### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = CFTR) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "CFTR" "cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)" "7" "q31-q32" "no" "LRG_663" "UD_132118582599" "" "http://www.LOVD.nl/CFTR" "Cystic Fibrosis Mutation Database (CFTR1) \r\nCFTR2 - Clinical and Functional Translation of CFTR website \r\n" "1" "1884" "1080" "602421" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "http://databases.lovd.nl/shared/refseq/CFTR_codingDNA.html" "1" "" "" "-1" "" "-1" "00002" "2011-04-05 00:00:00" "00006" "2020-04-17 10:58:10" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000116" "CFTR" "cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)" "001" "NM_000492.3" "" "NP_000483.3" "" "" "" "-132" "6000" "4443" "117120017" "117308719" "00002" "2012-05-11 13:12:09" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 20 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00011" "USH3B" "Usher syndrome, type 3B (USH-3B)" "AR" "614504" "" "" "" "00006" "2012-06-29 17:09:32" "00006" "2021-12-10 21:51:32" "00012" "PSORS" "psoriasis, pustular, generalized (PSORS)" "" "" "" "" "" "00006" "2012-07-06 21:50:32" "00006" "2019-08-12 13:38:21" "00013" "SPD" "dwarfism, primordial, syndromic (SPD)" "" "" "" "" "" "00006" "2012-07-08 19:59:01" "00006" "2015-12-08 23:54:35" "00128" "CF" "cystic fibrosis (CF)" "AR" "219700" "" "" "" "00006" "2013-05-14 09:22:43" "00006" "2021-12-10 21:51:32" "00129" "BESC1" "bronchiectasis, with/without elevated sweat chloride, type 1, modifier of (BESC-1)" "AD" "211400" "" "" "" "00006" "2013-05-14 09:24:34" "00006" "2021-12-10 21:51:32" "00130" "PCTT" "pancreatitis" "AD" "167800" "" "" "" "00006" "2013-05-14 09:29:20" "00006" "2025-09-05 16:49:18" "00131" "CBAVD" "vas deferens, congenital bilateral absence (CBAVD)" "AR" "277180" "" "" "" "00006" "2013-05-14 09:31:10" "00006" "2021-12-10 21:51:32" "00138" "autism" "autism" "" "209850" "" "" "" "00084" "2013-06-04 18:17:33" "00006" "2015-12-08 23:54:35" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "02819" "SPDRS" "salt and pepper developmental regression syndrome (SPDRS)" "DD" "609056" "" "124/125 psychomotor delay, 71/125 microcephaly, 98/125 epilepsy, 80/125 dystonia/movement disorder, 16/125 sit/walk independently, 100/125 developmental stagnation/failure to thrive, 118/125 development delay, 41/125 hearing impairment, 38/125 vision impairment, 43/125 abnormal pigmentation, 90/125 irritability, 52/125 feeding difficulties, 30/125 gastrostomy feeding tube, 7/125 facial dysmorphic features, 19/125 scoliosis, 52/125 abnormal electroencephalographic" "published in {PMID:Mu 2024:39533347}" "00006" "2014-09-25 23:29:40" "00006" "2024-11-21 10:21:16" "03306" "EVR5" "vitreoretinopathy, exudative, type 5 (EVR5)" "AD" "613310" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-04-30 09:59:41" "04240" "EVR;FEVR" "vitreoretinopathy, exudative (EVR; familial FVER))" "" "" "" "" "" "00006" "2015-04-10 12:38:11" "00006" "2019-07-31 13:55:30" "04270" "epilepsy" "epilepsy" "" "" "" "" "" "00006" "2015-05-14 16:00:06" "00006" "2017-09-07 14:25:59" "04281" "CDLS" "Cornelia de Lange syndrome (CDLS)" "" "" "" "" "" "00006" "2015-06-15 14:50:45" "" "" "04296" "MINAS" "neoplasia, multiple inherited alleles (MINAS)" "AD;AR;SMo" "" "" "" "" "00006" "2015-07-02 09:20:44" "00006" "2021-12-10 21:51:32" "05292" "IMD" "immunodeficiency (IMD)" "" "" "" "" "" "00006" "2017-06-24 18:16:32" "00006" "2017-10-24 17:01:05" "05378" "BMD/DMD" "dystrophinopathy (BMD or DMD)" "" "" "" "" "" "00006" "2018-01-13 20:18:25" "00006" "2019-03-26 16:49:54" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "07210" "scoliosis" "scoliosis" "" "" "" "" "" "00006" "2025-12-05 11:13:58" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 4 "{{geneid}}" "{{diseaseid}}" "CFTR" "00128" "CFTR" "00129" "CFTR" "00130" "CFTR" "00131" ## Individuals ## Do not remove or alter this header ## ## Count = 689 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000005" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000008" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000009" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000014" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000016" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000025" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000027" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000035" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000038" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000046" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000058" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000060" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000065" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000070" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000074" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000078" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000088" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000089" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000095" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000100" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00001226" "" "" "" "1" "" "00006" "{DB:CFTR2}" "see CFTR2 database for details" "" "-" "" "" "0" "" "" "" "" "00035165" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035166" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035167" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035168" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035169" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035170" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035171" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035172" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035173" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035174" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035175" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035176" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035177" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035178" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035179" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035180" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035181" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035182" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035183" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035184" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035185" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035186" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035187" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035188" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035189" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035190" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035191" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00132653" "" "" "" "1" "" "02292" "" "" "M" "-" "Pakistan" "" "0" "" "" "" "" "00132811" "" "" "" "1" "" "00006" "{DB:CFTR2}" "see CFTR2 database for details" "" "-" "" "" "0" "" "" "" "" "00132812" "" "" "" "1" "" "00006" "{DB:CFTR2}" "see CFTR2 database for details" "" "-" "" "" "0" "" "" "" "" "00132813" "" "" "" "1" "" "00006" "{DB:CFTR2}" "see CFTR2 database for details" "" "-" "" "" "0" "" "" "" "" "00147121" "" "" "" "1" "" "01807" "" "" "F" "" "(Germany)" "" "0" "" "" "" "" "00164653" "" "" "" "1" "" "02495" "" "" "F" "?" "Russian Federation" "15y" "0" "" "" "white" "" "00164654" "" "" "" "1" "" "02495" "" "" "F" "?" "(Russian Federation)" "08y" "0" "" "" "white" "" "00164657" "" "" "" "1" "" "02495" "" "" "M" "?" "(Russian Federation)" "17y" "0" "" "" "white" "" "00164659" "" "" "" "1" "" "02495" "" "" "M" "?" "(Russian Federation)" "09y" "0" "" "" "white" "" "00266176" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00271321" "" "" "" "1" "" "03383" "{PMID:Poulter 2012:22427576} {PMID:Savarese 2014:23834558}" "4 generation family, 1 affected" "F" "yes" "Pakistan" "" "0" "" "" "" "VL IV:1" "00287103" "" "" "" "1" "" "02551" "" "" "F" "" "" "" "0" "" "" "" "" "00294270" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294271" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294272" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294273" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294274" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294275" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294276" "" "" "" "29" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294277" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294278" "" "" "" "8" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294279" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294280" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294281" "" "" "" "9" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294282" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294283" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294284" "" "" "" "9" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294285" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294286" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294287" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294288" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294289" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294290" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294291" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294292" "" "" "" "11" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294294" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294295" "" "" "" "32" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294296" "" "" "" "6" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294297" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294298" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294299" "" "" "" "10" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294301" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294302" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294303" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294304" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294305" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294306" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294307" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294308" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294309" "" "" "" "9" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294310" "" "" "" "28" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294311" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294312" "" "" "" "11" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295212" "" "" "" "11" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295213" "" "" "" "10" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295214" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295215" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295216" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295315" "" "" "" "4" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295316" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295317" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295350" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295351" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295428" "" "" "" "6" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295432" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295433" "" "" "" "4" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00296871" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00296876" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "no" "Ireland" "" "0" "" "" "" "" "00296877" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00296878" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "-" "" "Ireland" "" "0" "" "" "" "" "00299457" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299458" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299459" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299460" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299461" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299462" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299463" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299464" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299465" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299466" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299467" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299468" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299469" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299470" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299471" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299472" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299473" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299474" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299475" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299476" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299477" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299478" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299479" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299480" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299481" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299482" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299483" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299484" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299485" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299486" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299487" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299488" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299489" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299490" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299491" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299492" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299493" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299494" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299495" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299496" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299497" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299498" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299499" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299500" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299501" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299502" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299503" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299504" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299505" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299506" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299507" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299508" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299509" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299510" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299511" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299512" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299513" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299514" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299515" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299516" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299517" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299518" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299519" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299520" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299521" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299522" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299523" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299524" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299525" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299526" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299527" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299528" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299529" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299530" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299531" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299532" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299533" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299534" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299535" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299536" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299537" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299538" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299539" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299540" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299541" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299542" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299543" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299544" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299545" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299546" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299547" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299548" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299549" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299550" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299551" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299552" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299553" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299554" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299555" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299556" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299557" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299558" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299559" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299560" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299561" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299562" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299563" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299564" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299565" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299566" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299567" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299568" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299569" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299570" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299571" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299572" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299573" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299574" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299575" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299576" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299577" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299578" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299579" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299580" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299581" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299582" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299583" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299584" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299585" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299586" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299587" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299588" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299589" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299590" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299591" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299592" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299593" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299594" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299595" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299596" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299597" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299598" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299599" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299600" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299601" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299602" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299603" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299604" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299605" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299606" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299607" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299608" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299609" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299610" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299611" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299612" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299613" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299614" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299615" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299616" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299617" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299618" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299619" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299620" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299621" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299622" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299623" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299624" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299625" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299626" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299627" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299628" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299629" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299630" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299631" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00299632" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "" "" "" "Ireland" "" "0" "" "" "" "" "00300617" "" "" "" "1" "" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "" "00300653" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300654" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300655" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300656" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300657" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300658" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300659" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300660" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300661" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300662" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300663" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300664" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300665" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300666" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300667" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300668" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300669" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300670" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300671" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300672" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300673" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300674" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300675" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300676" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300677" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300678" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300679" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300680" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300681" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300682" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300683" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300684" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300685" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300686" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300687" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300688" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300689" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300690" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300691" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300692" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300693" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300694" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300695" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300696" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300697" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300698" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300699" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300700" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300701" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300702" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300703" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300704" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300705" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300706" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300707" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300708" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300709" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300710" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300711" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300712" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300713" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300714" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300715" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300716" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300717" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300718" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300719" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300720" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300721" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300722" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300723" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300724" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300725" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300726" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300727" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300728" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300729" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300730" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300731" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300732" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300733" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300734" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300735" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300736" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300737" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300738" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300739" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300740" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300741" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300742" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300743" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300744" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300745" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300746" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300747" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300748" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300749" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300750" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300751" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300752" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300753" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300754" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300755" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300756" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300757" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300758" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300759" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300760" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300761" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300762" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300763" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300764" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300765" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300766" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300767" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300768" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300769" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300770" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300771" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300772" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300773" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300774" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300775" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300776" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300777" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300778" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300779" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300780" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300781" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300782" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300783" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300784" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300785" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300786" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300787" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300788" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300789" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300790" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300791" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300792" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300793" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300794" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300795" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300796" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300797" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300798" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300799" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300800" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300801" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300802" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300803" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300804" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300805" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300806" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300807" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300808" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300809" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300810" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300811" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300812" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300813" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300814" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300815" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300816" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300817" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300818" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300819" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300820" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300821" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300822" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300823" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300824" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300825" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300826" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300827" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300828" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300829" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300830" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300831" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300832" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300833" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300834" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300835" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300836" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300837" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300838" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300839" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300840" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300841" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300842" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300843" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300844" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300845" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300846" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300847" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300848" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300849" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300850" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300851" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300852" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300853" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300854" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300855" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300856" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300857" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300858" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300859" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300860" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300861" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300862" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300863" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300864" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300865" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300866" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300867" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300868" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300869" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300870" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300871" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300872" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300873" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300874" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300875" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300876" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300877" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300878" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300879" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300880" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300881" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300882" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300883" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300884" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300885" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300886" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300887" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300888" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300889" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300890" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300891" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300892" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300893" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300894" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300895" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300896" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300897" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300898" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300899" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300900" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300901" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300902" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300903" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300904" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300905" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300906" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300907" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300908" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300909" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300910" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300911" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300912" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300913" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300914" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300915" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300916" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300917" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300918" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300919" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300920" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300921" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300922" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300923" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300924" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300925" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300926" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300927" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300928" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300929" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300930" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300931" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300932" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300933" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300934" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300935" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300936" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300937" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300938" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300939" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300940" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300941" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300942" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300943" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300944" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300945" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300946" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300947" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300948" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300949" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300950" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300951" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300952" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300953" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300954" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300955" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300956" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300957" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300958" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300959" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300960" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300961" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300962" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300963" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300964" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300965" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300966" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300967" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300968" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300969" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300970" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300971" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300972" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300973" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300974" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300976" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300977" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300978" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300979" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300980" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300981" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300982" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300983" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300984" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300985" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300986" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300987" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300988" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300989" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300990" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300991" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300992" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300993" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300994" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300995" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300996" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300997" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300998" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00300999" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00301000" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00301001" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00301002" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00301003" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00301004" "" "" "" "1" "" "03595" "Sasaki 2020, submitted" "newborn screening" "" "" "Ireland" "" "0" "" "" "" "" "00306241" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00307306" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00307307" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00308717" "" "" "" "1" "" "00004" "{PMID:Le 2019:31180159}" "analysis 305 unrelated individuals" "" "" "Viet Nam" "" "0" "" "" "" "" "00308718" "" "" "" "1" "" "00004" "{PMID:Le 2019:31180159}" "analysis 305 unrelated individuals" "" "" "Viet Nam" "" "0" "" "" "" "" "00308719" "" "" "" "1" "" "00004" "{PMID:Le 2019:31180159}" "analysis 305 unrelated individuals" "" "" "Viet Nam" "" "0" "" "" "" "" "00308720" "" "" "" "1" "" "00004" "{PMID:Le 2019:31180159}" "analysis 305 unrelated individuals" "" "" "Viet Nam" "" "0" "" "" "" "" "00309687" "" "" "" "1" "" "00006" "{DB:CFTR2}" "see CFTR2 database for details" "" "" "" "" "0" "" "" "" "" "00309688" "" "" "" "1" "" "00006" "{DB:CFTR2}" "see CFTR2 database for details" "" "" "" "" "0" "" "" "" "" "00309689" "" "" "" "1" "" "00006" "{DB:CFTR2}" "see CFTR2 database for details" "" "" "" "" "0" "" "" "" "" "00309690" "" "" "" "1" "" "00006" "{DB:CFTR2}" "see CFTR2 database for details" "" "" "" "" "0" "" "" "" "" "00309691" "" "" "" "1" "" "00006" "{DB:CFTR2}" "see CFTR2 database for details" "" "" "" "" "0" "" "" "" "" "00311183" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00327627" "" "" "" "1" "" "02551" "" "" "F" "" "" "" "0" "" "" "" "" "00386491" "" "" "" "1" "" "00006" "{PMID:Nair 2018:30293248}" "patient" "" "" "Lebanon" "" "0" "" "" "" "" "00386492" "" "" "" "1" "" "00006" "{PMID:Nair 2018:30293248}" "patient" "" "" "Lebanon" "" "0" "" "" "" "" "00386493" "" "" "" "1" "" "00006" "{PMID:Nair 2018:30293248}" "patient" "" "" "Lebanon" "" "0" "" "" "" "" "00386494" "" "" "" "1" "" "00006" "{PMID:Nair 2018:30293248}" "patient" "" "" "Lebanon" "" "0" "" "" "" "" "00387690" "" "" "" "1" "" "04138" "" "" "F" "" "Turkey" "" "" "" "" "Turkish" "" "00393224" "" "" "" "1" "" "04138" "{PMID:Sofia 2016:27264265}, {DOI:Sofia 2016:10.2119/molmed.2016.00010}" "" "?" "" "Italy" "" "" "" "" "" "Pat35" "00394306" "" "" "" "1" "" "04138" "{PMID:Corleto 2010:20950468}, {DOI:Corleto 2010:10.1186/1471-230X-10-119}" "" "M" "" "Italy" "" "0" "" "" "" "case" "00394307" "" "" "" "1" "" "04138" "{PMID:Corleto 2010:20950468}, {DOI:Corleto 2010:10.1186/1471-230X-10-119}" "mother proband" "F" "" "Italy" "" "0" "" "" "" "mother" "00418594" "" "" "00418593" "1" "" "00006" "{PMID:Bertoli-Avella 2022:34952832}" "cousin" "F" "yes" "Oman" "" "0" "" "" "" "Fam1PatIV2" "00426973" "" "" "" "1" "" "00006" "{PMID:Reiner 2022:36459106}" "carrier screening 73,755 controls" "" "" "United States" "" "0" "" "" "" "" "00426974" "" "" "" "1" "" "00006" "{PMID:Reiner 2022:36459106}" "carrier screening 73,755 controls" "" "" "United States" "" "0" "" "" "" "" "00426975" "" "" "" "1" "" "00006" "{PMID:Reiner 2022:36459106}" "carrier screening 73,755 controls" "" "" "United States" "" "0" "" "" "" "" "00427043" "" "" "" "1" "" "00006" "{PMID:Reiner 2022:36459106}" "carrier screening 73,755 controls" "" "" "United States" "" "0" "" "" "" "" "00427044" "" "" "" "1" "" "00006" "{PMID:Reiner 2022:36459106}" "carrier screening 73,755 controls" "" "" "United States" "" "0" "" "" "" "" "00427045" "" "" "" "1" "" "00006" "{PMID:Reiner 2022:36459106}" "carrier screening 73,755 controls" "" "" "United States" "" "0" "" "" "" "" "00427046" "" "" "" "1" "" "00006" "{PMID:Reiner 2022:36459106}" "carrier screening 73,755 controls" "" "" "United States" "" "0" "" "" "" "" "00427047" "" "" "" "1" "" "00006" "{PMID:Reiner 2022:36459106}" "carrier screening 73,755 controls" "" "" "United States" "" "0" "" "" "" "" "00427048" "" "" "" "1" "" "00006" "{PMID:Reiner 2022:36459106}" "carrier screening 73,755 controls" "" "" "United States" "" "0" "" "" "" "" "00427049" "" "" "" "1" "" "00006" "{PMID:Reiner 2022:36459106}" "carrier screening 73,755 controls" "" "" "United States" "" "0" "" "" "" "" "00427050" "" "" "" "1" "" "00006" "{PMID:Reiner 2022:36459106}" "carrier screening 73,755 controls" "" "" "United States" "" "0" "" "" "" "" "00427969" "" "" "" "1" "" "00006" "{PMID:Bournazos 2022:34906502}" "family, 1 affected" "" "" "Australia" "" "0" "" "" "" "A005" "00433133" "" "" "" "1" "" "00006" "{PMID:Stray-Pedersen 2017:27577878}" "" "M" "" "Ecuador" "" "0" "" "" "" "Pat113,1" "00436356" "" "" "" "1" "" "00006" "{PMID:Yuan 2019:30158690}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "SMC1A-Pat4" "00453121" "" "" "" "1" "" "00006" "{PMID:Rots 2024:39013459}, {DOI:Rots 2024:10.1016/j.ajhg.2024.06.009}" "" "F" "" "" "" "0" "" "" "" "Pat77" "00455451" "" "" "" "1" "" "04749" "" "" "F" "" "Singapore" "" "" "" "" "" "" "00468742" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00468743" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00468744" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00470674" "" "" "" "1" "" "00006" "{PMID:Horbacz 2025:41210864}" "patient, affected" "F" "" "Poland" "" "0" "" "" "" "Pat35" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 661 "{{individualid}}" "{{diseaseid}}" "00000014" "00138" "00000014" "05378" "00000016" "00138" "00000016" "05378" "00000025" "05378" "00000038" "04270" "00001226" "00128" "00035167" "00128" "00035168" "00198" "00035171" "00128" "00035173" "00198" "00035176" "00198" "00035181" "00198" "00035182" "00128" "00035183" "00128" "00035185" "00198" "00035186" "00128" "00035187" "00198" "00132653" "02819" "00132811" "00011" "00132812" "00012" "00132813" "00013" "00147121" "00198" "00164653" "00128" "00164654" "00128" "00164657" "00128" "00164659" "00128" "00271321" "00128" "00271321" "03306" "00271321" "04240" "00287103" "00198" "00294270" "00198" "00294271" "00198" "00294272" "00198" "00294273" "00198" "00294274" "00198" "00294275" "00198" "00294276" "00198" "00294277" "00198" "00294278" "00198" "00294279" "00198" "00294280" "00198" "00294281" "00198" "00294282" "00198" "00294283" "00198" "00294284" "00198" "00294285" "00198" "00294286" "00198" "00294287" "00198" "00294288" "00198" "00294289" "00198" "00294290" "00198" "00294291" "00198" "00294292" "00198" "00294294" "00198" "00294295" "00198" "00294296" "00198" "00294297" "00198" "00294298" "00198" "00294299" "00198" "00294301" "00198" "00294302" "00198" "00294303" "00198" "00294304" "00198" "00294305" "00198" "00294306" "00198" "00294307" "00198" "00294308" "00198" "00294309" "00198" "00294310" "00198" "00294311" "00198" "00294312" "00198" "00295212" "00198" "00295213" "00198" "00295214" "00198" "00295215" "00198" "00295216" "00198" "00295315" "00198" "00295316" "00198" "00295317" "00198" "00295350" "00198" "00295351" "00198" "00295428" "00198" "00295432" "00198" "00295433" "00198" "00296871" "00128" "00296876" "00128" "00296877" "00128" "00296878" "00128" "00299457" "00128" "00299458" "00128" "00299459" "00128" "00299460" "00128" "00299461" "00128" "00299462" "00128" "00299463" "00128" "00299464" "00128" "00299465" "00128" "00299466" "00128" "00299467" "00128" "00299468" "00128" "00299469" "00128" "00299470" "00128" "00299471" "00128" "00299472" "00128" "00299473" "00128" "00299474" "00128" "00299475" "00128" "00299476" "00128" "00299477" "00128" "00299478" "00128" "00299479" "00128" "00299480" "00128" "00299481" "00128" "00299482" "00128" "00299483" "00128" "00299484" "00128" "00299485" "00128" "00299486" "00128" "00299487" "00128" "00299488" "00128" "00299489" "00128" "00299490" "00128" "00299491" "00128" "00299492" "00128" "00299493" "00128" "00299494" "00128" "00299495" "00128" "00299496" "00128" "00299497" "00128" "00299498" "00128" "00299499" "00128" "00299500" "00128" "00299501" "00128" "00299502" "00128" "00299503" "00128" "00299504" "00128" "00299505" "00128" "00299506" "00128" "00299507" "00128" "00299508" "00128" "00299509" "00128" "00299510" "00128" "00299511" "00128" "00299512" "00128" "00299513" "00128" "00299514" "00128" "00299515" "00128" "00299516" "00128" "00299517" "00128" "00299518" "00128" "00299519" "00128" "00299520" "00128" "00299521" "00128" "00299522" "00128" "00299523" "00128" "00299524" "00128" "00299525" "00128" "00299526" "00128" "00299527" "00128" "00299528" "00128" "00299529" "00128" "00299530" "00128" "00299531" "00128" "00299532" "00128" "00299533" "00128" "00299534" "00128" "00299535" "00128" "00299536" "00128" "00299537" "00128" "00299538" "00128" "00299539" "00128" "00299540" "00128" "00299541" "00128" "00299542" "00128" "00299543" "00128" "00299544" "00128" "00299545" "00128" "00299546" "00128" "00299547" "00128" "00299548" "00128" "00299549" "00128" "00299550" "00128" "00299551" "00128" "00299552" "00128" "00299553" "00128" "00299554" "00128" "00299555" "00128" "00299556" "00128" "00299557" "00128" "00299558" "00128" "00299559" "00128" "00299560" "00128" "00299561" "00128" "00299562" "00128" "00299563" "00128" "00299564" "00128" "00299565" "00128" "00299566" "00128" "00299567" "00128" "00299568" "00128" "00299569" "00128" "00299570" "00128" "00299571" "00128" "00299572" "00128" "00299573" "00128" "00299574" "00128" "00299575" "00128" "00299576" "00128" "00299577" "00128" "00299578" "00128" "00299579" "00128" "00299580" "00128" "00299581" "00128" "00299582" "00128" "00299583" "00128" "00299584" "00128" "00299585" "00128" "00299586" "00128" "00299587" "00128" "00299588" "00128" "00299589" "00128" "00299590" "00128" "00299591" "00128" "00299592" "00128" "00299593" "00128" "00299594" "00128" "00299595" "00128" "00299596" "00128" "00299597" "00128" "00299598" "00128" "00299599" "00128" "00299600" "00128" "00299601" "00128" "00299602" "00128" "00299603" "00128" "00299604" "00128" "00299605" "00128" "00299606" "00128" "00299607" "00128" "00299608" "00128" "00299609" "00128" "00299610" "00128" "00299611" "00128" "00299612" "00128" "00299613" "00128" "00299614" "00128" "00299615" "00128" "00299616" "00128" "00299617" "00128" "00299618" "00128" "00299619" "00128" "00299620" "00128" "00299621" "00128" "00299622" "00128" "00299623" "00128" "00299624" "00128" "00299625" "00128" "00299626" "00128" "00299627" "00128" "00299628" "00128" "00299629" "00128" "00299630" "00128" "00299631" "00128" "00299632" "00128" "00300617" "00198" "00300653" "00128" "00300654" "00128" "00300655" "00128" "00300656" "00128" "00300657" "00128" "00300658" "00128" "00300659" "00128" "00300660" "00128" "00300661" "00128" "00300662" "00128" "00300663" "00128" "00300664" "00128" "00300665" "00128" "00300666" "00128" "00300667" "00128" "00300668" "00128" "00300669" "00128" "00300670" "00128" "00300671" "00128" "00300672" "00128" "00300673" "00128" "00300674" "00128" "00300675" "00128" "00300676" "00128" "00300677" "00128" "00300678" "00128" "00300679" "00128" "00300680" "00128" "00300681" "00128" "00300682" "00128" "00300683" "00128" "00300684" "00128" "00300685" "00128" "00300686" "00128" "00300687" "00128" "00300688" "00128" "00300689" "00128" "00300690" "00128" "00300691" "00128" "00300692" "00128" "00300693" "00128" "00300694" "00128" "00300695" "00128" "00300696" "00128" "00300697" "00128" "00300698" "00128" "00300699" "00128" "00300700" "00128" "00300701" "00128" "00300702" "00128" "00300703" "00128" "00300704" "00128" "00300705" "00128" "00300706" "00128" "00300707" "00128" "00300708" "00128" "00300709" "00128" "00300710" "00128" "00300711" "00128" "00300712" "00128" "00300713" "00128" "00300714" "00128" "00300715" "00128" "00300716" "00128" "00300717" "00128" "00300718" "00128" "00300719" "00128" "00300720" "00128" "00300721" "00128" "00300722" "00128" "00300723" "00128" "00300724" "00128" "00300725" "00128" "00300726" "00128" "00300727" "00128" "00300728" "00128" "00300729" "00128" "00300730" "00128" "00300731" "00128" "00300732" "00128" "00300733" "00128" "00300734" "00128" "00300735" "00128" "00300736" "00128" "00300737" "00128" "00300738" "00128" "00300739" "00128" "00300740" "00128" "00300741" "00128" "00300742" "00128" "00300743" "00128" "00300744" "00128" "00300745" "00128" "00300746" "00128" "00300747" "00128" "00300748" "00128" "00300749" "00128" "00300750" "00128" "00300751" "00128" "00300752" "00128" "00300753" "00128" "00300754" "00128" "00300755" "00128" "00300756" "00128" "00300757" "00128" "00300758" "00128" "00300759" "00128" "00300760" "00128" "00300761" "00128" "00300762" "00128" "00300763" "00128" "00300764" "00128" "00300765" "00128" "00300766" "00128" "00300767" "00128" "00300768" "00128" "00300769" "00128" "00300770" "00128" "00300771" "00128" "00300772" "00128" "00300773" "00128" "00300774" "00128" "00300775" "00128" "00300776" "00128" "00300777" "00128" "00300778" "00128" "00300779" "00128" "00300780" "00128" "00300781" "00128" "00300782" "00128" "00300783" "00128" "00300784" "00128" "00300785" "00128" "00300786" "00128" "00300787" "00128" "00300788" "00128" "00300789" "00128" "00300790" "00128" "00300791" "00128" "00300792" "00128" "00300793" "00128" "00300794" "00128" "00300795" "00128" "00300796" "00128" "00300797" "00128" "00300798" "00128" "00300799" "00128" "00300800" "00128" "00300801" "00128" "00300802" "00128" "00300803" "00128" "00300804" "00128" "00300805" "00128" "00300806" "00128" "00300807" "00128" "00300808" "00128" "00300809" "00128" "00300810" "00128" "00300811" "00128" "00300812" "00128" "00300813" "00128" "00300814" "00128" "00300815" "00128" "00300816" "00128" "00300817" "00128" "00300818" "00128" "00300819" "00128" "00300820" "00128" "00300821" "00128" "00300822" "00128" "00300823" "00128" "00300824" "00128" "00300825" "00128" "00300826" "00128" "00300827" "00128" "00300828" "00128" "00300829" "00128" "00300830" "00128" "00300831" "00128" "00300832" "00128" "00300833" "00128" "00300834" "00128" "00300835" "00128" "00300836" "00128" "00300837" "00128" "00300838" "00128" "00300839" "00128" "00300840" "00128" "00300841" "00128" "00300842" "00128" "00300843" "00128" "00300844" "00128" "00300845" "00128" "00300846" "00128" "00300847" "00128" "00300848" "00128" "00300849" "00128" "00300850" "00128" "00300851" "00128" "00300852" "00128" "00300853" "00128" "00300854" "00128" "00300855" "00128" "00300856" "00128" "00300857" "00128" "00300858" "00128" "00300859" "00128" "00300860" "00128" "00300861" "00128" "00300862" "00128" "00300863" "00128" "00300864" "00128" "00300865" "00128" "00300866" "00128" "00300867" "00128" "00300868" "00128" "00300869" "00128" "00300870" "00128" "00300871" "00128" "00300872" "00128" "00300873" "00128" "00300874" "00128" "00300875" "00128" "00300876" "00128" "00300877" "00128" "00300878" "00128" "00300879" "00128" "00300880" "00128" "00300881" "00128" "00300882" "00128" "00300883" "00128" "00300884" "00128" "00300885" "00128" "00300886" "00128" "00300887" "00128" "00300888" "00128" "00300889" "00128" "00300890" "00128" "00300891" "00128" "00300892" "00128" "00300893" "00128" "00300894" "00128" "00300895" "00128" "00300896" "00128" "00300897" "00128" "00300898" "00128" "00300899" "00128" "00300900" "00128" "00300901" "00128" "00300902" "00128" "00300903" "00128" "00300904" "00128" "00300905" "00128" "00300906" "00128" "00300907" "00128" "00300908" "00128" "00300909" "00128" "00300910" "00128" "00300911" "00128" "00300912" "00128" "00300913" "00128" "00300914" "00128" "00300915" "00128" "00300916" "00128" "00300917" "00128" "00300918" "00128" "00300919" "00128" "00300920" "00128" "00300921" "00128" "00300922" "00128" "00300923" "00128" "00300924" "00128" "00300925" "00128" "00300926" "00128" "00300927" "00128" "00300928" "00128" "00300929" "00128" "00300930" "00128" "00300931" "00128" "00300932" "00128" "00300933" "00128" "00300934" "00128" "00300935" "00128" "00300936" "00128" "00300937" "00128" "00300938" "00128" "00300939" "00128" "00300940" "00128" "00300941" "00128" "00300942" "00128" "00300943" "00128" "00300944" "00128" "00300945" "00128" "00300946" "00128" "00300947" "00128" "00300948" "00128" "00300949" "00128" "00300950" "00128" "00300951" "00128" "00300952" "00128" "00300953" "00128" "00300954" "00128" "00300955" "00128" "00300956" "00128" "00300957" "00128" "00300958" "00128" "00300959" "00128" "00300960" "00128" "00300961" "00128" "00300962" "00128" "00300963" "00128" "00300964" "00128" "00300965" "00128" "00300966" "00128" "00300967" "00128" "00300968" "00128" "00300969" "00128" "00300970" "00128" "00300971" "00128" "00300972" "00128" "00300973" "00128" "00300974" "00128" "00300976" "00128" "00300977" "00128" "00300978" "00128" "00300979" "00128" "00300980" "00128" "00300981" "00128" "00300982" "00128" "00300983" "00128" "00300984" "00128" "00300985" "00128" "00300986" "00128" "00300987" "00128" "00300988" "00128" "00300989" "00128" "00300990" "00128" "00300991" "00128" "00300992" "00128" "00300993" "00128" "00300994" "00128" "00300995" "00128" "00300996" "00128" "00300997" "00128" "00300998" "00128" "00300999" "00128" "00301000" "00128" "00301001" "00128" "00301002" "00128" "00301003" "00128" "00301004" "00128" "00306241" "00198" "00307306" "00198" "00307307" "00198" "00308717" "00000" "00308718" "00000" "00308719" "00000" "00308720" "00000" "00309687" "00128" "00309688" "00128" "00309689" "00128" "00309690" "00128" "00309691" "00128" "00311183" "00198" "00327627" "00198" "00386491" "00198" "00386492" "00198" "00386493" "00198" "00386494" "00198" "00387690" "00130" "00393224" "00130" "00394306" "00130" "00394307" "00000" "00418594" "00128" "00426973" "00000" "00426974" "00000" "00426975" "00000" "00427043" "00000" "00427044" "00000" "00427045" "00000" "00427046" "00000" "00427047" "00000" "00427048" "00000" "00427049" "00000" "00427050" "00000" "00427969" "00198" "00433133" "05292" "00436356" "00128" "00436356" "04281" "00453121" "05611" "00455451" "04296" "00468742" "00198" "00468743" "00198" "00468744" "00198" "00470674" "07210" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00011, 00012, 00013, 00128, 00129, 00130, 00131, 00138, 00198, 02819, 03306, 04240, 04270, 04281, 04296, 05292, 05378, 05611, 07210 ## Count = 574 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000105426" "02819" "00132653" "02292" "Unknown" "09y" "Epilepsy geneneralized Seizures" "05y" "07y" "5y" "" "" "" "" "" "" "" "" "0000119837" "00198" "00147121" "01807" "Unknown" "" "HP:0002206 (Pulmonary fibrosis)" "" "" "" "" "" "" "" "" "" "" "" "0000129690" "00128" "00164653" "02495" "Familial, autosomal recessive" "15y" "Cystic fibrosis, mixed type, severe course. Chronic purulent obstructive bronchitis. Chronic pancreatic insufficiency. Bronchiectasis. Cirrhosis" "" "" "" "" "" "" "" "" "Cystic Fibrosis" "Cystic Fibrosis" "" "0000129691" "00128" "00164654" "02495" "Familial, autosomal recessive" "08y" "Cystic fibrosis mixed type, severe course. Chronic pancreatic insufficiency. Bronchiectases" "" "" "" "" "" "" "" "" "Cystic Fibrosis" "Cystic Fibrosis" "" "0000129694" "00128" "00164657" "02495" "Familial, autosomal recessive" "17y" "Cystic fibrosis, mixed type, severe course. Chronic purulent obstructive bronchitis. Chronic pancreatic insufficiency. Chronic polyposis rhinosinusitis." "" "" "" "" "" "" "" "" "Cystic Fibrosis" "Cystic Fibrosis" "" "0000129697" "00128" "00164659" "02495" "Familial, autosomal recessive" "09y" "Cystic fibrosis mixed type, severe course. Chronic purulent bronchitis. Chronic pancreatic insufficiency. Cirrhosis associated with cystic fibrosis. Chronic polyposis rhinosinusitis." "" "" "" "" "" "" "" "" "Cystic Fibrosis" "Cystic Fibrosis" "" "0000156040" "00128" "00035167" "01164" "Unknown" "" "clinical CF" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000156041" "00198" "00035168" "01164" "Unknown" "" "pancreatitis" "" "" "" "" "" "" "" "" "" "pancreatitis" "" "0000156042" "00128" "00035171" "01164" "Unknown" "" "cystic fibrosis" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000156043" "00198" "00035173" "01164" "Unknown" "" "tracheal stenosis" "" "" "" "" "" "" "" "" "" "tracheal stenosis" "" "0000156044" "00198" "00035176" "01164" "Unknown" "" "uncertain lipase-enhancement" "" "" "" "" "" "" "" "" "" "lipase enhancement" "" "0000156045" "00198" "00035181" "01164" "Unknown" "" "CBAVD" "" "" "" "" "" "" "" "" "" "CBAVD" "" "0000156046" "00128" "00035182" "01164" "Unknown" "" "cystic fibrosis" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000156047" "00128" "00035183" "01164" "Unknown" "" "cystic fibrosis" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000156048" "00198" "00035185" "01164" "Unknown" "" "pancreatitis" "" "" "" "" "" "" "" "" "" "pancreatitis" "" "0000156049" "00128" "00035186" "01164" "Unknown" "" "cystic fibrosis" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000156050" "00198" "00035187" "01164" "Unknown" "" "targeted analysis; sister-in-law: cystic fibrosis" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000207931" "04240" "00271321" "03383" "Familial, autosomal recessive" "" "familial exudative vitreoretinopathy (HP:0030490), bilateral retinal folds (HP:0008052)" "" "00y" "" "" "" "" "" "" "exudative vitreoretinopathy type 5 (EVR-5; familial)" "familial exudative vitreoretinopathy" "" "0000220839" "00198" "00287103" "02551" "Unknown" "" "Elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "" "" "0000224270" "00128" "00296871" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CFTR" "" "" "0000224273" "00128" "00296876" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CFTR" "" "" "0000224274" "00128" "00296877" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CFTR" "" "" "0000224275" "00128" "00296878" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CFTR" "" "" "0000226767" "00128" "00299457" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226768" "00128" "00299458" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226769" "00128" "00299459" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226770" "00128" "00299460" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226771" "00128" "00299461" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226772" "00128" "00299462" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226773" "00128" "00299463" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226774" "00128" "00299464" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226775" "00128" "00299465" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226776" "00128" "00299466" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226777" "00128" "00299467" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226778" "00128" "00299468" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226779" "00128" "00299469" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226780" "00128" "00299470" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226781" "00128" "00299471" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226782" "00128" "00299472" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226783" "00128" "00299473" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226784" "00128" "00299474" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226785" "00128" "00299475" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226786" "00128" "00299476" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226787" "00128" "00299477" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226788" "00128" "00299478" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226789" "00128" "00299479" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226790" "00128" "00299480" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226791" "00128" "00299481" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226792" "00128" "00299482" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226793" "00128" "00299483" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226794" "00128" "00299484" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226795" "00128" "00299485" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226796" "00128" "00299486" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226797" "00128" "00299487" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226798" "00128" "00299488" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226799" "00128" "00299489" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226800" "00128" "00299490" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226801" "00128" "00299491" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226802" "00128" "00299492" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226803" "00128" "00299493" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226804" "00128" "00299494" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226805" "00128" "00299495" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226806" "00128" "00299496" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226807" "00128" "00299497" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226808" "00128" "00299498" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226809" "00128" "00299499" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226810" "00128" "00299500" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226811" "00128" "00299501" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226812" "00128" "00299502" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226813" "00128" "00299503" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226814" "00128" "00299504" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226815" "00128" "00299505" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226816" "00128" "00299506" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226817" "00128" "00299507" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226818" "00128" "00299508" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226819" "00128" "00299509" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226820" "00128" "00299510" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226821" "00128" "00299511" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226822" "00128" "00299512" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226823" "00128" "00299513" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226824" "00128" "00299514" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226825" "00128" "00299515" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226826" "00128" "00299516" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226827" "00128" "00299517" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226828" "00128" "00299518" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226829" "00128" "00299519" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226830" "00128" "00299520" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226831" "00128" "00299521" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226832" "00128" "00299522" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226833" "00128" "00299523" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226834" "00128" "00299524" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226835" "00128" "00299525" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226836" "00128" "00299526" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226837" "00128" "00299527" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226838" "00128" "00299528" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226839" "00128" "00299529" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226840" "00128" "00299530" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226841" "00128" "00299531" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226842" "00128" "00299532" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226843" "00128" "00299533" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226844" "00128" "00299534" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226845" "00128" "00299535" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226846" "00128" "00299536" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226847" "00128" "00299537" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226848" "00128" "00299538" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226849" "00128" "00299539" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226850" "00128" "00299540" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226851" "00128" "00299541" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226852" "00128" "00299542" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226853" "00128" "00299543" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226854" "00128" "00299544" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226855" "00128" "00299545" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226856" "00128" "00299546" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226857" "00128" "00299547" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226858" "00128" "00299548" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226859" "00128" "00299549" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226860" "00128" "00299550" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226861" "00128" "00299551" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226862" "00128" "00299552" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226863" "00128" "00299553" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226864" "00128" "00299554" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226865" "00128" "00299555" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226866" "00128" "00299556" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226867" "00128" "00299557" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226868" "00128" "00299558" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226869" "00128" "00299559" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226870" "00128" "00299560" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226871" "00128" "00299561" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226872" "00128" "00299562" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226873" "00128" "00299563" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226874" "00128" "00299564" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226875" "00128" "00299565" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226876" "00128" "00299566" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226877" "00128" "00299567" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226878" "00128" "00299568" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226879" "00128" "00299569" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226880" "00128" "00299570" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226881" "00128" "00299571" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226882" "00128" "00299572" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226883" "00128" "00299573" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226884" "00128" "00299574" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226885" "00128" "00299575" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226886" "00128" "00299576" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226887" "00128" "00299577" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226888" "00128" "00299578" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226889" "00128" "00299579" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226890" "00128" "00299580" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226891" "00128" "00299581" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226892" "00128" "00299582" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226893" "00128" "00299583" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226894" "00128" "00299584" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226895" "00128" "00299585" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226896" "00128" "00299586" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226897" "00128" "00299587" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226898" "00128" "00299588" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226899" "00128" "00299589" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226900" "00128" "00299590" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226901" "00128" "00299591" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226902" "00128" "00299592" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226903" "00128" "00299593" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226904" "00128" "00299594" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226905" "00128" "00299595" "03595" "Familial, autosomal recessive" "" "raised immunoreactive tryptosin level" "" "" "" "" "" "" "" "" "CF" "" "" "0000226906" "00128" "00299596" "03595" "Familial, autosomal recessive" "" "raised immunoreactive tryptosin level" "" "" "" "" "" "" "" "" "CF" "" "" "0000226907" "00128" "00299597" "03595" "Familial, autosomal recessive" "" "raised immunoreactive tryptosin level" "" "" "" "" "" "" "" "" "CF" "" "" "0000226908" "00128" "00299598" "03595" "Familial, autosomal recessive" "" "raised immunoreactive tryptosin level" "" "" "" "" "" "" "" "" "CF" "" "" "0000226909" "00128" "00299599" "03595" "Familial, autosomal recessive" "" "raised immunoreactive tryptosin level" "" "" "" "" "" "" "" "" "CF" "" "" "0000226910" "00128" "00299600" "03595" "Familial, autosomal recessive" "" "raised immunoreactive tryptosin level" "" "" "" "" "" "" "" "" "CF" "" "" "0000226911" "00128" "00299601" "03595" "Familial, autosomal recessive" "" "raised immunoreactive tryptosin level" "" "" "" "" "" "" "" "" "CF" "" "" "0000226912" "00128" "00299602" "03595" "Familial, autosomal recessive" "" "raised immunoreactive tryptosin level" "" "" "" "" "" "" "" "" "CF" "" "" "0000226913" "00128" "00299603" "03595" "Familial, autosomal recessive" "" "raised immunoreactive tryptosin level" "" "" "" "" "" "" "" "" "CF" "" "" "0000226914" "00128" "00299604" "03595" "Familial, autosomal recessive" "" "raised immunoreactive tryptosin level" "" "" "" "" "" "" "" "" "CF" "" "" "0000226915" "00128" "00299605" "03595" "Familial, autosomal recessive" "" "raised immunoreactive tryptosin level" "" "" "" "" "" "" "" "" "CF" "" "" "0000226916" "00128" "00299606" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226917" "00128" "00299607" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226918" "00128" "00299608" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226919" "00128" "00299609" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226920" "00128" "00299610" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226921" "00128" "00299611" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226922" "00128" "00299612" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226923" "00128" "00299613" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226924" "00128" "00299614" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226925" "00128" "00299615" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226926" "00128" "00299616" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226927" "00128" "00299617" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226928" "00128" "00299618" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226929" "00128" "00299619" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226930" "00128" "00299620" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226931" "00128" "00299621" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226932" "00128" "00299622" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226933" "00128" "00299623" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226934" "00128" "00299624" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226935" "00128" "00299625" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "CF" "" "" "0000226936" "00128" "00299626" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226937" "00128" "00299627" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "CF" "" "" "0000226938" "00128" "00299628" "03595" "Familial, autosomal recessive" "" "borderline elevated sweat chloride (HP:0011947), mild respiratory tract infection" "" "" "" "" "" "" "" "" "CF" "" "" "0000226939" "00128" "00299629" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226940" "00128" "00299630" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226941" "00128" "00299631" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000226942" "00128" "00299632" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "CF" "" "" "0000227928" "00198" "00300617" "01164" "Unknown" "" "Pancreatitis (HP:0001733)" "" "" "" "" "" "" "" "" "" "" "" "0000227964" "00128" "00300653" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227965" "00128" "00300654" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227966" "00128" "00300655" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227967" "00128" "00300656" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227968" "00128" "00300657" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227969" "00128" "00300658" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227970" "00128" "00300659" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227971" "00128" "00300660" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227972" "00128" "00300661" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227973" "00128" "00300662" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227974" "00128" "00300663" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227975" "00128" "00300664" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227976" "00128" "00300665" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227977" "00128" "00300666" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227978" "00128" "00300667" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227979" "00128" "00300668" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227980" "00128" "00300669" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227981" "00128" "00300670" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227982" "00128" "00300671" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227983" "00128" "00300672" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227984" "00128" "00300673" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227985" "00128" "00300674" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227986" "00128" "00300675" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227987" "00128" "00300676" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227988" "00128" "00300677" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227989" "00128" "00300678" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227990" "00128" "00300679" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227991" "00128" "00300680" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227992" "00128" "00300681" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227993" "00128" "00300682" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227994" "00128" "00300683" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227995" "00128" "00300684" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227996" "00128" "00300685" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227997" "00128" "00300686" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227998" "00128" "00300687" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000227999" "00128" "00300688" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228000" "00128" "00300689" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228001" "00128" "00300690" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228002" "00128" "00300691" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228003" "00128" "00300692" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228004" "00128" "00300693" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228005" "00128" "00300694" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228006" "00128" "00300695" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228007" "00128" "00300696" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228008" "00128" "00300697" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228009" "00128" "00300698" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228010" "00128" "00300699" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228011" "00128" "00300700" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228012" "00128" "00300701" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228013" "00128" "00300702" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228014" "00128" "00300703" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228015" "00128" "00300704" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228016" "00128" "00300705" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228017" "00128" "00300706" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228018" "00128" "00300707" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228019" "00128" "00300708" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228020" "00128" "00300709" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228021" "00128" "00300710" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228022" "00128" "00300711" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228023" "00128" "00300712" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228024" "00128" "00300713" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228025" "00128" "00300714" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228026" "00128" "00300715" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228027" "00128" "00300716" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228028" "00128" "00300717" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228029" "00128" "00300718" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228030" "00128" "00300719" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228031" "00128" "00300720" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228032" "00128" "00300721" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228033" "00128" "00300722" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228034" "00128" "00300723" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228035" "00128" "00300724" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228036" "00128" "00300725" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228037" "00128" "00300726" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228038" "00128" "00300727" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228039" "00128" "00300728" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228040" "00128" "00300729" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228041" "00128" "00300730" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228042" "00128" "00300731" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228043" "00128" "00300732" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228044" "00128" "00300733" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228045" "00128" "00300734" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228046" "00128" "00300735" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228047" "00128" "00300736" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228048" "00128" "00300737" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228049" "00128" "00300738" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228050" "00128" "00300739" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228051" "00128" "00300740" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228052" "00128" "00300741" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228053" "00128" "00300742" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228054" "00128" "00300743" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228055" "00128" "00300744" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228056" "00128" "00300745" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228057" "00128" "00300746" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228058" "00128" "00300747" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228059" "00128" "00300748" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228060" "00128" "00300749" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228061" "00128" "00300750" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228062" "00128" "00300751" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228063" "00128" "00300752" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228064" "00128" "00300753" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228065" "00128" "00300754" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228066" "00128" "00300755" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228067" "00128" "00300756" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228068" "00128" "00300757" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228069" "00128" "00300758" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228070" "00128" "00300759" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228071" "00128" "00300760" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228072" "00128" "00300761" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228073" "00128" "00300762" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228074" "00128" "00300763" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228075" "00128" "00300764" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228076" "00128" "00300765" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228077" "00128" "00300766" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228078" "00128" "00300767" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228079" "00128" "00300768" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228080" "00128" "00300769" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228081" "00128" "00300770" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228082" "00128" "00300771" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228083" "00128" "00300772" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228084" "00128" "00300773" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228085" "00128" "00300774" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228086" "00128" "00300775" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228087" "00128" "00300776" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228088" "00128" "00300777" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228089" "00128" "00300778" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228090" "00128" "00300779" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228091" "00128" "00300780" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228092" "00128" "00300781" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228093" "00128" "00300782" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228094" "00128" "00300783" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228095" "00128" "00300784" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228096" "00128" "00300785" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228097" "00128" "00300786" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228098" "00128" "00300787" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228099" "00128" "00300788" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228100" "00128" "00300789" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228101" "00128" "00300790" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228102" "00128" "00300791" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228103" "00128" "00300792" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228104" "00128" "00300793" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228105" "00128" "00300794" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228106" "00128" "00300795" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228107" "00128" "00300796" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228108" "00128" "00300797" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228109" "00128" "00300798" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228110" "00128" "00300799" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228111" "00128" "00300800" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228112" "00128" "00300801" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228113" "00128" "00300802" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228114" "00128" "00300803" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228115" "00128" "00300804" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228116" "00128" "00300805" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228117" "00128" "00300806" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228118" "00128" "00300807" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228119" "00128" "00300808" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228120" "00128" "00300809" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228121" "00128" "00300810" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228122" "00128" "00300811" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228123" "00128" "00300812" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228124" "00128" "00300813" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228125" "00128" "00300814" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228126" "00128" "00300815" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228127" "00128" "00300816" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228128" "00128" "00300817" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228129" "00128" "00300818" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228130" "00128" "00300819" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228131" "00128" "00300820" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228132" "00128" "00300821" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228133" "00128" "00300822" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228134" "00128" "00300823" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228135" "00128" "00300824" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228136" "00128" "00300825" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228137" "00128" "00300826" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228138" "00128" "00300827" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228139" "00128" "00300828" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228140" "00128" "00300829" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228141" "00128" "00300830" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228142" "00128" "00300831" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228143" "00128" "00300832" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228144" "00128" "00300833" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228145" "00128" "00300834" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228146" "00128" "00300835" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228147" "00128" "00300836" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228148" "00128" "00300837" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228149" "00128" "00300838" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228150" "00128" "00300839" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228151" "00128" "00300840" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228152" "00128" "00300841" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228153" "00128" "00300842" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228154" "00128" "00300843" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228155" "00128" "00300844" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228156" "00128" "00300845" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228157" "00128" "00300846" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228158" "00128" "00300847" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228159" "00128" "00300848" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228160" "00128" "00300849" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228161" "00128" "00300850" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228162" "00128" "00300851" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228163" "00128" "00300852" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228164" "00128" "00300853" "03595" "Unknown" "" "Raised Immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228165" "00128" "00300854" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228166" "00128" "00300855" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228167" "00128" "00300856" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228168" "00128" "00300857" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228169" "00128" "00300858" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228170" "00128" "00300859" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228171" "00128" "00300860" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228172" "00128" "00300861" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228173" "00128" "00300862" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228174" "00128" "00300863" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228175" "00128" "00300864" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228176" "00128" "00300865" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228177" "00128" "00300866" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228178" "00128" "00300867" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228179" "00128" "00300868" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228180" "00128" "00300869" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228181" "00128" "00300870" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228182" "00128" "00300871" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228183" "00128" "00300872" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228184" "00128" "00300873" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228185" "00128" "00300874" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228186" "00128" "00300875" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228187" "00128" "00300876" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228188" "00128" "00300877" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228189" "00128" "00300878" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228190" "00128" "00300879" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228191" "00128" "00300880" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228192" "00128" "00300881" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228193" "00128" "00300882" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228194" "00128" "00300883" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228195" "00128" "00300884" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228196" "00128" "00300885" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228197" "00128" "00300886" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228198" "00128" "00300887" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228199" "00128" "00300888" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228200" "00128" "00300889" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228201" "00128" "00300890" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228202" "00128" "00300891" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228203" "00128" "00300892" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228204" "00128" "00300893" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228205" "00128" "00300894" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228206" "00128" "00300895" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228207" "00128" "00300896" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228208" "00128" "00300897" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228209" "00128" "00300898" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228210" "00128" "00300899" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228211" "00128" "00300900" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228212" "00128" "00300901" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228213" "00128" "00300902" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228214" "00128" "00300903" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228215" "00128" "00300904" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228216" "00128" "00300905" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228217" "00128" "00300906" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228218" "00128" "00300907" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228219" "00128" "00300908" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228220" "00128" "00300909" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228221" "00128" "00300910" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228222" "00128" "00300911" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228223" "00128" "00300912" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228224" "00128" "00300913" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228225" "00128" "00300914" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228226" "00128" "00300915" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228227" "00128" "00300916" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228228" "00128" "00300917" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228229" "00128" "00300918" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228230" "00128" "00300919" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228231" "00128" "00300920" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228232" "00128" "00300921" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228233" "00128" "00300922" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228234" "00128" "00300923" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228235" "00128" "00300924" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228236" "00128" "00300925" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228237" "00128" "00300926" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228238" "00128" "00300927" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228239" "00128" "00300928" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228240" "00128" "00300929" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228241" "00128" "00300930" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228242" "00128" "00300931" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228243" "00128" "00300932" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228244" "00128" "00300933" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228245" "00128" "00300934" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228246" "00128" "00300935" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228247" "00128" "00300936" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228248" "00128" "00300937" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228249" "00128" "00300938" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228250" "00128" "00300939" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228251" "00128" "00300940" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228252" "00128" "00300941" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228253" "00128" "00300942" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228254" "00128" "00300943" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228255" "00128" "00300944" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228256" "00128" "00300945" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228257" "00128" "00300946" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228258" "00128" "00300947" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228259" "00128" "00300948" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228260" "00128" "00300949" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228261" "00128" "00300950" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228262" "00128" "00300951" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228263" "00128" "00300952" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228264" "00128" "00300953" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228265" "00128" "00300954" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228266" "00128" "00300955" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228267" "00128" "00300956" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228268" "00128" "00300957" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228269" "00128" "00300958" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228270" "00128" "00300959" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228271" "00128" "00300960" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228272" "00128" "00300961" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228273" "00128" "00300962" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228274" "00128" "00300963" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228275" "00128" "00300964" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228276" "00128" "00300965" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228277" "00128" "00300966" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228278" "00128" "00300967" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228279" "00128" "00300968" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228280" "00128" "00300969" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228281" "00128" "00300970" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228282" "00128" "00300971" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228283" "00128" "00300972" "03595" "Unknown" "" "raised immunoreactive trypsinogen" "" "" "" "" "" "" "" "" "carrier" "cystic fibrosis?" "" "0000228284" "00128" "00300973" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228285" "00128" "00300974" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228287" "00128" "00300976" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228288" "00128" "00300977" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228289" "00128" "00300978" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228290" "00128" "00300979" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228291" "00128" "00300980" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228292" "00128" "00300981" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228293" "00128" "00300982" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228294" "00128" "00300983" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228295" "00128" "00300984" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228296" "00128" "00300985" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228297" "00128" "00300986" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228298" "00128" "00300987" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228299" "00128" "00300988" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228300" "00128" "00300989" "03595" "Familial, autosomal recessive" "" "elevated sweat chloride (HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228301" "00128" "00300990" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228302" "00128" "00300991" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228303" "00128" "00300992" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228304" "00128" "00300993" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228305" "00128" "00300994" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228306" "00128" "00300995" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228307" "00128" "00300996" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228308" "00128" "00300997" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228309" "00128" "00300998" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228310" "00128" "00300999" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228311" "00128" "00301000" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228312" "00128" "00301001" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228313" "00128" "00301002" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228314" "00128" "00301003" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000228315" "00128" "00301004" "03595" "Familial, autosomal recessive" "" "raised immunoreactive trypsinogen, no elevated sweat chloride (-HP:0012236)" "" "" "" "" "" "" "" "" "" "cystic fibrosis" "" "0000232087" "00198" "00306241" "01164" "Unknown" "" "Abnormal sweat electrolytes (HP:0040128)" "" "" "" "" "" "" "" "" "" "" "" "0000233106" "00198" "00307306" "01164" "Unknown" "" "Decreased fertility (HP:0000144)" "" "" "" "" "" "" "" "" "" "" "" "0000233107" "00198" "00307307" "01164" "Unknown" "" "Abnormal male reproductive system physiology (HP:0012874); Decreased fertility (HP:0000144)" "" "" "" "" "" "" "" "" "" "" "" "0000236436" "00198" "00311183" "01164" "Unknown" "" "Pancreatitis (HP:0001733)" "" "" "" "" "" "" "" "" "" "" "" "0000245872" "00198" "00327627" "02551" "Unknown" "" "Fibrocystic lung disease (HP:0006552)" "" "" "" "" "" "" "" "" "" "" "" "0000280297" "00198" "00386491" "00006" "Unknown" "" "chronic pancreatitis (metabolic)" "" "" "" "" "" "" "" "" "" "" "" "0000280298" "00198" "00386492" "00006" "Unknown" "" "macrocephaly; rhizomelic members; trident hands; lordosis; no hydrocephalus; no cloverleaf skull; no bowed femurs" "" "" "" "" "" "" "" "" "" "" "" "0000280299" "00198" "00386493" "00006" "Unknown" "" "chronic pancreatitis (metabolic)" "" "" "" "" "" "" "" "" "" "" "" "0000280300" "00198" "00386494" "00006" "Unknown" "" "macrocephaly; rhizomelic members; trident hands; lordosis; no hydrocephalus; no cloverleaf skull; no bowed femurs" "" "" "" "" "" "" "" "" "" "" "" "0000281258" "00130" "00387690" "04138" "Familial, autosomal dominant" "10y" "Abdominal pain (HP:0002027), No Pancreatic calcification (-HP:0005213), No Diabetes mellitus (-HP:0000819), No Exocrine pancreatic insufficiency (-HP:0001738), No Pancreatic pseudocyst (-HP:0005206), No Steatorrhea (-HP:0002570)" "05y" "10y" "Acute pancreatitis HP:0001735" "" "" "" "" "" "Pancreatitis, Hereditary OMIM:167800" "recurrent acute pancreatitis" "" "0000286465" "00130" "00393224" "04138" "Isolated (sporadic)" "" "chronic pancreatitis (HP:0006280)" "" "" "" "" "" "" "" "" "" "Idiopathic chronic pancreatitis" "" "0000287512" "00130" "00394306" "04138" "Isolated (sporadic)" "06y" "abdominal pain (HP:0002027), nausea (HP:0002018), fever (HP:0001945), leukocytosis (HP:0001974), no pancreatic pseudocyst (-HP:0005206), pancreatitis (HP:0001733), no pancreatic calcification (-HP:0005213), no abnormal pancreatic duct morphology (HP:0030992)" "05y?" "" "abdominal pain (HP:0002027), nausea (HP:0002018), fever (HP:0001945)" "" "" "" "" "" "" "recurrent acute pancreatitis" "" "0000287513" "00000" "00394307" "04138" "-" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000309930" "00128" "00418594" "00006" "Familial, autosomal recessive" "" "failure to thrive, weight below 5th percentile, height at 10th percentile; no dysmorphism; normal motor development; normal mental development; no neurological abnormalities; recurrent lower respiratory tract infections; chronic coughing, bilateral crackles, mild bronchiectasis hilar lymphadenopathy; no immunological abnormalities; no gastroenteric abnormalities; mitral valve prolapse, mitral regurgitation" "6m" "" "" "" "" "" "" "" "" "cystic fibrosis, primary ciliary dyskinesia, primary immunodeficiency" "" "0000318915" "00198" "00427969" "00006" "Familial, autosomal recessive" "7y" "" "" "" "" "" "" "" "" "" "Cystic fibrosis" "" "" "0000323659" "05292" "00433133" "00006" "Familial, autosomal recessive" "4m" "severe combined immunodeficiency" "" "" "" "" "" "" "" "" "" "primary immunodeficiency disease" "" "0000326535" "04281" "00436356" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "CDLS2" "Cornelia de Lange syndrome" "" "0000341766" "05611" "00453121" "00006" "Isolated (sporadic)" "11y4m" "see paper; ... (very detailed phenotype descriptions)" "" "" "" "" "" "" "" "" "KLEFS2" "neurodevelopmental disorder" "" "0000344015" "04296" "00455451" "04749" "Familial, autosomal dominant" "" "Pancreatic cancer 52y mucinous adenocarcinoma*; \r\nChronic pancreatitis 20-30y*" "" "" "" "" "" "" "" "" "" "" "" "0000353895" "00198" "00468742" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the nervous system" "" "0000353896" "00198" "00468743" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the skeletal system" "" "0000353897" "00198" "00468744" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the nervous system" "" "0000355568" "07210" "00470674" "00006" "Isolated (sporadic)" "12y" "see paper; ... scoliosis, no other skeletal defects; no symptoms; no physical activity" "" "" "" "" "" "" "" "" "" "severe adolescent idiopathic scoliosis" "" ## Screenings ## Do not remove or alter this header ## ## Count = 689 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000005" "00000005" "1" "00004" "" "2012-05-11 13:18:37" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000008" "00000008" "1" "00004" "" "2012-05-11 13:18:37" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000009" "00000009" "1" "00004" "" "2012-05-11 13:18:37" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000014" "00000014" "1" "00004" "" "2012-05-11 13:18:39" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000016" "00000016" "1" "00004" "" "2012-05-11 13:18:39" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000025" "00000025" "1" "00004" "" "2012-05-11 13:18:41" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000027" "00000027" "1" "00004" "" "2012-05-11 13:18:42" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000035" "00000035" "1" "00004" "" "2012-05-11 13:18:44" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000038" "00000038" "1" "00004" "" "2012-05-11 13:18:45" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000046" "00000046" "1" "00004" "" "2012-05-11 13:18:48" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000058" "00000058" "1" "00004" "" "2012-05-11 13:18:53" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000060" "00000060" "1" "00004" "" "2012-05-11 13:18:54" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000065" "00000065" "1" "00004" "" "2012-05-11 13:18:56" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000070" "00000070" "1" "00004" "" "2012-05-11 13:18:57" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000074" "00000074" "1" "00004" "" "2012-05-11 13:18:59" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000078" "00000078" "1" "00004" "" "2012-05-11 13:19:04" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000088" "00000088" "1" "00004" "" "2012-05-11 13:19:14" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000089" "00000089" "1" "00004" "" "2012-05-11 13:19:15" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000095" "00000095" "1" "00004" "" "2012-05-11 13:19:24" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000100" "00000100" "1" "00004" "" "2012-05-11 13:19:41" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000994" "00001226" "1" "00006" "00006" "2013-05-24 11:44:13" "" "" "SEQ" "DNA" "" "" "0000035235" "00035165" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035236" "00035166" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035237" "00035167" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035238" "00035168" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035239" "00035169" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035240" "00035170" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035241" "00035171" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035242" "00035172" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035243" "00035173" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035244" "00035174" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035245" "00035175" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035246" "00035176" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035247" "00035177" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035248" "00035178" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035249" "00035179" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035250" "00035180" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035251" "00035181" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035252" "00035182" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035253" "00035183" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035254" "00035184" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035255" "00035185" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035256" "00035186" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035257" "00035187" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035258" "00035188" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035259" "00035189" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035260" "00035190" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035261" "00035191" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000133493" "00132653" "1" "02292" "02292" "2017-11-03 04:59:41" "" "" "SEQ-NG-I" "DNA" "" "" "0000133645" "00132811" "1" "00006" "00006" "2013-05-24 11:44:13" "" "" "SEQ" "DNA" "" "" "0000133646" "00132812" "1" "00006" "00006" "2013-05-24 11:44:13" "" "" "SEQ" "DNA" "" "" "0000133647" "00132813" "1" "00006" "00006" "2013-05-24 11:44:13" "" "" "SEQ" "DNA" "" "" "0000147976" "00147121" "0" "01807" "01807" "2018-01-01 18:49:42" "" "" "SEQ" "DNA" "" "" "0000165518" "00164654" "1" "02495" "02495" "2018-06-04 14:54:27" "02495" "2018-06-28 14:55:40" "SEQ-NG-IT" "DNA" "Blood" "Target sequencing" "0000165521" "00164653" "1" "02495" "02495" "2018-06-04 15:31:25" "02495" "2018-06-28 14:54:27" "SEQ-NG-IT" "DNA" "Blood" "Target sequencing" "0000165522" "00164657" "1" "02495" "02495" "2018-06-04 15:38:23" "" "" "SEQ-NG-IT" "DNA" "Blood" "Target sequencing" "0000165524" "00164659" "1" "02495" "02495" "2018-06-04 15:44:41" "" "" "SEQ-NG-IT" "DNA" "Blood" "Target sequencing" "0000267297" "00266176" "1" "01164" "01164" "2019-10-15 11:11:38" "" "" "SEQ-NG-S" "DNA" "" "" "0000275481" "00271321" "1" "03383" "03383" "2019-12-29 00:23:11" "" "" "SEQ" "DNA" "" "" "0000288268" "00287103" "1" "02551" "02551" "2020-02-12 11:24:05" "" "" "SEQ" "DNA" "" "" "0000295438" "00294270" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295439" "00294271" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295440" "00294272" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295441" "00294273" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295442" "00294274" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295443" "00294275" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295444" "00294276" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295445" "00294277" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295446" "00294278" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295447" "00294279" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295448" "00294280" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295449" "00294281" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295450" "00294282" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295451" "00294283" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295452" "00294284" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295453" "00294285" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295454" "00294286" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295455" "00294287" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295456" "00294288" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295457" "00294289" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295458" "00294290" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295459" "00294291" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295460" "00294292" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295462" "00294294" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295463" "00294295" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295464" "00294296" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295465" "00294297" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295466" "00294298" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295467" "00294299" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295469" "00294301" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295470" "00294302" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295471" "00294303" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295472" "00294304" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295473" "00294305" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295474" "00294306" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295475" "00294307" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295476" "00294308" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295477" "00294309" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295478" "00294310" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295479" "00294311" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295480" "00294312" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296380" "00295212" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296381" "00295213" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296382" "00295214" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296383" "00295215" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296384" "00295216" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296483" "00295315" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296484" "00295316" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296485" "00295317" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296518" "00295350" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296519" "00295351" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296596" "00295428" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296600" "00295432" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296601" "00295433" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000297984" "00296871" "1" "03595" "03595" "2020-04-14 14:35:23" "" "" "PCRm" "DNA" "" "" "0000297986" "00296876" "1" "03595" "03595" "2020-04-14 14:51:26" "" "" "PCRm" "protein" "" "" "0000297987" "00296877" "1" "03595" "03595" "2020-04-14 14:54:15" "" "" "PCRm" "DNA" "" "" "0000297988" "00296878" "1" "03595" "03595" "2020-04-14 15:01:20" "" "" "PCRm" "DNA" "" "" "0000300567" "00299457" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300568" "00299458" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300569" "00299459" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300570" "00299460" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300571" "00299461" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300572" "00299462" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300573" "00299463" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300574" "00299464" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300575" "00299465" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300576" "00299466" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300577" "00299467" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300578" "00299468" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300579" "00299469" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300580" "00299470" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300581" "00299471" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300582" "00299472" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300583" "00299473" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300584" "00299474" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300585" "00299475" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300586" "00299476" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300587" "00299477" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300588" "00299478" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300589" "00299479" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300590" "00299480" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300591" "00299481" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300592" "00299482" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300593" "00299483" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300594" "00299484" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300595" "00299485" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300596" "00299486" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300597" "00299487" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300598" "00299488" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300599" "00299489" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300600" "00299490" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300601" "00299491" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300602" "00299492" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300603" "00299493" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300604" "00299494" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300605" "00299495" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300606" "00299496" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300607" "00299497" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300608" "00299498" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300609" "00299499" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300610" "00299500" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300611" "00299501" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300612" "00299502" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300613" "00299503" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300614" "00299504" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300615" "00299505" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300616" "00299506" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300617" "00299507" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300618" "00299508" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300619" "00299509" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300620" "00299510" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300621" "00299511" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300622" "00299512" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300623" "00299513" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300624" "00299514" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300625" "00299515" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300626" "00299516" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300627" "00299517" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300628" "00299518" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300629" "00299519" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300630" "00299520" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300631" "00299521" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300632" "00299522" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300633" "00299523" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300634" "00299524" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300635" "00299525" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300636" "00299526" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300637" "00299527" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300638" "00299528" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300639" "00299529" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300640" "00299530" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300641" "00299531" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300642" "00299532" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300643" "00299533" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300644" "00299534" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300645" "00299535" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300646" "00299536" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300647" "00299537" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300648" "00299538" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300649" "00299539" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300650" "00299540" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300651" "00299541" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300652" "00299542" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300653" "00299543" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300654" "00299544" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300655" "00299545" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300656" "00299546" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300657" "00299547" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300658" "00299548" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300659" "00299549" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300660" "00299550" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300661" "00299551" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300662" "00299552" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300663" "00299553" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300664" "00299554" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300665" "00299555" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300666" "00299556" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300667" "00299557" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300668" "00299558" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300669" "00299559" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300670" "00299560" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300671" "00299561" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300672" "00299562" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300673" "00299563" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300674" "00299564" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300675" "00299565" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300676" "00299566" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300677" "00299567" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300678" "00299568" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300679" "00299569" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300680" "00299570" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300681" "00299571" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300682" "00299572" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300683" "00299573" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300684" "00299574" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300685" "00299575" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300686" "00299576" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300687" "00299577" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300688" "00299578" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300689" "00299579" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300690" "00299580" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300691" "00299581" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300692" "00299582" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300693" "00299583" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300694" "00299584" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300695" "00299585" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300696" "00299586" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300697" "00299587" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300698" "00299588" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300699" "00299589" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300700" "00299590" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300701" "00299591" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300702" "00299592" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300703" "00299593" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300704" "00299594" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300705" "00299595" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300706" "00299596" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300707" "00299597" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300708" "00299598" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300709" "00299599" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300710" "00299600" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300711" "00299601" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300712" "00299602" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300713" "00299603" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300714" "00299604" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300715" "00299605" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300716" "00299606" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300717" "00299607" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300718" "00299608" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300719" "00299609" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300720" "00299610" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300721" "00299611" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300722" "00299612" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300723" "00299613" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300724" "00299614" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300725" "00299615" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300726" "00299616" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300727" "00299617" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300728" "00299618" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300729" "00299619" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300730" "00299620" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300731" "00299621" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300732" "00299622" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300733" "00299623" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300734" "00299624" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300735" "00299625" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300736" "00299626" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300737" "00299627" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300738" "00299628" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300739" "00299629" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300740" "00299630" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300741" "00299631" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000300742" "00299632" "1" "03595" "00006" "2020-04-17 12:06:15" "" "" "SEQ" "DNA" "" "" "0000301738" "00300617" "1" "01164" "01164" "2020-05-04 10:04:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000301774" "00300653" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301775" "00300654" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301776" "00300655" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301777" "00300656" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301778" "00300657" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301779" "00300658" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301780" "00300659" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301781" "00300660" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301782" "00300661" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301783" "00300662" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301784" "00300663" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301785" "00300664" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301786" "00300665" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301787" "00300666" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301788" "00300667" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301789" "00300668" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301790" "00300669" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301791" "00300670" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301792" "00300671" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301793" "00300672" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301794" "00300673" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301795" "00300674" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301796" "00300675" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301797" "00300676" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301798" "00300677" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301799" "00300678" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301800" "00300679" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301801" "00300680" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301802" "00300681" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301803" "00300682" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301804" "00300683" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301805" "00300684" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301806" "00300685" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301807" "00300686" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301808" "00300687" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301809" "00300688" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301810" "00300689" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301811" "00300690" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301812" "00300691" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301813" "00300692" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301814" "00300693" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301815" "00300694" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301816" "00300695" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301817" "00300696" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301818" "00300697" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301819" "00300698" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301820" "00300699" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301821" "00300700" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301822" "00300701" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301823" "00300702" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301824" "00300703" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301825" "00300704" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301826" "00300705" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301827" "00300706" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301828" "00300707" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301829" "00300708" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301830" "00300709" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301831" "00300710" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301832" "00300711" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301833" "00300712" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301834" "00300713" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301835" "00300714" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301836" "00300715" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301837" "00300716" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301838" "00300717" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301839" "00300718" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301840" "00300719" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301841" "00300720" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301842" "00300721" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301843" "00300722" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301844" "00300723" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301845" "00300724" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301846" "00300725" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301847" "00300726" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301848" "00300727" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301849" "00300728" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301850" "00300729" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301851" "00300730" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301852" "00300731" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301853" "00300732" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301854" "00300733" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301855" "00300734" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301856" "00300735" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301857" "00300736" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301858" "00300737" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301859" "00300738" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301860" "00300739" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301861" "00300740" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301862" "00300741" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301863" "00300742" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301864" "00300743" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301865" "00300744" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301866" "00300745" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301867" "00300746" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301868" "00300747" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301869" "00300748" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301870" "00300749" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301871" "00300750" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301872" "00300751" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301873" "00300752" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301874" "00300753" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301875" "00300754" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301876" "00300755" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301877" "00300756" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301878" "00300757" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301879" "00300758" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301880" "00300759" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301881" "00300760" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301882" "00300761" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301883" "00300762" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301884" "00300763" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301885" "00300764" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301886" "00300765" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301887" "00300766" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301888" "00300767" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301889" "00300768" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301890" "00300769" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301891" "00300770" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301892" "00300771" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301893" "00300772" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301894" "00300773" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301895" "00300774" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301896" "00300775" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301897" "00300776" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301898" "00300777" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301899" "00300778" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301900" "00300779" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301901" "00300780" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301902" "00300781" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301903" "00300782" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301904" "00300783" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301905" "00300784" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301906" "00300785" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301907" "00300786" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301908" "00300787" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301909" "00300788" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301910" "00300789" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301911" "00300790" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301912" "00300791" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301913" "00300792" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301914" "00300793" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301915" "00300794" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301916" "00300795" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301917" "00300796" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301918" "00300797" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301919" "00300798" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301920" "00300799" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301921" "00300800" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301922" "00300801" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301923" "00300802" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301924" "00300803" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301925" "00300804" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301926" "00300805" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301927" "00300806" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301928" "00300807" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301929" "00300808" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301930" "00300809" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301931" "00300810" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301932" "00300811" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301933" "00300812" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301934" "00300813" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301935" "00300814" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301936" "00300815" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301937" "00300816" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301938" "00300817" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301939" "00300818" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301940" "00300819" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301941" "00300820" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301942" "00300821" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301943" "00300822" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301944" "00300823" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301945" "00300824" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301946" "00300825" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301947" "00300826" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301948" "00300827" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301949" "00300828" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301950" "00300829" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301951" "00300830" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301952" "00300831" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301953" "00300832" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301954" "00300833" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301955" "00300834" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301956" "00300835" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301957" "00300836" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301958" "00300837" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301959" "00300838" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301960" "00300839" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301961" "00300840" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301962" "00300841" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301963" "00300842" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301964" "00300843" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301965" "00300844" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301966" "00300845" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301967" "00300846" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301968" "00300847" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301969" "00300848" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301970" "00300849" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301971" "00300850" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301972" "00300851" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301973" "00300852" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301974" "00300853" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301975" "00300854" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301976" "00300855" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301977" "00300856" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301978" "00300857" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301979" "00300858" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301980" "00300859" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301981" "00300860" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301982" "00300861" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301983" "00300862" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301984" "00300863" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301985" "00300864" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301986" "00300865" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301987" "00300866" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301988" "00300867" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301989" "00300868" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301990" "00300869" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301991" "00300870" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301992" "00300871" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301993" "00300872" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301994" "00300873" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301995" "00300874" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301996" "00300875" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301997" "00300876" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301998" "00300877" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000301999" "00300878" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302000" "00300879" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302001" "00300880" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302002" "00300881" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302003" "00300882" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302004" "00300883" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302005" "00300884" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302006" "00300885" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302007" "00300886" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302008" "00300887" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302009" "00300888" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302010" "00300889" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302011" "00300890" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302012" "00300891" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302013" "00300892" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302014" "00300893" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302015" "00300894" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302016" "00300895" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302017" "00300896" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302018" "00300897" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302019" "00300898" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302020" "00300899" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302021" "00300900" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302022" "00300901" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302023" "00300902" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302024" "00300903" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302025" "00300904" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302026" "00300905" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302027" "00300906" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302028" "00300907" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302029" "00300908" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302030" "00300909" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302031" "00300910" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302032" "00300911" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302033" "00300912" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302034" "00300913" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302035" "00300914" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302036" "00300915" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302037" "00300916" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302038" "00300917" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302039" "00300918" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302040" "00300919" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302041" "00300920" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302042" "00300921" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302043" "00300922" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302044" "00300923" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302045" "00300924" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302046" "00300925" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302047" "00300926" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302048" "00300927" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302049" "00300928" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302050" "00300929" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302051" "00300930" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302052" "00300931" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302053" "00300932" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302054" "00300933" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302055" "00300934" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302056" "00300935" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302057" "00300936" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302058" "00300937" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302059" "00300938" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302060" "00300939" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302061" "00300940" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302062" "00300941" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302063" "00300942" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302064" "00300943" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302065" "00300944" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302066" "00300945" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302067" "00300946" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302068" "00300947" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302069" "00300948" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302070" "00300949" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302071" "00300950" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302072" "00300951" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302073" "00300952" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302074" "00300953" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302075" "00300954" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302076" "00300955" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302077" "00300956" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302078" "00300957" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302079" "00300958" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302080" "00300959" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302081" "00300960" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302082" "00300961" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302083" "00300962" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302084" "00300963" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302085" "00300964" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302086" "00300965" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302087" "00300966" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302088" "00300967" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302089" "00300968" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302090" "00300969" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302091" "00300970" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302092" "00300971" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302093" "00300972" "1" "03595" "00006" "2020-05-04 15:16:50" "" "" "SEQ" "DNA" "" "" "0000302094" "00300973" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302095" "00300974" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302097" "00300976" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302098" "00300977" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302099" "00300978" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302100" "00300979" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302101" "00300980" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302102" "00300981" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302103" "00300982" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302104" "00300983" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302105" "00300984" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302106" "00300985" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302107" "00300986" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302108" "00300987" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302109" "00300988" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302110" "00300989" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302111" "00300990" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302112" "00300991" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302113" "00300992" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302114" "00300993" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302115" "00300994" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302116" "00300995" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302117" "00300996" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302118" "00300997" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302119" "00300998" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302120" "00300999" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302121" "00301000" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302122" "00301001" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302123" "00301002" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302124" "00301003" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000302125" "00301004" "1" "03595" "00006" "2020-05-04 15:39:45" "" "" "SEQ" "DNA" "" "" "0000307377" "00306241" "1" "01164" "01164" "2020-07-13 13:11:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308448" "00307306" "1" "01164" "01164" "2020-08-10 12:17:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308449" "00307307" "1" "01164" "01164" "2020-08-10 12:18:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000309862" "00308717" "1" "00004" "00006" "2020-08-27 15:56:29" "" "" "SEQ;SEQ-NG" "DNA" "" "105 WGS/200 WES" "0000309863" "00308718" "1" "00004" "00006" "2020-08-27 15:56:29" "" "" "SEQ;SEQ-NG" "DNA" "" "105 WGS/200 WES" "0000309864" "00308719" "1" "00004" "00006" "2020-08-27 15:56:29" "" "" "SEQ;SEQ-NG" "DNA" "" "105 WGS/200 WES" "0000309865" "00308720" "1" "00004" "00006" "2020-08-27 15:56:29" "" "" "SEQ;SEQ-NG" "DNA" "" "105 WGS/200 WES" "0000310832" "00309687" "1" "00006" "00006" "2020-09-01 14:45:23" "" "" "SEQ" "DNA" "" "" "0000310833" "00309688" "1" "00006" "00006" "2020-09-01 14:45:23" "" "" "SEQ" "DNA" "" "" "0000310834" "00309689" "1" "00006" "00006" "2020-09-01 14:45:23" "" "" "SEQ" "DNA" "" "" "0000310835" "00309690" "1" "00006" "00006" "2020-09-01 14:45:23" "" "" "SEQ" "DNA" "" "" "0000310836" "00309691" "1" "00006" "00006" "2020-09-01 14:45:23" "" "" "SEQ" "DNA" "" "" "0000312339" "00311183" "1" "01164" "01164" "2020-09-21 13:02:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000328841" "00327627" "1" "02551" "02551" "2021-01-25 10:43:01" "" "" "SEQ" "DNA" "" "" "0000387718" "00386491" "1" "00006" "00006" "2021-10-22 17:45:19" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000387719" "00386492" "1" "00006" "00006" "2021-10-22 17:45:19" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000387720" "00386493" "1" "00006" "00006" "2021-10-22 17:45:19" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000387721" "00386494" "1" "00006" "00006" "2021-10-22 17:45:19" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000388919" "00387690" "1" "04138" "04138" "2021-10-31 09:12:51" "" "" "SEQ-NG" "DNA" "Blood" "idiopathic pancreatitis gene panel" "0000394472" "00393224" "1" "04138" "04138" "2021-11-27 23:02:24" "" "" "SEQ-NG" "DNA" "blood" "" "0000395554" "00394306" "1" "04138" "04138" "2021-11-30 21:36:12" "" "" "MAPH;SEQ" "DNA" "blood" "" "0000395555" "00394307" "1" "04138" "04138" "2021-11-30 21:50:27" "" "" "MAPH;SEQ" "DNA" "blood" "" "0000419889" "00418594" "1" "00006" "00006" "2022-10-01 10:38:21" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000428293" "00426973" "1" "00006" "00006" "2022-12-04 11:25:02" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428294" "00426974" "1" "00006" "00006" "2022-12-04 11:25:02" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428295" "00426975" "1" "00006" "00006" "2022-12-04 11:25:02" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428363" "00427043" "1" "00006" "00006" "2022-12-04 12:45:35" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428364" "00427044" "1" "00006" "00006" "2022-12-04 12:45:35" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428365" "00427045" "1" "00006" "00006" "2022-12-04 12:45:35" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428366" "00427046" "1" "00006" "00006" "2022-12-04 12:45:35" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428367" "00427047" "1" "00006" "00006" "2022-12-04 12:45:35" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428368" "00427048" "1" "00006" "00006" "2022-12-04 12:45:35" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428369" "00427049" "1" "00006" "00006" "2022-12-04 12:45:35" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428370" "00427050" "1" "00006" "00006" "2022-12-04 12:45:35" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000429382" "00427969" "1" "00006" "00006" "2022-12-19 13:11:26" "" "" "RT-PCR;SEQ;SEQ-NG-RNA" "DNA;RNA" "whole blood" "singleton WES" "0000434564" "00433133" "1" "00006" "00006" "2023-02-28 15:41:53" "" "" "SEQ-NG" "DNA" "" "" "0000437838" "00436356" "1" "00006" "00006" "2023-09-04 09:51:16" "" "" "SEQ-NG" "DNA" "" "clinical WES" "0000454732" "00453121" "1" "00006" "00006" "2024-08-15 19:46:57" "" "" "SEQ-NG" "DNA" "" "" "0000457065" "00455451" "1" "04749" "04749" "2024-10-09 17:38:44" "" "" "SEQ-NG" "DNA" "" "" "0000470410" "00468742" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000470411" "00468743" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000470412" "00468744" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000472341" "00470674" "1" "00006" "00006" "2025-12-05 11:16:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 835 "{{screeningid}}" "{{geneid}}" "0000000005" "ACADM" "0000000005" "ATP7B" "0000000005" "CFTR" "0000000005" "ETFB" "0000000005" "GLB1" "0000000005" "MEFV" "0000000005" "NHLRC1" "0000000005" "PKHD1" "0000000005" "RAPSN" "0000000005" "SERPINA1" "0000000005" "SLC26A2" "0000000005" "USH2A" "0000000008" "ACADM" "0000000008" "ADA" "0000000008" "ATP7B" "0000000008" "CFTR" "0000000008" "ETFB" "0000000008" "FKTN" "0000000008" "HESX1" "0000000008" "HGSNAT" "0000000008" "MYO5A" "0000000008" "NPHS1" "0000000008" "SERPINA1" "0000000008" "USH2A" "0000000009" "ACADM" "0000000009" "ARSB" "0000000009" "ATP7B" "0000000009" "CFTR" "0000000009" "CLN3" "0000000009" "ETFB" "0000000009" "GAN" "0000000009" "GLB1" "0000000009" "HEXB" "0000000009" "IGHMBP2" "0000000009" "MEFV" "0000000009" "NHLRC1" "0000000009" "NPHS1" "0000000009" "NTRK1" "0000000009" "PMP22" "0000000009" "SERPINA1" "0000000009" "WNT10A" "0000000014" "ALG6" "0000000014" "ATP7B" "0000000014" "CFTR" "0000000014" "DPYD" "0000000014" "ETFB" "0000000014" "GLB1" "0000000014" "GNPTAB" "0000000014" "HEXB" "0000000014" "IGHMBP2" "0000000014" "MYO5A" "0000000014" "NHLRC1" "0000000014" "NPHP4" "0000000014" "NPHS1" "0000000014" "PKHD1" "0000000014" "SERPINA1" "0000000014" "SFTPB" "0000000014" "SGSH" "0000000014" "TSFM" "0000000016" "ADA" "0000000016" "ALG6" "0000000016" "ATP7B" "0000000016" "CFTR" "0000000016" "DPYD" "0000000016" "ENPP1" "0000000016" "GLB1" "0000000016" "IGHMBP2" "0000000016" "NPHS1" "0000000016" "PKHD1" "0000000025" "AMPD1" "0000000025" "ATP7B" "0000000025" "ATR" "0000000025" "CBS" "0000000025" "CFTR" "0000000025" "CYP21A2" "0000000025" "ETFB" "0000000025" "GLB1" "0000000025" "HBB" "0000000025" "IGHMBP2" "0000000025" "NPHS1" "0000000025" "PAH" "0000000025" "SERPINA1" "0000000025" "SLC26A2" "0000000027" "AMPD1" "0000000027" "ARSB" "0000000027" "ATP7B" "0000000027" "CBS" "0000000027" "CFTR" "0000000027" "DPYD" "0000000027" "ETFB" "0000000027" "HEXB" "0000000027" "MYO5A" "0000000027" "NHLRC1" "0000000027" "NPC1" "0000000027" "NPHS1" "0000000027" "SLC26A2" "0000000035" "ADA" "0000000035" "ATP7B" "0000000035" "BLM" "0000000035" "CFTR" "0000000035" "DPYD" "0000000035" "ETFB" "0000000035" "GLB1" "0000000035" "HBB" "0000000035" "IGHMBP2" "0000000035" "MYO5A" "0000000035" "PKHD1" "0000000035" "SERPINA1" "0000000035" "SMPD1" "0000000038" "ALS2" "0000000038" "ATP7B" "0000000038" "CFTR" "0000000038" "DPYD" "0000000038" "GLB1" "0000000038" "HEXB" "0000000038" "MTHFR" "0000000038" "MYO5A" "0000000038" "NHLRC1" "0000000038" "SMPD1" "0000000046" "AGXT" "0000000046" "ATP7B" "0000000046" "CFTR" "0000000046" "CYP27A1" "0000000046" "DPYD" "0000000046" "EHMT1" "0000000046" "GLB1" "0000000046" "IGHMBP2" "0000000046" "NPHS1" "0000000046" "POLG" "0000000046" "SERPINA1" "0000000046" "SMPD1" "0000000058" "ALDH5A1" "0000000058" "ATP7B" "0000000058" "CFTR" "0000000058" "CYP21A2" "0000000058" "GBA" "0000000058" "HEXB" "0000000058" "IGHMBP2" "0000000058" "MEFV" "0000000058" "MYO5A" "0000000058" "NHLRC1" "0000000058" "NPHS1" "0000000058" "PKHD1" "0000000058" "PMM2" "0000000058" "SERPINA1" "0000000058" "SLC26A2" "0000000058" "SMPD1" "0000000060" "ATP7B" "0000000060" "CFTR" "0000000060" "ENPP1" "0000000060" "GBA" "0000000060" "GLB1" "0000000060" "NHLRC1" "0000000060" "NPC2" "0000000060" "NPHS1" "0000000060" "SMPD1" "0000000065" "ATP7B" "0000000065" "CFTR" "0000000065" "ETFB" "0000000065" "GLB1" "0000000065" "MPL" "0000000065" "NHLRC1" "0000000065" "NPHS1" "0000000065" "SERPINA1" "0000000065" "SMPD1" "0000000070" "ACADSB" "0000000070" "ATP7B" "0000000070" "CFTR" "0000000070" "ETFB" "0000000070" "HBA1" "0000000070" "IGHMBP2" "0000000070" "MTHFR" "0000000070" "MYO5A" "0000000070" "SERPINA1" "0000000070" "SLC26A2" "0000000074" "AGXT" "0000000074" "ATP7B" "0000000074" "CFTR" "0000000074" "ERCC5" "0000000074" "GLB1" "0000000074" "MTHFR" "0000000074" "NHLRC1" "0000000074" "NPHS1" "0000000074" "SERPINA1" "0000000078" "ATP7B" "0000000078" "CDH23" "0000000078" "CFTR" "0000000078" "ETFB" "0000000078" "GLB1" "0000000078" "IGHMBP2" "0000000078" "NPHS1" "0000000078" "PMM2" "0000000078" "POLG" "0000000078" "RAG1" "0000000078" "SERPINA1" "0000000078" "SLC26A2" "0000000088" "ATP7B" "0000000088" "CFTR" "0000000088" "ETFB" "0000000088" "FKRP" "0000000088" "GALC" "0000000088" "GLB1" "0000000088" "HEXB" "0000000088" "IGHMBP2" "0000000088" "NHLRC1" "0000000088" "NPHS1" "0000000088" "POLG" "0000000088" "SBDS" "0000000088" "SERPINA1" "0000000089" "ATP7B" "0000000089" "BTD" "0000000089" "CFTR" "0000000089" "ETFB" "0000000089" "GALC" "0000000089" "GLB1" "0000000089" "IGHMBP2" "0000000089" "SMPD1" "0000000095" "ATP7B" "0000000095" "CFTR" "0000000095" "GLB1" "0000000095" "HEXB" "0000000095" "NHLRC1" "0000000095" "NPHS1" "0000000095" "SMPD1" "0000000100" "ADAMTS13" "0000000100" "ATP7B" "0000000100" "CFTR" "0000000100" "ETFB" "0000000100" "HADHA" "0000000100" "HESX1" "0000000100" "HGSNAT" "0000000100" "LAMA2" "0000000100" "NHLRC1" "0000000100" "NPHS1" "0000000100" "PKHD1" "0000000100" "SERPINA1" "0000000994" "CFTR" "0000035235" "CFTR" "0000035236" "CFTR" "0000035237" "CFTR" "0000035238" "CFTR" "0000035239" "CFTR" "0000035240" "CFTR" "0000035241" "CFTR" "0000035242" "CFTR" "0000035243" "CFTR" "0000035244" "CFTR" "0000035245" "CFTR" "0000035246" "CFTR" "0000035247" "CFTR" "0000035248" "CFTR" "0000035249" "CFTR" "0000035250" "CFTR" "0000035251" "CFTR" "0000035252" "CFTR" "0000035253" "CFTR" "0000035254" "CFTR" "0000035255" "CFTR" "0000035256" "CFTR" "0000035257" "CFTR" "0000035258" "CFTR" "0000035259" "CFTR" "0000035260" "CFTR" "0000035261" "CFTR" "0000133493" "CACNA1C-AS1" "0000133493" "CACNA1C-AS4" "0000133493" "CACNA1C-IT3" "0000133493" "CACNA1D" "0000133493" "CACNA1E" "0000133493" "CACNA1F" "0000133493" "CACNA1G" "0000133493" "CACNA1H" "0000133493" "CACNA1I" "0000133493" "CFTR" "0000133645" "CFTR" "0000133646" "CFTR" "0000133647" "CFTR" "0000165518" "CFTR" "0000165521" "CFTR" "0000165522" "CFTR" "0000165524" "CFTR" "0000275481" "CFTR" "0000297984" "CFTR" "0000297986" "CFTR" "0000297987" "CFTR" "0000297988" "CFTR" "0000300567" "CFTR" "0000300568" "CFTR" "0000300569" "CFTR" "0000300570" "CFTR" "0000300571" "CFTR" "0000300572" "CFTR" "0000300573" "CFTR" "0000300574" "CFTR" "0000300575" "CFTR" "0000300576" "CFTR" "0000300577" "CFTR" "0000300578" "CFTR" "0000300579" "CFTR" "0000300580" "CFTR" "0000300581" "CFTR" "0000300582" "CFTR" "0000300583" "CFTR" "0000300584" "CFTR" "0000300585" "CFTR" "0000300586" "CFTR" "0000300587" "CFTR" "0000300588" "CFTR" "0000300589" "CFTR" "0000300590" "CFTR" "0000300591" "CFTR" "0000300592" "CFTR" "0000300593" "CFTR" "0000300594" "CFTR" "0000300595" "CFTR" "0000300596" "CFTR" "0000300597" "CFTR" "0000300598" "CFTR" "0000300599" "CFTR" "0000300600" "CFTR" "0000300601" "CFTR" "0000300602" "CFTR" "0000300603" "CFTR" "0000300604" "CFTR" "0000300605" "CFTR" "0000300606" "CFTR" "0000300607" "CFTR" "0000300608" "CFTR" "0000300609" "CFTR" "0000300610" "CFTR" "0000300611" "CFTR" "0000300612" "CFTR" "0000300613" "CFTR" "0000300614" "CFTR" "0000300615" "CFTR" "0000300616" "CFTR" "0000300617" "CFTR" "0000300618" "CFTR" "0000300619" "CFTR" "0000300620" "CFTR" "0000300621" "CFTR" "0000300622" "CFTR" "0000300623" "CFTR" "0000300624" "CFTR" "0000300625" "CFTR" "0000300626" "CFTR" "0000300627" "CFTR" "0000300628" "CFTR" "0000300629" "CFTR" "0000300630" "CFTR" "0000300631" "CFTR" "0000300632" "CFTR" "0000300633" "CFTR" "0000300634" "CFTR" "0000300635" "CFTR" "0000300636" "CFTR" "0000300637" "CFTR" "0000300638" "CFTR" "0000300639" "CFTR" "0000300640" "CFTR" "0000300641" "CFTR" "0000300642" "CFTR" "0000300643" "CFTR" "0000300644" "CFTR" "0000300645" "CFTR" "0000300646" "CFTR" "0000300647" "CFTR" "0000300648" "CFTR" "0000300649" "CFTR" "0000300650" "CFTR" "0000300651" "CFTR" "0000300652" "CFTR" "0000300653" "CFTR" "0000300654" "CFTR" "0000300655" "CFTR" "0000300656" "CFTR" "0000300657" "CFTR" "0000300658" "CFTR" "0000300659" "CFTR" "0000300660" "CFTR" "0000300661" "CFTR" "0000300662" "CFTR" "0000300663" "CFTR" "0000300664" "CFTR" "0000300665" "CFTR" "0000300666" "CFTR" "0000300667" "CFTR" "0000300668" "CFTR" "0000300669" "CFTR" "0000300670" "CFTR" "0000300671" "CFTR" "0000300672" "CFTR" "0000300673" "CFTR" "0000300674" "CFTR" "0000300675" "CFTR" "0000300676" "CFTR" "0000300677" "CFTR" "0000300678" "CFTR" "0000300679" "CFTR" "0000300680" "CFTR" "0000300681" "CFTR" "0000300682" "CFTR" "0000300683" "CFTR" "0000300684" "CFTR" "0000300685" "CFTR" "0000300686" "CFTR" "0000300687" "CFTR" "0000300688" "CFTR" "0000300689" "CFTR" "0000300690" "CFTR" "0000300691" "CFTR" "0000300692" "CFTR" "0000300693" "CFTR" "0000300694" "CFTR" "0000300695" "CFTR" "0000300696" "CFTR" "0000300697" "CFTR" "0000300698" "CFTR" "0000300699" "CFTR" "0000300700" "CFTR" "0000300701" "CFTR" "0000300702" "CFTR" "0000300703" "CFTR" "0000300704" "CFTR" "0000300705" "CFTR" "0000300706" "CFTR" "0000300707" "CFTR" "0000300708" "CFTR" "0000300709" "CFTR" "0000300710" "CFTR" "0000300711" "CFTR" "0000300712" "CFTR" "0000300713" "CFTR" "0000300714" "CFTR" "0000300715" "CFTR" "0000300716" "CFTR" "0000300717" "CFTR" "0000300718" "CFTR" "0000300719" "CFTR" "0000300720" "CFTR" "0000300721" "CFTR" "0000300722" "CFTR" "0000300723" "CFTR" "0000300724" "CFTR" "0000300725" "CFTR" "0000300726" "CFTR" "0000300727" "CFTR" "0000300728" "CFTR" "0000300729" "CFTR" "0000300730" "CFTR" "0000300731" "CFTR" "0000300732" "CFTR" "0000300733" "CFTR" "0000300734" "CFTR" "0000300735" "CFTR" "0000300736" "CFTR" "0000300737" "CFTR" "0000300738" "CFTR" "0000300739" "CFTR" "0000300740" "CFTR" "0000300741" "CFTR" "0000300742" "CFTR" "0000301774" "CFTR" "0000301775" "CFTR" "0000301776" "CFTR" "0000301777" "CFTR" "0000301778" "CFTR" "0000301779" "CFTR" "0000301780" "CFTR" "0000301781" "CFTR" "0000301782" "CFTR" "0000301783" "CFTR" "0000301784" "CFTR" "0000301785" "CFTR" "0000301786" "CFTR" "0000301787" "CFTR" "0000301788" "CFTR" "0000301789" "CFTR" "0000301790" "CFTR" "0000301791" "CFTR" "0000301792" "CFTR" "0000301793" "CFTR" "0000301794" "CFTR" "0000301795" "CFTR" "0000301796" "CFTR" "0000301797" "CFTR" "0000301798" "CFTR" "0000301799" "CFTR" "0000301800" "CFTR" "0000301801" "CFTR" "0000301802" "CFTR" "0000301803" "CFTR" "0000301804" "CFTR" "0000301805" "CFTR" "0000301806" "CFTR" "0000301807" "CFTR" "0000301808" "CFTR" "0000301809" "CFTR" "0000301810" "CFTR" "0000301811" "CFTR" "0000301812" "CFTR" "0000301813" "CFTR" "0000301814" "CFTR" "0000301815" "CFTR" "0000301816" "CFTR" "0000301817" "CFTR" "0000301818" "CFTR" "0000301819" "CFTR" "0000301820" "CFTR" "0000301821" "CFTR" "0000301822" "CFTR" "0000301823" "CFTR" "0000301824" "CFTR" "0000301825" "CFTR" "0000301826" "CFTR" "0000301827" "CFTR" "0000301828" "CFTR" "0000301829" "CFTR" "0000301830" "CFTR" "0000301831" "CFTR" "0000301832" "CFTR" "0000301833" "CFTR" "0000301834" "CFTR" "0000301835" "CFTR" "0000301836" "CFTR" "0000301837" "CFTR" "0000301838" "CFTR" "0000301839" "CFTR" "0000301840" "CFTR" "0000301841" "CFTR" "0000301842" "CFTR" "0000301843" "CFTR" "0000301844" "CFTR" "0000301845" "CFTR" "0000301846" "CFTR" "0000301847" "CFTR" "0000301848" "CFTR" "0000301849" "CFTR" "0000301850" "CFTR" "0000301851" "CFTR" "0000301852" "CFTR" "0000301853" "CFTR" "0000301854" "CFTR" "0000301855" "CFTR" "0000301856" "CFTR" "0000301857" "CFTR" "0000301858" "CFTR" "0000301859" "CFTR" "0000301860" "CFTR" "0000301861" "CFTR" "0000301862" "CFTR" "0000301863" "CFTR" "0000301864" "CFTR" "0000301865" "CFTR" "0000301866" "CFTR" "0000301867" "CFTR" "0000301868" "CFTR" "0000301869" "CFTR" "0000301870" "CFTR" "0000301871" "CFTR" "0000301872" "CFTR" "0000301873" "CFTR" "0000301874" "CFTR" "0000301875" "CFTR" "0000301876" "CFTR" "0000301877" "CFTR" "0000301878" "CFTR" "0000301879" "CFTR" "0000301880" "CFTR" "0000301881" "CFTR" "0000301882" "CFTR" "0000301883" "CFTR" "0000301884" "CFTR" "0000301885" "CFTR" "0000301886" "CFTR" "0000301887" "CFTR" "0000301888" "CFTR" "0000301889" "CFTR" "0000301890" "CFTR" "0000301891" "CFTR" "0000301892" "CFTR" "0000301893" "CFTR" "0000301894" "CFTR" "0000301895" "CFTR" "0000301896" "CFTR" "0000301897" "CFTR" "0000301898" "CFTR" "0000301899" "CFTR" "0000301900" "CFTR" "0000301901" "CFTR" "0000301902" "CFTR" "0000301903" "CFTR" "0000301904" "CFTR" "0000301905" "CFTR" "0000301906" "CFTR" "0000301907" "CFTR" "0000301908" "CFTR" "0000301909" "CFTR" "0000301910" "CFTR" "0000301911" "CFTR" "0000301912" "CFTR" "0000301913" "CFTR" "0000301914" "CFTR" "0000301915" "CFTR" "0000301916" "CFTR" "0000301917" "CFTR" "0000301918" "CFTR" "0000301919" "CFTR" "0000301920" "CFTR" "0000301921" "CFTR" "0000301922" "CFTR" "0000301923" "CFTR" "0000301924" "CFTR" "0000301925" "CFTR" "0000301926" "CFTR" "0000301927" "CFTR" "0000301928" "CFTR" "0000301929" "CFTR" "0000301930" "CFTR" "0000301931" "CFTR" "0000301932" "CFTR" "0000301933" "CFTR" "0000301934" "CFTR" "0000301935" "CFTR" "0000301936" "CFTR" "0000301937" "CFTR" "0000301938" "CFTR" "0000301939" "CFTR" "0000301940" "CFTR" "0000301941" "CFTR" "0000301942" "CFTR" "0000301943" "CFTR" "0000301944" "CFTR" "0000301945" "CFTR" "0000301946" "CFTR" "0000301947" "CFTR" "0000301948" "CFTR" "0000301949" "CFTR" "0000301950" "CFTR" "0000301951" "CFTR" "0000301952" "CFTR" "0000301953" "CFTR" "0000301954" "CFTR" "0000301955" "CFTR" "0000301956" "CFTR" "0000301957" "CFTR" "0000301958" "CFTR" "0000301959" "CFTR" "0000301960" "CFTR" "0000301961" "CFTR" "0000301962" "CFTR" "0000301963" "CFTR" "0000301964" "CFTR" "0000301965" "CFTR" "0000301966" "CFTR" "0000301967" "CFTR" "0000301968" "CFTR" "0000301969" "CFTR" "0000301970" "CFTR" "0000301971" "CFTR" "0000301972" "CFTR" "0000301973" "CFTR" "0000301974" "CFTR" "0000301975" "CFTR" "0000301976" "CFTR" "0000301977" "CFTR" "0000301978" "CFTR" "0000301979" "CFTR" "0000301980" "CFTR" "0000301981" "CFTR" "0000301982" "CFTR" "0000301983" "CFTR" "0000301984" "CFTR" "0000301985" "CFTR" "0000301986" "CFTR" "0000301987" "CFTR" "0000301988" "CFTR" "0000301989" "CFTR" "0000301990" "CFTR" "0000301991" "CFTR" "0000301992" "CFTR" "0000301993" "CFTR" "0000301994" "CFTR" "0000301995" "CFTR" "0000301996" "CFTR" "0000301997" "CFTR" "0000301998" "CFTR" "0000301999" "CFTR" "0000302000" "CFTR" "0000302001" "CFTR" "0000302002" "CFTR" "0000302003" "CFTR" "0000302004" "CFTR" "0000302005" "CFTR" "0000302006" "CFTR" "0000302007" "CFTR" "0000302008" "CFTR" "0000302009" "CFTR" "0000302010" "CFTR" "0000302011" "CFTR" "0000302012" "CFTR" "0000302013" "CFTR" "0000302014" "CFTR" "0000302015" "CFTR" "0000302016" "CFTR" "0000302017" "CFTR" "0000302018" "CFTR" "0000302019" "CFTR" "0000302020" "CFTR" "0000302021" "CFTR" "0000302022" "CFTR" "0000302023" "CFTR" "0000302024" "CFTR" "0000302025" "CFTR" "0000302026" "CFTR" "0000302027" "CFTR" "0000302028" "CFTR" "0000302029" "CFTR" "0000302030" "CFTR" "0000302031" "CFTR" "0000302032" "CFTR" "0000302033" "CFTR" "0000302034" "CFTR" "0000302035" "CFTR" "0000302036" "CFTR" "0000302037" "CFTR" "0000302038" "CFTR" "0000302039" "CFTR" "0000302040" "CFTR" "0000302041" "CFTR" "0000302042" "CFTR" "0000302043" "CFTR" "0000302044" "CFTR" "0000302045" "CFTR" "0000302046" "CFTR" "0000302047" "CFTR" "0000302048" "CFTR" "0000302049" "CFTR" "0000302050" "CFTR" "0000302051" "CFTR" "0000302052" "CFTR" "0000302053" "CFTR" "0000302054" "CFTR" "0000302055" "CFTR" "0000302056" "CFTR" "0000302057" "CFTR" "0000302058" "CFTR" "0000302059" "CFTR" "0000302060" "CFTR" "0000302061" "CFTR" "0000302062" "CFTR" "0000302063" "CFTR" "0000302064" "CFTR" "0000302065" "CFTR" "0000302066" "CFTR" "0000302067" "CFTR" "0000302068" "CFTR" "0000302069" "CFTR" "0000302070" "CFTR" "0000302071" "CFTR" "0000302072" "CFTR" "0000302073" "CFTR" "0000302074" "CFTR" "0000302075" "CFTR" "0000302076" "CFTR" "0000302077" "CFTR" "0000302078" "CFTR" "0000302079" "CFTR" "0000302080" "CFTR" "0000302081" "CFTR" "0000302082" "CFTR" "0000302083" "CFTR" "0000302084" "CFTR" "0000302085" "CFTR" "0000302086" "CFTR" "0000302087" "CFTR" "0000302088" "CFTR" "0000302089" "CFTR" "0000302090" "CFTR" "0000302091" "CFTR" "0000302092" "CFTR" "0000302093" "CFTR" "0000302094" "CFTR" "0000302095" "CFTR" "0000302097" "CFTR" "0000302098" "CFTR" "0000302099" "CFTR" "0000302100" "CFTR" "0000302101" "CFTR" "0000302102" "CFTR" "0000302103" "CFTR" "0000302104" "CFTR" "0000302105" "CFTR" "0000302106" "CFTR" "0000302107" "CFTR" "0000302108" "CFTR" "0000302109" "CFTR" "0000302110" "CFTR" "0000302111" "CFTR" "0000302112" "CFTR" "0000302113" "CFTR" "0000302114" "CFTR" "0000302115" "CFTR" "0000302116" "CFTR" "0000302117" "CFTR" "0000302118" "CFTR" "0000302119" "CFTR" "0000302120" "CFTR" "0000302121" "CFTR" "0000302122" "CFTR" "0000302123" "CFTR" "0000302124" "CFTR" "0000302125" "CFTR" "0000309862" "CFTR" "0000309863" "CFTR" "0000309864" "CFTR" "0000309865" "CFTR" "0000310832" "CFTR" "0000310833" "CFTR" "0000310834" "CFTR" "0000310835" "CFTR" "0000310836" "CFTR" "0000388919" "CFTR" "0000388919" "CTRC" "0000388919" "PRSS1" "0000388919" "SPINK1" "0000395554" "CFTR" "0000395554" "CTRC" "0000395554" "PRSS1" "0000395554" "SPINK1" "0000395555" "CFTR" "0000395555" "CTRC" "0000395555" "PRSS1" "0000395555" "SPINK1" "0000457065" "CFTR" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 2066 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000001222" "0" "50" "7" "117199646" "117199648" "del" "0" "00002" "CFTR_000001" "g.117199646_117199648del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117559592_117559594del" "" "VUS" "" "0000001223" "0" "50" "7" "117199646" "117199648" "del" "0" "00002" "CFTR_000001" "g.117199646_117199648del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117559592_117559594del" "" "VUS" "" "0000001224" "0" "50" "7" "117199646" "117199648" "del" "0" "00002" "CFTR_000001" "g.117199646_117199648del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117559592_117559594del" "" "VUS" "" "0000001225" "0" "50" "7" "117199646" "117199648" "del" "0" "00002" "CFTR_000001" "g.117199646_117199648del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117559592_117559594del" "" "VUS" "" "0000001226" "0" "50" "7" "117199646" "117199648" "del" "0" "00002" "CFTR_000001" "g.117199646_117199648del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117559592_117559594del" "" "VUS" "" "0000001227" "0" "50" "7" "117199644" "117199646" "del" "0" "00002" "CFTR_000017" "g.117199644_117199646del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117559590_117559592del" "" "VUS" "" "0000001228" "0" "50" "7" "117232272" "117232273" "del" "0" "00002" "CFTR_001005" "g.117232272_117232273del" "" "" "" "chr7:g.117019508_117019509delAA" "" "Unknown" "" "" "0" "" "" "g.117592218_117592219del" "" "VUS" "" "0000001229" "0" "50" "7" "117282547" "117282547" "dup" "0" "00002" "CFTR_000030" "g.117282547dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117642493dup" "" "VUS" "" "0000001230" "0" "50" "7" "117171029" "117171029" "subst" "0.00147328" "00002" "CFTR_000006" "g.117171029G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117530975G>A" "" "VUS" "" "0000001231" "3" "50" "7" "117227832" "117227832" "subst" "0.000358192" "00002" "CFTR_000002" "g.117227832G>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117587778G>T" "" "VUS" "" "0000001232" "0" "50" "7" "117180284" "117180284" "subst" "6.09796E-5" "00002" "CFTR_000026" "g.117180284C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117540230C>T" "" "VUS" "" "0000001237" "0" "50" "7" "117251703" "117251703" "subst" "4.88301E-5" "00002" "CFTR_000124" "g.117251703C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117611649C>T" "" "VUS" "" "0000001238" "0" "50" "7" "117180285" "117180285" "subst" "0.000117891" "00002" "CFTR_001014" "g.117180285G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117540231G>A" "" "VUS" "" "0000001239" "0" "50" "7" "117180338" "117180338" "subst" "0.000418904" "00002" "CFTR_001015" "g.117180338C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117540284C>T" "" "VUS" "" "0000001240" "0" "50" "7" "117138367" "117159446" "del" "0" "00002" "CFTR_000014" "g.117138367_117159446del" "" "" "" "INTRON 1_3, 21,080 BP DEL" "" "Unknown" "" "" "0" "" "" "g.117498313_117519392del" "" "VUS" "" "0000001241" "0" "50" "7" "117227874" "117227874" "subst" "0.00342536" "00002" "CFTR_001017" "g.117227874A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117587820A>G" "" "VUS" "" "0000001242" "0" "50" "7" "117227874" "117227874" "subst" "0.00342536" "00002" "CFTR_001017" "g.117227874A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117587820A>G" "" "VUS" "" "0000001243" "0" "50" "7" "117227874" "117227874" "subst" "0.00342536" "00002" "CFTR_001017" "g.117227874A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117587820A>G" "" "VUS" "" "0000001244" "0" "50" "7" "117232223" "117232223" "subst" "0.00594922" "00002" "CFTR_000059" "g.117232223C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117592169C>T" "" "VUS" "" "0000001245" "0" "50" "7" "117232223" "117232223" "subst" "0.00594922" "00002" "CFTR_000059" "g.117232223C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117592169C>T" "" "VUS" "" "0000001246" "0" "50" "7" "117232223" "117232223" "subst" "0.00594922" "00002" "CFTR_000059" "g.117232223C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117592169C>T" "" "VUS" "" "0000018069" "0" "99" "7" "117180401" "117180401" "subst" "4.07608E-6" "00006" "CFTR_000121" "g.117180401G>A" "28/142036 chromosomes CFTR" "copy received from copy received from {DB:CFTR2}-121" "" "1248+1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508158" "0" "" "" "g.117540347G>A" "" "pathogenic (recessive)" "" "0000018272" "0" "99" "7" "117199646" "117199648" "del" "0" "00086" "CFTR_000001" "g.117199646_117199648del" "99061/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-1" "" "F508del, c.1521_1523delCTT" "see the CFTR2 database for details" "SUMMARY record" "" "rs113993960" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000018273" "0" "99" "7" "117227832" "117227832" "subst" "0.000358192" "00086" "CFTR_000002" "g.117227832G>T" "3610/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-2" "" "G542X" "see the CFTR2 database for details" "SUMMARY record" "" "rs113993959" "0" "" "" "g.117587778G>T" "" "pathogenic (recessive)" "" "0000018274" "0" "99" "7" "117227860" "117227860" "subst" "0.00017913" "00086" "CFTR_000003" "g.117227860G>A" "2986/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-3" "" "G551D" "see the CFTR2 database for details" "SUMMARY record" "" "rs75527207" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000018275" "0" "99" "7" "117292931" "117292931" "subst" "0.000139103" "00086" "CFTR_000004" "g.117292931C>G" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-4" "" "N1303K" "see the CFTR2 database for details" "SUMMARY record" "" "rs80034486" "0" "" "" "g.117652877C>G" "" "pathogenic (recessive)" "" "0000018276" "0" "99" "7" "117282620" "117282620" "subst" "0.0004396" "00086" "CFTR_000005" "g.117282620G>A" "1726/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-5" "" "W1282X" "see the CFTR2 database for details" "SUMMARY record" "" "rs77010898" "0" "" "" "g.117642566G>A" "" "pathogenic (recessive)" "" "0000018277" "0" "99" "7" "117171029" "117171029" "subst" "0.00147328" "00086" "CFTR_000006" "g.117171029G>A" "1854/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-6" "" "R117H" "see the CFTR2 database for details; classification recently changed, varying clinical consequence" "SUMMARY record" "" "rs78655421" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000018278" "0" "99" "7" "117227865" "117227865" "subst" "7.33E-5" "00086" "CFTR_000007" "g.117227865C>T" "1323/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-7" "" "R553X" "see the CFTR2 database for details" "SUMMARY record" "" "rs74597325" "0" "" "" "g.117587811C>T" "" "pathogenic (recessive)" "" "0000018279" "0" "99" "7" "117227792" "117227792" "subst" "8.54965E-5" "00086" "CFTR_000008" "g.117227792G>A" "1216/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-8" "" "1717-1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs76713772" "0" "" "" "g.117587738G>A" "" "pathogenic (recessive)" "" "0000018280" "0" "99" "7" "117171169" "117171169" "subst" "8.314E-5" "00086" "CFTR_000009" "g.117171169G>T" "1323/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-9" "" "621+1G->T" "see the CFTR2 database for details" "SUMMARY record" "" "rs78756941" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000018281" "0" "99" "7" "117242922" "117242922" "subst" "7.30953E-5" "00086" "CFTR_000010" "g.117242922G>A" "1027/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-10" "" "2789+5G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs80224560" "0" "" "" "g.117602868G>A" "" "pathogenic (recessive)" "" "0000018283" "0" "99" "7" "117267591" "117267591" "subst" "5.29799E-5" "00086" "CFTR_000012" "g.117267591C>T" "651/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-12" "" "R1162X" "see the CFTR2 database for details" "SUMMARY record" "" "rs74767530" "0" "" "" "g.117627537C>T" "" "pathogenic (recessive)" "" "0000018284" "0" "99" "7" "117232272" "117232273" "ins" "0" "00086" "CFTR_000013" "g.117232272_117232273delinsG" "542/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-13, -38" "" "2183AA->G or 2183delAA->G" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908799" "0" "" "" "g.117592218_117592219delinsG" "" "pathogenic (recessive)" "" "0000018285" "0" "99" "7" "117138367" "117159446" "del" "0" "00086" "CFTR_000014" "g.117138367_117159446del" "417/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-14" "" "CFTRdele2,3" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "g.117498313_117519392del" "" "pathogenic (recessive)" "" "0000018286" "0" "99" "7" "117149177" "117149177" "subst" "4.47839E-5" "00086" "CFTR_000015" "g.117149177G>A" "616/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-15" "" "G85E" "see the CFTR2 database for details" "SUMMARY record" "" "rs75961395" "0" "" "" "g.117509123G>A" "" "pathogenic (recessive)" "" "0000018287" "0" "99" "7" "117246808" "117246808" "subst" "9.76388E-5" "00086" "CFTR_000016" "g.117246808G>A" "501/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-16" "" "3120+1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs75096551" "0" "" "" "g.117606754G>A" "" "pathogenic (recessive)" "" "0000018288" "0" "99" "7" "117199644" "117199646" "del" "0" "00086" "CFTR_000017" "g.117199644_117199646del" "651/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-17" "" "I507del, c.1519_1521delATC" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908745" "0" "" "" "g.117559590_117559592del" "" "pathogenic (recessive)" "" "0000018289" "0" "99" "7" "117230494" "117230494" "subst" "3.27166E-5" "00086" "CFTR_000018" "g.117230494G>A" "421/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-18" "" "1898+1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908748" "0" "" "" "g.117590440G>A" "" "pathogenic (recessive)" "" "0000018290" "0" "99" "7" "117267635" "117267635" "del" "0" "00086" "CFTR_000019" "g.117267635del" "539/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-19" "" "3659delC" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908747" "0" "" "" "g.117627581del" "" "pathogenic (recessive)" "" "0000018291" "0" "99" "7" "117180324" "117180324" "subst" "2.44035E-5" "00086" "CFTR_000020" "g.117180324G>C" "533/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-20" "" "R347P" "see the CFTR2 database for details" "SUMMARY record" "" "rs77932196" "0" "" "" "g.117540270G>C" "" "pathogenic (recessive)" "" "0000018292" "0" "99" "7" "117254753" "117254753" "subst" "0.00040703" "00086" "CFTR_000021" "g.117254753G>C" "571/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-21; variable clinical consequences" "" "D1152H" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs75541969" "0" "" "" "g.117614699G>C" "" "pathogenic (!)" "" "0000018293" "0" "99" "7" "117227887" "117227887" "subst" "2.03832E-5" "00086" "CFTR_000022" "g.117227887G>C" "343/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-22" "" "R560T" "see the CFTR2 database for details" "SUMMARY record" "" "rs80055610" "0" "" "" "g.117587833G>C" "" "pathogenic (recessive)" "" "0000018294" "0" "99" "7" "117251609" "117251609" "subst" "4.31727E-5" "00086" "CFTR_000023" "g.117251609A>G" "470/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-23" "" "3272-26A->G" "see the CFTR2 database for details" "SUMMARY record" "" "rs76151804" "0" "" "" "g.117611555A>G" "" "pathogenic (recessive)" "" "0000018295" "0" "99" "7" "117199602" "117199602" "subst" "2.03178E-5" "00086" "CFTR_000024" "g.117199602C>T" "292/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-24" "" "Q493X" "see the CFTR2 database for details" "SUMMARY record" "" "rs77101217" "0" "" "" "g.117559548C>T" "" "pathogenic (recessive)" "" "0000018296" "0" "99" "7" "117149101" "117149101" "subst" "2.44296E-5" "00086" "CFTR_000025" "g.117149101G>T" "296/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-25" "" "E60X" "see the CFTR2 database for details" "SUMMARY record" "" "rs77284892" "0" "" "" "g.117509047G>T" "" "pathogenic (recessive)" "" "0000018297" "0" "99" "7" "117180284" "117180284" "subst" "6.09796E-5" "00086" "CFTR_000026" "g.117180284C>T" "429/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-26" "" "R334W" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909011" "0" "" "" "g.117540230C>T" "" "pathogenic (recessive)" "" "0000018298" "0" "99" "7" "117149185" "117149186" "del" "0" "00086" "CFTR_000027" "g.117149185_117149186del" "307/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-27" "" "394delTT" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908769" "0" "" "" "g.117509131_117509132del" "" "pathogenic (recessive)" "" "0000018299" "0" "99" "7" "117232273" "117232273" "dup" "0" "00086" "CFTR_000028" "g.117232273dup" "329/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-28" "" "2184insA" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908786" "0" "" "" "g.117592219dup" "" "pathogenic (recessive)" "" "0000018300" "0" "77" "7" "117188688" "117188689" "del" "0" "00086" "CFTR_000029" "g.117188688_117188689del" "516/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-29" "" "5T, 1210-12T[5]" "see the CFTR2 database for details; varying clinical consequences" "SUMMARY record" "" "rs1805177" "0" "" "" "g.117548634_117548635del" "" "likely pathogenic (!)" "" "0000018301" "0" "99" "7" "117282547" "117282547" "dup" "0" "00086" "CFTR_000030" "g.117282547dup" "210/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-30" "" "3905insT" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908789" "0" "" "" "g.117642493dup" "" "pathogenic (recessive)" "" "0000018302" "0" "99" "7" "117251771" "117251771" "subst" "1.2199E-5" "00086" "CFTR_000031" "g.117251771C>A" "225/142036 chromosomes CFTR (3276C>A^G)" "copy received from {DB:CFTR2}-31" "" "Y1092X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908761" "0" "" "" "g.117611717C>A" "" "pathogenic (recessive)" "" "0000018303" "0" "99" "7" "117188849" "117188849" "subst" "0" "00086" "CFTR_000032" "g.117188849C>A" "500/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-32" "" "A455E" "see the CFTR2 database for details" "SUMMARY record" "" "rs74551128" "0" "" "" "g.117548795C>A" "" "pathogenic (recessive)" "" "0000018304" "0" "99" "7" "117232273" "117232273" "del" "0" "00086" "CFTR_000033" "g.117232273del" "255/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-33" "" "2184delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908746" "0" "" "" "g.117592219del" "" "pathogenic (recessive)" "" "0000018305" "0" "99" "7" "117251691" "117251691" "subst" "3.66345E-5" "00086" "CFTR_000034" "g.117251691C>T" "220/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-34" "" "R1066C" "see the CFTR2 database for details" "SUMMARY record" "" "rs78194216" "0" "" "" "g.117611637C>T" "" "pathogenic (recessive)" "" "0000018306" "0" "99" "7" "117180232" "117180232" "del" "0" "00086" "CFTR_000035" "g.117180232del" "184/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-35" "" "1078delT" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908744" "0" "" "" "g.117540178del" "" "pathogenic (recessive)" "" "0000018307" "0" "99" "7" "117180305" "117180306" "dup" "0" "00086" "CFTR_000036" "g.117180305_117180306dup" "214/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-36" "" "1154insTC" "see the CFTR2 database for details" "SUMMARY record" "" "rs387906360" "0" "" "" "g.117540251_117540252dup" "" "pathogenic (recessive)" "" "0000018308" "0" "99" "7" "117267579" "117267579" "subst" "3.26216E-5" "00086" "CFTR_000037" "g.117267579C>T" "179/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-37" "" "R1158X" "see the CFTR2 database for details" "SUMMARY record" "" "rs79850223" "0" "" "" "g.117627525C>T" "" "pathogenic (recessive)" "" "0000018310" "0" "99" "7" "117180324" "117180324" "subst" "2.44035E-5" "00086" "CFTR_000039" "g.117180324G>A" "199/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-39" "" "R347H" "see the CFTR2 database for details" "SUMMARY record" "" "rs77932196" "0" "" "" "g.117540270G>A" "" "pathogenic (recessive)" "" "0000018311" "0" "99" "7" "117282526" "117282526" "subst" "8.13603E-6" "00086" "CFTR_000040" "g.117282526G>A" "120/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-40" "" "S1251N" "see the CFTR2 database for details" "SUMMARY record" "" "rs74503330" "0" "" "" "g.117642472G>A" "" "pathogenic (recessive)" "" "0000018312" "0" "99" "7" "117175339" "117175339" "subst" "0.000190896" "00086" "CFTR_000041" "g.117175339T>G" "333/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-41" "" "L206W" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908752" "0" "" "" "g.117535285T>G" "" "pathogenic (recessive)" "" "0000018313" "0" "99" "7" "117227854" "117227854" "subst" "8.14067E-5" "00086" "CFTR_000042" "g.117227854G>A" "203/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-42" "" "S549N" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908755" "0" "" "" "g.117587800G>A" "" "pathogenic (recessive)" "" "0000018314" "0" "99" "7" "117251797" "117251797" "subst" "1.6268E-5" "00086" "CFTR_000043" "g.117251797T>A" "238/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-43" "" "M1101K" "see the CFTR2 database for details" "SUMMARY record" "" "rs36210737" "0" "" "" "g.117611743T>A" "" "pathogenic (recessive)" "" "0000018315" "0" "99" "7" "117174420" "117174420" "subst" "4.08373E-5" "00086" "CFTR_000044" "g.117174420G>T" "274/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-44" "" "711+1G->T" "see the CFTR2 database for details" "SUMMARY record" "" "rs77188391" "0" "" "" "g.117534366G>T" "" "pathogenic (recessive)" "" "0000018316" "0" "99" "7" "117171045" "117171045" "subst" "0" "00086" "CFTR_000045" "g.117171045T>A" "88/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-45" "" "Y122X" "see the CFTR2 database for details" "SUMMARY record" "" "rs79660178" "0" "" "" "g.117530991T>A" "" "pathogenic (recessive)" "" "0000018317" "0" "99" "7" "117232233" "117232233" "del" "0" "00086" "CFTR_000046" "g.117232233del" "96/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-46" "" "2143delT" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908812" "0" "" "" "g.117592179del" "" "pathogenic (recessive)" "" "0000018318" "0" "99" "7" "117243762" "117243762" "subst" "7.71824E-5" "00086" "CFTR_000047" "g.117243762C>T" "167/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-47" "" "S945L" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508442" "0" "" "" "g.117603708C>T" "" "pathogenic (recessive)" "" "0000018319" "0" "11" "7" "117171122" "117171122" "subst" "0.00180589" "00086" "CFTR_000048" "g.117171122T>C" "148/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-48" "" "I148T" "see the CFTR2 database for details" "SUMMARY record" "" "rs35516286" "0" "" "" "g.117531068T>C" "" "benign" "" "0000018320" "0" "99" "7" "117171028" "117171028" "subst" "0.00021164" "00086" "CFTR_000049" "g.117171028C>T" "146/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-49" "" "R117C" "see the CFTR2 database for details" "SUMMARY record" "" "rs77834169" "0" "" "" "g.117530974C>T" "" "pathogenic (recessive)" "" "0000018321" "0" "99" "7" "117199683" "117199683" "subst" "4.06673E-6" "00086" "CFTR_000050" "g.117199683G>T" "156/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-50" "" "V520F" "see the CFTR2 database for details" "SUMMARY record" "" "rs77646904" "0" "" "" "g.117559629G>T" "" "pathogenic (recessive)" "" "0000018322" "0" "11" "7" "117267812" "117267812" "subst" "0.00492072" "00086" "CFTR_000051" "g.117267812T>G" "108/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-51" "" "S1235R" "see the CFTR2 database for details" "SUMMARY record" "" "rs34911792" "0" "" "" "g.117627758T>G" "" "benign" "" "0000018323" "0" "99" "7" "117180297" "117180297" "subst" "2.43893E-5" "00086" "CFTR_000052" "g.117180297C>T" "52/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-52" "" "T338I" "see the CFTR2 database for details" "SUMMARY record" "" "rs77409459" "0" "" "" "g.117540243C>T" "" "pathogenic (recessive)" "" "0000018324" "0" "99" "7" "117149123" "117149123" "subst" "3.25529E-5" "00086" "CFTR_000053" "g.117149123C>T" "239/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-53" "" "P67L" "see the CFTR2 database for details" "SUMMARY record" "" "rs368505753" "0" "" "" "g.117509069C>T" "" "pathogenic (recessive)" "" "0000018325" "0" "99" "7" "117282505" "117282505" "subst" "8.13862E-6" "00086" "CFTR_000054" "g.117282505G>A" "106/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-54" "" "G1244E" "see the CFTR2 database for details" "SUMMARY record" "" "rs267606723" "0" "" "" "g.117642451G>A" "" "pathogenic (recessive)" "" "0000018326" "0" "99" "7" "117174372" "117174372" "subst" "1.22207E-5" "00086" "CFTR_000055" "g.117174372G>A" "87/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-55" "" "G178R" "see the CFTR2 database for details" "SUMMARY record" "" "rs80282562" "0" "" "" "g.117534318G>A" "" "pathogenic (recessive)" "" "0000018327" "0" "99" "7" "117199670" "117199671" "del" "0" "00086" "CFTR_000056" "g.117199670_117199671del" "131/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-56" "" "1677delTA" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908776" "0" "" "" "g.117559616_117559617del" "" "pathogenic (recessive)" "" "0000018328" "0" "99" "7" "117180339" "117180339" "subst" "2.44027E-5" "00086" "CFTR_000057" "g.117180339G>A" "101/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-57" "" "R352Q" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908753" "0" "" "" "g.117540285G>A" "" "pathogenic (recessive)" "" "0000018329" "0" "99" "7" "117174424" "117174424" "subst" "0" "00086" "CFTR_000058" "g.117174424G>A" "60/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-58" "" "711+5G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs78440224" "0" "" "" "g.117534370G>A" "" "pathogenic (recessive)" "" "0000018330" "0" "11" "7" "117232223" "117232223" "subst" "0.00594922" "00086" "CFTR_000059" "g.117232223C>T" "68/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-59" "" "R668C" "see the CFTR2 database for details" "SUMMARY record" "" "rs1800100" "0" "" "" "g.117592169C>T" "" "benign" "" "0000018331" "0" "99" "7" "117227853" "117227853" "subst" "4.07024E-6" "00086" "CFTR_000060" "g.117227853A>C" "93/142036 chromosomes CFTR (1645A>C^1647T>G)" "copy received from {DB:CFTR2}-60" "" "S549R" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908757" "0" "" "" "g.117587799A>C" "" "pathogenic (recessive)" "" "0000018332" "0" "99" "7" "117227883" "117227883" "subst" "2.03779E-5" "00086" "CFTR_000061" "g.117227883G>A" "91/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-61" "" "A559T" "see the CFTR2 database for details" "SUMMARY record" "" "rs75549581" "0" "" "" "g.117587829G>A" "" "pathogenic (recessive)" "" "0000018333" "0" "99" "7" "117251725" "117251725" "subst" "4.06719E-6" "00086" "CFTR_000062" "g.117251725T>C" "96/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-62" "" "L1077P" "see the CFTR2 database for details" "SUMMARY record" "" "rs139304906" "0" "" "" "g.117611671T>C" "" "pathogenic (recessive)" "" "0000018334" "0" "99" "7" "117251761" "117251761" "subst" "2.44002E-5" "00086" "CFTR_000063" "g.117251761G>A" "68/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-63" "" "W1089X" "see the CFTR2 database for details" "SUMMARY record" "" "rs78802634" "0" "" "" "g.117611707G>A" "" "pathogenic (recessive)" "" "0000018335" "0" "11" "7" "117250664" "117250664" "subst" "0.000252205" "00086" "CFTR_000064" "g.117250664T>C" "94/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-64" "" "I1027T" "see the CFTR2 database for details" "SUMMARY record" "" "rs1800112" "0" "" "" "g.117610610T>C" "" "benign" "" "0000018336" "0" "11" "7" "117230454" "117230454" "subst" "0.00503416" "00086" "CFTR_000065" "g.117230454G>C" "74/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-65" "" "G576A" "see the CFTR2 database for details" "SUMMARY record" "" "rs1800098" "0" "" "" "g.117590400G>C" "" "benign" "" "0000018337" "0" "11" "7" "117199533" "117199533" "subst" "0" "00086" "CFTR_000066" "g.117199533A>G" "235/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-66" "" "M470V" "see the CFTR2 database for details\r\nVariant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "SUMMARY record" "" "rs213950" "0" "" "" "g.117559479A>G" "" "benign" "" "0000018338" "0" "99" "7" "117246807" "117246807" "subst" "4.06812E-6" "00086" "CFTR_000067" "g.117246807G>A" "85/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-67" "" "3120G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908797" "0" "" "" "g.117606753G>A" "" "pathogenic (recessive)" "" "0000018339" "0" "99" "7" "117149146" "117149146" "subst" "2.44182E-5" "00086" "CFTR_000068" "g.117149146C>T" "92/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-68" "" "R75X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908749" "0" "" "" "g.117509092C>T" "" "pathogenic (recessive)" "" "0000018340" "0" "99" "7" "117235030" "117235030" "subst" "0" "00086" "CFTR_000069" "g.117235030G>A" "56/142036 chromosomes CFTR (2537^2538G>A)" "copy received from {DB:CFTR2}-69" "" "W846X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508393" "0" "" "" "g.117594976G>A" "" "pathogenic (recessive)" "" "0000018341" "0" "99" "7" "117230480" "117230480" "subst" "2.042E-5" "00086" "CFTR_000070" "g.117230480G>T" "110/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-70" "" "E585X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508296" "0" "" "" "g.117590426G>T" "" "pathogenic (recessive)" "" "0000018342" "0" "99" "7" "117229530" "117229530" "subst" "0" "00086" "CFTR_000071" "g.117229530G>T" "26/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-71" "" "1811+1643G->T" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs397508261" "0" "" "" "g.117589476G>T" "" "pathogenic (recessive)" "" "0000018343" "0" "99" "7" "117282518" "117282518" "del" "1.22085E-5" "00086" "CFTR_000072" "g.117282518del" "91/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-72" "" "3876delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908784" "0" "" "" "g.117642464del" "" "pathogenic (recessive)" "" "0000018344" "0" "99" "7" "117282582" "117282582" "subst" "0.00119238" "00086" "CFTR_000073" "g.117282582G>A" "55/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-73; variable clinical consequences" "" "D1270N" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs11971167" "0" "" "" "g.117642528G>A" "" "pathogenic (!)" "" "0000018345" "0" "99" "7" "117175380" "117175380" "subst" "4.06174E-6" "00086" "CFTR_000074" "g.117175380C>T" "71/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-74" "" "Q220X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508778" "0" "" "" "g.117535326C>T" "" "pathogenic (recessive)" "" "0000018346" "0" "99" "7" "117232396" "117232396" "dup" "0" "00086" "CFTR_000075" "g.117232396dup" "62/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-75" "" "2307insA" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908787" "0" "" "" "g.117592342dup" "" "pathogenic (recessive)" "" "0000018347" "0" "99" "7" "117171007" "117171007" "subst" "2.03366E-5" "00086" "CFTR_000076" "g.117171007G>C" "65/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-76" "" "D110H" "see the CFTR2 database for details" "SUMMARY record" "" "rs113993958" "0" "" "" "g.117530953G>C" "" "pathogenic (recessive)" "" "0000018348" "0" "99" "7" "117292911" "117292911" "dup" "0" "00086" "CFTR_000077" "g.117292911dup" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-77" "" "4016insT" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908808" "0" "" "" "g.117652857dup" "" "pathogenic (recessive)" "" "0000018349" "0" "99" "7" "117306970" "117306970" "del" "0" "00086" "CFTR_000078" "g.117306970del" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-78" "" "4382delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508706" "0" "" "" "g.117666916del" "" "pathogenic (recessive)" "" "0000018350" "0" "99" "7" "117180291" "117180291" "subst" "4.06497E-6" "00086" "CFTR_000079" "g.117180291T>A" "55/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-79" "" "I336K" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508139" "0" "" "" "g.117540237T>A" "" "pathogenic (recessive)" "" "0000018351" "0" "99" "7" "117251692" "117251692" "subst" "3.25632E-5" "00086" "CFTR_000080" "g.117251692G>A" "100/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-80" "" "R1066H" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909019" "0" "" "" "g.117611638G>A" "" "pathogenic (recessive)" "" "0000018352" "0" "99" "7" "117232436" "117232436" "del" "4.06372E-6" "00086" "CFTR_000081" "g.117232436del" "40/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-81" "" "2347delG" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508353" "0" "" "" "g.117592382del" "" "pathogenic (recessive)" "" "0000018353" "0" "11" "7" "117250575" "117250575" "subst" "0.0022857" "00086" "CFTR_000082" "g.117250575G>C" "110/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-82" "" "L997F" "see the CFTR2 database for details" "SUMMARY record" "" "rs1800111" "0" "" "" "g.117610521G>C" "" "benign" "" "0000018354" "0" "99" "7" "117232349" "117232349" "subst" "0" "00086" "CFTR_000083" "g.117232349A>T" "50/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-83" "" "K710X" "see the CFTR2 database for details" "SUMMARY record" "" "rs75115087" "0" "" "" "g.117592295A>T" "" "pathogenic (recessive)" "" "0000018355" "0" "99" "7" "117232685" "117232685" "subst" "5.34891E-6" "00086" "CFTR_000084" "g.117232685G>T" "21/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-84" "" "E822X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508378" "0" "" "" "g.117592631G>T" "" "pathogenic (recessive)" "" "0000018356" "0" "99" "7" "117251689" "117251689" "subst" "0" "00086" "CFTR_000085" "g.117251689T>C" "43/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-85" "" "L1065P" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909036" "0" "" "" "g.117611635T>C" "" "pathogenic (recessive)" "" "0000018357" "0" "99" "7" "117227862" "117227862" "subst" "0" "00086" "CFTR_000086" "g.117227862C>T" "36/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-86" "" "Q552X" "see the CFTR2 database for details" "SUMMARY record" "" "rs76554633" "0" "" "" "g.117587808C>T" "" "pathogenic (recessive)" "" "0000018358" "0" "99" "7" "117149143" "117149143" "subst" "0.00142434" "00086" "CFTR_000087" "g.117149143C>T" "36/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-87; variable clinical consequences" "" "R74W" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs115545701" "0" "" "" "g.117509089C>T" "" "pathogenic (!)" "" "0000018359" "0" "99" "7" "117232712" "117232712" "subst" "1.06806E-5" "00086" "CFTR_000088" "g.117232712G>A" "85/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-88" "" "2622+1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs141158996" "0" "" "" "g.117592658G>A" "" "pathogenic (recessive)" "" "0000018360" "0" "55" "7" "117242919" "117242920" "ins" "5.27923E-5" "00086" "CFTR_000089" "g.117242919_117242920insA" "84/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-89" "" "2789+2insA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508414" "0" "" "" "g.117602865_117602866insA" "" "VUS" "" "0000018361" "0" "99" "7" "117170953" "117170953" "subst" "4.07219E-6" "00086" "CFTR_000090" "g.117170953G>T" "38/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-90" "" "E92X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908751" "0" "" "" "g.117530899G>T" "" "pathogenic (recessive)" "" "0000018362" "0" "99" "7" "117144368" "117144368" "subst" "0" "00086" "CFTR_000091" "g.117144368C>T" "47/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-91" "" "Q39X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508168" "0" "" "" "g.117504314C>T" "" "pathogenic (recessive)" "" "0000018363" "0" "11" "7" "117149147" "117149147" "subst" "0.0153305" "00086" "CFTR_000092" "g.117149147G>A" "71/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-92" "" "R75Q" "see the CFTR2 database for details" "SUMMARY record" "" "rs1800076" "0" "" "" "g.117509093G>A" "" "benign" "" "0000018364" "0" "99" "7" "117230463" "117230463" "subst" "4.07697E-6" "00086" "CFTR_000093" "g.117230463A>G" "53/142036 chromosomes CFTR" "copy received from {DB:CFTR2}; variable clinical consequences" "" "D579G" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508288" "0" "" "" "g.117590409A>G" "" "pathogenic (!)" "" "0000018365" "0" "99" "7" "117234984" "117234984" "subst" "2.43829E-5" "00086" "CFTR_000094" "g.117234984G>T" "30/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-94" "" "E831X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508387" "0" "" "" "g.117594930G>T" "" "pathogenic (recessive)" "" "0000018366" "0" "99" "7" "117243803" "117243803" "del" "4.06309E-6" "00086" "CFTR_000095" "g.117243803del" "40/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-95" "" "3007delG" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508447" "0" "" "" "g.117603749del" "" "pathogenic (recessive)" "" "0000018367" "0" "99" "7" "117149197" "117149197" "subst" "4.07704E-6" "00086" "CFTR_000096" "g.117149197G>A" "39/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-96" "" "405+1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908791" "0" "" "" "g.117509143G>A" "" "pathogenic (recessive)" "" "0000018368" "0" "99" "7" "117170952" "117170952" "subst" "1.63001E-5" "00086" "CFTR_000097" "g.117170952G>A" "40/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-97" "" "406-1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908792" "0" "" "" "g.117530898G>A" "" "pathogenic (recessive)" "" "0000018369" "0" "99" "7" "117174422" "117174422" "subst" "1.63335E-5" "00086" "CFTR_000098" "g.117174422A>G" "63/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-98" "" "711+3A->G" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508761" "0" "" "" "g.117534368A>G" "" "pathogenic (recessive)" "" "0000018370" "0" "99" "7" "117292959" "117292959" "subst" "0" "00086" "CFTR_000099" "g.117292959C>T" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-99" "" "Q1313X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909026" "0" "" "" "g.117652905C>T" "" "pathogenic (recessive)" "" "0000018371" "0" "99" "7" "117232346" "117232346" "subst" "1.62755E-5" "00086" "CFTR_000100" "g.117232346C>T" "63/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-100" "" "R709X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908760" "0" "" "" "g.117592292C>T" "" "pathogenic (recessive)" "" "0000018372" "0" "99" "7" "117235076" "117235076" "del" "0" "00086" "CFTR_000101" "g.117235076del" "35/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-101" "" "2711delT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508399" "0" "" "" "g.117595022del" "" "pathogenic (recessive)" "" "0000018373" "0" "99" "7" "117282648" "117282648" "subst" "0" "00086" "CFTR_000102" "g.117282648G>A" "21/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-102" "" "4005+1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs143570767" "0" "" "" "g.117642594G>A" "" "pathogenic (recessive)" "" "0000018374" "0" "99" "7" "117171121" "117171121" "del" "0" "00086" "CFTR_000103" "g.117171121del" "27/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-103" "" "574delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908770" "0" "" "" "g.117531067del" "" "pathogenic (recessive)" "" "0000018375" "0" "99" "7" "117199517" "117199517" "subst" "3.25264E-5" "00086" "CFTR_000104" "g.117199517G>A" "72/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-104" "" "1525-1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508200" "0" "" "" "g.117559463G>A" "" "pathogenic (recessive)" "" "0000018376" "0" "99" "7" "117230406" "117230406" "subst" "4.07787E-6" "00086" "CFTR_000105" "g.117230406G>A" "32/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-105" "" "1812-1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908794" "0" "" "" "g.117590352G>A" "" "pathogenic (recessive)" "" "0000018377" "0" "99" "7" "117267807" "117267807" "subst" "4.10691E-6" "00086" "CFTR_000106" "g.117267807A>G" "33/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-106" "" "I1234V" "see the CFTR2 database for details" "SUMMARY record" "" "rs75389940" "0" "" "" "g.117627753A>G" "" "pathogenic (recessive)" "" "0000018378" "0" "99" "7" "117251704" "117251704" "subst" "0.000622665" "00086" "CFTR_000107" "g.117251704G>A" "21/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-107" "" "R1070Q" "see the CFTR2 database for details; variable clinical consequences" "SUMMARY record" "" "rs78769542" "0" "" "" "g.117611650G>A" "" "pathogenic (!)" "" "0000018379" "0" "99" "7" "117199522" "117199522" "subst" "0" "00086" "CFTR_000108" "g.117199522C>A" "45/142036 chromosomes CFTR (1397C>A^G)" "copy received from {DB:CFTR2}-108" "" "S466X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908805" "0" "" "" "g.117559468C>A" "" "pathogenic (recessive)" "" "0000018380" "0" "99" "7" "117199591" "117199591" "subst" "4.06329E-6" "00086" "CFTR_000109" "g.117199591C>A" "58/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-109" "" "S489X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508211" "0" "" "" "g.117559537C>A" "" "pathogenic (recessive)" "" "0000018381" "0" "99" "7" "117199525" "117199525" "subst" "8.12935E-6" "00086" "CFTR_000110" "g.117199525T>C" "38/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-110" "" "L467P" "see the CFTR2 database for details" "SUMMARY record" "" "rs139573311" "0" "" "" "g.117559471T>C" "" "pathogenic (recessive)" "" "0000018382" "0" "99" "7" "117199600" "117199600" "subst" "8.12678E-6" "00086" "CFTR_000111" "g.117199600C>T" "24/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-111" "" "S492F" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909017" "0" "" "" "g.117559546C>T" "" "pathogenic (recessive)" "" "0000018383" "0" "99" "7" "117267766" "117267766" "del" "4.0832E-6" "00086" "CFTR_000112" "g.117267766del" "20/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-112" "" "3791delC" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908811" "0" "" "" "g.117627712del" "" "pathogenic (recessive)" "" "0000018384" "0" "99" "7" "117243708" "117243708" "subst" "0" "00086" "CFTR_000113" "g.117243708T>C" "31/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-113" "" "L927P" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508435" "0" "" "" "g.117603654T>C" "" "pathogenic (recessive)" "" "0000018385" "0" "99" "7" "117175301" "117175301" "subst" "4.06187E-6" "00086" "CFTR_000114" "g.117175301G>T" "42/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-114" "" "712-1G->T" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908793" "0" "" "" "g.117535247G>T" "" "pathogenic (recessive)" "" "0000018386" "0" "99" "7" "117170953" "117170953" "subst" "0" "00086" "CFTR_000115" "g.117170953G>A" "49/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-115" "" "E92K" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908751" "0" "" "" "g.117530899G>A" "" "pathogenic (recessive)" "" "0000018389" "0" "99" "7" "117243596" "117243596" "subst" "0" "00086" "CFTR_000117" "g.117243596C>T" "46/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-117" "" "Q890X" "see the CFTR2 database for details" "SUMMARY record" "" "rs79633941" "0" "" "" "g.117603542C>T" "" "pathogenic (recessive)" "" "0000018390" "0" "99" "7" "117232511" "117232511" "subst" "4.52108E-6" "00086" "CFTR_000118" "g.117232511C>T" "31/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-118" "" "R764X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908810" "0" "" "" "g.117592457C>T" "" "pathogenic (recessive)" "" "0000018391" "0" "99" "7" "117267694" "117267694" "subst" "8.15641E-6" "00086" "CFTR_000119" "g.117267694C>G" "19/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-119" "" "S1196X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908763" "0" "" "" "g.117627640C>G" "" "pathogenic (recessive)" "" "0000018392" "0" "99" "7" "117182155" "117182155" "subst" "0" "00086" "CFTR_000120" "g.117182155G>A" "15/142036 chromosomes CFTR (1202^1203G>A)" "copy received from {DB:CFTR2}-120" "" "W401X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508174" "0" "" "" "g.117542101G>A" "" "pathogenic (recessive)" "" "0000018393" "0" "99" "7" "117232416" "117232416" "subst" "4.06296E-6" "00086" "CFTR_000122" "g.117232416T>G" "33/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-122" "" "L732X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508350" "0" "" "" "g.117592362T>G" "" "pathogenic (recessive)" "" "0000018394" "0" "99" "7" "117170971" "117170971" "subst" "8.13656E-6" "00086" "CFTR_000123" "g.117170971C>T" "23/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-123" "" "Q98X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508461" "0" "" "" "g.117530917C>T" "" "pathogenic (recessive)" "" "0000018395" "0" "99" "7" "117251703" "117251703" "subst" "4.88301E-5" "00086" "CFTR_000124" "g.117251703C>T" "36/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-124; variable clinical consequences" "" "R1070W" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs202179988" "0" "" "" "g.117611649C>T" "" "pathogenic (!)" "" "0000018396" "0" "11" "7" "117144344" "117144344" "subst" "0.00165252" "00086" "CFTR_000125" "g.117144344C>T" "23/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-125" "" "R31C" "see the CFTR2 database for details" "SUMMARY record" "" "rs1800073" "0" "" "" "g.117504290C>T" "" "benign" "" "0000018397" "0" "99" "7" "117235044" "117235044" "subst" "0" "00086" "CFTR_000126" "g.117235044C>T" "27/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-126" "" "R851X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909012" "0" "" "" "g.117594990C>T" "" "pathogenic (recessive)" "" "0000018398" "0" "99" "7" "117267718" "117267718" "subst" "0" "00086" "CFTR_000127" "g.117267718G>A" "29/142036 chromosomes CFTR (3611^3612G>A)" "copy received from {DB:CFTR2}-127" "" "W1204X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908764" "0" "" "" "g.117627664G>A" "" "pathogenic (recessive)" "" "0000018399" "0" "99" "7" "117174371" "117174371" "del" "0" "00086" "CFTR_000128" "g.117174371del" "24/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-128" "" "663delT" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908771" "0" "" "" "g.117534317del" "" "pathogenic (recessive)" "" "0000018400" "0" "99" "7" "117251649" "117251649" "subst" "0.000632194" "00086" "CFTR_000129" "g.117251649T>G" "34/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-129; variable clinical consequences" "" "F1052V" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs150212784" "0" "" "" "g.117611595T>G" "" "pathogenic (!)" "" "0000018401" "0" "99" "7" "117180272" "117180272" "subst" "0" "00086" "CFTR_000130" "g.117180272G>T" "23/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-130" "" "G330X" "see the CFTR2 database for details" "SUMMARY record" "" "rs79031340" "0" "" "" "g.117540218G>T" "" "pathogenic (recessive)" "" "0000018402" "0" "99" "7" "117175335" "117175335" "subst" "4.06187E-6" "00086" "CFTR_000131" "g.117175335C>T" "33/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-131" "" "P205S" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908803" "0" "" "" "g.117535281C>T" "" "pathogenic (recessive)" "" "0000018403" "0" "99" "7" "117182083" "117182083" "dup" "0" "00086" "CFTR_000132" "g.117182083dup" "19/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-132" "" "1259insA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508163" "0" "" "" "g.117542029dup" "" "pathogenic (recessive)" "" "0000018404" "0" "99" "7" "117232674" "117232674" "del" "0" "00086" "CFTR_000133" "g.117232674del" "23/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-133" "" "2585delT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397515498" "0" "" "" "g.117592620del" "" "pathogenic (recessive)" "" "0000018405" "0" "99" "7" "117175445" "117175466" "del" "0" "00086" "CFTR_000134" "g.117175445_117175466del" "13/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-134" "" "c.722_743delGGAGAATGATGATGAAGTACAG, 852del22" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908804" "0" "" "" "g.117535391_117535412del" "" "pathogenic (recessive)" "" "0000018406" "0" "99" "7" "117251805" "117251805" "subst" "0" "00086" "CFTR_000135" "g.117251805G>T" "23/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-135" "" "E1104X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508538" "0" "" "" "g.117611751G>T" "" "pathogenic (recessive)" "" "0000018407" "0" "99" "7" "117175317" "117175317" "subst" "0" "00086" "CFTR_000136" "g.117175317C>T" "22/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-136" "" "H199Y" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908802" "0" "" "" "g.117535263C>T" "" "pathogenic (recessive)" "" "0000018408" "0" "99" "7" "117199698" "117199698" "subst" "0" "00086" "CFTR_000137" "g.117199698C>T" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-137" "" "Q525X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508227" "0" "" "" "g.117559644C>T" "" "pathogenic (recessive)" "" "0000018409" "0" "99" "7" "117188812" "117188815" "dup" "0" "00086" "CFTR_000138" "g.117188812_117188815dup" "50/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-138" "" "1461ins4" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508189" "0" "" "" "g.117548758_117548761dup" "" "pathogenic (recessive)" "" "0000018410" "0" "99" "7" "117230496" "117230496" "subst" "0" "00086" "CFTR_000139" "g.117230496A>G" "27/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-139" "" "1898+3A->G" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508298" "0" "" "" "g.117590442A>G" "" "pathogenic (recessive)" "" "0000018411" "0" "11" "7" "117188683" "117188689" "" "0" "00086" "CFTR_000140" "g.117188683_117188689=" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-140" "" "7T, 1210-12T[7]" "see the CFTR2 database for details; no clinical consequences" "SUMMARY record" "" "rs1805177" "0" "" "" "g.117548629_117548635=" "" "benign" "" "0000018412" "0" "99" "7" "117304664" "117306195" "del" "0" "00086" "CFTR_000141" "g.117304664_117306195del" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-141" "" "CFTRdele22,23" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "g.117664610_117666141del" "" "pathogenic (recessive)" "" "0000018413" "0" "99" "7" "117232062" "117232062" "subst" "2.66525E-5" "00086" "CFTR_000142" "g.117232062A>G" "17/142036 chromosomes CFTR" "copy received from {DB:CFTR2}; variable clinical consequences" "" "D614G" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs201124247" "0" "" "" "g.117592008A>G" "" "pathogenic (!)" "" "0000018414" "0" "99" "7" "117175402" "117175402" "subst" "4.0623E-6" "00086" "CFTR_000143" "g.117175402T>G" "29/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-143" "" "L227R" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508782" "0" "" "" "g.117535348T>G" "" "pathogenic (recessive)" "" "0000018415" "0" "55" "7" "117227881" "117227881" "subst" "4.07408E-6" "00086" "CFTR_000144" "g.117227881T>C" "34/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-144" "" "L558S" "see the CFTR2 database for details" "SUMMARY record" "" "rs193922504" "0" "" "" "g.117587827T>C" "" "VUS" "" "0000018416" "0" "99" "7" "117180365" "117180365" "del" "0" "00086" "CFTR_000145" "g.117180365del" "16/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-145" "" "1213delT" "see the CFTR2 database for details" "SUMMARY record" "" "rs387906361" "0" "" "" "g.117540311del" "" "pathogenic (recessive)" "" "0000018417" "0" "99" "7" "117182163" "117182163" "subst" "0" "00086" "CFTR_000146" "g.117182163G>A" "11/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-146" "" "1341+1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508176" "0" "" "" "g.117542109G>A" "" "pathogenic (recessive)" "" "0000018418" "0" "99" "7" "117199543" "117199543" "del" "0" "00086" "CFTR_000147" "g.117199543del" "12/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-147" "" "1548delG" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508205" "0" "" "" "g.117559489del" "" "pathogenic (recessive)" "" "0000018419" "0" "99" "7" "117227785" "117227785" "subst" "0" "00086" "CFTR_000148" "g.117227785G>A" "27/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-148" "" "1717-8G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs193922503" "0" "" "" "g.117587731G>A" "" "pathogenic (recessive)" "" "0000018420" "0" "99" "7" "117250572" "117250572" "subst" "4.06712E-6" "00086" "CFTR_000149" "g.117250572G>A" "20/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-149" "" "3121-1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508470" "0" "" "" "g.117610518G>A" "" "pathogenic (recessive)" "" "0000018421" "0" "99" "7" "117304855" "117304858" "ins" "0" "00086" "CFTR_000150" "g.117304855_117304858delinsAA" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-150" "" "4209TGTT->AA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508668" "0" "" "" "g.117664801_117664804delinsAA" "" "pathogenic (recessive)" "" "0000018422" "0" "99" "7" "117171004" "117171006" "ins" "0" "00086" "CFTR_000151" "g.117171004_117171006delinsG" "25/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-151" "" "457TAT->G" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908798" "0" "" "" "g.117530950_117530952delinsG" "" "pathogenic (recessive)" "" "0000018423" "0" "99" "7" "117251700" "117251700" "subst" "0.000252334" "00086" "CFTR_000153" "g.117251700G>A" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-153; variable clinical consequences" "" "G1069R" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs200321110" "0" "" "" "g.117611646G>A" "" "pathogenic (!)" "" "0000018424" "0" "99" "7" "117243836" "117243836" "subst" "0" "00086" "CFTR_000154" "g.117243836G>C" "12/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-154" "" "G970R" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508453" "0" "" "" "g.117603782G>C" "" "pathogenic (recessive)" "" "0000018425" "0" "99" "7" "117120149" "117120149" "subst" "2.03216E-5" "00086" "CFTR_000155" "g.117120149A>G" "26/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-155" "" "M1V" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508328" "0" "" "" "g.117480095A>G" "" "pathogenic (recessive)" "" "0000018426" "0" "11" "7" "117267592" "117267592" "subst" "0.000656131" "00086" "CFTR_000156" "g.117267592G>T" "16/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-156" "" "R1162L" "see the CFTR2 database for details" "SUMMARY record" "" "rs1800120" "0" "" "" "g.117627538G>T" "" "benign" "" "0000018427" "0" "99" "7" "117227887" "117227887" "subst" "0" "00086" "CFTR_000157" "g.117227887G>A" "15/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-157" "" "R560K" "see the CFTR2 database for details" "SUMMARY record" "" "rs80055610" "0" "" "" "g.117587833G>A" "" "pathogenic (recessive)" "" "0000018428" "0" "99" "7" "117180305" "117180305" "subst" "0" "00086" "CFTR_000158" "g.117180305T>C" "23/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-158" "" "S341P" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508144" "0" "" "" "g.117540251T>C" "" "pathogenic (recessive)" "" "0000018429" "0" "99" "7" "117246749" "117246749" "subst" "1.21994E-5" "00086" "CFTR_000159" "g.117246749C>T" "13/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-159; variable clinical consequences" "" "S977F" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs141033578" "0" "" "" "g.117606695C>T" "" "pathogenic (!)" "" "0000018430" "0" "11" "7" "117232481" "117232481" "subst" "0.00179701" "00086" "CFTR_000160" "g.117232481G>A" "26/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-160" "" "V754M" "see the CFTR2 database for details" "SUMMARY record" "" "rs150157202" "0" "" "" "g.117592427G>A" "" "benign" "" "0000018431" "0" "99" "7" "117230432" "117230432" "subst" "9.77971E-5" "00086" "CFTR_000161" "g.117230432T>G" "45/142036 chromosomes CFTR" "copy received from {DB:CFTR2}-161" "" "Y569D" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508276" "0" "" "" "g.117590378T>G" "" "pathogenic (recessive)" "" "0000018432" "0" "99" "7" "117251771" "117251771" "subst" "0" "00086" "CFTR_001031" "g.117251771C>G" "225/142036 chromosomes CFTR (3276C>A^G)" "copy received from {DB:CFTR2}-31" "" "Y1092X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908761" "0" "" "" "g.117611717C>G" "" "pathogenic (recessive)" "" "0000018433" "0" "99" "7" "117227855" "117227855" "subst" "8.14133E-6" "00086" "CFTR_001060" "g.117227855T>G" "93/142036 chromosomes CFTR (1645A>C^1647T>G)" "copy received from {DB:CFTR2}-60" "" "S549R" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909005" "0" "" "" "g.117587801T>G" "" "pathogenic (recessive)" "" "0000018434" "0" "99" "7" "117235031" "117235031" "subst" "4.06283E-6" "00086" "CFTR_001069" "g.117235031G>A" "56/142036 chromosomes CFTR (2537^2538G>A)" "copy received from {DB:CFTR2}-69" "" "W846X" "see the CFTR2 database for details" "SUMMARY record" "" "rs267606722" "0" "" "" "g.117594977G>A" "" "pathogenic (recessive)" "" "0000018435" "0" "99" "7" "117199522" "117199522" "subst" "1.21953E-5" "00086" "CFTR_001108" "g.117199522C>G" "45/142036 chromosomes CFTR (1397C>A^G)" "copy received from {DB:CFTR2}-108" "" "S466X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908805" "0" "" "" "g.117559468C>G" "" "pathogenic (recessive)" "" "0000018436" "0" "99" "7" "117182156" "117182156" "subst" "4.07305E-6" "00086" "CFTR_001120" "g.117182156G>A" "15/142036 chromosomes CFTR (1202^1203G>A)" "copy received from {DB:CFTR2}-120" "" "W401X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508175" "0" "" "" "g.117542102G>A" "" "pathogenic (recessive)" "" "0000018437" "0" "99" "7" "117267719" "117267719" "subst" "1.22446E-5" "00086" "CFTR_001127" "g.117267719G>A" "29/142036 chromosomes CFTR (3611^3612G>A)" "copy received from {DB:CFTR2}-127" "" "W1204X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908765" "0" "" "" "g.117627665G>A" "" "pathogenic (recessive)" "" "0000062354" "1" "90" "7" "117232273" "117232273" "del" "0" "01164" "CFTR_001133" "g.117232273del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117592219del" "" "pathogenic (recessive)" "" "0000062355" "1" "90" "7" "117230494" "117230494" "subst" "3.27166E-5" "01164" "CFTR_000018" "g.117230494G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117590440G>A" "" "pathogenic (recessive)" "" "0000062356" "1" "90" "7" "117199602" "117199602" "subst" "2.03178E-5" "01164" "CFTR_000024" "g.117199602C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117559548C>T" "" "pathogenic (recessive)" "" "0000062357" "1" "10" "7" "117230454" "117230454" "subst" "0.00503416" "01164" "CFTR_000065" "g.117230454G>C" "" "" "" "" "" "Germline" "" "rs1800098" "0" "" "" "g.117590400G>C" "" "benign" "" "0000062358" "1" "50" "7" "117232642" "117232642" "subst" "0.000758916" "01164" "CFTR_001136" "g.117232642A>G" "" "" "" "" "" "Germline" "" "rs1800103" "0" "" "" "g.117592588A>G" "" "VUS" "" "0000062359" "1" "50" "7" "117254818" "117254818" "subst" "0" "01164" "CFTR_001138" "g.117254818C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117614764C>A" "" "VUS" "" "0000062360" "1" "90" "7" "117246808" "117246808" "subst" "9.76388E-5" "01164" "CFTR_000016" "g.117246808G>A" "" "" "" "" "" "Germline" "" "rs75096551" "0" "" "" "g.117606754G>A" "" "pathogenic (recessive)" "" "0000062361" "1" "10" "7" "117180336" "117180336" "subst" "0.00018706" "01164" "CFTR_001129" "g.117180336C>G" "" "" "" "" "CFMD" "Germline" "" "rs1800086" "0" "" "" "g.117540282C>G" "" "benign" "" "0000062362" "1" "50" "7" "117232481" "117232481" "subst" "0.00179701" "01164" "CFTR_000160" "g.117232481G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117592427G>A" "" "VUS" "" "0000062363" "1" "90" "7" "117251704" "117251704" "subst" "0.000622665" "01164" "CFTR_000107" "g.117251704G>A" "" "" "" "" "pathogenic if in combination with c.1397C>G p.Ser466* in cis (Krasnov et al 2008 Hum Mut)" "Germline" "" "rs78769542" "0" "" "" "g.117611650G>A" "" "pathogenic (recessive)" "" "0000062364" "1" "90" "7" "117227881" "117227881" "subst" "4.07408E-6" "01164" "CFTR_000144" "g.117227881T>C" "" "" "" "" "CFMD" "Germline" "" "" "0" "" "" "g.117587827T>C" "" "pathogenic (recessive)" "" "0000062365" "1" "90" "7" "117251649" "117251649" "subst" "0.000632194" "01164" "CFTR_000129" "g.117251649T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117611595T>G" "" "pathogenic (recessive)" "" "0000062366" "1" "90" "7" "117138367" "117159446" "del" "0" "01164" "CFTR_000014" "g.117138367_117159446del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117498313_117519392del" "" "pathogenic (recessive)" "" "0000062367" "1" "50" "7" "117232501" "117232501" "subst" "4.35222E-5" "01164" "CFTR_001134" "g.117232501G>A" "" "" "" "" "Gallati : classical CF if in combination with path. Mutation. CFTR-related disorder or milde CF" "Germline" "" "" "0" "" "" "g.117592447G>A" "" "VUS" "" "0000062368" "1" "50" "7" "117144429" "117144429" "subst" "0.000329454" "01164" "CFTR_001140" "g.117144429T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117504375T>C" "" "VUS" "" "0000062369" "1" "90" "7" "117232574" "117232574" "subst" "1.11251E-5" "01164" "CFTR_001135" "g.117232574C>T" "" "" "" "" "CFMD" "Germline" "" "" "0" "" "" "g.117592520C>T" "" "pathogenic (recessive)" "" "0000062370" "1" "90" "7" "117304829" "117304829" "subst" "0" "01164" "CFTR_001141" "g.117304829A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117664775A>G" "" "pathogenic (recessive)" "" "0000062371" "1" "90" "7" "117199670" "117199671" "del" "0" "01164" "CFTR_000056" "g.117199670_117199671del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117559616_117559617del" "" "pathogenic (recessive)" "" "0000062372" "1" "90" "7" "117199522" "117199522" "subst" "1.21953E-5" "01164" "CFTR_001108" "g.117199522C>G" "" "" "" "" "" "Germline" "" "rs121908805" "0" "" "" "g.117559468C>G" "" "pathogenic (recessive)" "" "0000062373" "1" "10" "7" "117199786" "117199786" "subst" "0" "01164" "CFTR_001132" "g.117199786A>G" "" "" "" "" "sickkids" "Germline" "" "" "0" "" "" "g.117559732A>G" "" "benign" "" "0000062374" "1" "10" "7" "117232223" "117232223" "subst" "0.00594922" "01164" "CFTR_000059" "g.117232223C>T" "" "" "" "" "" "Germline" "" "rs1800100" "0" "" "" "g.117592169C>T" "" "benign" "" "0000062375" "1" "50" "7" "117199696" "117199696" "subst" "0" "01164" "CFTR_001131" "g.117199696G>A" "" "" "" "" "Alamut: pat" "Germline" "" "" "0" "" "" "g.117559642G>A" "" "VUS" "" "0000062376" "1" "50" "7" "117235040" "117235040" "subst" "0" "01164" "CFTR_001137" "g.117235040C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117594986C>T" "" "VUS" "" "0000062377" "1" "90" "7" "117227832" "117227832" "subst" "0.000358192" "01164" "CFTR_000002" "g.117227832G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117587778G>T" "" "pathogenic (recessive)" "" "0000062378" "1" "50" "7" "117304834" "117304834" "subst" "6.0983E-5" "01164" "CFTR_001128" "g.117304834G>T" "" "" "" "" "" "Germline" "" "rs113857788" "0" "" "" "g.117664780G>T" "" "VUS" "" "0000062379" "1" "50" "7" "117180230" "117180230" "subst" "0" "01164" "CFTR_001139" "g.117180230T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117540176T>C" "" "VUS" "" "0000062380" "1" "10" "7" "117199644" "117199644" "subst" "6.09637E-5" "01164" "CFTR_001130" "g.117199644A>G" "" "" "" "" "" "Germline" "" "rs1801178" "0" "" "" "g.117559590A>G" "" "benign" "" "0000222716" "0" "30" "7" "117188736" "117188736" "subst" "0" "02292" "CFTR_001151" "g.117188736C>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.117548682C>A" "" "likely benign" "" "0000222898" "0" "99" "7" "117120140" "117120162" "del" "0" "00086" "CFTR_001157" "g.117120140_117120162del" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "124del23bp, -9_14del23" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508136" "0" "" "" "g.117480086_117480108del" "" "pathogenic (recessive)" "" "0000222899" "0" "99" "7" "117120149" "117120202" "del" "0" "00086" "CFTR_001158" "g.(?_117120149)_(117120202_117144306)del" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele1" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222900" "0" "99" "7" "117227792" "117227888" "del" "0" "00086" "CFTR_001214" "g.(117199710_117227792)_(117227888_117230406)del" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele11" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222902" "0" "99" "7" "117231987" "117235113" "del" "0" "00086" "CFTR_001228" "g.(117230494_117231987)_(117235113_117242879)del" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele13,14a" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222903" "0" "99" "7" "117242879" "117251863" "del" "0" "00086" "CFTR_001246" "g.(117235113_117242879)_(117251863_117254666)del" "19/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele14b-17b" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222904" "0" "99" "7" "117170952" "117180401" "del" "0" "00086" "CFTR_001156" "g.(117149197_117170952)_(117180401_117182069)del" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele4-7" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222906" "0" "99" "7" "117170952" "117227888" "del" "0" "00086" "CFTR_001182" "g.(117149197_117170952)_(117227888_117230406)del" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele4-11" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222907" "0" "99" "7" "117246727" "117251863" "del" "0" "00086" "CFTR_001257" "g.(117243837_117246727)_(117251863_117254666)del" "13/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele16-17b" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222908" "0" "99" "7" "117250572" "117251863" "del" "0" "00086" "CFTR_001260" "g.(117246808_117250572)_(117251863_117254666)del" "21/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele17a,17b" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222909" "0" "99" "7" "117250572" "117254768" "del" "0" "00086" "CFTR_001261" "g.(117246808_117250572)_(117254768_117267575)del" "62/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele17a-18" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222910" "0" "99" "7" "117267575" "117267825" "del" "0" "00086" "CFTR_001279" "g.(117254768_117267575)_(117267825_117282491)del" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele19" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222911" "0" "99" "7" "117267575" "117292986" "del" "0" "00086" "CFTR_001280" "g.(117254768_117267575)_(117292986_117304741)del" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele19-21" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222912" "0" "99" "7" "117292895" "117292986" "del" "0" "00086" "CFTR_001294" "g.(117282648_117292895)_(117292986_117304741)del" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele21" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222913" "0" "99" "7" "117304741" "117307163" "del" "0" "00086" "CFTR_001300" "g.(117292986_117304741)_(117307163_?)del" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele22-24" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222914" "0" "99" "7" "117144306" "117144418" "del" "0" "00086" "CFTR_001163" "g.(117120202_117144306)_(117144418_117149087)del" "46/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele2" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222915" "0" "99" "7" "117144306" "117171169" "del" "0" "00086" "CFTR_001164" "g.(117120202_117144306)_(117171169_117174329)del" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele2-4" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222916" "0" "99" "7" "117176601" "117199710" "dup" "0" "00086" "CFTR_001194" "g.(117175466_117176601)_(117199710_117227792)dup" "16/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdup6b-10" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000222917" "0" "77" "7" "117188688" "117188689" "del" "0" "00086" "CFTR_000029" "g.117188688_117188689del" "35/141340 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "5T;TG11, 1210-33_1210-6GT[11]T[4]" "see the CFTR2 database for details; varying clinical consequences" "SUMMARY record" "" "" "0" "" "" "g.117548634_117548635del" "" "likely pathogenic (!)" "" "0000222918" "0" "77" "7" "117188684" "117188684" "subst" "0" "00086" "CFTR_001154" "g.117188684T>G" "182/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "5T;TG12, 1210-33_1210-6GT[12]T[4]" "see the CFTR2 database for details; varying clinical consequences" "SUMMARY record" "" "" "0" "" "" "g.117548630T>G" "" "likely pathogenic (!)" "" "0000222919" "0" "77" "7" "117188684" "117188684" "delins" "0" "00086" "CFTR_001153" "g.117188684delinsGTG" "43/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "5T;TG13, 1210-33_1210-6GT[13]T[4]" "see the CFTR2 database for details; varying clinical consequences" "SUMMARY record" "" "" "0" "" "" "g.117548630delinsGTG" "" "likely pathogenic (!)" "" "0000222924" "0" "99" "7" "117180290" "117180291" "ins" "1.21945E-5" "00086" "CFTR_001200" "g.117180290_117180291insG" "26/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1138insG" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508138" "0" "" "" "g.117540236_117540237insG" "" "pathogenic (recessive)" "" "0000222925" "0" "99" "7" "117180313" "117180313" "del" "6.50481E-5" "00086" "CFTR_001201" "g.117180313del" "21/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1161delC, 1029delC" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908774" "0" "" "" "g.117540259del" "" "pathogenic (recessive)" "" "0000222926" "0" "99" "7" "117180401" "117180401" "subst" "4.07608E-6" "00086" "CFTR_000121" "g.117180401G>A" "28/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1248+1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508158" "0" "" "" "g.117540347G>A" "" "pathogenic (recessive)" "" "0000222927" "0" "99" "7" "117182069" "117182069" "subst" "0" "00086" "CFTR_001202" "g.117182069G>A" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1249-1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs797045160" "0" "" "" "g.117542015G>A" "" "pathogenic (recessive)" "" "0000222928" "0" "99" "7" "117182108" "117182109" "dup" "0" "00086" "CFTR_001203" "g.117182108_117182109dup" "20/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1288insTA, 1153_1154insAT" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908785" "0" "" "" "g.117542054_117542055dup" "" "pathogenic (recessive)" "" "0000222929" "0" "99" "7" "117120159" "117120159" "subst" "0" "00086" "CFTR_001160" "g.117120159C>A" "14/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "S4X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508173" "0" "" "" "g.117480105C>A" "" "pathogenic (recessive)" "" "0000222930" "0" "99" "7" "117188696" "117188696" "del" "0" "00086" "CFTR_001204" "g.117188696del" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1343delG, 1211delG" "see the CFTR2 database for details" "SUMMARY record" "" "rs1235397597" "0" "" "" "g.117548642del" "" "pathogenic (recessive)" "" "0000222931" "0" "99" "7" "117188725" "117188725" "subst" "0" "00086" "CFTR_001205" "g.117188725C>T" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q414X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508183" "0" "" "" "g.117548671C>T" "" "pathogenic (recessive)" "" "0000222932" "0" "99" "7" "117188812" "117188812" "subst" "0" "00086" "CFTR_001206" "g.117188812G>T" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}; variable clinical consequences" "" "D443Y" "see the CFTR2 database for details; classification recently changed; varying clinical consequence" "SUMMARY record" "" "rs147422190" "0" "" "" "g.117548758G>T" "" "pathogenic (!)" "" "0000222933" "0" "99" "7" "117188825" "117188825" "del" "0" "00086" "CFTR_001207" "g.117188825del" "25/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1471delA, 1340delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508192" "0" "" "" "g.117548771del" "" "pathogenic (recessive)" "" "0000222934" "0" "99" "7" "117188850" "117188851" "del" "0" "00086" "CFTR_001208" "g.117188850_117188851del" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1497delGG, 1365_1366delGG" "see the CFTR2 database for details" "SUMMARY record" "" "rs797045161" "0" "" "" "g.117548796_117548797del" "" "pathogenic (recessive)" "" "0000222935" "0" "99" "7" "117144390" "117144390" "subst" "0" "00086" "CFTR_001168" "g.117144390C>A" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "A46D" "see the CFTR2 database for details" "SUMMARY record" "" "rs151020603" "0" "" "" "g.117504336C>A" "" "pathogenic (recessive)" "" "0000222936" "0" "99" "7" "117199516" "117199516" "subst" "8.13114E-6" "00086" "CFTR_001209" "g.117199516A>G" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1525-2A->G" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508201" "0" "" "" "g.117559462A>G" "" "pathogenic (recessive)" "" "0000222937" "0" "99" "7" "117199602" "117199603" "del" "0" "00086" "CFTR_001210" "g.117199602_117199603del" "21/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1609delCA, 1477_1478delCA" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908775" "0" "" "" "g.117559548_117559549del" "" "pathogenic (recessive)" "" "0000222938" "0" "99" "7" "117199612" "117199612" "subst" "0" "00086" "CFTR_001211" "g.117199612G>A" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "W496X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508216" "0" "" "" "g.117559558G>A" "" "pathogenic (recessive)" "" "0000222939" "0" "99" "7" "117199697" "117199697" "subst" "4.06971E-6" "00086" "CFTR_001212" "g.117199697C>A" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "C524X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908754" "0" "" "" "g.117559643C>A" "" "pathogenic (recessive)" "" "0000222940" "0" "99" "7" "117199710" "117199710" "subst" "4.07694E-6" "00086" "CFTR_001213" "g.117199710G>A" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1716+1G->A" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs397508230" "0" "" "" "g.117559656G>A" "" "pathogenic (recessive)" "" "0000222941" "0" "99" "7" "117144418" "117144418" "subst" "0" "00086" "CFTR_001169" "g.117144418G>A" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "296+1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508243" "0" "" "" "g.117504364G>A" "" "pathogenic (recessive)" "" "0000222942" "0" "99" "7" "117144418" "117144418" "subst" "0" "00086" "CFTR_001170" "g.117144418G>T" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "296+1G->T" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508243" "0" "" "" "g.117504364G>T" "" "pathogenic (recessive)" "" "0000222943" "0" "99" "7" "117227856" "117227856" "subst" "0" "00086" "CFTR_001215" "g.117227856G>T" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G550X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508247" "0" "" "" "g.117587802G>T" "" "pathogenic (recessive)" "" "0000222944" "0" "99" "7" "117149087" "117149087" "subst" "0" "00086" "CFTR_001171" "g.117149087G>A" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "297-1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508249" "0" "" "" "g.117509033G>A" "" "pathogenic (recessive)" "" "0000222945" "0" "99" "7" "117227858" "117227858" "del" "0" "00086" "CFTR_001216" "g.117227858del" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1782delA, 1650delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508251" "0" "" "" "g.117587804del" "" "pathogenic (recessive)" "" "0000222946" "0" "99" "7" "117227859" "117227859" "subst" "4.07136E-6" "00086" "CFTR_001217" "g.117227859G>A" "19/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G551S" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909013" "0" "" "" "g.117587805G>A" "" "pathogenic (recessive)" "" "0000222947" "0" "99" "7" "117149089" "117149089" "subst" "1.22229E-5" "00086" "CFTR_001173" "g.117149089G>A" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "E56K" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508256" "0" "" "" "g.117509035G>A" "" "pathogenic (recessive)" "" "0000222948" "0" "99" "7" "117229521" "117229521" "subst" "0" "00086" "CFTR_001155" "g.117229521A>G" "81/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1811+1634A>G, 1811+1.6kbA>G, 1679+1.6kbA>G" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508266" "0" "" "" "g.117589467A>G" "" "pathogenic (recessive)" "" "0000222949" "0" "99" "7" "117227888" "117227888" "subst" "4.07714E-6" "00086" "CFTR_001218" "g.117227888G>A" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1811+1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508263" "0" "" "" "g.117587834G>A" "" "pathogenic (recessive)" "" "0000222950" "0" "99" "7" "117227888" "117227888" "subst" "0" "00086" "CFTR_001219" "g.117227888G>C" "17/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1811+1G->C" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508263" "0" "" "" "g.117587834G>C" "" "pathogenic (recessive)" "" "0000222951" "0" "99" "7" "117230407" "117230407" "subst" "4.07777E-6" "00086" "CFTR_001220" "g.117230407A>C" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R560S" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508267" "0" "" "" "g.117590353A>C" "" "pathogenic (recessive)" "" "0000222952" "0" "99" "7" "117230409" "117230409" "subst" "1.22342E-5" "00086" "CFTR_001221" "g.117230409C>A" "16/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "A561E" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909047" "0" "" "" "g.117590355C>A" "" "pathogenic (recessive)" "" "0000222953" "0" "11" "7" "117230411" "117230411" "subst" "0.000146759" "00086" "CFTR_001222" "g.117230411G>A" "20/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "V562I" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs1800097" "0" "" "" "g.117590357G>A" "" "benign" "" "0000222954" "0" "99" "7" "117230419" "117230419" "del" "0" "00086" "CFTR_001223" "g.117230419del" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1824delA, 1692delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs193922505" "0" "" "" "g.117590365del" "" "pathogenic (recessive)" "" "0000222955" "0" "99" "7" "117230430" "117230430" "del" "0" "00086" "CFTR_001224" "g.117230430del" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1833delT, 1703delT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508274" "0" "" "" "g.117590376del" "" "pathogenic (recessive)" "" "0000222956" "0" "99" "7" "117149093" "117149093" "subst" "0" "00086" "CFTR_001174" "g.117149093G>A" "14/142036 chromosomes CFTR (170^171G>A)" "copy received from {DB:CFTR2}" "" "W57X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508279" "0" "" "" "g.117509039G>A" "" "pathogenic (recessive)" "" "0000222957" "0" "99" "7" "117149094" "117149094" "subst" "0" "00086" "CFTR_001175" "g.117149094G>A" "14/142036 chromosomes CFTR (170^171G>A)" "copy received from {DB:CFTR2}" "" "W57X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909025" "0" "" "" "g.117509040G>A" "" "pathogenic (recessive)" "" "0000222958" "0" "99" "7" "117149097" "117149100" "del" "0" "00086" "CFTR_001176" "g.117149097_117149100del" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "306delTAGA, 174_177delTAGA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508295" "0" "" "" "g.117509043_117509046del" "" "pathogenic (recessive)" "" "0000222959" "0" "99" "7" "117149098" "117149098" "dup" "0" "00086" "CFTR_001177" "g.117149098dup" "21/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "306insA, 174_175insA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508294" "0" "" "" "g.117509044dup" "" "pathogenic (recessive)" "" "0000222960" "0" "99" "7" "117230490" "117230490" "subst" "0" "00086" "CFTR_001225" "g.117230490A>T" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}; variable clinical consequences" "" "E588V" "see the CFTR2 database for details; classification recently changed; varying clinical consequence" "SUMMARY record" "" "rs397508297" "0" "" "" "g.117590436A>T" "" "pathogenic (!)" "" "0000222961" "0" "99" "7" "117230494" "117230494" "subst" "4.08958E-6" "00086" "CFTR_001226" "g.117230494G>C" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1898+1G->C" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908748" "0" "" "" "g.117590440G>C" "" "pathogenic (recessive)" "" "0000222962" "0" "99" "7" "117230498" "117230498" "subst" "2.45588E-5" "00086" "CFTR_001227" "g.117230498G>T" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1898+5G->T" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs121908796" "0" "" "" "g.117590444G>T" "" "pathogenic (recessive)" "" "0000222963" "0" "99" "7" "117232013" "117232019" "del" "0" "00086" "CFTR_001229" "g.117232013_117232019del" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1924del7, 1792_1798delAAAACTA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508303" "0" "" "" "g.117591959_117591965del" "" "pathogenic (recessive)" "" "0000222964" "0" "99" "7" "117232144" "117232152" "delins" "0" "00086" "CFTR_001230" "g.117232144_117232152delinsA" "23/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2055del9->A, 1923_1931del9insA" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908779" "0" "" "" "g.117592090_117592098delinsA" "" "pathogenic (recessive)" "" "0000222965" "0" "99" "7" "117232194" "117232206" "delins" "0" "00086" "CFTR_001231" "g.117232194_117232206delinsAGAAA" "28/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2105-2117del13insAGAAA, 1973_1985del13insAGAAA" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908780" "0" "" "" "g.117592140_117592152delinsAGAAA" "" "pathogenic (recessive)" "" "0000222966" "0" "99" "7" "117232207" "117232210" "del" "0" "00086" "CFTR_001232" "g.117232207_117232210del" "19/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2118del4, 1986_1989delAACT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508326" "0" "" "" "g.117592153_117592156del" "" "pathogenic (recessive)" "" "0000222967" "0" "99" "7" "117232238" "117232238" "subst" "4.0858E-6" "00086" "CFTR_001233" "g.117232238G>T" "12/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G673X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508331" "0" "" "" "g.117592184G>T" "" "pathogenic (recessive)" "" "0000222968" "0" "99" "7" "117232274" "117232274" "subst" "0" "00086" "CFTR_001234" "g.117232274C>T" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q685X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508336" "0" "" "" "g.117592220C>T" "" "pathogenic (recessive)" "" "0000222969" "0" "99" "7" "117232274" "117232274" "dup" "0" "00086" "CFTR_001235" "g.117232274dup" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2185insC, 2053_2054insC" "see the CFTR2 database for details" "SUMMARY record" "" "rs797045162" "0" "" "" "g.117592220dup" "" "pathogenic (recessive)" "" "0000222970" "0" "99" "7" "117232364" "117232364" "subst" "0" "00086" "CFTR_001236" "g.117232364C>T" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q715X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508343" "0" "" "" "g.117592310C>T" "" "pathogenic (recessive)" "" "0000222971" "0" "99" "7" "117232462" "117232469" "del" "0" "00086" "CFTR_001237" "g.117232462_117232469del" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2372del8, 2240_2247delCGATACTG" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508355" "0" "" "" "g.117592408_117592415del" "" "pathogenic (recessive)" "" "0000222972" "0" "99" "7" "117149156" "117149156" "dup" "0" "00086" "CFTR_001178" "g.117149156dup" "11/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "365-366insT, 233dupT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508366" "0" "" "" "g.117509102dup" "" "pathogenic (recessive)" "" "0000222973" "0" "99" "7" "117232574" "117232574" "subst" "1.11251E-5" "00086" "CFTR_001135" "g.117232574C>T" "32/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R785X" "see the CFTR2 database for details" "SUMMARY record" "" "rs374946172" "0" "" "" "g.117592520C>T" "" "pathogenic (recessive)" "" "0000222974" "0" "99" "7" "117232595" "117232595" "subst" "5.6572E-6" "00086" "CFTR_001238" "g.117232595C>T" "14/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R792X" "see the CFTR2 database for details" "SUMMARY record" "" "rs145449046" "0" "" "" "g.117592541C>T" "" "pathogenic (recessive)" "" "0000222975" "0" "99" "7" "117232644" "117232645" "dup" "0" "00086" "CFTR_001239" "g.117232644_117232645dup" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2556insAT, 2424_2425insAT" "see the CFTR2 database for details" "SUMMARY record" "" "rs387906359" "0" "" "" "g.117592590_117592591dup" "" "pathogenic (recessive)" "" "0000222976" "0" "99" "7" "117232684" "117232685" "del" "0" "00086" "CFTR_001240" "g.117232684_117232685del" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2594delGT, 2462_2463delGT" "see the CFTR2 database for details" "SUMMARY record" "" "rs797045156" "0" "" "" "g.117592630_117592631del" "" "pathogenic (recessive)" "" "0000222977" "0" "11" "7" "117234999" "117234999" "subst" "0.000451011" "00086" "CFTR_001241" "g.117234999G>T" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "D836Y" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs201386642" "0" "" "" "g.117594945G>T" "" "benign" "" "0000222978" "0" "99" "7" "117235040" "117235040" "subst" "0" "00086" "CFTR_001242" "g.117235040C>A" "14/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Y849X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508394" "0" "" "" "g.117594986C>A" "" "pathogenic (recessive)" "" "0000222979" "0" "99" "7" "117235082" "117235092" "del" "0" "00086" "CFTR_001243" "g.117235082_117235092del" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2721del11, 2589_2599delAATTTGGTGCT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508400" "0" "" "" "g.117595028_117595038del" "" "pathogenic (recessive)" "" "0000222980" "0" "99" "7" "117235094" "117235094" "dup" "0" "00086" "CFTR_001244" "g.117235094dup" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2732insA, 2600_2601insA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508405" "0" "" "" "g.117595040dup" "" "pathogenic (recessive)" "" "0000222981" "0" "55" "7" "117242854" "117242854" "subst" "0.00158796" "00086" "CFTR_001245" "g.117242854A>G" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2752-26A->G" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs201716473" "0" "" "" "g.117602800A>G" "" "VUS" "" "0000222982" "0" "99" "7" "117149186" "117149186" "subst" "0" "00086" "CFTR_001179" "g.117149186T>A" "7/142036 chromosomes CFTR (263T>A^263T>G)" "copy received from {DB:CFTR2}" "" "L88X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508412" "0" "" "" "g.117509132T>A" "" "pathogenic (recessive)" "" "0000222983" "0" "99" "7" "117149186" "117149186" "subst" "0" "00086" "CFTR_001180" "g.117149186T>G" "7/142036 chromosomes CFTR (263T>A^263T>G)" "copy received from {DB:CFTR2}" "" "L88X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508412" "0" "" "" "g.117509132T>G" "" "pathogenic (recessive)" "" "0000222984" "0" "99" "7" "117242905" "117242905" "subst" "0" "00086" "CFTR_001247" "g.117242905G>A" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "W882X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508413" "0" "" "" "g.117602851G>A" "" "pathogenic (recessive)" "" "0000222985" "0" "99" "7" "117243585" "117243585" "subst" "4.06742E-6" "00086" "CFTR_001248" "g.117243585G>C" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2790-1G->C" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508416" "0" "" "" "g.117603531G>C" "" "pathogenic (recessive)" "" "0000222986" "0" "99" "7" "117149199" "117149199" "subst" "0" "00086" "CFTR_001181" "g.117149199A>C" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "405+3A->C" "see the CFTR2 database for details" "SUMMARY record" "" "rs74467662" "0" "" "" "g.117509145A>C" "" "pathogenic (recessive)" "" "0000222987" "0" "99" "7" "117243663" "117243663" "subst" "0" "00086" "CFTR_001249" "g.117243663C>A" "16/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "S912X" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909034" "0" "" "" "g.117603609C>A" "" "pathogenic (recessive)" "" "0000222988" "0" "99" "7" "117243665" "117243666" "ins" "0" "00086" "CFTR_001250" "g.117243665_117243666insG" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2869insG" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908788" "0" "" "" "g.117603611_117603612insG" "" "pathogenic (recessive)" "" "0000222989" "0" "99" "7" "117243667" "117243667" "subst" "8.12473E-6" "00086" "CFTR_001251" "g.117243667T>A" "12/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Y913X" "see the CFTR2 database for details" "SUMMARY record" "" "rs149790377" "0" "" "" "g.117603613T>A" "" "pathogenic (recessive)" "" "0000222990" "0" "99" "7" "117243691" "117243692" "dup" "0" "00086" "CFTR_001252" "g.117243691_117243692dup" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2896insAG, 2764_2765insAG" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508431" "0" "" "" "g.117603637_117603638dup" "" "pathogenic (recessive)" "" "0000222991" "0" "99" "7" "117243738" "117243738" "dup" "0" "00086" "CFTR_001253" "g.117243738dup" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2942insT, 2810_2811insT" "see the CFTR2 database for details" "SUMMARY record" "" "rs193922510" "0" "" "" "g.117603684dup" "" "pathogenic (recessive)" "" "0000222992" "0" "99" "7" "117243753" "117243753" "del" "0" "00086" "CFTR_001254" "g.117243753del" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2957delT, 2825delT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508441" "0" "" "" "g.117603699del" "" "pathogenic (recessive)" "" "0000222993" "0" "99" "7" "117243787" "117243818" "del" "4.06276E-6" "00086" "CFTR_001255" "g.117243787_117243818del" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "2991del32, 2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508445" "0" "" "" "g.117603733_117603764del" "" "pathogenic (recessive)" "" "0000222994" "0" "99" "7" "117243824" "117243824" "del" "0" "00086" "CFTR_001256" "g.117243824del" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3028delA, 2896delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508451" "0" "" "" "g.117603770del" "" "pathogenic (recessive)" "" "0000222995" "0" "99" "7" "117250571" "117250571" "subst" "0" "00086" "CFTR_001259" "g.117250571A>G" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3121-2A->G" "see the CFTR2 database for details" "SUMMARY record" "" "rs193922515" "0" "" "" "g.117610517A>G" "" "pathogenic (recessive)" "" "0000222996" "0" "99" "7" "117249596" "117252110" "del" "0" "00086" "CFTR_001258" "g.117249596_117252110del" "2/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3121-977_3499+248del2515" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "g.117609542_117612056del" "" "pathogenic (recessive)" "" "0000222997" "0" "99" "7" "117250586" "117250587" "del" "0" "00086" "CFTR_001262" "g.117250586_117250587del" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3132delTG, 3002_3003delTG" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508477" "0" "" "" "g.117610532_117610533del" "" "pathogenic (recessive)" "" "0000222998" "0" "99" "7" "117250623" "117250623" "del" "0" "00086" "CFTR_001263" "g.117250623del" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3171delC, 3039delC" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908781" "0" "" "" "g.117610569del" "" "pathogenic (recessive)" "" "0000222999" "0" "99" "7" "117250623" "117250623" "dup" "0" "00086" "CFTR_001264" "g.117250623dup" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3171insC, 3039_3040insC" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508485" "0" "" "" "g.117610569dup" "" "pathogenic (recessive)" "" "0000223000" "0" "99" "7" "117170989" "117170989" "del" "0" "00086" "CFTR_001183" "g.117170989del" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "442delA, 310delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508499" "0" "" "" "g.117530935del" "" "pathogenic (recessive)" "" "0000223001" "0" "99" "7" "117250708" "117250708" "subst" "8.14246E-6" "00086" "CFTR_001265" "g.117250708C>T" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q1042X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508500" "0" "" "" "g.117610654C>T" "" "pathogenic (recessive)" "" "0000223002" "0" "99" "7" "117250723" "117250724" "del" "0" "00086" "CFTR_001266" "g.117250723_117250724del" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3271delGG, 3139_3139+1delGG" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508505" "0" "" "" "g.117610669_117610670del" "" "pathogenic (recessive)" "" "0000223003" "0" "99" "7" "117170992" "117170992" "del" "0" "00086" "CFTR_001184" "g.117170992del" "14/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "444delA, 313delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908801" "0" "" "" "g.117530938del" "" "pathogenic (recessive)" "" "0000223004" "0" "99" "7" "117251655" "117251655" "subst" "0" "00086" "CFTR_001267" "g.117251655C>G" "12/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "H1054D" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508510" "0" "" "" "g.117611601C>G" "" "pathogenic (recessive)" "" "0000223005" "0" "99" "7" "117251676" "117251676" "subst" "0" "00086" "CFTR_001268" "g.117251676G>C" "23/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G1061R" "see the CFTR2 database for details" "SUMMARY record" "" "rs142394380" "0" "" "" "g.117611622G>C" "" "pathogenic (recessive)" "" "0000223006" "0" "99" "7" "117251712" "117251712" "dup" "0" "00086" "CFTR_001269" "g.117251712dup" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3349insT, 3217insT" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "g.117611658dup" "" "pathogenic (recessive)" "" "0000223007" "0" "99" "7" "117251717" "117251717" "subst" "4.06788E-6" "00086" "CFTR_001270" "g.117251717T>A" "11/142036 chromosomes CFTR (c.3222T>A^G^3220T>C)" "copy received from {DB:CFTR2}; variable clinical consequences" "" "F1074L" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs186045772" "0" "" "" "g.117611663T>A" "" "pathogenic (!)" "" "0000223008" "0" "99" "7" "117251788" "117251788" "subst" "0" "00086" "CFTR_001271" "g.117251788G>A" "9/142036 chromosomes CFTR (3293^3294G>A)" "copy received from {DB:CFTR2}" "" "W1098X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508532" "0" "" "" "g.117611734G>A" "" "pathogenic (recessive)" "" "0000223009" "0" "99" "7" "117251789" "117251789" "subst" "0" "00086" "CFTR_001272" "g.117251789G>A" "9/142036 chromosomes CFTR (3293^3294G>A)" "copy received from {DB:CFTR2}" "" "W1098X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508533" "0" "" "" "g.117611735G>A" "" "pathogenic (recessive)" "" "0000223010" "0" "99" "7" "117251799" "117251799" "subst" "0" "00086" "CFTR_001273" "g.117251799A>T" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R1102X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508536" "0" "" "" "g.117611745A>T" "" "pathogenic (recessive)" "" "0000223011" "0" "99" "7" "117254665" "117254665" "subst" "4.07073E-6" "00086" "CFTR_001274" "g.117254665A>G" "13/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3500-2A->G" "see the CFTR2 database for details" "SUMMARY record" "" "rs755416052" "0" "" "" "g.117614611A>G" "" "pathogenic (recessive)" "" "0000223012" "0" "99" "7" "117254734" "117254734" "subst" "0" "00086" "CFTR_001275" "g.117254734G>A" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "W1145X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508561" "0" "" "" "g.117614680G>A" "" "pathogenic (recessive)" "" "0000223013" "0" "99" "7" "117254769" "117254769" "dup" "0" "00086" "CFTR_001277" "g.117254769dup" "12/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3600+2insT, 3468+2_3468+3insT" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "" "0" "" "" "g.117614715dup" "" "pathogenic (recessive)" "" "0000223014" "0" "99" "7" "117254772" "117254772" "subst" "0" "00086" "CFTR_001278" "g.117254772G>A" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3600+5G->A" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs1554392801" "0" "" "" "g.117614718G>A" "" "pathogenic (recessive)" "" "0000223015" "0" "99" "7" "117254767" "117254767" "subst" "4.07295E-6" "00086" "CFTR_001276" "g.117254767G>A" "16/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3600G->A" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs139729994" "0" "" "" "g.117614713G>A" "" "pathogenic (recessive)" "" "0000223016" "0" "99" "7" "117267639" "117267642" "dup" "0" "00086" "CFTR_001281" "g.117267639_117267642dup" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3667ins4, 3535_3536insTCAA" "see the CFTR2 database for details" "SUMMARY record" "" "rs387906378" "0" "" "" "g.117627585_117627588dup" "" "pathogenic (recessive)" "" "0000223017" "0" "99" "7" "117267712" "117267712" "del" "0" "00086" "CFTR_001282" "g.117267712del" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3737delA, 3605delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508587" "0" "" "" "g.117627658del" "" "pathogenic (recessive)" "" "0000223018" "0" "99" "7" "117267798" "117267798" "del" "0" "00086" "CFTR_001283" "g.117267798del" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3821delT, 3691delT" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908783" "0" "" "" "g.117627744del" "" "pathogenic (recessive)" "" "0000223019" "0" "99" "7" "117267864" "117267864" "subst" "0" "00086" "CFTR_001286" "g.117267864A>G" "13/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3849+40A->G" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs397508595" "0" "" "" "g.117627810A>G" "" "pathogenic (recessive)" "" "0000223020" "0" "99" "7" "117267828" "117267828" "subst" "0" "00086" "CFTR_001285" "g.117267828A>G" "14/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3849+4A->G" "see the CFTR2 database for details" "SUMMARY record" "" "rs387906362" "0" "" "" "g.117627774A>G" "" "pathogenic (recessive)" "" "0000223021" "0" "99" "7" "117267824" "117267824" "subst" "8.28418E-6" "00086" "CFTR_001284" "g.117267824G>A" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3849G->A" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs144781064" "0" "" "" "g.117627770G>A" "" "pathogenic (recessive)" "" "0000223022" "0" "99" "7" "117282491" "117282491" "subst" "0" "00086" "CFTR_001288" "g.117282491G>A" "12/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3850-1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs387906369" "0" "" "" "g.117642437G>A" "" "pathogenic (recessive)" "" "0000223023" "0" "99" "7" "117280015" "117280015" "subst" "0" "00086" "CFTR_000011" "g.117280015C>T" "1158/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3849+10kbC->T" "see the CFTR2 database for details" "SUMMARY record" "" "rs75039782" "0" "" "" "g.117639961C>T" "" "pathogenic (recessive)" "" "0000223024" "0" "99" "7" "117282489" "117282489" "subst" "4.06987E-6" "00086" "CFTR_001287" "g.117282489T>G" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3850-3T->G" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508596" "0" "" "" "g.117642435T>G" "" "pathogenic (recessive)" "" "0000223025" "0" "99" "7" "117282521" "117282521" "del" "0" "00086" "CFTR_001289" "g.117282521del" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3878delG, 3747delG" "see the CFTR2 database for details" "SUMMARY record" "" "rs797045159" "0" "" "" "g.117642467del" "" "pathogenic (recessive)" "" "0000223026" "0" "99" "7" "117282535" "117282535" "subst" "0" "00086" "CFTR_001290" "g.117282535T>G" "24/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "L1254X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508604" "0" "" "" "g.117642481T>G" "" "pathogenic (recessive)" "" "0000223027" "0" "99" "7" "117282537" "117282537" "subst" "0" "00086" "CFTR_001291" "g.117282537T>C" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "S1255P" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909041" "0" "" "" "g.117642483T>C" "" "pathogenic (recessive)" "" "0000223028" "0" "99" "7" "117282538" "117282538" "subst" "4.06875E-6" "00086" "CFTR_001292" "g.117282538C>A" "16/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "S1255X" "see the CFTR2 database for details" "SUMMARY record" "" "rs76649725" "0" "" "" "g.117642484C>A" "" "pathogenic (recessive)" "" "0000223029" "0" "99" "7" "117282649" "117282649" "subst" "4.07442E-6" "00086" "CFTR_001293" "g.117282649T>C" "15/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "4005+2T->C" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs146795445" "0" "" "" "g.117642595T>C" "" "pathogenic (recessive)" "" "0000223030" "0" "99" "7" "117292905" "117292908" "del" "0" "00086" "CFTR_001296" "g.117292905_117292908del" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "4010del4, 3882_3885delTATT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508628" "0" "" "" "g.117652851_117652854del" "" "pathogenic (recessive)" "" "0000223031" "0" "99" "7" "117292905" "117292905" "del" "0" "00086" "CFTR_001295" "g.117292905del" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "4015delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508630" "0" "" "" "g.117652851del" "" "pathogenic (recessive)" "" "0000223032" "0" "99" "7" "117292913" "117292913" "dup" "0" "00086" "CFTR_001297" "g.117292913dup" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "4022insT, 3890_3891insT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508631" "0" "" "" "g.117652859dup" "" "pathogenic (recessive)" "" "0000223034" "0" "99" "7" "117292930" "117292930" "del" "0" "00086" "CFTR_001299" "g.117292930del" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "4040delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508637" "0" "" "" "g.117652876del" "" "pathogenic (recessive)" "" "0000223035" "0" "99" "7" "117304766" "117304766" "subst" "0" "00086" "CFTR_001301" "g.117304766C>T" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q1330X" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "g.117664712C>T" "" "pathogenic (recessive)" "" "0000223036" "0" "99" "7" "117304824" "117304824" "subst" "0" "00086" "CFTR_001011" "g.117304824G>A" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G1349D" "see the CFTR2 database for details" "SUMMARY record" "" "rs193922525" "0" "" "" "g.117664770G>A" "" "pathogenic (recessive)" "" "0000223037" "0" "99" "7" "117304864" "117304864" "dup" "0" "00086" "CFTR_001302" "g.117304864dup" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "4218insT, 4086_4087insT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508669" "0" "" "" "g.117664810dup" "" "pathogenic (recessive)" "" "0000223038" "0" "99" "7" "117171088" "117171088" "del" "0" "00086" "CFTR_001185" "g.117171088del" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "541delC, 409delC" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508672" "0" "" "" "g.117531034del" "" "pathogenic (recessive)" "" "0000223039" "0" "99" "7" "117304889" "117304889" "subst" "4.06504E-6" "00086" "CFTR_001303" "g.117304889G>T" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "E1371X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508675" "0" "" "" "g.117664835G>T" "" "pathogenic (recessive)" "" "0000223040" "0" "99" "7" "117304905" "117304909" "del" "0" "00086" "CFTR_001304" "g.117304905_117304909del" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "4259del5, 4127_4131delTGGAT" "see the CFTR2 database for details" "SUMMARY record" "" "rs797045159" "0" "" "" "g.117664851_117664855del" "" "pathogenic (recessive)" "" "0000223041" "0" "99" "7" "117305520" "117305520" "subst" "0" "00086" "CFTR_001305" "g.117305520C>T" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q1382X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508684" "0" "" "" "g.117665466C>T" "" "pathogenic (recessive)" "" "0000223042" "0" "99" "7" "117305573" "117305574" "del" "0" "00086" "CFTR_001306" "g.117305573_117305574del" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "4326delTC, 4196_4197delTC" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508693" "0" "" "" "g.117665519_117665520del" "" "pathogenic (recessive)" "" "0000223043" "0" "99" "7" "117305607" "117305607" "subst" "0" "00086" "CFTR_001307" "g.117305607C>T" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q1411X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508701" "0" "" "" "g.117665553C>T" "" "pathogenic (recessive)" "" "0000223044" "0" "99" "7" "117305610" "117305610" "subst" "0" "00086" "CFTR_001308" "g.117305610C>T" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q1412X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508702" "0" "" "" "g.117665556C>T" "" "pathogenic (recessive)" "" "0000223045" "0" "99" "7" "117305619" "117305619" "subst" "0" "00086" "CFTR_001309" "g.117305619G>A" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "4374+1G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs372227120" "0" "" "" "g.117665565G>A" "" "pathogenic (recessive)" "" "0000223046" "0" "99" "7" "117305619" "117305619" "subst" "4.07488E-6" "00086" "CFTR_001310" "g.117305619G>T" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "4374+1G->T" "see the CFTR2 database for details" "SUMMARY record" "" "rs372227120" "0" "" "" "g.117665565G>T" "" "pathogenic (recessive)" "" "0000223047" "0" "99" "7" "117305523" "117305523" "dup" "0" "00086" "CFTR_000038" "g.117305523dup" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "4279insA, 4147_4148insA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508685" "0" "" "" "g.117665469dup" "" "pathogenic (recessive)" "" "0000223048" "0" "99" "7" "117307019" "117307020" "dup" "0" "00086" "CFTR_001311" "g.117307019_117307020dup" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "4428insGA, 4296_4297insGA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508709" "0" "" "" "g.117666965_117666966dup" "" "pathogenic (recessive)" "" "0000223049" "0" "99" "7" "117171149" "117171162" "del" "0" "00086" "CFTR_001186" "g.117171149_117171162del" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "602del14, 470_483del15" "see the CFTR2 database for details" "SUMMARY record" "" "rs1554379887" "0" "" "" "g.117531095_117531108del" "" "pathogenic (recessive)" "" "0000223050" "0" "99" "7" "117171171" "117171171" "subst" "0.000233234" "00086" "CFTR_001187" "g.117171171A>G" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}; variable clinical consequences" "" "621+3A->G" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs377729736" "0" "" "" "g.117531117A>G" "" "pathogenic (!)" "" "0000223051" "0" "99" "7" "117120152" "117120152" "subst" "4.06464E-6" "00086" "CFTR_001159" "g.117120152C>T" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q2X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508740" "0" "" "" "g.117480098C>T" "" "pathogenic (recessive)" "" "0000223052" "0" "11" "7" "117174349" "117174349" "subst" "0.000517839" "00086" "CFTR_001188" "g.117174349G>A" "11/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R170H" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs1800079" "0" "" "" "g.117534295G>A" "" "benign" "" "0000223053" "0" "99" "7" "117120198" "117120198" "del" "0" "00086" "CFTR_001161" "g.117120198del" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "182delT, 50delT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508742" "0" "" "" "g.117480144del" "" "pathogenic (recessive)" "" "0000223054" "0" "99" "7" "117120202" "117120202" "subst" "4.0786E-6" "00086" "CFTR_001162" "g.117120202G>T" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "185+1G->T" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508746" "0" "" "" "g.117480148G>T" "" "pathogenic (recessive)" "" "0000223055" "0" "99" "7" "117174383" "117174386" "del" "0" "00086" "CFTR_001189" "g.117174383_117174386del" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "675del4, 543_546delTAGT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508750" "0" "" "" "g.117534329_117534332del" "" "pathogenic (recessive)" "" "0000223056" "0" "99" "7" "117174417" "117174417" "subst" "0" "00086" "CFTR_001190" "g.117174417G>T" "18/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "E193X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508759" "0" "" "" "g.117534363G>T" "" "pathogenic (recessive)" "" "0000223057" "0" "99" "7" "117144310" "117144310" "subst" "0" "00086" "CFTR_001165" "g.117144310G>A" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "W19X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508762" "0" "" "" "g.117504256G>A" "" "pathogenic (recessive)" "" "0000223058" "0" "55" "7" "117175323" "117175323" "subst" "0.000223403" "00086" "CFTR_001191" "g.117175323G>A" "11/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "V201M" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs138338446" "0" "" "" "g.117535269G>A" "" "VUS" "" "0000223059" "0" "99" "7" "117175369" "117175369" "subst" "4.06167E-6" "00086" "CFTR_001192" "g.117175369G>A" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "W216X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508775" "0" "" "" "g.117535315G>A" "" "pathogenic (recessive)" "" "0000223060" "0" "99" "7" "117175439" "117175439" "del" "0" "00086" "CFTR_001193" "g.117175439del" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "849delG, 717delG" "see the CFTR2 database for details" "SUMMARY record" "" "rs1554380497" "0" "" "" "g.117535385del" "" "pathogenic (recessive)" "" "0000223061" "0" "99" "7" "117144332" "117144332" "subst" "0" "00086" "CFTR_001166" "g.117144332G>T" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G27X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508796" "0" "" "" "g.117504278G>T" "" "pathogenic (recessive)" "" "0000223062" "0" "99" "7" "117176661" "117176661" "del" "0" "00086" "CFTR_001195" "g.117176661del" "21/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "935delA, 803delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908772" "0" "" "" "g.117536607del" "" "pathogenic (recessive)" "" "0000223063" "0" "99" "7" "117176683" "117176683" "subst" "0" "00086" "CFTR_001196" "g.117176683C>G" "12/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Y275X" "see the CFTR2 database for details" "SUMMARY record" "" "rs193922532" "0" "" "" "g.117536629C>G" "" "pathogenic (recessive)" "" "0000223064" "0" "99" "7" "117176686" "117176686" "subst" "0" "00086" "CFTR_001197" "g.117176686C>A" "14/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "C276X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508799" "0" "" "" "g.117536632C>A" "" "pathogenic (recessive)" "" "0000223065" "0" "99" "7" "117176719" "117176723" "del" "0" "00086" "CFTR_001198" "g.117176719_117176723del" "15/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "991del5, 859_863delAACTT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508805" "0" "" "" "g.117536665_117536669del" "" "pathogenic (recessive)" "" "0000223066" "0" "55" "7" "117144345" "117144345" "subst" "3.66339E-5" "00086" "CFTR_001167" "g.117144345G>T" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R31L" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs149353983" "0" "" "" "g.117504291G>T" "" "VUS" "" "0000223067" "0" "99" "7" "117180271" "117180271" "del" "0" "00086" "CFTR_001199" "g.117180271del" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1119delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508824" "0" "" "" "g.117540217del" "" "pathogenic (recessive)" "" "0000223068" "1" "55" "7" "117180359" "117180359" "subst" "0" "00006" "CFTR_000116" "g.117180359C>A" "" "" "" "[1075C>A;1079C>A]" "" "Germline" "" "rs76879328" "0" "" "" "g.117540305C>A" "" "VUS" "" "0000223069" "1" "55" "7" "117180363" "117180363" "subst" "0" "00006" "CFTR_000152" "g.117180363C>A" "" "" "" "[1075C>A;1079C>A]" "" "Germline" "" "" "0" "" "" "g.117540309C>A" "" "VUS" "" "0000223070" "1" "77" "7" "117188688" "117188689" "del" "0" "00086" "CFTR_000029" "g.117188688_117188689del" "102/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "[350G>A;1210−12T[5]]" "see the CFTR2 database for details; varying clinical consequences" "SUMMARY record" "" "" "0" "" "" "g.117548634_117548635del" "" "likely pathogenic (!)" "" "0000223071" "1" "99" "7" "117171029" "117171029" "subst" "0.00147328" "00086" "CFTR_000006" "g.117171029G>A" "102/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "[350G>A;1210−12T[5]]" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000223072" "1" "99" "7" "117171029" "117171029" "subst" "0.00147328" "00086" "CFTR_000006" "g.117171029G>A" "125/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "[350G>A;1210−12T[7]]" "see the CFTR2 database for details; varying clinical consequences" "SUMMARY record" "" "" "0" "" "" "g.117530975G>A" "" "likely pathogenic (!)" "" "0000223073" "1" "11" "7" "117188683" "117188689" "" "0" "00086" "CFTR_000140" "g.117188683_117188689=" "125/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "[350G>A;1210−12T[7]]" "see the CFTR2 database for details; varying clinical consequences" "SUMMARY record" "" "" "0" "" "" "g.117548629_117548635=" "" "likely pathogenic (!)" "" "0000241257" "0" "70" "7" "117149143" "117149143" "subst" "0.00142434" "01807" "CFTR_000087" "g.117149143C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117509089C>T" "" "VUS" "" "0000248127" "0" "30" "7" "117199641" "117199641" "subst" "0.000357631" "02325" "CFTR_001340" "g.117199641A>G" "" "" "" "CFTR(NM_000492.3):c.1516A>G (p.I506V), CFTR(NM_000492.4):c.1516A>G (p.I506V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559587A>G" "" "likely benign" "" "0000248144" "0" "90" "7" "117232273" "117232273" "del" "0" "02325" "CFTR_001133" "g.117232273del" "" "" "" "CFTR(NM_000492.3):c.2052delA (p.K684Nfs*38), CFTR(NM_000492.4):c.2052delA (p.K684Nfs*38)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592219del" "" "pathogenic" "" "0000249377" "0" "30" "7" "117292919" "117292919" "subst" "0.0010524" "02325" "CFTR_001389" "g.117292919A>G" "" "" "" "CFTR(NM_000492.3):c.3897A>G (p.T1299=), CFTR(NM_000492.4):c.3897A>G (p.T1299=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117652865A>G" "" "likely benign" "" "0000249544" "0" "30" "7" "117306946" "117306946" "subst" "0.000122713" "02325" "CFTR_001397" "g.117306946A>G" "" "" "" "CFTR(NM_000492.4):c.4243-16A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117666892A>G" "" "likely benign" "" "0000249638" "0" "90" "7" "117170992" "117170992" "del" "0" "02325" "CFTR_001184" "g.117170992del" "" "" "" "CFTR(NM_000492.4):c.313delA (p.I105Sfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117530938del" "" "pathogenic" "" "0000249716" "0" "50" "7" "117243835" "117243835" "subst" "1.62672E-5" "02325" "CFTR_001365" "g.117243835A>G" "" "" "" "CFTR(NM_000492.4):c.2907A>G (p.A969=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117603781A>G" "" "VUS" "" "0000249735" "0" "50" "7" "117171095" "117171095" "subst" "8.14737E-6" "02325" "CFTR_001318" "g.117171095A>C" "" "" "" "CFTR(NM_000492.4):c.416A>C (p.H139P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117531041A>C" "" "VUS" "" "0000253449" "0" "10" "7" "117282644" "117282644" "subst" "0.0485144" "01943" "CFTR_001388" "g.117282644A>G" "" "" "" "CFTR(NM_000492.3):c.3870A>G (p.P1290=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117642590A>G" "" "benign" "" "0000253572" "0" "10" "7" "117199644" "117199644" "subst" "6.09637E-5" "01943" "CFTR_001130" "g.117199644A>G" "" "" "" "CFTR(NM_000492.3):c.1519A>G (p.I507V), CFTR(NM_000492.4):c.1519A>G (p.I507V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559590A>G" "" "benign" "" "0000253580" "0" "10" "7" "117232642" "117232642" "subst" "0.000758916" "01943" "CFTR_001136" "g.117232642A>G" "" "" "" "CFTR(NM_000492.3):c.2421A>G (p.I807M), CFTR(NM_000492.4):c.2421A>G (p.I807M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592588A>G" "" "benign" "" "0000253808" "0" "10" "7" "117231856" "117231856" "subst" "0" "01943" "CFTR_001414" "g.117231856A>G" "" "" "" "CFTR(NM_000492.3):c.1767-132A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117591802A>G" "" "benign" "" "0000253809" "0" "10" "7" "117251608" "117251608" "subst" "0" "01943" "CFTR_001374" "g.117251608A>G" "" "" "" "CFTR(NM_000492.3):c.3140-27A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611554A>G" "" "benign" "" "0000254117" "0" "30" "7" "117199641" "117199641" "subst" "0.000357631" "01943" "CFTR_001340" "g.117199641A>G" "" "" "" "CFTR(NM_000492.3):c.1516A>G (p.I506V), CFTR(NM_000492.4):c.1516A>G (p.I506V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559587A>G" "" "likely benign" "" "0000255038" "0" "30" "7" "117251780" "117251780" "subst" "0.0045507" "01943" "CFTR_001375" "g.117251780A>T" "" "" "" "CFTR(NM_000492.3):c.3285A>T (p.T1095=, p.(Thr1095=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611726A>T" "" "likely benign" "" "0000255402" "0" "90" "7" "117232273" "117232273" "del" "0" "01943" "CFTR_001133" "g.117232273del" "" "" "" "CFTR(NM_000492.3):c.2052delA (p.K684Nfs*38), CFTR(NM_000492.4):c.2052delA (p.K684Nfs*38)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592219del" "" "pathogenic" "" "0000255436" "0" "90" "7" "117306970" "117306970" "del" "0" "01943" "CFTR_001398" "g.117306970del" "" "" "" "CFTR(NM_000492.3):c.4251delA (p.E1418Rfs*14)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117666916del" "" "pathogenic" "" "0000255458" "0" "90" "7" "117254714" "117254714" "subst" "0.000105725" "01943" "CFTR_001378" "g.117254714A>G" "" "" "" "CFTR(NM_000492.3):c.3415A>G (p.I1139V), CFTR(NM_000492.4):c.3415A>G (p.I1139V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117614660A>G" "" "pathogenic" "" "0000255555" "0" "90" "7" "117292930" "117292930" "subst" "4.90802E-5" "01943" "CFTR_001390" "g.117292930A>T" "" "" "" "CFTR(NM_000492.3):c.3908A>T (p.N1303I), CFTR(NM_000492.4):c.3908A>T (p.N1303I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117652876A>T" "" "pathogenic" "" "0000255665" "0" "90" "7" "117230433" "117230433" "subst" "0" "01943" "CFTR_001347" "g.117230433A>G" "" "" "" "CFTR(NM_000492.3):c.1706A>G (p.Y569C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117590379A>G" "" "pathogenic" "" "0000255683" "0" "90" "7" "117174422" "117174422" "subst" "1.63335E-5" "01943" "CFTR_000098" "g.117174422A>G" "" "" "" "CFTR(NM_000492.3):c.579+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117534368A>G" "" "pathogenic" "" "0000255684" "0" "90" "7" "117254665" "117254665" "subst" "4.07073E-6" "01943" "CFTR_001274" "g.117254665A>G" "" "" "" "CFTR(NM_000492.3):c.3368-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117614611A>G" "" "pathogenic" "" "0000256098" "0" "50" "7" "117227874" "117227874" "subst" "0.00342536" "01943" "CFTR_001017" "g.117227874A>G" "" "" "" "CFTR(NM_000492.3):c.1666A>G (p.I556V), CFTR(NM_000492.4):c.1666A>G (p.I556V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587820A>G" "" "VUS" "" "0000256160" "0" "50" "7" "117180165" "117180165" "subst" "0" "01943" "CFTR_001326" "g.117180165A>T" "" "" "" "CFTR(NM_000492.3):c.881A>T (p.K294I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540111A>T" "" "VUS" "" "0000256278" "0" "50" "7" "117149187" "117149187" "subst" "8.14637E-6" "01943" "CFTR_001314" "g.117149187A>C" "" "" "" "CFTR(NM_000492.3):c.264A>C (p.L88F), CFTR(NM_000492.4):c.264A>C (p.L88F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117509133A>C" "" "VUS" "" "0000256469" "0" "50" "7" "117232649" "117232649" "subst" "3.39382E-5" "01943" "CFTR_001415" "g.117232649A>G" "" "" "" "CFTR(NM_000492.3):c.2428A>G (p.R810G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592595A>G" "" "VUS" "" "0000256703" "0" "50" "7" "117171171" "117171171" "subst" "0.000233234" "01943" "CFTR_001187" "g.117171171A>G" "" "" "" "CFTR(NM_000492.3):c.489+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117531117A>G" "" "VUS" "" "0000266699" "0" "90" "7" "117180284" "117180284" "subst" "6.09796E-5" "02325" "CFTR_000026" "g.117180284C>T" "" "" "" "CFTR(NM_000492.3):c.1000C>T (p.R334W), CFTR(NM_000492.4):c.1000C>T (p.R334W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540230C>T" "" "pathogenic" "" "0000266700" "0" "90" "7" "117180324" "117180324" "subst" "2.44035E-5" "02325" "CFTR_000039" "g.117180324G>A" "" "" "" "CFTR(NM_000492.4):c.1040G>A (p.R347H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540270G>A" "" "pathogenic" "" "0000266701" "0" "90" "7" "117180324" "117180324" "subst" "2.44035E-5" "02325" "CFTR_000020" "g.117180324G>C" "" "" "" "CFTR(NM_000492.3):c.1040G>C (p.R347P), CFTR(NM_000492.4):c.1040G>C (p.R347P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540270G>C" "" "pathogenic" "" "0000266702" "0" "30" "7" "117188689" "117188689" "subst" "0" "02325" "CFTR_001334" "g.117188689T>A" "" "" "" "CFTR(NM_000492.4):c.1210-6T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117548635T>A" "" "likely benign" "" "0000266703" "0" "90" "7" "117188849" "117188849" "subst" "0" "02325" "CFTR_000032" "g.117188849C>A" "" "" "" "CFTR(NM_000492.3):c.1364C>A (p.A455E), CFTR(NM_000492.4):c.1364C>A (p.(Ala455Glu), p.A455E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117548795C>A" "" "pathogenic" "" "0000266704" "0" "10" "7" "117199533" "117199533" "subst" "0.474443" "02325" "CFTR_001338" "g.117199533G>A" "" "" "" "CFTR(NM_000492.3):c.1408G>A (p.V470M), CFTR(NM_000492.4):c.1408G>A (p.(Val470Met), p.V470M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559479G>A" "" "benign" "" "0000266705" "0" "90" "7" "117199591" "117199591" "subst" "4.06329E-6" "02325" "CFTR_000109" "g.117199591C>A" "" "" "" "CFTR(NM_000492.3):c.1466C>A (p.S489*), CFTR(NM_000492.4):c.1466C>A (p.S489*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559537C>A" "" "pathogenic" "" "0000266706" "0" "90" "7" "117199644" "117199646" "del" "0" "02325" "CFTR_000017" "g.117199644_117199646del" "" "" "" "CFTR(NM_000492.3):c.1519_1521delATC (p.I507del), CFTR(NM_000492.4):c.1519_1521delATC (p.I507del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559590_117559592del" "" "pathogenic" "" "0000266707" "0" "90" "7" "117199646" "117199648" "del" "0" "02325" "CFTR_000001" "g.117199646_117199648del" "" "" "" "CFTR(NM_000492.3):c.1521_1523delCTT (p.(Phe508del)), CFTR(NM_000492.3):c.1521_1523delCTT (p.F508del), CFTR(NM_000492.4):c.1521_1523delCTT (p.F508del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic" "" "0000266708" "0" "90" "7" "117199670" "117199671" "del" "0" "02325" "CFTR_000056" "g.117199670_117199671del" "" "" "" "CFTR(NM_000492.3):c.1545_1546delTA (p.Y515*), CFTR(NM_000492.4):c.1545_1546delTA (p.Y515*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559616_117559617del" "" "pathogenic" "" "0000266709" "0" "90" "7" "117199683" "117199683" "subst" "4.06673E-6" "02325" "CFTR_000050" "g.117199683G>T" "" "" "" "CFTR(NM_000492.4):c.1558G>T (p.V520F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559629G>T" "" "pathogenic" "" "0000266710" "0" "90" "7" "117227792" "117227792" "subst" "8.54965E-5" "02325" "CFTR_000008" "g.117227792G>A" "" "" "" "CFTR(NM_000492.3):c.1585-1G>A, CFTR(NM_000492.4):c.1585-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587738G>A" "" "pathogenic" "" "0000266711" "0" "90" "7" "117227832" "117227832" "subst" "0.000358192" "02325" "CFTR_000002" "g.117227832G>T" "" "" "" "CFTR(NM_000492.3):c.1624G>T (p.G542*), CFTR(NM_000492.4):c.1624G>T (p.G542*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587778G>T" "" "pathogenic" "" "0000266712" "0" "90" "7" "117227854" "117227854" "subst" "8.14067E-5" "02325" "CFTR_000042" "g.117227854G>A" "" "" "" "CFTR(NM_000492.4):c.1646G>A (p.S549N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587800G>A" "" "pathogenic" "" "0000266713" "0" "90" "7" "117227855" "117227855" "subst" "8.14133E-6" "02325" "CFTR_001060" "g.117227855T>G" "" "" "" "CFTR(NM_000492.4):c.1647T>G (p.S549R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587801T>G" "" "pathogenic" "" "0000266714" "0" "90" "7" "117227860" "117227860" "subst" "0.00017913" "02325" "CFTR_000003" "g.117227860G>A" "" "" "" "CFTR(NM_000492.3):c.1652G>A (p.G551D), CFTR(NM_000492.4):c.1652G>A (p.G551D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic" "" "0000266715" "0" "90" "7" "117227865" "117227865" "subst" "7.33E-5" "02325" "CFTR_000007" "g.117227865C>T" "" "" "" "CFTR(NM_000492.3):c.1657C>T (p.R553*), CFTR(NM_000492.4):c.1657C>T (p.R553*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587811C>T" "" "pathogenic" "" "0000266716" "0" "90" "7" "117227887" "117227887" "subst" "2.03832E-5" "02325" "CFTR_000022" "g.117227887G>C" "" "" "" "CFTR(NM_000492.3):c.1679G>C (p.R560T), CFTR(NM_000492.4):c.1679G>C (p.R560T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587833G>C" "" "pathogenic" "" "0000266717" "0" "90" "7" "117230498" "117230498" "subst" "2.45588E-5" "02325" "CFTR_001227" "g.117230498G>T" "" "" "" "CFTR(NM_000492.3):c.1766+5G>T, CFTR(NM_000492.4):c.1766+5G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117590444G>T" "" "pathogenic" "" "0000266718" "0" "90" "7" "117149101" "117149101" "subst" "2.44296E-5" "02325" "CFTR_000025" "g.117149101G>T" "" "" "" "CFTR(NM_000492.3):c.178G>T (p.E60*), CFTR(NM_000492.4):c.178G>T (p.E60*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117509047G>T" "" "pathogenic" "" "0000266719" "0" "90" "7" "117232074" "117232074" "subst" "2.21086E-5" "02325" "CFTR_001350" "g.117232074T>C" "" "" "" "CFTR(NM_000492.4):c.1853T>C (p.I618T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592020T>C" "" "pathogenic" "" "0000266720" "0" "90" "7" "117149123" "117149123" "subst" "3.25529E-5" "02325" "CFTR_000053" "g.117149123C>T" "" "" "" "CFTR(NM_000492.4):c.200C>T (p.P67L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117509069C>T" "" "pathogenic" "" "0000266721" "0" "90" "7" "117232233" "117232233" "del" "0" "02325" "CFTR_001351" "g.117232233del" "" "" "" "CFTR(NM_000492.3):c.2012delT (p.L671*), CFTR(NM_000492.4):c.2012delT (p.L671*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592179del" "" "pathogenic" "" "0000266722" "0" "90" "7" "117232436" "117232436" "del" "4.06372E-6" "02325" "CFTR_001355" "g.117232436del" "" "" "" "CFTR(NM_000492.4):c.2215delG (p.V739Yfs*16)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592382del" "" "pathogenic" "" "0000266723" "0" "30" "7" "117232481" "117232481" "subst" "0.00179701" "02325" "CFTR_000160" "g.117232481G>A" "" "" "" "CFTR(NM_000492.3):c.2260G>A (p.V754M), CFTR(NM_000492.4):c.2260G>A (p.(Val754Met), p.V754M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592427G>A" "" "likely benign" "" "0000266724" "0" "30" "7" "117234976" "117234976" "subst" "1.21924E-5" "02325" "CFTR_001357" "g.117234976T>C" "" "" "" "CFTR(NM_000492.4):c.2491-8T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117594922T>C" "" "likely benign" "" "0000266725" "0" "90" "7" "117235030" "117235030" "subst" "0" "02325" "CFTR_000069" "g.117235030G>A" "" "" "" "CFTR(NM_000492.3):c.2537G>A (p.W846*), CFTR(NM_000492.4):c.2537G>A (p.W846*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117594976G>A" "" "pathogenic" "" "0000266726" "0" "90" "7" "117149177" "117149177" "subst" "4.47839E-5" "02325" "CFTR_000015" "g.117149177G>A" "" "" "" "CFTR(NM_000492.3):c.254G>A (p.G85E), CFTR(NM_000492.4):c.254G>A (p.G85E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117509123G>A" "" "pathogenic" "" "0000266727" "0" "10" "7" "117235055" "117235055" "subst" "0.382582" "02325" "CFTR_001359" "g.117235055T>G" "" "" "" "CFTR(NM_000492.3):c.2562T>G (p.T854=), CFTR(NM_000492.4):c.2562T>G (p.(Thr854=), p.T854=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117595001T>G" "" "benign" "" "0000266728" "0" "90" "7" "117149185" "117149186" "del" "0" "02325" "CFTR_000027" "g.117149185_117149186del" "" "" "" "CFTR(NM_000492.3):c.262_263delTT (p.L88Ifs*22), CFTR(NM_000492.4):c.262_263delTT (p.L88Ifs*22)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117509131_117509132del" "" "pathogenic" "" "0000266729" "0" "90" "7" "117242922" "117242922" "subst" "7.30953E-5" "02325" "CFTR_000010" "g.117242922G>A" "" "" "" "CFTR(NM_000492.3):c.2657+5G>A, CFTR(NM_000492.4):c.2657+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117602868G>A" "" "pathogenic" "" "0000266730" "0" "90" "7" "117243596" "117243596" "subst" "0" "02325" "CFTR_000117" "g.117243596C>T" "" "" "" "CFTR(NM_000492.4):c.2668C>T (p.Q890*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117603542C>T" "" "pathogenic" "" "0000266731" "0" "30" "7" "117243826" "117243826" "subst" "0.00576904" "02325" "CFTR_001363" "g.117243826G>A" "" "" "" "CFTR(NM_000492.3):c.2898G>A (p.T966=), CFTR(NM_000492.4):c.2898G>A (p.T966=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117603772G>A" "" "likely benign" "" "0000266732" "0" "90" "7" "117246808" "117246808" "subst" "9.76388E-5" "02325" "CFTR_000016" "g.117246808G>A" "" "" "" "CFTR(NM_000492.3):c.2988+1G>A, CFTR(NM_000492.4):c.2988+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117606754G>A" "" "pathogenic" "" "0000266733" "0" "30" "7" "117250576" "117250576" "subst" "0" "02325" "CFTR_001370" "g.117250576T>C" "" "" "" "CFTR(NM_000492.4):c.2992T>C (p.L998=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117610522T>C" "" "likely benign" "" "0000266734" "0" "90" "7" "117251649" "117251649" "subst" "0.000632194" "02325" "CFTR_000129" "g.117251649T>G" "" "" "" "CFTR(NM_000492.3):c.3154T>G (p.F1052V), CFTR(NM_000492.4):c.3154T>G (p.F1052V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611595T>G" "" "pathogenic" "" "0000266735" "0" "90" "7" "117251691" "117251691" "subst" "3.66345E-5" "02325" "CFTR_000034" "g.117251691C>T" "" "" "" "CFTR(NM_000492.3):c.3196C>T (p.R1066C), CFTR(NM_000492.4):c.3196C>T (p.R1066C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611637C>T" "" "pathogenic" "" "0000266736" "0" "90" "7" "117251771" "117251771" "subst" "1.2199E-5" "02325" "CFTR_000031" "g.117251771C>A" "" "" "" "CFTR(NM_000492.3):c.3276C>A (p.Y1092*), CFTR(NM_000492.4):c.3276C>A (p.Y1092*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611717C>A" "" "pathogenic" "" "0000266737" "0" "90" "7" "117251797" "117251797" "subst" "1.6268E-5" "02325" "CFTR_000043" "g.117251797T>A" "" "" "" "CFTR(NM_000492.4):c.3302T>A (p.M1101K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611743T>A" "" "pathogenic" "" "0000266738" "0" "90" "7" "117267579" "117267579" "subst" "3.26216E-5" "02325" "CFTR_000037" "g.117267579C>T" "" "" "" "CFTR(NM_000492.3):c.3472C>T (p.R1158*), CFTR(NM_000492.4):c.3472C>T (p.R1158*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117627525C>T" "" "pathogenic" "" "0000266739" "0" "90" "7" "117267591" "117267591" "subst" "5.29799E-5" "02325" "CFTR_000012" "g.117267591C>T" "" "" "" "CFTR(NM_000492.3):c.3484C>T (p.R1162*), CFTR(NM_000492.4):c.3484C>T (p.R1162*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117627537C>T" "" "pathogenic" "" "0000266740" "0" "90" "7" "117171028" "117171028" "subst" "0.00021164" "02325" "CFTR_000049" "g.117171028C>T" "" "" "" "CFTR(NM_000492.3):c.349C>T (p.R117C), CFTR(NM_000492.4):c.349C>T (p.R117C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117530974C>T" "" "pathogenic" "" "0000266741" "0" "90" "7" "117171029" "117171029" "subst" "0.00147328" "02325" "CFTR_000006" "g.117171029G>A" "" "" "" "CFTR(NM_000492.3):c.350G>A (p.R117H, p.(Arg117His)), CFTR(NM_000492.4):c.350G>A (p.R117H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic" "" "0000266742" "0" "90" "7" "117267635" "117267635" "del" "0" "02325" "CFTR_001383" "g.117267635del" "" "" "" "CFTR(NM_000492.3):c.3528delC (p.K1177Sfs*15), CFTR(NM_000492.4):c.3528delC (p.K1177Sfs*15)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117627581del" "" "pathogenic" "" "0000266743" "0" "30" "7" "117171039" "117171039" "subst" "5.69907E-5" "02325" "CFTR_001317" "g.117171039G>A" "" "" "" "CFTR(NM_000492.4):c.360G>A (p.A120=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117530985G>A" "" "likely benign" "" "0000266744" "0" "90" "7" "117171045" "117171045" "subst" "0" "02325" "CFTR_000045" "g.117171045T>A" "" "" "" "CFTR(NM_000492.4):c.366T>A (p.Y122*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117530991T>A" "" "pathogenic" "" "0000266745" "0" "90" "7" "117282547" "117282547" "dup" "0" "02325" "CFTR_001386" "g.117282547dup" "" "" "" "CFTR(NM_000492.3):c.3773dupT (p.L1258Ffs*7), CFTR(NM_000492.4):c.3773dupT (p.L1258Ffs*7)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117642493dup" "" "pathogenic" "" "0000266746" "0" "90" "7" "117282620" "117282620" "subst" "0.0004396" "02325" "CFTR_000005" "g.117282620G>A" "" "" "" "CFTR(NM_000492.3):c.3846G>A (p.W1282*), CFTR(NM_000492.4):c.3846G>A (p.W1282*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117642566G>A" "" "pathogenic" "" "0000266747" "0" "90" "7" "117292931" "117292931" "subst" "0.000139103" "02325" "CFTR_000004" "g.117292931C>G" "" "" "" "CFTR(NM_000492.3):c.3909C>G (p.N1303K), CFTR(NM_000492.4):c.3909C>G (p.N1303K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117652877C>G" "" "pathogenic" "" "0000266748" "0" "10" "7" "117307108" "117307108" "subst" "0.217664" "02325" "CFTR_001400" "g.117307108G>A" "" "" "" "CFTR(NM_000492.3):c.4389G>A (p.Q1463=), CFTR(NM_000492.4):c.4389G>A (p.(Gln1463=), p.Q1463=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117667054G>A" "" "benign" "" "0000266749" "0" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "02325" "CFTR_000009" "g.117171169G>T" "" "" "" "CFTR(NM_000492.3):c.489+1G>T, CFTR(NM_000492.4):c.489+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic" "" "0000266750" "0" "50" "7" "117174411" "117174411" "subst" "8.15647E-6" "02325" "CFTR_001320" "g.117174411T>G" "" "" "" "CFTR(NM_000492.4):c.571T>G (p.F191V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117534357T>G" "" "VUS" "" "0000266751" "0" "90" "7" "117174420" "117174420" "subst" "4.08373E-5" "02325" "CFTR_000044" "g.117174420G>T" "" "" "" "CFTR(NM_000492.3):c.579+1G>T, CFTR(NM_000492.4):c.579+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117534366G>T" "" "pathogenic" "" "0000266752" "0" "90" "7" "117175339" "117175339" "subst" "0.000190896" "02325" "CFTR_000041" "g.117175339T>G" "" "" "" "CFTR(NM_000492.3):c.617T>G (p.L206W), CFTR(NM_000492.4):c.617T>G (p.L206W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117535285T>G" "" "pathogenic" "" "0000266753" "0" "90" "7" "117175402" "117175402" "subst" "4.0623E-6" "02325" "CFTR_000143" "g.117175402T>G" "" "" "" "CFTR(NM_000492.4):c.680T>G (p.L227R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117535348T>G" "" "pathogenic" "" "0000266754" "0" "30" "7" "117180174" "117180174" "subst" "0.000562421" "02325" "CFTR_001327" "g.117180174G>A" "" "" "" "CFTR(NM_000492.3):c.890G>A (p.R297Q), CFTR(NM_000492.4):c.890G>A (p.R297Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540120G>A" "" "likely benign" "" "0000266755" "0" "90" "7" "117180232" "117180232" "del" "0" "02325" "CFTR_001328" "g.117180232del" "" "" "" "CFTR(NM_000492.3):c.948delT (p.F316Lfs*12), CFTR(NM_000492.4):c.948delT (p.F316Lfs*12)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540178del" "" "pathogenic" "" "0000268101" "0" "90" "7" "117180324" "117180324" "subst" "2.44035E-5" "02329" "CFTR_000039" "g.117180324G>A" "" "" "" "CFTR(NM_000492.4):c.1040G>A (p.R347H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540270G>A" "" "pathogenic" "" "0000268102" "0" "90" "7" "117188849" "117188849" "subst" "0" "02329" "CFTR_000032" "g.117188849C>A" "" "" "" "CFTR(NM_000492.3):c.1364C>A (p.A455E), CFTR(NM_000492.4):c.1364C>A (p.(Ala455Glu), p.A455E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117548795C>A" "" "pathogenic" "" "0000270073" "0" "30" "7" "117243664" "117243664" "subst" "4.46897E-5" "02326" "CFTR_001362" "g.117243664G>A" "" "" "" "CFTR(NM_000492.3):c.2736G>A (p.S912=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117603610G>A" "" "likely benign" "" "0000273310" "0" "10" "7" "117120141" "117120141" "subst" "0.0461313" "01943" "CFTR_001312" "g.117120141G>C" "" "" "" "CFTR(NM_000492.3):c.-8G>C, CFTR(NM_000492.4):c.-8G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117480087G>C" "" "benign" "" "0000273311" "0" "10" "7" "117307295" "117307295" "dup" "0" "01943" "CFTR_001402" "g.117307295dup" "" "" "" "CFTR(NM_000492.3):c.*133dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117667241dup" "" "benign" "" "0000273312" "0" "10" "7" "117307295" "117307295" "del" "0" "01943" "CFTR_001403" "g.117307295del" "" "" "" "CFTR(NM_000492.3):c.*133delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117667241del" "" "benign" "" "0000273313" "0" "90" "7" "117180284" "117180284" "subst" "6.09796E-5" "01943" "CFTR_000026" "g.117180284C>T" "" "" "" "CFTR(NM_000492.3):c.1000C>T (p.R334W), CFTR(NM_000492.4):c.1000C>T (p.R334W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540230C>T" "" "pathogenic" "" "0000273314" "0" "90" "7" "117180291" "117180291" "subst" "4.06497E-6" "01943" "CFTR_000079" "g.117180291T>A" "" "" "" "CFTR(NM_000492.3):c.1007T>A (p.I336K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540237T>A" "" "pathogenic" "" "0000273315" "0" "90" "7" "117180324" "117180324" "subst" "2.44035E-5" "01943" "CFTR_000020" "g.117180324G>C" "" "" "" "CFTR(NM_000492.3):c.1040G>C (p.R347P), CFTR(NM_000492.4):c.1040G>C (p.R347P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540270G>C" "" "pathogenic" "" "0000273316" "0" "50" "7" "117180330" "117180330" "subst" "0.000109827" "01943" "CFTR_001330" "g.117180330C>T" "" "" "" "CFTR(NM_000492.3):c.1046C>T (p.A349V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540276C>T" "" "VUS" "" "0000273317" "0" "50" "7" "117180336" "117180336" "subst" "0.00018706" "01943" "CFTR_001129" "g.117180336C>G" "" "" "" "CFTR(NM_000492.3):c.1052C>G (p.T351S), CFTR(NM_000492.4):c.1052C>G (p.(Thr351Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540282C>G" "" "VUS" "" "0000273318" "0" "90" "7" "117180365" "117180365" "subst" "8.13723E-6" "01943" "CFTR_001331" "g.117180365T>C" "" "" "" "CFTR(NM_000492.3):c.1081T>C (p.W361R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540311T>C" "" "pathogenic" "" "0000273319" "0" "90" "7" "117144368" "117144368" "subst" "0" "01943" "CFTR_000091" "g.117144368C>T" "" "" "" "CFTR(NM_000492.3):c.115C>T (p.Q39*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117504314C>T" "" "pathogenic" "" "0000273320" "0" "90" "7" "117182115" "117182121" "del" "0" "01943" "CFTR_001332" "g.117182115_117182121del" "" "" "" "CFTR(NM_000492.3):c.1162_1168delACGACTA (p.T388Qfs*3)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117542061_117542067del" "" "pathogenic" "" "0000273321" "0" "10" "7" "117182190" "117182190" "subst" "0.000171127" "01943" "CFTR_001333" "g.117182190C>T" "" "" "" "CFTR(NM_000492.3):c.1209+28C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117542136C>T" "" "benign" "" "0000273322" "0" "90" "7" "117188696" "117188696" "del" "0" "01943" "CFTR_001204" "g.117188696del" "" "" "" "CFTR(NM_000492.3):c.1210-1delG, CFTR(NM_000492.3):c.1211delG (p.G404Dfs*38), CFTR(NM_000492.4):c.1210-1delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117548642del" "" "pathogenic" "" "0000273323" "0" "90" "7" "117188772" "117188772" "del" "0" "01943" "CFTR_001335" "g.117188772del" "" "" "" "CFTR(NM_000492.3):c.1287delC (p.F430Sfs*12)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117548718del" "" "pathogenic" "" "0000273324" "0" "90" "7" "117188849" "117188849" "subst" "0" "01943" "CFTR_000032" "g.117188849C>A" "" "" "" "CFTR(NM_000492.3):c.1364C>A (p.A455E), CFTR(NM_000492.4):c.1364C>A (p.(Ala455Glu), p.A455E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117548795C>A" "" "pathogenic" "" "0000273325" "0" "70" "7" "117188852" "117188852" "subst" "0" "01943" "CFTR_001336" "g.117188852T>C" "" "" "" "CFTR(NM_000492.3):c.1367T>C (p.V456A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117548798T>C" "" "likely pathogenic" "" "0000273326" "0" "90" "7" "117144390" "117144390" "subst" "0" "01943" "CFTR_001168" "g.117144390C>A" "" "" "" "CFTR(NM_000492.3):c.137C>A (p.A46D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117504336C>A" "" "pathogenic" "" "0000273327" "0" "90" "7" "117188877" "117188877" "subst" "0" "01943" "CFTR_001337" "g.117188877G>T" "" "" "" "CFTR(NM_000492.3):c.1392G>T (p.K464N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117548823G>T" "" "pathogenic" "" "0000273328" "0" "90" "7" "117199517" "117199517" "subst" "3.25264E-5" "01943" "CFTR_000104" "g.117199517G>A" "" "" "" "CFTR(NM_000492.3):c.1393-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559463G>A" "" "pathogenic" "" "0000273329" "0" "90" "7" "117199522" "117199522" "subst" "1.21953E-5" "01943" "CFTR_001108" "g.117199522C>G" "" "" "" "CFTR(NM_000492.3):c.1397C>G (p.S466*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559468C>G" "" "pathogenic" "" "0000273330" "0" "90" "7" "117199591" "117199591" "subst" "4.06329E-6" "01943" "CFTR_000109" "g.117199591C>A" "" "" "" "CFTR(NM_000492.3):c.1466C>A (p.S489*), CFTR(NM_000492.4):c.1466C>A (p.S489*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559537C>A" "" "pathogenic" "" "0000273331" "0" "50" "7" "117199591" "117199591" "subst" "0" "01943" "CFTR_001339" "g.117199591C>T" "" "" "" "CFTR(NM_000492.3):c.1466C>T (p.S489L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559537C>T" "" "VUS" "" "0000273332" "0" "90" "7" "117199602" "117199602" "subst" "2.03178E-5" "01943" "CFTR_000024" "g.117199602C>T" "" "" "" "CFTR(NM_000492.3):c.1477C>T (p.Q493*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559548C>T" "" "pathogenic" "" "0000273333" "0" "90" "7" "117199644" "117199646" "del" "0" "01943" "CFTR_000017" "g.117199644_117199646del" "" "" "" "CFTR(NM_000492.3):c.1519_1521delATC (p.I507del), CFTR(NM_000492.4):c.1519_1521delATC (p.I507del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559590_117559592del" "" "pathogenic" "" "0000273335" "0" "90" "7" "117199646" "117199648" "del" "0" "01943" "CFTR_000001" "g.117199646_117199648del" "" "" "" "CFTR(NM_000492.3):c.1521_1523delCTT (p.(Phe508del)), CFTR(NM_000492.3):c.1521_1523delCTT (p.F508del), CFTR(NM_000492.4):c.1521_1523delCTT (p.F508del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic" "" "0000273336" "0" "10" "7" "117199648" "117199648" "subst" "0.000906775" "01943" "CFTR_001342" "g.117199648T>G" "" "" "" "CFTR(NM_000492.3):c.1523T>G (p.F508C), CFTR(NM_000492.4):c.1523T>G (p.F508C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559594T>G" "" "benign" "" "0000273337" "0" "90" "7" "117199670" "117199671" "del" "0" "01943" "CFTR_000056" "g.117199670_117199671del" "" "" "" "CFTR(NM_000492.3):c.1545_1546delTA (p.Y515*), CFTR(NM_000492.4):c.1545_1546delTA (p.Y515*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559616_117559617del" "" "pathogenic" "" "0000273338" "0" "50" "7" "117199709" "117199709" "subst" "0.016887" "01943" "CFTR_001343" "g.117199709G>A" "" "" "" "CFTR(NM_000492.3):c.1584G>A (p.E528=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559655G>A" "" "VUS" "" "0000273339" "0" "90" "7" "117227792" "117227792" "subst" "8.54965E-5" "01943" "CFTR_000008" "g.117227792G>A" "" "" "" "CFTR(NM_000492.3):c.1585-1G>A, CFTR(NM_000492.4):c.1585-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587738G>A" "" "pathogenic" "" "0000273340" "0" "90" "7" "117227832" "117227832" "subst" "0.000358192" "01943" "CFTR_000002" "g.117227832G>T" "" "" "" "CFTR(NM_000492.3):c.1624G>T (p.G542*), CFTR(NM_000492.4):c.1624G>T (p.G542*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587778G>T" "" "pathogenic" "" "0000273341" "0" "90" "7" "117227856" "117227856" "subst" "0" "01943" "CFTR_001215" "g.117227856G>T" "" "" "" "CFTR(NM_000492.3):c.1648G>T (p.G550*), CFTR(NM_000492.4):c.1648G>T (p.(Gly550*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587802G>T" "" "pathogenic" "" "0000273342" "0" "90" "7" "117227860" "117227860" "subst" "0.00017913" "01943" "CFTR_000003" "g.117227860G>A" "" "" "" "CFTR(NM_000492.3):c.1652G>A (p.G551D), CFTR(NM_000492.4):c.1652G>A (p.G551D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic" "" "0000273343" "0" "90" "7" "117227862" "117227862" "subst" "0" "01943" "CFTR_000086" "g.117227862C>T" "" "" "" "CFTR(NM_000492.3):c.1654C>T (p.Q552*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587808C>T" "" "pathogenic" "" "0000273344" "0" "90" "7" "117227865" "117227865" "subst" "7.33E-5" "01943" "CFTR_000007" "g.117227865C>T" "" "" "" "CFTR(NM_000492.3):c.1657C>T (p.R553*), CFTR(NM_000492.4):c.1657C>T (p.R553*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587811C>T" "" "pathogenic" "" "0000273345" "0" "10" "7" "117227997" "117227997" "dup" "0" "01943" "CFTR_001345" "g.117227997dup" "" "" "" "CFTR(NM_000492.3):c.1679+110dupA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587943dup" "" "benign" "" "0000273346" "0" "10" "7" "117227905" "117227905" "subst" "7.37113E-5" "01943" "CFTR_001344" "g.117227905G>A" "" "" "" "CFTR(NM_000492.3):c.1679+18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587851G>A" "" "benign" "" "0000273347" "0" "90" "7" "117227888" "117227888" "subst" "0" "01943" "CFTR_001219" "g.117227888G>C" "" "" "" "CFTR(NM_000492.3):c.1679+1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587834G>C" "" "pathogenic" "" "0000273348" "0" "90" "7" "117227887" "117227887" "subst" "2.03832E-5" "01943" "CFTR_000022" "g.117227887G>C" "" "" "" "CFTR(NM_000492.3):c.1679G>C (p.R560T), CFTR(NM_000492.4):c.1679G>C (p.R560T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587833G>C" "" "pathogenic" "" "0000273349" "0" "90" "7" "117230406" "117230406" "subst" "0" "01943" "CFTR_001346" "g.117230406G>C" "" "" "" "CFTR(NM_000492.3):c.1680-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117590352G>C" "" "pathogenic" "" "0000273350" "0" "90" "7" "117230452" "117230454" "delins" "0" "01943" "CFTR_001348" "g.117230452_117230454delinsAT" "" "" "" "CFTR(NM_000492.3):c.1725_1727delTGGinsAT (p.F575Lfs*4)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117590398_117590400delinsAT" "" "pathogenic" "" "0000273351" "0" "90" "7" "117230480" "117230480" "subst" "2.042E-5" "01943" "CFTR_000070" "g.117230480G>T" "" "" "" "CFTR(NM_000492.3):c.1753G>T (p.E585*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117590426G>T" "" "pathogenic" "" "0000273352" "0" "90" "7" "117230498" "117230498" "subst" "2.45588E-5" "01943" "CFTR_001227" "g.117230498G>T" "" "" "" "CFTR(NM_000492.3):c.1766+5G>T, CFTR(NM_000492.4):c.1766+5G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117590444G>T" "" "pathogenic" "" "0000273353" "0" "10" "7" "117231852" "117231852" "subst" "0" "01943" "CFTR_001349" "g.117231852T>C" "" "" "" "CFTR(NM_000492.3):c.1767-136T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117591798T>C" "" "benign" "" "0000273354" "0" "90" "7" "117149101" "117149101" "subst" "2.44296E-5" "01943" "CFTR_000025" "g.117149101G>T" "" "" "" "CFTR(NM_000492.3):c.178G>T (p.E60*), CFTR(NM_000492.4):c.178G>T (p.E60*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117509047G>T" "" "pathogenic" "" "0000273355" "0" "90" "7" "117232233" "117232233" "del" "0" "01943" "CFTR_001351" "g.117232233del" "" "" "" "CFTR(NM_000492.3):c.2012delT (p.L671*), CFTR(NM_000492.4):c.2012delT (p.L671*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592179del" "" "pathogenic" "" "0000273356" "0" "90" "7" "117232258" "117232258" "subst" "0" "01943" "CFTR_001352" "g.117232258G>A" "" "" "" "CFTR(NM_000492.3):c.2037G>A (p.W679*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592204G>A" "" "pathogenic" "" "0000273357" "0" "90" "7" "117232272" "117232273" "delins" "0" "01943" "CFTR_000013" "g.117232272_117232273delinsG" "" "" "" "CFTR(NM_000492.3):c.2051_2052delAAinsG (p.K684Sfs*38)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592218_117592219delinsG" "" "pathogenic" "" "0000273358" "0" "90" "7" "117232273" "117232273" "dup" "0" "01943" "CFTR_001353" "g.117232273dup" "" "" "" "CFTR(NM_000492.3):c.2052dupA (p.Q685Tfs*4), CFTR(NM_000492.4):c.2052dupA (p.Q685Tfs*4)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592219dup" "" "pathogenic" "" "0000273359" "0" "50" "7" "117232389" "117232389" "subst" "2.84481E-5" "01943" "CFTR_001354" "g.117232389G>T" "" "" "" "CFTR(NM_000492.3):c.2168G>T (p.G723V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592335G>T" "" "VUS" "" "0000273360" "0" "90" "7" "117232416" "117232416" "subst" "4.06296E-6" "01943" "CFTR_000122" "g.117232416T>G" "" "" "" "CFTR(NM_000492.3):c.2195T>G (p.L732*), CFTR(NM_000492.4):c.2195T>G (p.L732*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592362T>G" "" "pathogenic" "" "0000273361" "0" "90" "7" "117149143" "117149143" "subst" "0.00142434" "01943" "CFTR_000087" "g.117149143C>T" "" "" "" "CFTR(NM_000492.3):c.220C>T (p.R74W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117509089C>T" "" "pathogenic" "" "0000273362" "0" "90" "7" "117232511" "117232511" "subst" "4.52108E-6" "01943" "CFTR_000118" "g.117232511C>T" "" "" "" "CFTR(NM_000492.3):c.2290C>T (p.R764*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592457C>T" "" "pathogenic" "" "0000273363" "0" "90" "7" "117232646" "117232646" "del" "0" "01943" "CFTR_001356" "g.117232646del" "" "" "" "CFTR(NM_000492.3):c.2425delT (p.S809Qfs*12)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592592del" "" "pathogenic" "" "0000273364" "0" "90" "7" "117235030" "117235030" "subst" "0" "01943" "CFTR_000069" "g.117235030G>A" "" "" "" "CFTR(NM_000492.3):c.2537G>A (p.W846*), CFTR(NM_000492.4):c.2537G>A (p.W846*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117594976G>A" "" "pathogenic" "" "0000273365" "0" "90" "7" "117235040" "117235040" "subst" "0" "01943" "CFTR_001242" "g.117235040C>A" "" "" "" "CFTR(NM_000492.3):c.2547C>A (p.Y849*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117594986C>A" "" "pathogenic" "" "0000273366" "0" "90" "7" "117149177" "117149177" "subst" "4.47839E-5" "01943" "CFTR_000015" "g.117149177G>A" "" "" "" "CFTR(NM_000492.3):c.254G>A (p.G85E), CFTR(NM_000492.4):c.254G>A (p.G85E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117509123G>A" "" "pathogenic" "" "0000273367" "0" "90" "7" "117235044" "117235044" "subst" "0" "01943" "CFTR_000126" "g.117235044C>T" "" "" "" "CFTR(NM_000492.3):c.2551C>T (p.R851*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117594990C>T" "" "pathogenic" "" "0000273368" "0" "30" "7" "117235052" "117235052" "subst" "0.000345349" "01943" "CFTR_001358" "g.117235052T>C" "" "" "" "CFTR(NM_000492.3):c.2559T>C (p.I853=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117594998T>C" "" "likely benign" "" "0000273369" "0" "10" "7" "117235055" "117235055" "subst" "0.382582" "01943" "CFTR_001359" "g.117235055T>G" "" "" "" "CFTR(NM_000492.3):c.2562T>G (p.T854=), CFTR(NM_000492.4):c.2562T>G (p.(Thr854=), p.T854=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117595001T>G" "" "benign" "" "0000273370" "0" "90" "7" "117149185" "117149186" "del" "0" "01943" "CFTR_000027" "g.117149185_117149186del" "" "" "" "CFTR(NM_000492.3):c.262_263delTT (p.L88Ifs*22), CFTR(NM_000492.4):c.262_263delTT (p.L88Ifs*22)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117509131_117509132del" "" "pathogenic" "" "0000273371" "0" "50" "7" "117242865" "117242865" "subst" "0.00266809" "01943" "CFTR_001360" "g.117242865C>G" "" "" "" "CFTR(NM_000492.3):c.2620-15C>G, CFTR(NM_000492.4):c.2620-15C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117602811C>G" "" "VUS" "" "0000273372" "0" "90" "7" "117242922" "117242922" "subst" "7.30953E-5" "01943" "CFTR_000010" "g.117242922G>A" "" "" "" "CFTR(NM_000492.3):c.2657+5G>A, CFTR(NM_000492.4):c.2657+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117602868G>A" "" "pathogenic" "" "0000273373" "0" "90" "7" "117243607" "117243607" "subst" "1.21936E-5" "01943" "CFTR_001361" "g.117243607G>T" "" "" "" "CFTR(NM_000492.3):c.2679G>T (p.G893=), CFTR(NM_000492.4):c.2679G>T (p.G893=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117603553G>T" "" "pathogenic" "" "0000273375" "0" "10" "7" "117170947" "117170947" "subst" "0.000460829" "01943" "CFTR_001316" "g.117170947T>C" "" "" "" "CFTR(NM_000492.3):c.274-6T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117530893T>C" "" "benign" "" "0000273376" "0" "10" "7" "117243826" "117243826" "subst" "0.00576904" "01943" "CFTR_001363" "g.117243826G>A" "" "" "" "CFTR(NM_000492.3):c.2898G>A (p.T966=), CFTR(NM_000492.4):c.2898G>A (p.T966=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117603772G>A" "" "benign" "" "0000273377" "0" "50" "7" "117243828" "117243828" "subst" "0.000707357" "01943" "CFTR_001364" "g.117243828T>C" "" "" "" "CFTR(NM_000492.3):c.2900T>C (p.L967S), CFTR(NM_000492.4):c.2900T>C (p.L967S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117603774T>C" "" "VUS" "" "0000273379" "0" "10" "7" "117246657" "117246657" "subst" "0" "01943" "CFTR_001368" "g.117246657G>C" "" "" "" "CFTR(NM_000492.3):c.2909-71G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117606603G>C" "" "benign" "" "0000273380" "0" "10" "7" "117246636" "117246636" "subst" "0" "01943" "CFTR_001367" "g.117246636G>A" "" "" "" "CFTR(NM_000492.3):c.2909-92G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117606582G>A" "" "benign" "" "0000273381" "0" "90" "7" "117246800" "117246800" "subst" "4.06676E-6" "01943" "CFTR_001369" "g.117246800T>G" "" "" "" "CFTR(NM_000492.3):c.2981T>G (p.F994C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117606746T>G" "" "pathogenic" "" "0000273382" "0" "90" "7" "117246808" "117246808" "subst" "9.76388E-5" "01943" "CFTR_000016" "g.117246808G>A" "" "" "" "CFTR(NM_000492.3):c.2988+1G>A, CFTR(NM_000492.4):c.2988+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117606754G>A" "" "pathogenic" "" "0000273383" "0" "50" "7" "117250575" "117250575" "subst" "0.0022857" "01943" "CFTR_000082" "g.117250575G>C" "" "" "" "CFTR(NM_000492.3):c.2991G>C (p.L997F), CFTR(NM_000492.4):c.2991G>C (p.(Leu997Phe), p.L997F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117610521G>C" "" "VUS" "" "0000273384" "0" "50" "7" "117250628" "117250628" "subst" "0" "01943" "CFTR_001371" "g.117250628T>A" "" "" "" "CFTR(NM_000492.3):c.3044T>A (p.I1015N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117610574T>A" "" "VUS" "" "0000273385" "0" "90" "7" "117250651" "117250656" "del" "0" "01943" "CFTR_001372" "g.117250651_117250656del" "" "" "" "CFTR(NM_000492.3):c.3067_3072delATAGTG (p.I1023_V1024del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117610597_117610602del" "" "pathogenic" "" "0000273386" "0" "10" "7" "117250741" "117250741" "subst" "0.00135521" "01943" "CFTR_001373" "g.117250741C>T" "" "" "" "CFTR(NM_000492.3):c.3139+18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117610687C>T" "" "benign" "" "0000273387" "0" "90" "7" "117251649" "117251649" "subst" "0.000632194" "01943" "CFTR_000129" "g.117251649T>G" "" "" "" "CFTR(NM_000492.3):c.3154T>G (p.F1052V), CFTR(NM_000492.4):c.3154T>G (p.F1052V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611595T>G" "" "pathogenic" "" "0000273388" "0" "90" "7" "117251691" "117251691" "subst" "3.66345E-5" "01943" "CFTR_000034" "g.117251691C>T" "" "" "" "CFTR(NM_000492.3):c.3196C>T (p.R1066C), CFTR(NM_000492.4):c.3196C>T (p.R1066C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611637C>T" "" "pathogenic" "" "0000273389" "0" "90" "7" "117251692" "117251692" "subst" "3.25632E-5" "01943" "CFTR_000080" "g.117251692G>A" "" "" "" "CFTR(NM_000492.3):c.3197G>A (p.R1066H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611638G>A" "" "pathogenic" "" "0000273390" "0" "50" "7" "117251703" "117251703" "subst" "4.88301E-5" "01943" "CFTR_000124" "g.117251703C>T" "" "" "" "CFTR(NM_000492.3):c.3208C>T (p.R1070W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611649C>T" "" "VUS" "" "0000273391" "0" "90" "7" "117251704" "117251704" "subst" "0.000622665" "01943" "CFTR_000107" "g.117251704G>A" "" "" "" "CFTR(NM_000492.3):c.3209G>A (p.R1070Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611650G>A" "" "pathogenic" "" "0000273392" "0" "90" "7" "117251771" "117251771" "subst" "1.2199E-5" "01943" "CFTR_000031" "g.117251771C>A" "" "" "" "CFTR(NM_000492.3):c.3276C>A (p.Y1092*), CFTR(NM_000492.4):c.3276C>A (p.Y1092*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611717C>A" "" "pathogenic" "" "0000273393" "0" "90" "7" "117254702" "117254703" "del" "0" "01943" "CFTR_001376" "g.117254702_117254703del" "" "" "" "CFTR(NM_000492.3):c.3403_3404delTT (p.L1135Sfs*20)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117614648_117614649del" "" "pathogenic" "" "0000273394" "0" "90" "7" "117254706" "117254721" "del" "0" "01943" "CFTR_001377" "g.117254706_117254721del" "" "" "" "CFTR(NM_000492.3):c.3407_3422delCCATGAATATCATGAG (p.A1136Vfs*7)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117614652_117614667del" "" "pathogenic" "" "0000273395" "0" "30" "7" "117254728" "117254728" "subst" "8.54249E-5" "01943" "CFTR_001379" "g.117254728G>A" "" "" "" "CFTR(NM_000492.3):c.3429G>A (p.L1143=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117614674G>A" "" "likely benign" "" "0000273396" "0" "50" "7" "117267556" "117267556" "subst" "0.00153712" "01943" "CFTR_001380" "g.117267556T>C" "" "" "" "CFTR(NM_000492.3):c.3469-20T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117627502T>C" "" "VUS" "" "0000273397" "0" "90" "7" "117267583" "117267583" "subst" "4.07634E-6" "01943" "CFTR_001381" "g.117267583C>T" "" "" "" "CFTR(NM_000492.3):c.3476C>T (p.S1159F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117627529C>T" "" "pathogenic" "" "0000273398" "0" "90" "7" "117267588" "117267593" "delins" "0" "01943" "CFTR_001382" "g.117267588_117267593delinsGG" "" "" "" "CFTR(NM_000492.3):c.3481_3486delAGCCGAinsGG (p.S1161Gfs*30)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117627534_117627539delinsGG" "" "pathogenic" "" "0000273399" "0" "90" "7" "117267591" "117267591" "subst" "5.29799E-5" "01943" "CFTR_000012" "g.117267591C>T" "" "" "" "CFTR(NM_000492.3):c.3484C>T (p.R1162*), CFTR(NM_000492.4):c.3484C>T (p.R1162*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117627537C>T" "" "pathogenic" "" "0000273400" "0" "50" "7" "117267592" "117267592" "subst" "0.000656131" "01943" "CFTR_000156" "g.117267592G>T" "" "" "" "CFTR(NM_000492.3):c.3485G>T (p.R1162L), CFTR(NM_000492.4):c.3485G>T (p.R1162L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117627538G>T" "" "VUS" "" "0000273401" "0" "90" "7" "117171028" "117171028" "subst" "0.00021164" "01943" "CFTR_000049" "g.117171028C>T" "" "" "" "CFTR(NM_000492.3):c.349C>T (p.R117C), CFTR(NM_000492.4):c.349C>T (p.R117C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117530974C>T" "" "pathogenic" "" "0000273402" "0" "90" "7" "117171029" "117171029" "subst" "0.00147328" "01943" "CFTR_000006" "g.117171029G>A" "" "" "" "CFTR(NM_000492.3):c.350G>A (p.R117H, p.(Arg117His)), CFTR(NM_000492.4):c.350G>A (p.R117H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic" "" "0000273403" "0" "90" "7" "117267635" "117267635" "del" "0" "01943" "CFTR_001383" "g.117267635del" "" "" "" "CFTR(NM_000492.3):c.3528delC (p.K1177Sfs*15), CFTR(NM_000492.4):c.3528delC (p.K1177Sfs*15)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117627581del" "" "pathogenic" "" "0000273404" "0" "90" "7" "117267653" "117267653" "subst" "0" "01943" "CFTR_001384" "g.117267653C>G" "" "" "" "CFTR(NM_000492.3):c.3546C>G (p.Y1182*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117627599C>G" "" "pathogenic" "" "0000273405" "0" "90" "7" "117267766" "117267766" "del" "4.0832E-6" "01943" "CFTR_001385" "g.117267766del" "" "" "" "CFTR(NM_000492.3):c.3659delC (p.T1220Kfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117627712del" "" "pathogenic" "" "0000273406" "0" "90" "7" "117282547" "117282547" "dup" "0" "01943" "CFTR_001386" "g.117282547dup" "" "" "" "CFTR(NM_000492.3):c.3773dupT (p.L1258Ffs*7), CFTR(NM_000492.4):c.3773dupT (p.L1258Ffs*7)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117642493dup" "" "pathogenic" "" "0000273407" "0" "90" "7" "117282582" "117282582" "subst" "0.00119238" "01943" "CFTR_000073" "g.117282582G>A" "" "" "" "CFTR(NM_000492.3):c.3808G>A (p.D1270N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117642528G>A" "" "pathogenic" "" "0000273408" "0" "90" "7" "117282620" "117282620" "subst" "0.0004396" "01943" "CFTR_000005" "g.117282620G>A" "" "" "" "CFTR(NM_000492.3):c.3846G>A (p.W1282*), CFTR(NM_000492.4):c.3846G>A (p.W1282*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117642566G>A" "" "pathogenic" "" "0000273409" "0" "50" "7" "117282628" "117282628" "subst" "0.00066791" "01943" "CFTR_001387" "g.117282628C>T" "" "" "" "CFTR(NM_000492.3):c.3854C>T (p.A1285V, p.(Ala1285Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117642574C>T" "" "VUS" "" "0000273410" "0" "90" "7" "117292905" "117292908" "del" "0" "01943" "CFTR_001296" "g.117292905_117292908del" "" "" "" "CFTR(NM_000492.3):c.3883_3886delATTT (p.I1295Ffs*32)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117652851_117652854del" "" "pathogenic" "" "0000273411" "0" "90" "7" "117292931" "117292931" "subst" "0.000139103" "01943" "CFTR_000004" "g.117292931C>G" "" "" "" "CFTR(NM_000492.3):c.3909C>G (p.N1303K), CFTR(NM_000492.4):c.3909C>G (p.N1303K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117652877C>G" "" "pathogenic" "" "0000273412" "0" "10" "7" "117304726" "117304726" "subst" "8.13988E-6" "01943" "CFTR_001391" "g.117304726T>C" "" "" "" "CFTR(NM_000492.3):c.3964-16T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117664672T>C" "" "benign" "" "0000273413" "0" "90" "7" "117304782" "117304782" "subst" "0" "01943" "CFTR_001392" "g.117304782T>C" "" "" "" "CFTR(NM_000492.3):c.4004T>C (p.L1335P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117664728T>C" "" "pathogenic" "" "0000273414" "0" "90" "7" "117304824" "117304824" "del" "0" "01943" "CFTR_001393" "g.117304824del" "" "" "" "CFTR(NM_000492.3):c.4046delG (p.G1349Afs*5)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117664770del" "" "pathogenic" "" "0000273415" "0" "50" "7" "117304875" "117304875" "subst" "1.21937E-5" "01943" "CFTR_001394" "g.117304875T>C" "" "" "" "CFTR(NM_000492.3):c.4097T>C (p.I1366T), CFTR(NM_000492.4):c.4097T>C (p.I1366T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117664821T>C" "" "VUS" "" "0000273416" "0" "30" "7" "117305573" "117305573" "subst" "7.74208E-5" "01943" "CFTR_001395" "g.117305573C>G" "" "" "" "CFTR(NM_000492.3):c.4197C>G (p.L1399=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117665519C>G" "" "likely benign" "" "0000273417" "0" "50" "7" "117305596" "117305596" "subst" "0" "01943" "CFTR_001396" "g.117305596T>C" "" "" "" "CFTR(NM_000492.3):c.4220T>C (p.M1407T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117665542T>C" "" "VUS" "" "0000273418" "0" "10" "7" "117306991" "117306991" "subst" "0.00657198" "01943" "CFTR_001399" "g.117306991C>T" "" "" "" "CFTR(NM_000492.3):c.4272C>T (p.Y1424=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117666937C>T" "" "benign" "" "0000273419" "0" "10" "7" "117307108" "117307108" "subst" "0.217664" "01943" "CFTR_001400" "g.117307108G>A" "" "" "" "CFTR(NM_000492.3):c.4389G>A (p.Q1463=), CFTR(NM_000492.4):c.4389G>A (p.(Gln1463=), p.Q1463=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117667054G>A" "" "benign" "" "0000273420" "0" "90" "7" "117307145" "117307145" "subst" "2.44244E-5" "01943" "CFTR_001401" "g.117307145C>T" "" "" "" "CFTR(NM_000492.3):c.4426C>T (p.Q1476*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117667091C>T" "" "pathogenic" "" "0000273421" "0" "50" "7" "117171130" "117171130" "subst" "6.52827E-5" "01943" "CFTR_001319" "g.117171130C>A" "" "" "" "CFTR(NM_000492.3):c.451C>A (p.Q151K), CFTR(NM_000492.4):c.451C>A (p.Q151K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117531076C>A" "" "VUS" "" "0000273422" "0" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "01943" "CFTR_000009" "g.117171169G>T" "" "" "" "CFTR(NM_000492.3):c.489+1G>T, CFTR(NM_000492.4):c.489+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic" "" "0000273423" "0" "10" "7" "117120222" "117120222" "subst" "0.000151138" "01943" "CFTR_001313" "g.117120222G>A" "" "" "" "CFTR(NM_000492.3):c.53+21G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117480168G>A" "" "benign" "" "0000273424" "0" "90" "7" "117174420" "117174420" "subst" "4.08373E-5" "01943" "CFTR_000044" "g.117174420G>T" "" "" "" "CFTR(NM_000492.3):c.579+1G>T, CFTR(NM_000492.4):c.579+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117534366G>T" "" "pathogenic" "" "0000273425" "0" "90" "7" "117174424" "117174424" "subst" "0" "01943" "CFTR_000058" "g.117174424G>A" "" "" "" "CFTR(NM_000492.3):c.579+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117534370G>A" "" "pathogenic" "" "0000273426" "0" "90" "7" "117175336" "117175336" "dup" "0" "01943" "CFTR_001321" "g.117175336dup" "" "" "" "CFTR(NM_000492.3):c.614dupC (p.L206Ffs*52)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117535282dup" "" "pathogenic" "" "0000273427" "0" "90" "7" "117175339" "117175339" "subst" "0.000190896" "01943" "CFTR_000041" "g.117175339T>G" "" "" "" "CFTR(NM_000492.3):c.617T>G (p.L206W), CFTR(NM_000492.4):c.617T>G (p.L206W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117535285T>G" "" "pathogenic" "" "0000273428" "0" "90" "7" "117175380" "117175380" "subst" "4.06174E-6" "01943" "CFTR_000074" "g.117175380C>T" "" "" "" "CFTR(NM_000492.3):c.658C>T (p.Q220*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117535326C>T" "" "pathogenic" "" "0000273429" "0" "90" "7" "117175465" "117175465" "subst" "8.1275E-6" "01943" "CFTR_001322" "g.117175465G>C" "" "" "" "CFTR(NM_000492.3):c.743G>C (p.R248T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117535411G>C" "" "pathogenic" "" "0000273431" "0" "10" "7" "117176593" "117176596" "del" "0" "01943" "CFTR_001324" "g.117176593_117176596del" "" "" "" "CFTR(NM_000492.3):c.744-9_744-6delGATT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117536539_117536542del" "" "benign" "" "0000273432" "0" "10" "7" "117176738" "117176738" "subst" "0.0687115" "01943" "CFTR_001325" "g.117176738C>T" "" "" "" "CFTR(NM_000492.3):c.869+11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117536684C>T" "" "benign" "" "0000273433" "0" "50" "7" "117144344" "117144344" "subst" "0.00165252" "01943" "CFTR_000125" "g.117144344C>T" "" "" "" "CFTR(NM_000492.3):c.91C>T (p.R31C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117504290C>T" "" "VUS" "" "0000273434" "0" "90" "7" "117180232" "117180232" "del" "0" "01943" "CFTR_001328" "g.117180232del" "" "" "" "CFTR(NM_000492.3):c.948delT (p.F316Lfs*12), CFTR(NM_000492.4):c.948delT (p.F316Lfs*12)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540178del" "" "pathogenic" "" "0000273435" "0" "50" "7" "117180281" "117180281" "subst" "8.12942E-6" "01943" "CFTR_001329" "g.117180281C>T" "" "" "" "CFTR(NM_000492.3):c.997C>T (p.L333F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540227C>T" "" "VUS" "" "0000337030" "0" "90" "7" "117242922" "117242922" "subst" "7.30953E-5" "02327" "CFTR_000010" "g.117242922G>A" "" "" "" "CFTR(NM_000492.3):c.2657+5G>A, CFTR(NM_000492.4):c.2657+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117602868G>A" "" "pathogenic" "" "0000338980" "0" "10" "7" "117120141" "117120141" "subst" "0.0461313" "02327" "CFTR_001312" "g.117120141G>C" "" "" "" "CFTR(NM_000492.3):c.-8G>C, CFTR(NM_000492.4):c.-8G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117480087G>C" "" "benign" "" "0000339105" "0" "50" "7" "117230454" "117230454" "subst" "0.00503416" "02327" "CFTR_000065" "g.117230454G>C" "" "" "" "CFTR(NM_000492.3):c.1727G>C (p.G576A), CFTR(NM_000492.4):c.1727G>C (p.G576A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117590400G>C" "" "VUS" "" "0000340765" "0" "30" "7" "117199709" "117199709" "subst" "0.016887" "02327" "CFTR_001343" "g.117199709G>A" "" "" "" "CFTR(NM_000492.3):c.1584G>A (p.E528=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559655G>A" "" "likely benign" "" "0000340988" "0" "10" "7" "117251780" "117251780" "subst" "0.0045507" "02327" "CFTR_001375" "g.117251780A>T" "" "" "" "CFTR(NM_000492.3):c.3285A>T (p.T1095=, p.(Thr1095=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611726A>T" "" "benign" "" "0000340989" "0" "30" "7" "117292919" "117292919" "subst" "0.0010524" "02327" "CFTR_001389" "g.117292919A>G" "" "" "" "CFTR(NM_000492.3):c.3897A>G (p.T1299=), CFTR(NM_000492.4):c.3897A>G (p.T1299=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117652865A>G" "" "likely benign" "" "0000341031" "0" "10" "7" "117243826" "117243826" "subst" "0.00576904" "02327" "CFTR_001363" "g.117243826G>A" "" "" "" "CFTR(NM_000492.3):c.2898G>A (p.T966=), CFTR(NM_000492.4):c.2898G>A (p.T966=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117603772G>A" "" "benign" "" "0000341452" "0" "90" "7" "117188849" "117188849" "subst" "0" "02327" "CFTR_000032" "g.117188849C>A" "" "" "" "CFTR(NM_000492.3):c.1364C>A (p.A455E), CFTR(NM_000492.4):c.1364C>A (p.(Ala455Glu), p.A455E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117548795C>A" "" "pathogenic" "" "0000341762" "0" "90" "7" "117267591" "117267591" "subst" "5.29799E-5" "02327" "CFTR_000012" "g.117267591C>T" "" "" "" "CFTR(NM_000492.3):c.3484C>T (p.R1162*), CFTR(NM_000492.4):c.3484C>T (p.R1162*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117627537C>T" "" "pathogenic" "" "0000341772" "0" "70" "7" "117171028" "117171028" "subst" "0.00021164" "02327" "CFTR_000049" "g.117171028C>T" "" "" "" "CFTR(NM_000492.3):c.349C>T (p.R117C), CFTR(NM_000492.4):c.349C>T (p.R117C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117530974C>T" "" "likely pathogenic" "" "0000342409" "0" "50" "7" "117175465" "117175465" "subst" "8.1275E-6" "02327" "CFTR_001322" "g.117175465G>C" "" "" "" "CFTR(NM_000492.3):c.743G>C (p.R248T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117535411G>C" "" "VUS" "" "0000342568" "0" "50" "7" "117180174" "117180174" "subst" "0.000562421" "02327" "CFTR_001327" "g.117180174G>A" "" "" "" "CFTR(NM_000492.3):c.890G>A (p.R297Q), CFTR(NM_000492.4):c.890G>A (p.R297Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117540120G>A" "" "VUS" "" "0000343098" "0" "90" "7" "117227865" "117227865" "subst" "7.33E-5" "02327" "CFTR_000007" "g.117227865C>T" "" "" "" "CFTR(NM_000492.3):c.1657C>T (p.R553*), CFTR(NM_000492.4):c.1657C>T (p.R553*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587811C>T" "" "pathogenic" "" "0000343231" "0" "50" "7" "117232223" "117232223" "subst" "0.00594922" "02327" "CFTR_000059" "g.117232223C>T" "" "" "" "CFTR(NM_000492.3):c.2002C>T (p.R668C), CFTR(NM_000492.4):c.2002C>T (p.R668C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592169C>T" "" "VUS" "" "0000343342" "0" "30" "7" "117149147" "117149147" "subst" "0.0153305" "02327" "CFTR_000092" "g.117149147G>A" "" "" "" "CFTR(NM_000492.3):c.224G>A (p.R75Q, p.(Arg75Gln)), CFTR(NM_000492.4):c.224G>A (p.R75Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117509093G>A" "" "likely benign" "" "0000344102" "0" "50" "7" "117188812" "117188812" "subst" "0" "02327" "CFTR_001206" "g.117188812G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117548758G>T" "" "VUS" "" "0000345488" "0" "50" "7" "117230480" "117230480" "subst" "4.084E-6" "02327" "CFTR_001408" "g.117230480G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117590426G>A" "" "VUS" "" "0000346151" "0" "90" "7" "117227832" "117227832" "subst" "0.000358192" "02327" "CFTR_000002" "g.117227832G>T" "" "" "" "CFTR(NM_000492.3):c.1624G>T (p.G542*), CFTR(NM_000492.4):c.1624G>T (p.G542*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587778G>T" "" "pathogenic" "" "0000346157" "0" "90" "7" "117227860" "117227860" "subst" "0.00017913" "02327" "CFTR_000003" "g.117227860G>A" "" "" "" "CFTR(NM_000492.3):c.1652G>A (p.G551D), CFTR(NM_000492.4):c.1652G>A (p.G551D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic" "" "0000346196" "0" "50" "7" "117232086" "117232086" "subst" "8.82168E-5" "02327" "CFTR_001409" "g.117232086G>A" "" "" "" "CFTR(NM_000492.4):c.1865G>A (p.(Gly622Asp), p.G622D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592032G>A" "" "VUS" "" "0000346198" "0" "50" "7" "117232103" "117232103" "subst" "0" "02327" "CFTR_001410" "g.117232103G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592049G>C" "" "VUS" "" "0000346546" "0" "30" "7" "117250664" "117250664" "subst" "0.000252205" "02327" "CFTR_000064" "g.117250664T>C" "" "" "" "CFTR(NM_000492.3):c.3080T>C (p.I1027T), CFTR(NM_000492.4):c.3080T>C (p.I1027T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117610610T>C" "" "likely benign" "" "0000347181" "0" "50" "7" "117199524" "117199524" "subst" "4.06491E-5" "02327" "CFTR_001406" "g.117199524C>T" "" "" "" "CFTR(NM_000492.4):c.1399C>T (p.L467F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559470C>T" "" "VUS" "" "0000347333" "0" "50" "7" "117149187" "117149187" "subst" "8.14637E-6" "02327" "CFTR_001314" "g.117149187A>C" "" "" "" "CFTR(NM_000492.3):c.264A>C (p.L88F), CFTR(NM_000492.4):c.264A>C (p.L88F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117509133A>C" "" "VUS" "" "0000347352" "0" "50" "7" "117250575" "117250575" "subst" "0.0022857" "02327" "CFTR_000082" "g.117250575G>C" "" "" "" "CFTR(NM_000492.3):c.2991G>C (p.L997F), CFTR(NM_000492.4):c.2991G>C (p.(Leu997Phe), p.L997F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117610521G>C" "" "VUS" "" "0000347917" "0" "50" "7" "117243784" "117243784" "subst" "7.31368E-5" "02327" "CFTR_001411" "g.117243784G>C" "" "" "" "CFTR(NM_000492.4):c.2856G>C (p.M952I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117603730G>C" "" "VUS" "" "0000347927" "0" "50" "7" "117251649" "117251649" "subst" "0.000632194" "02327" "CFTR_000129" "g.117251649T>G" "" "" "" "CFTR(NM_000492.3):c.3154T>G (p.F1052V), CFTR(NM_000492.4):c.3154T>G (p.F1052V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117611595T>G" "" "VUS" "" "0000348063" "0" "50" "7" "117199648" "117199648" "subst" "0.000906775" "02327" "CFTR_001342" "g.117199648T>G" "" "" "" "CFTR(NM_000492.3):c.1523T>G (p.F508C), CFTR(NM_000492.4):c.1523T>G (p.F508C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559594T>G" "" "VUS" "" "0000348684" "0" "50" "7" "117267812" "117267812" "subst" "0.00492072" "02327" "CFTR_000051" "g.117267812T>G" "" "" "" "CFTR(NM_000492.3):c.3705T>G (p.S1235R, p.(Ser1235Arg)), CFTR(NM_000492.4):c.3705T>G (p.S1235R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117627758T>G" "" "VUS" "" "0000348687" "0" "90" "7" "117282526" "117282526" "subst" "8.13603E-6" "02327" "CFTR_000040" "g.117282526G>A" "" "" "" "CFTR(NM_000492.3):c.3752G>A (p.S1251N), CFTR(NM_000492.4):c.3752G>A (p.S1251N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117642472G>A" "" "pathogenic" "" "0000349686" "0" "90" "7" "117282620" "117282620" "subst" "0.0004396" "02327" "CFTR_000005" "g.117282620G>A" "" "" "" "CFTR(NM_000492.3):c.3846G>A (p.W1282*), CFTR(NM_000492.4):c.3846G>A (p.W1282*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117642566G>A" "" "pathogenic" "" "0000350560" "0" "10" "7" "117199533" "117199533" "subst" "0.474443" "02327" "CFTR_001338" "g.117199533G>A" "" "" "" "CFTR(NM_000492.3):c.1408G>A (p.V470M), CFTR(NM_000492.4):c.1408G>A (p.(Val470Met), p.V470M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559479G>A" "" "benign" "" "0000350651" "0" "30" "7" "117232481" "117232481" "subst" "0.00179701" "02327" "CFTR_000160" "g.117232481G>A" "" "" "" "CFTR(NM_000492.3):c.2260G>A (p.V754M), CFTR(NM_000492.4):c.2260G>A (p.(Val754Met), p.V754M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117592427G>A" "" "likely benign" "" "0000350852" "0" "30" "7" "117199721" "117199721" "subst" "0.000220758" "02327" "CFTR_001407" "g.117199721T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.117559667T>C" "" "likely benign" "" "0000369237" "0" "90" "7" "117182085" "117182085" "subst" "0" "02495" "CFTR_001416" "g.117182085C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117542031C>T" "" "pathogenic (recessive)" "" "0000369417" "0" "90" "7" "117232676" "117232676" "subst" "0" "02495" "CFTR_001417" "g.117232676G>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.117592622G>T" "" "pathogenic (recessive)" "" "0000369896" "0" "90" "7" "117304856" "117304856" "del" "0" "02495" "CFTR_001419" "g.117304856del" "" "" "" "4078delG" "" "Germline" "" "" "0" "" "" "g.117664802del" "" "pathogenic (recessive)" "" "0000369897" "0" "90" "7" "117304872" "117304872" "del" "0" "02495" "CFTR_001418" "g.117304872del" "" "" "" "4094delA" "" "Germline" "" "" "0" "" "" "g.117664818del" "" "pathogenic" "" "0000405593" "1" "99" "7" "117149087" "117199710" "del" "0" "00086" "CFTR_001172" "g.[(117144418_117149087)_(117199710_117227792)del; (117235113_117242879)_(117246808_117250572)de]" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele3-10,14b-16" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000530486" "0" "10" "7" "117120141" "117120141" "subst" "0.0461313" "02325" "CFTR_001312" "g.117120141G>C" "" "" "" "CFTR(NM_000492.3):c.-8G>C, CFTR(NM_000492.4):c.-8G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117480087G>C" "" "benign" "" "0000530488" "0" "10" "7" "117144445" "117144445" "subst" "0.00134932" "01943" "CFTR_001421" "g.117144445A>G" "" "" "" "CFTR(NM_000492.3):c.164+28A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117504391A>G" "" "benign" "" "0000530489" "0" "90" "7" "117149101" "117149101" "subst" "2.44296E-5" "02327" "CFTR_000025" "g.117149101G>T" "" "" "" "CFTR(NM_000492.3):c.178G>T (p.E60*), CFTR(NM_000492.4):c.178G>T (p.E60*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117509047G>T" "" "pathogenic" "" "0000530490" "0" "50" "7" "117149144" "117149144" "subst" "0.00026044" "01943" "CFTR_001422" "g.117149144G>A" "" "" "" "CFTR(NM_000492.3):c.221G>A (p.R74Q), CFTR(NM_000492.4):c.221G>A (p.(Arg74Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117509090G>A" "" "VUS" "" "0000530491" "0" "50" "7" "117149147" "117149147" "subst" "0.0153305" "01943" "CFTR_000092" "g.117149147G>A" "" "" "" "CFTR(NM_000492.3):c.224G>A (p.R75Q, p.(Arg75Gln)), CFTR(NM_000492.4):c.224G>A (p.R75Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117509093G>A" "" "VUS" "" "0000530492" "0" "30" "7" "117149147" "117149147" "subst" "0.0153305" "01804" "CFTR_000092" "g.117149147G>A" "" "" "" "CFTR(NM_000492.3):c.224G>A (p.R75Q, p.(Arg75Gln)), CFTR(NM_000492.4):c.224G>A (p.R75Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117509093G>A" "" "likely benign" "" "0000530493" "0" "50" "7" "117149147" "117149147" "subst" "0.0153305" "02325" "CFTR_000092" "g.117149147G>A" "" "" "" "CFTR(NM_000492.3):c.224G>A (p.R75Q, p.(Arg75Gln)), CFTR(NM_000492.4):c.224G>A (p.R75Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117509093G>A" "" "VUS" "" "0000530494" "0" "10" "7" "117149147" "117149147" "subst" "0.0153305" "02326" "CFTR_000092" "g.117149147G>A" "" "" "" "CFTR(NM_000492.3):c.224G>A (p.R75Q, p.(Arg75Gln)), CFTR(NM_000492.4):c.224G>A (p.R75Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117509093G>A" "" "benign" "" "0000530495" "0" "70" "7" "117171007" "117171007" "subst" "2.03366E-5" "02327" "CFTR_000076" "g.117171007G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117530953G>C" "" "likely pathogenic" "" "0000530496" "0" "90" "7" "117171011" "117171011" "subst" "6.10133E-5" "02325" "CFTR_001423" "g.117171011C>T" "" "" "" "CFTR(NM_000492.4):c.332C>T (p.P111L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117530957C>T" "" "pathogenic" "" "0000530497" "0" "90" "7" "117171029" "117171029" "subst" "0.00147328" "01804" "CFTR_000006" "g.117171029G>A" "" "" "" "CFTR(NM_000492.3):c.350G>A (p.R117H, p.(Arg117His)), CFTR(NM_000492.4):c.350G>A (p.R117H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117530975G>A" "" "pathogenic" "" "0000530498" "0" "50" "7" "117171029" "117171029" "subst" "0.00147328" "02327" "CFTR_000006" "g.117171029G>A" "" "" "" "CFTR(NM_000492.3):c.350G>A (p.R117H, p.(Arg117His)), CFTR(NM_000492.4):c.350G>A (p.R117H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117530975G>A" "" "VUS" "" "0000530499" "0" "30" "7" "117171103" "117171103" "subst" "0" "01943" "CFTR_001424" "g.117171103A>C" "" "" "" "CFTR(NM_000492.3):c.424A>C (p.I142L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117531049A>C" "" "likely benign" "" "0000530500" "0" "30" "7" "117171122" "117171122" "subst" "0.00180589" "01943" "CFTR_000048" "g.117171122T>C" "" "" "" "CFTR(NM_000492.3):c.443T>C (p.I148T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117531068T>C" "" "likely benign" "" "0000530501" "0" "70" "7" "117175339" "117175339" "subst" "0.000190896" "02327" "CFTR_000041" "g.117175339T>G" "" "" "" "CFTR(NM_000492.3):c.617T>G (p.L206W), CFTR(NM_000492.4):c.617T>G (p.L206W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117535285T>G" "" "likely pathogenic" "" "0000530502" "0" "30" "7" "117175372" "117175372" "subst" "0.00468322" "01943" "CFTR_001425" "g.117175372A>G" "" "" "" "CFTR(NM_000492.3):c.650A>G (p.E217G), CFTR(NM_000492.4):c.650A>G (p.E217G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117535318A>G" "" "likely benign" "" "0000530504" "0" "30" "7" "117175372" "117175372" "subst" "0.00468322" "02325" "CFTR_001425" "g.117175372A>G" "" "" "" "CFTR(NM_000492.3):c.650A>G (p.E217G), CFTR(NM_000492.4):c.650A>G (p.E217G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117535318A>G" "" "likely benign" "" "0000530505" "0" "10" "7" "117176593" "117176596" "dup" "0" "01943" "CFTR_001426" "g.117176593_117176596dup" "" "" "" "CFTR(NM_000492.3):c.744-9_744-6dupGATT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117536539_117536542dup" "" "benign" "" "0000530506" "0" "50" "7" "117176696" "117176696" "subst" "0" "01943" "CFTR_001427" "g.117176696G>A" "" "" "" "CFTR(NM_000492.3):c.838G>A (p.A280T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117536642G>A" "" "VUS" "" "0000530507" "0" "50" "7" "117180174" "117180174" "subst" "0.000562421" "01943" "CFTR_001327" "g.117180174G>A" "" "" "" "CFTR(NM_000492.3):c.890G>A (p.R297Q), CFTR(NM_000492.4):c.890G>A (p.R297Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117540120G>A" "" "VUS" "" "0000530508" "0" "50" "7" "117180186" "117180186" "subst" "0.000297076" "01943" "CFTR_001428" "g.117180186A>G" "" "" "" "CFTR(NM_000492.3):c.902A>G (p.Y301C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117540132A>G" "" "VUS" "" "0000530509" "0" "30" "7" "117180287" "117180287" "subst" "0" "01943" "CFTR_001429" "g.117180287A>C" "" "" "" "CFTR(NM_000492.3):c.1003A>C (p.K335Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117540233A>C" "" "likely benign" "" "0000530513" "0" "30" "7" "117188688" "117188689" "dup" "0" "02325" "CFTR_001405" "g.117188688_117188689dup" "" "" "" "CFTR(NM_000492.3):c.1210-7_1210-6dupTT, CFTR(NM_000492.4):c.1210-7_1210-6dupTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117548634_117548635dup" "" "likely benign" "" "0000530515" "0" "30" "7" "117188845" "117188847" "del" "0" "01943" "CFTR_001430" "g.117188845_117188847del" "" "" "" "CFTR(NM_000492.3):c.1360_1362delTTG (p.L454del), CFTR(NM_000492.4):c.1360_1362delTTG (p.L454del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117548791_117548793del" "" "likely benign" "" "0000530517" "0" "90" "7" "117188849" "117188849" "subst" "0" "02326" "CFTR_000032" "g.117188849C>A" "" "" "" "CFTR(NM_000492.3):c.1364C>A (p.A455E), CFTR(NM_000492.4):c.1364C>A (p.(Ala455Glu), p.A455E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117548795C>A" "" "pathogenic" "" "0000530519" "0" "90" "7" "117199644" "117199646" "del" "0" "02327" "CFTR_000017" "g.117199644_117199646del" "" "" "" "CFTR(NM_000492.3):c.1519_1521delATC (p.I507del), CFTR(NM_000492.4):c.1519_1521delATC (p.I507del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117559590_117559592del" "" "pathogenic" "" "0000530520" "0" "90" "7" "117199646" "117199648" "del" "0" "02326" "CFTR_000001" "g.117199646_117199648del" "" "" "" "CFTR(NM_000492.3):c.1521_1523delCTT (p.(Phe508del)), CFTR(NM_000492.3):c.1521_1523delCTT (p.F508del), CFTR(NM_000492.4):c.1521_1523delCTT (p.F508del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117559592_117559594del" "" "pathogenic" "" "0000530521" "0" "30" "7" "117199648" "117199648" "subst" "0.000906775" "02325" "CFTR_001342" "g.117199648T>G" "" "" "" "CFTR(NM_000492.3):c.1523T>G (p.F508C), CFTR(NM_000492.4):c.1523T>G (p.F508C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117559594T>G" "" "likely benign" "" "0000530523" "0" "10" "7" "117230454" "117230454" "subst" "0.00503416" "01943" "CFTR_000065" "g.117230454G>C" "" "" "" "CFTR(NM_000492.3):c.1727G>C (p.G576A), CFTR(NM_000492.4):c.1727G>C (p.G576A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117590400G>C" "" "benign" "" "0000530524" "0" "50" "7" "117230454" "117230454" "subst" "0.00503416" "02325" "CFTR_000065" "g.117230454G>C" "" "" "" "CFTR(NM_000492.3):c.1727G>C (p.G576A), CFTR(NM_000492.4):c.1727G>C (p.G576A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117590400G>C" "" "VUS" "" "0000530525" "0" "30" "7" "117230454" "117230454" "subst" "0.00503416" "02326" "CFTR_000065" "g.117230454G>C" "" "" "" "CFTR(NM_000492.3):c.1727G>C (p.G576A), CFTR(NM_000492.4):c.1727G>C (p.G576A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117590400G>C" "" "likely benign" "" "0000530526" "0" "90" "7" "117230494" "117230494" "subst" "3.27166E-5" "01943" "CFTR_000018" "g.117230494G>A" "" "" "" "CFTR(NM_000492.3):c.1766+1G>A, CFTR(NM_000492.4):c.1766+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117590440G>A" "" "pathogenic" "" "0000530527" "0" "90" "7" "117230494" "117230494" "subst" "3.27166E-5" "02325" "CFTR_000018" "g.117230494G>A" "" "" "" "CFTR(NM_000492.3):c.1766+1G>A, CFTR(NM_000492.4):c.1766+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117590440G>A" "" "pathogenic" "" "0000530528" "0" "90" "7" "117232086" "117232086" "subst" "8.82168E-5" "02325" "CFTR_001409" "g.117232086G>A" "" "" "" "CFTR(NM_000492.4):c.1865G>A (p.(Gly622Asp), p.G622D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117592032G>A" "" "pathogenic" "" "0000530529" "0" "10" "7" "117232223" "117232223" "subst" "0.00594922" "01943" "CFTR_000059" "g.117232223C>T" "" "" "" "CFTR(NM_000492.3):c.2002C>T (p.R668C), CFTR(NM_000492.4):c.2002C>T (p.R668C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117592169C>T" "" "benign" "" "0000530530" "0" "50" "7" "117232223" "117232223" "subst" "0.00594922" "02325" "CFTR_000059" "g.117232223C>T" "" "" "" "CFTR(NM_000492.3):c.2002C>T (p.R668C), CFTR(NM_000492.4):c.2002C>T (p.R668C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117592169C>T" "" "VUS" "" "0000530531" "0" "30" "7" "117232223" "117232223" "subst" "0.00594922" "02326" "CFTR_000059" "g.117232223C>T" "" "" "" "CFTR(NM_000492.3):c.2002C>T (p.R668C), CFTR(NM_000492.4):c.2002C>T (p.R668C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117592169C>T" "" "likely benign" "" "0000530532" "0" "30" "7" "117232466" "117232466" "subst" "0.000619811" "02327" "CFTR_001432" "g.117232466C>T" "" "" "" "CFTR(NM_000492.3):c.2245C>T (p.L749=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117592412C>T" "" "likely benign" "" "0000530535" "0" "30" "7" "117232481" "117232481" "subst" "0.00179701" "01943" "CFTR_000160" "g.117232481G>A" "" "" "" "CFTR(NM_000492.3):c.2260G>A (p.V754M), CFTR(NM_000492.4):c.2260G>A (p.(Val754Met), p.V754M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117592427G>A" "" "likely benign" "" "0000530536" "0" "30" "7" "117232481" "117232481" "subst" "0.00179701" "02326" "CFTR_000160" "g.117232481G>A" "" "" "" "CFTR(NM_000492.3):c.2260G>A (p.V754M), CFTR(NM_000492.4):c.2260G>A (p.(Val754Met), p.V754M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117592427G>A" "" "likely benign" "" "0000530537" "0" "50" "7" "117232697" "117232697" "subst" "2.11725E-5" "01943" "CFTR_001434" "g.117232697G>A" "" "" "" "CFTR(NM_000492.3):c.2476G>A (p.E826K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117592643G>A" "" "VUS" "" "0000530538" "0" "30" "7" "117234995" "117234995" "subst" "0.000292531" "02325" "CFTR_001435" "g.117234995T>G" "" "" "" "CFTR(NM_000492.3):c.2502T>G (p.F834L), CFTR(NM_000492.4):c.2502T>G (p.F834L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117594941T>G" "" "likely benign" "" "0000530539" "0" "30" "7" "117242865" "117242865" "subst" "0.00266809" "02325" "CFTR_001360" "g.117242865C>G" "" "" "" "CFTR(NM_000492.3):c.2620-15C>G, CFTR(NM_000492.4):c.2620-15C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117602811C>G" "" "likely benign" "" "0000530540" "0" "30" "7" "117242874" "117242874" "subst" "0.000548214" "02325" "CFTR_001436" "g.117242874T>C" "" "" "" "CFTR(NM_000492.3):c.2620-6T>C, CFTR(NM_000492.4):c.2620-6T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117602820T>C" "" "likely benign" "" "0000530541" "0" "90" "7" "117243607" "117243607" "subst" "1.21936E-5" "02325" "CFTR_001361" "g.117243607G>T" "" "" "" "CFTR(NM_000492.3):c.2679G>T (p.G893=), CFTR(NM_000492.4):c.2679G>T (p.G893=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117603553G>T" "" "pathogenic" "" "0000530542" "0" "90" "7" "117243698" "117243698" "subst" "6.49931E-5" "01943" "CFTR_001437" "g.117243698G>A" "" "" "" "CFTR(NM_000492.3):c.2770G>A (p.D924N), CFTR(NM_000492.4):c.2770G>A (p.D924N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117603644G>A" "" "pathogenic" "" "0000530543" "0" "50" "7" "117243698" "117243698" "subst" "6.49931E-5" "02325" "CFTR_001437" "g.117243698G>A" "" "" "" "CFTR(NM_000492.3):c.2770G>A (p.D924N), CFTR(NM_000492.4):c.2770G>A (p.D924N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117603644G>A" "" "VUS" "" "0000530544" "0" "90" "7" "117243708" "117243708" "subst" "0" "01943" "CFTR_000113" "g.117243708T>C" "" "" "" "CFTR(NM_000492.3):c.2780T>C (p.L927P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117603654T>C" "" "pathogenic" "" "0000530545" "0" "70" "7" "117243762" "117243762" "subst" "7.71824E-5" "02327" "CFTR_000047" "g.117243762C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117603708C>T" "" "likely pathogenic" "" "0000530546" "0" "50" "7" "117250575" "117250575" "subst" "0.0022857" "02325" "CFTR_000082" "g.117250575G>C" "" "" "" "CFTR(NM_000492.3):c.2991G>C (p.L997F), CFTR(NM_000492.4):c.2991G>C (p.(Leu997Phe), p.L997F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117610521G>C" "" "VUS" "" "0000530547" "0" "30" "7" "117250599" "117250599" "subst" "0" "02325" "CFTR_001438" "g.117250599A>G" "" "" "" "CFTR(NM_000492.4):c.3015A>G (p.I1005M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117610545A>G" "" "likely benign" "" "0000530548" "0" "10" "7" "117250664" "117250664" "subst" "0.000252205" "01943" "CFTR_000064" "g.117250664T>C" "" "" "" "CFTR(NM_000492.3):c.3080T>C (p.I1027T), CFTR(NM_000492.4):c.3080T>C (p.I1027T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117610610T>C" "" "benign" "" "0000530549" "0" "30" "7" "117250664" "117250664" "subst" "0.000252205" "02326" "CFTR_000064" "g.117250664T>C" "" "" "" "CFTR(NM_000492.3):c.3080T>C (p.I1027T), CFTR(NM_000492.4):c.3080T>C (p.I1027T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117610610T>C" "" "likely benign" "" "0000530550" "0" "90" "7" "117251609" "117251609" "subst" "4.31727E-5" "01943" "CFTR_000023" "g.117251609A>G" "" "" "" "CFTR(NM_000492.3):c.3140-26A>G, CFTR(NM_000492.4):c.3140-26A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117611555A>G" "" "pathogenic" "" "0000530551" "0" "90" "7" "117251609" "117251609" "subst" "4.31727E-5" "02327" "CFTR_000023" "g.117251609A>G" "" "" "" "CFTR(NM_000492.3):c.3140-26A>G, CFTR(NM_000492.4):c.3140-26A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117611555A>G" "" "pathogenic" "" "0000530552" "0" "90" "7" "117251609" "117251609" "subst" "4.31727E-5" "02325" "CFTR_000023" "g.117251609A>G" "" "" "" "CFTR(NM_000492.3):c.3140-26A>G, CFTR(NM_000492.4):c.3140-26A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117611555A>G" "" "pathogenic" "" "0000530553" "0" "90" "7" "117254753" "117254753" "subst" "0.00040703" "01943" "CFTR_000021" "g.117254753G>C" "" "" "" "CFTR(NM_000492.3):c.3454G>C (p.D1152H), CFTR(NM_000492.4):c.3454G>C (p.D1152H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117614699G>C" "" "pathogenic" "" "0000530554" "0" "90" "7" "117254753" "117254753" "subst" "0.00040703" "02325" "CFTR_000021" "g.117254753G>C" "" "" "" "CFTR(NM_000492.3):c.3454G>C (p.D1152H), CFTR(NM_000492.4):c.3454G>C (p.D1152H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117614699G>C" "" "pathogenic" "" "0000530555" "0" "90" "7" "117254753" "117254753" "subst" "0.00040703" "02329" "CFTR_000021" "g.117254753G>C" "" "" "" "CFTR(NM_000492.3):c.3454G>C (p.D1152H), CFTR(NM_000492.4):c.3454G>C (p.D1152H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117614699G>C" "" "pathogenic" "" "0000530556" "0" "10" "7" "117267559" "117267559" "subst" "0.000592587" "01943" "CFTR_001439" "g.117267559T>C" "" "" "" "CFTR(NM_000492.3):c.3469-17T>C, CFTR(NM_000492.4):c.3469-17T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117627505T>C" "" "benign" "" "0000530557" "0" "30" "7" "117267665" "117267665" "subst" "0.000215988" "01943" "CFTR_001440" "g.117267665A>G" "" "" "" "CFTR(NM_000492.3):c.3558A>G (p.Q1186=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117627611A>G" "" "likely benign" "" "0000530558" "0" "50" "7" "117267670" "117267670" "subst" "4.07624E-6" "01804" "CFTR_001441" "g.117267670C>T" "" "" "" "CFTR(NM_000492.3):c.3563C>T (p.(Ser1188Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117627616C>T" "" "VUS" "" "0000530559" "0" "90" "7" "117267807" "117267807" "subst" "4.10691E-6" "01943" "CFTR_000106" "g.117267807A>G" "" "" "" "CFTR(NM_000492.3):c.3700A>G (p.I1234V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117627753A>G" "" "pathogenic" "" "0000530560" "0" "50" "7" "117267812" "117267812" "subst" "0.00492072" "01943" "CFTR_000051" "g.117267812T>G" "" "" "" "CFTR(NM_000492.3):c.3705T>G (p.S1235R, p.(Ser1235Arg)), CFTR(NM_000492.4):c.3705T>G (p.S1235R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117627758T>G" "" "VUS" "" "0000530561" "0" "50" "7" "117267812" "117267812" "subst" "0.00492072" "01804" "CFTR_000051" "g.117267812T>G" "" "" "" "CFTR(NM_000492.3):c.3705T>G (p.S1235R, p.(Ser1235Arg)), CFTR(NM_000492.4):c.3705T>G (p.S1235R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117627758T>G" "" "VUS" "" "0000530562" "0" "30" "7" "117267812" "117267812" "subst" "0.00492072" "02325" "CFTR_000051" "g.117267812T>G" "" "" "" "CFTR(NM_000492.3):c.3705T>G (p.S1235R, p.(Ser1235Arg)), CFTR(NM_000492.4):c.3705T>G (p.S1235R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117627758T>G" "" "likely benign" "" "0000530563" "0" "30" "7" "117267869" "117267869" "subst" "0.00117055" "02326" "CFTR_001442" "g.117267869G>A" "" "" "" "CFTR(NM_000492.3):c.3717+45G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117627815G>A" "" "likely benign" "" "0000530564" "0" "90" "7" "117280015" "117280015" "subst" "0" "02325" "CFTR_000011" "g.117280015C>T" "" "" "" "CFTR(NM_000492.4):c.3718-2477C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117639961C>T" "" "pathogenic" "" "0000530565" "0" "90" "7" "117282526" "117282526" "subst" "8.13603E-6" "01943" "CFTR_000040" "g.117282526G>A" "" "" "" "CFTR(NM_000492.3):c.3752G>A (p.S1251N), CFTR(NM_000492.4):c.3752G>A (p.S1251N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117642472G>A" "" "pathogenic" "" "0000530566" "0" "90" "7" "117282526" "117282526" "subst" "8.13603E-6" "02325" "CFTR_000040" "g.117282526G>A" "" "" "" "CFTR(NM_000492.3):c.3752G>A (p.S1251N), CFTR(NM_000492.4):c.3752G>A (p.S1251N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117642472G>A" "" "pathogenic" "" "0000530567" "0" "30" "7" "117292919" "117292919" "subst" "0.0010524" "01943" "CFTR_001389" "g.117292919A>G" "" "" "" "CFTR(NM_000492.3):c.3897A>G (p.T1299=), CFTR(NM_000492.4):c.3897A>G (p.T1299=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117652865A>G" "" "likely benign" "" "0000530568" "0" "30" "7" "117292919" "117292919" "subst" "0.0010524" "02326" "CFTR_001389" "g.117292919A>G" "" "" "" "CFTR(NM_000492.3):c.3897A>G (p.T1299=), CFTR(NM_000492.4):c.3897A>G (p.T1299=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117652865A>G" "" "likely benign" "" "0000530569" "0" "50" "7" "117292956" "117292956" "subst" "0" "01943" "CFTR_001443" "g.117292956G>T" "" "" "" "CFTR(NM_000492.3):c.3934G>T (p.D1312Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117652902G>T" "" "VUS" "" "0000530570" "0" "90" "7" "117292959" "117292959" "subst" "0" "01943" "CFTR_000099" "g.117292959C>T" "" "" "" "CFTR(NM_000492.3):c.3937C>T (p.Q1313*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117652905C>T" "" "pathogenic" "" "0000530573" "0" "50" "7" "117305562" "117305562" "subst" "8.15235E-6" "02327" "CFTR_001444" "g.117305562A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117665508A>C" "" "VUS" "" "0000530574" "0" "30" "7" "117305628" "117305628" "subst" "0.000301738" "02325" "CFTR_001445" "g.117305628T>C" "" "" "" "CFTR(NM_000492.3):c.4242+10T>C, CFTR(NM_000492.4):c.4242+10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117665574T>C" "" "likely benign" "" "0000530575" "0" "10" "7" "117305631" "117305631" "subst" "0.00344397" "01943" "CFTR_001446" "g.117305631A>G" "" "" "" "CFTR(NM_000492.3):c.4242+13A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117665577A>G" "" "benign" "" "0000530576" "0" "10" "7" "117305631" "117305631" "subst" "0.00344397" "02326" "CFTR_001446" "g.117305631A>G" "" "" "" "CFTR(NM_000492.3):c.4242+13A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117665577A>G" "" "benign" "" "0000530577" "0" "10" "7" "117306991" "117306991" "subst" "0.00657198" "02327" "CFTR_001399" "g.117306991C>T" "" "" "" "CFTR(NM_000492.3):c.4272C>T (p.Y1424=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117666937C>T" "" "benign" "" "0000598353" "0" "90" "7" "117251797" "117251797" "subst" "1.6268E-5" "01164" "CFTR_000043" "g.117251797T>A" "" "" "" "" "ACMG grading: PS3, PP5, PM3, PP4, PP3, PM2; variant reported in Zielenski 1993. Am J Hum Genet 52: 609; Ooi 2012. J Cyst Fibros 11: 355; Van Goor 2014. J Cyst Fribros 13: 29" "Germline" "" "rs36210737" "0" "" "" "g.117611743T>A" "" "pathogenic" "ACMG" "0000610630" "0" "90" "7" "117144378" "117144378" "subst" "0.000122137" "02325" "CFTR_001420" "g.117144378C>T" "" "" "" "CFTR(NM_000492.3):c.125C>T (p.S42F), CFTR(NM_000492.4):c.125C>T (p.S42F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117504324C>T" "" "pathogenic" "" "0000610631" "0" "10" "7" "117188682" "117188682" "subst" "0" "02325" "CFTR_001447" "g.117188682G>T" "" "" "" "CFTR(NM_000492.3):c.1210-13_1210-11delGTTinsTTT, CFTR(NM_000492.4):c.1210-13G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117548628G>T" "" "benign" "" "0000610634" "0" "10" "7" "117199533" "117199533" "subst" "0.474443" "01943" "CFTR_001338" "g.117199533G>A" "" "" "" "CFTR(NM_000492.3):c.1408G>A (p.V470M), CFTR(NM_000492.4):c.1408G>A (p.(Val470Met), p.V470M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117559479G>A" "" "benign" "" "0000610635" "0" "90" "7" "117227792" "117227792" "subst" "8.54965E-5" "02327" "CFTR_000008" "g.117227792G>A" "" "" "" "CFTR(NM_000492.3):c.1585-1G>A, CFTR(NM_000492.4):c.1585-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117587738G>A" "" "pathogenic" "" "0000610636" "0" "10" "7" "117229537" "117229537" "subst" "0" "02327" "CFTR_001449" "g.117229537T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117589483T>A" "" "benign" "" "0000610637" "0" "30" "7" "117232466" "117232466" "subst" "0.000619811" "01943" "CFTR_001432" "g.117232466C>T" "" "" "" "CFTR(NM_000492.3):c.2245C>T (p.L749=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117592412C>T" "" "likely benign" "" "0000610638" "0" "30" "7" "117242865" "117242865" "subst" "0.00266809" "02327" "CFTR_001360" "g.117242865C>G" "" "" "" "CFTR(NM_000492.3):c.2620-15C>G, CFTR(NM_000492.4):c.2620-15C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117602811C>G" "" "likely benign" "" "0000610639" "0" "30" "7" "117250664" "117250664" "subst" "0.000252205" "02325" "CFTR_000064" "g.117250664T>C" "" "" "" "CFTR(NM_000492.3):c.3080T>C (p.I1027T), CFTR(NM_000492.4):c.3080T>C (p.I1027T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117610610T>C" "" "likely benign" "" "0000610640" "0" "50" "7" "117251656" "117251656" "subst" "0" "01943" "CFTR_001450" "g.117251656A>G" "" "" "" "CFTR(NM_000492.3):c.3161A>G (p.H1054R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117611602A>G" "" "VUS" "" "0000610641" "0" "90" "7" "117254714" "117254714" "subst" "0.000105725" "02325" "CFTR_001378" "g.117254714A>G" "" "" "" "CFTR(NM_000492.3):c.3415A>G (p.I1139V), CFTR(NM_000492.4):c.3415A>G (p.I1139V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117614660A>G" "" "pathogenic" "" "0000610642" "0" "70" "7" "117254753" "117254753" "subst" "0.00040703" "02327" "CFTR_000021" "g.117254753G>C" "" "" "" "CFTR(NM_000492.3):c.3454G>C (p.D1152H), CFTR(NM_000492.4):c.3454G>C (p.D1152H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117614699G>C" "" "likely pathogenic" "" "0000610643" "0" "30" "7" "117292835" "117292848" "del" "0" "02327" "CFTR_001451" "g.117292835_117292848del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117652781_117652794del" "" "likely benign" "" "0000610644" "0" "90" "7" "117292930" "117292930" "subst" "4.90802E-5" "02325" "CFTR_001390" "g.117292930A>T" "" "" "" "CFTR(NM_000492.3):c.3908A>T (p.N1303I), CFTR(NM_000492.4):c.3908A>T (p.N1303I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117652876A>T" "" "pathogenic" "" "0000610645" "0" "90" "7" "117292931" "117292931" "subst" "0.000139103" "02327" "CFTR_000004" "g.117292931C>G" "" "" "" "CFTR(NM_000492.3):c.3909C>G (p.N1303K), CFTR(NM_000492.4):c.3909C>G (p.N1303K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117652877C>G" "" "pathogenic" "" "0000610646" "0" "50" "7" "117304852" "117304852" "subst" "0" "02327" "CFTR_001452" "g.117304852A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117664798A>T" "" "VUS" "" "0000610647" "0" "10" "7" "117307108" "117307108" "subst" "0.217664" "02326" "CFTR_001400" "g.117307108G>A" "" "" "" "CFTR(NM_000492.3):c.4389G>A (p.Q1463=), CFTR(NM_000492.4):c.4389G>A (p.(Gln1463=), p.Q1463=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117667054G>A" "" "benign" "" "0000621806" "0" "50" "7" "117171130" "117171130" "subst" "6.52827E-5" "02325" "CFTR_001319" "g.117171130C>A" "" "" "" "CFTR(NM_000492.3):c.451C>A (p.Q151K), CFTR(NM_000492.4):c.451C>A (p.Q151K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117531076C>A" "" "VUS" "" "0000621807" "0" "30" "7" "117227896" "117227896" "subst" "5.71536E-5" "01943" "CFTR_001448" "g.117227896C>G" "" "" "" "CFTR(NM_000492.3):c.1679+9C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117587842C>G" "" "likely benign" "" "0000629503" "3" "90" "7" "117120150" "117120150" "subst" "8.12863E-6" "03383" "CFTR_001453" "g.117120150T>C" "" "{PMID:Savarese 2014:23834558}" "" "" "" "Germline" "yes" "" "0" "" "" "g.117480096T>C" "" "pathogenic (recessive)" "" "0000630800" "0" "50" "7" "117292931" "117292931" "subst" "0.000139103" "00004" "CFTR_000004" "g.117292931C>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117652877C>G" "" "VUS" "" "0000630802" "0" "50" "7" "117267812" "117267812" "subst" "0.00492072" "00004" "CFTR_000051" "g.117267812T>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117627758T>G" "" "VUS" "" "0000630803" "0" "50" "7" "117267812" "117267812" "subst" "0.00492072" "00004" "CFTR_000051" "g.117267812T>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117627758T>G" "" "VUS" "" "0000644181" "0" "50" "7" "117267794" "117267794" "subst" "0" "02551" "CFTR_001454" "g.117267794C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.117627740C>T" "" "VUS" "" "0000652127" "1" "90" "7" "117120159" "117120159" "subst" "0" "03575" "CFTR_001160" "g.117120159C>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs397508173}" "Germline" "" "rs397508173" "0" "" "" "g.117480105C>A" "" "pathogenic" "" "0000652128" "1" "50" "7" "117144344" "117144344" "subst" "0.00165252" "03575" "CFTR_000125" "g.117144344C>T" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; {DB:CLININrs1800073}" "Germline" "" "rs1800073" "0" "" "" "g.117504290C>T" "" "VUS" "" "0000652129" "1" "50" "7" "117144378" "117144378" "subst" "0.000122137" "03575" "CFTR_001420" "g.117144378C>T" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs143456784}" "Germline" "" "rs143456784" "0" "" "" "g.117504324C>T" "" "VUS" "" "0000652130" "1" "50" "7" "117149143" "117149143" "subst" "0.00142434" "03575" "CFTR_000087" "g.117149143C>T" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "drug response; 3 heterozygous, no homozygous; {DB:CLININrs115545701}" "Germline" "" "rs115545701" "0" "" "" "g.117509089C>T" "" "VUS" "" "0000652131" "1" "90" "7" "117149146" "117149146" "subst" "2.44182E-5" "03575" "CFTR_000068" "g.117149146C>T" "2/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs121908749}" "Germline" "" "rs121908749" "0" "" "" "g.117509092C>T" "" "pathogenic" "" "0000652132" "1" "50" "7" "117171037" "117171037" "subst" "0.000122116" "03575" "CFTR_001462" "g.117171037G>A" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs201958172}" "Germline" "" "rs201958172" "0" "" "" "g.117530983G>A" "" "VUS" "" "0000652133" "1" "50" "7" "117174387" "117174387" "subst" "0.000297347" "03575" "CFTR_001464" "g.117174387C>A" "29/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "29 heterozygous, no homozygous; {DB:CLININrs397508751}" "Germline" "" "rs397508751" "0" "" "" "g.117534333C>A" "" "VUS" "" "0000652134" "1" "50" "7" "117175314" "117175314" "subst" "0" "03575" "CFTR_001465" "g.117175314G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs193922529}" "Germline" "" "rs193922529" "0" "" "" "g.117535260G>A" "" "VUS" "" "0000652135" "1" "50" "7" "117175372" "117175372" "subst" "0.00468322" "03575" "CFTR_001425" "g.117175372A>G" "8/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 8 heterozygous, no homozygous; {DB:CLININrs121909046}" "Germline" "" "rs121909046" "0" "" "" "g.117535318A>G" "" "VUS" "" "0000652136" "1" "50" "7" "117180173" "117180173" "subst" "4.89233E-5" "03575" "CFTR_001466" "g.117180173C>T" "1/2790 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs397508814.1}" "Germline" "" "rs397508814" "0" "" "" "g.117540119C>T" "" "VUS" "" "0000652137" "1" "90" "7" "117180284" "117180284" "subst" "6.09796E-5" "03575" "CFTR_000026" "g.117180284C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs121909011}" "Germline" "" "rs121909011" "0" "" "" "g.117540230C>T" "" "pathogenic" "" "0000652138" "1" "90" "7" "117188852" "117188852" "subst" "0" "03575" "CFTR_001336" "g.117188852T>C" "9/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "9 heterozygous, no homozygous; {DB:CLININrs193922500}" "Germline" "" "rs193922500" "0" "" "" "g.117548798T>C" "" "pathogenic" "" "0000652139" "1" "90" "7" "117199517" "117199517" "subst" "3.25264E-5" "03575" "CFTR_000104" "g.117199517G>A" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs397508200}" "Germline" "" "rs397508200" "0" "" "" "g.117559463G>A" "" "pathogenic" "" "0000652140" "1" "50" "7" "117199578" "117199578" "subst" "6.09429E-5" "03575" "CFTR_001467" "g.117199578A>T" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs138427145}" "Germline" "" "rs138427145" "0" "" "" "g.117559524A>T" "" "VUS" "" "0000652141" "1" "90" "7" "117199646" "117199648" "del" "0" "03575" "CFTR_000001" "g.117199646_117199648del" "9/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "9 heterozygous, no homozygous; {DB:CLININrs113993960}" "Germline" "" "rs113993960" "0" "" "" "g.117559592_117559594del" "" "pathogenic" "" "0000652142" "1" "90" "7" "117227832" "117227832" "subst" "0.000358192" "03575" "CFTR_000002" "g.117227832G>T" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs113993959}" "Germline" "" "rs113993959" "0" "" "" "g.117587778G>T" "" "pathogenic" "" "0000652143" "1" "30" "7" "117227874" "117227874" "subst" "0.00342536" "03575" "CFTR_001017" "g.117227874A>G" "1/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs75789129}" "Germline" "" "rs75789129" "0" "" "" "g.117587820A>G" "" "likely benign" "" "0000652144" "1" "90" "7" "117230480" "117230480" "subst" "2.042E-5" "03575" "CFTR_000070" "g.117230480G>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs397508296}" "Germline" "" "rs397508296" "0" "" "" "g.117590426G>T" "" "pathogenic" "" "0000652145" "1" "90" "7" "117232013" "117232019" "del" "0" "03575" "CFTR_001229" "g.117232013_117232019del" "1/2760 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs397508303}" "Germline" "" "rs397508303" "0" "" "" "g.117591959_117591965del" "" "pathogenic" "" "0000652146" "1" "50" "7" "117232022" "117232022" "subst" "0" "03575" "CFTR_001468" "g.117232022A>T" "1/2783 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "no interpretation available; 1 heterozygous, no homozygous; {DB:CLININrs397508306}" "Germline" "" "rs397508306" "0" "" "" "g.117591968A>T" "" "VUS" "" "0000652147" "1" "50" "7" "117232062" "117232062" "subst" "2.66525E-5" "03575" "CFTR_000142" "g.117232062A>G" "3/2753 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; {DB:CLININrs201124247}" "Germline" "" "rs201124247" "0" "" "" "g.117592008A>G" "" "VUS" "" "0000652148" "1" "70" "7" "117232086" "117232086" "subst" "8.82168E-5" "03575" "CFTR_001409" "g.117232086G>A" "2/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs121908759}" "Germline" "" "rs121908759" "0" "" "" "g.117592032G>A" "" "likely pathogenic" "" "0000652149" "1" "90" "7" "117232207" "117232210" "del" "0" "03575" "CFTR_001232" "g.117232207_117232210del" "11/2646 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "11 heterozygous, no homozygous; {DB:CLININrs397508325}" "Germline" "" "rs397508325" "0" "" "" "g.117592153_117592156del" "" "pathogenic" "" "0000652151" "1" "50" "7" "117232518" "117232518" "subst" "0" "03575" "CFTR_001469" "g.117232518G>T" "1/2777 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "no interpretation available; 1 heterozygous, no homozygous; {DB:CLININrs397508363.1}" "Germline" "" "rs397508363" "0" "" "" "g.117592464G>T" "" "VUS" "" "0000652152" "1" "50" "7" "117232642" "117232642" "subst" "0.000758916" "03575" "CFTR_001136" "g.117232642A>G" "32/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 32 heterozygous, no homozygous; {DB:CLININrs1800103}" "Germline" "" "rs1800103" "0" "" "" "g.117592588A>G" "" "VUS" "" "0000652153" "1" "90" "7" "117235044" "117235044" "subst" "0" "03575" "CFTR_000126" "g.117235044C>T" "6/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "6 heterozygous, no homozygous; {DB:CLININrs121909012}" "Germline" "" "rs121909012" "0" "" "" "g.117594990C>T" "" "pathogenic" "" "0000652154" "1" "50" "7" "117243684" "117243684" "subst" "7.71831E-5" "03575" "CFTR_001471" "g.117243684A>G" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs397508430}" "Germline" "" "rs397508430" "0" "" "" "g.117603630A>G" "" "VUS" "" "0000652155" "1" "50" "7" "117246800" "117246800" "subst" "4.06676E-6" "03575" "CFTR_001369" "g.117246800T>G" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs397508469}" "Germline" "" "rs397508469" "0" "" "" "g.117606746T>G" "" "VUS" "" "0000652156" "1" "50" "7" "117251704" "117251704" "subst" "0.000622665" "03575" "CFTR_000107" "g.117251704G>A" "10/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "drug response; 10 heterozygous, no homozygous; {DB:CLININrs78769542}" "Germline" "" "rs78769542" "0" "" "" "g.117611650G>A" "" "VUS" "" "0000652158" "1" "50" "7" "117251817" "117251817" "subst" "1.62807E-5" "03575" "CFTR_001474" "g.117251817G>C" "1/2767 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "no interpretation available; 1 heterozygous, no homozygous; {DB:CLININrs397508542}" "Germline" "" "rs397508542" "0" "" "" "g.117611763G>C" "" "VUS" "" "0000652159" "1" "90" "7" "117251848" "117251848" "subst" "1.22352E-5" "03575" "CFTR_001475" "g.117251848C>T" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs146521846}" "Germline" "" "rs146521846" "0" "" "" "g.117611794C>T" "" "pathogenic" "" "0000652160" "1" "50" "7" "117254753" "117254753" "subst" "0.00040703" "03575" "CFTR_000021" "g.117254753G>C" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "drug response; 1 heterozygous, no homozygous; {DB:CLININrs75541969}" "Germline" "" "rs75541969" "0" "" "" "g.117614699G>C" "" "VUS" "" "0000652161" "1" "90" "7" "117267591" "117267591" "subst" "5.29799E-5" "03575" "CFTR_000012" "g.117267591C>T" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs74767530}" "Germline" "" "rs74767530" "0" "" "" "g.117627537C>T" "" "pathogenic" "" "0000652162" "1" "90" "7" "117267766" "117267766" "del" "4.0832E-6" "03575" "CFTR_001385" "g.117267766del" "2/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs121908811}" "Germline" "" "rs121908811" "0" "" "" "g.117627712del" "" "pathogenic" "" "0000652163" "1" "90" "7" "117280015" "117280015" "subst" "0" "03575" "CFTR_000011" "g.117280015C>T" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs75039782}" "Germline" "" "rs75039782" "0" "" "" "g.117639961C>T" "" "pathogenic" "" "0000652164" "1" "50" "7" "117282511" "117282511" "subst" "4.06941E-6" "03575" "CFTR_001476" "g.117282511C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs397508600}" "Germline" "" "rs397508600" "0" "" "" "g.117642457C>T" "" "VUS" "" "0000652165" "1" "90" "7" "117282535" "117282535" "subst" "0" "03575" "CFTR_001290" "g.117282535T>G" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs397508604}" "Germline" "" "rs397508604" "0" "" "" "g.117642481T>G" "" "pathogenic" "" "0000652166" "1" "50" "7" "117282582" "117282582" "subst" "0.00119238" "03575" "CFTR_000073" "g.117282582G>A" "9/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "drug response; 9 heterozygous, no homozygous; {DB:CLININrs11971167}" "Germline" "" "rs11971167" "0" "" "" "g.117642528G>A" "" "VUS" "" "0000652167" "1" "50" "7" "117282628" "117282628" "subst" "0.00066791" "03575" "CFTR_001387" "g.117282628C>T" "28/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "28 heterozygous, no homozygous; {DB:CLININrs397508617}" "Germline" "" "rs397508617" "0" "" "" "g.117642574C>T" "" "VUS" "" "0000652168" "1" "50" "7" "117304787" "117304787" "subst" "6.09969E-5" "03575" "CFTR_001479" "g.117304787T>G" "2/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "no interpretation available; 2 heterozygous, no homozygous; {DB:CLININrs397508659}" "Germline" "" "rs397508659" "0" "" "" "g.117664733T>G" "" "VUS" "" "0000652169" "1" "90" "7" "117307145" "117307145" "subst" "2.44244E-5" "03575" "CFTR_001401" "g.117307145C>T" "11/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "11 heterozygous, no homozygous; {DB:CLININrs374705585}" "Germline" "" "rs374705585" "0" "" "" "g.117667091C>T" "" "pathogenic" "" "0000653069" "1" "50" "7" "117149147" "117149147" "subst" "0.0153305" "03575" "CFTR_000092" "g.117149147G>A" "11/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 11 heterozygous, no homozygous; {DB:CLININrs1800076}" "Germline" "" "rs1800076" "0" "" "" "g.117509093G>A" "" "VUS" "" "0000653070" "1" "50" "7" "117199709" "117199709" "subst" "0.016887" "03575" "CFTR_001343" "g.117199709G>A" "10/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 10 heterozygous, no homozygous; {DB:CLININrs1800095}" "Germline" "" "rs1800095" "0" "" "" "g.117559655G>A" "" "VUS" "" "0000653071" "1" "50" "7" "117243686" "117243686" "subst" "0.000142177" "03575" "CFTR_001472" "g.117243686G>A" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; {DB:CLININrs373885282}" "Germline" "" "rs373885282" "0" "" "" "g.117603632G>A" "" "VUS" "" "0000653072" "1" "70" "7" "117250622" "117250622" "subst" "2.84645E-5" "03575" "CFTR_001473" "g.117250622C>A" "2/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs193922516}" "Germline" "" "rs193922516" "0" "" "" "g.117610568C>A" "" "likely pathogenic" "" "0000653073" "1" "90" "7" "117251692" "117251692" "subst" "3.25632E-5" "03575" "CFTR_000080" "g.117251692G>A" "1/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs121909019}" "Germline" "" "rs121909019" "0" "" "" "g.117611638G>A" "" "pathogenic" "" "0000653172" "1" "90" "7" "117149101" "117149101" "subst" "2.44296E-5" "03575" "CFTR_000025" "g.117149101G>T" "4/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "4 heterozygous, no homozygous; {DB:CLININrs77284892}" "Germline" "" "rs77284892" "0" "" "" "g.117509047G>T" "" "pathogenic" "" "0000653173" "1" "90" "7" "117171028" "117171028" "subst" "0.00021164" "03575" "CFTR_000049" "g.117171028C>T" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs77834169}" "Germline" "" "rs77834169" "0" "" "" "g.117530974C>T" "" "pathogenic" "" "0000653174" "1" "90" "7" "117199683" "117199683" "subst" "4.06673E-6" "03575" "CFTR_000050" "g.117199683G>T" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs77646904}" "Germline" "" "rs77646904" "0" "" "" "g.117559629G>T" "" "pathogenic" "" "0000653207" "1" "90" "7" "117171088" "117171091" "del" "0" "03575" "CFTR_001463" "g.117171088_117171091del" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs397508672}" "Germline" "" "rs397508672" "0" "" "" "g.117531034_117531037del" "" "pathogenic" "" "0000653208" "1" "90" "7" "117171088" "117171088" "del" "0" "03575" "CFTR_001185" "g.117171088del" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs397508672}" "Germline" "" "rs397508672" "0" "" "" "g.117531034del" "" "pathogenic" "" "0000653285" "1" "90" "7" "117292901" "117292908" "del" "0" "03575" "CFTR_001477" "g.117292901_117292908del" "6/2738 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "6 heterozygous, no homozygous; {DB:CLININrs387906373}" "Germline" "" "rs387906373" "0" "" "" "g.117652847_117652854del" "" "pathogenic" "" "0000653289" "1" "90" "7" "117235093" "117235093" "dup" "0" "03575" "CFTR_001470" "g.117235093dup" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs397508405}\r\nVariant Error EBUILDMISMATCH: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message." "Germline" "" "rs397508405" "0" "" "" "g.117595040dup" "" "pathogenic" "" "0000653290" "1" "90" "7" "117292930" "117292930" "del" "0" "03575" "CFTR_001478" "g.117292930del" "4/2740 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "4 heterozygous, no homozygous; {DB:CLININrs397508637}" "Germline" "" "rs397508637" "0" "" "" "g.117652876del" "" "pathogenic" "" "0000655715" "0" "90" "7" "117171029" "117171029" "subst" "0.00147328" "02329" "CFTR_000006" "g.117171029G>A" "" "" "" "CFTR(NM_000492.3):c.350G>A (p.R117H, p.(Arg117His)), CFTR(NM_000492.4):c.350G>A (p.R117H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117530975G>A" "" "pathogenic" "" "0000655716" "0" "50" "7" "117174387" "117174387" "subst" "0.000297347" "01943" "CFTR_001464" "g.117174387C>A" "" "" "" "CFTR(NM_000492.3):c.547C>A (p.L183I), CFTR(NM_000492.4):c.547C>A (p.L183I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117534333C>A" "" "VUS" "" "0000655717" "0" "50" "7" "117175387" "117175387" "subst" "0" "01943" "CFTR_001480" "g.117175387C>G" "" "" "" "CFTR(NM_000492.3):c.665C>G (p.S222C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117535333C>G" "" "VUS" "" "0000655718" "0" "50" "7" "117188849" "117188849" "subst" "0" "02325" "CFTR_001481" "g.117188849C>T" "" "" "" "CFTR(NM_000492.4):c.1364C>T (p.A455V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117548795C>T" "" "VUS" "" "0000655719" "0" "50" "7" "117199683" "117199683" "subst" "0.000130135" "01943" "CFTR_001482" "g.117199683G>A" "" "" "" "CFTR(NM_000492.3):c.1558G>A (p.V520I), CFTR(NM_000492.4):c.1558G>A (p.(Val520Ile), p.V520I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117559629G>A" "" "VUS" "" "0000655720" "0" "30" "7" "117199706" "117199706" "subst" "0.00113613" "02327" "CFTR_001483" "g.117199706A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117559652A>G" "" "likely benign" "" "0000655721" "0" "50" "7" "117232172" "117232172" "subst" "3.25534E-5" "01943" "CFTR_001484" "g.117232172G>A" "" "" "" "CFTR(NM_000492.3):c.1951G>A (p.D651N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117592118G>A" "" "VUS" "" "0000655722" "0" "30" "7" "117234995" "117234995" "subst" "0.000292531" "02326" "CFTR_001435" "g.117234995T>G" "" "" "" "CFTR(NM_000492.3):c.2502T>G (p.F834L), CFTR(NM_000492.4):c.2502T>G (p.F834L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117594941T>G" "" "likely benign" "" "0000655723" "0" "30" "7" "117246792" "117246792" "subst" "1.21991E-5" "01943" "CFTR_001485" "g.117246792A>G" "" "" "" "CFTR(NM_000492.3):c.2973A>G (p.I991M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117606738A>G" "" "likely benign" "" "0000655724" "0" "50" "7" "117250575" "117250575" "subst" "0.0022857" "02326" "CFTR_000082" "g.117250575G>C" "" "" "" "CFTR(NM_000492.3):c.2991G>C (p.L997F), CFTR(NM_000492.4):c.2991G>C (p.(Leu997Phe), p.L997F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117610521G>C" "" "VUS" "" "0000655725" "0" "90" "7" "117267579" "117267579" "subst" "3.26216E-5" "01943" "CFTR_000037" "g.117267579C>T" "" "" "" "CFTR(NM_000492.3):c.3472C>T (p.R1158*), CFTR(NM_000492.4):c.3472C>T (p.R1158*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117627525C>T" "" "pathogenic" "" "0000655726" "0" "70" "7" "117280015" "117280015" "subst" "0" "02327" "CFTR_000011" "g.117280015C>T" "" "" "" "CFTR(NM_000492.4):c.3718-2477C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117639961C>T" "" "likely pathogenic" "" "0000655727" "0" "70" "7" "117292957" "117292957" "subst" "4.0778E-6" "02329" "CFTR_001486" "g.117292957A>G" "" "" "" "CFTR(NM_000492.4):c.3935A>G (p.D1312G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.117652903A>G" "" "likely pathogenic" "" "0000660697" "2" "90" "7" "117180324" "117180324" "subst" "2.44035E-5" "03595" "CFTR_000039" "g.117180324G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117540270G>A" "" "pathogenic (recessive)" "" "0000660698" "3" "90" "7" "117199644" "117199646" "del" "0" "03595" "CFTR_000001" "g.117199644_117199646del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559590_117559592del" "" "pathogenic (recessive)" "" "0000660699" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.117199646_117199648del" "" "pathogenic (recessive)" "" "0000660700" "2" "90" "7" "117149101" "117149101" "subst" "2.44296E-5" "03595" "CFTR_000025" "g.117149101G>T" "" "Sasaki 2020, submitted" "" "Glu60Ter" "" "Germline" "" "" "0" "" "" "g.117509047G>T" "" "pathogenic (recessive)" "" "0000663288" "1" "90" "7" "117199644" "117199646" "del" "0" "03595" "CFTR_000017" "g.117199644_117199646del" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117559590_117559592del" "" "pathogenic (recessive)" "" "0000663289" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663290" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663291" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663292" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663293" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663294" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663295" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663296" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663297" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663298" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663299" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663300" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663301" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663302" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663303" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663304" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663305" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663306" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663307" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663308" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663309" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663310" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663311" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663312" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663313" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663314" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663315" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663316" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663317" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663318" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663319" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663320" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663321" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663322" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663323" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663324" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663325" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663326" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663327" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663328" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663329" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663330" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663331" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663332" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663333" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663334" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663335" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663336" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663337" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663338" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663339" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663340" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663341" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663342" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663343" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663344" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663345" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663346" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663347" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663348" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663349" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663350" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663351" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663352" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663353" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663354" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663355" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663356" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663357" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663358" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663359" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663360" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663361" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663362" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663363" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663364" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663365" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663366" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663367" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663368" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663369" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663370" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663371" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663372" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663373" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663374" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663375" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663376" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663377" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663378" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663379" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663380" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663381" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663382" "3" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663383" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663384" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663385" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663386" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663387" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663388" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663389" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663390" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663391" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663392" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663393" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663394" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663395" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663396" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663397" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663398" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663399" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663400" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663401" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663402" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663403" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663404" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663405" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663406" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663407" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663408" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663409" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663410" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663411" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663412" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663413" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663414" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663415" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663416" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663417" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663418" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663419" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663420" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663421" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663422" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663423" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663424" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663425" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663426" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663427" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663428" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663429" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663430" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663431" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663432" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663433" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663434" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663435" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663436" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663437" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663438" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663439" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663440" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663441" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663442" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663443" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663444" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663445" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663446" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663447" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663448" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663449" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000663450" "3" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663451" "3" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663452" "3" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663453" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663454" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663455" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663456" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663457" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663458" "1" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "621+1G>T" "" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000663459" "1" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "621+1G>T" "" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000663460" "1" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "621+1G>T" "" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000663461" "1" "90" "7" "117180284" "117180284" "subst" "6.09796E-5" "03595" "CFTR_000026" "g.117180284C>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117540230C>T" "" "pathogenic (recessive)" "" "0000663462" "1" "90" "7" "117199683" "117199683" "subst" "4.06673E-6" "03595" "CFTR_000050" "g.117199683G>T" "" "Sasaki 2020, submitted" "" "V520F" "" "Germline" "" "" "0" "" "" "g.117559629G>T" "" "pathogenic (recessive)" "" "0000663463" "1" "90" "7" "117227792" "117227792" "subst" "8.54965E-5" "03595" "CFTR_000008" "g.117227792G>A" "" "Sasaki 2020, submitted" "" "1717-1G>A" "" "Germline" "" "" "0" "" "" "g.117587738G>A" "" "pathogenic (recessive)" "" "0000663464" "1" "90" "7" "117227887" "117227887" "subst" "2.03832E-5" "03595" "CFTR_000022" "g.117227887G>C" "" "Sasaki 2020, submitted" "" "R560T/K" "" "Germline" "" "" "0" "" "" "g.117587833G>C" "" "pathogenic (recessive)" "" "0000663465" "1" "90" "7" "117232273" "117232273" "del" "0" "03595" "CFTR_001133" "g.117232273del" "" "Sasaki 2020, submitted" "" "2184delA" "" "Germline" "" "" "0" "" "" "g.117592219del" "" "pathogenic (recessive)" "" "0000663466" "2" "90" "7" "117180305" "117180306" "dup" "0" "03595" "CFTR_001489" "g.117180305_117180306dup" "" "Sasaki 2020, submitted" "" "1021_1022dup" "" "Germline" "" "" "0" "" "" "g.117540251_117540252dup" "" "pathogenic (recessive)" "" "0000663467" "2" "90" "7" "117180324" "117180324" "subst" "2.44035E-5" "03595" "CFTR_000020" "g.117180324G>C" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117540270G>C" "" "pathogenic (recessive)" "" "0000663468" "2" "90" "7" "117199644" "117199646" "del" "0" "03595" "CFTR_000017" "g.117199644_117199646del" "" "Sasaki 2020, submitted" "" "1518_1521delATC (I507)" "" "Germline" "" "" "0" "" "" "g.117559590_117559592del" "" "pathogenic (recessive)" "" "0000663469" "2" "90" "7" "117199644" "117199646" "del" "0" "03595" "CFTR_000017" "g.117199644_117199646del" "" "Sasaki 2020, submitted" "" "1519_1521delATC (I507)" "" "Germline" "" "" "0" "" "" "g.117559590_117559592del" "" "pathogenic (recessive)" "" "0000663470" "2" "90" "7" "117199683" "117199683" "subst" "4.06673E-6" "03595" "CFTR_000050" "g.117199683G>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117559629G>T" "" "pathogenic (recessive)" "" "0000663471" "2" "90" "7" "117199683" "117199683" "subst" "4.06673E-6" "03595" "CFTR_000050" "g.117199683G>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117559629G>T" "" "pathogenic (recessive)" "" "0000663472" "2" "90" "7" "117227792" "117227792" "subst" "8.54965E-5" "03595" "CFTR_000008" "g.117227792G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587738G>A" "" "pathogenic (recessive)" "" "0000663473" "2" "90" "7" "117227792" "117227792" "subst" "8.54965E-5" "03595" "CFTR_000008" "g.117227792G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587738G>A" "" "pathogenic (recessive)" "" "0000663474" "2" "90" "7" "117227832" "117227832" "subst" "0.000358192" "03595" "CFTR_000002" "g.117227832G>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587778G>T" "" "pathogenic (recessive)" "" "0000663475" "2" "90" "7" "117227832" "117227832" "subst" "0.000358192" "03595" "CFTR_000002" "g.117227832G>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587778G>T" "" "pathogenic (recessive)" "" "0000663476" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663477" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663478" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663479" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663480" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663481" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663482" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663483" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663484" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663485" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663486" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663487" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663488" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663489" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663490" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663491" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663492" "2" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000663493" "2" "90" "7" "117227887" "117227887" "subst" "2.03832E-5" "03595" "CFTR_000022" "g.117227887G>C" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587833G>C" "" "pathogenic (recessive)" "" "0000663494" "2" "90" "7" "117227887" "117227887" "subst" "2.03832E-5" "03595" "CFTR_000022" "g.117227887G>C" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587833G>C" "" "pathogenic (recessive)" "" "0000663495" "2" "90" "7" "117227887" "117227887" "subst" "2.03832E-5" "03595" "CFTR_000022" "g.117227887G>C" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587833G>C" "" "pathogenic (recessive)" "" "0000663496" "2" "90" "7" "117227887" "117227887" "subst" "2.03832E-5" "03595" "CFTR_000022" "g.117227887G>C" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587833G>C" "" "pathogenic (recessive)" "" "0000663497" "2" "90" "7" "117232164" "117232164" "del" "0" "03595" "CFTR_001491" "g.117232164del" "" "Sasaki 2020, submitted" "" "1943delA" "" "Germline" "" "" "0" "" "" "g.117592110del" "" "pathogenic (recessive)" "" "0000663498" "2" "90" "7" "117232273" "117232273" "dup" "0" "03595" "CFTR_001353" "g.117232273dup" "" "Sasaki 2020, submitted" "" "2052dupA" "" "Germline" "" "" "0" "" "" "g.117592219dup" "" "pathogenic (recessive)" "" "0000663499" "2" "90" "7" "117232349" "117232349" "subst" "0" "03595" "CFTR_000083" "g.117232349A>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117592295A>T" "" "pathogenic (recessive)" "" "0000663500" "2" "90" "7" "117232712" "117232712" "subst" "1.06806E-5" "03595" "CFTR_000088" "g.117232712G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117592658G>A" "" "pathogenic (recessive)" "" "0000663501" "2" "90" "7" "117232712" "117232712" "subst" "5.34028E-6" "03595" "CFTR_001493" "g.117232712G>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117592658G>T" "" "pathogenic (recessive)" "" "0000663502" "2" "90" "7" "117242919" "117242920" "ins" "5.27923E-5" "03595" "CFTR_000089" "g.117242919_117242920insA" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117602865_117602866insA" "" "pathogenic (recessive)" "" "0000663503" "2" "90" "7" "117242919" "117242920" "ins" "5.27923E-5" "03595" "CFTR_000089" "g.117242919_117242920insA" "" "Sasaki 2020, submitted" "" "likely mild mut" "" "Germline" "" "" "0" "" "" "g.117602865_117602866insA" "" "pathogenic (recessive)" "" "0000663504" "2" "90" "7" "117170954" "117171169" "del" "0" "03595" "CFTR_001487" "g.117170954_117171169del" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530900_117531115del" "" "pathogenic (recessive)" "" "0000663505" "2" "90" "7" "117243803" "117243803" "del" "4.06309E-6" "03595" "CFTR_001494" "g.117243803del" "" "Sasaki 2020, submitted" "" "2875delG (Ala959Hisfs*9)" "" "Germline" "" "" "0" "" "" "g.117603749del" "" "pathogenic (recessive)" "" "0000663506" "2" "90" "7" "117243824" "117243824" "del" "0" "03595" "CFTR_001256" "g.117243824del" "" "Sasaki 2020, submitted" "" "2896delA (Thr966Argfs*2)" "" "Germline" "" "" "0" "" "" "g.117603770del" "" "pathogenic (recessive)" "" "0000663507" "2" "90" "7" "117246808" "117246808" "subst" "9.76388E-5" "03595" "CFTR_000016" "g.117246808G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117606754G>A" "" "pathogenic (recessive)" "" "0000663508" "2" "90" "7" "117251609" "117251609" "subst" "4.31727E-5" "03595" "CFTR_000023" "g.117251609A>G" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117611555A>G" "" "pathogenic (recessive)" "" "0000663509" "2" "90" "7" "117171007" "117171007" "subst" "2.03366E-5" "03595" "CFTR_000076" "g.117171007G>C" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530953G>C" "" "pathogenic (recessive)" "" "0000663510" "2" "90" "7" "117267579" "117267579" "subst" "3.26216E-5" "03595" "CFTR_000037" "g.117267579C>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117627525C>T" "" "pathogenic (recessive)" "" "0000663511" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000663512" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000663513" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000663514" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000663515" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000663516" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000663517" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000663518" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000663519" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000663520" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000663521" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000663522" "2" "90" "7" "117267766" "117267766" "del" "4.0832E-6" "03595" "CFTR_001385" "g.117267766del" "" "Sasaki 2020, submitted" "" "3659delC" "" "Germline" "" "" "0" "" "" "g.117627712del" "" "pathogenic (recessive)" "" "0000663523" "2" "90" "7" "117280015" "117280015" "subst" "0" "03595" "CFTR_000011" "g.117280015C>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117639961C>T" "" "pathogenic (recessive)" "" "0000663524" "2" "90" "7" "117280015" "117280015" "subst" "0" "03595" "CFTR_000011" "g.117280015C>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117639961C>T" "" "pathogenic (recessive)" "" "0000663525" "2" "90" "7" "117280015" "117280015" "subst" "0" "03595" "CFTR_000011" "g.117280015C>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117639961C>T" "" "pathogenic (recessive)" "" "0000663526" "2" "90" "7" "117282620" "117282620" "subst" "0.0004396" "03595" "CFTR_000005" "g.117282620G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117642566G>A" "" "pathogenic (recessive)" "" "0000663527" "2" "90" "7" "117292931" "117292931" "subst" "0.000139103" "03595" "CFTR_000004" "g.117292931C>G" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117652877C>G" "" "pathogenic (recessive)" "" "0000663528" "2" "90" "7" "117292931" "117292931" "subst" "0.000139103" "03595" "CFTR_000004" "g.117292931C>G" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117652877C>G" "" "pathogenic (recessive)" "" "0000663529" "2" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000663530" "2" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000663531" "2" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000663532" "2" "90" "7" "117174372" "117174372" "subst" "1.22207E-5" "03595" "CFTR_000055" "g.117174372G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117534318G>A" "" "pathogenic (recessive)" "" "0000663533" "2" "90" "7" "117227887" "117227887" "subst" "2.03832E-5" "03595" "CFTR_000022" "g.117227887G>C" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117587833G>C" "" "pathogenic (recessive)" "" "0000663534" "2" "90" "7" "117149123" "117149123" "subst" "3.25529E-5" "03595" "CFTR_000053" "g.117149123C>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117509069C>T" "" "pathogenic (recessive)" "" "0000663535" "2" "90" "7" "117232473" "117232473" "subst" "4.09353E-6" "03595" "CFTR_001492" "g.117232473G>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117592419G>T" "" "pathogenic (recessive)" "" "0000663536" "2" "90" "7" "117235044" "117235044" "subst" "0" "03595" "CFTR_000126" "g.117235044C>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117594990C>T" "" "pathogenic (recessive)" "" "0000663537" "2" "90" "7" "117246749" "117246749" "subst" "1.21994E-5" "03595" "CFTR_000159" "g.117246749C>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117606695C>T" "" "pathogenic (recessive)" "" "0000663538" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000663539" "2" "90" "7" "117199683" "117199683" "subst" "4.06673E-6" "03595" "CFTR_000050" "g.117199683G>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117559629G>T" "" "pathogenic (recessive)" "" "0000663540" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000663541" "2" "90" "7" "117171029" "117171029" "subst" "1.22095E-5" "03595" "CFTR_001488" "g.117171029G>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>T" "" "pathogenic (recessive)" "" "0000663542" "2" "90" "7" "117188812" "117188815" "dup" "0" "03595" "CFTR_001490" "g.117188812_117188815dup" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117548758_117548761dup" "" "pathogenic (recessive)" "" "0000663543" "2" "90" "7" "117199602" "117199602" "subst" "2.03178E-5" "03595" "CFTR_000024" "g.117199602C>T" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117559548C>T" "" "pathogenic (recessive)" "" "0000663544" "2" "90" "7" "117242919" "117242920" "ins" "5.27923E-5" "03595" "CFTR_000089" "g.117242919_117242920insA" "" "Sasaki 2020, submitted" "" "2789+2insA" "" "Germline" "" "" "0" "" "" "g.117602865_117602866insA" "" "pathogenic (recessive)" "" "0000663545" "2" "90" "7" "117230494" "117230494" "subst" "3.27166E-5" "03595" "CFTR_000018" "g.117230494G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117590440G>A" "" "pathogenic (recessive)" "" "0000664803" "0" "50" "7" "117251769" "117251769" "subst" "3.25264E-5" "01164" "CFTR_001497" "g.117251769T>C" "" "" "" "" "ACMG grading: PS4,PM1,PM2,PP1; Selcen et al. 2004. Neurology 27: 405; Rudolf et al. 2016. J Neuromuscul Dis 27: 275" "Germline" "" "rs376968326" "0" "" "" "g.117611715T>C" "" "VUS" "ACMG" "0000664847" "1" "90" "7" "117180284" "117180284" "subst" "6.09796E-5" "03595" "CFTR_000026" "g.117180284C>T" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117540230C>T" "" "pathogenic (recessive)" "" "0000664848" "1" "90" "7" "117180324" "117180324" "subst" "2.44035E-5" "03595" "CFTR_000020" "g.117180324G>C" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117540270G>C" "" "pathogenic (recessive)" "" "0000664849" "1" "90" "7" "117199683" "117199683" "subst" "4.06673E-6" "03595" "CFTR_000050" "g.117199683G>T" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559629G>T" "" "pathogenic (recessive)" "" "0000664850" "1" "90" "7" "117199644" "117199646" "del" "0" "03595" "CFTR_000017" "g.117199644_117199646del" "" "Sasaki 2020, submitted" "" "1519_1521delATC" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559590_117559592del" "" "pathogenic (recessive)" "" "0000664851" "1" "90" "7" "117199644" "117199646" "del" "0" "03595" "CFTR_000017" "g.117199644_117199646del" "" "Sasaki 2020, submitted" "" "1519_1521delATC" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559590_117559592del" "" "pathogenic (recessive)" "" "0000664852" "1" "90" "7" "117199644" "117199646" "del" "0" "03595" "CFTR_000017" "g.117199644_117199646del" "" "Sasaki 2020, submitted" "" "1519_1521delATC" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559590_117559592del" "" "pathogenic (recessive)" "" "0000664853" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664854" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664855" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664856" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664857" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664858" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664859" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664860" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664861" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664862" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664863" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664864" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664865" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664866" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664867" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664868" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664869" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664870" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664871" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664872" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664873" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664874" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664875" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664876" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664877" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664878" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664879" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664880" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664881" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664882" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664883" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664884" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664885" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664886" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664887" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664888" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664889" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664890" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664891" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664892" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664893" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664894" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664895" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664896" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664897" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664898" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664899" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664900" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664901" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664902" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664903" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664904" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664905" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664906" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664907" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664908" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664909" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664910" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664911" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664912" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664913" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664914" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664915" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664916" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664917" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664918" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664919" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664920" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664921" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664922" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664923" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664924" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664925" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664926" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664927" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664928" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664929" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664930" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664931" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664932" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664933" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664934" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664935" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664936" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664937" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664938" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664939" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664940" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664941" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664942" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664943" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664944" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664945" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664946" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664947" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664948" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664949" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664950" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664951" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664952" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664953" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664954" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664955" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664956" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664957" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664958" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664959" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664960" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664961" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664962" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664963" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664964" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664965" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664966" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664967" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664968" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664969" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664970" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664971" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664972" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664973" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664974" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664975" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664976" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664977" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664978" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664979" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664980" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664981" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664982" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664983" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664984" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664985" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664986" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664987" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664988" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664989" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664990" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664991" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664992" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664993" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664994" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664995" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664996" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664997" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664998" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000664999" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665000" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665001" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665002" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665003" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665004" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665005" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665006" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665007" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665008" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665009" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665010" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665011" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665012" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665013" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665014" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665015" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665016" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665017" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665018" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665019" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665020" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665021" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665022" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665023" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665024" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665025" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665026" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665027" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665028" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665029" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665030" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665031" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665032" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665033" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665034" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665035" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665036" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665037" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665038" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665039" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665040" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665041" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665042" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665043" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665044" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665045" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665046" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665047" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665048" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665049" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665050" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665051" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665052" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665053" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665054" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665055" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665056" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665057" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665058" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665059" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665060" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665061" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665062" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665063" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665064" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665065" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665066" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665067" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665068" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665069" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665070" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665071" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665072" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665073" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665074" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665075" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665076" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665077" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665078" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665079" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665080" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665081" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665082" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665083" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665084" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665085" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665086" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665087" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665088" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665089" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665090" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665091" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665092" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665093" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665094" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665095" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665096" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665097" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665098" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665099" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665100" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665101" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665102" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665103" "1" "90" "7" "117227792" "117227792" "subst" "8.54965E-5" "03595" "CFTR_000008" "g.117227792G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587738G>A" "" "pathogenic (recessive)" "" "0000665104" "1" "90" "7" "117227792" "117227792" "subst" "8.54965E-5" "03595" "CFTR_000008" "g.117227792G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587738G>A" "" "pathogenic (recessive)" "" "0000665105" "1" "90" "7" "117227792" "117227792" "subst" "8.54965E-5" "03595" "CFTR_000008" "g.117227792G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587738G>A" "" "pathogenic (recessive)" "" "0000665106" "1" "90" "7" "117227832" "117227832" "subst" "0.000358192" "03595" "CFTR_000002" "g.117227832G>T" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587778G>T" "" "pathogenic (recessive)" "" "0000665107" "1" "90" "7" "117227832" "117227832" "subst" "0.000358192" "03595" "CFTR_000002" "g.117227832G>T" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587778G>T" "" "pathogenic (recessive)" "" "0000665108" "1" "90" "7" "117227855" "117227855" "subst" "0" "03595" "CFTR_001496" "g.117227855T>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587801T>A" "" "pathogenic (recessive)" "" "0000665109" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665110" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665111" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665112" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665113" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665114" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665115" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665116" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665117" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665118" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665119" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665120" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665121" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665122" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665123" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665124" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665125" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665126" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665127" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665128" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665129" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665130" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665131" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665132" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665133" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665134" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665135" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665136" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665137" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665138" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665139" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665140" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665141" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665142" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665143" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665144" "1" "90" "7" "117227865" "117227865" "subst" "7.33E-5" "03595" "CFTR_000007" "g.117227865C>T" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587811C>T" "" "pathogenic (recessive)" "" "0000665145" "1" "90" "7" "117227865" "117227865" "subst" "7.33E-5" "03595" "CFTR_000007" "g.117227865C>T" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587811C>T" "" "pathogenic (recessive)" "" "0000665146" "1" "90" "7" "117227887" "117227887" "subst" "2.03832E-5" "03595" "CFTR_000022" "g.117227887G>C" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587833G>C" "" "pathogenic (recessive)" "" "0000665147" "1" "90" "7" "117227887" "117227887" "subst" "2.03832E-5" "03595" "CFTR_000022" "g.117227887G>C" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587833G>C" "" "pathogenic (recessive)" "" "0000665148" "1" "90" "7" "117227887" "117227887" "subst" "2.03832E-5" "03595" "CFTR_000022" "g.117227887G>C" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587833G>C" "" "pathogenic (recessive)" "" "0000665149" "1" "90" "7" "117227887" "117227887" "subst" "2.03832E-5" "03595" "CFTR_000022" "g.117227887G>C" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587833G>C" "" "pathogenic (recessive)" "" "0000665150" "1" "90" "7" "117227887" "117227887" "subst" "2.03832E-5" "03595" "CFTR_000022" "g.117227887G>C" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587833G>C" "" "pathogenic (recessive)" "" "0000665151" "1" "90" "7" "117149177" "117149177" "subst" "4.47839E-5" "03595" "CFTR_000015" "g.117149177G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117509123G>A" "" "pathogenic (recessive)" "" "0000665152" "1" "90" "7" "117149177" "117149177" "subst" "4.47839E-5" "03595" "CFTR_000015" "g.117149177G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117509123G>A" "" "pathogenic (recessive)" "" "0000665153" "1" "90" "7" "117149177" "117149177" "subst" "4.47839E-5" "03595" "CFTR_000015" "g.117149177G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117509123G>A" "" "pathogenic (recessive)" "" "0000665154" "1" "90" "7" "117246808" "117246808" "subst" "9.76388E-5" "03595" "CFTR_000016" "g.117246808G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117606754G>A" "" "pathogenic (recessive)" "" "0000665155" "1" "90" "7" "117267591" "117267591" "subst" "5.29799E-5" "03595" "CFTR_000012" "g.117267591C>T" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117627537C>T" "" "pathogenic (recessive)" "" "0000665156" "1" "90" "7" "117267766" "117267766" "del" "4.0832E-6" "03595" "CFTR_001385" "g.117267766del" "" "Sasaki 2020, submitted" "" "3659delC" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117627712del" "" "pathogenic (recessive)" "" "0000665157" "1" "90" "7" "117267766" "117267766" "del" "4.0832E-6" "03595" "CFTR_001385" "g.117267766del" "" "Sasaki 2020, submitted" "" "3659delC" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117627712del" "" "pathogenic (recessive)" "" "0000665158" "1" "90" "7" "117267766" "117267766" "del" "4.0832E-6" "03595" "CFTR_001385" "g.117267766del" "" "Sasaki 2020, submitted" "" "3659delC" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117627712del" "" "pathogenic (recessive)" "" "0000665159" "1" "90" "7" "117267766" "117267766" "del" "4.0832E-6" "03595" "CFTR_001385" "g.117267766del" "" "Sasaki 2020, submitted" "" "3659delC" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117627712del" "" "pathogenic (recessive)" "" "0000665160" "1" "90" "7" "117292931" "117292931" "subst" "0.000139103" "03595" "CFTR_000004" "g.117292931C>G" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117652877C>G" "" "pathogenic (recessive)" "" "0000665161" "1" "90" "7" "117292931" "117292931" "subst" "0.000139103" "03595" "CFTR_000004" "g.117292931C>G" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117652877C>G" "" "pathogenic (recessive)" "" "0000665162" "1" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000665163" "1" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000665164" "1" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000665165" "1" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000665166" "1" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000665167" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665168" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665170" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665171" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665172" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665173" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665174" "1" "90" "7" "117227860" "117227860" "subst" "0.00017913" "03595" "CFTR_000003" "g.117227860G>A" "" "Sasaki 2020, submitted" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117587806G>A" "" "pathogenic (recessive)" "" "0000665175" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665176" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665177" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665178" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665179" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665180" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665181" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665182" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665183" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665184" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665185" "1" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "621+1G>T" "" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000665186" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665187" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665188" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665189" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665190" "1" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "621+1G>T" "" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000665191" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665192" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665193" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665194" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665195" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665196" "1" "90" "7" "117171169" "117171169" "subst" "8.314E-5" "03595" "CFTR_000009" "g.117171169G>T" "" "Sasaki 2020, submitted" "" "621+1G>T" "" "Germline" "" "" "0" "" "" "g.117531115G>T" "" "pathogenic (recessive)" "" "0000665197" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665198" "1" "90" "7" "117199646" "117199648" "del" "0" "03595" "CFTR_000001" "g.117199646_117199648del" "" "Sasaki 2020, submitted" "" "1521_1523delCTT" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000665199" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665200" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "[350G>A;)TG12,5T;-4G>C]" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665201" "2" "90" "7" "117246808" "117246808" "subst" "9.76388E-5" "03595" "CFTR_000016" "g.117246808G>A" "" "Sasaki 2020, submitted" "" "3120+1G>A" "" "Germline" "" "" "0" "" "" "g.117606754G>A" "" "pathogenic (recessive)" "" "0000665202" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665203" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665204" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665205" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665206" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665207" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665208" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665209" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665210" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665211" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665212" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665213" "2" "90" "7" "117171029" "117171029" "subst" "0.00147328" "03595" "CFTR_000006" "g.117171029G>A" "" "Sasaki 2020, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000665214" "2" "50" "7" "117188684" "117188684" "subst" "0" "03595" "CFTR_001154" "g.117188684T>G" "" "Sasaki 2020, submitted" "" "GT[12]T[4]" "" "Germline" "" "" "0" "" "" "g.117548630T>G" "" "VUS" "" "0000665215" "2" "50" "7" "117120145" "117120145" "subst" "7.7222E-5" "03595" "CFTR_001495" "g.117120145G>C" "" "Sasaki 2020, submitted" "" "[350G>A;)TG12,5T;-4G>C]" "" "Germline" "" "" "0" "" "" "g.117480091G>C" "" "VUS" "" "0000674000" "3" "90" "7" "117199645" "117199647" "del" "0.00695799" "01164" "CFTR_000001" "g.117199645_117199647del" "" "Dequeker et al. 2009. EJHG 17: 51-65" "" "" "ACMG grading: PS4,PM2,PM3,PM4,PP4" "Germline" "" "rs199826652" "0" "" "" "" "" "pathogenic" "ACMG" "0000677932" "0" "70" "7" "117149123" "117149123" "subst" "3.25529E-5" "02327" "CFTR_000053" "g.117149123C>T" "" "" "" "CFTR(NM_000492.4):c.200C>T (p.P67L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000677933" "0" "90" "7" "117149146" "117149146" "subst" "2.44182E-5" "02325" "CFTR_000068" "g.117149146C>T" "" "" "" "CFTR(NM_000492.4):c.223C>T (p.R75*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000677934" "0" "70" "7" "117149177" "117149177" "subst" "4.47839E-5" "02327" "CFTR_000015" "g.117149177G>A" "" "" "" "CFTR(NM_000492.3):c.254G>A (p.G85E), CFTR(NM_000492.4):c.254G>A (p.G85E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000677935" "0" "50" "7" "117175443" "117175443" "subst" "4.06253E-6" "02325" "CFTR_001498" "g.117175443G>A" "" "" "" "CFTR(NM_000492.4):c.721G>A (p.G241R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000677936" "0" "50" "7" "117180242" "117180242" "subst" "0.000634002" "01943" "CFTR_001499" "g.117180242T>G" "" "" "" "CFTR(NM_000492.3):c.958T>G (p.L320V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000677937" "0" "50" "7" "117232155" "117232155" "subst" "1.21978E-5" "02325" "CFTR_001500" "g.117232155T>A" "" "" "" "CFTR(NM_000492.4):c.1934T>A (p.M645K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000677938" "0" "50" "7" "117243783" "117243783" "subst" "0.000272209" "01943" "CFTR_001501" "g.117243783T>C" "" "" "" "CFTR(NM_000492.3):c.2855T>C (p.M952T), CFTR(NM_000492.4):c.2855T>C (p.M952T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000677939" "0" "30" "7" "117251699" "117251699" "subst" "3.256E-5" "01943" "CFTR_001502" "g.117251699C>T" "" "" "" "CFTR(NM_000492.3):c.3204C>T (p.F1068=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000677940" "0" "30" "7" "117267665" "117267665" "subst" "0.000215988" "02326" "CFTR_001440" "g.117267665A>G" "" "" "" "CFTR(NM_000492.3):c.3558A>G (p.Q1186=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000677941" "0" "50" "7" "117304907" "117304907" "subst" "4.06633E-6" "01943" "CFTR_001503" "g.117304907G>C" "" "" "" "CFTR(NM_000492.3):c.4129G>C (p.D1377H), CFTR(NM_000492.4):c.4129G>C (p.D1377H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000677942" "0" "50" "7" "117307052" "117307052" "subst" "0.000333797" "02325" "CFTR_001504" "g.117307052G>A" "" "" "" "CFTR(NM_000492.4):c.4333G>A (p.D1445N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000682855" "0" "90" "7" "117227865" "117227865" "subst" "7.33E-5" "01164" "CFTR_000007" "g.117227865C>T" "" "Cutting et al. 1990. Nature 346: 366; Amato et al. 2012. J 14: 81; Castellani et al. 2008. J Cyst Fibros 7: 179" "" "" "ACMG: PVS1, PS4, PM2, PM3, PP1 class 5" "Germline" "" "rs74597325" "0" "" "" "" "" "pathogenic" "" "0000682856" "0" "50" "7" "117171171" "117171171" "subst" "0.000233234" "01164" "CFTR_001187" "g.117171171A>G" "" "" "" "" "ACMG grading: BP2,PS3,PM3,PP3\r\nconflicting but valid lines of evidence, detected in a 37y old male with decreased fertility as seen on spermiogram" "Germline" "" "rs377729736" "0" "" "" "" "" "VUS" "ACMG" "0000684764" "0" "30" "7" "117188684" "117188684" "subst" "0" "00004" "CFTR_001154" "g.117188684T>G" "frequency 0.020" "{PMID:Le 2019:31180159}" "" "" "classification based on frequency in 305 unrelated individuals" "Germline" "" "" "0" "" "" "g.117548630T>G" "" "likely benign" "" "0000684765" "0" "30" "7" "117227874" "117227874" "subst" "0.00342536" "00004" "CFTR_001017" "g.117227874A>G" "frequency 0.042" "{PMID:Le 2019:31180159}" "" "" "classification based on frequency in 305 unrelated individuals" "Germline" "" "" "0" "" "" "g.117587820A>G" "" "likely benign" "" "0000684766" "0" "10" "7" "117267869" "117267869" "subst" "0.00117055" "00004" "CFTR_001442" "g.117267869G>A" "frequency 0.020" "{PMID:Le 2019:31180159}" "" "" "classification based on frequency in 305 unrelated individuals" "Germline" "" "" "0" "" "" "g.117627815G>A" "" "benign" "" "0000684767" "0" "30" "7" "117304834" "117304834" "subst" "0.000991991" "00004" "CFTR_001413" "g.117304834G>C" "frequency 0.051" "{PMID:Le 2019:31180159}" "" "" "classification based on frequency in 305 unrelated individuals" "Germline" "" "" "0" "" "" "g.117664780G>C" "" "likely benign" "" "0000685858" "0" "11" "7" "117120141" "117120141" "subst" "0.0461313" "00086" "CFTR_001312" "g.117120141G>C" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "125G/C" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs1800501" "0" "" "" "g.117480087G>C" "" "benign" "" "0000685859" "0" "77" "7" "117180285" "117180285" "subst" "0.000117891" "00086" "CFTR_001014" "g.117180285G>A" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R334Q" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs397508137" "0" "" "" "g.117540231G>A" "" "likely pathogenic (!)" "" "0000685860" "0" "99" "7" "117180285" "117180285" "subst" "0" "00086" "CFTR_001540" "g.117180285G>T" "15/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R334L" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508137" "0" "" "" "g.117540231G>T" "" "pathogenic (recessive)" "" "0000685861" "0" "99" "7" "117180321" "117180321" "subst" "0" "00086" "CFTR_001541" "g.117180321T>C" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "L346P" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508146" "0" "" "" "g.117540267T>C" "" "pathogenic (recessive)" "" "0000685862" "0" "55" "7" "117180330" "117180330" "subst" "0.000109827" "00086" "CFTR_001330" "g.117180330C>T" "11/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "A349V" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909021" "0" "" "" "g.117540276C>T" "" "VUS" "" "0000685863" "0" "77" "7" "117180338" "117180338" "subst" "0.000418904" "00086" "CFTR_001015" "g.117180338C>T" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R352W" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs193922497" "0" "" "" "g.117540284C>T" "" "likely pathogenic (!)" "" "0000685864" "0" "99" "7" "117188843" "117188843" "subst" "0" "00086" "CFTR_001543" "g.117188843T>C" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "L453S" "see the CFTR2 database for details" "SUMMARY record" "" "rs1562895128" "0" "" "" "g.117548789T>C" "" "pathogenic (recessive)" "" "0000685865" "0" "99" "7" "117188852" "117188852" "subst" "0" "00086" "CFTR_001336" "g.117188852T>C" "27/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "V456A" "see the CFTR2 database for details" "SUMMARY record" "" "rs193922500" "0" "" "" "g.117548798T>C" "" "pathogenic (recessive)" "" "0000685866" "0" "99" "7" "117199545" "117199545" "subst" "0" "00086" "CFTR_001545" "g.117199545G>A" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "E474K" "see the CFTR2 database for details" "SUMMARY record" "" "rs756206533" "0" "" "" "g.117559491G>A" "" "pathogenic (recessive)" "" "0000685867" "0" "77" "7" "117120162" "117120162" "subst" "2.43896E-5" "00086" "CFTR_001508" "g.117120162C>T" "60/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "P5L" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs193922501" "0" "" "" "g.117480108C>T" "" "likely pathogenic (!)" "" "0000685868" "0" "99" "7" "117199630" "117199630" "subst" "8.1277E-6" "00086" "CFTR_001546" "g.117199630T>C" "15/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "I502T" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508222" "0" "" "" "g.117559576T>C" "" "pathogenic (recessive)" "" "0000685869" "0" "11" "7" "117199648" "117199648" "subst" "0.000906775" "00086" "CFTR_001342" "g.117199648T>G" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "F508C" "see the CFTR2 database for details" "SUMMARY record" "" "rs74571530" "0" "" "" "g.117559594T>G" "" "benign" "" "0000685870" "0" "99" "7" "117199663" "117199663" "subst" "4.06537E-6" "00086" "CFTR_001547" "g.117199663A>G" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "D513G" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508225" "0" "" "" "g.117559609A>G" "" "pathogenic (recessive)" "" "0000685871" "0" "11" "7" "117199709" "117199709" "subst" "0.016887" "00086" "CFTR_001343" "g.117199709G>A" "29/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1716G/A" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs1800095" "0" "" "" "g.117559655G>A" "" "benign" "" "0000685872" "0" "55" "7" "117144445" "117144445" "subst" "0.00134932" "00086" "CFTR_001421" "g.117144445A>G" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "296+28A->G" "see the CFTR2 database for details" "SUMMARY record" "" "rs34010645" "0" "" "" "g.117504391A>G" "" "VUS" "" "0000685873" "0" "99" "7" "117144419" "117144419" "subst" "0" "00086" "CFTR_001513" "g.117144419T>C" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "296+2T->C" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908800" "0" "" "" "g.117504365T>C" "" "pathogenic (recessive)" "" "0000685874" "0" "99" "7" "117144421" "117144421" "dup" "0" "00086" "CFTR_001514" "g.117144421dup" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "164+3_164+4insT, 296+3insT" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508244" "0" "" "" "g.117504367dup" "" "pathogenic (recessive)" "" "0000685875" "0" "11" "7" "117149085" "117149085" "subst" "2.44559E-5" "00086" "CFTR_001515" "g.117149085C>T" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "297-3C->T" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs200337193" "0" "" "" "g.117509031C>T" "" "benign" "" "0000685876" "0" "99" "7" "117230414" "117230414" "subst" "4.07551E-6" "00086" "CFTR_001549" "g.117230414T>A" "33/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Y563N" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909006" "0" "" "" "g.117590360T>A" "" "pathogenic (recessive)" "" "0000685877" "0" "99" "7" "117230414" "117230414" "subst" "0" "00086" "CFTR_001550" "g.117230414T>G" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Y563D" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909006" "0" "" "" "g.117590360T>G" "" "pathogenic (recessive)" "" "0000685878" "0" "99" "7" "117149092" "117149092" "subst" "0" "00086" "CFTR_001516" "g.117149092T>G" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "W57G" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508272" "0" "" "" "g.117509038T>G" "" "pathogenic (recessive)" "" "0000685879" "0" "99" "7" "117230448" "117230448" "subst" "8.15175E-6" "00086" "CFTR_001551" "g.117230448C>A" "25/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "P574H" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908758" "0" "" "" "g.117590394C>A" "" "pathogenic (recessive)" "" "0000685880" "0" "77" "7" "117230451" "117230451" "subst" "1.63001E-5" "00086" "CFTR_001552" "g.117230451T>A" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "F575Y" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs773569201" "0" "" "" "g.117590397T>A" "" "likely pathogenic (!)" "" "0000685881" "0" "99" "7" "117230494" "117230494" "subst" "0" "00086" "CFTR_001553" "g.117230494G>T" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1898+1G->T" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908748" "0" "" "" "g.117590440G>T" "" "pathogenic (recessive)" "" "0000685882" "0" "99" "7" "117149101" "117149101" "subst" "0" "00086" "CFTR_001517" "g.117149101G>A" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "E60K" "see the CFTR2 database for details" "SUMMARY record" "" "rs77284892" "0" "" "" "g.117509047G>A" "" "pathogenic (recessive)" "" "0000685883" "0" "99" "7" "117232022" "117232022" "subst" "0" "00086" "CFTR_001468" "g.117232022A>T" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "I601F" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs397508306" "0" "" "" "g.117591968A>T" "" "pathogenic (recessive)" "" "0000685884" "0" "99" "7" "117232047" "117232047" "subst" "0" "00086" "CFTR_001554" "g.117232047A>G" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "H609R" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508310" "0" "" "" "g.117591993A>G" "" "pathogenic (recessive)" "" "0000685885" "0" "99" "7" "117232058" "117232058" "subst" "0" "00086" "CFTR_001555" "g.117232058G>A" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "A613T" "see the CFTR2 database for details" "SUMMARY record" "" "rs201978662" "0" "" "" "g.117592004G>A" "" "pathogenic (recessive)" "" "0000685886" "0" "77" "7" "117232074" "117232074" "subst" "2.21086E-5" "00086" "CFTR_001350" "g.117232074T>C" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "I618T" "see the CFTR2 database for details; varying clinical consequence, classification recently changed" "SUMMARY record" "" "rs139468767" "0" "" "" "g.117592020T>C" "" "likely pathogenic (!)" "" "0000685887" "0" "77" "7" "117232086" "117232086" "subst" "8.82168E-5" "00086" "CFTR_001409" "g.117232086G>A" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G622D" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs121908759" "0" "" "" "g.117592032G>A" "" "likely pathogenic (!)" "" "0000685888" "0" "99" "7" "117232379" "117232379" "subst" "4.06372E-6" "00086" "CFTR_001556" "g.117232379C>T" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q720X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508346" "0" "" "" "g.117592325C>T" "" "pathogenic (recessive)" "" "0000685889" "0" "77" "7" "117232470" "117232470" "subst" "0.00027771" "00086" "CFTR_001433" "g.117232470C>T" "13/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "P750L" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs140455771" "0" "" "" "g.117592416C>T" "" "likely pathogenic (!)" "" "0000685890" "0" "11" "7" "117232642" "117232642" "subst" "0.000758916" "00086" "CFTR_001136" "g.117232642A>G" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "I807M" "see the CFTR2 database for details" "SUMMARY record" "" "rs1800103" "0" "" "" "g.117592588A>G" "" "benign" "" "0000685891" "0" "99" "7" "117149194" "117149194" "subst" "4.07611E-6" "00086" "CFTR_001518" "g.117149194G>A" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G91R" "see the CFTR2 database for details" "SUMMARY record" "" "rs121908750" "0" "" "" "g.117509140G>A" "" "pathogenic (recessive)" "" "0000685892" "0" "55" "7" "117243663" "117243663" "subst" "0.00107255" "00086" "CFTR_001557" "g.117243663C>T" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "S912L" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909034" "0" "" "" "g.117603609C>T" "" "VUS" "" "0000685893" "0" "99" "7" "117170951" "117170951" "subst" "0" "00086" "CFTR_001519" "g.117170951A>G" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "406-2A->G" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508426" "0" "" "" "g.117530897A>G" "" "pathogenic (recessive)" "" "0000685894" "0" "55" "7" "117243698" "117243698" "subst" "6.49931E-5" "00086" "CFTR_001437" "g.117243698G>A" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "D924N" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs201759207" "0" "" "" "g.117603644G>A" "" "VUS" "" "0000685895" "0" "55" "7" "117243783" "117243783" "subst" "0.000272209" "00086" "CFTR_001501" "g.117243783T>C" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "M952T" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs142773283" "0" "" "" "g.117603729T>C" "" "VUS" "" "0000685896" "0" "77" "7" "117243828" "117243828" "subst" "0.000707357" "00086" "CFTR_001364" "g.117243828T>C" "20/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "L967S" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs1800110" "0" "" "" "g.117603774T>C" "" "likely pathogenic (!)" "" "0000685897" "0" "99" "7" "117246728" "117246728" "subst" "1.22079E-5" "00086" "CFTR_001558" "g.117246728G>A" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G970D" "see the CFTR2 database for details" "SUMMARY record" "" "rs386134230" "0" "" "" "g.117606674G>A" "" "pathogenic (recessive)" "" "0000685898" "0" "99" "7" "117246755" "117246755" "subst" "0" "00086" "CFTR_001559" "g.117246755A>T" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "D979V" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508462" "0" "" "" "g.117606701A>T" "" "pathogenic (recessive)" "" "0000685899" "0" "99" "7" "117170972" "117170972" "subst" "8.1357E-6" "00086" "CFTR_001520" "g.117170972A>G" "16/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q98R" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508464" "0" "" "" "g.117530918A>G" "" "pathogenic (recessive)" "" "0000685900" "0" "99" "7" "117170975" "117170975" "subst" "8.13498E-6" "00086" "CFTR_001521" "g.117170975C>T" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "P99L" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508467" "0" "" "" "g.117530921C>T" "" "pathogenic (recessive)" "" "0000685901" "0" "99" "7" "117250601" "117250601" "subst" "0" "00086" "CFTR_001561" "g.117250601C>A" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "A1006E" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508480" "0" "" "" "g.117610547C>A" "" "pathogenic (recessive)" "" "0000685902" "0" "55" "7" "117250625" "117250625" "subst" "0.000280579" "00086" "CFTR_001562" "g.117250625A>G" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Y1014C" "see the CFTR2 database for details" "SUMMARY record" "" "rs149279509" "0" "" "" "g.117610571A>G" "" "VUS" "" "0000685903" "0" "77" "7" "117250631" "117250631" "subst" "8.13279E-6" "00086" "CFTR_001563" "g.117250631T>C" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "F1016S" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs397508488" "0" "" "" "g.117610577T>C" "" "likely pathogenic (!)" "" "0000685904" "0" "99" "7" "117170984" "117170984" "subst" "4.06712E-6" "00086" "CFTR_001522" "g.117170984T>G" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "L102R" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508490" "0" "" "" "g.117530930T>G" "" "pathogenic (recessive)" "" "0000685905" "0" "77" "7" "117250679" "117250679" "subst" "1.62762E-5" "00086" "CFTR_001564" "g.117250679A>G" "16/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Y1032C" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs144055758" "0" "" "" "g.117610625A>G" "" "likely pathogenic (!)" "" "0000685906" "0" "99" "7" "117250691" "117250691" "subst" "4.06971E-6" "00086" "CFTR_001565" "g.117250691C>A" "13/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "T1036N" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508498" "0" "" "" "g.117610637C>A" "" "pathogenic (recessive)" "" "0000685907" "0" "11" "7" "117251653" "117251653" "subst" "8.15528E-6" "00086" "CFTR_001566" "g.117251653C>T" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "T1053I" "see the CFTR2 database for details" "SUMMARY record" "" "rs140883683" "0" "" "" "g.117611599C>T" "" "benign" "" "0000685908" "0" "99" "7" "117251787" "117251787" "subst" "0" "00086" "CFTR_001567" "g.117251787T>C" "11/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "W1098R" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508531" "0" "" "" "g.117611733T>C" "" "pathogenic (recessive)" "" "0000685909" "0" "77" "7" "117251792" "117251792" "subst" "1.62685E-5" "00086" "CFTR_001568" "g.117251792C>A" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "F1099L" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs747754623" "0" "" "" "g.117611738C>A" "" "likely pathogenic (!)" "" "0000685910" "0" "99" "7" "117251797" "117251797" "subst" "0" "00086" "CFTR_001569" "g.117251797T>G" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "M1101R" "see the CFTR2 database for details" "SUMMARY record" "" "rs36210737" "0" "" "" "g.117611743T>G" "" "pathogenic (recessive)" "" "0000685911" "0" "77" "7" "117171009" "117171009" "subst" "1.22021E-5" "00086" "CFTR_001523" "g.117171009C>A" "14/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "D110E" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs397508537" "0" "" "" "g.117530955C>A" "" "likely pathogenic (!)" "" "0000685912" "0" "99" "7" "117251848" "117251848" "subst" "1.22352E-5" "00086" "CFTR_001475" "g.117251848C>T" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "S1118F" "see the CFTR2 database for details" "SUMMARY record" "" "rs146521846" "0" "" "" "g.117611794C>T" "" "pathogenic (recessive)" "" "0000685913" "0" "77" "7" "117254757" "117254757" "subst" "3.25712E-5" "00086" "CFTR_001570" "g.117254757T>A" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "V1153E" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs397508567" "0" "" "" "g.117614703T>A" "" "likely pathogenic (!)" "" "0000685914" "0" "99" "7" "117267582" "117267582" "subst" "4.07654E-6" "00086" "CFTR_001571" "g.117267582T>C" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "S1159P" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508572" "0" "" "" "g.117627528T>C" "" "pathogenic (recessive)" "" "0000685915" "0" "99" "7" "117267583" "117267583" "subst" "4.07634E-6" "00086" "CFTR_001381" "g.117267583C>T" "14/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "S1159F" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508573" "0" "" "" "g.117627529C>T" "" "pathogenic (recessive)" "" "0000685916" "0" "77" "7" "117171028" "117171028" "subst" "2.035E-5" "00086" "CFTR_001524" "g.117171028C>G" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R117G" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs77834169" "0" "" "" "g.117530974C>G" "" "likely pathogenic (!)" "" "0000685917" "0" "99" "7" "117171029" "117171029" "subst" "0" "00086" "CFTR_001525" "g.117171029G>C" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R117P" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs78655421" "0" "" "" "g.117530975G>C" "" "pathogenic (recessive)" "" "0000685918" "0" "77" "7" "117171029" "117171029" "subst" "1.22095E-5" "00086" "CFTR_001488" "g.117171029G>T" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R117L" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs78655421" "0" "" "" "g.117530975G>T" "" "likely pathogenic (!)" "" "0000685919" "0" "77" "7" "117171037" "117171037" "subst" "0.000122116" "00086" "CFTR_001462" "g.117171037G>A" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "A120T" "see the CFTR2 database for details; varying clinical consequence, classification recently changed" "SUMMARY record" "" "rs201958172" "0" "" "" "g.117530983G>A" "" "likely pathogenic (!)" "" "0000685920" "0" "99" "7" "117267829" "117267829" "subst" "4.14828E-6" "00086" "CFTR_001572" "g.117267829G>A" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3849+5G->A" "see the CFTR2 database for details" "SUMMARY record" "" "rs193922520" "0" "" "" "g.117627775G>A" "" "pathogenic (recessive)" "" "0000685921" "0" "99" "7" "117282493" "117282493" "subst" "4.07014E-6" "00086" "CFTR_001573" "g.117282493T>G" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "V1240G" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508598" "0" "" "" "g.117642439T>G" "" "pathogenic (recessive)" "" "0000685922" "0" "77" "7" "117282511" "117282511" "subst" "4.06941E-6" "00086" "CFTR_001476" "g.117282511C>T" "23/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "T1246I" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs397508600" "0" "" "" "g.117642457C>T" "" "likely pathogenic (!)" "" "0000685923" "0" "99" "7" "117282519" "117282519" "subst" "4.06924E-6" "00086" "CFTR_001574" "g.117282519G>A" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G1249R" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508602" "0" "" "" "g.117642465G>A" "" "pathogenic (recessive)" "" "0000685924" "0" "99" "7" "117171056" "117171056" "subst" "1.22129E-5" "00086" "CFTR_001526" "g.117171056G>A" "13/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G126D" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508609" "0" "" "" "g.117531002G>A" "" "pathogenic (recessive)" "" "0000685925" "0" "99" "7" "117282580" "117282580" "subst" "0" "00086" "CFTR_001575" "g.117282580T>A" "12/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "I1269N" "see the CFTR2 database for details" "SUMMARY record" "" "rs1562923253" "0" "" "" "g.117642526T>A" "" "pathogenic (recessive)" "" "0000685926" "0" "99" "7" "117282622" "117282622" "subst" "0" "00086" "CFTR_001576" "g.117282622G>T" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R1283M" "see the CFTR2 database for details" "SUMMARY record" "" "rs77902683" "0" "" "" "g.117642568G>T" "" "pathogenic (recessive)" "" "0000685927" "0" "77" "7" "117282646" "117282646" "subst" "0" "00086" "CFTR_001577" "g.117282646A>G" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q1291R" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs397508621" "0" "" "" "g.117642592A>G" "" "likely pathogenic (!)" "" "0000685928" "0" "77" "7" "117282647" "117282647" "subst" "8.15069E-6" "00086" "CFTR_001578" "g.117282647G>C" "30/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q1291H" "see the CFTR2 database for details; varying clinical consequence, classification recently changed" "SUMMARY record" "" "rs121909015" "0" "" "" "g.117642593G>C" "" "likely pathogenic (!)" "" "0000685929" "0" "99" "7" "117120186" "117120186" "subst" "0" "00086" "CFTR_001509" "g.117120186C>T" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "S13F" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508635" "0" "" "" "g.117480132C>T" "" "pathogenic (recessive)" "" "0000685930" "0" "99" "7" "117304749" "117304749" "subst" "0" "00086" "CFTR_001579" "g.117304749T>C" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "L1324P" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508653" "0" "" "" "g.117664695T>C" "" "pathogenic (recessive)" "" "0000685931" "0" "99" "7" "117304782" "117304782" "subst" "0" "00086" "CFTR_001392" "g.117304782T>C" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "L1335P" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508658" "0" "" "" "g.117664728T>C" "" "pathogenic (recessive)" "" "0000685932" "0" "99" "7" "117304814" "117304820" "del" "0" "00086" "CFTR_001580" "g.117304814_117304820del" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "4168delCTAAGCC" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508662" "0" "" "" "g.117664760_117664766del" "" "pathogenic (recessive)" "" "0000685933" "0" "99" "7" "117304875" "117304875" "subst" "4.06458E-6" "00086" "CFTR_001581" "g.117304875T>A" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "I1366N" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs200955612" "0" "" "" "g.117664821T>A" "" "pathogenic (recessive)" "" "0000685934" "0" "99" "7" "117304902" "117304902" "subst" "0" "00086" "CFTR_001582" "g.117304902A>C" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "H1375P" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508678" "0" "" "" "g.117664848A>C" "" "pathogenic (recessive)" "" "0000685935" "0" "99" "7" "117171092" "117171094" "dup" "0" "00086" "CFTR_001527" "g.117171092_117171094dup" "20/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "L138ins" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508679" "0" "" "" "g.117531038_117531040dup" "" "pathogenic (recessive)" "" "0000685936" "0" "99" "7" "117171095" "117171095" "subst" "0" "00086" "CFTR_001528" "g.117171095A>G" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "H139R" "see the CFTR2 database for details" "SUMMARY record" "" "rs76371115" "0" "" "" "g.117531041A>G" "" "pathogenic (recessive)" "" "0000685937" "0" "77" "7" "117307083" "117307083" "subst" "1.22049E-5" "00086" "CFTR_001583" "g.117307083C>G" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "S1455X" "see the CFTR2 database for details; varying clinical consequence, classification recently changed" "SUMMARY record" "" "rs121909043" "0" "" "" "g.117667029C>G" "" "likely pathogenic (!)" "" "0000685938" "0" "77" "7" "117307145" "117307145" "subst" "2.44244E-5" "00086" "CFTR_001401" "g.117307145C>T" "/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q1476X" "see the CFTR2 database for details; varying clinical consequence, classification recently changed" "SUMMARY record" "" "rs374705585" "0" "" "" "g.117667091C>T" "" "likely pathogenic (!)" "" "0000685939" "0" "99" "7" "117120192" "117120192" "subst" "0" "00086" "CFTR_001510" "g.117120192T>C" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "L15P" "see the CFTR2 database for details" "SUMMARY record" "" "rs1562876459" "0" "" "" "g.117480138T>C" "" "pathogenic (recessive)" "" "0000685940" "0" "99" "7" "117171160" "117171160" "subst" "0" "00086" "CFTR_001529" "g.117171160T>G" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Y161D" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508729" "0" "" "" "g.117531106T>G" "" "pathogenic (recessive)" "" "0000685941" "0" "99" "7" "117174334" "117174334" "subst" "0" "00086" "CFTR_001530" "g.117174334T>C" "21/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "L165S" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508736" "0" "" "" "g.117534280T>C" "" "pathogenic (recessive)" "" "0000685942" "0" "99" "7" "117174411" "117174411" "subst" "8.15647E-6" "00086" "CFTR_001320" "g.117174411T>G" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "F191V" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs141482808" "0" "" "" "g.117534357T>G" "" "pathogenic (recessive)" "" "0000685943" "0" "99" "7" "117175302" "117175302" "subst" "0" "00086" "CFTR_001531" "g.117175302G>A" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G194R" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "rs376008630" "0" "" "" "g.117535248G>A" "" "pathogenic (recessive)" "" "0000685944" "0" "77" "7" "117175303" "117175303" "subst" "4.06213E-6" "00086" "CFTR_001532" "g.117175303G>T" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G194V" "see the CFTR2 database for details; varying clinical consequence, classification recently changed" "SUMMARY record" "" "rs397508763" "0" "" "" "g.117535249G>T" "" "likely pathogenic (!)" "" "0000685945" "0" "99" "7" "117175417" "117175417" "subst" "2.0312E-5" "00086" "CFTR_001533" "g.117175417T>A" "41/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "V232D" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508783" "0" "" "" "g.117535363T>A" "" "pathogenic (recessive)" "" "0000685946" "0" "77" "7" "117175431" "117175431" "subst" "1.21876E-5" "00086" "CFTR_001534" "g.117175431C>G" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q237E" "see the CFTR2 database for details; varying clinical consequence, classification recently changed" "SUMMARY record" "" "rs397508784" "0" "" "" "g.117535377C>G" "" "likely pathogenic (!)" "" "0000685947" "0" "77" "7" "117176630" "117176630" "subst" "0.000177959" "00086" "CFTR_001535" "g.117176630A>G" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "R258G" "see the CFTR2 database for details; varying clinical consequence, classification recently changed" "SUMMARY record" "" "rs191456345" "0" "" "" "g.117536576A>G" "" "likely pathogenic (!)" "" "0000685948" "0" "77" "7" "117176652" "117176652" "subst" "1.24769E-5" "00086" "CFTR_001536" "g.117176652T>G" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "M265R" "see the CFTR2 database for details; varying clinical consequence" "SUMMARY record" "" "rs148519623" "0" "" "" "g.117536598T>G" "" "likely pathogenic (!)" "" "0000685949" "0" "99" "7" "117144332" "117144332" "subst" "0" "00086" "CFTR_001511" "g.117144332G>A" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G27R" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508796" "0" "" "" "g.117504278G>A" "" "pathogenic (recessive)" "" "0000685950" "0" "99" "7" "117176708" "117176708" "dup" "0" "00086" "CFTR_001537" "g.117176708dup" "8/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "850dupA, 977insA" "see the CFTR2 database for details" "SUMMARY record" "" "rs786204693" "0" "" "" "g.117536654dup" "" "pathogenic (recessive)" "" "0000685951" "0" "99" "7" "117144341" "117144341" "subst" "0" "00086" "CFTR_001512" "g.117144341C>T" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q30X" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508815" "0" "" "" "g.117504287C>T" "" "pathogenic (recessive)" "" "0000685952" "0" "99" "7" "117180217" "117180217" "subst" "0" "00086" "CFTR_001538" "g.117180217C>G" "10/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "F311L" "see the CFTR2 database for details" "SUMMARY record" "" "rs121909016" "0" "" "" "g.117540163C>G" "" "pathogenic (recessive)" "" "0000685953" "0" "77" "7" "117180225" "117180225" "subst" "4.06491E-6" "00086" "CFTR_001539" "g.117180225G>A" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "G314E" "see the CFTR2 database for details; varying clinical consequence, classification recently changed" "SUMMARY record" "" "rs75763344" "0" "" "" "g.117540171G>A" "" "likely pathogenic (!)" "" "0000685954" "0" "11" "7" "117180242" "117180242" "subst" "0.000634002" "00086" "CFTR_001499" "g.117180242T>G" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "L320V" "see the CFTR2 database for details" "SUMMARY record" "" "rs144476686" "0" "" "" "g.117540188T>G" "" "benign" "" "0000685955" "0" "99" "7" "117188786" "117188792" "del" "0" "00086" "CFTR_001542" "g.117188786_117188792del" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1301_1307delCACTTCT, 1429del7" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508186" "0" "" "" "g.117548732_117548738del" "" "pathogenic (recessive)" "" "0000685956" "0" "99" "7" "117188858" "117188858" "del" "0" "00086" "CFTR_001544" "g.117188858del" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1373delG, 1504delG" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508196" "0" "" "" "g.117548804del" "" "pathogenic (recessive)" "" "0000685957" "0" "99" "7" "117227878" "117227878" "del" "0" "00086" "CFTR_001548" "g.117227878del" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1670delC, 1802delC" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508257" "0" "" "" "g.117587824del" "" "pathogenic (recessive)" "" "0000685958" "0" "99" "7" "117232164" "117232164" "del" "0" "00086" "CFTR_001491" "g.117232164del" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1943delA, 2075delA" "see the CFTR2 database for details" "SUMMARY record" "" "rs1481564133" "0" "" "" "g.117592110del" "" "pathogenic (recessive)" "" "0000685959" "1" "99" "7" "117282620" "117282620" "subst" "0.0004396" "00086" "CFTR_000005" "g.117282620G>A" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "[3846G>A;3848G>T]" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "" "0" "" "" "g.117642566G>A" "" "pathogenic (recessive)" "" "0000685960" "1" "99" "7" "117282622" "117282622" "subst" "0" "00086" "CFTR_001576" "g.117282622G>T" "6/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "[3846G>A;3848G>T]" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "" "0" "" "" "g.117642568G>T" "" "pathogenic (recessive)" "" "0000685961" "1" "11" "7" "117199648" "117199648" "subst" "0.000906775" "00086" "CFTR_001342" "g.117199648T>G" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "[1523T>G;3752G>A], F508C;S1251N" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "" "0" "" "" "g.117559594T>G" "" "benign" "" "0000685962" "1" "99" "7" "117282526" "117282526" "subst" "8.13603E-6" "00086" "CFTR_000040" "g.117282526G>A" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "[1523T>G;3752G>A], F508C;S1251N" "see the CFTR2 database for details; classification recently changed" "SUMMARY record" "" "" "0" "" "" "g.117642472G>A" "" "pathogenic (recessive)" "" "0000685963" "1" "99" "7" "117199646" "117199648" "del" "0" "00086" "CFTR_000001" "g.117199646_117199648del" "58/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "[1521_1523delCTT;3080T>C] F508del;I1027T" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000685964" "1" "11" "7" "117250664" "117250664" "subst" "0.000252205" "00086" "CFTR_000064" "g.117250664T>C" "58/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "[1521_1523delCTT;3080T>C] F508del;I1027T" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "g.117610610T>C" "" "benign" "" "0000685965" "1" "99" "7" "117199522" "117199522" "subst" "1.21953E-5" "00086" "CFTR_001108" "g.117199522C>G" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "[1397C>G;3209G>A] S466X;R1070Q" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "g.117559468C>G" "" "pathogenic (recessive)" "" "0000685966" "1" "77" "7" "117251704" "117251704" "subst" "0.000622665" "00086" "CFTR_000107" "g.117251704G>A" "9/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "[1397C>G;3209G>A] S466X;R1070Q" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "g.117611650G>A" "" "likely pathogenic (!)" "" "0000685967" "1" "99" "7" "117180359" "117180359" "subst" "0" "00086" "CFTR_001152" "g.117180359C>A" "22/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "[1075C>A;1079C>A] Q359K/T360K" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508152" "0" "" "" "g.117540305C>A" "" "pathogenic (recessive)" "" "0000685968" "1" "99" "7" "117180363" "117180363" "subst" "0" "00086" "CFTR_000152" "g.117180363C>A" "22/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "Q359K/T360K" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508152" "0" "" "" "g.117540309C>A" "" "pathogenic (recessive)" "" "0000685969" "1" "99" "7" "117170952" "117180401" "" "0" "00086" "CFTR_001505" "g.[(117149197_117170952)_(117180401_117182069)del;(117199710_117227792)_(117254768_117267575)del]" "5/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTR50kbdel" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000685970" "0" "99" "7" "3469" "117254666" "" "0" "00086" "CFTR_001506" "g.(117251863_117254666)_(3468+1_3469-1)del" "3/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "CFTRdele18" "see the CFTR2 database for details" "SUMMARY record" "" "" "0" "" "" "g.(117611809_117614612)_(117614714_117627521)del" "" "pathogenic (recessive)" "" "0000685971" "0" "99" "7" "117251789" "117251789" "" "0" "00086" "CFTR_001507" "g.117251789G>Y" "4/142036 chromosomes CFTR (3294G>C^T)" "copy received from {DB:CFTR2}" "" "W1098C" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508533" "0" "" "" "g.117611735G>Y" "" "pathogenic (recessive)" "" "0000685972" "0" "99" "7" "117232103" "117232103" "subst" "0" "00086" "CFTR_001410" "g.117232103G>C" "11/142036 chromosomes CFTR (1882G^A)" "copy received from {DB:CFTR2}" "" "G628R" "see the CFTR2 database for details" "SUMMARY record" "" "rs397508316" "0" "" "" "g.117592049G>C" "" "pathogenic (recessive)" "" "0000685973" "0" "11" "7" "117235055" "117235055" "subst" "0.382582" "00086" "CFTR_001359" "g.117235055T>G" "37/142036 chromosomes CFTR (2562T>C^G^A)" "copy received from {DB:CFTR2}" "" "T854T" "see the CFTR2 database for details" "SUMMARY record" "" "rs1042077" "0" "" "" "g.117595001T>G" "" "benign" "" "0000685974" "0" "99" "7" "117250595" "117250603" "del" "0" "00086" "CFTR_001560" "g.117250595_117250603del" "7/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "3011_3019delCTATAGCAG, 3009_3017delAGCTATAGC, 3143del9" "see the CFTR2 database for details" "SUMMARY record" "" "rs1562914072" "0" "" "" "g.117610541_117610549del" "" "pathogenic (recessive)" "" "0000685975" "0" "11" "7" "117188688" "117188689" "dup" "0" "00086" "CFTR_001405" "g.117188688_117188689dup" "4/142036 chromosomes CFTR" "copy received from {DB:CFTR2}" "" "1210−12T[9], 9T" "see the CFTR2 database for details" "SUMMARY record" "" "rs1805177" "0" "" "" "g.117548634_117548635dup" "" "benign" "" "0000689868" "0" "50" "7" "117149089" "117149089" "subst" "1.22229E-5" "02327" "CFTR_001173" "g.117149089G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000689869" "0" "90" "7" "117149185" "117149186" "del" "0" "02327" "CFTR_000027" "g.117149185_117149186del" "" "" "" "CFTR(NM_000492.3):c.262_263delTT (p.L88Ifs*22), CFTR(NM_000492.4):c.262_263delTT (p.L88Ifs*22)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689870" "0" "70" "7" "117149187" "117149187" "subst" "8.14637E-6" "02325" "CFTR_001314" "g.117149187A>C" "" "" "" "CFTR(NM_000492.3):c.264A>C (p.L88F), CFTR(NM_000492.4):c.264A>C (p.L88F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000689871" "0" "90" "7" "117170992" "117170992" "del" "0" "02327" "CFTR_001184" "g.117170992del" "" "" "" "CFTR(NM_000492.4):c.313delA (p.I105Sfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689872" "0" "90" "7" "117171045" "117171045" "subst" "0" "02327" "CFTR_000045" "g.117171045T>A" "" "" "" "CFTR(NM_000492.4):c.366T>A (p.Y122*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689873" "0" "70" "7" "117180284" "117180284" "subst" "6.09796E-5" "02327" "CFTR_000026" "g.117180284C>T" "" "" "" "CFTR(NM_000492.3):c.1000C>T (p.R334W), CFTR(NM_000492.4):c.1000C>T (p.R334W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000689874" "0" "70" "7" "117180324" "117180324" "subst" "2.44035E-5" "02327" "CFTR_000039" "g.117180324G>A" "" "" "" "CFTR(NM_000492.4):c.1040G>A (p.R347H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000689875" "0" "70" "7" "117180324" "117180324" "subst" "2.44035E-5" "02327" "CFTR_000020" "g.117180324G>C" "" "" "" "CFTR(NM_000492.3):c.1040G>C (p.R347P), CFTR(NM_000492.4):c.1040G>C (p.R347P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000689876" "0" "90" "7" "117180352" "117180352" "subst" "0" "02327" "CFTR_001584" "g.117180352G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689877" "0" "90" "7" "117199683" "117199683" "subst" "4.06673E-6" "02327" "CFTR_000050" "g.117199683G>T" "" "" "" "CFTR(NM_000492.4):c.1558G>T (p.V520F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689878" "0" "90" "7" "117227854" "117227854" "subst" "8.14067E-5" "02327" "CFTR_000042" "g.117227854G>A" "" "" "" "CFTR(NM_000492.4):c.1646G>A (p.S549N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689879" "0" "90" "7" "117227855" "117227855" "subst" "8.14133E-6" "02327" "CFTR_001060" "g.117227855T>G" "" "" "" "CFTR(NM_000492.4):c.1647T>G (p.S549R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689880" "0" "90" "7" "117229521" "117229521" "subst" "0" "02327" "CFTR_001155" "g.117229521A>G" "" "" "" "CFTR(NM_000492.4):c.1680-886A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689881" "0" "90" "7" "117230494" "117230494" "subst" "3.27166E-5" "02327" "CFTR_000018" "g.117230494G>A" "" "" "" "CFTR(NM_000492.3):c.1766+1G>A, CFTR(NM_000492.4):c.1766+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689882" "0" "90" "7" "117232233" "117232233" "del" "0" "02327" "CFTR_000046" "g.117232233del" "" "" "" "CFTR(NM_000492.3):c.2012delT (p.L671*), CFTR(NM_000492.4):c.2012delT (p.L671*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689883" "0" "90" "7" "117232436" "117232436" "del" "4.06372E-6" "02327" "CFTR_000081" "g.117232436del" "" "" "" "CFTR(NM_000492.4):c.2215delG (p.V739Yfs*16)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689884" "0" "90" "7" "117235031" "117235031" "subst" "4.06283E-6" "02327" "CFTR_001069" "g.117235031G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689885" "0" "90" "7" "117243596" "117243596" "subst" "0" "02327" "CFTR_000117" "g.117243596C>T" "" "" "" "CFTR(NM_000492.4):c.2668C>T (p.Q890*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689886" "0" "90" "7" "117246808" "117246808" "subst" "9.76388E-5" "02327" "CFTR_000016" "g.117246808G>A" "" "" "" "CFTR(NM_000492.3):c.2988+1G>A, CFTR(NM_000492.4):c.2988+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689887" "0" "90" "7" "117251691" "117251691" "subst" "3.66345E-5" "02327" "CFTR_000034" "g.117251691C>T" "" "" "" "CFTR(NM_000492.3):c.3196C>T (p.R1066C), CFTR(NM_000492.4):c.3196C>T (p.R1066C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689888" "0" "90" "7" "117251771" "117251771" "subst" "1.2199E-5" "02327" "CFTR_000031" "g.117251771C>A" "" "" "" "CFTR(NM_000492.3):c.3276C>A (p.Y1092*), CFTR(NM_000492.4):c.3276C>A (p.Y1092*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689889" "0" "90" "7" "117251797" "117251797" "subst" "1.6268E-5" "02327" "CFTR_000043" "g.117251797T>A" "" "" "" "CFTR(NM_000492.4):c.3302T>A (p.M1101K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689890" "0" "90" "7" "117267579" "117267579" "subst" "3.26216E-5" "02327" "CFTR_000037" "g.117267579C>T" "" "" "" "CFTR(NM_000492.3):c.3472C>T (p.R1158*), CFTR(NM_000492.4):c.3472C>T (p.R1158*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000689891" "0" "30" "7" "117305628" "117305628" "subst" "0.000301738" "01943" "CFTR_001445" "g.117305628T>C" "" "" "" "CFTR(NM_000492.3):c.4242+10T>C, CFTR(NM_000492.4):c.4242+10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693923" "0" "50" "7" "117250684" "117250684" "subst" "0" "01164" "CFTR_001585" "g.117250684C>T" "" "" "" "" "ACMG grading: PM2,PP3" "Germline" "" "" "0" "" "" "" "" "VUS" "ACMG" "0000695605" "0" "70" "7" "117171028" "117171028" "subst" "2.035E-5" "03779" "CFTR_001524" "g.117171028C>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs77834169" "0" "" "" "" "" "likely pathogenic" "" "0000712180" "0" "90" "7" "117174411" "117174411" "subst" "8.15647E-6" "03779" "CFTR_001320" "g.117174411T>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs141482808" "0" "" "" "" "" "pathogenic" "" "0000712181" "0" "90" "7" "117171028" "117171028" "subst" "2.035E-5" "03779" "CFTR_001524" "g.117171028C>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs77834169" "0" "" "" "" "" "pathogenic" "" "0000712182" "0" "90" "7" "117176630" "117176630" "subst" "0.000177959" "03779" "CFTR_001535" "g.117176630A>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs191456345" "0" "" "" "" "" "pathogenic" "" "0000712183" "0" "70" "7" "117171025" "117171025" "subst" "0" "03779" "CFTR_001586" "g.117171025G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs397508571" "0" "" "" "" "" "likely pathogenic" "" "0000712186" "0" "90" "7" "117304832" "117304832" "subst" "4.06573E-6" "03779" "CFTR_001593" "g.117304832C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs751098333" "0" "" "" "" "" "pathogenic" "" "0000712187" "0" "70" "7" "117282511" "117282511" "subst" "4.06941E-6" "03779" "CFTR_001476" "g.117282511C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs397508600" "0" "" "" "" "" "likely pathogenic" "" "0000712188" "0" "90" "7" "117267864" "117267864" "subst" "0" "03779" "CFTR_001286" "g.117267864A>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs397508595" "0" "" "" "" "" "pathogenic" "" "0000712189" "0" "50" "7" "117243744" "117243744" "subst" "0" "03779" "CFTR_001592" "g.117243744A>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs397508440" "0" "" "" "" "" "VUS" "" "0000712191" "0" "50" "7" "117180142" "117180142" "subst" "0" "03779" "CFTR_001588" "g.117180142T>A" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" "" "0000712192" "0" "90" "7" "117243634" "117243634" "subst" "0" "03779" "CFTR_001590" "g.117243634C>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs397508422" "0" "" "" "" "" "pathogenic" "" "0000712193" "0" "90" "7" "117243741" "117243741" "subst" "1.21865E-5" "03779" "CFTR_001591" "g.117243741T>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs193922511" "0" "" "" "" "" "pathogenic" "" "0000712195" "0" "50" "7" "117229690" "117229690" "subst" "0" "03779" "CFTR_001589" "g.117229690A>G" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" "" "0000712197" "0" "50" "7" "117176717" "117176717" "subst" "1.23038E-5" "03779" "CFTR_001587" "g.117176717A>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs397508804" "0" "" "" "" "" "VUS" "" "0000712742" "0" "30" "7" "117180174" "117180174" "subst" "0.000562421" "03779" "CFTR_001327" "g.117180174G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs143486492" "0" "" "" "" "" "likely benign" "" "0000712962" "0" "70" "7" "117282621" "117282621" "subst" "0" "02551" "CFTR_001594" "g.117282621A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000714756" "0" "50" "7" "117254714" "117254714" "subst" "0.000105725" "03779" "CFTR_001378" "g.117254714A>G" "" "" "" "" "Conflicting classification" "CLASSIFICATION record" "" "rs397508556" "0" "" "" "" "" "VUS (!)" "" "0000714757" "0" "50" "7" "117251665" "117251665" "subst" "0" "03779" "CFTR_001595" "g.117251665C>G" "" "" "" "" "Conflicting classification" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS (!)" "" "0000714758" "0" "50" "7" "117180186" "117180186" "subst" "0.000297076" "03779" "CFTR_001428" "g.117180186A>G" "" "" "" "" "Conflicting classification" "CLASSIFICATION record" "" "rs150691494" "0" "" "" "" "" "VUS (!)" "" "0000721195" "0" "50" "7" "117171145" "117171145" "subst" "1.63532E-5" "02327" "CFTR_001596" "g.117171145A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721196" "0" "30" "7" "117175331" "117175331" "subst" "2.03084E-5" "02325" "CFTR_001597" "g.117175331C>T" "" "" "" "CFTR(NM_000492.4):c.609C>T (p.I203=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721197" "0" "30" "7" "117188736" "117188736" "subst" "0" "02325" "CFTR_001151" "g.117188736C>A" "" "" "" "CFTR(NM_000492.4):c.1251C>A (p.N417K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721198" "0" "50" "7" "117230471" "117230471" "subst" "0" "02325" "CFTR_001599" "g.117230471A>T" "" "" "" "CFTR(NM_000492.4):c.1744A>T (p.T582S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721199" "0" "30" "7" "117232155" "117232155" "subst" "2.03297E-5" "02327" "CFTR_001600" "g.117232155T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721200" "0" "50" "7" "117232278" "117232278" "subst" "7.78248E-5" "01943" "CFTR_001601" "g.117232278C>A" "" "" "" "CFTR(NM_000492.3):c.2057C>A (p.S686Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721201" "0" "90" "7" "117232416" "117232416" "subst" "4.06296E-6" "02325" "CFTR_000122" "g.117232416T>G" "" "" "" "CFTR(NM_000492.3):c.2195T>G (p.L732*), CFTR(NM_000492.4):c.2195T>G (p.L732*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000721202" "0" "30" "7" "117242874" "117242874" "subst" "0.000548214" "01943" "CFTR_001436" "g.117242874T>C" "" "" "" "CFTR(NM_000492.3):c.2620-6T>C, CFTR(NM_000492.4):c.2620-6T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721203" "0" "50" "7" "117250609" "117250609" "subst" "0" "02325" "CFTR_001602" "g.117250609G>T" "" "" "" "CFTR(NM_000492.4):c.3025G>T (p.A1009S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721204" "0" "50" "7" "117250622" "117250622" "subst" "2.84645E-5" "02327" "CFTR_001603" "g.117250622C>T" "" "" "" "CFTR(NM_000492.4):c.3038C>T (p.P1013L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721205" "0" "10" "7" "117279869" "117279869" "subst" "0" "02327" "CFTR_001604" "g.117279869A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000729312" "0" "70" "7" "117188878" "117188878" "del" "0" "03779" "CFTR_001598" "g.117188878del" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000802868" "0" "50" "7" "117144345" "117144345" "subst" "5.69861E-5" "02325" "CFTR_001605" "g.117144345G>A" "" "" "" "CFTR(NM_000492.4):c.92G>A (p.R31H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802869" "0" "50" "7" "117180174" "117180174" "subst" "0.000562421" "02326" "CFTR_001327" "g.117180174G>A" "" "" "" "CFTR(NM_000492.3):c.890G>A (p.R297Q), CFTR(NM_000492.4):c.890G>A (p.R297Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802870" "0" "50" "7" "117180281" "117180281" "subst" "8.12942E-6" "02327" "CFTR_001329" "g.117180281C>T" "" "" "" "CFTR(NM_000492.3):c.997C>T (p.L333F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802871" "0" "50" "7" "117188883" "117188883" "subst" "0" "02326" "CFTR_001606" "g.117188883T>A" "" "" "" "CFTR(NM_000492.3):c.1392+6T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802872" "0" "50" "7" "117188889" "117188889" "subst" "0" "02326" "CFTR_001607" "g.117188889G>A" "" "" "" "CFTR(NM_000492.3):c.1392+12G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802873" "0" "90" "7" "117229521" "117229521" "subst" "0" "02325" "CFTR_001155" "g.117229521A>G" "" "" "" "CFTR(NM_000492.4):c.1680-886A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000802874" "0" "30" "7" "117234999" "117234999" "subst" "0.000451011" "01943" "CFTR_001241" "g.117234999G>T" "" "" "" "CFTR(NM_000492.3):c.2506G>T (p.D836Y), CFTR(NM_000492.4):c.2506G>T (p.(Asp836Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000802875" "0" "70" "7" "117243783" "117243783" "subst" "0.000272209" "02325" "CFTR_001501" "g.117243783T>C" "" "" "" "CFTR(NM_000492.3):c.2855T>C (p.M952T), CFTR(NM_000492.4):c.2855T>C (p.M952T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000802876" "0" "50" "7" "117246800" "117246800" "subst" "4.06676E-6" "02327" "CFTR_001369" "g.117246800T>G" "" "" "" "CFTR(NM_000492.3):c.2981T>G (p.F994C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802877" "0" "50" "7" "117267766" "117267766" "subst" "9.80032E-5" "02327" "CFTR_001608" "g.117267766C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802878" "0" "50" "7" "117304875" "117304875" "subst" "1.21937E-5" "02325" "CFTR_001394" "g.117304875T>C" "" "" "" "CFTR(NM_000492.3):c.4097T>C (p.I1366T), CFTR(NM_000492.4):c.4097T>C (p.I1366T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000815852" "0" "70" "7" "117282620" "117282620" "subst" "0.0004396" "00006" "CFTR_000005" "g.117282620G>A" "" "{PMID:Nair 2018:30293248}" "" "" "" "Germline/De novo (untested)" "" "rs77010898" "0" "" "" "g.117642566G>A" "" "likely pathogenic" "" "0000815853" "0" "70" "7" "117292905" "117292908" "del" "0" "00006" "CFTR_001296" "g.117292905_117292908del" "" "{PMID:Nair 2018:30293248}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.117652851_117652854del" "" "likely pathogenic" "" "0000815854" "0" "70" "7" "117292931" "117292931" "subst" "0.000139103" "00006" "CFTR_000004" "g.117292931C>G" "" "{PMID:Nair 2018:30293248}" "" "" "" "Germline/De novo (untested)" "" "rs80034486" "0" "" "" "g.117652877C>G" "" "likely pathogenic" "" "0000815855" "0" "70" "7" "117188696" "117188696" "subst" "0" "00006" "CFTR_001609" "g.117188696G>T" "" "{PMID:Nair 2018:30293248}" "" "" "" "Germline/De novo (untested)" "" "rs1324302547" "0" "" "" "g.117548642G>T" "" "likely pathogenic" "" "0000817714" "0" "50" "7" "117199641" "117199641" "subst" "0.000357631" "04138" "CFTR_001340" "g.117199641A>G" "" "" "" "" "" "Germline" "?" "rs1800091" "0" "" "" "" "{CV:7131}" "VUS" "ACMG" "0000825419" "0" "70" "7" "117232223" "117232223" "subst" "0.00594922" "04138" "CFTR_000059" "g.117232223C>T" "3/80 cases" "{PMID:Sofia 2016:27264265}, {DOI:Sofia 2016:10.2119/molmed.2016.00010}" "" "" "" "Germline" "?" "rs1800100" "" "" "" "g.117592169C>T" "{CV:35835}" "likely pathogenic" "" "0000825421" "0" "70" "7" "117230454" "117230454" "subst" "0.00503416" "04138" "CFTR_000065" "g.117230454G>C" "3/80 cases" "{PMID:Sofia 2016:27264265}, {DOI:Sofia 2016:10.2119/molmed.2016.00010}" "" "" "" "Germline" "?" "rs1800098" "" "" "" "g.117590400G>C" "{CV:7165}" "likely pathogenic" "" "0000826910" "0" "90" "7" "117199646" "117199648" "del" "0" "04138" "CFTR_000001" "g.117199646_117199648del" "" "{PMID:Corleto 2010:20950468}, {DOI:Corleto 2010:10.1186/1471-230X-10-119}" "" "p.F508del" "" "Germline" "?" "rs113993960" "" "" "" "g.117559592_117559594del" "{CV:7105}" "pathogenic" "" "0000826911" "21" "90" "7" "117199646" "117199648" "del" "0" "04138" "CFTR_000001" "g.117199646_117199648del" "" "{PMID:Corleto 2010:20950468}, {DOI:Corleto 2010:10.1186/1471-230X-10-119}" "" "p.F508del" "" "Germline" "?" "rs113993960" "" "" "" "g.117559592_117559594del" "{CV:7105}" "pathogenic" "" "0000851383" "0" "50" "7" "117144378" "117144378" "subst" "0.000122137" "01943" "CFTR_001420" "g.117144378C>T" "" "" "" "CFTR(NM_000492.3):c.125C>T (p.S42F), CFTR(NM_000492.4):c.125C>T (p.S42F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851384" "0" "50" "7" "117171171" "117171171" "subst" "0.000233234" "02327" "CFTR_001187" "g.117171171A>G" "" "" "" "CFTR(NM_000492.3):c.489+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851385" "0" "50" "7" "117182149" "117182149" "subst" "9.76928E-5" "01943" "CFTR_001612" "g.117182149C>T" "" "" "" "CFTR(NM_000492.3):c.1196C>T (p.A399V), CFTR(NM_000492.4):c.1196C>T (p.(Ala399Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851386" "0" "10" "7" "117188682" "117188682" "subst" "0" "02326" "CFTR_001447" "g.117188682G>T" "" "" "" "CFTR(NM_000492.3):c.1210-13_1210-11delGTTinsTTT, CFTR(NM_000492.4):c.1210-13G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000851387" "0" "30" "7" "117227774" "117227774" "subst" "1.22237E-5" "02326" "CFTR_001614" "g.117227774T>C" "" "" "" "CFTR(NM_000492.3):c.1585-19T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851388" "0" "90" "7" "117230498" "117230498" "subst" "2.45588E-5" "02326" "CFTR_001227" "g.117230498G>T" "" "" "" "CFTR(NM_000492.3):c.1766+5G>T, CFTR(NM_000492.4):c.1766+5G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000851389" "0" "50" "7" "117243750" "117243750" "subst" "0" "02325" "CFTR_001615" "g.117243750T>C" "" "" "" "CFTR(NM_000492.4):c.2822T>C (p.L941P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851390" "0" "50" "7" "117243828" "117243828" "subst" "0.000707357" "02325" "CFTR_001364" "g.117243828T>C" "" "" "" "CFTR(NM_000492.3):c.2900T>C (p.L967S), CFTR(NM_000492.4):c.2900T>C (p.L967S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851391" "0" "50" "7" "117304761" "117304761" "subst" "1.22013E-5" "01943" "CFTR_001616" "g.117304761T>C" "" "" "" "CFTR(NM_000492.3):c.3983T>C (p.I1328T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851392" "0" "10" "7" "117306991" "117306991" "subst" "0.00657198" "02326" "CFTR_001399" "g.117306991C>T" "" "" "" "CFTR(NM_000492.3):c.4272C>T (p.Y1424=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000851393" "0" "50" "7" "117307016" "117307016" "subst" "2.44294E-5" "02329" "CFTR_001617" "g.117307016G>A" "" "" "" "CFTR(NM_000492.3):c.4297G>A (p.E1433K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860589" "0" "30" "7" "117120179" "117120179" "subst" "0.000154576" "01943" "CFTR_001610" "g.117120179G>A" "" "" "" "CFTR(NM_000492.3):c.31G>A (p.V11I), CFTR(NM_000492.4):c.31G>A (p.(Val11Ile), p.V11I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860590" "0" "50" "7" "117174387" "117174387" "subst" "0.000297347" "02325" "CFTR_001464" "g.117174387C>A" "" "" "" "CFTR(NM_000492.3):c.547C>A (p.L183I), CFTR(NM_000492.4):c.547C>A (p.L183I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860591" "0" "50" "7" "117182116" "117182116" "subst" "0.000162742" "01943" "CFTR_001611" "g.117182116C>T" "" "" "" "CFTR(NM_000492.3):c.1163C>T (p.T388M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860592" "0" "30" "7" "117188688" "117188689" "dup" "0" "02326" "CFTR_001405" "g.117188688_117188689dup" "" "" "" "CFTR(NM_000492.3):c.1210-7_1210-6dupTT, CFTR(NM_000492.4):c.1210-7_1210-6dupTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860593" "0" "50" "7" "117199554" "117199554" "subst" "4.06421E-6" "02325" "CFTR_001613" "g.117199554C>A" "" "" "" "CFTR(NM_000492.4):c.1429C>A (p.P477T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860594" "0" "90" "7" "117199646" "117199648" "del" "0" "02329" "CFTR_000001" "g.117199646_117199648del" "" "" "" "CFTR(NM_000492.3):c.1521_1523delCTT (p.(Phe508del)), CFTR(NM_000492.3):c.1521_1523delCTT (p.F508del), CFTR(NM_000492.4):c.1521_1523delCTT (p.F508del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000860595" "0" "30" "7" "117227874" "117227874" "subst" "0.00342536" "02326" "CFTR_001017" "g.117227874A>G" "" "" "" "CFTR(NM_000492.3):c.1666A>G (p.I556V), CFTR(NM_000492.4):c.1666A>G (p.I556V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860597" "0" "50" "7" "117250625" "117250625" "subst" "0.000280579" "02325" "CFTR_001562" "g.117250625A>G" "" "" "" "CFTR(NM_000492.4):c.3041A>G (p.Y1014C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860598" "0" "30" "7" "117251780" "117251780" "subst" "0.0045507" "01804" "CFTR_001375" "g.117251780A>T" "" "" "" "CFTR(NM_000492.3):c.3285A>T (p.T1095=, p.(Thr1095=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860599" "0" "30" "7" "117267559" "117267559" "subst" "0.000592587" "02325" "CFTR_001439" "g.117267559T>C" "" "" "" "CFTR(NM_000492.3):c.3469-17T>C, CFTR(NM_000492.4):c.3469-17T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000880078" "1" "50" "7" "117304869" "117304869" "subst" "3.65863E-5" "00006" "CFTR_001618" "g.117304869C>T" "" "{PMID:Bertoli-Avella 2022:34952832}" "" "" "" "Germline" "" "" "0" "" "" "g.117664815C>T" "" "VUS" "" "0000880344" "0" "50" "7" "117171112" "117171112" "subst" "0" "03779" "CFTR_001621" "g.117171112C>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000880345" "0" "70" "7" "117199626" "117199626" "subst" "0" "03779" "CFTR_001625" "g.117199626A>G" "" "" "" "" "" "Unknown" "" "rs397508221" "0" "" "" "" "" "likely pathogenic" "" "0000880346" "0" "70" "7" "117149143" "117149143" "subst" "0.00142434" "03779" "CFTR_000087" "g.117149143C>T" "" "" "" "" "" "Unknown" "" "rs115545701" "0" "" "" "" "" "likely pathogenic" "" "0000880347" "0" "70" "7" "117149143" "117149143" "subst" "0.00142434" "03779" "CFTR_000087" "g.117149143C>T" "" "" "" "" "" "Unknown" "" "rs115545701" "0" "" "" "" "" "likely pathogenic" "" "0000880348" "0" "70" "7" "117282582" "117282582" "subst" "0.00119238" "03779" "CFTR_000073" "g.117282582G>A" "" "" "" "" "" "Unknown" "" "rs11971167" "0" "" "" "" "" "likely pathogenic" "" "0000880349" "0" "90" "7" "117175323" "117175323" "subst" "0.000223403" "03779" "CFTR_001191" "g.117175323G>A" "" "" "" "" "" "Unknown" "" "rs138338446" "0" "" "" "" "" "pathogenic" "" "0000880350" "0" "90" "7" "117180285" "117180285" "subst" "0.000117891" "03779" "CFTR_001014" "g.117180285G>A" "" "" "" "" "" "Unknown" "" "rs397508137" "0" "" "" "" "" "pathogenic" "" "0000880351" "0" "90" "7" "117199516" "117199516" "subst" "8.13114E-6" "03779" "CFTR_001209" "g.117199516A>G" "" "" "" "" "" "Unknown" "" "rs397508201" "0" "" "" "" "" "pathogenic" "" "0000880352" "0" "90" "7" "117170987" "117170987" "del" "0" "03779" "CFTR_001620" "g.117170987del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000880353" "0" "90" "7" "117149186" "117149186" "subst" "0" "03779" "CFTR_001180" "g.117149186T>G" "" "" "" "" "" "Unknown" "" "rs397508412" "0" "" "" "" "" "pathogenic" "" "0000880354" "0" "90" "7" "117250601" "117250601" "subst" "0" "03779" "CFTR_001561" "g.117250601C>A" "" "" "" "" "" "Unknown" "" "rs397508480" "0" "" "" "" "" "pathogenic" "" "0000880355" "0" "90" "7" "117230407" "117230407" "subst" "4.07777E-6" "03779" "CFTR_001220" "g.117230407A>C" "" "" "" "" "" "Unknown" "" "rs397508267" "0" "" "" "" "" "pathogenic" "" "0000880356" "0" "90" "7" "117176627" "117176627" "subst" "0" "03779" "CFTR_001622" "g.117176627G>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000880357" "0" "90" "7" "117304849" "117304851" "delins" "0" "03779" "CFTR_001627" "g.117304849_117304851delinsAA" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000880358" "0" "90" "7" "117170975" "117170975" "subst" "0" "03779" "CFTR_001619" "g.117170975C>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000880359" "0" "90" "7" "117242874" "117242874" "subst" "0.000548214" "03779" "CFTR_001436" "g.117242874T>C" "" "" "" "" "" "Unknown" "" "rs371315682" "0" "" "" "" "" "pathogenic" "" "0000880360" "0" "90" "7" "117243671" "117243673" "delins" "0" "03779" "CFTR_001626" "g.117243671_117243673delinsA" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000880361" "0" "90" "7" "117199698" "117199698" "subst" "0" "03779" "CFTR_000137" "g.117199698C>T" "" "" "" "" "" "Unknown" "" "rs397508227" "0" "" "" "" "" "pathogenic" "" "0000880374" "0" "90" "7" "117304902" "117304902" "subst" "0" "03779" "CFTR_001582" "g.117304902A>C" "" "" "" "" "" "Unknown" "" "rs397508678" "0" "" "" "" "" "pathogenic" "" "0000880375" "0" "90" "7" "117180217" "117180217" "subst" "0" "03779" "CFTR_001623" "g.117180217C>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000880378" "0" "90" "7" "117230451" "117230451" "subst" "1.63001E-5" "03779" "CFTR_001552" "g.117230451T>A" "" "" "" "" "" "Unknown" "" "rs773569201" "0" "" "" "" "" "pathogenic" "" "0000880380" "0" "10" "7" "117175302" "117175302" "subst" "0" "03779" "CFTR_001531" "g.117175302G>A" "" "" "" "" "" "Unknown" "" "rs376008630" "0" "" "" "" "" "benign" "" "0000880382" "0" "90" "7" "117175302" "117175302" "subst" "0" "03779" "CFTR_001531" "g.117175302G>A" "" "" "" "" "" "Unknown" "" "rs376008630" "0" "" "" "" "" "pathogenic" "" "0000880384" "0" "90" "7" "117232103" "117232103" "subst" "0" "03779" "CFTR_001410" "g.117232103G>C" "" "" "" "" "" "Unknown" "" "rs397508316" "0" "" "" "" "" "pathogenic" "" "0000880385" "0" "90" "7" "117282580" "117282580" "subst" "0" "03779" "CFTR_001575" "g.117282580T>A" "" "" "" "" "" "Unknown" "" "rs1562923253" "0" "" "" "" "" "pathogenic" "" "0000880390" "0" "90" "7" "117232074" "117232074" "subst" "2.21086E-5" "03779" "CFTR_001350" "g.117232074T>C" "" "" "" "" "" "Unknown" "" "rs139468767" "0" "" "" "" "" "pathogenic" "" "0000880391" "0" "90" "7" "117120192" "117120192" "subst" "0" "03779" "CFTR_001510" "g.117120192T>C" "" "" "" "" "" "Unknown" "" "rs1562876459" "0" "" "" "" "" "pathogenic" "" "0000880392" "0" "90" "7" "117180321" "117180321" "subst" "0" "03779" "CFTR_001541" "g.117180321T>C" "" "" "" "" "" "Unknown" "" "rs397508146" "0" "" "" "" "" "pathogenic" "" "0000880393" "0" "90" "7" "117188843" "117188843" "subst" "0" "03779" "CFTR_001543" "g.117188843T>C" "" "" "" "" "" "Unknown" "" "rs1562895128" "0" "" "" "" "" "pathogenic" "" "0000880394" "0" "90" "7" "117176652" "117176652" "subst" "1.24769E-5" "03779" "CFTR_001536" "g.117176652T>G" "" "" "" "" "" "Unknown" "" "rs148519623" "0" "" "" "" "" "pathogenic" "" "0000880395" "0" "90" "7" "117180360" "117180360" "subst" "0" "03779" "CFTR_001624" "g.117180360A>G" "" "" "" "" "" "Unknown" "" "rs397508153" "0" "" "" "" "" "pathogenic" "" "0000880397" "0" "90" "7" "117267582" "117267582" "subst" "4.07654E-6" "03779" "CFTR_001571" "g.117267582T>C" "" "" "" "" "" "Unknown" "" "rs397508572" "0" "" "" "" "" "pathogenic" "" "0000880398" "0" "90" "7" "117180305" "117180305" "subst" "0" "03779" "CFTR_000158" "g.117180305T>C" "" "" "" "" "" "Unknown" "" "rs397508144" "0" "" "" "" "" "pathogenic" "" "0000880399" "0" "90" "7" "117250691" "117250691" "subst" "4.06971E-6" "03779" "CFTR_001565" "g.117250691C>A" "" "" "" "" "" "Unknown" "" "rs397508498" "0" "" "" "" "" "pathogenic" "" "0000880400" "0" "90" "7" "117282493" "117282493" "subst" "4.07014E-6" "03779" "CFTR_001573" "g.117282493T>G" "" "" "" "" "" "Unknown" "" "rs397508598" "0" "" "" "" "" "pathogenic" "" "0000880401" "0" "90" "7" "117171160" "117171160" "subst" "0" "03779" "CFTR_001529" "g.117171160T>G" "" "" "" "" "" "Unknown" "" "rs397508729" "0" "" "" "" "" "pathogenic" "" "0000880402" "0" "90" "7" "117171092" "117171094" "dup" "0" "03779" "CFTR_001527" "g.117171092_117171094dup" "" "" "" "" "" "Unknown" "" "rs397508686" "0" "" "" "" "" "pathogenic" "" "0000880608" "0" "90" "7" "117250595" "117250603" "del" "0" "03779" "CFTR_001560" "g.117250595_117250603del" "" "" "" "" "" "Unknown" "" "rs1562914072" "0" "" "" "" "" "pathogenic" "" "0000880616" "0" "90" "7" "117230490" "117230490" "subst" "0" "03779" "CFTR_001225" "g.117230490A>T" "" "" "" "" "" "Unknown" "" "rs397508297" "0" "" "" "" "" "pathogenic" "" "0000880618" "0" "90" "7" "117250631" "117250631" "subst" "8.13279E-6" "03779" "CFTR_001563" "g.117250631T>C" "" "" "" "" "" "Unknown" "" "rs397508488" "0" "" "" "" "" "pathogenic" "" "0000880619" "0" "90" "7" "117251792" "117251792" "subst" "1.62685E-5" "03779" "CFTR_001568" "g.117251792C>A" "" "" "" "" "" "Unknown" "" "rs747754623" "0" "" "" "" "" "pathogenic" "" "0000880621" "0" "90" "7" "117227859" "117227859" "subst" "4.07136E-6" "03779" "CFTR_001217" "g.117227859G>A" "" "" "" "" "" "Unknown" "" "rs121909013" "0" "" "" "" "" "pathogenic" "" "0000880623" "0" "90" "7" "117304875" "117304875" "subst" "4.06458E-6" "03779" "CFTR_001581" "g.117304875T>A" "" "" "" "" "" "Unknown" "" "rs200955612" "0" "" "" "" "" "pathogenic" "" "0000880625" "0" "90" "7" "117199630" "117199630" "subst" "8.1277E-6" "03779" "CFTR_001546" "g.117199630T>C" "" "" "" "" "" "Unknown" "" "rs397508222" "0" "" "" "" "" "pathogenic" "" "0000881851" "0" "70" "7" "117230472" "117230472" "subst" "0" "03779" "CFTR_001629" "g.117230472C>T" "" "" "" "" "" "Unknown" "" "rs397508293" "0" "" "" "" "" "likely pathogenic" "" "0000881852" "0" "90" "7" "117227817" "117227817" "subst" "0" "03779" "CFTR_001628" "g.117227817G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000887557" "0" "50" "7" "117120179" "117120179" "subst" "0.000154576" "02325" "CFTR_001610" "g.117120179G>A" "" "" "" "CFTR(NM_000492.3):c.31G>A (p.V11I), CFTR(NM_000492.4):c.31G>A (p.(Val11Ile), p.V11I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000887558" "0" "30" "7" "117149076" "117149076" "dup" "0" "02326" "CFTR_001630" "g.117149076dup" "" "" "" "CFTR(NM_000492.3):c.165-12dupA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000887559" "0" "30" "7" "117149125" "117149125" "subst" "0.000166831" "02326" "CFTR_001631" "g.117149125A>G" "" "" "" "CFTR(NM_000492.3):c.202A>G (p.K68E), CFTR(NM_000492.4):c.202A>G (p.K68E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000887560" "0" "90" "7" "117175303" "117175303" "subst" "4.06213E-6" "02325" "CFTR_001532" "g.117175303G>T" "" "" "" "CFTR(NM_000492.4):c.581G>T (p.G194V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000887561" "0" "10" "7" "117188682" "117188682" "subst" "0" "02327" "CFTR_001447" "g.117188682G>T" "" "" "" "CFTR(NM_000492.3):c.1210-13_1210-11delGTTinsTTT, CFTR(NM_000492.4):c.1210-13G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000887563" "0" "50" "7" "117188877" "117188877" "subst" "0" "02327" "CFTR_001337" "g.117188877G>T" "" "" "" "CFTR(NM_000492.3):c.1392G>T (p.K464N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000887564" "0" "50" "7" "117199672" "117199672" "subst" "0" "02325" "CFTR_001633" "g.117199672G>A" "" "" "" "CFTR(NM_000492.4):c.1547G>A (p.R516K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000887565" "0" "30" "7" "117230411" "117230411" "subst" "0.000146759" "02327" "CFTR_001222" "g.117230411G>A" "" "" "" "CFTR(NM_000492.3):c.1684G>A (p.V562I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000887566" "0" "30" "7" "117234998" "117234998" "subst" "5.28206E-5" "02327" "CFTR_001634" "g.117234998T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000887567" "0" "90" "7" "117251649" "117251649" "subst" "0.000632194" "02326" "CFTR_000129" "g.117251649T>G" "" "" "" "CFTR(NM_000492.3):c.3154T>G (p.F1052V), CFTR(NM_000492.4):c.3154T>G (p.F1052V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000887568" "0" "30" "7" "117267672" "117267672" "subst" "0" "02326" "CFTR_001635" "g.117267672A>G" "" "" "" "CFTR(NM_000492.3):c.3565A>G (p.K1189E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000887570" "0" "30" "7" "117307015" "117307015" "subst" "0.000134352" "02327" "CFTR_001636" "g.117307015C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000906016" "3" "90" "7" "117199646" "117199648" "del" "0" "00006" "CFTR_000001" "g.117199646_117199648del" "2/73,755 controls" "{PMID:Reiner 2022:36459106}" "" "" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000906017" "3" "90" "7" "117199646" "117199648" "del" "0" "00006" "CFTR_000001" "g.117199646_117199648del" "2/73,755 controls" "{PMID:Reiner 2022:36459106}" "" "" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000906018" "3" "70" "7" "117251704" "117251704" "subst" "0.000622665" "00006" "CFTR_000107" "g.117251704G>A" "1/73,755 controls" "{PMID:Reiner 2022:36459106}" "" "" "" "Germline" "" "" "0" "" "" "g.117611650G>A" "" "likely pathogenic (recessive)" "" "0000906088" "1" "90" "7" "117254753" "117254753" "subst" "0.00040703" "00006" "CFTR_000021" "g.117254753G>C" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117614699G>C" "" "pathogenic (recessive)" "" "0000906089" "1" "90" "7" "117199646" "117199648" "del" "0" "00006" "CFTR_000001" "g.117199646_117199648del" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "1521_1523delCTT" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000906090" "1" "90" "7" "117227865" "117227865" "subst" "7.33E-5" "00006" "CFTR_000007" "g.117227865C>T" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117587811C>T" "" "pathogenic (recessive)" "" "0000906091" "1" "90" "7" "117199522" "117199522" "subst" "1.21953E-5" "00006" "CFTR_001108" "g.117199522C>G" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117559468C>G" "" "pathogenic (recessive)" "" "0000906092" "1" "90" "7" "117188849" "117188849" "subst" "0" "00006" "CFTR_000032" "g.117188849C>A" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117548795C>A" "" "pathogenic (recessive)" "" "0000906093" "1" "90" "7" "117199646" "117199648" "del" "0" "00006" "CFTR_000001" "g.117199646_117199648del" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "1521_1523delCTT" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000906094" "1" "90" "7" "117199646" "117199648" "del" "0" "00006" "CFTR_000001" "g.117199646_117199648del" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "1521_1523delCTT" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000906095" "1" "90" "7" "117199646" "117199648" "del" "0" "00006" "CFTR_000001" "g.117199646_117199648del" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "1521_1523delCTT" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000906146" "0" "90" "7" "117282620" "117282620" "subst" "0.0004396" "00006" "CFTR_000005" "g.117282620G>A" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117642566G>A" "" "pathogenic (recessive)" "" "0000906147" "0" "90" "7" "117307145" "117307145" "subst" "2.44244E-5" "00006" "CFTR_001401" "g.117307145C>T" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117667091C>T" "" "pathogenic (recessive)" "" "0000906148" "0" "90" "7" "117171029" "117171029" "subst" "0.00147328" "00006" "CFTR_000006" "g.117171029G>A" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000906149" "0" "90" "7" "117251704" "117251704" "subst" "0.000622665" "00006" "CFTR_000107" "g.117251704G>A" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117611650G>A" "" "pathogenic (recessive)" "" "0000906150" "0" "90" "7" "117171029" "117171029" "subst" "0.00147328" "00006" "CFTR_000006" "g.117171029G>A" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000906151" "0" "90" "7" "117307136" "117307136" "subst" "0" "00006" "CFTR_001637" "g.117307136G>T" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117667082G>T" "" "pathogenic (recessive)" "" "0000906152" "0" "90" "7" "117227832" "117227832" "subst" "0.000358192" "00006" "CFTR_000002" "g.117227832G>T" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117587778G>T" "" "pathogenic (recessive)" "" "0000906153" "0" "90" "7" "117171029" "117171029" "subst" "0.00147328" "00006" "CFTR_000006" "g.117171029G>A" "1/73755 controls" "{PMID:Reiner 2022:36459106}" "" "" "combination alleles not determined" "Germline" "" "" "0" "" "" "g.117530975G>A" "" "pathogenic (recessive)" "" "0000908855" "1" "50" "7" "117267573" "117267573" "subst" "3.67122E-5" "00006" "CFTR_001638" "g.117267573C>A" "" "{PMID:Bournazos 2022:34906502}" "" "" "" "Germline" "" "" "0" "" "" "g.117627519C>A" "" "VUS" "" "0000908926" "2" "90" "7" "117199646" "117199648" "del" "0" "00006" "CFTR_000001" "g.117199646_117199648del" "" "{PMID:Bournazos 2022:34906502}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000912622" "0" "10" "7" "117175372" "117175372" "subst" "0.00468322" "02327" "CFTR_001425" "g.117175372A>G" "" "" "" "CFTR(NM_000492.3):c.650A>G (p.E217G), CFTR(NM_000492.4):c.650A>G (p.E217G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000912623" "0" "50" "7" "117182116" "117182116" "subst" "0.000162742" "02327" "CFTR_001611" "g.117182116C>T" "" "" "" "CFTR(NM_000492.3):c.1163C>T (p.T388M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000912624" "0" "50" "7" "117199683" "117199683" "subst" "0.000130135" "02327" "CFTR_001482" "g.117199683G>A" "" "" "" "CFTR(NM_000492.3):c.1558G>A (p.V520I), CFTR(NM_000492.4):c.1558G>A (p.(Val520Ile), p.V520I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000912625" "0" "90" "7" "117227854" "117227854" "subst" "8.14067E-5" "02329" "CFTR_000042" "g.117227854G>A" "" "" "" "CFTR(NM_000492.4):c.1646G>A (p.S549N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000912626" "0" "10" "7" "117227874" "117227874" "subst" "0.00342536" "02327" "CFTR_001017" "g.117227874A>G" "" "" "" "CFTR(NM_000492.3):c.1666A>G (p.I556V), CFTR(NM_000492.4):c.1666A>G (p.I556V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000912627" "0" "30" "7" "117230411" "117230411" "subst" "0.000146759" "02326" "CFTR_001222" "g.117230411G>A" "" "" "" "CFTR(NM_000492.3):c.1684G>A (p.V562I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000912628" "0" "30" "7" "117232642" "117232642" "subst" "0.000758916" "02325" "CFTR_001136" "g.117232642A>G" "" "" "" "CFTR(NM_000492.3):c.2421A>G (p.I807M), CFTR(NM_000492.4):c.2421A>G (p.I807M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000912629" "0" "90" "7" "117250687" "117250687" "subst" "4.06961E-6" "02325" "CFTR_001639" "g.117250687C>T" "" "" "" "CFTR(NM_000492.4):c.3103C>T (p.Q1035*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000912630" "0" "50" "7" "117254708" "117254708" "subst" "2.0332E-5" "02327" "CFTR_001640" "g.117254708A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000912631" "0" "30" "7" "117267812" "117267812" "subst" "0.00492072" "02326" "CFTR_000051" "g.117267812T>G" "" "" "" "CFTR(NM_000492.3):c.3705T>G (p.S1235R, p.(Ser1235Arg)), CFTR(NM_000492.4):c.3705T>G (p.S1235R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000912632" "0" "10" "7" "117305631" "117305631" "subst" "0.00344397" "02327" "CFTR_001446" "g.117305631A>G" "" "" "" "CFTR(NM_000492.3):c.4242+13A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000920316" "11" "90" "7" "117199646" "117199648" "del" "0" "00006" "CFTR_000001" "g.117199646_117199648del" "" "{PMID:Stray-Pedersen 2017:27577878}" "" "" "main disease-related variant" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic" "ACMG" "0000920362" "21" "70" "7" "117232047" "117232047" "subst" "0" "00006" "CFTR_001554" "g.117232047A>G" "" "{PMID:Stray-Pedersen 2017:27577878}" "" "" "main disease-related variant" "Germline" "" "" "0" "" "" "g.117591993A>G" "" "likely pathogenic" "ACMG" "0000924617" "0" "30" "7" "117170947" "117170947" "subst" "0.000460829" "02326" "CFTR_001316" "g.117170947T>C" "" "" "" "CFTR(NM_000492.3):c.274-6T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924618" "0" "30" "7" "117188683" "117188684" "ins" "0" "02326" "CFTR_001641" "g.117188683_117188684insG" "" "" "" "CFTR(NM_000492.3):c.1210-12_1210-11insG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924620" "0" "30" "7" "117199644" "117199644" "subst" "6.09637E-5" "02327" "CFTR_001130" "g.117199644A>G" "" "" "" "CFTR(NM_000492.3):c.1519A>G (p.I507V), CFTR(NM_000492.4):c.1519A>G (p.I507V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924621" "0" "30" "7" "117227874" "117227874" "subst" "0.00342536" "02325" "CFTR_001017" "g.117227874A>G" "" "" "" "CFTR(NM_000492.3):c.1666A>G (p.I556V), CFTR(NM_000492.4):c.1666A>G (p.I556V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924623" "0" "90" "7" "117254714" "117254714" "subst" "0.000105725" "02326" "CFTR_001378" "g.117254714A>G" "" "" "" "CFTR(NM_000492.3):c.3415A>G (p.I1139V), CFTR(NM_000492.4):c.3415A>G (p.I1139V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000924624" "0" "10" "7" "117307108" "117307108" "subst" "0.217664" "02327" "CFTR_001400" "g.117307108G>A" "" "" "" "CFTR(NM_000492.3):c.4389G>A (p.Q1463=), CFTR(NM_000492.4):c.4389G>A (p.(Gln1463=), p.Q1463=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927694" "0" "50" "7" "117232394" "117232394" "subst" "0.000105665" "03779" "CFTR_001642" "g.117232394G>A" "" "" "" "" "" "Unknown" "" "rs199791061" "0" "" "" "" "" "VUS" "" "0000927708" "0" "70" "7" "117199545" "117199545" "subst" "0" "03779" "CFTR_001545" "g.117199545G>A" "" "" "" "" "" "Unknown" "" "rs756206533" "0" "" "" "" "" "likely pathogenic" "" "0000927739" "0" "50" "7" "117242874" "117242874" "subst" "0.000548214" "03779" "CFTR_001436" "g.117242874T>C" "" "" "" "" "" "Unknown" "" "rs371315682" "0" "" "" "" "" "VUS" "" "0000929268" "0" "30" "7" "117171122" "117171122" "subst" "0.00180589" "02326" "CFTR_000048" "g.117171122T>C" "" "" "" "CFTR(NM_000492.3):c.443T>C (p.I148T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929269" "0" "50" "7" "117174348" "117174348" "subst" "5.70837E-5" "02327" "CFTR_001643" "g.117174348C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000929270" "0" "90" "7" "117175380" "117175380" "subst" "4.06174E-6" "02327" "CFTR_000074" "g.117175380C>T" "" "" "" "CFTR(NM_000492.3):c.658C>T (p.Q220*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000929271" "0" "50" "7" "117188800" "117188800" "subst" "0" "02327" "CFTR_001644" "g.117188800C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000929272" "0" "30" "7" "117242865" "117242865" "subst" "0.00266809" "02326" "CFTR_001360" "g.117242865C>G" "" "" "" "CFTR(NM_000492.3):c.2620-15C>G, CFTR(NM_000492.4):c.2620-15C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929273" "0" "90" "7" "117243773" "117243773" "subst" "4.06273E-6" "02326" "CFTR_001645" "g.117243773C>T" "" "" "" "CFTR(NM_000492.3):c.2845C>T (p.H949Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000931663" "0" "50" "7" "117232521" "117232521" "subst" "0" "03779" "CFTR_001646" "g.117232521A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000931676" "0" "50" "7" "117307052" "117307052" "subst" "0.000333797" "03779" "CFTR_001504" "g.117307052G>A" "" "" "" "" "" "Unknown" "" "rs148783445" "0" "" "" "" "" "VUS" "" "0000933282" "3" "90" "7" "117199646" "117199648" "del" "0" "00006" "CFTR_000001" "g.117199646_117199648del" "" "{PMID:Yuan 2019:30158690}" "" "" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0000948805" "0" "50" "7" "117120179" "117120179" "subst" "0.000154576" "02327" "CFTR_001610" "g.117120179G>A" "" "" "" "CFTR(NM_000492.3):c.31G>A (p.V11I), CFTR(NM_000492.4):c.31G>A (p.(Val11Ile), p.V11I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948806" "0" "50" "7" "117149125" "117149125" "subst" "0.000166831" "02325" "CFTR_001631" "g.117149125A>G" "" "" "" "CFTR(NM_000492.3):c.202A>G (p.K68E), CFTR(NM_000492.4):c.202A>G (p.K68E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948807" "0" "50" "7" "117188845" "117188847" "del" "0" "02325" "CFTR_001430" "g.117188845_117188847del" "" "" "" "CFTR(NM_000492.3):c.1360_1362delTTG (p.L454del), CFTR(NM_000492.4):c.1360_1362delTTG (p.L454del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948808" "0" "70" "7" "117199683" "117199683" "subst" "0.000130135" "02325" "CFTR_001482" "g.117199683G>A" "" "" "" "CFTR(NM_000492.3):c.1558G>A (p.V520I), CFTR(NM_000492.4):c.1558G>A (p.(Val520Ile), p.V520I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000948809" "0" "50" "7" "117232638" "117232638" "subst" "1.13909E-5" "02327" "CFTR_001647" "g.117232638A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948810" "0" "50" "7" "117243684" "117243684" "subst" "7.71831E-5" "02325" "CFTR_001471" "g.117243684A>G" "" "" "" "CFTR(NM_000492.4):c.2756A>G (p.Y919C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948811" "0" "50" "7" "117246754" "117246754" "subst" "0" "02325" "CFTR_001648" "g.117246754G>A" "" "" "" "CFTR(NM_000492.4):c.2935G>A (p.D979N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948812" "0" "50" "7" "117250622" "117250622" "subst" "2.84645E-5" "02325" "CFTR_001603" "g.117250622C>T" "" "" "" "CFTR(NM_000492.4):c.3038C>T (p.P1013L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948813" "0" "50" "7" "117307052" "117307052" "subst" "0.000333797" "02327" "CFTR_001504" "g.117307052G>A" "" "" "" "CFTR(NM_000492.4):c.4333G>A (p.D1445N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000964387" "0" "30" "7" "117120133" "117120133" "subst" "8.13134E-6" "02327" "CFTR_001649" "g.117120133C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000964388" "0" "50" "7" "117144345" "117144345" "subst" "3.66339E-5" "02327" "CFTR_001167" "g.117144345G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000964390" "0" "30" "7" "117188680" "117188683" "dup" "0" "02329" "CFTR_001650" "g.117188680_117188683dup" "" "" "" "CFTR(NM_000492.4):c.1210-18_1210-15dupTGTG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000964391" "0" "70" "7" "117188852" "117188852" "subst" "0" "02327" "CFTR_001336" "g.117188852T>C" "" "" "" "CFTR(NM_000492.3):c.1367T>C (p.V456A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000964392" "0" "90" "7" "117199589" "117199601" "del" "0" "02325" "CFTR_001651" "g.117199589_117199601del" "" "" "" "CFTR(NM_000492.4):c.1464_1476delTTCATTCTGTTCT (p.C491Pfs*32)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000964393" "0" "90" "7" "117232693" "117232693" "del" "0" "02327" "CFTR_001652" "g.117232693del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000964394" "0" "50" "7" "117267592" "117267592" "subst" "0.000656131" "02325" "CFTR_000156" "g.117267592G>T" "" "" "" "CFTR(NM_000492.3):c.3485G>T (p.R1162L), CFTR(NM_000492.4):c.3485G>T (p.R1162L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977471" "0" "90" "7" "117149144" "117149144" "subst" "0.00026044" "01804" "CFTR_001422" "g.117149144G>A" "" "" "" "CFTR(NM_000492.3):c.221G>A (p.R74Q), CFTR(NM_000492.4):c.221G>A (p.(Arg74Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000977472" "0" "90" "7" "117174420" "117174420" "subst" "4.08373E-5" "01804" "CFTR_000044" "g.117174420G>T" "" "" "" "CFTR(NM_000492.3):c.579+1G>T, CFTR(NM_000492.4):c.579+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000977473" "0" "50" "7" "117175419" "117175419" "subst" "0" "02325" "CFTR_001653" "g.117175419C>T" "" "" "" "CFTR(NM_000492.4):c.697C>T (p.L233F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977474" "0" "50" "7" "117180335" "117180335" "subst" "0" "02327" "CFTR_001654" "g.117180335A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977475" "0" "50" "7" "117180336" "117180336" "subst" "0.00018706" "01804" "CFTR_001129" "g.117180336C>G" "" "" "" "CFTR(NM_000492.3):c.1052C>G (p.T351S), CFTR(NM_000492.4):c.1052C>G (p.(Thr351Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977476" "0" "50" "7" "117182149" "117182149" "subst" "9.76928E-5" "01804" "CFTR_001612" "g.117182149C>T" "" "" "" "CFTR(NM_000492.3):c.1196C>T (p.A399V), CFTR(NM_000492.4):c.1196C>T (p.(Ala399Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977478" "0" "10" "7" "117199533" "117199533" "subst" "0.474443" "01804" "CFTR_001338" "g.117199533G>A" "" "" "" "CFTR(NM_000492.3):c.1408G>A (p.V470M), CFTR(NM_000492.4):c.1408G>A (p.(Val470Met), p.V470M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000977479" "0" "90" "7" "117199646" "117199648" "del" "0" "01804" "CFTR_000001" "g.117199646_117199648del" "" "" "" "CFTR(NM_000492.3):c.1521_1523delCTT (p.(Phe508del)), CFTR(NM_000492.3):c.1521_1523delCTT (p.F508del), CFTR(NM_000492.4):c.1521_1523delCTT (p.F508del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000977480" "0" "30" "7" "117227840" "117227840" "subst" "8.14001E-6" "02327" "CFTR_001655" "g.117227840T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000977481" "0" "90" "7" "117230496" "117230496" "subst" "0" "02325" "CFTR_000139" "g.117230496A>G" "" "" "" "CFTR(NM_000492.4):c.1766+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000977482" "0" "10" "7" "117235055" "117235055" "subst" "0.382582" "01804" "CFTR_001359" "g.117235055T>G" "" "" "" "CFTR(NM_000492.3):c.2562T>G (p.T854=), CFTR(NM_000492.4):c.2562T>G (p.(Thr854=), p.T854=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000977483" "0" "70" "7" "117246797" "117246797" "subst" "4.06659E-6" "02325" "CFTR_001656" "g.117246797A>G" "" "" "" "CFTR(NM_000492.4):c.2978A>G (p.D993G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000977484" "0" "50" "7" "117250575" "117250575" "subst" "0.0022857" "01804" "CFTR_000082" "g.117250575G>C" "" "" "" "CFTR(NM_000492.3):c.2991G>C (p.L997F), CFTR(NM_000492.4):c.2991G>C (p.(Leu997Phe), p.L997F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977485" "0" "50" "7" "117250609" "117250609" "subst" "9.35187E-5" "02325" "CFTR_001657" "g.117250609G>A" "" "" "" "CFTR(NM_000492.4):c.3025G>A (p.(Ala1009Thr), p.A1009T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977486" "0" "90" "7" "117267575" "117267575" "subst" "0" "02325" "CFTR_001658" "g.117267575G>A" "" "" "" "CFTR(NM_000492.4):c.3469-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000977487" "0" "50" "7" "117267610" "117267610" "subst" "4.07362E-6" "01804" "CFTR_001659" "g.117267610A>G" "" "" "" "CFTR(NM_000492.4):c.3503A>G (p.(Asp1168Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977488" "0" "70" "7" "117292930" "117292930" "subst" "4.90802E-5" "02327" "CFTR_001390" "g.117292930A>T" "" "" "" "CFTR(NM_000492.3):c.3908A>T (p.N1303I), CFTR(NM_000492.4):c.3908A>T (p.N1303I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000977489" "0" "50" "7" "117304907" "117304907" "subst" "4.06633E-6" "02327" "CFTR_001503" "g.117304907G>C" "" "" "" "CFTR(NM_000492.3):c.4129G>C (p.D1377H), CFTR(NM_000492.4):c.4129G>C (p.D1377H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977490" "0" "10" "7" "117307108" "117307108" "subst" "0.217664" "01804" "CFTR_001400" "g.117307108G>A" "" "" "" "CFTR(NM_000492.3):c.4389G>A (p.Q1463=), CFTR(NM_000492.4):c.4389G>A (p.(Gln1463=), p.Q1463=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000996144" "0" "30" "7" "117144429" "117144429" "subst" "0.000329454" "01804" "CFTR_001140" "g.117144429T>C" "" "" "" "CFTR(NM_000492.3):c.164+12T>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000996145" "0" "50" "7" "117149143" "117149143" "subst" "0.00142434" "02327" "CFTR_000087" "g.117149143C>T" "" "" "" "CFTR(NM_000492.3):c.220C>T (p.R74W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996146" "0" "90" "7" "117174420" "117174420" "subst" "4.08373E-5" "02327" "CFTR_000044" "g.117174420G>T" "" "" "" "CFTR(NM_000492.3):c.579+1G>T, CFTR(NM_000492.4):c.579+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000996147" "0" "90" "7" "117188696" "117188696" "del" "0" "02327" "CFTR_001204" "g.117188696del" "" "" "" "CFTR(NM_000492.3):c.1210-1delG, CFTR(NM_000492.3):c.1211delG (p.G404Dfs*38), CFTR(NM_000492.4):c.1210-1delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000996148" "0" "10" "7" "117199644" "117199644" "subst" "6.09637E-5" "02325" "CFTR_001130" "g.117199644A>G" "" "" "" "CFTR(NM_000492.3):c.1519A>G (p.I507V), CFTR(NM_000492.4):c.1519A>G (p.I507V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000996149" "0" "50" "7" "117282582" "117282582" "subst" "0.00119238" "02327" "CFTR_000073" "g.117282582G>A" "" "" "" "CFTR(NM_000492.3):c.3808G>A (p.D1270N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000996150" "0" "50" "7" "117282628" "117282628" "subst" "0.00066791" "01804" "CFTR_001387" "g.117282628C>T" "" "" "" "CFTR(NM_000492.3):c.3854C>T (p.A1285V, p.(Ala1285Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001011152" "0" "90" "7" "117199646" "117199648" "del" "0" "00006" "CFTR_000001" "g.117199646_117199648del" "" "{PMID:Rots 2024:39013459}, {DOI:Rots 2024:10.1016/j.ajhg.2024.06.009}" "" "" "" "Germline" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic (recessive)" "" "0001011506" "0" "90" "7" "117188688" "117188689" "del" "0" "04749" "CFTR_000029" "g.117188688_117188689del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.117548634_117548635del" "" "pathogenic" "" "0001014263" "0" "50" "7" "117174349" "117174349" "subst" "0.000517839" "02325" "CFTR_001188" "g.117174349G>A" "" "" "" "CFTR(NM_000492.4):c.509G>A (p.R170H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001014264" "0" "50" "7" "117232300" "117232300" "subst" "7.36425E-5" "02325" "CFTR_001660" "g.117232300T>G" "" "" "" "CFTR(NM_000492.4):c.2079T>G (p.F693L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001014265" "0" "70" "7" "117243784" "117243784" "subst" "7.31368E-5" "02325" "CFTR_001411" "g.117243784G>C" "" "" "" "CFTR(NM_000492.4):c.2856G>C (p.M952I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001014266" "0" "50" "7" "117267699" "117267699" "subst" "2.0393E-5" "02325" "CFTR_001661" "g.117267699G>A" "" "" "" "CFTR(NM_000492.4):c.3592G>A (p.V1198M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001025303" "0" "30" "7" "117149163" "117149163" "subst" "0" "01943" "CFTR_001662" "g.117149163A>G" "" "" "" "CFTR(NM_000492.3):c.240A>G (p.R80=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001025304" "0" "90" "7" "117188696" "117188696" "del" "0" "02325" "CFTR_001204" "g.117188696del" "" "" "" "CFTR(NM_000492.3):c.1210-1delG, CFTR(NM_000492.3):c.1211delG (p.G404Dfs*38), CFTR(NM_000492.4):c.1210-1delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001025305" "0" "50" "7" "117199524" "117199524" "subst" "4.06491E-5" "02325" "CFTR_001406" "g.117199524C>T" "" "" "" "CFTR(NM_000492.4):c.1399C>T (p.L467F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001025306" "0" "70" "7" "117246713" "117246713" "subst" "4.07564E-6" "02325" "CFTR_001663" "g.117246713T>G" "" "" "" "CFTR(NM_000492.4):c.2909-15T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001025307" "0" "50" "7" "117254714" "117254714" "subst" "0.000105725" "02327" "CFTR_001378" "g.117254714A>G" "" "" "" "CFTR(NM_000492.3):c.3415A>G (p.I1139V), CFTR(NM_000492.4):c.3415A>G (p.I1139V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001025308" "0" "30" "7" "117304736" "117304736" "subst" "1.22062E-5" "02325" "CFTR_001664" "g.117304736C>T" "" "" "" "CFTR(NM_000492.4):c.3964-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001025309" "0" "50" "7" "117304907" "117304907" "subst" "4.06633E-6" "02325" "CFTR_001503" "g.117304907G>C" "" "" "" "CFTR(NM_000492.3):c.4129G>C (p.D1377H), CFTR(NM_000492.4):c.4129G>C (p.D1377H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001036086" "0" "50" "7" "117149151" "117149151" "subst" "4.06881E-6" "02327" "CFTR_001665" "g.117149151T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001036087" "0" "70" "7" "117174411" "117174411" "subst" "8.15647E-6" "02327" "CFTR_001320" "g.117174411T>G" "" "" "" "CFTR(NM_000492.4):c.571T>G (p.F191V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001036088" "0" "30" "7" "117230458" "117230458" "subst" "0.000216025" "02325" "CFTR_001666" "g.117230458C>T" "" "" "" "CFTR(NM_000492.4):c.1731C>T (p.Y577=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001036089" "0" "50" "7" "117243663" "117243663" "subst" "0.00107255" "01804" "CFTR_001557" "g.117243663C>T" "" "" "" "CFTR(NM_000492.4):c.2735C>T (p.(Ser912Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001036090" "0" "50" "7" "117304761" "117304761" "subst" "1.22013E-5" "02327" "CFTR_001616" "g.117304761T>C" "" "" "" "CFTR(NM_000492.3):c.3983T>C (p.I1328T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046093" "0" "50" "7" "117149189" "117149189" "subst" "8.1479E-6" "02325" "CFTR_001667" "g.117149189A>G" "" "" "" "CFTR(NM_000492.4):c.266A>G (p.Y89C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046094" "0" "90" "7" "117232273" "117232273" "dup" "0" "02325" "CFTR_000028" "g.117232273dup" "" "" "" "CFTR(NM_000492.3):c.2052dupA (p.Q685Tfs*4), CFTR(NM_000492.4):c.2052dupA (p.Q685Tfs*4)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001046095" "0" "90" "7" "117232595" "117232595" "subst" "5.6572E-6" "02325" "CFTR_001238" "g.117232595C>T" "" "" "" "CFTR(NM_000492.4):c.2374C>T (p.R792*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001047582" "0" "50" "7" "117180285" "117180285" "subst" "0.000117891" "03779" "CFTR_001014" "g.117180285G>A" "" "" "" "" "" "Unknown" "" "rs397508137" "0" "" "" "" "" "VUS" "" "0001047583" "0" "50" "7" "117180285" "117180285" "subst" "0.000117891" "03779" "CFTR_001014" "g.117180285G>A" "" "" "" "" "" "Unknown" "" "rs397508137" "0" "" "" "" "" "VUS" "" "0001047584" "0" "50" "7" "117308413" "117308413" "subst" "0" "03779" "CFTR_001733" "g.117308413C>T" "" "" "" "" "" "Unknown" "" "rs1042180" "0" "" "" "" "" "VUS" "" "0001047587" "0" "10" "7" "117180336" "117180336" "subst" "0.00018706" "03779" "CFTR_001129" "g.117180336C>G" "" "" "" "" "" "Unknown" "" "rs1800086" "0" "" "" "" "" "benign" "" "0001047599" "0" "90" "7" "117180286" "117180286" "del" "0" "03779" "CFTR_001685" "g.117180286del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001047601" "0" "70" "7" "117180323" "117180323" "subst" "1.21996E-5" "03779" "CFTR_001686" "g.117180323C>T" "" "" "" "" "" "Unknown" "" "rs397508147" "0" "" "" "" "" "likely pathogenic" "" "0001047602" "0" "70" "7" "117180323" "117180323" "subst" "1.21996E-5" "03779" "CFTR_001686" "g.117180323C>T" "" "" "" "" "" "Unknown" "" "rs397508147" "0" "" "" "" "" "likely pathogenic" "" "0001047603" "0" "70" "7" "117180323" "117180323" "subst" "1.21996E-5" "03779" "CFTR_001686" "g.117180323C>T" "" "" "" "" "" "Unknown" "" "rs397508147" "0" "" "" "" "" "likely pathogenic" "" "0001047604" "0" "90" "7" "117180338" "117180338" "subst" "0.000418904" "03779" "CFTR_001015" "g.117180338C>T" "" "" "" "" "" "Unknown" "" "rs193922497" "0" "" "" "" "" "pathogenic" "" "0001047606" "0" "90" "7" "117180374" "117180374" "subst" "0" "03779" "CFTR_001687" "g.117180374T>C" "" "" "" "" "" "Unknown" "" "rs78909279" "0" "" "" "" "" "pathogenic" "" "0001047607" "0" "50" "7" "117182088" "117182088" "subst" "0" "03779" "CFTR_001688" "g.117182088G>A" "" "" "" "" "" "Unknown" "" "rs397508165" "0" "" "" "" "" "VUS" "" "0001047609" "0" "90" "7" "117182128" "117182128" "subst" "0" "03779" "CFTR_001689" "g.117182128T>G" "" "" "" "" "" "Unknown" "" "rs397508170" "0" "" "" "" "" "pathogenic" "" "0001047610" "0" "70" "7" "117144378" "117144378" "subst" "0.000122137" "03779" "CFTR_001420" "g.117144378C>T" "" "" "" "" "" "Unknown" "" "rs143456784" "0" "" "" "" "" "likely pathogenic" "" "0001047611" "0" "50" "7" "117188800" "117188800" "subst" "0" "03779" "CFTR_001644" "g.117188800C>T" "" "" "" "" "" "Unknown" "" "rs397508187" "0" "" "" "" "" "VUS" "" "0001047612" "0" "10" "7" "117188812" "117188812" "subst" "0" "03779" "CFTR_001206" "g.117188812G>T" "" "" "" "" "" "Unknown" "" "rs147422190" "0" "" "" "" "" "benign" "" "0001047613" "0" "90" "7" "117188816" "117188816" "subst" "0" "03779" "CFTR_001690" "g.117188816T>C" "" "" "" "" "" "Unknown" "" "rs397508191" "0" "" "" "" "" "pathogenic" "" "0001047614" "0" "90" "7" "117188840" "117188840" "subst" "0" "03779" "CFTR_001691" "g.117188840A>C" "" "" "" "" "" "Unknown" "" "rs397508193" "0" "" "" "" "" "pathogenic" "" "0001047615" "0" "90" "7" "117188858" "117188858" "subst" "0" "03779" "CFTR_001692" "g.117188858G>T" "" "" "" "" "" "Unknown" "" "rs121909009" "0" "" "" "" "" "pathogenic" "" "0001047616" "0" "70" "7" "117188875" "117188875" "subst" "0" "03779" "CFTR_001693" "g.117188875A>C" "" "" "" "" "" "Unknown" "" "rs1799216615" "0" "" "" "" "" "likely pathogenic" "" "0001047617" "0" "90" "7" "117188878" "117188878" "del" "0" "03779" "CFTR_001598" "g.117188878del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001047619" "0" "90" "7" "117188878" "117188878" "del" "0" "03779" "CFTR_001598" "g.117188878del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001047621" "0" "10" "7" "117199641" "117199641" "subst" "0.000357631" "03779" "CFTR_001340" "g.117199641A>G" "" "" "" "" "" "Unknown" "" "rs1800091" "0" "" "" "" "" "benign" "" "0001047622" "0" "90" "7" "117199643" "117199643" "subst" "0" "03779" "CFTR_001698" "g.117199643C>G" "" "" "" "" "" "Unknown" "" "rs1800092" "0" "" "" "" "" "pathogenic" "" "0001047623" "0" "30" "7" "117227790" "117227790" "subst" "0" "03779" "CFTR_001702" "g.117227790T>C" "" "" "" "" "" "Unknown" "" "rs2485104020" "0" "" "" "" "" "likely benign" "" "0001047624" "0" "50" "7" "117218375" "117218375" "subst" "0" "03779" "CFTR_001701" "g.117218375T>C" "" "" "" "" "" "Unknown" "" "rs1004364997" "0" "" "" "" "" "VUS" "" "0001047625" "0" "90" "7" "117227817" "117227817" "subst" "0" "03779" "CFTR_001628" "g.117227817G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001047626" "0" "90" "7" "117227817" "117227817" "subst" "0" "03779" "CFTR_001628" "g.117227817G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001047627" "0" "90" "7" "117227817" "117227817" "subst" "0" "03779" "CFTR_001628" "g.117227817G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001047628" "0" "90" "7" "117227817" "117227817" "subst" "0" "03779" "CFTR_001628" "g.117227817G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001047629" "0" "90" "7" "117227862" "117227862" "subst" "0" "03779" "CFTR_000086" "g.117227862C>T" "" "" "" "" "" "Unknown" "" "rs76554633" "0" "" "" "" "" "pathogenic" "" "0001047630" "0" "70" "7" "117227863" "117227863" "subst" "0" "03779" "CFTR_001704" "g.117227863A>C" "" "" "" "" "" "Unknown" "" "rs1791967656" "0" "" "" "" "" "likely pathogenic" "" "0001047631" "0" "50" "7" "117227865" "117227865" "subst" "0" "03779" "CFTR_001705" "g.117227865C>G" "" "" "" "" "" "Unknown" "" "rs74597325" "0" "" "" "" "" "VUS" "" "0001047632" "0" "10" "7" "117227874" "117227874" "subst" "0.00342536" "03779" "CFTR_001017" "g.117227874A>G" "" "" "" "" "" "Unknown" "" "rs75789129" "0" "" "" "" "" "benign" "" "0001047633" "0" "10" "7" "117229536" "117229536" "subst" "0" "03779" "CFTR_001706" "g.117229536A>G" "" "" "" "" "" "Unknown" "" "rs572658447" "0" "" "" "" "" "benign" "" "0001047634" "0" "50" "7" "117230417" "117230417" "subst" "4.07591E-6" "03779" "CFTR_001707" "g.117230417A>G" "" "" "" "" "" "Unknown" "" "rs371291116" "0" "" "" "" "" "VUS" "" "0001047635" "0" "90" "7" "117230431" "117230431" "subst" "0" "03779" "CFTR_001708" "g.117230431G>T" "" "" "" "" "" "Unknown" "" "rs397508275" "0" "" "" "" "" "pathogenic" "" "0001047636" "0" "50" "7" "117230433" "117230433" "subst" "0" "03779" "CFTR_001347" "g.117230433A>G" "" "" "" "" "" "Unknown" "" "rs397508277" "0" "" "" "" "" "VUS" "" "0001047637" "0" "50" "7" "117230411" "117230411" "subst" "0.000146759" "03779" "CFTR_001222" "g.117230411G>A" "" "" "" "" "" "Unknown" "" "rs1800097" "0" "" "" "" "" "VUS" "" "0001047638" "0" "10" "7" "117230454" "117230454" "subst" "0.00503416" "03779" "CFTR_000065" "g.117230454G>C" "" "" "" "" "" "Unknown" "" "rs1800098" "0" "" "" "" "" "benign" "" "0001047639" "0" "50" "7" "117149096" "117149096" "subst" "4.07236E-6" "03779" "CFTR_001671" "g.117149096A>G" "" "" "" "" "" "Unknown" "" "rs397508291" "0" "" "" "" "" "VUS" "" "0001047640" "0" "50" "7" "117230486" "117230486" "subst" "4.0843E-6" "03779" "CFTR_001711" "g.117230486T>A" "" "" "" "" "" "Unknown" "" "rs767349773" "0" "" "" "" "" "VUS" "" "0001047641" "0" "50" "7" "117230489" "117230489" "subst" "2.04364E-5" "03779" "CFTR_001712" "g.117230489G>A" "" "" "" "" "" "Unknown" "" "rs755986694" "0" "" "" "" "" "VUS" "" "0001047642" "0" "50" "7" "117231990" "117231990" "subst" "0" "03779" "CFTR_001713" "g.117231990G>A" "" "" "" "" "" "Unknown" "" "rs1347776232" "0" "" "" "" "" "VUS" "" "0001047643" "0" "90" "7" "117232023" "117232023" "subst" "0" "03779" "CFTR_001714" "g.117232023T>C" "" "" "" "" "" "Unknown" "" "rs397508307" "0" "" "" "" "" "pathogenic" "" "0001047644" "0" "10" "7" "117232223" "117232223" "subst" "0.00594922" "03779" "CFTR_000059" "g.117232223C>T" "" "" "" "" "" "Unknown" "" "rs1800100" "0" "" "" "" "" "benign" "" "0001047645" "0" "10" "7" "117149143" "117149143" "subst" "0.00142434" "03779" "CFTR_000087" "g.117149143C>T" "" "" "" "" "" "Unknown" "" "rs115545701" "0" "" "" "" "" "benign" "" "0001047646" "0" "10" "7" "117149144" "117149144" "subst" "0.00026044" "03779" "CFTR_001422" "g.117149144G>A" "" "" "" "" "" "Unknown" "" "rs142540482" "0" "" "" "" "" "benign" "" "0001047647" "0" "90" "7" "117149145" "117149146" "delins" "0" "03779" "CFTR_001672" "g.117149145_117149146delinsA" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001047683" "0" "10" "7" "117232642" "117232642" "subst" "0.000758916" "03779" "CFTR_001136" "g.117232642A>G" "" "" "" "" "" "Unknown" "" "rs1800103" "0" "" "" "" "" "benign" "" "0001047684" "0" "90" "7" "117232671" "117232671" "del" "0" "03779" "CFTR_001718" "g.117232671del" "" "" "" "" "" "Unknown" "" "rs1584812778" "0" "" "" "" "" "pathogenic" "" "0001047685" "0" "90" "7" "117232671" "117232671" "del" "0" "03779" "CFTR_001718" "g.117232671del" "" "" "" "" "" "Unknown" "" "rs1584812778" "0" "" "" "" "" "pathogenic" "" "0001047686" "0" "10" "7" "117234999" "117234999" "subst" "0.000451011" "03779" "CFTR_001241" "g.117234999G>T" "" "" "" "" "" "Unknown" "" "rs201386642" "0" "" "" "" "" "benign" "" "0001047687" "0" "90" "7" "117149186" "117149186" "subst" "0" "03779" "CFTR_001180" "g.117149186T>G" "" "" "" "" "" "Unknown" "" "rs397508412" "0" "" "" "" "" "pathogenic" "" "0001047688" "0" "90" "7" "117149186" "117149186" "subst" "0" "03779" "CFTR_001180" "g.117149186T>G" "" "" "" "" "" "Unknown" "" "rs397508412" "0" "" "" "" "" "pathogenic" "" "0001047689" "0" "90" "7" "117243584" "117243584" "subst" "0" "03779" "CFTR_001720" "g.117243584A>G" "" "" "" "" "" "Unknown" "" "rs1554390958" "0" "" "" "" "" "pathogenic" "" "0001047690" "0" "70" "7" "117243600" "117243600" "subst" "3.25214E-5" "03779" "CFTR_001721" "g.117243600A>G" "" "" "" "" "" "Unknown" "" "rs766181463" "0" "" "" "" "" "likely pathogenic" "" "0001047691" "0" "90" "7" "117243624" "117243624" "del" "0" "03779" "CFTR_001723" "g.117243624del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001047692" "0" "90" "7" "117243663" "117243663" "subst" "0" "03779" "CFTR_001249" "g.117243663C>A" "" "" "" "" "" "Unknown" "" "rs121909034" "0" "" "" "" "" "pathogenic" "" "0001047693" "0" "90" "7" "117246728" "117246728" "subst" "1.22079E-5" "03779" "CFTR_001558" "g.117246728G>A" "" "" "" "" "" "Unknown" "" "rs386134230" "0" "" "" "" "" "pathogenic" "" "0001047694" "0" "90" "7" "117246728" "117246728" "subst" "0" "03779" "CFTR_001724" "g.117246728G>T" "" "" "" "" "" "Unknown" "" "rs386134230" "0" "" "" "" "" "pathogenic" "" "0001047695" "0" "90" "7" "117170987" "117170987" "del" "0" "03779" "CFTR_001620" "g.117170987del" "" "" "" "" "" "Unknown" "" "rs1798849948" "0" "" "" "" "" "pathogenic" "" "0001047696" "0" "90" "7" "117250722" "117250722" "del" "0" "03779" "CFTR_001725" "g.117250722del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001047698" "0" "90" "7" "117251675" "117251675" "del" "0" "03779" "CFTR_001726" "g.117251675del" "" "" "" "" "" "Unknown" "" "rs2485130252" "0" "" "" "" "" "pathogenic" "" "0001047699" "0" "90" "7" "117251692" "117251692" "subst" "0" "03779" "CFTR_001727" "g.117251692G>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001047700" "0" "90" "7" "117254753" "117254754" "del" "0" "03779" "CFTR_001728" "g.117254753_117254754del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001047701" "0" "90" "7" "117171029" "117171029" "subst" "1.22095E-5" "03779" "CFTR_001488" "g.117171029G>T" "" "" "" "" "" "Unknown" "" "rs78655421" "0" "" "" "" "" "pathogenic" "" "0001047702" "0" "90" "7" "117267639" "117267642" "dup" "0" "03779" "CFTR_001281" "g.117267639_117267642dup" "" "" "" "" "" "Unknown" "" "rs387906378" "0" "" "" "" "" "pathogenic" "" "0001047703" "0" "90" "7" "117267705" "117267705" "delins" "0" "03779" "CFTR_001729" "g.117267705delinsTCT" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001047704" "0" "90" "7" "117282631" "117282631" "subst" "0" "03779" "CFTR_001730" "g.117282631T>C" "" "" "" "" "" "Unknown" "" "rs121909028" "0" "" "" "" "" "pathogenic" "" "0001047705" "0" "90" "7" "117304834" "117304834" "subst" "6.0983E-5" "03779" "CFTR_001128" "g.117304834G>T" "" "" "" "" "" "Unknown" "" "rs113857788" "0" "" "" "" "" "pathogenic" "" "0001047706" "0" "90" "7" "117307083" "117307083" "subst" "1.22049E-5" "03779" "CFTR_001583" "g.117307083C>G" "" "" "" "" "" "Unknown" "" "rs121909043" "0" "" "" "" "" "pathogenic" "" "0001047707" "0" "90" "7" "117171160" "117171160" "subst" "0" "03779" "CFTR_001677" "g.117171160T>A" "" "" "" "" "" "Unknown" "" "rs397508729" "0" "" "" "" "" "pathogenic" "" "0001047708" "0" "90" "7" "117174398" "117174398" "subst" "0" "03779" "CFTR_001680" "g.117174398C>A" "" "" "" "" "" "Unknown" "" "rs397508753" "0" "" "" "" "" "pathogenic" "" "0001047709" "0" "90" "7" "117176627" "117176627" "subst" "0" "03779" "CFTR_001622" "g.117176627G>T" "" "" "" "" "" "Unknown" "" "rs2485020199" "0" "" "" "" "" "pathogenic" "" "0001047710" "0" "90" "7" "117180217" "117180217" "subst" "0" "03779" "CFTR_001538" "g.117180217C>G" "" "" "" "" "" "Unknown" "" "rs121909016" "0" "" "" "" "" "pathogenic" "" "0001047711" "0" "90" "7" "117180219" "117180221" "del" "0" "03779" "CFTR_001684" "g.117180219_117180221del" "" "" "" "" "" "Unknown" "" "rs121908768" "0" "" "" "" "" "pathogenic" "" "0001047712" "0" "70" "7" "117144348" "117144348" "subst" "4.06981E-6" "03779" "CFTR_001670" "g.117144348T>C" "" "" "" "" "" "Unknown" "" "rs397508821" "0" "" "" "" "" "likely pathogenic" "" "0001047713" "0" "10" "7" "117144344" "117144344" "subst" "0.00165252" "03779" "CFTR_000125" "g.117144344C>T" "" "" "" "" "" "Unknown" "" "rs1800073" "0" "" "" "" "" "benign" "" "0001047714" "0" "10" "7" "117175372" "117175372" "subst" "0.00468322" "03779" "CFTR_001425" "g.117175372A>G" "" "" "" "" "" "Unknown" "" "rs121909046" "0" "" "" "" "" "benign" "" "0001047715" "0" "10" "7" "117282582" "117282582" "subst" "0.00119238" "03779" "CFTR_000073" "g.117282582G>A" "" "" "" "" "" "Unknown" "" "rs11971167" "0" "" "" "" "" "benign" "" "0001047716" "0" "10" "7" "117267812" "117267812" "subst" "0.00492072" "03779" "CFTR_000051" "g.117267812T>G" "" "" "" "" "" "Unknown" "" "rs34911792" "0" "" "" "" "" "benign" "" "0001047717" "0" "10" "7" "117267592" "117267592" "subst" "0.000656131" "03779" "CFTR_000156" "g.117267592G>T" "" "" "" "" "" "Unknown" "" "rs1800120" "0" "" "" "" "" "benign" "" "0001047718" "0" "10" "7" "117251649" "117251649" "subst" "0.000632194" "03779" "CFTR_000129" "g.117251649T>G" "" "" "" "" "" "Unknown" "" "rs150212784" "0" "" "" "" "" "benign" "" "0001047719" "0" "10" "7" "117243828" "117243828" "subst" "0.000707357" "03779" "CFTR_001364" "g.117243828T>C" "" "" "" "" "" "Unknown" "" "rs1800110" "0" "" "" "" "" "benign" "" "0001047720" "0" "10" "7" "117170947" "117170947" "subst" "0.000460829" "03779" "CFTR_001316" "g.117170947T>C" "" "" "" "" "" "Unknown" "" "rs371315549" "0" "" "" "" "" "benign" "" "0001047721" "0" "10" "7" "117243663" "117243663" "subst" "0.00107255" "03779" "CFTR_001557" "g.117243663C>T" "" "" "" "" "" "Unknown" "" "rs121909034" "0" "" "" "" "" "benign" "" "0001047722" "0" "10" "7" "117235218" "117235218" "subst" "0" "03779" "CFTR_001719" "g.117235218T>A" "" "" "" "" "" "Unknown" "" "rs4148713" "0" "" "" "" "" "benign" "" "0001047723" "0" "10" "7" "117242865" "117242865" "subst" "0.00266809" "03779" "CFTR_001360" "g.117242865C>G" "" "" "" "" "" "Unknown" "" "rs139379077" "0" "" "" "" "" "benign" "" "0001047726" "0" "90" "7" "117232086" "117232086" "subst" "8.82168E-5" "03779" "CFTR_001409" "g.117232086G>A" "" "" "" "" "" "Unknown" "" "rs121908759" "0" "" "" "" "" "pathogenic" "" "0001047728" "0" "30" "7" "117232394" "117232394" "subst" "0.000105665" "03779" "CFTR_001642" "g.117232394G>A" "" "" "" "" "" "Unknown" "" "rs199791061" "0" "" "" "" "" "likely benign" "" "0001047729" "0" "50" "7" "117232047" "117232047" "subst" "0" "03779" "CFTR_001715" "g.117232047A>T" "" "" "" "" "" "Unknown" "" "rs397508310" "0" "" "" "" "" "VUS" "" "0001047730" "0" "50" "7" "117232118" "117232118" "subst" "0" "03779" "CFTR_001716" "g.117232118C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0001047731" "0" "50" "7" "117232599" "117232599" "subst" "0" "03779" "CFTR_001717" "g.117232599A>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0001047732" "0" "10" "7" "117232638" "117232638" "subst" "1.13909E-5" "03779" "CFTR_001647" "g.117232638A>G" "" "" "" "" "" "Unknown" "" "rs397508375" "0" "" "" "" "" "benign" "" "0001047733" "0" "50" "7" "117232638" "117232638" "subst" "1.13909E-5" "03779" "CFTR_001647" "g.117232638A>G" "" "" "" "" "" "Unknown" "" "rs397508375" "0" "" "" "" "" "VUS" "" "0001047734" "0" "50" "7" "117232638" "117232638" "subst" "1.13909E-5" "03779" "CFTR_001647" "g.117232638A>G" "" "" "" "" "" "Unknown" "" "rs397508375" "0" "" "" "" "" "VUS" "" "0001047735" "0" "50" "7" "117243612" "117243612" "subst" "0.000337349" "03779" "CFTR_001722" "g.117243612G>A" "" "" "" "" "" "Unknown" "" "rs201864483" "0" "" "" "" "" "VUS" "" "0001047736" "0" "50" "7" "117243698" "117243698" "subst" "6.49931E-5" "03779" "CFTR_001437" "g.117243698G>A" "" "" "" "" "" "Unknown" "" "rs201759207" "0" "" "" "" "" "VUS" "" "0001047737" "0" "50" "7" "117170957" "117170957" "subst" "0" "03779" "CFTR_001673" "g.117170957T>G" "" "" "" "" "" "Unknown" "" "rs2485008826" "0" "" "" "" "" "VUS" "" "0001047738" "0" "50" "7" "117243783" "117243783" "subst" "0.000272209" "03779" "CFTR_001501" "g.117243783T>C" "" "" "" "" "" "Unknown" "" "rs142773283" "0" "" "" "" "" "VUS" "" "0001047739" "0" "50" "7" "117170981" "117170981" "subst" "0" "03779" "CFTR_001674" "g.117170981T>C" "" "" "" "" "" "Unknown" "" "rs397508484" "0" "" "" "" "" "VUS" "" "0001047740" "0" "50" "7" "117250622" "117250622" "subst" "2.84645E-5" "03779" "CFTR_001473" "g.117250622C>A" "" "" "" "" "" "Unknown" "" "rs193922516" "0" "" "" "" "" "VUS" "" "0001047741" "0" "30" "7" "117234995" "117234995" "subst" "0.000292531" "03779" "CFTR_001435" "g.117234995T>G" "" "" "" "" "" "Unknown" "" "rs200735475" "0" "" "" "" "" "likely benign" "" "0001047742" "0" "70" "7" "117232649" "117232649" "subst" "3.39382E-5" "03779" "CFTR_001415" "g.117232649A>G" "" "" "" "" "" "Unknown" "" "rs377447726" "0" "" "" "" "" "likely pathogenic" "" "0001047744" "0" "70" "7" "117232649" "117232649" "subst" "3.39382E-5" "03779" "CFTR_001415" "g.117232649A>G" "" "" "" "" "" "Unknown" "" "rs377447726" "0" "" "" "" "" "likely pathogenic" "" "0001047745" "0" "50" "7" "117199564" "117199564" "subst" "0" "03779" "CFTR_001694" "g.117199564G>A" "" "" "" "" "" "Unknown" "" "rs397508208" "0" "" "" "" "" "VUS" "" "0001047746" "0" "50" "7" "117199591" "117199591" "subst" "0" "03779" "CFTR_001339" "g.117199591C>T" "" "" "" "" "" "Unknown" "" "rs397508211" "0" "" "" "" "" "VUS" "" "0001047747" "0" "70" "7" "117199619" "117199619" "subst" "0" "03779" "CFTR_001695" "g.117199619G>C" "" "" "" "" "" "Unknown" "" "rs397508218" "0" "" "" "" "" "likely pathogenic" "" "0001047748" "0" "70" "7" "117199619" "117199619" "subst" "0" "03779" "CFTR_001695" "g.117199619G>C" "" "" "" "" "" "Unknown" "" "rs397508218" "0" "" "" "" "" "likely pathogenic" "" "0001047749" "0" "70" "7" "117199619" "117199619" "subst" "0" "03779" "CFTR_001695" "g.117199619G>C" "" "" "" "" "" "Unknown" "" "rs397508218" "0" "" "" "" "" "likely pathogenic" "" "0001047750" "0" "70" "7" "117199620" "117199620" "subst" "4.06392E-6" "03779" "CFTR_001696" "g.117199620C>T" "" "" "" "" "" "Unknown" "" "rs397508219" "0" "" "" "" "" "likely pathogenic" "" "0001047751" "0" "50" "7" "117199624" "117199624" "subst" "0" "03779" "CFTR_001697" "g.117199624G>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0001047752" "0" "70" "7" "117199687" "117199687" "subst" "0" "03779" "CFTR_001699" "g.117199687T>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0001047753" "0" "50" "7" "117199708" "117199708" "subst" "0" "03779" "CFTR_001700" "g.117199708A>C" "" "" "" "" "" "Unknown" "" "rs1562898548" "0" "" "" "" "" "VUS" "" "0001047754" "0" "70" "7" "117227839" "117227839" "subst" "0" "03779" "CFTR_001703" "g.117227839G>T" "" "" "" "" "" "Unknown" "" "rs397508241" "0" "" "" "" "" "likely pathogenic" "" "0001047755" "0" "70" "7" "117230447" "117230447" "subst" "0" "03779" "CFTR_001709" "g.117230447C>T" "" "" "" "" "" "Unknown" "" "rs397508283" "0" "" "" "" "" "likely pathogenic" "" "0001047756" "0" "50" "7" "117230448" "117230448" "subst" "0" "03779" "CFTR_001710" "g.117230448C>G" "" "" "" "" "" "Unknown" "" "rs121908758" "0" "" "" "" "" "VUS" "" "0001047757" "0" "70" "7" "117175331" "117175331" "subst" "0" "03779" "CFTR_001682" "g.117175331C>G" "" "" "" "" "" "Unknown" "" "rs1800081" "0" "" "" "" "" "likely pathogenic" "" "0001047758" "0" "50" "7" "117175323" "117175323" "subst" "0.000223403" "03779" "CFTR_001191" "g.117175323G>A" "" "" "" "" "" "Unknown" "" "rs138338446" "0" "" "" "" "" "conflicting" "" "0001047759" "0" "70" "7" "117174415" "117174415" "subst" "0" "03779" "CFTR_001681" "g.117174415A>T" "" "" "" "" "" "Unknown" "" "rs397508758" "0" "" "" "" "" "likely pathogenic" "" "0001047760" "0" "50" "7" "117171130" "117171130" "subst" "6.52827E-5" "03779" "CFTR_001319" "g.117171130C>A" "" "" "" "" "" "Unknown" "" "rs397508720" "0" "" "" "" "" "VUS" "" "0001047761" "0" "70" "7" "117171151" "117171151" "subst" "0" "03779" "CFTR_001676" "g.117171151A>G" "" "" "" "" "" "Unknown" "" "rs397508724" "0" "" "" "" "" "likely pathogenic" "" "0001047762" "0" "50" "7" "117304869" "117304869" "subst" "3.65863E-5" "03779" "CFTR_001618" "g.117304869C>T" "" "" "" "" "" "Unknown" "" "rs397508670" "0" "" "" "" "" "VUS" "" "0001047763" "0" "50" "7" "117305578" "117305578" "subst" "0" "03779" "CFTR_001731" "g.117305578A>G" "" "" "" "" "" "Unknown" "" "rs397508697" "0" "" "" "" "" "VUS" "" "0001047764" "0" "70" "7" "117305601" "117305601" "subst" "4.07299E-6" "03779" "CFTR_001732" "g.117305601G>A" "" "" "" "" "" "Unknown" "" "rs397508699" "0" "" "" "" "" "likely pathogenic" "" "0001047765" "0" "70" "7" "117171101" "117171101" "subst" "0" "03779" "CFTR_001675" "g.117171101C>A" "" "" "" "" "" "Unknown" "" "rs397508700" "0" "" "" "" "" "likely pathogenic" "" "0001047766" "0" "70" "7" "117307016" "117307016" "subst" "2.44294E-5" "03779" "CFTR_001617" "g.117307016G>A" "" "" "" "" "" "Unknown" "" "rs750559671" "0" "" "" "" "" "likely pathogenic" "" "0001047767" "0" "50" "7" "117307052" "117307052" "subst" "0.000333797" "03779" "CFTR_001504" "g.117307052G>A" "" "" "" "" "" "Unknown" "" "rs148783445" "0" "" "" "" "" "VUS" "" "0001047768" "0" "70" "7" "117174340" "117174340" "subst" "0" "03779" "CFTR_001678" "g.117174340T>G" "" "" "" "" "" "Unknown" "" "rs397508741" "0" "" "" "" "" "likely pathogenic" "" "0001047769" "0" "50" "7" "117174348" "117174348" "subst" "5.70837E-5" "03779" "CFTR_001643" "g.117174348C>T" "" "" "" "" "" "Unknown" "" "rs578029902" "0" "" "" "" "" "VUS" "" "0001047770" "0" "50" "7" "117174367" "117174367" "subst" "0" "03779" "CFTR_001679" "g.117174367G>T" "" "" "" "" "" "Unknown" "" "rs762849766" "0" "" "" "" "" "VUS" "" "0001047771" "0" "30" "7" "117143718" "117143718" "subst" "0" "03779" "CFTR_001668" "g.117143718A>G" "" "" "" "" "" "Unknown" "" "rs34654194" "0" "" "" "" "" "likely benign" "" "0001047772" "0" "50" "7" "117144294" "117144294" "subst" "0" "03779" "CFTR_001669" "g.117144294C>G" "" "" "" "" "" "Unknown" "" "rs397508749" "0" "" "" "" "" "VUS" "" "0001047773" "0" "70" "7" "117175453" "117175453" "subst" "0" "03779" "CFTR_001683" "g.117175453T>A" "" "" "" "" "" "Unknown" "" "rs397508790" "0" "" "" "" "" "likely pathogenic" "" "0001047775" "0" "50" "7" "117267559" "117267559" "subst" "0.000592587" "03779" "CFTR_001439" "g.117267559T>C" "" "" "" "" "" "Unknown" "" "rs199630678" "0" "" "" "" "" "VUS" "" "0001047788" "0" "70" "7" "117232019" "117232019" "subst" "0" "03779" "CFTR_001755" "g.117232019A>G" "" "" "" "" "" "Unknown" "" "rs397508305" "0" "" "" "" "" "likely pathogenic" "" "0001047790" "0" "50" "7" "117149138" "117149138" "subst" "0" "03779" "CFTR_001737" "g.117149138C>A" "" "" "" "" "" "Unknown" "" "rs397508347" "0" "" "" "" "" "VUS" "" "0001047791" "0" "70" "7" "117149147" "117149147" "subst" "8.13935E-6" "03779" "CFTR_001738" "g.117149147G>T" "" "" "" "" "" "Unknown" "" "rs1800076" "0" "" "" "" "" "likely pathogenic" "" "0001047792" "0" "70" "7" "117149151" "117149151" "subst" "4.06881E-6" "03779" "CFTR_001665" "g.117149151T>G" "" "" "" "" "" "Unknown" "" "rs777536750" "0" "" "" "" "" "likely pathogenic" "" "0001047793" "0" "70" "7" "117235045" "117235045" "subst" "0" "03779" "CFTR_001757" "g.117235045G>T" "" "" "" "" "" "Unknown" "" "rs397508395" "0" "" "" "" "" "likely pathogenic" "" "0001047794" "0" "70" "7" "117243686" "117243686" "subst" "0.000142177" "03779" "CFTR_001472" "g.117243686G>A" "" "" "" "" "" "Unknown" "" "rs373885282" "0" "" "" "" "" "likely pathogenic" "" "0001047795" "0" "70" "7" "117243774" "117243774" "subst" "8.12519E-6" "03779" "CFTR_001761" "g.117243774A>T" "" "" "" "" "" "Unknown" "" "rs397508444" "0" "" "" "" "" "likely pathogenic" "" "0001047796" "0" "70" "7" "117246772" "117246772" "subst" "0" "03779" "CFTR_001764" "g.117246772G>C" "" "" "" "" "" "Unknown" "" "rs397508465" "0" "" "" "" "" "likely pathogenic" "" "0001047797" "0" "70" "7" "117246772" "117246772" "subst" "0" "03779" "CFTR_001765" "g.117246772G>T" "" "" "" "" "" "Unknown" "" "rs397508465" "0" "" "" "" "" "likely pathogenic" "" "0001047798" "0" "70" "7" "117250598" "117250598" "subst" "0" "03779" "CFTR_001767" "g.117250598T>G" "" "" "" "" "" "Unknown" "" "rs397508479" "0" "" "" "" "" "likely pathogenic" "" "0001047800" "0" "70" "7" "117250643" "117250643" "subst" "0" "03779" "CFTR_001768" "g.117250643T>A" "" "" "" "" "" "Unknown" "" "rs397508489" "0" "" "" "" "" "likely pathogenic" "" "0001047802" "0" "70" "7" "117170984" "117170984" "subst" "0" "03779" "CFTR_001741" "g.117170984T>C" "" "" "" "" "" "Unknown" "" "rs397508490" "0" "" "" "" "" "likely pathogenic" "" "0001047803" "0" "70" "7" "117250715" "117250715" "subst" "0" "03779" "CFTR_001769" "g.117250715A>G" "" "" "" "" "" "Unknown" "" "rs397508501" "0" "" "" "" "" "likely pathogenic" "" "0001047804" "0" "70" "7" "117170993" "117170993" "subst" "0" "03779" "CFTR_001742" "g.117170993T>A" "" "" "" "" "" "Unknown" "" "rs397508509" "0" "" "" "" "" "likely pathogenic" "" "0001047805" "0" "70" "7" "117251665" "117251665" "subst" "0" "03779" "CFTR_001595" "g.117251665C>G" "" "" "" "" "" "Unknown" "" "rs2485130244" "0" "" "" "" "" "likely pathogenic" "" "0001047806" "0" "50" "7" "117251694" "117251694" "subst" "4.07053E-6" "03779" "CFTR_001770" "g.117251694G>A" "" "" "" "" "" "Unknown" "" "rs121909020" "0" "" "" "" "" "VUS" "" "0001047807" "0" "70" "7" "117251695" "117251695" "subst" "1.22089E-5" "03779" "CFTR_001771" "g.117251695C>T" "" "" "" "" "" "Unknown" "" "rs1800114" "0" "" "" "" "" "likely pathogenic" "" "0001047809" "0" "70" "7" "117254665" "117254665" "dup" "0" "03779" "CFTR_001774" "g.117254665dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0001047810" "0" "70" "7" "117254679" "117254679" "subst" "0" "03779" "CFTR_001775" "g.117254679G>A" "" "" "" "" "" "Unknown" "" "rs1434504483" "0" "" "" "" "" "likely pathogenic" "" "0001047811" "0" "50" "7" "117267559" "117267559" "subst" "0.000592587" "03779" "CFTR_001439" "g.117267559T>C" "" "" "" "" "" "Unknown" "" "rs199630678" "0" "" "" "" "" "VUS" "" "0001047812" "0" "70" "7" "117171029" "117171029" "subst" "0" "03779" "CFTR_001525" "g.117171029G>C" "" "" "" "" "" "Unknown" "" "rs78655421" "0" "" "" "" "" "likely pathogenic" "" "0001047813" "0" "70" "7" "117171037" "117171037" "subst" "0.000122116" "03779" "CFTR_001462" "g.117171037G>A" "" "" "" "" "" "Unknown" "" "rs201958172" "0" "" "" "" "" "likely pathogenic" "" "0001047814" "0" "70" "7" "117120185" "117120185" "subst" "0" "03779" "CFTR_001734" "g.117120185T>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0001047815" "0" "30" "7" "117282628" "117282628" "subst" "0.00066791" "03779" "CFTR_001387" "g.117282628C>T" "" "" "" "" "" "Unknown" "" "rs397508617" "0" "" "" "" "" "likely benign" "" "0001047816" "0" "70" "7" "117292918" "117292918" "subst" "0" "03779" "CFTR_001780" "g.117292918C>T" "" "" "" "" "" "Unknown" "" "rs397508634" "0" "" "" "" "" "likely pathogenic" "" "0001047817" "0" "70" "7" "117292929" "117292929" "subst" "0" "03779" "CFTR_001781" "g.117292929A>C" "" "" "" "" "" "Unknown" "" "rs121909042" "0" "" "" "" "" "likely pathogenic" "" "0001047818" "0" "70" "7" "117292937" "117292937" "subst" "0" "03779" "CFTR_001782" "g.117292937T>A" "" "" "" "" "" "Unknown" "" "rs397508640" "0" "" "" "" "" "likely pathogenic" "" "0001047819" "0" "70" "7" "117304749" "117304749" "subst" "0" "03779" "CFTR_001579" "g.117304749T>C" "" "" "" "" "" "Unknown" "" "rs397508653" "0" "" "" "" "" "likely pathogenic" "" "0001047820" "0" "50" "7" "117304793" "117304793" "subst" "0" "03779" "CFTR_001783" "g.117304793C>T" "" "" "" "" "" "Unknown" "" "rs397508660" "0" "" "" "" "" "VUS" "" "0001047822" "0" "70" "7" "117176588" "117176599" "del" "0" "03779" "CFTR_001749" "g.117176588_117176599del" "" "" "" "" "" "Unknown" "" "rs387906367" "0" "" "" "" "" "likely pathogenic" "" "0001047823" "0" "70" "7" "117176732" "117176732" "subst" "0" "03779" "CFTR_001751" "g.117176732G>T" "" "" "" "" "" "Unknown" "" "rs533959068" "0" "" "" "" "" "likely pathogenic" "" "0001047824" "0" "70" "7" "117176732" "117176732" "subst" "0" "03779" "CFTR_001751" "g.117176732G>T" "" "" "" "" "" "Unknown" "" "rs533959068" "0" "" "" "" "" "likely pathogenic" "" "0001047825" "0" "30" "7" "117176815" "117176815" "subst" "0" "03779" "CFTR_001752" "g.117176815T>A" "" "" "" "" "" "Unknown" "" "rs79718042" "0" "" "" "" "" "likely benign" "" "0001047826" "0" "50" "7" "117175339" "117175339" "subst" "0" "03779" "CFTR_001746" "g.117175339T>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0001047827" "0" "50" "7" "117175396" "117175396" "subst" "0" "03779" "CFTR_001747" "g.117175396G>A" "" "" "" "" "" "Unknown" "" "rs866473559" "0" "" "" "" "" "VUS" "" "0001047828" "0" "50" "7" "117175423" "117175423" "subst" "0" "03779" "CFTR_001748" "g.117175423C>A" "" "" "" "" "" "Unknown" "" "rs769016520" "0" "" "" "" "" "VUS" "" "0001047829" "0" "50" "7" "117176592" "117176599" "del" "0" "03779" "CFTR_001750" "g.117176592_117176599del" "" "" "" "" "" "Unknown" "" "rs397508793" "0" "" "" "" "" "VUS" "" "0001047830" "0" "50" "7" "117144332" "117144332" "subst" "0" "03779" "CFTR_001735" "g.117144332G>C" "" "" "" "" "" "Unknown" "" "rs397508796" "0" "" "" "" "" "VUS" "" "0001047832" "0" "50" "7" "117144333" "117144333" "subst" "0" "03779" "CFTR_001736" "g.117144333G>A" "" "" "" "" "" "Unknown" "" "rs397508797" "0" "" "" "" "" "VUS" "" "0001047833" "0" "50" "7" "117180183" "117180183" "subst" "0" "03779" "CFTR_001753" "g.117180183C>A" "" "" "" "" "" "Unknown" "" "rs142134579" "0" "" "" "" "" "VUS" "" "0001047834" "0" "50" "7" "117180210" "117180210" "subst" "4.88138E-5" "03779" "CFTR_001754" "g.117180210C>G" "" "" "" "" "" "Unknown" "" "rs397508818" "0" "" "" "" "" "VUS" "" "0001047835" "0" "50" "7" "117232431" "117232431" "subst" "1.21924E-5" "03779" "CFTR_001756" "g.117232431C>T" "" "" "" "" "" "Unknown" "" "rs186089140" "0" "" "" "" "" "VUS" "" "0001047836" "0" "50" "7" "117235089" "117235089" "subst" "0" "03779" "CFTR_001758" "g.117235089T>C" "" "" "" "" "" "Unknown" "" "rs397508402" "0" "" "" "" "" "VUS" "" "0001047837" "0" "50" "7" "117149200" "117149200" "subst" "2.03897E-5" "03779" "CFTR_001739" "g.117149200A>G" "" "" "" "" "" "Unknown" "" "rs387906374" "0" "" "" "" "" "VUS" "" "0001047838" "0" "50" "7" "117243682" "117243682" "subst" "0" "03779" "CFTR_001759" "g.117243682T>G" "" "" "" "" "" "Unknown" "" "rs397508429" "0" "" "" "" "" "VUS" "" "0001047839" "0" "50" "7" "117243698" "117243698" "subst" "0" "03779" "CFTR_001760" "g.117243698G>C" "" "" "" "" "" "Unknown" "" "rs201759207" "0" "" "" "" "" "VUS" "" "0001047841" "0" "50" "7" "117170966" "117170966" "subst" "0" "03779" "CFTR_001740" "g.117170966C>A" "" "" "" "" "" "Unknown" "" "rs397508449" "0" "" "" "" "" "VUS" "" "0001047842" "0" "50" "7" "117246755" "117246755" "subst" "3.25264E-5" "03779" "CFTR_001762" "g.117246755A>C" "" "" "" "" "" "Unknown" "" "rs397508462" "0" "" "" "" "" "VUS" "" "0001047843" "0" "50" "7" "117246759" "117246759" "subst" "0" "03779" "CFTR_001763" "g.117246759A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0001047844" "0" "50" "7" "117246776" "117246776" "subst" "0.000105704" "03779" "CFTR_001766" "g.117246776T>C" "" "" "" "" "" "Unknown" "" "rs565971160" "0" "" "" "" "" "VUS" "" "0001047845" "0" "50" "7" "117246800" "117246800" "subst" "4.06676E-6" "03779" "CFTR_001369" "g.117246800T>G" "" "" "" "" "" "Unknown" "" "rs397508469" "0" "" "" "" "" "VUS" "" "0001047846" "0" "50" "7" "117251717" "117251717" "subst" "4.06788E-6" "03779" "CFTR_001270" "g.117251717T>A" "" "" "" "" "" "Unknown" "" "rs186045772" "0" "" "" "" "" "VUS" "" "0001047848" "0" "50" "7" "117251736" "117251736" "subst" "0" "03779" "CFTR_001772" "g.117251736G>C" "" "" "" "" "" "Unknown" "" "rs397508521" "0" "" "" "" "" "VUS" "" "0001047849" "0" "50" "7" "117251752" "117251752" "subst" "0" "03779" "CFTR_001773" "g.117251752C>T" "" "" "" "" "" "Unknown" "" "rs77958296" "0" "" "" "" "" "VUS" "" "0001047850" "0" "50" "7" "117254760" "117254760" "subst" "0" "03779" "CFTR_001776" "g.117254760A>T" "" "" "" "" "" "Unknown" "" "rs397508569" "0" "" "" "" "" "VUS" "" "0001047852" "0" "50" "7" "117254772" "117254772" "subst" "0" "03779" "CFTR_001278" "g.117254772G>A" "" "" "" "" "" "Unknown" "" "rs1554392801" "0" "" "" "" "" "VUS" "" "0001047853" "0" "50" "7" "117267610" "117267610" "subst" "4.07362E-6" "03779" "CFTR_001659" "g.117267610A>G" "" "" "" "" "" "Unknown" "" "rs150326506" "0" "" "" "" "" "VUS" "" "0001047854" "0" "50" "7" "117171044" "117171044" "subst" "4.07077E-6" "03779" "CFTR_001743" "g.117171044A>G" "" "" "" "" "" "Unknown" "" "rs377295859" "0" "" "" "" "" "VUS" "" "0001047855" "0" "50" "7" "117282528" "117282528" "subst" "0" "03779" "CFTR_001777" "g.117282528A>C" "" "" "" "" "" "Unknown" "" "rs397508603" "0" "" "" "" "" "VUS" "" "0001047856" "0" "50" "7" "117282620" "117282620" "subst" "0" "03779" "CFTR_001778" "g.117282620G>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0001047857" "0" "50" "7" "117292882" "117292882" "subst" "1.25886E-5" "03779" "CFTR_001779" "g.117292882C>G" "" "" "" "" "" "Unknown" "" "rs184271150" "0" "" "" "" "" "VUS" "" "0001047858" "0" "50" "7" "117292957" "117292957" "subst" "4.0778E-6" "03779" "CFTR_001486" "g.117292957A>G" "" "" "" "" "" "Unknown" "" "rs397508646" "0" "" "" "" "" "VUS" "" "0001047859" "0" "50" "7" "117304839" "117304839" "subst" "3.25219E-5" "03779" "CFTR_001784" "g.117304839T>C" "" "" "" "" "" "Unknown" "" "rs755993775" "0" "" "" "" "" "VUS" "" "0001047860" "0" "50" "7" "117304842" "117304842" "subst" "4.0653E-6" "03779" "CFTR_001785" "g.117304842G>T" "" "" "" "" "" "Unknown" "" "rs755028771" "0" "" "" "" "" "VUS" "" "0001047861" "0" "50" "7" "117306996" "117306996" "subst" "4.07269E-5" "03779" "CFTR_001786" "g.117306996C>T" "" "" "" "" "" "Unknown" "" "rs762847468" "0" "" "" "" "" "VUS" "" "0001047862" "0" "50" "7" "117171151" "117171151" "subst" "0" "03779" "CFTR_001744" "g.117171151A>C" "" "" "" "" "" "Unknown" "" "rs397508724" "0" "" "" "" "" "VUS" "" "0001047863" "0" "50" "7" "117174165" "117174165" "subst" "0" "03779" "CFTR_001745" "g.117174165T>C" "" "" "" "" "" "Unknown" "" "rs540073619" "0" "" "" "" "" "VUS" "" "0001052806" "0" "50" "7" "117120179" "117120179" "subst" "0.000154576" "01804" "CFTR_001610" "g.117120179G>A" "" "" "" "CFTR(NM_000492.3):c.31G>A (p.V11I), CFTR(NM_000492.4):c.31G>A (p.(Val11Ile), p.V11I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052807" "0" "90" "7" "117120197" "117120198" "dup" "0" "01804" "CFTR_001787" "g.117120197_117120198dup" "" "" "" "CFTR(NM_000492.4):c.49_50dup (p.(Trp19AlafsTer7))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001052808" "0" "50" "7" "117149183" "117149183" "subst" "0" "01804" "CFTR_001788" "g.117149183T>C" "" "" "" "CFTR(NM_000492.4):c.260T>C (p.(Phe87Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052810" "0" "90" "7" "117188849" "117188849" "subst" "0" "01804" "CFTR_000032" "g.117188849C>A" "" "" "" "CFTR(NM_000492.3):c.1364C>A (p.A455E), CFTR(NM_000492.4):c.1364C>A (p.(Ala455Glu), p.A455E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001052811" "0" "50" "7" "117199683" "117199683" "subst" "0.000130135" "01804" "CFTR_001482" "g.117199683G>A" "" "" "" "CFTR(NM_000492.3):c.1558G>A (p.V520I), CFTR(NM_000492.4):c.1558G>A (p.(Val520Ile), p.V520I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052812" "0" "90" "7" "117227856" "117227856" "subst" "0" "01804" "CFTR_001215" "g.117227856G>T" "" "" "" "CFTR(NM_000492.3):c.1648G>T (p.G550*), CFTR(NM_000492.4):c.1648G>T (p.(Gly550*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001052813" "0" "30" "7" "117232481" "117232481" "subst" "0.00179701" "01804" "CFTR_000160" "g.117232481G>A" "" "" "" "CFTR(NM_000492.3):c.2260G>A (p.V754M), CFTR(NM_000492.4):c.2260G>A (p.(Val754Met), p.V754M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001052814" "0" "50" "7" "117307050" "117307050" "subst" "1.22089E-5" "01804" "CFTR_001789" "g.117307050C>T" "" "" "" "CFTR(NM_000492.4):c.4331C>T (p.(Ser1444Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001058532" "0" "90" "7" "117180305" "117180306" "dup" "0" "00006" "CFTR_000036" "g.117180305_117180306dup" "" "{PMID:Retterer 2016:26633542}" "" "1021_1022dupTC" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.117540251_117540252dup" "" "pathogenic" "" "0001058533" "0" "90" "7" "117199646" "117199648" "del" "0" "00006" "CFTR_000001" "g.117199646_117199648del" "" "{PMID:Retterer 2016:26633542}" "" "1521_1523delCTT" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic" "" "0001058534" "0" "90" "7" "117199646" "117199648" "del" "0" "00006" "CFTR_000001" "g.117199646_117199648del" "" "{PMID:Retterer 2016:26633542}" "" "1521_1523delCTT" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.117559592_117559594del" "" "pathogenic" "" "0001060229" "0" "50" "7" "117250922" "117250922" "subst" "0" "03779" "CFTR_001790" "g.117250922A>T" "" "" "" "" "" "Unknown" "" "rs115992437" "0" "" "" "" "" "VUS" "" "0001060230" "0" "50" "7" "117250922" "117250922" "subst" "0" "03779" "CFTR_001790" "g.117250922A>T" "" "" "" "" "" "Unknown" "" "rs115992437" "0" "" "" "" "" "VUS" "" "0001060847" "0" "90" "7" "117232562" "117232562" "subst" "0" "00006" "CFTR_001791" "g.117232562C>T" "" "{PMID:Horbacz 2025:41210864}" "" "" "ACMG PVS1, PM2, PS4, PP5; not in 142 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.117592508C>T" "" "pathogenic" "ACMG" "0001064799" "0" "50" "7" "117149143" "117149143" "subst" "0.00142434" "02325" "CFTR_000087" "g.117149143C>T" "" "" "" "CFTR(NM_000492.3):c.220C>T (p.R74W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001064800" "0" "30" "7" "117180145" "117180145" "subst" "0" "02325" "CFTR_001792" "g.117180145T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001064801" "0" "30" "7" "117180238" "117180238" "subst" "3.25148E-5" "02325" "CFTR_001793" "g.117180238G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001064802" "0" "70" "7" "117180285" "117180285" "subst" "0.000117891" "02325" "CFTR_001014" "g.117180285G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001064803" "0" "90" "7" "117182156" "117182156" "subst" "4.07305E-6" "02325" "CFTR_001120" "g.117182156G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001064804" "0" "70" "7" "117227875" "117227875" "subst" "0" "02325" "CFTR_001794" "g.117227875T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001064805" "0" "90" "7" "117232086" "117232086" "subst" "8.82168E-5" "01804" "CFTR_001409" "g.117232086G>A" "" "" "" "CFTR(NM_000492.4):c.1865G>A (p.(Gly622Asp), p.G622D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001064806" "0" "50" "7" "117232118" "117232118" "subst" "8.23554E-6" "02325" "CFTR_001795" "g.117232118C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001064807" "0" "90" "7" "117232132" "117232132" "del" "0" "02325" "CFTR_001796" "g.117232132del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001064808" "0" "50" "7" "117234999" "117234999" "subst" "0.000451011" "01804" "CFTR_001241" "g.117234999G>T" "" "" "" "CFTR(NM_000492.3):c.2506G>T (p.D836Y), CFTR(NM_000492.4):c.2506G>T (p.(Asp836Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001064809" "0" "30" "7" "117246826" "117246826" "subst" "4.07359E-6" "02325" "CFTR_001797" "g.117246826C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001064810" "0" "30" "7" "117250608" "117250608" "subst" "3.25298E-5" "02325" "CFTR_001798" "g.117250608C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001064811" "0" "50" "7" "117250609" "117250609" "subst" "9.35187E-5" "01804" "CFTR_001657" "g.117250609G>A" "" "" "" "CFTR(NM_000492.4):c.3025G>A (p.(Ala1009Thr), p.A1009T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes CFTR ## Count = 2066 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000001222" "00000116" "50" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "11" "0000001223" "00000116" "50" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "11" "0000001224" "00000116" "50" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "11" "0000001225" "00000116" "50" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "11" "0000001226" "00000116" "50" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "11" "0000001227" "00000116" "50" "1519" "0" "1521" "0" "c.1519_1521del" "r.(?)" "p.(Ile507del)" "11" "0000001228" "00000116" "50" "2051" "0" "2052" "0" "c.2051_2052del" "r.(?)" "p.(Lys684Thrfs*4)" "14" "0000001229" "00000116" "50" "3773" "0" "3773" "0" "c.3773dup" "r.(?)" "p.(Leu1258Phefs*7)" "23" "0000001230" "00000116" "50" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "4" "0000001231" "00000116" "50" "1624" "0" "1624" "0" "c.1624G>T" "r.(?)" "p.(Gly542*)" "12" "0000001232" "00000116" "50" "1000" "0" "1000" "0" "c.1000C>T" "r.(?)" "p.(Arg334Trp)" "8" "0000001237" "00000116" "50" "3208" "0" "3208" "0" "c.3208C>T" "r.(?)" "p.(Arg1070Trp)" "20" "0000001238" "00000116" "50" "1001" "0" "1001" "0" "c.1001G>A" "r.(?)" "p.(Arg334Gln)" "8" "0000001239" "00000116" "50" "1054" "0" "1054" "0" "c.1054C>T" "r.(?)" "p.(Arg352Trp)" "8" "0000001240" "00000116" "50" "54" "-5940" "273" "10250" "c.54-5940_273+10250del" "r.del?" "p.(Ser18Argfs*16)" "1i_3i" "0000001241" "00000116" "50" "1666" "0" "1666" "0" "c.1666A>G" "r.(?)" "p.(Ile556Val)" "12" "0000001242" "00000116" "50" "1666" "0" "1666" "0" "c.1666A>G" "r.(?)" "p.(Ile556Val)" "12" "0000001243" "00000116" "50" "1666" "0" "1666" "0" "c.1666A>G" "r.(?)" "p.(Ile556Val)" "12" "0000001244" "00000116" "50" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Arg668Cys)" "14" "0000001245" "00000116" "50" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Arg668Cys)" "14" "0000001246" "00000116" "50" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Arg668Cys)" "14" "0000018069" "00000116" "99" "1116" "1" "1116" "1" "c.1116+1G>A" "r.spl" "p.?" "8i" "0000018272" "00000116" "99" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "11" "0000018273" "00000116" "99" "1624" "0" "1624" "0" "c.1624G>T" "r.(?)" "p.(Gly542*)" "12" "0000018274" "00000116" "99" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "12" "0000018275" "00000116" "99" "3909" "0" "3909" "0" "c.3909C>G" "r.(?)" "p.(Asn1303Lys)" "24" "0000018276" "00000116" "99" "3846" "0" "3846" "0" "c.3846G>A" "r.(?)" "p.(Trp1282*)" "23" "0000018277" "00000116" "99" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "4" "0000018278" "00000116" "99" "1657" "0" "1657" "0" "c.1657C>T" "r.(?)" "p.(Arg553*)" "12" "0000018279" "00000116" "99" "1585" "-1" "1585" "-1" "c.1585-1G>A" "r.spl" "p.?" "11i" "0000018280" "00000116" "99" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "4i" "0000018281" "00000116" "99" "2657" "5" "2657" "5" "c.2657+5G>A" "r.spl?" "p.?" "16i" "0000018283" "00000116" "99" "3484" "0" "3484" "0" "c.3484C>T" "r.(?)" "p.(Arg1162*)" "22" "0000018284" "00000116" "99" "2051" "0" "2052" "0" "c.2051_2052delinsG" "r.(?)" "p.(Lys684Serfs*38)" "14" "0000018285" "00000116" "99" "54" "-5940" "273" "10250" "c.54-5940_273+10250del" "r.(?)" "p.(Ser18Argfs*16)" "1i_3i" "0000018286" "00000116" "99" "254" "0" "254" "0" "c.254G>A" "r.(?)" "p.(Gly85Glu)" "3" "0000018287" "00000116" "99" "2988" "1" "2988" "1" "c.2988+1G>A" "r.spl" "p.?" "18i" "0000018288" "00000116" "99" "1519" "0" "1521" "0" "c.1519_1521del" "r.(?)" "p.(Ile507del)" "11" "0000018289" "00000116" "99" "1766" "1" "1766" "1" "c.1766+1G>A" "r.spl" "p.?" "13i" "0000018290" "00000116" "99" "3528" "0" "3528" "0" "c.3528del" "r.(?)" "p.(Lys1177Serfs*15)" "22" "0000018291" "00000116" "99" "1040" "0" "1040" "0" "c.1040G>C" "r.(?)" "p.(Arg347Pro)" "8" "0000018292" "00000116" "99" "3454" "0" "3454" "0" "c.3454G>C" "r.(?)" "p.(Asp1152His)" "21" "0000018293" "00000116" "99" "1679" "0" "1679" "0" "c.1679G>C" "r.spl?" "p.(Arg560Thr)" "12" "0000018294" "00000116" "99" "3140" "-26" "3140" "-26" "c.3140-26A>G" "r.spl?" "p.(=)" "19i" "0000018295" "00000116" "99" "1477" "0" "1477" "0" "c.1477C>T" "r.(?)" "p.(Gln493*)" "11" "0000018296" "00000116" "99" "178" "0" "178" "0" "c.178G>T" "r.(?)" "p.(Glu60*)" "3" "0000018297" "00000116" "99" "1000" "0" "1000" "0" "c.1000C>T" "r.(?)" "p.(Arg334Trp)" "8" "0000018298" "00000116" "99" "262" "0" "263" "0" "c.262_263del" "r.(?)" "p.(Leu88Ilefs*22 )" "3" "0000018299" "00000116" "99" "2052" "0" "2052" "0" "c.2052dup" "r.(?)" "p.(Gln685Thrfs*4)" "14" "0000018300" "00000116" "77" "1210" "-7" "1210" "-6" "c.1210-7_1210-6del" "r.spl?" "p.(?)" "9i" "0000018301" "00000116" "99" "3773" "0" "3773" "0" "c.3773dup" "r.(?)" "p.(Leu1258Phefs*7)" "23" "0000018302" "00000116" "99" "3276" "0" "3276" "0" "c.3276C>A" "r.(?)" "p.(Tyr1092*)" "20" "0000018303" "00000116" "99" "1364" "0" "1364" "0" "c.1364C>A" "r.(?)" "p.(Ala455Glu)" "10" "0000018304" "00000116" "99" "2052" "0" "2052" "0" "c.2052del" "r.(?)" "p.(Lys684Asnfs*38)" "14" "0000018305" "00000116" "99" "3196" "0" "3196" "0" "c.3196C>T" "r.(?)" "p.(Arg1066Cys)" "20" "0000018306" "00000116" "99" "948" "0" "948" "0" "c.948del" "r.(?)" "p.(Phe316Leufs*12)" "8" "0000018307" "00000116" "99" "1021" "0" "1022" "0" "c.1021_1022dup" "r.(?)" "p.(Phe342Hisfs*28)" "8" "0000018308" "00000116" "99" "3472" "0" "3472" "0" "c.3472C>T" "r.(?)" "p.(Arg1158*)" "22" "0000018310" "00000116" "99" "1040" "0" "1040" "0" "c.1040G>A" "r.(?)" "p.(Arg347His)" "8" "0000018311" "00000116" "99" "3752" "0" "3752" "0" "c.3752G>A" "r.(?)" "p.(Ser1251Asn)" "23" "0000018312" "00000116" "99" "617" "0" "617" "0" "c.617T>G" "r.(?)" "p.(Leu206Trp)" "6" "0000018313" "00000116" "99" "1646" "0" "1646" "0" "c.1646G>A" "r.(?)" "p.(Ser549Asn)" "12" "0000018314" "00000116" "99" "3302" "0" "3302" "0" "c.3302T>A" "r.(?)" "p.(Met1101Lys)" "20" "0000018315" "00000116" "99" "579" "1" "579" "1" "c.579+1G>T" "r.spl" "p.?" "5i" "0000018316" "00000116" "99" "366" "0" "366" "0" "c.366T>A" "r.(?)" "p.(Tyr122*)" "4" "0000018317" "00000116" "99" "2012" "0" "2012" "0" "c.2012del" "r.(?)" "p.(Leu671*)" "14" "0000018318" "00000116" "99" "2834" "0" "2834" "0" "c.2834C>T" "r.(?)" "p.(Ser945Leu)" "17" "0000018319" "00000116" "11" "443" "0" "443" "0" "c.443T>C" "r.(?)" "p.(Ile148Thr)" "4" "0000018320" "00000116" "99" "349" "0" "349" "0" "c.349C>T" "r.(?)" "p.(Arg117Cys)" "4" "0000018321" "00000116" "99" "1558" "0" "1558" "0" "c.1558G>T" "r.(?)" "p.(Val520Phe)" "11" "0000018322" "00000116" "11" "3705" "0" "3705" "0" "c.3705T>G" "r.(?)" "p.(Ser1235Arg)" "22" "0000018323" "00000116" "99" "1013" "0" "1013" "0" "c.1013C>T" "r.(?)" "p.(Thr338Ile)" "8" "0000018324" "00000116" "99" "200" "0" "200" "0" "c.200C>T" "r.(?)" "p.(Pro67Leu)" "14" "0000018325" "00000116" "99" "3731" "0" "3731" "0" "c.3731G>A" "r.(?)" "p.(Gly1244Glu)" "23" "0000018326" "00000116" "99" "532" "0" "532" "0" "c.532G>A" "r.(?)" "p.(Gly178Glu)" "5" "0000018327" "00000116" "99" "1545" "0" "1546" "0" "c.1545_1546del" "r.(?)" "p.(Tyr515*)" "11" "0000018328" "00000116" "99" "1055" "0" "1055" "0" "c.1055G>A" "r.(?)" "p.(Arg352Gln)" "8" "0000018329" "00000116" "99" "579" "5" "579" "5" "c.579+5G>A" "r.spl" "p.?" "5i" "0000018330" "00000116" "11" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Arg668Cys)" "14" "0000018331" "00000116" "99" "1645" "0" "1645" "0" "c.1645A>C" "r.(?)" "p.(Ser549Arg)" "12" "0000018332" "00000116" "99" "1675" "0" "1675" "0" "c.1675G>A" "r.(?)" "p.(Ala559Thr)" "12" "0000018333" "00000116" "99" "3230" "0" "3230" "0" "c.3230T>C" "r.(?)" "p.(Leu1077Pro)" "20" "0000018334" "00000116" "99" "3266" "0" "3266" "0" "c.3266G>A" "r.(?)" "p.(Trp1089*)" "20" "0000018335" "00000116" "11" "3080" "0" "3080" "0" "c.3080T>C" "r.(?)" "p.(Ile1027Thr)" "19" "0000018336" "00000116" "11" "1727" "0" "1727" "0" "c.1727G>C" "r.(?)" "p.(Gly576Ala)" "13" "0000018337" "00000116" "11" "1408" "0" "1408" "0" "c.1408A>G" "r.(?)" "p.(Met470Val)" "11" "0000018338" "00000116" "99" "2988" "0" "2988" "0" "c.2988G>A" "r.(?)" "p.(Gln996=)" "18" "0000018339" "00000116" "99" "223" "0" "223" "0" "c.223C>T" "r.(?)" "p.(Arg75*)" "3" "0000018340" "00000116" "99" "2537" "0" "2537" "0" "c.2537G>A" "r.(?)" "p.(Trp846*)" "15" "0000018341" "00000116" "99" "1753" "0" "1753" "0" "c.1753G>T" "r.(?)" "p.(Glu585*)" "13" "0000018342" "00000116" "99" "1680" "-877" "1680" "-877" "c.1680-877G>T" "r.spl?" "p.(=)" "12i" "0000018343" "00000116" "99" "3744" "0" "3744" "0" "c.3744del" "r.(?)" "p.(Lys1250Argfs*9)" "23" "0000018344" "00000116" "99" "3808" "0" "3808" "0" "c.3808G>A" "r.(?)" "p.(Asp1270Asn)" "23" "0000018345" "00000116" "99" "658" "0" "658" "0" "c.658C>T" "r.(?)" "p.(Gln220*)" "6" "0000018346" "00000116" "99" "2175" "0" "2175" "0" "c.2175dup" "r.(?)" "p.(Glu726Argfs*4)" "14" "0000018347" "00000116" "99" "328" "0" "328" "0" "c.328G>C" "r.(?)" "p.(Asp110His)" "4" "0000018348" "00000116" "99" "3889" "0" "3889" "0" "c.3889dup" "r.(?)" "p.(Ser1297PhefsTer5)" "24" "0000018349" "00000116" "99" "4251" "0" "4251" "0" "c.4251del" "r.(?)" "p.(Glu1418Argfs*14)" "26" "0000018350" "00000116" "99" "1007" "0" "1007" "0" "c.1007T>A" "r.(?)" "p.(Ile336Lys)" "8" "0000018351" "00000116" "99" "3197" "0" "3197" "0" "c.3197G>A" "r.(?)" "p.(Arg1066His)" "20" "0000018352" "00000116" "99" "2215" "0" "2215" "0" "c.2215del" "r.(?)" "p.(Val739Tyrfs*16)" "14" "0000018353" "00000116" "11" "2991" "0" "2991" "0" "c.2991G>C" "r.(?)" "p.(Leu997Phe)" "19" "0000018354" "00000116" "99" "2128" "0" "2128" "0" "c.2128A>T" "r.(?)" "p.(Lys710*)" "14" "0000018355" "00000116" "99" "2464" "0" "2464" "0" "c.2464G>T" "r.(?)" "p.(Glu822*)" "14" "0000018356" "00000116" "99" "3194" "0" "3194" "0" "c.3194T>C" "r.(?)" "p.(Leu1065Pro)" "20" "0000018357" "00000116" "99" "1654" "0" "1654" "0" "c.1654C>T" "r.(?)" "p.(Gln552*)" "12" "0000018358" "00000116" "99" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Trp)" "3" "0000018359" "00000116" "99" "2490" "1" "2490" "1" "c.2490+1G>A" "r.spl" "p.?" "14i" "0000018360" "00000116" "55" "2657" "2" "2657" "3" "c.2657+2_2657+3insA" "r.spl" "p.?" "16i" "0000018361" "00000116" "99" "274" "0" "274" "0" "c.274G>T" "r.spl?" "p.(Glu92*)" "4" "0000018362" "00000116" "99" "115" "0" "115" "0" "c.115C>T" "r.(?)" "p.(Gln39*)" "2" "0000018363" "00000116" "11" "224" "0" "224" "0" "c.224G>A" "r.(?)" "p.(Arg75Gln)" "3" "0000018364" "00000116" "99" "1736" "0" "1736" "0" "c.1736A>G" "r.(?)" "p.(Asp579Gly)" "13" "0000018365" "00000116" "99" "2491" "0" "2491" "0" "c.2491G>T" "r.spl?" "p.(Glu831*)" "15" "0000018366" "00000116" "99" "2875" "0" "2875" "0" "c.2875del" "r.(?)" "p.(Ala959Hisfs*9)" "17" "0000018367" "00000116" "99" "273" "1" "273" "1" "c.273+1G>A" "r.spl" "p.?" "3i" "0000018368" "00000116" "99" "274" "-1" "274" "-1" "c.274-1G>A" "r.spl" "p.?" "3i" "0000018369" "00000116" "99" "579" "3" "579" "3" "c.579+3A>G" "r.spl?" "p.?" "5i" "0000018370" "00000116" "99" "3937" "0" "3937" "0" "c.3937C>T" "r.(?)" "p.(Gln1313*)" "24" "0000018371" "00000116" "99" "2125" "0" "2125" "0" "c.2125C>T" "r.(?)" "p.(Arg709*)" "14" "0000018372" "00000116" "99" "2583" "0" "2583" "0" "c.2583del" "r.(?)" "p.(Phe861Leufs*3)" "15" "0000018373" "00000116" "99" "3873" "1" "3873" "1" "c.3873+1G>A" "r.spl" "p.?" "23i" "0000018374" "00000116" "99" "442" "0" "442" "0" "c.442del" "r.(?)" "p.(Ile148Leufs*5)" "4" "0000018375" "00000116" "99" "1393" "-1" "1393" "-1" "c.1393-1G>A" "r.spl" "p.?" "10i" "0000018376" "00000116" "99" "1680" "-1" "1680" "-1" "c.1680-1G>A" "r.spl" "p.?" "12i" "0000018377" "00000116" "99" "3700" "0" "3700" "0" "c.3700A>G" "r.(?)" "p.(Ile1234Val)" "22" "0000018378" "00000116" "99" "3209" "0" "3209" "0" "c.3209G>A" "r.(?)" "p.(Arg1070Gln)" "20" "0000018379" "00000116" "99" "1397" "0" "1397" "0" "c.1397C>A" "r.(?)" "p.(Ser466*)" "11" "0000018380" "00000116" "99" "1466" "0" "1466" "0" "c.1466C>A" "r.(?)" "p.(Ser489*)" "11" "0000018381" "00000116" "99" "1400" "0" "1400" "0" "c.1400T>C" "r.(?)" "p.(Leu467Pro)" "11" "0000018382" "00000116" "99" "1475" "0" "1475" "0" "c.1475C>T" "r.(?)" "p.(Ser492Phe)" "11" "0000018383" "00000116" "99" "3659" "0" "3659" "0" "c.3659del" "r.(?)" "p.(Thr1220Lysfs*8)" "22" "0000018384" "00000116" "99" "2780" "0" "2780" "0" "c.2780T>C" "r.(?)" "p.(Leu927Pro)" "17" "0000018385" "00000116" "99" "580" "-1" "580" "-1" "c.580-1G>T" "r.spl" "p.?" "5i" "0000018386" "00000116" "99" "274" "0" "274" "0" "c.274G>A" "r.spl?" "p.(Glu92Lys)" "4" "0000018389" "00000116" "99" "2668" "0" "2668" "0" "c.2668C>T" "r.(?)" "p.(Gln890*)" "17" "0000018390" "00000116" "99" "2290" "0" "2290" "0" "c.2290C>T" "r.(?)" "p.(Arg764*)" "14" "0000018391" "00000116" "99" "3587" "0" "3587" "0" "c.3587C>G" "r.(?)" "p.(Ser1196*)" "22" "0000018392" "00000116" "99" "1202" "0" "1202" "0" "c.1202G>A" "r.(?)" "p.(Trp401*)" "9" "0000018393" "00000116" "99" "2195" "0" "2195" "0" "c.2195T>G" "r.(?)" "p.(Leu732*)" "14" "0000018394" "00000116" "99" "292" "0" "292" "0" "c.292C>T" "r.(?)" "p.(Gln98*)" "4" "0000018395" "00000116" "99" "3208" "0" "3208" "0" "c.3208C>T" "r.(?)" "p.(Arg1070Trp)" "20" "0000018396" "00000116" "11" "91" "0" "91" "0" "c.91C>T" "r.(?)" "p.(Arg31Cys)" "2" "0000018397" "00000116" "99" "2551" "0" "2551" "0" "c.2551C>T" "r.(?)" "p.(Arg851*)" "15" "0000018398" "00000116" "99" "3611" "0" "3611" "0" "c.3611G>A" "r.(?)" "p.(Trp1204*)" "22" "0000018399" "00000116" "99" "531" "0" "531" "0" "c.531del" "r.(?)" "p.(Ile177Metfs*12)" "5" "0000018400" "00000116" "99" "3154" "0" "3154" "0" "c.3154T>G" "r.(?)" "p.(Phe1052Val)" "20" "0000018401" "00000116" "99" "988" "0" "988" "0" "c.988G>T" "r.(?)" "p.(Gly330*)" "8" "0000018402" "00000116" "99" "613" "0" "613" "0" "c.613C>T" "r.(?)" "p.(Pro205Ser)" "6" "0000018403" "00000116" "99" "1130" "0" "1130" "0" "c.1130dup" "r.(?)" "p.(Gln378Alafs*4)" "9" "0000018404" "00000116" "99" "2453" "0" "2453" "0" "c.2453del" "r.(?)" "p.(Leu818Trpfs*3)" "14" "0000018405" "00000116" "99" "723" "0" "743" "1" "c.723_743+1del" "r.(?)" "p.(Gly241Glufs*13)" "6" "0000018406" "00000116" "99" "3310" "0" "3310" "0" "c.3310G>T" "r.(?)" "p.(Glu1104*)" "20" "0000018407" "00000116" "99" "595" "0" "595" "0" "c.595C>T" "r.(?)" "p.(His199Tyr)" "6" "0000018408" "00000116" "99" "1573" "0" "1573" "0" "c.1573C>T" "r.(?)" "p.(Gln525*)" "11" "0000018409" "00000116" "99" "1327" "0" "1330" "0" "c.1327_1330dup" "r.(?)" "p.(Ile444Argfs*3)" "10" "0000018410" "00000116" "99" "1766" "3" "1766" "3" "c.1766+3A>G" "r.spl" "p.?" "13i" "0000018411" "00000116" "11" "1210" "-12" "1210" "-6" "c.1210-12_1210-6=" "r.=" "p.=" "9i" "0000018412" "00000116" "99" "3964" "-78" "4242" "577" "c.3964-78_4242+577del" "r.del" "p.0" "24i" "0000018413" "00000116" "99" "1841" "0" "1841" "0" "c.1841A>G" "r.(?)" "p.(Asp614Gly)" "14" "0000018414" "00000116" "99" "680" "0" "680" "0" "c.680T>G" "r.(?)" "p.(Leu227Arg)" "6" "0000018415" "00000116" "55" "1673" "0" "1673" "0" "c.1673T>C" "r.(?)" "p.(Leu558Ser)" "12" "0000018416" "00000116" "99" "1081" "0" "1081" "0" "c.1081del" "r.(?)" "p.(Trp361Glyfs*8)" "8" "0000018417" "00000116" "99" "1209" "1" "1209" "1" "c.1209+1G>A" "r.spl" "p.?" "9i" "0000018418" "00000116" "99" "1418" "0" "1418" "0" "c.1418del" "r.(?)" "p.(Gly473Glufs*54)" "11" "0000018419" "00000116" "99" "1585" "-8" "1585" "-8" "c.1585-8G>A" "r.spl" "p.(=)" "11i" "0000018420" "00000116" "99" "2989" "-1" "2989" "-1" "c.2989-1G>A" "r.spl" "p.?" "18i" "0000018421" "00000116" "99" "4077" "0" "4080" "0" "c.4077_4080delinsAA" "r.(?)" "p.(Val1360ThrfsTer3)" "25" "0000018422" "00000116" "99" "325" "0" "327" "0" "c.325_327delinsG" "r.(?)" "p.(Tyr109Glyfs*4 )" "4" "0000018423" "00000116" "99" "3205" "0" "3205" "0" "c.3205G>A" "r.(?)" "p.(Gly1069Arg)" "20" "0000018424" "00000116" "99" "2908" "0" "2908" "0" "c.2908G>C" "r.(?)" "p.(Gly970Arg)" "17" "0000018425" "00000116" "99" "1" "0" "1" "0" "c.1A>G" "r.(?)" "p.(Met1?)" "1" "0000018426" "00000116" "11" "3485" "0" "3485" "0" "c.3485G>T" "r.(?)" "p.(Arg1162Leu)" "22" "0000018427" "00000116" "99" "1679" "0" "1679" "0" "c.1679G>A" "r.spl?" "p.(Arg560Lys)" "12" "0000018428" "00000116" "99" "1021" "0" "1021" "0" "c.1021T>C" "r.(?)" "p.(Ser341Pro)" "8" "0000018429" "00000116" "99" "2930" "0" "2930" "0" "c.2930C>T" "r.(?)" "p.(Ser977Phe)" "18" "0000018430" "00000116" "11" "2260" "0" "2260" "0" "c.2260G>A" "r.(?)" "p.(Val754Met)" "14" "0000018431" "00000116" "99" "1705" "0" "1705" "0" "c.1705T>G" "r.(?)" "p.(Tyr569Asp)" "13" "0000018432" "00000116" "99" "3276" "0" "3276" "0" "c.3276C>G" "r.(?)" "p.(Tyr1092*)" "20" "0000018433" "00000116" "99" "1647" "0" "1647" "0" "c.1647T>G" "r.(?)" "p.(Ser549Arg)" "12" "0000018434" "00000116" "99" "2538" "0" "2538" "0" "c.2538G>A" "r.(?)" "p.(Trp846*)" "15" "0000018435" "00000116" "99" "1397" "0" "1397" "0" "c.1397C>G" "r.(?)" "p.(Ser466*)" "11" "0000018436" "00000116" "99" "1203" "0" "1203" "0" "c.1203G>A" "r.(?)" "p.(Trp401*)" "9" "0000018437" "00000116" "99" "3612" "0" "3612" "0" "c.3612G>A" "r.(?)" "p.(Trp1204*)" "22" "0000062354" "00000116" "90" "2052" "0" "2052" "0" "c.2052del" "r.(?)" "p.(Lys684Asnfs*38)" "" "0000062355" "00000116" "90" "1766" "1" "1766" "1" "c.1766+1G>A" "r.spl?" "p.(=)" "" "0000062356" "00000116" "90" "1477" "0" "1477" "0" "c.1477C>T" "r.(?)" "p.(Gln493*)" "" "0000062357" "00000116" "10" "1727" "0" "1727" "0" "c.1727G>C" "r.(?)" "p.(Gly576Ala)" "" "0000062358" "00000116" "50" "2421" "0" "2421" "0" "c.2421A>G" "r.(?)" "p.(Ile807Met)" "" "0000062359" "00000116" "50" "3468" "51" "3468" "51" "c.3468+51C>A" "r.(=)" "p.(=)" "" "0000062360" "00000116" "90" "2988" "1" "2988" "1" "c.2988+1G>A" "r.spl?" "p.(=)" "" "0000062361" "00000116" "10" "1052" "0" "1052" "0" "c.1052C>G" "r.(?)" "p.(Thr351Ser)" "" "0000062362" "00000116" "50" "2260" "0" "2260" "0" "c.2260G>A" "r.(?)" "p.(Val754Met)" "" "0000062363" "00000116" "90" "3209" "0" "3209" "0" "c.3209G>A" "r.(?)" "p.(Arg1070Gln)" "" "0000062364" "00000116" "90" "1673" "0" "1673" "0" "c.1673T>C" "r.(?)" "p.(Leu558Ser)" "" "0000062365" "00000116" "90" "3154" "0" "3154" "0" "c.3154T>G" "r.(?)" "p.(Phe1052Val)" "" "0000062366" "00000116" "90" "54" "-5940" "273" "10250" "c.54-5940_273+10250del" "r.(?)" "p.(Ser18Argfs*16)" "1i_3i" "0000062367" "00000116" "50" "2280" "0" "2280" "0" "c.2280G>A" "r.(=)" "p.(=)" "" "0000062368" "00000116" "50" "164" "12" "164" "12" "c.164+12T>C" "r.(=)" "p.(=)" "" "0000062369" "00000116" "90" "2353" "0" "2353" "0" "c.2353C>T" "r.(?)" "p.(Arg785*)" "" "0000062370" "00000116" "90" "4051" "0" "4051" "0" "c.4051A>G" "r.(?)" "p.(Lys1351Glu)" "" "0000062371" "00000116" "90" "1545" "0" "1546" "0" "c.1545_1546del" "r.(?)" "p.(Tyr515*)" "" "0000062372" "00000116" "90" "1397" "0" "1397" "0" "c.1397C>G" "r.(?)" "p.(Ser466*)" "" "0000062373" "00000116" "10" "1584" "77" "1584" "77" "c.1584+77A>G" "r.(=)" "p.(=)" "" "0000062374" "00000116" "10" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Arg668Cys)" "" "0000062375" "00000116" "50" "1571" "0" "1571" "0" "c.1571G>A" "r.(?)" "p.(Cys524Tyr)" "" "0000062376" "00000116" "50" "2547" "0" "2547" "0" "c.2547C>T" "r.(=)" "p.(=)" "" "0000062377" "00000116" "90" "1624" "0" "1624" "0" "c.1624G>T" "r.(?)" "p.(Gly542*)" "" "0000062378" "00000116" "50" "4056" "0" "4056" "0" "c.4056G>T" "r.(?)" "p.(Gln1352His)" "" "0000062379" "00000116" "50" "946" "0" "946" "0" "c.946T>C" "r.(?)" "p.(Phe316Leu)" "" "0000062380" "00000116" "10" "1519" "0" "1519" "0" "c.1519A>G" "r.(?)" "p.(Ile507Val)" "" "0000222716" "00000116" "30" "1251" "0" "1251" "0" "c.1251C>A" "r.(?)" "p.(Asn417Lys)" "10" "0000222898" "00000116" "99" "-9" "0" "14" "0" "c.-9_14del" "r.?" "p.?" "1" "0000222899" "00000116" "99" "1" "0" "53" "1" "c.(?_1)_(53+1_54-1)del" "r.(?)" "p.0?" "_1_1i" "0000222900" "00000116" "99" "1585" "-1" "1679" "1" "c.(1584+1_1585-1)_(1679+1_1680-1)del" "r.?" "p.?" "11I_12i" "0000222902" "00000116" "99" "1767" "-1" "2619" "1" "c.(1766+1_1767-1)_(2619+1_2620-1)del" "r.?" "p.?" "13i_15i" "0000222903" "00000116" "99" "2620" "-1" "3367" "1" "c.(2619+1_2620-1)_(3367+1_3368-1)del" "r.?" "p.?" "15i_20i" "0000222904" "00000116" "99" "274" "-1" "1116" "1" "c.(273+1_274-1)_(1116+1_1117-1)del" "r.?" "p.?" "3i_8i" "0000222906" "00000116" "99" "274" "-1" "1679" "1" "c.(273+1_274-1)_(1679+1_1680-1)del" "r.?" "p.?" "3i_12i" "0000222907" "00000116" "99" "2909" "-1" "3367" "1" "c.(2908+1_2909-1)_(3367+1_3368-1)del" "r.?" "p.?" "17i_20i" "0000222908" "00000116" "99" "2989" "-1" "3367" "1" "c.(2988+1_2989-1)_(3367+1_3368-1)del" "r.?" "p.?" "18i_20i" "0000222909" "00000116" "99" "2989" "-1" "3468" "1" "c.(2988+1_2989-1)_(3468+1_3469-1)del" "r.?" "p.?" "18i_21i" "0000222910" "00000116" "99" "3469" "-1" "3717" "1" "c.(3468+1_3469-1)_(3717+1_3718-1)del" "r.?" "p.?" "21i_22i" "0000222911" "00000116" "99" "3469" "-1" "3963" "1" "c.(3468+1_3469-1)_(3963+1_3964-1)del" "r.?" "p.?" "21i_24i" "0000222912" "00000116" "99" "3874" "-1" "3963" "1" "c.(3873+1_3874-1)_(3963+1_3964-1)del" "r.?" "p.?" "23i_24i" "0000222913" "00000116" "99" "3964" "-1" "4444" "0" "c.(3963+1_3964-1)_(*1_?)del" "r.?" "p.?" "24i_27_" "0000222914" "00000116" "99" "54" "-1" "164" "1" "c.(53+1_54-1)_(164+1_165-1)del" "r.?" "p.?" "1i_2i" "0000222915" "00000116" "99" "54" "-1" "489" "1" "c.(53+1_54-1)_(489+1_490-1)del" "r.?" "p.?" "1i_4i" "0000222916" "00000116" "99" "744" "-1" "1584" "1" "c.(743+1_744-1)_(1584+1_1585-1)dup" "r.?" "p.?" "6i_11i" "0000222917" "00000116" "77" "1210" "-7" "1210" "-6" "c.1210-7_1210-6del" "r.spl?" "p.(?)" "9i" "0000222918" "00000116" "77" "1210" "-11" "1210" "-11" "c.1210-11T>G" "r.spl" "p.(?)" "9i" "0000222919" "00000116" "77" "1210" "-11" "1210" "-11" "c.1210-11delinsGTG" "r.spl?" "p.(?)" "9i" "0000222924" "00000116" "99" "1006" "0" "1007" "0" "c.1006_1007insG" "r.(?)" "p.(Ile336Serfs*28)" "8" "0000222925" "00000116" "99" "1029" "0" "1029" "0" "c.1029del" "r.(?)" "p.(Cys343*)" "8" "0000222926" "00000116" "99" "1116" "1" "1116" "1" "c.1116+1G>A" "r.spl" "p.?" "8i" "0000222927" "00000116" "99" "1117" "-1" "1117" "-1" "c.1117-1G>A" "r.spl" "p.?" "8i" "0000222928" "00000116" "99" "1155" "0" "1156" "0" "c.1155_1156dup" "r.(?)" "p.(Asn386Ilefs*3)" "9" "0000222929" "00000116" "99" "11" "0" "11" "0" "c.11C>A" "r.(?)" "p.(Ser4*)" "1" "0000222930" "00000116" "99" "1211" "0" "1211" "0" "c.1211del" "r.(?)" "p.(Gly404Aspfs*38)" "10" "0000222931" "00000116" "99" "1240" "0" "1240" "0" "c.1240C>T" "r.(?)" "p.(Gln414*)" "10" "0000222932" "00000116" "99" "1327" "0" "1327" "0" "c.1327G>T" "r.(?)" "p.(Asp443Tyr)" "10" "0000222933" "00000116" "99" "1340" "0" "1340" "0" "c.1340del" "r.(?)" "p.(Lys447Argfs*2)" "10" "0000222934" "00000116" "99" "1365" "0" "1366" "0" "c.1365_1366del" "r.(?)" "p.(Val456Cysfs*25)" "10" "0000222935" "00000116" "99" "137" "0" "137" "0" "c.137C>A" "r.(?)" "p.(Ala46Asp)" "2" "0000222936" "00000116" "99" "1393" "-2" "1393" "-2" "c.1393-2A>G" "r.spl" "p.?" "10i" "0000222937" "00000116" "99" "1477" "0" "1478" "0" "c.1477_1478del" "r.(?)" "p.(Gln493Valfs*10)" "11" "0000222938" "00000116" "99" "1487" "0" "1487" "0" "c.1487G>A" "r.(?)" "p.(Trp496*)" "11" "0000222939" "00000116" "99" "1572" "0" "1572" "0" "c.1572C>A" "r.(?)" "p.(Cys524*)" "11" "0000222940" "00000116" "99" "1584" "1" "1584" "1" "c.1584+1G>A" "r.spl" "p.?" "11i" "0000222941" "00000116" "99" "164" "1" "164" "1" "c.164+1G>A" "r.spl" "p.?" "2i" "0000222942" "00000116" "99" "164" "1" "164" "1" "c.164+1G>T" "r.spl" "p.?" "2i" "0000222943" "00000116" "99" "1648" "0" "1648" "0" "c.1648G>T" "r.(?)" "p.(Gly550*)" "12" "0000222944" "00000116" "99" "165" "-1" "165" "-1" "c.165-1G>A" "r.spl" "p.?" "2i" "0000222945" "00000116" "99" "1650" "0" "1650" "0" "c.1650del" "r.(?)" "p.(Gly551Valfs*8)" "12" "0000222946" "00000116" "99" "1651" "0" "1651" "0" "c.1651G>A" "r.(?)" "p.(Gly551Ser)" "12" "0000222947" "00000116" "99" "166" "0" "166" "0" "c.166G>A" "r.(?)" "p.(Glu56Lys)" "3" "0000222948" "00000116" "99" "1680" "-886" "1680" "-886" "c.1680-886A>G" "r.spl" "p.?" "12i" "0000222949" "00000116" "99" "1679" "1" "1679" "1" "c.1679+1G>A" "r.spl" "p.?" "12i" "0000222950" "00000116" "99" "1679" "1" "1679" "1" "c.1679+1G>C" "r.spl" "p.?" "12i" "0000222951" "00000116" "99" "1680" "0" "1680" "0" "c.1680A>C" "r.(?)" "p.(Arg560Ser)" "13" "0000222952" "00000116" "99" "1682" "0" "1682" "0" "c.1682C>A" "r.(?)" "p.(Ala561Glu)" "13" "0000222953" "00000116" "11" "1684" "0" "1684" "0" "c.1684G>A" "r.(?)" "p.(Val562Ile)" "13" "0000222954" "00000116" "99" "1692" "0" "1692" "0" "c.1692del" "r.(?)" "p.(Asp565Metfs*7)" "13" "0000222955" "00000116" "99" "1703" "0" "1703" "0" "c.1703del" "r.(?)" "p.(Leu568Cysfs*4)" "13" "0000222956" "00000116" "99" "170" "0" "170" "0" "c.170G>A" "r.(?)" "p.(Trp57*)" "3" "0000222957" "00000116" "99" "171" "0" "171" "0" "c.171G>A" "r.(?)" "p.(Trp57*)" "3" "0000222958" "00000116" "99" "174" "0" "177" "0" "c.174_177del" "r.(?)" "p.(Asp58Glufs*32)" "3" "0000222959" "00000116" "99" "175" "0" "175" "0" "c.175dup" "r.(?)" "p.(Arg59Lysfs*10)" "3" "0000222960" "00000116" "99" "1763" "0" "1763" "0" "c.1763A>T" "r.(?)" "p.(Glu588Val)" "13" "0000222961" "00000116" "99" "1766" "1" "1766" "1" "c.1766+1G>C" "r.spl" "p.?" "13i" "0000222962" "00000116" "99" "1766" "5" "1766" "5" "c.1766+5G>T" "r.spl" "p.?" "13i" "0000222963" "00000116" "99" "1792" "0" "1798" "0" "c.1792_1798del" "r.(?)" "p.(Lys598Glyfs*11)" "14" "0000222964" "00000116" "99" "1923" "0" "1931" "0" "c.1923_1931delinsA" "r.(?)" "p.(Ser641Argfs*5)" "14" "0000222965" "00000116" "99" "1973" "0" "1985" "0" "c.1973_1985delinsAGAAA" "r.(?)" "p.(Arg658Lysfs*4)" "14" "0000222966" "00000116" "99" "1986" "0" "1989" "0" "c.1986_1989del" "r.(?)" "p.(Thr663Argfs*8)" "14" "0000222967" "00000116" "99" "2017" "0" "2017" "0" "c.2017G>T" "r.(?)" "p.(Gly673*)" "14" "0000222968" "00000116" "99" "2053" "0" "2053" "0" "c.2053C>T" "r.(?)" "p.(Gln685*)" "14" "0000222969" "00000116" "99" "2053" "0" "2053" "0" "c.2053dup" "r.(?)" "p.(Gln685Profs*4)" "14" "0000222970" "00000116" "99" "2143" "0" "2143" "0" "c.2143C>T" "r.(?)" "p.(Gln715*)" "14" "0000222971" "00000116" "99" "2241" "0" "2248" "0" "c.2241_2248del" "r.(?)" "p.(Ile748Serfs*28)" "14" "0000222972" "00000116" "99" "233" "0" "233" "0" "c.233dup" "r.(?)" "p.(Trp79Leufs*32)" "3" "0000222973" "00000116" "99" "2353" "0" "2353" "0" "c.2353C>T" "r.(?)" "p.(Arg785*)" "14" "0000222974" "00000116" "99" "2374" "0" "2374" "0" "c.2374C>T" "r.(?)" "p.(Arg792*)" "14" "0000222975" "00000116" "99" "2423" "0" "2424" "0" "c.2423_2424dup" "r.(?)" "p.(Ser809Ilefs*13)" "14" "0000222976" "00000116" "99" "2463" "0" "2464" "0" "c.2463_2464del" "r.(?)" "p.(Ser821Argfs*4)" "14" "0000222977" "00000116" "11" "2506" "0" "2506" "0" "c.2506G>T" "r.(?)" "p.(Asp836Tyr)" "15" "0000222978" "00000116" "99" "2547" "0" "2547" "0" "c.2547C>A" "r.(?)" "p.(Tyr849*)" "15" "0000222979" "00000116" "99" "2589" "0" "2599" "0" "c.2589_2599del" "r.(?)" "p.(Ile864Serfs*28)" "15" "0000222980" "00000116" "99" "2601" "0" "2601" "0" "c.2601dup" "r.(?)" "p.(Val868Serfs*28)" "15" "0000222981" "00000116" "55" "2620" "-26" "2620" "-26" "c.2620-26A>G" "r.spl" "p.(=)" "15i" "0000222982" "00000116" "99" "263" "0" "263" "0" "c.263T>A" "r.(?)" "p.(Leu88*)" "3" "0000222983" "00000116" "99" "263" "0" "263" "0" "c.263T>G" "r.(?)" "p.(Leu88*)" "3" "0000222984" "00000116" "99" "2645" "0" "2645" "0" "c.2645G>A" "r.(?)" "p.(Trp882*)" "16" "0000222985" "00000116" "99" "2658" "-1" "2658" "-1" "c.2658-1G>C" "r.spl" "p.?" "16i" "0000222986" "00000116" "99" "273" "3" "273" "3" "c.273+3A>C" "r.spl" "p.?" "3i" "0000222987" "00000116" "99" "2735" "0" "2735" "0" "c.2735C>A" "r.(?)" "p.(Ser912*)" "17" "0000222988" "00000116" "99" "2737" "0" "2738" "0" "c.2737_2738insG" "r.(?)" "p.(Tyr913*)" "17" "0000222989" "00000116" "99" "2739" "0" "2739" "0" "c.2739T>A" "r.(?)" "p.(Tyr913*)" "17" "0000222990" "00000116" "99" "2763" "0" "2764" "0" "c.2763_2764dup" "r.(?)" "p.(Val922Glufs*2)" "17" "0000222991" "00000116" "99" "2810" "0" "2810" "0" "c.2810dup" "r.(?)" "p.(Val938Glyfs*37)" "17" "0000222992" "00000116" "99" "2825" "0" "2825" "0" "c.2825del" "r.(?)" "p.(Ile942Thrfs*26)" "17" "0000222993" "00000116" "99" "2859" "0" "2890" "0" "c.2859_2890del" "r.(?)" "p.(Leu953Phefs*11)" "17" "0000222994" "00000116" "99" "2896" "0" "2896" "0" "c.2896del" "r.(?)" "p.(Thr966Argfs*2)" "17" "0000222995" "00000116" "99" "2989" "-2" "2989" "-2" "c.2989-2A>G" "r.spl" "p.?" "18i" "0000222996" "00000116" "99" "2989" "-977" "3367" "248" "c.2989-977_3367+248del" "r.(?)" "p.(Leu997Glufs*11)" "18i_20i" "0000222997" "00000116" "99" "3002" "0" "3003" "0" "c.3002_3003del" "r.(?)" "p.(Val1001Aspfs*45)" "19" "0000222998" "00000116" "99" "3039" "0" "3039" "0" "c.3039del" "r.(?)" "p.(Tyr1014Thrfs*9)" "19" "0000222999" "00000116" "99" "3039" "0" "3039" "0" "c.3039dup" "r.(?)" "p.(Tyr1014Leufs*33)" "19" "0000223000" "00000116" "99" "310" "0" "310" "0" "c.310del" "r.(?)" "p.(Arg104Glufs*3)" "4" "0000223001" "00000116" "99" "3124" "0" "3124" "0" "c.3124C>T" "r.(?)" "p.(Gln1042*)" "19" "0000223002" "00000116" "99" "3139" "0" "3139" "1" "c.3139_3139+1del" "r.spl" "p.(Gly1047Glnfs*28)" "19" "0000223003" "00000116" "99" "313" "0" "313" "0" "c.313del" "r.(?)" "p.(Ile105Serfs*2)" "4" "0000223004" "00000116" "99" "3160" "0" "3160" "0" "c.3160C>G" "r.(?)" "p.(His1054Asp)" "20" "0000223005" "00000116" "99" "3181" "0" "3181" "0" "c.3181G>C" "r.(?)" "p.(Gly1061Arg)" "20" "0000223006" "00000116" "99" "3217" "0" "3217" "0" "c.3217dup" "r.(?)" "p.(Tyr1073Leufs*3)" "20" "0000223007" "00000116" "99" "3222" "0" "3222" "0" "c.3222T>A" "r.(?)" "p.(Phe1074Leu)" "20" "0000223008" "00000116" "99" "3293" "0" "3293" "0" "c.3293G>A" "r.(?)" "p.(Trp1098*)" "20" "0000223009" "00000116" "99" "3294" "0" "3294" "0" "c.3294G>A" "r.(?)" "p.(Trp1098*)" "20" "0000223010" "00000116" "99" "3304" "0" "3304" "0" "c.3304A>T" "r.(?)" "p.(Arg1102*)" "20" "0000223011" "00000116" "99" "3368" "-2" "3368" "-2" "c.3368-2A>G" "r.spl" "p.?" "20i" "0000223012" "00000116" "99" "3435" "0" "3435" "0" "c.3435G>A" "r.(?)" "p.(Trp1145*)" "21" "0000223013" "00000116" "99" "3468" "2" "3468" "2" "c.3468+2dup" "r.spl" "p.?" "21i" "0000223014" "00000116" "99" "3468" "5" "3468" "5" "c.3468+5G>A" "r.spl" "p.?" "21i" "0000223015" "00000116" "99" "3468" "0" "3468" "0" "c.3468G>A" "r.spl" "p.(Leu1156=)" "21" "0000223016" "00000116" "99" "3532" "0" "3535" "0" "c.3532_3535dup" "r.(?)" "p.(Thr1179Ilefs*17)" "22" "0000223017" "00000116" "99" "3605" "0" "3605" "0" "c.3605del" "r.(?)" "p.(Asp1202Alafs*9)" "22" "0000223018" "00000116" "99" "3691" "0" "3691" "0" "c.3691del" "r.(?)" "p.(Ser1231Profs*4)" "22" "0000223019" "00000116" "99" "3717" "40" "3717" "40" "c.3717+40A>G" "r.spl" "p.(=)" "22i" "0000223020" "00000116" "99" "3717" "4" "3717" "4" "c.3717+4A>G" "r.spl" "p.?" "22i" "0000223021" "00000116" "99" "3717" "0" "3717" "0" "c.3717G>A" "r.spl" "p.(Arg1239=)" "22" "0000223022" "00000116" "99" "3718" "-1" "3718" "-1" "c.3718-1G>A" "r.spl" "p.?" "22i" "0000223023" "00000116" "99" "3718" "-2477" "3718" "-2477" "c.3718-2477C>T" "r.spl" "p.(=)" "22i" "0000223024" "00000116" "99" "3718" "-3" "3718" "-3" "c.3718-3T>G" "r.spl" "p.?" "22i" "0000223025" "00000116" "99" "3747" "0" "3747" "0" "c.3747del" "r.(?)" "p.(Lys1250Argfs*9)" "23" "0000223026" "00000116" "99" "3761" "0" "3761" "0" "c.3761T>G" "r.(?)" "p.(Leu1254*)" "23" "0000223027" "00000116" "99" "3763" "0" "3763" "0" "c.3763T>C" "r.(?)" "p.(Ser1255Pro)" "23" "0000223028" "00000116" "99" "3764" "0" "3764" "0" "c.3764C>A" "r.(?)" "p.(Ser1255*)" "23" "0000223029" "00000116" "99" "3873" "2" "3873" "2" "c.3873+2T>C" "r.spl" "p.?" "23i" "0000223030" "00000116" "99" "3883" "0" "3886" "0" "c.3883_3886del" "r.(?)" "p.(Ile1295Phefs*32)" "24" "0000223031" "00000116" "99" "3883" "0" "3883" "0" "c.3883del" "r.(?)" "p.(Ile1295Phefs*33)" "24" "0000223032" "00000116" "99" "3891" "0" "3891" "0" "c.3891dup" "r.(?)" "p.(Gly1298Trpfs*4)" "24" "0000223034" "00000116" "99" "3908" "0" "3908" "0" "c.3908del" "r.(?)" "p.(Asn1303Thrfs*25)" "24" "0000223035" "00000116" "99" "3988" "0" "3988" "0" "c.3988C>T" "r.(?)" "p.(Gln1330*)" "25" "0000223036" "00000116" "99" "4046" "0" "4046" "0" "c.4046G>A" "r.(?)" "p.(Gly1349Asp)" "25" "0000223037" "00000116" "99" "4086" "0" "4086" "0" "c.4086dup" "r.(?)" "p.(Lys1363*)" "25" "0000223038" "00000116" "99" "409" "0" "409" "0" "c.409del" "r.(?)" "p.(Leu137Serfs*16)" "4" "0000223039" "00000116" "99" "4111" "0" "4111" "0" "c.4111G>T" "r.(?)" "p.(Glu1371*)" "25" "0000223040" "00000116" "99" "4127" "0" "4131" "0" "c.4127_4131del" "r.(?)" "p.(Leu1376Serfs*8)" "25" "0000223041" "00000116" "99" "4144" "0" "4144" "0" "c.4144C>T" "r.(?)" "p.(Gln1382*)" "26" "0000223042" "00000116" "99" "4197" "0" "4198" "0" "c.4197_4198del" "r.(?)" "p.(Cys1400*)" "26" "0000223043" "00000116" "99" "4231" "0" "4231" "0" "c.4231C>T" "r.(?)" "p.(Gln1411*)" "26" "0000223044" "00000116" "99" "4234" "0" "4234" "0" "c.4234C>T" "r.(?)" "p.(Gln1412*)" "26" "0000223045" "00000116" "99" "4242" "1" "4242" "1" "c.4242+1G>A" "r.spl" "p.?" "26i" "0000223046" "00000116" "99" "4242" "1" "4242" "1" "c.4242+1G>T" "r.spl" "p.?" "26i" "0000223047" "00000116" "99" "4147" "0" "4147" "0" "c.4147dup" "r.(?)" "p.(Ile1383Asnfs*3)" "26" "0000223048" "00000116" "99" "4300" "0" "4301" "0" "c.4300_4301dup" "r.(?)" "p.(Ser1435Glyfs*14)" "27" "0000223049" "00000116" "99" "470" "0" "483" "0" "c.470_483del" "r.(?)" "p.(Phe157*)" "4" "0000223050" "00000116" "99" "489" "3" "489" "3" "c.489+3A>G" "r.spl" "p.?" "4i" "0000223051" "00000116" "99" "4" "0" "4" "0" "c.4C>T" "r.(?)" "p.(Gln2*)" "1" "0000223052" "00000116" "11" "509" "0" "509" "0" "c.509G>A" "r.(?)" "p.(Arg170His)" "5" "0000223053" "00000116" "99" "50" "0" "50" "0" "c.50del" "r.(?)" "p.(Phe17Serfs*8)" "1" "0000223054" "00000116" "99" "53" "1" "53" "1" "c.53+1G>T" "r.spl" "p.?" "1i" "0000223055" "00000116" "99" "543" "0" "546" "0" "c.543_546del" "r.(?)" "p.(Leu183Phefs*5)" "5" "0000223056" "00000116" "99" "577" "0" "577" "0" "c.577G>T" "r.(?)" "p.(Glu193*)" "5" "0000223057" "00000116" "99" "57" "0" "57" "0" "c.57G>A" "r.(?)" "p.(Trp19*)" "2" "0000223058" "00000116" "55" "601" "0" "601" "0" "c.601G>A" "r.(?)" "p.(Val201Met)" "6" "0000223059" "00000116" "99" "647" "0" "647" "0" "c.647G>A" "r.(?)" "p.(Trp216*)" "6" "0000223060" "00000116" "99" "717" "0" "717" "0" "c.717del" "r.(?)" "p.(Leu240*)" "6" "0000223061" "00000116" "99" "79" "0" "79" "0" "c.79G>T" "r.(?)" "p.(Gly27*)" "2" "0000223062" "00000116" "99" "803" "0" "803" "0" "c.803del" "r.(?)" "p.(Asn268Ilefs*17)" "7" "0000223063" "00000116" "99" "825" "0" "825" "0" "c.825C>G" "r.(?)" "p.(Tyr275*)" "7" "0000223064" "00000116" "99" "828" "0" "828" "0" "c.828C>A" "r.(?)" "p.(Cys276*)" "7" "0000223065" "00000116" "99" "861" "0" "865" "0" "c.861_865del" "r.(?)" "p.(Asn287Lysfs*19)" "7" "0000223066" "00000116" "55" "92" "0" "92" "0" "c.92G>T" "r.(?)" "p.(Arg31Leu)" "2" "0000223067" "00000116" "99" "987" "0" "987" "0" "c.987del" "r.(?)" "p.(Gly330Glufs*39)" "8" "0000223068" "00000116" "55" "1075" "0" "1075" "0" "c.1075C>A" "r.(?)" "p.(Gln359Lys)" "8" "0000223069" "00000116" "55" "1079" "0" "1079" "0" "c.1079C>A" "r.(?)" "p.(Thr360Lys)" "8" "0000223070" "00000116" "77" "1210" "-7" "1210" "-6" "c.1210-7_1210-6del" "r.?" "p.(=)" "9i" "0000223071" "00000116" "99" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "4" "0000223072" "00000116" "99" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "4" "0000223073" "00000116" "11" "1210" "-12" "1210" "-6" "c.1210-12_1210-6=" "r.(?)" "p.(=)" "9i" "0000241257" "00000116" "70" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Trp)" "" "0000248127" "00000116" "30" "1516" "0" "1516" "0" "c.1516A>G" "r.(?)" "p.(Ile506Val)" "" "0000248144" "00000116" "90" "2052" "0" "2052" "0" "c.2052del" "r.(?)" "p.(Lys684AsnfsTer38)" "" "0000249377" "00000116" "30" "3897" "0" "3897" "0" "c.3897A>G" "r.(?)" "p.(Thr1299=)" "" "0000249544" "00000116" "30" "4243" "-16" "4243" "-16" "c.4243-16A>G" "r.(=)" "p.(=)" "" "0000249638" "00000116" "90" "313" "0" "313" "0" "c.313del" "r.(?)" "p.(Ile105SerfsTer2)" "" "0000249716" "00000116" "50" "2907" "0" "2907" "0" "c.2907A>G" "r.(?)" "p.(Ala969=)" "" "0000249735" "00000116" "50" "416" "0" "416" "0" "c.416A>C" "r.(?)" "p.(His139Pro)" "" "0000253449" "00000116" "10" "3870" "0" "3870" "0" "c.3870A>G" "r.(?)" "p.(Pro1290=)" "" "0000253572" "00000116" "10" "1519" "0" "1519" "0" "c.1519A>G" "r.(?)" "p.(Ile507Val)" "" "0000253580" "00000116" "10" "2421" "0" "2421" "0" "c.2421A>G" "r.(?)" "p.(Ile807Met)" "" "0000253808" "00000116" "10" "1767" "-132" "1767" "-132" "c.1767-132A>G" "r.(=)" "p.(=)" "" "0000253809" "00000116" "10" "3140" "-27" "3140" "-27" "c.3140-27A>G" "r.(=)" "p.(=)" "" "0000254117" "00000116" "30" "1516" "0" "1516" "0" "c.1516A>G" "r.(?)" "p.(Ile506Val)" "" "0000255038" "00000116" "30" "3285" "0" "3285" "0" "c.3285A>T" "r.(?)" "p.(Thr1095=)" "" "0000255402" "00000116" "90" "2052" "0" "2052" "0" "c.2052del" "r.(?)" "p.(Lys684AsnfsTer38)" "" "0000255436" "00000116" "90" "4251" "0" "4251" "0" "c.4251del" "r.(?)" "p.(Glu1418ArgfsTer14)" "" "0000255458" "00000116" "90" "3415" "0" "3415" "0" "c.3415A>G" "r.(?)" "p.(Ile1139Val)" "" "0000255555" "00000116" "90" "3908" "0" "3908" "0" "c.3908A>T" "r.(?)" "p.(Asn1303Ile)" "" "0000255665" "00000116" "90" "1706" "0" "1706" "0" "c.1706A>G" "r.(?)" "p.(Tyr569Cys)" "" "0000255683" "00000116" "90" "579" "3" "579" "3" "c.579+3A>G" "r.spl?" "p.?" "" "0000255684" "00000116" "90" "3368" "-2" "3368" "-2" "c.3368-2A>G" "r.spl?" "p.?" "" "0000256098" "00000116" "50" "1666" "0" "1666" "0" "c.1666A>G" "r.(?)" "p.(Ile556Val)" "" "0000256160" "00000116" "50" "881" "0" "881" "0" "c.881A>T" "r.(?)" "p.(Lys294Ile)" "" "0000256278" "00000116" "50" "264" "0" "264" "0" "c.264A>C" "r.(?)" "p.(Leu88Phe)" "" "0000256469" "00000116" "50" "2428" "0" "2428" "0" "c.2428A>G" "r.(?)" "p.(Arg810Gly)" "" "0000256703" "00000116" "50" "489" "3" "489" "3" "c.489+3A>G" "r.spl?" "p.?" "" "0000266699" "00000116" "90" "1000" "0" "1000" "0" "c.1000C>T" "r.(?)" "p.(Arg334Trp)" "" "0000266700" "00000116" "90" "1040" "0" "1040" "0" "c.1040G>A" "r.(?)" "p.(Arg347His)" "" "0000266701" "00000116" "90" "1040" "0" "1040" "0" "c.1040G>C" "r.(?)" "p.(Arg347Pro)" "" "0000266702" "00000116" "30" "1210" "-6" "1210" "-6" "c.1210-6T>A" "r.(=)" "p.(=)" "" "0000266703" "00000116" "90" "1364" "0" "1364" "0" "c.1364C>A" "r.(?)" "p.(Ala455Glu)" "" "0000266704" "00000116" "10" "1408" "0" "1408" "0" "c.1408G>A" "r.(?)" "p.(Val470Met)" "" "0000266705" "00000116" "90" "1466" "0" "1466" "0" "c.1466C>A" "r.(?)" "p.(Ser489Ter)" "" "0000266706" "00000116" "90" "1519" "0" "1521" "0" "c.1519_1521del" "r.(?)" "p.(Ile507del)" "" "0000266707" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000266708" "00000116" "90" "1545" "0" "1546" "0" "c.1545_1546del" "r.(?)" "p.(Tyr515Ter)" "" "0000266709" "00000116" "90" "1558" "0" "1558" "0" "c.1558G>T" "r.(?)" "p.(Val520Phe)" "" "0000266710" "00000116" "90" "1585" "-1" "1585" "-1" "c.1585-1G>A" "r.spl?" "p.?" "" "0000266711" "00000116" "90" "1624" "0" "1624" "0" "c.1624G>T" "r.(?)" "p.(Gly542Ter)" "" "0000266712" "00000116" "90" "1646" "0" "1646" "0" "c.1646G>A" "r.(?)" "p.(Ser549Asn)" "" "0000266713" "00000116" "90" "1647" "0" "1647" "0" "c.1647T>G" "r.(?)" "p.(Ser549Arg)" "" "0000266714" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000266715" "00000116" "90" "1657" "0" "1657" "0" "c.1657C>T" "r.(?)" "p.(Arg553Ter)" "" "0000266716" "00000116" "90" "1679" "0" "1679" "0" "c.1679G>C" "r.(?)" "p.(Arg560Thr)" "" "0000266717" "00000116" "90" "1766" "5" "1766" "5" "c.1766+5G>T" "r.spl?" "p.?" "" "0000266718" "00000116" "90" "178" "0" "178" "0" "c.178G>T" "r.(?)" "p.(Glu60Ter)" "" "0000266719" "00000116" "90" "1853" "0" "1853" "0" "c.1853T>C" "r.(?)" "p.(Ile618Thr)" "" "0000266720" "00000116" "90" "200" "0" "200" "0" "c.200C>T" "r.(?)" "p.(Pro67Leu)" "" "0000266721" "00000116" "90" "2012" "0" "2012" "0" "c.2012del" "r.(?)" "p.(Leu671Ter)" "" "0000266722" "00000116" "90" "2215" "0" "2215" "0" "c.2215del" "r.(?)" "p.(Val739TyrfsTer16)" "" "0000266723" "00000116" "30" "2260" "0" "2260" "0" "c.2260G>A" "r.(?)" "p.(Val754Met)" "" "0000266724" "00000116" "30" "2491" "-8" "2491" "-8" "c.2491-8T>C" "r.(=)" "p.(=)" "" "0000266725" "00000116" "90" "2537" "0" "2537" "0" "c.2537G>A" "r.(?)" "p.(Trp846Ter)" "" "0000266726" "00000116" "90" "254" "0" "254" "0" "c.254G>A" "r.(?)" "p.(Gly85Glu)" "" "0000266727" "00000116" "10" "2562" "0" "2562" "0" "c.2562T>G" "r.(?)" "p.(Thr854=)" "" "0000266728" "00000116" "90" "262" "0" "263" "0" "c.262_263del" "r.(?)" "p.(Leu88IlefsTer22)" "" "0000266729" "00000116" "90" "2657" "5" "2657" "5" "c.2657+5G>A" "r.spl?" "p.?" "" "0000266730" "00000116" "90" "2668" "0" "2668" "0" "c.2668C>T" "r.(?)" "p.(Gln890Ter)" "" "0000266731" "00000116" "30" "2898" "0" "2898" "0" "c.2898G>A" "r.(?)" "p.(Thr966=)" "" "0000266732" "00000116" "90" "2988" "1" "2988" "1" "c.2988+1G>A" "r.spl?" "p.?" "" "0000266733" "00000116" "30" "2992" "0" "2992" "0" "c.2992T>C" "r.(?)" "p.(Leu998=)" "" "0000266734" "00000116" "90" "3154" "0" "3154" "0" "c.3154T>G" "r.(?)" "p.(Phe1052Val)" "" "0000266735" "00000116" "90" "3196" "0" "3196" "0" "c.3196C>T" "r.(?)" "p.(Arg1066Cys)" "" "0000266736" "00000116" "90" "3276" "0" "3276" "0" "c.3276C>A" "r.(?)" "p.(Tyr1092Ter)" "" "0000266737" "00000116" "90" "3302" "0" "3302" "0" "c.3302T>A" "r.(?)" "p.(Met1101Lys)" "" "0000266738" "00000116" "90" "3472" "0" "3472" "0" "c.3472C>T" "r.(?)" "p.(Arg1158Ter)" "" "0000266739" "00000116" "90" "3484" "0" "3484" "0" "c.3484C>T" "r.(?)" "p.(Arg1162Ter)" "" "0000266740" "00000116" "90" "349" "0" "349" "0" "c.349C>T" "r.(?)" "p.(Arg117Cys)" "" "0000266741" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000266742" "00000116" "90" "3528" "0" "3528" "0" "c.3528del" "r.(?)" "p.(Lys1177SerfsTer15)" "" "0000266743" "00000116" "30" "360" "0" "360" "0" "c.360G>A" "r.(?)" "p.(Ala120=)" "" "0000266744" "00000116" "90" "366" "0" "366" "0" "c.366T>A" "r.(?)" "p.(Tyr122Ter)" "" "0000266745" "00000116" "90" "3773" "0" "3773" "0" "c.3773dup" "r.(?)" "p.(Leu1258PhefsTer7)" "" "0000266746" "00000116" "90" "3846" "0" "3846" "0" "c.3846G>A" "r.(?)" "p.(Trp1282Ter)" "" "0000266747" "00000116" "90" "3909" "0" "3909" "0" "c.3909C>G" "r.(?)" "p.(Asn1303Lys)" "" "0000266748" "00000116" "10" "4389" "0" "4389" "0" "c.4389G>A" "r.(?)" "p.(Gln1463=)" "" "0000266749" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl?" "p.?" "" "0000266750" "00000116" "50" "571" "0" "571" "0" "c.571T>G" "r.(?)" "p.(Phe191Val)" "" "0000266751" "00000116" "90" "579" "1" "579" "1" "c.579+1G>T" "r.spl?" "p.?" "" "0000266752" "00000116" "90" "617" "0" "617" "0" "c.617T>G" "r.(?)" "p.(Leu206Trp)" "" "0000266753" "00000116" "90" "680" "0" "680" "0" "c.680T>G" "r.(?)" "p.(Leu227Arg)" "" "0000266754" "00000116" "30" "890" "0" "890" "0" "c.890G>A" "r.(?)" "p.(Arg297Gln)" "" "0000266755" "00000116" "90" "948" "0" "948" "0" "c.948del" "r.(?)" "p.(Phe316LeufsTer12)" "" "0000268101" "00000116" "90" "1040" "0" "1040" "0" "c.1040G>A" "r.(?)" "p.(Arg347His)" "" "0000268102" "00000116" "90" "1364" "0" "1364" "0" "c.1364C>A" "r.(?)" "p.(Ala455Glu)" "" "0000270073" "00000116" "30" "2736" "0" "2736" "0" "c.2736G>A" "r.(?)" "p.(Ser912=)" "" "0000273310" "00000116" "10" "-8" "0" "-8" "0" "c.-8G>C" "r.(?)" "p.(=)" "" "0000273311" "00000116" "10" "4576" "0" "4576" "0" "c.*133dup" "r.(?)" "p.(=)" "" "0000273312" "00000116" "10" "4576" "0" "4576" "0" "c.*133del" "r.(?)" "p.(=)" "" "0000273313" "00000116" "90" "1000" "0" "1000" "0" "c.1000C>T" "r.(?)" "p.(Arg334Trp)" "" "0000273314" "00000116" "90" "1007" "0" "1007" "0" "c.1007T>A" "r.(?)" "p.(Ile336Lys)" "" "0000273315" "00000116" "90" "1040" "0" "1040" "0" "c.1040G>C" "r.(?)" "p.(Arg347Pro)" "" "0000273316" "00000116" "50" "1046" "0" "1046" "0" "c.1046C>T" "r.(?)" "p.(Ala349Val)" "" "0000273317" "00000116" "50" "1052" "0" "1052" "0" "c.1052C>G" "r.(?)" "p.(Thr351Ser)" "" "0000273318" "00000116" "90" "1081" "0" "1081" "0" "c.1081T>C" "r.(?)" "p.(Trp361Arg)" "" "0000273319" "00000116" "90" "115" "0" "115" "0" "c.115C>T" "r.(?)" "p.(Gln39Ter)" "" "0000273320" "00000116" "90" "1162" "0" "1168" "0" "c.1162_1168del" "r.(?)" "p.(Thr388GlnfsTer3)" "" "0000273321" "00000116" "10" "1209" "28" "1209" "28" "c.1209+28C>T" "r.(=)" "p.(=)" "" "0000273322" "00000116" "90" "1211" "0" "1211" "0" "c.1211del" "r.(?)" "p.(Gly404AspfsTer38)" "" "0000273323" "00000116" "90" "1287" "0" "1287" "0" "c.1287del" "r.(?)" "p.(Phe430SerfsTer12)" "" "0000273324" "00000116" "90" "1364" "0" "1364" "0" "c.1364C>A" "r.(?)" "p.(Ala455Glu)" "" "0000273325" "00000116" "70" "1367" "0" "1367" "0" "c.1367T>C" "r.(?)" "p.(Val456Ala)" "" "0000273326" "00000116" "90" "137" "0" "137" "0" "c.137C>A" "r.(?)" "p.(Ala46Asp)" "" "0000273327" "00000116" "90" "1392" "0" "1392" "0" "c.1392G>T" "r.(?)" "p.(Lys464Asn)" "" "0000273328" "00000116" "90" "1393" "-1" "1393" "-1" "c.1393-1G>A" "r.spl?" "p.?" "" "0000273329" "00000116" "90" "1397" "0" "1397" "0" "c.1397C>G" "r.(?)" "p.(Ser466Ter)" "" "0000273330" "00000116" "90" "1466" "0" "1466" "0" "c.1466C>A" "r.(?)" "p.(Ser489Ter)" "" "0000273331" "00000116" "50" "1466" "0" "1466" "0" "c.1466C>T" "r.(?)" "p.(Ser489Leu)" "" "0000273332" "00000116" "90" "1477" "0" "1477" "0" "c.1477C>T" "r.(?)" "p.(Gln493Ter)" "" "0000273333" "00000116" "90" "1519" "0" "1521" "0" "c.1519_1521del" "r.(?)" "p.(Ile507del)" "" "0000273335" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000273336" "00000116" "10" "1523" "0" "1523" "0" "c.1523T>G" "r.(?)" "p.(Phe508Cys)" "" "0000273337" "00000116" "90" "1545" "0" "1546" "0" "c.1545_1546del" "r.(?)" "p.(Tyr515Ter)" "" "0000273338" "00000116" "50" "1584" "0" "1584" "0" "c.1584G>A" "r.(?)" "p.(Glu528=)" "" "0000273339" "00000116" "90" "1585" "-1" "1585" "-1" "c.1585-1G>A" "r.spl?" "p.?" "" "0000273340" "00000116" "90" "1624" "0" "1624" "0" "c.1624G>T" "r.(?)" "p.(Gly542Ter)" "" "0000273341" "00000116" "90" "1648" "0" "1648" "0" "c.1648G>T" "r.(?)" "p.(Gly550Ter)" "" "0000273342" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000273343" "00000116" "90" "1654" "0" "1654" "0" "c.1654C>T" "r.(?)" "p.(Gln552Ter)" "" "0000273344" "00000116" "90" "1657" "0" "1657" "0" "c.1657C>T" "r.(?)" "p.(Arg553Ter)" "" "0000273345" "00000116" "10" "1679" "110" "1679" "110" "c.1679+110dup" "r.(=)" "p.(=)" "" "0000273346" "00000116" "10" "1679" "18" "1679" "18" "c.1679+18G>A" "r.(=)" "p.(=)" "" "0000273347" "00000116" "90" "1679" "1" "1679" "1" "c.1679+1G>C" "r.spl?" "p.?" "" "0000273348" "00000116" "90" "1679" "0" "1679" "0" "c.1679G>C" "r.(?)" "p.(Arg560Thr)" "" "0000273349" "00000116" "90" "1680" "-1" "1680" "-1" "c.1680-1G>C" "r.spl?" "p.?" "" "0000273350" "00000116" "90" "1725" "0" "1727" "0" "c.1725_1727delinsAT" "r.(?)" "p.(Phe575LeufsTer4)" "" "0000273351" "00000116" "90" "1753" "0" "1753" "0" "c.1753G>T" "r.(?)" "p.(Glu585Ter)" "" "0000273352" "00000116" "90" "1766" "5" "1766" "5" "c.1766+5G>T" "r.spl?" "p.?" "" "0000273353" "00000116" "10" "1767" "-136" "1767" "-136" "c.1767-136T>C" "r.(=)" "p.(=)" "" "0000273354" "00000116" "90" "178" "0" "178" "0" "c.178G>T" "r.(?)" "p.(Glu60Ter)" "" "0000273355" "00000116" "90" "2012" "0" "2012" "0" "c.2012del" "r.(?)" "p.(Leu671Ter)" "" "0000273356" "00000116" "90" "2037" "0" "2037" "0" "c.2037G>A" "r.(?)" "p.(Trp679Ter)" "" "0000273357" "00000116" "90" "2051" "0" "2052" "0" "c.2051_2052delinsG" "r.(?)" "p.(Lys684SerfsTer38)" "" "0000273358" "00000116" "90" "2052" "0" "2052" "0" "c.2052dup" "r.(?)" "p.(Gln685ThrfsTer4)" "" "0000273359" "00000116" "50" "2168" "0" "2168" "0" "c.2168G>T" "r.(?)" "p.(Gly723Val)" "" "0000273360" "00000116" "90" "2195" "0" "2195" "0" "c.2195T>G" "r.(?)" "p.(Leu732Ter)" "" "0000273361" "00000116" "90" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Trp)" "" "0000273362" "00000116" "90" "2290" "0" "2290" "0" "c.2290C>T" "r.(?)" "p.(Arg764Ter)" "" "0000273363" "00000116" "90" "2425" "0" "2425" "0" "c.2425del" "r.(?)" "p.(Ser809GlnfsTer12)" "" "0000273364" "00000116" "90" "2537" "0" "2537" "0" "c.2537G>A" "r.(?)" "p.(Trp846Ter)" "" "0000273365" "00000116" "90" "2547" "0" "2547" "0" "c.2547C>A" "r.(?)" "p.(Tyr849Ter)" "" "0000273366" "00000116" "90" "254" "0" "254" "0" "c.254G>A" "r.(?)" "p.(Gly85Glu)" "" "0000273367" "00000116" "90" "2551" "0" "2551" "0" "c.2551C>T" "r.(?)" "p.(Arg851Ter)" "" "0000273368" "00000116" "30" "2559" "0" "2559" "0" "c.2559T>C" "r.(?)" "p.(Ile853=)" "" "0000273369" "00000116" "10" "2562" "0" "2562" "0" "c.2562T>G" "r.(?)" "p.(Thr854=)" "" "0000273370" "00000116" "90" "262" "0" "263" "0" "c.262_263del" "r.(?)" "p.(Leu88IlefsTer22)" "" "0000273371" "00000116" "50" "2620" "-15" "2620" "-15" "c.2620-15C>G" "r.(=)" "p.(=)" "" "0000273372" "00000116" "90" "2657" "5" "2657" "5" "c.2657+5G>A" "r.spl?" "p.?" "" "0000273373" "00000116" "90" "2679" "0" "2679" "0" "c.2679G>T" "r.(?)" "p.(Gly893=)" "" "0000273375" "00000116" "10" "274" "-6" "274" "-6" "c.274-6T>C" "r.(=)" "p.(=)" "" "0000273376" "00000116" "10" "2898" "0" "2898" "0" "c.2898G>A" "r.(?)" "p.(Thr966=)" "" "0000273377" "00000116" "50" "2900" "0" "2900" "0" "c.2900T>C" "r.(?)" "p.(Leu967Ser)" "" "0000273379" "00000116" "10" "2909" "-71" "2909" "-71" "c.2909-71G>C" "r.(=)" "p.(=)" "" "0000273380" "00000116" "10" "2909" "-92" "2909" "-92" "c.2909-92G>A" "r.(=)" "p.(=)" "" "0000273381" "00000116" "90" "2981" "0" "2981" "0" "c.2981T>G" "r.(?)" "p.(Phe994Cys)" "" "0000273382" "00000116" "90" "2988" "1" "2988" "1" "c.2988+1G>A" "r.spl?" "p.?" "" "0000273383" "00000116" "50" "2991" "0" "2991" "0" "c.2991G>C" "r.(?)" "p.(Leu997Phe)" "" "0000273384" "00000116" "50" "3044" "0" "3044" "0" "c.3044T>A" "r.(?)" "p.(Ile1015Asn)" "" "0000273385" "00000116" "90" "3067" "0" "3072" "0" "c.3067_3072del" "r.(?)" "p.(Ile1023_Val1024del)" "" "0000273386" "00000116" "10" "3139" "18" "3139" "18" "c.3139+18C>T" "r.(=)" "p.(=)" "" "0000273387" "00000116" "90" "3154" "0" "3154" "0" "c.3154T>G" "r.(?)" "p.(Phe1052Val)" "" "0000273388" "00000116" "90" "3196" "0" "3196" "0" "c.3196C>T" "r.(?)" "p.(Arg1066Cys)" "" "0000273389" "00000116" "90" "3197" "0" "3197" "0" "c.3197G>A" "r.(?)" "p.(Arg1066His)" "" "0000273390" "00000116" "50" "3208" "0" "3208" "0" "c.3208C>T" "r.(?)" "p.(Arg1070Trp)" "" "0000273391" "00000116" "90" "3209" "0" "3209" "0" "c.3209G>A" "r.(?)" "p.(Arg1070Gln)" "" "0000273392" "00000116" "90" "3276" "0" "3276" "0" "c.3276C>A" "r.(?)" "p.(Tyr1092Ter)" "" "0000273393" "00000116" "90" "3403" "0" "3404" "0" "c.3403_3404del" "r.(?)" "p.(Leu1135SerfsTer20)" "" "0000273394" "00000116" "90" "3407" "0" "3422" "0" "c.3407_3422del" "r.(?)" "p.(Ala1136ValfsTer7)" "" "0000273395" "00000116" "30" "3429" "0" "3429" "0" "c.3429G>A" "r.(?)" "p.(Leu1143=)" "" "0000273396" "00000116" "50" "3469" "-20" "3469" "-20" "c.3469-20T>C" "r.(=)" "p.(=)" "" "0000273397" "00000116" "90" "3476" "0" "3476" "0" "c.3476C>T" "r.(?)" "p.(Ser1159Phe)" "" "0000273398" "00000116" "90" "3481" "0" "3486" "0" "c.3481_3486delinsGG" "r.(?)" "p.(Ser1161GlyfsTer30)" "" "0000273399" "00000116" "90" "3484" "0" "3484" "0" "c.3484C>T" "r.(?)" "p.(Arg1162Ter)" "" "0000273400" "00000116" "50" "3485" "0" "3485" "0" "c.3485G>T" "r.(?)" "p.(Arg1162Leu)" "" "0000273401" "00000116" "90" "349" "0" "349" "0" "c.349C>T" "r.(?)" "p.(Arg117Cys)" "" "0000273402" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000273403" "00000116" "90" "3528" "0" "3528" "0" "c.3528del" "r.(?)" "p.(Lys1177SerfsTer15)" "" "0000273404" "00000116" "90" "3546" "0" "3546" "0" "c.3546C>G" "r.(?)" "p.(Tyr1182Ter)" "" "0000273405" "00000116" "90" "3659" "0" "3659" "0" "c.3659del" "r.(?)" "p.(Thr1220LysfsTer8)" "" "0000273406" "00000116" "90" "3773" "0" "3773" "0" "c.3773dup" "r.(?)" "p.(Leu1258PhefsTer7)" "" "0000273407" "00000116" "90" "3808" "0" "3808" "0" "c.3808G>A" "r.(?)" "p.(Asp1270Asn)" "" "0000273408" "00000116" "90" "3846" "0" "3846" "0" "c.3846G>A" "r.(?)" "p.(Trp1282Ter)" "" "0000273409" "00000116" "50" "3854" "0" "3854" "0" "c.3854C>T" "r.(?)" "p.(Ala1285Val)" "" "0000273410" "00000116" "90" "3883" "0" "3886" "0" "c.3883_3886del" "r.(?)" "p.(Ile1295PhefsTer32)" "" "0000273411" "00000116" "90" "3909" "0" "3909" "0" "c.3909C>G" "r.(?)" "p.(Asn1303Lys)" "" "0000273412" "00000116" "10" "3964" "-16" "3964" "-16" "c.3964-16T>C" "r.(=)" "p.(=)" "" "0000273413" "00000116" "90" "4004" "0" "4004" "0" "c.4004T>C" "r.(?)" "p.(Leu1335Pro)" "" "0000273414" "00000116" "90" "4046" "0" "4046" "0" "c.4046del" "r.(?)" "p.(Gly1349AlafsTer5)" "" "0000273415" "00000116" "50" "4097" "0" "4097" "0" "c.4097T>C" "r.(?)" "p.(Ile1366Thr)" "" "0000273416" "00000116" "30" "4197" "0" "4197" "0" "c.4197C>G" "r.(?)" "p.(Leu1399=)" "" "0000273417" "00000116" "50" "4220" "0" "4220" "0" "c.4220T>C" "r.(?)" "p.(Met1407Thr)" "" "0000273418" "00000116" "10" "4272" "0" "4272" "0" "c.4272C>T" "r.(?)" "p.(Tyr1424=)" "" "0000273419" "00000116" "10" "4389" "0" "4389" "0" "c.4389G>A" "r.(?)" "p.(Gln1463=)" "" "0000273420" "00000116" "90" "4426" "0" "4426" "0" "c.4426C>T" "r.(?)" "p.(Gln1476Ter)" "" "0000273421" "00000116" "50" "451" "0" "451" "0" "c.451C>A" "r.(?)" "p.(Gln151Lys)" "" "0000273422" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl?" "p.?" "" "0000273423" "00000116" "10" "53" "21" "53" "21" "c.53+21G>A" "r.(=)" "p.(=)" "" "0000273424" "00000116" "90" "579" "1" "579" "1" "c.579+1G>T" "r.spl?" "p.?" "" "0000273425" "00000116" "90" "579" "5" "579" "5" "c.579+5G>A" "r.spl?" "p.?" "" "0000273426" "00000116" "90" "614" "0" "614" "0" "c.614dup" "r.(?)" "p.(Leu206PhefsTer52)" "" "0000273427" "00000116" "90" "617" "0" "617" "0" "c.617T>G" "r.(?)" "p.(Leu206Trp)" "" "0000273428" "00000116" "90" "658" "0" "658" "0" "c.658C>T" "r.(?)" "p.(Gln220Ter)" "" "0000273429" "00000116" "90" "743" "0" "743" "0" "c.743G>C" "r.(?)" "p.(Arg248Thr)" "" "0000273431" "00000116" "10" "744" "-9" "744" "-6" "c.744-9_744-6del" "r.(=)" "p.(=)" "" "0000273432" "00000116" "10" "869" "11" "869" "11" "c.869+11C>T" "r.(=)" "p.(=)" "" "0000273433" "00000116" "50" "91" "0" "91" "0" "c.91C>T" "r.(?)" "p.(Arg31Cys)" "" "0000273434" "00000116" "90" "948" "0" "948" "0" "c.948del" "r.(?)" "p.(Phe316LeufsTer12)" "" "0000273435" "00000116" "50" "997" "0" "997" "0" "c.997C>T" "r.(?)" "p.(Leu333Phe)" "" "0000337030" "00000116" "90" "2657" "5" "2657" "5" "c.2657+5G>A" "r.spl?" "p.?" "" "0000338980" "00000116" "10" "-8" "0" "-8" "0" "c.-8G>C" "r.(?)" "p.(=)" "" "0000339105" "00000116" "50" "1727" "0" "1727" "0" "c.1727G>C" "r.(?)" "p.(Gly576Ala)" "" "0000340765" "00000116" "30" "1584" "0" "1584" "0" "c.1584G>A" "r.(?)" "p.(Glu528=)" "" "0000340988" "00000116" "10" "3285" "0" "3285" "0" "c.3285A>T" "r.(?)" "p.(Thr1095=)" "" "0000340989" "00000116" "30" "3897" "0" "3897" "0" "c.3897A>G" "r.(?)" "p.(Thr1299=)" "" "0000341031" "00000116" "10" "2898" "0" "2898" "0" "c.2898G>A" "r.(?)" "p.(Thr966=)" "" "0000341452" "00000116" "90" "1364" "0" "1364" "0" "c.1364C>A" "r.(?)" "p.(Ala455Glu)" "" "0000341762" "00000116" "90" "3484" "0" "3484" "0" "c.3484C>T" "r.(?)" "p.(Arg1162Ter)" "" "0000341772" "00000116" "70" "349" "0" "349" "0" "c.349C>T" "r.(?)" "p.(Arg117Cys)" "" "0000342409" "00000116" "50" "743" "0" "743" "0" "c.743G>C" "r.(?)" "p.(Arg248Thr)" "" "0000342568" "00000116" "50" "890" "0" "890" "0" "c.890G>A" "r.(?)" "p.(Arg297Gln)" "" "0000343098" "00000116" "90" "1657" "0" "1657" "0" "c.1657C>T" "r.(?)" "p.(Arg553Ter)" "" "0000343231" "00000116" "50" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Arg668Cys)" "" "0000343342" "00000116" "30" "224" "0" "224" "0" "c.224G>A" "r.(?)" "p.(Arg75Gln)" "" "0000344102" "00000116" "50" "1327" "0" "1327" "0" "c.1327G>T" "r.(?)" "p.(Asp443Tyr)" "" "0000345488" "00000116" "50" "1753" "0" "1753" "0" "c.1753G>A" "r.(?)" "p.(Glu585Lys)" "" "0000346151" "00000116" "90" "1624" "0" "1624" "0" "c.1624G>T" "r.(?)" "p.(Gly542Ter)" "" "0000346157" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000346196" "00000116" "50" "1865" "0" "1865" "0" "c.1865G>A" "r.(?)" "p.(Gly622Asp)" "" "0000346198" "00000116" "50" "1882" "0" "1882" "0" "c.1882G>C" "r.(?)" "p.(Gly628Arg)" "" "0000346546" "00000116" "30" "3080" "0" "3080" "0" "c.3080T>C" "r.(?)" "p.(Ile1027Thr)" "" "0000347181" "00000116" "50" "1399" "0" "1399" "0" "c.1399C>T" "r.(?)" "p.(Leu467Phe)" "" "0000347333" "00000116" "50" "264" "0" "264" "0" "c.264A>C" "r.(?)" "p.(Leu88Phe)" "" "0000347352" "00000116" "50" "2991" "0" "2991" "0" "c.2991G>C" "r.(?)" "p.(Leu997Phe)" "" "0000347917" "00000116" "50" "2856" "0" "2856" "0" "c.2856G>C" "r.(?)" "p.(Met952Ile)" "" "0000347927" "00000116" "50" "3154" "0" "3154" "0" "c.3154T>G" "r.(?)" "p.(Phe1052Val)" "" "0000348063" "00000116" "50" "1523" "0" "1523" "0" "c.1523T>G" "r.(?)" "p.(Phe508Cys)" "" "0000348684" "00000116" "50" "3705" "0" "3705" "0" "c.3705T>G" "r.(?)" "p.(Ser1235Arg)" "" "0000348687" "00000116" "90" "3752" "0" "3752" "0" "c.3752G>A" "r.(?)" "p.(Ser1251Asn)" "" "0000349686" "00000116" "90" "3846" "0" "3846" "0" "c.3846G>A" "r.(?)" "p.(Trp1282Ter)" "" "0000350560" "00000116" "10" "1408" "0" "1408" "0" "c.1408G>A" "r.(?)" "p.(Val470Met)" "" "0000350651" "00000116" "30" "2260" "0" "2260" "0" "c.2260G>A" "r.(?)" "p.(Val754Met)" "" "0000350852" "00000116" "30" "1584" "12" "1584" "12" "c.1584+12T>C" "r.(=)" "p.(=)" "" "0000369237" "00000116" "90" "1132" "0" "1132" "0" "c.1132C>T" "r.(?)" "p.(Gln378*)" "9" "0000369417" "00000116" "90" "2455" "0" "2455" "0" "c.2455G>T" "r.(?)" "p.(Glu819*)" "14" "0000369896" "00000116" "90" "4078" "0" "4078" "0" "c.4078del" "r.(?)" "p.(Val1360Phefs*20)" "" "0000369897" "00000116" "90" "4094" "0" "4094" "0" "c.4094del" "r.(?)" "p.(Lys1365Argfs*15)" "" "0000405593" "00000116" "99" "165" "-1" "1584" "1" "c.[(164+1_165-1)_(1584+1_1585-1)del; (2619+1_2620-1)_(2988+1_2989-1)del]" "r.?" "p.?" "2i_11i;15i_18i" "0000530486" "00000116" "10" "-8" "0" "-8" "0" "c.-8G>C" "r.(?)" "p.(=)" "" "0000530488" "00000116" "10" "164" "28" "164" "28" "c.164+28A>G" "r.(=)" "p.(=)" "" "0000530489" "00000116" "90" "178" "0" "178" "0" "c.178G>T" "r.(?)" "p.(Glu60Ter)" "" "0000530490" "00000116" "50" "221" "0" "221" "0" "c.221G>A" "r.(?)" "p.(Arg74Gln)" "" "0000530491" "00000116" "50" "224" "0" "224" "0" "c.224G>A" "r.(?)" "p.(Arg75Gln)" "" "0000530492" "00000116" "30" "224" "0" "224" "0" "c.224G>A" "r.(?)" "p.(Arg75Gln)" "" "0000530493" "00000116" "50" "224" "0" "224" "0" "c.224G>A" "r.(?)" "p.(Arg75Gln)" "" "0000530494" "00000116" "10" "224" "0" "224" "0" "c.224G>A" "r.(?)" "p.(Arg75Gln)" "" "0000530495" "00000116" "70" "328" "0" "328" "0" "c.328G>C" "r.(?)" "p.(Asp110His)" "" "0000530496" "00000116" "90" "332" "0" "332" "0" "c.332C>T" "r.(?)" "p.(Pro111Leu)" "" "0000530497" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000530498" "00000116" "50" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000530499" "00000116" "30" "424" "0" "424" "0" "c.424A>C" "r.(?)" "p.(Ile142Leu)" "" "0000530500" "00000116" "30" "443" "0" "443" "0" "c.443T>C" "r.(?)" "p.(Ile148Thr)" "" "0000530501" "00000116" "70" "617" "0" "617" "0" "c.617T>G" "r.(?)" "p.(Leu206Trp)" "" "0000530502" "00000116" "30" "650" "0" "650" "0" "c.650A>G" "r.(?)" "p.(Glu217Gly)" "" "0000530504" "00000116" "30" "650" "0" "650" "0" "c.650A>G" "r.(?)" "p.(Glu217Gly)" "" "0000530505" "00000116" "10" "744" "-9" "744" "-6" "c.744-9_744-6dup" "r.(=)" "p.(=)" "" "0000530506" "00000116" "50" "838" "0" "838" "0" "c.838G>A" "r.(?)" "p.(Ala280Thr)" "" "0000530507" "00000116" "50" "890" "0" "890" "0" "c.890G>A" "r.(?)" "p.(Arg297Gln)" "" "0000530508" "00000116" "50" "902" "0" "902" "0" "c.902A>G" "r.(?)" "p.(Tyr301Cys)" "" "0000530509" "00000116" "30" "1003" "0" "1003" "0" "c.1003A>C" "r.(?)" "p.(Lys335Gln)" "" "0000530513" "00000116" "30" "1210" "-7" "1210" "-6" "c.1210-7_1210-6dup" "r.(=)" "p.(=)" "" "0000530515" "00000116" "30" "1360" "0" "1362" "0" "c.1360_1362del" "r.(?)" "p.(Leu454del)" "" "0000530517" "00000116" "90" "1364" "0" "1364" "0" "c.1364C>A" "r.(?)" "p.(Ala455Glu)" "" "0000530519" "00000116" "90" "1519" "0" "1521" "0" "c.1519_1521del" "r.(?)" "p.(Ile507del)" "" "0000530520" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000530521" "00000116" "30" "1523" "0" "1523" "0" "c.1523T>G" "r.(?)" "p.(Phe508Cys)" "" "0000530523" "00000116" "10" "1727" "0" "1727" "0" "c.1727G>C" "r.(?)" "p.(Gly576Ala)" "" "0000530524" "00000116" "50" "1727" "0" "1727" "0" "c.1727G>C" "r.(?)" "p.(Gly576Ala)" "" "0000530525" "00000116" "30" "1727" "0" "1727" "0" "c.1727G>C" "r.(?)" "p.(Gly576Ala)" "" "0000530526" "00000116" "90" "1766" "1" "1766" "1" "c.1766+1G>A" "r.spl?" "p.?" "" "0000530527" "00000116" "90" "1766" "1" "1766" "1" "c.1766+1G>A" "r.spl?" "p.?" "" "0000530528" "00000116" "90" "1865" "0" "1865" "0" "c.1865G>A" "r.(?)" "p.(Gly622Asp)" "" "0000530529" "00000116" "10" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Arg668Cys)" "" "0000530530" "00000116" "50" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Arg668Cys)" "" "0000530531" "00000116" "30" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Arg668Cys)" "" "0000530532" "00000116" "30" "2245" "0" "2245" "0" "c.2245C>T" "r.(?)" "p.(Leu749=)" "" "0000530535" "00000116" "30" "2260" "0" "2260" "0" "c.2260G>A" "r.(?)" "p.(Val754Met)" "" "0000530536" "00000116" "30" "2260" "0" "2260" "0" "c.2260G>A" "r.(?)" "p.(Val754Met)" "" "0000530537" "00000116" "50" "2476" "0" "2476" "0" "c.2476G>A" "r.(?)" "p.(Glu826Lys)" "" "0000530538" "00000116" "30" "2502" "0" "2502" "0" "c.2502T>G" "r.(?)" "p.(Phe834Leu)" "" "0000530539" "00000116" "30" "2620" "-15" "2620" "-15" "c.2620-15C>G" "r.(=)" "p.(=)" "" "0000530540" "00000116" "30" "2620" "-6" "2620" "-6" "c.2620-6T>C" "r.(=)" "p.(=)" "" "0000530541" "00000116" "90" "2679" "0" "2679" "0" "c.2679G>T" "r.(?)" "p.(Gly893=)" "" "0000530542" "00000116" "90" "2770" "0" "2770" "0" "c.2770G>A" "r.(?)" "p.(Asp924Asn)" "" "0000530543" "00000116" "50" "2770" "0" "2770" "0" "c.2770G>A" "r.(?)" "p.(Asp924Asn)" "" "0000530544" "00000116" "90" "2780" "0" "2780" "0" "c.2780T>C" "r.(?)" "p.(Leu927Pro)" "" "0000530545" "00000116" "70" "2834" "0" "2834" "0" "c.2834C>T" "r.(?)" "p.(Ser945Leu)" "" "0000530546" "00000116" "50" "2991" "0" "2991" "0" "c.2991G>C" "r.(?)" "p.(Leu997Phe)" "" "0000530547" "00000116" "30" "3015" "0" "3015" "0" "c.3015A>G" "r.(?)" "p.(Ile1005Met)" "" "0000530548" "00000116" "10" "3080" "0" "3080" "0" "c.3080T>C" "r.(?)" "p.(Ile1027Thr)" "" "0000530549" "00000116" "30" "3080" "0" "3080" "0" "c.3080T>C" "r.(?)" "p.(Ile1027Thr)" "" "0000530550" "00000116" "90" "3140" "-26" "3140" "-26" "c.3140-26A>G" "r.(=)" "p.(=)" "" "0000530551" "00000116" "90" "3140" "-26" "3140" "-26" "c.3140-26A>G" "r.(=)" "p.(=)" "" "0000530552" "00000116" "90" "3140" "-26" "3140" "-26" "c.3140-26A>G" "r.(=)" "p.(=)" "" "0000530553" "00000116" "90" "3454" "0" "3454" "0" "c.3454G>C" "r.(?)" "p.(Asp1152His)" "" "0000530554" "00000116" "90" "3454" "0" "3454" "0" "c.3454G>C" "r.(?)" "p.(Asp1152His)" "" "0000530555" "00000116" "90" "3454" "0" "3454" "0" "c.3454G>C" "r.(?)" "p.(Asp1152His)" "" "0000530556" "00000116" "10" "3469" "-17" "3469" "-17" "c.3469-17T>C" "r.(=)" "p.(=)" "" "0000530557" "00000116" "30" "3558" "0" "3558" "0" "c.3558A>G" "r.(?)" "p.(Gln1186=)" "" "0000530558" "00000116" "50" "3563" "0" "3563" "0" "c.3563C>T" "r.(?)" "p.(Ser1188Leu)" "" "0000530559" "00000116" "90" "3700" "0" "3700" "0" "c.3700A>G" "r.(?)" "p.(Ile1234Val)" "" "0000530560" "00000116" "50" "3705" "0" "3705" "0" "c.3705T>G" "r.(?)" "p.(Ser1235Arg)" "" "0000530561" "00000116" "50" "3705" "0" "3705" "0" "c.3705T>G" "r.(?)" "p.(Ser1235Arg)" "" "0000530562" "00000116" "30" "3705" "0" "3705" "0" "c.3705T>G" "r.(?)" "p.(Ser1235Arg)" "" "0000530563" "00000116" "30" "3717" "45" "3717" "45" "c.3717+45G>A" "r.(=)" "p.(=)" "" "0000530564" "00000116" "90" "3718" "-2477" "3718" "-2477" "c.3718-2477C>T" "r.(=)" "p.(=)" "" "0000530565" "00000116" "90" "3752" "0" "3752" "0" "c.3752G>A" "r.(?)" "p.(Ser1251Asn)" "" "0000530566" "00000116" "90" "3752" "0" "3752" "0" "c.3752G>A" "r.(?)" "p.(Ser1251Asn)" "" "0000530567" "00000116" "30" "3897" "0" "3897" "0" "c.3897A>G" "r.(?)" "p.(Thr1299=)" "" "0000530568" "00000116" "30" "3897" "0" "3897" "0" "c.3897A>G" "r.(?)" "p.(Thr1299=)" "" "0000530569" "00000116" "50" "3934" "0" "3934" "0" "c.3934G>T" "r.(?)" "p.(Asp1312Tyr)" "" "0000530570" "00000116" "90" "3937" "0" "3937" "0" "c.3937C>T" "r.(?)" "p.(Gln1313Ter)" "" "0000530573" "00000116" "50" "4186" "0" "4186" "0" "c.4186A>C" "r.(?)" "p.(Thr1396Pro)" "" "0000530574" "00000116" "30" "4242" "10" "4242" "10" "c.4242+10T>C" "r.(=)" "p.(=)" "" "0000530575" "00000116" "10" "4242" "13" "4242" "13" "c.4242+13A>G" "r.(=)" "p.(=)" "" "0000530576" "00000116" "10" "4242" "13" "4242" "13" "c.4242+13A>G" "r.(=)" "p.(=)" "" "0000530577" "00000116" "10" "4272" "0" "4272" "0" "c.4272C>T" "r.(?)" "p.(Tyr1424=)" "" "0000598353" "00000116" "90" "3302" "0" "3302" "0" "c.3302T>A" "r.(?)" "p.(Met1101Lys)" "" "0000610630" "00000116" "90" "125" "0" "125" "0" "c.125C>T" "r.(?)" "p.(Ser42Phe)" "" "0000610631" "00000116" "10" "1210" "-13" "1210" "-13" "c.1210-13G>T" "r.(=)" "p.(=)" "" "0000610634" "00000116" "10" "1408" "0" "1408" "0" "c.1408G>A" "r.(?)" "p.(Val470Met)" "" "0000610635" "00000116" "90" "1585" "-1" "1585" "-1" "c.1585-1G>A" "r.spl?" "p.?" "" "0000610636" "00000116" "10" "1680" "-870" "1680" "-870" "c.1680-870T>A" "r.(=)" "p.(=)" "" "0000610637" "00000116" "30" "2245" "0" "2245" "0" "c.2245C>T" "r.(?)" "p.(Leu749=)" "" "0000610638" "00000116" "30" "2620" "-15" "2620" "-15" "c.2620-15C>G" "r.(=)" "p.(=)" "" "0000610639" "00000116" "30" "3080" "0" "3080" "0" "c.3080T>C" "r.(?)" "p.(Ile1027Thr)" "" "0000610640" "00000116" "50" "3161" "0" "3161" "0" "c.3161A>G" "r.(?)" "p.(His1054Arg)" "" "0000610641" "00000116" "90" "3415" "0" "3415" "0" "c.3415A>G" "r.(?)" "p.(Ile1139Val)" "" "0000610642" "00000116" "70" "3454" "0" "3454" "0" "c.3454G>C" "r.(?)" "p.(Asp1152His)" "" "0000610643" "00000116" "30" "3874" "-61" "3874" "-48" "c.3874-61_3874-48del" "r.(=)" "p.(=)" "" "0000610644" "00000116" "90" "3908" "0" "3908" "0" "c.3908A>T" "r.(?)" "p.(Asn1303Ile)" "" "0000610645" "00000116" "90" "3909" "0" "3909" "0" "c.3909C>G" "r.(?)" "p.(Asn1303Lys)" "" "0000610646" "00000116" "50" "4074" "0" "4074" "0" "c.4074A>T" "r.(?)" "p.(Arg1358Ser)" "" "0000610647" "00000116" "10" "4389" "0" "4389" "0" "c.4389G>A" "r.(?)" "p.(Gln1463=)" "" "0000621806" "00000116" "50" "451" "0" "451" "0" "c.451C>A" "r.(?)" "p.(Gln151Lys)" "" "0000621807" "00000116" "30" "1679" "9" "1679" "9" "c.1679+9C>G" "r.(=)" "p.(=)" "" "0000629503" "00000116" "90" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.0?" "" "0000630800" "00000116" "50" "3909" "0" "3909" "0" "c.3909C>G" "r.(?)" "p.(Asn1303Lys)" "24" "0000630802" "00000116" "50" "3705" "0" "3705" "0" "c.3705T>G" "r.(?)" "p.(Ser1235Arg)" "22" "0000630803" "00000116" "50" "3705" "0" "3705" "0" "c.3705T>G" "r.(?)" "p.(Ser1235Arg)" "22" "0000644181" "00000116" "50" "3687" "0" "3687" "0" "c.3687C>T" "r.(?)" "p.(Asn1229=)" "" "0000652127" "00000116" "90" "11" "0" "11" "0" "c.11C>A" "r.(?)" "p.(Ser4*)" "" "0000652128" "00000116" "50" "91" "0" "91" "0" "c.91C>T" "r.(?)" "p.(Arg31Cys)" "" "0000652129" "00000116" "50" "125" "0" "125" "0" "c.125C>T" "r.(?)" "p.(Ser42Phe)" "" "0000652130" "00000116" "50" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Trp)" "" "0000652131" "00000116" "90" "223" "0" "223" "0" "c.223C>T" "r.(?)" "p.(Arg75*)" "" "0000652132" "00000116" "50" "358" "0" "358" "0" "c.358G>A" "r.(?)" "p.(Ala120Thr)" "" "0000652133" "00000116" "50" "547" "0" "547" "0" "c.547C>A" "r.(?)" "p.(Leu183Ile)" "" "0000652134" "00000116" "50" "592" "0" "592" "0" "c.592G>A" "r.(?)" "p.(Ala198Thr)" "" "0000652135" "00000116" "50" "650" "0" "650" "0" "c.650A>G" "r.(?)" "p.(Glu217Gly)" "" "0000652136" "00000116" "50" "889" "0" "889" "0" "c.889C>T" "r.(?)" "p.(Arg297Trp)" "" "0000652137" "00000116" "90" "1000" "0" "1000" "0" "c.1000C>T" "r.(?)" "p.(Arg334Trp)" "" "0000652138" "00000116" "90" "1367" "0" "1367" "0" "c.1367T>C" "r.(?)" "p.(Val456Ala)" "" "0000652139" "00000116" "90" "1393" "-1" "1393" "-1" "c.1393-1G>A" "r.spl?" "p.?" "" "0000652140" "00000116" "50" "1453" "0" "1453" "0" "c.1453A>T" "r.(?)" "p.(Ser485Cys)" "" "0000652141" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000652142" "00000116" "90" "1624" "0" "1624" "0" "c.1624G>T" "r.(?)" "p.(Gly542*)" "" "0000652143" "00000116" "30" "1666" "0" "1666" "0" "c.1666A>G" "r.(?)" "p.(Ile556Val)" "" "0000652144" "00000116" "90" "1753" "0" "1753" "0" "c.1753G>T" "r.(?)" "p.(Glu585*)" "" "0000652145" "00000116" "90" "1792" "0" "1798" "0" "c.1792_1798del" "r.(?)" "p.(Lys598Glyfs*11)" "" "0000652146" "00000116" "50" "1801" "0" "1801" "0" "c.1801A>T" "r.(?)" "p.(Ile601Phe)" "" "0000652147" "00000116" "50" "1841" "0" "1841" "0" "c.1841A>G" "r.(?)" "p.(Asp614Gly)" "" "0000652148" "00000116" "70" "1865" "0" "1865" "0" "c.1865G>A" "r.(?)" "p.(Gly622Asp)" "" "0000652149" "00000116" "90" "1986" "0" "1989" "0" "c.1986_1989del" "r.(?)" "p.(Thr663Argfs*8)" "" "0000652151" "00000116" "50" "2297" "0" "2297" "0" "c.2297G>T" "r.(?)" "p.(Arg766Met)" "" "0000652152" "00000116" "50" "2421" "0" "2421" "0" "c.2421A>G" "r.(?)" "p.(Ile807Met)" "" "0000652153" "00000116" "90" "2551" "0" "2551" "0" "c.2551C>T" "r.(?)" "p.(Arg851*)" "" "0000652154" "00000116" "50" "2756" "0" "2756" "0" "c.2756A>G" "r.(?)" "p.(Tyr919Cys)" "" "0000652155" "00000116" "50" "2981" "0" "2981" "0" "c.2981T>G" "r.(?)" "p.(Phe994Cys)" "" "0000652156" "00000116" "50" "3209" "0" "3209" "0" "c.3209G>A" "r.(?)" "p.(Arg1070Gln)" "" "0000652158" "00000116" "50" "3322" "0" "3322" "0" "c.3322G>C" "r.(?)" "p.(Val1108Leu)" "" "0000652159" "00000116" "90" "3353" "0" "3353" "0" "c.3353C>T" "r.(?)" "p.(Ser1118Phe)" "" "0000652160" "00000116" "50" "3454" "0" "3454" "0" "c.3454G>C" "r.(?)" "p.(Asp1152His)" "" "0000652161" "00000116" "90" "3484" "0" "3484" "0" "c.3484C>T" "r.(?)" "p.(Arg1162*)" "" "0000652162" "00000116" "90" "3659" "0" "3659" "0" "c.3659del" "r.(?)" "p.(Thr1220Lysfs*8)" "" "0000652163" "00000116" "90" "3718" "-2477" "3718" "-2477" "c.3718-2477C>T" "r.(=)" "p.(=)" "" "0000652164" "00000116" "50" "3737" "0" "3737" "0" "c.3737C>T" "r.(?)" "p.(Thr1246Ile)" "" "0000652165" "00000116" "90" "3761" "0" "3761" "0" "c.3761T>G" "r.(?)" "p.(Leu1254*)" "" "0000652166" "00000116" "50" "3808" "0" "3808" "0" "c.3808G>A" "r.(?)" "p.(Asp1270Asn)" "" "0000652167" "00000116" "50" "3854" "0" "3854" "0" "c.3854C>T" "r.(?)" "p.(Ala1285Val)" "" "0000652168" "00000116" "50" "4009" "0" "4009" "0" "c.4009T>G" "r.(?)" "p.(Phe1337Val)" "" "0000652169" "00000116" "90" "4426" "0" "4426" "0" "c.4426C>T" "r.(?)" "p.(Gln1476*)" "" "0000653069" "00000116" "50" "224" "0" "224" "0" "c.224G>A" "r.(?)" "p.(Arg75Gln)" "" "0000653070" "00000116" "50" "1584" "0" "1584" "0" "c.1584G>A" "r.(=)" "p.(=)" "" "0000653071" "00000116" "50" "2758" "0" "2758" "0" "c.2758G>A" "r.(?)" "p.(Val920Met)" "" "0000653072" "00000116" "70" "3038" "0" "3038" "0" "c.3038C>A" "r.(?)" "p.(Pro1013His)" "" "0000653073" "00000116" "90" "3197" "0" "3197" "0" "c.3197G>A" "r.(?)" "p.(Arg1066His)" "" "0000653172" "00000116" "90" "178" "0" "178" "0" "c.178G>T" "r.(?)" "p.(Glu60*)" "" "0000653173" "00000116" "90" "349" "0" "349" "0" "c.349C>T" "r.(?)" "p.(Arg117Cys)" "" "0000653174" "00000116" "90" "1558" "0" "1558" "0" "c.1558G>T" "r.(?)" "p.(Val520Phe)" "" "0000653207" "00000116" "90" "409" "0" "412" "0" "c.409_412del" "r.(?)" "p.(Leu137Tyrfs*15)" "" "0000653208" "00000116" "90" "409" "0" "409" "0" "c.409del" "r.(?)" "p.(Leu137Serfs*16)" "" "0000653285" "00000116" "90" "3879" "0" "3886" "0" "c.3879_3886del" "r.(?)" "p.(Ile1295Trpfs*4)" "" "0000653289" "00000116" "90" "2600" "0" "2600" "0" "c.2600dup" "r.(?)" "p.(Leu867Phefs*29)" "" "0000653290" "00000116" "90" "3908" "0" "3908" "0" "c.3908del" "r.(?)" "p.(Asn1303Thrfs*25)" "" "0000655715" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000655716" "00000116" "50" "547" "0" "547" "0" "c.547C>A" "r.(?)" "p.(Leu183Ile)" "" "0000655717" "00000116" "50" "665" "0" "665" "0" "c.665C>G" "r.(?)" "p.(Ser222Cys)" "" "0000655718" "00000116" "50" "1364" "0" "1364" "0" "c.1364C>T" "r.(?)" "p.(Ala455Val)" "" "0000655719" "00000116" "50" "1558" "0" "1558" "0" "c.1558G>A" "r.(?)" "p.(Val520Ile)" "" "0000655720" "00000116" "30" "1581" "0" "1581" "0" "c.1581A>G" "r.(?)" "p.(Glu527=)" "" "0000655721" "00000116" "50" "1951" "0" "1951" "0" "c.1951G>A" "r.(?)" "p.(Asp651Asn)" "" "0000655722" "00000116" "30" "2502" "0" "2502" "0" "c.2502T>G" "r.(?)" "p.(Phe834Leu)" "" "0000655723" "00000116" "30" "2973" "0" "2973" "0" "c.2973A>G" "r.(?)" "p.(Ile991Met)" "" "0000655724" "00000116" "50" "2991" "0" "2991" "0" "c.2991G>C" "r.(?)" "p.(Leu997Phe)" "" "0000655725" "00000116" "90" "3472" "0" "3472" "0" "c.3472C>T" "r.(?)" "p.(Arg1158Ter)" "" "0000655726" "00000116" "70" "3718" "-2477" "3718" "-2477" "c.3718-2477C>T" "r.(=)" "p.(=)" "" "0000655727" "00000116" "70" "3935" "0" "3935" "0" "c.3935A>G" "r.(?)" "p.(Asp1312Gly)" "" "0000660697" "00000116" "90" "1040" "0" "1040" "0" "c.1040G>A" "r.(?)" "p.(Arg347His)" "" "0000660698" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000660699" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000660700" "00000116" "90" "178" "0" "178" "0" "c.178G>T" "r.(?)" "p.(Glu60*)" "" "0000663288" "00000116" "90" "1519" "0" "1521" "0" "c.1519_1521del" "r.(?)" "p.(Ile507del)" "" "0000663289" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663290" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663291" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663292" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663293" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663294" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663295" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663296" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663297" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663298" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663299" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663300" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663301" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663302" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663303" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663304" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663305" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663306" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663307" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663308" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663309" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663310" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663311" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663312" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663313" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663314" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663315" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663316" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663317" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663318" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663319" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663320" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663321" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663322" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663323" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663324" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663325" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663326" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663327" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663328" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663329" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663330" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663331" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663332" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663333" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663334" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663335" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663336" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663337" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663338" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663339" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663340" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663341" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663342" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663343" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663344" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663345" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663346" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663347" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663348" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663349" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663350" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663351" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663352" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663353" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663354" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663355" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663356" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663357" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663358" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663359" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663360" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663361" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663362" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663363" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663364" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663365" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663366" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663367" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663368" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663369" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663370" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663371" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663372" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663373" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663374" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663375" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663376" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663377" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663378" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663379" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663380" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663381" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663382" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663383" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663384" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663385" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663386" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663387" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663388" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663389" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663390" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663391" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663392" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663393" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663394" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663395" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663396" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663397" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663398" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663399" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663400" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663401" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663402" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663403" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663404" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663405" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663406" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663407" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663408" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663409" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663410" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663411" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663412" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663413" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663414" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663415" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663416" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663417" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663418" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663419" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663420" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663421" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663422" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663423" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663424" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663425" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663426" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663427" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663428" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663429" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663430" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663431" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663432" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663433" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663434" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663435" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663436" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663437" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663438" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663439" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663440" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663441" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663442" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663443" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663444" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663445" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663446" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663447" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663448" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663449" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000663450" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663451" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663452" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663453" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663454" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663455" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663456" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663457" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663458" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000663459" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000663460" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000663461" "00000116" "90" "1000" "0" "1000" "0" "c.1000C>T" "r.(?)" "p.(Arg334Trp)" "" "0000663462" "00000116" "90" "1558" "0" "1558" "0" "c.1558G>T" "r.(?)" "p.(Val520Phe)" "" "0000663463" "00000116" "90" "1585" "-1" "1585" "-1" "c.1585-1G>A" "r.spl" "p.?" "" "0000663464" "00000116" "90" "1679" "0" "1679" "0" "c.1679G>C" "r.(?)" "p.(Arg560Thr)" "" "0000663465" "00000116" "90" "2052" "0" "2052" "0" "c.2052del" "r.(?)" "p.(Lys684Asnfs*38)" "" "0000663466" "00000116" "90" "1021" "0" "1022" "0" "c.1021_1022dup" "r.(?)" "p.(Phe342Hisfs*28)" "" "0000663467" "00000116" "90" "1040" "0" "1040" "0" "c.1040G>C" "r.(?)" "p.(Arg347Pro)" "" "0000663468" "00000116" "90" "1519" "0" "1521" "0" "c.1519_1521del" "r.(?)" "p.(Ile507del)" "" "0000663469" "00000116" "90" "1519" "0" "1521" "0" "c.1519_1521del" "r.(?)" "p.(Ile507del)" "" "0000663470" "00000116" "90" "1558" "0" "1558" "0" "c.1558G>T" "r.(?)" "p.(Val520Phe)" "" "0000663471" "00000116" "90" "1558" "0" "1558" "0" "c.1558G>T" "r.(?)" "p.(Val520Phe)" "" "0000663472" "00000116" "90" "1585" "-1" "1585" "-1" "c.1585-1G>A" "r.spl" "p.?" "" "0000663473" "00000116" "90" "1585" "-1" "1585" "-1" "c.1585-1G>A" "r.spl" "p.?" "" "0000663474" "00000116" "90" "1624" "0" "1624" "0" "c.1624G>T" "r.(?)" "p.(Gly542*)" "" "0000663475" "00000116" "90" "1624" "0" "1624" "0" "c.1624G>T" "r.(?)" "p.(Gly542*)" "" "0000663476" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663477" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663478" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663479" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663480" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663481" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663482" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663483" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663484" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663485" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663486" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663487" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663488" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663489" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663490" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663491" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663492" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000663493" "00000116" "90" "1679" "0" "1679" "0" "c.1679G>C" "r.(?)" "p.(Arg560Thr)" "" "0000663494" "00000116" "90" "1679" "0" "1679" "0" "c.1679G>C" "r.(?)" "p.(Arg560Thr)" "" "0000663495" "00000116" "90" "1679" "0" "1679" "0" "c.1679G>C" "r.(?)" "p.(Arg560Thr)" "" "0000663496" "00000116" "90" "1679" "0" "1679" "0" "c.1679G>C" "r.(?)" "p.(Arg560Thr)" "" "0000663497" "00000116" "90" "1943" "0" "1943" "0" "c.1943del" "r.(?)" "p.(Asp648Valfs*15)" "" "0000663498" "00000116" "90" "2052" "0" "2052" "0" "c.2052dup" "r.(?)" "p.(Gln685Thrfs*4)" "" "0000663499" "00000116" "90" "2128" "0" "2128" "0" "c.2128A>T" "r.(?)" "p.(Lys710*)" "" "0000663500" "00000116" "90" "2490" "1" "2490" "1" "c.2490+1G>A" "r.spl" "p.?" "" "0000663501" "00000116" "90" "2490" "1" "2490" "1" "c.2490+1G>T" "r.spl" "p.?" "" "0000663502" "00000116" "90" "2657" "2" "2657" "3" "c.2657+2_2657+3insA" "r.spl" "p.?" "" "0000663503" "00000116" "90" "2657" "2" "2657" "3" "c.2657+2_2657+3insA" "r.spl" "p.?" "" "0000663504" "00000116" "90" "275" "0" "489" "1" "c.275_489+1del" "r.spl" "p.?" "" "0000663505" "00000116" "90" "2875" "0" "2875" "0" "c.2875del" "r.(?)" "p.(Ala959Hisfs*9)" "" "0000663506" "00000116" "90" "2896" "0" "2896" "0" "c.2896del" "r.(?)" "p.(Thr966Argfs*2)" "" "0000663507" "00000116" "90" "2988" "1" "2988" "1" "c.2988+1G>A" "r.spl" "p.?" "" "0000663508" "00000116" "90" "3140" "-26" "3140" "-26" "c.3140-26A>G" "r.spl" "p.(=)" "" "0000663509" "00000116" "90" "328" "0" "328" "0" "c.328G>C" "r.(?)" "p.(Asp110His)" "" "0000663510" "00000116" "90" "3472" "0" "3472" "0" "c.3472C>T" "r.(?)" "p.(Arg1158*)" "" "0000663511" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000663512" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000663513" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000663514" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000663515" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000663516" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000663517" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000663518" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000663519" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000663520" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000663521" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000663522" "00000116" "90" "3659" "0" "3659" "0" "c.3659del" "r.(?)" "p.(Thr1220Lysfs*8)" "" "0000663523" "00000116" "90" "3718" "-2477" "3718" "-2477" "c.3718-2477C>T" "r.spl" "p.(=)" "" "0000663524" "00000116" "90" "3718" "-2477" "3718" "-2477" "c.3718-2477C>T" "r.spl" "p.(=)" "" "0000663525" "00000116" "90" "3718" "-2477" "3718" "-2477" "c.3718-2477C>T" "r.spl" "p.(=)" "" "0000663526" "00000116" "90" "3846" "0" "3846" "0" "c.3846G>A" "r.(?)" "p.(Trp1282*)" "" "0000663527" "00000116" "90" "3909" "0" "3909" "0" "c.3909C>G" "r.(?)" "p.(Asn1303Lys)" "" "0000663528" "00000116" "90" "3909" "0" "3909" "0" "c.3909C>G" "r.(?)" "p.(Asn1303Lys)" "" "0000663529" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000663530" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000663531" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000663532" "00000116" "90" "532" "0" "532" "0" "c.532G>A" "r.(?)" "p.(Gly178Arg)" "" "0000663533" "00000116" "90" "1679" "0" "1679" "0" "c.1679G>C" "r.(?)" "p.(Arg560Thr)" "" "0000663534" "00000116" "90" "200" "0" "200" "0" "c.200C>T" "r.(?)" "p.(Pro67Leu)" "" "0000663535" "00000116" "90" "2252" "0" "2252" "0" "c.2252G>T" "r.(?)" "p.(Arg751Leu)" "" "0000663536" "00000116" "90" "2551" "0" "2551" "0" "c.2551C>T" "r.(?)" "p.(Arg851*)" "" "0000663537" "00000116" "90" "2930" "0" "2930" "0" "c.2930C>T" "r.(?)" "p.(Ser977Phe)" "" "0000663538" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000663539" "00000116" "90" "1558" "0" "1558" "0" "c.1558G>T" "r.(?)" "p.(Val520Phe)" "" "0000663540" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000663541" "00000116" "90" "350" "0" "350" "0" "c.350G>T" "r.(?)" "p.(Arg117Leu)" "" "0000663542" "00000116" "90" "1327" "0" "1330" "0" "c.1327_1330dup" "r.(?)" "p.(Ile444Argfs*3)" "" "0000663543" "00000116" "90" "1477" "0" "1477" "0" "c.1477C>T" "r.(?)" "p.(Gln493*)" "" "0000663544" "00000116" "90" "2657" "2" "2657" "3" "c.2657+2_2657+3insA" "r.spl" "p.?" "" "0000663545" "00000116" "90" "1766" "1" "1766" "1" "c.1766+1G>A" "r.spl" "p.?" "" "0000664803" "00000116" "50" "3274" "0" "3274" "0" "c.3274T>C" "r.(?)" "p.(Tyr1092His)" "" "0000664847" "00000116" "90" "1000" "0" "1000" "0" "c.1000C>T" "r.(?)" "p.(Arg334Trp)" "" "0000664848" "00000116" "90" "1040" "0" "1040" "0" "c.1040G>C" "r.(?)" "p.(Arg347Pro)" "" "0000664849" "00000116" "90" "1558" "0" "1558" "0" "c.1558G>T" "r.(?)" "p.(Val520Phe)" "" "0000664850" "00000116" "90" "1519" "0" "1521" "0" "c.1519_1521del" "r.(?)" "p.(Ile507del)" "" "0000664851" "00000116" "90" "1519" "0" "1521" "0" "c.1519_1521del" "r.(?)" "p.(Ile507del)" "" "0000664852" "00000116" "90" "1519" "0" "1521" "0" "c.1519_1521del" "r.(?)" "p.(Ile507del)" "" "0000664853" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664854" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664855" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664856" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664857" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664858" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664859" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664860" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664861" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664862" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664863" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664864" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664865" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664866" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664867" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664868" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664869" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664870" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664871" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664872" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664873" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664874" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664875" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664876" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664877" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664878" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664879" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664880" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664881" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664882" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664883" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664884" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664885" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664886" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664887" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664888" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664889" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664890" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664891" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664892" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664893" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664894" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664895" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664896" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664897" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664898" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664899" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664900" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664901" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664902" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664903" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664904" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664905" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664906" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664907" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664908" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664909" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664910" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664911" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664912" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664913" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664914" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664915" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664916" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664917" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664918" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664919" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664920" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664921" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664922" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664923" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664924" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664925" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664926" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664927" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664928" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664929" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664930" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664931" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664932" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664933" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664934" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664935" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664936" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664937" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664938" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664939" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664940" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664941" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664942" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664943" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664944" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664945" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664946" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664947" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664948" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664949" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664950" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664951" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664952" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664953" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664954" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664955" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664956" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664957" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664958" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664959" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664960" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664961" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664962" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664963" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664964" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664965" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664966" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664967" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664968" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664969" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664970" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664971" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664972" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664973" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664974" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664975" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664976" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664977" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664978" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664979" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664980" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664981" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664982" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664983" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664984" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664985" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664986" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664987" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664988" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664989" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664990" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664991" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664992" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664993" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664994" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664995" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664996" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664997" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664998" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000664999" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665000" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665001" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665002" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665003" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665004" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665005" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665006" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665007" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665008" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665009" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665010" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665011" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665012" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665013" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665014" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665015" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665016" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665017" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665018" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665019" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665020" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665021" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665022" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665023" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665024" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665025" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665026" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665027" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665028" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665029" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665030" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665031" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665032" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665033" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665034" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665035" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665036" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665037" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665038" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665039" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665040" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665041" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665042" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665043" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665044" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665045" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665046" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665047" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665048" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665049" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665050" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665051" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665052" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665053" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665054" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665055" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665056" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665057" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665058" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665059" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665060" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665061" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665062" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665063" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665064" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665065" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665066" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665067" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665068" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665069" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665070" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665071" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665072" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665073" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665074" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665075" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665076" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665077" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665078" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665079" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665080" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665081" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665082" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665083" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665084" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665085" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665086" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665087" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665088" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665089" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665090" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665091" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665092" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665093" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665094" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665095" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665096" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665097" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665098" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665099" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665100" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665101" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665102" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Ile507del)" "" "0000665103" "00000116" "90" "1585" "-1" "1585" "-1" "c.1585-1G>A" "r.spl" "p.?" "" "0000665104" "00000116" "90" "1585" "-1" "1585" "-1" "c.1585-1G>A" "r.spl" "p.?" "" "0000665105" "00000116" "90" "1585" "-1" "1585" "-1" "c.1585-1G>A" "r.spl" "p.?" "" "0000665106" "00000116" "90" "1624" "0" "1624" "0" "c.1624G>T" "r.(?)" "p.(Gly542*)" "" "0000665107" "00000116" "90" "1624" "0" "1624" "0" "c.1624G>T" "r.(?)" "p.(Gly542*)" "" "0000665108" "00000116" "90" "1647" "0" "1647" "0" "c.1647T>A" "r.(?)" "p.(Ser549Arg)" "" "0000665109" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665110" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665111" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665112" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665113" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665114" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665115" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665116" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665117" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665118" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665119" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665120" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665121" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665122" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665123" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665124" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665125" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665126" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665127" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665128" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665129" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665130" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665131" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665132" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665133" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665134" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665135" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665136" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665137" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665138" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665139" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665140" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665141" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665142" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665143" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665144" "00000116" "90" "1657" "0" "1657" "0" "c.1657C>T" "r.(?)" "p.(Arg553*)" "" "0000665145" "00000116" "90" "1657" "0" "1657" "0" "c.1657C>T" "r.(?)" "p.(Arg553*)" "" "0000665146" "00000116" "90" "1679" "0" "1679" "0" "c.1679G>C" "r.(?)" "p.(Arg560Thr)" "" "0000665147" "00000116" "90" "1679" "0" "1679" "0" "c.1679G>C" "r.(?)" "p.(Arg560Thr)" "" "0000665148" "00000116" "90" "1679" "0" "1679" "0" "c.1679G>C" "r.(?)" "p.(Arg560Thr)" "" "0000665149" "00000116" "90" "1679" "0" "1679" "0" "c.1679G>C" "r.(?)" "p.(Arg560Thr)" "" "0000665150" "00000116" "90" "1679" "0" "1679" "0" "c.1679G>C" "r.(?)" "p.(Arg560Thr)" "" "0000665151" "00000116" "90" "254" "0" "254" "0" "c.254G>A" "r.(?)" "p.(Gly85Glu)" "" "0000665152" "00000116" "90" "254" "0" "254" "0" "c.254G>A" "r.(?)" "p.(Gly85Glu)" "" "0000665153" "00000116" "90" "254" "0" "254" "0" "c.254G>A" "r.(?)" "p.(Gly85Glu)" "" "0000665154" "00000116" "90" "2988" "1" "2988" "1" "c.2988+1G>A" "r.spl" "p.?" "" "0000665155" "00000116" "90" "3484" "0" "3484" "0" "c.3484C>T" "r.(?)" "p.(Arg1162*)" "" "0000665156" "00000116" "90" "3659" "0" "3659" "0" "c.3659del" "r.(?)" "p.(Thr1220Lysfs*8)" "" "0000665157" "00000116" "90" "3659" "0" "3659" "0" "c.3659del" "r.(?)" "p.(Thr1220Lysfs*8)" "" "0000665158" "00000116" "90" "3659" "0" "3659" "0" "c.3659del" "r.(?)" "p.(Thr1220Lysfs*8)" "" "0000665159" "00000116" "90" "3659" "0" "3659" "0" "c.3659del" "r.(?)" "p.(Thr1220Lysfs*8)" "" "0000665160" "00000116" "90" "3909" "0" "3909" "0" "c.3909C>G" "r.(?)" "p.(Asn1303Lys)" "" "0000665161" "00000116" "90" "3909" "0" "3909" "0" "c.3909C>G" "r.(?)" "p.(Asn1303Lys)" "" "0000665162" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000665163" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000665164" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000665165" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000665166" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000665167" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665168" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665170" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665171" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665172" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665173" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665174" "00000116" "90" "1652" "0" "1652" "0" "c.1652G>A" "r.(?)" "p.(Gly551Asp)" "" "0000665175" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665176" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665177" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665178" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665179" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665180" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665181" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665182" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665183" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665184" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665185" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000665186" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665187" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665188" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665189" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665190" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000665191" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665192" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665193" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665194" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665195" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665196" "00000116" "90" "489" "1" "489" "1" "c.489+1G>T" "r.spl" "p.?" "" "0000665197" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665198" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000665199" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665200" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665201" "00000116" "90" "2988" "1" "2988" "1" "c.2988+1G>A" "r.spl" "p.?" "" "0000665202" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665203" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665204" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665205" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665206" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665207" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665208" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665209" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665210" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665211" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665212" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665213" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000665214" "00000116" "50" "1210" "-11" "1210" "-11" "c.1210-11T>G" "r.spl?" "p.(=)" "" "0000665215" "00000116" "50" "-4" "0" "-4" "0" "c.-4G>C" "r.(?)" "p.(=)" "" "0000674000" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000677932" "00000116" "70" "200" "0" "200" "0" "c.200C>T" "r.(?)" "p.(Pro67Leu)" "" "0000677933" "00000116" "90" "223" "0" "223" "0" "c.223C>T" "r.(?)" "p.(Arg75Ter)" "" "0000677934" "00000116" "70" "254" "0" "254" "0" "c.254G>A" "r.(?)" "p.(Gly85Glu)" "" "0000677935" "00000116" "50" "721" "0" "721" "0" "c.721G>A" "r.(?)" "p.(Gly241Arg)" "" "0000677936" "00000116" "50" "958" "0" "958" "0" "c.958T>G" "r.(?)" "p.(Leu320Val)" "" "0000677937" "00000116" "50" "1934" "0" "1934" "0" "c.1934T>A" "r.(?)" "p.(Met645Lys)" "" "0000677938" "00000116" "50" "2855" "0" "2855" "0" "c.2855T>C" "r.(?)" "p.(Met952Thr)" "" "0000677939" "00000116" "30" "3204" "0" "3204" "0" "c.3204C>T" "r.(?)" "p.(Phe1068=)" "" "0000677940" "00000116" "30" "3558" "0" "3558" "0" "c.3558A>G" "r.(?)" "p.(Gln1186=)" "" "0000677941" "00000116" "50" "4129" "0" "4129" "0" "c.4129G>C" "r.(?)" "p.(Asp1377His)" "" "0000677942" "00000116" "50" "4333" "0" "4333" "0" "c.4333G>A" "r.(?)" "p.(Asp1445Asn)" "" "0000682855" "00000116" "90" "1657" "0" "1657" "0" "c.1657C>T" "r.(?)" "p.(Arg553*)" "" "0000682856" "00000116" "50" "489" "3" "489" "3" "c.489+3A>G" "r.(?)" "p.(?)" "" "0000684764" "00000116" "30" "1210" "-11" "1210" "-11" "c.1210-11T>G" "r.(=)" "p.(=)" "" "0000684765" "00000116" "30" "1666" "0" "1666" "0" "c.1666A>G" "r.(?)" "p.(Ile556Val)" "" "0000684766" "00000116" "10" "3717" "45" "3717" "45" "c.3717+45G>A" "r.(=)" "p.(=)" "" "0000684767" "00000116" "30" "4056" "0" "4056" "0" "c.4056G>C" "r.(?)" "p.(Gln1352His)" "" "0000685858" "00000116" "11" "-8" "0" "-8" "0" "c.-8G>C" "r.(?)" "p.(=)" "" "0000685859" "00000116" "77" "1001" "0" "1001" "0" "c.1001G>A" "r.(?)" "p.(Arg334Gln)" "" "0000685860" "00000116" "99" "1001" "0" "1001" "0" "c.1001G>T" "r.(?)" "p.(Arg334Leu)" "" "0000685861" "00000116" "99" "1037" "0" "1037" "0" "c.1037T>C" "r.(?)" "p.(Leu346Pro)" "" "0000685862" "00000116" "55" "1046" "0" "1046" "0" "c.1046C>T" "r.(?)" "p.(Ala349Val)" "" "0000685863" "00000116" "77" "1054" "0" "1054" "0" "c.1054C>T" "r.(?)" "p.(Arg352Trp)" "" "0000685864" "00000116" "99" "1358" "0" "1358" "0" "c.1358T>C" "r.(?)" "p.(Leu453Ser)" "" "0000685865" "00000116" "99" "1367" "0" "1367" "0" "c.1367T>C" "r.(?)" "p.(Val456Ala)" "" "0000685866" "00000116" "99" "1420" "0" "1420" "0" "c.1420G>A" "r.(?)" "p.(Glu474Lys)" "" "0000685867" "00000116" "77" "14" "0" "14" "0" "c.14C>T" "r.(?)" "p.(Pro5Leu)" "" "0000685868" "00000116" "99" "1505" "0" "1505" "0" "c.1505T>C" "r.(?)" "p.(Ile502Thr)" "" "0000685869" "00000116" "11" "1523" "0" "1523" "0" "c.1523T>G" "r.(?)" "p.(Phe508Cys)" "" "0000685870" "00000116" "99" "1538" "0" "1538" "0" "c.1538A>G" "r.(?)" "p.(Asp513Gly)" "" "0000685871" "00000116" "11" "1584" "0" "1584" "0" "c.1584G>A" "r.spl?" "p.(Glu528=)" "" "0000685872" "00000116" "55" "164" "28" "164" "28" "c.164+28A>G" "r.spl?" "p.?" "" "0000685873" "00000116" "99" "164" "2" "164" "2" "c.164+2T>C" "r.spl" "p.?" "" "0000685874" "00000116" "99" "164" "4" "164" "4" "c.164+4dup" "r.spl?" "p.?" "" "0000685875" "00000116" "11" "165" "-3" "165" "-3" "c.165-3C>T" "r.spl?" "p.?" "" "0000685876" "00000116" "99" "1687" "0" "1687" "0" "c.1687T>A" "r.(?)" "p.(Tyr563Asn)" "" "0000685877" "00000116" "99" "1687" "0" "1687" "0" "c.1687T>G" "r.(?)" "p.(Tyr563Asp)" "" "0000685878" "00000116" "99" "169" "0" "169" "0" "c.169T>G" "r.(?)" "p.(Trp57Gly)" "" "0000685879" "00000116" "99" "1721" "0" "1721" "0" "c.1721C>A" "r.(?)" "p.(Pro574His)" "" "0000685880" "00000116" "77" "1724" "0" "1724" "0" "c.1724T>A" "r.(?)" "p.(Phe575Tyr)" "" "0000685881" "00000116" "99" "1766" "1" "1766" "1" "c.1766+1G>T" "r.(?)" "p.?" "" "0000685882" "00000116" "99" "178" "0" "178" "0" "c.178G>A" "r.(?)" "p.(Glu60Lys)" "" "0000685883" "00000116" "99" "1801" "0" "1801" "0" "c.1801A>T" "r.(?)" "p.(Ile601Phe)" "" "0000685884" "00000116" "99" "1826" "0" "1826" "0" "c.1826A>G" "r.(?)" "p.(His609Arg)" "" "0000685885" "00000116" "99" "1837" "0" "1837" "0" "c.1837G>A" "r.(?)" "p.(Ala613Thr)" "" "0000685886" "00000116" "77" "1853" "0" "1853" "0" "c.1853T>C" "r.(?)" "p.(Ile618Thr)" "" "0000685887" "00000116" "77" "1865" "0" "1865" "0" "c.1865G>A" "r.(?)" "p.(Gly622Asp)" "" "0000685888" "00000116" "99" "2158" "0" "2158" "0" "c.2158C>T" "r.(?)" "p.(Gln720*)" "" "0000685889" "00000116" "77" "2249" "0" "2249" "0" "c.2249C>T" "r.(?)" "p.(Pro750Leu)" "" "0000685890" "00000116" "11" "2421" "0" "2421" "0" "c.2421A>G" "r.(?)" "p.(Ile807Met)" "" "0000685891" "00000116" "99" "271" "0" "271" "0" "c.271G>A" "r.(?)" "p.(Gly91Arg)" "" "0000685892" "00000116" "55" "2735" "0" "2735" "0" "c.2735C>T" "r.(?)" "p.(Ser912Leu)" "" "0000685893" "00000116" "99" "274" "-2" "274" "-2" "c.274-2A>G" "r.spl" "p.?" "" "0000685894" "00000116" "55" "2770" "0" "2770" "0" "c.2770G>A" "r.(?)" "p.(Asp924Asn)" "" "0000685895" "00000116" "55" "2855" "0" "2855" "0" "c.2855T>C" "r.(?)" "p.(Met952Thr)" "" "0000685896" "00000116" "77" "2900" "0" "2900" "0" "c.2900T>C" "r.(?)" "p.(Leu967Ser)" "" "0000685897" "00000116" "99" "2909" "0" "2909" "0" "c.2909G>A" "r.(?)" "p.(Gly970Asp)" "" "0000685898" "00000116" "99" "2936" "0" "2936" "0" "c.2936A>T" "r.(?)" "p.(Asp979Val)" "" "0000685899" "00000116" "99" "293" "0" "293" "0" "c.293A>G" "r.(?)" "p.(Gln98Arg)" "" "0000685900" "00000116" "99" "296" "0" "296" "0" "c.296C>T" "r.(?)" "p.(Pro99Leu)" "" "0000685901" "00000116" "99" "3017" "0" "3017" "0" "c.3017C>A" "r.(?)" "p.(Ala1006Glu)" "" "0000685902" "00000116" "55" "3041" "0" "3041" "0" "c.3041A>G" "r.(?)" "p.(Tyr1014Cys)" "" "0000685903" "00000116" "77" "3047" "0" "3047" "0" "c.3047T>C" "r.(?)" "p.(Phe1016Ser)" "" "0000685904" "00000116" "99" "305" "0" "305" "0" "c.305T>G" "r.(?)" "p.(Leu102Arg)" "" "0000685905" "00000116" "77" "3095" "0" "3095" "0" "c.3095A>G" "r.(?)" "p.(Tyr1032Cys)" "" "0000685906" "00000116" "99" "3107" "0" "3107" "0" "c.3107C>A" "r.(?)" "p.(Thr1036Asn)" "" "0000685907" "00000116" "11" "3158" "0" "3158" "0" "c.3158C>T" "r.(?)" "p.(Thr1053Ile)" "" "0000685908" "00000116" "99" "3292" "0" "3292" "0" "c.3292T>C" "r.(?)" "p.(Trp1098Arg)" "" "0000685909" "00000116" "77" "3297" "0" "3297" "0" "c.3297C>A" "r.(?)" "p.(Phe1099Leu)" "" "0000685910" "00000116" "99" "3302" "0" "3302" "0" "c.3302T>G" "r.(?)" "p.(Met1101Arg)" "" "0000685911" "00000116" "77" "330" "0" "330" "0" "c.330C>A" "r.(?)" "p.(Asp110Glu)" "" "0000685912" "00000116" "99" "3353" "0" "3353" "0" "c.3353C>T" "r.(?)" "p.(Ser1118Phe)" "" "0000685913" "00000116" "77" "3458" "0" "3458" "0" "c.3458T>A" "r.(?)" "p.(Val1153Glu)" "" "0000685914" "00000116" "99" "3475" "0" "3475" "0" "c.3475T>C" "r.(?)" "p.(Ser1159Pro)" "" "0000685915" "00000116" "99" "3476" "0" "3476" "0" "c.3476C>T" "r.(?)" "p.(Ser1159Phe)" "" "0000685916" "00000116" "77" "349" "0" "349" "0" "c.349C>G" "r.(?)" "p.(Arg117Gly)" "" "0000685917" "00000116" "99" "350" "0" "350" "0" "c.350G>C" "r.(?)" "p.(Arg117Pro)" "" "0000685918" "00000116" "77" "350" "0" "350" "0" "c.350G>T" "r.(?)" "p.(Arg117Leu)" "" "0000685919" "00000116" "77" "358" "0" "358" "0" "c.358G>A" "r.(?)" "p.(Ala120Thr)" "" "0000685920" "00000116" "99" "3717" "5" "3717" "5" "c.3717+5G>A" "r.spl?" "p.?" "" "0000685921" "00000116" "99" "3719" "0" "3719" "0" "c.3719T>G" "r.(?)" "p.(Val1240Gly)" "" "0000685922" "00000116" "77" "3737" "0" "3737" "0" "c.3737C>T" "r.(?)" "p.(Thr1246Ile)" "" "0000685923" "00000116" "99" "3745" "0" "3745" "0" "c.3745G>A" "r.(?)" "p.(Gly1249Arg)" "" "0000685924" "00000116" "99" "377" "0" "377" "0" "c.377G>A" "r.(?)" "p.(Gly126Asp)" "" "0000685925" "00000116" "99" "3806" "0" "3806" "0" "c.3806T>A" "r.(?)" "p.(Ile1269Asn)" "" "0000685926" "00000116" "99" "3848" "0" "3848" "0" "c.3848G>T" "r.(?)" "p.(Arg1283Met)" "" "0000685927" "00000116" "77" "3872" "0" "3872" "0" "c.3872A>G" "r.(?)" "p.(Gln1291Arg)" "" "0000685928" "00000116" "77" "3873" "0" "3873" "0" "c.3873G>C" "r.spl?" "p.(Gln1291His)" "" "0000685929" "00000116" "99" "38" "0" "38" "0" "c.38C>T" "r.(?)" "p.(Ser13Phe)" "" "0000685930" "00000116" "99" "3971" "0" "3971" "0" "c.3971T>C" "r.(?)" "p.(Leu1324Pro)" "" "0000685931" "00000116" "99" "4004" "0" "4004" "0" "c.4004T>C" "r.(?)" "p.(Leu1335Pro)" "" "0000685932" "00000116" "99" "4036" "0" "4042" "0" "c.4036_4042del" "r.(?)" "p.(Leu1346Metfs*6)" "" "0000685933" "00000116" "99" "4097" "0" "4097" "0" "c.4097T>A" "r.(?)" "p.(Ile1366Asn)" "" "0000685934" "00000116" "99" "4124" "0" "4124" "0" "c.4124A>C" "r.(?)" "p.(His1375Pro)" "" "0000685935" "00000116" "99" "413" "0" "415" "0" "c.413_415dup" "r.(?)" "p.(Leu138dup)" "" "0000685936" "00000116" "99" "416" "0" "416" "0" "c.416A>G" "r.(?)" "p.(His139Arg)" "" "0000685937" "00000116" "77" "4364" "0" "4364" "0" "c.4364C>G" "r.(?)" "p.(Ser1455*)" "" "0000685938" "00000116" "77" "4426" "0" "4426" "0" "c.4426C>T" "r.(?)" "p.(Gln1476*)" "" "0000685939" "00000116" "99" "44" "0" "44" "0" "c.44T>C" "r.(?)" "p.(Leu15Pro)" "" "0000685940" "00000116" "99" "481" "0" "481" "0" "c.481T>G" "r.(?)" "p.(Tyr161Asp)" "" "0000685941" "00000116" "99" "494" "0" "494" "0" "c.494T>C" "r.(?)" "p.(Leu165Ser)" "" "0000685942" "00000116" "99" "571" "0" "571" "0" "c.571T>G" "r.(?)" "p.(Phe191Val)" "" "0000685943" "00000116" "99" "580" "0" "580" "0" "c.580G>A" "r.spl?" "p.(Gly194Arg)" "" "0000685944" "00000116" "77" "581" "0" "581" "0" "c.581G>T" "r.spl?" "p.(Gly194Val)" "" "0000685945" "00000116" "99" "695" "0" "695" "0" "c.695T>A" "r.(?)" "p.(Val232Asp)" "" "0000685946" "00000116" "77" "709" "0" "709" "0" "c.709C>G" "r.(?)" "p.(Gln237Glu)" "" "0000685947" "00000116" "77" "772" "0" "772" "0" "c.772A>G" "r.(?)" "p.(Arg258Gly)" "" "0000685948" "00000116" "77" "794" "0" "794" "0" "c.794T>G" "r.(?)" "p.(Met265Arg)" "" "0000685949" "00000116" "99" "79" "0" "79" "0" "c.79G>A" "r.(?)" "p.(Gly27Arg)" "" "0000685950" "00000116" "99" "850" "0" "850" "0" "c.850dup" "r.(?)" "p.(Met284Asnfs*3)" "" "0000685951" "00000116" "99" "88" "0" "88" "0" "c.88C>T" "r.(?)" "p.(Gln30*)" "" "0000685952" "00000116" "99" "933" "0" "933" "0" "c.933C>G" "r.(?)" "p.(Phe311Leu)" "" "0000685953" "00000116" "77" "941" "0" "941" "0" "c.941G>A" "r.(?)" "p.(Gly314Glu)" "" "0000685954" "00000116" "11" "958" "0" "958" "0" "c.958T>G" "r.(?)" "p.(Leu320Val)" "" "0000685955" "00000116" "99" "1301" "0" "1307" "0" "c.1301_1307del" "r.(?)" "p.(Ser434Leufs*6)" "" "0000685956" "00000116" "99" "1373" "0" "1373" "0" "c.1373del" "r.(?)" "p.(Gly458Aspfs*11)" "" "0000685957" "00000116" "99" "1670" "0" "1670" "0" "c.1670del" "r.(?)" "p.(Ser557Phefs*2)" "" "0000685958" "00000116" "99" "1943" "0" "1943" "0" "c.1943del" "r.(?)" "p.(Asp648Valfs*15)" "" "0000685959" "00000116" "99" "3846" "0" "3846" "0" "c.3846G>A" "r.(?)" "p.(Trp1282*)" "" "0000685960" "00000116" "99" "3848" "0" "3848" "0" "c.3848G>T" "r.(?)" "-" "" "0000685961" "00000116" "11" "1523" "0" "1523" "0" "c.1523T>G" "r.(?)" "p.(Phe508Cys)" "" "0000685962" "00000116" "99" "3752" "0" "3752" "0" "c.3752G>A" "r.(?)" "p.(Ser1251Asn)" "" "0000685963" "00000116" "99" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000685964" "00000116" "11" "3080" "0" "3080" "0" "c.3080T>C" "r.(?)" "p.(Ile1027Thr)" "" "0000685965" "00000116" "99" "1397" "0" "1397" "0" "c.1397C>G" "r.(?)" "p.(Ser466*)" "" "0000685966" "00000116" "77" "3209" "0" "3209" "0" "c.3209G>A" "r.(?)" "p.(Arg1070Gln)" "" "0000685967" "00000116" "99" "1075" "0" "1075" "0" "c.1075C>A" "r.(?)" "p.(Gln359Lys)" "" "0000685968" "00000116" "99" "1079" "0" "1079" "0" "c.1079C>A" "r.(?)" "p.(Thr360Lys)" "" "0000685969" "00000116" "99" "274" "-1" "1116" "1" "c.[(273+1_274-1)_(1116+1_1117-1)del;(1584+1_1585-1)_(3468+1_3469-1)del]" "r.?" "p.?" "" "0000685970" "00000116" "99" "3368" "-1" "3468" "1" "c.(3367+1_3368-1)_(3468+1_3469-1)del" "r.?" "p.?" "20i_21i" "0000685971" "00000116" "99" "3294" "0" "3294" "0" "c.3294G>Y" "r.(?)" "p.(Trp1098Cys)" "" "0000685972" "00000116" "99" "1882" "0" "1882" "0" "c.1882G>C" "r.(?)" "p.(Gly628Arg)" "" "0000685973" "00000116" "11" "2562" "0" "2562" "0" "c.2562T>G" "r.(?)" "p.(Thr854=)" "" "0000685974" "00000116" "99" "3011" "0" "3019" "0" "c.3011_3019del" "r.(?)" "p.(Ala1004_Ala1006del)" "" "0000685975" "00000116" "11" "1210" "-7" "1210" "-6" "c.1210-7_1210-6dup" "r.(?)" "p.(=)" "9i" "0000689868" "00000116" "50" "166" "0" "166" "0" "c.166G>A" "r.(?)" "p.(Glu56Lys)" "" "0000689869" "00000116" "90" "262" "0" "263" "0" "c.262_263del" "r.(?)" "p.(Leu88IlefsTer22)" "" "0000689870" "00000116" "70" "264" "0" "264" "0" "c.264A>C" "r.(?)" "p.(Leu88Phe)" "" "0000689871" "00000116" "90" "313" "0" "313" "0" "c.313del" "r.(?)" "p.(Ile105SerfsTer2)" "" "0000689872" "00000116" "90" "366" "0" "366" "0" "c.366T>A" "r.(?)" "p.(Tyr122Ter)" "" "0000689873" "00000116" "70" "1000" "0" "1000" "0" "c.1000C>T" "r.(?)" "p.(Arg334Trp)" "" "0000689874" "00000116" "70" "1040" "0" "1040" "0" "c.1040G>A" "r.(?)" "p.(Arg347His)" "" "0000689875" "00000116" "70" "1040" "0" "1040" "0" "c.1040G>C" "r.(?)" "p.(Arg347Pro)" "" "0000689876" "00000116" "90" "1068" "0" "1068" "0" "c.1068G>A" "r.(?)" "p.(Trp356Ter)" "" "0000689877" "00000116" "90" "1558" "0" "1558" "0" "c.1558G>T" "r.(?)" "p.(Val520Phe)" "" "0000689878" "00000116" "90" "1646" "0" "1646" "0" "c.1646G>A" "r.(?)" "p.(Ser549Asn)" "" "0000689879" "00000116" "90" "1647" "0" "1647" "0" "c.1647T>G" "r.(?)" "p.(Ser549Arg)" "" "0000689880" "00000116" "90" "1680" "-886" "1680" "-886" "c.1680-886A>G" "r.(=)" "p.(=)" "" "0000689881" "00000116" "90" "1766" "1" "1766" "1" "c.1766+1G>A" "r.spl?" "p.?" "" "0000689882" "00000116" "90" "2012" "0" "2012" "0" "c.2012del" "r.(?)" "p.(Leu671Ter)" "" "0000689883" "00000116" "90" "2215" "0" "2215" "0" "c.2215del" "r.(?)" "p.(Val739TyrfsTer16)" "" "0000689884" "00000116" "90" "2538" "0" "2538" "0" "c.2538G>A" "r.(?)" "p.(Trp846Ter)" "" "0000689885" "00000116" "90" "2668" "0" "2668" "0" "c.2668C>T" "r.(?)" "p.(Gln890Ter)" "" "0000689886" "00000116" "90" "2988" "1" "2988" "1" "c.2988+1G>A" "r.spl?" "p.?" "" "0000689887" "00000116" "90" "3196" "0" "3196" "0" "c.3196C>T" "r.(?)" "p.(Arg1066Cys)" "" "0000689888" "00000116" "90" "3276" "0" "3276" "0" "c.3276C>A" "r.(?)" "p.(Tyr1092Ter)" "" "0000689889" "00000116" "90" "3302" "0" "3302" "0" "c.3302T>A" "r.(?)" "p.(Met1101Lys)" "" "0000689890" "00000116" "90" "3472" "0" "3472" "0" "c.3472C>T" "r.(?)" "p.(Arg1158Ter)" "" "0000689891" "00000116" "30" "4242" "10" "4242" "10" "c.4242+10T>C" "r.(=)" "p.(=)" "" "0000693923" "00000116" "50" "3100" "0" "3100" "0" "c.3100C>T" "r.(?)" "p.(Leu1034Phe)" "" "0000695605" "00000116" "70" "349" "0" "349" "0" "c.349C>G" "r.(?)" "p.(Arg117Gly)" "" "0000712180" "00000116" "90" "571" "0" "571" "0" "c.571T>G" "r.(?)" "p.(Phe191Val)" "" "0000712181" "00000116" "90" "349" "0" "349" "0" "c.349C>G" "r.(?)" "p.(Arg117Gly)" "" "0000712182" "00000116" "90" "772" "0" "772" "0" "c.772A>G" "r.(?)" "p.(Arg258Gly)" "" "0000712183" "00000116" "70" "346" "0" "346" "0" "c.346G>A" "r.(?)" "p.(Glu116Lys)" "" "0000712186" "00000116" "90" "4054" "0" "4054" "0" "c.4054C>T" "r.(?)" "p.(Gln1352Ter)" "" "0000712187" "00000116" "70" "3737" "0" "3737" "0" "c.3737C>T" "r.(?)" "p.(Thr1246Ile)" "" "0000712188" "00000116" "90" "3717" "40" "3717" "40" "c.3717+40A>G" "r.(?)" "p.(?)" "" "0000712189" "00000116" "50" "2816" "0" "2816" "0" "c.2816A>G" "r.(?)" "p.(His939Arg)" "" "0000712191" "00000116" "50" "870" "-12" "870" "-12" "c.870-12T>A" "r.(?)" "p.(?)" "" "0000712192" "00000116" "90" "2706" "0" "2706" "0" "c.2706C>G" "r.(?)" "p.(Ser902Arg)" "" "0000712193" "00000116" "90" "2813" "0" "2813" "0" "c.2813T>G" "r.(?)" "p.(Val938Gly)" "" "0000712195" "00000116" "50" "1680" "-717" "1680" "-717" "c.1680-717A>G" "r.(?)" "p.(?)" "" "0000712197" "00000116" "50" "859" "0" "859" "0" "c.859A>T" "r.(?)" "p.(Asn287Tyr)" "" "0000712742" "00000116" "30" "890" "0" "890" "0" "c.890G>A" "r.(?)" "p.(Arg297Gln)" "" "0000712962" "00000116" "70" "3847" "0" "3847" "0" "c.3847A>G" "r.(?)" "p.(Arg1283Gly)" "" "0000714756" "00000116" "50" "3415" "0" "3415" "0" "c.3415A>G" "r.(?)" "p.(Ile1139Val)" "" "0000714757" "00000116" "50" "3170" "0" "3170" "0" "c.3170C>G" "r.(?)" "p.(Thr1057Arg)" "" "0000714758" "00000116" "50" "902" "0" "902" "0" "c.902A>G" "r.(?)" "p.(Tyr301Cys)" "" "0000721195" "00000116" "50" "466" "0" "466" "0" "c.466A>G" "r.(?)" "p.(Met156Val)" "" "0000721196" "00000116" "30" "609" "0" "609" "0" "c.609C>T" "r.(?)" "p.(Ile203=)" "" "0000721197" "00000116" "30" "1251" "0" "1251" "0" "c.1251C>A" "r.(?)" "p.(Asn417Lys)" "" "0000721198" "00000116" "50" "1744" "0" "1744" "0" "c.1744A>T" "r.(?)" "p.(Thr582Ser)" "" "0000721199" "00000116" "30" "1934" "0" "1934" "0" "c.1934T>C" "r.(?)" "p.(Met645Thr)" "" "0000721200" "00000116" "50" "2057" "0" "2057" "0" "c.2057C>A" "r.(?)" "p.(Ser686Tyr)" "" "0000721201" "00000116" "90" "2195" "0" "2195" "0" "c.2195T>G" "r.(?)" "p.(Leu732Ter)" "" "0000721202" "00000116" "30" "2620" "-6" "2620" "-6" "c.2620-6T>C" "r.(=)" "p.(=)" "" "0000721203" "00000116" "50" "3025" "0" "3025" "0" "c.3025G>T" "r.(?)" "p.(Ala1009Ser)" "" "0000721204" "00000116" "50" "3038" "0" "3038" "0" "c.3038C>T" "r.(?)" "p.(Pro1013Leu)" "" "0000721205" "00000116" "10" "3718" "-2623" "3718" "-2623" "c.3718-2623A>C" "r.(=)" "p.(=)" "" "0000729312" "00000116" "70" "1392" "1" "1392" "1" "c.1392+1del" "r.(?)" "p.(?)" "" "0000802868" "00000116" "50" "92" "0" "92" "0" "c.92G>A" "r.(?)" "p.(Arg31His)" "" "0000802869" "00000116" "50" "890" "0" "890" "0" "c.890G>A" "r.(?)" "p.(Arg297Gln)" "" "0000802870" "00000116" "50" "997" "0" "997" "0" "c.997C>T" "r.(?)" "p.(Leu333Phe)" "" "0000802871" "00000116" "50" "1392" "6" "1392" "6" "c.1392+6T>A" "r.(=)" "p.(=)" "" "0000802872" "00000116" "50" "1392" "12" "1392" "12" "c.1392+12G>A" "r.(=)" "p.(=)" "" "0000802873" "00000116" "90" "1680" "-886" "1680" "-886" "c.1680-886A>G" "r.(=)" "p.(=)" "" "0000802874" "00000116" "30" "2506" "0" "2506" "0" "c.2506G>T" "r.(?)" "p.(Asp836Tyr)" "" "0000802875" "00000116" "70" "2855" "0" "2855" "0" "c.2855T>C" "r.(?)" "p.(Met952Thr)" "" "0000802876" "00000116" "50" "2981" "0" "2981" "0" "c.2981T>G" "r.(?)" "p.(Phe994Cys)" "" "0000802877" "00000116" "50" "3659" "0" "3659" "0" "c.3659C>T" "r.(?)" "p.(Thr1220Ile)" "" "0000802878" "00000116" "50" "4097" "0" "4097" "0" "c.4097T>C" "r.(?)" "p.(Ile1366Thr)" "" "0000815852" "00000116" "70" "3846" "0" "3846" "0" "c.3846G>A" "r.(?)" "p.(Trp1282Ter)" "" "0000815853" "00000116" "70" "3883" "0" "3886" "0" "c.3883_3886del" "r.(?)" "p.(Ile1295PhefsTer32)" "" "0000815854" "00000116" "70" "3909" "0" "3909" "0" "c.3909C>G" "r.(?)" "p.(Asn1303Lys)" "" "0000815855" "00000116" "70" "1211" "0" "1211" "0" "c.1211G>T" "r.(?)" "p.(Gly404Val)" "" "0000817714" "00000116" "50" "1516" "0" "1516" "0" "c.1516A>G" "r.(?)" "p.(Ile506Val)" "11" "0000825419" "00000116" "70" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Arg668Cys)" "14" "0000825421" "00000116" "70" "1727" "0" "1727" "0" "c.1727G>C" "r.(?)" "p.(Gly576Ala)" "13" "0000826910" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "11" "0000826911" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "11" "0000851383" "00000116" "50" "125" "0" "125" "0" "c.125C>T" "r.(?)" "p.(Ser42Phe)" "" "0000851384" "00000116" "50" "489" "3" "489" "3" "c.489+3A>G" "r.spl?" "p.?" "" "0000851385" "00000116" "50" "1196" "0" "1196" "0" "c.1196C>T" "r.(?)" "p.(Ala399Val)" "" "0000851386" "00000116" "10" "1210" "-13" "1210" "-13" "c.1210-13G>T" "r.(=)" "p.(=)" "" "0000851387" "00000116" "30" "1585" "-19" "1585" "-19" "c.1585-19T>C" "r.(=)" "p.(=)" "" "0000851388" "00000116" "90" "1766" "5" "1766" "5" "c.1766+5G>T" "r.spl?" "p.?" "" "0000851389" "00000116" "50" "2822" "0" "2822" "0" "c.2822T>C" "r.(?)" "p.(Leu941Pro)" "" "0000851390" "00000116" "50" "2900" "0" "2900" "0" "c.2900T>C" "r.(?)" "p.(Leu967Ser)" "" "0000851391" "00000116" "50" "3983" "0" "3983" "0" "c.3983T>C" "r.(?)" "p.(Ile1328Thr)" "" "0000851392" "00000116" "10" "4272" "0" "4272" "0" "c.4272C>T" "r.(?)" "p.(Tyr1424=)" "" "0000851393" "00000116" "50" "4297" "0" "4297" "0" "c.4297G>A" "r.(?)" "p.(Glu1433Lys)" "" "0000860589" "00000116" "30" "31" "0" "31" "0" "c.31G>A" "r.(?)" "p.(Val11Ile)" "" "0000860590" "00000116" "50" "547" "0" "547" "0" "c.547C>A" "r.(?)" "p.(Leu183Ile)" "" "0000860591" "00000116" "50" "1163" "0" "1163" "0" "c.1163C>T" "r.(?)" "p.(Thr388Met)" "" "0000860592" "00000116" "30" "1210" "-7" "1210" "-6" "c.1210-7_1210-6dup" "r.(=)" "p.(=)" "" "0000860593" "00000116" "50" "1429" "0" "1429" "0" "c.1429C>A" "r.(?)" "p.(Pro477Thr)" "" "0000860594" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000860595" "00000116" "30" "1666" "0" "1666" "0" "c.1666A>G" "r.(?)" "p.(Ile556Val)" "" "0000860597" "00000116" "50" "3041" "0" "3041" "0" "c.3041A>G" "r.(?)" "p.(Tyr1014Cys)" "" "0000860598" "00000116" "30" "3285" "0" "3285" "0" "c.3285A>T" "r.(?)" "p.(Thr1095=)" "" "0000860599" "00000116" "30" "3469" "-17" "3469" "-17" "c.3469-17T>C" "r.(=)" "p.(=)" "" "0000880078" "00000116" "50" "4091" "0" "4091" "0" "c.4091C>T" "r.(?)" "p.(Ala1364Val)" "" "0000880344" "00000116" "50" "433" "0" "433" "0" "c.433C>G" "r.(?)" "p.(Leu145Val)" "" "0000880345" "00000116" "70" "1501" "0" "1501" "0" "c.1501A>G" "r.(?)" "p.(Thr501Ala)" "" "0000880346" "00000116" "70" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Trp)" "" "0000880347" "00000116" "70" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Trp)" "" "0000880348" "00000116" "70" "3808" "0" "3808" "0" "c.3808G>A" "r.(?)" "p.(Asp1270Asn)" "" "0000880349" "00000116" "90" "601" "0" "601" "0" "c.601G>A" "r.(?)" "p.(Val201Met)" "" "0000880350" "00000116" "90" "1001" "0" "1001" "0" "c.1001G>A" "r.(?)" "p.(Arg334Gln)" "" "0000880351" "00000116" "90" "1393" "-2" "1393" "-2" "c.1393-2A>G" "r.(?)" "p.(?)" "" "0000880352" "00000116" "90" "308" "0" "308" "0" "c.308del" "r.(?)" "p.(Gly103GlufsTer4)" "" "0000880353" "00000116" "90" "263" "0" "263" "0" "c.263T>G" "r.(?)" "p.(Leu88Ter)" "" "0000880354" "00000116" "90" "3017" "0" "3017" "0" "c.3017C>A" "r.(?)" "p.(Ala1006Glu)" "" "0000880355" "00000116" "90" "1680" "0" "1680" "0" "c.1680A>C" "r.(?)" "p.(Arg560Ser)" "" "0000880356" "00000116" "90" "769" "0" "769" "0" "c.769G>T" "r.(?)" "p.(Glu257Ter)" "" "0000880357" "00000116" "90" "4071" "0" "4073" "0" "c.4071_4073delinsAA" "r.(?)" "p.(Arg1358AsnfsTer22)" "" "0000880358" "00000116" "90" "296" "0" "296" "0" "c.296C>G" "r.(?)" "p.(Pro99Arg)" "" "0000880359" "00000116" "90" "2620" "-6" "2620" "-6" "c.2620-6T>C" "r.(?)" "p.(?)" "" "0000880360" "00000116" "90" "2743" "0" "2745" "0" "c.2743_2745delinsA" "r.(?)" "p.(Val915IlefsTer59)" "" "0000880361" "00000116" "90" "1573" "0" "1573" "0" "c.1573C>T" "r.(?)" "p.(Gln525Ter)" "" "0000880374" "00000116" "90" "4124" "0" "4124" "0" "c.4124A>C" "r.(?)" "p.(His1375Pro)" "" "0000880375" "00000116" "90" "933" "0" "933" "0" "c.933C>A" "r.(?)" "p.(Phe311Leu)" "" "0000880378" "00000116" "90" "1724" "0" "1724" "0" "c.1724T>A" "r.(?)" "p.(Phe575Tyr)" "" "0000880380" "00000116" "10" "580" "0" "580" "0" "c.580G>A" "r.(?)" "p.(Gly194Arg)" "" "0000880382" "00000116" "90" "580" "0" "580" "0" "c.580G>A" "r.(?)" "p.(Gly194Arg)" "" "0000880384" "00000116" "90" "1882" "0" "1882" "0" "c.1882G>C" "r.(?)" "p.(Gly628Arg)" "" "0000880385" "00000116" "90" "3806" "0" "3806" "0" "c.3806T>A" "r.(?)" "p.(Ile1269Asn)" "" "0000880390" "00000116" "90" "1853" "0" "1853" "0" "c.1853T>C" "r.(?)" "p.(Ile618Thr)" "" "0000880391" "00000116" "90" "44" "0" "44" "0" "c.44T>C" "r.(?)" "p.(Leu15Pro)" "" "0000880392" "00000116" "90" "1037" "0" "1037" "0" "c.1037T>C" "r.(?)" "p.(Leu346Pro)" "" "0000880393" "00000116" "90" "1358" "0" "1358" "0" "c.1358T>C" "r.(?)" "p.(Leu453Ser)" "" "0000880394" "00000116" "90" "794" "0" "794" "0" "c.794T>G" "r.(?)" "p.(Met265Arg)" "" "0000880395" "00000116" "90" "1076" "0" "1076" "0" "c.1076A>G" "r.(?)" "p.(Gln359Arg)" "" "0000880397" "00000116" "90" "3475" "0" "3475" "0" "c.3475T>C" "r.(?)" "p.(Ser1159Pro)" "" "0000880398" "00000116" "90" "1021" "0" "1021" "0" "c.1021T>C" "r.(?)" "p.(Ser341Pro)" "" "0000880399" "00000116" "90" "3107" "0" "3107" "0" "c.3107C>A" "r.(?)" "p.(Thr1036Asn)" "" "0000880400" "00000116" "90" "3719" "0" "3719" "0" "c.3719T>G" "r.(?)" "p.(Val1240Gly)" "" "0000880401" "00000116" "90" "481" "0" "481" "0" "c.481T>G" "r.(?)" "p.(Tyr161Asp)" "" "0000880402" "00000116" "90" "413" "0" "415" "0" "c.413_415dup" "r.(?)" "p.(Leu138dup)" "" "0000880608" "00000116" "90" "3011" "0" "3019" "0" "c.3011_3019del" "r.(?)" "p.(Ala1004_Ala1006del)" "" "0000880616" "00000116" "90" "1763" "0" "1763" "0" "c.1763A>T" "r.(?)" "p.(Glu588Val)" "" "0000880618" "00000116" "90" "3047" "0" "3047" "0" "c.3047T>C" "r.(?)" "p.(Phe1016Ser)" "" "0000880619" "00000116" "90" "3297" "0" "3297" "0" "c.3297C>A" "r.(?)" "p.(Phe1099Leu)" "" "0000880621" "00000116" "90" "1651" "0" "1651" "0" "c.1651G>A" "r.(?)" "p.(Gly551Ser)" "" "0000880623" "00000116" "90" "4097" "0" "4097" "0" "c.4097T>A" "r.(?)" "p.(Ile1366Asn)" "" "0000880625" "00000116" "90" "1505" "0" "1505" "0" "c.1505T>C" "r.(?)" "p.(Ile502Thr)" "" "0000881851" "00000116" "70" "1745" "0" "1745" "0" "c.1745C>T" "r.(?)" "p.(Thr582Ile)" "" "0000881852" "00000116" "90" "1609" "0" "1609" "0" "c.1609G>A" "r.(?)" "p.(Asp537Asn)" "" "0000887557" "00000116" "50" "31" "0" "31" "0" "c.31G>A" "r.(?)" "p.(Val11Ile)" "" "0000887558" "00000116" "30" "165" "-12" "165" "-12" "c.165-12dup" "r.(=)" "p.(=)" "" "0000887559" "00000116" "30" "202" "0" "202" "0" "c.202A>G" "r.(?)" "p.(Lys68Glu)" "" "0000887560" "00000116" "90" "581" "0" "581" "0" "c.581G>T" "r.(?)" "p.(Gly194Val)" "" "0000887561" "00000116" "10" "1210" "-13" "1210" "-13" "c.1210-13G>T" "r.(=)" "p.(=)" "" "0000887563" "00000116" "50" "1392" "0" "1392" "0" "c.1392G>T" "r.(?)" "p.(Lys464Asn)" "" "0000887564" "00000116" "50" "1547" "0" "1547" "0" "c.1547G>A" "r.(?)" "p.(Arg516Lys)" "" "0000887565" "00000116" "30" "1684" "0" "1684" "0" "c.1684G>A" "r.(?)" "p.(Val562Ile)" "" "0000887566" "00000116" "30" "2505" "0" "2505" "0" "c.2505T>C" "r.(?)" "p.(Asp835=)" "" "0000887567" "00000116" "90" "3154" "0" "3154" "0" "c.3154T>G" "r.(?)" "p.(Phe1052Val)" "" "0000887568" "00000116" "30" "3565" "0" "3565" "0" "c.3565A>G" "r.(?)" "p.(Lys1189Glu)" "" "0000887570" "00000116" "30" "4296" "0" "4296" "0" "c.4296C>T" "r.(?)" "p.(Asn1432=)" "" "0000906016" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000906017" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000906018" "00000116" "70" "3209" "0" "3209" "0" "c.3209G>A" "r.(?)" "p.(Arg1070Gln)" "" "0000906088" "00000116" "90" "3454" "0" "3454" "0" "c.3454G>C" "r.(?)" "p.(Asp1152His)" "" "0000906089" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000906090" "00000116" "90" "1657" "0" "1657" "0" "c.1657C>T" "r.(?)" "p.(Arg553Ter)" "" "0000906091" "00000116" "90" "1397" "0" "1397" "0" "c.1397C>G" "r.(?)" "p.(Ser466Ter)" "" "0000906092" "00000116" "90" "1364" "0" "1364" "0" "c.1364C>A" "r.(?)" "p.(Ala455Glu)" "" "0000906093" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000906094" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000906095" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000906146" "00000116" "90" "3846" "0" "3846" "0" "c.3846G>A" "r.(?)" "p.(Trp1282Ter)" "" "0000906147" "00000116" "90" "4426" "0" "4426" "0" "c.4426C>T" "r.(?)" "p.(Gln1476Ter)" "" "0000906148" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000906149" "00000116" "90" "3209" "0" "3209" "0" "c.3209G>A" "r.(?)" "p.(Arg1070Gln)" "" "0000906150" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000906151" "00000116" "90" "4417" "0" "4417" "0" "c.4417G>T" "r.(?)" "p.(Glu1473Ter)" "" "0000906152" "00000116" "90" "1624" "0" "1624" "0" "c.1624G>T" "r.(?)" "p.(Gly542Ter)" "" "0000906153" "00000116" "90" "350" "0" "350" "0" "c.350G>A" "r.(?)" "p.(Arg117His)" "" "0000908855" "00000116" "50" "3469" "-3" "3469" "-3" "c.3469-3C>A" "r.0?" "p.0?" "" "0000908926" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.1521_1523del" "p.Phe508del" "" "0000912622" "00000116" "10" "650" "0" "650" "0" "c.650A>G" "r.(?)" "p.(Glu217Gly)" "" "0000912623" "00000116" "50" "1163" "0" "1163" "0" "c.1163C>T" "r.(?)" "p.(Thr388Met)" "" "0000912624" "00000116" "50" "1558" "0" "1558" "0" "c.1558G>A" "r.(?)" "p.(Val520Ile)" "" "0000912625" "00000116" "90" "1646" "0" "1646" "0" "c.1646G>A" "r.(?)" "p.(Ser549Asn)" "" "0000912626" "00000116" "10" "1666" "0" "1666" "0" "c.1666A>G" "r.(?)" "p.(Ile556Val)" "" "0000912627" "00000116" "30" "1684" "0" "1684" "0" "c.1684G>A" "r.(?)" "p.(Val562Ile)" "" "0000912628" "00000116" "30" "2421" "0" "2421" "0" "c.2421A>G" "r.(?)" "p.(Ile807Met)" "" "0000912629" "00000116" "90" "3103" "0" "3103" "0" "c.3103C>T" "r.(?)" "p.(Gln1035*)" "" "0000912630" "00000116" "50" "3409" "0" "3409" "0" "c.3409A>G" "r.(?)" "p.(Met1137Val)" "" "0000912631" "00000116" "30" "3705" "0" "3705" "0" "c.3705T>G" "r.(?)" "p.(Ser1235Arg)" "" "0000912632" "00000116" "10" "4242" "13" "4242" "13" "c.4242+13A>G" "r.(=)" "p.(=)" "" "0000920316" "00000116" "90" "1520" "0" "1522" "0" "c.1520_1522del" "r.(?)" "p.(Phe508del)" "10" "0000920362" "00000116" "70" "1826" "0" "1826" "0" "c.1826A>G" "r.(?)" "p.(His609Arg)" "13" "0000924617" "00000116" "30" "274" "-6" "274" "-6" "c.274-6T>C" "r.(=)" "p.(=)" "" "0000924618" "00000116" "30" "1210" "-12" "1210" "-11" "c.1210-12_1210-11insG" "r.(=)" "p.(=)" "" "0000924620" "00000116" "30" "1519" "0" "1519" "0" "c.1519A>G" "r.(?)" "p.(Ile507Val)" "" "0000924621" "00000116" "30" "1666" "0" "1666" "0" "c.1666A>G" "r.(?)" "p.(Ile556Val)" "" "0000924623" "00000116" "90" "3415" "0" "3415" "0" "c.3415A>G" "r.(?)" "p.(Ile1139Val)" "" "0000924624" "00000116" "10" "4389" "0" "4389" "0" "c.4389G>A" "r.(?)" "p.(Gln1463=)" "" "0000927694" "00000116" "50" "2173" "0" "2173" "0" "c.2173G>A" "r.(?)" "p.(Glu725Lys)" "" "0000927708" "00000116" "70" "1420" "0" "1420" "0" "c.1420G>A" "r.(?)" "p.(Glu474Lys)" "" "0000927739" "00000116" "50" "2620" "-6" "2620" "-6" "c.2620-6T>C" "r.(?)" "p.(?)" "" "0000929268" "00000116" "30" "443" "0" "443" "0" "c.443T>C" "r.(?)" "p.(Ile148Thr)" "" "0000929269" "00000116" "50" "508" "0" "508" "0" "c.508C>T" "r.(?)" "p.(Arg170Cys)" "" "0000929270" "00000116" "90" "658" "0" "658" "0" "c.658C>T" "r.(?)" "p.(Gln220Ter)" "" "0000929271" "00000116" "50" "1315" "0" "1315" "0" "c.1315C>T" "r.(?)" "p.(Pro439Ser)" "" "0000929272" "00000116" "30" "2620" "-15" "2620" "-15" "c.2620-15C>G" "r.(=)" "p.(=)" "" "0000929273" "00000116" "90" "2845" "0" "2845" "0" "c.2845C>T" "r.(?)" "p.(His949Tyr)" "" "0000931663" "00000116" "50" "2300" "0" "2300" "0" "c.2300A>G" "r.(?)" "p.(Gln767Arg)" "" "0000931676" "00000116" "50" "4333" "0" "4333" "0" "c.4333G>A" "r.(?)" "p.(Asp1445Asn)" "" "0000933282" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000948805" "00000116" "50" "31" "0" "31" "0" "c.31G>A" "r.(?)" "p.(Val11Ile)" "" "0000948806" "00000116" "50" "202" "0" "202" "0" "c.202A>G" "r.(?)" "p.(Lys68Glu)" "" "0000948807" "00000116" "50" "1360" "0" "1362" "0" "c.1360_1362del" "r.(?)" "p.(Leu454del)" "" "0000948808" "00000116" "70" "1558" "0" "1558" "0" "c.1558G>A" "r.(?)" "p.(Val520Ile)" "" "0000948809" "00000116" "50" "2417" "0" "2417" "0" "c.2417A>G" "r.(?)" "p.(Asp806Gly)" "" "0000948810" "00000116" "50" "2756" "0" "2756" "0" "c.2756A>G" "r.(?)" "p.(Tyr919Cys)" "" "0000948811" "00000116" "50" "2935" "0" "2935" "0" "c.2935G>A" "r.(?)" "p.(Asp979Asn)" "" "0000948812" "00000116" "50" "3038" "0" "3038" "0" "c.3038C>T" "r.(?)" "p.(Pro1013Leu)" "" "0000948813" "00000116" "50" "4333" "0" "4333" "0" "c.4333G>A" "r.(?)" "p.(Asp1445Asn)" "" "0000964387" "00000116" "30" "-16" "0" "-16" "0" "c.-16C>T" "r.(?)" "p.(=)" "" "0000964388" "00000116" "50" "92" "0" "92" "0" "c.92G>T" "r.(?)" "p.(Arg31Leu)" "" "0000964390" "00000116" "30" "1210" "-15" "1210" "-12" "c.1210-15_1210-12dup" "r.(=)" "p.(=)" "" "0000964391" "00000116" "70" "1367" "0" "1367" "0" "c.1367T>C" "r.(?)" "p.(Val456Ala)" "" "0000964392" "00000116" "90" "1464" "0" "1476" "0" "c.1464_1476del" "r.(?)" "p.(Cys491Profs*32)" "" "0000964393" "00000116" "90" "2472" "0" "2472" "0" "c.2472del" "r.(?)" "p.(Asn825Thrfs*5)" "" "0000964394" "00000116" "50" "3485" "0" "3485" "0" "c.3485G>T" "r.(?)" "p.(Arg1162Leu)" "" "0000977471" "00000116" "90" "221" "0" "221" "0" "c.221G>A" "r.(?)" "p.(Arg74Gln)" "" "0000977472" "00000116" "90" "579" "1" "579" "1" "c.579+1G>T" "r.spl?" "p.?" "" "0000977473" "00000116" "50" "697" "0" "697" "0" "c.697C>T" "r.(?)" "p.(Leu233Phe)" "" "0000977474" "00000116" "50" "1051" "0" "1051" "0" "c.1051A>G" "r.(?)" "p.(Thr351Ala)" "" "0000977475" "00000116" "50" "1052" "0" "1052" "0" "c.1052C>G" "r.(?)" "p.(Thr351Ser)" "" "0000977476" "00000116" "50" "1196" "0" "1196" "0" "c.1196C>T" "r.(?)" "p.(Ala399Val)" "" "0000977478" "00000116" "10" "1408" "0" "1408" "0" "c.1408G>A" "r.(?)" "p.(Val470Met)" "" "0000977479" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0000977480" "00000116" "30" "1632" "0" "1632" "0" "c.1632T>G" "r.(?)" "p.(=)" "" "0000977481" "00000116" "90" "1766" "3" "1766" "3" "c.1766+3A>G" "r.spl?" "p.?" "" "0000977482" "00000116" "10" "2562" "0" "2562" "0" "c.2562T>G" "r.(?)" "p.(Thr854=)" "" "0000977483" "00000116" "70" "2978" "0" "2978" "0" "c.2978A>G" "r.(?)" "p.(Asp993Gly)" "" "0000977484" "00000116" "50" "2991" "0" "2991" "0" "c.2991G>C" "r.(?)" "p.(Leu997Phe)" "" "0000977485" "00000116" "50" "3025" "0" "3025" "0" "c.3025G>A" "r.(?)" "p.(Ala1009Thr)" "" "0000977486" "00000116" "90" "3469" "-1" "3469" "-1" "c.3469-1G>A" "r.spl?" "p.?" "" "0000977487" "00000116" "50" "3503" "0" "3503" "0" "c.3503A>G" "r.(?)" "p.(Asp1168Gly)" "" "0000977488" "00000116" "70" "3908" "0" "3908" "0" "c.3908A>T" "r.(?)" "p.(Asn1303Ile)" "" "0000977489" "00000116" "50" "4129" "0" "4129" "0" "c.4129G>C" "r.(?)" "p.(Asp1377His)" "" "0000977490" "00000116" "10" "4389" "0" "4389" "0" "c.4389G>A" "r.(?)" "p.(Gln1463=)" "" "0000996144" "00000116" "30" "164" "12" "164" "12" "c.164+12T>C" "r.(=)" "p.(=)" "" "0000996145" "00000116" "50" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Trp)" "" "0000996146" "00000116" "90" "579" "1" "579" "1" "c.579+1G>T" "r.spl?" "p.?" "" "0000996147" "00000116" "90" "1211" "0" "1211" "0" "c.1211del" "r.(?)" "p.(Gly404AspfsTer38)" "" "0000996148" "00000116" "10" "1519" "0" "1519" "0" "c.1519A>G" "r.(?)" "p.(Ile507Val)" "" "0000996149" "00000116" "50" "3808" "0" "3808" "0" "c.3808G>A" "r.(?)" "p.(Asp1270Asn)" "" "0000996150" "00000116" "50" "3854" "0" "3854" "0" "c.3854C>T" "r.(?)" "p.(Ala1285Val)" "" "0001011152" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0001011506" "00000116" "90" "1210" "-7" "1210" "-6" "c.1210-7_1210-6del" "r.spl" "p.?" "" "0001014263" "00000116" "50" "509" "0" "509" "0" "c.509G>A" "r.(?)" "p.(Arg170His)" "" "0001014264" "00000116" "50" "2079" "0" "2079" "0" "c.2079T>G" "r.(?)" "p.(Phe693Leu)" "" "0001014265" "00000116" "70" "2856" "0" "2856" "0" "c.2856G>C" "r.(?)" "p.(Met952Ile)" "" "0001014266" "00000116" "50" "3592" "0" "3592" "0" "c.3592G>A" "r.(?)" "p.(Val1198Met)" "" "0001025303" "00000116" "30" "240" "0" "240" "0" "c.240A>G" "r.(?)" "p.(=)" "" "0001025304" "00000116" "90" "1211" "0" "1211" "0" "c.1211del" "r.(?)" "p.(Gly404AspfsTer38)" "" "0001025305" "00000116" "50" "1399" "0" "1399" "0" "c.1399C>T" "r.(?)" "p.(Leu467Phe)" "" "0001025306" "00000116" "70" "2909" "-15" "2909" "-15" "c.2909-15T>G" "r.(=)" "p.(=)" "" "0001025307" "00000116" "50" "3415" "0" "3415" "0" "c.3415A>G" "r.(?)" "p.(Ile1139Val)" "" "0001025308" "00000116" "30" "3964" "-6" "3964" "-6" "c.3964-6C>T" "r.(=)" "p.(=)" "" "0001025309" "00000116" "50" "4129" "0" "4129" "0" "c.4129G>C" "r.(?)" "p.(Asp1377His)" "" "0001036086" "00000116" "50" "228" "0" "228" "0" "c.228T>G" "r.(?)" "p.(Cys76Trp)" "" "0001036087" "00000116" "70" "571" "0" "571" "0" "c.571T>G" "r.(?)" "p.(Phe191Val)" "" "0001036088" "00000116" "30" "1731" "0" "1731" "0" "c.1731C>T" "r.(?)" "p.(=)" "" "0001036089" "00000116" "50" "2735" "0" "2735" "0" "c.2735C>T" "r.(?)" "p.(Ser912Leu)" "" "0001036090" "00000116" "50" "3983" "0" "3983" "0" "c.3983T>C" "r.(?)" "p.(Ile1328Thr)" "" "0001046093" "00000116" "50" "266" "0" "266" "0" "c.266A>G" "r.(?)" "p.(Tyr89Cys)" "" "0001046094" "00000116" "90" "2052" "0" "2052" "0" "c.2052dup" "r.(?)" "p.(Gln685ThrfsTer4)" "" "0001046095" "00000116" "90" "2374" "0" "2374" "0" "c.2374C>T" "r.(?)" "p.(Arg792*)" "" "0001047582" "00000116" "50" "1001" "0" "1001" "0" "c.1001G>A" "r.(?)" "p.(Arg334Gln)" "" "0001047583" "00000116" "50" "1001" "0" "1001" "0" "c.1001G>A" "r.(?)" "p.(Arg334Gln)" "" "0001047584" "00000116" "50" "5694" "0" "5694" "0" "c.*1251C>T" "r.(?)" "p.(?)" "" "0001047587" "00000116" "10" "1052" "0" "1052" "0" "c.1052C>G" "r.(?)" "p.(Thr351Ser)" "" "0001047599" "00000116" "90" "1002" "0" "1002" "0" "c.1002del" "r.(?)" "p.(Ile336TyrfsTer33)" "" "0001047601" "00000116" "70" "1039" "0" "1039" "0" "c.1039C>T" "r.(?)" "p.(Arg347Cys)" "" "0001047602" "00000116" "70" "1039" "0" "1039" "0" "c.1039C>T" "r.(?)" "p.(Arg347Cys)" "" "0001047603" "00000116" "70" "1039" "0" "1039" "0" "c.1039C>T" "r.(?)" "p.(Arg347Cys)" "" "0001047604" "00000116" "90" "1054" "0" "1054" "0" "c.1054C>T" "r.(?)" "p.(Arg352Trp)" "" "0001047606" "00000116" "90" "1090" "0" "1090" "0" "c.1090T>C" "r.(?)" "p.(Ser364Pro)" "" "0001047607" "00000116" "50" "1135" "0" "1135" "0" "c.1135G>A" "r.(?)" "p.(Glu379Lys)" "" "0001047609" "00000116" "90" "1175" "0" "1175" "0" "c.1175T>G" "r.(?)" "p.(Val392Gly)" "" "0001047610" "00000116" "70" "125" "0" "125" "0" "c.125C>T" "r.(?)" "p.(Ser42Phe)" "" "0001047611" "00000116" "50" "1315" "0" "1315" "0" "c.1315C>T" "r.(?)" "p.(Pro439Ser)" "" "0001047612" "00000116" "10" "1327" "0" "1327" "0" "c.1327G>T" "r.(?)" "p.(Asp443Tyr)" "" "0001047613" "00000116" "90" "1331" "0" "1331" "0" "c.1331T>C" "r.(?)" "p.(Ile444Thr)" "" "0001047614" "00000116" "90" "1355" "0" "1355" "0" "c.1355A>C" "r.(?)" "p.(Gln452Pro)" "" "0001047615" "00000116" "90" "1373" "0" "1373" "0" "c.1373G>T" "r.(?)" "p.(Gly458Val)" "" "0001047616" "00000116" "70" "1390" "0" "1390" "0" "c.1390A>C" "r.(?)" "p.(Lys464Gln)" "" "0001047617" "00000116" "90" "1392" "1" "1392" "1" "c.1392+1del" "r.(?)" "p.(?)" "" "0001047619" "00000116" "90" "1392" "1" "1392" "1" "c.1392+1del" "r.(?)" "p.(?)" "" "0001047621" "00000116" "10" "1516" "0" "1516" "0" "c.1516A>G" "r.(?)" "p.(Ile506Val)" "" "0001047622" "00000116" "90" "1518" "0" "1518" "0" "c.1518C>G" "r.(?)" "p.(Ile506Met)" "" "0001047623" "00000116" "30" "1585" "-3" "1585" "-3" "c.1585-3T>C" "r.(?)" "p.(?)" "" "0001047624" "00000116" "50" "1585" "-9418" "1585" "-9418" "c.1585-9418T>C" "r.(?)" "p.(?)" "" "0001047625" "00000116" "90" "1609" "0" "1609" "0" "c.1609G>A" "r.(?)" "p.(Asp537Asn)" "" "0001047626" "00000116" "90" "1609" "0" "1609" "0" "c.1609G>A" "r.(?)" "p.(Asp537Asn)" "" "0001047627" "00000116" "90" "1609" "0" "1609" "0" "c.1609G>A" "r.(?)" "p.(Asp537Asn)" "" "0001047628" "00000116" "90" "1609" "0" "1609" "0" "c.1609G>A" "r.(?)" "p.(Asp537Asn)" "" "0001047629" "00000116" "90" "1654" "0" "1654" "0" "c.1654C>T" "r.(?)" "p.(Gln552Ter)" "" "0001047630" "00000116" "70" "1655" "0" "1655" "0" "c.1655A>C" "r.(?)" "p.(Gln552Pro)" "" "0001047631" "00000116" "50" "1657" "0" "1657" "0" "c.1657C>G" "r.(?)" "p.(Arg553Gly)" "" "0001047632" "00000116" "10" "1666" "0" "1666" "0" "c.1666A>G" "r.(?)" "p.(Ile556Val)" "" "0001047633" "00000116" "10" "1680" "-871" "1680" "-871" "c.1680-871A>G" "r.(?)" "p.(?)" "" "0001047634" "00000116" "50" "1690" "0" "1690" "0" "c.1690A>G" "r.(?)" "p.(Lys564Glu)" "" "0001047635" "00000116" "90" "1704" "0" "1704" "0" "c.1704G>T" "r.(?)" "p.(Leu568Phe)" "" "0001047636" "00000116" "50" "1706" "0" "1706" "0" "c.1706A>G" "r.(?)" "p.(Tyr569Cys)" "" "0001047637" "00000116" "50" "1684" "0" "1684" "0" "c.1684G>A" "r.(?)" "p.(Val562Ile)" "" "0001047638" "00000116" "10" "1727" "0" "1727" "0" "c.1727G>C" "r.(?)" "p.(Gly576Ala)" "" "0001047639" "00000116" "50" "173" "0" "173" "0" "c.173A>G" "r.(?)" "p.(Asp58Gly)" "" "0001047640" "00000116" "50" "1759" "0" "1759" "0" "c.1759T>A" "r.(?)" "p.(Phe587Ile)" "" "0001047641" "00000116" "50" "1762" "0" "1762" "0" "c.1762G>A" "r.(?)" "p.(Glu588Lys)" "" "0001047642" "00000116" "50" "1769" "0" "1769" "0" "c.1769G>A" "r.(?)" "p.(Cys590Tyr)" "" "0001047643" "00000116" "90" "1802" "0" "1802" "0" "c.1802T>C" "r.(?)" "p.(Ile601Thr)" "" "0001047644" "00000116" "10" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Arg668Cys)" "" "0001047645" "00000116" "10" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Trp)" "" "0001047646" "00000116" "10" "221" "0" "221" "0" "c.221G>A" "r.(?)" "p.(Arg74Gln)" "" "0001047647" "00000116" "90" "222" "0" "223" "0" "c.222_223delinsA" "r.(?)" "p.(Arg75AspfsTer16)" "" "0001047683" "00000116" "10" "2421" "0" "2421" "0" "c.2421A>G" "r.(?)" "p.(Ile807Met)" "" "0001047684" "00000116" "90" "2450" "0" "2450" "0" "c.2450del" "r.(?)" "p.(Gly817AlafsTer4)" "" "0001047685" "00000116" "90" "2450" "0" "2450" "0" "c.2450del" "r.(?)" "p.(Gly817AlafsTer4)" "" "0001047686" "00000116" "10" "2506" "0" "2506" "0" "c.2506G>T" "r.(?)" "p.(Asp836Tyr)" "" "0001047687" "00000116" "90" "263" "0" "263" "0" "c.263T>G" "r.(?)" "p.(Leu88Ter)" "" "0001047688" "00000116" "90" "263" "0" "263" "0" "c.263T>G" "r.(?)" "p.(Leu88Ter)" "" "0001047689" "00000116" "90" "2658" "-2" "2658" "-2" "c.2658-2A>G" "r.(?)" "p.(?)" "" "0001047690" "00000116" "70" "2672" "0" "2672" "0" "c.2672A>G" "r.(?)" "p.(Asp891Gly)" "" "0001047691" "00000116" "90" "2696" "0" "2696" "0" "c.2696del" "r.(?)" "p.(Arg899LysfsTer7)" "" "0001047692" "00000116" "90" "2735" "0" "2735" "0" "c.2735C>A" "r.(?)" "p.(Ser912Ter)" "" "0001047693" "00000116" "90" "2909" "0" "2909" "0" "c.2909G>A" "r.(?)" "p.(Gly970Asp)" "" "0001047694" "00000116" "90" "2909" "0" "2909" "0" "c.2909G>T" "r.(?)" "p.(Gly970Val)" "" "0001047695" "00000116" "90" "308" "0" "308" "0" "c.308del" "r.(?)" "p.(Gly103GlufsTer4)" "" "0001047696" "00000116" "90" "3138" "0" "3138" "0" "c.3138del" "r.(?)" "p.(Gly1047AlafsTer13)" "" "0001047698" "00000116" "90" "3180" "0" "3180" "0" "c.3180del" "r.(?)" "p.(Gly1061AspfsTer22)" "" "0001047699" "00000116" "90" "3197" "0" "3197" "0" "c.3197G>C" "r.(?)" "p.(Arg1066Pro)" "" "0001047700" "00000116" "90" "3454" "0" "3455" "0" "c.3454_3455del" "r.(?)" "p.(Asp1152CysfsTer3)" "" "0001047701" "00000116" "90" "350" "0" "350" "0" "c.350G>T" "r.(?)" "p.(Arg117Leu)" "" "0001047702" "00000116" "90" "3532" "0" "3535" "0" "c.3532_3535dup" "r.(?)" "p.(Thr1179IlefsTer17)" "" "0001047703" "00000116" "90" "3598" "0" "3598" "0" "c.3598delinsTCT" "r.(?)" "p.(Lys1200SerfsTer12)" "" "0001047704" "00000116" "90" "3857" "0" "3857" "0" "c.3857T>C" "r.(?)" "p.(Phe1286Ser)" "" "0001047705" "00000116" "90" "4056" "0" "4056" "0" "c.4056G>T" "r.(?)" "p.(Gln1352His)" "" "0001047706" "00000116" "90" "4364" "0" "4364" "0" "c.4364C>G" "r.(?)" "p.(Ser1455Ter)" "" "0001047707" "00000116" "90" "481" "0" "481" "0" "c.481T>A" "r.(?)" "p.(Tyr161Asn)" "" "0001047708" "00000116" "90" "558" "0" "558" "0" "c.558C>A" "r.(?)" "p.(Asn186Lys)" "" "0001047709" "00000116" "90" "769" "0" "769" "0" "c.769G>T" "r.(?)" "p.(Glu257Ter)" "" "0001047710" "00000116" "90" "933" "0" "933" "0" "c.933C>G" "r.(?)" "p.(Phe311Leu)" "" "0001047711" "00000116" "90" "935" "0" "937" "0" "c.935_937del" "r.(?)" "p.(Phe312del)" "" "0001047712" "00000116" "70" "95" "0" "95" "0" "c.95T>C" "r.(?)" "p.(Leu32Pro)" "" "0001047713" "00000116" "10" "91" "0" "91" "0" "c.91C>T" "r.(?)" "p.(Arg31Cys)" "" "0001047714" "00000116" "10" "650" "0" "650" "0" "c.650A>G" "r.(?)" "p.(Glu217Gly)" "" "0001047715" "00000116" "10" "3808" "0" "3808" "0" "c.3808G>A" "r.(?)" "p.(Asp1270Asn)" "" "0001047716" "00000116" "10" "3705" "0" "3705" "0" "c.3705T>G" "r.(?)" "p.(Ser1235Arg)" "" "0001047717" "00000116" "10" "3485" "0" "3485" "0" "c.3485G>T" "r.(?)" "p.(Arg1162Leu)" "" "0001047718" "00000116" "10" "3154" "0" "3154" "0" "c.3154T>G" "r.(?)" "p.(Phe1052Val)" "" "0001047719" "00000116" "10" "2900" "0" "2900" "0" "c.2900T>C" "r.(?)" "p.(Leu967Ser)" "" "0001047720" "00000116" "10" "274" "-6" "274" "-6" "c.274-6T>C" "r.(?)" "p.(?)" "" "0001047721" "00000116" "10" "2735" "0" "2735" "0" "c.2735C>T" "r.(?)" "p.(Ser912Leu)" "" "0001047722" "00000116" "10" "2619" "106" "2619" "106" "c.2619+106T>A" "r.(?)" "p.(?)" "" "0001047723" "00000116" "10" "2620" "-15" "2620" "-15" "c.2620-15C>G" "r.(?)" "p.(?)" "" "0001047726" "00000116" "90" "1865" "0" "1865" "0" "c.1865G>A" "r.(?)" "p.(Gly622Asp)" "" "0001047728" "00000116" "30" "2173" "0" "2173" "0" "c.2173G>A" "r.(?)" "p.(Glu725Lys)" "" "0001047729" "00000116" "50" "1826" "0" "1826" "0" "c.1826A>T" "r.(?)" "p.(His609Leu)" "" "0001047730" "00000116" "50" "1897" "0" "1897" "0" "c.1897C>T" "r.(?)" "p.(Leu633Phe)" "" "0001047731" "00000116" "50" "2378" "0" "2378" "0" "c.2378A>T" "r.(?)" "p.(Lys793Ile)" "" "0001047732" "00000116" "10" "2417" "0" "2417" "0" "c.2417A>G" "r.(?)" "p.(Asp806Gly)" "" "0001047733" "00000116" "50" "2417" "0" "2417" "0" "c.2417A>G" "r.(?)" "p.(Asp806Gly)" "" "0001047734" "00000116" "50" "2417" "0" "2417" "0" "c.2417A>G" "r.(?)" "p.(Asp806Gly)" "" "0001047735" "00000116" "50" "2684" "0" "2684" "0" "c.2684G>A" "r.(?)" "p.(Ser895Asn)" "" "0001047736" "00000116" "50" "2770" "0" "2770" "0" "c.2770G>A" "r.(?)" "p.(Asp924Asn)" "" "0001047737" "00000116" "50" "278" "0" "278" "0" "c.278T>G" "r.(?)" "p.(Val93Gly)" "" "0001047738" "00000116" "50" "2855" "0" "2855" "0" "c.2855T>C" "r.(?)" "p.(Met952Thr)" "" "0001047739" "00000116" "50" "302" "0" "302" "0" "c.302T>C" "r.(?)" "p.(Leu101Ser)" "" "0001047740" "00000116" "50" "3038" "0" "3038" "0" "c.3038C>A" "r.(?)" "p.(Pro1013His)" "" "0001047741" "00000116" "30" "2502" "0" "2502" "0" "c.2502T>G" "r.(?)" "p.(Phe834Leu)" "" "0001047742" "00000116" "70" "2428" "0" "2428" "0" "c.2428A>G" "r.(?)" "p.(Arg810Gly)" "" "0001047744" "00000116" "70" "2428" "0" "2428" "0" "c.2428A>G" "r.(?)" "p.(Arg810Gly)" "" "0001047745" "00000116" "50" "1439" "0" "1439" "0" "c.1439G>A" "r.(?)" "p.(Gly480Asp)" "" "0001047746" "00000116" "50" "1466" "0" "1466" "0" "c.1466C>T" "r.(?)" "p.(Ser489Leu)" "" "0001047747" "00000116" "70" "1494" "0" "1494" "0" "c.1494G>C" "r.(?)" "p.(Met498Ile)" "" "0001047748" "00000116" "70" "1494" "0" "1494" "0" "c.1494G>C" "r.(?)" "p.(Met498Ile)" "" "0001047749" "00000116" "70" "1494" "0" "1494" "0" "c.1494G>C" "r.(?)" "p.(Met498Ile)" "" "0001047750" "00000116" "70" "1495" "0" "1495" "0" "c.1495C>T" "r.(?)" "p.(Pro499Ser)" "" "0001047751" "00000116" "50" "1499" "0" "1499" "0" "c.1499G>T" "r.(?)" "p.(Gly500Val)" "" "0001047752" "00000116" "70" "1562" "0" "1562" "0" "c.1562T>G" "r.(?)" "p.(Ile521Ser)" "" "0001047753" "00000116" "50" "1583" "0" "1583" "0" "c.1583A>C" "r.(?)" "p.(Glu528Ala)" "" "0001047754" "00000116" "70" "1631" "0" "1631" "0" "c.1631G>T" "r.(?)" "p.(Gly544Val)" "" "0001047755" "00000116" "70" "1720" "0" "1720" "0" "c.1720C>T" "r.(?)" "p.(Pro574Ser)" "" "0001047756" "00000116" "50" "1721" "0" "1721" "0" "c.1721C>G" "r.(?)" "p.(Pro574Arg)" "" "0001047757" "00000116" "70" "609" "0" "609" "0" "c.609C>G" "r.(?)" "p.(Ile203Met)" "" "0001047758" "00000116" "50" "601" "0" "601" "0" "c.601G>A" "r.(?)" "p.(Val201Met)" "" "0001047759" "00000116" "70" "575" "0" "575" "0" "c.575A>T" "r.(?)" "p.(Asp192Val)" "" "0001047760" "00000116" "50" "451" "0" "451" "0" "c.451C>A" "r.(?)" "p.(Gln151Lys)" "" "0001047761" "00000116" "70" "472" "0" "472" "0" "c.472A>G" "r.(?)" "p.(Ser158Gly)" "" "0001047762" "00000116" "50" "4091" "0" "4091" "0" "c.4091C>T" "r.(?)" "p.(Ala1364Val)" "" "0001047763" "00000116" "50" "4202" "0" "4202" "0" "c.4202A>G" "r.(?)" "p.(Glu1401Gly)" "" "0001047764" "00000116" "70" "4225" "0" "4225" "0" "c.4225G>A" "r.(?)" "p.(Glu1409Lys)" "" "0001047765" "00000116" "70" "422" "0" "422" "0" "c.422C>A" "r.(?)" "p.(Ala141Asp)" "" "0001047766" "00000116" "70" "4297" "0" "4297" "0" "c.4297G>A" "r.(?)" "p.(Glu1433Lys)" "" "0001047767" "00000116" "50" "4333" "0" "4333" "0" "c.4333G>A" "r.(?)" "p.(Asp1445Asn)" "" "0001047768" "00000116" "70" "500" "0" "500" "0" "c.500T>G" "r.(?)" "p.(Leu167Arg)" "" "0001047769" "00000116" "50" "508" "0" "508" "0" "c.508C>T" "r.(?)" "p.(Arg170Cys)" "" "0001047770" "00000116" "50" "527" "0" "527" "0" "c.527G>T" "r.(?)" "p.(Ser176Ile)" "" "0001047771" "00000116" "30" "54" "-589" "54" "-589" "c.54-589A>G" "r.(?)" "p.(?)" "" "0001047772" "00000116" "50" "54" "-13" "54" "-13" "c.54-13C>G" "r.(?)" "p.(?)" "" "0001047773" "00000116" "70" "731" "0" "731" "0" "c.731T>A" "r.(?)" "p.(Met244Lys)" "" "0001047775" "00000116" "50" "3469" "-17" "3469" "-17" "c.3469-17T>C" "r.(?)" "p.(?)" "" "0001047788" "00000116" "70" "1798" "0" "1798" "0" "c.1798A>G" "r.(?)" "p.(Arg600Gly)" "" "0001047790" "00000116" "50" "215" "0" "215" "0" "c.215C>A" "r.(?)" "p.(Ala72Asp)" "" "0001047791" "00000116" "70" "224" "0" "224" "0" "c.224G>T" "r.(?)" "p.(Arg75Leu)" "" "0001047792" "00000116" "70" "228" "0" "228" "0" "c.228T>G" "r.(?)" "p.(Cys76Trp)" "" "0001047793" "00000116" "70" "2552" "0" "2552" "0" "c.2552G>T" "r.(?)" "p.(Arg851Leu)" "" "0001047794" "00000116" "70" "2758" "0" "2758" "0" "c.2758G>A" "r.(?)" "p.(Val920Met)" "" "0001047795" "00000116" "70" "2846" "0" "2846" "0" "c.2846A>T" "r.(?)" "p.(His949Leu)" "" "0001047796" "00000116" "70" "2953" "0" "2953" "0" "c.2953G>C" "r.(?)" "p.(Asp985His)" "" "0001047797" "00000116" "70" "2953" "0" "2953" "0" "c.2953G>T" "r.(?)" "p.(Asp985Tyr)" "" "0001047798" "00000116" "70" "3014" "0" "3014" "0" "c.3014T>G" "r.(?)" "p.(Ile1005Arg)" "" "0001047800" "00000116" "70" "3059" "0" "3059" "0" "c.3059T>A" "r.(?)" "p.(Val1020Glu)" "" "0001047802" "00000116" "70" "305" "0" "305" "0" "c.305T>C" "r.(?)" "p.(Leu102Pro)" "" "0001047803" "00000116" "70" "3131" "0" "3131" "0" "c.3131A>G" "r.(?)" "p.(Glu1044Gly)" "" "0001047804" "00000116" "70" "314" "0" "314" "0" "c.314T>A" "r.(?)" "p.(Ile105Asn)" "" "0001047805" "00000116" "70" "3170" "0" "3170" "0" "c.3170C>G" "r.(?)" "p.(Thr1057Arg)" "" "0001047806" "00000116" "50" "3199" "0" "3199" "0" "c.3199G>A" "r.(?)" "p.(Ala1067Thr)" "" "0001047807" "00000116" "70" "3200" "0" "3200" "0" "c.3200C>T" "r.(?)" "p.(Ala1067Val)" "" "0001047809" "00000116" "70" "3368" "-2" "3368" "-2" "c.3368-2dup" "r.(?)" "p.(?)" "" "0001047810" "00000116" "70" "3380" "0" "3380" "0" "c.3380G>A" "r.(?)" "p.(Gly1127Glu)" "" "0001047811" "00000116" "50" "3469" "-17" "3469" "-17" "c.3469-17T>C" "r.(?)" "p.(?)" "" "0001047812" "00000116" "70" "350" "0" "350" "0" "c.350G>C" "r.(?)" "p.(Arg117Pro)" "" "0001047813" "00000116" "70" "358" "0" "358" "0" "c.358G>A" "r.(?)" "p.(Ala120Thr)" "" "0001047814" "00000116" "70" "37" "0" "37" "0" "c.37T>C" "r.(?)" "p.(Ser13Pro)" "" "0001047815" "00000116" "30" "3854" "0" "3854" "0" "c.3854C>T" "r.(?)" "p.(Ala1285Val)" "" "0001047816" "00000116" "70" "3896" "0" "3896" "0" "c.3896C>T" "r.(?)" "p.(Thr1299Ile)" "" "0001047817" "00000116" "70" "3907" "0" "3907" "0" "c.3907A>C" "r.(?)" "p.(Asn1303His)" "" "0001047818" "00000116" "70" "3915" "0" "3915" "0" "c.3915T>A" "r.(?)" "p.(Asp1305Glu)" "" "0001047819" "00000116" "70" "3971" "0" "3971" "0" "c.3971T>C" "r.(?)" "p.(Leu1324Pro)" "" "0001047820" "00000116" "50" "4015" "0" "4015" "0" "c.4015C>T" "r.(?)" "p.(Leu1339Phe)" "" "0001047822" "00000116" "70" "744" "-14" "744" "-3" "c.744-14_744-3del" "r.(?)" "p.(?)" "" "0001047823" "00000116" "70" "869" "5" "869" "5" "c.869+5G>T" "r.(?)" "p.(?)" "" "0001047824" "00000116" "70" "869" "5" "869" "5" "c.869+5G>T" "r.(?)" "p.(?)" "" "0001047825" "00000116" "30" "869" "88" "869" "88" "c.869+88T>A" "r.(?)" "p.(?)" "" "0001047826" "00000116" "50" "617" "0" "617" "0" "c.617T>C" "r.(?)" "p.(Leu206Ser)" "" "0001047827" "00000116" "50" "674" "0" "674" "0" "c.674G>A" "r.(?)" "p.(Cys225Tyr)" "" "0001047828" "00000116" "50" "701" "0" "701" "0" "c.701C>A" "r.(?)" "p.(Ala234Asp)" "" "0001047829" "00000116" "50" "744" "-10" "744" "-3" "c.744-10_744-3del" "r.(?)" "p.(?)" "" "0001047830" "00000116" "50" "79" "0" "79" "0" "c.79G>C" "r.(?)" "p.(Gly27Arg)" "" "0001047832" "00000116" "50" "80" "0" "80" "0" "c.80G>A" "r.(?)" "p.(Gly27Glu)" "" "0001047833" "00000116" "50" "899" "0" "899" "0" "c.899C>A" "r.(?)" "p.(Ala300Asp)" "" "0001047834" "00000116" "50" "926" "0" "926" "0" "c.926C>G" "r.(?)" "p.(Ala309Gly)" "" "0001047835" "00000116" "50" "2210" "0" "2210" "0" "c.2210C>T" "r.(?)" "p.(Ser737Phe)" "" "0001047836" "00000116" "50" "2596" "0" "2596" "0" "c.2596T>C" "r.(?)" "p.(Cys866Arg)" "" "0001047837" "00000116" "50" "273" "4" "273" "4" "c.273+4A>G" "r.(?)" "p.(?)" "" "0001047838" "00000116" "50" "2754" "0" "2754" "0" "c.2754T>G" "r.(?)" "p.(Ile918Met)" "" "0001047839" "00000116" "50" "2770" "0" "2770" "0" "c.2770G>C" "r.(?)" "p.(Asp924His)" "" "0001047841" "00000116" "50" "287" "0" "287" "0" "c.287C>A" "r.(?)" "p.(Ala96Glu)" "" "0001047842" "00000116" "50" "2936" "0" "2936" "0" "c.2936A>C" "r.(?)" "p.(Asp979Ala)" "" "0001047843" "00000116" "50" "2940" "0" "2940" "0" "c.2940A>G" "r.(?)" "p.(Ile980Met)" "" "0001047844" "00000116" "50" "2957" "0" "2957" "0" "c.2957T>C" "r.(?)" "p.(Leu986Pro)" "" "0001047845" "00000116" "50" "2981" "0" "2981" "0" "c.2981T>G" "r.(?)" "p.(Phe994Cys)" "" "0001047846" "00000116" "50" "3222" "0" "3222" "0" "c.3222T>A" "r.(?)" "p.(Phe1074Leu)" "" "0001047848" "00000116" "50" "3241" "0" "3241" "0" "c.3241G>C" "r.(?)" "p.(Ala1081Pro)" "" "0001047849" "00000116" "50" "3257" "0" "3257" "0" "c.3257C>T" "r.(?)" "p.(Thr1086Ile)" "" "0001047850" "00000116" "50" "3461" "0" "3461" "0" "c.3461A>T" "r.(?)" "p.(Asp1154Val)" "" "0001047852" "00000116" "50" "3468" "5" "3468" "5" "c.3468+5G>A" "r.(?)" "p.(?)" "" "0001047853" "00000116" "50" "3503" "0" "3503" "0" "c.3503A>G" "r.(?)" "p.(Asp1168Gly)" "" "0001047854" "00000116" "50" "365" "0" "365" "0" "c.365A>G" "r.(?)" "p.(Tyr122Cys)" "" "0001047855" "00000116" "50" "3754" "0" "3754" "0" "c.3754A>C" "r.(?)" "p.(Thr1252Pro)" "" "0001047856" "00000116" "50" "3846" "0" "3846" "0" "c.3846G>T" "r.(?)" "p.(Trp1282Cys)" "" "0001047857" "00000116" "50" "3874" "-14" "3874" "-14" "c.3874-14C>G" "r.(?)" "p.(?)" "" "0001047858" "00000116" "50" "3935" "0" "3935" "0" "c.3935A>G" "r.(?)" "p.(Asp1312Gly)" "" "0001047859" "00000116" "50" "4061" "0" "4061" "0" "c.4061T>C" "r.(?)" "p.(Met1354Thr)" "" "0001047860" "00000116" "50" "4064" "0" "4064" "0" "c.4064G>T" "r.(?)" "p.(Cys1355Phe)" "" "0001047861" "00000116" "50" "4277" "0" "4277" "0" "c.4277C>T" "r.(?)" "p.(Ser1426Phe)" "" "0001047862" "00000116" "50" "472" "0" "472" "0" "c.472A>C" "r.(?)" "p.(Ser158Arg)" "" "0001047863" "00000116" "50" "490" "-165" "490" "-165" "c.490-165T>C" "r.(?)" "p.(?)" "" "0001052806" "00000116" "50" "31" "0" "31" "0" "c.31G>A" "r.(?)" "p.(Val11Ile)" "" "0001052807" "00000116" "90" "49" "0" "50" "0" "c.49_50dup" "r.(?)" "p.(Trp19Alafs*7)" "" "0001052808" "00000116" "50" "260" "0" "260" "0" "c.260T>C" "r.(?)" "p.(Phe87Ser)" "" "0001052810" "00000116" "90" "1364" "0" "1364" "0" "c.1364C>A" "r.(?)" "p.(Ala455Glu)" "" "0001052811" "00000116" "50" "1558" "0" "1558" "0" "c.1558G>A" "r.(?)" "p.(Val520Ile)" "" "0001052812" "00000116" "90" "1648" "0" "1648" "0" "c.1648G>T" "r.(?)" "p.(Gly550Ter)" "" "0001052813" "00000116" "30" "2260" "0" "2260" "0" "c.2260G>A" "r.(?)" "p.(Val754Met)" "" "0001052814" "00000116" "50" "4331" "0" "4331" "0" "c.4331C>T" "r.(?)" "p.(Ser1444Phe)" "" "0001058532" "00000116" "90" "1021" "0" "1022" "0" "c.1021_1022dup" "r.(?)" "p.(Phe342HisfsTer28)" "" "0001058533" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0001058534" "00000116" "90" "1521" "0" "1523" "0" "c.1521_1523del" "r.(?)" "p.(Phe508del)" "" "0001060229" "00000116" "50" "3139" "199" "3139" "199" "c.3139+199A>T" "r.(?)" "p.(?)" "" "0001060230" "00000116" "50" "3139" "199" "3139" "199" "c.3139+199A>T" "r.(?)" "p.(?)" "" "0001060847" "00000116" "90" "2341" "0" "2341" "0" "c.2341C>T" "r.(?)" "p.(Gln781Ter)" "" "0001064799" "00000116" "50" "220" "0" "220" "0" "c.220C>T" "r.(?)" "p.(Arg74Trp)" "" "0001064800" "00000116" "30" "870" "-9" "870" "-9" "c.870-9T>C" "r.(=)" "p.(=)" "" "0001064801" "00000116" "30" "954" "0" "954" "0" "c.954G>A" "r.(?)" "p.(=)" "" "0001064802" "00000116" "70" "1001" "0" "1001" "0" "c.1001G>A" "r.(?)" "p.(Arg334Gln)" "" "0001064803" "00000116" "90" "1203" "0" "1203" "0" "c.1203G>A" "r.(?)" "p.(Trp401*)" "" "0001064804" "00000116" "70" "1667" "0" "1667" "0" "c.1667T>C" "r.(?)" "p.(Ile556Thr)" "" "0001064805" "00000116" "90" "1865" "0" "1865" "0" "c.1865G>A" "r.(?)" "p.(Gly622Asp)" "" "0001064806" "00000116" "50" "1897" "0" "1897" "0" "c.1897C>A" "r.(?)" "p.(Leu633Ile)" "" "0001064807" "00000116" "90" "1911" "0" "1911" "0" "c.1911del" "r.(?)" "p.(Gln637Hisfs*26)" "" "0001064808" "00000116" "50" "2506" "0" "2506" "0" "c.2506G>T" "r.(?)" "p.(Asp836Tyr)" "" "0001064809" "00000116" "30" "2988" "19" "2988" "19" "c.2988+19C>G" "r.(=)" "p.(=)" "" "0001064810" "00000116" "30" "3024" "0" "3024" "0" "c.3024C>T" "r.(?)" "p.(=)" "" "0001064811" "00000116" "50" "3025" "0" "3025" "0" "c.3025G>A" "r.(?)" "p.(Ala1009Thr)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 1245 "{{screeningid}}" "{{variantid}}" "0000000005" "0000001246" "0000000008" "0000001237" "0000000009" "0000001239" "0000000014" "0000001225" "0000000016" "0000001231" "0000000025" "0000001245" "0000000025" "0000630803" "0000000027" "0000001224" "0000000027" "0000001228" "0000000035" "0000001244" "0000000038" "0000630800" "0000000046" "0000001223" "0000000046" "0000001240" "0000000058" "0000630802" "0000000060" "0000001238" "0000000065" "0000001229" "0000000070" "0000001241" "0000000074" "0000001242" "0000000078" "0000001226" "0000000088" "0000001227" "0000000089" "0000001222" "0000000089" "0000001230" "0000000095" "0000001243" "0000000100" "0000001232" "0000000994" "0000018069" "0000000994" "0000018272" "0000000994" "0000018273" "0000000994" "0000018274" "0000000994" "0000018275" "0000000994" "0000018276" "0000000994" "0000018277" "0000000994" "0000018278" "0000000994" "0000018279" "0000000994" "0000018280" "0000000994" "0000018281" "0000000994" "0000018283" "0000000994" "0000018284" "0000000994" "0000018285" "0000000994" "0000018286" "0000000994" "0000018287" "0000000994" "0000018288" "0000000994" "0000018289" "0000000994" "0000018290" "0000000994" "0000018291" "0000000994" "0000018292" "0000000994" "0000018293" "0000000994" "0000018294" "0000000994" "0000018295" "0000000994" "0000018296" "0000000994" "0000018297" "0000000994" "0000018298" "0000000994" "0000018299" "0000000994" "0000018300" "0000000994" "0000018301" "0000000994" "0000018302" "0000000994" "0000018303" "0000000994" "0000018304" "0000000994" "0000018305" "0000000994" "0000018306" "0000000994" "0000018307" "0000000994" "0000018308" "0000000994" "0000018310" "0000000994" "0000018311" "0000000994" "0000018312" "0000000994" "0000018313" "0000000994" "0000018314" "0000000994" "0000018315" "0000000994" "0000018316" "0000000994" "0000018317" "0000000994" "0000018318" "0000000994" "0000018319" "0000000994" "0000018320" "0000000994" "0000018321" "0000000994" "0000018322" "0000000994" "0000018323" "0000000994" "0000018324" "0000000994" "0000018325" "0000000994" "0000018326" "0000000994" "0000018327" "0000000994" "0000018328" "0000000994" "0000018329" "0000000994" "0000018330" "0000000994" "0000018331" "0000000994" "0000018332" "0000000994" "0000018333" "0000000994" "0000018334" "0000000994" "0000018335" "0000000994" "0000018336" "0000000994" "0000018337" "0000000994" "0000018338" "0000000994" "0000018339" "0000000994" "0000018340" "0000000994" "0000018341" "0000000994" "0000018342" "0000000994" "0000018343" "0000000994" "0000018344" "0000000994" "0000018345" "0000000994" "0000018346" "0000000994" "0000018347" "0000000994" "0000018348" "0000000994" "0000018349" "0000000994" "0000018350" "0000000994" "0000018351" "0000000994" "0000018352" "0000000994" "0000018353" "0000000994" "0000018354" "0000000994" "0000018355" "0000000994" "0000018356" "0000000994" "0000018357" "0000000994" "0000018358" "0000000994" "0000018359" "0000000994" "0000018360" "0000000994" "0000018361" "0000000994" "0000018362" "0000000994" "0000018363" "0000000994" "0000018364" "0000000994" "0000018365" "0000000994" "0000018366" "0000000994" "0000018367" "0000000994" "0000018368" "0000000994" "0000018369" "0000000994" "0000018370" "0000000994" "0000018371" "0000000994" "0000018372" "0000000994" "0000018373" "0000000994" "0000018374" "0000000994" "0000018375" "0000000994" "0000018376" "0000000994" "0000018377" "0000000994" "0000018378" "0000000994" "0000018379" "0000000994" "0000018380" "0000000994" "0000018381" "0000000994" "0000018382" "0000000994" "0000018383" "0000000994" "0000018384" "0000000994" "0000018385" "0000000994" "0000018386" "0000000994" "0000018389" "0000000994" "0000018390" "0000000994" "0000018391" "0000000994" "0000018392" "0000000994" "0000018393" "0000000994" "0000018394" "0000000994" "0000018395" "0000000994" "0000018396" "0000000994" "0000018397" "0000000994" "0000018398" "0000000994" "0000018399" "0000000994" "0000018400" "0000000994" "0000018401" "0000000994" "0000018402" "0000000994" "0000018403" "0000000994" "0000018404" "0000000994" "0000018405" "0000000994" "0000018406" "0000000994" "0000018407" "0000000994" "0000018408" "0000000994" "0000018409" "0000000994" "0000018410" "0000000994" "0000018411" "0000000994" "0000018412" "0000000994" "0000018413" "0000000994" "0000018414" "0000000994" "0000018415" "0000000994" "0000018416" "0000000994" "0000018417" "0000000994" "0000018418" "0000000994" "0000018419" "0000000994" "0000018420" "0000000994" "0000018421" "0000000994" "0000018422" "0000000994" "0000018423" "0000000994" "0000018424" "0000000994" "0000018425" "0000000994" "0000018426" "0000000994" "0000018427" "0000000994" "0000018428" "0000000994" "0000018429" "0000000994" "0000018430" "0000000994" "0000018431" "0000000994" "0000018432" "0000000994" "0000018433" "0000000994" "0000018434" "0000000994" "0000018435" "0000000994" "0000018436" "0000000994" "0000018437" "0000000994" "0000222898" "0000000994" "0000222899" "0000000994" "0000222900" "0000000994" "0000222902" "0000000994" "0000222903" "0000000994" "0000222904" "0000000994" "0000222906" "0000000994" "0000222907" "0000000994" "0000222908" "0000000994" "0000222909" "0000000994" "0000222910" "0000000994" "0000222911" "0000000994" "0000222912" "0000000994" "0000222913" "0000000994" "0000222914" "0000000994" "0000222915" "0000000994" "0000222916" "0000000994" "0000222917" "0000000994" "0000222918" "0000000994" "0000222919" "0000000994" "0000222924" "0000000994" "0000222925" "0000000994" "0000222926" "0000000994" "0000222927" "0000000994" "0000222928" "0000000994" "0000222929" "0000000994" "0000222930" "0000000994" "0000222931" "0000000994" "0000222932" "0000000994" "0000222933" "0000000994" "0000222934" "0000000994" "0000222935" "0000000994" "0000222936" "0000000994" "0000222937" "0000000994" "0000222938" "0000000994" "0000222939" "0000000994" "0000222940" "0000000994" "0000222941" "0000000994" "0000222942" "0000000994" "0000222943" "0000000994" "0000222944" "0000000994" "0000222945" "0000000994" "0000222946" "0000000994" "0000222947" "0000000994" "0000222948" "0000000994" "0000222949" "0000000994" "0000222950" "0000000994" "0000222951" "0000000994" "0000222952" "0000000994" "0000222953" "0000000994" "0000222954" "0000000994" "0000222955" "0000000994" "0000222956" "0000000994" "0000222957" "0000000994" "0000222958" "0000000994" "0000222959" "0000000994" "0000222960" "0000000994" "0000222961" "0000000994" "0000222962" "0000000994" "0000222963" "0000000994" "0000222964" "0000000994" "0000222965" "0000000994" "0000222966" "0000000994" "0000222967" "0000000994" "0000222968" "0000000994" "0000222969" "0000000994" "0000222970" "0000000994" "0000222971" "0000000994" "0000222972" "0000000994" "0000222973" "0000000994" "0000222974" "0000000994" "0000222975" "0000000994" "0000222976" "0000000994" "0000222977" "0000000994" "0000222978" "0000000994" "0000222979" "0000000994" "0000222980" "0000000994" "0000222981" "0000000994" "0000222982" "0000000994" "0000222983" "0000000994" "0000222984" "0000000994" "0000222985" "0000000994" "0000222986" "0000000994" "0000222987" "0000000994" "0000222988" "0000000994" "0000222989" "0000000994" "0000222990" "0000000994" "0000222991" "0000000994" "0000222992" "0000000994" "0000222993" "0000000994" "0000222994" "0000000994" "0000222995" "0000000994" "0000222996" "0000000994" "0000222997" "0000000994" "0000222998" "0000000994" "0000222999" "0000000994" "0000223000" "0000000994" "0000223001" "0000000994" "0000223002" "0000000994" "0000223003" "0000000994" "0000223004" "0000000994" "0000223005" "0000000994" "0000223006" "0000000994" "0000223007" "0000000994" "0000223008" "0000000994" "0000223009" "0000000994" "0000223010" "0000000994" "0000223011" "0000000994" "0000223012" "0000000994" "0000223013" "0000000994" "0000223014" "0000000994" "0000223015" "0000000994" "0000223016" "0000000994" "0000223017" "0000000994" "0000223018" "0000000994" "0000223019" "0000000994" "0000223020" "0000000994" "0000223021" "0000000994" "0000223022" "0000000994" "0000223023" "0000000994" "0000223024" "0000000994" "0000223025" "0000000994" "0000223026" "0000000994" "0000223027" "0000000994" "0000223028" "0000000994" "0000223029" "0000000994" "0000223030" "0000000994" "0000223031" "0000000994" "0000223032" "0000000994" "0000223034" "0000000994" "0000223035" "0000000994" "0000223036" "0000000994" "0000223037" "0000000994" "0000223038" "0000000994" "0000223039" "0000000994" "0000223040" "0000000994" "0000223041" "0000000994" "0000223042" "0000000994" "0000223043" "0000000994" "0000223044" "0000000994" "0000223045" "0000000994" "0000223046" "0000000994" "0000223047" "0000000994" "0000223048" "0000000994" "0000223049" "0000000994" "0000223050" "0000000994" "0000223051" "0000000994" "0000223052" "0000000994" "0000223053" "0000000994" "0000223054" "0000000994" "0000223055" "0000000994" "0000223056" "0000000994" "0000223057" "0000000994" "0000223058" "0000000994" "0000223059" "0000000994" "0000223060" "0000000994" "0000223061" "0000000994" "0000223062" "0000000994" "0000223063" "0000000994" "0000223064" "0000000994" "0000223065" "0000000994" "0000223066" "0000000994" "0000223067" "0000000994" "0000405593" "0000000994" "0000685858" "0000000994" "0000685859" "0000000994" "0000685860" "0000000994" "0000685861" "0000000994" "0000685862" "0000000994" "0000685863" "0000000994" "0000685864" "0000000994" "0000685865" "0000000994" "0000685866" "0000000994" "0000685867" "0000000994" "0000685868" "0000000994" "0000685869" "0000000994" "0000685870" "0000000994" "0000685871" "0000000994" "0000685872" "0000000994" "0000685873" "0000000994" "0000685874" "0000000994" "0000685875" "0000000994" "0000685876" "0000000994" "0000685877" "0000000994" "0000685878" "0000000994" "0000685879" "0000000994" "0000685880" "0000000994" "0000685881" "0000000994" "0000685882" "0000000994" "0000685883" "0000000994" "0000685884" "0000000994" "0000685885" "0000000994" "0000685886" "0000000994" "0000685887" "0000000994" "0000685888" "0000000994" "0000685889" "0000000994" "0000685890" "0000000994" "0000685891" "0000000994" "0000685892" "0000000994" "0000685893" "0000000994" "0000685894" "0000000994" "0000685895" "0000000994" "0000685896" "0000000994" "0000685897" "0000000994" "0000685898" "0000000994" "0000685899" "0000000994" "0000685900" "0000000994" "0000685901" "0000000994" "0000685902" "0000000994" "0000685903" "0000000994" "0000685904" "0000000994" "0000685905" "0000000994" "0000685906" "0000000994" "0000685907" "0000000994" "0000685908" "0000000994" "0000685909" "0000000994" "0000685910" "0000000994" "0000685911" "0000000994" "0000685912" "0000000994" "0000685913" "0000000994" "0000685914" "0000000994" "0000685915" "0000000994" "0000685916" "0000000994" "0000685917" "0000000994" "0000685918" "0000000994" "0000685919" "0000000994" "0000685920" "0000000994" "0000685921" "0000000994" "0000685922" "0000000994" "0000685923" "0000000994" "0000685924" "0000000994" "0000685925" "0000000994" "0000685926" "0000000994" "0000685927" "0000000994" "0000685928" "0000000994" "0000685929" "0000000994" "0000685930" "0000000994" "0000685931" "0000000994" "0000685932" "0000000994" "0000685933" "0000000994" "0000685934" "0000000994" "0000685935" "0000000994" "0000685936" "0000000994" "0000685937" "0000000994" "0000685938" "0000000994" "0000685939" "0000000994" "0000685940" "0000000994" "0000685941" "0000000994" "0000685942" "0000000994" "0000685943" "0000000994" "0000685944" "0000000994" "0000685945" "0000000994" "0000685946" "0000000994" "0000685947" "0000000994" "0000685948" "0000000994" "0000685949" "0000000994" "0000685950" "0000000994" "0000685951" "0000000994" "0000685952" "0000000994" "0000685953" "0000000994" "0000685954" "0000000994" "0000685955" "0000000994" "0000685956" "0000000994" "0000685957" "0000000994" "0000685958" "0000000994" "0000685969" "0000000994" "0000685970" "0000000994" "0000685971" "0000000994" "0000685972" "0000000994" "0000685973" "0000000994" "0000685974" "0000000994" "0000685975" "0000035235" "0000062354" "0000035236" "0000062355" "0000035237" "0000062356" "0000035238" "0000062357" "0000035239" "0000062358" "0000035240" "0000062359" "0000035241" "0000062360" "0000035242" "0000062361" "0000035243" "0000062362" "0000035244" "0000062363" "0000035245" "0000062364" "0000035246" "0000062365" "0000035247" "0000062366" "0000035248" "0000062367" "0000035249" "0000062368" "0000035250" "0000062369" "0000035251" "0000062370" "0000035252" "0000062371" "0000035253" "0000062372" "0000035254" "0000062373" "0000035255" "0000062374" "0000035256" "0000062375" "0000035257" "0000062376" "0000035258" "0000062377" "0000035259" "0000062378" "0000035260" "0000062379" "0000035261" "0000062380" "0000133493" "0000222716" "0000133645" "0000223068" "0000133645" "0000223069" "0000133646" "0000223070" "0000133646" "0000223071" "0000133647" "0000223072" "0000133647" "0000223073" "0000147976" "0000241257" "0000165518" "0000369237" "0000165521" "0000369417" "0000165522" "0000369896" "0000165524" "0000369897" "0000267297" "0000598353" "0000275481" "0000629503" "0000288268" "0000644181" "0000295438" "0000652127" "0000295439" "0000652128" "0000295440" "0000652129" "0000295441" "0000652130" "0000295442" "0000652131" "0000295443" "0000652132" "0000295444" "0000652133" "0000295445" "0000652134" "0000295446" "0000652135" "0000295447" "0000652136" "0000295448" "0000652137" "0000295449" "0000652138" "0000295450" "0000652139" "0000295451" "0000652140" "0000295452" "0000652141" "0000295453" "0000652142" "0000295454" "0000652143" "0000295455" "0000652144" "0000295456" "0000652145" "0000295457" "0000652146" "0000295458" "0000652147" "0000295459" "0000652148" "0000295460" "0000652149" "0000295462" "0000652151" "0000295463" "0000652152" "0000295464" "0000652153" "0000295465" "0000652154" "0000295466" "0000652155" "0000295467" "0000652156" "0000295469" "0000652158" "0000295470" "0000652159" "0000295471" "0000652160" "0000295472" "0000652161" "0000295473" "0000652162" "0000295474" "0000652163" "0000295475" "0000652164" "0000295476" "0000652165" "0000295477" "0000652166" "0000295478" "0000652167" "0000295479" "0000652168" "0000295480" "0000652169" "0000296380" "0000653069" "0000296381" "0000653070" "0000296382" "0000653071" "0000296383" "0000653072" "0000296384" "0000653073" "0000296483" "0000653172" "0000296484" "0000653173" "0000296485" "0000653174" "0000296518" "0000653207" "0000296519" "0000653208" "0000296596" "0000653285" "0000296600" "0000653289" "0000296601" "0000653290" "0000297984" "0000660697" "0000297984" "0000663289" "0000297986" "0000660698" "0000297987" "0000660699" "0000297988" "0000660700" "0000297988" "0000663288" "0000300567" "0000663290" "0000300568" "0000663291" "0000300569" "0000663292" "0000300570" "0000663293" "0000300571" "0000663294" "0000300572" "0000663295" "0000300573" "0000663296" "0000300574" "0000663297" "0000300575" "0000663298" "0000300576" "0000663299" "0000300577" "0000663300" "0000300578" "0000663301" "0000300579" "0000663302" "0000300580" "0000663303" "0000300581" "0000663304" "0000300582" "0000663305" "0000300583" "0000663306" "0000300584" "0000663307" "0000300585" "0000663308" "0000300586" "0000663309" "0000300587" "0000663310" "0000300588" "0000663311" "0000300589" "0000663312" "0000300590" "0000663313" "0000300591" "0000663314" "0000300592" "0000663315" "0000300593" "0000663316" "0000300594" "0000663317" "0000300595" "0000663318" "0000300596" "0000663319" "0000300597" "0000663320" "0000300598" "0000663321" "0000300599" "0000663322" "0000300600" "0000663323" "0000300601" "0000663324" "0000300602" "0000663325" "0000300603" "0000663326" "0000300604" "0000663327" "0000300605" "0000663328" "0000300606" "0000663329" "0000300607" "0000663330" "0000300608" "0000663331" "0000300609" "0000663332" "0000300610" "0000663333" "0000300611" "0000663334" "0000300612" "0000663335" "0000300613" "0000663336" "0000300614" "0000663337" "0000300615" "0000663338" "0000300616" "0000663339" "0000300617" "0000663340" "0000300618" "0000663341" "0000300619" "0000663342" "0000300620" "0000663343" "0000300621" "0000663344" "0000300622" "0000663345" "0000300623" "0000663346" "0000300624" "0000663347" "0000300625" "0000663348" "0000300626" "0000663349" "0000300627" "0000663350" "0000300628" "0000663351" "0000300629" "0000663352" "0000300630" "0000663353" "0000300631" "0000663354" "0000300632" "0000663355" "0000300633" "0000663356" "0000300634" "0000663357" "0000300635" "0000663358" "0000300636" "0000663359" "0000300637" "0000663360" "0000300638" "0000663361" "0000300639" "0000663362" "0000300640" "0000663363" "0000300641" "0000663364" "0000300642" "0000663365" "0000300643" "0000663366" "0000300644" "0000663367" "0000300645" "0000663368" "0000300646" "0000663369" "0000300647" "0000663370" "0000300648" "0000663371" "0000300649" "0000663372" "0000300650" "0000663373" "0000300651" "0000663374" "0000300652" "0000663375" "0000300653" "0000663376" "0000300654" "0000663377" "0000300655" "0000663378" "0000300656" "0000663379" "0000300657" "0000663380" "0000300658" "0000663381" "0000300659" "0000663382" "0000300660" "0000663383" "0000300660" "0000663466" "0000300661" "0000663384" "0000300661" "0000663467" "0000300662" "0000663385" "0000300662" "0000663468" "0000300663" "0000663386" "0000300663" "0000663469" "0000300664" "0000663387" "0000300664" "0000663470" "0000300665" "0000663388" "0000300665" "0000663471" "0000300666" "0000663389" "0000300666" "0000663472" "0000300667" "0000663390" "0000300667" "0000663473" "0000300668" "0000663391" "0000300668" "0000663474" "0000300669" "0000663392" "0000300669" "0000663475" "0000300670" "0000663393" "0000300670" "0000663476" "0000300671" "0000663394" "0000300671" "0000663477" "0000300672" "0000663395" "0000300672" "0000663478" "0000300673" "0000663396" "0000300673" "0000663479" "0000300674" "0000663397" "0000300674" "0000663480" "0000300675" "0000663398" "0000300675" "0000663481" "0000300676" "0000663399" "0000300676" "0000663482" "0000300677" "0000663400" "0000300677" "0000663483" "0000300678" "0000663401" "0000300678" "0000663484" "0000300679" "0000663402" "0000300679" "0000663485" "0000300680" "0000663403" "0000300680" "0000663486" "0000300681" "0000663404" "0000300681" "0000663487" "0000300682" "0000663405" "0000300682" "0000663488" "0000300683" "0000663406" "0000300683" "0000663489" "0000300684" "0000663407" "0000300684" "0000663490" "0000300685" "0000663408" "0000300685" "0000663491" "0000300686" "0000663409" "0000300686" "0000663492" "0000300687" "0000663410" "0000300687" "0000663493" "0000300688" "0000663411" "0000300688" "0000663494" "0000300689" "0000663412" "0000300689" "0000663495" "0000300690" "0000663413" "0000300690" "0000663496" "0000300691" "0000663414" "0000300691" "0000663497" "0000300692" "0000663415" "0000300692" "0000663498" "0000300693" "0000663416" "0000300693" "0000663499" "0000300694" "0000663417" "0000300694" "0000663500" "0000300695" "0000663418" "0000300695" "0000663501" "0000300696" "0000663419" "0000300696" "0000663502" "0000300697" "0000663420" "0000300697" "0000663503" "0000300698" "0000663421" "0000300698" "0000663504" "0000300699" "0000663422" "0000300699" "0000663505" "0000300700" "0000663423" "0000300700" "0000663506" "0000300701" "0000663424" "0000300701" "0000663507" "0000300702" "0000663425" "0000300702" "0000663508" "0000300703" "0000663426" "0000300703" "0000663509" "0000300704" "0000663427" "0000300704" "0000663510" "0000300705" "0000663428" "0000300705" "0000663511" "0000300706" "0000663429" "0000300706" "0000663512" "0000300707" "0000663430" "0000300707" "0000663513" "0000300708" "0000663431" "0000300708" "0000663514" "0000300709" "0000663432" "0000300709" "0000663515" "0000300710" "0000663433" "0000300710" "0000663516" "0000300711" "0000663434" "0000300711" "0000663517" "0000300712" "0000663435" "0000300712" "0000663518" "0000300713" "0000663436" "0000300713" "0000663519" "0000300714" "0000663437" "0000300714" "0000663520" "0000300715" "0000663438" "0000300715" "0000663521" "0000300716" "0000663439" "0000300716" "0000663522" "0000300717" "0000663440" "0000300717" "0000663523" "0000300718" "0000663441" "0000300718" "0000663524" "0000300719" "0000663442" "0000300719" "0000663525" "0000300720" "0000663443" "0000300720" "0000663526" "0000300721" "0000663444" "0000300721" "0000663527" "0000300722" "0000663445" "0000300722" "0000663528" "0000300723" "0000663446" "0000300723" "0000663529" "0000300724" "0000663447" "0000300724" "0000663530" "0000300725" "0000663448" "0000300725" "0000663531" "0000300726" "0000663449" "0000300726" "0000663532" "0000300727" "0000663450" "0000300728" "0000663451" "0000300729" "0000663452" "0000300730" "0000663453" "0000300730" "0000663533" "0000300731" "0000663454" "0000300731" "0000663534" "0000300732" "0000663455" "0000300732" "0000663535" "0000300733" "0000663456" "0000300733" "0000663536" "0000300734" "0000663457" "0000300734" "0000663537" "0000300735" "0000663458" "0000300735" "0000663538" "0000300736" "0000663459" "0000300736" "0000663539" "0000300737" "0000663460" "0000300737" "0000663540" "0000300738" "0000663461" "0000300738" "0000663541" "0000300739" "0000663462" "0000300739" "0000663542" "0000300740" "0000663463" "0000300740" "0000663543" "0000300741" "0000663464" "0000300741" "0000663544" "0000300742" "0000663465" "0000300742" "0000663545" "0000301738" "0000664803" "0000301774" "0000664847" "0000301775" "0000664848" "0000301776" "0000664849" "0000301777" "0000664850" "0000301778" "0000664851" "0000301779" "0000664852" "0000301780" "0000664853" "0000301781" "0000664854" "0000301782" "0000664855" "0000301783" "0000664856" "0000301784" "0000664857" "0000301785" "0000664858" "0000301786" "0000664859" "0000301787" "0000664860" "0000301788" "0000664861" "0000301789" "0000664862" "0000301790" "0000664863" "0000301791" "0000664864" "0000301792" "0000664865" "0000301793" "0000664866" "0000301794" "0000664867" "0000301795" "0000664868" "0000301796" "0000664869" "0000301797" "0000664870" "0000301798" "0000664871" "0000301799" "0000664872" "0000301800" "0000664873" "0000301801" "0000664874" "0000301802" "0000664875" "0000301803" "0000664876" "0000301804" "0000664877" "0000301805" "0000664878" "0000301806" "0000664879" "0000301807" "0000664880" "0000301808" "0000664881" "0000301809" "0000664882" "0000301810" "0000664883" "0000301811" "0000664884" "0000301812" "0000664885" "0000301813" "0000664886" "0000301814" "0000664887" "0000301815" "0000664888" "0000301816" "0000664889" "0000301817" "0000664890" "0000301818" "0000664891" "0000301819" "0000664892" "0000301820" "0000664893" "0000301821" "0000664894" "0000301822" "0000664895" "0000301823" "0000664896" "0000301824" "0000664897" "0000301825" "0000664898" "0000301826" "0000664899" "0000301827" "0000664900" "0000301828" "0000664901" "0000301829" "0000664902" "0000301830" "0000664903" "0000301831" "0000664904" "0000301832" "0000664905" "0000301833" "0000664906" "0000301834" "0000664907" "0000301835" "0000664908" "0000301836" "0000664909" "0000301837" "0000664910" "0000301838" "0000664911" "0000301839" "0000664912" "0000301840" "0000664913" "0000301841" "0000664914" "0000301842" "0000664915" "0000301843" "0000664916" "0000301844" "0000664917" "0000301845" "0000664918" "0000301846" "0000664919" "0000301847" "0000664920" "0000301848" "0000664921" "0000301849" "0000664922" "0000301850" "0000664923" "0000301851" "0000664924" "0000301852" "0000664925" "0000301853" "0000664926" "0000301854" "0000664927" "0000301855" "0000664928" "0000301856" "0000664929" "0000301857" "0000664930" "0000301858" "0000664931" "0000301859" "0000664932" "0000301860" "0000664933" "0000301861" "0000664934" "0000301862" "0000664935" "0000301863" "0000664936" "0000301864" "0000664937" "0000301865" "0000664938" "0000301866" "0000664939" "0000301867" "0000664940" "0000301868" "0000664941" "0000301869" "0000664942" "0000301870" "0000664943" "0000301871" "0000664944" "0000301872" "0000664945" "0000301873" "0000664946" "0000301874" "0000664947" "0000301875" "0000664948" "0000301876" "0000664949" "0000301877" "0000664950" "0000301878" "0000664951" "0000301879" "0000664952" "0000301880" "0000664953" "0000301881" "0000664954" "0000301882" "0000664955" "0000301883" "0000664956" "0000301884" "0000664957" "0000301885" "0000664958" "0000301886" "0000664959" "0000301887" "0000664960" "0000301888" "0000664961" "0000301889" "0000664962" "0000301890" "0000664963" "0000301891" "0000664964" "0000301892" "0000664965" "0000301893" "0000664966" "0000301894" "0000664967" "0000301895" "0000664968" "0000301896" "0000664969" "0000301897" "0000664970" "0000301898" "0000664971" "0000301899" "0000664972" "0000301900" "0000664973" "0000301901" "0000664974" "0000301902" "0000664975" "0000301903" "0000664976" "0000301904" "0000664977" "0000301905" "0000664978" "0000301906" "0000664979" "0000301907" "0000664980" "0000301908" "0000664981" "0000301909" "0000664982" "0000301910" "0000664983" "0000301911" "0000664984" "0000301912" "0000664985" "0000301913" "0000664986" "0000301914" "0000664987" "0000301915" "0000664988" "0000301916" "0000664989" "0000301917" "0000664990" "0000301918" "0000664991" "0000301919" "0000664992" "0000301920" "0000664993" "0000301921" "0000664994" "0000301922" "0000664995" "0000301923" "0000664996" "0000301924" "0000664997" "0000301925" "0000664998" "0000301926" "0000664999" "0000301927" "0000665000" "0000301928" "0000665001" "0000301929" "0000665002" "0000301930" "0000665003" "0000301931" "0000665004" "0000301932" "0000665005" "0000301933" "0000665006" "0000301934" "0000665007" "0000301935" "0000665008" "0000301936" "0000665009" "0000301937" "0000665010" "0000301938" "0000665011" "0000301939" "0000665012" "0000301940" "0000665013" "0000301941" "0000665014" "0000301942" "0000665015" "0000301943" "0000665016" "0000301944" "0000665017" "0000301945" "0000665018" "0000301946" "0000665019" "0000301947" "0000665020" "0000301948" "0000665021" "0000301949" "0000665022" "0000301950" "0000665023" "0000301951" "0000665024" "0000301952" "0000665025" "0000301953" "0000665026" "0000301954" "0000665027" "0000301955" "0000665028" "0000301956" "0000665029" "0000301957" "0000665030" "0000301958" "0000665031" "0000301959" "0000665032" "0000301960" "0000665033" "0000301961" "0000665034" "0000301962" "0000665035" "0000301963" "0000665036" "0000301964" "0000665037" "0000301965" "0000665038" "0000301966" "0000665039" "0000301967" "0000665040" "0000301968" "0000665041" "0000301969" "0000665042" "0000301970" "0000665043" "0000301971" "0000665044" "0000301972" "0000665045" "0000301973" "0000665046" "0000301974" "0000665047" "0000301975" "0000665048" "0000301976" "0000665049" "0000301977" "0000665050" "0000301978" "0000665051" "0000301979" "0000665052" "0000301980" "0000665053" "0000301981" "0000665054" "0000301982" "0000665055" "0000301983" "0000665056" "0000301984" "0000665057" "0000301985" "0000665058" "0000301986" "0000665059" "0000301987" "0000665060" "0000301988" "0000665061" "0000301989" "0000665062" "0000301990" "0000665063" "0000301991" "0000665064" "0000301992" "0000665065" "0000301993" "0000665066" "0000301994" "0000665067" "0000301995" "0000665068" "0000301996" "0000665069" "0000301997" "0000665070" "0000301998" "0000665071" "0000301999" "0000665072" "0000302000" "0000665073" "0000302001" "0000665074" "0000302002" "0000665075" "0000302003" "0000665076" "0000302004" "0000665077" "0000302005" "0000665078" "0000302006" "0000665079" "0000302007" "0000665080" "0000302008" "0000665081" "0000302009" "0000665082" "0000302010" "0000665083" "0000302011" "0000665084" "0000302012" "0000665085" "0000302013" "0000665086" "0000302014" "0000665087" "0000302015" "0000665088" "0000302016" "0000665089" "0000302017" "0000665090" "0000302018" "0000665091" "0000302019" "0000665092" "0000302020" "0000665093" "0000302021" "0000665094" "0000302022" "0000665095" "0000302023" "0000665096" "0000302024" "0000665097" "0000302025" "0000665098" "0000302026" "0000665099" "0000302027" "0000665100" "0000302028" "0000665101" "0000302029" "0000665102" "0000302030" "0000665103" "0000302031" "0000665104" "0000302032" "0000665105" "0000302033" "0000665106" "0000302034" "0000665107" "0000302035" "0000665108" "0000302036" "0000665109" "0000302037" "0000665110" "0000302038" "0000665111" "0000302039" "0000665112" "0000302040" "0000665113" "0000302041" "0000665114" "0000302042" "0000665115" "0000302043" "0000665116" "0000302044" "0000665117" "0000302045" "0000665118" "0000302046" "0000665119" "0000302047" "0000665120" "0000302048" "0000665121" "0000302049" "0000665122" "0000302050" "0000665123" "0000302051" "0000665124" "0000302052" "0000665125" "0000302053" "0000665126" "0000302054" "0000665127" "0000302055" "0000665128" "0000302056" "0000665129" "0000302057" "0000665130" "0000302058" "0000665131" "0000302059" "0000665132" "0000302060" "0000665133" "0000302061" "0000665134" "0000302062" "0000665135" "0000302063" "0000665136" "0000302064" "0000665137" "0000302065" "0000665138" "0000302066" "0000665139" "0000302067" "0000665140" "0000302068" "0000665141" "0000302069" "0000665142" "0000302070" "0000665143" "0000302071" "0000665144" "0000302072" "0000665145" "0000302073" "0000665146" "0000302074" "0000665147" "0000302075" "0000665148" "0000302076" "0000665149" "0000302077" "0000665150" "0000302078" "0000665151" "0000302079" "0000665152" "0000302080" "0000665153" "0000302081" "0000665154" "0000302082" "0000665155" "0000302083" "0000665156" "0000302084" "0000665157" "0000302085" "0000665158" "0000302086" "0000665159" "0000302087" "0000665160" "0000302088" "0000665161" "0000302089" "0000665162" "0000302090" "0000665163" "0000302091" "0000665164" "0000302092" "0000665165" "0000302093" "0000665166" "0000302094" "0000665167" "0000302095" "0000665168" "0000302097" "0000665170" "0000302098" "0000665171" "0000302099" "0000665172" "0000302100" "0000665173" "0000302101" "0000665174" "0000302102" "0000665175" "0000302103" "0000665176" "0000302104" "0000665177" "0000302105" "0000665178" "0000302106" "0000665179" "0000302107" "0000665180" "0000302108" "0000665181" "0000302109" "0000665182" "0000302110" "0000665183" "0000302111" "0000665184" "0000302111" "0000665199" "0000302111" "0000665214" "0000302111" "0000665215" "0000302112" "0000665185" "0000302112" "0000665200" "0000302113" "0000665186" "0000302113" "0000665201" "0000302114" "0000665187" "0000302114" "0000665202" "0000302115" "0000665188" "0000302115" "0000665203" "0000302116" "0000665189" "0000302116" "0000665204" "0000302117" "0000665190" "0000302117" "0000665205" "0000302118" "0000665191" "0000302118" "0000665206" "0000302119" "0000665192" "0000302119" "0000665207" "0000302120" "0000665193" "0000302120" "0000665208" "0000302121" "0000665194" "0000302121" "0000665209" "0000302122" "0000665195" "0000302122" "0000665210" "0000302123" "0000665196" "0000302123" "0000665211" "0000302124" "0000665197" "0000302124" "0000665212" "0000302125" "0000665198" "0000302125" "0000665213" "0000307377" "0000674000" "0000308448" "0000682855" "0000308449" "0000682856" "0000309862" "0000684764" "0000309863" "0000684765" "0000309864" "0000684766" "0000309865" "0000684767" "0000310832" "0000685959" "0000310832" "0000685960" "0000310833" "0000685961" "0000310833" "0000685962" "0000310834" "0000685963" "0000310834" "0000685964" "0000310835" "0000685965" "0000310835" "0000685966" "0000310836" "0000685967" "0000310836" "0000685968" "0000312339" "0000693923" "0000328841" "0000712962" "0000387718" "0000815852" "0000387719" "0000815853" "0000387720" "0000815854" "0000387721" "0000815855" "0000388919" "0000817714" "0000394472" "0000825419" "0000394472" "0000825421" "0000395554" "0000826911" "0000395555" "0000826910" "0000419889" "0000880078" "0000428293" "0000906016" "0000428294" "0000906017" "0000428295" "0000906018" "0000428363" "0000906088" "0000428363" "0000906146" "0000428364" "0000906089" "0000428364" "0000906147" "0000428365" "0000906090" "0000428365" "0000906148" "0000428366" "0000906091" "0000428366" "0000906149" "0000428367" "0000906092" "0000428367" "0000906150" "0000428368" "0000906093" "0000428368" "0000906151" "0000428369" "0000906094" "0000428369" "0000906152" "0000428370" "0000906095" "0000428370" "0000906153" "0000429382" "0000908855" "0000429382" "0000908926" "0000434564" "0000920316" "0000434564" "0000920362" "0000437838" "0000933282" "0000454732" "0001011152" "0000457065" "0001011506" "0000470410" "0001058532" "0000470411" "0001058533" "0000470412" "0001058534" "0000472341" "0001060847"