Gly109Arg" "error in annotation \"\"p.\"\" instead of \"\"c\"\"" "Unknown" "?" "" "0" "" "" "g.18647192C>G" "" "likely pathogenic" "" "0000830223" "20" "70" "X" "18662743" "18662743" "subst" "0" "00000" "RS1_000039" "g.18662743C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.329G>A, p.Cys110Tyr" "" "Unknown" "?" "" "0" "" "" "g.18644623C>T" "" "likely pathogenic" "" "0000830224" "20" "70" "X" "18662743" "18662743" "subst" "0" "00000" "RS1_000039" "g.18662743C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.329G>A, p.Cys110Tyr" "" "Unknown" "?" "" "0" "" "" "g.18644623C>T" "" "likely pathogenic" "" "0000830225" "20" "70" "X" "18662743" "18662743" "subst" "0" "00000" "RS1_000039" "g.18662743C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.329G>As, p.Cys110Tyr" "" "Unknown" "?" "" "0" "" "" "g.18644623C>T" "" "likely pathogenic" "" "0000830226" "20" "70" "X" "18660264" "18660264" "subst" "0" "00000" "RS1_000192" "g.18660264T>C" "" "{PMID:Pennesi 2018:30551202}" "" "c.535A>G, p.Asn179Asp" "" "Unknown" "?" "" "0" "" "" "g.18642144T>C" "" "likely pathogenic" "" "0000830227" "20" "70" "X" "18660225" "18660225" "subst" "0" "00000" "RS1_000007" "g.18660225G>A" "" "{PMID:Pennesi 2018:30551202}" "" "c.574C>T, p.Pro192Ser" "" "Unknown" "?" "" "0" "" "" "g.18642105G>A" "" "likely pathogenic" "" "0000830228" "20" "70" "X" "18660225" "18660225" "dup" "0" "00000" "RS1_000070" "g.18660225dup" "" "{PMID:Pennesi 2018:30551202}" "" "579DupC, p.Ile194His" "error in annotation both in cDNA (no \"\"c.\"\" and protein change should be p.Ile194Hisfs*70 and not p.Ile194His" "Unknown" "?" "" "0" "" "" "g.18642105dup" "" "likely pathogenic" "" "0000830232" "20" "70" "X" "18660225" "18660225" "subst" "0" "00000" "RS1_000007" "g.18660225G>A" "" "{PMID:Pennesi 2018:30551202}" "" "c.574C>T, p.Pro192Ser" "" "Unknown" "?" "" "0" "" "" "g.18642105G>A" "" "likely pathogenic" "" "0000830233" "20" "70" "X" "18660225" "18660225" "subst" "0" "00000" "RS1_000007" "g.18660225G>A" "" "{PMID:Pennesi 2018:30551202}" "" "c.574C>T, p.Pro192Ser" "" "Unknown" "?" "" "0" "" "" "g.18642105G>A" "" "likely pathogenic" "" "0000830234" "20" "70" "X" "18660225" "18660225" "subst" "0" "00000" "RS1_000007" "g.18660225G>A" "" "{PMID:Pennesi 2018:30551202}" "" "c.574C>T, p.Pro192Ser" "" "Unknown" "?" "" "0" "" "" "g.18642105G>A" "" "likely pathogenic" "" "0000830235" "20" "70" "X" "18660203" "18660203" "subst" "0" "00000" "RS1_000073" "g.18660203A>G" "" "{PMID:Pennesi 2018:30551202}" "" "c.596T>C, pIle199Thr" "" "Unknown" "?" "" "0" "" "" "g.18642083A>G" "" "likely pathogenic" "" "0000830236" "20" "70" "X" "18660203" "18660203" "subst" "0" "00000" "RS1_000073" "g.18660203A>G" "" "{PMID:Pennesi 2018:30551202}" "" "c.596T>C, pIle199Thr" "" "Unknown" "?" "" "0" "" "" "g.18642083A>G" "" "likely pathogenic" "" "0000830237" "20" "70" "X" "18660201" "18660201" "subst" "0" "00000" "RS1_000074" "g.18660201G>A" "" "{PMID:Pennesi 2018:30551202}" "" "c.598C>T, p.Arg200Cys" "" "Unknown" "?" "" "0" "" "" "g.18642081G>A" "" "likely pathogenic" "" "0000830238" "20" "70" "X" "18660200" "18660200" "subst" "0" "00000" "RS1_000075" "g.18660200C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.599G>A, p.Arg200His" "" "Unknown" "?" "" "0" "" "" "g.18642080C>T" "" "likely pathogenic" "" "0000830239" "20" "70" "X" "18660200" "18660200" "subst" "0" "00000" "RS1_000075" "g.18660200C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.599G>A, p.Arg200His" "" "Unknown" "?" "" "0" "" "" "g.18642080C>T" "" "likely pathogenic" "" "0000830240" "20" "70" "X" "18660200" "18660200" "subst" "0" "00000" "RS1_000075" "g.18660200C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.599G>A, p.Arg200His" "" "Unknown" "?" "" "0" "" "" "g.18642080C>T" "" "likely pathogenic" "" "0000830241" "20" "70" "X" "18660200" "18660200" "subst" "0" "00000" "RS1_000075" "g.18660200C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.599G>A, p.Arg200His" "" "Unknown" "?" "" "0" "" "" "g.18642080C>T" "" "likely pathogenic" "" "0000830242" "20" "70" "X" "18660200" "18660200" "subst" "0" "00000" "RS1_000075" "g.18660200C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.599G>A, p.Arg200His" "" "Unknown" "?" "" "0" "" "" "g.18642080C>T" "" "likely pathogenic" "" "0000830243" "20" "70" "X" "18660173" "18660173" "subst" "0" "00000" "RS1_000310" "g.18660173C>G" "" "{PMID:Pennesi 2018:30551202}" "" "c.626G>C, p.Arg209Pro" "" "Unknown" "?" "" "0" "" "" "g.18642053C>G" "" "likely pathogenic" "" "0000830244" "20" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Pennesi 2018:30551202}" "" "c.637C>T, p.Arg213Trp" "" "Unknown" "?" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000830245" "20" "70" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "" "{PMID:Pennesi 2018:30551202}" "" "c.637C>T, p.Arg213Trp" "" "Unknown" "?" "" "0" "" "" "g.18642042G>A" "" "likely pathogenic" "" "0000830248" "20" "70" "X" "18662549" "18662549" "subst" "0" "00000" "RS1_000148" "g.18662549C>T" "" "{PMID:Pennesi 2018:30551202}" "" "c.522+1G>A" "" "Unknown" "?" "" "0" "" "" "g.18644429C>T" "" "likely pathogenic" "" "0000830249" "20" "70" "X" "18660277" "18660277" "subst" "0" "00000" "RS1_000339" "g.18660277C>G" "" "{PMID:Pennesi 2018:30551202}" "" "c.523-1G>C" "" "Unknown" "?" "" "0" "" "" "g.18642157C>G" "" "likely pathogenic" "" "0000830250" "20" "70" "X" "18662696" "18662696" "subst" "0" "00000" "RS1_000199" "g.18662696C>G" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.376G>C, D126H" "" "Unknown" "?" "" "0" "" "" "g.18644576C>G" "" "likely pathogenic" "" "0000830251" "20" "70" "X" "18660218" "18660220" "dup" "0" "00000" "RS1_000206" "g.18660218_18660220dup" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.583_585dupATC, I195dup" "" "Unknown" "?" "" "0" "" "" "g.18642098_18642100dup" "" "likely pathogenic" "" "0000830252" "20" "70" "X" "18662640" "18662687" "dup" "0" "00000" "RS1_000200" "g.18662640_18662687dup" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.387_434dup48, Q129_I144dup" "" "Unknown" "?" "" "0" "" "" "g.18644520_18644567dup" "" "likely pathogenic" "" "0000830253" "20" "70" "X" "18662640" "18662687" "dup" "0" "00000" "RS1_000200" "g.18662640_18662687dup" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.387_434dup48, Q129_I144dup" "" "Unknown" "?" "" "0" "" "" "g.18644520_18644567dup" "" "likely pathogenic" "" "0000830254" "20" "70" "X" "18660225" "18660225" "del" "0" "00000" "RS1_000205" "g.18660225del" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.579delC, I194Sfs*43" "" "Unknown" "?" "" "0" "" "" "g.18642105del" "" "likely pathogenic" "" "0000830255" "20" "70" "X" "18662698" "18662698" "subst" "0" "00000" "RS1_000202" "g.18662698A>C" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.374T>G, I125R" "" "Unknown" "?" "" "0" "" "" "g.18644578A>C" "" "likely pathogenic" "" "0000830256" "20" "70" "X" "18660209" "18660209" "subst" "5.6062E-6" "00000" "RS1_000072" "g.18660209C>T" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.590G>A , R197H" "" "Unknown" "?" "" "0" "" "" "g.18642089C>T" "" "likely pathogenic" "" "0000830257" "20" "70" "X" "18665351" "18665351" "subst" "0" "00000" "RS1_000003" "g.18665351A>G" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.286T>C, W96R" "" "Unknown" "?" "" "0" "" "" "g.18647231A>G" "" "likely pathogenic" "" "0000830258" "20" "70" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000055" "g.18662651G>A" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.421C>T, R141C" "" "Unknown" "?" "" "0" "" "" "g.18644531G>A" "" "likely pathogenic" "" "0000830259" "20" "70" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000055" "g.18662651G>A" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.421C>T, R141C" "" "Unknown" "?" "" "0" "" "" "g.18644531G>A" "" "likely pathogenic" "" "0000830260" "20" "70" "X" "18660136" "18660136" "dup" "0" "00000" "RS1_000204" "g.18660136dup" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.663dupC, K222Qfs*42" "" "Unknown" "?" "" "0" "" "" "g.18642016dup" "" "likely pathogenic" "" "0000830261" "20" "70" "X" "18660255" "18660255" "subst" "5.62066E-6" "00000" "RS1_000067" "g.18660255G>A" "" "{PMID:Sudha 2018:29851975}" "" "RS1 C.544C>T, R182C" "" "Unknown" "?" "" "0" "" "" "g.18642135G>A" "" "likely pathogenic" "" "0000830262" "20" "70" "X" "18662650" "18662650" "subst" "0" "00000" "RS1_000056" "g.18662650C>T" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.422G>A, R141H" "" "Unknown" "?" "" "0" "" "" "g.18644530C>T" "" "likely pathogenic" "" "0000830263" "20" "70" "X" "18662650" "18662650" "subst" "0" "00000" "RS1_000056" "g.18662650C>T" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.422G>A, R141H" "" "Unknown" "?" "" "0" "" "" "g.18644530C>T" "" "likely pathogenic" "" "0000830264" "20" "70" "X" "18662650" "18662650" "subst" "0" "00000" "RS1_000056" "g.18662650C>T" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.422G>A, R141H" "" "Unknown" "?" "" "0" "" "" "g.18644530C>T" "" "likely pathogenic" "" "0000830265" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.214G>A, E72K" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830266" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.214G>A, E72K" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830267" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.214G>A, E72K" "" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830268" "20" "70" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000359" "g.18662651G>T" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.421C>A, R141S" "" "Unknown" "?" "" "0" "" "" "g.18644531G>T" "" "likely pathogenic" "" "0000830269" "20" "70" "X" "18662723" "18662723" "subst" "0" "00000" "RS1_000201" "g.18662723G>A" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.349C>T, Q117*" "" "Unknown" "?" "" "0" "" "" "g.18644603G>A" "" "likely pathogenic" "" "0000830270" "20" "70" "X" "18665370" "18665370" "subst" "0" "00000" "RS1_000034" "g.18665370A>T" "" "{PMID:Sudha 2018:29851975}" "" "RS1 c.267T>A, Y89*" "" "Unknown" "?" "" "0" "" "" "g.18647250A>T" "" "likely pathogenic" "" "0000830323" "20" "70" "X" "18665451" "18665452" "ins" "0" "00000" "RS1_000396" "g.18665451_18665452insA" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.185_186insT, p.Glu62Aspfs*24" "" "Unknown" "?" "" "0" "" "" "g.18647331_18647332insA" "" "likely pathogenic" "" "0000830324" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.214G>A, p.Glu72Lys" "" "Unknown" "?" "rs104894928" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830325" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.214G>A, p.Glu72Lys" "" "Unknown" "?" "rs104894928" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830326" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.214G>A, p.Glu72Lys" "" "Unknown" "?" "rs104894928" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830327" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.214G>A, p.Glu72Lys" "" "Germline" "yes" "rs104894928" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830328" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.214G>A, p.Glu72Lys" "" "Germline" "yes" "rs104894928" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830329" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.214G>A, p.Glu72Lys" "" "Unknown" "?" "rs104894928" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830330" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.214G>A, p.Glu72Lys" "" "Germline" "yes" "rs104894928" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830331" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.214G>A, p.Glu72Lys" "" "Germline" "yes" "rs104894928" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000830332" "20" "70" "X" "18665419" "18665419" "subst" "0" "00000" "RS1_000388" "g.18665419G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.218C>T, p.Ser73Leu" "" "Unknown" "?" "" "0" "" "" "g.18647299G>A" "" "likely pathogenic" "" "0000830333" "20" "70" "X" "18665371" "18665371" "subst" "0" "00000" "RS1_000033" "g.18665371T>C" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.266A>G, p.Tyr89Cys" "" "Unknown" "?" "rs61752060" "0" "" "" "g.18647251T>C" "" "likely pathogenic" "" "0000830334" "20" "70" "X" "18665371" "18665371" "subst" "0" "00000" "RS1_000033" "g.18665371T>C" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.266A>G, p.Tyr89Cys" "" "Unknown" "?" "rs61752060" "0" "" "" "g.18647251T>C" "" "likely pathogenic" "" "0000830335" "20" "70" "X" "18665371" "18665371" "subst" "0" "00000" "RS1_000033" "g.18665371T>C" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.266A>G, p.Tyr89Cys" "" "Unknown" "?" "rs61752060" "0" "" "" "g.18647251T>C" "" "likely pathogenic" "" "0000830336" "20" "70" "X" "18665371" "18665371" "subst" "0" "00000" "RS1_000033" "g.18665371T>C" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.266A>G, p.Tyr89Cys" "" "Unknown" "?" "rs61752060" "0" "" "" "g.18647251T>C" "" "likely pathogenic" "" "0000830337" "20" "70" "X" "18665370" "18665370" "subst" "0" "00000" "RS1_000034" "g.18665370A>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.267T>A, p.Tyr89*" "" "Germline" "yes" "rs61752061" "0" "" "" "g.18647250A>T" "" "likely pathogenic" "" "0000830338" "20" "70" "X" "18665370" "18665370" "subst" "0" "00000" "RS1_000034" "g.18665370A>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.267T>A, p.Tyr89*" "" "Germline" "yes" "rs61752061" "0" "" "" "g.18647250A>T" "" "likely pathogenic" "" "0000830339" "20" "70" "X" "18665352" "18665352" "del" "0" "00000" "RS1_000378" "g.18665352del" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.285delG, p.Trp96Glyfs*30" "" "Unknown" "?" "" "0" "" "" "g.18647232del" "" "likely pathogenic" "" "0000830340" "20" "70" "X" "18665336" "18665336" "subst" "0" "00000" "RS1_000127" "g.18665336C>G" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.301G>C, p.Ala101Pro" "" "Unknown" "?" "rs61752066" "0" "" "" "g.18647216C>G" "" "likely pathogenic" "" "0000830341" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.304C>T, p.Arg102Trp" "" "Unknown" "?" "rs61752067" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000830342" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.304C>T, p.Arg102Trp" "" "Germline" "yes" "rs61752067" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000830343" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.304C>T, p.Arg102Trp" "" "Germline" "yes" "rs61752067" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000830344" "20" "70" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.304C>T, p.Arg102Trp" "" "Unknown" "?" "rs61752067" "0" "" "" "g.18647213G>A" "" "likely pathogenic" "" "0000830345" "20" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.305G>A, p.Arg102Gln" "" "Unknown" "?" "rs61752068" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000830346" "20" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.305G>A, p.Arg102Gln" "" "Germline" "yes" "rs61752068" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000830347" "20" "70" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.305G>A, p.Arg102Gln" "" "Germline" "yes" "rs61752068" "0" "" "" "g.18647212C>T" "" "likely pathogenic" "" "0000830348" "20" "70" "X" "18665311" "18665311" "subst" "0" "00000" "RS1_000133" "g.18665311C>G" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.326G>C, p.Gly109Ala" "" "Unknown" "?" "" "0" "" "" "g.18647191C>G" "" "likely pathogenic" "" "0000830349" "20" "70" "X" "18662742" "18662742" "subst" "0" "00000" "RS1_000120" "g.18662742A>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.330T>A, p.Cys110*" "" "Germline" "yes" "rs1801161" "0" "" "" "g.18644622A>T" "" "likely pathogenic" "" "0000830350" "20" "70" "X" "18662742" "18662742" "subst" "0" "00000" "RS1_000120" "g.18662742A>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.330T>A, p.Cys110*" "" "Germline" "yes" "rs1801161" "0" "" "" "g.18644622A>T" "" "likely pathogenic" "" "0000830351" "20" "70" "X" "18662668" "18662668" "subst" "0" "00000" "RS1_000363" "g.18662668C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.404G>A, p.Gly135Glu" "" "Germline" "yes" "" "0" "" "" "g.18644548C>T" "" "likely pathogenic" "" "0000830352" "20" "70" "X" "18662655" "18662655" "subst" "0" "00000" "RS1_000360" "g.18662655C>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.417G>T, p.Gln139His" "" "Germline" "yes" "" "0" "" "" "g.18644535C>A" "" "likely pathogenic" "" "0000830353" "20" "70" "X" "18662650" "18662650" "subst" "0" "00000" "RS1_000056" "g.18662650C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.422G>A, p.Arg141His" "" "Unknown" "?" "rs61752159" "0" "" "" "g.18644530C>T" "" "likely pathogenic" "" "0000830354" "20" "70" "X" "18662634" "18662634" "subst" "0" "00000" "RS1_000060" "g.18662634C>G" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.438G>C, p.Glu146Asp" "" "Germline" "yes" "rs61753163" "0" "" "" "g.18644514C>G" "" "likely pathogenic" "" "0000830355" "20" "70" "X" "18662549" "18662549" "subst" "0" "00000" "RS1_000148" "g.18662549C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.522+1G>A, undetermined splicing defect" "" "Unknown" "?" "rs281865348" "0" "" "" "g.18644429C>T" "" "likely pathogenic" "" "0000830356" "20" "70" "X" "18660277" "18660277" "subst" "0" "00000" "RS1_000340" "g.18660277C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.523-1G>A, undetermined splicing defect" "" "Unknown" "?" "" "0" "" "" "g.18642157C>T" "" "likely pathogenic" "" "0000830357" "20" "70" "X" "18660255" "18660255" "subst" "5.62066E-6" "00000" "RS1_000067" "g.18660255G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.544C>T, p.Arg182Cys" "" "Unknown" "?" "rs61753171" "0" "" "" "g.18642135G>A" "" "likely pathogenic" "" "0000830358" "20" "70" "X" "18660255" "18660255" "subst" "5.62066E-6" "00000" "RS1_000067" "g.18660255G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.544C>T, p.Arg182Cys" "" "Unknown" "?" "rs61753171" "0" "" "" "g.18642135G>A" "" "likely pathogenic" "" "0000830359" "20" "70" "X" "18660255" "18660255" "subst" "5.62066E-6" "00000" "RS1_000067" "g.18660255G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.544C>T, p.Arg182Cys" "" "Unknown" "?" "rs61753171" "0" "" "" "g.18642135G>A" "" "likely pathogenic" "" "0000830360" "20" "70" "X" "18660255" "18660255" "subst" "5.62066E-6" "00000" "RS1_000067" "g.18660255G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.544C>T, p.Arg182Cys" "" "Unknown" "?" "rs61753171" "0" "" "" "g.18642135G>A" "" "likely pathogenic" "" "0000830361" "20" "70" "X" "18660225" "18660225" "subst" "0" "00000" "RS1_000007" "g.18660225G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.574C>T, p.Pro192Ser" "" "Unknown" "?" "rs61753174" "0" "" "" "g.18642105G>A" "" "likely pathogenic" "" "0000830362" "20" "70" "X" "18660210" "18660210" "subst" "0" "00000" "RS1_000071" "g.18660210G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.589C>T, p.Arg197Cys" "" "Unknown" "?" "rs281865354" "0" "" "" "g.18642090G>A" "" "likely pathogenic" "" "0000830363" "20" "70" "X" "18660210" "18660210" "subst" "0" "00000" "RS1_000071" "g.18660210G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.589C>T, p.Arg197Cys" "" "Unknown" "?" "rs281865354" "0" "" "" "g.18642090G>A" "" "likely pathogenic" "" "0000830364" "20" "70" "X" "18660210" "18660210" "subst" "0" "00000" "RS1_000071" "g.18660210G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.589C>T, p.Arg197Cys" "" "Unknown" "?" "rs281865354" "0" "" "" "g.18642090G>A" "" "likely pathogenic" "" "0000830365" "20" "70" "X" "18660209" "18660209" "subst" "5.6062E-6" "00000" "RS1_000072" "g.18660209C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.590G>A, p.Arg197His" "" "Unknown" "?" "rs281865355" "0" "" "" "g.18642089C>T" "" "likely pathogenic" "" "0000830366" "20" "70" "X" "18660201" "18660201" "subst" "0" "00000" "RS1_000074" "g.18660201G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.598C>T, p.Arg200Cys" "" "Germline" "yes" "rs281865357" "0" "" "" "g.18642081G>A" "" "likely pathogenic" "" "0000830367" "20" "70" "X" "18660200" "18660200" "subst" "0" "00000" "RS1_000075" "g.18660200C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.599G>A, p.Arg200His" "" "Unknown" "?" "rs281865358" "0" "" "" "g.18642080C>T" "" "likely pathogenic" "" "0000830368" "20" "70" "X" "18660200" "18660200" "subst" "0" "00000" "RS1_000075" "g.18660200C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.599G>A, p.Arg200His" "" "Unknown" "?" "rs281865358" "0" "" "" "g.18642080C>T" "" "likely pathogenic" "" "0000830369" "20" "70" "X" "18660191" "18660191" "subst" "0" "00000" "RS1_000077" "g.18660191G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.608C>T, p.Pro203Leu" "" "Unknown" "?" "rs104894930" "0" "" "" "g.18642071G>A" "" "likely pathogenic" "" "0000830370" "20" "70" "X" "18660191" "18660191" "subst" "0" "00000" "RS1_000077" "g.18660191G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.608C>T, p.Pro203Leu" "" "Unknown" "?" "rs104894930" "0" "" "" "g.18642071G>A" "" "likely pathogenic" "" "0000830371" "20" "70" "X" "18660174" "18660174" "subst" "0" "00000" "RS1_000080" "g.18660174G>A" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.625C>T, p.Arg209Cys" "" "Unknown" "?" "rs281865361" "0" "" "" "g.18642054G>A" "" "likely pathogenic" "" "0000830372" "20" "70" "X" "18660174" "18660174" "subst" "0" "00000" "RS1_000330" "g.18660174G>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.625C>A, p.Arg209Ser" "" "Unknown" "?" "" "0" "" "" "g.18642054G>T" "" "likely pathogenic" "" "0000830373" "20" "70" "X" "18660161" "18660161" "subst" "0" "00000" "RS1_000092" "g.18660161C>T" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.638G>A, p.Arg213Gln" "" "Unknown" "?" "rs281865364" "0" "" "" "g.18642041C>T" "" "likely pathogenic" "" "0000830374" "20" "70" "X" "18660142" "18660142" "subst" "0" "00000" "RS1_000326" "g.18660142G>C" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.657C>G, p.Cys219Trp" "" "Unknown" "?" "" "0" "" "" "g.18642022G>C" "" "likely pathogenic" "" "0000830375" "20" "70" "X" "18660132" "18660132" "subst" "0" "00000" "RS1_000118" "g.18660132A>G" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.667T>C, p.Cys223Arg" "" "Germline" "yes" "rs104894929" "0" "" "" "g.18642012A>G" "" "likely pathogenic" "" "0000830376" "20" "70" "X" "18660132" "18660132" "subst" "0" "00000" "RS1_000118" "g.18660132A>G" "" "{PMID:Kondo 2019:30652005}" "" "RS1 c.667T>C, p.Cys223Arg" "" "Germline" "yes" "rs104894929" "0" "" "" "g.18642012A>G" "" "likely pathogenic" "" "0000830418" "21" "90" "X" "18660225" "18660225" "dup" "0" "00000" "RS1_000070" "g.18660225dup" "" "{PMID:Christodoulou 2019:30923717}" "" "c.578_579incC;p.HisfsX264" "c.578_579insC automapped to NM_000330.4:c.579dupC" "Germline" "yes" "" "0" "" "" "g.18642105dup" "" "pathogenic" "" "0000830454" "21" "90" "X" "18662695" "18662697" "del" "0" "00000" "RS1_000366" "g.18662695_18662697del" "" "{PMID:Selvan 2018:31238476}" "" "c. 375_377 del AGA" "" "Germline" "yes" "" "0" "" "" "g.18644575_18644577del" "" "pathogenic" "" "0000830455" "21" "90" "X" "18662695" "18662697" "del" "0" "00000" "RS1_000366" "g.18662695_18662697del" "" "{PMID:Selvan 2018:31238476}" "" "c. 375_377 del AGA" "" "Germline" "yes" "" "0" "" "" "g.18644575_18644577del" "" "pathogenic" "" "0000830496" "21" "70" "X" "18662611" "18662611" "subst" "0" "00000" "RS1_000125" "g.18662611T>C" "" "{PMID:Smith 2020:32124668}" "" "p.Gln154Arg:c.461A>G" "" "Germline" "yes" "" "0" "" "" "g.18644491T>C" "" "likely pathogenic" "" "0000830497" "21" "70" "X" "18662611" "18662611" "subst" "0" "00000" "RS1_000125" "g.18662611T>C" "" "{PMID:Smith 2020:32124668}" "" "p.Gln154Arg:c.461A>G" "" "Germline" "yes" "" "0" "" "" "g.18644491T>C" "" "likely pathogenic" "" "0000830498" "21" "70" "X" "18665386" "18665386" "subst" "5.59375E-6" "00000" "RS1_000384" "g.18665386G>C" "" "{PMID:Smith 2020:32124668}" "" "p.Ser84Cys: c.251C>G" "" "Germline" "yes" "" "0" "" "" "g.18647266G>C" "" "likely pathogenic" "" "0000830506" "20" "90" "X" "18665441" "18665441" "subst" "0" "00000" "RS1_000393" "g.18665441G>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.196C>A, p.H66N" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647321G>T" "" "pathogenic" "ACMG" "0000830507" "20" "90" "X" "18665429" "18665429" "subst" "0" "00000" "RS1_000028" "g.18665429C>T" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.208G>A , p.G70S" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647309C>T" "" "pathogenic" "ACMG" "0000830508" "20" "90" "X" "18665429" "18665429" "subst" "0" "00000" "RS1_000028" "g.18665429C>T" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.208G>A , p.G70S" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647309C>T" "" "pathogenic" "ACMG" "0000830509" "20" "90" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "4/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.214G>A , p.E72K" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "pathogenic" "ACMG" "0000830510" "20" "90" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "4/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.214G>A , p.E72K" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "pathogenic" "ACMG" "0000830511" "20" "90" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "4/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.214G>A , p.E72K" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "pathogenic" "ACMG" "0000830512" "20" "90" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "4/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.214G>A , p.E72K" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647303C>T" "" "pathogenic" "ACMG" "0000830513" "20" "90" "X" "18665423" "18665423" "subst" "0" "00000" "RS1_000124" "g.18665423C>G" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.214G>C , p.E72Q" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647303C>G" "" "pathogenic" "ACMG" "0000830514" "20" "90" "X" "18665395" "18665395" "subst" "0" "00000" "RS1_000146" "g.18665395A>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.242T>A, p.I81N" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647275A>T" "" "pathogenic" "ACMG" "0000830515" "20" "90" "X" "18665361" "18665361" "subst" "0" "00000" "RS1_000382" "g.18665361C>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.276G>A , p.W92X" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647241C>T" "" "pathogenic" "ACMG" "0000830516" "20" "90" "X" "18665361" "18665361" "subst" "0" "00000" "RS1_000381" "g.18665361C>A" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.276G>T , p.W92C" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647241C>A" "" "pathogenic" "ACMG" "0000830517" "20" "90" "X" "18665349" "18665349" "subst" "0" "00000" "RS1_000317" "g.18665349C>G" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.288G>C , p.W96C" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647229C>G" "" "pathogenic" "ACMG" "0000830518" "20" "90" "X" "18665344" "18665345" "del" "0" "00000" "RS1_000377" "g.18665344_18665345del" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.292_293del, p.A98Kfs*22" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647224_18647225del" "" "pathogenic" "ACMG" "0000830519" "20" "90" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.304C>T , p.R102W" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "pathogenic" "ACMG" "0000830520" "20" "90" "X" "18665333" "18665333" "subst" "5.59936E-6" "00000" "RS1_000004" "g.18665333G>A" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.304C>T , p.R102W" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647213G>A" "" "pathogenic" "ACMG" "0000830521" "20" "90" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.305G>A , p.R102Q" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647212C>T" "" "pathogenic" "ACMG" "0000830522" "20" "90" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.305G>A , p.R102Q" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647212C>T" "" "pathogenic" "ACMG" "0000830523" "20" "90" "X" "18665332" "18665332" "subst" "0" "00000" "RS1_000036" "g.18665332C>T" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.305G>A , p.R102Q" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647212C>T" "" "pathogenic" "ACMG" "0000830524" "20" "70" "X" "18665326" "18665326" "subst" "0" "00000" "RS1_000375" "g.18665326T>C" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.311A>G , p.N104S" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647206T>C" "" "likely pathogenic" "ACMG" "0000830525" "20" "90" "X" "18665290" "18665320" "del" "0" "00000" "RS1_000372" "g.18665290_18665320del" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.317_326+21del," "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647170_18647200del" "" "pathogenic" "ACMG" "0000830526" "20" "90" "X" "18665308" "18665310" "delins" "0" "00000" "RS1_000373" "g.18665308_18665310delinsA" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.326+1_326+3delinsT," "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18647188_18647190delinsA" "" "pathogenic" "ACMG" "0000830527" "20" "90" "X" "18662747" "18662747" "subst" "0" "00000" "RS1_000371" "g.18662747T>C" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.327-2A>G," "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644627T>C" "" "pathogenic" "ACMG" "0000830528" "20" "90" "X" "18662702" "18662702" "subst" "0" "00000" "RS1_000367" "g.18662702G>A" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.370C>T, p.Q124X" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644582G>A" "" "pathogenic" "ACMG" "0000830529" "20" "90" "X" "18662702" "18662702" "subst" "0" "00000" "RS1_000367" "g.18662702G>A" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.370C>T, p.Q124X" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644582G>A" "" "pathogenic" "ACMG" "0000830530" "20" "90" "X" "18662662" "18662759" "del" "0" "00000" "RS1_000362" "g.18662662_18662759del" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.327-14_410del," "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644542_18644639del" "" "pathogenic" "ACMG" "0000830531" "20" "90" "X" "18662742" "18662742" "del" "0" "00000" "RS1_000370" "g.18662742del" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.330del, p.C110Wfs*16" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644622del" "" "pathogenic" "ACMG" "0000830532" "20" "90" "X" "18662738" "18662738" "subst" "0" "00000" "RS1_000369" "g.18662738A>G" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.334T>C , p.W112R" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644618A>G" "" "pathogenic" "ACMG" "0000830533" "20" "90" "X" "18662698" "18662701" "del" "0" "00000" "RS1_000045" "g.18662698_18662701del" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.375_378del , p.D126X" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644578_18644581del" "" "pathogenic" "ACMG" "0000830534" "20" "90" "X" "18662698" "18662701" "del" "0" "00000" "RS1_000045" "g.18662698_18662701del" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.375_378del , p.D126X" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644578_18644581del" "" "pathogenic" "ACMG" "0000830535" "20" "90" "X" "18662687" "18662689" "del" "0" "00000" "RS1_000364" "g.18662687_18662689del" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.383_385del, p.E129Ifs*139" "error in annotation: c.383_385del automapped to c.385_387del; it does not cause frameshift p.Glu129Ilefs*139 but an in-frame deletion p.Glu129del; number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644567_18644569del" "" "pathogenic" "ACMG" "0000830536" "20" "90" "X" "18662651" "18662651" "subst" "0" "00000" "RS1_000055" "g.18662651G>A" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.421C>T , p.R141C" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644531G>A" "" "pathogenic" "ACMG" "0000830537" "20" "90" "X" "18662650" "18662650" "subst" "0" "00000" "RS1_000056" "g.18662650C>T" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.422G>A , p.R141H" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644530C>T" "" "pathogenic" "ACMG" "0000830538" "20" "90" "X" "18662650" "18662650" "subst" "0" "00000" "RS1_000056" "g.18662650C>T" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.422G>A , p.R141H" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644530C>T" "" "pathogenic" "ACMG" "0000830539" "20" "90" "X" "18662650" "18662650" "subst" "0" "00000" "RS1_000056" "g.18662650C>T" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.422G>A , p.R141H" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644530C>T" "" "pathogenic" "ACMG" "0000830540" "20" "90" "X" "18662647" "18662647" "subst" "0" "00000" "RS1_000358" "g.18662647C>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.425G>A , p.C142Y" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644527C>T" "" "pathogenic" "ACMG" "0000830541" "20" "90" "X" "18662639" "18662639" "subst" "0" "00000" "RS1_000163" "g.18662639C>G" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.433G>C , p.D145H" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644519C>G" "" "pathogenic" "ACMG" "0000830542" "20" "90" "X" "18662636" "18662636" "subst" "0" "00000" "RS1_000059" "g.18662636C>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.436G>A , p.E146K" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644516C>T" "" "pathogenic" "ACMG" "0000830543" "20" "90" "X" "18662631" "18662631" "subst" "0" "00000" "RS1_000356" "g.18662631C>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.441G>A , p.W147X" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644511C>T" "" "pathogenic" "ACMG" "0000830544" "20" "70" "X" "18662629" "18662629" "subst" "0" "00000" "RS1_000355" "g.18662629A>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.443T>A, p.M148K" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644509A>T" "" "likely pathogenic" "ACMG" "0000830545" "20" "90" "X" "18662621" "18662621" "subst" "0" "00000" "RS1_000354" "g.18662621A>G" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.451T>C, p.Y151H" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644501A>G" "" "pathogenic" "ACMG" "0000830546" "20" "90" "X" "18662606" "18662606" "subst" "0" "00000" "RS1_000164" "g.18662606T>C" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.466A>G , p.R156G" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644486T>C" "" "pathogenic" "ACMG" "0000830547" "20" "90" "X" "18662605" "18662605" "dup" "0" "00000" "RS1_000350" "g.18662605dup" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.467_468insG, p.T157Dfs*3" "error in annotation: c.467_468insG automapped to c.468dup; number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644485dup" "" "pathogenic" "ACMG" "0000830548" "20" "90" "X" "18662584" "18662584" "del" "0" "00000" "RS1_000165" "g.18662584del" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.489del, p.W163X" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644464del" "" "pathogenic" "ACMG" "0000830549" "20" "90" "X" "18662584" "18662584" "del" "0" "00000" "RS1_000165" "g.18662584del" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.489del, p.W163X" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644464del" "" "pathogenic" "ACMG" "0000830550" "20" "90" "X" "18662584" "18662584" "del" "0" "00000" "RS1_000165" "g.18662584del" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.489del, p.W163X" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644464del" "" "pathogenic" "ACMG" "0000830551" "20" "90" "X" "18662583" "18662583" "subst" "0" "00000" "RS1_000096" "g.18662583C>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.489G>A , p.W163X" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644463C>T" "" "pathogenic" "ACMG" "0000830552" "20" "90" "X" "18662579" "18662581" "delins" "0" "00000" "RS1_000348" "g.18662579_18662581delinsGATT" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.491_493delinsAATC , p.I164Kext 38" "variant can be annotated as p.Ile164Lysfs*100, but there are less than 100 amino acids until the end of the protein, so it is an extension; number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644459_18644461delinsGATT" "" "pathogenic" "ACMG" "0000830553" "20" "90" "X" "18662576" "18662576" "subst" "0" "00000" "RS1_000346" "g.18662576A>G" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.496T>C, p.Y166H" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644456A>G" "" "pathogenic" "ACMG" "0000830554" "20" "90" "X" "18662573" "18662573" "subst" "0" "00000" "RS1_000345" "g.18662573T>C" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.499A>G , p.K167E" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644453T>C" "" "pathogenic" "ACMG" "0000830555" "20" "90" "X" "18662567" "18662567" "subst" "0" "00000" "RS1_000343" "g.18662567G>A" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.505C>T , p.Q169X" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644447G>A" "" "pathogenic" "ACMG" "0000830556" "20" "90" "X" "18662567" "18662567" "subst" "0" "00000" "RS1_000343" "g.18662567G>A" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.505C>T , p.Q169X" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644447G>A" "" "pathogenic" "ACMG" "0000830557" "20" "90" "X" "18662561" "18662561" "subst" "0" "00000" "RS1_000341" "g.18662561C>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.511 G>A, p.G171R" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18644441C>T" "" "pathogenic" "ACMG" "0000830558" "20" "70" "X" "18660254" "18660254" "subst" "0" "00000" "RS1_000337" "g.18660254C>A" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.545G>T , p.R182L" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642134C>A" "" "likely pathogenic" "ACMG" "0000830559" "20" "90" "X" "18660224" "18660224" "subst" "0" "00000" "RS1_000159" "g.18660224G>A" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.575C>T , p.P192L" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642104G>A" "" "pathogenic" "ACMG" "0000830560" "20" "90" "X" "18660221" "18660221" "subst" "0" "00000" "RS1_000008" "g.18660221G>A" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.578C>T, p.P193L" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642101G>A" "" "pathogenic" "ACMG" "0000830561" "20" "90" "X" "18660225" "18660225" "dup" "0" "00000" "RS1_000070" "g.18660225dup" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.579_580insC , p.X225Lext 38" "error in annotation: c.579_580insC automapped to c.579dup and causes p.Ile194Hisfs*70 and not p.*225Leuext 38; number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642105dup" "" "pathogenic" "ACMG" "0000830562" "20" "70" "X" "18660219" "18660219" "subst" "0" "00000" "RS1_000335" "g.18660219T>A" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.580A>T , p.I194F" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642099T>A" "" "likely pathogenic" "ACMG" "0000830563" "20" "90" "X" "18660218" "18660218" "subst" "0" "00000" "RS1_000195" "g.18660218A>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.581T>A, p.I194N" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642098A>T" "" "pathogenic" "ACMG" "0000830564" "20" "90" "X" "18660210" "18660210" "subst" "0" "00000" "RS1_000071" "g.18660210G>A" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.589C>T, p.R197C" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642090G>A" "" "pathogenic" "ACMG" "0000830565" "20" "90" "X" "18660209" "18660209" "subst" "5.6062E-6" "00000" "RS1_000072" "g.18660209C>T" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.590G>A, p.R197H" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642089C>T" "" "pathogenic" "ACMG" "0000830566" "20" "90" "X" "18660209" "18660209" "subst" "5.6062E-6" "00000" "RS1_000072" "g.18660209C>T" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.590G>A, p.R197H" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642089C>T" "" "pathogenic" "ACMG" "0000830567" "20" "90" "X" "18660201" "18660201" "subst" "0" "00000" "RS1_000074" "g.18660201G>A" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.598C>T , p.R200C" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642081G>A" "" "pathogenic" "ACMG" "0000830568" "20" "90" "X" "18660201" "18660201" "subst" "0" "00000" "RS1_000074" "g.18660201G>A" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.598C>T , p.R200C" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642081G>A" "" "pathogenic" "ACMG" "0000830569" "20" "90" "X" "18660201" "18660201" "subst" "0" "00000" "RS1_000074" "g.18660201G>A" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.598C>T , p.R200C" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642081G>A" "" "pathogenic" "ACMG" "0000830570" "20" "90" "X" "18660200" "18660200" "subst" "0" "00000" "RS1_000075" "g.18660200C>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.599G>A, p.R200H" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642080C>T" "" "pathogenic" "ACMG" "0000830571" "20" "70" "X" "18660192" "18660192" "subst" "0" "00000" "RS1_000333" "g.18660192G>A" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.607C>T , p.P203S" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642072G>A" "" "likely pathogenic" "ACMG" "0000830572" "20" "70" "X" "18660191" "18660191" "subst" "0" "00000" "RS1_000332" "g.18660191G>T" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.608C>A , p.P203Q" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642071G>T" "" "likely pathogenic" "ACMG" "0000830573" "20" "70" "X" "18660191" "18660191" "subst" "0" "00000" "RS1_000332" "g.18660191G>T" "2/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.608C>A , p.P203Q" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642071G>T" "" "likely pathogenic" "ACMG" "0000830574" "20" "90" "X" "18660191" "18660191" "subst" "0" "00000" "RS1_000077" "g.18660191G>A" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.608C>T , p.P203L" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642071G>A" "" "pathogenic" "ACMG" "0000830575" "20" "70" "X" "18660176" "18660176" "subst" "0" "00000" "RS1_000331" "g.18660176A>G" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.623T>C, p.V208A" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642056A>G" "" "likely pathogenic" "ACMG" "0000830576" "20" "90" "X" "18660174" "18660174" "subst" "0" "00000" "RS1_000080" "g.18660174G>A" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.625C>T, p.R209C" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642054G>A" "" "pathogenic" "ACMG" "0000830577" "20" "90" "X" "18660173" "18660173" "subst" "0" "00000" "RS1_000009" "g.18660173C>T" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.626G>A , p.R209H" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642053C>T" "" "pathogenic" "ACMG" "0000830578" "20" "90" "X" "18660173" "18660173" "subst" "0" "00000" "RS1_000009" "g.18660173C>T" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.626G>A , p.R209H" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642053C>T" "" "pathogenic" "ACMG" "0000830579" "20" "90" "X" "18660173" "18660173" "subst" "0" "00000" "RS1_000009" "g.18660173C>T" "3/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.626G>A , p.R209H" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642053C>T" "" "pathogenic" "ACMG" "0000830580" "20" "90" "X" "18660168" "18660168" "subst" "0" "00000" "RS1_000151" "g.18660168C>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.631G>A , p.A211T" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642048C>T" "" "pathogenic" "ACMG" "0000830581" "20" "90" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "4/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.637C>T , p.R213W" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642042G>A" "" "pathogenic" "ACMG" "0000830582" "20" "90" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "4/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.637C>T , p.R213W" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642042G>A" "" "pathogenic" "ACMG" "0000830583" "20" "90" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "4/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.637C>T , p.R213W" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642042G>A" "" "pathogenic" "ACMG" "0000830584" "20" "90" "X" "18660162" "18660162" "subst" "0" "00000" "RS1_000081" "g.18660162G>A" "4/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.637C>T , p.R213W" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642042G>A" "" "pathogenic" "ACMG" "0000830585" "20" "90" "X" "18660161" "18660161" "subst" "0" "00000" "RS1_000092" "g.18660161C>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.638G>A, p.R213Q" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642041C>T" "" "pathogenic" "ACMG" "0000830586" "20" "90" "X" "18660147" "18660147" "subst" "0" "00000" "RS1_000327" "g.18660147C>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.652G>A , p.E218K" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642027C>T" "" "pathogenic" "ACMG" "0000830587" "20" "90" "X" "18660143" "18660143" "subst" "0" "00000" "RS1_000303" "g.18660143C>T" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.656G>A, p.C219Y" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642023C>T" "" "pathogenic" "ACMG" "0000830588" "20" "90" "X" "18660132" "18660132" "subst" "0" "00000" "RS1_000118" "g.18660132A>G" "1/90" "{PMID:Chen 2020:32300273}" "" "RS1 c.667T>C , p.C223R" "number of alleles does not match number of patients (91 vs 90)" "Unknown" "?" "" "0" "" "" "g.18642012A>G" "" "pathogenic" "ACMG" "0000830589" "20" "90" "X" "18659669" "18665975" "delins" "0" "00000" "RS1_000421" "g.18659669_18665975delinsAAAAACTCCCTAGCTCTTTGGAAATGGTAAACA" "1/90 cases RS" "{PMID:Chen 2020:32300273}" "" "del ex4-6" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.18641549_18647855delinsAAAAACTCCCTAGCTCTTTGGAAATGGTAAACA" "" "pathogenic" "ACMG" "0000839873" "0" "50" "X" "18646877" "18646877" "subst" "0" "01164" "CDKL5_000165" "g.18646877A>T" "" "ACMG: PM4, PM2_SUP" "" "" "NM_001323289.2:c.2883A>T p.(*961Tyrext*64)" "Germline" "?" "" "" "" "" "" "" "VUS (!)" "ACMG" "0000846908" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.214G>A , p.(Glu72Lys)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000846909" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.214G>A , p.(Glu72Lys)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000846910" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.214G>A , p.(Glu72Lys)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000846911" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.214G>A , p.(Glu72Lys)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000846912" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.214G>A , p.(Glu72Lys)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000846913" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.214G>A , p.(Glu72Lys)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000846914" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.214G>A , p.(Glu72Lys)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000846915" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.214G>A , p.(Glu72Lys)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000846916" "20" "70" "X" "18665423" "18665423" "subst" "1.67844E-5" "00000" "RS1_000029" "g.18665423C>T" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.214G>A , p.(Glu72Lys)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647303C>T" "" "likely pathogenic" "" "0000846917" "20" "70" "X" "18665312" "18665312" "subst" "1.68157E-5" "00000" "RS1_000006" "g.18665312C>G" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.325G>C , p.(Gly109Arg)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647192C>G" "" "likely pathogenic" "" "0000846918" "20" "70" "X" "18665312" "18665312" "subst" "1.68157E-5" "00000" "RS1_000006" "g.18665312C>G" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.325G>C , p.(Gly109Arg)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647192C>G" "" "likely pathogenic" "" "0000846919" "20" "70" "X" "18665312" "18665312" "subst" "1.68157E-5" "00000" "RS1_000006" "g.18665312C>G" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.325G>C , p.(Gly109Arg)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647192C>G" "" "likely pathogenic" "" "0000846920" "20" "70" "X" "18665312" "18665312" "subst" "1.68157E-5" "00000" "RS1_000006" "g.18665312C>G" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.325G>C , p.(Gly109Arg)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647192C>G" "" "likely pathogenic" "" "0000846921" "20" "70" "X" "18665312" "18665312" "subst" "1.68157E-5" "00000" "RS1_000006" "g.18665312C>G" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.325G>C , p.(Gly109Arg)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647192C>G" "" "likely pathogenic" "" "0000846922" "20" "70" "X" "18660266" "18660266" "subst" "0" "00000" "RS1_000066" "g.18660266C>T" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.533G>C , p.(Gly178Asp)" "error in annotation, p.(Gly178Asp) is caused by c.533G>A and not c.533G>C - this change causes p.(Gly178Ala); hemizygous" "Germline" "yes" "" "0" "" "" "g.18642146C>T" "" "likely pathogenic" "" "0000846923" "20" "70" "X" "18660266" "18660266" "subst" "0" "00000" "RS1_000066" "g.18660266C>T" "" "{PMID:Avela 2019:31087526}" "" "RS1 c.533G>C , p.(Gly178Asp)" "error in annotation, p.(Gly178Asp) is caused by c.533G>A and not c.533G>C - this change causes p.(Gly178Ala); hemizygous" "Germline" "yes" "" "0" "" "" "g.18642146C>T" "" "likely pathogenic" "" "0000856500" "0" "30" "X" "18528968" "18528968" "subst" "2.25054E-5" "01943" "RS1_000409" "g.18528968A>G" "" "" "" "CDKL5(NM_001323289.1):c.93A>G (p.R31=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856501" "0" "30" "X" "18582667" "18582670" "del" "0" "02325" "RS1_000225" "g.18582667_18582670del" "" "" "" "CDKL5(NM_003159.3):c.145+25_145+28delATAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856502" "0" "10" "X" "18582669" "18582670" "del" "0" "02325" "CDKL5_000059" "g.18582669_18582670del" "" "" "" "CDKL5(NM_003159.2):c.145+27_145+28delAT, CDKL5(NM_003159.3):c.145+27_145+28delAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000856503" "0" "50" "X" "18622936" "18622936" "subst" "2.80536E-5" "01943" "RS1_000410" "g.18622936T>C" "" "" "" "CDKL5(NM_001323289.1):c.1892T>C (p.I631T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856504" "0" "30" "X" "18627008" "18627008" "subst" "0.000515611" "01943" "RS1_000249" "g.18627008C>G" "" "" "" "CDKL5(NM_001037343.1):c.2022C>G (p.S674=), CDKL5(NM_001323289.1):c.2022C>G (p.S674=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856505" "0" "50" "X" "18646549" "18646549" "subst" "0" "02325" "RS1_000412" "g.18646549C>T" "" "" "" "CDKL5(NM_003159.3):c.2555C>T (p.P852L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856506" "0" "10" "X" "18662742" "18662742" "subst" "0.0232788" "02326" "RS1_000040" "g.18662742A>G" "" "" "" "CDKL5(NM_003159.2):c.2714-1385A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000867253" "0" "90" "X" "18606106" "18606106" "subst" "0" "01804" "CDKL5_000102" "g.18606106C>T" "" "" "" "CDKL5(NM_001037343.1):c.587C>T (p.(Ser196Leu), p.S196L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000867254" "0" "30" "X" "18631366" "18631366" "subst" "0" "01943" "RS1_000411" "g.18631366C>T" "" "" "" "CDKL5(NM_001323289.1):c.2247C>T (p.H749=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000867255" "0" "90" "X" "18660225" "18660225" "dup" "0" "02327" "RS1_000070" "g.18660225dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000867256" "0" "50" "X" "18662634" "18662634" "subst" "0" "01943" "RS1_000060" "g.18662634C>G" "" "" "" "RS1(NM_000330.3):c.438G>C (p.E146D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000867257" "0" "90" "X" "18665314" "18665314" "subst" "0" "02327" "RS1_000103" "g.18665314A>C" "" "" "" "RS1(NM_000330.4):c.323T>G (p.F108C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000871138" "0" "90" "X" "18598085" "18598085" "subst" "0" "00006" "CDKL5_000138" "g.18598085C>T" "" "{PMID:Halvardson 2016:27334371}" "" "C400T (R134X)" "" "De novo" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000896044" "0" "70" "X" "18528946" "18528946" "subst" "0" "02327" "RS1_000414" "g.18528946A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000896045" "0" "70" "X" "18600005" "18600005" "subst" "0" "02327" "RS1_000415" "g.18600005C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000896046" "0" "50" "X" "18631283" "18631283" "subst" "1.12087E-5" "02325" "RS1_000416" "g.18631283C>T" "" "" "" "CDKL5(NM_003159.3):c.2164C>T (p.R722C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000896047" "0" "50" "X" "18631388" "18631388" "subst" "0" "02325" "RS1_000417" "g.18631388G>C" "" "" "" "CDKL5(NM_003159.3):c.2269G>C (p.D757H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000896048" "0" "30" "X" "18671565" "18671565" "subst" "0.000564159" "01943" "RS1_000418" "g.18671565C>T" "" "" "" "CDKL5(NM_003159.2):c.2994C>T (p.F998=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000896049" "0" "70" "X" "18690187" "18690187" "subst" "0" "02327" "RS1_000419" "g.18690187A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000896533" "21" "70" "X" "18665361" "18665361" "subst" "0" "00000" "RS1_000091" "g.18665361C>G" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0" "{PMID:Chen 2021:33608557}" "" "RS1 c.[276G>C];[0]; p.(Trp92Cys)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647241C>G" "" "likely pathogenic" "" "0000896640" "21" "70" "X" "18660201" "18660201" "subst" "0" "00000" "RS1_000074" "g.18660201G>A" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0" "{PMID:Chen 2021:33608557}" "" "RS1 c.[598C>T];[0]; p.(Arg200Cys)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18642081G>A" "" "likely pathogenic" "" "0000896645" "21" "90" "X" "18665393" "18665394" "del" "0" "00000" "RS1_000318" "g.18665393_18665394del" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0" "{PMID:Chen 2021:33608557}" "" "RS1 c.[244_245del];[0]; p.(Thr82LeufsTer3)" "hemizygous" "Germline" "yes" "" "0" "" "" "g.18647273_18647274del" "" "pathogenic" "" "0000905993" "0" "90" "X" "18662659" "18662659" "subst" "0" "00000" "RS1_000274" "g.18662659G>T" "" "{PMID:Zhu 2022:35456422}" "" "RS1 c.413C>A, p.(Thr138Asn)" "hemizygous, probably causal" "Germline/De novo (untested)" "?" "" "0" "" "" "g.18644539G>T" "" "pathogenic" "ACMG" "0000905994" "0" "90" "X" "18662659" "18662659" "subst" "0" "00000" "RS1_000274" "g.18662659G>T" "" "{PMID:Zhu 2022:35456422}" "" "RS1 c.413C>A, p.(Thr138Asn)" "hemizygous, probably causal" "Germline/De novo (untested)" "?" "" "0" "" "" "g.18644539G>T" "" "pathogenic" "ACMG" "0000905995" "0" "90" "X" "18662659" "18662659" "subst" "0" "00000" "RS1_000274" "g.18662659G>T" "" "{PMID:Zhu 2022:35456422}" "" "RS1 c.413C>A, p.(Thr138Asn)" "hemizygous, probably causal" "Germline/De novo (untested)" "?" "" "0" "" "" "g.18644539G>T" "" "pathogenic" "ACMG" "0000908556" "0" "90" "X" "18643365" "18643365" "subst" "0" "00006" "CDKL5_000166" "g.18643365C>T" "" "{PMID:Veeramah 2013:23647072}" "" "C2494T" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000915663" "0" "50" "X" "18606075" "18606075" "subst" "0" "02327" "RS1_000420" "g.18606075G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000915664" "0" "30" "X" "18622162" "18622162" "subst" "5.595E-6" "02325" "RS1_000232" "g.18622162G>C" "" "" "" "CDKL5(NM_001037343.1):c.1118G>C (p.G373A), CDKL5(NM_003159.3):c.1118G>C (p.G373A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915665" "0" "90" "X" "18622692" "18622692" "subst" "0" "02329" "CDKL5_000029" "g.18622692C>T" "" "" "" "CDKL5(NM_001323289.2):c.1648C>T (p.R550*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000915666" "0" "70" "X" "18660201" "18660201" "subst" "0" "02327" "RS1_000074" "g.18660201G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000915667" "0" "50" "X" "18662660" "18662660" "subst" "0" "02327" "RS1_000050" "g.18662660T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000927307" "0" "90" "X" "18665314" "18665314" "subst" "0" "02330" "RS1_000103" "g.18665314A>C" "" "" "" "RS1(NM_000330.4):c.323T>G (p.F108C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000931368" "0" "90" "X" "18662659" "18662659" "subst" "0" "02327" "RS1_000274" "g.18662659G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000936401" "0" "90" "X" "18622336" "18622337" "del" "0" "00006" "CDKL5_000167" "g.18622336_18622337del" "" "{PMID:Hamdan 2017:29100083}" "" "NM_003159:c.1291_1292del (T431fs)" "" "De novo" "" "" "0" "" "" "g.18604216_18604217del" "" "pathogenic" "" "0000936463" "0" "90" "X" "18602451" "18602451" "subst" "0" "00006" "CDKL5_000019" "g.18602451C>T" "" "{PMID:Hamdan 2017:29100083}" "" "NM_003159:c.C532T (R178W)" "" "De novo" "" "" "0" "" "" "" "" "pathogenic" "" "0000939890" "0" "70" "X" "18593504" "18593504" "subst" "0" "00006" "CDKL5_000168" "g.18593504G>A" "" "{PMID:Nambot 2018:29095811}" "" "" "" "De novo" "" "" "0" "" "" "g.18575384G>A" "" "likely pathogenic (dominant)" "" "0000951727" "0" "90" "X" "18665414" "18665414" "subst" "0" "02327" "RS1_000032" "g.18665414C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000951728" "0" "70" "X" "18665421" "18665421" "subst" "0" "02327" "RS1_000030" "g.18665421C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000951729" "0" "70" "X" "18690187" "18690187" "subst" "0" "02327" "RS1_000429" "g.18690187A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000959728" "0" "90" "X" "18567863" "18630964" "dup" "0" "00006" "CDKL5_000169" "g.18567863_18630964dup" "" "{PMID:Ostrander 2018:30109124}" "" "c.146-14735_2276+3273dup (ex5-15)" "ACMG PVS1, PS2, PM2, PP3, PP5" "De novo" "" "" "0" "" "" "g.18549743_18612844dup" "" "pathogenic (recessive)" "ACMG" "0000970958" "0" "50" "X" "18646513" "18646513" "subst" "0" "02329" "RS1_000431" "g.18646513G>A" "" "" "" "CDKL5(NM_001323289.2):c.2519G>A (p.R840H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000970961" "0" "30" "X" "18674870" "18674870" "subst" "1.67964E-5" "02327" "RS1_000270" "g.18674870G>A" "" "" "" "RS1(NM_000330.3):c.87C>T (p.G29=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984590" "0" "30" "X" "18668712" "18668712" "subst" "5.6146E-6" "01804" "RS1_000433" "g.18668712G>A" "" "" "" "CDKL5(NM_001037343.2):c.2980G>A (p.(Gly994Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006633" "0" "50" "X" "18598093" "18598093" "subst" "5.64E-6" "01804" "RS1_000434" "g.18598093G>A" "" "" "" "CDKL5(NM_001037343.1):c.403+5G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006634" "0" "30" "X" "18622765" "18622765" "subst" "5.04295E-5" "02325" "RS1_000435" "g.18622765C>T" "" "" "" "CDKL5(NM_003159.3):c.1721C>T (p.P574L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006635" "0" "30" "X" "18626961" "18626961" "subst" "0" "01804" "RS1_000436" "g.18626961G>A" "" "" "" "CDKL5(NM_001037343.1):c.1975G>A (p.(Val659Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006636" "0" "50" "X" "18646512" "18646512" "subst" "0" "01804" "RS1_000437" "g.18646512C>T" "" "" "" "CDKL5(NM_001037343.1):c.2518C>T (p.(Arg840Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006637" "0" "30" "X" "18662607" "18662607" "subst" "0" "02325" "RS1_000438" "g.18662607G>A" "" "" "" "RS1(NM_000330.4):c.465C>T (p.Y155=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001016011" "0" "90" "X" "18606174" "18606174" "subst" "0" "02329" "RS1_000439" "g.18606174C>T" "" "" "" "CDKL5(NM_001323289.2):c.655C>T (p.Q219*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001016012" "0" "90" "X" "18665423" "18665423" "subst" "1.67844E-5" "02325" "RS1_000029" "g.18665423C>T" "" "" "" "RS1(NM_000330.3):c.214G>A (p.E72K), RS1(NM_000330.4):c.214G>A (p.E72K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001017747" "0" "70" "X" "18616629" "18616629" "subst" "0" "03544" "CDKL5_000170" "g.18616629T>G" "" "" "" "" "" "De novo" "-" "" "0" "" "" "g.18598509T>G" "{CV:3381752}" "likely pathogenic" "ACMG" "0001027472" "0" "90" "X" "18665349" "18665349" "subst" "0" "02327" "RS1_000147" "g.18665349C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001044243" "0" "30" "X" "18525284" "18525284" "subst" "5.60375E-6" "01804" "RS1_000514" "g.18525284A>G" "" "" "" "CDKL5(NM_001323289.2):c.64+4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044244" "0" "30" "X" "18577478" "18577478" "subst" "0" "01804" "RS1_000515" "g.18577478G>A" "" "" "" "CDKL5(NM_001323289.2):c.100-5119G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001058527" "0" "90" "X" "18528948" "18528948" "subst" "0" "00006" "CDKL5_000171" "g.18528948G>A" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.18510828G>A" "" "pathogenic" "" "0001058528" "0" "90" "X" "18622719" "18622719" "subst" "0" "00006" "CDKL5_000030" "g.18622719C>T" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.18604599C>T" "" "pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes CDKL5 ## Count = 868 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000006452" "00001567" "50" "2981" "-263" "2981" "-263" "c.2981-263G>T" "r.(=)" "p.(=)" "" "0000062335" "00001567" "50" "2723" "0" "2723" "0" "c.2723G>A" "r.(?)" "p.(Cys908Tyr)" "" "0000062336" "00001567" "50" "2052" "0" "2052" "0" "c.2052A>G" "r.(=)" "p.(=)" "" "0000062337" "00001567" "50" "431" "0" "431" "0" "c.431G>T" "r.(?)" "p.(Ser144Ile)" "" "0000062338" "00001567" "50" "745" "-56" "745" "-56" "c.745-56G>A" "r.(=)" "p.(=)" "" "0000062339" "00001567" "90" "1390" "0" "1390" "0" "c.1390C>T" "r.(?)" "p.(Gln464*)" "" "0000062340" "00001567" "90" "2182" "0" "2182" "0" "c.2182del" "r.(?)" "p.(His728Metfs*56)" "" "0000062341" "00001567" "90" "1622" "0" "1622" "0" "c.1622del" "r.(?)" "p.(Leu541Cysfs*31)" "" "0000062342" "00001567" "50" "2487" "0" "2487" "0" "c.2487G>A" "r.(=)" "p.(=)" "" "0000062343" "00001567" "90" "2377" "0" "2377" "0" "c.2377del" "r.(?)" "p.(Val793Tyrfs*10)" "" "0000062344" "00001567" "50" "683" "0" "683" "0" "c.683G>A" "r.(?)" "p.(Gly228Glu)" "" "0000062345" "00001567" "10" "-163" "16516" "-163" "16516" "c.-163+16516G>C" "r.(=)" "p.(=)" "" "0000062346" "00001567" "50" "449" "0" "449" "0" "c.449A>G" "r.(?)" "p.(Lys150Arg)" "" "0000062347" "00001567" "90" "1648" "0" "1648" "0" "c.1648C>T" "r.(?)" "p.(Arg550*)" "" "0000062348" "00001567" "50" "683" "0" "683" "0" "c.683G>T" "r.(?)" "p.(Gly228Val)" "" "0000062349" "00001567" "50" "464" "0" "464" "0" "c.464G>A" "r.(?)" "p.(Gly155Asp)" "" "0000062350" "00001567" "50" "145" "0" "145" "0" "c.145G>A" "r.(?)" "p.(Glu49Lys)" "" "0000062351" "00001567" "50" "464" "-81" "464" "-81" "c.464-81T>C" "r.(=)" "p.(=)" "" "0000079564" "00001567" "00" "104" "0" "104" "0" "c.104C>T" "r.(?)" "p.(Thr35Ile)" "" "0000130261" "00001567" "70" "119" "0" "119" "0" "c.119C>A" "r.(?)" "p.(Ala40Glu)" "" "0000130283" "00001567" "70" "858" "0" "858" "0" "c.858C>A" "r.(?)" "p.(Tyr286*)" "" "0000140783" "00001567" "90" "0" "0" "0" "0" "c.(2797+1243_2798-1)_*85{0}" "r.?" "p.?" "19i_" "0000184789" "00001567" "10" "145" "17" "145" "17" "c.145+17A>G" "r.(?)" "p.(=)" "4i" "0000184790" "00001567" "10" "3003" "0" "3003" "0" "c.3003C>T" "r.(?)" "p.(His1001=)" "21" "0000184791" "00001567" "10" "3084" "0" "3084" "0" "c.3084G>T" "r.(?)" "p.(Thr1028=)" "21" "0000184792" "00001567" "10" "2372" "0" "2372" "0" "c.2372A>C" "r.(?)" "p.(Gln791Pro)" "16" "0000184793" "00001567" "10" "99" "29" "99" "29" "c.99+29T>G" "r.(=)" "p.(=)" "3i" "0000184794" "00001567" "10" "145" "27" "145" "28" "c.145+27_145+28del" "r.(=)" "p.(=)" "4i" "0000184795" "00001567" "10" "404" "-53" "404" "-53" "c.404-53C>T" "r.(=)" "p.(=)" "6i" "0000184796" "00001567" "10" "555" "-19" "555" "-19" "c.555-19C>G" "r.(=)" "p.?" "8i" "0000184797" "00001567" "10" "2046" "79" "2046" "79" "c.2046+79G>A" "r.(=)" "p.(=)" "13i" "0000184798" "00001567" "10" "2372" "0" "2372" "0" "c.2372A>C" "r.(?)" "p.(Gln791Pro)" "16" "0000184799" "00001567" "10" "3003" "0" "3003" "0" "c.3003C>T" "r.(?)" "p.(=)" "21" "0000184800" "00001567" "10" "3039" "15" "3039" "15" "c.3039+15C>T" "r.(=)" "p.(=)" "21i" "0000184801" "00001567" "10" "3084" "0" "3084" "0" "c.3084G>T" "r.(?)" "p.(=)" "21" "0000184802" "00001567" "10" "145" "17" "145" "17" "c.145+17A>G" "r.(=)" "p.(=)" "4i" "0000184803" "00001567" "10" "2372" "0" "2372" "0" "c.2372A>C" "r.(?)" "p.(Gln791Pro)" "16" "0000184804" "00001567" "10" "3003" "0" "3003" "0" "c.3003C>T" "r.(?)" "p.(?)" "21" "0000184805" "00001567" "10" "3084" "0" "3084" "0" "c.3084G>T" "r.(?)" "p.(?)" "21" "0000184806" "00001567" "10" "3223" "0" "3223" "0" "c.*130A>G" "r.(?)" "p.(=)" "21" "0000184807" "00001567" "10" "3224" "0" "3224" "0" "c.*131T>A" "r.(?)" "p.(=)" "21" "0000184808" "00001567" "30" "3003" "0" "3003" "0" "c.3003C>T" "r.(?)" "p.(=)" "21" "0000184809" "00001567" "30" "3084" "0" "3084" "0" "c.3084G>A" "r.(?)" "p.(=)" "21" "0000184810" "00001567" "50" "2200" "0" "2200" "0" "c.2200A>G" "r.(?)" "p.(Thr734Ala)" "15" "0000184811" "00001567" "50" "2840" "0" "2840" "0" "c.2840C>T" "r.(?)" "p.(Pro947Leu)" "20" "0000184812" "00001567" "50" "2372" "0" "2372" "0" "c.2372A>C" "r.(?)" "p.(Gln791Pro)" "16" "0000184813" "00001567" "50" "555" "-19" "555" "-19" "c.555-19C>G" "r.(spl?)" "p.?" "8i" "0000184814" "00001567" "50" "555" "-19" "555" "-19" "c.555-19C>G" "r.(spl?)" "p.?" "8i" "0000184815" "00001567" "50" "0" "0" "0" "0" "c.978--42_978-50del" "r.(spl?)" "p.?" "11i" "0000184816" "00001567" "50" "2378" "0" "2378" "0" "c.2378T>C" "r.(?)" "p.(V793A)" "17" "0000184817" "00001567" "50" "145" "27" "145" "28" "c.145+27_145+28del" "r.(?)" "p.(=)" "4i" "0000184818" "00001567" "50" "145" "27" "145" "28" "c.145+27_145+28del" "r.(?)" "p.(=)" "4i" "0000184819" "00001567" "50" "145" "27" "145" "28" "c.145+27_145+28del" "r.(?)" "p.(=)" "4i" "0000184820" "00001567" "50" "145" "27" "145" "28" "c.145+27_145+28del" "r.(?)" "p.(=)" "4i" "0000184821" "00001567" "50" "2713" "20" "2713" "20" "c.2713+20G>A" "r.(?)" "p.(=)" "18i" "0000184822" "00001567" "50" "549" "0" "549" "0" "c.549dupA" "r.(?)" "p.(Leu184Thrfs*22)" "8" "0000184823" "00001567" "70" "2530" "0" "2530" "0" "c.2530del" "r.(?)" "p.(His844Ilefs*19)" "18" "0000184824" "00001567" "90" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ala40Val)" "4" "0000184825" "00001567" "90" "1648" "0" "1648" "0" "c.1648C>T" "r.0" "p.(Arg550*)" "12" "0000184826" "00001567" "90" "2500" "0" "2500" "0" "c.2500C>T" "r.0" "p.(Q834*)" "18" "0000184827" "00001567" "90" "-162" "-1" "99" "1" "c.-162-?_99+?del" "r.-162_99del" "p.0?" "1i" "0000184828" "00001567" "90" "64" "2" "64" "2" "c.64+2del" "r.spl?" "p.?" "2i" "0000184829" "00001567" "90" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ala40Val)" "4" "0000184830" "00001567" "90" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ala40Val)" "4" "0000184831" "00001567" "90" "145" "2" "145" "2" "c.145+2T>C" "r.100_145del" "p.Glu34Lysfs*60" "4i" "0000184832" "00001567" "90" "163" "0" "166" "0" "c.163_166del" "r.(?)" "p.(fs*)" "5" "0000184833" "00001567" "90" "175" "0" "175" "0" "c.175C>T" "r.(?)" "p.(R59*)" "5" "0000184834" "00001567" "90" "183" "0" "183" "0" "c.183delT" "r.(?)" "p.(fs*)" "5" "0000184835" "00001567" "90" "183" "0" "183" "0" "c.183delT" "r.(?)" "p.(fs*)" "5" "0000184836" "00001567" "90" "183" "0" "183" "0" "c.183delT" "r.(?)" "p.(fs*)" "5" "0000184837" "00001567" "90" "194" "0" "194" "0" "c.194G>A" "r.(?)" "p.(R65Q)" "5" "0000184838" "00001567" "90" "215" "0" "215" "0" "c.215T>A" "r.(?)" "p.(I72N)" "5" "0000184839" "00001567" "90" "215" "0" "215" "0" "c.215T>C" "r.215u>c" "p.Ile72Thr" "5" "0000184840" "00001567" "90" "215" "0" "215" "0" "c.215T>C" "r.(?)" "p.(I72T)" "5" "0000184841" "00001567" "90" "216" "0" "216" "0" "c.216T>A" "r.(?)" "p.(I72I)" "5" "0000184842" "00001567" "90" "229" "0" "232" "0" "c.229_232del" "r.(?)" "p.(Glu77HisfsTer35)" "5" "0000184843" "00001567" "90" "352" "0" "352" "0" "c.352C>T" "r.(?)" "p.(Q118*)" "6" "0000184844" "00001567" "90" "380" "0" "380" "0" "c.380A>G" "r.(?)" "p.(His127Arg)" "6" "0000184845" "00001567" "90" "404" "-1" "404" "-1" "c.404-1G>T" "r.spl?" "p.?" "6i" "0000184846" "00001567" "90" "425" "0" "425" "0" "c.425T>A" "r.(?)" "p.(L142*)" "7" "0000184847" "00001567" "90" "455" "0" "455" "0" "c.455G>T" "r.(?)" "p.(C152F)" "7" "0000184848" "00001567" "90" "455" "0" "455" "0" "c.455G>T" "r.(?)" "p.(C152F)" "7" "0000184849" "00001567" "90" "525" "0" "525" "0" "c.525A>T" "r.(?)" "p.(R175S)" "8" "0000184850" "00001567" "90" "525" "0" "525" "0" "c.525A>T" "r.(?)" "p.(R175S)" "8" "0000184851" "00001567" "90" "525" "0" "525" "0" "c.525A>T" "r.(?)" "p.(R175S)" "8" "0000184852" "00001567" "90" "532" "0" "532" "0" "c.532C>T" "r.(?)" "p.(R178W)" "8" "0000184853" "00001567" "90" "533" "0" "533" "0" "c.533G>C" "r.(?)" "p.(R178P)" "8" "0000184854" "00001567" "90" "539" "0" "539" "0" "c.539C>T" "r.(?)" "p.(P180L)" "8" "0000184855" "00001567" "90" "659" "0" "659" "0" "c.659T>C" "r.(?)" "p.(L220P)" "9" "0000184856" "00001567" "90" "678" "0" "691" "0" "c.678_691delins?" "r.(?)" "p.(fs*)" "9" "0000184857" "00001567" "90" "680" "0" "680" "0" "c.680T>G" "r.(?)" "p.(L227R)" "9" "0000184866" "00001567" "90" "801" "0" "802" "0" "c.801_802del" "r.(?)" "p.(Asn267LysfsTer5)" "10" "0000184867" "00001567" "90" "838" "0" "847" "0" "c.838_847del" "r.(?)" "p.?" "11" "0000184868" "00001567" "90" "863" "0" "863" "0" "c.863C>T" "r.(?)" "p.(T288I)" "11" "0000184869" "00001567" "90" "864" "0" "864" "0" "c.864dup" "r.(?)" "p.(Glu289ArgfsTer37)" "11" "0000184870" "00001567" "90" "872" "0" "872" "0" "c.872G>A" "r.(?)" "p.(C291Y)" "11" "0000184871" "00001567" "90" "902" "0" "903" "0" "c.902_903dup" "r.(?)" "p.(Leu302Aspfs*49)" "11" "0000184872" "00001567" "90" "978" "-2" "978" "-2" "c.978-2A>G" "r.spl?" "p.?" "11i" "0000184873" "00001567" "90" "1196" "0" "1196" "0" "c.1196A>C" "r.(?)" "p.(N399T)" "12" "0000184874" "00001567" "90" "1648" "0" "1648" "0" "c.1648C>T" "r.(?)" "p.(R550*)" "12" "0000184875" "00001567" "90" "1675" "0" "1675" "0" "c.1675C>T" "r.(?)" "p.(R559*)" "12" "0000184876" "00001567" "90" "1892" "0" "1893" "0" "c.1892_1893dup" "r.(?)" "p.?" "12" "0000184877" "00001567" "90" "1311" "0" "1311" "0" "c.1311dup" "r.(?)" "p.(Ser438GlnfsTer25)" "13" "0000184878" "00001567" "90" "2016" "0" "2016" "0" "c.2016del" "r.(?)" "p.(Ser673LeufsTer111)" "13" "0000184879" "00001567" "90" "2045" "0" "2045" "0" "c.2045delAinsGCGTCACAATAAAATAT" "r.(spl?)" "p.?" "13" "0000184880" "00001567" "90" "2048" "0" "2048" "0" "c.2048del" "r.2047delG" "p.(Gly683ValfsTer101)" "13i" "0000184881" "00001567" "90" "2152" "0" "2152" "0" "c.2152G>A" "r.(spl?)" "p.(Val718Met)" "14" "0000184882" "00001567" "90" "2325" "0" "2326" "0" "c.2325_2326del" "r.(?)" "p.?" "16" "0000184883" "00001567" "90" "2343" "0" "2343" "0" "c.2343del" "r.(?)" "p.(Arg781SerfsTer3)" "16" "0000184884" "00001567" "90" "2363" "0" "2367" "0" "c.2363_2367del" "r.(?)" "p.(fs*)" "16" "0000184885" "00001567" "90" "2376" "5" "2376" "5" "c.2376+5G>A" "r.(?)" "p.?" "16i" "0000184886" "00001567" "90" "2377" "1" "2377" "1" "c.2377+1G>A" "r.spl?" "p.?" "16i" "0000184887" "00001567" "90" "2635" "0" "2636" "0" "c.2635_2636del" "r.(?)" "p.(fs*)" "18" "0000222143" "00001567" "90" "2714" "-1477" "2714" "-1477" "c.2714-1477C>T" "r.(=)" "p.(=)" "" "0000222860" "00001567" "70" "176" "0" "176" "0" "c.176G>C" "r.(?)" "p.(Arg59Pro)" "5" "0000251144" "00001567" "10" "2372" "0" "2372" "0" "c.2372A>C" "r.(?)" "p.(Gln791Pro)" "" "0000251671" "00001567" "10" "65" "-86" "65" "-86" "c.65-86A>G" "r.(=)" "p.(=)" "" "0000251672" "00001567" "10" "283" "-103" "283" "-103" "c.283-103del" "r.(=)" "p.(=)" "" "0000251673" "00001567" "10" "745" "-148" "745" "-148" "c.745-148del" "r.(=)" "p.(=)" "" "0000251983" "00001567" "30" "886" "0" "886" "0" "c.886A>G" "r.(?)" "p.(Thr296Ala)" "" "0000252352" "00001567" "30" "282" "19" "282" "19" "c.282+19A>G" "r.(=)" "p.(=)" "" "0000252353" "00001567" "30" "2496" "16" "2496" "16" "c.2496+16A>G" "r.(=)" "p.(=)" "" "0000255501" "00001567" "90" "1714" "0" "1714" "0" "c.1714A>T" "r.(?)" "p.(Lys572Ter)" "" "0000256167" "00001567" "50" "1031" "0" "1031" "0" "c.1031A>G" "r.(?)" "p.(Lys344Arg)" "" "0000264494" "00001567" "90" "2714" "-3902" "2714" "-3902" "c.2714-3902del" "r.(=)" "p.(=)" "" "0000264495" "00001567" "10" "2797" "1169" "2797" "1169" "c.2797+1169C>T" "r.(=)" "p.(=)" "" "0000266614" "00001567" "30" "100" "-7" "100" "-7" "c.100-7C>T" "r.(=)" "p.(=)" "" "0000266615" "00001567" "90" "1675" "0" "1675" "0" "c.1675C>T" "r.(?)" "p.(Arg559Ter)" "" "0000266616" "00001567" "30" "3003" "0" "3003" "0" "c.3003C>T" "r.(?)" "p.(His1001=)" "" "0000266617" "00001567" "30" "3084" "0" "3084" "0" "c.3084G>A" "r.(?)" "p.(Thr1028=)" "" "0000266618" "00001567" "90" "403" "1" "403" "1" "c.403+1G>T" "r.spl?" "p.?" "" "0000269908" "00001567" "10" "-162" "-5" "-162" "-5" "c.-162-5T>C" "r.spl?" "p.?" "" "0000269909" "00001567" "30" "100" "-7" "100" "-7" "c.100-7C>T" "r.(=)" "p.(=)" "" "0000269910" "00001567" "10" "1330" "0" "1330" "0" "c.1330C>T" "r.(?)" "p.(Arg444Cys)" "" "0000269911" "00001567" "30" "1332" "0" "1332" "0" "c.1332C>T" "r.(?)" "p.(Arg444=)" "" "0000269913" "00001567" "30" "1613" "0" "1613" "0" "c.1613C>T" "r.(?)" "p.(Thr538Met)" "" "0000269914" "00001567" "10" "2600" "0" "2600" "0" "c.2600C>A" "r.(?)" "p.(Thr867Asn)" "" "0000269915" "00001567" "10" "2797" "72" "2797" "72" "c.2797+72del" "r.(=)" "p.(=)" "" "0000269916" "00001567" "10" "2855" "0" "2855" "0" "c.2855G>A" "r.(?)" "p.(Arg952Gln)" "" "0000269917" "00001567" "10" "2995" "0" "2995" "0" "c.2995G>A" "r.(?)" "p.(Val999Met)" "" "0000269918" "00001567" "10" "3003" "0" "3003" "0" "c.3003C>T" "r.(?)" "p.(His1001=)" "" "0000269919" "00001567" "10" "3084" "0" "3084" "0" "c.3084G>A" "r.(?)" "p.(Thr1028=)" "" "0000269920" "00001567" "10" "404" "-16" "404" "-16" "c.404-16del" "r.(=)" "p.(=)" "" "0000269921" "00001567" "90" "514" "0" "514" "0" "c.514G>T" "r.(?)" "p.(Val172Phe)" "" "0000269922" "00001567" "70" "533" "0" "533" "0" "c.533G>A" "r.(?)" "p.(Arg178Gln)" "" "0000269923" "00001567" "90" "533" "0" "533" "0" "c.533G>C" "r.(?)" "p.(Arg178Pro)" "" "0000269924" "00001567" "10" "555" "-19" "555" "-19" "c.555-19C>G" "r.(=)" "p.(=)" "" "0000269925" "00001567" "90" "587" "0" "587" "0" "c.587C>T" "r.(?)" "p.(Ser196Leu)" "" "0000269926" "00001567" "30" "603" "0" "603" "0" "c.603T>C" "r.(?)" "p.(Leu201=)" "" "0000269927" "00001567" "10" "826" "-135" "826" "-135" "c.826-135del" "r.(=)" "p.(=)" "" "0000273057" "00001567" "10" "145" "27" "145" "28" "c.145+27_145+28del" "r.(=)" "p.(=)" "" "0000273058" "00001567" "10" "1613" "0" "1613" "0" "c.1613C>T" "r.(?)" "p.(Thr538Met)" "" "0000273059" "00001567" "90" "1945" "-1" "1945" "-1" "c.1945-1G>T" "r.spl?" "p.?" "" "0000273060" "00001567" "30" "2613" "0" "2613" "0" "c.2613C>T" "r.(?)" "p.(Phe871=)" "" "0000273061" "00001567" "10" "2995" "0" "2995" "0" "c.2995G>A" "r.(?)" "p.(Val999Met)" "" "0000273062" "00001567" "30" "3084" "0" "3084" "0" "c.3084G>A" "r.(?)" "p.(Thr1028=)" "" "0000273063" "00001567" "10" "555" "-19" "555" "-19" "c.555-19C>G" "r.(=)" "p.(=)" "" "0000307382" "00001567" "10" "2714" "-3876" "2714" "-3876" "c.2714-3876G>A" "r.(=)" "p.(=)" "" "0000333319" "00001567" "50" "239" "0" "239" "0" "c.239G>T" "r.(?)" "p.(Arg80Leu)" "" "0000333320" "00001567" "50" "1247" "0" "1248" "0" "c.1247_1248del" "r.(?)" "p.(Glu416ValfsTer2)" "" "0000333321" "00001567" "50" "1331" "0" "1331" "0" "c.1331G>A" "r.(?)" "p.(Arg444His)" "" "0000333322" "00001567" "50" "1339" "0" "1339" "0" "c.1339T>C" "r.(?)" "p.(Phe447Leu)" "" "0000333323" "00001567" "50" "1386" "0" "1386" "0" "c.1386A>C" "r.(?)" "p.(Glu462Asp)" "" "0000333326" "00001567" "50" "2635" "0" "2636" "0" "c.2635_2636del" "r.(?)" "p.(Leu879GlufsTer30)" "" "0000333328" "00001567" "30" "21611" "0" "21611" "0" "c.*18518G>C" "r.(=)" "p.(=)" "" "0000337397" "00001567" "90" "554" "1" "554" "1" "c.554+1G>A" "r.spl?" "p.?" "" "0000342908" "00001567" "10" "1330" "0" "1330" "0" "c.1330C>T" "r.(?)" "p.(Arg444Cys)" "" "0000343547" "00001567" "90" "533" "0" "533" "0" "c.533G>A" "r.(?)" "p.(Arg178Gln)" "" "0000343905" "00001567" "90" "389" "0" "389" "0" "c.389A>T" "r.(?)" "p.(Asp130Val)" "" "0000344551" "00001567" "90" "2714" "-1471" "2714" "-1471" "c.2714-1471del" "r.(=)" "p.(=)" "" "0000344974" "00001567" "10" "2372" "0" "2372" "0" "c.2372A>C" "r.(?)" "p.(Gln791Pro)" "" "0000345645" "00001567" "90" "2797" "1102" "2797" "1102" "c.2797+1102C>G" "r.(=)" "p.(=)" "" "0000345858" "00001567" "70" "59" "0" "59" "0" "c.59G>A" "r.(?)" "p.(Gly20Asp)" "" "0000346259" "00001567" "50" "2797" "1206" "2797" "1206" "c.2797+1206C>A" "r.(=)" "p.(=)" "" "0000346351" "00001567" "10" "3003" "0" "3003" "0" "c.3003C>T" "r.(?)" "p.(His1001=)" "" "0000347264" "00001567" "50" "1886" "0" "1886" "0" "c.1886T>C" "r.(?)" "p.(Leu629Ser)" "" "0000348268" "00001567" "90" "2714" "-3936" "2714" "-3936" "c.2714-3936G>C" "r.(=)" "p.(=)" "" "0000348814" "00001567" "90" "587" "0" "587" "0" "c.587C>T" "r.(?)" "p.(Ser196Leu)" "" "0000349044" "00001567" "50" "1442" "0" "1442" "0" "c.1442C>T" "r.(?)" "p.(Ser481Phe)" "" "0000349239" "00001567" "10" "3084" "0" "3084" "0" "c.3084G>A" "r.(?)" "p.(Thr1028=)" "" "0000350988" "00001567" "90" "282" "2" "282" "2" "c.282+2T>G" "r.spl?" "p.?" "" "0000350989" "00001567" "90" "464" "-1" "464" "-1" "c.464-1G>A" "r.spl?" "p.?" "" "0000400771" "00001567" "90" "282" "3" "282" "6" "c.282+3_282+6del" "r.spl?" "p.?" "" "0000441232" "00001567" "90" "2635" "0" "2636" "0" "c.2635_2636del" "r.(?)" "p.(Leu879Glufs*30)" "" "0000575131" "00001567" "30" "145" "17" "145" "17" "c.145+17A>G" "r.(=)" "p.(=)" "" "0000575132" "00001567" "10" "145" "17" "145" "17" "c.145+17A>G" "r.(=)" "p.(=)" "" "0000575136" "00001567" "30" "145" "27" "145" "28" "c.145+27_145+28dup" "r.(=)" "p.(=)" "" "0000575137" "00001567" "50" "194" "0" "194" "0" "c.194G>A" "r.(?)" "p.(Arg65Gln)" "" "0000575138" "00001567" "90" "277" "0" "277" "0" "c.277G>T" "r.(?)" "p.(Glu93Ter)" "" "0000575139" "00001567" "50" "436" "0" "436" "0" "c.436A>C" "r.(?)" "p.(Asn146His)" "" "0000575140" "00001567" "30" "464" "-9" "464" "-9" "c.464-9A>G" "r.(=)" "p.(=)" "" "0000575141" "00001567" "90" "535" "0" "535" "0" "c.535T>A" "r.(?)" "p.(Ser179Thr)" "" "0000575142" "00001567" "30" "1094" "0" "1094" "0" "c.1094G>A" "r.(?)" "p.(Ser365Asn)" "" "0000575143" "00001567" "30" "1118" "0" "1118" "0" "c.1118G>C" "r.(?)" "p.(Gly373Ala)" "" "0000575144" "00001567" "30" "1135" "0" "1135" "0" "c.1135C>G" "r.(?)" "p.(Leu379Val)" "" "0000575145" "00001567" "50" "1330" "0" "1330" "0" "c.1330C>T" "r.(?)" "p.(Arg444Cys)" "" "0000575146" "00001567" "30" "1330" "0" "1330" "0" "c.1330C>T" "r.(?)" "p.(Arg444Cys)" "" "0000575148" "00001567" "10" "1619" "0" "1619" "0" "c.1619C>G" "r.(?)" "p.(Thr540Ser)" "" "0000575149" "00001567" "90" "1897" "0" "1897" "0" "c.1897C>T" "r.(?)" "p.(Gln633Ter)" "" "0000575150" "00001567" "30" "2046" "3" "2046" "3" "c.2046+3A>G" "r.spl?" "p.?" "" "0000575151" "00001567" "30" "2157" "0" "2157" "0" "c.2157A>T" "r.(?)" "p.(Pro719=)" "" "0000575152" "00001567" "50" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Gly746Arg)" "" "0000575154" "00001567" "10" "2713" "49" "2713" "49" "c.2713+49C>T" "r.(=)" "p.(=)" "" "0000575155" "00001567" "30" "2714" "-3904" "2714" "-3904" "c.2714-3904G>A" "r.(=)" "p.(=)" "" "0000575156" "00001567" "70" "2714" "-1483" "2714" "-1483" "c.2714-1483T>A" "r.(=)" "p.(=)" "" "0000575157" "00001567" "70" "2797" "1096" "2797" "1096" "c.2797+1096C>G" "r.(=)" "p.(=)" "" "0000575158" "00001567" "90" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000575159" "00001567" "50" "2897" "0" "2897" "0" "c.2897T>C" "r.(?)" "p.(Val966Ala)" "" "0000575160" "00001567" "10" "2995" "0" "2995" "0" "c.2995G>A" "r.(?)" "p.(Val999Met)" "" "0000575161" "00001567" "50" "21563" "0" "21563" "0" "c.*18470T>C" "r.(=)" "p.(=)" "" "0000575162" "00001567" "30" "21574" "0" "21574" "0" "c.*18481C>T" "r.(=)" "p.(=)" "" "0000619373" "00001567" "30" "99" "7" "99" "7" "c.99+7A>G" "r.(=)" "p.(=)" "" "0000619376" "00001567" "90" "1415" "0" "1416" "0" "c.1415_1416del" "r.(?)" "p.(Thr472AsnfsTer6)" "" "0000619377" "00001567" "50" "2912" "0" "2912" "0" "c.2912G>A" "r.(?)" "p.(Gly971Asp)" "" "0000624540" "00001567" "10" "1332" "0" "1332" "0" "c.1332C>T" "r.(?)" "p.(Arg444=)" "" "0000624541" "00001567" "30" "1866" "0" "1866" "0" "c.1866C>T" "r.(?)" "p.(Ala622=)" "" "0000624542" "00001567" "30" "2022" "0" "2022" "0" "c.2022C>G" "r.(?)" "p.(Ser674=)" "" "0000624543" "00001567" "30" "2493" "0" "2493" "0" "c.2493C>T" "r.(?)" "p.(Thr831=)" "" "0000624544" "00001567" "10" "2714" "-3876" "2714" "-3876" "c.2714-3876G>A" "r.(=)" "p.(=)" "" "0000624545" "00001567" "90" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000629310" "00001567" "90" "1942" "0" "1942" "0" "c.1942C>T" "r.(?)" "p.(Gln648*)" "" "0000652857" "00001567" "90" "146" "-1" "146" "-1" "c.146-1G>A" "r.spl?" "p.?" "" "0000652858" "00001567" "90" "220" "0" "220" "0" "c.220G>T" "r.(?)" "p.(Glu74*)" "" "0000652859" "00001567" "90" "250" "0" "250" "0" "c.250A>T" "r.(?)" "p.(Lys84*)" "" "0000652860" "00001567" "90" "400" "0" "400" "0" "c.400C>T" "r.(?)" "p.(Arg134*)" "" "0000652861" "00001567" "70" "404" "-3" "404" "-3" "c.404-3C>A" "r.spl?" "p.?" "" "0000652862" "00001567" "90" "404" "-2" "404" "-2" "c.404-2A>G" "r.spl?" "p.?" "" "0000652864" "00001567" "90" "449" "0" "449" "0" "c.449A>G" "r.(?)" "p.(Lys150Arg)" "" "0000652865" "00001567" "90" "577" "0" "577" "0" "c.577G>A" "r.(?)" "p.(Asp193Asn)" "" "0000652866" "00001567" "10" "2372" "0" "2372" "0" "c.2372A>C" "r.(?)" "p.(Gln791Pro)" "" "0000659233" "00001567" "90" "1842" "0" "1842" "0" "c.1842T>A" "r.(?)" "p.(Tyr614Ter)" "" "0000667679" "00001567" "90" "464" "-2" "464" "-2" "c.464-2A>G" "r.spl" "p.?" "" "0000667680" "00001567" "90" "433" "0" "433" "0" "c.433C>T" "r.(?)" "p.(His145Tyr)" "" "0000667681" "00001567" "90" "545" "0" "545" "0" "c.545T>C" "r.(?)" "p.(Leu182Pro)" "" "0000667682" "00001567" "90" "2564" "0" "2564" "0" "c.2564C>G" "r.(?)" "p.(Ser855*)" "" "0000667683" "00001567" "90" "1925" "0" "1925" "0" "c.1925del" "r.(?)" "p.(Leu642Argfs*16)" "" "0000667684" "00001567" "90" "533" "0" "533" "0" "c.533G>A" "r.(?)" "p.(Arg178Gln)" "" "0000667685" "00001567" "90" "620" "0" "620" "0" "c.620G>A" "r.(?)" "p.(Gly207Glu)" "" "0000667686" "00001567" "70" "1925" "0" "1925" "0" "c.1925del" "r.(?)" "p.(Leu642Argfs*16)" "" "0000667700" "00001567" "50" "1741" "0" "1741" "0" "c.1741C>T" "r.(?)" "p.(His581Tyr)" "" "0000667701" "00001567" "50" "2572" "0" "2572" "0" "c.2572C>T" "r.(?)" "p.(Arg858Cys)" "" "0000670105" "00001567" "10" "2372" "0" "2372" "0" "c.2372A>C" "r.(?)" "p.(Gln791Pro)" "" "0000673666" "00001567" "70" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ala40Val)" "" "0000673667" "00001567" "70" "450" "0" "450" "0" "c.450A>C" "r.(?)" "p.(Lys150Asn)" "" "0000682318" "00001567" "30" "1002" "0" "1002" "0" "c.1002T>C" "r.(?)" "p.(Ala334=)" "" "0000682319" "00001567" "30" "2046" "12" "2046" "12" "c.2046+12del" "r.(=)" "p.(=)" "" "0000682320" "00001567" "30" "2714" "-3876" "2714" "-3876" "c.2714-3876G>A" "r.(=)" "p.(=)" "" "0000682321" "00001567" "30" "2867" "0" "2867" "0" "c.2867G>A" "r.(?)" "p.(Arg956His)" "" "0000682322" "00001567" "30" "2979" "0" "2979" "0" "c.2979C>T" "r.(?)" "p.(Ser993=)" "" "0000682323" "00001567" "50" "21581" "0" "21581" "0" "c.*18488G>A" "r.(=)" "p.(=)" "" "0000685631" "00001567" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000686212" "00001567" "50" "1564" "0" "1564" "0" "c.1564T>G" "r.(?)" "p.(Leu522Val)" "" "0000686214" "00001567" "70" "2276" "1" "2276" "1" "c.2276+1G>A" "r.spl" "p.?" "" "0000686215" "00001567" "90" "2376" "2" "2376" "2" "c.2376+2T>A" "r.spl" "p.?" "" "0000686216" "00001567" "90" "374" "0" "374" "0" "c.374G>A" "r.(?)" "p.(Trp125*)" "" "0000686217" "00001567" "70" "178" "0" "178" "0" "c.178G>A" "r.(?)" "p.(Glu60Lys)" "" "0000686218" "00001567" "90" "1247" "0" "1248" "0" "c.1247_1248del" "r.(?)" "p.(Glu416Valfs*2)" "" "0000693509" "00001567" "30" "1767" "0" "1767" "0" "c.1767C>T" "r.(?)" "p.(His589=)" "" "0000696947" "00001567" "90" "1103" "0" "1103" "0" "c.1103dup" "r.(?)" "p.(Asn368Lysfs*8)" "12" "0000704185" "00001567" "90" "358" "0" "367" "0" "c.358_367del" "r.(?)" "p.(Ile120PhefsTer14)" "" "0000728731" "00001567" "30" "283" "-14" "283" "-14" "c.283-14T>C" "r.(=)" "p.(=)" "" "0000728732" "00001567" "50" "1837" "0" "1837" "0" "c.1837A>T" "r.(?)" "p.(Met613Leu)" "" "0000728733" "00001567" "30" "2408" "0" "2408" "0" "c.2408C>T" "r.(?)" "p.(Thr803Met)" "" "0000728734" "00001567" "90" "2578" "0" "2578" "0" "c.2578C>T" "r.(?)" "p.(Gln860Ter)" "" "0000728735" "00001567" "90" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000728736" "00001567" "90" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000728737" "00001567" "30" "2799" "0" "2799" "0" "c.2799A>G" "r.(?)" "p.(Gly933=)" "" "0000728738" "00001567" "30" "2845" "0" "2845" "0" "c.2845G>A" "r.(?)" "p.(Val949Ile)" "" "0000728739" "00001567" "30" "2899" "0" "2899" "0" "c.2899C>G" "r.(?)" "p.(Leu967Val)" "" "0000728740" "00001567" "30" "3083" "0" "3083" "0" "c.3083C>T" "r.(?)" "p.(Thr1028Met)" "" "0000728741" "00001567" "50" "6299" "0" "6299" "0" "c.*3206G>A" "r.(=)" "p.(=)" "" "0000763089" "00001567" "90" "2854" "0" "2854" "0" "c.2854C>T" "r.(?)" "p.(Arg952*)" "" "0000763184" "00001567" "90" "2854" "0" "2854" "0" "c.2854C>T" "r.(?)" "p.(Arg952*)" "" "0000786783" "00001567" "70" "1842" "0" "1842" "0" "c.1842T>A" "r.(?)" "p.(Tyr614Ter)" "12" "0000787226" "00001567" "50" "517" "0" "517" "0" "c.517G>C" "r.(?)" "p.(Ala173Pro)" "8" "0000787227" "00001567" "50" "1837" "0" "1837" "0" "c.1837A>C" "r.(?)" "p.(Met613Leu)" "12" "0000787228" "00001567" "50" "2269" "0" "2269" "0" "c.2269G>A" "r.(?)" "p.(Asp757Asn)" "15" "0000787229" "00001567" "50" "2896" "0" "2896" "0" "c.2896G>A" "r.(?)" "p.(Val966Ile)" "20" "0000787467" "00001567" "50" "2896" "0" "2896" "0" "c.2896G>A" "r.(?)" "p.(Val966Ile)" "20" "0000810204" "00001567" "30" "180" "0" "180" "0" "c.180G>A" "r.(?)" "p.(Glu60=)" "" "0000810205" "00001567" "30" "1080" "0" "1080" "0" "c.1080C>T" "r.(?)" "p.(Leu360=)" "" "0000810206" "00001567" "30" "1180" "0" "1180" "0" "c.1180A>G" "r.(?)" "p.(Ser394Gly)" "" "0000810207" "00001567" "30" "1338" "0" "1338" "0" "c.1338A>T" "r.(?)" "p.(Ser446=)" "" "0000810208" "00001567" "30" "2409" "0" "2409" "0" "c.2409G>A" "r.(?)" "p.(Thr803=)" "" "0000810209" "00001567" "30" "2422" "0" "2422" "0" "c.2422A>G" "r.(?)" "p.(Ile808Val)" "" "0000810210" "00001567" "90" "2714" "-3936" "2714" "-3936" "c.2714-3936G>A" "r.(=)" "p.(=)" "" "0000810211" "00001567" "30" "2714" "-3844" "2714" "-3844" "c.2714-3844A>G" "r.(=)" "p.(=)" "" "0000810212" "00001567" "50" "2714" "-1446" "2714" "-1446" "c.2714-1446T>C" "r.(=)" "p.(=)" "" "0000810213" "00001567" "30" "2797" "19" "2797" "19" "c.2797+19A>G" "r.(=)" "p.(=)" "" "0000810214" "00001567" "70" "21615" "0" "21615" "0" "c.*18522C>A" "r.(=)" "p.(=)" "" "0000819315" "00001567" "70" "2714" "-1473" "2714" "-1473" "c.2714-1473C>T" "r.(=)" "p.(=)" "" "0000819346" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000819353" "00001567" "70" "2714" "-3887" "2714" "-3887" "c.2714-3887G>A" "r.(=)" "p.(=)" "" "0000819354" "00001567" "70" "2714" "-3887" "2714" "-3887" "c.2714-3887G>A" "r.(=)" "p.(=)" "" "0000819367" "00001567" "70" "2714" "-1421" "2714" "-1421" "c.2714-1421C>T" "r.(=)" "p.(=)" "" "0000819372" "00001567" "70" "2797" "1221" "2797" "1228" "c.2797+1221_2797+1228dup" "r.(=)" "p.(=)" "" "0000819375" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000819376" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000819378" "00001567" "70" "2714" "-3918" "2714" "-3918" "c.2714-3918C>T" "r.(=)" "p.(=)" "" "0000819486" "00001567" "70" "2797" "1243" "2797" "1243" "c.2797+1243C>G" "r.(=)" "p.(=)" "" "0000819493" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000819498" "00001567" "70" "2714" "-1476" "2714" "-1476" "c.2714-1476G>A" "r.(=)" "p.(=)" "" "0000819507" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000819550" "00001567" "70" "2714" "-1476" "2714" "-1476" "c.2714-1476G>A" "r.(=)" "p.(=)" "" "0000819551" "00001567" "70" "2714" "-1476" "2714" "-1476" "c.2714-1476G>A" "r.(=)" "p.(=)" "" "0000822969" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000822970" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000823182" "00001567" "50" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000823185" "00001567" "50" "2714" "-1384" "2714" "-1384" "c.2714-1384C>T" "r.(=)" "p.(=)" "" "0000823186" "00001567" "50" "2714" "-1384" "2714" "-1384" "c.2714-1384C>T" "r.(=)" "p.(=)" "" "0000823187" "00001567" "50" "2714" "-1476" "2714" "-1476" "c.2714-1476G>A" "r.(=)" "p.(=)" "" "0000823188" "00001567" "50" "2714" "-1481" "2714" "-1481" "c.2714-1481A>C" "r.(=)" "p.(=)" "" "0000823189" "00001567" "50" "2714" "-1553" "2714" "-1553" "c.2714-1553G>T" "r.(=)" "p.(=)" "" "0000823190" "00001567" "50" "2714" "-1578" "2714" "-1578" "c.2714-1578C>T" "r.(=)" "p.(=)" "" "0000823191" "00001567" "50" "2714" "-3902" "2714" "-3902" "c.2714-3902G>C" "r.(=)" "p.(=)" "" "0000823192" "00001567" "50" "2714" "-3902" "2714" "-3902" "c.2714-3902dup" "r.(=)" "p.(=)" "" "0000823193" "00001567" "50" "2714" "-3953" "2714" "-3953" "c.2714-3953G>A" "r.(=)" "p.(=)" "" "0000828911" "00001567" "70" "2797" "1151" "2797" "1151" "c.2797+1151C>G" "r.(=)" "p.(=)" "" "0000828912" "00001567" "70" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000828937" "00001567" "90" "2797" "1183" "2797" "1184" "c.2797+1183_2797+1184del" "r.(=)" "p.(=)" "" "0000829083" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000829084" "00001567" "70" "2797" "1151" "2797" "1151" "c.2797+1151C>G" "r.(=)" "p.(=)" "" "0000829085" "00001567" "70" "2797" "1139" "2797" "1139" "c.2797+1139C>G" "r.(=)" "p.(=)" "" "0000829086" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000829087" "00001567" "70" "2714" "-3863" "2714" "-3863" "c.2714-3863T>C" "r.(=)" "p.(=)" "" "0000829088" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902G>A" "r.(=)" "p.(=)" "" "0000829089" "00001567" "70" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000829090" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000829098" "00001567" "70" "2714" "-1391" "2714" "-1391" "c.2714-1391C>T" "r.(=)" "p.(=)" "" "0000829099" "00001567" "70" "2714" "-1455" "2714" "-1455" "c.2714-1455A>G" "r.(=)" "p.(=)" "" "0000829100" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000829101" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000829102" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000829103" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000829104" "00001567" "70" "2714" "-3927" "2714" "-3927" "c.2714-3927C>T" "r.(=)" "p.(=)" "" "0000829105" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000829116" "00001567" "70" "2714" "-1516" "2714" "-1516" "c.2714-1516T>C" "r.(=)" "p.(=)" "" "0000829117" "00001567" "70" "2714" "-3954" "2714" "-3954" "c.2714-3954C>G" "r.(=)" "p.(=)" "" "0000829118" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902dup" "r.(=)" "p.(=)" "" "0000829210" "00001567" "90" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000829211" "00001567" "90" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000829212" "00001567" "90" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000829213" "00001567" "90" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000829214" "00001567" "90" "2714" "-1491" "2714" "-1491" "c.2714-1491C>T" "r.(=)" "p.(=)" "" "0000829215" "00001567" "90" "2714" "-3859" "2714" "-3859" "c.2714-3859A>C" "r.(=)" "p.(=)" "" "0000829216" "00001567" "90" "2714" "-3872" "2714" "-3872" "c.2714-3872G>A" "r.(=)" "p.(=)" "" "0000829217" "00001567" "90" "2714" "-3872" "2714" "-3872" "c.2714-3872G>A" "r.(=)" "p.(=)" "" "0000829218" "00001567" "90" "2714" "-3927" "2714" "-3927" "c.2714-3927C>T" "r.(=)" "p.(=)" "" "0000829219" "00001567" "90" "2714" "-3935" "2714" "-3935" "c.2714-3935G>C" "r.(=)" "p.(=)" "" "0000829220" "00001567" "90" "2714" "-3972" "2714" "-3972" "c.2714-3972T>A" "r.(=)" "p.(=)" "" "0000829221" "00001567" "90" "2714" "-3996" "2714" "-3996" "c.2714-3996C>T" "r.(=)" "p.(=)" "" "0000829241" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000829242" "00001567" "70" "2797" "1209" "2797" "1209" "c.2797+1209G>T" "r.(=)" "p.(=)" "" "0000829243" "00001567" "70" "2797" "1209" "2797" "1209" "c.2797+1209G>T" "r.(=)" "p.(=)" "" "0000829244" "00001567" "70" "2797" "1209" "2797" "1209" "c.2797+1209G>T" "r.(=)" "p.(=)" "" "0000829245" "00001567" "70" "2714" "-1409" "2714" "-1408" "c.2714-1409_2714-1408del" "r.(=)" "p.(=)" "" "0000829246" "00001567" "70" "2714" "-1506" "2714" "-1506" "c.2714-1506A>T" "r.(=)" "p.(=)" "" "0000829247" "00001567" "70" "2714" "-1578" "2714" "-1578" "c.2714-1578C>A" "r.(=)" "p.(=)" "" "0000829248" "00001567" "70" "2714" "-3954" "2714" "-3954" "c.2714-3954C>A" "r.(=)" "p.(=)" "" "0000829273" "00001567" "70" "2797" "1221" "2797" "1221" "c.2797+1221A>G" "r.(=)" "p.(=)" "" "0000829274" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000829275" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>G" "r.(=)" "p.(=)" "" "0000829276" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>A" "r.(=)" "p.(=)" "" "0000829277" "00001567" "70" "2714" "-1384" "2714" "-1384" "c.2714-1384C>T" "r.(=)" "p.(=)" "" "0000829278" "00001567" "70" "2714" "-1474" "2714" "-1474" "c.2714-1474C>T" "r.(=)" "p.(=)" "" "0000829279" "00001567" "70" "2714" "-1557" "2714" "-1557" "c.2714-1557C>G" "r.(=)" "p.(=)" "" "0000829280" "00001567" "70" "2714" "-3882" "2714" "-3882" "c.2714-3882G>T" "r.(=)" "p.(=)" "" "0000829281" "00001567" "70" "2714" "-3900" "2714" "-3900" "c.2714-3900C>G" "r.(=)" "p.(=)" "" "0000829282" "00001567" "70" "2714" "-3918" "2714" "-3918" "c.2714-3918C>T" "r.(=)" "p.(=)" "" "0000829283" "00001567" "70" "2714" "-3975" "2714" "-3975" "c.2714-3975A>G" "r.(=)" "p.(=)" "" "0000829284" "00001567" "70" "2714" "-1471" "2714" "-1471" "c.2714-1471del" "r.(=)" "p.(=)" "" "0000829289" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902dup" "r.(=)" "p.(=)" "" "0000829293" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902dup" "r.(=)" "p.(=)" "" "0000829294" "00001567" "70" "2714" "-1471" "2714" "-1471" "c.2714-1471del" "r.(=)" "p.(=)" "" "0000829296" "00001567" "70" "2714" "-3900" "2714" "-3900" "c.2714-3900del" "r.(=)" "p.(=)" "" "0000829297" "00001567" "70" "2714" "-3954" "2714" "-3954" "c.2714-3954C>T" "r.(=)" "p.(=)" "" "0000829300" "00001567" "70" "2714" "-1425" "2714" "-1425" "c.2714-1425G>A" "r.(=)" "p.(=)" "" "0000829301" "00001567" "70" "2714" "-1385" "2714" "-1385" "c.2714-1385del" "r.(=)" "p.(=)" "" "0000829302" "00001567" "70" "2714" "-3909" "2714" "-3909" "c.2714-3909A>T" "r.(=)" "p.(=)" "" "0000829306" "00001567" "70" "2714" "-3966" "2714" "-3966" "c.2714-3966C>T" "r.(=)" "p.(=)" "" "0000829307" "00001567" "70" "2714" "-3906" "2714" "-3906" "c.2714-3906G>A" "r.(=)" "p.(=)" "" "0000829308" "00001567" "70" "2714" "-3927" "2714" "-3927" "c.2714-3927C>T" "r.(=)" "p.(=)" "" "0000829310" "00001567" "70" "2714" "-1551" "2714" "-1551" "c.2714-1551A>G" "r.(=)" "p.(=)" "" "0000829311" "00001567" "70" "2714" "-1506" "2714" "-1506" "c.2714-1506A>G" "r.(=)" "p.(=)" "" "0000829312" "00001567" "70" "2714" "-1554" "2714" "-1554" "c.2714-1554T>C" "r.(=)" "p.(=)" "" "0000829313" "00001567" "70" "2797" "1219" "2797" "1219" "c.2797+1219C>T" "r.(=)" "p.(=)" "" "0000829314" "00001567" "70" "2714" "-1429" "2714" "-1426" "c.2714-1429_2714-1426del" "r.(=)" "p.(=)" "" "0000829315" "00001567" "70" "2714" "-1543" "2714" "-1543" "c.2714-1543del" "r.(=)" "p.(=)" "" "0000829322" "00001567" "70" "2797" "1134" "2797" "1134" "c.2797+1134G>T" "r.(=)" "p.(=)" "" "0000829323" "00001567" "70" "2797" "1134" "2797" "1134" "c.2797+1134G>T" "r.(=)" "p.(=)" "" "0000829324" "00001567" "70" "2797" "1134" "2797" "1134" "c.2797+1134G>T" "r.(=)" "p.(=)" "" "0000829325" "00001567" "70" "2797" "1134" "2797" "1134" "c.2797+1134G>T" "r.(=)" "p.(=)" "" "0000829326" "00001567" "70" "2797" "1134" "2797" "1134" "c.2797+1134G>T" "r.(=)" "p.(=)" "" "0000829327" "00001567" "70" "2797" "1220" "2797" "1221" "c.2797+1220_2797+1221del" "r.(=)" "p.(=)" "" "0000829328" "00001567" "70" "2797" "1220" "2797" "1221" "c.2797+1220_2797+1221del" "r.(=)" "p.(=)" "" "0000829329" "00001567" "70" "2714" "-3917" "2714" "-3917" "c.2714-3917G>A" "r.(=)" "p.(=)" "" "0000829330" "00001567" "70" "2714" "-3917" "2714" "-3917" "c.2714-3917G>A" "r.(=)" "p.(=)" "" "0000829331" "00001567" "70" "2714" "-3917" "2714" "-3917" "c.2714-3917G>A" "r.(=)" "p.(=)" "" "0000829335" "00001567" "70" "2797" "1219" "2797" "1219" "c.2797+1219C>G" "r.(=)" "p.(=)" "" "0000829336" "00001567" "70" "2797" "1141" "2797" "1141" "c.2797+1141A>G" "r.(=)" "p.(=)" "" "0000829337" "00001567" "70" "2797" "1141" "2797" "1141" "c.2797+1141A>G" "r.(=)" "p.(=)" "" "0000829338" "00001567" "70" "2714" "-1392" "2714" "-1392" "c.2714-1392G>A" "r.(=)" "p.(=)" "" "0000829339" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902dup" "r.(=)" "p.(=)" "" "0000829340" "00001567" "70" "2714" "-3924" "2714" "-3924" "c.2714-3924A>G" "r.(=)" "p.(=)" "" "0000829341" "00001567" "70" "2714" "-3936" "2714" "-3936" "c.2714-3936G>A" "r.(=)" "p.(=)" "" "0000829342" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000829344" "00001567" "70" "2714" "-3936" "2714" "-3936" "c.2714-3936G>A" "r.(=)" "p.(=)" "" "0000829345" "00001567" "70" "2714" "-3936" "2714" "-3936" "c.2714-3936G>A" "r.(=)" "p.(=)" "" "0000829346" "00001567" "70" "2714" "-1550" "2714" "-1518" "c.2714-1550_2714-1518del" "r.(=)" "p.(=)" "" "0000829354" "00001567" "70" "2714" "-3918" "2714" "-3918" "c.2714-3918C>T" "r.(=)" "p.(=)" "" "0000829355" "00001567" "70" "2714" "-3917" "2714" "-3917" "c.2714-3917G>A" "r.(=)" "p.(=)" "" "0000829356" "00001567" "70" "2714" "-3917" "2714" "-3917" "c.2714-3917G>A" "r.(=)" "p.(=)" "" "0000829361" "00001567" "70" "2797" "1139" "2797" "1139" "c.2797+1139C>T" "r.(=)" "p.(=)" "" "0000829362" "00001567" "70" "2797" "1139" "2797" "1139" "c.2797+1139C>T" "r.(=)" "p.(=)" "" "0000829363" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000829364" "00001567" "70" "2714" "-1476" "2714" "-1476" "c.2714-1476G>A" "r.(=)" "p.(=)" "" "0000829365" "00001567" "70" "2797" "1156" "2797" "1156" "c.2797+1156C>A" "r.(=)" "p.(=)" "" "0000829366" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>G" "r.(=)" "p.(=)" "" "0000829367" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000829368" "00001567" "70" "2797" "1101" "2797" "1101" "c.2797+1101C>T" "r.(=)" "p.(=)" "" "0000829369" "00001567" "70" "2714" "-4017" "2714" "-4017" "c.2714-4017A>G" "r.(=)" "p.(=)" "" "0000829370" "00001567" "70" "2714" "-3954" "2714" "-3954" "c.2714-3954C>T" "r.(=)" "p.(=)" "" "0000829371" "00001567" "70" "2797" "1233" "2797" "1233" "c.2797+1233T>C" "r.(=)" "p.(=)" "" "0000829372" "00001567" "70" "2714" "-3953" "2714" "-3953" "c.2714-3953G>A" "r.(=)" "p.(=)" "" "0000829373" "00001567" "70" "2714" "-3954" "2714" "-3954" "c.2714-3954C>T" "r.(=)" "p.(=)" "" "0000829374" "00001567" "70" "2797" "1146" "2797" "1148" "c.2797+1146_2797+1148del" "r.(=)" "p.(=)" "" "0000829375" "00001567" "70" "2797" "1151" "2797" "1151" "c.2797+1151C>A" "r.(=)" "p.(=)" "" "0000829376" "00001567" "70" "2797" "1149" "2797" "1149" "c.2797+1149T>C" "r.(=)" "p.(=)" "" "0000829377" "00001567" "70" "2797" "1211" "2797" "1211" "c.2797+1211C>A" "r.(=)" "p.(=)" "" "0000829378" "00001567" "70" "2714" "-1476" "2714" "-1476" "c.2714-1476G>A" "r.(=)" "p.(=)" "" "0000829379" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000829380" "00001567" "70" "2714" "-3953" "2714" "-3953" "c.2714-3953G>A" "r.(=)" "p.(=)" "" "0000829381" "00001567" "70" "2714" "-3872" "2714" "-3872" "c.2714-3872G>A" "r.(=)" "p.(=)" "" "0000829382" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000829383" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000829384" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000829385" "00001567" "70" "2797" "1206" "2797" "1206" "c.2797+1206C>A" "r.(=)" "p.(=)" "" "0000829386" "00001567" "70" "2714" "-3917" "2714" "-3917" "c.2714-3917G>A" "r.(=)" "p.(=)" "" "0000829387" "00001567" "70" "2797" "1211" "2797" "1211" "c.2797+1211C>A" "r.(=)" "p.(=)" "" "0000829388" "00001567" "70" "2714" "-3849" "2714" "-3849" "c.2714-3849T>C" "r.(=)" "p.(=)" "" "0000829389" "00001567" "70" "2714" "-1473" "2714" "-1473" "c.2714-1473C>T" "r.(=)" "p.(=)" "" "0000829390" "00001567" "70" "2797" "1209" "2797" "1209" "c.2797+1209del" "r.(=)" "p.(=)" "" "0000829640" "00001567" "70" "2797" "1243" "2797" "1243" "c.2797+1243C>T" "r.(=)" "p.(=)" "" "0000829642" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000829643" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000829644" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000829645" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>G" "r.(=)" "p.(=)" "" "0000829646" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>G" "r.(=)" "p.(=)" "" "0000829647" "00001567" "70" "2797" "1188" "2797" "1188" "c.2797+1188T>G" "r.(=)" "p.(=)" "" "0000829648" "00001567" "70" "2797" "1185" "2797" "1185" "c.2797+1185A>T" "r.(=)" "p.(=)" "" "0000829649" "00001567" "70" "2797" "1151" "2797" "1151" "c.2797+1151C>G" "r.(=)" "p.(=)" "" "0000829650" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000829651" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000829652" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000829653" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000829654" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000829655" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000829656" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000829657" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000829658" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000829659" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000829660" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000829661" "00001567" "70" "2797" "1110" "2797" "1110" "c.2797+1110T>G" "r.(=)" "p.(=)" "" "0000829662" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>G" "r.(=)" "p.(=)" "" "0000829663" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>A" "r.(=)" "p.(=)" "" "0000829664" "00001567" "70" "2797" "1101" "2797" "1101" "c.2797+1101C>G" "r.(=)" "p.(=)" "" "0000829665" "00001567" "70" "2714" "-1384" "2714" "-1384" "c.2714-1384C>T" "r.(=)" "p.(=)" "" "0000829666" "00001567" "70" "2714" "-1384" "2714" "-1384" "c.2714-1384C>T" "r.(=)" "p.(=)" "" "0000829667" "00001567" "70" "2714" "-1392" "2714" "-1392" "c.2714-1392G>A" "r.(=)" "p.(=)" "" "0000829668" "00001567" "70" "2714" "-1433" "2714" "-1433" "c.2714-1433del" "r.(=)" "p.(=)" "" "0000829669" "00001567" "70" "2714" "-1476" "2714" "-1476" "c.2714-1476G>A" "r.(=)" "p.(=)" "" "0000829670" "00001567" "70" "2714" "-1476" "2714" "-1476" "c.2714-1476G>A" "r.(=)" "p.(=)" "" "0000829671" "00001567" "70" "2714" "-1476" "2714" "-1476" "c.2714-1476G>A" "r.(=)" "p.(=)" "" "0000829672" "00001567" "70" "2714" "-1490" "2714" "-1490" "c.2714-1490dup" "r.(=)" "p.(=)" "" "0000829673" "00001567" "70" "2714" "-1551" "2714" "-1551" "c.2714-1551A>G" "r.(=)" "p.(=)" "" "0000829674" "00001567" "70" "2714" "-1563" "2714" "-1563" "c.2714-1563T>G" "r.(=)" "p.(=)" "" "0000829675" "00001567" "70" "2714" "-3854" "2714" "-3854" "c.2714-3854A>G" "r.(=)" "p.(=)" "" "0000829676" "00001567" "70" "2714" "-3882" "2714" "-3882" "c.2714-3882G>T" "r.(=)" "p.(=)" "" "0000829677" "00001567" "70" "2714" "-3882" "2714" "-3882" "c.2714-3882G>T" "r.(=)" "p.(=)" "" "0000829678" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902G>A" "r.(=)" "p.(=)" "" "0000829679" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902G>A" "r.(=)" "p.(=)" "" "0000829680" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902G>A" "r.(=)" "p.(=)" "" "0000829681" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902G>A" "r.(=)" "p.(=)" "" "0000829682" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902G>A" "r.(=)" "p.(=)" "" "0000829683" "00001567" "70" "2714" "-3903" "2714" "-3903" "c.2714-3903G>A" "r.(=)" "p.(=)" "" "0000829684" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902dup" "r.(=)" "p.(=)" "" "0000829685" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902dup" "r.(=)" "p.(=)" "" "0000829686" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902dup" "r.(=)" "p.(=)" "" "0000829687" "00001567" "70" "2714" "-3917" "2714" "-3917" "c.2714-3917G>A" "r.(=)" "p.(=)" "" "0000829688" "00001567" "70" "2714" "-3924" "2714" "-3924" "c.2714-3924A>G" "r.(=)" "p.(=)" "" "0000829689" "00001567" "70" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000829690" "00001567" "70" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000829691" "00001567" "70" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000829692" "00001567" "70" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000829693" "00001567" "70" "2714" "-3927" "2714" "-3927" "c.2714-3927C>T" "r.(=)" "p.(=)" "" "0000829694" "00001567" "70" "2714" "-3936" "2714" "-3936" "c.2714-3936G>A" "r.(=)" "p.(=)" "" "0000829695" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000829696" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000829734" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000829735" "00001567" "70" "2714" "-1513" "2714" "-1513" "c.2714-1513A>G" "r.(=)" "p.(=)" "" "0000829736" "00001567" "70" "2714" "-1390" "2714" "-1390" "c.2714-1390C>G" "r.(=)" "p.(=)" "" "0000829737" "00001567" "70" "2714" "-1465" "2714" "-1382" "c.2714-1465_2714-1382del" "r.(=)" "p.(=)" "" "0000829738" "00001567" "70" "2714" "-1543" "2714" "-1543" "c.2714-1543C>T" "r.(=)" "p.(=)" "" "0000829739" "00001567" "70" "2714" "-3859" "2714" "-3859" "c.2714-3859A>C" "r.(=)" "p.(=)" "" "0000829740" "00001567" "70" "2714" "-3859" "2714" "-3859" "c.2714-3859A>C" "r.(=)" "p.(=)" "" "0000829741" "00001567" "70" "2714" "-3859" "2714" "-3859" "c.2714-3859A>C" "r.(=)" "p.(=)" "" "0000829742" "00001567" "70" "2714" "-3859" "2714" "-3859" "c.2714-3859A>C" "r.(=)" "p.(=)" "" "0000829743" "00001567" "70" "2714" "-3859" "2714" "-3859" "c.2714-3859A>C" "r.(=)" "p.(=)" "" "0000829744" "00001567" "70" "2714" "-3859" "2714" "-3859" "c.2714-3859A>C" "r.(=)" "p.(=)" "" "0000829745" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000829746" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000829747" "00001567" "70" "2714" "-1516" "2714" "-1516" "c.2714-1516T>G" "r.(=)" "p.(=)" "" "0000829748" "00001567" "70" "2714" "-1516" "2714" "-1516" "c.2714-1516T>G" "r.(=)" "p.(=)" "" "0000829749" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000829750" "00001567" "70" "2714" "-1543" "2714" "-1543" "c.2714-1543C>T" "r.(=)" "p.(=)" "" "0000829751" "00001567" "70" "2714" "-3859" "2714" "-3859" "c.2714-3859A>C" "r.(=)" "p.(=)" "" "0000829752" "00001567" "70" "2714" "-3859" "2714" "-3859" "c.2714-3859A>C" "r.(=)" "p.(=)" "" "0000829753" "00001567" "70" "2714" "-3954" "2714" "-3954" "c.2714-3954C>T" "r.(=)" "p.(=)" "" "0000829754" "00001567" "70" "2714" "-3859" "2714" "-3859" "c.2714-3859A>C" "r.(=)" "p.(=)" "" "0000829755" "00001567" "70" "2714" "-3859" "2714" "-3859" "c.2714-3859A>C" "r.(=)" "p.(=)" "" "0000829756" "00001567" "70" "2714" "-3859" "2714" "-3859" "c.2714-3859A>C" "r.(=)" "p.(=)" "" "0000829800" "00001567" "70" "2714" "-1471" "2714" "-1471" "c.2714-1471del" "r.(=)" "p.(=)" "" "0000829801" "00001567" "70" "2797" "1100" "2797" "1100" "c.2797+1100C>T" "r.(=)" "p.(=)" "" "0000830086" "00001567" "70" "2797" "1240" "2797" "1240" "c.2797+1240A>T" "r.(=)" "p.(=)" "" "0000830087" "00001567" "70" "2797" "1221" "2797" "1221" "c.2797+1221A>C" "r.(=)" "p.(=)" "" "0000830088" "00001567" "70" "2797" "1221" "2797" "1221" "c.2797+1221A>C" "r.(=)" "p.(=)" "" "0000830089" "00001567" "70" "2797" "1221" "2797" "1221" "c.2797+1221A>C" "r.(=)" "p.(=)" "" "0000830090" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830091" "00001567" "70" "2797" "1209" "2797" "1209" "c.2797+1209G>T" "r.(=)" "p.(=)" "" "0000830092" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830093" "00001567" "70" "2797" "1151" "2797" "1151" "c.2797+1151C>T" "r.(=)" "p.(=)" "" "0000830094" "00001567" "70" "2797" "1151" "2797" "1151" "c.2797+1151C>T" "r.(=)" "p.(=)" "" "0000830095" "00001567" "70" "2797" "1139" "2797" "1139" "c.2797+1139C>T" "r.(=)" "p.(=)" "" "0000830096" "00001567" "70" "2797" "1139" "2797" "1139" "c.2797+1139C>T" "r.(=)" "p.(=)" "" "0000830097" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>G" "r.(=)" "p.(=)" "" "0000830098" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>G" "r.(=)" "p.(=)" "" "0000830099" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000830100" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000830101" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000830102" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000830103" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>G" "r.(=)" "p.(=)" "" "0000830108" "00001567" "70" "2714" "-1391" "2714" "-1391" "c.2714-1391C>T" "r.(=)" "p.(=)" "" "0000830109" "00001567" "70" "2714" "-1429" "2714" "-1429" "c.2714-1429A>C" "r.(=)" "p.(=)" "" "0000830110" "00001567" "70" "2714" "-1476" "2714" "-1476" "c.2714-1476G>A" "r.(=)" "p.(=)" "" "0000830111" "00001567" "70" "2714" "-1477" "2714" "-1477" "c.2714-1477C>T" "r.(=)" "p.(=)" "" "0000830112" "00001567" "70" "2714" "-1477" "2714" "-1477" "c.2714-1477C>T" "r.(=)" "p.(=)" "" "0000830113" "00001567" "70" "2714" "-1513" "2714" "-1513" "c.2714-1513del" "r.(=)" "p.(=)" "" "0000830114" "00001567" "70" "2714" "-1479" "2714" "-1479" "c.2714-1479A>G" "r.(=)" "p.(=)" "" "0000830115" "00001567" "70" "2714" "-1516" "2714" "-1516" "c.2714-1516T>C" "r.(=)" "p.(=)" "" "0000830116" "00001567" "70" "2714" "-3863" "2714" "-3863" "c.2714-3863T>C" "r.(=)" "p.(=)" "" "0000830118" "00001567" "70" "2714" "-3905" "2714" "-3905" "c.2714-3905G>A" "r.(=)" "p.(=)" "" "0000830119" "00001567" "70" "2714" "-3905" "2714" "-3905" "c.2714-3905G>A" "r.(=)" "p.(=)" "" "0000830120" "00001567" "70" "2714" "-3909" "2714" "-3909" "c.2714-3909A>C" "r.(=)" "p.(=)" "" "0000830121" "00001567" "70" "2714" "-3918" "2714" "-3918" "c.2714-3918C>T" "r.(=)" "p.(=)" "" "0000830122" "00001567" "70" "2714" "-3918" "2714" "-3918" "c.2714-3918C>T" "r.(=)" "p.(=)" "" "0000830123" "00001567" "70" "2714" "-3917" "2714" "-3917" "c.2714-3917G>A" "r.(=)" "p.(=)" "" "0000830124" "00001567" "70" "2714" "-3917" "2714" "-3917" "c.2714-3917G>A" "r.(=)" "p.(=)" "" "0000830125" "00001567" "70" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000830126" "00001567" "70" "2714" "-3936" "2714" "-3936" "c.2714-3936G>A" "r.(=)" "p.(=)" "" "0000830127" "00001567" "70" "2714" "-3936" "2714" "-3936" "c.2714-3936G>A" "r.(=)" "p.(=)" "" "0000830128" "00001567" "70" "2714" "-3936" "2714" "-3936" "c.2714-3936G>A" "r.(=)" "p.(=)" "" "0000830129" "00001567" "70" "2714" "-3953" "2714" "-3953" "c.2714-3953G>A" "r.(=)" "p.(=)" "" "0000830130" "00001567" "70" "2714" "-3960" "2714" "-3960" "c.2714-3960G>T" "r.(=)" "p.(=)" "" "0000830131" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000830132" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000830133" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000830155" "00001567" "70" "2714" "-3963" "2714" "-3963" "c.2714-3963A>T" "r.(=)" "p.(=)" "" "0000830156" "00001567" "70" "2714" "-3963" "2714" "-3963" "c.2714-3963A>T" "r.(=)" "p.(=)" "" "0000830157" "00001567" "70" "2797" "1141" "2797" "1141" "c.2797+1141A>G" "r.(=)" "p.(=)" "" "0000830159" "00001567" "70" "2797" "1219" "2797" "1219" "c.2797+1219C>T" "r.(=)" "p.(=)" "" "0000830160" "00001567" "70" "2714" "-1417" "2714" "-1417" "c.2714-1417del" "r.(=)" "p.(=)" "" "0000830161" "00001567" "70" "2714" "-1417" "2714" "-1417" "c.2714-1417del" "r.(=)" "p.(=)" "" "0000830162" "00001567" "90" "2714" "-1468" "2714" "-1468" "c.2714-1468G>T" "r.(=)" "p.(=)" "" "0000830163" "00001567" "90" "2714" "-1468" "2714" "-1468" "c.2714-1468G>T" "r.(=)" "p.(=)" "" "0000830164" "00001567" "90" "2714" "-1468" "2714" "-1468" "c.2714-1468G>T" "r.(=)" "p.(=)" "" "0000830165" "00001567" "90" "2714" "-1468" "2714" "-1468" "c.2714-1468G>T" "r.(=)" "p.(=)" "" "0000830166" "00001567" "90" "2714" "-1468" "2714" "-1468" "c.2714-1468G>T" "r.(=)" "p.(=)" "" "0000830167" "00001567" "90" "2714" "-1468" "2714" "-1468" "c.2714-1468G>T" "r.(=)" "p.(=)" "" "0000830168" "00001567" "90" "2714" "-1468" "2714" "-1468" "c.2714-1468G>T" "r.(=)" "p.(=)" "" "0000830169" "00001567" "90" "2714" "-1468" "2714" "-1468" "c.2714-1468G>T" "r.(=)" "p.(=)" "" "0000830170" "00001567" "90" "2714" "-1468" "2714" "-1468" "c.2714-1468G>T" "r.(=)" "p.(=)" "" "0000830171" "00001567" "90" "2714" "-3927" "2714" "-3927" "c.2714-3927C>A" "r.(=)" "p.(=)" "" "0000830173" "00001567" "90" "2714" "-1477" "2714" "-1477" "c.2714-1477C>T" "r.(=)" "p.(=)" "" "0000830196" "00001567" "70" "2797" "1224" "2797" "1224" "c.2797+1224G>C" "r.(=)" "p.(=)" "" "0000830197" "00001567" "70" "2797" "1219" "2797" "1219" "c.2797+1219C>T" "r.(=)" "p.(=)" "" "0000830198" "00001567" "70" "2797" "1219" "2797" "1219" "c.2797+1219C>T" "r.(=)" "p.(=)" "" "0000830199" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830200" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830201" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830202" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830203" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830204" "00001567" "70" "2797" "1161" "2797" "1161" "c.2797+1161T>C" "r.(=)" "p.(=)" "" "0000830205" "00001567" "70" "2797" "1149" "2797" "1149" "c.2797+1149T>G" "r.(=)" "p.(=)" "" "0000830206" "00001567" "70" "2797" "1149" "2797" "1149" "c.2797+1149T>G" "r.(=)" "p.(=)" "" "0000830207" "00001567" "70" "2797" "1141" "2797" "1141" "c.2797+1141A>G" "r.(=)" "p.(=)" "" "0000830208" "00001567" "70" "2797" "1141" "2797" "1141" "c.2797+1141A>G" "r.(=)" "p.(=)" "" "0000830211" "00001567" "70" "2797" "1207" "2797" "1207" "c.2797+1207dup" "r.(=)" "p.(=)" "" "0000830212" "00001567" "70" "2714" "-1574" "2714" "-1574" "c.2714-1574del" "r.(=)" "p.(=)" "" "0000830213" "00001567" "70" "2797" "1141" "2797" "1141" "c.2797+1141A>G" "r.(=)" "p.(=)" "" "0000830214" "00001567" "70" "2797" "1141" "2797" "1141" "c.2797+1141A>G" "r.(=)" "p.(=)" "" "0000830215" "00001567" "70" "2797" "1141" "2797" "1141" "c.2797+1141A>G" "r.(=)" "p.(=)" "" "0000830216" "00001567" "70" "2797" "1141" "2797" "1141" "c.2797+1141A>G" "r.(=)" "p.(=)" "" "0000830217" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000830218" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000830219" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000830220" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000830221" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>G" "r.(=)" "p.(=)" "" "0000830222" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>G" "r.(=)" "p.(=)" "" "0000830223" "00001567" "70" "2714" "-1384" "2714" "-1384" "c.2714-1384C>T" "r.(=)" "p.(=)" "" "0000830224" "00001567" "70" "2714" "-1384" "2714" "-1384" "c.2714-1384C>T" "r.(=)" "p.(=)" "" "0000830225" "00001567" "70" "2714" "-1384" "2714" "-1384" "c.2714-1384C>T" "r.(=)" "p.(=)" "" "0000830226" "00001567" "70" "2714" "-3863" "2714" "-3863" "c.2714-3863T>C" "r.(=)" "p.(=)" "" "0000830227" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902G>A" "r.(=)" "p.(=)" "" "0000830228" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902dup" "r.(=)" "p.(=)" "" "0000830232" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902G>A" "r.(=)" "p.(=)" "" "0000830233" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902G>A" "r.(=)" "p.(=)" "" "0000830234" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902G>A" "r.(=)" "p.(=)" "" "0000830235" "00001567" "70" "2714" "-3924" "2714" "-3924" "c.2714-3924A>G" "r.(=)" "p.(=)" "" "0000830236" "00001567" "70" "2714" "-3924" "2714" "-3924" "c.2714-3924A>G" "r.(=)" "p.(=)" "" "0000830237" "00001567" "70" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000830238" "00001567" "70" "2714" "-3927" "2714" "-3927" "c.2714-3927C>T" "r.(=)" "p.(=)" "" "0000830239" "00001567" "70" "2714" "-3927" "2714" "-3927" "c.2714-3927C>T" "r.(=)" "p.(=)" "" "0000830240" "00001567" "70" "2714" "-3927" "2714" "-3927" "c.2714-3927C>T" "r.(=)" "p.(=)" "" "0000830241" "00001567" "70" "2714" "-3927" "2714" "-3927" "c.2714-3927C>T" "r.(=)" "p.(=)" "" "0000830242" "00001567" "70" "2714" "-3927" "2714" "-3927" "c.2714-3927C>T" "r.(=)" "p.(=)" "" "0000830243" "00001567" "70" "2714" "-3954" "2714" "-3954" "c.2714-3954C>G" "r.(=)" "p.(=)" "" "0000830244" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000830245" "00001567" "70" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000830248" "00001567" "70" "2714" "-1578" "2714" "-1578" "c.2714-1578C>T" "r.(=)" "p.(=)" "" "0000830249" "00001567" "70" "2714" "-3850" "2714" "-3850" "c.2714-3850C>G" "r.(=)" "p.(=)" "" "0000830250" "00001567" "70" "2714" "-1431" "2714" "-1431" "c.2714-1431C>G" "r.(=)" "p.(=)" "" "0000830251" "00001567" "70" "2714" "-3909" "2714" "-3907" "c.2714-3909_2714-3907dup" "r.(=)" "p.(=)" "" "0000830252" "00001567" "70" "2714" "-1487" "2714" "-1440" "c.2714-1487_2714-1440dup" "r.(=)" "p.(=)" "" "0000830253" "00001567" "70" "2714" "-1487" "2714" "-1440" "c.2714-1487_2714-1440dup" "r.(=)" "p.(=)" "" "0000830254" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902del" "r.(=)" "p.(=)" "" "0000830255" "00001567" "70" "2714" "-1429" "2714" "-1429" "c.2714-1429A>C" "r.(=)" "p.(=)" "" "0000830256" "00001567" "70" "2714" "-3918" "2714" "-3918" "c.2714-3918C>T" "r.(=)" "p.(=)" "" "0000830257" "00001567" "70" "2797" "1141" "2797" "1141" "c.2797+1141A>G" "r.(=)" "p.(=)" "" "0000830258" "00001567" "70" "2714" "-1476" "2714" "-1476" "c.2714-1476G>A" "r.(=)" "p.(=)" "" "0000830259" "00001567" "70" "2714" "-1476" "2714" "-1476" "c.2714-1476G>A" "r.(=)" "p.(=)" "" "0000830260" "00001567" "70" "2714" "-3991" "2714" "-3991" "c.2714-3991dup" "r.(=)" "p.(=)" "" "0000830261" "00001567" "70" "2714" "-3872" "2714" "-3872" "c.2714-3872G>A" "r.(=)" "p.(=)" "" "0000830262" "00001567" "70" "2714" "-1477" "2714" "-1477" "c.2714-1477C>T" "r.(=)" "p.(=)" "" "0000830263" "00001567" "70" "2714" "-1477" "2714" "-1477" "c.2714-1477C>T" "r.(=)" "p.(=)" "" "0000830264" "00001567" "70" "2714" "-1477" "2714" "-1477" "c.2714-1477C>T" "r.(=)" "p.(=)" "" "0000830265" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830266" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830267" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830268" "00001567" "70" "2714" "-1476" "2714" "-1476" "c.2714-1476G>T" "r.(=)" "p.(=)" "" "0000830269" "00001567" "70" "2714" "-1404" "2714" "-1404" "c.2714-1404G>A" "r.(=)" "p.(=)" "" "0000830270" "00001567" "70" "2797" "1160" "2797" "1160" "c.2797+1160A>T" "r.(=)" "p.(=)" "" "0000830323" "00001567" "70" "2797" "1241" "2797" "1242" "c.2797+1241_2797+1242insA" "r.(=)" "p.(=)" "" "0000830324" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830325" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830326" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830327" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830328" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830329" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830330" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830331" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830332" "00001567" "70" "2797" "1209" "2797" "1209" "c.2797+1209G>A" "r.(=)" "p.(=)" "" "0000830333" "00001567" "70" "2797" "1161" "2797" "1161" "c.2797+1161T>C" "r.(=)" "p.(=)" "" "0000830334" "00001567" "70" "2797" "1161" "2797" "1161" "c.2797+1161T>C" "r.(=)" "p.(=)" "" "0000830335" "00001567" "70" "2797" "1161" "2797" "1161" "c.2797+1161T>C" "r.(=)" "p.(=)" "" "0000830336" "00001567" "70" "2797" "1161" "2797" "1161" "c.2797+1161T>C" "r.(=)" "p.(=)" "" "0000830337" "00001567" "70" "2797" "1160" "2797" "1160" "c.2797+1160A>T" "r.(=)" "p.(=)" "" "0000830338" "00001567" "70" "2797" "1160" "2797" "1160" "c.2797+1160A>T" "r.(=)" "p.(=)" "" "0000830339" "00001567" "70" "2797" "1142" "2797" "1142" "c.2797+1142del" "r.(=)" "p.(=)" "" "0000830340" "00001567" "70" "2797" "1126" "2797" "1126" "c.2797+1126C>G" "r.(=)" "p.(=)" "" "0000830341" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000830342" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000830343" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000830344" "00001567" "70" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000830345" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000830346" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000830347" "00001567" "70" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000830348" "00001567" "70" "2797" "1101" "2797" "1101" "c.2797+1101C>G" "r.(=)" "p.(=)" "" "0000830349" "00001567" "70" "2714" "-1385" "2714" "-1385" "c.2714-1385A>T" "r.(=)" "p.(=)" "" "0000830350" "00001567" "70" "2714" "-1385" "2714" "-1385" "c.2714-1385A>T" "r.(=)" "p.(=)" "" "0000830351" "00001567" "70" "2714" "-1459" "2714" "-1459" "c.2714-1459C>T" "r.(=)" "p.(=)" "" "0000830352" "00001567" "70" "2714" "-1472" "2714" "-1472" "c.2714-1472C>A" "r.(=)" "p.(=)" "" "0000830353" "00001567" "70" "2714" "-1477" "2714" "-1477" "c.2714-1477C>T" "r.(=)" "p.(=)" "" "0000830354" "00001567" "70" "2714" "-1493" "2714" "-1493" "c.2714-1493C>G" "r.(=)" "p.(=)" "" "0000830355" "00001567" "70" "2714" "-1578" "2714" "-1578" "c.2714-1578C>T" "r.(=)" "p.(=)" "" "0000830356" "00001567" "70" "2714" "-3850" "2714" "-3850" "c.2714-3850C>T" "r.(=)" "p.(=)" "" "0000830357" "00001567" "70" "2714" "-3872" "2714" "-3872" "c.2714-3872G>A" "r.(=)" "p.(=)" "" "0000830358" "00001567" "70" "2714" "-3872" "2714" "-3872" "c.2714-3872G>A" "r.(=)" "p.(=)" "" "0000830359" "00001567" "70" "2714" "-3872" "2714" "-3872" "c.2714-3872G>A" "r.(=)" "p.(=)" "" "0000830360" "00001567" "70" "2714" "-3872" "2714" "-3872" "c.2714-3872G>A" "r.(=)" "p.(=)" "" "0000830361" "00001567" "70" "2714" "-3902" "2714" "-3902" "c.2714-3902G>A" "r.(=)" "p.(=)" "" "0000830362" "00001567" "70" "2714" "-3917" "2714" "-3917" "c.2714-3917G>A" "r.(=)" "p.(=)" "" "0000830363" "00001567" "70" "2714" "-3917" "2714" "-3917" "c.2714-3917G>A" "r.(=)" "p.(=)" "" "0000830364" "00001567" "70" "2714" "-3917" "2714" "-3917" "c.2714-3917G>A" "r.(=)" "p.(=)" "" "0000830365" "00001567" "70" "2714" "-3918" "2714" "-3918" "c.2714-3918C>T" "r.(=)" "p.(=)" "" "0000830366" "00001567" "70" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000830367" "00001567" "70" "2714" "-3927" "2714" "-3927" "c.2714-3927C>T" "r.(=)" "p.(=)" "" "0000830368" "00001567" "70" "2714" "-3927" "2714" "-3927" "c.2714-3927C>T" "r.(=)" "p.(=)" "" "0000830369" "00001567" "70" "2714" "-3936" "2714" "-3936" "c.2714-3936G>A" "r.(=)" "p.(=)" "" "0000830370" "00001567" "70" "2714" "-3936" "2714" "-3936" "c.2714-3936G>A" "r.(=)" "p.(=)" "" "0000830371" "00001567" "70" "2714" "-3953" "2714" "-3953" "c.2714-3953G>A" "r.(=)" "p.(=)" "" "0000830372" "00001567" "70" "2714" "-3953" "2714" "-3953" "c.2714-3953G>T" "r.(=)" "p.(=)" "" "0000830373" "00001567" "70" "2714" "-3966" "2714" "-3966" "c.2714-3966C>T" "r.(=)" "p.(=)" "" "0000830374" "00001567" "70" "2714" "-3985" "2714" "-3985" "c.2714-3985G>C" "r.(=)" "p.(=)" "" "0000830375" "00001567" "70" "2714" "-3995" "2714" "-3995" "c.2714-3995A>G" "r.(=)" "p.(=)" "" "0000830376" "00001567" "70" "2714" "-3995" "2714" "-3995" "c.2714-3995A>G" "r.(=)" "p.(=)" "" "0000830418" "00001567" "90" "2714" "-3902" "2714" "-3902" "c.2714-3902dup" "r.(=)" "p.(=)" "" "0000830454" "00001567" "90" "2714" "-1432" "2714" "-1430" "c.2714-1432_2714-1430del" "r.(=)" "p.(=)" "" "0000830455" "00001567" "90" "2714" "-1432" "2714" "-1430" "c.2714-1432_2714-1430del" "r.(=)" "p.(=)" "" "0000830496" "00001567" "70" "2714" "-1516" "2714" "-1516" "c.2714-1516T>C" "r.(=)" "p.(=)" "" "0000830497" "00001567" "70" "2714" "-1516" "2714" "-1516" "c.2714-1516T>C" "r.(=)" "p.(=)" "" "0000830498" "00001567" "70" "2797" "1176" "2797" "1176" "c.2797+1176G>C" "r.(=)" "p.(=)" "" "0000830506" "00001567" "90" "2797" "1231" "2797" "1231" "c.2797+1231G>T" "r.(=)" "p.(=)" "" "0000830507" "00001567" "90" "2797" "1219" "2797" "1219" "c.2797+1219C>T" "r.(=)" "p.(=)" "" "0000830508" "00001567" "90" "2797" "1219" "2797" "1219" "c.2797+1219C>T" "r.(=)" "p.(=)" "" "0000830509" "00001567" "90" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830510" "00001567" "90" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830511" "00001567" "90" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830512" "00001567" "90" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000830513" "00001567" "90" "2797" "1213" "2797" "1213" "c.2797+1213C>G" "r.(=)" "p.(=)" "" "0000830514" "00001567" "90" "2797" "1185" "2797" "1185" "c.2797+1185A>T" "r.(=)" "p.(=)" "" "0000830515" "00001567" "90" "2797" "1151" "2797" "1151" "c.2797+1151C>T" "r.(=)" "p.(=)" "" "0000830516" "00001567" "90" "2797" "1151" "2797" "1151" "c.2797+1151C>A" "r.(=)" "p.(=)" "" "0000830517" "00001567" "90" "2797" "1139" "2797" "1139" "c.2797+1139C>G" "r.(=)" "p.(=)" "" "0000830518" "00001567" "90" "2797" "1134" "2797" "1135" "c.2797+1134_2797+1135del" "r.(=)" "p.(=)" "" "0000830519" "00001567" "90" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000830520" "00001567" "90" "2797" "1123" "2797" "1123" "c.2797+1123G>A" "r.(=)" "p.(=)" "" "0000830521" "00001567" "90" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000830522" "00001567" "90" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000830523" "00001567" "90" "2797" "1122" "2797" "1122" "c.2797+1122C>T" "r.(=)" "p.(=)" "" "0000830524" "00001567" "70" "2797" "1116" "2797" "1116" "c.2797+1116T>C" "r.(=)" "p.(=)" "" "0000830525" "00001567" "90" "2797" "1080" "2797" "1110" "c.2797+1080_2797+1110del" "r.(=)" "p.(=)" "" "0000830526" "00001567" "90" "2797" "1098" "2797" "1100" "c.2797+1098_2797+1100delinsA" "r.(=)" "p.(=)" "" "0000830527" "00001567" "90" "2714" "-1380" "2714" "-1380" "c.2714-1380T>C" "r.(=)" "p.(=)" "" "0000830528" "00001567" "90" "2714" "-1425" "2714" "-1425" "c.2714-1425G>A" "r.(=)" "p.(=)" "" "0000830529" "00001567" "90" "2714" "-1425" "2714" "-1425" "c.2714-1425G>A" "r.(=)" "p.(=)" "" "0000830530" "00001567" "90" "2714" "-1465" "2714" "-1368" "c.2714-1465_2714-1368del" "r.(=)" "p.(=)" "" "0000830531" "00001567" "90" "2714" "-1385" "2714" "-1385" "c.2714-1385del" "r.(=)" "p.(=)" "" "0000830532" "00001567" "90" "2714" "-1389" "2714" "-1389" "c.2714-1389A>G" "r.(=)" "p.(=)" "" "0000830533" "00001567" "90" "2714" "-1429" "2714" "-1426" "c.2714-1429_2714-1426del" "r.(=)" "p.(=)" "" "0000830534" "00001567" "90" "2714" "-1429" "2714" "-1426" "c.2714-1429_2714-1426del" "r.(=)" "p.(=)" "" "0000830535" "00001567" "90" "2714" "-1440" "2714" "-1438" "c.2714-1440_2714-1438del" "r.(=)" "p.(=)" "" "0000830536" "00001567" "90" "2714" "-1476" "2714" "-1476" "c.2714-1476G>A" "r.(=)" "p.(=)" "" "0000830537" "00001567" "90" "2714" "-1477" "2714" "-1477" "c.2714-1477C>T" "r.(=)" "p.(=)" "" "0000830538" "00001567" "90" "2714" "-1477" "2714" "-1477" "c.2714-1477C>T" "r.(=)" "p.(=)" "" "0000830539" "00001567" "90" "2714" "-1477" "2714" "-1477" "c.2714-1477C>T" "r.(=)" "p.(=)" "" "0000830540" "00001567" "90" "2714" "-1480" "2714" "-1480" "c.2714-1480C>T" "r.(=)" "p.(=)" "" "0000830541" "00001567" "90" "2714" "-1488" "2714" "-1488" "c.2714-1488C>G" "r.(=)" "p.(=)" "" "0000830542" "00001567" "90" "2714" "-1491" "2714" "-1491" "c.2714-1491C>T" "r.(=)" "p.(=)" "" "0000830543" "00001567" "90" "2714" "-1496" "2714" "-1496" "c.2714-1496C>T" "r.(=)" "p.(=)" "" "0000830544" "00001567" "70" "2714" "-1498" "2714" "-1498" "c.2714-1498A>T" "r.(=)" "p.(=)" "" "0000830545" "00001567" "90" "2714" "-1506" "2714" "-1506" "c.2714-1506A>G" "r.(=)" "p.(=)" "" "0000830546" "00001567" "90" "2714" "-1521" "2714" "-1521" "c.2714-1521T>C" "r.(=)" "p.(=)" "" "0000830547" "00001567" "90" "2714" "-1522" "2714" "-1522" "c.2714-1522dup" "r.(=)" "p.(=)" "" "0000830548" "00001567" "90" "2714" "-1543" "2714" "-1543" "c.2714-1543del" "r.(=)" "p.(=)" "" "0000830549" "00001567" "90" "2714" "-1543" "2714" "-1543" "c.2714-1543del" "r.(=)" "p.(=)" "" "0000830550" "00001567" "90" "2714" "-1543" "2714" "-1543" "c.2714-1543del" "r.(=)" "p.(=)" "" "0000830551" "00001567" "90" "2714" "-1544" "2714" "-1544" "c.2714-1544C>T" "r.(=)" "p.(=)" "" "0000830552" "00001567" "90" "2714" "-1548" "2714" "-1546" "c.2714-1548_2714-1546delinsGATT" "r.(=)" "p.(=)" "" "0000830553" "00001567" "90" "2714" "-1551" "2714" "-1551" "c.2714-1551A>G" "r.(=)" "p.(=)" "" "0000830554" "00001567" "90" "2714" "-1554" "2714" "-1554" "c.2714-1554T>C" "r.(=)" "p.(=)" "" "0000830555" "00001567" "90" "2714" "-1560" "2714" "-1560" "c.2714-1560G>A" "r.(=)" "p.(=)" "" "0000830556" "00001567" "90" "2714" "-1560" "2714" "-1560" "c.2714-1560G>A" "r.(=)" "p.(=)" "" "0000830557" "00001567" "90" "2714" "-1566" "2714" "-1566" "c.2714-1566C>T" "r.(=)" "p.(=)" "" "0000830558" "00001567" "70" "2714" "-3873" "2714" "-3873" "c.2714-3873C>A" "r.(=)" "p.(=)" "" "0000830559" "00001567" "90" "2714" "-3903" "2714" "-3903" "c.2714-3903G>A" "r.(=)" "p.(=)" "" "0000830560" "00001567" "90" "2714" "-3906" "2714" "-3906" "c.2714-3906G>A" "r.(=)" "p.(=)" "" "0000830561" "00001567" "90" "2714" "-3902" "2714" "-3902" "c.2714-3902dup" "r.(=)" "p.(=)" "" "0000830562" "00001567" "70" "2714" "-3908" "2714" "-3908" "c.2714-3908T>A" "r.(=)" "p.(=)" "" "0000830563" "00001567" "90" "2714" "-3909" "2714" "-3909" "c.2714-3909A>T" "r.(=)" "p.(=)" "" "0000830564" "00001567" "90" "2714" "-3917" "2714" "-3917" "c.2714-3917G>A" "r.(=)" "p.(=)" "" "0000830565" "00001567" "90" "2714" "-3918" "2714" "-3918" "c.2714-3918C>T" "r.(=)" "p.(=)" "" "0000830566" "00001567" "90" "2714" "-3918" "2714" "-3918" "c.2714-3918C>T" "r.(=)" "p.(=)" "" "0000830567" "00001567" "90" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000830568" "00001567" "90" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000830569" "00001567" "90" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000830570" "00001567" "90" "2714" "-3927" "2714" "-3927" "c.2714-3927C>T" "r.(=)" "p.(=)" "" "0000830571" "00001567" "70" "2714" "-3935" "2714" "-3935" "c.2714-3935G>A" "r.(=)" "p.(=)" "" "0000830572" "00001567" "70" "2714" "-3936" "2714" "-3936" "c.2714-3936G>T" "r.(=)" "p.(=)" "" "0000830573" "00001567" "70" "2714" "-3936" "2714" "-3936" "c.2714-3936G>T" "r.(=)" "p.(=)" "" "0000830574" "00001567" "90" "2714" "-3936" "2714" "-3936" "c.2714-3936G>A" "r.(=)" "p.(=)" "" "0000830575" "00001567" "70" "2714" "-3951" "2714" "-3951" "c.2714-3951A>G" "r.(=)" "p.(=)" "" "0000830576" "00001567" "90" "2714" "-3953" "2714" "-3953" "c.2714-3953G>A" "r.(=)" "p.(=)" "" "0000830577" "00001567" "90" "2714" "-3954" "2714" "-3954" "c.2714-3954C>T" "r.(=)" "p.(=)" "" "0000830578" "00001567" "90" "2714" "-3954" "2714" "-3954" "c.2714-3954C>T" "r.(=)" "p.(=)" "" "0000830579" "00001567" "90" "2714" "-3954" "2714" "-3954" "c.2714-3954C>T" "r.(=)" "p.(=)" "" "0000830580" "00001567" "90" "2714" "-3959" "2714" "-3959" "c.2714-3959C>T" "r.(=)" "p.(=)" "" "0000830581" "00001567" "90" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000830582" "00001567" "90" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000830583" "00001567" "90" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000830584" "00001567" "90" "2714" "-3965" "2714" "-3965" "c.2714-3965G>A" "r.(=)" "p.(=)" "" "0000830585" "00001567" "90" "2714" "-3966" "2714" "-3966" "c.2714-3966C>T" "r.(=)" "p.(=)" "" "0000830586" "00001567" "90" "2714" "-3980" "2714" "-3980" "c.2714-3980C>T" "r.(=)" "p.(=)" "" "0000830587" "00001567" "90" "2714" "-3984" "2714" "-3984" "c.2714-3984C>T" "r.(=)" "p.(=)" "" "0000830588" "00001567" "90" "2714" "-3995" "2714" "-3995" "c.2714-3995A>G" "r.(=)" "p.(=)" "" "0000830589" "00001567" "90" "2714" "-4458" "2797" "1765" "c.2714-4458_2797+1765delinsAAAAACTCCCTAGCTCTTTGGAAATGGTAAACA" "r.?" "p.?" "" "0000839873" "00001567" "50" "2713" "170" "2713" "170" "c.2713+170A>T" "r.(=)" "p.(=)" "" "0000846908" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000846909" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000846910" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000846911" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000846912" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000846913" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000846914" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000846915" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000846916" "00001567" "70" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0000846917" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>G" "r.(=)" "p.(=)" "" "0000846918" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>G" "r.(=)" "p.(=)" "" "0000846919" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>G" "r.(=)" "p.(=)" "" "0000846920" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>G" "r.(=)" "p.(=)" "" "0000846921" "00001567" "70" "2797" "1102" "2797" "1102" "c.2797+1102C>G" "r.(=)" "p.(=)" "" "0000846922" "00001567" "70" "2714" "-3861" "2714" "-3861" "c.2714-3861C>T" "r.(=)" "p.(=)" "" "0000846923" "00001567" "70" "2714" "-3861" "2714" "-3861" "c.2714-3861C>T" "r.(=)" "p.(=)" "" "0000856500" "00001567" "30" "93" "0" "93" "0" "c.93A>G" "r.(?)" "p.(Arg31=)" "" "0000856501" "00001567" "30" "145" "25" "145" "28" "c.145+25_145+28del" "r.(=)" "p.(=)" "" "0000856502" "00001567" "10" "145" "27" "145" "28" "c.145+27_145+28del" "r.(=)" "p.(=)" "" "0000856503" "00001567" "50" "1892" "0" "1892" "0" "c.1892T>C" "r.(?)" "p.(Ile631Thr)" "" "0000856504" "00001567" "30" "2022" "0" "2022" "0" "c.2022C>G" "r.(?)" "p.(Ser674=)" "" "0000856505" "00001567" "50" "2555" "0" "2555" "0" "c.2555C>T" "r.(?)" "p.(Pro852Leu)" "" "0000856506" "00001567" "10" "2714" "-1385" "2714" "-1385" "c.2714-1385A>G" "r.(=)" "p.(=)" "" "0000867253" "00001567" "90" "587" "0" "587" "0" "c.587C>T" "r.(?)" "p.(Ser196Leu)" "" "0000867254" "00001567" "30" "2247" "0" "2247" "0" "c.2247C>T" "r.(?)" "p.(His749=)" "" "0000867255" "00001567" "90" "2714" "-3902" "2714" "-3902" "c.2714-3902dup" "r.(=)" "p.(=)" "" "0000867256" "00001567" "50" "2714" "-1493" "2714" "-1493" "c.2714-1493C>G" "r.(=)" "p.(=)" "" "0000867257" "00001567" "90" "2797" "1104" "2797" "1104" "c.2797+1104A>C" "r.(=)" "p.(=)" "" "0000871138" "00001567" "90" "400" "0" "400" "0" "c.400C>T" "r.(?)" "p.(Arg134*)" "" "0000896044" "00001567" "70" "71" "0" "71" "0" "c.71A>G" "r.(?)" "p.(Tyr24Cys)" "" "0000896045" "00001567" "70" "404" "-6" "404" "-6" "c.404-6C>G" "r.(=)" "p.(=)" "" "0000896046" "00001567" "50" "2164" "0" "2164" "0" "c.2164C>T" "r.(?)" "p.(Arg722Cys)" "" "0000896047" "00001567" "50" "2269" "0" "2269" "0" "c.2269G>C" "r.(?)" "p.(Asp757His)" "" "0000896048" "00001567" "30" "2994" "0" "2994" "0" "c.2994C>T" "r.(?)" "p.(Phe998=)" "" "0000896049" "00001567" "70" "21616" "0" "21616" "0" "c.*18523A>G" "r.(=)" "p.(=)" "" "0000896533" "00001567" "70" "2797" "1151" "2797" "1151" "c.2797+1151C>G" "r.(=)" "p.(=)" "" "0000896640" "00001567" "70" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000896645" "00001567" "90" "2797" "1183" "2797" "1184" "c.2797+1183_2797+1184del" "r.(=)" "p.(=)" "" "0000905993" "00001567" "90" "2714" "-1468" "2714" "-1468" "c.2714-1468G>T" "r.(=)" "p.(=)" "" "0000905994" "00001567" "90" "2714" "-1468" "2714" "-1468" "c.2714-1468G>T" "r.(=)" "p.(=)" "" "0000905995" "00001567" "90" "2714" "-1468" "2714" "-1468" "c.2714-1468G>T" "r.(=)" "p.(=)" "" "0000908556" "00001567" "90" "2494" "0" "2494" "0" "c.2494C>T" "r.(?)" "p.(Gln832*)" "" "0000915663" "00001567" "50" "556" "0" "556" "0" "c.556G>C" "r.(?)" "p.(Ala186Pro)" "" "0000915664" "00001567" "30" "1118" "0" "1118" "0" "c.1118G>C" "r.(?)" "p.(Gly373Ala)" "" "0000915665" "00001567" "90" "1648" "0" "1648" "0" "c.1648C>T" "r.(?)" "p.(Arg550*)" "" "0000915666" "00001567" "70" "2714" "-3926" "2714" "-3926" "c.2714-3926G>A" "r.(=)" "p.(=)" "" "0000915667" "00001567" "50" "2714" "-1467" "2714" "-1467" "c.2714-1467T>C" "r.(=)" "p.(=)" "" "0000927307" "00001567" "90" "2797" "1104" "2797" "1104" "c.2797+1104A>C" "r.(=)" "p.(=)" "" "0000931368" "00001567" "90" "2714" "-1468" "2714" "-1468" "c.2714-1468G>T" "r.(=)" "p.(=)" "" "0000936401" "00001567" "90" "1292" "0" "1293" "0" "c.1292_1293del" "r.(?)" "p.(Thr431Lysfs*31)" "" "0000936463" "00001567" "90" "532" "0" "532" "0" "c.532C>T" "r.(?)" "p.(Arg178Trp)" "" "0000939890" "00001567" "70" "176" "0" "176" "0" "c.176G>A" "r.(?)" "p.(Arg59Gln)" "12" "0000951727" "00001567" "90" "2797" "1204" "2797" "1204" "c.2797+1204C>A" "r.(=)" "p.(=)" "" "0000951728" "00001567" "70" "2797" "1211" "2797" "1211" "c.2797+1211C>G" "r.(=)" "p.(=)" "" "0000951729" "00001567" "70" "21616" "0" "21616" "0" "c.*18523A>T" "r.(=)" "p.(=)" "" "0000959728" "00001567" "90" "100" "-14734" "2153" "-308" "c.100-14734_2153-308dup" "r.?" "p.?" "3i_14i" "0000970958" "00001567" "50" "2519" "0" "2519" "0" "c.2519G>A" "r.(?)" "p.(Arg840His)" "" "0000970961" "00001567" "30" "6299" "0" "6299" "0" "c.*3206G>A" "r.(=)" "p.(=)" "" "0000984590" "00001567" "30" "2980" "0" "2980" "0" "c.2980G>A" "r.(?)" "p.(Gly994Arg)" "" "0001006633" "00001567" "50" "403" "5" "403" "5" "c.403+5G>A" "r.spl?" "p.?" "" "0001006634" "00001567" "30" "1721" "0" "1721" "0" "c.1721C>T" "r.(?)" "p.(Pro574Leu)" "" "0001006635" "00001567" "30" "1975" "0" "1975" "0" "c.1975G>A" "r.(?)" "p.(Val659Met)" "" "0001006636" "00001567" "50" "2518" "0" "2518" "0" "c.2518C>T" "r.(?)" "p.(Arg840Cys)" "" "0001006637" "00001567" "30" "2714" "-1520" "2714" "-1520" "c.2714-1520G>A" "r.(=)" "p.(=)" "" "0001016011" "00001567" "90" "655" "0" "655" "0" "c.655C>T" "r.(?)" "p.(Gln219*)" "" "0001016012" "00001567" "90" "2797" "1213" "2797" "1213" "c.2797+1213C>T" "r.(=)" "p.(=)" "" "0001017747" "00001567" "70" "873" "0" "873" "0" "c.873T>G" "r.?" "p.(Cys291Trp)" "11" "0001027472" "00001567" "90" "2797" "1139" "2797" "1139" "c.2797+1139C>T" "r.(=)" "p.(=)" "" "0001044243" "00001567" "30" "64" "4" "64" "4" "c.64+4A>G" "r.spl?" "p.?" "" "0001044244" "00001567" "30" "100" "-5119" "100" "-5119" "c.100-5119G>A" "r.(=)" "p.(=)" "" "0001058527" "00001567" "90" "73" "0" "73" "0" "c.73G>A" "r.(?)" "p.(Gly25Arg)" "" "0001058528" "00001567" "90" "1675" "0" "1675" "0" "c.1675C>T" "r.(?)" "p.(Arg559Ter)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 694 "{{screeningid}}" "{{variantid}}" "0000000102" "0000830156" "0000000102" "0000830418" "0000000102" "0000830455" "0000000209" "0000006452" "0000035216" "0000062335" "0000035217" "0000062336" "0000035218" "0000062337" "0000035219" "0000062338" "0000035220" "0000062339" "0000035221" "0000062340" "0000035222" "0000062341" "0000035223" "0000062342" "0000035224" "0000062343" "0000035225" "0000062344" "0000035226" "0000062345" "0000035227" "0000062346" "0000035228" "0000062347" "0000035229" "0000062348" "0000035230" "0000062349" "0000035231" "0000062350" "0000035232" "0000062351" "0000050584" "0000079564" "0000081175" "0000130261" "0000081197" "0000130283" "0000087413" "0000140783" "0000115336" "0000184831" "0000115337" "0000184789" "0000115337" "0000184790" "0000115337" "0000184791" "0000115338" "0000184794" "0000115339" "0000184837" "0000115340" "0000184838" "0000115341" "0000184839" "0000115342" "0000184841" "0000115343" "0000184842" "0000115344" "0000184843" "0000115345" "0000184844" "0000115346" "0000184795" "0000115347" "0000184846" "0000115348" "0000184847" "0000115348" "0000184849" "0000115349" "0000184852" "0000115350" "0000184853" "0000115351" "0000184813" "0000115352" "0000184814" "0000115353" "0000184796" "0000115354" "0000184855" "0000115355" "0000184857" "0000115364" "0000184866" "0000115365" "0000184867" "0000115366" "0000184869" "0000115367" "0000184815" "0000115368" "0000184873" "0000115369" "0000184874" "0000115370" "0000184825" "0000115371" "0000184875" "0000115372" "0000184876" "0000115373" "0000184877" "0000115374" "0000184878" "0000115375" "0000184879" "0000115376" "0000184797" "0000115377" "0000184881" "0000115378" "0000184882" "0000115379" "0000184883" "0000115380" "0000184798" "0000115381" "0000184792" "0000115382" "0000184885" "0000115383" "0000184816" "0000115384" "0000184799" "0000115384" "0000184801" "0000115385" "0000184800" "0000115386" "0000184802" "0000115387" "0000184817" "0000115388" "0000184818" "0000115389" "0000184819" "0000115390" "0000184820" "0000115391" "0000184803" "0000115392" "0000184821" "0000115393" "0000184804" "0000115394" "0000184805" "0000115395" "0000184806" "0000115396" "0000184807" "0000115397" "0000184810" "0000115398" "0000184812" "0000115399" "0000184811" "0000115400" "0000184808" "0000115401" "0000184809" "0000115402" "0000184822" "0000115403" "0000184823" "0000115404" "0000184827" "0000115405" "0000184836" "0000115406" "0000184868" "0000115407" "0000184870" "0000115408" "0000184834" "0000115409" "0000184835" "0000115410" "0000184826" "0000115411" "0000184833" "0000115412" "0000184884" "0000115413" "0000184854" "0000115414" "0000184856" "0000115415" "0000184845" "0000115416" "0000184872" "0000115417" "0000184886" "0000115418" "0000184829" "0000115419" "0000184830" "0000115420" "0000184840" "0000115421" "0000184871" "0000115422" "0000184880" "0000115423" "0000184848" "0000115424" "0000184850" "0000115425" "0000184851" "0000115426" "0000184832" "0000115427" "0000184887" "0000115428" "0000184828" "0000115429" "0000184793" "0000115430" "0000184824" "0000132955" "0000222143" "0000133620" "0000222860" "0000177896" "0000400771" "0000210074" "0000441232" "0000275346" "0000629310" "0000296168" "0000652857" "0000296169" "0000652858" "0000296170" "0000652859" "0000296171" "0000652860" "0000296172" "0000652861" "0000296173" "0000652862" "0000296175" "0000652864" "0000296176" "0000652865" "0000296177" "0000652866" "0000304251" "0000667679" "0000304252" "0000667680" "0000304253" "0000667681" "0000304254" "0000667682" "0000304255" "0000667683" "0000304256" "0000667684" "0000304257" "0000667685" "0000304258" "0000667686" "0000304272" "0000667700" "0000304273" "0000667701" "0000306417" "0000670105" "0000307101" "0000673666" "0000307102" "0000673667" "0000310690" "0000685631" "0000311037" "0000686212" "0000311039" "0000686214" "0000311040" "0000686215" "0000311041" "0000686216" "0000311042" "0000686217" "0000311043" "0000686218" "0000314952" "0000696947" "0000321356" "0000704185" "0000362715" "0000763089" "0000362810" "0000763184" "0000375432" "0000786783" "0000375481" "0000787467" "0000375875" "0000787226" "0000375876" "0000787227" "0000375877" "0000787228" "0000375878" "0000787229" "0000389970" "0000819315" "0000390001" "0000819346" "0000390008" "0000819353" "0000390009" "0000819354" "0000390022" "0000819367" "0000390027" "0000819372" "0000390030" "0000819375" "0000390031" "0000819376" "0000390033" "0000819378" "0000390141" "0000819486" "0000390148" "0000819493" "0000390153" "0000819498" "0000390162" "0000819507" "0000390205" "0000819550" "0000390206" "0000819551" "0000392626" "0000822969" "0000392627" "0000822970" "0000392747" "0000823182" "0000392750" "0000823185" "0000392751" "0000823186" "0000392752" "0000823187" "0000392753" "0000823188" "0000392754" "0000823189" "0000392755" "0000823190" "0000392756" "0000823191" "0000392757" "0000823192" "0000392758" "0000823193" "0000397165" "0000828911" "0000397166" "0000828912" "0000397191" "0000828937" "0000397228" "0000829083" "0000397229" "0000829084" "0000397230" "0000829085" "0000397231" "0000829086" "0000397232" "0000829087" "0000397233" "0000829088" "0000397234" "0000829089" "0000397235" "0000829090" "0000397242" "0000829098" "0000397243" "0000829099" "0000397244" "0000829100" "0000397245" "0000829101" "0000397246" "0000829102" "0000397247" "0000829103" "0000397248" "0000829104" "0000397249" "0000829105" "0000397260" "0000829116" "0000397261" "0000829117" "0000397262" "0000829118" "0000397275" "0000829210" "0000397276" "0000829211" "0000397277" "0000829212" "0000397278" "0000829213" "0000397279" "0000829214" "0000397280" "0000829215" "0000397281" "0000829216" "0000397282" "0000829217" "0000397283" "0000829218" "0000397284" "0000829219" "0000397285" "0000829220" "0000397286" "0000829221" "0000397289" "0000829241" "0000397290" "0000829242" "0000397291" "0000829243" "0000397292" "0000829244" "0000397293" "0000829245" "0000397294" "0000829246" "0000397295" "0000829247" "0000397296" "0000829248" "0000397301" "0000829273" "0000397302" "0000829274" "0000397303" "0000829275" "0000397304" "0000829276" "0000397305" "0000829277" "0000397306" "0000829278" "0000397307" "0000829279" "0000397308" "0000829280" "0000397309" "0000829281" "0000397310" "0000829282" "0000397311" "0000829283" "0000397312" "0000829284" "0000397317" "0000829289" "0000397321" "0000829293" "0000397322" "0000829294" "0000397324" "0000829296" "0000397325" "0000829297" "0000397328" "0000829300" "0000397329" "0000829301" "0000397330" "0000829302" "0000397334" "0000829306" "0000397335" "0000829307" "0000397336" "0000829308" "0000397338" "0000829310" "0000397339" "0000829311" "0000397340" "0000829312" "0000397341" "0000829313" "0000397342" "0000829314" "0000397343" "0000829315" "0000397350" "0000829322" "0000397351" "0000829323" "0000397352" "0000829324" "0000397353" "0000829325" "0000397354" "0000829326" "0000397355" "0000829327" "0000397356" "0000829328" "0000397357" "0000829329" "0000397358" "0000829330" "0000397359" "0000829331" "0000397363" "0000829335" "0000397364" "0000829336" "0000397365" "0000829337" "0000397366" "0000829338" "0000397367" "0000829339" "0000397368" "0000829340" "0000397369" "0000829341" "0000397370" "0000829342" "0000397372" "0000829344" "0000397373" "0000829345" "0000397374" "0000829346" "0000397380" "0000829354" "0000397381" "0000829355" "0000397382" "0000829356" "0000397387" "0000829361" "0000397388" "0000829362" "0000397389" "0000829363" "0000397390" "0000829364" "0000397391" "0000829365" "0000397392" "0000829366" "0000397393" "0000829367" "0000397394" "0000829368" "0000397395" "0000829369" "0000397396" "0000829370" "0000397397" "0000829371" "0000397398" "0000829372" "0000397399" "0000829373" "0000397400" "0000829374" "0000397401" "0000829375" "0000397402" "0000829376" "0000397403" "0000829377" "0000397404" "0000829378" "0000397405" "0000829379" "0000397406" "0000829380" "0000397407" "0000829381" "0000397408" "0000829382" "0000397409" "0000829383" "0000397410" "0000829384" "0000397411" "0000829385" "0000397412" "0000829386" "0000397413" "0000829387" "0000397414" "0000829388" "0000397415" "0000829389" "0000397416" "0000829390" "0000397592" "0000829640" "0000397594" "0000829642" "0000397595" "0000829643" "0000397596" "0000829644" "0000397597" "0000829645" "0000397598" "0000829646" "0000397599" "0000829647" "0000397600" "0000829648" "0000397601" "0000829649" "0000397602" "0000829650" "0000397603" "0000829651" "0000397604" "0000829652" "0000397605" "0000829653" "0000397606" "0000829654" "0000397607" "0000829655" "0000397608" "0000829656" "0000397609" "0000829657" "0000397610" "0000829658" "0000397611" "0000829659" "0000397612" "0000829660" "0000397613" "0000829661" "0000397614" "0000829662" "0000397615" "0000829663" "0000397616" "0000829664" "0000397617" "0000829665" "0000397618" "0000829666" "0000397619" "0000829667" "0000397620" "0000829668" "0000397621" "0000829669" "0000397622" "0000829670" "0000397623" "0000829671" "0000397624" "0000829672" "0000397625" "0000829673" "0000397626" "0000829674" "0000397627" "0000829675" "0000397628" "0000829676" "0000397629" "0000829677" "0000397630" "0000829678" "0000397631" "0000829679" "0000397632" "0000829680" "0000397633" "0000829681" "0000397634" "0000829682" "0000397635" "0000829683" "0000397636" "0000829684" "0000397637" "0000829685" "0000397638" "0000829686" "0000397639" "0000829687" "0000397640" "0000829688" "0000397641" "0000829689" "0000397642" "0000829690" "0000397643" "0000829691" "0000397644" "0000829692" "0000397645" "0000829693" "0000397646" "0000829694" "0000397647" "0000829695" "0000397648" "0000829696" "0000397672" "0000829734" "0000397673" "0000829735" "0000397674" "0000829736" "0000397675" "0000829737" "0000397676" "0000829738" "0000397677" "0000829739" "0000397678" "0000829740" "0000397679" "0000829741" "0000397680" "0000829742" "0000397681" "0000829743" "0000397682" "0000829744" "0000397683" "0000829745" "0000397684" "0000829746" "0000397685" "0000829747" "0000397686" "0000829748" "0000397687" "0000829749" "0000397688" "0000829750" "0000397689" "0000829751" "0000397690" "0000829752" "0000397691" "0000829753" "0000397692" "0000829754" "0000397693" "0000829755" "0000397694" "0000829756" "0000397732" "0000829800" "0000397733" "0000829801" "0000397903" "0000830086" "0000397904" "0000830087" "0000397905" "0000830088" "0000397906" "0000830089" "0000397907" "0000830090" "0000397908" "0000830091" "0000397909" "0000830092" "0000397910" "0000830093" "0000397911" "0000830094" "0000397912" "0000830095" "0000397913" "0000830096" "0000397914" "0000830097" "0000397915" "0000830098" "0000397916" "0000830099" "0000397917" "0000830100" "0000397918" "0000830101" "0000397919" "0000830102" "0000397920" "0000830103" "0000397925" "0000830108" "0000397926" "0000830109" "0000397927" "0000830110" "0000397928" "0000830111" "0000397929" "0000830112" "0000397930" "0000830113" "0000397931" "0000830114" "0000397932" "0000830115" "0000397933" "0000830116" "0000397935" "0000830118" "0000397936" "0000830119" "0000397937" "0000830120" "0000397938" "0000830121" "0000397939" "0000830122" "0000397940" "0000830123" "0000397941" "0000830124" "0000397942" "0000830125" "0000397943" "0000830126" "0000397944" "0000830127" "0000397945" "0000830128" "0000397946" "0000830129" "0000397947" "0000830130" "0000397948" "0000830131" "0000397949" "0000830132" "0000397950" "0000830133" "0000397968" "0000830155" "0000397969" "0000830157" "0000397971" "0000830159" "0000397972" "0000830160" "0000397973" "0000830161" "0000397974" "0000830162" "0000397975" "0000830163" "0000397976" "0000830164" "0000397977" "0000830165" "0000397978" "0000830166" "0000397979" "0000830167" "0000397980" "0000830168" "0000397981" "0000830169" "0000397982" "0000830170" "0000397983" "0000830171" "0000397985" "0000830173" "0000397988" "0000830196" "0000397989" "0000830197" "0000397990" "0000830198" "0000397991" "0000830199" "0000397992" "0000830200" "0000397993" "0000830201" "0000397994" "0000830202" "0000397995" "0000830203" "0000397996" "0000830204" "0000397997" "0000830205" "0000397998" "0000830206" "0000397999" "0000830207" "0000398000" "0000830208" "0000398003" "0000830211" "0000398004" "0000830212" "0000398005" "0000830213" "0000398006" "0000830214" "0000398007" "0000830215" "0000398008" "0000830216" "0000398009" "0000830217" "0000398010" "0000830218" "0000398011" "0000830219" "0000398012" "0000830220" "0000398013" "0000830221" "0000398014" "0000830222" "0000398015" "0000830223" "0000398016" "0000830224" "0000398017" "0000830225" "0000398018" "0000830226" "0000398019" "0000830227" "0000398020" "0000830228" "0000398024" "0000830232" "0000398025" "0000830233" "0000398026" "0000830234" "0000398027" "0000830235" "0000398028" "0000830236" "0000398029" "0000830237" "0000398030" "0000830238" "0000398031" "0000830239" "0000398032" "0000830240" "0000398033" "0000830241" "0000398034" "0000830242" "0000398035" "0000830243" "0000398036" "0000830244" "0000398037" "0000830245" "0000398040" "0000830248" "0000398041" "0000830249" "0000398042" "0000830250" "0000398043" "0000830251" "0000398044" "0000830252" "0000398045" "0000830253" "0000398046" "0000830254" "0000398047" "0000830255" "0000398048" "0000830256" "0000398049" "0000830257" "0000398050" "0000830258" "0000398051" "0000830259" "0000398052" "0000830260" "0000398053" "0000830261" "0000398054" "0000830262" "0000398055" "0000830263" "0000398056" "0000830264" "0000398057" "0000830265" "0000398058" "0000830266" "0000398059" "0000830267" "0000398060" "0000830268" "0000398061" "0000830269" "0000398062" "0000830270" "0000398115" "0000830323" "0000398116" "0000830324" "0000398117" "0000830325" "0000398118" "0000830326" "0000398119" "0000830327" "0000398120" "0000830328" "0000398121" "0000830329" "0000398122" "0000830330" "0000398123" "0000830331" "0000398124" "0000830332" "0000398125" "0000830333" "0000398126" "0000830334" "0000398127" "0000830335" "0000398128" "0000830336" "0000398129" "0000830337" "0000398130" "0000830338" "0000398131" "0000830339" "0000398132" "0000830340" "0000398133" "0000830341" "0000398134" "0000830342" "0000398135" "0000830343" "0000398136" "0000830344" "0000398137" "0000830345" "0000398138" "0000830346" "0000398139" "0000830347" "0000398140" "0000830348" "0000398141" "0000830349" "0000398142" "0000830350" "0000398143" "0000830351" "0000398144" "0000830352" "0000398145" "0000830353" "0000398146" "0000830354" "0000398147" "0000830355" "0000398148" "0000830356" "0000398149" "0000830357" "0000398150" "0000830358" "0000398151" "0000830359" "0000398152" "0000830360" "0000398153" "0000830361" "0000398154" "0000830362" "0000398155" "0000830363" "0000398156" "0000830364" "0000398157" "0000830365" "0000398158" "0000830366" "0000398159" "0000830367" "0000398160" "0000830368" "0000398161" "0000830369" "0000398162" "0000830370" "0000398163" "0000830371" "0000398164" "0000830372" "0000398165" "0000830373" "0000398166" "0000830374" "0000398167" "0000830375" "0000398168" "0000830376" "0000398245" "0000830454" "0000398285" "0000830496" "0000398286" "0000830497" "0000398287" "0000830498" "0000398295" "0000830506" "0000398296" "0000830507" "0000398297" "0000830508" "0000398298" "0000830509" "0000398299" "0000830510" "0000398300" "0000830511" "0000398301" "0000830512" "0000398302" "0000830513" "0000398303" "0000830514" "0000398304" "0000830515" "0000398305" "0000830516" "0000398306" "0000830517" "0000398307" "0000830518" "0000398308" "0000830519" "0000398309" "0000830520" "0000398310" "0000830521" "0000398311" "0000830522" "0000398312" "0000830523" "0000398313" "0000830524" "0000398314" "0000830525" "0000398315" "0000830526" "0000398316" "0000830527" "0000398317" "0000830528" "0000398318" "0000830529" "0000398319" "0000830530" "0000398320" "0000830531" "0000398321" "0000830532" "0000398322" "0000830533" "0000398323" "0000830534" "0000398324" "0000830535" "0000398325" "0000830536" "0000398326" "0000830537" "0000398327" "0000830538" "0000398328" "0000830539" "0000398329" "0000830540" "0000398330" "0000830541" "0000398331" "0000830542" "0000398332" "0000830543" "0000398333" "0000830544" "0000398334" "0000830545" "0000398335" "0000830546" "0000398336" "0000830547" "0000398337" "0000830548" "0000398338" "0000830549" "0000398339" "0000830550" "0000398340" "0000830551" "0000398341" "0000830552" "0000398342" "0000830553" "0000398343" "0000830554" "0000398344" "0000830555" "0000398345" "0000830556" "0000398346" "0000830557" "0000398347" "0000830558" "0000398348" "0000830559" "0000398349" "0000830560" "0000398350" "0000830561" "0000398351" "0000830562" "0000398352" "0000830563" "0000398353" "0000830564" "0000398354" "0000830565" "0000398355" "0000830566" "0000398356" "0000830567" "0000398357" "0000830568" "0000398358" "0000830569" "0000398359" "0000830570" "0000398360" "0000830571" "0000398361" "0000830572" "0000398362" "0000830573" "0000398363" "0000830574" "0000398364" "0000830575" "0000398365" "0000830576" "0000398366" "0000830577" "0000398367" "0000830578" "0000398368" "0000830579" "0000398369" "0000830580" "0000398370" "0000830581" "0000398371" "0000830582" "0000398372" "0000830583" "0000398373" "0000830584" "0000398374" "0000830585" "0000398375" "0000830586" "0000398376" "0000830587" "0000398377" "0000830588" "0000398378" "0000830589" "0000404254" "0000839873" "0000409704" "0000846908" "0000409705" "0000846909" "0000409706" "0000846910" "0000409707" "0000846911" "0000409708" "0000846912" "0000409709" "0000846913" "0000409710" "0000846914" "0000409711" "0000846915" "0000409712" "0000846916" "0000409713" "0000846917" "0000409714" "0000846918" "0000409715" "0000846919" "0000409716" "0000846920" "0000409717" "0000846921" "0000409718" "0000846922" "0000409719" "0000846923" "0000413630" "0000871138" "0000421755" "0000896533" "0000421830" "0000896640" "0000421834" "0000896645" "0000428271" "0000905993" "0000428272" "0000905994" "0000428273" "0000905995" "0000429134" "0000908556" "0000440098" "0000936401" "0000440165" "0000936463" "0000441948" "0000939890" "0000449510" "0000959728" "0000459656" "0001017747" "0000470405" "0001058527" "0000470406" "0001058528"