### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = CELSR1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "CELSR1" "cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila)" "22" "q13.31" "unknown" "NG_030466.1" "UD_132463715236" "" "https://www.LOVD.nl/CELSR1" "" "1" "1850" "9620" "604523" "1" "1" "1" "1" "Establishment of the database was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "https://databases.lovd.nl/shared/refseq/CELSR1_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2011-10-31 00:00:00" "00006" "2017-09-04 09:35:07" "00000" "2025-07-08 13:22:38" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00004951" "CELSR1" "cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila)" "001" "NM_014246.1" "" "NP_055061.1" "" "" "" "1" "11389" "9045" "46933067" "46756731" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00152" "CHD" "heart disease, congenital (CHD)" "" "" "" "" "" "00008" "2013-06-19 09:27:11" "00006" "2015-01-23 22:14:45" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00860" "NTD" "neural tube defects, susceptibility to (NTD)" "AD" "182940" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05294" "craniorachischisis" "craniorachischisis" "" "" "" "severe type of neural tube defect, neural tube remains open from the midbrain or rostral hindbrain to base of spine" "" "00006" "2017-06-26 10:55:08" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 0 ## Individuals ## Do not remove or alter this header ## ## Count = 40 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00117785" "" "" "" "4" "" "00006" "" "" "" "" "" "" "0" "" "" "" "" "00117786" "" "" "" "12" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117787" "" "" "" "1" "" "00006" "" "" "" "" "" "" "0" "" "" "" "" "00117788" "" "" "" "10" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117789" "" "" "" "1" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117790" "" "" "" "1" "" "02069" "" "" "" "?" "United States" "" "0" "" "" "" "" "00117791" "" "" "" "1" "" "02069" "" "" "" "?" "United States" "" "0" "" "" "" "" "00117792" "" "" "" "8" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117793" "" "" "" "2" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117794" "" "" "" "1" "" "02069" "" "" "" "?" "United States" "" "0" "" "" "" "" "00117795" "" "" "" "1" "" "02069" "" "" "" "?" "United States" "" "0" "" "" "" "" "00117796" "" "" "" "1" "" "02069" "" "" "" "?" "United States" "" "0" "" "" "" "" "00117797" "" "" "" "3" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117798" "" "" "" "1" "" "02069" "" "" "" "?" "United States" "" "0" "" "" "" "" "00117799" "" "" "" "1" "" "02069" "" "" "" "?" "United States" "" "0" "" "" "" "" "00117800" "" "" "" "1" "" "02069" "" "" "" "?" "United States" "" "0" "" "" "" "" "00117801" "" "" "" "1" "" "02069" "" "" "" "?" "United States" "" "0" "" "" "" "" "00117802" "" "" "" "11" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117803" "" "" "" "12" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117804" "" "" "" "1" "" "02069" "" "" "" "?" "United States" "" "0" "" "" "" "" "00117805" "" "" "" "14" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117806" "" "" "" "2" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117807" "" "" "" "11" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117808" "" "" "" "8" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117809" "" "" "" "1" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117810" "" "" "" "1" "" "02069" "" "" "" "?" "United States" "" "0" "" "" "" "" "00117811" "" "" "" "1" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117812" "" "" "" "1" "" "02069" "" "" "" "?" "United States" "" "0" "" "" "" "" "00117813" "" "" "" "1" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117814" "" "" "" "2" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117815" "" "" "" "1" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117816" "" "" "" "19" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117817" "" "" "" "1" "" "02069" "" "" "" "?" "United States" "" "0" "" "" "" "" "00117818" "" "" "" "21" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117819" "" "" "" "10" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117820" "" "" "" "1" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00117821" "" "" "" "3" "" "02062" "" "" "" "" "" "" "0" "" "" "" "" "00299641" "" "" "" "1" "" "00006" "{PMID:Arno 2017:28132693}" "2-generation family, 1 affeted" "M" "" "" "" "0" "" "" "" "FamGC3626Pat2" "00453720" "" "" "" "1" "" "00006" "{PMID:Mansoorshahi 2024:39226896}" "analysis 215 early-onset complications bicuspid aortic valve-affected families." "" "" "United States" "" "0" "" "" "" "BAV090" "00453721" "" "" "" "1" "" "00006" "{PMID:Mansoorshahi 2024:39226896}" "analysis 215 early-onset complications bicuspid aortic valve-affected families." "" "" "United States" "" "0" "" "" "" "BAV263" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 40 "{{individualid}}" "{{diseaseid}}" "00117785" "05294" "00117786" "00198" "00117787" "00198" "00117788" "05294" "00117789" "05294" "00117790" "00860" "00117791" "00860" "00117792" "05294" "00117793" "05294" "00117794" "00860" "00117795" "00860" "00117796" "00860" "00117797" "05294" "00117798" "00860" "00117799" "00860" "00117800" "00860" "00117801" "00860" "00117802" "05294" "00117803" "05294" "00117804" "00860" "00117805" "05294" "00117806" "05294" "00117807" "00198" "00117808" "05294" "00117809" "05294" "00117810" "00860" "00117811" "05294" "00117812" "00860" "00117813" "05294" "00117814" "00198" "00117815" "05294" "00117816" "05294" "00117817" "00860" "00117818" "05294" "00117819" "05294" "00117820" "05294" "00117821" "00198" "00299641" "04214" "00453720" "00152" "00453721" "00152" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00152, 00198, 00860, 04214, 05294 ## Count = 16 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000093197" "00860" "00117790" "02069" "Isolated (sporadic)" "" "myelomeningocele" "" "" "" "" "" "" "" "" "" "" "" "0000093198" "00860" "00117791" "02069" "Isolated (sporadic)" "" "myelomeningocele" "" "" "" "" "" "" "" "" "" "" "" "0000093199" "00860" "00117794" "02069" "Isolated (sporadic)" "" "myelomeningocele" "" "" "" "" "" "" "" "" "" "" "" "0000093200" "00860" "00117795" "02069" "Isolated (sporadic)" "" "myelomeningocele" "" "" "" "" "" "" "" "" "" "" "" "0000093201" "00860" "00117796" "02069" "Isolated (sporadic)" "" "myelomeningocele" "" "" "" "" "" "" "" "" "" "" "" "0000093202" "00860" "00117798" "02069" "Isolated (sporadic)" "" "myelomeningocele" "" "" "" "" "" "" "" "" "" "" "" "0000093203" "00860" "00117799" "02069" "Isolated (sporadic)" "" "myelomeningocele" "" "" "" "" "" "" "" "" "" "" "" "0000093204" "00860" "00117800" "02069" "Isolated (sporadic)" "" "myelomeningocele" "" "" "" "" "" "" "" "" "" "" "" "0000093205" "00860" "00117801" "02069" "Isolated (sporadic)" "" "myelomeningocele" "" "" "" "" "" "" "" "" "" "" "" "0000093206" "00860" "00117804" "02069" "Isolated (sporadic)" "" "myelomeningocele" "" "" "" "" "" "" "" "" "" "" "" "0000093207" "00860" "00117810" "02069" "Isolated (sporadic)" "" "myelomeningocele" "" "" "" "" "" "" "" "" "" "" "" "0000093208" "00860" "00117812" "02069" "Isolated (sporadic)" "" "myelomeningocele" "" "" "" "" "" "" "" "" "" "" "" "0000093209" "00860" "00117817" "02069" "Isolated (sporadic)" "" "myelomeningocele" "" "" "" "" "" "" "" "" "" "" "" "0000226951" "04214" "00299641" "00006" "Familial, autosomal recessive" "51y" "see paper; ..., 29y-photopsia (HP:0030786), slightly reduced acuity (HP:0007663), mild nyctalopia (HP:0000662); irregular pigmented lesions in periphery(HP:0007703), pale discs (HP:0000543), cystoid macular edema (HP:0011505), peripheral telangiectasia (HP:0007763) with some retinal edema (HP:0020120) and vitreous cells (HP:0004327), possible para-arteriolar sparing; 29y-ERG no identifiable responses other than a minimal, delayed response to 30Hz flicker (PERG, EOG and ERG tested), severe photoreceptor dysfunction; 29y-colour vision Ishihara 15/15 each eye; 29y-Goldmann visual fields ring scotoma at 30 degrees, binocular Esterman age 36: central 20 degrees only retained; presenting VA logMAR (Snellen) R 0.48 (20/60), L 0.3 (20/40); latest VA logMAR R 1.8 (20/1250), L 1.5 (20/630); latest refractive error, dioptres R -1.00/-1.00x5, L +0.75/-1.00x90" "29y" "" "" "" "" "" "" "" "RP78" "retinitis pigmentosa" "" "0000342377" "00152" "00453720" "00006" "Unknown" "" "large root and ascending aneurysm" "" "" "" "" "" "" "" "" "" "bicuspid aortic valve" "" "0000342378" "00152" "00453721" "00006" "Unknown" "" "aortic valve replacement (ross)" "" "" "" "" "" "" "" "" "" "bicuspid aortic valve" "" ## Screenings ## Do not remove or alter this header ## ## Count = 40 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000118248" "00117785" "1" "00006" "00006" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118249" "00117786" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118250" "00117787" "1" "00006" "00006" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118251" "00117788" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118252" "00117789" "1" "02062" "02062" "2011-11-01 10:49:04" "" "" "SEQ" "DNA" "" "" "0000118253" "00117790" "1" "02069" "02069" "2013-09-29 10:04:22" "02062" "2013-10-28 17:27:31" "SEQ" "DNA" "" "" "0000118254" "00117791" "1" "02069" "02069" "2013-09-29 10:09:10" "02062" "2013-10-28 17:28:50" "SEQ" "DNA" "" "" "0000118255" "00117792" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118256" "00117793" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118257" "00117794" "1" "02069" "02069" "2013-09-29 10:50:25" "02062" "2013-10-28 17:33:32" "SEQ" "DNA" "" "" "0000118258" "00117795" "1" "02069" "02069" "2013-09-29 10:11:47" "02062" "2013-10-28 17:33:18" "SEQ" "DNA" "" "" "0000118259" "00117796" "1" "02069" "02069" "2013-09-29 10:46:12" "02062" "2013-10-28 17:32:53" "SEQ" "DNA" "" "" "0000118260" "00117797" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118261" "00117798" "1" "02069" "02069" "2013-09-29 09:45:50" "02062" "2013-10-28 17:29:20" "SEQ" "DNA" "" "" "0000118262" "00117799" "1" "02069" "02069" "2013-09-29 10:38:08" "02062" "2013-10-28 17:32:06" "SEQ" "DNA" "" "" "0000118263" "00117800" "1" "02069" "02069" "2013-09-29 09:33:50" "02062" "2013-10-28 17:31:49" "SEQ" "DNA" "" "" "0000118264" "00117801" "1" "02069" "02069" "2013-09-29 10:42:24" "02062" "2013-10-28 17:31:35" "SEQ" "DNA" "" "" "0000118265" "00117802" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118266" "00117803" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118267" "00117804" "1" "02069" "02069" "2013-09-29 10:30:40" "02062" "2013-10-28 17:31:19" "SEQ" "DNA" "" "" "0000118268" "00117805" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118269" "00117806" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118270" "00117807" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118271" "00117808" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118272" "00117809" "1" "02062" "02062" "2011-11-01 11:02:38" "" "" "SEQ" "DNA" "" "" "0000118273" "00117810" "1" "02069" "02069" "2013-09-29 10:27:43" "02062" "2013-10-28 17:30:57" "SEQ" "DNA" "" "" "0000118274" "00117811" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118275" "00117812" "1" "02069" "02069" "2013-09-29 10:21:10" "02062" "2013-10-28 17:30:41" "SEQ" "DNA" "" "" "0000118276" "00117813" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118277" "00117814" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118278" "00117815" "1" "02062" "02062" "2011-11-01 11:05:48" "" "" "SEQ" "DNA" "" "" "0000118279" "00117816" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118280" "00117817" "1" "02069" "02069" "2013-09-29 10:16:59" "02062" "2013-10-28 17:30:09" "SEQ" "DNA" "" "" "0000118281" "00117818" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118282" "00117819" "1" "02062" "02062" "2011-11-04 16:01:10" "" "" "SEQ" "DNA" "" "" "0000118283" "00117820" "1" "02062" "02062" "2011-11-01 11:15:31" "" "" "SEQ" "DNA" "" "" "0000118284" "00117821" "1" "02062" "02062" "2011-11-01 10:49:04" "" "" "SEQ" "DNA" "" "" "0000300751" "00299641" "1" "00006" "00006" "2020-04-18 08:53:03" "00006" "2020-04-18 09:16:58" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WGS" "0000455332" "00453720" "1" "00006" "00006" "2024-09-11 19:50:28" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000455333" "00453721" "1" "00006" "00006" "2024-09-11 19:50:28" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 38 "{{screeningid}}" "{{geneid}}" "0000118248" "CELSR1" "0000118249" "CELSR1" "0000118250" "CELSR1" "0000118251" "CELSR1" "0000118252" "CELSR1" "0000118253" "CELSR1" "0000118254" "CELSR1" "0000118255" "CELSR1" "0000118256" "CELSR1" "0000118257" "CELSR1" "0000118258" "CELSR1" "0000118259" "CELSR1" "0000118260" "CELSR1" "0000118261" "CELSR1" "0000118262" "CELSR1" "0000118263" "CELSR1" "0000118264" "CELSR1" "0000118265" "CELSR1" "0000118266" "CELSR1" "0000118267" "CELSR1" "0000118268" "CELSR1" "0000118269" "CELSR1" "0000118270" "CELSR1" "0000118271" "CELSR1" "0000118272" "CELSR1" "0000118273" "CELSR1" "0000118274" "CELSR1" "0000118275" "CELSR1" "0000118276" "CELSR1" "0000118277" "CELSR1" "0000118278" "CELSR1" "0000118279" "CELSR1" "0000118280" "CELSR1" "0000118281" "CELSR1" "0000118282" "CELSR1" "0000118283" "CELSR1" "0000118284" "CELSR1" "0000300751" "ARHGEF18" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 158 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000194316" "1" "10" "22" "46931402" "46931402" "subst" "0.02866" "00006" "CELSR1_000017" "g.46931402G>C" "4/72" "" "" "" "" "Germline" "" "" "0" "" "" "g.46535505G>C" "" "benign" "" "0000194317" "1" "10" "22" "46931402" "46931402" "subst" "0.02866" "02062" "CELSR1_000017" "g.46931402G>C" "12/130" "" "" "" "control chromosomes tested" "Germline" "" "" "0" "" "" "g.46535505G>C" "" "benign" "" "0000194318" "1" "10" "22" "46931077" "46931077" "subst" "0.927859" "02062" "CELSR1_000018" "g.46931077G>C" "10/58" "" "" "" "" "Germline" "" "" "0" "" "" "g.46535180G>C" "" "benign" "" "0000194319" "1" "10" "22" "46929692" "46929692" "subst" "0.942179" "02062" "CELSR1_000011" "g.46929692A>G" "8/68" "" "" "" "" "Germline" "" "" "0" "" "" "g.46533795A>G" "" "benign" "" "0000194320" "1" "10" "22" "46805772" "46805772" "subst" "0.0233717" "02062" "CELSR1_000005" "g.46805772C>T" "3/72" "" "" "" "" "Germline" "" "" "0" "" "" "g.46409875C>T" "" "benign" "" "0000194321" "1" "10" "22" "46787697" "46787697" "subst" "0.1447" "02062" "CELSR1_000006" "g.46787697A>G" "11/72" "" "" "" "" "Germline" "" "" "0" "" "" "g.46391800A>G" "" "benign" "" "0000194322" "1" "10" "22" "46787694" "46787694" "subst" "0.163684" "02062" "CELSR1_000007" "g.46787694A>G" "12/72" "" "" "" "" "Germline" "" "" "0" "" "" "g.46391797A>G" "" "benign" "" "0000194323" "1" "10" "22" "46786315" "46786315" "subst" "0.169482" "02062" "CELSR1_000008" "g.46786315T>C" "14/72" "" "" "" "" "Germline" "" "" "0" "" "" "g.46390418T>C" "" "benign" "" "0000194324" "1" "10" "22" "46782382" "46782382" "subst" "0.0474181" "02062" "CELSR1_000009" "g.46782382C>T" "11/156" "" "" "" "control chromosomes tested" "Germline" "" "" "0" "" "" "g.46386485C>T" "" "benign" "" "0000194325" "1" "10" "22" "46780521" "46780521" "subst" "0.15562" "02062" "CELSR1_000010" "g.46780521T>C" "8/72" "" "" "" "" "Germline" "" "" "0" "" "" "g.46384624T>C" "" "benign" "" "0000194326" "1" "10" "22" "46772988" "46772988" "subst" "0.00533711" "02062" "CELSR1_000013" "g.46772988G>T" "2/180" "" "" "" "control chromosomes tested" "Germline" "" "" "0" "" "" "g.46377091G>T" "" "benign" "" "0000194327" "1" "10" "22" "46761497" "46761497" "subst" "0.191448" "02062" "CELSR1_000014" "g.46761497C>G" "19/72" "" "" "" "" "Germline" "" "" "0" "" "" "g.46365600C>G" "" "benign" "" "0000194328" "1" "10" "22" "46760481" "46760481" "subst" "0.213419" "02062" "CELSR1_000015" "g.46760481C>G" "21/72" "" "" "" "" "Germline" "" "" "0" "" "" "g.46364584C>G" "" "benign" "" "0000194329" "1" "10" "22" "46760086" "46760086" "subst" "0.137299" "02062" "CELSR1_000016" "g.46760086C>T" "10/72" "" "" "" "" "Germline" "" "" "0" "" "" "g.46364189C>T" "" "benign" "" "0000194330" "1" "30" "22" "46860063" "46860063" "subst" "0.014417" "02062" "CELSR1_000004" "g.46860063C>T" "2/72" "" "" "" "" "Germline" "" "" "0" "" "" "g.46464166C>T" "" "likely benign" "" "0000194331" "1" "30" "22" "46782382" "46782382" "subst" "0.0474181" "02062" "CELSR1_000009" "g.46782382C>T" "2/72" "" "" "" "" "Germline" "" "" "0" "" "" "g.46386485C>T" "" "likely benign" "" "0000194332" "0" "30" "22" "46777896" "46777896" "subst" "0.00367767" "02062" "CELSR1_000003" "g.46777896C>G" "1/72" "" "" "" "not in 346 control chromosomes; sporadic genetic origin" "Germline" "" "" "0" "" "" "g.46381999C>G" "" "likely benign" "" "0000194333" "1" "30" "22" "46774558" "46774558" "subst" "0.000484917" "02062" "CELSR1_000012" "g.46774558C>T" "1/72" "" "" "" "" "Germline" "" "" "0" "" "" "g.46378661C>T" "" "likely benign" "" "0000194334" "1" "30" "22" "46772988" "46772988" "subst" "0.00533711" "02062" "CELSR1_000013" "g.46772988G>T" "1/72" "" "" "" "" "Germline" "" "" "0" "" "" "g.46377091G>T" "" "likely benign" "" "0000194335" "0" "50" "22" "46931402" "46931402" "subst" "0.02866" "00006" "CELSR1_000017" "g.46931402G>C" "" "" "" "" "" "Germline" "" "rs11575871" "0" "" "" "g.46535505G>C" "" "VUS" "" "0000194336" "0" "50" "22" "46931077" "46931077" "subst" "0.927859" "00006" "CELSR1_000018" "g.46931077G>C" "" "" "" "" "" "Germline" "" "rs4823850" "0" "" "" "g.46535180G>C" "" "VUS" "" "0000194337" "0" "50" "22" "46929696" "46929696" "subst" "2.03169E-5" "02069" "CELSR1_000022" "g.46929696G>C" "1/192 patients" "" "" "" "" "Germline" "" "" "0" "" "" "g.46533799G>C" "" "VUS" "" "0000194338" "0" "50" "22" "46929692" "46929692" "subst" "0.942179" "00006" "CELSR1_000011" "g.46929692A>G" "" "" "" "" "" "Germline" "" "rs4823561" "0" "" "" "g.46533795A>G" "" "VUS" "" "0000194339" "0" "50" "22" "46860063" "46860063" "subst" "0.014417" "00006" "CELSR1_000004" "g.46860063C>T" "" "" "" "" "" "Germline" "" "rs6008842" "0" "" "" "g.46464166C>T" "" "VUS" "" "0000194340" "0" "50" "22" "46835264" "46835264" "subst" "0" "02069" "CELSR1_000023" "g.46835264C>T" "1/192 patients" "" "" "" "" "Germline" "" "" "0" "" "" "g.46439367C>T" "" "VUS" "" "0000194341" "0" "50" "22" "46806301" "46806301" "subst" "0.000126147" "02069" "CELSR1_000030" "g.46806301G>A" "1/192 patients" "" "" "" "" "Germline" "" "" "0" "" "" "g.46410404G>A" "" "VUS" "" "0000194342" "0" "50" "22" "46805772" "46805772" "subst" "0.0233717" "00006" "CELSR1_000005" "g.46805772C>T" "" "" "" "" "" "Germline" "" "rs11704506" "0" "" "" "g.46409875C>T" "" "VUS" "" "0000194343" "0" "50" "22" "46794486" "46794486" "subst" "3.25275E-5" "02069" "CELSR1_000019" "g.46794486C>A" "1/192 patients" "" "" "" "" "Germline" "" "" "0" "" "" "g.46398589C>A" "" "VUS" "" "0000194344" "0" "50" "22" "46794474" "46794474" "subst" "0" "02069" "CELSR1_000029" "g.46794474C>T" "1/192 patients" "" "" "" "" "Germline" "" "" "0" "" "" "g.46398577C>T" "" "VUS" "" "0000194345" "0" "50" "22" "46787697" "46787697" "subst" "0.1447" "00006" "CELSR1_000006" "g.46787697A>G" "" "" "" "" "" "Germline" "" "rs6008795" "0" "" "" "g.46391800A>G" "" "VUS" "" "0000194346" "0" "50" "22" "46787694" "46787694" "subst" "0.163684" "00006" "CELSR1_000007" "g.46787694A>G" "" "" "" "" "" "Germline" "" "rs6008794" "0" "" "" "g.46391797A>G" "" "VUS" "" "0000194347" "0" "50" "22" "46787149" "46787149" "subst" "5.28782E-5" "02069" "CELSR1_000027" "g.46787149C>T" "1/192 patients" "" "" "" "" "Germline" "" "" "0" "" "" "g.46391252C>T" "" "VUS" "" "0000194348" "0" "50" "22" "46786315" "46786315" "subst" "0.169482" "00006" "CELSR1_000008" "g.46786315T>C" "" "" "" "" "" "Germline" "" "rs4044210" "0" "" "" "g.46390418T>C" "" "VUS" "" "0000194349" "0" "50" "22" "46782382" "46782382" "subst" "0.0474181" "00006" "CELSR1_000009" "g.46782382C>T" "" "" "" "" "" "Germline" "" "rs34267201" "0" "" "" "g.46386485C>T" "" "VUS" "" "0000194350" "0" "50" "22" "46780521" "46780521" "subst" "0.15562" "00006" "CELSR1_000010" "g.46780521T>C" "" "" "" "" "" "Germline" "" "rs6007897" "0" "" "" "g.46384624T>C" "" "VUS" "" "0000194351" "0" "50" "22" "46777896" "46777896" "subst" "0.00367767" "00006" "CELSR1_000003" "g.46777896C>G" "" "" "" "" "" "Germline" "" "rs7787089" "0" "" "" "g.46381999C>G" "" "VUS" "" "0000194352" "0" "50" "22" "46777771" "46777771" "subst" "0.000143029" "02069" "CELSR1_000026" "g.46777771G>A" "1/192 patients" "" "" "" "" "Germline" "" "" "0" "" "" "g.46381874G>A" "" "VUS" "" "0000194353" "0" "50" "22" "46772988" "46772988" "subst" "0.00533711" "00006" "CELSR1_000013" "g.46772988G>T" "" "" "" "" "" "Germline" "" "rs12170597" "0" "" "" "g.46377091G>T" "" "VUS" "" "0000194354" "0" "50" "22" "46762367" "46762367" "subst" "4.02755E-5" "02062" "CELSR1_000005" "g.46762367T>G" "1/72" "" "" "" "not in 328 control chromosomes; sporadic genetic origin" "Germline" "" "" "0" "" "" "g.46366470T>G" "" "VUS" "" "0000194355" "0" "50" "22" "46761497" "46761497" "subst" "0.191448" "00006" "CELSR1_000014" "g.46761497C>G" "" "" "" "" "" "Germline" "" "rs12165943" "0" "" "" "g.46365600C>G" "" "VUS" "" "0000194356" "0" "50" "22" "46760556" "46760556" "subst" "1.64097E-5" "02069" "CELSR1_000024" "g.46760556C>T" "1/192 patients" "" "" "" "" "Germline" "" "" "0" "" "" "g.46364659C>T" "" "VUS" "" "0000194357" "0" "50" "22" "46760481" "46760481" "subst" "0.213419" "00006" "CELSR1_000015" "g.46760481C>G" "" "" "" "" "" "Germline" "" "rs9615351" "0" "" "" "g.46364584C>G" "" "VUS" "" "0000194358" "0" "50" "22" "46760086" "46760086" "subst" "0.137299" "00006" "CELSR1_000016" "g.46760086C>T" "" "" "" "" "" "Germline" "" "rs35364389" "0" "" "" "g.46364189C>T" "" "VUS" "" "0000194359" "0" "50" "22" "46760037" "46760037" "subst" "0.00583508" "00006" "CELSR1_000004" "g.46760037G>A" "" "" "" "" "" "Germline" "" "rs6008777" "0" "" "" "g.46364140G>A" "" "VUS" "" "0000194360" "0" "50" "22" "46759981" "46759981" "subst" "0.00765659" "02062" "CELSR1_000002" "g.46759981G>C" "3/398" "" "" "" "control chromosomes tested; sporadic genetic origin" "Germline" "" "" "0" "" "" "g.46364084G>C" "" "VUS" "" "0000194361" "0" "50" "22" "46759981" "46759981" "subst" "0.00765659" "00006" "CELSR1_000002" "g.46759981G>C" "" "" "" "" "" "Germline" "" "rs61741871" "0" "" "" "g.46364084G>C" "" "VUS" "" "0000194362" "0" "70" "22" "46930000" "46930000" "subst" "0" "02069" "CELSR1_000021" "g.46930000G>C" "1/192 patients" "" "" "" "" "Germline" "" "" "0" "" "" "g.46534103G>C" "" "likely pathogenic" "" "0000194363" "0" "70" "22" "46859702" "46859702" "subst" "1.68255E-5" "02069" "CELSR1_000031" "g.46859702G>A" "1/192 patients" "" "" "" "" "Germline" "" "" "0" "" "" "g.46463805G>A" "" "likely pathogenic" "" "0000194364" "0" "70" "22" "46805660" "46805661" "dup" "0" "02069" "CELSR1_000020" "g.46805660_46805661dup" "1/192 patients" "" "" "" "" "Germline" "" "" "0" "" "" "g.46409763_46409764dup" "" "likely pathogenic" "" "0000194365" "0" "70" "22" "46792625" "46792626" "del" "0" "02069" "CELSR1_000028" "g.46792625_46792626del" "1/192 patients" "" "" "" "" "Germline" "" "" "0" "" "" "g.46396728_46396729del" "" "likely pathogenic" "" "0000194366" "0" "70" "22" "46773053" "46773053" "subst" "0.000130215" "02069" "CELSR1_000025" "g.46773053G>A" "1/192 patients" "" "" "" "" "Germline" "" "" "0" "" "" "g.46377156G>A" "" "likely pathogenic" "" "0000194367" "0" "70" "22" "46760037" "46760037" "subst" "0.00583508" "02062" "CELSR1_000004" "g.46760037G>A" "2/72" "" "" "" "not in 328 control chromosomes; sporadic genetic origin" "Germline" "" "" "0" "" "" "g.46364140G>A" "" "likely pathogenic" "" "0000194368" "0" "70" "22" "46760037" "46760037" "subst" "0.00583508" "02062" "CELSR1_000004" "g.46760037G>A" "2/72" "" "" "" "not in 328 control chromosomes; sporadic genetic origin" "Germline" "" "" "0" "" "" "g.46364140G>A" "" "likely pathogenic" "" "0000194369" "0" "70" "22" "46759981" "46759981" "subst" "0.00765659" "02062" "CELSR1_000002" "g.46759981G>C" "2/72" "" "" "" "sporadic genetic origin" "Germline" "" "" "0" "" "" "g.46364084G>C" "" "likely pathogenic" "" "0000194370" "0" "70" "22" "46759981" "46759981" "subst" "0.00765659" "02062" "CELSR1_000002" "g.46759981G>C" "2/72" "" "" "" "sporadic genetic origin" "Germline" "" "" "0" "" "" "g.46364084G>C" "" "likely pathogenic" "" "0000194371" "0" "90" "22" "46930750" "46930750" "subst" "0.00116581" "02062" "CELSR1_000001" "g.46930750G>A" "1/72" "" "" "" "not in 416 control chromosomes; sporadic genetic origin" "Germline" "" "" "0" "" "" "g.46534853G>A" "" "pathogenic" "" "0000273091" "0" "30" "22" "46931858" "46931858" "subst" "0.00013276" "01943" "CELSR1_000043" "g.46931858C>T" "" "" "" "CELSR1(NM_014246.1):c.1210G>A (p.E404K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46535961C>T" "" "likely benign" "" "0000273092" "0" "50" "22" "46932931" "46932931" "subst" "0" "01943" "CELSR1_000045" "g.46932931G>A" "" "" "" "CELSR1(NM_001378328.1):c.137C>T (p.P46L), CELSR1(NM_014246.1):c.137C>T (p.P46L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46537034G>A" "" "VUS" "" "0000273093" "0" "30" "22" "46932591" "46932591" "subst" "0" "01943" "CELSR1_000044" "g.46932591C>A" "" "" "" "CELSR1(NM_014246.1):c.477G>T (p.P159=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46536694C>A" "" "likely benign" "" "0000273094" "0" "30" "22" "46794505" "46794505" "subst" "8.54659E-5" "01943" "CELSR1_000040" "g.46794505G>A" "" "" "" "CELSR1(NM_014246.1):c.5442C>T (p.P1814=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46398608G>A" "" "likely benign" "" "0000273095" "0" "30" "22" "46793621" "46793621" "subst" "0.00514519" "01943" "CELSR1_000039" "g.46793621T>C" "" "" "" "CELSR1(NM_014246.1):c.5651A>G (p.N1884S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46397724T>C" "" "likely benign" "" "0000273096" "0" "30" "22" "46782462" "46782462" "subst" "0.000457657" "01943" "CELSR1_000036" "g.46782462G>A" "" "" "" "CELSR1(NM_014246.1):c.6576C>T (p.S2192=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46386565G>A" "" "likely benign" "" "0000273097" "0" "30" "22" "46777936" "46777936" "subst" "0.00090026" "01943" "CELSR1_000035" "g.46777936G>T" "" "" "" "CELSR1(NM_014246.1):c.6895C>A (p.L2299M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46382039G>T" "" "likely benign" "" "0000273098" "0" "30" "22" "46774548" "46774548" "subst" "0" "01943" "CELSR1_000034" "g.46774548G>A" "" "" "" "CELSR1(NM_014246.1):c.7323C>T (p.V2441=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46378651G>A" "" "likely benign" "" "0000273099" "0" "30" "22" "46773018" "46773018" "subst" "0.00114774" "01943" "CELSR1_000033" "g.46773018G>A" "" "" "" "CELSR1(NM_014246.1):c.7524C>T (p.A2508=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46377121G>A" "" "likely benign" "" "0000273100" "0" "30" "22" "46761573" "46761573" "subst" "0" "01943" "CELSR1_000032" "g.46761573G>T" "" "" "" "CELSR1(NM_014246.1):c.8314C>A (p.Q2772K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46365676G>T" "" "likely benign" "" "0000329086" "0" "50" "22" "46785381" "46785381" "subst" "7.36956E-5" "01804" "CELSR1_000037" "g.46785381G>A" "" "" "" "CELSR1(NM_014246.1):c.6361C>T (p.(Arg2121Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46389484G>A" "" "VUS" "" "0000340944" "0" "10" "22" "46832075" "46832075" "subst" "4.06736E-5" "02327" "CELSR1_000049" "g.46832075A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46436178A>G" "" "benign" "" "0000345259" "0" "50" "22" "46780497" "46780497" "subst" "0" "02327" "CELSR1_000046" "g.46780497C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46384600C>G" "" "VUS" "" "0000349370" "0" "10" "22" "46780521" "46780521" "subst" "0" "02327" "CELSR1_000047" "g.46780521T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46384624T>A" "" "benign" "" "0000572277" "0" "50" "22" "46760121" "46760121" "subst" "3.32237E-5" "01943" "CELSR1_000050" "g.46760121G>A" "" "" "" "CELSR1(NM_014246.1):c.8807C>T (p.P2936L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46364224G>A" "" "VUS" "" "0000572278" "0" "30" "22" "46772949" "46772949" "subst" "0.0109673" "01943" "CELSR1_000052" "g.46772949T>A" "" "" "" "CELSR1(NM_001378328.1):c.7584+9A>T, CELSR1(NM_014246.1):c.7584+9A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46377052T>A" "" "likely benign" "" "0000618634" "0" "30" "22" "46932655" "46932655" "subst" "0" "01943" "CELSR1_000056" "g.46932655C>A" "" "" "" "CELSR1(NM_014246.1):c.413G>T (p.G138V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46536758C>A" "" "likely benign" "" "0000663639" "1" "50" "22" "46760604" "46760604" "subst" "0.000365658" "00006" "CELSR1_000057" "g.46760604C>T" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "" "0" "" "" "g.46364707C>T" "" "VUS" "" "0000663640" "2" "50" "22" "46762275" "46762275" "subst" "2.0601E-5" "00006" "CELSR1_000058" "g.46762275G>A" "" "{PMID:Arno 2017:28132693}" "" "" "" "Germline" "" "" "0" "" "" "g.46366378G>A" "" "VUS" "" "0000728204" "0" "50" "22" "46859834" "46859834" "subst" "0" "02327" "CELSR1_000059" "g.46859834C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728205" "0" "30" "22" "46932798" "46932798" "subst" "0" "01943" "CELSR1_000060" "g.46932798G>T" "" "" "" "CELSR1(NM_014246.1):c.270C>A (p.V90=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809666" "0" "30" "22" "46760596" "46760596" "subst" "4.14453E-6" "01943" "CELSR1_000061" "g.46760596G>C" "" "" "" "CELSR1(NM_014246.1):c.8592C>G (p.P2864=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915562" "0" "30" "22" "46795804" "46795804" "subst" "0.000126241" "02325" "CELSR1_000062" "g.46795804A>G" "" "" "" "CELSR1(NM_014246.4):c.5227-5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927193" "0" "10" "22" "46760086" "46760086" "subst" "0.137299" "02330" "CELSR1_000016" "g.46760086C>T" "" "" "" "CELSR1(NM_001378328.1):c.8842G>A (p.G2948S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927194" "0" "10" "22" "46760481" "46760481" "subst" "0.213419" "02330" "CELSR1_000015" "g.46760481C>G" "" "" "" "CELSR1(NM_001378328.1):c.8707G>C (p.E2903Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927195" "0" "10" "22" "46761497" "46761497" "subst" "0.191448" "02330" "CELSR1_000014" "g.46761497C>G" "" "" "" "CELSR1(NM_001378328.1):c.8390G>C (p.C2797S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927196" "0" "10" "22" "46762266" "46762266" "subst" "0.0684504" "02330" "CELSR1_000063" "g.46762266C>T" "" "" "" "CELSR1(NM_001378328.1):c.8300+17G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927197" "0" "10" "22" "46763671" "46763671" "subst" "0.129308" "02330" "CELSR1_000064" "g.46763671A>G" "" "" "" "CELSR1(NM_001378328.1):c.8034T>C (p.D2678=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927198" "0" "10" "22" "46763757" "46763757" "subst" "0.061253" "02330" "CELSR1_000065" "g.46763757G>A" "" "" "" "CELSR1(NM_001378328.1):c.7953-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927199" "0" "10" "22" "46765577" "46765577" "subst" "0.013086" "02330" "CELSR1_000066" "g.46765577C>T" "" "" "" "CELSR1(NM_001378328.1):c.7872+12G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927200" "0" "10" "22" "46768811" "46768811" "subst" "0.0418026" "02330" "CELSR1_000067" "g.46768811G>A" "" "" "" "CELSR1(NM_001378328.1):c.7728C>T (p.V2576=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927201" "0" "10" "22" "46776747" "46776747" "subst" "0.00212176" "02330" "CELSR1_000068" "g.46776747G>A" "" "" "" "CELSR1(NM_001378328.1):c.7194C>T (p.F2398=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927202" "0" "10" "22" "46777892" "46777892" "subst" "0.0365992" "02330" "CELSR1_000069" "g.46777892C>T" "" "" "" "CELSR1(NM_001378328.1):c.6939G>A (p.P2313=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927203" "0" "10" "22" "46780521" "46780521" "subst" "0.15562" "02330" "CELSR1_000010" "g.46780521T>C" "" "" "" "CELSR1(NM_001378328.1):c.6802A>G (p.T2268A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927204" "0" "10" "22" "46782382" "46782382" "subst" "0.0474181" "02330" "CELSR1_000009" "g.46782382C>T" "" "" "" "CELSR1(NM_001378328.1):c.6656G>A (p.R2219H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927205" "0" "10" "22" "46785301" "46785301" "subst" "0.0726676" "02330" "CELSR1_000070" "g.46785301C>T" "" "" "" "CELSR1(NM_001378328.1):c.6441G>A (p.T2147=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927206" "0" "10" "22" "46786315" "46786315" "subst" "0.169482" "02330" "CELSR1_000008" "g.46786315T>C" "" "" "" "CELSR1(NM_001378328.1):c.6319A>G (p.I2107V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927207" "0" "10" "22" "46787694" "46787694" "subst" "0.163684" "02330" "CELSR1_000007" "g.46787694A>G" "" "" "" "CELSR1(NM_001378328.1):c.5984T>C (p.L1995P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927208" "0" "10" "22" "46787697" "46787697" "subst" "0.1447" "02330" "CELSR1_000006" "g.46787697A>G" "" "" "" "CELSR1(NM_001378328.1):c.5981T>C (p.L1994P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927209" "0" "10" "22" "46790029" "46790029" "subst" "0.162191" "02330" "CELSR1_000071" "g.46790029G>T" "" "" "" "CELSR1(NM_001378328.1):c.5964+10C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927210" "0" "10" "22" "46793592" "46793592" "subst" "0.00607272" "02330" "CELSR1_000072" "g.46793592A>G" "" "" "" "CELSR1(NM_001378328.1):c.5680T>C (p.Y1894H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927211" "0" "10" "22" "46794475" "46794475" "subst" "0.0366116" "02330" "CELSR1_000073" "g.46794475T>C" "" "" "" "CELSR1(NM_001378328.1):c.5472A>G (p.G1824=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927212" "0" "10" "22" "46806278" "46806278" "del" "0" "02330" "CELSR1_000074" "g.46806278del" "" "" "" "CELSR1(NM_001378328.1):c.4933+19delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927213" "0" "10" "22" "46829377" "46829377" "subst" "0.018973" "02330" "CELSR1_000075" "g.46829377G>A" "" "" "" "CELSR1(NM_001378328.1):c.4524C>T (p.G1508=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927214" "0" "10" "22" "46859594" "46859594" "subst" "0.00123785" "02330" "CELSR1_000076" "g.46859594G>A" "" "" "" "CELSR1(NM_001378328.1):c.4183+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927215" "0" "10" "22" "46860063" "46860063" "subst" "0.014417" "02330" "CELSR1_000004" "g.46860063C>T" "" "" "" "CELSR1(NM_001378328.1):c.3724G>A (p.V1242I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927216" "0" "10" "22" "46860088" "46860088" "subst" "0.0671161" "02330" "CELSR1_000077" "g.46860088G>C" "" "" "" "CELSR1(NM_001378328.1):c.3699C>G (p.A1233=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927217" "0" "10" "22" "46929692" "46929692" "subst" "0.942179" "02330" "CELSR1_000011" "g.46929692A>G" "" "" "" "CELSR1(NM_001378328.1):c.3376T>C (p.C1126R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927218" "0" "10" "22" "46930107" "46930107" "subst" "0.198149" "02330" "CELSR1_000078" "g.46930107C>T" "" "" "" "CELSR1(NM_001378328.1):c.2961G>A (p.V987=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927219" "0" "10" "22" "46931077" "46931077" "subst" "0.927859" "02330" "CELSR1_000018" "g.46931077G>C" "" "" "" "CELSR1(NM_001378328.1):c.1991C>G (p.S664W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927220" "0" "10" "22" "46931793" "46931793" "subst" "0.938461" "02330" "CELSR1_000079" "g.46931793G>C" "" "" "" "CELSR1(NM_001378328.1):c.1275C>G (p.L425=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927221" "0" "10" "22" "46931838" "46931838" "subst" "0.926373" "02330" "CELSR1_000080" "g.46931838G>A" "" "" "" "CELSR1(NM_001378328.1):c.1230C>T (p.S410=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927222" "0" "10" "22" "46932660" "46932660" "subst" "0" "02330" "CELSR1_000081" "g.46932660G>A" "" "" "" "CELSR1(NM_001378328.1):c.408C>T (p.P136=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927223" "0" "10" "22" "46933061" "46933063" "del" "0" "02330" "CELSR1_000055" "g.46933061_46933063del" "" "" "" "CELSR1(NM_001378328.1):c.18_20delGCC (p.P7del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000931304" "0" "10" "22" "46772949" "46772949" "subst" "0.0109673" "02330" "CELSR1_000052" "g.46772949T>A" "" "" "" "CELSR1(NM_001378328.1):c.7584+9A>T, CELSR1(NM_014246.1):c.7584+9A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000931305" "0" "10" "22" "46805007" "46805007" "subst" "0.0624253" "02330" "CELSR1_000082" "g.46805007G>A" "" "" "" "CELSR1(NM_001378328.1):c.5112C>T (p.D1704=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000931306" "0" "10" "22" "46860223" "46860223" "subst" "0.0100382" "02330" "CELSR1_000083" "g.46860223C>T" "" "" "" "CELSR1(NM_001378328.1):c.3564G>A (p.T1188=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000951628" "0" "10" "22" "46760648" "46760648" "subst" "0.0610125" "02330" "CELSR1_000084" "g.46760648C>T" "" "" "" "CELSR1(NM_001378328.1):c.8555-15G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000951629" "0" "10" "22" "46931292" "46931292" "subst" "0.00379087" "02330" "CELSR1_000085" "g.46931292C>T" "" "" "" "CELSR1(NM_001378328.1):c.1776G>A (p.A592=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000951630" "0" "10" "22" "46931402" "46931402" "subst" "0.02866" "02330" "CELSR1_000017" "g.46931402G>C" "" "" "" "CELSR1(NM_001378328.1):c.1666C>G (p.L556V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000951631" "0" "50" "22" "46932547" "46932547" "subst" "0" "02330" "CELSR1_000086" "g.46932547G>T" "" "" "" "CELSR1(NM_001378328.1):c.521C>A (p.P174Q), CELSR1(NM_014246.1):c.521C>A (p.(Pro174Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000970513" "0" "10" "22" "46761565" "46761565" "subst" "0.0151444" "02330" "CELSR1_000087" "g.46761565G>C" "" "" "" "CELSR1(NM_001378328.1):c.8322C>G (p.L2774=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000970514" "0" "10" "22" "46762360" "46762360" "subst" "0.0133267" "02330" "CELSR1_000088" "g.46762360G>A" "" "" "" "CELSR1(NM_001378328.1):c.8223C>T (p.N2741=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000970515" "0" "10" "22" "46763692" "46763692" "subst" "0.00852339" "02330" "CELSR1_000089" "g.46763692C>A" "" "" "" "CELSR1(NM_001378328.1):c.8013G>T (p.G2671=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000970516" "0" "10" "22" "46777880" "46777880" "subst" "0.0127249" "02330" "CELSR1_000090" "g.46777880G>A" "" "" "" "CELSR1(NM_001378328.1):c.6951C>T (p.T2317=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000970517" "0" "30" "22" "46787555" "46787555" "subst" "0.00067457" "02330" "CELSR1_000091" "g.46787555G>A" "" "" "" "CELSR1(NM_001378328.1):c.6123C>T (p.A2041=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000970519" "0" "10" "22" "46929702" "46929702" "subst" "0.00305931" "02330" "CELSR1_000092" "g.46929702G>C" "" "" "" "CELSR1(NM_001378328.1):c.3366C>G (p.G1122=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000970520" "0" "10" "22" "46932777" "46932777" "subst" "0.000779474" "02330" "CELSR1_000093" "g.46932777G>C" "" "" "" "CELSR1(NM_001378328.1):c.291C>G (p.A97=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000970521" "0" "10" "22" "46932788" "46932788" "subst" "0.000696124" "02330" "CELSR1_000094" "g.46932788C>T" "" "" "" "CELSR1(NM_001378328.1):c.280G>A (p.A94T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000970522" "0" "10" "22" "46932931" "46932931" "subst" "0" "02330" "CELSR1_000045" "g.46932931G>A" "" "" "" "CELSR1(NM_001378328.1):c.137C>T (p.P46L), CELSR1(NM_014246.1):c.137C>T (p.P46L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000984296" "0" "30" "22" "46762969" "46762969" "subst" "0.00143238" "01804" "CELSR1_000095" "g.46762969C>T" "" "" "" "CELSR1(NM_001378328.1):c.8126G>A (p.(Arg2709Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984297" "0" "50" "22" "46787620" "46787620" "subst" "0" "02327" "CELSR1_000096" "g.46787620C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984298" "0" "10" "22" "46805772" "46805772" "subst" "0.0233717" "02330" "CELSR1_000005" "g.46805772C>T" "" "" "" "CELSR1(NM_001378328.1):c.4939G>A (p.A1647T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000984299" "0" "50" "22" "46807523" "46807523" "subst" "0" "02330" "CELSR1_000097" "g.46807523T>C" "" "" "" "CELSR1(NM_001378328.1):c.4745A>G (p.Q1582R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984300" "0" "70" "22" "46859690" "46859715" "dup" "0" "02329" "CELSR1_000098" "g.46859690_46859715dup" "" "" "" "CELSR1(NM_001378328.1):c.4072_4097dupGACTACTGCGAGACGGAGATCGACCT (p.C1367Tfs*62)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000984301" "0" "10" "22" "46930794" "46930794" "subst" "0.00799722" "02330" "CELSR1_000099" "g.46930794G>A" "" "" "" "CELSR1(NM_001378328.1):c.2274C>T (p.Y758=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000984302" "0" "30" "22" "46931893" "46931893" "subst" "0.000157147" "01804" "CELSR1_000100" "g.46931893A>G" "" "" "" "CELSR1(NM_001378328.1):c.1175T>C (p.(Val392Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984303" "0" "50" "22" "46932910" "46932910" "subst" "0" "01804" "CELSR1_000101" "g.46932910C>A" "" "" "" "CELSR1(NM_001378328.1):c.158G>T (p.(Gly53Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006221" "0" "30" "22" "46759929" "46759929" "subst" "0.000112488" "02330" "CELSR1_000102" "g.46759929C>T" "" "" "" "CELSR1(NM_001378328.1):c.8999G>A (p.R3000H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006222" "0" "30" "22" "46760507" "46760507" "subst" "3.26939E-5" "01804" "CELSR1_000103" "g.46760507C>T" "" "" "" "CELSR1(NM_014246.1):c.8681G>A (p.(Arg2894His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006223" "0" "10" "22" "46780573" "46780573" "subst" "0.00194626" "02330" "CELSR1_000104" "g.46780573G>A" "" "" "" "CELSR1(NM_001378328.1):c.6750C>T (p.V2250=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001006224" "0" "30" "22" "46782374" "46782374" "subst" "8.93527E-6" "01804" "CELSR1_000105" "g.46782374C>G" "" "" "" "CELSR1(NM_014246.1):c.6664G>C (p.(Gly2222Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006225" "0" "50" "22" "46829333" "46829333" "subst" "4.0665E-6" "01804" "CELSR1_000106" "g.46829333C>G" "" "" "" "CELSR1(NM_014246.1):c.4568G>C (p.(Ser1523Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006226" "0" "30" "22" "46859727" "46859727" "subst" "8.29511E-6" "01804" "CELSR1_000107" "g.46859727C>T" "" "" "" "CELSR1(NM_014246.1):c.4060G>A (p.(Gly1354Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006227" "0" "50" "22" "46859972" "46859972" "subst" "0" "01804" "CELSR1_000108" "g.46859972C>T" "" "" "" "CELSR1(NM_014246.1):c.3815G>A (p.(Gly1272Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006228" "0" "50" "22" "46930535" "46930535" "subst" "4.06412E-6" "01804" "CELSR1_000109" "g.46930535A>C" "" "" "" "CELSR1(NM_014246.1):c.2533T>G (p.(Tyr845Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006229" "0" "50" "22" "46931126" "46931126" "subst" "0" "02327" "CELSR1_000110" "g.46931126C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006230" "0" "50" "22" "46931387" "46931389" "del" "0" "01804" "CELSR1_000111" "g.46931387_46931389del" "" "" "" "CELSR1(NM_014246.1):c.1681_1683delAAC (p.(Asn561del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006231" "0" "50" "22" "46931462" "46931462" "subst" "4.07478E-6" "01804" "CELSR1_000112" "g.46931462C>T" "" "" "" "CELSR1(NM_014246.1):c.1606G>A (p.(Ala536Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006232" "0" "30" "22" "46932032" "46932032" "subst" "0.0012307" "02325" "CELSR1_000113" "g.46932032T>A" "" "" "" "CELSR1(NM_014246.4):c.1036A>T (p.T346S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006233" "0" "30" "22" "46932547" "46932547" "subst" "0" "01804" "CELSR1_000086" "g.46932547G>T" "" "" "" "CELSR1(NM_001378328.1):c.521C>A (p.P174Q), CELSR1(NM_014246.1):c.521C>A (p.(Pro174Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001006234" "0" "30" "22" "46932653" "46932653" "subst" "0" "01804" "CELSR1_000114" "g.46932653A>G" "" "" "" "CELSR1(NM_014246.1):c.415T>C (p.(Cys139Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001007439" "0" "70" "22" "46762987" "46762987" "subst" "4.13654E-6" "00006" "CELSR1_000115" "g.46762987A>T" "" "{PMID:Mansoorshahi 2024:39226896}" "" "" "" "Germline" "" "rs749087374" "0" "" "" "g.46367090A>T" "" "VUS" "" "0001007440" "0" "70" "22" "46807655" "46807655" "subst" "4.06451E-6" "00006" "CELSR1_000116" "g.46807655G>A" "" "{PMID:Mansoorshahi 2024:39226896}" "" "" "" "Germline" "" "rs1455765188" "0" "" "" "g.46411758G>A" "" "VUS" "" "0001015958" "0" "50" "22" "46930393" "46930393" "subst" "0" "02329" "CELSR1_000117" "g.46930393A>C" "" "" "" "CELSR1(NM_001378328.1):c.2675T>G (p.F892C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001027413" "0" "50" "22" "46790074" "46790074" "subst" "0" "02329" "CELSR1_000118" "g.46790074C>T" "" "" "" "CELSR1(NM_001378328.1):c.5929G>A (p.D1977N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001027414" "0" "30" "22" "46860228" "46860228" "subst" "2.45489E-5" "02325" "CELSR1_000119" "g.46860228C>T" "" "" "" "CELSR1(NM_014246.4):c.3559G>A (p.V1187I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043934" "0" "30" "22" "46765705" "46765705" "subst" "8.1592E-5" "01804" "CELSR1_000120" "g.46765705A>C" "" "" "" "CELSR1(NM_001378328.1):c.7760-4T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043935" "0" "30" "22" "46931309" "46931309" "subst" "0.00417621" "01804" "CELSR1_000121" "g.46931309T>C" "" "" "" "CELSR1(NM_001378328.1):c.1759A>G (p.(Ile587Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046826" "0" "30" "22" "46761160" "46761160" "subst" "3.67383E-5" "02325" "CELSR1_000122" "g.46761160G>A" "" "" "" "CELSR1(NM_014246.4):c.8522C>T (p.P2841L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046827" "0" "30" "22" "46777755" "46777755" "subst" "0" "02325" "CELSR1_000123" "g.46777755C>T" "" "" "" "CELSR1(NM_014246.4):c.7076G>A (p.R2359H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046828" "0" "50" "22" "46930670" "46930670" "subst" "0" "02325" "CELSR1_000124" "g.46930670C>T" "" "" "" "CELSR1(NM_014246.4):c.2398G>A (p.E800K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes CELSR1 ## Count = 158 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000194316" "00004951" "10" "1666" "0" "1666" "0" "c.1666C>G" "r.(?)" "p.(L556V)" "1" "0000194317" "00004951" "10" "1666" "0" "1666" "0" "c.1666C>G" "r.(?)" "p.(L556V)" "1" "0000194318" "00004951" "10" "1991" "0" "1991" "0" "c.1991C>G" "r.(?)" "p.(S664W)" "1" "0000194319" "00004951" "10" "3376" "0" "3376" "0" "c.3376T>C" "r.(?)" "p.(C1126R)" "1" "0000194320" "00004951" "10" "4939" "0" "4939" "0" "c.4939G>A" "r.(?)" "p.(A1647T)" "8" "0000194321" "00004951" "10" "5981" "0" "5981" "0" "c.5981T>C" "r.(?)" "p.(L1994P)" "15" "0000194322" "00004951" "10" "5984" "0" "5984" "0" "c.5984T>C" "r.(?)" "p.(L1995P)" "15" "0000194323" "00004951" "10" "6319" "0" "6319" "0" "c.6319A>G" "r.(?)" "p.(I2107V)" "17" "0000194324" "00004951" "10" "6656" "0" "6656" "0" "c.6656G>A" "r.(?)" "p.(R2219H)" "19" "0000194325" "00004951" "10" "6802" "0" "6802" "0" "c.6802A>G" "r.(?)" "p.(T2268A)" "20" "0000194326" "00004951" "10" "7554" "0" "7554" "0" "c.7554C>A" "r.(?)" "p.(F2518L)" "24" "0000194327" "00004951" "10" "8390" "0" "8390" "0" "c.8390G>C" "r.(?)" "p.(C2797S)" "31" "0000194328" "00004951" "10" "8707" "0" "8707" "0" "c.8707G>C" "r.(?)" "p.(E2903Q)" "33" "0000194329" "00004951" "10" "8842" "0" "8842" "0" "c.8842G>A" "r.(?)" "p.(G2948S)" "34" "0000194330" "00004951" "30" "3724" "0" "3724" "0" "c.3724G>A" "r.(?)" "p.(V1242I)" "2" "0000194331" "00004951" "30" "6656" "0" "6656" "0" "c.6656G>A" "r.(?)" "p.(R2219H)" "19" "0000194332" "00004951" "30" "6935" "0" "6935" "0" "c.6935G>C" "r.(?)" "p.(Arg2312Pro)" "21" "0000194333" "00004951" "30" "7313" "0" "7313" "0" "c.7313G>A" "r.(?)" "p.(R2438Q)" "23" "0000194334" "00004951" "30" "7554" "0" "7554" "0" "c.7554C>A" "r.(?)" "p.(F2518L)" "24" "0000194335" "00004951" "50" "1666" "0" "1666" "0" "c.1666C>G" "r.(?)" "p.(L556V)" "1" "0000194336" "00004951" "50" "1991" "0" "1991" "0" "c.1991C>G" "r.(?)" "p.(S664W)" "1" "0000194337" "00004951" "50" "3372" "0" "3372" "0" "c.3372C>G" "r.(?)" "p.(Ile1124Met)" "1" "0000194338" "00004951" "50" "3376" "0" "3376" "0" "c.3376T>C" "r.(?)" "p.(C1126R)" "1" "0000194339" "00004951" "50" "3724" "0" "3724" "0" "c.3724G>A" "r.(?)" "p.(V1242I)" "2" "0000194340" "00004951" "50" "4228" "0" "4228" "0" "c.4228G>A" "r.(?)" "p.(Gly1410Arg)" "3" "0000194341" "00004951" "50" "4927" "0" "4927" "0" "c.4927C>T" "r.(?)" "p.(Arg1643Trp)" "7" "0000194342" "00004951" "50" "4939" "0" "4939" "0" "c.4939G>A" "r.(?)" "p.(A1647T)" "8" "0000194343" "00004951" "50" "5461" "0" "5461" "0" "c.5461G>T" "r.(?)" "p.(Val1821Leu)" "11" "0000194344" "00004951" "50" "5473" "0" "5473" "0" "c.5473G>A" "r.(?)" "p.(Gly1825Ser)" "11" "0000194345" "00004951" "50" "5981" "0" "5981" "0" "c.5981T>C" "r.(?)" "p.(L1994P)" "15" "0000194346" "00004951" "50" "5984" "0" "5984" "0" "c.5984T>C" "r.(?)" "p.(L1995P)" "15" "0000194347" "00004951" "50" "6184" "0" "6184" "0" "c.6184G>A" "r.(?)" "p.(Gly2062Ser)" "16" "0000194348" "00004951" "50" "6319" "0" "6319" "0" "c.6319A>G" "r.(?)" "p.(I2107V)" "17" "0000194349" "00004951" "50" "6656" "0" "6656" "0" "c.6656G>A" "r.(?)" "p.(R2219H)" "19" "0000194350" "00004951" "50" "6802" "0" "6802" "0" "c.6802A>G" "r.(?)" "p.(T2268A)" "20" "0000194351" "00004951" "50" "6935" "0" "6935" "0" "c.6935G>C" "r.(?)" "p.(R2312P)" "21" "0000194352" "00004951" "50" "7060" "0" "7060" "0" "c.7060C>T" "r.(?)" "p.(Arg2354Cys)" "21" "0000194353" "00004951" "50" "7554" "0" "7554" "0" "c.7554C>A" "r.(?)" "p.(F2518L)" "24" "0000194354" "00004951" "50" "8216" "0" "8216" "0" "c.8216A>C" "r.(?)" "p.(Asn2739Thr)" "30" "0000194355" "00004951" "50" "8390" "0" "8390" "0" "c.8390G>C" "r.(?)" "p.(C2797S)" "31" "0000194356" "00004951" "50" "8632" "0" "8632" "0" "c.8632G>A" "r.(?)" "p.(Gly2878Ser)" "33" "0000194357" "00004951" "50" "8707" "0" "8707" "0" "c.8707G>C" "r.(?)" "p.(E2903Q)" "33" "0000194358" "00004951" "50" "8842" "0" "8842" "0" "c.8842G>A" "r.(?)" "p.(G2948S)" "34" "0000194359" "00004951" "50" "8891" "0" "8891" "0" "c.8891C>T" "r.(?)" "p.(S2964L)" "34" "0000194360" "00004951" "50" "8947" "0" "8947" "0" "c.8947C>G" "r.(?)" "p.(Pro2983Ala)" "34" "0000194361" "00004951" "50" "8947" "0" "8947" "0" "c.8947C>G" "r.(?)" "p.(P2983A)" "34" "0000194362" "00004951" "70" "3068" "0" "3068" "0" "c.3068C>G" "r.(?)" "p.(Ala1023Gly)" "1" "0000194363" "00004951" "70" "4085" "0" "4085" "0" "c.4085C>T" "r.(?)" "p.(Thr1362Met)" "2" "0000194364" "00004951" "70" "5052" "0" "5053" "0" "c.5052_5053dup" "r.(?)" "p.(Glu1685Valfs*22)" "8" "0000194365" "00004951" "70" "5723" "0" "5724" "0" "c.5723_5724del" "r.(?)" "p.(Val1908Glyfs*38)" "10" "0000194366" "00004951" "70" "7489" "0" "7489" "0" "c.7489C>T" "r.(?)" "p.(Arg2497Cys)" "24" "0000194367" "00004951" "70" "8891" "0" "8891" "0" "c.8891C>T" "r.(?)" "p.(Ser2964Leu)" "34" "0000194368" "00004951" "70" "8891" "0" "8891" "0" "c.8891C>T" "r.(?)" "p.(Ser2964Leu)" "34" "0000194369" "00004951" "70" "8947" "0" "8947" "0" "c.8947C>G" "r.(?)" "p.(Pro2983Ala)" "34" "0000194370" "00004951" "70" "8947" "0" "8947" "0" "c.8947C>G" "r.(?)" "p.(Pro2983Ala)" "34" "0000194371" "00004951" "90" "2318" "0" "2318" "0" "c.2318C>T" "r.(?)" "p.(Ala773Val)" "1" "0000273091" "00004951" "30" "1210" "0" "1210" "0" "c.1210G>A" "r.(?)" "p.(Glu404Lys)" "" "0000273092" "00004951" "50" "137" "0" "137" "0" "c.137C>T" "r.(?)" "p.(Pro46Leu)" "" "0000273093" "00004951" "30" "477" "0" "477" "0" "c.477G>T" "r.(?)" "p.(Pro159=)" "" "0000273094" "00004951" "30" "5442" "0" "5442" "0" "c.5442C>T" "r.(?)" "p.(Pro1814=)" "" "0000273095" "00004951" "30" "5651" "0" "5651" "0" "c.5651A>G" "r.(?)" "p.(Asn1884Ser)" "" "0000273096" "00004951" "30" "6576" "0" "6576" "0" "c.6576C>T" "r.(?)" "p.(Ser2192=)" "" "0000273097" "00004951" "30" "6895" "0" "6895" "0" "c.6895C>A" "r.(?)" "p.(Leu2299Met)" "" "0000273098" "00004951" "30" "7323" "0" "7323" "0" "c.7323C>T" "r.(?)" "p.(Val2441=)" "" "0000273099" "00004951" "30" "7524" "0" "7524" "0" "c.7524C>T" "r.(?)" "p.(Ala2508=)" "" "0000273100" "00004951" "30" "8314" "0" "8314" "0" "c.8314C>A" "r.(?)" "p.(Gln2772Lys)" "" "0000329086" "00004951" "50" "6361" "0" "6361" "0" "c.6361C>T" "r.(?)" "p.(Arg2121Cys)" "" "0000340944" "00004951" "10" "4518" "0" "4518" "0" "c.4518T>C" "r.(?)" "p.(Ser1506=)" "" "0000345259" "00004951" "50" "6826" "0" "6826" "0" "c.6826G>C" "r.(?)" "p.(Glu2276Gln)" "" "0000349370" "00004951" "10" "6802" "0" "6802" "0" "c.6802A>T" "r.(?)" "p.(Thr2268Ser)" "" "0000572277" "00004951" "50" "8807" "0" "8807" "0" "c.8807C>T" "r.(?)" "p.(Pro2936Leu)" "" "0000572278" "00004951" "30" "7584" "9" "7584" "9" "c.7584+9A>T" "r.(=)" "p.(=)" "" "0000618634" "00004951" "30" "413" "0" "413" "0" "c.413G>T" "r.(?)" "p.(Gly138Val)" "" "0000663639" "00004951" "50" "8584" "0" "8584" "0" "c.8584G>A" "r.(?)" "p.(Gly2862Ser)" "" "0000663640" "00004951" "50" "8300" "8" "8300" "8" "c.8300+8C>T" "r.(=)" "p.(=)" "" "0000728204" "00004951" "50" "3953" "0" "3953" "0" "c.3953G>A" "r.(?)" "p.(Cys1318Tyr)" "" "0000728205" "00004951" "30" "270" "0" "270" "0" "c.270C>A" "r.(?)" "p.(Val90=)" "" "0000809666" "00004951" "30" "8592" "0" "8592" "0" "c.8592C>G" "r.(?)" "p.(Pro2864=)" "" "0000915562" "00004951" "30" "5227" "-5" "5227" "-5" "c.5227-5T>C" "r.spl?" "p.?" "" "0000927193" "00004951" "10" "8842" "0" "8842" "0" "c.8842G>A" "r.(?)" "p.(Gly2948Ser)" "" "0000927194" "00004951" "10" "8707" "0" "8707" "0" "c.8707G>C" "r.(?)" "p.(Glu2903Gln)" "" "0000927195" "00004951" "10" "8390" "0" "8390" "0" "c.8390G>C" "r.(?)" "p.(Cys2797Ser)" "" "0000927196" "00004951" "10" "8300" "17" "8300" "17" "c.8300+17G>A" "r.(=)" "p.(=)" "" "0000927197" "00004951" "10" "8034" "0" "8034" "0" "c.8034T>C" "r.(?)" "p.(Asp2678=)" "" "0000927198" "00004951" "10" "7953" "-5" "7953" "-5" "c.7953-5C>T" "r.spl?" "p.?" "" "0000927199" "00004951" "10" "7872" "12" "7872" "12" "c.7872+12G>A" "r.(=)" "p.(=)" "" "0000927200" "00004951" "10" "7728" "0" "7728" "0" "c.7728C>T" "r.(?)" "p.(Val2576=)" "" "0000927201" "00004951" "10" "7194" "0" "7194" "0" "c.7194C>T" "r.(?)" "p.(Phe2398=)" "" "0000927202" "00004951" "10" "6939" "0" "6939" "0" "c.6939G>A" "r.(?)" "p.(Pro2313=)" "" "0000927203" "00004951" "10" "6802" "0" "6802" "0" "c.6802A>G" "r.(?)" "p.(Thr2268Ala)" "" "0000927204" "00004951" "10" "6656" "0" "6656" "0" "c.6656G>A" "r.(?)" "p.(Arg2219His)" "" "0000927205" "00004951" "10" "6441" "0" "6441" "0" "c.6441G>A" "r.(?)" "p.(Thr2147=)" "" "0000927206" "00004951" "10" "6319" "0" "6319" "0" "c.6319A>G" "r.(?)" "p.(Ile2107Val)" "" "0000927207" "00004951" "10" "5984" "0" "5984" "0" "c.5984T>C" "r.(?)" "p.(Leu1995Pro)" "" "0000927208" "00004951" "10" "5981" "0" "5981" "0" "c.5981T>C" "r.(?)" "p.(Leu1994Pro)" "" "0000927209" "00004951" "10" "5964" "10" "5964" "10" "c.5964+10C>A" "r.(=)" "p.(=)" "" "0000927210" "00004951" "10" "5680" "0" "5680" "0" "c.5680T>C" "r.(?)" "p.(Tyr1894His)" "" "0000927211" "00004951" "10" "5472" "0" "5472" "0" "c.5472A>G" "r.(?)" "p.(Gly1824=)" "" "0000927212" "00004951" "10" "4933" "19" "4933" "19" "c.4933+19del" "r.(=)" "p.(=)" "" "0000927213" "00004951" "10" "4524" "0" "4524" "0" "c.4524C>T" "r.(?)" "p.(Gly1508=)" "" "0000927214" "00004951" "10" "4183" "10" "4183" "10" "c.4183+10C>T" "r.(=)" "p.(=)" "" "0000927215" "00004951" "10" "3724" "0" "3724" "0" "c.3724G>A" "r.(?)" "p.(Val1242Ile)" "" "0000927216" "00004951" "10" "3699" "0" "3699" "0" "c.3699C>G" "r.(?)" "p.(Ala1233=)" "" "0000927217" "00004951" "10" "3376" "0" "3376" "0" "c.3376T>C" "r.(?)" "p.(Cys1126Arg)" "" "0000927218" "00004951" "10" "2961" "0" "2961" "0" "c.2961G>A" "r.(?)" "p.(Val987=)" "" "0000927219" "00004951" "10" "1991" "0" "1991" "0" "c.1991C>G" "r.(?)" "p.(Ser664Trp)" "" "0000927220" "00004951" "10" "1275" "0" "1275" "0" "c.1275C>G" "r.(?)" "p.(Leu425=)" "" "0000927221" "00004951" "10" "1230" "0" "1230" "0" "c.1230C>T" "r.(?)" "p.(Ser410=)" "" "0000927222" "00004951" "10" "408" "0" "408" "0" "c.408C>T" "r.(?)" "p.(Pro136=)" "" "0000927223" "00004951" "10" "18" "0" "20" "0" "c.18_20del" "r.(?)" "p.(Pro7del)" "" "0000931304" "00004951" "10" "7584" "9" "7584" "9" "c.7584+9A>T" "r.(=)" "p.(=)" "" "0000931305" "00004951" "10" "5112" "0" "5112" "0" "c.5112C>T" "r.(?)" "p.(=)" "" "0000931306" "00004951" "10" "3564" "0" "3564" "0" "c.3564G>A" "r.(?)" "p.(=)" "" "0000951628" "00004951" "10" "8555" "-15" "8555" "-15" "c.8555-15G>A" "r.(=)" "p.(=)" "" "0000951629" "00004951" "10" "1776" "0" "1776" "0" "c.1776G>A" "r.(?)" "p.(=)" "" "0000951630" "00004951" "10" "1666" "0" "1666" "0" "c.1666C>G" "r.(?)" "p.(Leu556Val)" "" "0000951631" "00004951" "50" "521" "0" "521" "0" "c.521C>A" "r.(?)" "p.(Pro174Gln)" "" "0000970513" "00004951" "10" "8322" "0" "8322" "0" "c.8322C>G" "r.(?)" "p.(=)" "" "0000970514" "00004951" "10" "8223" "0" "8223" "0" "c.8223C>T" "r.(?)" "p.(=)" "" "0000970515" "00004951" "10" "8013" "0" "8013" "0" "c.8013G>T" "r.(?)" "p.(=)" "" "0000970516" "00004951" "10" "6951" "0" "6951" "0" "c.6951C>T" "r.(?)" "p.(=)" "" "0000970517" "00004951" "30" "6123" "0" "6123" "0" "c.6123C>T" "r.(?)" "p.(=)" "" "0000970519" "00004951" "10" "3366" "0" "3366" "0" "c.3366C>G" "r.(?)" "p.(=)" "" "0000970520" "00004951" "10" "291" "0" "291" "0" "c.291C>G" "r.(?)" "p.(=)" "" "0000970521" "00004951" "10" "280" "0" "280" "0" "c.280G>A" "r.(?)" "p.(Ala94Thr)" "" "0000970522" "00004951" "10" "137" "0" "137" "0" "c.137C>T" "r.(?)" "p.(Pro46Leu)" "" "0000984296" "00004951" "30" "8126" "0" "8126" "0" "c.8126G>A" "r.(?)" "p.(Arg2709Gln)" "" "0000984297" "00004951" "50" "6058" "0" "6058" "0" "c.6058G>A" "r.(?)" "p.(Gly2020Arg)" "" "0000984298" "00004951" "10" "4939" "0" "4939" "0" "c.4939G>A" "r.(?)" "p.(Ala1647Thr)" "" "0000984299" "00004951" "50" "4745" "0" "4745" "0" "c.4745A>G" "r.(?)" "p.(Gln1582Arg)" "" "0000984300" "00004951" "70" "4072" "0" "4097" "0" "c.4072_4097dup" "r.(?)" "p.(Cys1367Thrfs*62)" "" "0000984301" "00004951" "10" "2274" "0" "2274" "0" "c.2274C>T" "r.(?)" "p.(=)" "" "0000984302" "00004951" "30" "1175" "0" "1175" "0" "c.1175T>C" "r.(?)" "p.(Val392Ala)" "" "0000984303" "00004951" "50" "158" "0" "158" "0" "c.158G>T" "r.(?)" "p.(Gly53Val)" "" "0001006221" "00004951" "30" "8999" "0" "8999" "0" "c.8999G>A" "r.(?)" "p.(Arg3000His)" "" "0001006222" "00004951" "30" "8681" "0" "8681" "0" "c.8681G>A" "r.(?)" "p.(Arg2894His)" "" "0001006223" "00004951" "10" "6750" "0" "6750" "0" "c.6750C>T" "r.(?)" "p.(=)" "" "0001006224" "00004951" "30" "6664" "0" "6664" "0" "c.6664G>C" "r.(?)" "p.(Gly2222Arg)" "" "0001006225" "00004951" "50" "4568" "0" "4568" "0" "c.4568G>C" "r.(?)" "p.(Ser1523Thr)" "" "0001006226" "00004951" "30" "4060" "0" "4060" "0" "c.4060G>A" "r.(?)" "p.(Gly1354Ser)" "" "0001006227" "00004951" "50" "3815" "0" "3815" "0" "c.3815G>A" "r.(?)" "p.(Gly1272Asp)" "" "0001006228" "00004951" "50" "2533" "0" "2533" "0" "c.2533T>G" "r.(?)" "p.(Tyr845Asp)" "" "0001006229" "00004951" "50" "1942" "0" "1942" "0" "c.1942G>A" "r.(?)" "p.(Glu648Lys)" "" "0001006230" "00004951" "50" "1681" "0" "1683" "0" "c.1681_1683del" "r.(?)" "p.(Asn561del)" "" "0001006231" "00004951" "50" "1606" "0" "1606" "0" "c.1606G>A" "r.(?)" "p.(Ala536Thr)" "" "0001006232" "00004951" "30" "1036" "0" "1036" "0" "c.1036A>T" "r.(?)" "p.(Thr346Ser)" "" "0001006233" "00004951" "30" "521" "0" "521" "0" "c.521C>A" "r.(?)" "p.(Pro174Gln)" "" "0001006234" "00004951" "30" "415" "0" "415" "0" "c.415T>C" "r.(?)" "p.(Cys139Arg)" "" "0001007439" "00004951" "70" "8108" "0" "8108" "0" "c.8108T>A" "r.(?)" "p.(Val2703Glu)" "" "0001007440" "00004951" "70" "4613" "0" "4613" "0" "c.4613C>T" "r.(?)" "p.(Pro1538Leu)" "" "0001015958" "00004951" "50" "2675" "0" "2675" "0" "c.2675T>G" "r.(?)" "p.(Phe892Cys)" "" "0001027413" "00004951" "50" "5929" "0" "5929" "0" "c.5929G>A" "r.(?)" "p.(Asp1977Asn)" "" "0001027414" "00004951" "30" "3559" "0" "3559" "0" "c.3559G>A" "r.(?)" "p.(Val1187Ile)" "" "0001043934" "00004951" "30" "7760" "-4" "7760" "-4" "c.7760-4T>G" "r.spl?" "p.?" "" "0001043935" "00004951" "30" "1759" "0" "1759" "0" "c.1759A>G" "r.(?)" "p.(Ile587Val)" "" "0001046826" "00004951" "30" "8522" "0" "8522" "0" "c.8522C>T" "r.(?)" "p.(Pro2841Leu)" "" "0001046827" "00004951" "30" "7076" "0" "7076" "0" "c.7076G>A" "r.(?)" "p.(Arg2359His)" "" "0001046828" "00004951" "50" "2398" "0" "2398" "0" "c.2398G>A" "r.(?)" "p.(Glu800Lys)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 60 "{{screeningid}}" "{{variantid}}" "0000118248" "0000194316" "0000118249" "0000194317" "0000118250" "0000194335" "0000118250" "0000194336" "0000118250" "0000194338" "0000118250" "0000194339" "0000118250" "0000194342" "0000118250" "0000194345" "0000118250" "0000194346" "0000118250" "0000194348" "0000118250" "0000194349" "0000118250" "0000194350" "0000118250" "0000194351" "0000118250" "0000194353" "0000118250" "0000194355" "0000118250" "0000194357" "0000118250" "0000194358" "0000118250" "0000194359" "0000118250" "0000194361" "0000118251" "0000194318" "0000118252" "0000194369" "0000118252" "0000194371" "0000118253" "0000194362" "0000118254" "0000194337" "0000118255" "0000194319" "0000118256" "0000194330" "0000118257" "0000194363" "0000118258" "0000194340" "0000118259" "0000194341" "0000118260" "0000194320" "0000118261" "0000194364" "0000118262" "0000194365" "0000118263" "0000194343" "0000118264" "0000194344" "0000118265" "0000194321" "0000118266" "0000194322" "0000118267" "0000194347" "0000118268" "0000194323" "0000118269" "0000194331" "0000118270" "0000194324" "0000118271" "0000194325" "0000118272" "0000194332" "0000118272" "0000194367" "0000118273" "0000194352" "0000118274" "0000194333" "0000118275" "0000194366" "0000118276" "0000194334" "0000118277" "0000194326" "0000118278" "0000194354" "0000118279" "0000194327" "0000118280" "0000194356" "0000118281" "0000194328" "0000118282" "0000194329" "0000118283" "0000194368" "0000118283" "0000194370" "0000118284" "0000194360" "0000300751" "0000663639" "0000300751" "0000663640" "0000455332" "0001007439" "0000455333" "0001007440"