### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = CHEK2)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"CHEK2"	"checkpoint kinase 2"	"22"	"q12.1"	"unknown"	"NG_008150.1"	"UD_132085317206"	""	"http://www.LOVD.nl/CHEK2"	""	"1"	"16627"	"11200"	"604373"	"1"	"1"	"1"	"1"	"Establishment of this gene variant database (LSDB) was supported by the <a href=\'http://www.LUMC.nl\' target=\'_blank\'>Leiden University Medical Center (LUMC)</a>, Leiden, Nederland."	""	"g"	"http://databases.lovd.nl/shared/refseq/CHEK2_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00001"	"2013-05-03 00:00:00"	"00006"	"2015-11-25 23:40:08"	"00000"	"2025-07-08 13:22:38"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00024043"	"CHEK2"	"CHK2 checkpoint homolog (S. pombe), transcript variant 1"	"002"	"NM_007194.3"	""	"NP_009125.1"	""	""	""	"-72"	"1786"	"1632"	"29137822"	"29083731"	"00008"	"2015-06-29 18:25:08"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 17
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00000"	"Healthy/Control"	"Healthy individual / control"	""	""	""	""	""	"00000"	"2012-07-26 17:29:43"	""	""
"00091"	"CRC"	"cancer, colorectal, susceptibility to (CRC)"	"AD;SMu"	"114500"	""	""	""	"00001"	"2012-12-07 10:49:46"	"00006"	"2021-12-10 21:51:32"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00318"	"cancer, breast"	"cancer, breast"	""	""	""	""	""	"00006"	"2014-02-02 14:42:53"	"00006"	"2019-08-28 08:24:47"
"00681"	"cancer, pancreatic"	"cancer, pancreatic"	""	"260350"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2019-08-28 08:24:29"
"00683"	"cancer, breast"	"cancer, breast, susceptibility"	""	"114480"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-30 17:21:12"
"00927"	"-"	"cancer, colorectal, somatic"	""	""	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2015-12-08 23:50:05"
"01524"	"cancer, prostate"	"cancer, prostate"	"AD;SMu"	"176807"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"01544"	"RB1"	"retinoblastoma, type 1"	"AD;SMu"	"180200"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2025-01-14 18:01:23"
"01989"	"OSTEOSARCOMA"	"osteosarcoma"	"SMu"	"259500"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"02837"	"LFS2"	"Li-Fraumeni syndrome, type 2 (LFS-2)"	""	"609265"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"04148"	"BROVCA"	"cancer, breast-ovarian, familial, susceptibility to"	""	""	""	""	""	"00006"	"2014-11-02 11:19:07"	"00006"	"2017-08-28 21:33:05"
"04296"	"MINAS"	"neoplasia, multiple inherited alleles (MINAS)"	"AD;AR;SMo"	""	""	""	""	"00006"	"2015-07-02 09:20:44"	"00006"	"2021-12-10 21:51:32"
"05093"	"cancer"	"cancer"	""	""	""	""	""	"00006"	"2015-10-23 13:34:05"	""	""
"05330"	"TSC"	"tuberous sclerosis"	""	""	""	""	""	"00006"	"2017-09-19 09:35:08"	"00006"	"2022-08-19 09:49:37"
"05389"	"SWNTS"	"Schwannomatosis (SWNTS)"	""	""	""	""	""	"00006"	"2018-02-01 14:09:26"	""	""
"05489"	"cancer, colon"	"cancer, colon"	""	""	""	""	""	"00006"	"2018-10-26 16:33:57"	""	""


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 4
"{{geneid}}"	"{{diseaseid}}"
"CHEK2"	"00683"
"CHEK2"	"01524"
"CHEK2"	"01989"
"CHEK2"	"02837"


## Individuals ## Do not remove or alter this header ##
## Count = 925
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00046286"	""	""	""	"18"	""	"01339"	""	"18 breast-ovarian cancer families (kConFab)"	""	""	"Australia;New Zealand"	""	"0"	""	""	""	""
"00048339"	""	""	""	"1"	""	"00589"	""	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00048346"	""	""	""	"1"	""	"00589"	""	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00048378"	""	""	""	"1"	""	"00578"	""	""	""	""	"Netherlands"	""	"0"	"P14-4696"	""	""	""
"00048421"	""	""	""	"1"	""	"00578"	""	""	""	""	"Netherlands"	""	"0"	"P15-1636"	""	""	""
"00050251"	""	""	""	"1"	""	"00006"	"{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}"	"uninherited diplotypes"	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00054820"	""	""	""	"1"	""	"01474"	""	""	"F"	"no"	"Czech Republic"	""	"0"	""	""	""	""
"00089324"	""	""	""	"1"	""	"00589"	""	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00090522"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090523"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090524"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090525"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090527"	""	""	""	"10"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090528"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090529"	""	""	""	"2"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090530"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090531"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090532"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090533"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090534"	""	""	""	"1"	""	"01816"	""	"gene panel study on controls"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090535"	""	""	""	"2"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090536"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090537"	""	""	""	"2"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090538"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090539"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090540"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090541"	""	""	""	"4"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090542"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090543"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090544"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090545"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090546"	""	""	""	"1"	""	"01816"	""	"gene panel study on controls"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090547"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090548"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090549"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090550"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090551"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090552"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090553"	""	""	""	"5"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090554"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090555"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00090883"	""	""	""	"1"	""	"01816"	""	"gene panel study on colon cancer cases"	""	""	"United States"	""	"0"	"data for MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS2 in the LOVD Insight database"	""	""	""
"00110546"	""	""	""	"1"	""	"01741"	""	""	""	""	"Germany"	""	"0"	""	""	""	""
"00152726"	""	""	""	"1"	""	"01164"	""	""	"F"	"?"	"Germany"	""	"0"	""	""	""	"128017"
"00152727"	""	""	""	"1"	""	"00006"	"{PMID:Yurgelun 2017:28135145}"	""	"M"	""	"United States"	""	"0"	""	""	"white, non-Hispanic"	"28135145-Pat"
"00154486"	""	""	""	"1"	""	"01164"	""	"Patient analysed for HBOC"	"F"	"?"	"Germany"	""	"0"	""	""	""	"129514"
"00155664"	""	""	""	"1"	""	"01873"	"contributed by Dept. of Dr Vaccaro"	""	""	""	"Argentina"	""	"0"	""	""	""	""
"00164718"	""	""	""	"1"	""	"01807"	""	""	"F"	""	"(Germany)"	""	"0"	""	""	""	""
"00178086"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179289"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179290"	""	""	""	"3"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179291"	""	""	""	"3"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179292"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179293"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179294"	""	""	""	"4"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179295"	""	""	""	"21"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179296"	""	""	""	"9"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179297"	""	""	""	"4"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179298"	""	""	""	"4"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179299"	""	""	""	"14"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179300"	""	""	""	"27"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179301"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179302"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179303"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179304"	""	""	""	"6"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179305"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179306"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179307"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179308"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179309"	""	""	""	"3"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179310"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179311"	""	""	""	"15"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179312"	""	""	""	"9"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179313"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179314"	""	""	""	"5"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179315"	""	""	""	"5"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179316"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179317"	""	""	""	"4"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179318"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179319"	""	""	""	"7"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179320"	""	""	""	"8"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179321"	""	""	""	"11"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179322"	""	""	""	"15"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179323"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179324"	""	""	""	"19"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179325"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179326"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179327"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179328"	""	""	""	"13"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179329"	""	""	""	"10"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179330"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179331"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179332"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179333"	""	""	""	"4"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179334"	""	""	""	"4"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179335"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179336"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179337"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179338"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179339"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179340"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179341"	""	""	""	"10"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179342"	""	""	""	"5"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179343"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179344"	""	""	""	"3"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179345"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179346"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179347"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179348"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179349"	""	""	""	"8"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179350"	""	""	""	"7"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179351"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179352"	""	""	""	"14"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179353"	""	""	""	"16"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179354"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179355"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179356"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179357"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179358"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179359"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179360"	""	""	""	"3"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179361"	""	""	""	"4"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179362"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179363"	""	""	""	"7"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179364"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179365"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179366"	""	""	""	"16"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179367"	""	""	""	"18"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179368"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179369"	""	""	""	"18"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179370"	""	""	""	"31"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179371"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179372"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179373"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179374"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179375"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179376"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179377"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179378"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179379"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179380"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179381"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179382"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179383"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179384"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179385"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179386"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179387"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179388"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179389"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179390"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179391"	""	""	""	"397"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00179392"	""	""	""	"629"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179393"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179394"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179395"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00179396"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-controls-F"
"00180885"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"-con-F"
"00180886"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00180887"	""	""	""	"8"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 7051 female breast cancer cases"	"F"	""	"Japan"	""	"0"	""	""	""	"30287823-cases-F"
"00180888"	""	""	""	"10"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 11241 controls"	"F"	""	"Japan"	""	"0"	""	""	""	"-con-F"
"00181626"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 53 male breast cancer cases"	"M"	""	"Japan"	""	"0"	""	""	""	"-cases-M"
"00182911"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182912"	""	""	""	"3"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182913"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182914"	""	""	""	"27"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182915"	""	""	""	"8"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182916"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182917"	""	""	""	"21"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182918"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182919"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182920"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182921"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182922"	""	""	""	"5"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182923"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182924"	""	""	""	"9"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182925"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182926"	""	""	""	"15"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182927"	""	""	""	"20"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182928"	""	""	""	"9"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182929"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182930"	""	""	""	"13"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182931"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182932"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182933"	""	""	""	"5"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182934"	""	""	""	"9"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182935"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182936"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182937"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182938"	""	""	""	"9"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182939"	""	""	""	"17"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182940"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182941"	""	""	""	"4"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182942"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182943"	""	""	""	"7"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182944"	""	""	""	"18"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182945"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182946"	""	""	""	"16"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182947"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182948"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182949"	""	""	""	"2"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182950"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182951"	""	""	""	"12"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182952"	""	""	""	"664"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182953"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00182954"	""	""	""	"1"	""	"01714"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	"analysis 12490 male controls"	"M"	""	"Japan"	""	"0"	""	""	""	"-controls-M"
"00207765"	""	""	""	"1"	""	"01164"	""	""	"F"	""	"Germany"	""	"0"	""	""	""	""
"00207769"	""	""	""	"1"	""	"01164"	""	""	"F"	""	"Germany"	""	"0"	""	""	""	""
"00207951"	""	""	""	"1"	""	"01164"	""	""	"F"	""	"Germany"	""	"0"	""	""	""	""
"00208617"	""	""	""	"1"	""	"01164"	""	""	"F"	""	"Germany"	""	"0"	""	""	""	""
"00208790"	""	""	""	"1"	""	"01164"	""	""	"F"	""	"Germany"	""	"0"	""	""	""	""
"00210181"	""	""	""	"1"	""	"01164"	""	""	"F"	""	"Germany"	""	"0"	""	""	""	""
"00210186"	""	""	""	"1"	""	"01164"	""	""	"F"	""	"Germany"	""	"0"	""	""	""	""
"00213626"	""	""	""	"5"	""	"00643"	"{PMID:Apostolou 2018:29785007}, {DOI:Apostolou 2018:10.1038/s10038-018-0466-3}"	""	"F"	"no"	"Greece"	""	"0"	"yes"	""	""	"29785007-Pats"
"00218073"	""	""	""	"7"	""	"00006"	"{PMID:Tedaldi 2014:24986639}"	"4-generation family, 7 affected (6F, M), 2 unaffected carriers"	"F;M"	"no"	"Italy"	""	"0"	""	""	""	"24986639-Fam"
"00218082"	""	""	""	"1"	""	"00006"	"{PMID:Slavin 2017:28649662}"	""	"F"	""	""	""	"0"	""	""	"European, white"	"28649662-PatCH 0049-0638"
"00218083"	""	""	""	"1"	""	"00006"	"{PMID:Slavin 2017:28649662}"	""	"F"	""	""	""	"0"	""	""	"European, white"	"28649662-PatFCP704"
"00218084"	""	""	""	"1"	""	"00006"	"{PMID:Slavin 2017:28649662}"	""	"F"	""	""	""	"0"	""	""	"European, white"	"28649662-PatUPSX4689"
"00218085"	""	""	""	"1"	""	"00006"	"{PMID:Slavin 2017:28649662}"	""	"F"	""	""	""	"0"	""	""	"European, white"	"28649662-PatUPSX5002"
"00218086"	""	""	""	"1"	""	"00006"	"{PMID:Slavin 2017:28649662}"	""	"F"	""	""	""	"0"	""	""	"European, white"	"28649662-PatJO 7702-0353"
"00218088"	""	""	""	"5"	""	"00006"	"{PMID:Walsh 2006:16551709}"	""	"F"	""	"Czech Republic"	""	"0"	""	""	""	"16551709-FamPrague"
"00218089"	""	""	""	"2"	""	"00006"	"{PMID:Walsh 2006:16551709}"	""	"F"	""	"Czech Republic"	""	"0"	""	""	""	"16551709-FamBrno"
"00218090"	""	""	""	"1"	""	"00006"	"{PMID:Walsh 2006:16551709}"	""	"F"	""	"Slovakia (Slovak Republic)"	""	"0"	""	""	""	"16551709-FamBratislava"
"00218091"	""	""	""	"1"	""	"00643"	"{PMID:Apostolou 2018:29785007}, {DOI:Apostolou 2018:10.1038/s10038-018-0466-3}"	""	"F"	""	"Greece"	""	"0"	""	""	""	"29785007-Pat"
"00246489"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246490"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246491"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246492"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246493"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246494"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246495"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246496"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246497"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246498"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246499"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246500"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246501"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246502"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246503"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246504"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246505"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246506"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246507"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246508"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246509"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246510"	""	""	""	"1"	""	"00643"	"{PMID:Fostira 2020:31300551}"	""	""	""	"Greece"	""	"0"	""	""	""	""
"00246637"	""	""	""	"1"	""	"01164"	""	""	"M"	""	""	""	"0"	""	""	""	""
"00246641"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00248203"	""	""	""	"1"	""	"01474"	"{PMID:Lhota 2016:26822949}"	"analysis 325 breast cancer cases negative for BRCA1/BRCA2/PALB2"	"F"	"no"	"Czech Republic"	""	"0"	""	""	""	""
"00248250"	""	""	""	"1"	""	"01474"	"{PMID:Lhota 2016:26822949}"	"analysis 325 breast cancer cases negative for BRCA1/BRCA2/PALB2"	"F"	"no"	"Czech Republic"	""	"0"	""	""	""	""
"00248407"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00262119"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00263128"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00264001"	""	""	""	"1"	""	"00727"	""	""	"M"	""	""	""	"0"	""	""	""	""
"00264038"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00265102"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00265412"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00266173"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00266410"	""	""	""	"1"	""	"03452"	""	""	""	""	"Argentina"	""	"0"	""	""	""	"contributed by Dept. of Dr Vaccaro"
"00266474"	""	""	""	"1"	""	"02337"	""	""	""	""	"Argentina"	""	"0"	""	""	""	""
"00266485"	""	""	""	"1"	""	"02337"	""	""	""	""	"Argentina"	""	"0"	""	""	"Italy"	""
"00289278"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00289305"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00293081"	""	""	""	"2"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00293082"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00293083"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00293084"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00293085"	""	""	""	"3"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00293086"	""	""	""	"4"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00293087"	""	""	""	"2"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00295191"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00295192"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00295193"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00295194"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00295556"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00295558"	""	""	""	"1"	""	"01164"	""	""	"M"	""	""	""	"0"	""	""	""	""
"00295586"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00295658"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00295741"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00295748"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00295886"	""	""	""	"1"	""	"03629"	""	""	"F"	"-"	"Brazil"	""	"0"	""	""	""	"P-82"
"00295887"	""	""	""	"1"	""	"03629"	""	""	"F"	"-"	"Brazil"	""	"0"	""	""	""	"P-102"
"00295899"	""	""	""	"1"	""	"03629"	""	""	"F"	"-"	"Brazil"	""	"0"	""	""	""	"P-107"
"00296396"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00296860"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00300642"	""	""	""	"1"	""	"01164"	""	""	"F"	""	"Germany"	""	"0"	""	""	""	""
"00301396"	""	""	""	"1"	""	"01164"	""	""	"M"	""	"Germany"	""	"0"	""	""	""	""
"00307257"	""	""	""	"1"	""	"03753"	"{PMID:Mendonca 2021:34478740}"	""	"M"	""	"Brazil"	""	"0"	""	""	""	"Patient 62"
"00308000"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00336112"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00336113"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00336340"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00336341"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338433"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338434"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338435"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338436"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338437"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338438"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338439"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338440"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338441"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338442"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338443"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338444"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338445"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338446"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338447"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338448"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338449"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338450"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338451"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338452"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338453"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338454"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338455"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338456"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338457"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338458"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338459"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338460"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338461"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338462"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338463"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338464"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338465"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338466"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338467"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338468"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338469"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338470"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338471"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338472"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338473"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338474"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338475"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338476"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338477"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338478"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338479"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338480"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338481"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338482"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338483"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338484"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338485"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338486"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338487"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338488"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338489"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338490"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338491"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338492"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338493"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338494"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338495"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338496"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338497"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338498"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338499"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338500"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338501"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338502"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338503"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338504"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338505"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338506"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338507"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338508"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338509"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338510"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338511"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338512"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338513"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338514"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338515"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338516"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338517"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338518"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338519"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338520"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338521"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338522"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338523"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338524"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338525"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00338526"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342006"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342007"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342008"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342009"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342010"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342011"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342012"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342013"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342014"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342015"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342016"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342017"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342018"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342019"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342020"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342612"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342613"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342614"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342615"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00342616"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345280"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345281"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345282"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345283"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345284"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345285"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345286"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345287"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345288"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345289"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345290"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345291"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345292"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345293"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345294"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345295"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345296"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345297"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345298"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345299"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345300"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345301"	""	""	""	"18"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345302"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345303"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345304"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345305"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345306"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345307"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345308"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345309"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345310"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345311"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345312"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345313"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345314"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345315"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345316"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345317"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345318"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345319"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345320"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345321"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345322"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345323"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345324"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345325"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345326"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345327"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345328"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345329"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345330"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345331"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345332"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345333"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345334"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345335"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345336"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345337"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345338"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345339"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345340"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345341"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345342"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345343"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345344"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345345"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345346"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345347"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345348"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345349"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345350"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345351"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345352"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345353"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345354"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345355"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345356"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345357"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345358"	""	""	""	"6"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345359"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345360"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345361"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345362"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345363"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345364"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345365"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345366"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345367"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345368"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345369"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345370"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345371"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345372"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345373"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345374"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345375"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345376"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345377"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345378"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345379"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345380"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345381"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345382"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345383"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345384"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345385"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345386"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345387"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345388"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345389"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345390"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345391"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345392"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345393"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345394"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345395"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345396"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345397"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345398"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345399"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345400"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345401"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345402"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345403"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345404"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345405"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345406"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345407"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345408"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345409"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345410"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345411"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345412"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345413"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345414"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345415"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345416"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345417"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345418"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345419"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345420"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345421"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345422"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345423"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345424"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345425"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345426"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345427"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345428"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345429"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345430"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345431"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345432"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345433"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345434"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345435"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345436"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345437"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345438"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345439"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345440"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345441"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345442"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345443"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345444"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345445"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345446"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345447"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345448"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345449"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345450"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345451"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345452"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345453"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345454"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345455"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345456"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345457"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345458"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345459"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345460"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345461"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345462"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345463"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345464"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345465"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345466"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345467"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345468"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345469"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345470"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345471"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345472"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345473"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00345474"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00349215"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00349216"	""	""	""	"25"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00349217"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00349218"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00349219"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00349413"	""	""	""	"885"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351159"	""	""	""	"9"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351160"	""	""	""	"31"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351161"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351162"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351163"	""	""	""	"14"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351164"	""	""	""	"13"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351165"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351166"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351167"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351168"	""	""	""	"23"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351169"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351170"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351171"	""	""	""	"9"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351172"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351173"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351174"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351175"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351176"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351177"	""	""	""	"83"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351178"	""	""	""	"6"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351179"	""	""	""	"7"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351180"	""	""	""	"15"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351181"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351182"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351183"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351184"	""	""	""	"38"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351185"	""	""	""	"11"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351186"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351187"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351188"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351189"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351190"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351191"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351192"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351193"	""	""	""	"16"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351194"	""	""	""	"9"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351195"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351196"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351197"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351198"	""	""	""	"11"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351199"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351200"	""	""	""	"15"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351201"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351202"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351203"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351204"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351205"	""	""	""	"9"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351206"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351207"	""	""	""	"44"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351208"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351209"	""	""	""	"6"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351210"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351211"	""	""	""	"10"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351212"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351213"	""	""	""	"6"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351214"	""	""	""	"10"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351215"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351216"	""	""	""	"13"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351217"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351218"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351219"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351220"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351221"	""	""	""	"13"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351222"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351223"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351224"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351225"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351226"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351227"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351228"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351229"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351230"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351231"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351232"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351233"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351234"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351235"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351236"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351237"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351238"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351239"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351240"	""	""	""	"18"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351241"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351242"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351243"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351244"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351245"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351246"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351247"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351248"	""	""	""	"29"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351249"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351250"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351251"	""	""	""	"27"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351252"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351253"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351254"	""	""	""	"34"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351255"	""	""	""	"6"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351256"	""	""	""	"15"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351257"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351258"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351259"	""	""	""	"7"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351260"	""	""	""	"17"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351261"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351262"	""	""	""	"7"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351263"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351264"	""	""	""	"66"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351265"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351266"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351267"	""	""	""	"20"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351268"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351269"	""	""	""	"34"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351270"	""	""	""	"6"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351271"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351272"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351273"	""	""	""	"73"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351274"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351275"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351276"	""	""	""	"20"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351277"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351278"	""	""	""	"8"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351279"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351280"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351281"	""	""	""	"15"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351282"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351283"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351284"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351285"	""	""	""	"66"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351286"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351287"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351288"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351289"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351290"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351291"	""	""	""	"7"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351292"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351293"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351294"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351295"	""	""	""	"15"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00351296"	""	""	""	"7"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 60466 cases (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00353991"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00353992"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00353993"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00353994"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00353995"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00354189"	""	""	""	"254"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355935"	""	""	""	"9"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355936"	""	""	""	"21"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355937"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355938"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355939"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355940"	""	""	""	"7"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355941"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355942"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355943"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355944"	""	""	""	"23"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355945"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355946"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355947"	""	""	""	"7"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355948"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355949"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355950"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355951"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355952"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355953"	""	""	""	"45"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355954"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355955"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355956"	""	""	""	"11"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355957"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355958"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355959"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355960"	""	""	""	"27"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355961"	""	""	""	"14"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355962"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355963"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355964"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355965"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355966"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355967"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355968"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355969"	""	""	""	"12"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355970"	""	""	""	"9"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355971"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355972"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355973"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355974"	""	""	""	"7"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355975"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355976"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355977"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355978"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355979"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355980"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355981"	""	""	""	"7"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355982"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355983"	""	""	""	"50"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355984"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355985"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355986"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355987"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355988"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355989"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355990"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355991"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355992"	""	""	""	"6"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355993"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355994"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355995"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355996"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355997"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355998"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00355999"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356000"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356001"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356002"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356003"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356004"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356005"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356006"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356007"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356008"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356009"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356010"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356011"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356012"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356013"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356014"	""	""	""	"8"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356015"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356016"	""	""	""	"7"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356017"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356018"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356019"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356020"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356021"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356022"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356023"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356024"	""	""	""	"26"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356025"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356026"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356027"	""	""	""	"15"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356028"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356029"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356030"	""	""	""	"26"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356031"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356032"	""	""	""	"9"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356033"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356034"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356035"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356036"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356037"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356038"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356039"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356040"	""	""	""	"28"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356041"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356042"	""	""	""	"7"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356043"	""	""	""	"9"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356044"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356045"	""	""	""	"13"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356046"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356047"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356048"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356049"	""	""	""	"22"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356050"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356051"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356052"	""	""	""	"7"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356053"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356054"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356055"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356056"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356057"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356058"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356059"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356060"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356061"	""	""	""	"33"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356062"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356063"	""	""	""	"4"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356064"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356065"	""	""	""	"2"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356066"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356067"	""	""	""	"10"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356068"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356069"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356070"	""	""	""	"1"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356071"	""	""	""	"5"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00356072"	""	""	""	"3"	""	"04020"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	"analysis 53461 controls (BRIDGES)"	""	""	""	""	"0"	"bcac.ccge.medschl.cam.ac.uk/contact"	""	""	""
"00372032"	""	""	""	"1"	""	"01164"	""	""	"M"	"?"	""	""	"0"	""	""	""	"176731"
"00376147"	""	""	""	"1"	""	"00585"	""	""	"F"	""	"Belgium"	""	"0"	""	""	""	""
"00376149"	""	""	""	"1"	""	"00585"	""	""	"F"	""	"Belgium"	""	"0"	""	""	""	""
"00376157"	""	""	""	"1"	""	"00585"	""	""	"M"	""	"Belgium"	""	"0"	""	""	""	""
"00377110"	""	""	""	"1"	""	"02551"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00396928"	""	""	""	"1"	""	"00006"	"{PMID:Moreno-Cabrera 2021:33219106}"	""	""	""	"Spain"	""	"0"	""	""	""	"S1"
"00396929"	""	""	""	"1"	""	"00006"	"{PMID:Moreno-Cabrera 2021:33219106}"	""	""	""	"Spain"	""	"0"	""	""	""	"S2"
"00396930"	""	""	""	"1"	""	"00006"	"{PMID:Moreno-Cabrera 2021:33219106}"	""	""	""	"Spain"	""	"0"	""	""	""	"S3"
"00396931"	""	""	""	"1"	""	"00006"	"{PMID:Moreno-Cabrera 2021:33219106}"	""	""	""	"Spain"	""	"0"	""	""	""	"S4"
"00396936"	""	""	""	"1"	""	"00006"	"{PMID:Moreno-Cabrera 2021:33219106}"	""	""	""	"Spain"	""	"0"	""	""	""	"S9"
"00399698"	""	""	""	"1"	""	"00006"	"{PMID:Evans 2022:33758026}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"Pat117"
"00399699"	""	""	""	"1"	""	"00006"	"{PMID:Evans 2022:33758026}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"Pat118"
"00399700"	""	""	""	"1"	""	"00006"	"{PMID:Evans 2022:33758026}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"Pat119"
"00406955"	""	""	""	"2"	""	"00006"	"{PMID:Jiang 2022:33563768}"	"analysis 486 colorectal cancer patients"	""	""	"China"	""	"0"	""	""	""	""
"00406956"	""	""	""	"2"	""	"00006"	"{PMID:Jiang 2022:33563768}"	"analysis 486 colorectal cancer patients"	""	""	"China"	""	"0"	""	""	""	""
"00406957"	""	""	""	"2"	""	"00006"	"{PMID:Jiang 2022:33563768}"	"analysis 486 colorectal cancer patients"	""	""	"China"	""	"0"	""	""	""	""
"00406958"	""	""	""	"2"	""	"00006"	"{PMID:Jiang 2022:33563768}"	"analysis 486 colorectal cancer patients"	""	""	"China"	""	"0"	""	""	""	""
"00410597"	""	""	""	"1"	""	"00006"	"{PMID:Schuermans 2022:35606766}"	"secondary finding analysis 329 adult patients suffering from undiagnosed rare disease"	""	""	"Belgium"	""	"0"	""	""	""	""
"00410598"	""	""	""	"1"	""	"00006"	"{PMID:Schuermans 2022:35606766}"	"secondary finding analysis 329 adult patients suffering from undiagnosed rare disease"	""	""	"Belgium"	""	"0"	""	""	""	""
"00430357"	""	""	""	"1"	""	"01082"	""	""	"M"	"?"	"Brazil"	""	""	""	""	""	"MINAS_19"
"00431637"	""	""	""	"1"	""	"01082"	""	""	"F"	"?"	"Brazil"	""	""	""	""	""	"MINAS_06"
"00432985"	""	""	""	"1"	""	"01082"	""	""	"F"	""	"Brazil"	""	""	""	""	""	"MINAS_10"
"00432986"	""	""	""	"1"	""	"01082"	""	""	"F"	""	"Brazil"	""	""	""	""	""	"MINAS_11"
"00432990"	""	""	""	"1"	""	"01082"	""	""	"F"	""	"Brazil"	""	""	""	""	""	"MINAS_15"
"00432995"	""	""	""	"1"	""	"01082"	""	""	"F"	""	"Brazil"	""	""	""	""	""	"MINAS_27"
"00432997"	""	""	""	"1"	""	"01082"	""	""	"F"	""	"Brazil"	""	""	""	""	""	"MINAS_30"
"00437977"	""	""	""	"1"	""	"00006"	"{PMID:Schnoll 2023:36758531}"	"2-generation family, 1 affected, unaffected parents"	"M"	""	"Brazil"	""	"0"	""	""	""	"Pat2"
"00443556"	""	""	""	"1"	""	"04599"	""	""	"F"	""	"Mexico"	""	""	""	""	"Mexican"	"MXCCR0131"
"00443557"	""	""	""	"1"	""	"04599"	""	""	"M"	""	"Mexico"	""	""	""	""	"Mexican"	"UCDMX002_S2"
"00443558"	""	""	""	"1"	""	"04599"	""	""	"M"	""	"Mexico"	""	""	""	""	"Mexican"	"UCDMX003_S3"
"00455058"	""	""	""	"1"	""	"04749"	""	""	"F"	""	"Singapore"	""	""	""	""	"Chinese"	""
"00460996"	""	""	""	"1"	""	"04796"	""	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00461009"	""	""	""	"1"	""	"04796"	""	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00464502"	""	""	""	"1"	""	"04818"	""	""	"M"	""	""	""	""	""	""	""	""
"00464503"	""	""	""	"1"	""	"04818"	""	""	"M"	""	""	""	""	""	""	""	""


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 910
"{{individualid}}"	"{{diseaseid}}"
"00046286"	"00318"
"00048339"	"00318"
"00048346"	"00318"
"00048378"	"00318"
"00048421"	"00318"
"00050251"	"00198"
"00054820"	"00318"
"00089324"	"00318"
"00090522"	"00091"
"00090523"	"00091"
"00090524"	"00091"
"00090525"	"00091"
"00090527"	"00091"
"00090528"	"00091"
"00090529"	"00091"
"00090530"	"00091"
"00090531"	"00091"
"00090532"	"00091"
"00090533"	"00091"
"00090534"	"00000"
"00090535"	"00091"
"00090536"	"00091"
"00090537"	"00091"
"00090538"	"00091"
"00090539"	"00091"
"00090540"	"00091"
"00090541"	"00091"
"00090542"	"00091"
"00090543"	"00091"
"00090544"	"00091"
"00090545"	"00091"
"00090546"	"00000"
"00090547"	"00091"
"00090548"	"00091"
"00090549"	"00091"
"00090550"	"00091"
"00090551"	"00091"
"00090552"	"00091"
"00090553"	"00091"
"00090554"	"00091"
"00090555"	"00091"
"00090883"	"00091"
"00110546"	"02837"
"00152726"	"04148"
"00152727"	"00927"
"00154486"	"04148"
"00155664"	"00198"
"00164718"	"00198"
"00178086"	"00318"
"00179289"	"00000"
"00179290"	"00318"
"00179291"	"00000"
"00179292"	"00000"
"00179293"	"00318"
"00179294"	"00000"
"00179295"	"00318"
"00179296"	"00000"
"00179297"	"00318"
"00179298"	"00000"
"00179299"	"00318"
"00179300"	"00000"
"00179301"	"00318"
"00179302"	"00000"
"00179303"	"00000"
"00179304"	"00318"
"00179305"	"00000"
"00179306"	"00318"
"00179307"	"00318"
"00179308"	"00318"
"00179309"	"00000"
"00179310"	"00318"
"00179311"	"00318"
"00179312"	"00000"
"00179313"	"00318"
"00179314"	"00318"
"00179315"	"00000"
"00179316"	"00000"
"00179317"	"00318"
"00179318"	"00000"
"00179319"	"00318"
"00179320"	"00000"
"00179321"	"00318"
"00179322"	"00000"
"00179323"	"00318"
"00179324"	"00000"
"00179325"	"00318"
"00179326"	"00000"
"00179327"	"00318"
"00179328"	"00318"
"00179329"	"00000"
"00179330"	"00000"
"00179331"	"00318"
"00179332"	"00318"
"00179333"	"00318"
"00179334"	"00000"
"00179335"	"00000"
"00179336"	"00000"
"00179337"	"00318"
"00179338"	"00318"
"00179339"	"00000"
"00179340"	"00000"
"00179341"	"00318"
"00179342"	"00000"
"00179343"	"00318"
"00179344"	"00000"
"00179345"	"00318"
"00179346"	"00000"
"00179347"	"00000"
"00179348"	"00318"
"00179349"	"00318"
"00179350"	"00000"
"00179351"	"00000"
"00179352"	"00318"
"00179353"	"00000"
"00179354"	"00318"
"00179355"	"00000"
"00179356"	"00000"
"00179357"	"00318"
"00179358"	"00000"
"00179359"	"00318"
"00179360"	"00318"
"00179361"	"00000"
"00179362"	"00000"
"00179363"	"00000"
"00179364"	"00000"
"00179365"	"00318"
"00179366"	"00318"
"00179367"	"00000"
"00179368"	"00000"
"00179369"	"00318"
"00179370"	"00000"
"00179371"	"00000"
"00179372"	"00318"
"00179373"	"00318"
"00179374"	"00318"
"00179375"	"00318"
"00179376"	"00318"
"00179377"	"00000"
"00179378"	"00000"
"00179379"	"00000"
"00179380"	"00000"
"00179381"	"00000"
"00179382"	"00000"
"00179383"	"00318"
"00179384"	"00318"
"00179385"	"00318"
"00179386"	"00318"
"00179387"	"00000"
"00179388"	"00318"
"00179389"	"00000"
"00179390"	"00000"
"00179391"	"00318"
"00179392"	"00000"
"00179393"	"00000"
"00179394"	"00000"
"00179395"	"00000"
"00179396"	"00000"
"00180885"	"00000"
"00180886"	"00318"
"00180887"	"00318"
"00180888"	"00000"
"00181626"	"00318"
"00182911"	"00000"
"00182912"	"00000"
"00182913"	"00000"
"00182914"	"00000"
"00182915"	"00000"
"00182916"	"00000"
"00182917"	"00000"
"00182918"	"00000"
"00182919"	"00000"
"00182920"	"00000"
"00182921"	"00000"
"00182922"	"00000"
"00182923"	"00000"
"00182924"	"00000"
"00182925"	"00000"
"00182926"	"00000"
"00182927"	"00000"
"00182928"	"00000"
"00182929"	"00000"
"00182930"	"00000"
"00182931"	"00000"
"00182932"	"00000"
"00182933"	"00000"
"00182934"	"00000"
"00182935"	"00000"
"00182936"	"00000"
"00182937"	"00000"
"00182938"	"00000"
"00182939"	"00000"
"00182940"	"00000"
"00182941"	"00000"
"00182942"	"00000"
"00182943"	"00000"
"00182944"	"00000"
"00182945"	"00000"
"00182946"	"00000"
"00182947"	"00000"
"00182948"	"00000"
"00182949"	"00000"
"00182950"	"00000"
"00182951"	"00000"
"00182952"	"00000"
"00182953"	"00000"
"00182954"	"00000"
"00208790"	"05330"
"00213626"	"00683"
"00218073"	"04148"
"00218082"	"04148"
"00218083"	"04148"
"00218084"	"04148"
"00218085"	"04148"
"00218086"	"04148"
"00218088"	"04148"
"00218089"	"04148"
"00218090"	"04148"
"00218091"	"04148"
"00246489"	"00318"
"00246490"	"00318"
"00246491"	"00318"
"00246492"	"00318"
"00246493"	"00318"
"00246494"	"00318"
"00246495"	"00318"
"00246496"	"00318"
"00246497"	"00318"
"00246498"	"00318"
"00246499"	"00318"
"00246500"	"00318"
"00246501"	"00318"
"00246502"	"00318"
"00246503"	"00318"
"00246504"	"00318"
"00246505"	"00318"
"00246506"	"00318"
"00246507"	"00318"
"00246508"	"00318"
"00246509"	"00318"
"00246510"	"00318"
"00248203"	"00318"
"00248250"	"00318"
"00264001"	"04296"
"00266410"	"05489"
"00266474"	"05489"
"00266485"	"00318"
"00289278"	"00198"
"00289305"	"00198"
"00293081"	"00198"
"00293082"	"00198"
"00293083"	"00198"
"00293084"	"00198"
"00293085"	"00198"
"00293086"	"00198"
"00293087"	"00198"
"00295191"	"00198"
"00295192"	"00198"
"00295193"	"00198"
"00295194"	"00198"
"00295556"	"00198"
"00295558"	"00198"
"00295586"	"00198"
"00295658"	"00198"
"00295741"	"00198"
"00295748"	"00198"
"00295886"	"00683"
"00295887"	"00683"
"00295899"	"00683"
"00296396"	"00198"
"00296860"	"00198"
"00300642"	"00198"
"00301396"	"00198"
"00307257"	"01544"
"00308000"	"00198"
"00336112"	"00000"
"00336113"	"00000"
"00336340"	"00000"
"00336341"	"00000"
"00338433"	"00000"
"00338434"	"00000"
"00338435"	"00000"
"00338436"	"00000"
"00338437"	"00000"
"00338438"	"00000"
"00338439"	"00000"
"00338440"	"00000"
"00338441"	"00000"
"00338442"	"00000"
"00338443"	"00000"
"00338444"	"00000"
"00338445"	"00000"
"00338446"	"00000"
"00338447"	"00000"
"00338448"	"00000"
"00338449"	"00000"
"00338450"	"00000"
"00338451"	"00000"
"00338452"	"00000"
"00338453"	"00000"
"00338454"	"00000"
"00338455"	"00000"
"00338456"	"00000"
"00338457"	"00000"
"00338458"	"00000"
"00338459"	"00000"
"00338460"	"00000"
"00338461"	"00000"
"00338462"	"00000"
"00338463"	"00000"
"00338464"	"00000"
"00338465"	"00000"
"00338466"	"00000"
"00338467"	"00000"
"00338468"	"00000"
"00338469"	"00000"
"00338470"	"00000"
"00338471"	"00000"
"00338472"	"00000"
"00338473"	"00000"
"00338474"	"00000"
"00338475"	"00000"
"00338476"	"00000"
"00338477"	"00000"
"00338478"	"00000"
"00338479"	"00000"
"00338480"	"00000"
"00338481"	"00000"
"00338482"	"00000"
"00338483"	"00000"
"00338484"	"00000"
"00338485"	"00000"
"00338486"	"00000"
"00338487"	"00000"
"00338488"	"00000"
"00338489"	"00000"
"00338490"	"00000"
"00338491"	"00000"
"00338492"	"00000"
"00338493"	"00000"
"00338494"	"00000"
"00338495"	"00000"
"00338496"	"00000"
"00338497"	"00000"
"00338498"	"00000"
"00338499"	"00000"
"00338500"	"00000"
"00338501"	"00000"
"00338502"	"00000"
"00338503"	"00000"
"00338504"	"00000"
"00338505"	"00000"
"00338506"	"00000"
"00338507"	"00000"
"00338508"	"00000"
"00338509"	"00000"
"00338510"	"00000"
"00338511"	"00000"
"00338512"	"00000"
"00338513"	"00000"
"00338514"	"00000"
"00338515"	"00000"
"00338516"	"00000"
"00338517"	"00000"
"00338518"	"00000"
"00338519"	"00000"
"00338520"	"00000"
"00338521"	"00000"
"00338522"	"00000"
"00338523"	"00000"
"00338524"	"00000"
"00338525"	"00000"
"00338526"	"00000"
"00342006"	"00318"
"00342007"	"00318"
"00342008"	"00318"
"00342009"	"00318"
"00342010"	"00318"
"00342011"	"00318"
"00342012"	"00318"
"00342013"	"00318"
"00342014"	"00318"
"00342015"	"00318"
"00342016"	"00318"
"00342017"	"00318"
"00342018"	"00318"
"00342019"	"00318"
"00342020"	"00318"
"00342612"	"00318"
"00342613"	"00318"
"00342614"	"00318"
"00342615"	"00318"
"00342616"	"00318"
"00345280"	"00318"
"00345281"	"00318"
"00345282"	"00318"
"00345283"	"00318"
"00345284"	"00318"
"00345285"	"00318"
"00345286"	"00318"
"00345287"	"00318"
"00345288"	"00318"
"00345289"	"00318"
"00345290"	"00318"
"00345291"	"00318"
"00345292"	"00318"
"00345293"	"00318"
"00345294"	"00318"
"00345295"	"00318"
"00345296"	"00318"
"00345297"	"00318"
"00345298"	"00318"
"00345299"	"00318"
"00345300"	"00318"
"00345301"	"00318"
"00345302"	"00318"
"00345303"	"00318"
"00345304"	"00318"
"00345305"	"00318"
"00345306"	"00318"
"00345307"	"00318"
"00345308"	"00318"
"00345309"	"00318"
"00345310"	"00318"
"00345311"	"00318"
"00345312"	"00318"
"00345313"	"00318"
"00345314"	"00318"
"00345315"	"00318"
"00345316"	"00318"
"00345317"	"00318"
"00345318"	"00318"
"00345319"	"00318"
"00345320"	"00318"
"00345321"	"00318"
"00345322"	"00318"
"00345323"	"00318"
"00345324"	"00318"
"00345325"	"00318"
"00345326"	"00318"
"00345327"	"00318"
"00345328"	"00318"
"00345329"	"00318"
"00345330"	"00318"
"00345331"	"00318"
"00345332"	"00318"
"00345333"	"00318"
"00345334"	"00318"
"00345335"	"00318"
"00345336"	"00318"
"00345337"	"00318"
"00345338"	"00318"
"00345339"	"00318"
"00345340"	"00318"
"00345341"	"00318"
"00345342"	"00318"
"00345343"	"00318"
"00345344"	"00318"
"00345345"	"00318"
"00345346"	"00318"
"00345347"	"00318"
"00345348"	"00318"
"00345349"	"00318"
"00345350"	"00318"
"00345351"	"00318"
"00345352"	"00318"
"00345353"	"00318"
"00345354"	"00318"
"00345355"	"00318"
"00345356"	"00318"
"00345357"	"00318"
"00345358"	"00318"
"00345359"	"00318"
"00345360"	"00318"
"00345361"	"00318"
"00345362"	"00318"
"00345363"	"00318"
"00345364"	"00318"
"00345365"	"00318"
"00345366"	"00318"
"00345367"	"00318"
"00345368"	"00318"
"00345369"	"00318"
"00345370"	"00318"
"00345371"	"00318"
"00345372"	"00318"
"00345373"	"00318"
"00345374"	"00318"
"00345375"	"00318"
"00345376"	"00318"
"00345377"	"00318"
"00345378"	"00318"
"00345379"	"00318"
"00345380"	"00318"
"00345381"	"00318"
"00345382"	"00318"
"00345383"	"00318"
"00345384"	"00318"
"00345385"	"00318"
"00345386"	"00318"
"00345387"	"00318"
"00345388"	"00318"
"00345389"	"00318"
"00345390"	"00318"
"00345391"	"00318"
"00345392"	"00318"
"00345393"	"00318"
"00345394"	"00318"
"00345395"	"00318"
"00345396"	"00318"
"00345397"	"00318"
"00345398"	"00318"
"00345399"	"00318"
"00345400"	"00318"
"00345401"	"00318"
"00345402"	"00318"
"00345403"	"00318"
"00345404"	"00318"
"00345405"	"00318"
"00345406"	"00318"
"00345407"	"00318"
"00345408"	"00318"
"00345409"	"00318"
"00345410"	"00318"
"00345411"	"00318"
"00345412"	"00318"
"00345413"	"00318"
"00345414"	"00318"
"00345415"	"00318"
"00345416"	"00318"
"00345417"	"00318"
"00345418"	"00318"
"00345419"	"00318"
"00345420"	"00318"
"00345421"	"00318"
"00345422"	"00318"
"00345423"	"00318"
"00345424"	"00318"
"00345425"	"00318"
"00345426"	"00318"
"00345427"	"00318"
"00345428"	"00318"
"00345429"	"00318"
"00345430"	"00318"
"00345431"	"00318"
"00345432"	"00318"
"00345433"	"00318"
"00345434"	"00318"
"00345435"	"00318"
"00345436"	"00318"
"00345437"	"00318"
"00345438"	"00318"
"00345439"	"00318"
"00345440"	"00318"
"00345441"	"00318"
"00345442"	"00318"
"00345443"	"00318"
"00345444"	"00318"
"00345445"	"00318"
"00345446"	"00318"
"00345447"	"00318"
"00345448"	"00318"
"00345449"	"00318"
"00345450"	"00318"
"00345451"	"00318"
"00345452"	"00318"
"00345453"	"00318"
"00345454"	"00318"
"00345455"	"00318"
"00345456"	"00318"
"00345457"	"00318"
"00345458"	"00318"
"00345459"	"00318"
"00345460"	"00318"
"00345461"	"00318"
"00345462"	"00318"
"00345463"	"00318"
"00345464"	"00318"
"00345465"	"00318"
"00345466"	"00318"
"00345467"	"00318"
"00345468"	"00318"
"00345469"	"00318"
"00345470"	"00318"
"00345471"	"00318"
"00345472"	"00318"
"00345473"	"00318"
"00345474"	"00318"
"00349215"	"00318"
"00349216"	"00318"
"00349217"	"00318"
"00349218"	"00318"
"00349219"	"00318"
"00349413"	"00318"
"00351159"	"00318"
"00351160"	"00318"
"00351161"	"00318"
"00351162"	"00318"
"00351163"	"00318"
"00351164"	"00318"
"00351165"	"00318"
"00351166"	"00318"
"00351167"	"00318"
"00351168"	"00318"
"00351169"	"00318"
"00351170"	"00318"
"00351171"	"00318"
"00351172"	"00318"
"00351173"	"00318"
"00351174"	"00318"
"00351175"	"00318"
"00351176"	"00318"
"00351177"	"00318"
"00351178"	"00318"
"00351179"	"00318"
"00351180"	"00318"
"00351181"	"00318"
"00351182"	"00318"
"00351183"	"00318"
"00351184"	"00318"
"00351185"	"00318"
"00351186"	"00318"
"00351187"	"00318"
"00351188"	"00318"
"00351189"	"00318"
"00351190"	"00318"
"00351191"	"00318"
"00351192"	"00318"
"00351193"	"00318"
"00351194"	"00318"
"00351195"	"00318"
"00351196"	"00318"
"00351197"	"00318"
"00351198"	"00318"
"00351199"	"00318"
"00351200"	"00318"
"00351201"	"00318"
"00351202"	"00318"
"00351203"	"00318"
"00351204"	"00318"
"00351205"	"00318"
"00351206"	"00318"
"00351207"	"00318"
"00351208"	"00318"
"00351209"	"00318"
"00351210"	"00318"
"00351211"	"00318"
"00351212"	"00318"
"00351213"	"00318"
"00351214"	"00318"
"00351215"	"00318"
"00351216"	"00318"
"00351217"	"00318"
"00351218"	"00318"
"00351219"	"00318"
"00351220"	"00318"
"00351221"	"00318"
"00351222"	"00318"
"00351223"	"00318"
"00351224"	"00318"
"00351225"	"00318"
"00351226"	"00318"
"00351227"	"00318"
"00351228"	"00318"
"00351229"	"00318"
"00351230"	"00318"
"00351231"	"00318"
"00351232"	"00318"
"00351233"	"00318"
"00351234"	"00318"
"00351235"	"00318"
"00351236"	"00318"
"00351237"	"00318"
"00351238"	"00318"
"00351239"	"00318"
"00351240"	"00318"
"00351241"	"00318"
"00351242"	"00318"
"00351243"	"00318"
"00351244"	"00318"
"00351245"	"00318"
"00351246"	"00318"
"00351247"	"00318"
"00351248"	"00318"
"00351249"	"00318"
"00351250"	"00318"
"00351251"	"00318"
"00351252"	"00318"
"00351253"	"00318"
"00351254"	"00318"
"00351255"	"00318"
"00351256"	"00318"
"00351257"	"00318"
"00351258"	"00318"
"00351259"	"00318"
"00351260"	"00318"
"00351261"	"00318"
"00351262"	"00318"
"00351263"	"00318"
"00351264"	"00318"
"00351265"	"00318"
"00351266"	"00318"
"00351267"	"00318"
"00351268"	"00318"
"00351269"	"00318"
"00351270"	"00318"
"00351271"	"00318"
"00351272"	"00318"
"00351273"	"00318"
"00351274"	"00318"
"00351275"	"00318"
"00351276"	"00318"
"00351277"	"00318"
"00351278"	"00318"
"00351279"	"00318"
"00351280"	"00318"
"00351281"	"00318"
"00351282"	"00318"
"00351283"	"00318"
"00351284"	"00318"
"00351285"	"00318"
"00351286"	"00318"
"00351287"	"00318"
"00351288"	"00318"
"00351289"	"00318"
"00351290"	"00318"
"00351291"	"00318"
"00351292"	"00318"
"00351293"	"00318"
"00351294"	"00318"
"00351295"	"00318"
"00351296"	"00318"
"00353991"	"00000"
"00353992"	"00000"
"00353993"	"00000"
"00353994"	"00000"
"00353995"	"00000"
"00354189"	"00000"
"00355935"	"00000"
"00355936"	"00000"
"00355937"	"00000"
"00355938"	"00000"
"00355939"	"00000"
"00355940"	"00000"
"00355941"	"00000"
"00355942"	"00000"
"00355943"	"00000"
"00355944"	"00000"
"00355945"	"00000"
"00355946"	"00000"
"00355947"	"00000"
"00355948"	"00000"
"00355949"	"00000"
"00355950"	"00000"
"00355951"	"00000"
"00355952"	"00000"
"00355953"	"00000"
"00355954"	"00000"
"00355955"	"00000"
"00355956"	"00000"
"00355957"	"00000"
"00355958"	"00000"
"00355959"	"00000"
"00355960"	"00000"
"00355961"	"00000"
"00355962"	"00000"
"00355963"	"00000"
"00355964"	"00000"
"00355965"	"00000"
"00355966"	"00000"
"00355967"	"00000"
"00355968"	"00000"
"00355969"	"00000"
"00355970"	"00000"
"00355971"	"00000"
"00355972"	"00000"
"00355973"	"00000"
"00355974"	"00000"
"00355975"	"00000"
"00355976"	"00000"
"00355977"	"00000"
"00355978"	"00000"
"00355979"	"00000"
"00355980"	"00000"
"00355981"	"00000"
"00355982"	"00000"
"00355983"	"00000"
"00355984"	"00000"
"00355985"	"00000"
"00355986"	"00000"
"00355987"	"00000"
"00355988"	"00000"
"00355989"	"00000"
"00355990"	"00000"
"00355991"	"00000"
"00355992"	"00000"
"00355993"	"00000"
"00355994"	"00000"
"00355995"	"00000"
"00355996"	"00000"
"00355997"	"00000"
"00355998"	"00000"
"00355999"	"00000"
"00356000"	"00000"
"00356001"	"00000"
"00356002"	"00000"
"00356003"	"00000"
"00356004"	"00000"
"00356005"	"00000"
"00356006"	"00000"
"00356007"	"00000"
"00356008"	"00000"
"00356009"	"00000"
"00356010"	"00000"
"00356011"	"00000"
"00356012"	"00000"
"00356013"	"00000"
"00356014"	"00000"
"00356015"	"00000"
"00356016"	"00000"
"00356017"	"00000"
"00356018"	"00000"
"00356019"	"00000"
"00356020"	"00000"
"00356021"	"00000"
"00356022"	"00000"
"00356023"	"00000"
"00356024"	"00000"
"00356025"	"00000"
"00356026"	"00000"
"00356027"	"00000"
"00356028"	"00000"
"00356029"	"00000"
"00356030"	"00000"
"00356031"	"00000"
"00356032"	"00000"
"00356033"	"00000"
"00356034"	"00000"
"00356035"	"00000"
"00356036"	"00000"
"00356037"	"00000"
"00356038"	"00000"
"00356039"	"00000"
"00356040"	"00000"
"00356041"	"00000"
"00356042"	"00000"
"00356043"	"00000"
"00356044"	"00000"
"00356045"	"00000"
"00356046"	"00000"
"00356047"	"00000"
"00356048"	"00000"
"00356049"	"00000"
"00356050"	"00000"
"00356051"	"00000"
"00356052"	"00000"
"00356053"	"00000"
"00356054"	"00000"
"00356055"	"00000"
"00356056"	"00000"
"00356057"	"00000"
"00356058"	"00000"
"00356059"	"00000"
"00356060"	"00000"
"00356061"	"00000"
"00356062"	"00000"
"00356063"	"00000"
"00356064"	"00000"
"00356065"	"00000"
"00356066"	"00000"
"00356067"	"00000"
"00356068"	"00000"
"00356069"	"00000"
"00356070"	"00000"
"00356071"	"00000"
"00356072"	"00000"
"00372032"	"05389"
"00376147"	"00681"
"00376149"	"00681"
"00376157"	"00681"
"00377110"	"00198"
"00396928"	"05093"
"00396929"	"05093"
"00396930"	"05093"
"00396931"	"05093"
"00396936"	"05093"
"00399698"	"00318"
"00399699"	"00318"
"00399700"	"00318"
"00406955"	"05489"
"00406956"	"05489"
"00406957"	"05489"
"00406958"	"05489"
"00410597"	"00198"
"00410598"	"00198"
"00430357"	"04296"
"00431637"	"04296"
"00432985"	"04296"
"00432986"	"04296"
"00432990"	"04296"
"00432995"	"04296"
"00432997"	"04296"
"00437977"	"00198"
"00443556"	"05489"
"00443557"	"05489"
"00443558"	"05489"
"00455058"	"04296"
"00460996"	"00198"
"00461009"	"00198"
"00464502"	"01524"
"00464503"	"01524"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00000, 00091, 00198, 00318, 00681, 00683, 00927, 01524, 01544, 01989, 02837, 04148, 04296, 05093, 05330, 05389, 05489
## Count = 101
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Development/Cognition}}"	"{{Phenotype/Seizures}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/TSC}}"	"{{Phenotype/Development_delay_global/HPO_0001263}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Intellectual_dis/HPO_0001249}}"	"{{Phenotype/Cysts}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Cancer/Sub_type}}"	"{{Phenotype/Eye/Retina}}"	"{{Phenotype/Neoplasm}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000035049"	"00318"	"00048339"	"00589"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000035056"	"00318"	"00048346"	"00589"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000035088"	"00318"	"00048378"	"00578"	"Unknown"	""	"BR32"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000035131"	"00318"	"00048421"	"00578"	"Unknown"	""	"BR34"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000036863"	"00198"	"00050251"	"00006"	"Unknown"	""	"severe undiagnosed developmental disorders"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000041474"	"00318"	"00054820"	"01474"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000068713"	"00318"	"00089324"	"00589"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000087723"	"02837"	"00110546"	"01741"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000125669"	"04148"	"00152726"	"01164"	"Unknown"	"51y"	"BC at age 50, mother BC bilateral at age 68, aunt BC"	"50y"	""	""	"50y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000125670"	"00927"	"00152727"	"00006"	"Unknown"	"59y"	"cancer, colon, cecum, stage IV; 49y-chronic lymphocytic leukemia"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000127221"	"04148"	"00154486"	"01164"	"Unknown"	"31y"	"Breast Cancer 31y, mother Breast Cancer 57y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"31y"	""
"0000129757"	"00198"	"00164718"	"01807"	"Unknown"	""	"HP:0010619 (Fibroadenoma of the breast)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000143832"	"00318"	"00178086"	"00006"	"Unknown"	""	"no history of other cancer (mother breast cancer); cancer unilateral; histological classificationsmissed, TNM clinical classification missed; both estrogen and progesterone receptor status positive"	""	""	""	"44y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000143834"	"00318"	"00179373"	"00006"	"Unknown"	""	"no history of other cancer (family members gastric cancer and testicular tumor0; unilateral breast cancer; histological classification solid-tubular subtype invasive ductal breast carcinoma, TNM clinical classification T2, N1, and M0; hormone receptor status for estrogen positive, progesterone negative, HER2 equivocal"	""	""	""	"56y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000155551"	"00198"	"00207765"	"01164"	"Unknown"	""	"HP:0003002 (Breast carcinoma)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000155554"	"00198"	"00207769"	"01164"	"Unknown"	""	"HP:0003002 (Breast carcinoma)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000157403"	"00198"	"00208790"	"01164"	"Unknown"	""	"HP:0000951 (Abnormality of the skin); HP:0001028 (Hemangioma); HP:0010786 (Urinary tract neoplasm); HP:0001250 (Seizures); HP:0005584 (Renal cell carcinoma); HP:0012638 (Abnormality of nervous system physiology); HP:0007620 (Cutaneous leiomyoma)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"suspected Tuberous sclerosis, differential diagnosis: leiomyomatosis. The patient had: epilepsy, kidney tumor, hemangiomas, leiomyoma"
"0000166526"	"04148"	"00218073"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..., breast cancer, other cancer types"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000166535"	"04148"	"00218082"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000166536"	"04148"	"00218083"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000166537"	"04148"	"00218084"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000166538"	"04148"	"00218085"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000166539"	"04148"	"00218086"	"00006"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186340"	"00318"	"00246489"	"00643"	"Unknown"	""	"family history; 47y first breast cancer, 56y second breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186341"	"00318"	"00246490"	"00643"	"Unknown"	""	"family history; no triple-negative breast cancer; 47y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186342"	"00318"	"00246491"	"00643"	"Unknown"	""	"no family history; no triple-negative breast cancer; 36y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186343"	"00318"	"00246492"	"00643"	"Unknown"	""	"no family history; no triple-negative breast cancer; 30y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186344"	"00318"	"00246493"	"00643"	"Unknown"	""	"family history; 57y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186345"	"00318"	"00246494"	"00643"	"Unknown"	""	"family history; triple-negative breast cancer; 39y first breast cancer, 58y second breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186346"	"00318"	"00246495"	"00643"	"Unknown"	""	"family history; no triple-negative breast cancer; 46y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186347"	"00318"	"00246496"	"00643"	"Unknown"	""	"family history; no triple-negative breast cancer; 35y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186348"	"00318"	"00246497"	"00643"	"Unknown"	""	"family history; no triple-negative breast cancer; 34y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186349"	"00318"	"00246498"	"00643"	"Unknown"	""	"family history; no triple-negative breast cancer; 41y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186350"	"00318"	"00246499"	"00643"	"Unknown"	""	"family history; 51y first breast cancer, 67y second breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186351"	"00318"	"00246500"	"00643"	"Unknown"	""	"family history; 48y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186352"	"00318"	"00246501"	"00643"	"Unknown"	""	"family history; no triple-negative breast cancer; 36y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186353"	"00318"	"00246502"	"00643"	"Unknown"	""	"family history; no triple-negative breast cancer; 31y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186354"	"00318"	"00246503"	"00643"	"Unknown"	""	"family history; no triple-negative breast cancer; 29y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186355"	"00318"	"00246504"	"00643"	"Unknown"	""	"family history; 46y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186356"	"00318"	"00246505"	"00643"	"Unknown"	""	"family history; no triple-negative breast cancer; 50y first breast cancer, 52y second breast cancer; 53y colorectal cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186357"	"00318"	"00246506"	"00643"	"Unknown"	""	"family history; no triple-negative breast cancer; 33y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186358"	"00318"	"00246507"	"00643"	"Unknown"	""	"family history; 50y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186359"	"00318"	"00246508"	"00643"	"Unknown"	""	"family history; no triple-negative breast cancer; 41y first breast cancer, 42y second breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186360"	"00318"	"00246509"	"00643"	"Unknown"	""	"no triple-negative breast cancer; 30y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186361"	"00318"	"00246510"	"00643"	"Unknown"	""	"family history; no triple-negative breast cancer; 48y first breast cancer"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000186490"	"00198"	"00246637"	"01164"	"Unknown"	""	"HP:0005266 (Intestinal polyp), tubular adenoma in sigma; father colorectal cancer at 65y; grandfather colorectal cancer at 85y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000186494"	"00198"	"00246641"	"01164"	"Unknown"	""	"HP:0003002 (Breast carcinoma) right side at 47y/left side at 61y; grandmother ps. breast cancer at 35-40y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000187212"	"00318"	"00248203"	"01474"	"Unknown"	""	"35y ductal breast cancer, subtype luminal B"	"35y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000187259"	"00318"	"00248250"	"01474"	"Unknown"	""	"41y ductal breast cancer, subtype HER-2"	"41y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000187401"	"00198"	"00248407"	"01164"	"Unknown"	""	"HP:0002861 (Melanoma); HP:0003002 (Breast carcinoma)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000200599"	"00198"	"00262119"	"01164"	"Unknown"	""	"Breast carcinoma (HP:0003002)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000201567"	"00198"	"00263128"	"01164"	"Unknown"	""	"Breast carcinoma (HP:0003002)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000201859"	"04296"	"00264001"	"00727"	"Unknown"	""	"Fibrofolliculoma (multiple), 18y; Renal cell carcinoma, 53y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000201893"	"00198"	"00264038"	"01164"	"Unknown"	""	"Ductal carcinoma in situ (HP:0030075)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000202948"	"00198"	"00265102"	"01164"	"Unknown"	""	"Breast carcinoma (HP:0003002)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000203221"	"00198"	"00265412"	"01164"	"Unknown"	""	"Papillary thyroid carcinoma (HP:0002895); Breast carcinoma (HP:0003002)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000203949"	"00198"	"00266173"	"01164"	"Unknown"	""	"Breast carcinoma (HP:0003002)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000204208"	"05489"	"00266474"	"02337"	"Familial"	""	"family history"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"colon cancer"	""
"0000204219"	"00318"	"00266485"	"02337"	"Familial"	""	"family history"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000222909"	"00198"	"00289278"	"01164"	"Unknown"	""	"Paraganglioma (HP:0002668); Abnormality of the skin (HP:0000951)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000222936"	"00198"	"00289305"	"01164"	"Unknown"	""	"Neoplasm of the pancreas (HP:0002894); Breast carcinoma (HP:0003002)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000223121"	"00198"	"00295556"	"01164"	"Unknown"	""	"Breast carcinoma (HP:0003002)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000223123"	"00198"	"00295558"	"01164"	"Unknown"	""	"Neoplasm of the rectum (HP:0100743); Prostate neoplasm (HP:0100787); Neoplasm of the gastrointestinal tract (HP:0007378); Abnormality of the prostate (HP:0008775)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000223151"	"00198"	"00295586"	"01164"	"Unknown"	""	"Breast carcinoma (HP:0003002); Portal vein thrombosis (HP:0030242)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000223222"	"00198"	"00295658"	"01164"	"Unknown"	""	"Ovarian neoplasm (HP:0100615); Neoplasm of the genitourinary tract (HP:0007379)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000223259"	"00198"	"00295741"	"01164"	"Unknown"	""	"Breast carcinoma (HP:0003002)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000223266"	"00198"	"00295748"	"01164"	"Unknown"	""	"Ductal carcinoma in situ (HP:0030075)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000223363"	"00683"	"00295886"	"03629"	"Familial, autosomal dominant"	""	"breast cancer (HP:0003002)"	""	""	""	"45y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	"Hereditary breast cancer"
"0000223364"	"00683"	"00295887"	"03629"	"Familial, autosomal dominant"	""	"breast cancer (HP:0003002)"	""	""	""	"28y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	"Hereditary breast cancer"
"0000223375"	"00683"	"00295899"	"03629"	"Familial, autosomal dominant"	""	"breast cancer (HP:0003002)"	"65y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	"Hereditary breast cancer"
"0000223810"	"00198"	"00296396"	"01164"	"Unknown"	""	"Multifocal breast carcinoma (HP:0006625)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000224257"	"00198"	"00296860"	"01164"	"Unknown"	""	"Ovarian neoplasm (HP:0100615); Uterine neoplasm (HP:0010784)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000227953"	"00198"	"00300642"	"01164"	"Unknown"	""	"Thromboembolism (HP:0001907); Intestinal polyposis (HP:0200008)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000228574"	"00198"	"00301396"	"01164"	"Unknown"	""	"Polycythemia (HP:0001901); Intestinal polyp (HP:0005266)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000233061"	"01544"	"00307257"	"03753"	"Unknown"	""	"Unilateral"	""	""	""	"00y22m"	"HP:0000486"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000233423"	"00198"	"00308000"	"01164"	"Unknown"	""	"Breast carcinoma (HP:0003002)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000267370"	"05389"	"00372032"	"01164"	"Unknown"	"06y"	"Multiple café au lait spots, impulsive behavioural disorder, adjustment disorder, cognitive development and language development rather slow, concentration problems."	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000271358"	"00681"	"00376147"	"00585"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"pancreatic ductal adenocarcinoma"	""
"0000271360"	"00681"	"00376149"	"00585"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"pancreatic ductal adenocarcinoma"	""
"0000271368"	"00681"	"00376157"	"00585"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"pancreatic ductal adenocarcinoma"	""
"0000272292"	"00198"	"00377110"	"02551"	"Unknown"	""	"Breast carcinoma (HP:0003002)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000290087"	"05093"	"00396928"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"renal cancer syndromes"	""
"0000290088"	"05093"	"00396929"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast and ovarian cancer"	""
"0000290089"	"05093"	"00396930"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"non polyposis colon cancer"	""
"0000290090"	"05093"	"00396931"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000290095"	"05093"	"00396936"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast and ovarian cancer"	""
"0000292804"	"00318"	"00399698"	"00006"	"Familial, autosomal dominant"	""	"sporadic breast cancer, NOS"	"26y-30y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000292805"	"00318"	"00399699"	"00006"	"Familial, autosomal dominant"	""	"familial breast cancer, invasive breast cancer, grade 3"	"26y-30y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000292806"	"00318"	"00399700"	"00006"	"Familial, autosomal dominant"	""	"familial breast cancer, invasive breast cancer, grade 3, ER+/HER2-"	"26y-30y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	"breast cancer"	""
"0000321159"	"04296"	"00430357"	"01082"	"Familial, autosomal dominant"	""	"Prostate adenocarcinoma(HP:0012125)"	""	""	""	"61y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000323679"	"04296"	"00431637"	"01082"	"Familial, autosomal dominant"	"49y"	"Breast Cancer (HP:0003002)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000323682"	"04296"	"00432985"	"01082"	"Familial, autosomal dominant"	"43y"	"Breast Cancer (HP:0003002)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000323683"	"04296"	"00432986"	"01082"	"Familial, autosomal dominant"	"43y"	"Bilateral breast cancer (HP:0003002)"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000323687"	"04296"	"00432990"	"01082"	"Familial, autosomal dominant"	""	"Breast cancer (HP:0003002)"	""	""	""	"33y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000323692"	"04296"	"00432995"	"01082"	"Familial, autosomal dominant"	""	"Breast cancer (HP:0003002)"	""	""	""	"59y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000323694"	"04296"	"00432997"	"01082"	"Familial, autosomal dominant"	""	"Breast cancer (HP:0003002)"	""	""	""	"37y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000327884"	"00198"	"00437977"	"00006"	"Unknown"	"11y"	"see paper; ..., short stature, central obesity, mild-moderate cognitive impairment, no motor developmental delay"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000332872"	"05489"	"00443556"	"04599"	"Unknown"	"61"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000332873"	"05489"	"00443557"	"04599"	"Unknown"	"29"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000332874"	"05489"	"00443558"	"04599"	"Unknown"	"57"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000343649"	"04296"	"00455058"	"04749"	"Familial, autosomal dominant"	""	"HP:0003002; breast cancer 47y† R IDC ER/PR+ Her2-"	""	""	""	"47y"	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""	""


## Screenings ## Do not remove or alter this header ##
## Count = 925
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000046391"	"00046286"	"1"	"01339"	"00008"	"2015-07-03 21:52:27"	""	""	"SEQ"	"DNA"	""	""
"0000048255"	"00048339"	"2"	"00589"	"00008"	"2015-09-04 19:57:50"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000048262"	"00048346"	"4"	"00589"	"00008"	"2015-09-04 19:57:50"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000048294"	"00048378"	"2"	"00578"	"00008"	"2015-09-04 19:57:50"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000048337"	"00048421"	"2"	"00578"	"00008"	"2015-09-04 19:57:50"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000050196"	"00050251"	"1"	"00006"	"00006"	"2015-09-27 13:26:52"	""	""	"SEQ;SEQ-NG-I"	"DNA"	""	""
"0000054769"	"00054820"	"1"	"01474"	"01474"	"2015-11-25 12:56:32"	"00006"	"2019-07-19 16:12:09"	"SEQ-NG-S"	"DNA"	"blood"	""
"0000089469"	"00089324"	"1"	"00589"	"00008"	"2016-12-02 14:43:16"	""	""	"SEQ"	"DNA"	""	""
"0000090667"	"00090522"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090668"	"00090523"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090669"	"00090524"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090670"	"00090525"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090672"	"00090527"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090673"	"00090528"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090674"	"00090529"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090675"	"00090530"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090676"	"00090531"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090677"	"00090532"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090678"	"00090533"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090679"	"00090534"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090680"	"00090535"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090681"	"00090536"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090682"	"00090537"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090683"	"00090538"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090684"	"00090539"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090685"	"00090540"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090686"	"00090541"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090687"	"00090542"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090688"	"00090543"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090689"	"00090544"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090690"	"00090545"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090691"	"00090546"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090692"	"00090547"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090693"	"00090548"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090694"	"00090549"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090695"	"00090550"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090696"	"00090551"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090697"	"00090552"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090698"	"00090553"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090699"	"00090554"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000090700"	"00090555"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000091028"	"00090883"	"1"	"01816"	"00006"	"2016-11-21 16:06:29"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000111012"	"00110546"	"1"	"01741"	"01741"	"2017-07-31 12:23:35"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000153588"	"00152726"	"1"	"01164"	"01164"	"2018-02-09 09:44:32"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000153589"	"00152727"	"1"	"00006"	"00006"	"2018-02-09 11:24:50"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000155346"	"00154486"	"1"	"01164"	"01164"	"2018-02-26 10:02:15"	"00006"	"2018-02-26 16:14:25"	"SEQ-NG-I"	"DNA"	""	"gene panel, 12 genes (see dept. web site)"
"0000156529"	"00155664"	"1"	"01873"	"00006"	"2017-11-15 18:25:58"	""	""	"SEQ"	"DNA"	""	""
"0000165585"	"00164718"	"1"	"01807"	"01807"	"2018-06-05 19:09:10"	""	""	"SEQ"	"DNA"	""	""
"0000178989"	"00178086"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180192"	"00179289"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180193"	"00179290"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180194"	"00179291"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180195"	"00179292"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180196"	"00179293"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180197"	"00179294"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180198"	"00179295"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180199"	"00179296"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180200"	"00179297"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180201"	"00179298"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180202"	"00179299"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180203"	"00179300"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180204"	"00179301"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180205"	"00179302"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180206"	"00179303"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180207"	"00179304"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180208"	"00179305"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180209"	"00179306"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180210"	"00179307"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180211"	"00179308"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180212"	"00179309"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180213"	"00179310"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180214"	"00179311"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180215"	"00179312"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180216"	"00179313"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180217"	"00179314"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180218"	"00179315"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180219"	"00179316"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180220"	"00179317"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180221"	"00179318"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180222"	"00179319"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180223"	"00179320"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180224"	"00179321"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180225"	"00179322"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180226"	"00179323"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180227"	"00179324"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180228"	"00179325"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180229"	"00179326"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180230"	"00179327"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180231"	"00179328"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180232"	"00179329"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180233"	"00179330"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180234"	"00179331"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180235"	"00179332"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180236"	"00179333"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180237"	"00179334"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180238"	"00179335"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180239"	"00179336"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180240"	"00179337"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180241"	"00179338"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180242"	"00179339"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180243"	"00179340"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180244"	"00179341"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180245"	"00179342"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180246"	"00179343"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180247"	"00179344"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180248"	"00179345"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180249"	"00179346"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180250"	"00179347"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180251"	"00179348"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180252"	"00179349"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180253"	"00179350"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180254"	"00179351"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180255"	"00179352"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180256"	"00179353"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180257"	"00179354"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180258"	"00179355"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180259"	"00179356"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180260"	"00179357"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180261"	"00179358"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180262"	"00179359"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180263"	"00179360"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180264"	"00179361"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180265"	"00179362"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180266"	"00179363"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180267"	"00179364"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180268"	"00179365"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180269"	"00179366"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180270"	"00179367"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180271"	"00179368"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180272"	"00179369"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180273"	"00179370"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180274"	"00179371"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180275"	"00179372"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180276"	"00179373"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180277"	"00179374"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180278"	"00179375"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180279"	"00179376"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180280"	"00179377"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180281"	"00179378"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180282"	"00179379"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180283"	"00179380"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180284"	"00179381"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180285"	"00179382"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180286"	"00179383"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180287"	"00179384"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180288"	"00179385"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180289"	"00179386"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180290"	"00179387"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180291"	"00179388"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180292"	"00179389"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180293"	"00179390"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180294"	"00179391"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180295"	"00179392"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180296"	"00179393"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180297"	"00179394"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180298"	"00179395"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000180299"	"00179396"	"1"	"01714"	"00006"	"2018-08-17 01:16:42"	""	""	"SEQ"	"DNA"	""	""
"0000181822"	"00180885"	"1"	"01714"	"00006"	"2018-09-07 18:47:50"	""	""	"SEQ"	"DNA"	""	""
"0000181823"	"00180886"	"1"	"01714"	"00006"	"2018-09-07 18:47:50"	""	""	"SEQ"	"DNA"	""	""
"0000181824"	"00180887"	"1"	"01714"	"00006"	"2018-09-07 18:47:50"	""	""	"SEQ"	"DNA"	""	""
"0000181825"	"00180888"	"1"	"01714"	"00006"	"2018-09-07 18:47:50"	""	""	"SEQ"	"DNA"	""	""
"0000182586"	"00181626"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183871"	"00182911"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183872"	"00182912"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183873"	"00182913"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183874"	"00182914"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183875"	"00182915"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183876"	"00182916"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183877"	"00182917"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183878"	"00182918"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183879"	"00182919"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183880"	"00182920"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183881"	"00182921"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183882"	"00182922"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183883"	"00182923"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183884"	"00182924"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183885"	"00182925"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183886"	"00182926"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183887"	"00182927"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183888"	"00182928"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183889"	"00182929"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183890"	"00182930"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183891"	"00182931"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183892"	"00182932"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183893"	"00182933"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183894"	"00182934"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183895"	"00182935"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183896"	"00182936"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183897"	"00182937"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183898"	"00182938"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183899"	"00182939"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183900"	"00182940"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183901"	"00182941"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183902"	"00182942"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183903"	"00182943"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183904"	"00182944"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183905"	"00182945"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183906"	"00182946"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183907"	"00182947"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183908"	"00182948"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183909"	"00182949"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183910"	"00182950"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183911"	"00182951"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183912"	"00182952"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183913"	"00182953"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000183914"	"00182954"	"1"	"01714"	"00006"	"2018-08-25 06:42:38"	"00009"	"2018-10-11 14:19:58"	"SEQ"	"DNA"	""	""
"0000208806"	"00207765"	"1"	"01164"	"01164"	"2018-11-30 14:25:40"	""	""	"SEQ-NG"	"DNA"	""	""
"0000208810"	"00207769"	"1"	"01164"	"01164"	"2018-11-30 14:29:43"	""	""	"SEQ-NG"	"DNA"	""	""
"0000208996"	"00207951"	"1"	"01164"	"01164"	"2018-12-04 16:43:50"	""	""	"SEQ-NG"	"DNA"	""	""
"0000209666"	"00208617"	"1"	"01164"	"01164"	"2018-12-12 12:06:07"	""	""	"SEQ-NG"	"DNA"	""	""
"0000209839"	"00208790"	"1"	"01164"	"01164"	"2018-12-17 10:13:29"	""	""	"SEQ-NG"	"DNA"	""	""
"0000211257"	"00210181"	"1"	"01164"	"01164"	"2018-12-27 15:49:32"	""	""	"SEQ-NG"	"DNA"	""	""
"0000211262"	"00210186"	"1"	"01164"	"01164"	"2018-12-27 15:49:38"	""	""	"SEQ-NG"	"DNA"	""	""
"0000214695"	"00213626"	"1"	"00643"	"00643"	"2019-01-14 16:35:29"	""	"2019-01-14 16:48:45"	"MLPA"	"DNA"	"Blood"	"gene panel"
"0000219143"	"00218073"	"1"	"00006"	"00006"	"2019-01-22 08:47:48"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000219152"	"00218082"	"1"	"00006"	"00006"	"2019-01-22 09:11:01"	""	""	"SEQ;SEQ-NG;MLPA"	"DNA"	""	"26 gene panel BRCA"
"0000219153"	"00218083"	"1"	"00006"	"00006"	"2019-01-22 09:11:01"	""	""	"SEQ;SEQ-NG;MLPA"	"DNA"	""	"26 gene panel BRCA"
"0000219154"	"00218084"	"1"	"00006"	"00006"	"2019-01-22 09:11:01"	""	""	"SEQ;SEQ-NG;MLPA"	"DNA"	""	"26 gene panel BRCA"
"0000219155"	"00218085"	"1"	"00006"	"00006"	"2019-01-22 09:11:01"	""	""	"SEQ;SEQ-NG;MLPA"	"DNA"	""	"26 gene panel BRCA"
"0000219156"	"00218086"	"1"	"00006"	"00006"	"2019-01-22 09:11:01"	""	""	"SEQ;SEQ-NG;MLPA"	"DNA"	""	"26 gene panel BRCA"
"0000219158"	"00218088"	"1"	"00006"	"00006"	"2019-01-22 09:27:16"	""	""	"PCR"	"DNA"	""	""
"0000219159"	"00218089"	"1"	"00006"	"00006"	"2019-01-22 09:34:15"	""	""	"PCR"	"DNA"	""	""
"0000219160"	"00218090"	"1"	"00006"	"00006"	"2019-01-22 09:36:56"	""	""	"PCR"	"DNA"	""	""
"0000219161"	"00218091"	"1"	"00006"	"00006"	"2019-01-22 09:51:48"	""	""	"PCR;SEQ"	"DNA"	""	""
"0000247601"	"00246489"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247602"	"00246490"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247603"	"00246491"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247604"	"00246492"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247605"	"00246493"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247606"	"00246494"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247607"	"00246495"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247608"	"00246496"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247609"	"00246497"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247610"	"00246498"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247611"	"00246499"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247612"	"00246500"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247613"	"00246501"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247614"	"00246502"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247615"	"00246503"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247616"	"00246504"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247617"	"00246505"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247618"	"00246506"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247619"	"00246507"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247620"	"00246508"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247621"	"00246509"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247622"	"00246510"	"1"	"00643"	"00006"	"2019-07-12 12:55:51"	""	""	"SEQ"	"DNA"	""	"gene panel"
"0000247748"	"00246637"	"1"	"01164"	"01164"	"2019-07-15 17:47:33"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000247752"	"00246641"	"1"	"01164"	"01164"	"2019-07-15 17:47:36"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000249308"	"00248203"	"1"	"01474"	"00006"	"2015-12-04 13:41:45"	""	""	"SEQ-NG-S"	"DNA"	"blood"	"581 gene panel"
"0000249355"	"00248250"	"1"	"01474"	"00006"	"2015-12-04 13:41:45"	""	""	"SEQ-NG-S"	"DNA"	"blood"	"581 gene panel"
"0000249511"	"00248407"	"1"	"01164"	"01164"	"2019-07-23 17:05:30"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000263225"	"00262119"	"1"	"01164"	"01164"	"2019-08-19 09:49:18"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000264234"	"00263128"	"1"	"01164"	"01164"	"2019-08-23 11:18:43"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000265142"	"00264001"	"1"	"00727"	"00727"	"2019-09-05 18:37:50"	""	""	"SEQ-ON"	"DNA"	""	""
"0000265160"	"00264038"	"1"	"01164"	"01164"	"2019-09-06 17:29:15"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000266222"	"00265102"	"1"	"01164"	"01164"	"2019-09-13 15:59:16"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000266538"	"00265412"	"1"	"01164"	"01164"	"2019-09-25 09:36:56"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000267294"	"00266173"	"1"	"01164"	"01164"	"2019-10-15 11:11:38"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000267537"	"00266410"	"1"	"03452"	"03452"	"2019-09-18 18:58:36"	""	""	"SEQ-NG"	"DNA"	""	""
"0000267600"	"00266474"	"1"	"02337"	"01873"	"2019-08-07 20:11:25"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000267611"	"00266485"	"1"	"02337"	"01873"	"2019-08-07 20:11:25"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000290448"	"00289278"	"1"	"01164"	"01164"	"2020-03-02 12:26:05"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000290475"	"00289305"	"1"	"01164"	"01164"	"2020-03-02 12:32:15"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000294249"	"00293081"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000294250"	"00293082"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000294251"	"00293083"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000294252"	"00293084"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000294253"	"00293085"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000294254"	"00293086"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000294255"	"00293087"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000296359"	"00295191"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000296360"	"00295192"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000296361"	"00295193"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000296362"	"00295194"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000296726"	"00295556"	"1"	"01164"	"01164"	"2020-03-18 10:48:02"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000296728"	"00295558"	"1"	"01164"	"01164"	"2020-03-18 10:48:06"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000296756"	"00295586"	"1"	"01164"	"01164"	"2020-03-18 10:49:10"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000296830"	"00295658"	"1"	"01164"	"01164"	"2020-03-22 12:43:49"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000296914"	"00295741"	"1"	"01164"	"01164"	"2020-03-26 12:29:49"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000296921"	"00295748"	"1"	"01164"	"01164"	"2020-03-26 12:30:03"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000297058"	"00295886"	"1"	"03629"	"03629"	"2020-03-30 03:53:21"	""	""	"SEQ-NG-I"	"DNA"	""	"gene panel ATM, AXIN2, BARD1, BRCA1, BRCA2, BRIP1, CDH1, CHEK2, MLH1, MRE11A, MSH2, MSH6, MUTYH, NF1, PALB2, PMS2, PTEN, RAD51, RAD51C, RAD51D, STK11, TP53"
"0000297059"	"00295887"	"1"	"03629"	"03629"	"2020-03-30 03:53:21"	""	""	"SEQ-NG-I"	"DNA"	""	"gene panel ATM, AXIN2, BARD1, BRCA1, BRCA2, BRIP1, CDH1, CHEK2, MLH1, MRE11A, MSH2, MSH6, MUTYH, NF1, PALB2, PMS2, PTEN, RAD51, RAD51C, RAD51D, STK11, TP53"
"0000297071"	"00295899"	"1"	"03629"	"03629"	"2020-03-30 03:58:47"	""	""	"SEQ-NG-I"	"DNA"	""	"gene panel ATM, AXIN2, BARD1, BRCA1, BRCA2, BRIP1, CDH1, CHEK2, MLH1, MRE11A, MSH2, MSH6, MUTYH, NF1, PALB2, PMS2, PTEN, RAD51, RAD51C, RAD51D, STK11, TP53"
"0000297507"	"00296396"	"1"	"01164"	"01164"	"2020-04-06 09:48:12"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000297970"	"00296860"	"1"	"01164"	"01164"	"2020-04-14 14:22:01"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000301763"	"00300642"	"1"	"01164"	"01164"	"2020-05-04 10:29:01"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000302517"	"00301396"	"1"	"01164"	"01164"	"2020-05-15 11:23:01"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000308399"	"00307257"	"1"	"03753"	"03753"	"2020-08-06 23:25:39"	""	""	"SEQ-NG-I"	"DNA"	"blood/FFPE tumor"	"160 genes"
"0000309144"	"00308000"	"1"	"01164"	"01164"	"2020-08-25 11:29:42"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000337342"	"00336112"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000337343"	"00336113"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000337570"	"00336340"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000337571"	"00336341"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339663"	"00338433"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339664"	"00338434"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339665"	"00338435"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339666"	"00338436"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339667"	"00338437"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339668"	"00338438"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339669"	"00338439"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339670"	"00338440"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339671"	"00338441"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339672"	"00338442"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339673"	"00338443"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339674"	"00338444"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339675"	"00338445"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339676"	"00338446"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339677"	"00338447"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339678"	"00338448"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339679"	"00338449"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339680"	"00338450"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339681"	"00338451"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339682"	"00338452"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339683"	"00338453"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339684"	"00338454"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339685"	"00338455"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339686"	"00338456"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339687"	"00338457"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339688"	"00338458"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339689"	"00338459"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339690"	"00338460"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339691"	"00338461"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339692"	"00338462"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339693"	"00338463"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339694"	"00338464"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339695"	"00338465"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339696"	"00338466"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339697"	"00338467"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339698"	"00338468"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339699"	"00338469"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339700"	"00338470"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339701"	"00338471"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339702"	"00338472"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339703"	"00338473"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339704"	"00338474"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339705"	"00338475"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339706"	"00338476"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339707"	"00338477"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339708"	"00338478"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339709"	"00338479"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339710"	"00338480"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339711"	"00338481"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339712"	"00338482"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339713"	"00338483"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339714"	"00338484"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339715"	"00338485"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339716"	"00338486"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339717"	"00338487"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339718"	"00338488"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339719"	"00338489"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339720"	"00338490"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339721"	"00338491"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339722"	"00338492"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339723"	"00338493"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339724"	"00338494"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339725"	"00338495"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339726"	"00338496"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339727"	"00338497"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339728"	"00338498"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339729"	"00338499"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339730"	"00338500"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339731"	"00338501"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339732"	"00338502"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339733"	"00338503"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339734"	"00338504"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339735"	"00338505"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339736"	"00338506"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339737"	"00338507"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339738"	"00338508"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339739"	"00338509"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339740"	"00338510"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339741"	"00338511"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339742"	"00338512"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339743"	"00338513"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339744"	"00338514"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339745"	"00338515"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339746"	"00338516"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339747"	"00338517"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339748"	"00338518"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339749"	"00338519"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339750"	"00338520"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339751"	"00338521"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339752"	"00338522"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339753"	"00338523"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339754"	"00338524"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339755"	"00338525"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000339756"	"00338526"	"1"	"04020"	"00006"	"2021-03-11 11:28:20"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343236"	"00342006"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343237"	"00342007"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343238"	"00342008"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343239"	"00342009"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343240"	"00342010"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343241"	"00342011"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343242"	"00342012"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343243"	"00342013"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343244"	"00342014"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343245"	"00342015"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343246"	"00342016"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343247"	"00342017"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343248"	"00342018"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343249"	"00342019"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343250"	"00342020"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343842"	"00342612"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343843"	"00342613"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343844"	"00342614"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343845"	"00342615"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000343846"	"00342616"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346510"	"00345280"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346511"	"00345281"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346512"	"00345282"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346513"	"00345283"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346514"	"00345284"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346515"	"00345285"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346516"	"00345286"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346517"	"00345287"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346518"	"00345288"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346519"	"00345289"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346520"	"00345290"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346521"	"00345291"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346522"	"00345292"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346523"	"00345293"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346524"	"00345294"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346525"	"00345295"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346526"	"00345296"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346527"	"00345297"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346528"	"00345298"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346529"	"00345299"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346530"	"00345300"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346531"	"00345301"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346532"	"00345302"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346533"	"00345303"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346534"	"00345304"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346535"	"00345305"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346536"	"00345306"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346537"	"00345307"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346538"	"00345308"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346539"	"00345309"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346540"	"00345310"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346541"	"00345311"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346542"	"00345312"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346543"	"00345313"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346544"	"00345314"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346545"	"00345315"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346546"	"00345316"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346547"	"00345317"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346548"	"00345318"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346549"	"00345319"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346550"	"00345320"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346551"	"00345321"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346552"	"00345322"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346553"	"00345323"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346554"	"00345324"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346555"	"00345325"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346556"	"00345326"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346557"	"00345327"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346558"	"00345328"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346559"	"00345329"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346560"	"00345330"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346561"	"00345331"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346562"	"00345332"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346563"	"00345333"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346564"	"00345334"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346565"	"00345335"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346566"	"00345336"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346567"	"00345337"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346568"	"00345338"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346569"	"00345339"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346570"	"00345340"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346571"	"00345341"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346572"	"00345342"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346573"	"00345343"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346574"	"00345344"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346575"	"00345345"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346576"	"00345346"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346577"	"00345347"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346578"	"00345348"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346579"	"00345349"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346580"	"00345350"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346581"	"00345351"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346582"	"00345352"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346583"	"00345353"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346584"	"00345354"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346585"	"00345355"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346586"	"00345356"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346587"	"00345357"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346588"	"00345358"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346589"	"00345359"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346590"	"00345360"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346591"	"00345361"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346592"	"00345362"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346593"	"00345363"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346594"	"00345364"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346595"	"00345365"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346596"	"00345366"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346597"	"00345367"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346598"	"00345368"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346599"	"00345369"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346600"	"00345370"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346601"	"00345371"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346602"	"00345372"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346603"	"00345373"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346604"	"00345374"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346605"	"00345375"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346606"	"00345376"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346607"	"00345377"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346608"	"00345378"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346609"	"00345379"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346610"	"00345380"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346611"	"00345381"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346612"	"00345382"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346613"	"00345383"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346614"	"00345384"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346615"	"00345385"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346616"	"00345386"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346617"	"00345387"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346618"	"00345388"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346619"	"00345389"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346620"	"00345390"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346621"	"00345391"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346622"	"00345392"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346623"	"00345393"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346624"	"00345394"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346625"	"00345395"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346626"	"00345396"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346627"	"00345397"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346628"	"00345398"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346629"	"00345399"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346630"	"00345400"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346631"	"00345401"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346632"	"00345402"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346633"	"00345403"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346634"	"00345404"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346635"	"00345405"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346636"	"00345406"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346637"	"00345407"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346638"	"00345408"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346639"	"00345409"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346640"	"00345410"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346641"	"00345411"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346642"	"00345412"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346643"	"00345413"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346644"	"00345414"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346645"	"00345415"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346646"	"00345416"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346647"	"00345417"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346648"	"00345418"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346649"	"00345419"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346650"	"00345420"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346651"	"00345421"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346652"	"00345422"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346653"	"00345423"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346654"	"00345424"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346655"	"00345425"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346656"	"00345426"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346657"	"00345427"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346658"	"00345428"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346659"	"00345429"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346660"	"00345430"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346661"	"00345431"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346662"	"00345432"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346663"	"00345433"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346664"	"00345434"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346665"	"00345435"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346666"	"00345436"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346667"	"00345437"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346668"	"00345438"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346669"	"00345439"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346670"	"00345440"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346671"	"00345441"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346672"	"00345442"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346673"	"00345443"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346674"	"00345444"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346675"	"00345445"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346676"	"00345446"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346677"	"00345447"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346678"	"00345448"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346679"	"00345449"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346680"	"00345450"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346681"	"00345451"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346682"	"00345452"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346683"	"00345453"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346684"	"00345454"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346685"	"00345455"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346686"	"00345456"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346687"	"00345457"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346688"	"00345458"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346689"	"00345459"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346690"	"00345460"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346691"	"00345461"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346692"	"00345462"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346693"	"00345463"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346694"	"00345464"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346695"	"00345465"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346696"	"00345466"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346697"	"00345467"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346698"	"00345468"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346699"	"00345469"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346700"	"00345470"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346701"	"00345471"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346702"	"00345472"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346703"	"00345473"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000346704"	"00345474"	"1"	"04020"	"00006"	"2021-03-11 11:58:58"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000350445"	"00349215"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000350446"	"00349216"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000350447"	"00349217"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000350448"	"00349218"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000350449"	"00349219"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000350643"	"00349413"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352389"	"00351159"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352390"	"00351160"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352391"	"00351161"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352392"	"00351162"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352393"	"00351163"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352394"	"00351164"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352395"	"00351165"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352396"	"00351166"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352397"	"00351167"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352398"	"00351168"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352399"	"00351169"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352400"	"00351170"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352401"	"00351171"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352402"	"00351172"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352403"	"00351173"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352404"	"00351174"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352405"	"00351175"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352406"	"00351176"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352407"	"00351177"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352408"	"00351178"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352409"	"00351179"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352410"	"00351180"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352411"	"00351181"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352412"	"00351182"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352413"	"00351183"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352414"	"00351184"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352415"	"00351185"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352416"	"00351186"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352417"	"00351187"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352418"	"00351188"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352419"	"00351189"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352420"	"00351190"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352421"	"00351191"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352422"	"00351192"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352423"	"00351193"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352424"	"00351194"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352425"	"00351195"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352426"	"00351196"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352427"	"00351197"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352428"	"00351198"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352429"	"00351199"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352430"	"00351200"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352431"	"00351201"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352432"	"00351202"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352433"	"00351203"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352434"	"00351204"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352435"	"00351205"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352436"	"00351206"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352437"	"00351207"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352438"	"00351208"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352439"	"00351209"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352440"	"00351210"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352441"	"00351211"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352442"	"00351212"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352443"	"00351213"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352444"	"00351214"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352445"	"00351215"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352446"	"00351216"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352447"	"00351217"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352448"	"00351218"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352449"	"00351219"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352450"	"00351220"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352451"	"00351221"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352452"	"00351222"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352453"	"00351223"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352454"	"00351224"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352455"	"00351225"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352456"	"00351226"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352457"	"00351227"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352458"	"00351228"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352459"	"00351229"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352460"	"00351230"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352461"	"00351231"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352462"	"00351232"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352463"	"00351233"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352464"	"00351234"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352465"	"00351235"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352466"	"00351236"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352467"	"00351237"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352468"	"00351238"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352469"	"00351239"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352470"	"00351240"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352471"	"00351241"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352472"	"00351242"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352473"	"00351243"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352474"	"00351244"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352475"	"00351245"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352476"	"00351246"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352477"	"00351247"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352478"	"00351248"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352479"	"00351249"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352480"	"00351250"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352481"	"00351251"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352482"	"00351252"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352483"	"00351253"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352484"	"00351254"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352485"	"00351255"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352486"	"00351256"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352487"	"00351257"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352488"	"00351258"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352489"	"00351259"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352490"	"00351260"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352491"	"00351261"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352492"	"00351262"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352493"	"00351263"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352494"	"00351264"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352495"	"00351265"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352496"	"00351266"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352497"	"00351267"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352498"	"00351268"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352499"	"00351269"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352500"	"00351270"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352501"	"00351271"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352502"	"00351272"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352503"	"00351273"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352504"	"00351274"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352505"	"00351275"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352506"	"00351276"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352507"	"00351277"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352508"	"00351278"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352509"	"00351279"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352510"	"00351280"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352511"	"00351281"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352512"	"00351282"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352513"	"00351283"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352514"	"00351284"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352515"	"00351285"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352516"	"00351286"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352517"	"00351287"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352518"	"00351288"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352519"	"00351289"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352520"	"00351290"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352521"	"00351291"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352522"	"00351292"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352523"	"00351293"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352524"	"00351294"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352525"	"00351295"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000352526"	"00351296"	"1"	"04020"	"00006"	"2021-03-11 12:50:37"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000355221"	"00353991"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000355222"	"00353992"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000355223"	"00353993"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000355224"	"00353994"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000355225"	"00353995"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000355419"	"00354189"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357165"	"00355935"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357166"	"00355936"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357167"	"00355937"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357168"	"00355938"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357169"	"00355939"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357170"	"00355940"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357171"	"00355941"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357172"	"00355942"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357173"	"00355943"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357174"	"00355944"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357175"	"00355945"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357176"	"00355946"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357177"	"00355947"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357178"	"00355948"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357179"	"00355949"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357180"	"00355950"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357181"	"00355951"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357182"	"00355952"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357183"	"00355953"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357184"	"00355954"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357185"	"00355955"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357186"	"00355956"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357187"	"00355957"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357188"	"00355958"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357189"	"00355959"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357190"	"00355960"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357191"	"00355961"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357192"	"00355962"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357193"	"00355963"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357194"	"00355964"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357195"	"00355965"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357196"	"00355966"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357197"	"00355967"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357198"	"00355968"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357199"	"00355969"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357200"	"00355970"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357201"	"00355971"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357202"	"00355972"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357203"	"00355973"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357204"	"00355974"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357205"	"00355975"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357206"	"00355976"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357207"	"00355977"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357208"	"00355978"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357209"	"00355979"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357210"	"00355980"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357211"	"00355981"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357212"	"00355982"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357213"	"00355983"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357214"	"00355984"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357215"	"00355985"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357216"	"00355986"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357217"	"00355987"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357218"	"00355988"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357219"	"00355989"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357220"	"00355990"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357221"	"00355991"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357222"	"00355992"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357223"	"00355993"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357224"	"00355994"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357225"	"00355995"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357226"	"00355996"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357227"	"00355997"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357228"	"00355998"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357229"	"00355999"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357230"	"00356000"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357231"	"00356001"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357232"	"00356002"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357233"	"00356003"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357234"	"00356004"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357235"	"00356005"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357236"	"00356006"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357237"	"00356007"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357238"	"00356008"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357239"	"00356009"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357240"	"00356010"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357241"	"00356011"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357242"	"00356012"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357243"	"00356013"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357244"	"00356014"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357245"	"00356015"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357246"	"00356016"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357247"	"00356017"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357248"	"00356018"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357249"	"00356019"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357250"	"00356020"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357251"	"00356021"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357252"	"00356022"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357253"	"00356023"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357254"	"00356024"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357255"	"00356025"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357256"	"00356026"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357257"	"00356027"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357258"	"00356028"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357259"	"00356029"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357260"	"00356030"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357261"	"00356031"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357262"	"00356032"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357263"	"00356033"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357264"	"00356034"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357265"	"00356035"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357266"	"00356036"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357267"	"00356037"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357268"	"00356038"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357269"	"00356039"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357270"	"00356040"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357271"	"00356041"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357272"	"00356042"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357273"	"00356043"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357274"	"00356044"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357275"	"00356045"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357276"	"00356046"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357277"	"00356047"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357278"	"00356048"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357279"	"00356049"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357280"	"00356050"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357281"	"00356051"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357282"	"00356052"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357283"	"00356053"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357284"	"00356054"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357285"	"00356055"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357286"	"00356056"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357287"	"00356057"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357288"	"00356058"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357289"	"00356059"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357290"	"00356060"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357291"	"00356061"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357292"	"00356062"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357293"	"00356063"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357294"	"00356064"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357295"	"00356065"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357296"	"00356066"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357297"	"00356067"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357298"	"00356068"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357299"	"00356069"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357300"	"00356070"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357301"	"00356071"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000357302"	"00356072"	"1"	"04020"	"00006"	"2021-03-11 13:17:33"	""	""	"SEQ-NG"	"DNA"	""	"34-gene panel"
"0000373260"	"00372032"	"1"	"01164"	"01164"	"2021-05-05 12:37:45"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000377343"	"00376147"	"1"	"00585"	"00585"	"2021-06-17 14:26:27"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000377345"	"00376149"	"1"	"00585"	"00585"	"2021-06-17 14:26:27"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000377353"	"00376157"	"1"	"00585"	"00585"	"2021-06-17 14:26:27"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000378315"	"00377110"	"1"	"02551"	"02551"	"2021-07-05 14:04:01"	""	""	"SEQ"	"DNA"	""	""
"0000398170"	"00396928"	"1"	"00006"	"00006"	"2021-12-17 16:17:25"	""	""	"MLPA;SEQ-NG"	"DNA"	""	""
"0000398171"	"00396929"	"1"	"00006"	"00006"	"2021-12-17 16:17:25"	""	""	"MLPA;SEQ-NG"	"DNA"	""	""
"0000398172"	"00396930"	"1"	"00006"	"00006"	"2021-12-17 16:17:25"	""	""	"MLPA;SEQ-NG"	"DNA"	""	""
"0000398173"	"00396931"	"1"	"00006"	"00006"	"2021-12-17 16:17:25"	""	""	"MLPA;SEQ-NG"	"DNA"	""	""
"0000398178"	"00396936"	"1"	"00006"	"00006"	"2021-12-17 16:17:25"	""	""	"MLPA;SEQ-NG"	"DNA"	""	""
"0000400941"	"00399698"	"1"	"00006"	"00006"	"2022-01-22 16:55:15"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000400942"	"00399699"	"1"	"00006"	"00006"	"2022-01-22 16:55:15"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000400943"	"00399700"	"1"	"00006"	"00006"	"2022-01-22 16:55:15"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000408201"	"00406955"	"1"	"00006"	"00006"	"2022-04-05 15:38:44"	""	""	"SEQ-NG"	"DNA"	""	"81-gene panel"
"0000408202"	"00406956"	"1"	"00006"	"00006"	"2022-04-05 15:38:44"	""	""	"SEQ-NG"	"DNA"	""	"81-gene panel"
"0000408203"	"00406957"	"1"	"00006"	"00006"	"2022-04-05 15:38:44"	""	""	"SEQ-NG"	"DNA"	""	"81-gene panel"
"0000408204"	"00406958"	"1"	"00006"	"00006"	"2022-04-05 15:38:44"	""	""	"SEQ-NG"	"DNA"	""	"81-gene panel"
"0000411862"	"00410597"	"1"	"00006"	"00006"	"2022-05-29 12:28:55"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000411863"	"00410598"	"1"	"00006"	"00006"	"2022-05-29 12:28:55"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000431772"	"00430357"	"1"	"01082"	"01082"	"2023-01-18 20:44:33"	""	""	"SEQ-NG"	"DNA"	""	""
"0000434428"	"00431637"	"1"	"01082"	"01082"	"2023-02-27 21:30:25"	""	""	"SEQ-NG"	"DNA"	""	""
"0000434465"	"00432985"	"1"	"01082"	"01082"	"2023-02-28 15:39:13"	""	""	"SEQ-NG"	"DNA"	""	""
"0000434579"	"00432986"	"1"	"01082"	"01082"	"2023-02-28 15:47:06"	""	""	"SEQ-NG"	"DNA"	""	""
"0000434586"	"00432990"	"1"	"01082"	"01082"	"2023-02-28 20:41:26"	""	""	"SEQ-NG"	"DNA"	""	""
"0000434593"	"00432995"	"1"	"01082"	"01082"	"2023-03-01 12:02:11"	""	""	"SEQ-NG"	"DNA"	""	""
"0000434595"	"00432997"	"1"	"01082"	"01082"	"2023-03-01 12:45:47"	""	""	"SEQ-NG"	"DNA"	""	""
"0000439461"	"00437977"	"1"	"00006"	"00006"	"2023-10-17 21:53:57"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000445049"	"00443556"	"1"	"04599"	"04599"	"2023-11-28 23:05:02"	""	""	"SEQ-NG-I"	"DNA"	"Blood"	""
"0000445050"	"00443557"	"1"	"04599"	"04599"	"2023-11-28 23:41:06"	""	""	"SEQ-NG-I"	"DNA"	"Blood"	""
"0000445051"	"00443558"	"1"	"04599"	"04599"	"2023-11-29 00:26:44"	""	""	"SEQ-NG-I"	"DNA"	"Blood"	""
"0000456671"	"00455058"	"1"	"04749"	"04749"	"2024-10-01 17:48:34"	""	""	"SEQ-NG"	"DNA"	""	""
"0000462628"	"00460996"	"1"	"04796"	"00006"	"2024-11-05 16:15:00"	""	""	"RT-PCR;SEQ;SEQ-NG"	"DNA;RNA"	"blood"	"mRNA splicing analysis on tissue"
"0000462641"	"00461009"	"1"	"04796"	"00006"	"2024-11-05 16:15:00"	""	""	"RT-PCR;SEQ;SEQ-NG"	"DNA;RNA"	"blood"	"mRNA splicing analysis on tissue"
"0000466140"	"00464502"	"1"	"04818"	"04818"	"2025-03-19 11:17:12"	""	""	"SEQ-NG"	"DNA"	""	""
"0000466141"	"00464503"	"1"	"04818"	"04818"	"2025-03-19 11:18:14"	""	""	"SEQ-NG"	"DNA"	""	""


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 885
"{{screeningid}}"	"{{geneid}}"
"0000046391"	"CHEK2"
"0000048255"	"BRCA2"
"0000048262"	"BRCA2"
"0000048294"	"BRCA1"
"0000048337"	"BRCA1"
"0000050196"	"CHEK2"
"0000054769"	"CHEK2"
"0000054769"	"FANCL"
"0000054769"	"XRCC4"
"0000089469"	"BRCA1"
"0000089469"	"BRCA2"
"0000089469"	"CHEK2"
"0000090667"	"CHEK2"
"0000090668"	"CHEK2"
"0000090669"	"CHEK2"
"0000090670"	"CHEK2"
"0000090672"	"CHEK2"
"0000090673"	"CHEK2"
"0000090674"	"CHEK2"
"0000090675"	"CHEK2"
"0000090676"	"CHEK2"
"0000090677"	"CHEK2"
"0000090678"	"CHEK2"
"0000090679"	"CHEK2"
"0000090680"	"CHEK2"
"0000090681"	"CHEK2"
"0000090682"	"CHEK2"
"0000090683"	"CHEK2"
"0000090684"	"CHEK2"
"0000090685"	"CHEK2"
"0000090686"	"CHEK2"
"0000090687"	"CHEK2"
"0000090688"	"CHEK2"
"0000090689"	"CHEK2"
"0000090690"	"CHEK2"
"0000090691"	"CHEK2"
"0000090692"	"CHEK2"
"0000090693"	"CHEK2"
"0000090694"	"CHEK2"
"0000090695"	"CHEK2"
"0000090696"	"CHEK2"
"0000090697"	"CHEK2"
"0000090698"	"CHEK2"
"0000090699"	"CHEK2"
"0000090700"	"CHEK2"
"0000091028"	"CHEK2"
"0000111012"	"CHEK2"
"0000153588"	"ATM"
"0000153588"	"BRCA1"
"0000153588"	"BRCA2"
"0000153588"	"CHEK2"
"0000153588"	"PTEN"
"0000153588"	"RAD51C"
"0000153588"	"RAD51D"
"0000153588"	"TP53"
"0000155346"	"ATM"
"0000155346"	"BRCA1"
"0000155346"	"BRCA2"
"0000155346"	"CDH1"
"0000155346"	"CHEK2"
"0000155346"	"NBN"
"0000155346"	"PALB2"
"0000178989"	"BRCA2"
"0000180192"	"CHEK2"
"0000180193"	"CHEK2"
"0000180194"	"CHEK2"
"0000180195"	"CHEK2"
"0000180196"	"CHEK2"
"0000180197"	"CHEK2"
"0000180198"	"CHEK2"
"0000180199"	"CHEK2"
"0000180200"	"CHEK2"
"0000180201"	"CHEK2"
"0000180202"	"CHEK2"
"0000180203"	"CHEK2"
"0000180204"	"CHEK2"
"0000180205"	"CHEK2"
"0000180206"	"CHEK2"
"0000180207"	"CHEK2"
"0000180208"	"CHEK2"
"0000180209"	"CHEK2"
"0000180210"	"CHEK2"
"0000180211"	"CHEK2"
"0000180212"	"CHEK2"
"0000180213"	"CHEK2"
"0000180214"	"CHEK2"
"0000180215"	"CHEK2"
"0000180216"	"CHEK2"
"0000180217"	"CHEK2"
"0000180218"	"CHEK2"
"0000180219"	"CHEK2"
"0000180220"	"CHEK2"
"0000180221"	"CHEK2"
"0000180222"	"CHEK2"
"0000180223"	"CHEK2"
"0000180224"	"CHEK2"
"0000180225"	"CHEK2"
"0000180226"	"CHEK2"
"0000180227"	"CHEK2"
"0000180228"	"CHEK2"
"0000180229"	"CHEK2"
"0000180230"	"CHEK2"
"0000180231"	"CHEK2"
"0000180232"	"CHEK2"
"0000180233"	"CHEK2"
"0000180234"	"CHEK2"
"0000180235"	"CHEK2"
"0000180236"	"CHEK2"
"0000180237"	"CHEK2"
"0000180238"	"CHEK2"
"0000180239"	"CHEK2"
"0000180240"	"CHEK2"
"0000180241"	"CHEK2"
"0000180242"	"CHEK2"
"0000180243"	"CHEK2"
"0000180244"	"CHEK2"
"0000180245"	"CHEK2"
"0000180246"	"CHEK2"
"0000180247"	"CHEK2"
"0000180248"	"CHEK2"
"0000180249"	"CHEK2"
"0000180250"	"CHEK2"
"0000180251"	"CHEK2"
"0000180252"	"CHEK2"
"0000180253"	"CHEK2"
"0000180254"	"CHEK2"
"0000180255"	"CHEK2"
"0000180256"	"CHEK2"
"0000180257"	"CHEK2"
"0000180258"	"CHEK2"
"0000180259"	"CHEK2"
"0000180260"	"CHEK2"
"0000180261"	"CHEK2"
"0000180262"	"CHEK2"
"0000180263"	"CHEK2"
"0000180264"	"CHEK2"
"0000180265"	"CHEK2"
"0000180266"	"CHEK2"
"0000180267"	"CHEK2"
"0000180268"	"CHEK2"
"0000180269"	"CHEK2"
"0000180270"	"CHEK2"
"0000180271"	"CHEK2"
"0000180272"	"CHEK2"
"0000180273"	"CHEK2"
"0000180274"	"CHEK2"
"0000180275"	"CHEK2"
"0000180276"	"CHEK2"
"0000180277"	"CHEK2"
"0000180278"	"CHEK2"
"0000180279"	"CHEK2"
"0000180280"	"CHEK2"
"0000180281"	"CHEK2"
"0000180282"	"CHEK2"
"0000180283"	"CHEK2"
"0000180284"	"CHEK2"
"0000180285"	"CHEK2"
"0000180286"	"CHEK2"
"0000180287"	"CHEK2"
"0000180288"	"CHEK2"
"0000180289"	"CHEK2"
"0000180290"	"CHEK2"
"0000180291"	"CHEK2"
"0000180292"	"CHEK2"
"0000180293"	"CHEK2"
"0000180294"	"CHEK2"
"0000180295"	"CHEK2"
"0000180296"	"CHEK2"
"0000180297"	"CHEK2"
"0000180298"	"CHEK2"
"0000180299"	"CHEK2"
"0000181822"	"CHEK2"
"0000181823"	"CHEK2"
"0000181824"	"CHEK2"
"0000181825"	"CHEK2"
"0000182586"	"CHEK2"
"0000183871"	"CHEK2"
"0000183872"	"CHEK2"
"0000183873"	"CHEK2"
"0000183874"	"CHEK2"
"0000183875"	"CHEK2"
"0000183876"	"CHEK2"
"0000183877"	"CHEK2"
"0000183878"	"CHEK2"
"0000183879"	"CHEK2"
"0000183880"	"CHEK2"
"0000183881"	"CHEK2"
"0000183882"	"CHEK2"
"0000183883"	"CHEK2"
"0000183884"	"CHEK2"
"0000183885"	"CHEK2"
"0000183886"	"CHEK2"
"0000183887"	"CHEK2"
"0000183888"	"CHEK2"
"0000183889"	"CHEK2"
"0000183890"	"CHEK2"
"0000183891"	"CHEK2"
"0000183892"	"CHEK2"
"0000183893"	"CHEK2"
"0000183894"	"CHEK2"
"0000183895"	"CHEK2"
"0000183896"	"CHEK2"
"0000183897"	"CHEK2"
"0000183898"	"CHEK2"
"0000183899"	"CHEK2"
"0000183900"	"CHEK2"
"0000183901"	"CHEK2"
"0000183902"	"CHEK2"
"0000183903"	"CHEK2"
"0000183904"	"CHEK2"
"0000183905"	"CHEK2"
"0000183906"	"CHEK2"
"0000183907"	"CHEK2"
"0000183908"	"CHEK2"
"0000183909"	"CHEK2"
"0000183910"	"CHEK2"
"0000183911"	"CHEK2"
"0000183912"	"CHEK2"
"0000183913"	"CHEK2"
"0000183914"	"CHEK2"
"0000214695"	"BRCA1"
"0000214695"	"BRCA2"
"0000219143"	"BRCA1"
"0000219143"	"BRCA2"
"0000219143"	"CHEK2"
"0000219152"	"CHEK2"
"0000219153"	"CHEK2"
"0000219154"	"CHEK2"
"0000219155"	"CHEK2"
"0000219156"	"CHEK2"
"0000219158"	"CHEK2"
"0000219159"	"CHEK2"
"0000219160"	"CHEK2"
"0000219161"	"CHEK2"
"0000247601"	"CHEK2"
"0000247602"	"CHEK2"
"0000247603"	"CHEK2"
"0000247604"	"CHEK2"
"0000247605"	"CHEK2"
"0000247606"	"CHEK2"
"0000247607"	"CHEK2"
"0000247608"	"CHEK2"
"0000247609"	"CHEK2"
"0000247610"	"CHEK2"
"0000247611"	"CHEK2"
"0000247612"	"CHEK2"
"0000247613"	"CHEK2"
"0000247614"	"CHEK2"
"0000247615"	"CHEK2"
"0000247616"	"CHEK2"
"0000247617"	"CHEK2"
"0000247618"	"CHEK2"
"0000247619"	"CHEK2"
"0000247620"	"CHEK2"
"0000247621"	"CHEK2"
"0000247622"	"CHEK2"
"0000265142"	"CHEK2"
"0000267537"	"ATM"
"0000267537"	"BRCA1"
"0000267537"	"BRCA2"
"0000267537"	"CDH1"
"0000267537"	"CHEK2"
"0000267537"	"PALB2"
"0000267537"	"TP53"
"0000297058"	"CHEK2"
"0000297059"	"CHEK2"
"0000297071"	"CHEK2"
"0000337342"	"CHEK2"
"0000337343"	"CHEK2"
"0000337570"	"CHEK2"
"0000337571"	"CHEK2"
"0000339663"	"CHEK2"
"0000339664"	"CHEK2"
"0000339665"	"CHEK2"
"0000339666"	"CHEK2"
"0000339667"	"CHEK2"
"0000339668"	"CHEK2"
"0000339669"	"CHEK2"
"0000339670"	"CHEK2"
"0000339671"	"CHEK2"
"0000339672"	"CHEK2"
"0000339673"	"CHEK2"
"0000339674"	"CHEK2"
"0000339675"	"CHEK2"
"0000339676"	"CHEK2"
"0000339677"	"CHEK2"
"0000339678"	"CHEK2"
"0000339679"	"CHEK2"
"0000339680"	"CHEK2"
"0000339681"	"CHEK2"
"0000339682"	"CHEK2"
"0000339683"	"CHEK2"
"0000339684"	"CHEK2"
"0000339685"	"CHEK2"
"0000339686"	"CHEK2"
"0000339687"	"CHEK2"
"0000339688"	"CHEK2"
"0000339689"	"CHEK2"
"0000339690"	"CHEK2"
"0000339691"	"CHEK2"
"0000339692"	"CHEK2"
"0000339693"	"CHEK2"
"0000339694"	"CHEK2"
"0000339695"	"CHEK2"
"0000339696"	"CHEK2"
"0000339697"	"CHEK2"
"0000339698"	"CHEK2"
"0000339699"	"CHEK2"
"0000339700"	"CHEK2"
"0000339701"	"CHEK2"
"0000339702"	"CHEK2"
"0000339703"	"CHEK2"
"0000339704"	"CHEK2"
"0000339705"	"CHEK2"
"0000339706"	"CHEK2"
"0000339707"	"CHEK2"
"0000339708"	"CHEK2"
"0000339709"	"CHEK2"
"0000339710"	"CHEK2"
"0000339711"	"CHEK2"
"0000339712"	"CHEK2"
"0000339713"	"CHEK2"
"0000339714"	"CHEK2"
"0000339715"	"CHEK2"
"0000339716"	"CHEK2"
"0000339717"	"CHEK2"
"0000339718"	"CHEK2"
"0000339719"	"CHEK2"
"0000339720"	"CHEK2"
"0000339721"	"CHEK2"
"0000339722"	"CHEK2"
"0000339723"	"CHEK2"
"0000339724"	"CHEK2"
"0000339725"	"CHEK2"
"0000339726"	"CHEK2"
"0000339727"	"CHEK2"
"0000339728"	"CHEK2"
"0000339729"	"CHEK2"
"0000339730"	"CHEK2"
"0000339731"	"CHEK2"
"0000339732"	"CHEK2"
"0000339733"	"CHEK2"
"0000339734"	"CHEK2"
"0000339735"	"CHEK2"
"0000339736"	"CHEK2"
"0000339737"	"CHEK2"
"0000339738"	"CHEK2"
"0000339739"	"CHEK2"
"0000339740"	"CHEK2"
"0000339741"	"CHEK2"
"0000339742"	"CHEK2"
"0000339743"	"CHEK2"
"0000339744"	"CHEK2"
"0000339745"	"CHEK2"
"0000339746"	"CHEK2"
"0000339747"	"CHEK2"
"0000339748"	"CHEK2"
"0000339749"	"CHEK2"
"0000339750"	"CHEK2"
"0000339751"	"CHEK2"
"0000339752"	"CHEK2"
"0000339753"	"CHEK2"
"0000339754"	"CHEK2"
"0000339755"	"CHEK2"
"0000339756"	"CHEK2"
"0000343236"	"CHEK2"
"0000343237"	"CHEK2"
"0000343238"	"CHEK2"
"0000343239"	"CHEK2"
"0000343240"	"CHEK2"
"0000343241"	"CHEK2"
"0000343242"	"CHEK2"
"0000343243"	"CHEK2"
"0000343244"	"CHEK2"
"0000343245"	"CHEK2"
"0000343246"	"CHEK2"
"0000343247"	"CHEK2"
"0000343248"	"CHEK2"
"0000343249"	"CHEK2"
"0000343250"	"CHEK2"
"0000343842"	"CHEK2"
"0000343843"	"CHEK2"
"0000343844"	"CHEK2"
"0000343845"	"CHEK2"
"0000343846"	"CHEK2"
"0000346510"	"CHEK2"
"0000346511"	"CHEK2"
"0000346512"	"CHEK2"
"0000346513"	"CHEK2"
"0000346514"	"CHEK2"
"0000346515"	"CHEK2"
"0000346516"	"CHEK2"
"0000346517"	"CHEK2"
"0000346518"	"CHEK2"
"0000346519"	"CHEK2"
"0000346520"	"CHEK2"
"0000346521"	"CHEK2"
"0000346522"	"CHEK2"
"0000346523"	"CHEK2"
"0000346524"	"CHEK2"
"0000346525"	"CHEK2"
"0000346526"	"CHEK2"
"0000346527"	"CHEK2"
"0000346528"	"CHEK2"
"0000346529"	"CHEK2"
"0000346530"	"CHEK2"
"0000346531"	"CHEK2"
"0000346532"	"CHEK2"
"0000346533"	"CHEK2"
"0000346534"	"CHEK2"
"0000346535"	"CHEK2"
"0000346536"	"CHEK2"
"0000346537"	"CHEK2"
"0000346538"	"CHEK2"
"0000346539"	"CHEK2"
"0000346540"	"CHEK2"
"0000346541"	"CHEK2"
"0000346542"	"CHEK2"
"0000346543"	"CHEK2"
"0000346544"	"CHEK2"
"0000346545"	"CHEK2"
"0000346546"	"CHEK2"
"0000346547"	"CHEK2"
"0000346548"	"CHEK2"
"0000346549"	"CHEK2"
"0000346550"	"CHEK2"
"0000346551"	"CHEK2"
"0000346552"	"CHEK2"
"0000346553"	"CHEK2"
"0000346554"	"CHEK2"
"0000346555"	"CHEK2"
"0000346556"	"CHEK2"
"0000346557"	"CHEK2"
"0000346558"	"CHEK2"
"0000346559"	"CHEK2"
"0000346560"	"CHEK2"
"0000346561"	"CHEK2"
"0000346562"	"CHEK2"
"0000346563"	"CHEK2"
"0000346564"	"CHEK2"
"0000346565"	"CHEK2"
"0000346566"	"CHEK2"
"0000346567"	"CHEK2"
"0000346568"	"CHEK2"
"0000346569"	"CHEK2"
"0000346570"	"CHEK2"
"0000346571"	"CHEK2"
"0000346572"	"CHEK2"
"0000346573"	"CHEK2"
"0000346574"	"CHEK2"
"0000346575"	"CHEK2"
"0000346576"	"CHEK2"
"0000346577"	"CHEK2"
"0000346578"	"CHEK2"
"0000346579"	"CHEK2"
"0000346580"	"CHEK2"
"0000346581"	"CHEK2"
"0000346582"	"CHEK2"
"0000346583"	"CHEK2"
"0000346584"	"CHEK2"
"0000346585"	"CHEK2"
"0000346586"	"CHEK2"
"0000346587"	"CHEK2"
"0000346588"	"CHEK2"
"0000346589"	"CHEK2"
"0000346590"	"CHEK2"
"0000346591"	"CHEK2"
"0000346592"	"CHEK2"
"0000346593"	"CHEK2"
"0000346594"	"CHEK2"
"0000346595"	"CHEK2"
"0000346596"	"CHEK2"
"0000346597"	"CHEK2"
"0000346598"	"CHEK2"
"0000346599"	"CHEK2"
"0000346600"	"CHEK2"
"0000346601"	"CHEK2"
"0000346602"	"CHEK2"
"0000346603"	"CHEK2"
"0000346604"	"CHEK2"
"0000346605"	"CHEK2"
"0000346606"	"CHEK2"
"0000346607"	"CHEK2"
"0000346608"	"CHEK2"
"0000346609"	"CHEK2"
"0000346610"	"CHEK2"
"0000346611"	"CHEK2"
"0000346612"	"CHEK2"
"0000346613"	"CHEK2"
"0000346614"	"CHEK2"
"0000346615"	"CHEK2"
"0000346616"	"CHEK2"
"0000346617"	"CHEK2"
"0000346618"	"CHEK2"
"0000346619"	"CHEK2"
"0000346620"	"CHEK2"
"0000346621"	"CHEK2"
"0000346622"	"CHEK2"
"0000346623"	"CHEK2"
"0000346624"	"CHEK2"
"0000346625"	"CHEK2"
"0000346626"	"CHEK2"
"0000346627"	"CHEK2"
"0000346628"	"CHEK2"
"0000346629"	"CHEK2"
"0000346630"	"CHEK2"
"0000346631"	"CHEK2"
"0000346632"	"CHEK2"
"0000346633"	"CHEK2"
"0000346634"	"CHEK2"
"0000346635"	"CHEK2"
"0000346636"	"CHEK2"
"0000346637"	"CHEK2"
"0000346638"	"CHEK2"
"0000346639"	"CHEK2"
"0000346640"	"CHEK2"
"0000346641"	"CHEK2"
"0000346642"	"CHEK2"
"0000346643"	"CHEK2"
"0000346644"	"CHEK2"
"0000346645"	"CHEK2"
"0000346646"	"CHEK2"
"0000346647"	"CHEK2"
"0000346648"	"CHEK2"
"0000346649"	"CHEK2"
"0000346650"	"CHEK2"
"0000346651"	"CHEK2"
"0000346652"	"CHEK2"
"0000346653"	"CHEK2"
"0000346654"	"CHEK2"
"0000346655"	"CHEK2"
"0000346656"	"CHEK2"
"0000346657"	"CHEK2"
"0000346658"	"CHEK2"
"0000346659"	"CHEK2"
"0000346660"	"CHEK2"
"0000346661"	"CHEK2"
"0000346662"	"CHEK2"
"0000346663"	"CHEK2"
"0000346664"	"CHEK2"
"0000346665"	"CHEK2"
"0000346666"	"CHEK2"
"0000346667"	"CHEK2"
"0000346668"	"CHEK2"
"0000346669"	"CHEK2"
"0000346670"	"CHEK2"
"0000346671"	"CHEK2"
"0000346672"	"CHEK2"
"0000346673"	"CHEK2"
"0000346674"	"CHEK2"
"0000346675"	"CHEK2"
"0000346676"	"CHEK2"
"0000346677"	"CHEK2"
"0000346678"	"CHEK2"
"0000346679"	"CHEK2"
"0000346680"	"CHEK2"
"0000346681"	"CHEK2"
"0000346682"	"CHEK2"
"0000346683"	"CHEK2"
"0000346684"	"CHEK2"
"0000346685"	"CHEK2"
"0000346686"	"CHEK2"
"0000346687"	"CHEK2"
"0000346688"	"CHEK2"
"0000346689"	"CHEK2"
"0000346690"	"CHEK2"
"0000346691"	"CHEK2"
"0000346692"	"CHEK2"
"0000346693"	"CHEK2"
"0000346694"	"CHEK2"
"0000346695"	"CHEK2"
"0000346696"	"CHEK2"
"0000346697"	"CHEK2"
"0000346698"	"CHEK2"
"0000346699"	"CHEK2"
"0000346700"	"CHEK2"
"0000346701"	"CHEK2"
"0000346702"	"CHEK2"
"0000346703"	"CHEK2"
"0000346704"	"CHEK2"
"0000350445"	"CHEK2"
"0000350446"	"CHEK2"
"0000350447"	"CHEK2"
"0000350448"	"CHEK2"
"0000350449"	"CHEK2"
"0000350643"	"CHEK2"
"0000352389"	"CHEK2"
"0000352390"	"CHEK2"
"0000352391"	"CHEK2"
"0000352392"	"CHEK2"
"0000352393"	"CHEK2"
"0000352394"	"CHEK2"
"0000352395"	"CHEK2"
"0000352396"	"CHEK2"
"0000352397"	"CHEK2"
"0000352398"	"CHEK2"
"0000352399"	"CHEK2"
"0000352400"	"CHEK2"
"0000352401"	"CHEK2"
"0000352402"	"CHEK2"
"0000352403"	"CHEK2"
"0000352404"	"CHEK2"
"0000352405"	"CHEK2"
"0000352406"	"CHEK2"
"0000352407"	"CHEK2"
"0000352408"	"CHEK2"
"0000352409"	"CHEK2"
"0000352410"	"CHEK2"
"0000352411"	"CHEK2"
"0000352412"	"CHEK2"
"0000352413"	"CHEK2"
"0000352414"	"CHEK2"
"0000352415"	"CHEK2"
"0000352416"	"CHEK2"
"0000352417"	"CHEK2"
"0000352418"	"CHEK2"
"0000352419"	"CHEK2"
"0000352420"	"CHEK2"
"0000352421"	"CHEK2"
"0000352422"	"CHEK2"
"0000352423"	"CHEK2"
"0000352424"	"CHEK2"
"0000352425"	"CHEK2"
"0000352426"	"CHEK2"
"0000352427"	"CHEK2"
"0000352428"	"CHEK2"
"0000352429"	"CHEK2"
"0000352430"	"CHEK2"
"0000352431"	"CHEK2"
"0000352432"	"CHEK2"
"0000352433"	"CHEK2"
"0000352434"	"CHEK2"
"0000352435"	"CHEK2"
"0000352436"	"CHEK2"
"0000352437"	"CHEK2"
"0000352438"	"CHEK2"
"0000352439"	"CHEK2"
"0000352440"	"CHEK2"
"0000352441"	"CHEK2"
"0000352442"	"CHEK2"
"0000352443"	"CHEK2"
"0000352444"	"CHEK2"
"0000352445"	"CHEK2"
"0000352446"	"CHEK2"
"0000352447"	"CHEK2"
"0000352448"	"CHEK2"
"0000352449"	"CHEK2"
"0000352450"	"CHEK2"
"0000352451"	"CHEK2"
"0000352452"	"CHEK2"
"0000352453"	"CHEK2"
"0000352454"	"CHEK2"
"0000352455"	"CHEK2"
"0000352456"	"CHEK2"
"0000352457"	"CHEK2"
"0000352458"	"CHEK2"
"0000352459"	"CHEK2"
"0000352460"	"CHEK2"
"0000352461"	"CHEK2"
"0000352462"	"CHEK2"
"0000352463"	"CHEK2"
"0000352464"	"CHEK2"
"0000352465"	"CHEK2"
"0000352466"	"CHEK2"
"0000352467"	"CHEK2"
"0000352468"	"CHEK2"
"0000352469"	"CHEK2"
"0000352470"	"CHEK2"
"0000352471"	"CHEK2"
"0000352472"	"CHEK2"
"0000352473"	"CHEK2"
"0000352474"	"CHEK2"
"0000352475"	"CHEK2"
"0000352476"	"CHEK2"
"0000352477"	"CHEK2"
"0000352478"	"CHEK2"
"0000352479"	"CHEK2"
"0000352480"	"CHEK2"
"0000352481"	"CHEK2"
"0000352482"	"CHEK2"
"0000352483"	"CHEK2"
"0000352484"	"CHEK2"
"0000352485"	"CHEK2"
"0000352486"	"CHEK2"
"0000352487"	"CHEK2"
"0000352488"	"CHEK2"
"0000352489"	"CHEK2"
"0000352490"	"CHEK2"
"0000352491"	"CHEK2"
"0000352492"	"CHEK2"
"0000352493"	"CHEK2"
"0000352494"	"CHEK2"
"0000352495"	"CHEK2"
"0000352496"	"CHEK2"
"0000352497"	"CHEK2"
"0000352498"	"CHEK2"
"0000352499"	"CHEK2"
"0000352500"	"CHEK2"
"0000352501"	"CHEK2"
"0000352502"	"CHEK2"
"0000352503"	"CHEK2"
"0000352504"	"CHEK2"
"0000352505"	"CHEK2"
"0000352506"	"CHEK2"
"0000352507"	"CHEK2"
"0000352508"	"CHEK2"
"0000352509"	"CHEK2"
"0000352510"	"CHEK2"
"0000352511"	"CHEK2"
"0000352512"	"CHEK2"
"0000352513"	"CHEK2"
"0000352514"	"CHEK2"
"0000352515"	"CHEK2"
"0000352516"	"CHEK2"
"0000352517"	"CHEK2"
"0000352518"	"CHEK2"
"0000352519"	"CHEK2"
"0000352520"	"CHEK2"
"0000352521"	"CHEK2"
"0000352522"	"CHEK2"
"0000352523"	"CHEK2"
"0000352524"	"CHEK2"
"0000352525"	"CHEK2"
"0000352526"	"CHEK2"
"0000355221"	"CHEK2"
"0000355222"	"CHEK2"
"0000355223"	"CHEK2"
"0000355224"	"CHEK2"
"0000355225"	"CHEK2"
"0000355419"	"CHEK2"
"0000357165"	"CHEK2"
"0000357166"	"CHEK2"
"0000357167"	"CHEK2"
"0000357168"	"CHEK2"
"0000357169"	"CHEK2"
"0000357170"	"CHEK2"
"0000357171"	"CHEK2"
"0000357172"	"CHEK2"
"0000357173"	"CHEK2"
"0000357174"	"CHEK2"
"0000357175"	"CHEK2"
"0000357176"	"CHEK2"
"0000357177"	"CHEK2"
"0000357178"	"CHEK2"
"0000357179"	"CHEK2"
"0000357180"	"CHEK2"
"0000357181"	"CHEK2"
"0000357182"	"CHEK2"
"0000357183"	"CHEK2"
"0000357184"	"CHEK2"
"0000357185"	"CHEK2"
"0000357186"	"CHEK2"
"0000357187"	"CHEK2"
"0000357188"	"CHEK2"
"0000357189"	"CHEK2"
"0000357190"	"CHEK2"
"0000357191"	"CHEK2"
"0000357192"	"CHEK2"
"0000357193"	"CHEK2"
"0000357194"	"CHEK2"
"0000357195"	"CHEK2"
"0000357196"	"CHEK2"
"0000357197"	"CHEK2"
"0000357198"	"CHEK2"
"0000357199"	"CHEK2"
"0000357200"	"CHEK2"
"0000357201"	"CHEK2"
"0000357202"	"CHEK2"
"0000357203"	"CHEK2"
"0000357204"	"CHEK2"
"0000357205"	"CHEK2"
"0000357206"	"CHEK2"
"0000357207"	"CHEK2"
"0000357208"	"CHEK2"
"0000357209"	"CHEK2"
"0000357210"	"CHEK2"
"0000357211"	"CHEK2"
"0000357212"	"CHEK2"
"0000357213"	"CHEK2"
"0000357214"	"CHEK2"
"0000357215"	"CHEK2"
"0000357216"	"CHEK2"
"0000357217"	"CHEK2"
"0000357218"	"CHEK2"
"0000357219"	"CHEK2"
"0000357220"	"CHEK2"
"0000357221"	"CHEK2"
"0000357222"	"CHEK2"
"0000357223"	"CHEK2"
"0000357224"	"CHEK2"
"0000357225"	"CHEK2"
"0000357226"	"CHEK2"
"0000357227"	"CHEK2"
"0000357228"	"CHEK2"
"0000357229"	"CHEK2"
"0000357230"	"CHEK2"
"0000357231"	"CHEK2"
"0000357232"	"CHEK2"
"0000357233"	"CHEK2"
"0000357234"	"CHEK2"
"0000357235"	"CHEK2"
"0000357236"	"CHEK2"
"0000357237"	"CHEK2"
"0000357238"	"CHEK2"
"0000357239"	"CHEK2"
"0000357240"	"CHEK2"
"0000357241"	"CHEK2"
"0000357242"	"CHEK2"
"0000357243"	"CHEK2"
"0000357244"	"CHEK2"
"0000357245"	"CHEK2"
"0000357246"	"CHEK2"
"0000357247"	"CHEK2"
"0000357248"	"CHEK2"
"0000357249"	"CHEK2"
"0000357250"	"CHEK2"
"0000357251"	"CHEK2"
"0000357252"	"CHEK2"
"0000357253"	"CHEK2"
"0000357254"	"CHEK2"
"0000357255"	"CHEK2"
"0000357256"	"CHEK2"
"0000357257"	"CHEK2"
"0000357258"	"CHEK2"
"0000357259"	"CHEK2"
"0000357260"	"CHEK2"
"0000357261"	"CHEK2"
"0000357262"	"CHEK2"
"0000357263"	"CHEK2"
"0000357264"	"CHEK2"
"0000357265"	"CHEK2"
"0000357266"	"CHEK2"
"0000357267"	"CHEK2"
"0000357268"	"CHEK2"
"0000357269"	"CHEK2"
"0000357270"	"CHEK2"
"0000357271"	"CHEK2"
"0000357272"	"CHEK2"
"0000357273"	"CHEK2"
"0000357274"	"CHEK2"
"0000357275"	"CHEK2"
"0000357276"	"CHEK2"
"0000357277"	"CHEK2"
"0000357278"	"CHEK2"
"0000357279"	"CHEK2"
"0000357280"	"CHEK2"
"0000357281"	"CHEK2"
"0000357282"	"CHEK2"
"0000357283"	"CHEK2"
"0000357284"	"CHEK2"
"0000357285"	"CHEK2"
"0000357286"	"CHEK2"
"0000357287"	"CHEK2"
"0000357288"	"CHEK2"
"0000357289"	"CHEK2"
"0000357290"	"CHEK2"
"0000357291"	"CHEK2"
"0000357292"	"CHEK2"
"0000357293"	"CHEK2"
"0000357294"	"CHEK2"
"0000357295"	"CHEK2"
"0000357296"	"CHEK2"
"0000357297"	"CHEK2"
"0000357298"	"CHEK2"
"0000357299"	"CHEK2"
"0000357300"	"CHEK2"
"0000357301"	"CHEK2"
"0000357302"	"CHEK2"
"0000373260"	"BRCA1"
"0000373260"	"CHEK2"
"0000373260"	"NTHL1"
"0000398170"	"CHEK2"
"0000398171"	"CHEK2"
"0000398172"	"CHEK2"
"0000398173"	"CHEK2"
"0000398178"	"CHEK2"
"0000445049"	"CHEK2"
"0000445050"	"CHEK2"
"0000445051"	"CHEK2"
"0000456671"	"CHEK2"
"0000456671"	"MLH1"
"0000462628"	"CHEK2"
"0000462641"	"CHEK2"
"0000466140"	"CHEK2"
"0000466141"	"CHEK2"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 1496
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000073915"	"0"	"11"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"01339"	"CHEK2_000001"	"g.29091857del"	"18/1658"	"{kConFab:LCS}"	""	"CHEK2 1100 del C"	""	"Unknown"	""	""	"0"	""	""	"g.28695869del"	""	"likely benign"	"kConFab"
"0000077041"	"0"	"00"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"00589"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	"Ook CHEK2 c.1100delC"	"Unknown"	""	""	"0"	""	""	"g.28695869del"	""	""	""
"0000077048"	"3"	"00"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"00589"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	"Brandao  2011, c.692C>T leidt tot meer exon 11 skipping maar wt transcript ook gewoon aanwezig. Patient heeft ook CHEK2 c.1100delC homozygoot en BRCA2 VUS c.2755G>A"	"Unknown"	""	""	"0"	""	""	"g.28695869del"	""	""	""
"0000077213"	"0"	"00"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"00578"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	"also CHEK2 c.1100del"	"Germline"	""	""	"0"	""	""	"g.28695869del"	""	""	""
"0000077235"	"0"	"00"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"00578"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	"also CHEK2 c.1100del"	"Germline"	""	""	"0"	""	""	"g.28695869del"	""	""	""
"0000079148"	"3"	"90"	"22"	"29130652"	"29130652"	"subst"	"0.000148661"	"00006"	"CHEK2_000005"	"g.29130652G>A"	""	"{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}"	""	""	"association variant/phenotype uncertain"	"Germline"	""	""	"0"	""	""	"g.28734664G>A"	""	"pathogenic"	""
"0000084779"	"0"	"70"	"22"	"29130433"	"29130433"	"del"	"0"	"01474"	"CHEK2_000006"	"g.29130433del"	""	""	""	"277delT"	""	"Germline"	""	""	"0"	""	""	"g.28734445del"	""	"likely pathogenic"	""
"0000147523"	"1"	"00"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"00589"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.28695869del"	""	""	""
"0000148796"	"1"	"50"	"22"	"29083961"	"29083961"	"subst"	"0"	"01816"	"CHEK2_000036"	"g.29083961C>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28687973C>A"	""	"VUS"	""
"0000148797"	"1"	"50"	"22"	"29085131"	"29085131"	"subst"	"8.73073E-5"	"01816"	"CHEK2_000007"	"g.29085131G>C"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28689143G>C"	""	"VUS"	""
"0000148798"	"1"	"50"	"22"	"29090030"	"29090030"	"subst"	"7.85388E-5"	"01816"	"CHEK2_000008"	"g.29090030G>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28694042G>A"	""	"VUS"	""
"0000148799"	"1"	"90"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"01816"	"CHEK2_000009"	"g.29090054G>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28694066G>A"	""	"pathogenic"	""
"0000148801"	"1"	"10"	"22"	"29091147"	"29091147"	"subst"	"0.00135029"	"01816"	"CHEK2_000010"	"g.29091147A>C"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695159A>C"	""	"benign"	""
"0000148802"	"1"	"50"	"22"	"29091178"	"29091178"	"subst"	"0.000390523"	"01816"	"CHEK2_000011"	"g.29091178C>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695190C>A"	""	"VUS"	""
"0000148803"	"1"	"90"	"22"	"29091207"	"29091207"	"subst"	"0.000476256"	"01816"	"CHEK2_000012"	"g.29091207G>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695219G>A"	""	"pathogenic"	""
"0000148804"	"1"	"30"	"22"	"29091740"	"29091740"	"subst"	"0.00028901"	"01816"	"CHEK2_000013"	"g.29091740C>T"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695752C>T"	""	"likely benign"	""
"0000148805"	"1"	"50"	"22"	"29091742"	"29091742"	"subst"	"7.32422E-5"	"01816"	"CHEK2_000014"	"g.29091742G>T"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695754G>T"	""	"VUS"	""
"0000148806"	"1"	"50"	"22"	"29091782"	"29091782"	"subst"	"4.47314E-5"	"01816"	"CHEK2_000015"	"g.29091782G>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695794G>A"	""	"VUS"	""
"0000148807"	"1"	"50"	"22"	"29091816"	"29091816"	"subst"	"3.66059E-5"	"01816"	"CHEK2_000016"	"g.29091816T>C"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695828T>C"	""	"VUS"	""
"0000148808"	"1"	"90"	"22"	"29091857"	"29091857"	""	"0.00207692"	"01816"	"CHEK2_000001"	"g.29091857del"	""	"Thibodeau lab (Mayo Clinic)"	""	"1100delC"	""	"Germline"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic"	""
"0000148809"	"1"	"90"	"22"	"29091857"	"29091857"	""	"0.00207692"	"01816"	"CHEK2_000001"	"g.29091857del"	""	"Thibodeau lab (Mayo Clinic)"	""	"1100delC"	""	"Germline"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic"	""
"0000148810"	"1"	"90"	"22"	"29105993"	"29105993"	"subst"	"0"	"01816"	"CHEK2_000017"	"g.29105993C>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28710005C>A"	""	"pathogenic"	""
"0000148811"	"1"	"50"	"22"	"29115403"	"29115403"	"subst"	"4.48398E-5"	"01816"	"CHEK2_000018"	"g.29115403G>C"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28719415G>C"	""	"VUS"	""
"0000148812"	"1"	"50"	"22"	"29115405"	"29115405"	"subst"	"0"	"01816"	"CHEK2_000019"	"g.29115405T>C"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28719417T>C"	""	"VUS"	""
"0000148813"	"1"	"50"	"22"	"29121000"	"29121000"	"subst"	"3.24907E-5"	"01816"	"CHEK2_000020"	"g.29121000T>C"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725012T>C"	""	"VUS"	""
"0000148814"	"1"	"50"	"22"	"29121016"	"29121016"	"subst"	"0.000113725"	"01816"	"CHEK2_000021"	"g.29121016G>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725028G>A"	""	"VUS"	""
"0000148815"	"1"	"50"	"22"	"29121019"	"29121019"	"subst"	"0.00099909"	"01816"	"CHEK2_000022"	"g.29121019G>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725031G>A"	""	"VUS"	""
"0000148816"	"1"	"50"	"22"	"29121025"	"29121025"	"subst"	"0"	"01816"	"CHEK2_000023"	"g.29121025C>G"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725037C>G"	""	"VUS"	""
"0000148817"	"1"	"50"	"22"	"29121043"	"29121043"	"subst"	"4.06147E-6"	"01816"	"CHEK2_000024"	"g.29121043T>C"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725055T>C"	""	"VUS"	""
"0000148818"	"1"	"50"	"22"	"29121075"	"29121075"	"subst"	"4.06171E-6"	"01816"	"CHEK2_000025"	"g.29121075T>C"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725087T>C"	""	"VUS"	""
"0000148819"	"1"	"70"	"22"	"29121087"	"29121087"	"subst"	"0.00425643"	"01816"	"CHEK2_000026"	"g.29121087A>G"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725099A>G"	""	"likely pathogenic"	""
"0000148820"	"1"	"70"	"22"	"29121087"	"29121087"	"subst"	"0.00425643"	"01816"	"CHEK2_000026"	"g.29121087A>G"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725099A>G"	""	"likely pathogenic"	""
"0000148821"	"1"	"70"	"22"	"29121242"	"29121242"	"subst"	"4.47053E-5"	"01816"	"CHEK2_000034"	"g.29121242G>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725254G>A"	""	"likely pathogenic"	""
"0000148822"	"1"	"50"	"22"	"29121247"	"29121247"	"subst"	"0"	"01816"	"CHEK2_000035"	"g.29121247T>C"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725259T>C"	""	"VUS"	""
"0000148823"	"1"	"50"	"22"	"29121248"	"29121248"	"subst"	"0"	"01816"	"CHEK2_000032"	"g.29121248G>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725260G>A"	""	"VUS"	""
"0000148824"	"1"	"70"	"22"	"29121326"	"29121326"	"subst"	"0.000117887"	"01816"	"CHEK2_000033"	"g.29121326T>C"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725338T>C"	""	"likely pathogenic"	""
"0000148825"	"1"	"90"	"22"	"29130427"	"29130427"	"subst"	"8.12466E-6"	"01816"	"CHEK2_000027"	"g.29130427G>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28734439G>A"	""	"pathogenic"	""
"0000148826"	"1"	"50"	"22"	"29130473"	"29130487"	"del"	"0"	"01816"	"CHEK2_000028"	"g.29130473_29130487del"	""	"Thibodeau lab (Mayo Clinic)"	""	"260delCCAAGAACCTAGGA"	"correct would be delCCAAGAACCTgAGGA"	"Germline"	""	""	"0"	""	""	"g.28734485_28734499del"	""	"VUS"	""
"0000148827"	"1"	"10"	"22"	"29130456"	"29130456"	"subst"	"0.000901699"	"01816"	"CHEK2_000029"	"g.29130456G>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28734468G>A"	""	"benign"	""
"0000148828"	"1"	"50"	"22"	"29130576"	"29130576"	"subst"	"2.03257E-5"	"01816"	"CHEK2_000030"	"g.29130576G>A"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28734588G>A"	""	"VUS"	""
"0000148829"	"1"	"50"	"22"	"29130645"	"29130645"	"subst"	"0"	"01816"	"CHEK2_000031"	"g.29130645T>C"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28734657T>C"	""	"VUS"	""
"0000149157"	"3"	"70"	"22"	"29121087"	"29121087"	"subst"	"0.00425643"	"01816"	"CHEK2_000026"	"g.29121087A>G"	""	"Thibodeau lab (Mayo Clinic)"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725099A>G"	""	"likely pathogenic"	""
"0000178000"	"0"	"90"	"22"	"29121245"	"29121245"	"del"	"0"	"01741"	"CHEK2_000037"	"g.29121245del"	""	""	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.28725257del"	""	"pathogenic"	""
"0000248132"	"0"	"30"	"22"	"29091865"	"29091865"	"subst"	"3.27826E-5"	"02325"	"CHEK2_000056"	"g.29091865A>G"	""	""	""	"CHEK2(NM_001005735.1):c.1225-4T>C, CHEK2(NM_007194.4):c.1096-4T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28695877A>G"	""	"likely benign"	""
"0000249269"	"0"	"10"	"22"	"29085257"	"29085257"	"subst"	"0"	"02325"	"CHEK2_000046"	"g.29085257A>G"	""	""	""	"CHEK2(NM_007194.4):c.1462-54T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28689269A>G"	""	"benign"	""
"0000249615"	"0"	"90"	"22"	"29091113"	"29091113"	"subst"	"0"	"02325"	"CHEK2_000050"	"g.29091113A>C"	""	""	""	"CHEK2(NM_007194.4):c.1375+2T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28695125A>C"	""	"pathogenic"	""
"0000249634"	"0"	"90"	"22"	"29115473"	"29115473"	"del"	"0"	"02325"	"CHEK2_000063"	"g.29115473del"	""	""	""	"CHEK2(NM_007194.4):c.597delT (p.F199Lfs*6)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28719485del"	""	"pathogenic"	""
"0000249728"	"0"	"50"	"22"	"29130403"	"29130403"	"subst"	"0"	"02325"	"CHEK2_000074"	"g.29130403A>G"	""	""	""	"CHEK2(NM_007194.4):c.307T>C (p.F103L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28734415A>G"	""	"VUS"	""
"0000249729"	"0"	"50"	"22"	"29121050"	"29121050"	"subst"	"8.12301E-6"	"02325"	"CHEK2_000070"	"g.29121050A>C"	""	""	""	"CHEK2(NM_001005735.1):c.636T>G (p.(Phe212Leu)), CHEK2(NM_007194.4):c.507T>G (p.F169L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725062A>C"	""	"VUS"	""
"0000249768"	"0"	"50"	"22"	"29120979"	"29120979"	"subst"	"1.21842E-5"	"02325"	"CHEK2_000066"	"g.29120979A>G"	""	""	""	"CHEK2(NM_007194.4):c.578T>C (p.L193P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28724991A>G"	""	"VUS"	""
"0000249850"	"0"	"50"	"22"	"29121360"	"29121360"	"subst"	"0.000574245"	"02325"	"CHEK2_000073"	"g.29121360A>T"	""	""	""	"CHEK2(NM_001005735.1):c.449-5T>A (p.?), CHEK2(NM_007194.4):c.320-5T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725372A>T"	""	"VUS"	""
"0000250144"	"0"	"10"	"22"	"29091147"	"29091147"	"subst"	"0.00135029"	"02329"	"CHEK2_000010"	"g.29091147A>C"	""	""	""	"CHEK2(NM_001005735.1):c.1472T>G (p.(Ile491Ser)), CHEK2(NM_007194.4):c.1343T>G (p.I448S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28695159A>C"	""	"benign"	""
"0000250245"	"0"	"10"	"22"	"29085112"	"29085112"	"subst"	"0.00382611"	"02329"	"CHEK2_000041"	"g.29085112A>T"	""	""	""	"CHEK2(NM_001005735.1):c.1671+11T>A (p.(=)), CHEK2(NM_007194.4):c.1542+11T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28689124A>T"	""	"benign"	""
"0000254122"	"0"	"30"	"22"	"29091865"	"29091865"	"subst"	"3.27826E-5"	"01943"	"CHEK2_000056"	"g.29091865A>G"	""	""	""	"CHEK2(NM_001005735.1):c.1225-4T>C, CHEK2(NM_007194.4):c.1096-4T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28695877A>G"	""	"likely benign"	""
"0000266763"	"0"	"50"	"22"	"29130713"	"29130713"	"subst"	"6.27704E-5"	"02325"	"CHEK2_000077"	"g.29130713G>A"	""	""	""	"CHEK2(NM_007194.4):c.-4C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28734725G>A"	""	"VUS"	""
"0000266764"	"0"	"10"	"22"	"29083867"	"29083867"	"subst"	"0"	"02325"	"CHEK2_000038"	"g.29083867G>A"	""	""	""	"CHEK2(NM_007194.4):c.*18C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28687879G>A"	""	"benign"	""
"0000266765"	"0"	"50"	"22"	"29095831"	"29095831"	"subst"	"4.06138E-6"	"02325"	"CHEK2_000060"	"g.29095831C>G"	""	""	""	"CHEK2(NM_007194.4):c.1003G>C (p.V335L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28699843C>G"	""	"VUS"	""
"0000266766"	"0"	"50"	"22"	"29092962"	"29092962"	"subst"	"1.62632E-5"	"02325"	"CHEK2_000059"	"g.29092962T>G"	""	""	""	"CHEK2(NM_001005735.1):c.1151A>C (p.(Asn384Thr)), CHEK2(NM_007194.4):c.1022A>C (p.N341T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28696974T>G"	""	"VUS"	""
"0000266767"	"0"	"50"	"22"	"29092931"	"29092931"	"subst"	"8.94011E-5"	"02325"	"CHEK2_000058"	"g.29092931C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1182G>T (p.(Glu394Asp)), CHEK2(NM_007194.4):c.1053G>T (p.E351D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28696943C>A"	""	"VUS"	""
"0000266768"	"0"	"30"	"22"	"29092870"	"29092870"	"subst"	"0.000179219"	"02325"	"CHEK2_000057"	"g.29092870C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1224+19G>A (p.(=)), CHEK2(NM_007194.4):c.1095+19G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28696882C>T"	""	"likely benign"	""
"0000266769"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"02325"	"CHEK2_000001"	"g.29091857del"	""	""	""	"CHEK2(NM_001005735.1):c.1229delC (p.(Thr410Metfs*15)), CHEK2(NM_007194.4):c.1100delC (p.T367Mfs*15)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic"	""
"0000266770"	"0"	"30"	"22"	"29091240"	"29091240"	"subst"	"5.73394E-5"	"02325"	"CHEK2_000052"	"g.29091240G>C"	""	""	""	"CHEK2(NM_001005735.1):c.1389-10C>G (p.(=)), CHEK2(NM_007194.4):c.1260-10C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28695252G>C"	""	"likely benign"	""
"0000266772"	"0"	"50"	"22"	"29090098"	"29090098"	"subst"	"8.7276E-6"	"02325"	"CHEK2_000049"	"g.29090098G>C"	""	""	""	"CHEK2(NM_007194.4):c.1383C>G (p.D461E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28694110G>C"	""	"VUS"	""
"0000266773"	"0"	"50"	"22"	"29090031"	"29090031"	"subst"	"4.36331E-6"	"02325"	"CHEK2_000048"	"g.29090031G>T"	""	""	""	"CHEK2(NM_007194.4):c.1450C>A (p.P484T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28694043G>T"	""	"VUS"	""
"0000266774"	"0"	"70"	"22"	"29090015"	"29090015"	"subst"	"0"	"02325"	"CHEK2_000047"	"g.29090015C>T"	""	""	""	"CHEK2(NM_007194.4):c.1461+5G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28694027C>T"	""	"likely pathogenic"	""
"0000266775"	"0"	"30"	"22"	"29085195"	"29085195"	"subst"	"2.61945E-5"	"02325"	"CHEK2_000045"	"g.29085195G>T"	""	""	""	"CHEK2(NM_001005735.1):c.1599C>A (p.(Asp533Glu)), CHEK2(NM_007194.4):c.1470C>A (p.D490E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28689207G>T"	""	"likely benign"	""
"0000266776"	"0"	"30"	"22"	"29085140"	"29085140"	"subst"	"8.29448E-5"	"02325"	"CHEK2_000043"	"g.29085140G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1654C>T (p.(Pro552Ser)), CHEK2(NM_007194.4):c.1525C>T (p.P509S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28689152G>A"	""	"likely benign"	""
"0000266777"	"0"	"30"	"22"	"29083913"	"29083913"	"subst"	"0"	"02325"	"CHEK2_000040"	"g.29083913C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1733G>A (p.(Arg578His)), CHEK2(NM_007194.4):c.1604G>A (p.R535H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28687925C>T"	""	"likely benign"	""
"0000266778"	"0"	"30"	"22"	"29083909"	"29083909"	"subst"	"0"	"02325"	"CHEK2_000039"	"g.29083909T>C"	""	""	""	"CHEK2(NM_007194.4):c.1608A>G (p.P536=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28687921T>C"	""	"likely benign"	""
"0000266779"	"0"	"30"	"22"	"29085138"	"29085138"	"subst"	"0"	"02325"	"CHEK2_000042"	"g.29085138G>A"	""	""	""	"CHEK2(NM_007194.4):c.1527C>T (p.P509=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28689150G>A"	""	"likely benign"	""
"0000266780"	"0"	"50"	"22"	"29130534"	"29130534"	"subst"	"1.62455E-5"	"02325"	"CHEK2_000076"	"g.29130534G>T"	""	""	""	"CHEK2(NM_007194.4):c.176C>A (p.T59K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28734546G>T"	""	"VUS"	""
"0000266781"	"0"	"50"	"22"	"29130520"	"29130520"	"subst"	"0.00015432"	"02325"	"CHEK2_000075"	"g.29130520C>T"	""	""	""	"CHEK2(NM_001005735.1):c.190G>A (p.(Glu64Lys)), CHEK2(NM_007194.4):c.190G>A (p.E64K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28734532C>T"	""	"VUS"	""
"0000266782"	"0"	"70"	"22"	"29121326"	"29121326"	"subst"	"0.000117887"	"02325"	"CHEK2_000033"	"g.29121326T>C"	""	""	""	"CHEK2(NM_001005735.1):c.478A>G (p.(Arg160Gly)), CHEK2(NM_007194.4):c.349A>G (p.R117G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725338T>C"	""	"likely pathogenic"	""
"0000266783"	"0"	"70"	"22"	"29121242"	"29121242"	"subst"	"4.47053E-5"	"02325"	"CHEK2_000034"	"g.29121242G>A"	""	""	""	"CHEK2(NM_007194.4):c.433C>T (p.R145W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725254G>A"	""	"likely pathogenic"	""
"0000266784"	"0"	"90"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"02325"	"CHEK2_000072"	"g.29121230C>T"	""	""	""	"CHEK2(NM_001005735.1):c.573+1G>A (p.?), CHEK2(NM_007194.4):c.444+1G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725242C>T"	""	"pathogenic"	""
"0000266785"	"0"	"50"	"22"	"29121079"	"29121079"	"subst"	"4.06151E-6"	"02325"	"CHEK2_000071"	"g.29121079T>C"	""	""	""	"CHEK2(NM_007194.4):c.478A>G (p.I160V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725091T>C"	""	"VUS"	""
"0000266786"	"0"	"50"	"22"	"29121049"	"29121049"	"subst"	"0"	"02325"	"CHEK2_000069"	"g.29121049C>T"	""	""	""	"CHEK2(NM_007194.4):c.508G>A (p.V170I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725061C>T"	""	"VUS"	""
"0000266787"	"0"	"30"	"22"	"29121001"	"29121001"	"subst"	"5.68579E-5"	"02325"	"CHEK2_000067"	"g.29121001T>G"	""	""	""	"CHEK2(NM_001005735.1):c.685A>C (p.(Asn229His)), CHEK2(NM_007194.4):c.556A>C (p.N186H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725013T>G"	""	"likely benign"	""
"0000266788"	"0"	"70"	"22"	"29120965"	"29120965"	"subst"	"0"	"02325"	"CHEK2_000065"	"g.29120965C>G"	""	""	""	"CHEK2(NM_007194.4):c.592G>C (p.V198L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28724977C>G"	""	"likely pathogenic"	""
"0000266789"	"0"	"50"	"22"	"29095854"	"29095854"	"subst"	"1.62438E-5"	"02325"	"CHEK2_000061"	"g.29095854T>C"	""	""	""	"CHEK2(NM_001005735.1):c.1109A>G (p.(Tyr370Cys)), CHEK2(NM_007194.4):c.980A>G (p.Y327C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28699866T>C"	""	"VUS"	""
"0000268111"	"0"	"30"	"22"	"29092870"	"29092870"	"subst"	"0.000179219"	"02329"	"CHEK2_000057"	"g.29092870C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1224+19G>A (p.(=)), CHEK2(NM_007194.4):c.1095+19G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28696882C>T"	""	"likely benign"	""
"0000268112"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"02329"	"CHEK2_000001"	"g.29091857del"	""	""	""	"CHEK2(NM_001005735.1):c.1229delC (p.(Thr410Metfs*15)), CHEK2(NM_007194.4):c.1100delC (p.T367Mfs*15)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic"	""
"0000268113"	"0"	"30"	"22"	"29085168"	"29085168"	"subst"	"4.80207E-5"	"02329"	"CHEK2_000044"	"g.29085168C>G"	""	""	""	"CHEK2(NM_001005735.1):c.1626G>C (p.(Leu542=)), CHEK2(NM_007194.4):c.1497G>C (p.L499=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28689180C>G"	""	"likely benign"	""
"0000268114"	"0"	"30"	"22"	"29085140"	"29085140"	"subst"	"8.29448E-5"	"02329"	"CHEK2_000043"	"g.29085140G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1654C>T (p.(Pro552Ser)), CHEK2(NM_007194.4):c.1525C>T (p.P509S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28689152G>A"	""	"likely benign"	""
"0000268115"	"0"	"30"	"22"	"29085138"	"29085138"	"subst"	"0"	"02329"	"CHEK2_000042"	"g.29085138G>A"	""	""	""	"CHEK2(NM_007194.4):c.1527C>T (p.P509=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28689150G>A"	""	"likely benign"	""
"0000268116"	"0"	"10"	"22"	"29130456"	"29130456"	"subst"	"0.000901699"	"02329"	"CHEK2_000029"	"g.29130456G>A"	""	""	""	"CHEK2(NM_001005735.1):c.254C>T (p.(Pro85Leu)), CHEK2(NM_007194.4):c.254C>T (p.P85L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28734468G>A"	""	"benign"	""
"0000268117"	"0"	"30"	"22"	"29121019"	"29121019"	"subst"	"0.00099909"	"02329"	"CHEK2_000022"	"g.29121019G>A"	""	""	""	"CHEK2(NM_001005735.1):c.667C>T (p.(Arg223Cys)), CHEK2(NM_007194.4):c.538C>T (p.R180C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725031G>A"	""	"likely benign"	""
"0000268118"	"0"	"30"	"22"	"29121018"	"29121018"	"subst"	"6.09226E-5"	"02329"	"CHEK2_000068"	"g.29121018C>T"	""	""	""	"CHEK2(NM_001005735.1):c.668G>A (p.(Arg223His)), CHEK2(NM_007194.4):c.539G>A (p.R180H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725030C>T"	""	"likely benign"	""
"0000273521"	"0"	"70"	"22"	"29091863"	"29091863"	"subst"	"0"	"01943"	"CHEK2_000055"	"g.29091863T>C"	""	""	""	"CHEK2(NM_007194.4):c.1096-2A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28695875T>C"	""	"likely pathogenic"	""
"0000273523"	"0"	"50"	"22"	"29091842"	"29091842"	"subst"	"0"	"01943"	"CHEK2_000053"	"g.29091842G>C"	""	""	""	"CHEK2(NM_007194.4):c.1115C>G (p.S372C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28695854G>C"	""	"VUS"	""
"0000273525"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"01943"	"CHEK2_000001"	"g.29091857del"	""	""	""	"CHEK2(NM_001005735.1):c.1229delC (p.(Thr410Metfs*15)), CHEK2(NM_007194.4):c.1100delC (p.T367Mfs*15)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic"	""
"0000273526"	"0"	"30"	"22"	"29121019"	"29121019"	"subst"	"0.00099909"	"01943"	"CHEK2_000022"	"g.29121019G>A"	""	""	""	"CHEK2(NM_001005735.1):c.667C>T (p.(Arg223Cys)), CHEK2(NM_007194.4):c.538C>T (p.R180C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725031G>A"	""	"likely benign"	""
"0000273527"	"0"	"50"	"22"	"29121001"	"29121001"	"subst"	"5.68579E-5"	"01943"	"CHEK2_000067"	"g.29121001T>G"	""	""	""	"CHEK2(NM_001005735.1):c.685A>C (p.(Asn229His)), CHEK2(NM_007194.4):c.556A>C (p.N186H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725013T>G"	""	"VUS"	""
"0000289192"	"0"	"50"	"22"	"29141951"	"29141951"	"subst"	"4.06855E-6"	"01943"	"HSCB_000001"	"g.29141951G>C"	""	""	""	"HSCB(NM_172002.5):c.523G>C (p.A175P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28745963G>C"	""	"VUS"	""
"0000328963"	"0"	"30"	"22"	"29121001"	"29121001"	"subst"	"5.68579E-5"	"01804"	"CHEK2_000067"	"g.29121001T>G"	""	""	""	"CHEK2(NM_001005735.1):c.685A>C (p.(Asn229His)), CHEK2(NM_007194.4):c.556A>C (p.N186H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725013T>G"	""	"likely benign"	""
"0000328964"	"0"	"30"	"22"	"29121360"	"29121360"	"subst"	"0.000574245"	"01804"	"CHEK2_000073"	"g.29121360A>T"	""	""	""	"CHEK2(NM_001005735.1):c.449-5T>A (p.?), CHEK2(NM_007194.4):c.320-5T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725372A>T"	""	"likely benign"	""
"0000342105"	"0"	"30"	"22"	"29121019"	"29121019"	"subst"	"0.00099909"	"02327"	"CHEK2_000022"	"g.29121019G>A"	""	""	""	"CHEK2(NM_001005735.1):c.667C>T (p.(Arg223Cys)), CHEK2(NM_007194.4):c.538C>T (p.R180C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28725031G>A"	""	"likely benign"	""
"0000349475"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"02327"	"CHEK2_000001"	"g.29091857del"	""	""	""	"CHEK2(NM_001005735.1):c.1229delC (p.(Thr410Metfs*15)), CHEK2(NM_007194.4):c.1100delC (p.T367Mfs*15)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic"	""
"0000352780"	"0"	"90"	"22"	"29095825"	"29099555"	"del"	"0"	"01164"	"CHEK2_000078"	"g.(29092976_29095825)_(29099555_29105993)del"	""	""	""	"ex8-9del"	""	"Germline"	""	""	"0"	""	""	"g.(28696988_28699837)_(28703567_28710005)del"	""	"pathogenic"	"ACMG"
"0000352803"	"0"	"90"	"22"	"29095825"	"29099555"	"del"	"0"	"00006"	"CHEK2_000078"	"g.(29092976_29095825)_(29099555_29105993)del"	""	"{PMID:Yurgelun 2017:28135145}"	""	"CHEK2 del exons 8-9"	"moderate penetrance"	"Germline"	""	""	"0"	""	""	"g.(28696988_28699837)_(28703567_28710005)del"	""	"pathogenic (!)"	""
"0000355061"	"0"	"70"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"01164"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	"Weischer ; 2008. J Clin Oncol. 26: 542: aggregated odds ratios of 2.7 (95% CI, 2.1 to 3.4) for unselected breast cancer, 2.6 (95% CI, 1.3 to 5.5) for early-onset breast cancer, and 4.8 (95% CI, 3.3 to 7.2) for familial breast cancer (=3-5 fold risk); Cybulski ; 2004. Am J Hum Genet 75: 1131:Multi-organ cancers (Colon, Prostate, Kidney and Thyroid)"	"Germline"	"?"	"rs555607708"	"0"	""	""	"g.28695869del"	""	"likely pathogenic"	""
"0000355062"	"0"	"50"	"22"	"29121087"	"29121087"	"subst"	"0.00425643"	"01164"	"CHEK2_000026"	"g.29121087A>G"	""	""	""	""	"Muranen ; 2016. Breast Cancer Res 18: 98: modest risk of BC (OR 1,4) with better prognosis; Wang ; 2012. Asian Pac J Cancer Prev 10: 10: low penetrance allele for BC (OR 1,48)"	"Germline"	"?"	"rs17879961"	"0"	""	""	"g.28725099A>G"	""	"VUS"	"ACMG"
"0000358850"	"1"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"01873"	"CHEK2_000001"	"g.29091857del"	""	"contributed by Dept. of Dr Vaccaro"	""	"1100delC"	""	"Germline"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic"	""
"0000369310"	"0"	"30"	"22"	"29099475"	"29099475"	"subst"	"5.6556E-6"	"01807"	"CHEK2_000079"	"g.29099475A>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.28703487A>T"	""	"likely benign"	""
"0000403653"	"1"	"10"	"22"	"29083913"	"29083913"	"subst"	"0"	"01714"	"CHEK2_000040"	"g.29083913C>T"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	"rs544216926"	"0"	""	""	"g.28687925C>T"	""	"benign"	""
"0000403654"	"1"	"50"	"22"	"29083943"	"29083943"	"subst"	"0"	"01714"	"CHEK2_000081"	"g.29083943C>T"	"3/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28687955C>T"	""	"VUS"	""
"0000403655"	"1"	"50"	"22"	"29083943"	"29083943"	"subst"	"0"	"01714"	"CHEK2_000081"	"g.29083943C>T"	"3/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28687955C>T"	""	"VUS"	""
"0000403656"	"1"	"50"	"22"	"29083949"	"29083949"	"subst"	"0"	"01714"	"CHEK2_000082"	"g.29083949C>T"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28687961C>T"	""	"VUS"	""
"0000403657"	"1"	"50"	"22"	"29083950"	"29083950"	"subst"	"0"	"01714"	"CHEK2_000083"	"g.29083950G>A"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	"rs149501505"	"0"	""	""	"g.28687962G>A"	""	"VUS"	""
"0000403658"	"1"	"50"	"22"	"29083955"	"29083955"	"subst"	"0"	"01714"	"CHEK2_000084"	"g.29083955C>T"	"4/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	"rs373959274"	"0"	""	""	"g.28687967C>T"	""	"VUS"	""
"0000403659"	"1"	"10"	"22"	"29083956"	"29083956"	"subst"	"0"	"01714"	"CHEK2_000085"	"g.29083956G>A"	"21/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs533475838"	"0"	""	""	"g.28687968G>A"	""	"benign"	""
"0000403660"	"1"	"10"	"22"	"29083956"	"29083956"	"subst"	"0"	"01714"	"CHEK2_000085"	"g.29083956G>A"	"9/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs533475838"	"0"	""	""	"g.28687968G>A"	""	"benign"	""
"0000403661"	"1"	"90"	"22"	"29083962"	"29083962"	"subst"	"0"	"01714"	"CHEK2_000086"	"g.29083962G>A"	"4/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs200432447"	"0"	""	""	"g.28687974G>A"	""	"pathogenic"	""
"0000403662"	"1"	"90"	"22"	"29083962"	"29083962"	"subst"	"0"	"01714"	"CHEK2_000086"	"g.29083962G>A"	"4/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs200432447"	"0"	""	""	"g.28687974G>A"	""	"pathogenic"	""
"0000403663"	"1"	"10"	"22"	"29085152"	"29085152"	"subst"	"7.42079E-5"	"01714"	"CHEK2_000088"	"g.29085152A>T"	"14/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs587781960"	"0"	""	""	"g.28689164A>T"	""	"benign"	""
"0000403664"	"1"	"10"	"22"	"29085152"	"29085152"	"subst"	"7.42079E-5"	"01714"	"CHEK2_000088"	"g.29085152A>T"	"27/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs587781960"	"0"	""	""	"g.28689164A>T"	""	"benign"	""
"0000403665"	"1"	"10"	"22"	"29085174"	"29085174"	"subst"	"8.73073E-6"	"01714"	"CHEK2_000089"	"g.29085174A>G"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs762041905"	"0"	""	""	"g.28689186A>G"	""	"benign"	""
"0000403666"	"1"	"10"	"22"	"29085174"	"29085174"	"subst"	"8.73073E-6"	"01714"	"CHEK2_000089"	"g.29085174A>G"	"2/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs762041905"	"0"	""	""	"g.28689186A>G"	""	"benign"	""
"0000403667"	"1"	"50"	"22"	"29085199"	"29085199"	"subst"	"0"	"01714"	"CHEK2_000090"	"g.29085199T>G"	"2/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28689211T>G"	""	"VUS"	""
"0000403668"	"1"	"90"	"22"	"29090043"	"29090043"	"subst"	"8.72638E-6"	"01714"	"CHEK2_000092"	"g.29090043C>T"	"7/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs773600515"	"0"	""	""	"g.28694055C>T"	""	"pathogenic"	""
"0000403669"	"1"	"90"	"22"	"29090043"	"29090043"	"subst"	"8.72638E-6"	"01714"	"CHEK2_000092"	"g.29090043C>T"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs773600515"	"0"	""	""	"g.28694055C>T"	""	"pathogenic"	""
"0000403670"	"1"	"90"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"01714"	"CHEK2_000009"	"g.29090054G>A"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	"rs142763740"	"0"	""	""	"g.28694066G>A"	""	"pathogenic"	""
"0000403671"	"3"	"50"	"22"	"29090061"	"29090061"	"subst"	"1.74534E-5"	"01714"	"CHEK2_000093"	"g.29090061G>A"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	"rs540635787"	"0"	""	""	"g.28694073G>A"	""	"VUS"	""
"0000403672"	"1"	"50"	"22"	"29090067"	"29090067"	"subst"	"0"	"01714"	"CHEK2_000094"	"g.29090067T>C"	"2/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28694079T>C"	""	"VUS"	""
"0000403673"	"1"	"50"	"22"	"29090067"	"29090067"	"subst"	"0"	"01714"	"CHEK2_000094"	"g.29090067T>C"	"3/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28694079T>C"	""	"VUS"	""
"0000403674"	"1"	"50"	"22"	"29090079"	"29090079"	"subst"	"0"	"01714"	"CHEK2_000095"	"g.29090079C>T"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28694091C>T"	""	"VUS"	""
"0000403675"	"1"	"10"	"22"	"29091133"	"29091133"	"subst"	"1.22024E-5"	"01714"	"CHEK2_000097"	"g.29091133C>G"	"15/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs763395924"	"0"	""	""	"g.28695145C>G"	""	"benign"	""
"0000403676"	"1"	"10"	"22"	"29091133"	"29091133"	"subst"	"1.22024E-5"	"01714"	"CHEK2_000097"	"g.29091133C>G"	"9/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs763395924"	"0"	""	""	"g.28695145C>G"	""	"benign"	""
"0000403677"	"1"	"50"	"22"	"29091183"	"29091183"	"subst"	"0"	"01714"	"CHEK2_000098"	"g.29091183A>C"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28695195A>C"	""	"VUS"	""
"0000403678"	"1"	"50"	"22"	"29091225"	"29091225"	"subst"	"1.22275E-5"	"01714"	"CHEK2_000099"	"g.29091225C>G"	"5/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs549755590"	"0"	""	""	"g.28695237C>G"	""	"VUS"	""
"0000403679"	"1"	"50"	"22"	"29091225"	"29091225"	"subst"	"1.22275E-5"	"01714"	"CHEK2_000099"	"g.29091225C>G"	"5/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs549755590"	"0"	""	""	"g.28695237C>G"	""	"VUS"	""
"0000403680"	"1"	"50"	"22"	"29091701"	"29091701"	"subst"	"0"	"01714"	"CHEK2_000100"	"g.29091701A>T"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28695713A>T"	""	"VUS"	""
"0000403681"	"1"	"90"	"22"	"29091719"	"29091719"	"subst"	"0"	"01714"	"CHEK2_000102"	"g.29091719A>T"	"4/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28695731A>T"	""	"pathogenic"	""
"0000403682"	"1"	"50"	"22"	"29091739"	"29091739"	"subst"	"0"	"01714"	"CHEK2_000103"	"g.29091739A>C"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28695751A>C"	""	"VUS"	""
"0000403683"	"1"	"10"	"22"	"29091754"	"29091754"	"subst"	"2.03355E-5"	"01714"	"CHEK2_000104"	"g.29091754A>G"	"7/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs560781587"	"0"	""	""	"g.28695766A>G"	""	"benign"	""
"0000403684"	"1"	"10"	"22"	"29091754"	"29091754"	"subst"	"2.03355E-5"	"01714"	"CHEK2_000104"	"g.29091754A>G"	"8/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs560781587"	"0"	""	""	"g.28695766A>G"	""	"benign"	""
"0000403685"	"1"	"10"	"22"	"29091762"	"29091762"	"subst"	"0"	"01714"	"CHEK2_000105"	"g.29091762C>T"	"11/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695774C>T"	""	"benign"	""
"0000403686"	"1"	"10"	"22"	"29091762"	"29091762"	"subst"	"0"	"01714"	"CHEK2_000105"	"g.29091762C>T"	"15/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695774C>T"	""	"benign"	""
"0000403687"	"1"	"10"	"22"	"29091781"	"29091781"	"subst"	"9.35309E-5"	"01714"	"CHEK2_000106"	"g.29091781C>T"	"2/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs142692907"	"0"	""	""	"g.28695793C>T"	""	"benign"	""
"0000403688"	"1"	"10"	"22"	"29091781"	"29091781"	"subst"	"9.35309E-5"	"01714"	"CHEK2_000106"	"g.29091781C>T"	"19/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs142692907"	"0"	""	""	"g.28695793C>T"	""	"benign"	""
"0000403689"	"1"	"50"	"22"	"29091822"	"29091822"	"subst"	"0"	"01714"	"CHEK2_000107"	"g.29091822A>G"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28695834A>G"	""	"VUS"	""
"0000403690"	"1"	"50"	"22"	"29091826"	"29091826"	"subst"	"0"	"01714"	"CHEK2_000108"	"g.29091826C>T"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28695838C>T"	""	"VUS"	""
"0000403691"	"1"	"10"	"22"	"29091840"	"29091840"	"subst"	"0"	"01714"	"CHEK2_000109"	"g.29091840T>C"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	"rs142470496"	"0"	""	""	"g.28695852T>C"	""	"benign"	""
"0000403692"	"1"	"50"	"22"	"29091846"	"29091846"	"subst"	"0.00045449"	"01714"	"CHEK2_000054"	"g.29091846G>A"	"13/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs531398630"	"0"	""	""	"g.28695858G>A"	""	"VUS"	""
"0000403693"	"1"	"50"	"22"	"29091846"	"29091846"	"subst"	"0.00045449"	"01714"	"CHEK2_000054"	"g.29091846G>A"	"10/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs531398630"	"0"	""	""	"g.28695858G>A"	""	"VUS"	""
"0000403694"	"1"	"50"	"22"	"29091850"	"29091850"	"subst"	"0"	"01714"	"CHEK2_000110"	"g.29091850A>G"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28695862A>G"	""	"VUS"	""
"0000403695"	"1"	"90"	"22"	"29092909"	"29092909"	"subst"	"0"	"01714"	"CHEK2_000112"	"g.29092909C>A"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28696921C>A"	""	"pathogenic"	""
"0000403696"	"1"	"90"	"22"	"29092917"	"29092917"	"subst"	"0"	"01714"	"CHEK2_000113"	"g.29092917G>T"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28696929G>T"	""	"pathogenic"	""
"0000403697"	"1"	"50"	"22"	"29092952"	"29092952"	"subst"	"3.25203E-5"	"01714"	"CHEK2_000115"	"g.29092952T>C"	"4/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs202051128"	"0"	""	""	"g.28696964T>C"	""	"VUS"	""
"0000403698"	"1"	"50"	"22"	"29092952"	"29092952"	"subst"	"3.25203E-5"	"01714"	"CHEK2_000115"	"g.29092952T>C"	"4/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs202051128"	"0"	""	""	"g.28696964T>C"	""	"VUS"	""
"0000403699"	"1"	"10"	"22"	"29092961"	"29092961"	"subst"	"2.8462E-5"	"01714"	"CHEK2_000116"	"g.29092961G>A"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	"rs377668478"	"0"	""	""	"g.28696973G>A"	""	"benign"	""
"0000403700"	"1"	"50"	"22"	"29095854"	"29095854"	"subst"	"1.62438E-5"	"01714"	"CHEK2_000061"	"g.29095854T>C"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	"rs587780194"	"0"	""	""	"g.28699866T>C"	""	"VUS"	""
"0000403701"	"1"	"50"	"22"	"29095882"	"29095882"	"subst"	"1.21828E-5"	"01714"	"CHEK2_000117"	"g.29095882G>A"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	"rs148053495"	"0"	""	""	"g.28699894G>A"	""	"VUS"	""
"0000403702"	"1"	"50"	"22"	"29095917"	"29095917"	"subst"	"0"	"01714"	"CHEK2_000118"	"g.29095917C>A"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28699929C>A"	""	"VUS"	""
"0000403703"	"1"	"50"	"22"	"29095917"	"29095917"	"subst"	"0"	"01714"	"CHEK2_000118"	"g.29095917C>A"	"2/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28699929C>A"	""	"VUS"	""
"0000403704"	"1"	"90"	"22"	"29099491"	"29099491"	"del"	"0"	"01714"	"CHEK2_000119"	"g.29099491del"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28703503del"	""	"pathogenic"	""
"0000403705"	"1"	"50"	"22"	"29099515"	"29099515"	"subst"	"0"	"01714"	"CHEK2_000120"	"g.29099515C>A"	"10/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28703527C>A"	""	"VUS"	""
"0000403706"	"1"	"50"	"22"	"29099515"	"29099515"	"subst"	"0"	"01714"	"CHEK2_000120"	"g.29099515C>A"	"5/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28703527C>A"	""	"VUS"	""
"0000403707"	"1"	"50"	"22"	"29099552"	"29099552"	"subst"	"0"	"01714"	"CHEK2_000122"	"g.29099552A>C"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28703564A>C"	""	"VUS"	""
"0000403708"	"1"	"50"	"22"	"29099552"	"29099552"	"subst"	"0"	"01714"	"CHEK2_000122"	"g.29099552A>C"	"3/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28703564A>C"	""	"VUS"	""
"0000403709"	"1"	"90"	"22"	"29099555"	"29099555"	"subst"	"0"	"01714"	"CHEK2_000123"	"g.29099555C>A"	"2/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28703567C>A"	""	"pathogenic"	""
"0000403710"	"1"	"90"	"22"	"29099555"	"29099555"	"subst"	"0"	"01714"	"CHEK2_000123"	"g.29099555C>A"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28703567C>A"	""	"pathogenic"	""
"0000403711"	"1"	"90"	"22"	"29099556"	"29099556"	"subst"	"0"	"01714"	"CHEK2_000124"	"g.29099556T>C"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28703568T>C"	""	"pathogenic"	""
"0000403712"	"1"	"50"	"22"	"29106001"	"29106001"	"subst"	"0"	"01714"	"CHEK2_000125"	"g.29106001A>C"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28710013A>C"	""	"VUS"	""
"0000403713"	"1"	"50"	"22"	"29107899"	"29107899"	"subst"	"4.06702E-6"	"01714"	"CHEK2_000126"	"g.29107899C>A"	"8/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28711911C>A"	""	"VUS"	""
"0000403714"	"1"	"50"	"22"	"29107899"	"29107899"	"subst"	"4.06702E-6"	"01714"	"CHEK2_000126"	"g.29107899C>A"	"7/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28711911C>A"	""	"VUS"	""
"0000403715"	"1"	"50"	"22"	"29107913"	"29107913"	"subst"	"0"	"01714"	"CHEK2_000127"	"g.29107913C>T"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28711925C>T"	""	"VUS"	""
"0000403716"	"1"	"50"	"22"	"29107934"	"29107934"	"subst"	"6.09459E-5"	"01714"	"CHEK2_000128"	"g.29107934C>T"	"14/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs587781379"	"0"	""	""	"g.28711946C>T"	""	"VUS"	""
"0000403717"	"1"	"50"	"22"	"29107934"	"29107934"	"subst"	"6.09459E-5"	"01714"	"CHEK2_000128"	"g.29107934C>T"	"16/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs587781379"	"0"	""	""	"g.28711946C>T"	""	"VUS"	""
"0000403718"	"1"	"10"	"22"	"29107975"	"29107975"	"subst"	"8.12585E-6"	"01714"	"CHEK2_000129"	"g.29107975G>A"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs864622322"	"0"	""	""	"g.28711987G>A"	""	"benign"	""
"0000403719"	"1"	"10"	"22"	"29107975"	"29107975"	"subst"	"8.12585E-6"	"01714"	"CHEK2_000129"	"g.29107975G>A"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs864622322"	"0"	""	""	"g.28711987G>A"	""	"benign"	""
"0000403720"	"1"	"50"	"22"	"29108000"	"29108000"	"subst"	"0"	"01714"	"CHEK2_000130"	"g.29108000G>C"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28712012G>C"	""	"VUS"	""
"0000403721"	"1"	"90"	"22"	"29108006"	"29108006"	"subst"	"4.06382E-6"	"01714"	"CHEK2_000131"	"g.29108006C>T"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28712018C>T"	""	"pathogenic"	""
"0000403722"	"1"	"90"	"22"	"29108006"	"29108006"	"subst"	"4.06382E-6"	"01714"	"CHEK2_000131"	"g.29108006C>T"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28712018C>T"	""	"pathogenic"	""
"0000403723"	"1"	"90"	"22"	"29108007"	"29108007"	"subst"	"0"	"01714"	"CHEK2_000132"	"g.29108007T>C"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28712019T>C"	""	"pathogenic"	""
"0000403724"	"1"	"50"	"22"	"29115383"	"29115383"	"subst"	"0"	"01714"	"CHEK2_000133"	"g.29115383C>T"	"3/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28719395C>T"	""	"VUS"	""
"0000403725"	"1"	"50"	"22"	"29115409"	"29115409"	"subst"	"4.45867E-6"	"01714"	"CHEK2_000134"	"g.29115409T>G"	"4/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28719421T>G"	""	"VUS"	""
"0000403726"	"1"	"50"	"22"	"29115420"	"29115420"	"subst"	"0"	"01714"	"CHEK2_000135"	"g.29115420A>G"	"2/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28719432A>G"	""	"VUS"	""
"0000403727"	"1"	"50"	"22"	"29115428"	"29115428"	"subst"	"0"	"01714"	"CHEK2_000136"	"g.29115428G>T"	"7/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28719440G>T"	""	"VUS"	""
"0000403728"	"1"	"50"	"22"	"29121000"	"29121000"	"subst"	"3.24907E-5"	"01714"	"CHEK2_000020"	"g.29121000T>C"	"2/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	"rs369223840"	"0"	""	""	"g.28725012T>C"	""	"VUS"	""
"0000403729"	"1"	"50"	"22"	"29121012"	"29121012"	"subst"	"4.06138E-6"	"01714"	"CHEK2_000137"	"g.29121012G>C"	"2/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28725024G>C"	""	"VUS"	""
"0000403730"	"1"	"10"	"22"	"29121015"	"29121015"	"subst"	"0.000129966"	"01714"	"CHEK2_000138"	"g.29121015C>T"	"16/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs121908701"	"0"	""	""	"g.28725027C>T"	""	"benign"	""
"0000403731"	"1"	"10"	"22"	"29121015"	"29121015"	"subst"	"0.000129966"	"01714"	"CHEK2_000138"	"g.29121015C>T"	"18/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs121908701"	"0"	""	""	"g.28725027C>T"	""	"benign"	""
"0000403732"	"1"	"90"	"22"	"29121016"	"29121016"	"subst"	"0.000113725"	"01714"	"CHEK2_000021"	"g.29121016G>A"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	"rs137853010"	"0"	""	""	"g.28725028G>A"	""	"pathogenic"	""
"0000403733"	"1"	"50"	"22"	"29121019"	"29121019"	"subst"	"0.00099909"	"01714"	"CHEK2_000022"	"g.29121019G>A"	"18/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs77130927"	"0"	""	""	"g.28725031G>A"	""	"VUS"	""
"0000403734"	"1"	"50"	"22"	"29121019"	"29121019"	"subst"	"0.00099909"	"01714"	"CHEK2_000022"	"g.29121019G>A"	"31/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs77130927"	"0"	""	""	"g.28725031G>A"	""	"VUS"	""
"0000403735"	"1"	"50"	"22"	"29121034"	"29121034"	"subst"	"0"	"01714"	"CHEK2_000139"	"g.29121034C>T"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28725046C>T"	""	"VUS"	""
"0000403736"	"1"	"50"	"22"	"29121050"	"29121050"	"subst"	"0"	"01714"	"CHEK2_000140"	"g.29121050A>G"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28725062A>G"	""	"VUS"	""
"0000403737"	"1"	"90"	"22"	"29121232"	"29121232"	"del"	"0"	"01714"	"CHEK2_000142"	"g.29121232del"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28725244del"	""	"pathogenic"	""
"0000403738"	"1"	"90"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"01714"	"CHEK2_000072"	"g.29121230C>T"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	"rs121908698"	"0"	""	""	"g.28725242C>T"	""	"pathogenic"	""
"0000403739"	"1"	"90"	"22"	"29121241"	"29121241"	"subst"	"1.21921E-5"	"01714"	"CHEK2_000143"	"g.29121241C>T"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	"rs587781667"	"0"	""	""	"g.28725253C>T"	""	"pathogenic"	""
"0000403740"	"1"	"90"	"22"	"29121266"	"29121266"	"subst"	"2.43827E-5"	"01714"	"CHEK2_000145"	"g.29121266G>A"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs730881701"	"0"	""	""	"g.28725278G>A"	""	"pathogenic"	""
"0000403741"	"1"	"90"	"22"	"29121266"	"29121266"	"subst"	"2.43827E-5"	"01714"	"CHEK2_000145"	"g.29121266G>A"	"2/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs730881701"	"0"	""	""	"g.28725278G>A"	""	"pathogenic"	""
"0000403742"	"1"	"50"	"22"	"29121280"	"29121280"	"subst"	"0"	"01714"	"CHEK2_000146"	"g.29121280C>T"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28725292C>T"	""	"VUS"	""
"0000403743"	"1"	"50"	"22"	"29121283"	"29121283"	"subst"	"0"	"01714"	"CHEK2_000147"	"g.29121283T>C"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28725295T>C"	""	"VUS"	""
"0000403744"	"1"	"50"	"22"	"29121320"	"29121320"	"subst"	"0"	"01714"	"CHEK2_000148"	"g.29121320T>G"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28725332T>G"	""	"VUS"	""
"0000403745"	"1"	"50"	"22"	"29126418"	"29126418"	"subst"	"0"	"01714"	"CHEK2_000150"	"g.29126418A>G"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28730430A>G"	""	"VUS"	""
"0000403746"	"1"	"50"	"22"	"29126425"	"29126425"	"subst"	"0.000221088"	"01714"	"CHEK2_000151"	"g.29126425C>T"	"2/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	"rs137926355"	"0"	""	""	"g.28730437C>T"	""	"VUS"	""
"0000403747"	"1"	"50"	"22"	"29126448"	"29126448"	"subst"	"0"	"01714"	"CHEK2_000152"	"g.29126448T>C"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28730460T>C"	""	"VUS"	""
"0000403748"	"1"	"50"	"22"	"29126456"	"29126456"	"subst"	"0"	"01714"	"CHEK2_000153"	"g.29126456C>A"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28730468C>A"	""	"VUS"	""
"0000403749"	"1"	"50"	"22"	"29130397"	"29130397"	"subst"	"0"	"01714"	"CHEK2_000154"	"g.29130397T>C"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	""	"0"	""	""	"g.28734409T>C"	""	"VUS"	""
"0000403750"	"1"	"50"	"22"	"29130426"	"29130426"	"subst"	"2.03113E-5"	"01714"	"CHEK2_000155"	"g.29130426C>T"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 11241 controls"	"Germline"	""	"rs750596499"	"0"	""	""	"g.28734438C>T"	""	"VUS"	""
"0000403751"	"1"	"90"	"22"	"29130427"	"29130427"	"subst"	"8.12466E-6"	"01714"	"CHEK2_000027"	"g.29130427G>A"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	"rs587781269"	"0"	""	""	"g.28734439G>A"	""	"pathogenic"	""
"0000403752"	"1"	"50"	"22"	"29130442"	"29130442"	"subst"	"4.0619E-6"	"01714"	"CHEK2_000156"	"g.29130442G>A"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs777588170"	"0"	""	""	"g.28734454G>A"	""	"VUS"	""
"0000403753"	"1"	"50"	"22"	"29130442"	"29130442"	"subst"	"4.0619E-6"	"01714"	"CHEK2_000156"	"g.29130442G>A"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs777588170"	"0"	""	""	"g.28734454G>A"	""	"VUS"	""
"0000403754"	"1"	"50"	"22"	"29130473"	"29130487"	"del"	"0"	"01714"	"CHEK2_000028"	"g.29130473_29130487del"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	"rs587780181"	"0"	""	""	"g.28734485_28734499del"	""	"VUS"	""
"0000403755"	"1"	"10"	"22"	"29130458"	"29130458"	"subst"	"0.0352077"	"01714"	"CHEK2_000157"	"g.29130458T>C"	"397/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs1805129"	"0"	""	""	"g.28734470T>C"	""	"benign"	""
"0000403756"	"1"	"10"	"22"	"29130458"	"29130458"	"subst"	"0.0352077"	"01714"	"CHEK2_000157"	"g.29130458T>C"	"629/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs1805129"	"0"	""	""	"g.28734470T>C"	""	"benign"	""
"0000403757"	"1"	"50"	"22"	"29130495"	"29130495"	"subst"	"2.03052E-5"	"01714"	"CHEK2_000159"	"g.29130495T>C"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	"rs769819013"	"0"	""	""	"g.28734507T>C"	""	"VUS"	""
"0000403758"	"1"	"50"	"22"	"29130551"	"29130551"	"subst"	"0"	"01714"	"CHEK2_000160"	"g.29130551A>G"	"2/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28734563A>G"	""	"VUS"	""
"0000403759"	"1"	"50"	"22"	"29130638"	"29130638"	"subst"	"4.11543E-6"	"01714"	"CHEK2_000161"	"g.29130638G>A"	"2/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	"rs759679862"	"0"	""	""	"g.28734650G>A"	""	"VUS"	""
"0000403760"	"1"	"50"	"22"	"29130643"	"29130643"	"subst"	"0"	"01714"	"CHEK2_000162"	"g.29130643C>A"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	"not in 7051 cases breast cancer"	"Germline"	""	""	"0"	""	""	"g.28734655C>A"	""	"VUS"	""
"0000405518"	"3"	"10"	"22"	"29083956"	"29083956"	"subst"	"0"	"01714"	"CHEK2_000085"	"g.29083956G>A"	"1/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs533475838"	"0"	""	""	"g.28687968G>A"	""	"benign"	""
"0000405519"	"3"	"10"	"22"	"29091754"	"29091754"	"subst"	"2.03355E-5"	"01714"	"CHEK2_000104"	"g.29091754A>G"	"1/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs560781587"	"0"	""	""	"g.28695766A>G"	""	"benign"	""
"0000405520"	"3"	"10"	"22"	"29130458"	"29130458"	"subst"	"0.0352077"	"01714"	"CHEK2_000157"	"g.29130458T>C"	"8/7051 cases breast cancer"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs1805129"	"0"	""	""	"g.28734470T>C"	""	"benign"	""
"0000405521"	"3"	"10"	"22"	"29130458"	"29130458"	"subst"	"0.0352077"	"01714"	"CHEK2_000157"	"g.29130458T>C"	"10/11241 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs1805129"	"0"	""	""	"g.28734470T>C"	""	"benign"	""
"0000406476"	"1"	"10"	"22"	"29130458"	"29130458"	"subst"	"0.0352077"	"01714"	"CHEK2_000157"	"g.29130458T>C"	"2/53 cases"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs1805129"	"0"	""	""	"g.28734470T>C"	""	"benign"	""
"0000407761"	"1"	"10"	"22"	"29083920"	"29083920"	"subst"	"0"	"01714"	"CHEK2_000080"	"g.29083920T>C"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs562517792"	"0"	""	""	"g.28687932T>C"	""	"benign"	""
"0000407762"	"1"	"50"	"22"	"29083943"	"29083943"	"subst"	"0"	"01714"	"CHEK2_000081"	"g.29083943C>T"	"3/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28687955C>T"	""	"VUS"	""
"0000407763"	"1"	"50"	"22"	"29083955"	"29083955"	"subst"	"0"	"01714"	"CHEK2_000084"	"g.29083955C>T"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs373959274"	"0"	""	""	"g.28687967C>T"	""	"VUS"	""
"0000407764"	"1"	"50"	"22"	"29083956"	"29083956"	"subst"	"0"	"01714"	"CHEK2_000085"	"g.29083956G>A"	"27/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs533475838"	"0"	""	""	"g.28687968G>A"	""	"VUS"	""
"0000407765"	"1"	"90"	"22"	"29083962"	"29083962"	"subst"	"0"	"01714"	"CHEK2_000086"	"g.29083962G>A"	"8/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs200432447"	"0"	""	""	"g.28687974G>A"	""	"pathogenic"	""
"0000407766"	"1"	"50"	"22"	"29085125"	"29085125"	"subst"	"0"	"01714"	"CHEK2_000087"	"g.29085125G>T"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28689137G>T"	""	"VUS"	""
"0000407767"	"1"	"50"	"22"	"29085152"	"29085152"	"subst"	"7.42079E-5"	"01714"	"CHEK2_000088"	"g.29085152A>T"	"21/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs587781960"	"0"	""	""	"g.28689164A>T"	""	"VUS"	""
"0000407768"	"1"	"50"	"22"	"29090036"	"29090036"	"subst"	"0"	"01714"	"CHEK2_000091"	"g.29090036C>G"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28694048C>G"	""	"VUS"	""
"0000407769"	"1"	"50"	"22"	"29090043"	"29090043"	"subst"	"8.72638E-6"	"01714"	"CHEK2_000092"	"g.29090043C>T"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs773600515"	"0"	""	""	"g.28694055C>T"	""	"VUS"	""
"0000407770"	"1"	"50"	"22"	"29090079"	"29090079"	"subst"	"0"	"01714"	"CHEK2_000095"	"g.29090079C>T"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28694091C>T"	""	"VUS"	""
"0000407771"	"1"	"50"	"22"	"29091132"	"29091132"	"subst"	"0"	"01714"	"CHEK2_000096"	"g.29091132G>A"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695144G>A"	""	"VUS"	""
"0000407772"	"1"	"50"	"22"	"29091133"	"29091133"	"subst"	"1.22024E-5"	"01714"	"CHEK2_000097"	"g.29091133C>G"	"5/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs763395924"	"0"	""	""	"g.28695145C>G"	""	"VUS"	""
"0000407773"	"1"	"50"	"22"	"29091183"	"29091183"	"subst"	"0"	"01714"	"CHEK2_000098"	"g.29091183A>C"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695195A>C"	""	"VUS"	""
"0000407774"	"1"	"50"	"22"	"29091225"	"29091225"	"subst"	"1.22275E-5"	"01714"	"CHEK2_000099"	"g.29091225C>G"	"9/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs549755590"	"0"	""	""	"g.28695237C>G"	""	"VUS"	""
"0000407775"	"1"	"50"	"22"	"29091702"	"29091702"	"subst"	"0"	"01714"	"CHEK2_000101"	"g.29091702T>A"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695714T>A"	""	"VUS"	""
"0000407776"	"1"	"10"	"22"	"29091754"	"29091754"	"subst"	"2.03355E-5"	"01714"	"CHEK2_000104"	"g.29091754A>G"	"15/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs560781587"	"0"	""	""	"g.28695766A>G"	""	"benign"	""
"0000407777"	"1"	"10"	"22"	"29091762"	"29091762"	"subst"	"0"	"01714"	"CHEK2_000105"	"g.29091762C>T"	"20/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695774C>T"	""	"benign"	""
"0000407778"	"1"	"10"	"22"	"29091781"	"29091781"	"subst"	"9.35309E-5"	"01714"	"CHEK2_000106"	"g.29091781C>T"	"9/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs142692907"	"0"	""	""	"g.28695793C>T"	""	"benign"	""
"0000407779"	"1"	"50"	"22"	"29091826"	"29091826"	"subst"	"0"	"01714"	"CHEK2_000108"	"g.29091826C>T"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695838C>T"	""	"VUS"	""
"0000407780"	"1"	"50"	"22"	"29091846"	"29091846"	"subst"	"0.00045449"	"01714"	"CHEK2_000054"	"g.29091846G>A"	"13/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs531398630"	"0"	""	""	"g.28695858G>A"	""	"VUS"	""
"0000407781"	"1"	"50"	"22"	"29092904"	"29092904"	"subst"	"0"	"01714"	"CHEK2_000111"	"g.29092904C>T"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28696916C>T"	""	"VUS"	""
"0000407782"	"1"	"50"	"22"	"29092948"	"29092948"	"subst"	"5.28421E-5"	"01714"	"CHEK2_000114"	"g.29092948G>A"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs201206424"	"0"	""	""	"g.28696960G>A"	""	"VUS"	""
"0000407783"	"1"	"50"	"22"	"29092952"	"29092952"	"subst"	"3.25203E-5"	"01714"	"CHEK2_000115"	"g.29092952T>C"	"5/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs202051128"	"0"	""	""	"g.28696964T>C"	""	"VUS"	""
"0000407784"	"1"	"50"	"22"	"29099515"	"29099515"	"subst"	"0"	"01714"	"CHEK2_000120"	"g.29099515C>A"	"9/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28703527C>A"	""	"VUS"	""
"0000407785"	"1"	"50"	"22"	"29099544"	"29099544"	"subst"	"0"	"01714"	"CHEK2_000121"	"g.29099544A>G"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28703556A>G"	""	"VUS"	""
"0000407786"	"3"	"50"	"22"	"29099552"	"29099552"	"subst"	"0"	"01714"	"CHEK2_000122"	"g.29099552A>C"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28703564A>C"	""	"VUS"	""
"0000407787"	"1"	"50"	"22"	"29099552"	"29099552"	"subst"	"0"	"01714"	"CHEK2_000122"	"g.29099552A>C"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28703564A>C"	""	"VUS"	""
"0000407788"	"1"	"50"	"22"	"29107899"	"29107899"	"subst"	"4.06702E-6"	"01714"	"CHEK2_000126"	"g.29107899C>A"	"9/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28711911C>A"	""	"VUS"	""
"0000407789"	"1"	"50"	"22"	"29107934"	"29107934"	"subst"	"6.09459E-5"	"01714"	"CHEK2_000128"	"g.29107934C>T"	"17/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs587781379"	"0"	""	""	"g.28711946C>T"	""	"VUS"	""
"0000407790"	"1"	"50"	"22"	"29115383"	"29115383"	"subst"	"0"	"01714"	"CHEK2_000133"	"g.29115383C>T"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28719395C>T"	""	"VUS"	""
"0000407791"	"1"	"50"	"22"	"29115409"	"29115409"	"subst"	"4.45867E-6"	"01714"	"CHEK2_000134"	"g.29115409T>G"	"4/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28719421T>G"	""	"VUS"	""
"0000407792"	"1"	"50"	"22"	"29115420"	"29115420"	"subst"	"0"	"01714"	"CHEK2_000135"	"g.29115420A>G"	"2/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28719432A>G"	""	"VUS"	""
"0000407793"	"1"	"50"	"22"	"29115428"	"29115428"	"subst"	"0"	"01714"	"CHEK2_000136"	"g.29115428G>T"	"7/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28719440G>T"	""	"VUS"	""
"0000407794"	"1"	"50"	"22"	"29121015"	"29121015"	"subst"	"0.000129966"	"01714"	"CHEK2_000138"	"g.29121015C>T"	"18/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs121908701"	"0"	""	""	"g.28725027C>T"	""	"VUS"	""
"0000407795"	"3"	"90"	"22"	"29121019"	"29121019"	"subst"	"0.00099909"	"01714"	"CHEK2_000022"	"g.29121019G>A"	"2/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs77130927"	"0"	""	""	"g.28725031G>A"	""	"pathogenic"	""
"0000407796"	"1"	"90"	"22"	"29121019"	"29121019"	"subst"	"0.00099909"	"01714"	"CHEK2_000022"	"g.29121019G>A"	"16/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs77130927"	"0"	""	""	"g.28725031G>A"	""	"pathogenic"	""
"0000407797"	"1"	"90"	"22"	"29121066"	"29121066"	"subst"	"0"	"01714"	"CHEK2_000141"	"g.29121066C>G"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725078C>G"	""	"pathogenic"	""
"0000407798"	"1"	"10"	"22"	"29121265"	"29121265"	"subst"	"0.000178802"	"01714"	"CHEK2_000144"	"g.29121265C>T"	"2/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs368570187"	"0"	""	""	"g.28725277C>T"	""	"benign"	""
"0000407799"	"1"	"50"	"22"	"29121283"	"29121283"	"subst"	"0"	"01714"	"CHEK2_000147"	"g.29121283T>C"	"2/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725295T>C"	""	"VUS"	""
"0000407800"	"1"	"50"	"22"	"29121329"	"29121329"	"subst"	"0"	"01714"	"CHEK2_000149"	"g.29121329C>G"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725341C>G"	""	"VUS"	""
"0000407801"	"3"	"10"	"22"	"29130458"	"29130458"	"subst"	"0.0352077"	"01714"	"CHEK2_000157"	"g.29130458T>C"	"12/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs1805129"	"0"	""	""	"g.28734470T>C"	""	"benign"	""
"0000407802"	"1"	"10"	"22"	"29130458"	"29130458"	"subst"	"0.0352077"	"01714"	"CHEK2_000157"	"g.29130458T>C"	"664/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs1805129"	"0"	""	""	"g.28734470T>C"	""	"benign"	""
"0000407803"	"1"	"50"	"22"	"29130490"	"29130490"	"subst"	"0"	"01714"	"CHEK2_000158"	"g.29130490T>C"	"1/12490 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28734502T>C"	""	"VUS"	""
"0000407804"	"1"	"50"	"22"	"29130651"	"29130651"	"subst"	"8.2543E-6"	"01714"	"CHEK2_000163"	"g.29130651T>C"	"1/12481 controls"	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	"rs753257724"	"0"	""	""	"g.28734663T>C"	""	"VUS"	""
"0000407999"	"0"	"90"	"22"	"29090043"	"29090043"	"subst"	"8.72638E-6"	"01714"	"CHEK2_000092"	"g.29090043C>T"	""	"{PMID:Momozawa 2018:30287823}, {DOI:Momozawa 2018:10.1038/s41467-018-06581-8}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28694055C>T"	""	"pathogenic"	""
"0000438778"	"0"	"70"	"22"	"29121087"	"29121087"	"subst"	"0.00425643"	"01164"	"CHEK2_000026"	"g.29121087A>G"	""	""	""	""	"Muranen ; 2016. Breast Cancer Res 18: 98 modest risk of BC (OR 1,4) with better prognosis Bak ; 2014. Hered Cancer Clin Pract 12: 10 probably no risk elevation, classified as likely benign Wang ; 2012. Asian Pac J Cancer Prev 10: 10 low penetrance allele for BC (OR 1,48)"	"Germline"	""	"rs17879961"	"0"	""	""	"g.28725099A>G"	""	"likely pathogenic"	"ACMG"
"0000438783"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"01164"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	"ACMG grading: PP1,PS4,PS3,PVS1,PP5; Bell ; 1999. Science 286: 2528 Li-Fraumeni Snydome Adank ; 2011. J Med Genet 48: 860 CHEK2*1100delC homozygosity is associated with a high breast cancer risk in women Cybulski ; 2011. J Clin Oncol 29: 3747 BC risk is dependend on family history (20% if no cancer in famly, 28 % if one affected famliy member 2-grade, 34% if one affected famly member 1 grade and 44% two affected famly members) Weischer ; 2008. J Clin Oncol. 26: 542 aggregated odds ratios of 2.7 (95% CI, 2.1 to 3.4) for unselected breast cancer, 2.6 (95% CI, 1.3 to 5.5) for early-onset breast cancer, and 4.8 (95% CI, 3.3 to 7.2) for familial breast cancer (=3-5 fold risk) Cybulski ; 2004. Am J Hum Genet 75: 1131 Multi-organ cancers (Colon, Prostate, Kidney and Thyroid)"	"Germline"	""	"rs555607708"	"0"	""	""	"g.28695869del"	""	"pathogenic"	"ACMG"
"0000438784"	"0"	"70"	"22"	"29121087"	"29121087"	"subst"	"0.00425643"	"01164"	"CHEK2_000026"	"g.29121087A>G"	""	""	""	""	"Muranen ; 2016. Breast Cancer Res 18: 98 modest risk of BC (OR 1,4) with better prognosis Bak ; 2014. Hered Cancer Clin Pract 12: 10 probably no risk elevation, classified as likely benign Wang ; 2012. Asian Pac J Cancer Prev 10: 10 low penetrance allele for BC (OR 1,48)"	"Germline"	""	"rs17879961"	"0"	""	""	"g.28725099A>G"	""	"likely pathogenic"	"ACMG"
"0000439061"	"0"	"70"	"22"	"29121087"	"29121087"	"subst"	"0.00425643"	"01164"	"CHEK2_000026"	"g.29121087A>G"	""	""	""	""	"Muranen ; 2016. Breast Cancer Res 18: 98 modest risk of BC (OR 1,4) with better prognosis Bak ; 2014. Hered Cancer Clin Pract 12: 10 probably no risk elevation, classified as likely benign Wang ; 2012. Asian Pac J Cancer Prev 10: 10 low penetrance allele for BC (OR 1,48)"	"Germline"	""	"rs17879961"	"0"	""	""	"g.28725099A>G"	""	"likely pathogenic"	"ACMG"
"0000439879"	"0"	"50"	"22"	"29083961"	"29083961"	"subst"	"0"	"01164"	"CHEK2_000036"	"g.29083961C>A"	""	""	""	""	"BC at age 37y, mother BC at age 58y; reported in Le Calvez-Kelm  2011. Breast 13:6"	"Germline"	""	"rs587780180"	"0"	""	""	"g.28687973C>A"	""	"VUS"	"ACMG"
"0000440060"	"0"	"90"	"22"	"29091122"	"29091122"	"dup"	"0"	"01164"	"CHEK2_000164"	"g.29091122dup"	""	""	""	""	"ACMG grading: PM2,PVS1,PP5; co-occurrence with truncating variant in TSC1"	"Germline"	""	"rs730881700"	"0"	""	""	"g.28695134dup"	""	"pathogenic"	"ACMG"
"0000442725"	"0"	"50"	"22"	"29105998"	"29105998"	"subst"	"0"	"01164"	"CHEK2_000165"	"g.29105998T>G"	""	""	""	""	"sister BC at age 42y and 49y, cousin ms BC 57y, aunt ms BC <55y, grandmother ps BC"	"Germline"	""	"rs587782196"	"0"	""	""	"g.28710010T>G"	""	"VUS"	"ACMG"
"0000442731"	"0"	"50"	"22"	"29091178"	"29091178"	"subst"	"0.000390523"	"01164"	"CHEK2_000011"	"g.29091178C>A"	""	""	""	""	"not affected, positive family history; 2 aunts ms BC, cousin ms BC, all at a young age; reported in Baloch (2014) Mol Biol Rep 41:; Seppala (2003) BJC 89:; Tischkowitz (2008) Cancer Lett Oct18: ; Le Calvez-Kelm (2011) Breast Cancer Res 13: ; Bell (2007) Int J Cancer 121"	"Germline"	""	"rs200050883"	"0"	""	""	"g.28695190C>A"	""	"VUS"	"ACMG"
"0000447048"	"1"	"90"	"22"	"29099554"	"29107625"	"del"	"0"	"00643"	"CHEK2_000166"	"g.29099554_29107625del"	"5/2355 cases BRCA"	"{PMID:Apostolou 2018:29785007}, {DOI:Apostolou 2018:10.1038/s10038-018-0466-3}"	""	"793_846del7566 exon 7"	""	"Germline"	"yes"	""	"0"	""	""	"g.28703566_28711637del"	""	"pathogenic (dominant)"	""
"0000453985"	"1"	"90"	"22"	"29088207"	"29111154"	"dup"	"0"	"00006"	"CHEK2_000167"	"g.29088207_29111154dup"	""	"{PMID:Tedaldi 2014:24986639}"	""	"dup ex6-13"	""	"Germline"	"yes"	""	"0"	""	""	"g.28692219_28715166dup"	""	"pathogenic (dominant)"	""
"0000453986"	"1"	"90"	"22"	"29086941"	"29092508"	"del"	"0"	"00006"	"CHEK2_000168"	"g.29086941_29092508del"	"5/201 cases BRCA"	"{PMID:Walsh 2006:16551709}"	""	"hg18 g.27416941_27422508del"	"CHEK2 del5567 ex9-10"	"Germline"	""	""	"0"	""	""	"g.28690953_28696520del"	""	"pathogenic (dominant)"	""
"0000453987"	"1"	"90"	"22"	"29086941"	"29092508"	"del"	"0"	"00006"	"CHEK2_000168"	"g.29086941_29092508del"	"2/349 cases BRCA"	"{PMID:Walsh 2006:16551709}"	""	"hg18 g.27416941_27422508del"	""	"Germline"	""	""	"0"	""	""	"g.28690953_28696520del"	""	"pathogenic (dominant)"	""
"0000453988"	"1"	"90"	"22"	"29086941"	"29092508"	"del"	"0"	"00006"	"CHEK2_000168"	"g.29086941_29092508del"	"1/81 cases BRCA"	"{PMID:Walsh 2006:16551709}"	""	"hg18 g.27416941_27422508del"	""	"Germline"	""	""	"0"	""	""	"g.28690953_28696520del"	""	"pathogenic (dominant)"	""
"0000453989"	"1"	"90"	"22"	"29120964"	"29121356"	"del"	"0"	"00643"	"CHEK2_000169"	"g.(29115474_29120964)_(29121356_29130390)del"	"1/2355 cases BRCA"	"{PMID:Apostolou 2018:29785007}, {DOI:Apostolou 2018:10.1038/s10038-018-0466-3}"	""	"320_592del6160"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (dominant)"	""
"0000454001"	"0"	"70"	"22"	"29120964"	"29121356"	"del"	"0"	"00006"	"CHEK2_000169"	"g.(29115474_29120964)_(29121356_29130390)del"	"1/2134 cases BRCA"	"{PMID:Slavin 2017:28649662}"	""	"el ex3-4"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000454002"	"0"	"90"	"22"	"29092888"	"29095926"	"del"	"0"	"00006"	"CHEK2_000170"	"g.(29091862_29092888)_(29095926_29099492)del"	"4/2134 cases BRCA"	"{PMID:Slavin 2017:28649662}"	""	"del ex9-10"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000454003"	"0"	"90"	"22"	"29092888"	"29095926"	"del"	"0"	"00006"	"CHEK2_000170"	"g.(29091862_29092888)_(29095926_29099492)del"	"4/2134 cases BRCA"	"{PMID:Slavin 2017:28649662}"	""	"del ex9-10"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000454004"	"0"	"90"	"22"	"29092888"	"29095926"	"del"	"0"	"00006"	"CHEK2_000170"	"g.(29091862_29092888)_(29095926_29099492)del"	"4/2134 cases BRCA"	"{PMID:Slavin 2017:28649662}"	""	"del ex9-10"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000454005"	"0"	"90"	"22"	"29092888"	"29095926"	"del"	"0"	"00006"	"CHEK2_000170"	"g.(29091862_29092888)_(29095926_29099492)del"	"4/2134 cases BRCA"	"{PMID:Slavin 2017:28649662}"	""	"del ex9-10"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000500447"	"0"	"90"	"22"	"29137756"	"29137822"	"del"	"0"	"00643"	"CHEK2_000171"	"g.(29130716_29137756)_(29137822_?)del"	""	"{PMID:Fostira 2020:31300551}"	""	"c.(?_-1900)_(?_1-1)del"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000500448"	"0"	"90"	"22"	"29130610"	"29130610"	"subst"	"0"	"00643"	"CHEK2_000181"	"g.29130610G>A"	""	"{PMID:Fostira 2020:31300551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28734622G>A"	""	"pathogenic"	""
"0000500449"	"0"	"90"	"22"	"29120964"	"29121356"	"del"	"0"	"00643"	"CHEK2_000169"	"g.(29115474_29120964)_(29121356_29130390)del"	""	"{PMID:Fostira 2020:31300551}"	""	"320_592del6160"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000500450"	"0"	"90"	"22"	"29121082"	"29121082"	"subst"	"1.6246E-5"	"00643"	"CHEK2_000180"	"g.29121082A>G"	""	"{PMID:Fostira 2020:31300551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725094A>G"	""	"pathogenic"	""
"0000500451"	"0"	"90"	"22"	"29121082"	"29121082"	"subst"	"1.6246E-5"	"00643"	"CHEK2_000180"	"g.29121082A>G"	""	"{PMID:Fostira 2020:31300551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725094A>G"	""	"pathogenic"	""
"0000500452"	"0"	"90"	"22"	"29121077"	"29121078"	"ins"	"0"	"00643"	"CHEK2_000179"	"g.29121077_29121078insTTT"	""	"{PMID:Fostira 2020:31300551}"	""	"Glu161fs"	""	"Germline"	""	""	"0"	""	""	"g.28725089_28725090insTTT"	""	"pathogenic"	""
"0000500453"	"0"	"90"	"22"	"29121058"	"29121058"	"subst"	"2.84301E-5"	"00643"	"CHEK2_000178"	"g.29121058C>T"	""	"{PMID:Fostira 2020:31300551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725070C>T"	""	"pathogenic"	""
"0000500454"	"0"	"90"	"22"	"29121058"	"29121058"	"subst"	"2.84301E-5"	"00643"	"CHEK2_000178"	"g.29121058C>T"	""	"{PMID:Fostira 2020:31300551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725070C>T"	""	"pathogenic"	""
"0000500455"	"0"	"90"	"22"	"29121058"	"29121058"	"subst"	"2.84301E-5"	"00643"	"CHEK2_000178"	"g.29121058C>T"	""	"{PMID:Fostira 2020:31300551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725070C>T"	""	"pathogenic"	""
"0000500456"	"0"	"90"	"22"	"29121052"	"29121052"	"del"	"0"	"00643"	"CHEK2_000177"	"g.29121052del"	""	"{PMID:Fostira 2020:31300551}"	""	"507delT"	""	"Germline"	""	""	"0"	""	""	"g.28725064del"	""	"pathogenic"	""
"0000500457"	"0"	"90"	"22"	"29121052"	"29121052"	"del"	"0"	"00643"	"CHEK2_000177"	"g.29121052del"	""	"{PMID:Fostira 2020:31300551}"	""	"507delT"	""	"Germline"	""	""	"0"	""	""	"g.28725064del"	""	"pathogenic"	""
"0000500458"	"0"	"90"	"22"	"29121009"	"29121009"	"subst"	"0"	"00643"	"CHEK2_000176"	"g.29121009A>G"	""	"{PMID:Fostira 2020:31300551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725021A>G"	""	"pathogenic"	""
"0000500459"	"0"	"90"	"22"	"29121008"	"29121008"	"subst"	"1.21843E-5"	"00643"	"CHEK2_000175"	"g.29121008C>G"	""	"{PMID:Fostira 2020:31300551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725020C>G"	""	"pathogenic"	""
"0000500460"	"0"	"90"	"22"	"29121008"	"29121008"	"subst"	"1.21843E-5"	"00643"	"CHEK2_000175"	"g.29121008C>G"	""	"{PMID:Fostira 2020:31300551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725020C>G"	""	"pathogenic"	""
"0000500461"	"0"	"90"	"22"	"29121008"	"29121008"	"subst"	"1.21843E-5"	"00643"	"CHEK2_000175"	"g.29121008C>G"	""	"{PMID:Fostira 2020:31300551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725020C>G"	""	"pathogenic"	""
"0000500462"	"0"	"90"	"22"	"29121008"	"29121008"	"subst"	"1.21843E-5"	"00643"	"CHEK2_000175"	"g.29121008C>G"	""	"{PMID:Fostira 2020:31300551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725020C>G"	""	"pathogenic"	""
"0000500463"	"0"	"90"	"22"	"29120962"	"29120962"	"subst"	"2.84352E-5"	"00643"	"CHEK2_000174"	"g.29120962T>A"	""	"{PMID:Fostira 2020:31300551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28724974T>A"	""	"pathogenic"	""
"0000500464"	"0"	"90"	"22"	"29120962"	"29120962"	"subst"	"2.84352E-5"	"00643"	"CHEK2_000174"	"g.29120962T>A"	""	"{PMID:Fostira 2020:31300551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28724974T>A"	""	"pathogenic"	""
"0000500465"	"0"	"90"	"22"	"29105994"	"29106047"	"del"	"0"	"00643"	"CHEK2_000173"	"g.29105994_29106047del"	""	"{PMID:Fostira 2020:31300551}"	""	"793_846del7566"	""	"Germline"	""	""	"0"	""	""	"g.28710006_28710059del"	""	"pathogenic"	""
"0000500466"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"00643"	"CHEK2_000001"	"g.29091857del"	""	"{PMID:Fostira 2020:31300551}"	""	"1100delC"	""	"Germline"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic"	""
"0000500467"	"0"	"90"	"22"	"29091770"	"29091770"	"del"	"0"	"00643"	"CHEK2_000172"	"g.29091770del"	""	"{PMID:Fostira 2020:31300551}"	""	"1188delT"	""	"Germline"	""	""	"0"	""	""	"g.28695782del"	""	"pathogenic"	""
"0000500468"	"0"	"90"	"22"	"29091122"	"29091122"	"dup"	"0"	"00643"	"CHEK2_000164"	"g.29091122dup"	""	"{PMID:Fostira 2020:31300551}"	""	"1368dupA"	""	"Germline"	""	""	"0"	""	""	"g.28695134dup"	""	"pathogenic"	""
"0000500620"	"0"	"70"	"22"	"29121087"	"29121087"	"subst"	"0.00425643"	"01164"	"CHEK2_000026"	"g.29121087A>G"	""	""	""	""	"pathogenic allele with strongly reduced penetrance"	"Germline"	""	"rs17879961"	"0"	""	""	"g.28725099A>G"	""	"likely pathogenic"	"ACMG"
"0000500627"	"0"	"50"	"22"	"29130520"	"29130520"	"subst"	"0.00015432"	"01164"	"CHEK2_000075"	"g.29130520C>T"	""	""	""	""	"ACMG grading: PS3, PP5"	"Germline"	""	"rs141568342"	"0"	""	""	"g.28734532C>T"	""	"VUS"	"ACMG"
"0000571656"	"0"	"50"	"22"	"29083956"	"29083956"	"subst"	"0"	"02327"	"CHEK2_000085"	"g.29083956G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1690C>T (p.(Arg564Trp)), CHEK2(NM_007194.4):c.1561C>T (p.R521W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28687968G>A"	""	"VUS"	""
"0000571658"	"0"	"90"	"22"	"29083962"	"29083962"	"subst"	"0"	"02327"	"CHEK2_000086"	"g.29083962G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1684C>T (p.(Arg562*)), CHEK2(NM_007194.4):c.1555C>T (p.R519*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28687974G>A"	""	"pathogenic"	""
"0000571659"	"0"	"30"	"22"	"29085112"	"29085112"	"subst"	"0.00382611"	"01804"	"CHEK2_000041"	"g.29085112A>T"	""	""	""	"CHEK2(NM_001005735.1):c.1671+11T>A (p.(=)), CHEK2(NM_007194.4):c.1542+11T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28689124A>T"	""	"likely benign"	""
"0000571660"	"0"	"50"	"22"	"29085140"	"29085140"	"subst"	"8.29448E-5"	"01804"	"CHEK2_000043"	"g.29085140G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1654C>T (p.(Pro552Ser)), CHEK2(NM_007194.4):c.1525C>T (p.P509S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28689152G>A"	""	"VUS"	""
"0000571661"	"0"	"30"	"22"	"29085140"	"29085140"	"subst"	"8.29448E-5"	"02327"	"CHEK2_000043"	"g.29085140G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1654C>T (p.(Pro552Ser)), CHEK2(NM_007194.4):c.1525C>T (p.P509S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28689152G>A"	""	"likely benign"	""
"0000571662"	"0"	"30"	"22"	"29085168"	"29085168"	"subst"	"4.80207E-5"	"02327"	"CHEK2_000044"	"g.29085168C>G"	""	""	""	"CHEK2(NM_001005735.1):c.1626G>C (p.(Leu542=)), CHEK2(NM_007194.4):c.1497G>C (p.L499=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28689180C>G"	""	"likely benign"	""
"0000571663"	"0"	"30"	"22"	"29089974"	"29089974"	"subst"	"0"	"02327"	"CHEK2_000182"	"g.29089974G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28693986G>C"	""	"likely benign"	""
"0000571664"	"0"	"50"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"01943"	"CHEK2_000009"	"g.29090054G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1556C>T (p.(Thr519Met)), CHEK2(NM_007194.4):c.1427C>T (p.T476M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28694066G>A"	""	"VUS"	""
"0000571665"	"0"	"50"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"02369"	"CHEK2_000009"	"g.29090054G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1556C>T (p.(Thr519Met)), CHEK2(NM_007194.4):c.1427C>T (p.T476M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28694066G>A"	""	"VUS"	""
"0000571666"	"0"	"50"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"02327"	"CHEK2_000009"	"g.29090054G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1556C>T (p.(Thr519Met)), CHEK2(NM_007194.4):c.1427C>T (p.T476M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28694066G>A"	""	"VUS"	""
"0000571667"	"0"	"50"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"02325"	"CHEK2_000009"	"g.29090054G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1556C>T (p.(Thr519Met)), CHEK2(NM_007194.4):c.1427C>T (p.T476M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28694066G>A"	""	"VUS"	""
"0000571668"	"0"	"50"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"02329"	"CHEK2_000009"	"g.29090054G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1556C>T (p.(Thr519Met)), CHEK2(NM_007194.4):c.1427C>T (p.T476M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28694066G>A"	""	"VUS"	""
"0000571669"	"0"	"70"	"22"	"29090060"	"29090060"	"subst"	"6.54485E-5"	"02327"	"CHEK2_000183"	"g.29090060C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1550G>A (p.(Arg517His)), CHEK2(NM_007194.4):c.1421G>A (p.R474H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28694072C>T"	""	"likely pathogenic"	""
"0000571670"	"0"	"70"	"22"	"29090060"	"29090060"	"subst"	"6.54485E-5"	"02325"	"CHEK2_000183"	"g.29090060C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1550G>A (p.(Arg517His)), CHEK2(NM_007194.4):c.1421G>A (p.R474H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28694072C>T"	""	"likely pathogenic"	""
"0000571671"	"0"	"30"	"22"	"29090145"	"29090145"	"subst"	"0"	"02327"	"CHEK2_000184"	"g.29090145A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28694157A>G"	""	"likely benign"	""
"0000571672"	"0"	"90"	"22"	"29091122"	"29091122"	"dup"	"0"	"02325"	"CHEK2_000164"	"g.29091122dup"	""	""	""	"CHEK2(NM_007194.4):c.1368dupA (p.E457Rfs*33)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695134dup"	""	"pathogenic"	""
"0000571673"	"0"	"10"	"22"	"29091147"	"29091147"	"subst"	"0.00135029"	"02327"	"CHEK2_000010"	"g.29091147A>C"	""	""	""	"CHEK2(NM_001005735.1):c.1472T>G (p.(Ile491Ser)), CHEK2(NM_007194.4):c.1343T>G (p.I448S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695159A>C"	""	"benign"	""
"0000571674"	"0"	"50"	"22"	"29091178"	"29091178"	"subst"	"0.000390523"	"01804"	"CHEK2_000011"	"g.29091178C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1441G>T (p.(Asp481Tyr)), CHEK2(NM_007194.4):c.1312G>T (p.D438Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695190C>A"	""	"VUS"	""
"0000571675"	"0"	"50"	"22"	"29091178"	"29091178"	"subst"	"0.000390523"	"02325"	"CHEK2_000011"	"g.29091178C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1441G>T (p.(Asp481Tyr)), CHEK2(NM_007194.4):c.1312G>T (p.D438Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695190C>A"	""	"VUS"	""
"0000571676"	"0"	"50"	"22"	"29091178"	"29091178"	"subst"	"0.000390523"	"02329"	"CHEK2_000011"	"g.29091178C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1441G>T (p.(Asp481Tyr)), CHEK2(NM_007194.4):c.1312G>T (p.D438Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695190C>A"	""	"VUS"	""
"0000571677"	"0"	"50"	"22"	"29091225"	"29091225"	"subst"	"8.15169E-6"	"02327"	"CHEK2_000185"	"g.29091225C>T"	""	""	""	"CHEK2(NM_007194.4):c.1265G>A (p.S422N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695237C>T"	""	"VUS"	""
"0000571678"	"0"	"30"	"22"	"29091240"	"29091240"	"subst"	"5.73394E-5"	"01804"	"CHEK2_000052"	"g.29091240G>C"	""	""	""	"CHEK2(NM_001005735.1):c.1389-10C>G (p.(=)), CHEK2(NM_007194.4):c.1260-10C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695252G>C"	""	"likely benign"	""
"0000571679"	"0"	"50"	"22"	"29091731"	"29091731"	"subst"	"8.15322E-6"	"02327"	"CHEK2_000186"	"g.29091731T>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695743T>A"	""	"VUS"	""
"0000571681"	"0"	"50"	"22"	"29091741"	"29091741"	"subst"	"5.29032E-5"	"02325"	"CHEK2_000187"	"g.29091741G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1345C>T (p.(Arg449Cys)), CHEK2(NM_007194.4):c.1216C>T (p.R406C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695753G>A"	""	"VUS"	""
"0000571682"	"0"	"70"	"22"	"29091788"	"29091788"	"subst"	"0"	"02325"	"CHEK2_000188"	"g.29091788T>C"	""	""	""	"CHEK2(NM_007194.3):c.1169A>G (p.(Tyr390Cys)), CHEK2(NM_007194.4):c.1169A>G (p.Y390C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695800T>C"	""	"likely pathogenic"	""
"0000571683"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"01804"	"CHEK2_000001"	"g.29091857del"	""	""	""	"CHEK2(NM_001005735.1):c.1229delC (p.(Thr410Metfs*15)), CHEK2(NM_007194.4):c.1100delC (p.T367Mfs*15)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695869del"	""	"pathogenic"	""
"0000571684"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"02369"	"CHEK2_000001"	"g.29091857del"	""	""	""	"CHEK2(NM_001005735.1):c.1229delC (p.(Thr410Metfs*15)), CHEK2(NM_007194.4):c.1100delC (p.T367Mfs*15)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695869del"	""	"pathogenic"	""
"0000571685"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"02326"	"CHEK2_000001"	"g.29091857del"	""	""	""	"CHEK2(NM_001005735.1):c.1229delC (p.(Thr410Metfs*15)), CHEK2(NM_007194.4):c.1100delC (p.T367Mfs*15)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695869del"	""	"pathogenic"	""
"0000571686"	"0"	"50"	"22"	"29092931"	"29092931"	"subst"	"8.94011E-5"	"02327"	"CHEK2_000058"	"g.29092931C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1182G>T (p.(Glu394Asp)), CHEK2(NM_007194.4):c.1053G>T (p.E351D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28696943C>A"	""	"VUS"	""
"0000571687"	"0"	"50"	"22"	"29092956"	"29092956"	"subst"	"0"	"02327"	"CHEK2_000189"	"g.29092956A>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28696968A>C"	""	"VUS"	""
"0000571688"	"0"	"50"	"22"	"29095831"	"29095831"	"subst"	"4.06138E-6"	"02327"	"CHEK2_000060"	"g.29095831C>G"	""	""	""	"CHEK2(NM_007194.4):c.1003G>C (p.V335L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28699843C>G"	""	"VUS"	""
"0000571689"	"0"	"50"	"22"	"29095854"	"29095854"	"subst"	"1.62438E-5"	"02327"	"CHEK2_000061"	"g.29095854T>C"	""	""	""	"CHEK2(NM_001005735.1):c.1109A>G (p.(Tyr370Cys)), CHEK2(NM_007194.4):c.980A>G (p.Y327C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28699866T>C"	""	"VUS"	""
"0000571690"	"0"	"50"	"22"	"29095917"	"29095917"	"subst"	"4.47191E-5"	"02325"	"CHEK2_000190"	"g.29095917C>G"	""	""	""	"CHEK2(NM_007194.4):c.917G>C (p.G306A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28699929C>G"	""	"VUS"	""
"0000571691"	"0"	"70"	"22"	"29095917"	"29095917"	"subst"	"4.47191E-5"	"02329"	"CHEK2_000190"	"g.29095917C>G"	""	""	""	"CHEK2(NM_007194.4):c.917G>C (p.G306A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28699929C>G"	""	"likely pathogenic"	""
"0000571692"	"0"	"30"	"22"	"29095943"	"29095943"	"subst"	"8.19988E-6"	"02327"	"CHEK2_000191"	"g.29095943G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1038-18C>T (p.(=)), CHEK2(NM_007194.4):c.909-18C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28699955G>A"	""	"likely benign"	""
"0000571694"	"0"	"50"	"22"	"29107938"	"29107938"	"subst"	"0"	"01804"	"CHEK2_000193"	"g.29107938T>A"	""	""	""	"CHEK2(NM_001005735.1):c.880A>T (p.(Ile294Phe)), CHEK2(NM_007194.4):c.751A>T (p.I251F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28711950T>A"	""	"VUS"	""
"0000571695"	"0"	"30"	"22"	"29107974"	"29107974"	"subst"	"7.7195E-5"	"02325"	"CHEK2_000194"	"g.29107974C>T"	""	""	""	"CHEK2(NM_007194.4):c.715G>A (p.E239K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28711986C>T"	""	"likely benign"	""
"0000571696"	"0"	"70"	"22"	"29115474"	"29115474"	"subst"	"0"	"02325"	"CHEK2_000195"	"g.29115474C>A"	""	""	""	"CHEK2(NM_007194.4):c.593-1G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28719486C>A"	""	"likely pathogenic"	""
"0000571697"	"0"	"10"	"22"	"29115552"	"29115552"	"subst"	"0"	"02369"	"CHEK2_000196"	"g.29115552A>G"	""	""	""	"CHEK2(NM_007194.4):c.593-79T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28719564A>G"	""	"benign"	""
"0000571699"	"0"	"70"	"22"	"29120962"	"29120962"	"subst"	"2.84352E-5"	"02325"	"CHEK2_000174"	"g.29120962T>A"	""	""	""	"CHEK2(NM_007194.4):c.592+3A>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28724974T>A"	""	"likely pathogenic"	""
"0000571700"	"0"	"90"	"22"	"29120968"	"29120968"	"del"	"0"	"02325"	"CHEK2_000198"	"g.29120968del"	""	""	""	"CHEK2(NM_007194.4):c.591delA (p.V198Ffs*7)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28724980del"	""	"pathogenic"	""
"0000571701"	"0"	"30"	"22"	"29120979"	"29120979"	"subst"	"1.21842E-5"	"02327"	"CHEK2_000066"	"g.29120979A>G"	""	""	""	"CHEK2(NM_007194.4):c.578T>C (p.L193P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28724991A>G"	""	"likely benign"	""
"0000571702"	"0"	"30"	"22"	"29121001"	"29121001"	"subst"	"5.68579E-5"	"02327"	"CHEK2_000067"	"g.29121001T>G"	""	""	""	"CHEK2(NM_001005735.1):c.685A>C (p.(Asn229His)), CHEK2(NM_007194.4):c.556A>C (p.N186H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725013T>G"	""	"likely benign"	""
"0000571703"	"0"	"50"	"22"	"29121016"	"29121016"	"subst"	"0.000113725"	"02327"	"CHEK2_000021"	"g.29121016G>A"	""	""	""	"CHEK2(NM_001005735.1):c.670C>T (p.(Arg224Cys)), CHEK2(NM_007194.4):c.541C>T (p.R181C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725028G>A"	""	"VUS"	""
"0000571704"	"0"	"50"	"22"	"29121058"	"29121058"	"subst"	"2.84301E-5"	"01943"	"CHEK2_000178"	"g.29121058C>T"	""	""	""	"CHEK2(NM_001005735.1):c.628G>A (p.G210R, p.(Gly210Arg)), CHEK2(NM_007194.4):c.499G>A (p.G167R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725070C>T"	""	"VUS"	""
"0000571705"	"0"	"70"	"22"	"29121075"	"29121077"	"del"	"0"	"02325"	"CHEK2_000199"	"g.29121075_29121077del"	""	""	""	"CHEK2(NM_007194.4):c.483_485delAGA (p.E161del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725087_28725089del"	""	"likely pathogenic"	""
"0000571707"	"0"	"70"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"01804"	"CHEK2_000072"	"g.29121230C>T"	""	""	""	"CHEK2(NM_001005735.1):c.573+1G>A (p.?), CHEK2(NM_007194.4):c.444+1G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725242C>T"	""	"likely pathogenic"	""
"0000571708"	"0"	"90"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"02327"	"CHEK2_000072"	"g.29121230C>T"	""	""	""	"CHEK2(NM_001005735.1):c.573+1G>A (p.?), CHEK2(NM_007194.4):c.444+1G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725242C>T"	""	"pathogenic"	""
"0000571709"	"0"	"70"	"22"	"29121242"	"29121242"	"subst"	"4.47053E-5"	"02327"	"CHEK2_000034"	"g.29121242G>A"	""	""	""	"CHEK2(NM_007194.4):c.433C>T (p.R145W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725254G>A"	""	"likely pathogenic"	""
"0000571710"	"0"	"30"	"22"	"29121265"	"29121265"	"subst"	"0.000178802"	"02327"	"CHEK2_000144"	"g.29121265C>T"	""	""	""	"CHEK2(NM_001005735.1):c.539G>A (p.(Arg180Gln)), CHEK2(NM_007194.4):c.410G>A (p.R137Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725277C>T"	""	"likely benign"	""
"0000571711"	"0"	"70"	"22"	"29121326"	"29121326"	"subst"	"0.000117887"	"01943"	"CHEK2_000033"	"g.29121326T>C"	""	""	""	"CHEK2(NM_001005735.1):c.478A>G (p.(Arg160Gly)), CHEK2(NM_007194.4):c.349A>G (p.R117G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725338T>C"	""	"likely pathogenic"	""
"0000571712"	"0"	"70"	"22"	"29121326"	"29121326"	"subst"	"0.000117887"	"01804"	"CHEK2_000033"	"g.29121326T>C"	""	""	""	"CHEK2(NM_001005735.1):c.478A>G (p.(Arg160Gly)), CHEK2(NM_007194.4):c.349A>G (p.R117G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725338T>C"	""	"likely pathogenic"	""
"0000571713"	"0"	"70"	"22"	"29121326"	"29121326"	"subst"	"0.000117887"	"02327"	"CHEK2_000033"	"g.29121326T>C"	""	""	""	"CHEK2(NM_001005735.1):c.478A>G (p.(Arg160Gly)), CHEK2(NM_007194.4):c.349A>G (p.R117G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725338T>C"	""	"likely pathogenic"	""
"0000571714"	"0"	"70"	"22"	"29121326"	"29121326"	"subst"	"0.000117887"	"02329"	"CHEK2_000033"	"g.29121326T>C"	""	""	""	"CHEK2(NM_001005735.1):c.478A>G (p.(Arg160Gly)), CHEK2(NM_007194.4):c.349A>G (p.R117G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725338T>C"	""	"likely pathogenic"	""
"0000571715"	"0"	"90"	"22"	"29130427"	"29130427"	"subst"	"8.12466E-6"	"02327"	"CHEK2_000027"	"g.29130427G>A"	""	""	""	"CHEK2(NM_007194.4):c.283C>T (p.R95*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28734439G>A"	""	"pathogenic"	""
"0000571716"	"0"	"30"	"22"	"29130458"	"29130458"	"subst"	"0.0352077"	"01804"	"CHEK2_000157"	"g.29130458T>C"	""	""	""	"CHEK2(NM_001005735.1):c.252A>G (p.(Glu84=)), CHEK2(NM_007194.4):c.252A>G (p.E84=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28734470T>C"	""	"likely benign"	""
"0000571717"	"0"	"10"	"22"	"29130458"	"29130458"	"subst"	"0.0352077"	"02369"	"CHEK2_000157"	"g.29130458T>C"	""	""	""	"CHEK2(NM_001005735.1):c.252A>G (p.(Glu84=)), CHEK2(NM_007194.4):c.252A>G (p.E84=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28734470T>C"	""	"benign"	""
"0000571718"	"0"	"10"	"22"	"29130458"	"29130458"	"subst"	"0.0352077"	"02327"	"CHEK2_000157"	"g.29130458T>C"	""	""	""	"CHEK2(NM_001005735.1):c.252A>G (p.(Glu84=)), CHEK2(NM_007194.4):c.252A>G (p.E84=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28734470T>C"	""	"benign"	""
"0000571719"	"0"	"10"	"22"	"29130458"	"29130458"	"subst"	"0.0352077"	"02329"	"CHEK2_000157"	"g.29130458T>C"	""	""	""	"CHEK2(NM_001005735.1):c.252A>G (p.(Glu84=)), CHEK2(NM_007194.4):c.252A>G (p.E84=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28734470T>C"	""	"benign"	""
"0000571720"	"0"	"50"	"22"	"29130520"	"29130520"	"subst"	"0.00015432"	"01804"	"CHEK2_000075"	"g.29130520C>T"	""	""	""	"CHEK2(NM_001005735.1):c.190G>A (p.(Glu64Lys)), CHEK2(NM_007194.4):c.190G>A (p.E64K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28734532C>T"	""	"VUS"	""
"0000571721"	"0"	"50"	"22"	"29130520"	"29130520"	"subst"	"0.00015432"	"02327"	"CHEK2_000075"	"g.29130520C>T"	""	""	""	"CHEK2(NM_001005735.1):c.190G>A (p.(Glu64Lys)), CHEK2(NM_007194.4):c.190G>A (p.E64K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28734532C>T"	""	"VUS"	""
"0000578059"	"0"	"50"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"01474"	"CHEK2_000072"	"g.29121230C>T"	""	"{PMID:Lhota 2016:26822949}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725242C>T"	""	"VUS"	""
"0000578116"	"0"	"50"	"22"	"29130433"	"29130433"	"del"	"0"	"01474"	"CHEK2_000006"	"g.29130433del"	""	"{PMID:Lhota 2016:26822949}"	""	"277delT"	""	"Germline"	""	""	"0"	""	""	"g.28734445del"	""	"VUS"	""
"0000578117"	"0"	"50"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"01474"	"CHEK2_000072"	"g.29121230C>T"	""	"{PMID:Lhota 2016:26822949}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725242C>T"	""	"VUS"	""
"0000578299"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"01164"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	"ACMG grading: PS3,PP5,PS4,PVS1,PP1; reported in Bell  1999. Science 286: 2528; Adank  2011. J Med Genet 48: 860; Cybulski  2011. J Clin Oncol 29: 3747; Weischer  2008. J Clin Oncol. 26: 542; Cybulski  2004. Am J Hum Genet 75: 1131"	"Germline"	""	"rs555607708"	"0"	""	""	"g.28695869del"	""	"pathogenic"	"ACMG"
"0000593707"	"0"	"70"	"22"	"29091725"	"29091725"	"subst"	"8.16147E-6"	"01164"	"CHEK2_000200"	"g.29091725C>T"	""	""	""	""	"ACMG grading: PM2,PVS1; reported in Coppa  2018. Cancer Med 7: 46-55; Goidescu  2018. Clujul Med 91: 157-165"	"Germline"	""	"rs371418985"	"0"	""	""	"g.28695737C>T"	""	"likely pathogenic"	"ACMG"
"0000594734"	"0"	"90"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"01164"	"CHEK2_000072"	"g.29121230C>T"	""	""	""	""	""	"Germline"	""	"rs121908698"	"0"	""	""	"g.28725242C>T"	""	"pathogenic"	"ACMG"
"0000595719"	"0"	"50"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"00727"	"CHEK2_000201"	"g.29091857del"	""	""	""	"1100delC"	""	"Germline"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic"	""
"0000595737"	"0"	"50"	"22"	"29105990"	"29105993"	"del"	"0"	"01164"	"CHEK2_000202"	"g.29105990_29105993del"	""	""	""	""	"ACMG grading: PM2,PP3; reported in Desrichard  2011. Breast Cancer Res 13: 119"	"Germline"	""	"rs764884641"	"0"	""	""	"g.28710002_28710005del"	""	"VUS"	"ACMG"
"0000596840"	"0"	"50"	"22"	"29121077"	"29121077"	"subst"	"0.000121847"	"01164"	"CHEK2_000203"	"g.29121077T>C"	""	""	""	""	"ACMG grading: BS3; reported in Delimitsou  2019. Hum Mutat 40: 631"	"Germline"	""	"rs575910805"	"0"	""	""	"g.28725089T>C"	""	"VUS"	"ACMG"
"0000597236"	"0"	"50"	"22"	"29105990"	"29105993"	"del"	"0"	"01164"	"CHEK2_000202"	"g.29105990_29105993del"	""	""	""	""	"ACMG grading: PM2,PP3; reported in Desrichard  2011. Breast Cancer Res 13: 119"	"Germline"	""	"rs764884641"	"0"	""	""	"g.28710002_28710005del"	""	"VUS"	"ACMG"
"0000598348"	"0"	"70"	"22"	"29121087"	"29121087"	"subst"	"0.00425643"	"01164"	"CHEK2_000026"	"g.29121087A>G"	""	""	""	""	"variant reported in Muranen  2016. Breast Cancer Res 18: 98; Bak  2014. Hered Cancer Clin Pract 12: 10; Wang  2012. Asian Pac J Cancer Prev 10: 10; Mavaddat  2018. AJHG 104: 21"	"Germline"	""	"rs17879961"	"0"	""	""	"g.28725099A>G"	""	"likely pathogenic"	"ACMG"
"0000598752"	"0"	"30"	"22"	"29085168"	"29085168"	"subst"	"4.80207E-5"	"03452"	"CHEK2_000044"	"g.29085168C>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28689180C>G"	""	"likely benign"	""
"0000599052"	"0"	"10"	"22"	"29130012"	"29130012"	"subst"	"0"	"02337"	"CHEK2_000204"	"g.29130012T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28734024T>C"	""	"benign"	""
"0000599053"	"0"	"50"	"22"	"29083961"	"29083961"	"subst"	"0"	"02337"	"CHEK2_000036"	"g.29083961C>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28687973C>A"	""	"VUS"	""
"0000599054"	"0"	"10"	"22"	"29130012"	"29130012"	"subst"	"0"	"02337"	"CHEK2_000204"	"g.29130012T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28734024T>C"	""	"benign"	""
"0000618511"	"0"	"30"	"22"	"29083867"	"29083867"	"subst"	"0"	"02369"	"CHEK2_000038"	"g.29083867G>A"	""	""	""	"CHEK2(NM_007194.4):c.*18C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28687879G>A"	""	"likely benign"	""
"0000618512"	"0"	"30"	"22"	"29083914"	"29083914"	"subst"	"0"	"02327"	"CHEK2_000205"	"g.29083914G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28687926G>A"	""	"likely benign"	""
"0000618513"	"0"	"50"	"22"	"29083926"	"29083926"	"subst"	"0"	"02327"	"CHEK2_000206"	"g.29083926C>A"	""	""	""	"CHEK2(NM_007194.4):c.1591G>T (p.E531*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28687938C>A"	""	"VUS"	""
"0000618514"	"0"	"30"	"22"	"29083935"	"29083935"	"subst"	"0"	"02369"	"CHEK2_000207"	"g.29083935C>T"	""	""	""	"CHEK2(NM_007194.4):c.1582G>A (p.E528K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28687947C>T"	""	"likely benign"	""
"0000618515"	"0"	"50"	"22"	"29083956"	"29083956"	"subst"	"0"	"02369"	"CHEK2_000085"	"g.29083956G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1690C>T (p.(Arg564Trp)), CHEK2(NM_007194.4):c.1561C>T (p.R521W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28687968G>A"	""	"VUS"	""
"0000618516"	"0"	"50"	"22"	"29083961"	"29083961"	"subst"	"0"	"02369"	"CHEK2_000036"	"g.29083961C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1685G>T (p.(Arg562Leu)), CHEK2(NM_007194.4):c.1556G>T (p.R519L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28687973C>A"	""	"VUS"	""
"0000618517"	"0"	"30"	"22"	"29085031"	"29085031"	"subst"	"0"	"02369"	"CHEK2_000208"	"g.29085031T>C"	""	""	""	"CHEK2(NM_007194.4):c.1542+92A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28689043T>C"	""	"likely benign"	""
"0000618518"	"0"	"10"	"22"	"29085112"	"29085112"	"subst"	"0.00382611"	"02369"	"CHEK2_000041"	"g.29085112A>T"	""	""	""	"CHEK2(NM_001005735.1):c.1671+11T>A (p.(=)), CHEK2(NM_007194.4):c.1542+11T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28689124A>T"	""	"benign"	""
"0000618519"	"0"	"10"	"22"	"29085112"	"29085112"	"subst"	"0.00382611"	"02327"	"CHEK2_000041"	"g.29085112A>T"	""	""	""	"CHEK2(NM_001005735.1):c.1671+11T>A (p.(=)), CHEK2(NM_007194.4):c.1542+11T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28689124A>T"	""	"benign"	""
"0000618520"	"0"	"10"	"22"	"29085168"	"29085168"	"subst"	"4.80207E-5"	"02369"	"CHEK2_000044"	"g.29085168C>G"	""	""	""	"CHEK2(NM_001005735.1):c.1626G>C (p.(Leu542=)), CHEK2(NM_007194.4):c.1497G>C (p.L499=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28689180C>G"	""	"benign"	""
"0000618521"	"0"	"30"	"22"	"29090117"	"29090117"	"subst"	"0"	"02327"	"CHEK2_000210"	"g.29090117A>G"	""	""	""	"CHEK2(NM_001005735.1):c.1505-12T>C (p.(=)), CHEK2(NM_007194.4):c.1376-12T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28694129A>G"	""	"likely benign"	""
"0000618522"	"0"	"30"	"22"	"29091089"	"29091089"	"subst"	"0.000196345"	"02327"	"CHEK2_000211"	"g.29091089A>G"	""	""	""	"CHEK2(NM_007194.4):c.1375+26T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695101A>G"	""	"likely benign"	""
"0000618523"	"0"	"30"	"22"	"29091154"	"29091154"	"subst"	"7.32076E-5"	"02327"	"CHEK2_000213"	"g.29091154T>C"	""	""	""	"CHEK2(NM_001005735.1):c.1465A>G (p.(Asn489Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695166T>C"	""	"likely benign"	""
"0000618524"	"0"	"50"	"22"	"29091207"	"29091207"	"subst"	"0.000476256"	"02369"	"CHEK2_000012"	"g.29091207G>A"	""	""	""	"CHEK2(NM_007194.4):c.1283C>T (p.S428F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695219G>A"	""	"VUS"	""
"0000618525"	"0"	"50"	"22"	"29091220"	"29091220"	"subst"	"0.000276981"	"02369"	"CHEK2_000214"	"g.29091220A>G"	""	""	""	"CHEK2(NM_007194.4):c.1270T>C (p.Y424H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695232A>G"	""	"VUS"	""
"0000618526"	"0"	"50"	"22"	"29092931"	"29092931"	"subst"	"8.94011E-5"	"02369"	"CHEK2_000058"	"g.29092931C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1182G>T (p.(Glu394Asp)), CHEK2(NM_007194.4):c.1053G>T (p.E351D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28696943C>A"	""	"VUS"	""
"0000618527"	"0"	"50"	"22"	"29095851"	"29095851"	"subst"	"0"	"02325"	"CHEK2_000215"	"g.29095851A>G"	""	""	""	"CHEK2(NM_007194.4):c.983T>C (p.F328S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28699863A>G"	""	"VUS"	""
"0000618528"	"0"	"50"	"22"	"29095917"	"29095917"	"subst"	"4.47191E-5"	"02327"	"CHEK2_000190"	"g.29095917C>G"	""	""	""	"CHEK2(NM_007194.4):c.917G>C (p.G306A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28699929C>G"	""	"VUS"	""
"0000618529"	"0"	"30"	"22"	"29095998"	"29095998"	"subst"	"0"	"02369"	"CHEK2_000216"	"g.29095998C>A"	""	""	""	"CHEK2(NM_007194.4):c.909-73G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28700010C>A"	""	"likely benign"	""
"0000618530"	"0"	"50"	"22"	"29099517"	"29099519"	"del"	"0"	"02325"	"CHEK2_000217"	"g.29099517_29099519del"	""	""	""	"CHEK2(NM_007194.4):c.885_887delAGA (p.E295del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28703529_28703531del"	""	"VUS"	""
"0000618532"	"0"	"30"	"22"	"29107769"	"29107769"	"subst"	"0"	"02369"	"CHEK2_000220"	"g.29107769G>A"	""	""	""	"CHEK2(NM_007194.4):c.792+128C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28711781G>A"	""	"likely benign"	""
"0000618533"	"0"	"10"	"22"	"29115487"	"29115487"	"subst"	"0.00313987"	"02327"	"CHEK2_000221"	"g.29115487G>A"	""	""	""	"CHEK2(NM_001005735.1):c.722-14C>T (p.(=)), CHEK2(NM_007194.4):c.593-14C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28719499G>A"	""	"benign"	""
"0000618534"	"0"	"50"	"22"	"29121001"	"29121001"	"subst"	"5.68579E-5"	"02369"	"CHEK2_000067"	"g.29121001T>G"	""	""	""	"CHEK2(NM_001005735.1):c.685A>C (p.(Asn229His)), CHEK2(NM_007194.4):c.556A>C (p.N186H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725013T>G"	""	"VUS"	""
"0000618535"	"0"	"30"	"22"	"29121018"	"29121018"	"subst"	"6.09226E-5"	"02327"	"CHEK2_000068"	"g.29121018C>T"	""	""	""	"CHEK2(NM_001005735.1):c.668G>A (p.(Arg223His)), CHEK2(NM_007194.4):c.539G>A (p.R180H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725030C>T"	""	"likely benign"	""
"0000618536"	"0"	"50"	"22"	"29121018"	"29121018"	"subst"	"6.09226E-5"	"02325"	"CHEK2_000068"	"g.29121018C>T"	""	""	""	"CHEK2(NM_001005735.1):c.668G>A (p.(Arg223His)), CHEK2(NM_007194.4):c.539G>A (p.R180H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725030C>T"	""	"VUS"	""
"0000618537"	"0"	"50"	"22"	"29121050"	"29121050"	"subst"	"8.12301E-6"	"02327"	"CHEK2_000070"	"g.29121050A>C"	""	""	""	"CHEK2(NM_001005735.1):c.636T>G (p.(Phe212Leu)), CHEK2(NM_007194.4):c.507T>G (p.F169L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725062A>C"	""	"VUS"	""
"0000618539"	"0"	"30"	"22"	"29121212"	"29121212"	"subst"	"0.000463339"	"02369"	"CHEK2_000225"	"g.29121212A>G"	""	""	""	"CHEK2(NM_007194.4):c.444+19T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725224A>G"	""	"likely benign"	""
"0000618540"	"0"	"70"	"22"	"29121232"	"29121232"	"del"	"0"	"01804"	"CHEK2_000142"	"g.29121232del"	""	""	""	"CHEK2(NM_001005735.1):c.573+1delG, CHEK2(NM_007194.3):c.444+1del (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725244del"	""	"likely pathogenic"	""
"0000618541"	"0"	"50"	"22"	"29121239"	"29121239"	"subst"	"1.21917E-5"	"02325"	"CHEK2_000226"	"g.29121239T>G"	""	""	""	"CHEK2(NM_007194.4):c.436A>C (p.I146L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725251T>G"	""	"VUS"	""
"0000618542"	"0"	"70"	"22"	"29121326"	"29121326"	"subst"	"0.000117887"	"02369"	"CHEK2_000033"	"g.29121326T>C"	""	""	""	"CHEK2(NM_001005735.1):c.478A>G (p.(Arg160Gly)), CHEK2(NM_007194.4):c.349A>G (p.R117G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725338T>C"	""	"likely pathogenic"	""
"0000618543"	"0"	"30"	"22"	"29130380"	"29130380"	"subst"	"0"	"02369"	"CHEK2_000227"	"g.29130380A>C"	""	""	""	"CHEK2(NM_007194.4):c.319+11T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28734392A>C"	""	"likely benign"	""
"0000618544"	"0"	"50"	"22"	"29130433"	"29130433"	"subst"	"4.062E-6"	"02327"	"CHEK2_000228"	"g.29130433A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28734445A>G"	""	"VUS"	""
"0000618545"	"0"	"30"	"22"	"29130584"	"29130584"	"subst"	"0"	"02327"	"CHEK2_000230"	"g.29130584A>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28734596A>T"	""	"likely benign"	""
"0000624273"	"0"	"30"	"22"	"29085183"	"29085183"	"subst"	"4.3654E-6"	"02369"	"CHEK2_000209"	"g.29085183C>G"	""	""	""	"CHEK2(NM_007194.4):c.1482G>C (p.K494N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28689195C>G"	""	"likely benign"	""
"0000624274"	"0"	"30"	"22"	"29091145"	"29091145"	"subst"	"0"	"02369"	"CHEK2_000212"	"g.29091145G>T"	""	""	""	"CHEK2(NM_007194.4):c.1345C>A (p.P449T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695157G>T"	""	"likely benign"	""
"0000624275"	"0"	"30"	"22"	"29099571"	"29099571"	"subst"	"0.000186382"	"02369"	"CHEK2_000219"	"g.29099571A>G"	""	""	""	"CHEK2(NM_001005735.1):c.976-17T>C (p.(=)), CHEK2(NM_007194.4):c.847-17T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28703583A>G"	""	"likely benign"	""
"0000624276"	"0"	"30"	"22"	"29115541"	"29115541"	"subst"	"0"	"02369"	"CHEK2_000222"	"g.29115541A>C"	""	""	""	"CHEK2(NM_007194.4):c.593-68T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28719553A>C"	""	"likely benign"	""
"0000624277"	"0"	"70"	"22"	"29121058"	"29121058"	"subst"	"2.84301E-5"	"02325"	"CHEK2_000178"	"g.29121058C>T"	""	""	""	"CHEK2(NM_001005735.1):c.628G>A (p.G210R, p.(Gly210Arg)), CHEK2(NM_007194.4):c.499G>A (p.G167R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725070C>T"	""	"likely pathogenic"	""
"0000624278"	"0"	"30"	"22"	"29121166"	"29121166"	"subst"	"5.28155E-5"	"02369"	"CHEK2_000223"	"g.29121166G>A"	""	""	""	"CHEK2(NM_007194.4):c.445-54C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725178G>A"	""	"likely benign"	""
"0000624279"	"0"	"30"	"22"	"29121207"	"29121207"	"subst"	"0.00125185"	"02369"	"CHEK2_000224"	"g.29121207G>A"	""	""	""	"CHEK2(NM_007194.4):c.444+24C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725219G>A"	""	"likely benign"	""
"0000624280"	"0"	"50"	"22"	"29130471"	"29130471"	"subst"	"0"	"02325"	"CHEK2_000229"	"g.29130471G>T"	""	""	""	"CHEK2(NM_007194.4):c.239C>A (p.P80H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28734483G>T"	""	"VUS"	""
"0000647114"	"0"	"70"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"01164"	"CHEK2_000009"	"g.29090054G>A"	""	""	""	""	"ACMG: PS3,PM5,PP3; Desrichard et al. 2011. Breast Cancer Res 13: R119; Roeb et al. 2012. Hum Mol Genet 21: 2738"	"Germline"	""	"rs142763740"	"0"	""	""	"g.28694066G>A"	""	"likely pathogenic"	"ACMG"
"0000647144"	"0"	"70"	"22"	"29121087"	"29121087"	"subst"	"0.00425643"	"01164"	"CHEK2_000026"	"g.29121087A>G"	""	""	""	""	"Muranen et al. 2016. Breast Cancer Res 18: 98; Bak et al. 2014. Hered Cancer Clin Pract 12: 10; Wang et al. 2012. Asian Pac J Cancer Prev 10: 10; Mavaddat et al. 2018. AJHG 104: 21"	"Germline"	""	"rs17879961"	"0"	""	""	"g.28725099A>G"	""	"likely pathogenic"	"ACMG"
"0000650938"	"1"	"70"	"22"	"29085176"	"29085176"	"del"	"4.3654E-6"	"03575"	"CHEK2_000231"	"g.29085176del"	"2/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"2 heterozygous, no homozygous; {DB:CLININrs774175654}"	"Germline"	""	"rs774175654"	"0"	""	""	"g.28689188del"	""	"likely pathogenic"	""
"0000650939"	"1"	"90"	"22"	"29092973"	"29092973"	"subst"	"8.13537E-6"	"03575"	"CHEK2_000232"	"g.29092973G>T"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs760502479}"	"Germline"	""	"rs760502479"	"0"	""	""	"g.28696985G>T"	""	"pathogenic"	""
"0000650940"	"1"	"90"	"22"	"29120976"	"29120976"	"del"	"0"	"03575"	"CHEK2_000234"	"g.29120976del"	"1/2778 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs587780186}"	"Germline"	""	"rs587780186"	"0"	""	""	"g.28724988del"	""	"pathogenic"	""
"0000650941"	"1"	"50"	"22"	"29120992"	"29120992"	"subst"	"4.06128E-6"	"03575"	"CHEK2_000235"	"g.29120992T>C"	"1/2793 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs587780185}"	"Germline"	""	"rs587780185"	"0"	""	""	"g.28725004T>C"	""	"VUS"	""
"0000650942"	"1"	"50"	"22"	"29121016"	"29121016"	"subst"	"0.000113725"	"03575"	"CHEK2_000021"	"g.29121016G>A"	"3/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"3 heterozygous, no homozygous; {DB:CLININrs137853010}"	"Germline"	""	"rs137853010"	"0"	""	""	"g.28725028G>A"	""	"VUS"	""
"0000650943"	"1"	"90"	"22"	"29121266"	"29121266"	"subst"	"2.43827E-5"	"03575"	"CHEK2_000145"	"g.29121266G>A"	"4/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"4 heterozygous, no homozygous; {DB:CLININrs730881701}"	"Germline"	""	"rs730881701"	"0"	""	""	"g.28725278G>A"	""	"pathogenic"	""
"0000650944"	"1"	"50"	"22"	"29130520"	"29130520"	"subst"	"0.00015432"	"03575"	"CHEK2_000075"	"g.29130520C>T"	"2/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; {DB:CLININrs141568342}"	"Germline"	""	"rs141568342"	"0"	""	""	"g.28734532C>T"	""	"VUS"	""
"0000653048"	"1"	"70"	"22"	"29115382"	"29115382"	"subst"	"0"	"03575"	"CHEK2_000233"	"g.29115382C>A"	"1/2791 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs786203650}"	"Germline"	""	"rs786203650"	"0"	""	""	"g.28719394C>A"	""	"likely pathogenic"	""
"0000653049"	"1"	"50"	"22"	"29121087"	"29121087"	"subst"	"0.00425643"	"03575"	"CHEK2_000026"	"g.29121087A>G"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs17879961}"	"Germline"	""	"rs17879961"	"0"	""	""	"g.28725099A>G"	""	"VUS"	""
"0000653050"	"1"	"70"	"22"	"29121242"	"29121242"	"subst"	"4.47053E-5"	"03575"	"CHEK2_000034"	"g.29121242G>A"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs137853007}"	"Germline"	""	"rs137853007"	"0"	""	""	"g.28725254G>A"	""	"likely pathogenic"	""
"0000653051"	"1"	"30"	"22"	"29130456"	"29130456"	"subst"	"0.000901699"	"03575"	"CHEK2_000029"	"g.29130456G>A"	"1/2791 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs17883862}"	"Germline"	""	"rs17883862"	"0"	""	""	"g.28734468G>A"	""	"likely benign"	""
"0000653424"	"0"	"50"	"22"	"29121278"	"29121278"	"subst"	"0"	"01164"	"CHEK2_000236"	"g.29121278T>C"	""	""	""	""	"ACMG: PM2; BC at age 49y, mother BC at age 60y, aunt ms BC at age 50y; HBOC panel with genes BRCA1, BRCA2, PALB2. ATM, TP53, RAD51C, RAD51D, STK11 and PTEN negative"	"Germline"	""	""	"0"	""	""	"g.28725290T>C"	""	"VUS"	"ACMG"
"0000653426"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"01164"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	"ACMG: PVS1,PS3,PS4,PP1,PP5; Bell et al. 1999. Science 286: 2528; Adank et al. 2011. J Med Genet 48: 860; Cybulski et al. 2011. J Clin Oncol 29: 3747; Weischer et al. 2008. J Clin Oncol. 26: 542; Cybulski et al. 2004. Am J Hum Genet 75: 1131"	"Germline"	""	"rs555607708"	"0"	""	""	"g.28695869del"	""	"pathogenic"	"ACMG"
"0000653463"	"0"	"50"	"22"	"29130520"	"29130520"	"subst"	"0.00015432"	"01164"	"CHEK2_000075"	"g.29130520C>T"	""	""	""	""	"ACMG: PS3,PM2; BC at age 39y, no information about family history of cancer; Susswein et al. 2016. Genet Med 18: 823; Wu et al. 2006. Hum Mutat 27: 742; Roeb et al. 2012. Hum Mol Genet 21: 2738; Desrichard et al. 2011. Breast Cancer Res 13: 119; Dong et al. 2003. Am J Hum Genet 72: 270"	"Germline"	""	"rs141568342"	"0"	""	""	"g.28734532C>T"	""	"VUS"	"ACMG"
"0000653547"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"01164"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	"ACMG: PVS1,PS3,PS4,PP1,PP5; BC at age 66y, mother Thyroid-Cancer at age 70y; Bell et al. 1999. Science 286: 2528; Adank et al. 2011. J Med Genet 48: 860; Cybulski et al. 2011. J Clin Oncol 29: 3747; Weischer et al. 2008. J Clin Oncol. 26: 542; Cybulski et al. 2004. Am J Hum Genet 75: 1131"	"Germline"	""	"rs555607708"	"0"	""	""	"g.28695869del"	""	"pathogenic"	"ACMG"
"0000658912"	"0"	"50"	"22"	"29090076"	"29090076"	"subst"	"0"	"02325"	"CHEK2_000238"	"g.29090076C>T"	""	""	""	"CHEK2(NM_007194.4):c.1405G>A (p.V469M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28694088C>T"	""	"VUS"	""
"0000658913"	"0"	"30"	"22"	"29091240"	"29091240"	"subst"	"5.73394E-5"	"02327"	"CHEK2_000052"	"g.29091240G>C"	""	""	""	"CHEK2(NM_001005735.1):c.1389-10C>G (p.(=)), CHEK2(NM_007194.4):c.1260-10C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28695252G>C"	""	"likely benign"	""
"0000658914"	"0"	"30"	"22"	"29095943"	"29095943"	"subst"	"8.19988E-6"	"01804"	"CHEK2_000191"	"g.29095943G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1038-18C>T (p.(=)), CHEK2(NM_007194.4):c.909-18C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28699955G>A"	""	"likely benign"	""
"0000658915"	"0"	"30"	"22"	"29115374"	"29115374"	"subst"	"1.03392E-5"	"02327"	"CHEK2_000239"	"g.29115374A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28719386A>G"	""	"likely benign"	""
"0000658916"	"0"	"10"	"22"	"29115487"	"29115487"	"subst"	"0.00313987"	"02369"	"CHEK2_000221"	"g.29115487G>A"	""	""	""	"CHEK2(NM_001005735.1):c.722-14C>T (p.(=)), CHEK2(NM_007194.4):c.593-14C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28719499G>A"	""	"benign"	""
"0000658917"	"0"	"70"	"22"	"29121058"	"29121058"	"subst"	"2.84301E-5"	"02327"	"CHEK2_000178"	"g.29121058C>T"	""	""	""	"CHEK2(NM_001005735.1):c.628G>A (p.G210R, p.(Gly210Arg)), CHEK2(NM_007194.4):c.499G>A (p.G167R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725070C>T"	""	"likely pathogenic"	""
"0000658918"	"0"	"30"	"22"	"29121360"	"29121360"	"subst"	"0.000574245"	"02329"	"CHEK2_000073"	"g.29121360A>T"	""	""	""	"CHEK2(NM_001005735.1):c.449-5T>A (p.?), CHEK2(NM_007194.4):c.320-5T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28725372A>T"	""	"likely benign"	""
"0000658919"	"0"	"50"	"22"	"29130713"	"29130713"	"subst"	"6.27704E-5"	"02327"	"CHEK2_000077"	"g.29130713G>A"	""	""	""	"CHEK2(NM_007194.4):c.-4C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.28734725G>A"	""	"VUS"	""
"0000659564"	"0"	"50"	"22"	"29130473"	"29130487"	"del"	"0"	"01164"	"CHEK2_000028"	"g.29130473_29130487del"	""	""	""	""	"BC at age 47y, mother BC at age 44y, grandmother (ms) BC at age 60y; Bell et al. 2007. IntJCancer 121: 2661; Dong et al. 2003. AmJHumGenet 72: 270"	"Germline"	""	"rs587780181"	"0"	""	""	"g.28734485_28734499del"	""	"VUS"	"ACMG"
"0000659572"	"0"	"70"	"22"	"29130625"	"29130625"	"subst"	"8.19135E-6"	"01164"	"CHEK2_000237"	"g.29130625G>A"	""	""	""	""	"2x DCIS at age 46y, mother BC at age 55y, grandmother (ms) BC at age 48y"	"Germline"	""	"rs761494650"	"0"	""	""	"g.28734637G>A"	""	"likely pathogenic"	"ACMG"
"0000659668"	"1"	"70"	"22"	"29091207"	"29091207"	"subst"	"0.000476256"	"03629"	"CHEK2_000012"	"g.29091207G>A"	"1/22 cases"	""	""	""	""	"Germline"	""	"rs137853011"	"0"	""	""	"g.28695219G>A"	""	"likely pathogenic"	""
"0000659669"	"1"	"70"	"22"	"29121326"	"29121326"	"subst"	"0.000117887"	"03629"	"CHEK2_000033"	"g.29121326T>C"	"1/22 cases"	""	""	""	""	"Germline"	""	"rs28909982"	"0"	""	""	"g.28725338T>C"	""	"likely pathogenic"	""
"0000659681"	"1"	"50"	"22"	"29099515"	"29099515"	"subst"	"0"	"03629"	"CHEK2_000120"	"g.29099515C>A"	""	""	""	""	""	"Germline"	""	"rs876659553"	"0"	""	""	"g.28703527C>A"	""	"VUS"	""
"0000660109"	"0"	"90"	"22"	"29130433"	"29130433"	"del"	"0"	"01164"	"CHEK2_000006"	"g.29130433del"	""	""	""	""	"ACMG grading: PVS1,PM2,PP5; BC right side at age 57y, left side at age 79y, cousin (ms) uterus-ca at age 46y; Lhota et al. 2016. Clin Genet 90: 324; Susswein et al. 2016. Genet Med 18: 823"	"Germline"	""	"rs786203458"	"0"	""	""	"g.28734445del"	""	"pathogenic"	"ACMG"
"0000660678"	"0"	"90"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"01164"	"CHEK2_000072"	"g.29121230C>T"	""	""	""	""	"OC (endometroid type) and adeno-carzinoma uterus at age 48y, mother gynecol. cancer at age 60y, aunt (ps) BC, uncle (ps) prostate cancer at age 66y"	"Germline"	""	"rs121908698"	"0"	""	""	"g.28725242C>T"	""	"pathogenic"	""
"0000664836"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"01164"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	"ACMG grading: PVS1,PS3,PS4,PP1,PP5\r\nmultiple polyps (hyperplastic and sessile serrated) at age 62y"	"Germline"	""	"rs555607708"	"0"	""	""	"g.28695869del"	""	"pathogenic"	"ACMG"
"0000665806"	"0"	"70"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"01164"	"CHEK2_000009"	"g.29090054G>A"	""	""	""	""	"ACMG grading: PM2,PM3,PP1,PP3; Arnoldi et al. 2012. Clin Genet 81: 150"	"Germline"	""	"rs142763740"	"0"	""	""	"g.28694066G>A"	""	"likely pathogenic"	"ACMG"
"0000681825"	"0"	"30"	"22"	"29083951"	"29083951"	"subst"	"0"	"02327"	"CHEK2_000240"	"g.29083951G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000681826"	"0"	"50"	"22"	"29083956"	"29083956"	"subst"	"0"	"02329"	"CHEK2_000085"	"g.29083956G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1690C>T (p.(Arg564Trp)), CHEK2(NM_007194.4):c.1561C>T (p.R521W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000681827"	"0"	"50"	"22"	"29090031"	"29090031"	"subst"	"4.36331E-6"	"02327"	"CHEK2_000048"	"g.29090031G>T"	""	""	""	"CHEK2(NM_007194.4):c.1450C>A (p.P484T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000681828"	"0"	"30"	"22"	"29090098"	"29090098"	"subst"	"8.7276E-6"	"02329"	"CHEK2_000049"	"g.29090098G>C"	""	""	""	"CHEK2(NM_007194.4):c.1383C>G (p.D461E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000681829"	"0"	"50"	"22"	"29090118"	"29090118"	"subst"	"8.72775E-6"	"02327"	"CHEK2_000241"	"g.29090118T>C"	""	""	""	"CHEK2(NM_001005735.1):c.1505-13A>G (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000681830"	"0"	"50"	"22"	"29091178"	"29091178"	"subst"	"0.000390523"	"02369"	"CHEK2_000011"	"g.29091178C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1441G>T (p.(Asp481Tyr)), CHEK2(NM_007194.4):c.1312G>T (p.D438Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000681831"	"0"	"30"	"22"	"29091178"	"29091178"	"subst"	"0.000390523"	"02327"	"CHEK2_000011"	"g.29091178C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1441G>T (p.(Asp481Tyr)), CHEK2(NM_007194.4):c.1312G>T (p.D438Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000681832"	"0"	"50"	"22"	"29091865"	"29091865"	"subst"	"3.27826E-5"	"02327"	"CHEK2_000056"	"g.29091865A>G"	""	""	""	"CHEK2(NM_001005735.1):c.1225-4T>C, CHEK2(NM_007194.4):c.1096-4T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000681833"	"0"	"50"	"22"	"29092931"	"29092931"	"subst"	"8.94011E-5"	"02329"	"CHEK2_000058"	"g.29092931C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1182G>T (p.(Glu394Asp)), CHEK2(NM_007194.4):c.1053G>T (p.E351D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000681834"	"0"	"70"	"22"	"29092947"	"29092947"	"subst"	"8.12909E-6"	"02325"	"CHEK2_000244"	"g.29092947C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1166G>A (p.(Arg389His)), CHEK2(NM_007194.4):c.1037G>A (p.R346H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000681835"	"0"	"90"	"22"	"29099492"	"29099492"	"subst"	"0"	"02327"	"CHEK2_000245"	"g.29099492C>A"	""	""	""	"CHEK2(NM_007194.4):c.908+1G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000681836"	"0"	"30"	"22"	"29121001"	"29121001"	"subst"	"5.68579E-5"	"02329"	"CHEK2_000067"	"g.29121001T>G"	""	""	""	"CHEK2(NM_001005735.1):c.685A>C (p.(Asn229His)), CHEK2(NM_007194.4):c.556A>C (p.N186H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000681837"	"0"	"70"	"22"	"29121058"	"29121058"	"subst"	"2.84301E-5"	"02329"	"CHEK2_000178"	"g.29121058C>T"	""	""	""	"CHEK2(NM_001005735.1):c.628G>A (p.G210R, p.(Gly210Arg)), CHEK2(NM_007194.4):c.499G>A (p.G167R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000681838"	"0"	"90"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"02329"	"CHEK2_000072"	"g.29121230C>T"	""	""	""	"CHEK2(NM_001005735.1):c.573+1G>A (p.?), CHEK2(NM_007194.4):c.444+1G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000681839"	"0"	"90"	"22"	"29121232"	"29121232"	"del"	"0"	"01943"	"CHEK2_000142"	"g.29121232del"	""	""	""	"CHEK2(NM_001005735.1):c.573+1delG, CHEK2(NM_007194.3):c.444+1del (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000681840"	"0"	"50"	"22"	"29121360"	"29121360"	"subst"	"0.000574245"	"02369"	"CHEK2_000073"	"g.29121360A>T"	""	""	""	"CHEK2(NM_001005735.1):c.449-5T>A (p.?), CHEK2(NM_007194.4):c.320-5T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000681841"	"0"	"30"	"22"	"29130456"	"29130456"	"subst"	"0.000901699"	"02369"	"CHEK2_000029"	"g.29130456G>A"	""	""	""	"CHEK2(NM_001005735.1):c.254C>T (p.(Pro85Leu)), CHEK2(NM_007194.4):c.254C>T (p.P85L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000681842"	"0"	"50"	"22"	"29130588"	"29130590"	"del"	"0"	"02327"	"CHEK2_000246"	"g.29130588_29130590del"	""	""	""	"CHEK2(NM_007194.4):c.123_125delCTC (p.S42del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000681843"	"0"	"70"	"22"	"29130717"	"29130717"	"subst"	"0"	"02327"	"CHEK2_000247"	"g.29130717T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000682720"	"0"	"70"	"22"	"29092912"	"29092912"	"subst"	"0"	"03753"	"CHEK2_000243"	"g.29092912G>A"	"0.058"	"{PMID:Mendonca 2021:34478740}"	""	""	""	"Somatic"	""	""	""	""	""	""	""	"pathogenic"	"ACMG"
"0000682721"	"0"	"70"	"22"	"29091114"	"29091114"	"subst"	"0"	"03753"	"CHEK2_000242"	"g.29091114C>T"	"0.039"	"{PMID:Mendonca 2021:34478740}"	""	""	""	"Somatic"	""	""	""	""	""	""	""	"pathogenic"	"ACMG"
"0000683623"	"0"	"70"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"01164"	"CHEK2_000009"	"g.29090054G>A"	""	"Desrichard et al. 2011. Breast Cancer Res 13: R119; Roeb et al. 2012. Hum Mol Genet 21: 2738"	""	""	"ACMG grading: PS3,PM2,PM5,PP3\r\nGerman S3 indication criteria not fulfilled, triple-negative breast cancer at 48 years, metastasized; grandfather ms colon cancer at 56 years."	"Germline"	""	"rs142763740"	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000693136"	"0"	"50"	"22"	"29083956"	"29083956"	"subst"	"0"	"02325"	"CHEK2_000085"	"g.29083956G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1690C>T (p.(Arg564Trp)), CHEK2(NM_007194.4):c.1561C>T (p.R521W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000693137"	"0"	"30"	"22"	"29085195"	"29085195"	"subst"	"2.61945E-5"	"02329"	"CHEK2_000045"	"g.29085195G>T"	""	""	""	"CHEK2(NM_001005735.1):c.1599C>A (p.(Asp533Glu)), CHEK2(NM_007194.4):c.1470C>A (p.D490E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000693138"	"0"	"90"	"22"	"29090046"	"29090046"	"subst"	"0"	"02327"	"CHEK2_000248"	"g.29090046C>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000693139"	"0"	"30"	"22"	"29091145"	"29091145"	"subst"	"0"	"02327"	"CHEK2_000212"	"g.29091145G>T"	""	""	""	"CHEK2(NM_007194.4):c.1345C>A (p.P449T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000693140"	"0"	"50"	"22"	"29091156"	"29091167"	"del"	"0"	"02327"	"CHEK2_000249"	"g.29091156_29091167del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000693141"	"0"	"50"	"22"	"29091220"	"29091220"	"subst"	"0.000276981"	"02329"	"CHEK2_000214"	"g.29091220A>G"	""	""	""	"CHEK2(NM_007194.4):c.1270T>C (p.Y424H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000693142"	"0"	"50"	"22"	"29091225"	"29091225"	"subst"	"8.15169E-6"	"02369"	"CHEK2_000185"	"g.29091225C>T"	""	""	""	"CHEK2(NM_007194.4):c.1265G>A (p.S422N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000693144"	"0"	"70"	"22"	"29091788"	"29091788"	"subst"	"0"	"02329"	"CHEK2_000188"	"g.29091788T>C"	""	""	""	"CHEK2(NM_007194.3):c.1169A>G (p.(Tyr390Cys)), CHEK2(NM_007194.4):c.1169A>G (p.Y390C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000693145"	"0"	"50"	"22"	"29092917"	"29092917"	"subst"	"1.62567E-5"	"02325"	"CHEK2_000250"	"g.29092917G>A"	""	""	""	"CHEK2(NM_007194.4):c.1067C>T (p.S356L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000693146"	"0"	"50"	"22"	"29095881"	"29095881"	"subst"	"4.46682E-5"	"02327"	"CHEK2_000251"	"g.29095881C>T"	""	""	""	"CHEK2(NM_007194.4):c.953G>A (p.R318H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000693147"	"0"	"90"	"22"	"29099492"	"29099492"	"subst"	"0"	"02325"	"CHEK2_000245"	"g.29099492C>A"	""	""	""	"CHEK2(NM_007194.4):c.908+1G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000693148"	"0"	"90"	"22"	"29099502"	"29099502"	"del"	"0"	"02327"	"CHEK2_000252"	"g.29099502del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000693149"	"0"	"50"	"22"	"29107974"	"29107974"	"subst"	"7.7195E-5"	"02327"	"CHEK2_000194"	"g.29107974C>T"	""	""	""	"CHEK2(NM_007194.4):c.715G>A (p.E239K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000693150"	"0"	"30"	"22"	"29120947"	"29120947"	"subst"	"4.06322E-6"	"02327"	"CHEK2_000253"	"g.29120947A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000693151"	"0"	"50"	"22"	"29121050"	"29121050"	"subst"	"8.12301E-6"	"02369"	"CHEK2_000070"	"g.29121050A>C"	""	""	""	"CHEK2(NM_001005735.1):c.636T>G (p.(Phe212Leu)), CHEK2(NM_007194.4):c.507T>G (p.F169L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000693152"	"0"	"70"	"22"	"29121075"	"29121077"	"del"	"0"	"02327"	"CHEK2_000199"	"g.29121075_29121077del"	""	""	""	"CHEK2(NM_007194.4):c.483_485delAGA (p.E161del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000693153"	"0"	"70"	"22"	"29121242"	"29121242"	"subst"	"4.47053E-5"	"02369"	"CHEK2_000034"	"g.29121242G>A"	""	""	""	"CHEK2(NM_007194.4):c.433C>T (p.R145W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000693154"	"0"	"50"	"22"	"29121360"	"29121360"	"subst"	"0.000574245"	"02327"	"CHEK2_000073"	"g.29121360A>T"	""	""	""	"CHEK2(NM_001005735.1):c.449-5T>A (p.?), CHEK2(NM_007194.4):c.320-5T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000693155"	"0"	"30"	"22"	"29130595"	"29130595"	"subst"	"0"	"02327"	"CHEK2_000254"	"g.29130595A>G"	""	""	""	"CHEK2(NM_007194.4):c.115T>C (p.S39P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728072"	"0"	"30"	"22"	"29085176"	"29085176"	"subst"	"0.000227009"	"02369"	"CHEK2_000255"	"g.29085176C>T"	""	""	""	"CHEK2(NM_007194.4):c.1489G>A (p.D497N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728073"	"0"	"50"	"22"	"29090026"	"29090026"	"subst"	"0"	"02327"	"CHEK2_000256"	"g.29090026C>A"	""	""	""	"CHEK2(NM_007194.4):c.1455G>T (p.W485C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000728074"	"0"	"50"	"22"	"29090043"	"29090043"	"subst"	"8.72638E-6"	"02327"	"CHEK2_000092"	"g.29090043C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000728075"	"0"	"50"	"22"	"29090099"	"29090099"	"subst"	"0"	"02325"	"CHEK2_000257"	"g.29090099T>C"	""	""	""	"CHEK2(NM_007194.4):c.1382A>G (p.D461G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000728076"	"0"	"50"	"22"	"29091147"	"29091147"	"subst"	"0.00135029"	"02326"	"CHEK2_000010"	"g.29091147A>C"	""	""	""	"CHEK2(NM_001005735.1):c.1472T>G (p.(Ile491Ser)), CHEK2(NM_007194.4):c.1343T>G (p.I448S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000728077"	"0"	"30"	"22"	"29091240"	"29091240"	"subst"	"5.73394E-5"	"02369"	"CHEK2_000052"	"g.29091240G>C"	""	""	""	"CHEK2(NM_001005735.1):c.1389-10C>G (p.(=)), CHEK2(NM_007194.4):c.1260-10C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728078"	"0"	"30"	"22"	"29091841"	"29091841"	"subst"	"0"	"02327"	"CHEK2_000258"	"g.29091841G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728079"	"0"	"70"	"22"	"29092947"	"29092947"	"subst"	"8.12909E-6"	"02327"	"CHEK2_000244"	"g.29092947C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1166G>A (p.(Arg389His)), CHEK2(NM_007194.4):c.1037G>A (p.R346H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000728080"	"0"	"70"	"22"	"29092948"	"29092948"	"subst"	"5.28421E-5"	"02325"	"CHEK2_000114"	"g.29092948G>A"	""	""	""	"CHEK2(NM_007194.4):c.1036C>T (p.R346C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000728081"	"0"	"50"	"22"	"29095882"	"29095882"	"subst"	"1.21828E-5"	"02327"	"CHEK2_000117"	"g.29095882G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000728082"	"0"	"30"	"22"	"29095999"	"29095999"	"subst"	"0"	"02369"	"CHEK2_000259"	"g.29095999A>G"	""	""	""	"CHEK2(NM_007194.4):c.909-74T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728083"	"0"	"50"	"22"	"29099553"	"29099553"	"subst"	"0"	"02369"	"CHEK2_000260"	"g.29099553G>T"	""	""	""	"CHEK2(NM_007194.4):c.848C>A (p.P283H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000728084"	"0"	"50"	"22"	"29115403"	"29115403"	"subst"	"4.48398E-5"	"02326"	"CHEK2_000018"	"g.29115403G>C"	""	""	""	"CHEK2(NM_007194.4):c.663C>G (p.I221M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000728085"	"0"	"30"	"22"	"29115511"	"29115511"	"subst"	"0"	"02369"	"CHEK2_000261"	"g.29115511T>C"	""	""	""	"CHEK2(NM_007194.4):c.593-38A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728086"	"0"	"30"	"22"	"29121034"	"29121034"	"subst"	"0"	"02327"	"CHEK2_000139"	"g.29121034C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728087"	"0"	"70"	"22"	"29121075"	"29121077"	"del"	"0"	"02369"	"CHEK2_000199"	"g.29121075_29121077del"	""	""	""	"CHEK2(NM_007194.4):c.483_485delAGA (p.E161del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000728088"	"0"	"50"	"22"	"29121077"	"29121077"	"subst"	"0.000121847"	"02327"	"CHEK2_000203"	"g.29121077T>C"	""	""	""	"CHEK2(NM_001005735.1):c.609A>G (p.(Ile203Met)), CHEK2(NM_007194.4):c.480A>G (p.I160M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000728089"	"0"	"90"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"02369"	"CHEK2_000072"	"g.29121230C>T"	""	""	""	"CHEK2(NM_001005735.1):c.573+1G>A (p.?), CHEK2(NM_007194.4):c.444+1G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000728090"	"0"	"30"	"22"	"29121265"	"29121265"	"subst"	"0.000178802"	"02326"	"CHEK2_000144"	"g.29121265C>T"	""	""	""	"CHEK2(NM_001005735.1):c.539G>A (p.(Arg180Gln)), CHEK2(NM_007194.4):c.410G>A (p.R137Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000728091"	"0"	"90"	"22"	"29121266"	"29121266"	"subst"	"2.43827E-5"	"02327"	"CHEK2_000145"	"g.29121266G>A"	""	""	""	"CHEK2(NM_007194.4):c.409C>T (p.R137*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000728092"	"0"	"50"	"22"	"29121278"	"29121278"	"subst"	"0"	"02369"	"CHEK2_000236"	"g.29121278T>C"	""	""	""	"CHEK2(NM_007194.4):c.397A>G (p.T133A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000728093"	"0"	"50"	"22"	"29130520"	"29130520"	"subst"	"0.00015432"	"02329"	"CHEK2_000075"	"g.29130520C>T"	""	""	""	"CHEK2(NM_001005735.1):c.190G>A (p.(Glu64Lys)), CHEK2(NM_007194.4):c.190G>A (p.E64K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000728094"	"0"	"90"	"22"	"29130632"	"29130633"	"del"	"0"	"02326"	"CHEK2_000262"	"g.29130632_29130633del"	""	""	""	"CHEK2(NM_007194.4):c.78_79delCC (p.Q27Vfs*49)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000736973"	"1"	"50"	"22"	"29107993"	"29107993"	"dup"	"0"	"04020"	"CHEK2_000474"	"g.29107993dup"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107992_C_CT"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000736974"	"1"	"50"	"22"	"29121245"	"29121245"	"del"	"0"	"04020"	"CHEK2_000037"	"g.29121245del"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121242_GA_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000737201"	"1"	"50"	"22"	"29091113"	"29091114"	"del"	"4.06928E-6"	"04020"	"CHEK2_000310"	"g.29091113_29091114del"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091112_TAC_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000737202"	"1"	"50"	"22"	"29115411"	"29115411"	"del"	"0"	"04020"	"CHEK2_000487"	"g.29115411del"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115410_TC_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739294"	"1"	"50"	"22"	"29083931"	"29083931"	"subst"	"0"	"04020"	"CHEK2_000266"	"g.29083931C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083931_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739295"	"1"	"50"	"22"	"29083937"	"29083937"	"subst"	"0"	"04020"	"CHEK2_000268"	"g.29083937G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083937_G_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739296"	"1"	"50"	"22"	"29083950"	"29083950"	"subst"	"0"	"04020"	"CHEK2_000270"	"g.29083950G>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083950_G_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739297"	"1"	"50"	"22"	"29083965"	"29083965"	"subst"	"0"	"04020"	"CHEK2_000273"	"g.29083965T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083965_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739298"	"1"	"50"	"22"	"29085135"	"29085135"	"subst"	"0"	"04020"	"CHEK2_000276"	"g.29085135C>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085135_C_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739299"	"1"	"50"	"22"	"29085136"	"29085136"	"subst"	"0"	"04020"	"CHEK2_000277"	"g.29085136T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085136_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739300"	"1"	"50"	"22"	"29085146"	"29085146"	"subst"	"0"	"04020"	"CHEK2_000282"	"g.29085146C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085146_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739301"	"1"	"50"	"22"	"29085155"	"29085155"	"subst"	"3.92869E-5"	"04020"	"CHEK2_000283"	"g.29085155C>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085155_C_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739302"	"1"	"50"	"22"	"29085157"	"29085157"	"subst"	"0"	"04020"	"CHEK2_000284"	"g.29085157T>C"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085157_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739303"	"1"	"50"	"22"	"29090028"	"29090028"	"subst"	"0"	"04020"	"CHEK2_000295"	"g.29090028A>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090028_A_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739304"	"1"	"50"	"22"	"29090033"	"29090033"	"subst"	"0"	"04020"	"CHEK2_000297"	"g.29090033T>C"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090033_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739305"	"1"	"50"	"22"	"29090039"	"29090039"	"subst"	"0"	"04020"	"CHEK2_000300"	"g.29090039A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090039_A_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739306"	"1"	"50"	"22"	"29090067"	"29090067"	"subst"	"0"	"04020"	"CHEK2_000094"	"g.29090067T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090067_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739307"	"1"	"50"	"22"	"29090079"	"29090079"	"subst"	"0"	"04020"	"CHEK2_000095"	"g.29090079C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090079_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739308"	"1"	"50"	"22"	"29090102"	"29090102"	"subst"	"0"	"04020"	"CHEK2_000306"	"g.29090102A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090102_A_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739309"	"1"	"50"	"22"	"29090106"	"29090106"	"subst"	"0"	"04020"	"CHEK2_000308"	"g.29090106C>G"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090106_C_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739310"	"1"	"50"	"22"	"29091115"	"29091115"	"subst"	"0"	"04020"	"CHEK2_000311"	"g.29091115C>T"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091115_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739311"	"1"	"50"	"22"	"29091134"	"29091134"	"subst"	"0"	"04020"	"CHEK2_000312"	"g.29091134C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091134_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739312"	"1"	"50"	"22"	"29091138"	"29091138"	"subst"	"0"	"04020"	"CHEK2_000314"	"g.29091138A>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091138_A_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739313"	"1"	"50"	"22"	"29091162"	"29091162"	"subst"	"0"	"04020"	"CHEK2_000316"	"g.29091162C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091162_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739314"	"1"	"50"	"22"	"29091731"	"29091731"	"subst"	"0"	"04020"	"CHEK2_000331"	"g.29091731T>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091731_T_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739315"	"1"	"50"	"22"	"29091753"	"29091753"	"subst"	"8.13484E-6"	"04020"	"CHEK2_000339"	"g.29091753C>T"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091753_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739316"	"1"	"50"	"22"	"29091756"	"29091756"	"subst"	"1.62684E-5"	"04020"	"CHEK2_000340"	"g.29091756T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091756_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739317"	"1"	"50"	"22"	"29092889"	"29092889"	"subst"	"0"	"04020"	"CHEK2_000362"	"g.29092889C>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092889_C_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739318"	"1"	"50"	"22"	"29092908"	"29092908"	"subst"	"8.12764E-6"	"04020"	"CHEK2_000369"	"g.29092908T>C"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092908_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739319"	"1"	"50"	"22"	"29092921"	"29092921"	"subst"	"0"	"04020"	"CHEK2_000370"	"g.29092921G>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092921_G_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739320"	"1"	"50"	"22"	"29092929"	"29092929"	"subst"	"4.06369E-6"	"04020"	"CHEK2_000371"	"g.29092929T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092929_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739321"	"1"	"50"	"22"	"29092933"	"29092933"	"subst"	"0"	"04020"	"CHEK2_000373"	"g.29092933C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092933_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739322"	"1"	"50"	"22"	"29092947"	"29092947"	"subst"	"0"	"04020"	"CHEK2_000375"	"g.29092947C>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092947_C_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739323"	"1"	"50"	"22"	"29092952"	"29092952"	"subst"	"3.25203E-5"	"04020"	"CHEK2_000115"	"g.29092952T>C"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092952_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739324"	"1"	"50"	"22"	"29092956"	"29092956"	"subst"	"0"	"04020"	"CHEK2_000377"	"g.29092956A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092956_A_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739325"	"1"	"50"	"22"	"29092960"	"29092960"	"subst"	"6.50666E-5"	"04020"	"CHEK2_000378"	"g.29092960C>T"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092960_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739326"	"1"	"50"	"22"	"29092972"	"29092972"	"subst"	"0"	"04020"	"CHEK2_000379"	"g.29092972G>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092972_G_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739327"	"1"	"50"	"22"	"29095851"	"29095851"	"subst"	"0"	"04020"	"CHEK2_000215"	"g.29095851A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095851_A_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739328"	"1"	"50"	"22"	"29095854"	"29095854"	"subst"	"0"	"04020"	"CHEK2_000384"	"g.29095854T>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095854_T_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739329"	"1"	"50"	"22"	"29095862"	"29095862"	"subst"	"0"	"04020"	"CHEK2_000388"	"g.29095862G>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095862_G_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739330"	"1"	"50"	"22"	"29095872"	"29095872"	"subst"	"0"	"04020"	"CHEK2_000390"	"g.29095872T>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095872_T_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739331"	"1"	"50"	"22"	"29095899"	"29095899"	"subst"	"0"	"04020"	"CHEK2_000395"	"g.29095899T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095899_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739332"	"1"	"50"	"22"	"29099499"	"29099499"	"subst"	"0"	"04020"	"CHEK2_000408"	"g.29099499A>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099499_A_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739333"	"1"	"50"	"22"	"29099523"	"29099523"	"subst"	"0"	"04020"	"CHEK2_000415"	"g.29099523T>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099523_T_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739334"	"1"	"50"	"22"	"29099531"	"29099531"	"subst"	"0"	"04020"	"CHEK2_000417"	"g.29099531G>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099531_G_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739335"	"1"	"50"	"22"	"29099541"	"29099541"	"subst"	"0"	"04020"	"CHEK2_000418"	"g.29099541T>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099541_T_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739336"	"1"	"50"	"22"	"29099554"	"29099554"	"subst"	"0"	"04020"	"CHEK2_000422"	"g.29099554G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099554_G_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739337"	"1"	"50"	"22"	"29105996"	"29105996"	"subst"	"0"	"04020"	"CHEK2_000424"	"g.29105996G>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29105996_G_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739338"	"1"	"50"	"22"	"29105998"	"29105998"	"subst"	"0"	"04020"	"CHEK2_000165"	"g.29105998T>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29105998_T_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739339"	"1"	"50"	"22"	"29106032"	"29106032"	"subst"	"0"	"04020"	"CHEK2_000436"	"g.29106032C>T"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106032_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739340"	"1"	"50"	"22"	"29106038"	"29106038"	"subst"	"0"	"04020"	"CHEK2_000437"	"g.29106038G>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106038_G_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739341"	"1"	"50"	"22"	"29106049"	"29106049"	"subst"	"0"	"04020"	"CHEK2_000444"	"g.29106049T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106049_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739342"	"1"	"50"	"22"	"29107923"	"29107923"	"subst"	"0"	"04020"	"CHEK2_000453"	"g.29107923A>G"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107923_A_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739343"	"1"	"50"	"22"	"29107924"	"29107924"	"subst"	"0"	"04020"	"CHEK2_000454"	"g.29107924C>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107924_C_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739344"	"1"	"50"	"22"	"29107928"	"29107928"	"subst"	"0"	"04020"	"CHEK2_000455"	"g.29107928C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107928_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739345"	"1"	"50"	"22"	"29107953"	"29107953"	"subst"	"4.13715E-6"	"04020"	"CHEK2_000459"	"g.29107953C>G"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107953_C_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739346"	"1"	"50"	"22"	"29107953"	"29107953"	"subst"	"0"	"04020"	"CHEK2_000460"	"g.29107953C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107953_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739347"	"1"	"50"	"22"	"29107979"	"29107979"	"subst"	"0"	"04020"	"CHEK2_000471"	"g.29107979G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107979_G_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739348"	"1"	"50"	"22"	"29108004"	"29108004"	"subst"	"0"	"04020"	"CHEK2_000480"	"g.29108004C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29108004_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739349"	"1"	"50"	"22"	"29115402"	"29115402"	"subst"	"0"	"04020"	"CHEK2_000485"	"g.29115402T>C"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115402_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739350"	"1"	"50"	"22"	"29115404"	"29115404"	"subst"	"0"	"04020"	"CHEK2_000486"	"g.29115404A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115404_A_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739351"	"1"	"50"	"22"	"29115446"	"29115446"	"subst"	"0"	"04020"	"CHEK2_000495"	"g.29115446T>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115446_T_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739352"	"1"	"50"	"22"	"29115459"	"29115459"	"subst"	"0"	"04020"	"CHEK2_000501"	"g.29115459C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115459_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739353"	"1"	"50"	"22"	"29115467"	"29115467"	"subst"	"0"	"04020"	"CHEK2_000505"	"g.29115467A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115467_A_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739354"	"1"	"50"	"22"	"29115468"	"29115468"	"subst"	"0"	"04020"	"CHEK2_000506"	"g.29115468C>T"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115468_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739355"	"1"	"50"	"22"	"29120970"	"29120970"	"subst"	"0"	"04020"	"CHEK2_000510"	"g.29120970T>C"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29120970_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739356"	"1"	"50"	"22"	"29120977"	"29120977"	"subst"	"0"	"04020"	"CHEK2_000511"	"g.29120977T>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29120977_T_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739357"	"1"	"50"	"22"	"29120977"	"29120977"	"subst"	"0"	"04020"	"CHEK2_000512"	"g.29120977T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29120977_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739358"	"1"	"50"	"22"	"29120992"	"29120992"	"subst"	"4.06128E-6"	"04020"	"CHEK2_000235"	"g.29120992T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29120992_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739359"	"1"	"50"	"22"	"29120998"	"29120998"	"subst"	"0"	"04020"	"CHEK2_000514"	"g.29120998A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29120998_A_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739360"	"1"	"50"	"22"	"29121036"	"29121036"	"subst"	"0"	"04020"	"CHEK2_000519"	"g.29121036A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121036_A_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739361"	"1"	"50"	"22"	"29121042"	"29121042"	"subst"	"0"	"04020"	"CHEK2_000522"	"g.29121042G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121042_G_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739362"	"1"	"50"	"22"	"29121054"	"29121054"	"subst"	"0"	"04020"	"CHEK2_000524"	"g.29121054G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121054_G_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739363"	"1"	"50"	"22"	"29121057"	"29121057"	"subst"	"8.12282E-6"	"04020"	"CHEK2_000525"	"g.29121057C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121057_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739364"	"1"	"50"	"22"	"29121078"	"29121078"	"subst"	"4.06161E-6"	"04020"	"CHEK2_000528"	"g.29121078A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121078_A_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739365"	"1"	"50"	"22"	"29121105"	"29121105"	"subst"	"0"	"04020"	"CHEK2_000532"	"g.29121105C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121105_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739366"	"1"	"50"	"22"	"29121233"	"29121233"	"subst"	"0"	"04020"	"CHEK2_000534"	"g.29121233T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121233_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739367"	"1"	"50"	"22"	"29121301"	"29121301"	"subst"	"0"	"04020"	"CHEK2_000543"	"g.29121301A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121301_A_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739368"	"1"	"50"	"22"	"29121335"	"29121335"	"subst"	"0"	"04020"	"CHEK2_000548"	"g.29121335A>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121335_A_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739369"	"1"	"50"	"22"	"29121347"	"29121347"	"subst"	"0"	"04020"	"CHEK2_000552"	"g.29121347T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121347_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739370"	"1"	"50"	"22"	"29130397"	"29130397"	"subst"	"0"	"04020"	"CHEK2_000557"	"g.29130397T>G"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130397_T_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739371"	"1"	"50"	"22"	"29130400"	"29130400"	"subst"	"0"	"04020"	"CHEK2_000558"	"g.29130400C>T"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130400_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739372"	"1"	"50"	"22"	"29130433"	"29130433"	"subst"	"4.062E-6"	"04020"	"CHEK2_000228"	"g.29130433A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130433_A_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739373"	"1"	"50"	"22"	"29130494"	"29130494"	"subst"	"0"	"04020"	"CHEK2_000568"	"g.29130494A>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130494_A_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739374"	"1"	"50"	"22"	"29130502"	"29130502"	"subst"	"4.06098E-6"	"04020"	"CHEK2_000570"	"g.29130502C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130502_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739375"	"1"	"50"	"22"	"29130540"	"29130540"	"subst"	"4.06131E-6"	"04020"	"CHEK2_000572"	"g.29130540G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130540_G_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739376"	"1"	"50"	"22"	"29130549"	"29130549"	"subst"	"0"	"04020"	"CHEK2_000573"	"g.29130549T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130549_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739377"	"1"	"50"	"22"	"29130564"	"29130564"	"subst"	"0"	"04020"	"CHEK2_000579"	"g.29130564G>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130564_G_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739378"	"1"	"50"	"22"	"29130604"	"29130604"	"subst"	"0"	"04020"	"CHEK2_000586"	"g.29130604G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130604_G_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739379"	"1"	"50"	"22"	"29130616"	"29130616"	"subst"	"0"	"04020"	"CHEK2_000590"	"g.29130616A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130616_A_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739380"	"1"	"50"	"22"	"29130634"	"29130634"	"subst"	"0"	"04020"	"CHEK2_000593"	"g.29130634T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130634_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739381"	"1"	"50"	"22"	"29130639"	"29130639"	"subst"	"0"	"04020"	"CHEK2_000596"	"g.29130639C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130639_C_T"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739382"	"1"	"50"	"22"	"29130649"	"29130649"	"subst"	"0"	"04020"	"CHEK2_000597"	"g.29130649G>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130649_G_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739383"	"1"	"50"	"22"	"29130650"	"29130650"	"subst"	"2.064E-5"	"04020"	"CHEK2_000598"	"g.29130650C>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130650_C_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739384"	"1"	"50"	"22"	"29130652"	"29130652"	"subst"	"0.000148661"	"04020"	"CHEK2_000005"	"g.29130652G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130652_G_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739385"	"1"	"50"	"22"	"29130699"	"29130699"	"subst"	"0"	"04020"	"CHEK2_000607"	"g.29130699T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130699_T_C"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739386"	"1"	"50"	"22"	"29130702"	"29130702"	"subst"	"0"	"04020"	"CHEK2_000608"	"g.29130702C>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130702_C_G"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000739387"	"1"	"50"	"22"	"29137756"	"29137756"	"subst"	"0"	"04020"	"CHEK2_000612"	"g.29137756C>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29137756_C_A"	"not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742867"	"1"	"50"	"22"	"29085191"	"29085191"	"del"	"0"	"04020"	"CHEK2_000290"	"g.29085191del"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085189_CT_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742868"	"1"	"50"	"22"	"29090048"	"29090048"	"del"	"0"	"04020"	"CHEK2_000301"	"g.29090048del"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090046_CT_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742869"	"1"	"50"	"22"	"29091770"	"29091770"	"del"	"0"	"04020"	"CHEK2_000172"	"g.29091770del"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091768_CA_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742870"	"1"	"50"	"22"	"29091822"	"29091823"	"del"	"0"	"04020"	"CHEK2_000354"	"g.29091822_29091823del"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091816_TGA_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742871"	"1"	"50"	"22"	"29091842"	"29091842"	"dup"	"0"	"04020"	"CHEK2_000357"	"g.29091842dup"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091840_T_TG"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742872"	"1"	"50"	"22"	"29095872"	"29095872"	"del"	"0"	"04020"	"CHEK2_000391"	"g.29095872del"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095870_CT_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742873"	"1"	"50"	"22"	"29095918"	"29095918"	"dup"	"0"	"04020"	"CHEK2_000400"	"g.29095918dup"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095913_T_TC"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742874"	"1"	"50"	"22"	"29106023"	"29106024"	"del"	"0"	"04020"	"CHEK2_000434"	"g.29106023_29106024del"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106021_TTC_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742875"	"1"	"50"	"22"	"29115439"	"29115442"	"del"	"0"	"04020"	"CHEK2_000493"	"g.29115439_29115442del"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115433_AACTG_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742876"	"1"	"50"	"22"	"29115473"	"29115473"	"del"	"0"	"04020"	"CHEK2_000063"	"g.29115473del"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115468_CA_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742877"	"1"	"50"	"22"	"29121052"	"29121052"	"del"	"0"	"04020"	"CHEK2_000177"	"g.29121052del"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121049_CA_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742878"	"1"	"50"	"22"	"29121308"	"29121308"	"dup"	"0"	"04020"	"CHEK2_000545"	"g.29121308dup"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121307_T_TA"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742879"	"1"	"50"	"22"	"29130464"	"29130464"	"del"	"0"	"04020"	"CHEK2_000566"	"g.29130464del"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130462_TG_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742880"	"1"	"50"	"22"	"29130494"	"29130498"	"del"	"0"	"04020"	"CHEK2_000569"	"g.29130494_29130498del"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130486_GGAATA_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000742881"	"1"	"50"	"22"	"29130553"	"29130554"	"del"	"0"	"04020"	"CHEK2_000576"	"g.29130553_29130554del"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130549_TGA_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000743473"	"1"	"50"	"22"	"29107892"	"29107905"	"del"	"0"	"04020"	"CHEK2_000445"	"g.29107892_29107905del"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107891_ACTTACTGCCTCTCT_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000743474"	"1"	"50"	"22"	"29090038"	"29090039"	"del"	"0"	"04020"	"CHEK2_000299"	"g.29090038_29090039del"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090037_TTA_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000743475"	"1"	"50"	"22"	"29091751"	"29091752"	"delins"	"0"	"04020"	"CHEK2_000338"	"g.29091751_29091752delinsGA"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091751_AG_GA"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000743476"	"1"	"50"	"22"	"29090029"	"29090029"	"del"	"0"	"04020"	"CHEK2_000296"	"g.29090029del"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090028_AC_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000743477"	"1"	"50"	"22"	"29130433"	"29130433"	"del"	"0"	"04020"	"CHEK2_000006"	"g.29130433del"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130432_CA_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746141"	"1"	"50"	"22"	"29083896"	"29083896"	"subst"	"0"	"04020"	"CHEK2_000263"	"g.29083896C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083896_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746142"	"1"	"50"	"22"	"29083914"	"29083914"	"subst"	"0"	"04020"	"CHEK2_000205"	"g.29083914G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083914_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746143"	"1"	"50"	"22"	"29083922"	"29083922"	"subst"	"0"	"04020"	"CHEK2_000264"	"g.29083922G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083922_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746144"	"1"	"50"	"22"	"29083922"	"29083922"	"subst"	"0"	"04020"	"CHEK2_000265"	"g.29083922G>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083922_G_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746145"	"1"	"50"	"22"	"29083932"	"29083932"	"subst"	"0"	"04020"	"CHEK2_000267"	"g.29083932C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083932_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746146"	"1"	"50"	"22"	"29083949"	"29083949"	"subst"	"0"	"04020"	"CHEK2_000269"	"g.29083949C>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083949_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746147"	"1"	"50"	"22"	"29083955"	"29083955"	"subst"	"0"	"04020"	"CHEK2_000084"	"g.29083955C>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083955_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746148"	"1"	"50"	"22"	"29083956"	"29083956"	"subst"	"0"	"04020"	"CHEK2_000271"	"g.29083956G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083956_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746149"	"1"	"50"	"22"	"29083971"	"29083971"	"subst"	"0"	"04020"	"CHEK2_000274"	"g.29083971A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083971_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746150"	"1"	"50"	"22"	"29085137"	"29085137"	"subst"	"0"	"04020"	"CHEK2_000278"	"g.29085137G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085137_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746151"	"1"	"50"	"22"	"29085145"	"29085145"	"subst"	"0"	"04020"	"CHEK2_000281"	"g.29085145G>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085145_G_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746152"	"1"	"50"	"22"	"29085158"	"29085158"	"subst"	"0"	"04020"	"CHEK2_000285"	"g.29085158T>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085158_T_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746153"	"1"	"50"	"22"	"29085172"	"29085172"	"subst"	"0"	"04020"	"CHEK2_000287"	"g.29085172A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085172_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746154"	"1"	"50"	"22"	"29085176"	"29085176"	"subst"	"0"	"04020"	"CHEK2_000288"	"g.29085176C>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085176_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746155"	"1"	"50"	"22"	"29085193"	"29085193"	"subst"	"0"	"04020"	"CHEK2_000291"	"g.29085193A>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085193_A_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746156"	"1"	"50"	"22"	"29085203"	"29085203"	"subst"	"8.73286E-6"	"04020"	"CHEK2_000292"	"g.29085203C>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085203_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746157"	"1"	"50"	"22"	"29090027"	"29090027"	"subst"	"0"	"04020"	"CHEK2_000294"	"g.29090027C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090027_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746158"	"1"	"50"	"22"	"29090031"	"29090031"	"subst"	"4.36331E-6"	"04020"	"CHEK2_000048"	"g.29090031G>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090031_G_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746159"	"1"	"50"	"22"	"29090034"	"29090034"	"subst"	"0"	"04020"	"CHEK2_000298"	"g.29090034G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090034_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746160"	"1"	"50"	"22"	"29090043"	"29090043"	"subst"	"8.72638E-6"	"04020"	"CHEK2_000092"	"g.29090043C>T"	"5/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090043_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746161"	"1"	"50"	"22"	"29090055"	"29090055"	"subst"	"0"	"04020"	"CHEK2_000302"	"g.29090055T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090055_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746162"	"1"	"50"	"22"	"29090060"	"29090060"	"subst"	"6.54485E-5"	"04020"	"CHEK2_000183"	"g.29090060C>T"	"18/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090060_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746163"	"1"	"50"	"22"	"29090061"	"29090061"	"subst"	"0"	"04020"	"CHEK2_000303"	"g.29090061G>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090061_G_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746164"	"1"	"50"	"22"	"29090073"	"29090073"	"subst"	"0"	"04020"	"CHEK2_000304"	"g.29090073C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090073_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746165"	"1"	"50"	"22"	"29090081"	"29090081"	"subst"	"0"	"04020"	"CHEK2_000305"	"g.29090081A>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090081_A_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746166"	"1"	"50"	"22"	"29090099"	"29090099"	"subst"	"0"	"04020"	"CHEK2_000257"	"g.29090099T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090099_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746167"	"1"	"50"	"22"	"29090105"	"29090105"	"subst"	"0"	"04020"	"CHEK2_000307"	"g.29090105G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090105_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746168"	"1"	"50"	"22"	"29090107"	"29090107"	"subst"	"0"	"04020"	"CHEK2_000309"	"g.29090107T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090107_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746169"	"1"	"50"	"22"	"29091136"	"29091136"	"subst"	"4.06739E-6"	"04020"	"CHEK2_000313"	"g.29091136A>G"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091136_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746170"	"1"	"50"	"22"	"29091139"	"29091139"	"subst"	"2.84715E-5"	"04020"	"CHEK2_000315"	"g.29091139C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091139_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746171"	"1"	"50"	"22"	"29091172"	"29091172"	"subst"	"0"	"04020"	"CHEK2_000317"	"g.29091172T>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091172_T_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746172"	"1"	"50"	"22"	"29091177"	"29091177"	"subst"	"0"	"04020"	"CHEK2_000319"	"g.29091177T>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091177_T_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746173"	"1"	"50"	"22"	"29091201"	"29091201"	"subst"	"0"	"04020"	"CHEK2_000320"	"g.29091201T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091201_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746174"	"1"	"50"	"22"	"29091204"	"29091204"	"subst"	"0"	"04020"	"CHEK2_000321"	"g.29091204T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091204_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746175"	"1"	"50"	"22"	"29091213"	"29091213"	"subst"	"0"	"04020"	"CHEK2_000322"	"g.29091213G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091213_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746176"	"1"	"50"	"22"	"29091213"	"29091213"	"subst"	"1.62858E-5"	"04020"	"CHEK2_000323"	"g.29091213G>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091213_G_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746177"	"1"	"50"	"22"	"29091226"	"29091226"	"subst"	"0"	"04020"	"CHEK2_000324"	"g.29091226T>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091226_T_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746178"	"1"	"50"	"22"	"29091716"	"29091716"	"subst"	"0"	"04020"	"CHEK2_000327"	"g.29091716C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091716_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746179"	"1"	"50"	"22"	"29091719"	"29091719"	"subst"	"0"	"04020"	"CHEK2_000328"	"g.29091719A>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091719_A_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746180"	"1"	"50"	"22"	"29091721"	"29091721"	"subst"	"0"	"04020"	"CHEK2_000329"	"g.29091721A>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091721_A_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746181"	"1"	"50"	"22"	"29091731"	"29091731"	"subst"	"8.15322E-6"	"04020"	"CHEK2_000186"	"g.29091731T>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091731_T_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746182"	"1"	"50"	"22"	"29091732"	"29091732"	"subst"	"0"	"04020"	"CHEK2_000332"	"g.29091732C>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091732_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746183"	"1"	"50"	"22"	"29091735"	"29091735"	"subst"	"0"	"04020"	"CHEK2_000336"	"g.29091735C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091735_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746184"	"1"	"50"	"22"	"29091758"	"29091758"	"subst"	"0"	"04020"	"CHEK2_000341"	"g.29091758C>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091758_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746185"	"1"	"50"	"22"	"29091771"	"29091771"	"subst"	"0"	"04020"	"CHEK2_000343"	"g.29091771G>C"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091771_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746186"	"1"	"50"	"22"	"29091780"	"29091780"	"subst"	"0"	"04020"	"CHEK2_000346"	"g.29091780G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091780_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746187"	"1"	"50"	"22"	"29091787"	"29091787"	"subst"	"0"	"04020"	"CHEK2_000347"	"g.29091787G>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091787_G_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746188"	"1"	"50"	"22"	"29091788"	"29091788"	"subst"	"0"	"04020"	"CHEK2_000188"	"g.29091788T>C"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091788_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746189"	"1"	"50"	"22"	"29091797"	"29091797"	"subst"	"4.06686E-6"	"04020"	"CHEK2_000349"	"g.29091797G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091797_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746190"	"1"	"50"	"22"	"29091801"	"29091801"	"subst"	"0"	"04020"	"CHEK2_000350"	"g.29091801C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091801_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746191"	"1"	"50"	"22"	"29091814"	"29091814"	"subst"	"0"	"04020"	"CHEK2_000353"	"g.29091814C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091814_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746192"	"1"	"50"	"22"	"29091849"	"29091849"	"subst"	"0"	"04020"	"CHEK2_000358"	"g.29091849C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091849_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746193"	"1"	"50"	"22"	"29092887"	"29092887"	"subst"	"0"	"04020"	"CHEK2_000360"	"g.29092887A>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092887_A_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746194"	"1"	"50"	"22"	"29092888"	"29092888"	"subst"	"0"	"04020"	"CHEK2_000361"	"g.29092888C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092888_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746195"	"1"	"50"	"22"	"29092899"	"29092899"	"subst"	"4.06438E-6"	"04020"	"CHEK2_000364"	"g.29092899C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092899_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746196"	"1"	"50"	"22"	"29092900"	"29092900"	"subst"	"8.12803E-6"	"04020"	"CHEK2_000365"	"g.29092900A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092900_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746197"	"1"	"50"	"22"	"29092903"	"29092903"	"subst"	"0"	"04020"	"CHEK2_000366"	"g.29092903C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092903_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746198"	"1"	"50"	"22"	"29092906"	"29092906"	"subst"	"0"	"04020"	"CHEK2_000367"	"g.29092906C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092906_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746199"	"1"	"50"	"22"	"29092906"	"29092906"	"subst"	"0"	"04020"	"CHEK2_000368"	"g.29092906C>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092906_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746200"	"1"	"50"	"22"	"29092932"	"29092932"	"subst"	"4.06372E-6"	"04020"	"CHEK2_000372"	"g.29092932T>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092932_T_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746201"	"1"	"50"	"22"	"29095831"	"29095831"	"subst"	"4.06138E-6"	"04020"	"CHEK2_000380"	"g.29095831C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095831_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746202"	"1"	"50"	"22"	"29095842"	"29095842"	"subst"	"0"	"04020"	"CHEK2_000381"	"g.29095842A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095842_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746203"	"1"	"50"	"22"	"29095848"	"29095848"	"subst"	"4.06088E-6"	"04020"	"CHEK2_000382"	"g.29095848T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095848_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746204"	"1"	"50"	"22"	"29095851"	"29095851"	"subst"	"0"	"04020"	"CHEK2_000383"	"g.29095851A>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095851_A_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746205"	"1"	"50"	"22"	"29095857"	"29095857"	"subst"	"0"	"04020"	"CHEK2_000385"	"g.29095857A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095857_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746206"	"1"	"50"	"22"	"29095867"	"29095867"	"subst"	"0"	"04020"	"CHEK2_000389"	"g.29095867T>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095867_T_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746207"	"1"	"50"	"22"	"29095872"	"29095872"	"subst"	"2.03037E-5"	"04020"	"CHEK2_000392"	"g.29095872T>G"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095872_T_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746208"	"1"	"50"	"22"	"29095881"	"29095881"	"subst"	"8.1215E-6"	"04020"	"CHEK2_000393"	"g.29095881C>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095881_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746209"	"1"	"50"	"22"	"29095882"	"29095882"	"subst"	"1.21828E-5"	"04020"	"CHEK2_000117"	"g.29095882G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095882_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746210"	"1"	"50"	"22"	"29095911"	"29095911"	"subst"	"0"	"04020"	"CHEK2_000397"	"g.29095911T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095911_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746211"	"1"	"50"	"22"	"29095917"	"29095917"	"subst"	"4.06537E-6"	"04020"	"CHEK2_000399"	"g.29095917C>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095917_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746212"	"1"	"50"	"22"	"29095918"	"29095918"	"subst"	"0"	"04020"	"CHEK2_000401"	"g.29095918C>A"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095918_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746213"	"1"	"50"	"22"	"29095923"	"29095923"	"subst"	"0"	"04020"	"CHEK2_000404"	"g.29095923A>G"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095923_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746214"	"1"	"50"	"22"	"29095924"	"29095924"	"subst"	"3.66372E-5"	"04020"	"CHEK2_000405"	"g.29095924T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095924_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746215"	"1"	"50"	"22"	"29099492"	"29099492"	"subst"	"0"	"04020"	"CHEK2_000245"	"g.29099492C>A"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099492_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746216"	"1"	"50"	"22"	"29099497"	"29099497"	"subst"	"0"	"04020"	"CHEK2_000407"	"g.29099497C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099497_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746217"	"1"	"50"	"22"	"29099499"	"29099499"	"subst"	"0"	"04020"	"CHEK2_000409"	"g.29099499A>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099499_A_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746218"	"1"	"50"	"22"	"29099502"	"29099502"	"subst"	"0"	"04020"	"CHEK2_000410"	"g.29099502A>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099502_A_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746219"	"1"	"50"	"22"	"29099505"	"29099505"	"subst"	"0"	"04020"	"CHEK2_000411"	"g.29099505A>C"	"6/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099505_A_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746220"	"1"	"50"	"22"	"29099508"	"29099508"	"subst"	"0"	"04020"	"CHEK2_000412"	"g.29099508T>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099508_T_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746221"	"1"	"50"	"22"	"29099509"	"29099509"	"subst"	"0"	"04020"	"CHEK2_000413"	"g.29099509A>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099509_A_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746222"	"1"	"50"	"22"	"29099514"	"29099514"	"subst"	"0"	"04020"	"CHEK2_000414"	"g.29099514T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099514_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746223"	"1"	"50"	"22"	"29099546"	"29099546"	"subst"	"4.53157E-6"	"04020"	"CHEK2_000420"	"g.29099546G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099546_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746224"	"1"	"50"	"22"	"29099550"	"29099550"	"subst"	"0"	"04020"	"CHEK2_000421"	"g.29099550C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099550_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746225"	"1"	"50"	"22"	"29105993"	"29105993"	"subst"	"0"	"04020"	"CHEK2_000017"	"g.29105993C>A"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29105993_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746226"	"1"	"50"	"22"	"29105993"	"29105993"	"subst"	"0"	"04020"	"CHEK2_000423"	"g.29105993C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29105993_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746227"	"1"	"50"	"22"	"29105998"	"29105998"	"subst"	"4.09598E-6"	"04020"	"CHEK2_000425"	"g.29105998T>C"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29105998_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746228"	"1"	"50"	"22"	"29106004"	"29106004"	"subst"	"0"	"04020"	"CHEK2_000426"	"g.29106004T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106004_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746229"	"1"	"50"	"22"	"29106008"	"29106008"	"subst"	"0"	"04020"	"CHEK2_000427"	"g.29106008T>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106008_T_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746230"	"1"	"50"	"22"	"29106013"	"29106013"	"subst"	"0"	"04020"	"CHEK2_000428"	"g.29106013A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106013_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746231"	"1"	"50"	"22"	"29106016"	"29106016"	"subst"	"0"	"04020"	"CHEK2_000429"	"g.29106016T>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106016_T_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746232"	"1"	"50"	"22"	"29106018"	"29106018"	"subst"	"0"	"04020"	"CHEK2_000431"	"g.29106018T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106018_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746233"	"1"	"50"	"22"	"29106023"	"29106023"	"subst"	"0"	"04020"	"CHEK2_000433"	"g.29106023C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106023_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746234"	"1"	"50"	"22"	"29106028"	"29106028"	"subst"	"0"	"04020"	"CHEK2_000435"	"g.29106028T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106028_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746235"	"1"	"50"	"22"	"29106043"	"29106043"	"subst"	"0"	"04020"	"CHEK2_000440"	"g.29106043G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106043_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746236"	"1"	"50"	"22"	"29106043"	"29106043"	"subst"	"0"	"04020"	"CHEK2_000441"	"g.29106043G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106043_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746237"	"1"	"50"	"22"	"29106048"	"29106048"	"subst"	"1.22387E-5"	"04020"	"CHEK2_000442"	"g.29106048C>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106048_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746238"	"1"	"50"	"22"	"29106048"	"29106048"	"subst"	"1.63183E-5"	"04020"	"CHEK2_000443"	"g.29106048C>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106048_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746239"	"1"	"50"	"22"	"29107895"	"29107895"	"subst"	"4.06772E-6"	"04020"	"CHEK2_000446"	"g.29107895A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107895_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746240"	"1"	"50"	"22"	"29107896"	"29107896"	"subst"	"0"	"04020"	"CHEK2_000447"	"g.29107896C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107896_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746241"	"1"	"50"	"22"	"29107899"	"29107899"	"subst"	"4.06702E-6"	"04020"	"CHEK2_000126"	"g.29107899C>A"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107899_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746242"	"1"	"50"	"22"	"29107901"	"29107901"	"subst"	"0"	"04020"	"CHEK2_000448"	"g.29107901T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107901_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746243"	"1"	"50"	"22"	"29107902"	"29107902"	"subst"	"8.13213E-6"	"04020"	"CHEK2_000449"	"g.29107902C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107902_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746244"	"1"	"50"	"22"	"29107902"	"29107902"	"subst"	"0"	"04020"	"CHEK2_000450"	"g.29107902C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107902_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746245"	"1"	"50"	"22"	"29107905"	"29107905"	"subst"	"0"	"04020"	"CHEK2_000451"	"g.29107905T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107905_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746246"	"1"	"50"	"22"	"29107911"	"29107911"	"subst"	"0"	"04020"	"CHEK2_000452"	"g.29107911A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107911_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746247"	"1"	"50"	"22"	"29107938"	"29107938"	"subst"	"0"	"04020"	"CHEK2_000193"	"g.29107938T>A"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107938_T_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746248"	"1"	"50"	"22"	"29107943"	"29107943"	"subst"	"0"	"04020"	"CHEK2_000456"	"g.29107943T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107943_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746249"	"1"	"50"	"22"	"29107949"	"29107949"	"subst"	"4.06246E-6"	"04020"	"CHEK2_000457"	"g.29107949G>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107949_G_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746250"	"1"	"50"	"22"	"29107956"	"29107956"	"subst"	"0"	"04020"	"CHEK2_000461"	"g.29107956T>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107956_T_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746251"	"1"	"50"	"22"	"29107958"	"29107958"	"subst"	"8.12453E-6"	"04020"	"CHEK2_000462"	"g.29107958T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107958_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746252"	"1"	"50"	"22"	"29107962"	"29107962"	"subst"	"0"	"04020"	"CHEK2_000463"	"g.29107962A>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107962_A_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746253"	"1"	"50"	"22"	"29107967"	"29107967"	"subst"	"0"	"04020"	"CHEK2_000466"	"g.29107967T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107967_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746254"	"1"	"50"	"22"	"29107968"	"29107968"	"subst"	"0"	"04020"	"CHEK2_000467"	"g.29107968T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107968_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746255"	"1"	"50"	"22"	"29107970"	"29107970"	"subst"	"0"	"04020"	"CHEK2_000468"	"g.29107970C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107970_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746256"	"1"	"50"	"22"	"29107971"	"29107971"	"subst"	"0"	"04020"	"CHEK2_000469"	"g.29107971T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107971_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746257"	"1"	"50"	"22"	"29107973"	"29107973"	"subst"	"8.12513E-6"	"04020"	"CHEK2_000470"	"g.29107973T>C"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107973_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746258"	"1"	"50"	"22"	"29107982"	"29107982"	"subst"	"0.000345329"	"04020"	"CHEK2_000472"	"g.29107982A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107982_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746259"	"1"	"50"	"22"	"29107991"	"29107991"	"subst"	"0"	"04020"	"CHEK2_000473"	"g.29107991T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107991_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746260"	"1"	"50"	"22"	"29107994"	"29107994"	"subst"	"4.06286E-6"	"04020"	"CHEK2_000475"	"g.29107994C>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107994_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746261"	"1"	"50"	"22"	"29108001"	"29108001"	"subst"	"2.43787E-5"	"04020"	"CHEK2_000476"	"g.29108001C>A"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29108001_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746262"	"1"	"50"	"22"	"29108001"	"29108001"	"subst"	"4.06312E-6"	"04020"	"CHEK2_000477"	"g.29108001C>G"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29108001_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746263"	"1"	"50"	"22"	"29108003"	"29108003"	"subst"	"0"	"04020"	"CHEK2_000478"	"g.29108003C>A"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29108003_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746264"	"1"	"50"	"22"	"29108003"	"29108003"	"subst"	"0"	"04020"	"CHEK2_000479"	"g.29108003C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29108003_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746265"	"1"	"50"	"22"	"29108004"	"29108004"	"subst"	"0"	"04020"	"CHEK2_000481"	"g.29108004C>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29108004_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746266"	"1"	"50"	"22"	"29108007"	"29108007"	"subst"	"0"	"04020"	"CHEK2_000132"	"g.29108007T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29108007_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746267"	"1"	"50"	"22"	"29115389"	"29115389"	"subst"	"0"	"04020"	"CHEK2_000482"	"g.29115389A>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115389_A_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746268"	"1"	"50"	"22"	"29115399"	"29115399"	"subst"	"0"	"04020"	"CHEK2_000483"	"g.29115399A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115399_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746269"	"1"	"50"	"22"	"29115425"	"29115425"	"subst"	"0"	"04020"	"CHEK2_000489"	"g.29115425T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115425_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746270"	"1"	"50"	"22"	"29115432"	"29115432"	"subst"	"0"	"04020"	"CHEK2_000490"	"g.29115432A>G"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115432_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746271"	"1"	"50"	"22"	"29115444"	"29115444"	"subst"	"0"	"04020"	"CHEK2_000494"	"g.29115444C>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115444_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746272"	"1"	"50"	"22"	"29115449"	"29115449"	"subst"	"0"	"04020"	"CHEK2_000496"	"g.29115449A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115449_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746273"	"1"	"50"	"22"	"29115450"	"29115450"	"subst"	"0"	"04020"	"CHEK2_000497"	"g.29115450C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115450_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746274"	"1"	"50"	"22"	"29115455"	"29115455"	"subst"	"0"	"04020"	"CHEK2_000500"	"g.29115455A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115455_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746275"	"1"	"50"	"22"	"29115458"	"29115458"	"subst"	"0"	"04020"	"CHEK2_000062"	"g.29115458T>C"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115458_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746276"	"1"	"50"	"22"	"29115465"	"29115465"	"subst"	"0"	"04020"	"CHEK2_000504"	"g.29115465A>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115465_A_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746277"	"1"	"50"	"22"	"29115469"	"29115469"	"subst"	"0"	"04020"	"CHEK2_000507"	"g.29115469A>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115469_A_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746278"	"1"	"50"	"22"	"29115471"	"29115471"	"subst"	"0"	"04020"	"CHEK2_000508"	"g.29115471A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115471_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746279"	"1"	"50"	"22"	"29120963"	"29120963"	"subst"	"0"	"04020"	"CHEK2_000509"	"g.29120963A>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29120963_A_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746280"	"1"	"50"	"22"	"29120979"	"29120979"	"subst"	"1.21842E-5"	"04020"	"CHEK2_000066"	"g.29120979A>G"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29120979_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746281"	"1"	"50"	"22"	"29120992"	"29120992"	"subst"	"0"	"04020"	"CHEK2_000513"	"g.29120992T>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29120992_T_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746282"	"1"	"50"	"22"	"29121002"	"29121002"	"subst"	"4.06134E-6"	"04020"	"CHEK2_000515"	"g.29121002G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121002_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746283"	"1"	"50"	"22"	"29121008"	"29121008"	"subst"	"1.21843E-5"	"04020"	"CHEK2_000175"	"g.29121008C>G"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121008_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746284"	"1"	"50"	"22"	"29121033"	"29121033"	"subst"	"0"	"04020"	"CHEK2_000518"	"g.29121033A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121033_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746285"	"1"	"50"	"22"	"29121040"	"29121040"	"subst"	"0"	"04020"	"CHEK2_000521"	"g.29121040C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121040_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746286"	"1"	"50"	"22"	"29121045"	"29121045"	"subst"	"0"	"04020"	"CHEK2_000523"	"g.29121045T>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121045_T_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746287"	"1"	"50"	"22"	"29121060"	"29121060"	"subst"	"0"	"04020"	"CHEK2_000526"	"g.29121060T>C"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121060_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746288"	"1"	"50"	"22"	"29121067"	"29121067"	"subst"	"0"	"04020"	"CHEK2_000527"	"g.29121067T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121067_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746289"	"1"	"50"	"22"	"29121079"	"29121079"	"subst"	"4.06151E-6"	"04020"	"CHEK2_000071"	"g.29121079T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121079_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746290"	"1"	"50"	"22"	"29121081"	"29121081"	"subst"	"4.06154E-6"	"04020"	"CHEK2_000529"	"g.29121081T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121081_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746291"	"1"	"50"	"22"	"29121082"	"29121082"	"subst"	"1.6246E-5"	"04020"	"CHEK2_000180"	"g.29121082A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121082_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746292"	"1"	"50"	"22"	"29121087"	"29121087"	"subst"	"0"	"04020"	"CHEK2_000531"	"g.29121087A>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121087_A_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746293"	"1"	"50"	"22"	"29121230"	"29121230"	"subst"	"4.06435E-6"	"04020"	"CHEK2_000533"	"g.29121230C>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121230_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746294"	"1"	"50"	"22"	"29121250"	"29121250"	"subst"	"0"	"04020"	"CHEK2_000535"	"g.29121250T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121250_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746295"	"1"	"50"	"22"	"29121253"	"29121253"	"subst"	"0"	"04020"	"CHEK2_000536"	"g.29121253T>G"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121253_T_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746296"	"1"	"50"	"22"	"29121256"	"29121256"	"subst"	"0"	"04020"	"CHEK2_000537"	"g.29121256C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121256_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746297"	"1"	"50"	"22"	"29121256"	"29121256"	"subst"	"0"	"04020"	"CHEK2_000538"	"g.29121256C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121256_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746298"	"1"	"50"	"22"	"29121260"	"29121260"	"subst"	"0"	"04020"	"CHEK2_000539"	"g.29121260A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121260_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746299"	"1"	"50"	"22"	"29121262"	"29121262"	"subst"	"0"	"04020"	"CHEK2_000540"	"g.29121262G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121262_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746300"	"1"	"50"	"22"	"29121275"	"29121275"	"subst"	"1.62538E-5"	"04020"	"CHEK2_000541"	"g.29121275C>G"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121275_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746301"	"1"	"50"	"22"	"29121278"	"29121278"	"subst"	"0"	"04020"	"CHEK2_000236"	"g.29121278T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121278_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746302"	"1"	"50"	"22"	"29121321"	"29121321"	"subst"	"8.12909E-6"	"04020"	"CHEK2_000546"	"g.29121321G>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121321_G_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746303"	"1"	"50"	"22"	"29121325"	"29121325"	"subst"	"0"	"04020"	"CHEK2_000547"	"g.29121325C>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121325_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746304"	"1"	"50"	"22"	"29121340"	"29121340"	"subst"	"8.13286E-6"	"04020"	"CHEK2_000550"	"g.29121340T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121340_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746305"	"1"	"50"	"22"	"29121342"	"29121342"	"subst"	"0"	"04020"	"CHEK2_000551"	"g.29121342G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121342_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746306"	"1"	"50"	"22"	"29130390"	"29130390"	"subst"	"0"	"04020"	"CHEK2_000555"	"g.29130390C>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130390_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746307"	"1"	"50"	"22"	"29130400"	"29130400"	"subst"	"0"	"04020"	"CHEK2_000559"	"g.29130400C>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130400_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746308"	"1"	"50"	"22"	"29130409"	"29130409"	"subst"	"0"	"04020"	"CHEK2_000560"	"g.29130409C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130409_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746309"	"1"	"50"	"22"	"29130426"	"29130426"	"subst"	"2.03113E-5"	"04020"	"CHEK2_000155"	"g.29130426C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130426_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746310"	"1"	"50"	"22"	"29130431"	"29130431"	"subst"	"2.43716E-5"	"04020"	"CHEK2_000561"	"g.29130431C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130431_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746311"	"1"	"50"	"22"	"29130452"	"29130452"	"subst"	"4.06151E-6"	"04020"	"CHEK2_000563"	"g.29130452C>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130452_C_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746312"	"1"	"50"	"22"	"29130472"	"29130472"	"subst"	"4.06121E-6"	"04020"	"CHEK2_000567"	"g.29130472G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130472_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746313"	"1"	"50"	"22"	"29130550"	"29130550"	"subst"	"0"	"04020"	"CHEK2_000574"	"g.29130550G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130550_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746314"	"1"	"50"	"22"	"29130559"	"29130559"	"subst"	"0"	"04020"	"CHEK2_000577"	"g.29130559G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130559_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746315"	"1"	"50"	"22"	"29130562"	"29130562"	"subst"	"0"	"04020"	"CHEK2_000578"	"g.29130562T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130562_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746316"	"1"	"50"	"22"	"29130564"	"29130564"	"subst"	"0"	"04020"	"CHEK2_000580"	"g.29130564G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130564_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746317"	"1"	"50"	"22"	"29130572"	"29130572"	"subst"	"0"	"04020"	"CHEK2_000581"	"g.29130572C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130572_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746318"	"1"	"50"	"22"	"29130576"	"29130576"	"subst"	"0"	"04020"	"CHEK2_000582"	"g.29130576G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130576_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746319"	"1"	"50"	"22"	"29130583"	"29130583"	"subst"	"1.21993E-5"	"04020"	"CHEK2_000583"	"g.29130583T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130583_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746320"	"1"	"50"	"22"	"29130595"	"29130595"	"subst"	"0"	"04020"	"CHEK2_000254"	"g.29130595A>G"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130595_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746321"	"1"	"50"	"22"	"29130597"	"29130597"	"subst"	"0"	"04020"	"CHEK2_000585"	"g.29130597A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130597_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746322"	"1"	"50"	"22"	"29130606"	"29130606"	"subst"	"0"	"04020"	"CHEK2_000587"	"g.29130606G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130606_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746323"	"1"	"50"	"22"	"29130607"	"29130607"	"subst"	"0"	"04020"	"CHEK2_000588"	"g.29130607A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130607_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746324"	"1"	"50"	"22"	"29130612"	"29130612"	"subst"	"0"	"04020"	"CHEK2_000589"	"g.29130612G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130612_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746325"	"1"	"50"	"22"	"29130625"	"29130625"	"subst"	"8.19135E-6"	"04020"	"CHEK2_000237"	"g.29130625G>A"	"5/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130625_G_A"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746326"	"1"	"50"	"22"	"29130627"	"29130627"	"subst"	"0"	"04020"	"CHEK2_000591"	"g.29130627G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130627_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746327"	"1"	"50"	"22"	"29130629"	"29130629"	"subst"	"0"	"04020"	"CHEK2_000592"	"g.29130629C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130629_C_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746328"	"1"	"50"	"22"	"29130652"	"29130652"	"subst"	"0"	"04020"	"CHEK2_000599"	"g.29130652G>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130652_G_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746329"	"1"	"50"	"22"	"29130654"	"29130654"	"subst"	"0"	"04020"	"CHEK2_000600"	"g.29130654G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130654_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746330"	"1"	"50"	"22"	"29130664"	"29130664"	"subst"	"0"	"04020"	"CHEK2_000601"	"g.29130664T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130664_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746331"	"1"	"50"	"22"	"29130672"	"29130672"	"subst"	"0"	"04020"	"CHEK2_000602"	"g.29130672T>C"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130672_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746332"	"1"	"50"	"22"	"29130675"	"29130675"	"subst"	"4.14645E-6"	"04020"	"CHEK2_000603"	"g.29130675G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130675_G_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746333"	"1"	"50"	"22"	"29130697"	"29130697"	"subst"	"0"	"04020"	"CHEK2_000606"	"g.29130697A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130697_A_G"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746334"	"1"	"50"	"22"	"29130702"	"29130702"	"subst"	"1.25244E-5"	"04020"	"CHEK2_000609"	"g.29130702C>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130702_C_T"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000746335"	"1"	"50"	"22"	"29130709"	"29130709"	"subst"	"0"	"04020"	"CHEK2_000611"	"g.29130709T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130709_T_C"	"not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000750078"	"1"	"50"	"22"	"29091122"	"29091122"	"dup"	"0"	"04020"	"CHEK2_000164"	"g.29091122dup"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091121_C_CT"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000750079"	"1"	"50"	"22"	"29091228"	"29091228"	"del"	"0"	"04020"	"CHEK2_000325"	"g.29091228del"	"25/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091226_TA_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000750080"	"1"	"50"	"22"	"29091734"	"29091758"	"del"	"0"	"04020"	"CHEK2_000335"	"g.29091734_29091758del"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091723_TCCAGCAGTCCACAGCACGGTTATAC_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000750081"	"1"	"50"	"22"	"29099502"	"29099502"	"del"	"0"	"04020"	"CHEK2_000252"	"g.29099502del"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099498_CA_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000750082"	"1"	"50"	"22"	"29099529"	"29099530"	"del"	"0"	"04020"	"CHEK2_000416"	"g.29099529_29099530del"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099524_CAA_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000750276"	"1"	"50"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"04020"	"CHEK2_000001"	"g.29091857del"	"885/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091856_AG_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752022"	"1"	"50"	"22"	"29083913"	"29083913"	"subst"	"0"	"04020"	"CHEK2_000040"	"g.29083913C>T"	"9/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083913_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752023"	"1"	"50"	"22"	"29083920"	"29083920"	"subst"	"0"	"04020"	"CHEK2_000080"	"g.29083920T>C"	"31/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083920_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752024"	"1"	"50"	"22"	"29083935"	"29083935"	"subst"	"0"	"04020"	"CHEK2_000207"	"g.29083935C>T"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083935_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752025"	"1"	"50"	"22"	"29083950"	"29083950"	"subst"	"0"	"04020"	"CHEK2_000083"	"g.29083950G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083950_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752026"	"1"	"50"	"22"	"29083956"	"29083956"	"subst"	"0"	"04020"	"CHEK2_000085"	"g.29083956G>A"	"14/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083956_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752027"	"1"	"50"	"22"	"29083961"	"29083961"	"subst"	"0"	"04020"	"CHEK2_000036"	"g.29083961C>A"	"13/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083961_C_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752028"	"1"	"50"	"22"	"29083961"	"29083961"	"subst"	"0"	"04020"	"CHEK2_000272"	"g.29083961C>T"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083961_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752029"	"1"	"50"	"22"	"29085123"	"29085123"	"subst"	"4.36731E-6"	"04020"	"CHEK2_000275"	"g.29085123C>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085123_C_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752030"	"1"	"50"	"22"	"29085139"	"29085139"	"subst"	"2.18259E-5"	"04020"	"CHEK2_000279"	"g.29085139G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085139_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752031"	"1"	"50"	"22"	"29085140"	"29085140"	"subst"	"8.29448E-5"	"04020"	"CHEK2_000043"	"g.29085140G>A"	"23/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085140_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752032"	"1"	"50"	"22"	"29085143"	"29085143"	"subst"	"1.30955E-5"	"04020"	"CHEK2_000280"	"g.29085143G>C"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085143_G_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752033"	"1"	"50"	"22"	"29085152"	"29085152"	"subst"	"7.42079E-5"	"04020"	"CHEK2_000088"	"g.29085152A>T"	"5/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085152_A_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752034"	"1"	"50"	"22"	"29085164"	"29085164"	"subst"	"0.000497651"	"04020"	"CHEK2_000286"	"g.29085164C>T"	"9/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085164_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752035"	"1"	"50"	"22"	"29085176"	"29085176"	"subst"	"0.000227009"	"04020"	"CHEK2_000255"	"g.29085176C>T"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085176_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752036"	"1"	"50"	"22"	"29085179"	"29085179"	"subst"	"4.36544E-6"	"04020"	"CHEK2_000289"	"g.29085179G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085179_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752037"	"1"	"50"	"22"	"29085195"	"29085195"	"subst"	"2.61945E-5"	"04020"	"CHEK2_000045"	"g.29085195G>T"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085195_G_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752038"	"1"	"50"	"22"	"29090022"	"29090022"	"subst"	"1.74538E-5"	"04020"	"CHEK2_000293"	"g.29090022G>A"	"5/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090022_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752039"	"1"	"50"	"22"	"29090030"	"29090030"	"subst"	"7.85388E-5"	"04020"	"CHEK2_000008"	"g.29090030G>A"	"5/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090030_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752040"	"1"	"50"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"04020"	"CHEK2_000009"	"g.29090054G>A"	"83/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090054_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752041"	"1"	"50"	"22"	"29090061"	"29090061"	"subst"	"1.74534E-5"	"04020"	"CHEK2_000093"	"g.29090061G>A"	"6/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090061_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752042"	"1"	"50"	"22"	"29090098"	"29090098"	"subst"	"8.7276E-6"	"04020"	"CHEK2_000049"	"g.29090098G>C"	"7/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090098_G_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752043"	"1"	"50"	"22"	"29091133"	"29091133"	"subst"	"1.22024E-5"	"04020"	"CHEK2_000097"	"g.29091133C>G"	"15/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091133_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752044"	"1"	"50"	"22"	"29091147"	"29091147"	"subst"	"0.00135029"	"04020"	"CHEK2_000010"	"g.29091147A>C"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091147_A_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752045"	"1"	"50"	"22"	"29091154"	"29091154"	"subst"	"7.32076E-5"	"04020"	"CHEK2_000213"	"g.29091154T>C"	"5/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091154_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752046"	"1"	"50"	"22"	"29091175"	"29091175"	"subst"	"4.06825E-6"	"04020"	"CHEK2_000318"	"g.29091175G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091175_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752047"	"1"	"50"	"22"	"29091178"	"29091178"	"subst"	"0.000390523"	"04020"	"CHEK2_000011"	"g.29091178C>A"	"38/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091178_C_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752048"	"1"	"50"	"22"	"29091207"	"29091207"	"subst"	"0.000476256"	"04020"	"CHEK2_000012"	"g.29091207G>A"	"11/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091207_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752049"	"1"	"50"	"22"	"29091220"	"29091220"	"subst"	"0.000276981"	"04020"	"CHEK2_000214"	"g.29091220A>G"	"5/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091220_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752050"	"1"	"50"	"22"	"29091225"	"29091225"	"subst"	"8.15169E-6"	"04020"	"CHEK2_000185"	"g.29091225C>T"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091225_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752051"	"1"	"50"	"22"	"29091714"	"29091714"	"subst"	"0"	"04020"	"CHEK2_000326"	"g.29091714C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091714_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752052"	"1"	"50"	"22"	"29091722"	"29091722"	"subst"	"0"	"04020"	"CHEK2_000330"	"g.29091722C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091722_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752053"	"1"	"50"	"22"	"29091725"	"29091725"	"subst"	"8.16147E-6"	"04020"	"CHEK2_000200"	"g.29091725C>T"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091725_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752054"	"1"	"50"	"22"	"29091732"	"29091732"	"subst"	"1.22252E-5"	"04020"	"CHEK2_000333"	"g.29091732C>G"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091732_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752055"	"1"	"50"	"22"	"29091732"	"29091732"	"subst"	"0"	"04020"	"CHEK2_000334"	"g.29091732C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091732_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752056"	"1"	"50"	"22"	"29091740"	"29091740"	"subst"	"0.00028901"	"04020"	"CHEK2_000013"	"g.29091740C>T"	"16/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091740_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752057"	"1"	"50"	"22"	"29091741"	"29091741"	"subst"	"5.29032E-5"	"04020"	"CHEK2_000187"	"g.29091741G>A"	"9/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091741_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752058"	"1"	"50"	"22"	"29091742"	"29091742"	"subst"	"7.32422E-5"	"04020"	"CHEK2_000014"	"g.29091742G>T"	"5/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091742_G_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752059"	"1"	"50"	"22"	"29091743"	"29091743"	"subst"	"1.62743E-5"	"04020"	"CHEK2_000337"	"g.29091743T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091743_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752060"	"1"	"50"	"22"	"29091761"	"29091761"	"subst"	"1.62678E-5"	"04020"	"CHEK2_000342"	"g.29091761A>T"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091761_A_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752061"	"1"	"50"	"22"	"29091774"	"29091774"	"subst"	"2.84659E-5"	"04020"	"CHEK2_000344"	"g.29091774C>G"	"11/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091774_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752062"	"1"	"50"	"22"	"29091777"	"29091777"	"subst"	"2.03328E-5"	"04020"	"CHEK2_000345"	"g.29091777C>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091777_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752063"	"1"	"50"	"22"	"29091782"	"29091782"	"subst"	"4.47314E-5"	"04020"	"CHEK2_000015"	"g.29091782G>A"	"15/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091782_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752064"	"1"	"50"	"22"	"29091788"	"29091788"	"subst"	"2.44008E-5"	"04020"	"CHEK2_000348"	"g.29091788T>G"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091788_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752065"	"1"	"50"	"22"	"29091804"	"29091804"	"subst"	"1.22004E-5"	"04020"	"CHEK2_000351"	"g.29091804A>G"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091804_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752066"	"1"	"50"	"22"	"29091810"	"29091810"	"subst"	"0"	"04020"	"CHEK2_000352"	"g.29091810T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091810_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752067"	"1"	"50"	"22"	"29091816"	"29091816"	"subst"	"3.66059E-5"	"04020"	"CHEK2_000016"	"g.29091816T>C"	"5/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091816_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752068"	"1"	"50"	"22"	"29091824"	"29091824"	"subst"	"5.29057E-5"	"04020"	"CHEK2_000355"	"g.29091824G>A"	"9/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091824_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752069"	"1"	"50"	"22"	"29091839"	"29091839"	"subst"	"0"	"04020"	"CHEK2_000356"	"g.29091839T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091839_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752070"	"1"	"50"	"22"	"29091846"	"29091846"	"subst"	"0.00045449"	"04020"	"CHEK2_000054"	"g.29091846G>A"	"44/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091846_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752071"	"1"	"50"	"22"	"29091861"	"29091861"	"subst"	"0"	"04020"	"CHEK2_000359"	"g.29091861T>C"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091861_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752072"	"1"	"50"	"22"	"29092893"	"29092893"	"subst"	"2.43891E-5"	"04020"	"CHEK2_000363"	"g.29092893A>G"	"6/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092893_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752073"	"1"	"50"	"22"	"29092917"	"29092917"	"subst"	"1.62567E-5"	"04020"	"CHEK2_000250"	"g.29092917G>A"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092917_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752074"	"1"	"50"	"22"	"29092931"	"29092931"	"subst"	"8.94011E-5"	"04020"	"CHEK2_000058"	"g.29092931C>A"	"10/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092931_C_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752075"	"1"	"50"	"22"	"29092945"	"29092945"	"subst"	"1.6257E-5"	"04020"	"CHEK2_000374"	"g.29092945C>T"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092945_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752076"	"1"	"50"	"22"	"29092947"	"29092947"	"subst"	"8.12909E-6"	"04020"	"CHEK2_000244"	"g.29092947C>T"	"6/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092947_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752077"	"1"	"50"	"22"	"29092948"	"29092948"	"subst"	"5.28421E-5"	"04020"	"CHEK2_000114"	"g.29092948G>A"	"10/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092948_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752078"	"1"	"50"	"22"	"29092951"	"29092951"	"subst"	"4.06537E-6"	"04020"	"CHEK2_000376"	"g.29092951G>A"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092951_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752079"	"1"	"50"	"22"	"29092962"	"29092962"	"subst"	"1.62632E-5"	"04020"	"CHEK2_000059"	"g.29092962T>G"	"13/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092962_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752080"	"1"	"50"	"22"	"29095831"	"29095831"	"subst"	"4.06138E-6"	"04020"	"CHEK2_000060"	"g.29095831C>G"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095831_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752081"	"1"	"50"	"22"	"29095854"	"29095854"	"subst"	"1.62438E-5"	"04020"	"CHEK2_000061"	"g.29095854T>C"	"5/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095854_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752082"	"1"	"50"	"22"	"29095860"	"29095860"	"subst"	"8.12143E-6"	"04020"	"CHEK2_000386"	"g.29095860T>A"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095860_T_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752083"	"1"	"50"	"22"	"29095861"	"29095861"	"subst"	"0"	"04020"	"CHEK2_000387"	"g.29095861T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095861_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752084"	"1"	"50"	"22"	"29095881"	"29095881"	"subst"	"4.46682E-5"	"04020"	"CHEK2_000251"	"g.29095881C>T"	"13/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095881_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752085"	"1"	"50"	"22"	"29095897"	"29095897"	"subst"	"6.49746E-5"	"04020"	"CHEK2_000394"	"g.29095897C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095897_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752086"	"1"	"50"	"22"	"29095903"	"29095903"	"subst"	"2.84303E-5"	"04020"	"CHEK2_000396"	"g.29095903C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095903_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752087"	"1"	"50"	"22"	"29095914"	"29095914"	"subst"	"0"	"04020"	"CHEK2_000398"	"g.29095914C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095914_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752088"	"1"	"50"	"22"	"29095917"	"29095917"	"subst"	"4.47191E-5"	"04020"	"CHEK2_000190"	"g.29095917C>G"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095917_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752089"	"1"	"50"	"22"	"29095918"	"29095918"	"subst"	"8.1318E-6"	"04020"	"CHEK2_000402"	"g.29095918C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095918_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752090"	"1"	"50"	"22"	"29095919"	"29095919"	"subst"	"1.62655E-5"	"04020"	"CHEK2_000403"	"g.29095919T>G"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095919_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752091"	"1"	"50"	"22"	"29099495"	"29099495"	"subst"	"3.03027E-5"	"04020"	"CHEK2_000406"	"g.29099495T>G"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099495_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752092"	"1"	"50"	"22"	"29099515"	"29099515"	"subst"	"0"	"04020"	"CHEK2_000120"	"g.29099515C>A"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099515_C_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752093"	"1"	"50"	"22"	"29099545"	"29099545"	"subst"	"0"	"04020"	"CHEK2_000419"	"g.29099545T>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099545_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752094"	"1"	"50"	"22"	"29106001"	"29106001"	"subst"	"0"	"04020"	"CHEK2_000125"	"g.29106001A>C"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106001_A_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752095"	"1"	"50"	"22"	"29106017"	"29106017"	"subst"	"1.22317E-5"	"04020"	"CHEK2_000430"	"g.29106017C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106017_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752096"	"1"	"50"	"22"	"29106019"	"29106019"	"subst"	"0"	"04020"	"CHEK2_000432"	"g.29106019A>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106019_A_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752097"	"1"	"50"	"22"	"29106038"	"29106038"	"subst"	"0"	"04020"	"CHEK2_000438"	"g.29106038G>A"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106038_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752098"	"1"	"50"	"22"	"29106040"	"29106040"	"subst"	"0"	"04020"	"CHEK2_000439"	"g.29106040G>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106040_G_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752099"	"1"	"50"	"22"	"29107934"	"29107934"	"subst"	"6.09459E-5"	"04020"	"CHEK2_000128"	"g.29107934C>T"	"5/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107934_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752100"	"1"	"50"	"22"	"29107950"	"29107950"	"subst"	"0"	"04020"	"CHEK2_000458"	"g.29107950C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107950_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752101"	"1"	"50"	"22"	"29107962"	"29107962"	"subst"	"1.21869E-5"	"04020"	"CHEK2_000464"	"g.29107962A>G"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107962_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752102"	"1"	"50"	"22"	"29107964"	"29107964"	"subst"	"4.06273E-6"	"04020"	"CHEK2_000465"	"g.29107964G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107964_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752103"	"1"	"50"	"22"	"29107974"	"29107974"	"subst"	"7.7195E-5"	"04020"	"CHEK2_000194"	"g.29107974C>T"	"18/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107974_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752104"	"1"	"50"	"22"	"29115401"	"29115401"	"subst"	"9.00293E-6"	"04020"	"CHEK2_000484"	"g.29115401A>G"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115401_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752105"	"1"	"50"	"22"	"29115405"	"29115405"	"subst"	"0"	"04020"	"CHEK2_000019"	"g.29115405T>C"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115405_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752106"	"1"	"50"	"22"	"29115422"	"29115422"	"subst"	"0"	"04020"	"CHEK2_000488"	"g.29115422G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115422_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752107"	"1"	"50"	"22"	"29115434"	"29115434"	"subst"	"0"	"04020"	"CHEK2_000491"	"g.29115434A>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115434_A_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752108"	"1"	"50"	"22"	"29115437"	"29115437"	"subst"	"1.32613E-5"	"04020"	"CHEK2_000492"	"g.29115437G>A"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115437_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752109"	"1"	"50"	"22"	"29115452"	"29115452"	"subst"	"0"	"04020"	"CHEK2_000498"	"g.29115452G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115452_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752110"	"1"	"50"	"22"	"29115453"	"29115453"	"subst"	"0"	"04020"	"CHEK2_000499"	"g.29115453T>A"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115453_T_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752111"	"1"	"50"	"22"	"29115459"	"29115459"	"subst"	"0"	"04020"	"CHEK2_000502"	"g.29115459C>A"	"29/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115459_C_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752112"	"1"	"50"	"22"	"29115462"	"29115462"	"subst"	"0"	"04020"	"CHEK2_000503"	"g.29115462A>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115462_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752113"	"1"	"50"	"22"	"29121000"	"29121000"	"subst"	"3.24907E-5"	"04020"	"CHEK2_000020"	"g.29121000T>C"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121000_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752114"	"1"	"50"	"22"	"29121001"	"29121001"	"subst"	"5.68579E-5"	"04020"	"CHEK2_000067"	"g.29121001T>G"	"27/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121001_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752115"	"1"	"50"	"22"	"29121009"	"29121009"	"subst"	"0"	"04020"	"CHEK2_000176"	"g.29121009A>G"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121009_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752116"	"1"	"50"	"22"	"29121013"	"29121013"	"subst"	"4.06144E-6"	"04020"	"CHEK2_000516"	"g.29121013G>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121013_G_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752117"	"1"	"50"	"22"	"29121015"	"29121015"	"subst"	"0.000129966"	"04020"	"CHEK2_000138"	"g.29121015C>T"	"34/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121015_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752118"	"1"	"50"	"22"	"29121016"	"29121016"	"subst"	"0.000113725"	"04020"	"CHEK2_000021"	"g.29121016G>A"	"6/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121016_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752119"	"1"	"50"	"22"	"29121018"	"29121018"	"subst"	"6.09226E-5"	"04020"	"CHEK2_000068"	"g.29121018C>T"	"15/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121018_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752120"	"1"	"50"	"22"	"29121027"	"29121027"	"subst"	"0"	"04020"	"CHEK2_000517"	"g.29121027T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121027_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752121"	"1"	"50"	"22"	"29121037"	"29121037"	"subst"	"8.12275E-6"	"04020"	"CHEK2_000520"	"g.29121037G>A"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121037_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752122"	"1"	"50"	"22"	"29121050"	"29121050"	"subst"	"8.12301E-6"	"04020"	"CHEK2_000070"	"g.29121050A>C"	"7/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121050_A_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752123"	"1"	"50"	"22"	"29121058"	"29121058"	"subst"	"2.84301E-5"	"04020"	"CHEK2_000178"	"g.29121058C>T"	"17/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121058_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752124"	"1"	"50"	"22"	"29121075"	"29121075"	"subst"	"4.06171E-6"	"04020"	"CHEK2_000025"	"g.29121075T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121075_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752125"	"1"	"50"	"22"	"29121077"	"29121077"	"subst"	"0.000121847"	"04020"	"CHEK2_000203"	"g.29121077T>C"	"7/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121077_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752126"	"1"	"50"	"22"	"29121085"	"29121085"	"subst"	"4.06157E-6"	"04020"	"CHEK2_000530"	"g.29121085C>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121085_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752127"	"1"	"50"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"04020"	"CHEK2_000072"	"g.29121230C>T"	"66/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121230_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752128"	"1"	"50"	"22"	"29121239"	"29121239"	"subst"	"1.21917E-5"	"04020"	"CHEK2_000226"	"g.29121239T>G"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121239_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752129"	"1"	"50"	"22"	"29121241"	"29121241"	"subst"	"1.21921E-5"	"04020"	"CHEK2_000143"	"g.29121241C>T"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121241_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752130"	"1"	"50"	"22"	"29121242"	"29121242"	"subst"	"4.47053E-5"	"04020"	"CHEK2_000034"	"g.29121242G>A"	"20/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121242_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752131"	"1"	"50"	"22"	"29121247"	"29121247"	"subst"	"0"	"04020"	"CHEK2_000035"	"g.29121247T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121247_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752132"	"1"	"50"	"22"	"29121265"	"29121265"	"subst"	"0.000178802"	"04020"	"CHEK2_000144"	"g.29121265C>T"	"34/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121265_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752133"	"1"	"50"	"22"	"29121266"	"29121266"	"subst"	"2.43827E-5"	"04020"	"CHEK2_000145"	"g.29121266G>A"	"6/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121266_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752134"	"1"	"50"	"22"	"29121292"	"29121292"	"subst"	"0"	"04020"	"CHEK2_000542"	"g.29121292G>A"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121292_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752135"	"1"	"50"	"22"	"29121307"	"29121307"	"subst"	"8.12783E-6"	"04020"	"CHEK2_000544"	"g.29121307T>C"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121307_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752136"	"1"	"50"	"22"	"29121326"	"29121326"	"subst"	"0.000117887"	"04020"	"CHEK2_000033"	"g.29121326T>C"	"73/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121326_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752137"	"1"	"50"	"22"	"29121339"	"29121339"	"subst"	"0"	"04020"	"CHEK2_000549"	"g.29121339G>C"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121339_G_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752138"	"1"	"50"	"22"	"29121353"	"29121353"	"subst"	"0"	"04020"	"CHEK2_000553"	"g.29121353A>G"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121353_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752139"	"1"	"50"	"22"	"29130389"	"29130389"	"subst"	"7.31654E-5"	"04020"	"CHEK2_000554"	"g.29130389A>T"	"20/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130389_A_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752140"	"1"	"50"	"22"	"29130391"	"29130391"	"subst"	"1.21965E-5"	"04020"	"CHEK2_000556"	"g.29130391C>T"	"3/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130391_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752141"	"1"	"50"	"22"	"29130427"	"29130427"	"subst"	"8.12466E-6"	"04020"	"CHEK2_000027"	"g.29130427G>A"	"8/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130427_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752142"	"1"	"50"	"22"	"29130441"	"29130441"	"subst"	"1.21867E-5"	"04020"	"CHEK2_000562"	"g.29130441G>A"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130441_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752143"	"1"	"50"	"22"	"29130454"	"29130454"	"subst"	"0"	"04020"	"CHEK2_000564"	"g.29130454C>G"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130454_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752144"	"1"	"50"	"22"	"29130456"	"29130456"	"subst"	"0.000901699"	"04020"	"CHEK2_000029"	"g.29130456G>A"	"15/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130456_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752145"	"1"	"50"	"22"	"29130456"	"29130456"	"subst"	"1.21851E-5"	"04020"	"CHEK2_000565"	"g.29130456G>C"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130456_G_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752146"	"1"	"50"	"22"	"29130471"	"29130471"	"subst"	"0"	"04020"	"CHEK2_000229"	"g.29130471G>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130471_G_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752147"	"1"	"50"	"22"	"29130495"	"29130495"	"subst"	"2.03052E-5"	"04020"	"CHEK2_000159"	"g.29130495T>C"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130495_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752148"	"1"	"50"	"22"	"29130520"	"29130520"	"subst"	"0.00015432"	"04020"	"CHEK2_000075"	"g.29130520C>T"	"66/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130520_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752149"	"1"	"50"	"22"	"29130534"	"29130534"	"subst"	"0"	"04020"	"CHEK2_000571"	"g.29130534G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130534_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752150"	"1"	"50"	"22"	"29130534"	"29130534"	"subst"	"1.62455E-5"	"04020"	"CHEK2_000076"	"g.29130534G>T"	"5/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130534_G_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752151"	"1"	"50"	"22"	"29130553"	"29130553"	"subst"	"4.06197E-5"	"04020"	"CHEK2_000575"	"g.29130553A>T"	"5/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130553_A_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752152"	"1"	"50"	"22"	"29130576"	"29130576"	"subst"	"2.03257E-5"	"04020"	"CHEK2_000030"	"g.29130576G>A"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130576_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752153"	"1"	"50"	"22"	"29130588"	"29130588"	"subst"	"0"	"04020"	"CHEK2_000584"	"g.29130588G>A"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130588_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752154"	"1"	"50"	"22"	"29130636"	"29130636"	"subst"	"4.51987E-5"	"04020"	"CHEK2_000594"	"g.29130636A>G"	"7/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130636_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752155"	"1"	"50"	"22"	"29130637"	"29130637"	"subst"	"1.23326E-5"	"04020"	"CHEK2_000595"	"g.29130637C>T"	"2/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130637_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752156"	"1"	"50"	"22"	"29130645"	"29130645"	"subst"	"0"	"04020"	"CHEK2_000031"	"g.29130645T>C"	"4/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130645_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752157"	"1"	"50"	"22"	"29130691"	"29130691"	"subst"	"0"	"04020"	"CHEK2_000604"	"g.29130691C>T"	"1/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130691_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752158"	"1"	"50"	"22"	"29130696"	"29130696"	"subst"	"6.67089E-5"	"04020"	"CHEK2_000605"	"g.29130696G>A"	"15/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130696_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000752159"	"1"	"50"	"22"	"29130703"	"29130703"	"subst"	"0.000288105"	"04020"	"CHEK2_000610"	"g.29130703G>A"	"7/60466 cases"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130703_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000754852"	"1"	"50"	"22"	"29091122"	"29091122"	"dup"	"0"	"04020"	"CHEK2_000164"	"g.29091122dup"	"5/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091121_C_CT"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000754853"	"1"	"50"	"22"	"29091228"	"29091228"	"del"	"0"	"04020"	"CHEK2_000325"	"g.29091228del"	"5/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091226_TA_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000754854"	"1"	"50"	"22"	"29091734"	"29091758"	"del"	"0"	"04020"	"CHEK2_000335"	"g.29091734_29091758del"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091723_TCCAGCAGTCCACAGCACGGTTATAC_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000754855"	"1"	"50"	"22"	"29099502"	"29099502"	"del"	"0"	"04020"	"CHEK2_000252"	"g.29099502del"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099498_CA_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000754856"	"1"	"50"	"22"	"29099529"	"29099530"	"del"	"0"	"04020"	"CHEK2_000416"	"g.29099529_29099530del"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099524_CAA_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000755050"	"1"	"50"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"04020"	"CHEK2_000001"	"g.29091857del"	"254/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091856_AG_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756796"	"1"	"50"	"22"	"29083913"	"29083913"	"subst"	"0"	"04020"	"CHEK2_000040"	"g.29083913C>T"	"9/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083913_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756797"	"1"	"50"	"22"	"29083920"	"29083920"	"subst"	"0"	"04020"	"CHEK2_000080"	"g.29083920T>C"	"21/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083920_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756798"	"1"	"50"	"22"	"29083935"	"29083935"	"subst"	"0"	"04020"	"CHEK2_000207"	"g.29083935C>T"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083935_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756799"	"1"	"50"	"22"	"29083950"	"29083950"	"subst"	"0"	"04020"	"CHEK2_000083"	"g.29083950G>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083950_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756800"	"1"	"50"	"22"	"29083956"	"29083956"	"subst"	"0"	"04020"	"CHEK2_000085"	"g.29083956G>A"	"5/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083956_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756801"	"1"	"50"	"22"	"29083961"	"29083961"	"subst"	"0"	"04020"	"CHEK2_000036"	"g.29083961C>A"	"7/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083961_C_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756802"	"1"	"50"	"22"	"29083961"	"29083961"	"subst"	"0"	"04020"	"CHEK2_000272"	"g.29083961C>T"	"4/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29083961_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756803"	"1"	"50"	"22"	"29085123"	"29085123"	"subst"	"4.36731E-6"	"04020"	"CHEK2_000275"	"g.29085123C>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085123_C_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756804"	"1"	"50"	"22"	"29085139"	"29085139"	"subst"	"2.18259E-5"	"04020"	"CHEK2_000279"	"g.29085139G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085139_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756805"	"1"	"50"	"22"	"29085140"	"29085140"	"subst"	"8.29448E-5"	"04020"	"CHEK2_000043"	"g.29085140G>A"	"23/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085140_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756806"	"1"	"50"	"22"	"29085143"	"29085143"	"subst"	"1.30955E-5"	"04020"	"CHEK2_000280"	"g.29085143G>C"	"4/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085143_G_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756807"	"1"	"50"	"22"	"29085152"	"29085152"	"subst"	"7.42079E-5"	"04020"	"CHEK2_000088"	"g.29085152A>T"	"4/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085152_A_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756808"	"1"	"50"	"22"	"29085164"	"29085164"	"subst"	"0.000497651"	"04020"	"CHEK2_000286"	"g.29085164C>T"	"7/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085164_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756809"	"1"	"50"	"22"	"29085176"	"29085176"	"subst"	"0.000227009"	"04020"	"CHEK2_000255"	"g.29085176C>T"	"5/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085176_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756810"	"1"	"50"	"22"	"29085179"	"29085179"	"subst"	"4.36544E-6"	"04020"	"CHEK2_000289"	"g.29085179G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085179_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756811"	"1"	"50"	"22"	"29085195"	"29085195"	"subst"	"2.61945E-5"	"04020"	"CHEK2_000045"	"g.29085195G>T"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29085195_G_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756812"	"1"	"50"	"22"	"29090022"	"29090022"	"subst"	"1.74538E-5"	"04020"	"CHEK2_000293"	"g.29090022G>A"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090022_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756813"	"1"	"50"	"22"	"29090030"	"29090030"	"subst"	"7.85388E-5"	"04020"	"CHEK2_000008"	"g.29090030G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090030_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756814"	"1"	"50"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"04020"	"CHEK2_000009"	"g.29090054G>A"	"45/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090054_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756815"	"1"	"50"	"22"	"29090061"	"29090061"	"subst"	"1.74534E-5"	"04020"	"CHEK2_000093"	"g.29090061G>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090061_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756816"	"1"	"50"	"22"	"29090098"	"29090098"	"subst"	"8.7276E-6"	"04020"	"CHEK2_000049"	"g.29090098G>C"	"5/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29090098_G_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756817"	"1"	"50"	"22"	"29091133"	"29091133"	"subst"	"1.22024E-5"	"04020"	"CHEK2_000097"	"g.29091133C>G"	"11/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091133_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756818"	"1"	"50"	"22"	"29091147"	"29091147"	"subst"	"0.00135029"	"04020"	"CHEK2_000010"	"g.29091147A>C"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091147_A_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756819"	"1"	"50"	"22"	"29091154"	"29091154"	"subst"	"7.32076E-5"	"04020"	"CHEK2_000213"	"g.29091154T>C"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091154_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756820"	"1"	"50"	"22"	"29091175"	"29091175"	"subst"	"4.06825E-6"	"04020"	"CHEK2_000318"	"g.29091175G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091175_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756821"	"1"	"50"	"22"	"29091178"	"29091178"	"subst"	"0.000390523"	"04020"	"CHEK2_000011"	"g.29091178C>A"	"27/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091178_C_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756822"	"1"	"50"	"22"	"29091207"	"29091207"	"subst"	"0.000476256"	"04020"	"CHEK2_000012"	"g.29091207G>A"	"14/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091207_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756823"	"1"	"50"	"22"	"29091220"	"29091220"	"subst"	"0.000276981"	"04020"	"CHEK2_000214"	"g.29091220A>G"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091220_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756824"	"1"	"50"	"22"	"29091225"	"29091225"	"subst"	"8.15169E-6"	"04020"	"CHEK2_000185"	"g.29091225C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091225_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756825"	"1"	"50"	"22"	"29091714"	"29091714"	"subst"	"0"	"04020"	"CHEK2_000326"	"g.29091714C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091714_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756826"	"1"	"50"	"22"	"29091722"	"29091722"	"subst"	"0"	"04020"	"CHEK2_000330"	"g.29091722C>T"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091722_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756827"	"1"	"50"	"22"	"29091725"	"29091725"	"subst"	"8.16147E-6"	"04020"	"CHEK2_000200"	"g.29091725C>T"	"4/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091725_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756828"	"1"	"50"	"22"	"29091732"	"29091732"	"subst"	"1.22252E-5"	"04020"	"CHEK2_000333"	"g.29091732C>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091732_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756829"	"1"	"50"	"22"	"29091732"	"29091732"	"subst"	"0"	"04020"	"CHEK2_000334"	"g.29091732C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091732_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756830"	"1"	"50"	"22"	"29091740"	"29091740"	"subst"	"0.00028901"	"04020"	"CHEK2_000013"	"g.29091740C>T"	"12/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091740_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756831"	"1"	"50"	"22"	"29091741"	"29091741"	"subst"	"5.29032E-5"	"04020"	"CHEK2_000187"	"g.29091741G>A"	"9/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091741_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756832"	"1"	"50"	"22"	"29091742"	"29091742"	"subst"	"7.32422E-5"	"04020"	"CHEK2_000014"	"g.29091742G>T"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091742_G_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756833"	"1"	"50"	"22"	"29091743"	"29091743"	"subst"	"1.62743E-5"	"04020"	"CHEK2_000337"	"g.29091743T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091743_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756834"	"1"	"50"	"22"	"29091761"	"29091761"	"subst"	"1.62678E-5"	"04020"	"CHEK2_000342"	"g.29091761A>T"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091761_A_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756835"	"1"	"50"	"22"	"29091774"	"29091774"	"subst"	"2.84659E-5"	"04020"	"CHEK2_000344"	"g.29091774C>G"	"7/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091774_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756836"	"1"	"50"	"22"	"29091777"	"29091777"	"subst"	"2.03328E-5"	"04020"	"CHEK2_000345"	"g.29091777C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091777_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756837"	"1"	"50"	"22"	"29091782"	"29091782"	"subst"	"4.47314E-5"	"04020"	"CHEK2_000015"	"g.29091782G>A"	"4/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091782_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756838"	"1"	"50"	"22"	"29091788"	"29091788"	"subst"	"2.44008E-5"	"04020"	"CHEK2_000348"	"g.29091788T>G"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091788_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756839"	"1"	"50"	"22"	"29091804"	"29091804"	"subst"	"1.22004E-5"	"04020"	"CHEK2_000351"	"g.29091804A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091804_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756840"	"1"	"50"	"22"	"29091810"	"29091810"	"subst"	"0"	"04020"	"CHEK2_000352"	"g.29091810T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091810_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756841"	"1"	"50"	"22"	"29091816"	"29091816"	"subst"	"3.66059E-5"	"04020"	"CHEK2_000016"	"g.29091816T>C"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091816_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756842"	"1"	"50"	"22"	"29091824"	"29091824"	"subst"	"5.29057E-5"	"04020"	"CHEK2_000355"	"g.29091824G>A"	"7/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091824_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756843"	"1"	"50"	"22"	"29091839"	"29091839"	"subst"	"0"	"04020"	"CHEK2_000356"	"g.29091839T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091839_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756844"	"1"	"50"	"22"	"29091846"	"29091846"	"subst"	"0.00045449"	"04020"	"CHEK2_000054"	"g.29091846G>A"	"50/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091846_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756845"	"1"	"50"	"22"	"29091861"	"29091861"	"subst"	"0"	"04020"	"CHEK2_000359"	"g.29091861T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29091861_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756846"	"1"	"50"	"22"	"29092893"	"29092893"	"subst"	"2.43891E-5"	"04020"	"CHEK2_000363"	"g.29092893A>G"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092893_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756847"	"1"	"50"	"22"	"29092917"	"29092917"	"subst"	"1.62567E-5"	"04020"	"CHEK2_000250"	"g.29092917G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092917_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756848"	"1"	"50"	"22"	"29092931"	"29092931"	"subst"	"8.94011E-5"	"04020"	"CHEK2_000058"	"g.29092931C>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092931_C_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756849"	"1"	"50"	"22"	"29092945"	"29092945"	"subst"	"1.6257E-5"	"04020"	"CHEK2_000374"	"g.29092945C>T"	"4/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092945_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756850"	"1"	"50"	"22"	"29092947"	"29092947"	"subst"	"8.12909E-6"	"04020"	"CHEK2_000244"	"g.29092947C>T"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092947_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756851"	"1"	"50"	"22"	"29092948"	"29092948"	"subst"	"5.28421E-5"	"04020"	"CHEK2_000114"	"g.29092948G>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092948_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756852"	"1"	"50"	"22"	"29092951"	"29092951"	"subst"	"4.06537E-6"	"04020"	"CHEK2_000376"	"g.29092951G>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092951_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756853"	"1"	"50"	"22"	"29092962"	"29092962"	"subst"	"1.62632E-5"	"04020"	"CHEK2_000059"	"g.29092962T>G"	"6/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29092962_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756854"	"1"	"50"	"22"	"29095831"	"29095831"	"subst"	"4.06138E-6"	"04020"	"CHEK2_000060"	"g.29095831C>G"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095831_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756855"	"1"	"50"	"22"	"29095854"	"29095854"	"subst"	"1.62438E-5"	"04020"	"CHEK2_000061"	"g.29095854T>C"	"5/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095854_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756856"	"1"	"50"	"22"	"29095860"	"29095860"	"subst"	"8.12143E-6"	"04020"	"CHEK2_000386"	"g.29095860T>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095860_T_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756857"	"1"	"50"	"22"	"29095861"	"29095861"	"subst"	"0"	"04020"	"CHEK2_000387"	"g.29095861T>C"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095861_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756858"	"1"	"50"	"22"	"29095881"	"29095881"	"subst"	"4.46682E-5"	"04020"	"CHEK2_000251"	"g.29095881C>T"	"5/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095881_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756859"	"1"	"50"	"22"	"29095897"	"29095897"	"subst"	"6.49746E-5"	"04020"	"CHEK2_000394"	"g.29095897C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095897_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756860"	"1"	"50"	"22"	"29095903"	"29095903"	"subst"	"2.84303E-5"	"04020"	"CHEK2_000396"	"g.29095903C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095903_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756861"	"1"	"50"	"22"	"29095914"	"29095914"	"subst"	"0"	"04020"	"CHEK2_000398"	"g.29095914C>T"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095914_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756862"	"1"	"50"	"22"	"29095917"	"29095917"	"subst"	"4.47191E-5"	"04020"	"CHEK2_000190"	"g.29095917C>G"	"5/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095917_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756863"	"1"	"50"	"22"	"29095918"	"29095918"	"subst"	"8.1318E-6"	"04020"	"CHEK2_000402"	"g.29095918C>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095918_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756864"	"1"	"50"	"22"	"29095919"	"29095919"	"subst"	"1.62655E-5"	"04020"	"CHEK2_000403"	"g.29095919T>G"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29095919_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756865"	"1"	"50"	"22"	"29099495"	"29099495"	"subst"	"3.03027E-5"	"04020"	"CHEK2_000406"	"g.29099495T>G"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099495_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756866"	"1"	"50"	"22"	"29099515"	"29099515"	"subst"	"0"	"04020"	"CHEK2_000120"	"g.29099515C>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099515_C_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756867"	"1"	"50"	"22"	"29099545"	"29099545"	"subst"	"0"	"04020"	"CHEK2_000419"	"g.29099545T>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29099545_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756868"	"1"	"50"	"22"	"29106001"	"29106001"	"subst"	"0"	"04020"	"CHEK2_000125"	"g.29106001A>C"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106001_A_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756869"	"1"	"50"	"22"	"29106017"	"29106017"	"subst"	"1.22317E-5"	"04020"	"CHEK2_000430"	"g.29106017C>G"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106017_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756870"	"1"	"50"	"22"	"29106019"	"29106019"	"subst"	"0"	"04020"	"CHEK2_000432"	"g.29106019A>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106019_A_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756871"	"1"	"50"	"22"	"29106038"	"29106038"	"subst"	"0"	"04020"	"CHEK2_000438"	"g.29106038G>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106038_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756872"	"1"	"50"	"22"	"29106040"	"29106040"	"subst"	"0"	"04020"	"CHEK2_000439"	"g.29106040G>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29106040_G_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756873"	"1"	"50"	"22"	"29107934"	"29107934"	"subst"	"6.09459E-5"	"04020"	"CHEK2_000128"	"g.29107934C>T"	"4/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107934_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756874"	"1"	"50"	"22"	"29107950"	"29107950"	"subst"	"0"	"04020"	"CHEK2_000458"	"g.29107950C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107950_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756875"	"1"	"50"	"22"	"29107962"	"29107962"	"subst"	"1.21869E-5"	"04020"	"CHEK2_000464"	"g.29107962A>G"	"8/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107962_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756876"	"1"	"50"	"22"	"29107964"	"29107964"	"subst"	"4.06273E-6"	"04020"	"CHEK2_000465"	"g.29107964G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107964_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756877"	"1"	"50"	"22"	"29107974"	"29107974"	"subst"	"7.7195E-5"	"04020"	"CHEK2_000194"	"g.29107974C>T"	"7/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29107974_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756878"	"1"	"50"	"22"	"29115401"	"29115401"	"subst"	"9.00293E-6"	"04020"	"CHEK2_000484"	"g.29115401A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115401_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756879"	"1"	"50"	"22"	"29115405"	"29115405"	"subst"	"0"	"04020"	"CHEK2_000019"	"g.29115405T>C"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115405_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756880"	"1"	"50"	"22"	"29115422"	"29115422"	"subst"	"0"	"04020"	"CHEK2_000488"	"g.29115422G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115422_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756881"	"1"	"50"	"22"	"29115434"	"29115434"	"subst"	"0"	"04020"	"CHEK2_000491"	"g.29115434A>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115434_A_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756882"	"1"	"50"	"22"	"29115437"	"29115437"	"subst"	"1.32613E-5"	"04020"	"CHEK2_000492"	"g.29115437G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115437_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756883"	"1"	"50"	"22"	"29115452"	"29115452"	"subst"	"0"	"04020"	"CHEK2_000498"	"g.29115452G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115452_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756884"	"1"	"50"	"22"	"29115453"	"29115453"	"subst"	"0"	"04020"	"CHEK2_000499"	"g.29115453T>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115453_T_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756885"	"1"	"50"	"22"	"29115459"	"29115459"	"subst"	"0"	"04020"	"CHEK2_000502"	"g.29115459C>A"	"26/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115459_C_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756886"	"1"	"50"	"22"	"29115462"	"29115462"	"subst"	"0"	"04020"	"CHEK2_000503"	"g.29115462A>G"	"4/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29115462_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756887"	"1"	"50"	"22"	"29121000"	"29121000"	"subst"	"3.24907E-5"	"04020"	"CHEK2_000020"	"g.29121000T>C"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121000_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756888"	"1"	"50"	"22"	"29121001"	"29121001"	"subst"	"5.68579E-5"	"04020"	"CHEK2_000067"	"g.29121001T>G"	"15/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121001_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756889"	"1"	"50"	"22"	"29121009"	"29121009"	"subst"	"0"	"04020"	"CHEK2_000176"	"g.29121009A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121009_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756890"	"1"	"50"	"22"	"29121013"	"29121013"	"subst"	"4.06144E-6"	"04020"	"CHEK2_000516"	"g.29121013G>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121013_G_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756891"	"1"	"50"	"22"	"29121015"	"29121015"	"subst"	"0.000129966"	"04020"	"CHEK2_000138"	"g.29121015C>T"	"26/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121015_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756892"	"1"	"50"	"22"	"29121016"	"29121016"	"subst"	"0.000113725"	"04020"	"CHEK2_000021"	"g.29121016G>A"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121016_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756893"	"1"	"50"	"22"	"29121018"	"29121018"	"subst"	"6.09226E-5"	"04020"	"CHEK2_000068"	"g.29121018C>T"	"9/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121018_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756894"	"1"	"50"	"22"	"29121027"	"29121027"	"subst"	"0"	"04020"	"CHEK2_000517"	"g.29121027T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121027_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756895"	"1"	"50"	"22"	"29121037"	"29121037"	"subst"	"8.12275E-6"	"04020"	"CHEK2_000520"	"g.29121037G>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121037_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756896"	"1"	"50"	"22"	"29121050"	"29121050"	"subst"	"8.12301E-6"	"04020"	"CHEK2_000070"	"g.29121050A>C"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121050_A_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756897"	"1"	"50"	"22"	"29121058"	"29121058"	"subst"	"2.84301E-5"	"04020"	"CHEK2_000178"	"g.29121058C>T"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121058_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756898"	"1"	"50"	"22"	"29121075"	"29121075"	"subst"	"4.06171E-6"	"04020"	"CHEK2_000025"	"g.29121075T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121075_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756899"	"1"	"50"	"22"	"29121077"	"29121077"	"subst"	"0.000121847"	"04020"	"CHEK2_000203"	"g.29121077T>C"	"4/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121077_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756900"	"1"	"50"	"22"	"29121085"	"29121085"	"subst"	"4.06157E-6"	"04020"	"CHEK2_000530"	"g.29121085C>T"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121085_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756901"	"1"	"50"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"04020"	"CHEK2_000072"	"g.29121230C>T"	"28/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121230_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756902"	"1"	"50"	"22"	"29121239"	"29121239"	"subst"	"1.21917E-5"	"04020"	"CHEK2_000226"	"g.29121239T>G"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121239_T_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756903"	"1"	"50"	"22"	"29121241"	"29121241"	"subst"	"1.21921E-5"	"04020"	"CHEK2_000143"	"g.29121241C>T"	"7/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121241_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756904"	"1"	"50"	"22"	"29121242"	"29121242"	"subst"	"4.47053E-5"	"04020"	"CHEK2_000034"	"g.29121242G>A"	"9/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121242_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756905"	"1"	"50"	"22"	"29121247"	"29121247"	"subst"	"0"	"04020"	"CHEK2_000035"	"g.29121247T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121247_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756906"	"1"	"50"	"22"	"29121265"	"29121265"	"subst"	"0.000178802"	"04020"	"CHEK2_000144"	"g.29121265C>T"	"13/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121265_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756907"	"1"	"50"	"22"	"29121266"	"29121266"	"subst"	"2.43827E-5"	"04020"	"CHEK2_000145"	"g.29121266G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121266_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756908"	"1"	"50"	"22"	"29121292"	"29121292"	"subst"	"0"	"04020"	"CHEK2_000542"	"g.29121292G>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121292_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756909"	"1"	"50"	"22"	"29121307"	"29121307"	"subst"	"8.12783E-6"	"04020"	"CHEK2_000544"	"g.29121307T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121307_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756910"	"1"	"50"	"22"	"29121326"	"29121326"	"subst"	"0.000117887"	"04020"	"CHEK2_000033"	"g.29121326T>C"	"22/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121326_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756911"	"1"	"50"	"22"	"29121339"	"29121339"	"subst"	"0"	"04020"	"CHEK2_000549"	"g.29121339G>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121339_G_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756912"	"1"	"50"	"22"	"29121353"	"29121353"	"subst"	"0"	"04020"	"CHEK2_000553"	"g.29121353A>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29121353_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756913"	"1"	"50"	"22"	"29130389"	"29130389"	"subst"	"7.31654E-5"	"04020"	"CHEK2_000554"	"g.29130389A>T"	"7/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130389_A_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756914"	"1"	"50"	"22"	"29130391"	"29130391"	"subst"	"1.21965E-5"	"04020"	"CHEK2_000556"	"g.29130391C>T"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130391_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756915"	"1"	"50"	"22"	"29130427"	"29130427"	"subst"	"8.12466E-6"	"04020"	"CHEK2_000027"	"g.29130427G>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130427_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756916"	"1"	"50"	"22"	"29130441"	"29130441"	"subst"	"1.21867E-5"	"04020"	"CHEK2_000562"	"g.29130441G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130441_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756917"	"1"	"50"	"22"	"29130454"	"29130454"	"subst"	"0"	"04020"	"CHEK2_000564"	"g.29130454C>G"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130454_C_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756918"	"1"	"50"	"22"	"29130456"	"29130456"	"subst"	"0.000901699"	"04020"	"CHEK2_000029"	"g.29130456G>A"	"5/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130456_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756919"	"1"	"50"	"22"	"29130456"	"29130456"	"subst"	"1.21851E-5"	"04020"	"CHEK2_000565"	"g.29130456G>C"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130456_G_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756920"	"1"	"50"	"22"	"29130471"	"29130471"	"subst"	"0"	"04020"	"CHEK2_000229"	"g.29130471G>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130471_G_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756921"	"1"	"50"	"22"	"29130495"	"29130495"	"subst"	"2.03052E-5"	"04020"	"CHEK2_000159"	"g.29130495T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130495_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756922"	"1"	"50"	"22"	"29130520"	"29130520"	"subst"	"0.00015432"	"04020"	"CHEK2_000075"	"g.29130520C>T"	"33/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130520_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756923"	"1"	"50"	"22"	"29130534"	"29130534"	"subst"	"0"	"04020"	"CHEK2_000571"	"g.29130534G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130534_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756924"	"1"	"50"	"22"	"29130534"	"29130534"	"subst"	"1.62455E-5"	"04020"	"CHEK2_000076"	"g.29130534G>T"	"4/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130534_G_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756925"	"1"	"50"	"22"	"29130553"	"29130553"	"subst"	"4.06197E-5"	"04020"	"CHEK2_000575"	"g.29130553A>T"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130553_A_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756926"	"1"	"50"	"22"	"29130576"	"29130576"	"subst"	"2.03257E-5"	"04020"	"CHEK2_000030"	"g.29130576G>A"	"2/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130576_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756927"	"1"	"50"	"22"	"29130588"	"29130588"	"subst"	"0"	"04020"	"CHEK2_000584"	"g.29130588G>A"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130588_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756928"	"1"	"50"	"22"	"29130636"	"29130636"	"subst"	"4.51987E-5"	"04020"	"CHEK2_000594"	"g.29130636A>G"	"10/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130636_A_G"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756929"	"1"	"50"	"22"	"29130637"	"29130637"	"subst"	"1.23326E-5"	"04020"	"CHEK2_000595"	"g.29130637C>T"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130637_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756930"	"1"	"50"	"22"	"29130645"	"29130645"	"subst"	"0"	"04020"	"CHEK2_000031"	"g.29130645T>C"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130645_T_C"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756931"	"1"	"50"	"22"	"29130691"	"29130691"	"subst"	"0"	"04020"	"CHEK2_000604"	"g.29130691C>T"	"1/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130691_C_T"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756932"	"1"	"50"	"22"	"29130696"	"29130696"	"subst"	"6.67089E-5"	"04020"	"CHEK2_000605"	"g.29130696G>A"	"5/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130696_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000756933"	"1"	"50"	"22"	"29130703"	"29130703"	"subst"	"0.000288105"	"04020"	"CHEK2_000610"	"g.29130703G>A"	"3/53461 controls"	"{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}"	""	"chr22_29130703_G_A"	"the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types"	"Germline"	""	""	"0"	""	""	""	""	"NA"	""
"0000783227"	"0"	"90"	"22"	"29091122"	"29091122"	"dup"	"0"	"01164"	"CHEK2_000164"	"g.29091122dup"	""	""	""	""	"ACMG: PVS1, PS4, PM2_SUP"	"Germline"	"?"	""	"0"	""	""	"g.28695134dup"	""	"pathogenic (dominant)"	"ACMG"
"0000789657"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"00585"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic"	"ACMG"
"0000789659"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"00585"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic"	"ACMG"
"0000789669"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"00585"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic"	"ACMG"
"0000791036"	"0"	"50"	"22"	"29130643"	"29130643"	"subst"	"0"	"02551"	"CHEK2_000613"	"g.29130643C>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	""	""	"VUS"	""
"0000809529"	"0"	"50"	"22"	"29083935"	"29083935"	"subst"	"0"	"02326"	"CHEK2_000614"	"g.29083935C>G"	""	""	""	"CHEK2(NM_007194.4):c.1582G>C (p.E528Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809530"	"0"	"50"	"22"	"29083956"	"29083956"	"subst"	"0"	"02326"	"CHEK2_000085"	"g.29083956G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1690C>T (p.(Arg564Trp)), CHEK2(NM_007194.4):c.1561C>T (p.R521W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809531"	"0"	"30"	"22"	"29085176"	"29085176"	"subst"	"0.000227009"	"02327"	"CHEK2_000255"	"g.29085176C>T"	""	""	""	"CHEK2(NM_007194.4):c.1489G>A (p.D497N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000809532"	"0"	"50"	"22"	"29090058"	"29090058"	"subst"	"3.0541E-5"	"02326"	"CHEK2_000615"	"g.29090058A>T"	""	""	""	"CHEK2(NM_007194.4):c.1423T>A (p.F475I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809533"	"0"	"50"	"22"	"29090091"	"29090091"	"subst"	"0"	"02326"	"CHEK2_000616"	"g.29090091T>C"	""	""	""	"CHEK2(NM_007194.4):c.1390A>G (p.K464E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809534"	"0"	"90"	"22"	"29091207"	"29091207"	"subst"	"0.000476256"	"02326"	"CHEK2_000012"	"g.29091207G>A"	""	""	""	"CHEK2(NM_007194.4):c.1283C>T (p.S428F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000809535"	"0"	"50"	"22"	"29091220"	"29091220"	"subst"	"0.000276981"	"01943"	"CHEK2_000214"	"g.29091220A>G"	""	""	""	"CHEK2(NM_007194.4):c.1270T>C (p.Y424H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809536"	"0"	"50"	"22"	"29091220"	"29091220"	"subst"	"0.000276981"	"02325"	"CHEK2_000214"	"g.29091220A>G"	""	""	""	"CHEK2(NM_007194.4):c.1270T>C (p.Y424H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809539"	"0"	"70"	"22"	"29091775"	"29091775"	"subst"	"4.06646E-6"	"02369"	"CHEK2_000617"	"g.29091775T>A"	""	""	""	"CHEK2(NM_007194.4):c.1182A>T (p.E394D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000809540"	"0"	"50"	"22"	"29091779"	"29091779"	"subst"	"0"	"02327"	"CHEK2_000618"	"g.29091779G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809541"	"0"	"30"	"22"	"29091781"	"29091781"	"subst"	"9.35309E-5"	"01943"	"CHEK2_000106"	"g.29091781C>T"	""	""	""	"CHEK2(NM_007194.4):c.1176G>A (p.A392=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000809542"	"0"	"70"	"22"	"29092948"	"29092948"	"subst"	"5.28421E-5"	"02369"	"CHEK2_000114"	"g.29092948G>A"	""	""	""	"CHEK2(NM_007194.4):c.1036C>T (p.R346C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000809543"	"0"	"50"	"22"	"29092962"	"29092962"	"subst"	"1.62632E-5"	"01943"	"CHEK2_000059"	"g.29092962T>G"	""	""	""	"CHEK2(NM_001005735.1):c.1151A>C (p.(Asn384Thr)), CHEK2(NM_007194.4):c.1022A>C (p.N341T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809544"	"0"	"30"	"22"	"29095943"	"29095943"	"subst"	"8.19988E-6"	"01943"	"CHEK2_000191"	"g.29095943G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1038-18C>T (p.(=)), CHEK2(NM_007194.4):c.909-18C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000809545"	"0"	"50"	"22"	"29099548"	"29099548"	"subst"	"0"	"02327"	"CHEK2_000619"	"g.29099548T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809546"	"0"	"70"	"22"	"29105993"	"29105993"	"subst"	"0"	"02326"	"CHEK2_000423"	"g.29105993C>G"	""	""	""	"CHEK2(NM_001005735.1):c.975+1G>C (p.?), CHEK2(NM_007194.4):c.846+1G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000809547"	"0"	"30"	"22"	"29107873"	"29107873"	"subst"	"0.000138671"	"01943"	"CHEK2_000620"	"g.29107873G>A"	""	""	""	"CHEK2(NM_007194.4):c.792+24C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000809548"	"0"	"90"	"22"	"29115473"	"29115473"	"del"	"0"	"02326"	"CHEK2_000063"	"g.29115473del"	""	""	""	"CHEK2(NM_007194.4):c.597delT (p.F199Lfs*6)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000809549"	"0"	"50"	"22"	"29120991"	"29120991"	"subst"	"0"	"02327"	"CHEK2_000621"	"g.29120991A>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809550"	"0"	"50"	"22"	"29121000"	"29121000"	"subst"	"3.24907E-5"	"02327"	"CHEK2_000020"	"g.29121000T>C"	""	""	""	"CHEK2(NM_007194.4):c.557A>G (p.N186S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809551"	"0"	"50"	"22"	"29121008"	"29121008"	"subst"	"1.21843E-5"	"01943"	"CHEK2_000175"	"g.29121008C>G"	""	""	""	"CHEK2(NM_007194.4):c.549G>C (p.L183F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809552"	"0"	"50"	"22"	"29121015"	"29121015"	"subst"	"0.000129966"	"02369"	"CHEK2_000138"	"g.29121015C>T"	""	""	""	"CHEK2(NM_007194.4):c.542G>A (p.R181H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809553"	"0"	"50"	"22"	"29121016"	"29121016"	"subst"	"0.000113725"	"01943"	"CHEK2_000021"	"g.29121016G>A"	""	""	""	"CHEK2(NM_001005735.1):c.670C>T (p.(Arg224Cys)), CHEK2(NM_007194.4):c.541C>T (p.R181C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809554"	"0"	"30"	"22"	"29121207"	"29121207"	"subst"	"0.00125185"	"01943"	"CHEK2_000224"	"g.29121207G>A"	""	""	""	"CHEK2(NM_007194.4):c.444+24C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000809555"	"0"	"70"	"22"	"29121242"	"29121242"	"subst"	"4.47053E-5"	"01943"	"CHEK2_000034"	"g.29121242G>A"	""	""	""	"CHEK2(NM_007194.4):c.433C>T (p.R145W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000809556"	"0"	"10"	"22"	"29130300"	"29130300"	"subst"	"0"	"02369"	"CHEK2_000622"	"g.29130300C>T"	""	""	""	"CHEK2(NM_007194.4):c.319+91G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000809557"	"0"	"50"	"22"	"29130417"	"29130417"	"subst"	"0"	"01943"	"CHEK2_000623"	"g.29130417G>A"	""	""	""	"CHEK2(NM_007194.4):c.293C>T (p.A98V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000809558"	"0"	"30"	"22"	"29130456"	"29130456"	"subst"	"0.000901699"	"01943"	"CHEK2_000029"	"g.29130456G>A"	""	""	""	"CHEK2(NM_001005735.1):c.254C>T (p.(Pro85Leu)), CHEK2(NM_007194.4):c.254C>T (p.P85L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000809559"	"0"	"10"	"22"	"29130456"	"29130456"	"subst"	"0.000901699"	"02326"	"CHEK2_000029"	"g.29130456G>A"	""	""	""	"CHEK2(NM_001005735.1):c.254C>T (p.(Pro85Leu)), CHEK2(NM_007194.4):c.254C>T (p.P85L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000809560"	"0"	"30"	"22"	"29130456"	"29130456"	"subst"	"0.000901699"	"02327"	"CHEK2_000029"	"g.29130456G>A"	""	""	""	"CHEK2(NM_001005735.1):c.254C>T (p.(Pro85Leu)), CHEK2(NM_007194.4):c.254C>T (p.P85L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000809561"	"0"	"90"	"22"	"29130652"	"29130652"	"subst"	"0.000148661"	"02329"	"CHEK2_000005"	"g.29130652G>A"	""	""	""	"CHEK2(NM_001005735.1):c.58C>T (p.(Gln20Ter)), CHEK2(NM_007194.4):c.58C>T (p.Q20*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000830377"	"0"	"50"	"22"	"0"	"0"	""	"0"	"00006"	"LARGE_000000"	"g.?"	""	"{PMID:Moreno-Cabrera 2021:33219106}"	""	"dup ex3-4"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"VUS"	""
"0000830378"	"0"	"90"	"22"	"0"	"0"	""	"0"	"00006"	"LARGE_000000"	"g.?"	""	"{PMID:Moreno-Cabrera 2021:33219106}"	""	"del ex3-4"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000830379"	"0"	"50"	"22"	"0"	"0"	""	"0"	"00006"	"LARGE_000000"	"g.?"	""	"{PMID:Moreno-Cabrera 2021:33219106}"	""	"dup ex3-4"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"VUS"	""
"0000830380"	"0"	"70"	"22"	"0"	"0"	""	"0"	"00006"	"LARGE_000000"	"g.?"	""	"{PMID:Moreno-Cabrera 2021:33219106}"	""	"del ex2"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000830385"	"0"	"50"	"22"	"0"	"0"	""	"0"	"00006"	"LARGE_000000"	"g.?"	""	"{PMID:Moreno-Cabrera 2021:33219106}"	""	"dup ex3-4"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"VUS"	""
"0000833964"	"1"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"00006"	"CHEK2_000001"	"g.29091857del"	""	"{PMID:Evans 2022:33758026}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic (dominant)"	"ACMG"
"0000833965"	"1"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"00006"	"CHEK2_000001"	"g.29091857del"	""	"{PMID:Evans 2022:33758026}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic (dominant)"	"ACMG"
"0000833966"	"1"	"90"	"22"	"29130427"	"29130427"	"subst"	"8.12466E-6"	"00006"	"CHEK2_000027"	"g.29130427G>A"	""	"{PMID:Evans 2022:33758026}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.28734439G>A"	""	"pathogenic (dominant)"	"ACMG"
"0000845078"	"0"	"50"	"22"	"29091846"	"29091846"	"subst"	"0.00045449"	"00006"	"CHEK2_000054"	"g.29091846G>A"	">1/309 cases"	"{PMID:Jiang 2022:33563768}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.28695858G>A"	""	"VUS"	""
"0000845079"	"0"	"50"	"22"	"29091761"	"29091761"	"subst"	"1.62678E-5"	"00006"	"CHEK2_000342"	"g.29091761A>T"	">1/309 cases"	"{PMID:Jiang 2022:33563768}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.28695773A>T"	""	"VUS"	""
"0000845080"	"0"	"50"	"22"	"29083920"	"29083920"	"subst"	"0"	"00006"	"CHEK2_000080"	"g.29083920T>C"	">1/309 cases"	"{PMID:Jiang 2022:33563768}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.28687932T>C"	""	"VUS"	""
"0000845081"	"0"	"50"	"22"	"29121019"	"29121019"	"subst"	"0.00099909"	"00006"	"CHEK2_000022"	"g.29121019G>A"	">1/309 cases"	"{PMID:Jiang 2022:33563768}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.28725031G>A"	""	"VUS"	""
"0000856088"	"0"	"50"	"22"	"29083926"	"29083926"	"subst"	"0"	"02325"	"CHEK2_000206"	"g.29083926C>A"	""	""	""	"CHEK2(NM_007194.4):c.1591G>T (p.E531*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856089"	"0"	"50"	"22"	"29083953"	"29083953"	"del"	"0"	"01943"	"CHEK2_000624"	"g.29083953del"	""	""	""	"CHEK2(NM_007194.4):c.1567delC (p.R523Vfs*43)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856090"	"0"	"50"	"22"	"29083961"	"29083961"	"subst"	"0"	"02325"	"CHEK2_000036"	"g.29083961C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1685G>T (p.(Arg562Leu)), CHEK2(NM_007194.4):c.1556G>T (p.R519L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856091"	"0"	"90"	"22"	"29083962"	"29083962"	"subst"	"0"	"02326"	"CHEK2_000086"	"g.29083962G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1684C>T (p.(Arg562*)), CHEK2(NM_007194.4):c.1555C>T (p.R519*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000856092"	"0"	"50"	"22"	"29083968"	"29083970"	"del"	"0"	"02325"	"CHEK2_000625"	"g.29083968_29083970del"	""	""	""	"CHEK2(NM_007194.4):c.1550_1552delCTA (p.T517del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856093"	"0"	"30"	"22"	"29085155"	"29085155"	"subst"	"3.92869E-5"	"02327"	"CHEK2_000283"	"g.29085155C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856094"	"0"	"50"	"22"	"29090061"	"29090061"	"subst"	"1.74534E-5"	"02369"	"CHEK2_000093"	"g.29090061G>A"	""	""	""	"CHEK2(NM_007194.4):c.1420C>T (p.R474C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856095"	"0"	"70"	"22"	"29090061"	"29090061"	"subst"	"1.74534E-5"	"02327"	"CHEK2_000093"	"g.29090061G>A"	""	""	""	"CHEK2(NM_007194.4):c.1420C>T (p.R474C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000856096"	"0"	"30"	"22"	"29090074"	"29090074"	"subst"	"0.000466882"	"01943"	"CHEK2_000627"	"g.29090074C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1536G>A (p.(Val512=)), CHEK2(NM_007194.4):c.1407G>A (p.V469=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856097"	"0"	"50"	"22"	"29090098"	"29090098"	"subst"	"8.7276E-6"	"02327"	"CHEK2_000049"	"g.29090098G>C"	""	""	""	"CHEK2(NM_007194.4):c.1383C>G (p.D461E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856098"	"0"	"70"	"22"	"29090106"	"29090106"	"subst"	"0"	"01943"	"CHEK2_000308"	"g.29090106C>G"	""	""	""	"CHEK2(NM_007194.4):c.1376-1G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000856099"	"0"	"30"	"22"	"29091089"	"29091089"	"subst"	"0.000196345"	"01943"	"CHEK2_000211"	"g.29091089A>G"	""	""	""	"CHEK2(NM_007194.4):c.1375+26T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856100"	"0"	"30"	"22"	"29091147"	"29091147"	"subst"	"0.00135029"	"02369"	"CHEK2_000010"	"g.29091147A>C"	""	""	""	"CHEK2(NM_001005735.1):c.1472T>G (p.(Ile491Ser)), CHEK2(NM_007194.4):c.1343T>G (p.I448S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856101"	"0"	"50"	"22"	"29091178"	"29091178"	"subst"	"0.000390523"	"01943"	"CHEK2_000011"	"g.29091178C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1441G>T (p.(Asp481Tyr)), CHEK2(NM_007194.4):c.1312G>T (p.D438Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856102"	"0"	"30"	"22"	"29091203"	"29091203"	"subst"	"2.8491E-5"	"01943"	"CHEK2_000628"	"g.29091203C>T"	""	""	""	"CHEK2(NM_007194.4):c.1287G>A (p.E429=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856103"	"0"	"50"	"22"	"29091238"	"29091238"	"subst"	"0"	"02327"	"CHEK2_000629"	"g.29091238T>C"	""	""	""	"CHEK2(NM_007194.3):c.1260-8A>G (p.(=)), CHEK2(NM_007194.4):c.1260-8A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856104"	"0"	"30"	"22"	"29091240"	"29091240"	"subst"	"5.73394E-5"	"01943"	"CHEK2_000052"	"g.29091240G>C"	""	""	""	"CHEK2(NM_001005735.1):c.1389-10C>G (p.(=)), CHEK2(NM_007194.4):c.1260-10C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856105"	"0"	"50"	"22"	"29091714"	"29091714"	"subst"	"0"	"02327"	"CHEK2_000326"	"g.29091714C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856106"	"0"	"50"	"22"	"29091782"	"29091782"	"subst"	"4.47314E-5"	"02327"	"CHEK2_000015"	"g.29091782G>A"	""	""	""	"CHEK2(NM_007194.4):c.1175C>T (p.A392V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856107"	"0"	"70"	"22"	"29091788"	"29091788"	"subst"	"0"	"02327"	"CHEK2_000188"	"g.29091788T>C"	""	""	""	"CHEK2(NM_007194.3):c.1169A>G (p.(Tyr390Cys)), CHEK2(NM_007194.4):c.1169A>G (p.Y390C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000856108"	"0"	"50"	"22"	"29092917"	"29092917"	"subst"	"1.62567E-5"	"02369"	"CHEK2_000250"	"g.29092917G>A"	""	""	""	"CHEK2(NM_007194.4):c.1067C>T (p.S356L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856109"	"0"	"70"	"22"	"29092945"	"29092945"	"subst"	"1.6257E-5"	"01943"	"CHEK2_000374"	"g.29092945C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1168G>A (p.(Asp390Asn)), CHEK2(NM_007194.4):c.1039G>A (p.D347N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000856110"	"0"	"30"	"22"	"29095838"	"29095838"	"subst"	"0"	"01943"	"CHEK2_000631"	"g.29095838G>A"	""	""	""	"CHEK2(NM_007194.4):c.996C>T (p.L332=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856111"	"0"	"50"	"22"	"29095854"	"29095854"	"subst"	"1.62438E-5"	"01943"	"CHEK2_000061"	"g.29095854T>C"	""	""	""	"CHEK2(NM_001005735.1):c.1109A>G (p.(Tyr370Cys)), CHEK2(NM_007194.4):c.980A>G (p.Y327C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856112"	"0"	"30"	"22"	"29096015"	"29096015"	"subst"	"0"	"02369"	"CHEK2_000632"	"g.29096015G>A"	""	""	""	"CHEK2(NM_007194.4):c.909-90C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856113"	"0"	"50"	"22"	"29107938"	"29107938"	"subst"	"0"	"02325"	"CHEK2_000193"	"g.29107938T>A"	""	""	""	"CHEK2(NM_001005735.1):c.880A>T (p.(Ile294Phe)), CHEK2(NM_007194.4):c.751A>T (p.I251F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856114"	"0"	"30"	"22"	"29115359"	"29115359"	"subst"	"0"	"01943"	"CHEK2_000633"	"g.29115359C>T"	""	""	""	"CHEK2(NM_007194.4):c.683+24G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856115"	"0"	"70"	"22"	"29120962"	"29120962"	"subst"	"2.84352E-5"	"01943"	"CHEK2_000174"	"g.29120962T>A"	""	""	""	"CHEK2(NM_007194.4):c.592+3A>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000856116"	"0"	"50"	"22"	"29121019"	"29121019"	"subst"	"0.00099909"	"02325"	"CHEK2_000022"	"g.29121019G>A"	""	""	""	"CHEK2(NM_001005735.1):c.667C>T (p.(Arg223Cys)), CHEK2(NM_007194.4):c.538C>T (p.R180C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856117"	"0"	"50"	"22"	"29121050"	"29121050"	"subst"	"8.12301E-6"	"01943"	"CHEK2_000070"	"g.29121050A>C"	""	""	""	"CHEK2(NM_001005735.1):c.636T>G (p.(Phe212Leu)), CHEK2(NM_007194.4):c.507T>G (p.F169L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856118"	"0"	"50"	"22"	"29121063"	"29121063"	"subst"	"0"	"02369"	"CHEK2_000635"	"g.29121063C>T"	""	""	""	"CHEK2(NM_007194.4):c.494G>A (p.G165D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856119"	"0"	"30"	"22"	"29121089"	"29121089"	"subst"	"0"	"02327"	"CHEK2_000636"	"g.29121089G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856120"	"0"	"50"	"22"	"29121241"	"29121241"	"subst"	"1.21921E-5"	"01943"	"CHEK2_000143"	"g.29121241C>T"	""	""	""	"CHEK2(NM_007194.4):c.434G>A (p.R145Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856121"	"0"	"30"	"22"	"29121265"	"29121265"	"subst"	"0.000178802"	"02329"	"CHEK2_000144"	"g.29121265C>T"	""	""	""	"CHEK2(NM_001005735.1):c.539G>A (p.(Arg180Gln)), CHEK2(NM_007194.4):c.410G>A (p.R137Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000856122"	"0"	"50"	"22"	"29121325"	"29121325"	"subst"	"0"	"01943"	"CHEK2_000547"	"g.29121325C>T"	""	""	""	"CHEK2(NM_007194.4):c.350G>A (p.R117K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856123"	"0"	"50"	"22"	"29121360"	"29121360"	"subst"	"0.000574245"	"01943"	"CHEK2_000073"	"g.29121360A>T"	""	""	""	"CHEK2(NM_001005735.1):c.449-5T>A (p.?), CHEK2(NM_007194.4):c.320-5T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856124"	"0"	"50"	"22"	"29130595"	"29130595"	"subst"	"0"	"01943"	"CHEK2_000254"	"g.29130595A>G"	""	""	""	"CHEK2(NM_007194.4):c.115T>C (p.S39P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000856125"	"0"	"90"	"22"	"29130632"	"29130633"	"del"	"0"	"02329"	"CHEK2_000262"	"g.29130632_29130633del"	""	""	""	"CHEK2(NM_007194.4):c.78_79delCC (p.Q27Vfs*49)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000856126"	"0"	"90"	"22"	"29130652"	"29130652"	"subst"	"0.000148661"	"01943"	"CHEK2_000005"	"g.29130652G>A"	""	""	""	"CHEK2(NM_001005735.1):c.58C>T (p.(Gln20Ter)), CHEK2(NM_007194.4):c.58C>T (p.Q20*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000866762"	"0"	"30"	"22"	"29083913"	"29083913"	"subst"	"0"	"01804"	"CHEK2_000040"	"g.29083913C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1733G>A (p.(Arg578His)), CHEK2(NM_007194.4):c.1604G>A (p.R535H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000866763"	"0"	"50"	"22"	"29083956"	"29083956"	"subst"	"0"	"01804"	"CHEK2_000085"	"g.29083956G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1690C>T (p.(Arg564Trp)), CHEK2(NM_007194.4):c.1561C>T (p.R521W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866764"	"0"	"50"	"22"	"29083961"	"29083961"	"subst"	"0"	"01804"	"CHEK2_000036"	"g.29083961C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1685G>T (p.(Arg562Leu)), CHEK2(NM_007194.4):c.1556G>T (p.R519L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866765"	"0"	"50"	"22"	"29083961"	"29083961"	"subst"	"0"	"01804"	"CHEK2_000272"	"g.29083961C>T"	""	""	""	"CHEK2(NM_007194.3):c.1556G>A (p.(Arg519Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866766"	"0"	"30"	"22"	"29085168"	"29085168"	"subst"	"4.80207E-5"	"01804"	"CHEK2_000044"	"g.29085168C>G"	""	""	""	"CHEK2(NM_001005735.1):c.1626G>C (p.(Leu542=)), CHEK2(NM_007194.4):c.1497G>C (p.L499=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000866767"	"0"	"50"	"22"	"29085195"	"29085195"	"subst"	"2.61945E-5"	"01804"	"CHEK2_000045"	"g.29085195G>T"	""	""	""	"CHEK2(NM_001005735.1):c.1599C>A (p.(Asp533Glu)), CHEK2(NM_007194.4):c.1470C>A (p.D490E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866768"	"0"	"30"	"22"	"29090040"	"29090040"	"subst"	"0"	"01804"	"CHEK2_000626"	"g.29090040A>G"	""	""	""	"CHEK2(NM_001005735.1):c.1570T>C (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000866769"	"0"	"50"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"01804"	"CHEK2_000009"	"g.29090054G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1556C>T (p.(Thr519Met)), CHEK2(NM_007194.4):c.1427C>T (p.T476M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866770"	"0"	"50"	"22"	"29090117"	"29090117"	"subst"	"0"	"01804"	"CHEK2_000210"	"g.29090117A>G"	""	""	""	"CHEK2(NM_001005735.1):c.1505-12T>C (p.(=)), CHEK2(NM_007194.4):c.1376-12T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866771"	"0"	"30"	"22"	"29091147"	"29091147"	"subst"	"0.00135029"	"01804"	"CHEK2_000010"	"g.29091147A>C"	""	""	""	"CHEK2(NM_001005735.1):c.1472T>G (p.(Ile491Ser)), CHEK2(NM_007194.4):c.1343T>G (p.I448S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000866772"	"0"	"50"	"22"	"29091207"	"29091207"	"subst"	"0.000476256"	"02325"	"CHEK2_000012"	"g.29091207G>A"	""	""	""	"CHEK2(NM_007194.4):c.1283C>T (p.S428F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866773"	"0"	"50"	"22"	"29091207"	"29091207"	"subst"	"0.000476256"	"02329"	"CHEK2_000012"	"g.29091207G>A"	""	""	""	"CHEK2(NM_007194.4):c.1283C>T (p.S428F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866774"	"0"	"50"	"22"	"29091225"	"29091225"	"subst"	"8.15169E-6"	"02326"	"CHEK2_000185"	"g.29091225C>T"	""	""	""	"CHEK2(NM_007194.4):c.1265G>A (p.S422N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866775"	"0"	"50"	"22"	"29091238"	"29091238"	"subst"	"0"	"01804"	"CHEK2_000629"	"g.29091238T>C"	""	""	""	"CHEK2(NM_007194.3):c.1260-8A>G (p.(=)), CHEK2(NM_007194.4):c.1260-8A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866776"	"0"	"50"	"22"	"29091741"	"29091741"	"subst"	"5.29032E-5"	"01804"	"CHEK2_000187"	"g.29091741G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1345C>T (p.(Arg449Cys)), CHEK2(NM_007194.4):c.1216C>T (p.R406C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866778"	"0"	"50"	"22"	"29091867"	"29091867"	"subst"	"0"	"02329"	"CHEK2_000630"	"g.29091867A>C"	""	""	""	"CHEK2(NM_007194.4):c.1096-6T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866779"	"0"	"30"	"22"	"29092870"	"29092870"	"subst"	"0.000179219"	"01804"	"CHEK2_000057"	"g.29092870C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1224+19G>A (p.(=)), CHEK2(NM_007194.4):c.1095+19G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000866780"	"0"	"50"	"22"	"29092908"	"29092908"	"subst"	"8.12764E-6"	"01804"	"CHEK2_000369"	"g.29092908T>C"	""	""	""	"CHEK2(NM_001005735.1):c.1205A>G (p.(Glu402Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866781"	"0"	"90"	"22"	"29092912"	"29092912"	"subst"	"0"	"02327"	"CHEK2_000243"	"g.29092912G>A"	""	""	""	"CHEK2(NM_007194.4):c.1072C>T (p.Q358*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000866782"	"0"	"90"	"22"	"29092912"	"29092912"	"subst"	"0"	"02325"	"CHEK2_000243"	"g.29092912G>A"	""	""	""	"CHEK2(NM_007194.4):c.1072C>T (p.Q358*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000866783"	"0"	"50"	"22"	"29092931"	"29092931"	"subst"	"8.94011E-5"	"01804"	"CHEK2_000058"	"g.29092931C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1182G>T (p.(Glu394Asp)), CHEK2(NM_007194.4):c.1053G>T (p.E351D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866784"	"0"	"50"	"22"	"29095851"	"29095851"	"subst"	"0"	"02329"	"CHEK2_000215"	"g.29095851A>G"	""	""	""	"CHEK2(NM_007194.4):c.983T>C (p.F328S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866785"	"0"	"50"	"22"	"29095861"	"29095861"	"subst"	"0"	"02325"	"CHEK2_000387"	"g.29095861T>C"	""	""	""	"CHEK2(NM_007194.4):c.973A>G (p.K325E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866786"	"0"	"50"	"22"	"29099495"	"29099495"	"subst"	"3.03027E-5"	"02329"	"CHEK2_000406"	"g.29099495T>G"	""	""	""	"CHEK2(NM_007194.4):c.906A>C (p.E302D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866787"	"0"	"50"	"22"	"29107962"	"29107962"	"subst"	"1.21869E-5"	"02329"	"CHEK2_000464"	"g.29107962A>G"	""	""	""	"CHEK2(NM_007194.4):c.727T>C (p.C243R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866788"	"0"	"50"	"22"	"29115384"	"29115384"	"subst"	"0"	"01804"	"CHEK2_000634"	"g.29115384T>C"	""	""	""	"CHEK2(NM_007194.3):c.682A>G (p.(Ser228Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866789"	"0"	"50"	"22"	"29120979"	"29120979"	"subst"	"1.21842E-5"	"02329"	"CHEK2_000066"	"g.29120979A>G"	""	""	""	"CHEK2(NM_007194.4):c.578T>C (p.L193P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866790"	"0"	"50"	"22"	"29121019"	"29121019"	"subst"	"0.00099909"	"01804"	"CHEK2_000022"	"g.29121019G>A"	""	""	""	"CHEK2(NM_001005735.1):c.667C>T (p.(Arg223Cys)), CHEK2(NM_007194.4):c.538C>T (p.R180C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866791"	"0"	"50"	"22"	"29121050"	"29121050"	"subst"	"8.12301E-6"	"02329"	"CHEK2_000070"	"g.29121050A>C"	""	""	""	"CHEK2(NM_001005735.1):c.636T>G (p.(Phe212Leu)), CHEK2(NM_007194.4):c.507T>G (p.F169L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866792"	"0"	"70"	"22"	"29121058"	"29121058"	"subst"	"2.84301E-5"	"01804"	"CHEK2_000178"	"g.29121058C>T"	""	""	""	"CHEK2(NM_001005735.1):c.628G>A (p.G210R, p.(Gly210Arg)), CHEK2(NM_007194.4):c.499G>A (p.G167R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000866793"	"0"	"70"	"22"	"29121058"	"29121058"	"subst"	"2.84301E-5"	"02369"	"CHEK2_000178"	"g.29121058C>T"	""	""	""	"CHEK2(NM_001005735.1):c.628G>A (p.G210R, p.(Gly210Arg)), CHEK2(NM_007194.4):c.499G>A (p.G167R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000866794"	"0"	"70"	"22"	"29121075"	"29121077"	"del"	"0"	"02329"	"CHEK2_000199"	"g.29121075_29121077del"	""	""	""	"CHEK2(NM_007194.4):c.483_485delAGA (p.E161del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000866795"	"0"	"50"	"22"	"29121077"	"29121077"	"subst"	"0.000121847"	"01943"	"CHEK2_000203"	"g.29121077T>C"	""	""	""	"CHEK2(NM_001005735.1):c.609A>G (p.(Ile203Met)), CHEK2(NM_007194.4):c.480A>G (p.I160M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866796"	"0"	"50"	"22"	"29121077"	"29121077"	"subst"	"0.000121847"	"01804"	"CHEK2_000203"	"g.29121077T>C"	""	""	""	"CHEK2(NM_001005735.1):c.609A>G (p.(Ile203Met)), CHEK2(NM_007194.4):c.480A>G (p.I160M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866798"	"0"	"30"	"22"	"29121122"	"29121122"	"subst"	"0"	"01804"	"CHEK2_000637"	"g.29121122A>G"	""	""	""	"CHEK2(NM_001005735.1):c.574-10T>C (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000866799"	"0"	"30"	"22"	"29121211"	"29121211"	"subst"	"4.06478E-6"	"01804"	"CHEK2_000638"	"g.29121211C>A"	""	""	""	"CHEK2(NM_007194.3):c.444+20G>T (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000866800"	"0"	"30"	"22"	"29121212"	"29121212"	"subst"	"0.000463339"	"02329"	"CHEK2_000225"	"g.29121212A>G"	""	""	""	"CHEK2(NM_007194.4):c.444+19T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000866801"	"0"	"90"	"22"	"29121266"	"29121266"	"subst"	"2.43827E-5"	"02329"	"CHEK2_000145"	"g.29121266G>A"	""	""	""	"CHEK2(NM_007194.4):c.409C>T (p.R137*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000866802"	"0"	"50"	"22"	"29130471"	"29130471"	"subst"	"0"	"02329"	"CHEK2_000229"	"g.29130471G>T"	""	""	""	"CHEK2(NM_007194.4):c.239C>A (p.P80H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866803"	"0"	"30"	"22"	"29130495"	"29130495"	"subst"	"2.03052E-5"	"02329"	"CHEK2_000159"	"g.29130495T>C"	""	""	""	"CHEK2(NM_007194.4):c.215A>G (p.Y72C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000866804"	"0"	"50"	"22"	"29130595"	"29130595"	"subst"	"0"	"02329"	"CHEK2_000254"	"g.29130595A>G"	""	""	""	"CHEK2(NM_007194.4):c.115T>C (p.S39P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866805"	"0"	"90"	"22"	"29130652"	"29130652"	"subst"	"0.000148661"	"01804"	"CHEK2_000005"	"g.29130652G>A"	""	""	""	"CHEK2(NM_001005735.1):c.58C>T (p.(Gln20Ter)), CHEK2(NM_007194.4):c.58C>T (p.Q20*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000866806"	"0"	"50"	"22"	"29130691"	"29130691"	"subst"	"0"	"01943"	"CHEK2_000604"	"g.29130691C>T"	""	""	""	"CHEK2(NM_007194.4):c.19G>A (p.V7I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000866807"	"0"	"30"	"22"	"29130691"	"29130691"	"subst"	"0"	"02369"	"CHEK2_000604"	"g.29130691C>T"	""	""	""	"CHEK2(NM_007194.4):c.19G>A (p.V7I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000866808"	"0"	"30"	"22"	"29130696"	"29130696"	"subst"	"6.67089E-5"	"02369"	"CHEK2_000605"	"g.29130696G>A"	""	""	""	"CHEK2(NM_007194.4):c.14C>T (p.S5L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000869111"	"0"	"90"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"00006"	"CHEK2_000072"	"g.29121230C>T"	""	"{PMID:Schuermans 2022:35606766}"	""	""	"secondary finding"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.28725242C>T"	""	"pathogenic"	""
"0000869112"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"00006"	"CHEK2_000001"	"g.29091857del"	""	"{PMID:Schuermans 2022:35606766}"	""	""	"secondary finding"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.28695869del"	""	"pathogenic"	""
"0000895631"	"0"	"50"	"22"	"29083955"	"29083955"	"subst"	"0"	"02326"	"CHEK2_000084"	"g.29083955C>T"	""	""	""	"CHEK2(NM_007194.4):c.1562G>A (p.R521Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895632"	"0"	"30"	"22"	"29083961"	"29083961"	"subst"	"0"	"02327"	"CHEK2_000272"	"g.29083961C>T"	""	""	""	"CHEK2(NM_007194.3):c.1556G>A (p.(Arg519Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895633"	"0"	"50"	"22"	"29090026"	"29090026"	"subst"	"0"	"02329"	"CHEK2_000256"	"g.29090026C>A"	""	""	""	"CHEK2(NM_007194.4):c.1455G>T (p.W485C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895634"	"0"	"30"	"22"	"29090053"	"29090053"	"subst"	"4.36319E-6"	"02327"	"CHEK2_000639"	"g.29090053C>T"	""	""	""	"CHEK2(NM_007194.4):c.1428G>A (p.T476=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895635"	"0"	"70"	"22"	"29090060"	"29090060"	"subst"	"6.54485E-5"	"02326"	"CHEK2_000183"	"g.29090060C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1550G>A (p.(Arg517His)), CHEK2(NM_007194.4):c.1421G>A (p.R474H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000895636"	"0"	"70"	"22"	"29090060"	"29090060"	"subst"	"6.54485E-5"	"02329"	"CHEK2_000183"	"g.29090060C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1550G>A (p.(Arg517His)), CHEK2(NM_007194.4):c.1421G>A (p.R474H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000895637"	"0"	"30"	"22"	"29090074"	"29090074"	"subst"	"0.000466882"	"02329"	"CHEK2_000627"	"g.29090074C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1536G>A (p.(Val512=)), CHEK2(NM_007194.4):c.1407G>A (p.V469=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895638"	"0"	"50"	"22"	"29090098"	"29090098"	"subst"	"8.7276E-6"	"02326"	"CHEK2_000049"	"g.29090098G>C"	""	""	""	"CHEK2(NM_007194.4):c.1383C>G (p.D461E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895639"	"0"	"30"	"22"	"29091203"	"29091203"	"subst"	"2.8491E-5"	"02327"	"CHEK2_000628"	"g.29091203C>T"	""	""	""	"CHEK2(NM_007194.4):c.1287G>A (p.E429=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895640"	"0"	"50"	"22"	"29091220"	"29091220"	"subst"	"0.000276981"	"02327"	"CHEK2_000214"	"g.29091220A>G"	""	""	""	"CHEK2(NM_007194.4):c.1270T>C (p.Y424H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895641"	"0"	"50"	"22"	"29091713"	"29091713"	"subst"	"0"	"02327"	"CHEK2_000640"	"g.29091713A>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895642"	"0"	"70"	"22"	"29091723"	"29091723"	"subst"	"0"	"02326"	"CHEK2_000641"	"g.29091723T>G"	""	""	""	"CHEK2(NM_007194.4):c.1234A>C (p.S412R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000895643"	"0"	"50"	"22"	"29091726"	"29091726"	"subst"	"0"	"02325"	"CHEK2_000642"	"g.29091726A>T"	""	""	""	"CHEK2(NM_007194.4):c.1231T>A (p.W411R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895644"	"0"	"70"	"22"	"29091788"	"29091788"	"subst"	"2.44008E-5"	"02325"	"CHEK2_000348"	"g.29091788T>G"	""	""	""	"CHEK2(NM_007194.4):c.1169A>C (p.Y390S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000895645"	"0"	"50"	"22"	"29091797"	"29091797"	"subst"	"0"	"02325"	"CHEK2_000643"	"g.29091797G>C"	""	""	""	"CHEK2(NM_007194.4):c.1160C>G (p.T387S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895646"	"0"	"90"	"22"	"29092912"	"29092912"	"subst"	"0"	"02326"	"CHEK2_000243"	"g.29092912G>A"	""	""	""	"CHEK2(NM_007194.4):c.1072C>T (p.Q358*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000895647"	"0"	"70"	"22"	"29092945"	"29092945"	"subst"	"1.6257E-5"	"02325"	"CHEK2_000374"	"g.29092945C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1168G>A (p.(Asp390Asn)), CHEK2(NM_007194.4):c.1039G>A (p.D347N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000895648"	"0"	"50"	"22"	"29092948"	"29092948"	"subst"	"0"	"02329"	"CHEK2_000644"	"g.29092948G>T"	""	""	""	"CHEK2(NM_007194.4):c.1036C>A (p.R346S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895649"	"0"	"30"	"22"	"29092961"	"29092961"	"subst"	"2.8462E-5"	"02329"	"CHEK2_000116"	"g.29092961G>A"	""	""	""	"CHEK2(NM_007194.4):c.1023C>T (p.N341=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895650"	"0"	"50"	"22"	"29092962"	"29092962"	"subst"	"1.62632E-5"	"02369"	"CHEK2_000059"	"g.29092962T>G"	""	""	""	"CHEK2(NM_001005735.1):c.1151A>C (p.(Asn384Thr)), CHEK2(NM_007194.4):c.1022A>C (p.N341T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895651"	"0"	"30"	"22"	"29095838"	"29095838"	"subst"	"0"	"02327"	"CHEK2_000631"	"g.29095838G>A"	""	""	""	"CHEK2(NM_007194.4):c.996C>T (p.L332=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895652"	"0"	"30"	"22"	"29095865"	"29095865"	"subst"	"0"	"02327"	"CHEK2_000645"	"g.29095865G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895653"	"0"	"50"	"22"	"29095917"	"29095917"	"subst"	"0"	"02327"	"CHEK2_000118"	"g.29095917C>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895654"	"0"	"50"	"22"	"29095919"	"29095919"	"subst"	"1.62655E-5"	"02327"	"CHEK2_000403"	"g.29095919T>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895655"	"0"	"50"	"22"	"29099499"	"29099499"	"subst"	"0"	"02327"	"CHEK2_000408"	"g.29099499A>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895656"	"0"	"30"	"22"	"29106051"	"29106051"	"subst"	"0"	"02327"	"CHEK2_000646"	"g.29106051T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895657"	"0"	"50"	"22"	"29107938"	"29107938"	"subst"	"0"	"02369"	"CHEK2_000193"	"g.29107938T>A"	""	""	""	"CHEK2(NM_001005735.1):c.880A>T (p.(Ile294Phe)), CHEK2(NM_007194.4):c.751A>T (p.I251F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895658"	"0"	"50"	"22"	"29107997"	"29107997"	"subst"	"0"	"02326"	"CHEK2_000647"	"g.29107997C>T"	""	""	""	"CHEK2(NM_007194.4):c.692G>A (p.C231Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895659"	"0"	"30"	"22"	"29108025"	"29108025"	"subst"	"4.06719E-6"	"02327"	"CHEK2_000648"	"g.29108025T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895660"	"0"	"50"	"22"	"29115466"	"29115471"	"del"	"0"	"02327"	"CHEK2_000649"	"g.29115466_29115471del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895661"	"0"	"90"	"22"	"29120962"	"29120962"	"subst"	"2.84352E-5"	"02327"	"CHEK2_000174"	"g.29120962T>A"	""	""	""	"CHEK2(NM_007194.4):c.592+3A>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000895662"	"0"	"50"	"22"	"29121000"	"29121000"	"subst"	"3.24907E-5"	"02325"	"CHEK2_000020"	"g.29121000T>C"	""	""	""	"CHEK2(NM_007194.4):c.557A>G (p.N186S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895663"	"0"	"30"	"22"	"29121001"	"29121001"	"subst"	"5.68579E-5"	"02326"	"CHEK2_000067"	"g.29121001T>G"	""	""	""	"CHEK2(NM_001005735.1):c.685A>C (p.(Asn229His)), CHEK2(NM_007194.4):c.556A>C (p.N186H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895664"	"0"	"90"	"22"	"29130427"	"29130427"	"subst"	"8.12466E-6"	"02326"	"CHEK2_000027"	"g.29130427G>A"	""	""	""	"CHEK2(NM_007194.4):c.283C>T (p.R95*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000895665"	"0"	"90"	"22"	"29130494"	"29130494"	"subst"	"0"	"02327"	"CHEK2_000568"	"g.29130494A>C"	""	""	""	"CHEK2(NM_007194.4):c.216T>G (p.Y72*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000895666"	"0"	"30"	"22"	"29130590"	"29130590"	"subst"	"0"	"02369"	"CHEK2_000650"	"g.29130590G>A"	""	""	""	"CHEK2(NM_007194.4):c.120C>T (p.S40=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895667"	"0"	"90"	"22"	"29130612"	"29130612"	"subst"	"0"	"02329"	"CHEK2_000589"	"g.29130612G>C"	""	""	""	"CHEK2(NM_007194.4):c.98C>G (p.S33*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000895668"	"0"	"30"	"22"	"29130696"	"29130696"	"subst"	"6.67089E-5"	"02325"	"CHEK2_000605"	"g.29130696G>A"	""	""	""	"CHEK2(NM_007194.4):c.14C>T (p.S5L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000895669"	"0"	"50"	"22"	"29130696"	"29130696"	"subst"	"6.67089E-5"	"02329"	"CHEK2_000605"	"g.29130696G>A"	""	""	""	"CHEK2(NM_007194.4):c.14C>T (p.S5L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000895670"	"0"	"50"	"22"	"29130702"	"29130702"	"subst"	"0"	"02327"	"CHEK2_000651"	"g.29130702C>A"	""	""	""	"CHEK2(NM_007194.4):c.8G>T (p.R3L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915500"	"0"	"30"	"22"	"29085195"	"29085195"	"subst"	"2.61945E-5"	"02327"	"CHEK2_000045"	"g.29085195G>T"	""	""	""	"CHEK2(NM_001005735.1):c.1599C>A (p.(Asp533Glu)), CHEK2(NM_007194.4):c.1470C>A (p.D490E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000915501"	"0"	"90"	"22"	"29091113"	"29091113"	"subst"	"0"	"02327"	"CHEK2_000050"	"g.29091113A>C"	""	""	""	"CHEK2(NM_007194.4):c.1375+2T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000915502"	"0"	"70"	"22"	"29091782"	"29091782"	"subst"	"4.47314E-5"	"02325"	"CHEK2_000015"	"g.29091782G>A"	""	""	""	"CHEK2(NM_007194.4):c.1175C>T (p.A392V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000915503"	"0"	"90"	"22"	"29091839"	"29091855"	"del"	"0"	"02325"	"CHEK2_000652"	"g.29091839_29091855del"	""	""	""	"CHEK2(NM_007194.4):c.1111_1127delCACTCCAAGATTTTGGG (p.H371Rfs*18)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000915505"	"0"	"50"	"22"	"29092931"	"29092931"	"subst"	"8.94011E-5"	"02326"	"CHEK2_000058"	"g.29092931C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1182G>T (p.(Glu394Asp)), CHEK2(NM_007194.4):c.1053G>T (p.E351D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915506"	"0"	"30"	"22"	"29095803"	"29095803"	"subst"	"0"	"02369"	"CHEK2_000653"	"g.29095803A>T"	""	""	""	"CHEK2(NM_007194.4):c.1008+23T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000915507"	"0"	"50"	"22"	"29095826"	"29095826"	"subst"	"1.21849E-5"	"02327"	"CHEK2_000654"	"g.29095826C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915508"	"0"	"50"	"22"	"29099497"	"29099497"	"subst"	"0"	"02327"	"CHEK2_000407"	"g.29099497C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915509"	"0"	"30"	"22"	"29107858"	"29107858"	"subst"	"0.000680166"	"02369"	"CHEK2_000655"	"g.29107858G>A"	""	""	""	"CHEK2(NM_007194.4):c.792+39C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000915510"	"0"	"50"	"22"	"29115484"	"29115488"	"del"	"0"	"02329"	"CHEK2_000656"	"g.29115484_29115488del"	""	""	""	"CHEK2(NM_001005735.1):c.722-11_722-7del (p.(=)), CHEK2(NM_007194.4):c.593-11_593-7delTTCTT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915511"	"0"	"70"	"22"	"29120962"	"29120962"	"subst"	"2.84352E-5"	"02329"	"CHEK2_000174"	"g.29120962T>A"	""	""	""	"CHEK2(NM_007194.4):c.592+3A>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000915512"	"0"	"50"	"22"	"29121016"	"29121016"	"subst"	"0.000113725"	"01804"	"CHEK2_000021"	"g.29121016G>A"	""	""	""	"CHEK2(NM_001005735.1):c.670C>T (p.(Arg224Cys)), CHEK2(NM_007194.4):c.541C>T (p.R181C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915513"	"0"	"30"	"22"	"29121019"	"29121019"	"subst"	"0.00099909"	"02326"	"CHEK2_000022"	"g.29121019G>A"	""	""	""	"CHEK2(NM_001005735.1):c.667C>T (p.(Arg223Cys)), CHEK2(NM_007194.4):c.538C>T (p.R180C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000915514"	"0"	"50"	"22"	"29121037"	"29121037"	"subst"	"8.12275E-6"	"02327"	"CHEK2_000520"	"g.29121037G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915515"	"0"	"30"	"22"	"29121207"	"29121207"	"subst"	"0.00125185"	"02329"	"CHEK2_000224"	"g.29121207G>A"	""	""	""	"CHEK2(NM_007194.4):c.444+24C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000915516"	"0"	"90"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"02326"	"CHEK2_000072"	"g.29121230C>T"	""	""	""	"CHEK2(NM_001005735.1):c.573+1G>A (p.?), CHEK2(NM_007194.4):c.444+1G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000915517"	"0"	"50"	"22"	"29130520"	"29130520"	"subst"	"0.00015432"	"02326"	"CHEK2_000075"	"g.29130520C>T"	""	""	""	"CHEK2(NM_001005735.1):c.190G>A (p.(Glu64Lys)), CHEK2(NM_007194.4):c.190G>A (p.E64K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000915518"	"0"	"90"	"22"	"29130654"	"29130654"	"subst"	"0"	"02325"	"CHEK2_000600"	"g.29130654G>C"	""	""	""	"CHEK2(NM_007194.4):c.56C>G (p.S19*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000915519"	"0"	"30"	"22"	"29130748"	"29130748"	"subst"	"0"	"02327"	"CHEK2_000657"	"g.29130748G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000918150"	"0"	"90"	"22"	"29106048"	"29106048"	"subst"	"1.63183E-5"	"01082"	"CHEK2_000443"	"g.29106048C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28710060C>T"	""	"pathogenic (dominant)"	"ACMG"
"0000920184"	"0"	"90"	"22"	"29121087"	"29121087"	"subst"	"0.00425643"	"01082"	"CHEK2_000026"	"g.29121087A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725099A>G"	"5591"	"pathogenic (dominant)"	"ACMG"
"0000920371"	"0"	"90"	"22"	"29130389"	"29130389"	"subst"	"7.31654E-5"	"01082"	"CHEK2_000554"	"g.29130389A>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28734401A>T"	""	"pathogenic (dominant)"	"ACMG"
"0000920373"	"0"	"90"	"22"	"29099555"	"29099555"	"subst"	"0"	"01082"	"CHEK2_000123"	"g.29099555C>A"	""	""	""	"976-1G>T"	""	"Germline"	""	""	"0"	""	""	"g.28703567C>A"	"1801561"	"pathogenic (dominant)"	"ACMG"
"0000920383"	"0"	"90"	"22"	"29090054"	"29090054"	"subst"	"0.000340323"	"01082"	"CHEK2_000009"	"g.29090054G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28694066G>A"	"128060"	"pathogenic (dominant)"	"ACMG"
"0000920390"	"0"	"90"	"22"	"29121087"	"29121087"	"subst"	"0.00425643"	"01082"	"CHEK2_000026"	"g.29121087A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28725099A>G"	""	"pathogenic (dominant)"	"ACMG"
"0000920395"	"0"	"90"	"22"	"29091839"	"29091855"	"dup"	"0"	"01082"	"CHEK2_000658"	"g.29091839_29091855dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695851_28695867dup"	""	"pathogenic (dominant)"	"ACMG"
"0000927126"	"0"	"50"	"22"	"29083887"	"29083887"	"subst"	"0"	"02327"	"CHEK2_000659"	"g.29083887A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927127"	"0"	"30"	"22"	"29083950"	"29083950"	"subst"	"0"	"02327"	"CHEK2_000083"	"g.29083950G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000927128"	"0"	"50"	"22"	"29090021"	"29090021"	"subst"	"0"	"02327"	"CHEK2_000660"	"g.29090021T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927129"	"0"	"50"	"22"	"29090028"	"29090028"	"subst"	"0"	"02327"	"CHEK2_000295"	"g.29090028A>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927130"	"0"	"50"	"22"	"29091115"	"29091115"	"subst"	"0"	"02327"	"CHEK2_000661"	"g.29091115C>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927131"	"0"	"90"	"22"	"29091725"	"29091725"	"subst"	"8.16147E-6"	"02325"	"CHEK2_000200"	"g.29091725C>T"	""	""	""	"CHEK2(NM_007194.4):c.1232G>A (p.W411*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000927132"	"0"	"50"	"22"	"29091741"	"29091741"	"subst"	"5.29032E-5"	"02329"	"CHEK2_000187"	"g.29091741G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1345C>T (p.(Arg449Cys)), CHEK2(NM_007194.4):c.1216C>T (p.R406C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927133"	"0"	"30"	"22"	"29092870"	"29092870"	"subst"	"0.000179219"	"02327"	"CHEK2_000057"	"g.29092870C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1224+19G>A (p.(=)), CHEK2(NM_007194.4):c.1095+19G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000927134"	"0"	"50"	"22"	"29092951"	"29092951"	"subst"	"4.06537E-6"	"02327"	"CHEK2_000376"	"g.29092951G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927135"	"0"	"50"	"22"	"29099493"	"29099493"	"subst"	"0"	"02327"	"CHEK2_000662"	"g.29099493A>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927136"	"0"	"50"	"22"	"29099553"	"29099553"	"subst"	"0"	"02325"	"CHEK2_000260"	"g.29099553G>T"	""	""	""	"CHEK2(NM_007194.4):c.848C>A (p.P283H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927137"	"0"	"30"	"22"	"29099571"	"29099571"	"subst"	"0.000186382"	"02326"	"CHEK2_000219"	"g.29099571A>G"	""	""	""	"CHEK2(NM_001005735.1):c.976-17T>C (p.(=)), CHEK2(NM_007194.4):c.847-17T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000927138"	"0"	"70"	"22"	"29107895"	"29107895"	"subst"	"4.06772E-6"	"01804"	"CHEK2_000446"	"g.29107895A>G"	""	""	""	"CHEK2(NM_007194.3):c.792+2T>C (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000927139"	"0"	"50"	"22"	"29107949"	"29107949"	"subst"	"4.06246E-6"	"02325"	"CHEK2_000457"	"g.29107949G>T"	""	""	""	"CHEK2(NM_007194.4):c.740C>A (p.A247D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927140"	"0"	"90"	"22"	"29107956"	"29107956"	"subst"	"0"	"02325"	"CHEK2_000461"	"g.29107956T>A"	""	""	""	"CHEK2(NM_007194.4):c.733A>T (p.K245*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000927141"	"0"	"50"	"22"	"29115403"	"29115403"	"subst"	"4.48398E-5"	"02329"	"CHEK2_000018"	"g.29115403G>C"	""	""	""	"CHEK2(NM_007194.4):c.663C>G (p.I221M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927142"	"0"	"90"	"22"	"29115439"	"29115442"	"del"	"0"	"02327"	"CHEK2_000493"	"g.29115439_29115442del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000927143"	"0"	"50"	"22"	"29121077"	"29121077"	"subst"	"0.000121847"	"02369"	"CHEK2_000203"	"g.29121077T>C"	""	""	""	"CHEK2(NM_001005735.1):c.609A>G (p.(Ile203Met)), CHEK2(NM_007194.4):c.480A>G (p.I160M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927144"	"0"	"30"	"22"	"29121083"	"29121083"	"subst"	"3.24923E-5"	"02327"	"CHEK2_000663"	"g.29121083T>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000927145"	"0"	"50"	"22"	"29121106"	"29121106"	"subst"	"4.06194E-6"	"02329"	"CHEK2_000664"	"g.29121106C>A"	""	""	""	"CHEK2(NM_007194.4):c.451G>T (p.G151C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927146"	"0"	"30"	"22"	"29121212"	"29121212"	"subst"	"0.000463339"	"02327"	"CHEK2_000225"	"g.29121212A>G"	""	""	""	"CHEK2(NM_007194.4):c.444+19T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000927147"	"0"	"50"	"22"	"29121253"	"29121253"	"subst"	"0"	"02327"	"CHEK2_000536"	"g.29121253T>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927148"	"0"	"30"	"22"	"29130456"	"29130456"	"subst"	"0.000901699"	"01804"	"CHEK2_000029"	"g.29130456G>A"	""	""	""	"CHEK2(NM_001005735.1):c.254C>T (p.(Pro85Leu)), CHEK2(NM_007194.4):c.254C>T (p.P85L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000927149"	"0"	"90"	"22"	"29130494"	"29130494"	"subst"	"0"	"02326"	"CHEK2_000568"	"g.29130494A>C"	""	""	""	"CHEK2(NM_007194.4):c.216T>G (p.Y72*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000931258"	"0"	"30"	"22"	"29083920"	"29083920"	"subst"	"0"	"02327"	"CHEK2_000080"	"g.29083920T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000931259"	"0"	"70"	"22"	"29083962"	"29083962"	"subst"	"0"	"01804"	"CHEK2_000086"	"g.29083962G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1684C>T (p.(Arg562*)), CHEK2(NM_007194.4):c.1555C>T (p.R519*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000931260"	"0"	"30"	"22"	"29085164"	"29085164"	"subst"	"0.000497651"	"02329"	"CHEK2_000286"	"g.29085164C>T"	""	""	""	"CHEK2(NM_007194.4):c.1501G>A (p.E501K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000931261"	"0"	"30"	"22"	"29085176"	"29085176"	"subst"	"0.000227009"	"02329"	"CHEK2_000255"	"g.29085176C>T"	""	""	""	"CHEK2(NM_007194.4):c.1489G>A (p.D497N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000931262"	"0"	"50"	"22"	"29090025"	"29090025"	"subst"	"0"	"02327"	"CHEK2_000665"	"g.29090025G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000931263"	"0"	"70"	"22"	"29090054"	"29090065"	"del"	"0"	"02329"	"CHEK2_000666"	"g.29090054_29090065del"	""	""	""	"CHEK2(NM_007194.4):c.1417_1428delGCACGTTTTACG (p.A473_T476del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000931264"	"0"	"70"	"22"	"29090106"	"29090106"	"subst"	"0"	"02329"	"CHEK2_000308"	"g.29090106C>G"	""	""	""	"CHEK2(NM_007194.4):c.1376-1G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000931265"	"0"	"50"	"22"	"29091139"	"29091139"	"subst"	"2.84715E-5"	"02329"	"CHEK2_000315"	"g.29091139C>T"	""	""	""	"CHEK2(NM_007194.4):c.1351G>A (p.V451I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000931266"	"0"	"50"	"22"	"29091777"	"29091777"	"subst"	"2.03328E-5"	"01804"	"CHEK2_000345"	"g.29091777C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1309G>A (p.(Glu437Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000931267"	"0"	"90"	"22"	"29091839"	"29091855"	"del"	"0"	"02327"	"CHEK2_000652"	"g.29091839_29091855del"	""	""	""	"CHEK2(NM_007194.4):c.1111_1127delCACTCCAAGATTTTGGG (p.H371Rfs*18)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000931268"	"0"	"50"	"22"	"29095831"	"29095831"	"subst"	"4.06138E-6"	"02329"	"CHEK2_000060"	"g.29095831C>G"	""	""	""	"CHEK2(NM_007194.4):c.1003G>C (p.V335L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000931269"	"0"	"30"	"22"	"29121019"	"29121019"	"subst"	"0.00099909"	"02369"	"CHEK2_000022"	"g.29121019G>A"	""	""	""	"CHEK2(NM_001005735.1):c.667C>T (p.(Arg223Cys)), CHEK2(NM_007194.4):c.538C>T (p.R180C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000931271"	"0"	"50"	"22"	"29130702"	"29130702"	"subst"	"0"	"02325"	"CHEK2_000651"	"g.29130702C>A"	""	""	""	"CHEK2(NM_007194.4):c.8G>T (p.R3L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000935185"	"0"	"90"	"22"	"29106048"	"29106048"	"subst"	"1.63183E-5"	"00006"	"CHEK2_000443"	"g.29106048C>T"	""	"{PMID:Schnoll 2023:36758531}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.28710060C>T"	""	"pathogenic"	""
"0000951563"	"0"	"50"	"22"	"29083961"	"29083961"	"subst"	"0"	"02329"	"CHEK2_000036"	"g.29083961C>A"	""	""	""	"CHEK2(NM_001005735.1):c.1685G>T (p.(Arg562Leu)), CHEK2(NM_007194.4):c.1556G>T (p.R519L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000951564"	"0"	"50"	"22"	"29083962"	"29083962"	"subst"	"0"	"02325"	"CHEK2_000086"	"g.29083962G>A"	""	""	""	"CHEK2(NM_001005735.1):c.1684C>T (p.(Arg562*)), CHEK2(NM_007194.4):c.1555C>T (p.R519*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000951565"	"0"	"70"	"22"	"29083975"	"29083987"	"del"	"0"	"02326"	"CHEK2_000668"	"g.29083975_29083987del"	""	""	""	"CHEK2(NM_007194.4):c.1543-9_1546delTATTTTCAGCCTT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000951566"	"0"	"70"	"22"	"29090015"	"29090015"	"subst"	"0"	"02327"	"CHEK2_000047"	"g.29090015C>T"	""	""	""	"CHEK2(NM_007194.4):c.1461+5G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000951567"	"0"	"90"	"22"	"29091787"	"29091787"	"subst"	"0"	"02329"	"CHEK2_000347"	"g.29091787G>T"	""	""	""	"CHEK2(NM_007194.4):c.1170C>A (p.Y390*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000951568"	"0"	"50"	"22"	"29091803"	"29091803"	"subst"	"8.13365E-6"	"02327"	"CHEK2_000669"	"g.29091803C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000951569"	"0"	"50"	"22"	"29099540"	"29099540"	"subst"	"0"	"02326"	"CHEK2_000670"	"g.29099540C>A"	""	""	""	"CHEK2(NM_007194.4):c.861G>T (p.K287N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000951570"	"0"	"70"	"22"	"29105993"	"29105993"	"subst"	"0"	"02369"	"CHEK2_000423"	"g.29105993C>G"	""	""	""	"CHEK2(NM_001005735.1):c.975+1G>C (p.?), CHEK2(NM_007194.4):c.846+1G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000951571"	"0"	"50"	"22"	"29107962"	"29107962"	"subst"	"1.21869E-5"	"02327"	"CHEK2_000464"	"g.29107962A>G"	""	""	""	"CHEK2(NM_007194.4):c.727T>C (p.C243R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000951572"	"0"	"90"	"22"	"29115473"	"29115473"	"del"	"0"	"02369"	"CHEK2_000063"	"g.29115473del"	""	""	""	"CHEK2(NM_007194.4):c.597delT (p.F199Lfs*6)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000951573"	"0"	"10"	"22"	"29115487"	"29115487"	"subst"	"0.00313987"	"02326"	"CHEK2_000221"	"g.29115487G>A"	""	""	""	"CHEK2(NM_001005735.1):c.722-14C>T (p.(=)), CHEK2(NM_007194.4):c.593-14C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000951574"	"0"	"90"	"22"	"29121031"	"29121031"	"del"	"0"	"02327"	"CHEK2_000671"	"g.29121031del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000951575"	"0"	"50"	"22"	"29121079"	"29121079"	"subst"	"4.06151E-6"	"02327"	"CHEK2_000071"	"g.29121079T>C"	""	""	""	"CHEK2(NM_007194.4):c.478A>G (p.I160V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000951576"	"0"	"50"	"22"	"29121081"	"29121081"	"subst"	"4.06154E-6"	"02327"	"CHEK2_000529"	"g.29121081T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000951577"	"0"	"50"	"22"	"29121084"	"29121084"	"subst"	"0"	"02325"	"CHEK2_000672"	"g.29121084G>A"	""	""	""	"CHEK2(NM_007194.4):c.473C>T (p.A158V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000951578"	"0"	"90"	"22"	"29130427"	"29130427"	"subst"	"8.12466E-6"	"02369"	"CHEK2_000027"	"g.29130427G>A"	""	""	""	"CHEK2(NM_007194.4):c.283C>T (p.R95*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000951579"	"0"	"90"	"22"	"29130559"	"29130559"	"subst"	"4.06227E-6"	"02327"	"CHEK2_000673"	"g.29130559G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000951580"	"0"	"50"	"22"	"29130588"	"29130590"	"del"	"0"	"02329"	"CHEK2_000246"	"g.29130588_29130590del"	""	""	""	"CHEK2(NM_007194.4):c.123_125delCTC (p.S42del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000951581"	"0"	"90"	"22"	"29130652"	"29130652"	"subst"	"0.000148661"	"02369"	"CHEK2_000005"	"g.29130652G>A"	""	""	""	"CHEK2(NM_001005735.1):c.58C>T (p.(Gln20Ter)), CHEK2(NM_007194.4):c.58C>T (p.Q20*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000951915"	"0"	"90"	"22"	"29115450"	"29115451"	"del"	"0"	"04599"	"CHEK2_000667"	"g.29115450_29115451del"	""	""	""	""	""	"Germline"	"?"	""	"0"	""	""	"g.28719462_28719463del"	"460846"	"pathogenic"	"ACMG"
"0000952207"	"0"	"90"	"22"	"29091770"	"29091770"	"del"	"0"	"04599"	"CHEK2_000172"	"g.29091770del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28695782del"	""	"pathogenic"	"ACMG"
"0000952208"	"0"	"90"	"22"	"29115450"	"29115451"	"del"	"0"	"04599"	"CHEK2_000667"	"g.29115450_29115451del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28719462_28719463del"	""	"pathogenic"	"ACMG"
"0000970430"	"0"	"30"	"22"	"29083867"	"29083867"	"subst"	"0"	"02327"	"CHEK2_000038"	"g.29083867G>A"	""	""	""	"CHEK2(NM_007194.4):c.*18C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000970431"	"0"	"30"	"22"	"29083965"	"29083965"	"subst"	"0"	"02327"	"CHEK2_000674"	"g.29083965T>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000970432"	"0"	"30"	"22"	"29090053"	"29090053"	"subst"	"4.36319E-6"	"02329"	"CHEK2_000639"	"g.29090053C>T"	""	""	""	"CHEK2(NM_007194.4):c.1428G>A (p.T476=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000970433"	"0"	"30"	"22"	"29091138"	"29091138"	"subst"	"0"	"02327"	"CHEK2_000675"	"g.29091138A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000970434"	"0"	"50"	"22"	"29091174"	"29091174"	"subst"	"0"	"02329"	"CHEK2_000676"	"g.29091174T>C"	""	""	""	"CHEK2(NM_007194.4):c.1316A>G (p.Q439R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000970435"	"0"	"50"	"22"	"29091225"	"29091225"	"subst"	"8.15169E-6"	"02329"	"CHEK2_000185"	"g.29091225C>T"	""	""	""	"CHEK2(NM_007194.4):c.1265G>A (p.S422N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000970436"	"0"	"30"	"22"	"29091682"	"29091682"	"subst"	"4.0783E-6"	"01804"	"CHEK2_000677"	"g.29091682T>C"	""	""	""	"CHEK2(NM_007194.3):c.1259+16A>G (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000970437"	"0"	"70"	"22"	"29091788"	"29091788"	"subst"	"0"	"02369"	"CHEK2_000188"	"g.29091788T>C"	""	""	""	"CHEK2(NM_007194.3):c.1169A>G (p.(Tyr390Cys)), CHEK2(NM_007194.4):c.1169A>G (p.Y390C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000970438"	"0"	"70"	"22"	"29091788"	"29091788"	"subst"	"2.44008E-5"	"02329"	"CHEK2_000348"	"g.29091788T>G"	""	""	""	"CHEK2(NM_007194.4):c.1169A>C (p.Y390S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000970440"	"0"	"50"	"22"	"29092902"	"29092902"	"subst"	"0"	"02329"	"CHEK2_000678"	"g.29092902T>C"	""	""	""	"CHEK2(NM_007194.4):c.1082A>G (p.D361G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000970441"	"0"	"70"	"22"	"29092945"	"29092945"	"subst"	"1.6257E-5"	"02369"	"CHEK2_000374"	"g.29092945C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1168G>A (p.(Asp390Asn)), CHEK2(NM_007194.4):c.1039G>A (p.D347N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000970442"	"0"	"70"	"22"	"29092947"	"29092947"	"subst"	"8.12909E-6"	"02329"	"CHEK2_000244"	"g.29092947C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1166G>A (p.(Arg389His)), CHEK2(NM_007194.4):c.1037G>A (p.R346H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000970443"	"0"	"50"	"22"	"29092962"	"29092962"	"subst"	"1.62632E-5"	"01804"	"CHEK2_000059"	"g.29092962T>G"	""	""	""	"CHEK2(NM_001005735.1):c.1151A>C (p.(Asn384Thr)), CHEK2(NM_007194.4):c.1022A>C (p.N341T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000970444"	"0"	"10"	"22"	"29095634"	"29095634"	"subst"	"0"	"02327"	"CHEK2_000679"	"g.29095634A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000970445"	"0"	"50"	"22"	"29099554"	"29099554"	"subst"	"0"	"02329"	"CHEK2_000422"	"g.29099554G>A"	""	""	""	"CHEK2(NM_007194.4):c.847C>T (p.P283S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000970446"	"0"	"30"	"22"	"29099571"	"29099571"	"subst"	"0.000186382"	"01804"	"CHEK2_000219"	"g.29099571A>G"	""	""	""	"CHEK2(NM_001005735.1):c.976-17T>C (p.(=)), CHEK2(NM_007194.4):c.847-17T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000970447"	"0"	"70"	"22"	"29105990"	"29105993"	"del"	"0"	"02369"	"CHEK2_000202"	"g.29105990_29105993del"	""	""	""	"CHEK2(NM_007194.4):c.846+4_846+7delAGTA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000970448"	"0"	"50"	"22"	"29107943"	"29107943"	"subst"	"0"	"02325"	"CHEK2_000456"	"g.29107943T>C"	""	""	""	"CHEK2(NM_007194.4):c.746A>G (p.K249R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000970450"	"0"	"50"	"22"	"29121054"	"29121054"	"subst"	"0"	"02329"	"CHEK2_000524"	"g.29121054G>A"	""	""	""	"CHEK2(NM_007194.4):c.503C>T (p.T168I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000970451"	"0"	"50"	"22"	"29121274"	"29121274"	"subst"	"0"	"02327"	"CHEK2_000680"	"g.29121274T>C"	""	""	""	"CHEK2(NM_007194.4):c.401A>G (p.D134G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000970452"	"0"	"50"	"22"	"29121334"	"29121334"	"subst"	"0"	"01804"	"CHEK2_000681"	"g.29121334C>A"	""	""	""	"CHEK2(NM_007194.3):c.341G>T (p.(Trp114Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000970453"	"0"	"30"	"22"	"29130402"	"29130402"	"subst"	"0"	"02327"	"CHEK2_000682"	"g.29130402A>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000970455"	"0"	"50"	"22"	"29130552"	"29130552"	"subst"	"5.28035E-5"	"02327"	"CHEK2_000683"	"g.29130552G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000970456"	"0"	"50"	"22"	"29130649"	"29130649"	"subst"	"0"	"02329"	"CHEK2_000684"	"g.29130649G>A"	""	""	""	"CHEK2(NM_007194.4):c.61C>T (p.P21S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000972036"	"0"	"70"	"22"	"29121230"	"29121230"	"subst"	"0.000134123"	"03779"	"CHEK2_000072"	"g.29121230C>T"	""	""	""	""	""	"CLASSIFICATION record"	""	"rs121908698"	"0"	""	""	""	""	"likely pathogenic"	""
"0000984169"	"0"	"30"	"22"	"29085046"	"29085046"	"subst"	"0"	"02369"	"CHEK2_000685"	"g.29085046A>G"	""	""	""	"CHEK2(NM_007194.4):c.1542+77T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000984170"	"0"	"30"	"22"	"29090071"	"29090071"	"subst"	"8.72654E-6"	"02327"	"CHEK2_000686"	"g.29090071A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000984171"	"0"	"50"	"22"	"29090121"	"29090132"	"del"	"0"	"02329"	"CHEK2_000687"	"g.29090121_29090132del"	""	""	""	"CHEK2(NM_007194.4):c.1376-26_1376-15delTGTGATTTGCCC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000984172"	"0"	"50"	"22"	"29091154"	"29091154"	"subst"	"7.32076E-5"	"01804"	"CHEK2_000213"	"g.29091154T>C"	""	""	""	"CHEK2(NM_001005735.1):c.1465A>G (p.(Asn489Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000984173"	"0"	"90"	"22"	"29092900"	"29092901"	"ins"	"0"	"01804"	"CHEK2_000688"	"g.29092900_29092901insAA"	""	""	""	"CHEK2(NM_007194.3):c.1084_1085insTT (p.(Cys362PhefsTer4))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000984174"	"0"	"50"	"22"	"29095857"	"29095857"	"subst"	"0"	"02325"	"CHEK2_000385"	"g.29095857A>G"	""	""	""	"CHEK2(NM_007194.4):c.977T>C (p.L326P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000984175"	"0"	"30"	"22"	"29095916"	"29095916"	"subst"	"4.06494E-6"	"01804"	"CHEK2_000689"	"g.29095916C>G"	""	""	""	"CHEK2(NM_007194.3):c.918G>C (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000984176"	"0"	"30"	"22"	"29099571"	"29099571"	"subst"	"0.000186382"	"02329"	"CHEK2_000219"	"g.29099571A>G"	""	""	""	"CHEK2(NM_001005735.1):c.976-17T>C (p.(=)), CHEK2(NM_007194.4):c.847-17T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000984177"	"0"	"30"	"22"	"29115468"	"29115468"	"subst"	"0"	"02327"	"CHEK2_000506"	"g.29115468C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000984178"	"0"	"10"	"22"	"29115487"	"29115487"	"subst"	"0.00313987"	"01804"	"CHEK2_000221"	"g.29115487G>A"	""	""	""	"CHEK2(NM_001005735.1):c.722-14C>T (p.(=)), CHEK2(NM_007194.4):c.593-14C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000984179"	"0"	"50"	"22"	"29121018"	"29121018"	"subst"	"6.09226E-5"	"01804"	"CHEK2_000068"	"g.29121018C>T"	""	""	""	"CHEK2(NM_001005735.1):c.668G>A (p.(Arg223His)), CHEK2(NM_007194.4):c.539G>A (p.R180H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000984180"	"0"	"50"	"22"	"29121274"	"29121274"	"subst"	"0"	"02325"	"CHEK2_000680"	"g.29121274T>C"	""	""	""	"CHEK2(NM_007194.4):c.401A>G (p.D134G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000984181"	"0"	"30"	"22"	"29121327"	"29121327"	"subst"	"0"	"01804"	"CHEK2_000690"	"g.29121327C>T"	""	""	""	"CHEK2(NM_007194.3):c.348G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001005983"	"0"	"50"	"22"	"29083975"	"29083987"	"del"	"0"	"02325"	"CHEK2_000668"	"g.29083975_29083987del"	""	""	""	"CHEK2(NM_007194.4):c.1543-9_1546delTATTTTCAGCCTT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001005984"	"0"	"70"	"22"	"29090054"	"29090065"	"del"	"0"	"02325"	"CHEK2_000666"	"g.29090054_29090065del"	""	""	""	"CHEK2(NM_007194.4):c.1417_1428delGCACGTTTTACG (p.A473_T476del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001005985"	"0"	"70"	"22"	"29090060"	"29090060"	"subst"	"6.54485E-5"	"01804"	"CHEK2_000183"	"g.29090060C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1550G>A (p.(Arg517His)), CHEK2(NM_007194.4):c.1421G>A (p.R474H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001005986"	"0"	"30"	"22"	"29090074"	"29090074"	"subst"	"0.000466882"	"01804"	"CHEK2_000627"	"g.29090074C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1536G>A (p.(Val512=)), CHEK2(NM_007194.4):c.1407G>A (p.V469=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001005987"	"0"	"90"	"22"	"29091210"	"29091211"	"ins"	"0"	"02369"	"CHEK2_000691"	"g.29091210_29091211insG"	""	""	""	"CHEK2(NM_007194.4):c.1279_1280insC (p.F427Sfs*3)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001005988"	"0"	"90"	"22"	"29091228"	"29091228"	"del"	"0"	"02369"	"CHEK2_000325"	"g.29091228del"	""	""	""	"CHEK2(NM_007194.4):c.1263delT (p.S422Vfs*15)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001005989"	"0"	"50"	"22"	"29091753"	"29091753"	"subst"	"8.13484E-6"	"02329"	"CHEK2_000339"	"g.29091753C>T"	""	""	""	"CHEK2(NM_007194.4):c.1204G>A (p.A402T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001005990"	"0"	"70"	"22"	"29091788"	"29091788"	"subst"	"0"	"01804"	"CHEK2_000188"	"g.29091788T>C"	""	""	""	"CHEK2(NM_007194.3):c.1169A>G (p.(Tyr390Cys)), CHEK2(NM_007194.4):c.1169A>G (p.Y390C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001005991"	"0"	"50"	"22"	"29092893"	"29092893"	"subst"	"2.43891E-5"	"02329"	"CHEK2_000363"	"g.29092893A>G"	""	""	""	"CHEK2(NM_007194.4):c.1091T>C (p.I364T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001005992"	"0"	"50"	"22"	"29092933"	"29092933"	"subst"	"0"	"02329"	"CHEK2_000373"	"g.29092933C>T"	""	""	""	"CHEK2(NM_007194.4):c.1051G>A (p.E351K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001005993"	"0"	"70"	"22"	"29092947"	"29092947"	"subst"	"8.12909E-6"	"01804"	"CHEK2_000244"	"g.29092947C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1166G>A (p.(Arg389His)), CHEK2(NM_007194.4):c.1037G>A (p.R346H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001005994"	"0"	"70"	"22"	"29092948"	"29092948"	"subst"	"5.28421E-5"	"02327"	"CHEK2_000114"	"g.29092948G>A"	""	""	""	"CHEK2(NM_007194.4):c.1036C>T (p.R346C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001005995"	"0"	"50"	"22"	"29092962"	"29092962"	"subst"	"1.62632E-5"	"02329"	"CHEK2_000059"	"g.29092962T>G"	""	""	""	"CHEK2(NM_001005735.1):c.1151A>C (p.(Asn384Thr)), CHEK2(NM_007194.4):c.1022A>C (p.N341T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001005996"	"0"	"50"	"22"	"29115484"	"29115488"	"del"	"0"	"01804"	"CHEK2_000656"	"g.29115484_29115488del"	""	""	""	"CHEK2(NM_001005735.1):c.722-11_722-7del (p.(=)), CHEK2(NM_007194.4):c.593-11_593-7delTTCTT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001005997"	"0"	"30"	"22"	"29117603"	"29117603"	"subst"	"0"	"02327"	"CHEK2_000692"	"g.29117603G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001005998"	"0"	"30"	"22"	"29117635"	"29117635"	"dup"	"0"	"01804"	"CHEK2_000197"	"g.29117635dup"	""	""	""	"CHEK2(NM_001257387.1):c.-185-6dup (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001005999"	"0"	"50"	"22"	"29130495"	"29130495"	"subst"	"2.03052E-5"	"02327"	"CHEK2_000159"	"g.29130495T>C"	""	""	""	"CHEK2(NM_007194.4):c.215A>G (p.Y72C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001006000"	"0"	"50"	"22"	"29130534"	"29130534"	"subst"	"1.62455E-5"	"02329"	"CHEK2_000076"	"g.29130534G>T"	""	""	""	"CHEK2(NM_007194.4):c.176C>A (p.T59K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001006001"	"0"	"30"	"22"	"29130575"	"29130575"	"subst"	"2.0325E-5"	"02329"	"CHEK2_000693"	"g.29130575C>T"	""	""	""	"CHEK2(NM_007194.4):c.135G>A (p.T45=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001006002"	"0"	"30"	"22"	"29130696"	"29130696"	"subst"	"6.67089E-5"	"02327"	"CHEK2_000605"	"g.29130696G>A"	""	""	""	"CHEK2(NM_007194.4):c.14C>T (p.S5L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001008363"	"0"	"90"	"22"	"29091857"	"29091857"	"del"	"0.00207692"	"03779"	"CHEK2_000001"	"g.29091857del"	""	""	""	""	""	"CLASSIFICATION record"	""	"rs555607708"	"0"	""	""	""	""	"pathogenic"	""
"0001010979"	"0"	"90"	"22"	"29090022"	"29090022"	"subst"	"1.74538E-5"	"04749"	"CHEK2_000293"	"g.29090022G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28694034G>A"	""	"pathogenic"	""
"0001015922"	"0"	"30"	"22"	"29092075"	"29092075"	"subst"	"0"	"02329"	"CHEK2_000694"	"g.29092075C>T"	""	""	""	"CHEK2(NM_007194.4):c.1096-214G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001015923"	"0"	"50"	"22"	"29092889"	"29092889"	"subst"	"0"	"02329"	"CHEK2_000362"	"g.29092889C>G"	""	""	""	"CHEK2(NM_007194.4):c.1095G>C (p.K365N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001015924"	"0"	"50"	"22"	"29099495"	"29099495"	"subst"	"3.03027E-5"	"02327"	"CHEK2_000406"	"g.29099495T>G"	""	""	""	"CHEK2(NM_007194.4):c.906A>C (p.E302D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001015925"	"0"	"10"	"22"	"29108112"	"29108112"	"subst"	"0"	"02327"	"CHEK2_000695"	"g.29108112A>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001015926"	"0"	"10"	"22"	"29120915"	"29120915"	"subst"	"0.00269203"	"02327"	"CHEK2_000696"	"g.29120915T>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001015927"	"0"	"30"	"22"	"29120975"	"29120975"	"subst"	"0"	"02327"	"CHEK2_000697"	"g.29120975G>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001015928"	"0"	"30"	"22"	"29121265"	"29121265"	"subst"	"0.000178802"	"01804"	"CHEK2_000144"	"g.29121265C>T"	""	""	""	"CHEK2(NM_001005735.1):c.539G>A (p.(Arg180Gln)), CHEK2(NM_007194.4):c.410G>A (p.R137Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001015929"	"0"	"70"	"22"	"29121352"	"29121353"	"del"	"0"	"02329"	"CHEK2_000698"	"g.29121352_29121353del"	""	""	""	"CHEK2(NM_007194.4):c.326_327delTG (p.V109Efs*2)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001015930"	"0"	"10"	"22"	"29130352"	"29130352"	"dup"	"0"	"02369"	"CHEK2_000003"	"g.29130352dup"	""	""	""	"CHEK2(NM_007194.4):c.319+43dupA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001015931"	"0"	"50"	"22"	"29130678"	"29130678"	"subst"	"0"	"02329"	"CHEK2_000699"	"g.29130678T>G"	""	""	""	"CHEK2(NM_007194.4):c.32A>C (p.Q11P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001015932"	"0"	"50"	"22"	"29130703"	"29130703"	"subst"	"0.000288105"	"02329"	"CHEK2_000610"	"g.29130703G>A"	""	""	""	"CHEK2(NM_007194.4):c.7C>T (p.R3W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001022155"	"0"	"90"	"22"	"29090106"	"29090106"	"subst"	"0"	"04796"	"CHEK2_000308"	"g.29090106C>G"	""	""	""	""	"multiple effects on RNA"	"In vitro (cloned)"	""	""	"0"	""	""	"g.28694118C>G"	""	"pathogenic"	""
"0001022168"	"0"	"70"	"22"	"29090132"	"29090132"	"subst"	"8.72913E-6"	"04796"	"CHEK2_000700"	"g.29090132G>C"	""	""	""	""	"effect on RNA inclusion of intron sequences"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.28694144G>C"	""	"likely pathogenic"	""
"0001027381"	"0"	"30"	"22"	"29083894"	"29083894"	"subst"	"0"	"02369"	"CHEK2_000701"	"g.29083894A>C"	""	""	""	"CHEK2(NM_007194.4):c.1623T>G (p.A541=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001027382"	"0"	"50"	"22"	"29090031"	"29090031"	"subst"	"4.36331E-6"	"02329"	"CHEK2_000048"	"g.29090031G>T"	""	""	""	"CHEK2(NM_007194.4):c.1450C>A (p.P484T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001027383"	"0"	"10"	"22"	"29091037"	"29091037"	"subst"	"0"	"02327"	"CHEK2_000702"	"g.29091037G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001027384"	"0"	"70"	"22"	"29091113"	"29091113"	"subst"	"0"	"02369"	"CHEK2_000050"	"g.29091113A>C"	""	""	""	"CHEK2(NM_007194.4):c.1375+2T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001027385"	"0"	"30"	"22"	"29091246"	"29091246"	"subst"	"0"	"02327"	"CHEK2_000703"	"g.29091246G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001027386"	"0"	"70"	"22"	"29091782"	"29091782"	"subst"	"4.47314E-5"	"02329"	"CHEK2_000015"	"g.29091782G>A"	""	""	""	"CHEK2(NM_007194.4):c.1175C>T (p.A392V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001027387"	"0"	"50"	"22"	"29091840"	"29091841"	"inv"	"0"	"02327"	"CHEK2_000704"	"g.29091840_29091841inv"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001027388"	"0"	"70"	"22"	"29092945"	"29092945"	"subst"	"1.6257E-5"	"01804"	"CHEK2_000374"	"g.29092945C>T"	""	""	""	"CHEK2(NM_001005735.1):c.1168G>A (p.(Asp390Asn)), CHEK2(NM_007194.4):c.1039G>A (p.D347N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001027389"	"0"	"50"	"22"	"29095854"	"29095854"	"subst"	"1.62438E-5"	"01804"	"CHEK2_000061"	"g.29095854T>C"	""	""	""	"CHEK2(NM_001005735.1):c.1109A>G (p.(Tyr370Cys)), CHEK2(NM_007194.4):c.980A>G (p.Y327C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001027390"	"0"	"30"	"22"	"29095856"	"29095856"	"subst"	"4.06075E-6"	"02329"	"CHEK2_000705"	"g.29095856G>A"	""	""	""	"CHEK2(NM_007194.4):c.978C>T (p.L326=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001027391"	"0"	"50"	"22"	"29095867"	"29095867"	"subst"	"0"	"02325"	"CHEK2_000389"	"g.29095867T>G"	""	""	""	"CHEK2(NM_007194.4):c.967A>C (p.T323P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001027392"	"0"	"30"	"22"	"29107934"	"29107934"	"subst"	"6.09459E-5"	"02327"	"CHEK2_000128"	"g.29107934C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001027393"	"0"	"90"	"22"	"29107962"	"29107963"	"del"	"4.0624E-6"	"02325"	"CHEK2_000706"	"g.29107962_29107963del"	""	""	""	"CHEK2(NM_007194.4):c.726_727delAT (p.C243*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001027394"	"0"	"90"	"22"	"29115402"	"29115402"	"del"	"0"	"01804"	"CHEK2_000707"	"g.29115402del"	""	""	""	"CHEK2(NM_007194.3):c.664del (p.(Met222CysfsTer13))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001027395"	"0"	"10"	"22"	"29120935"	"29120935"	"dup"	"0"	"02369"	"CHEK2_000708"	"g.29120935dup"	""	""	""	"CHEK2(NM_007194.4):c.592+39dupT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001027396"	"0"	"50"	"22"	"29121016"	"29121016"	"subst"	"0.000113725"	"02329"	"CHEK2_000021"	"g.29121016G>A"	""	""	""	"CHEK2(NM_001005735.1):c.670C>T (p.(Arg224Cys)), CHEK2(NM_007194.4):c.541C>T (p.R181C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001027397"	"0"	"70"	"22"	"29121242"	"29121242"	"subst"	"4.47053E-5"	"02329"	"CHEK2_000034"	"g.29121242G>A"	""	""	""	"CHEK2(NM_007194.4):c.433C>T (p.R145W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001027398"	"0"	"30"	"22"	"29126623"	"29126623"	"subst"	"0"	"02369"	"CHEK2_000709"	"g.29126623A>G"	""	""	""	"CHEK2(NM_007194.4):c.319+3768T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001029977"	"0"	"50"	"22"	"29092945"	"29092945"	"subst"	"1.6257E-5"	"04818"	"CHEK2_000374"	"g.29092945C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28696957C>T"	""	"VUS"	"ACMG"
"0001029978"	"0"	"50"	"22"	"29115484"	"29115488"	"del"	"0"	"04818"	"CHEK2_000656"	"g.29115484_29115488del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.28719496_28719500del"	""	"VUS"	"ACMG"
"0001043788"	"0"	"70"	"22"	"29090062"	"29090064"	"del"	"0"	"02325"	"CHEK2_000710"	"g.29090062_29090064del"	""	""	""	"CHEK2(NM_007194.4):c.1417_1419delGCA (p.A473del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001043789"	"0"	"30"	"22"	"29090117"	"29090117"	"subst"	"0"	"02329"	"CHEK2_000210"	"g.29090117A>G"	""	""	""	"CHEK2(NM_001005735.1):c.1505-12T>C (p.(=)), CHEK2(NM_007194.4):c.1376-12T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001043790"	"0"	"50"	"22"	"29091199"	"29091199"	"subst"	"0"	"01804"	"CHEK2_000711"	"g.29091199T>C"	""	""	""	"CHEK2(NM_007194.3):c.1291A>G (p.(Arg431Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001043791"	"0"	"70"	"22"	"29091238"	"29091238"	"subst"	"0"	"02325"	"CHEK2_000629"	"g.29091238T>C"	""	""	""	"CHEK2(NM_007194.3):c.1260-8A>G (p.(=)), CHEK2(NM_007194.4):c.1260-8A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001043793"	"0"	"50"	"22"	"29092893"	"29092893"	"subst"	"2.43891E-5"	"02327"	"CHEK2_000363"	"g.29092893A>G"	""	""	""	"CHEK2(NM_007194.4):c.1091T>C (p.I364T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001043794"	"0"	"50"	"22"	"29092960"	"29092960"	"subst"	"6.50666E-5"	"02329"	"CHEK2_000378"	"g.29092960C>T"	""	""	""	"CHEK2(NM_007194.4):c.1024G>A (p.G342S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001043795"	"0"	"50"	"22"	"29095881"	"29095881"	"subst"	"4.46682E-5"	"02325"	"CHEK2_000251"	"g.29095881C>T"	""	""	""	"CHEK2(NM_007194.4):c.953G>A (p.R318H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001043796"	"0"	"30"	"22"	"29099571"	"29099571"	"subst"	"0.000186382"	"02327"	"CHEK2_000219"	"g.29099571A>G"	""	""	""	"CHEK2(NM_001005735.1):c.976-17T>C (p.(=)), CHEK2(NM_007194.4):c.847-17T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001043797"	"0"	"50"	"22"	"29099587"	"29099587"	"subst"	"0"	"02327"	"CHEK2_000712"	"g.29099587T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001043798"	"0"	"50"	"22"	"29108003"	"29108003"	"subst"	"0"	"02327"	"CHEK2_000713"	"g.29108003C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001043799"	"0"	"30"	"22"	"29115378"	"29115378"	"subst"	"0"	"02327"	"CHEK2_000714"	"g.29115378T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001043800"	"0"	"90"	"22"	"29115473"	"29115473"	"del"	"0"	"02327"	"CHEK2_000063"	"g.29115473del"	""	""	""	"CHEK2(NM_007194.4):c.597delT (p.F199Lfs*6)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001043801"	"0"	"90"	"22"	"29115473"	"29115473"	"del"	"0"	"02329"	"CHEK2_000063"	"g.29115473del"	""	""	""	"CHEK2(NM_007194.4):c.597delT (p.F199Lfs*6)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001043802"	"0"	"50"	"22"	"29115484"	"29115488"	"del"	"0"	"02325"	"CHEK2_000656"	"g.29115484_29115488del"	""	""	""	"CHEK2(NM_001005735.1):c.722-11_722-7del (p.(=)), CHEK2(NM_007194.4):c.593-11_593-7delTTCTT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001043803"	"0"	"50"	"22"	"29121054"	"29121054"	"subst"	"0"	"02327"	"CHEK2_000524"	"g.29121054G>A"	""	""	""	"CHEK2(NM_007194.4):c.503C>T (p.T168I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001043804"	"0"	"30"	"22"	"29126411"	"29126411"	"subst"	"0"	"01804"	"CHEK2_000715"	"g.29126411G>A"	""	""	""	"CHEK2(NM_001005735.1):c.445C>T (p.(Leu149=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001046809"	"0"	"50"	"22"	"29083906"	"29083906"	"dup"	"0"	"01804"	"CHEK2_000716"	"g.29083906dup"	""	""	""	"CHEK2(NM_007194.3):c.1611dup (p.(Val538CysfsTer12))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001046810"	"0"	"50"	"22"	"29090118"	"29090118"	"subst"	"8.72775E-6"	"01804"	"CHEK2_000241"	"g.29090118T>C"	""	""	""	"CHEK2(NM_001005735.1):c.1505-13A>G (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001046811"	"0"	"70"	"22"	"29105993"	"29105993"	"subst"	"0"	"01804"	"CHEK2_000423"	"g.29105993C>G"	""	""	""	"CHEK2(NM_001005735.1):c.975+1G>C (p.?), CHEK2(NM_007194.4):c.846+1G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001046812"	"0"	"30"	"22"	"29108079"	"29108079"	"subst"	"0"	"02327"	"CHEK2_000717"	"g.29108079C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001046813"	"0"	"50"	"22"	"29120997"	"29120997"	"subst"	"0"	"01804"	"CHEK2_000718"	"g.29120997G>T"	""	""	""	"CHEK2(NM_007194.3):c.560C>A (p.(Ser187Tyr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001046814"	"0"	"50"	"22"	"29121050"	"29121050"	"subst"	"8.12301E-6"	"01804"	"CHEK2_000070"	"g.29121050A>C"	""	""	""	"CHEK2(NM_001005735.1):c.636T>G (p.(Phe212Leu)), CHEK2(NM_007194.4):c.507T>G (p.F169L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes CHEK2
## Count = 1496
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000073915"	"00024043"	"11"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	"11"
"0000077041"	"00024043"	"00"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	"11"
"0000077048"	"00024043"	"00"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	"11"
"0000077213"	"00024043"	"00"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	"11"
"0000077235"	"00024043"	"00"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	"11"
"0000079148"	"00024043"	"90"	"58"	"0"	"58"	"0"	"c.58C>T"	"r.(?)"	"p.(Gln20*)"	"2"
"0000084779"	"00024043"	"70"	"277"	"0"	"277"	"0"	"c.277del"	"r.(?)"	"p.(Trp93Glyfs*17)"	"2"
"0000147523"	"00024043"	"00"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	"11"
"0000148796"	"00024043"	"00"	"1556"	"0"	"1556"	"0"	"c.1556G>T"	"r.(?)"	"p.(Arg519Leu)"	""
"0000148797"	"00024043"	"00"	"1534"	"0"	"1534"	"0"	"c.1534C>G"	"r.(?)"	"p.(Leu512Val)"	""
"0000148798"	"00024043"	"00"	"1451"	"0"	"1451"	"0"	"c.1451C>T"	"r.(?)"	"p.(Pro484Leu)"	""
"0000148799"	"00024043"	"00"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	""
"0000148801"	"00024043"	"00"	"1343"	"0"	"1343"	"0"	"c.1343T>G"	"r.(?)"	"p.(Ile448Ser)"	""
"0000148802"	"00024043"	"00"	"1312"	"0"	"1312"	"0"	"c.1312G>T"	"r.(?)"	"p.(Asp438Tyr)"	""
"0000148803"	"00024043"	"00"	"1283"	"0"	"1283"	"0"	"c.1283C>T"	"r.(?)"	"p.(Ser428Phe)"	""
"0000148804"	"00024043"	"00"	"1217"	"0"	"1217"	"0"	"c.1217G>A"	"r.(?)"	"p.(Arg406His)"	""
"0000148805"	"00024043"	"00"	"1215"	"0"	"1215"	"0"	"c.1215C>A"	"r.(?)"	"p.(Asn405Lys)"	""
"0000148806"	"00024043"	"00"	"1175"	"0"	"1175"	"0"	"c.1175C>T"	"r.(?)"	"p.(Ala392Val)"	""
"0000148807"	"00024043"	"00"	"1141"	"0"	"1141"	"0"	"c.1141A>G"	"r.(?)"	"p.(Met381Val)"	""
"0000148808"	"00024043"	"00"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	""
"0000148809"	"00024043"	"00"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	""
"0000148810"	"00024043"	"00"	"846"	"1"	"846"	"1"	"c.846+1G>T"	"r.spl?"	"p.?"	""
"0000148811"	"00024043"	"00"	"663"	"0"	"663"	"0"	"c.663C>G"	"r.(?)"	"p.(Ile221Met)"	""
"0000148812"	"00024043"	"00"	"661"	"0"	"661"	"0"	"c.661A>G"	"r.(?)"	"p.(Ile221Val)"	""
"0000148813"	"00024043"	"00"	"557"	"0"	"557"	"0"	"c.557A>G"	"r.(?)"	"p.(Asn186Ser)"	""
"0000148814"	"00024043"	"00"	"541"	"0"	"541"	"0"	"c.541C>T"	"r.(?)"	"p.(Arg181Cys)"	""
"0000148815"	"00024043"	"00"	"538"	"0"	"538"	"0"	"c.538C>T"	"r.(?)"	"p.(Arg180Cys)"	""
"0000148816"	"00024043"	"00"	"532"	"0"	"532"	"0"	"c.532G>C"	"r.(?)"	"p.(Gly178Arg)"	""
"0000148817"	"00024043"	"00"	"514"	"0"	"514"	"0"	"c.514A>G"	"r.(?)"	"p.(Thr172Ala)"	""
"0000148818"	"00024043"	"00"	"482"	"0"	"482"	"0"	"c.482A>G"	"r.(?)"	"p.(Glu161Gly)"	""
"0000148819"	"00024043"	"00"	"470"	"0"	"470"	"0"	"c.470T>C"	"r.(?)"	"p.(Ile157Thr)"	""
"0000148820"	"00024043"	"00"	"470"	"0"	"470"	"0"	"c.470T>C"	"r.(?)"	"p.(Ile157Thr)"	""
"0000148821"	"00024043"	"00"	"433"	"0"	"433"	"0"	"c.433C>T"	"r.(?)"	"p.(Arg145Trp)"	""
"0000148822"	"00024043"	"00"	"428"	"0"	"428"	"0"	"c.428A>G"	"r.(?)"	"p.(His143Arg)"	""
"0000148823"	"00024043"	"00"	"427"	"0"	"427"	"0"	"c.427C>T"	"r.(?)"	"p.(His143Tyr)"	""
"0000148824"	"00024043"	"00"	"349"	"0"	"349"	"0"	"c.349A>G"	"r.(?)"	"p.(Arg117Gly)"	""
"0000148825"	"00024043"	"00"	"283"	"0"	"283"	"0"	"c.283C>T"	"r.(?)"	"p.(Arg95*)"	""
"0000148826"	"00024043"	"50"	"246"	"0"	"260"	"0"	"c.246_260del"	"r.(?)"	"p.(Asp82_Glu86del)"	"2"
"0000148827"	"00024043"	"00"	"254"	"0"	"254"	"0"	"c.254C>T"	"r.(?)"	"p.(Pro85Leu)"	""
"0000148828"	"00024043"	"00"	"134"	"0"	"134"	"0"	"c.134C>T"	"r.(?)"	"p.(Thr45Met)"	""
"0000148829"	"00024043"	"00"	"65"	"0"	"65"	"0"	"c.65A>G"	"r.(?)"	"p.(His22Arg)"	""
"0000149157"	"00024043"	"00"	"470"	"0"	"470"	"0"	"c.470T>C"	"r.(?)"	"p.(Ile157Thr)"	""
"0000178000"	"00024043"	"90"	"432"	"0"	"432"	"0"	"c.432del"	"r.(?)"	"p.(Arg145Glyfs*16)"	"3"
"0000248132"	"00024043"	"30"	"1096"	"-4"	"1096"	"-4"	"c.1096-4T>C"	"r.spl?"	"p.?"	""
"0000249269"	"00024043"	"10"	"1462"	"-54"	"1462"	"-54"	"c.1462-54T>C"	"r.(=)"	"p.(=)"	""
"0000249615"	"00024043"	"90"	"1375"	"2"	"1375"	"2"	"c.1375+2T>G"	"r.spl?"	"p.?"	""
"0000249634"	"00024043"	"90"	"597"	"0"	"597"	"0"	"c.597del"	"r.(?)"	"p.(Phe199LeufsTer6)"	""
"0000249728"	"00024043"	"50"	"307"	"0"	"307"	"0"	"c.307T>C"	"r.(?)"	"p.(Phe103Leu)"	""
"0000249729"	"00024043"	"50"	"507"	"0"	"507"	"0"	"c.507T>G"	"r.(?)"	"p.(Phe169Leu)"	""
"0000249768"	"00024043"	"50"	"578"	"0"	"578"	"0"	"c.578T>C"	"r.(?)"	"p.(Leu193Pro)"	""
"0000249850"	"00024043"	"50"	"320"	"-5"	"320"	"-5"	"c.320-5T>A"	"r.spl?"	"p.?"	""
"0000250144"	"00024043"	"10"	"1343"	"0"	"1343"	"0"	"c.1343T>G"	"r.(?)"	"p.(Ile448Ser)"	""
"0000250245"	"00024043"	"10"	"1542"	"11"	"1542"	"11"	"c.1542+11T>A"	"r.(=)"	"p.(=)"	""
"0000254122"	"00024043"	"30"	"1096"	"-4"	"1096"	"-4"	"c.1096-4T>C"	"r.spl?"	"p.?"	""
"0000266763"	"00024043"	"50"	"-4"	"0"	"-4"	"0"	"c.-4C>T"	"r.(?)"	"p.(=)"	""
"0000266764"	"00024043"	"10"	"1650"	"0"	"1650"	"0"	"c.*18C>T"	"r.(=)"	"p.(=)"	""
"0000266765"	"00024043"	"50"	"1003"	"0"	"1003"	"0"	"c.1003G>C"	"r.(?)"	"p.(Val335Leu)"	""
"0000266766"	"00024043"	"50"	"1022"	"0"	"1022"	"0"	"c.1022A>C"	"r.(?)"	"p.(Asn341Thr)"	""
"0000266767"	"00024043"	"50"	"1053"	"0"	"1053"	"0"	"c.1053G>T"	"r.(?)"	"p.(Glu351Asp)"	""
"0000266768"	"00024043"	"30"	"1095"	"19"	"1095"	"19"	"c.1095+19G>A"	"r.(=)"	"p.(=)"	""
"0000266769"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	"11"
"0000266770"	"00024043"	"30"	"1260"	"-10"	"1260"	"-10"	"c.1260-10C>G"	"r.(=)"	"p.(=)"	""
"0000266772"	"00024043"	"50"	"1383"	"0"	"1383"	"0"	"c.1383C>G"	"r.(?)"	"p.(Asp461Glu)"	""
"0000266773"	"00024043"	"50"	"1450"	"0"	"1450"	"0"	"c.1450C>A"	"r.(?)"	"p.(Pro484Thr)"	""
"0000266774"	"00024043"	"70"	"1461"	"5"	"1461"	"5"	"c.1461+5G>A"	"r.spl?"	"p.?"	""
"0000266775"	"00024043"	"30"	"1470"	"0"	"1470"	"0"	"c.1470C>A"	"r.(?)"	"p.(Asp490Glu)"	""
"0000266776"	"00024043"	"30"	"1525"	"0"	"1525"	"0"	"c.1525C>T"	"r.(?)"	"p.(Pro509Ser)"	""
"0000266777"	"00024043"	"30"	"1604"	"0"	"1604"	"0"	"c.1604G>A"	"r.(?)"	"p.(Arg535His)"	""
"0000266778"	"00024043"	"30"	"1608"	"0"	"1608"	"0"	"c.1608A>G"	"r.(?)"	"p.(Pro536=)"	""
"0000266779"	"00024043"	"30"	"1527"	"0"	"1527"	"0"	"c.1527C>T"	"r.(?)"	"p.(Pro509=)"	""
"0000266780"	"00024043"	"50"	"176"	"0"	"176"	"0"	"c.176C>A"	"r.(?)"	"p.(Thr59Lys)"	""
"0000266781"	"00024043"	"50"	"190"	"0"	"190"	"0"	"c.190G>A"	"r.(?)"	"p.(Glu64Lys)"	""
"0000266782"	"00024043"	"70"	"349"	"0"	"349"	"0"	"c.349A>G"	"r.(?)"	"p.(Arg117Gly)"	""
"0000266783"	"00024043"	"70"	"433"	"0"	"433"	"0"	"c.433C>T"	"r.(?)"	"p.(Arg145Trp)"	""
"0000266784"	"00024043"	"90"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.spl?"	"p.?"	""
"0000266785"	"00024043"	"50"	"478"	"0"	"478"	"0"	"c.478A>G"	"r.(?)"	"p.(Ile160Val)"	""
"0000266786"	"00024043"	"50"	"508"	"0"	"508"	"0"	"c.508G>A"	"r.(?)"	"p.(Val170Ile)"	""
"0000266787"	"00024043"	"30"	"556"	"0"	"556"	"0"	"c.556A>C"	"r.(?)"	"p.(Asn186His)"	""
"0000266788"	"00024043"	"70"	"592"	"0"	"592"	"0"	"c.592G>C"	"r.(?)"	"p.(Val198Leu)"	""
"0000266789"	"00024043"	"50"	"980"	"0"	"980"	"0"	"c.980A>G"	"r.(?)"	"p.(Tyr327Cys)"	""
"0000268111"	"00024043"	"30"	"1095"	"19"	"1095"	"19"	"c.1095+19G>A"	"r.(=)"	"p.(=)"	""
"0000268112"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	"11"
"0000268113"	"00024043"	"30"	"1497"	"0"	"1497"	"0"	"c.1497G>C"	"r.(?)"	"p.(Leu499=)"	""
"0000268114"	"00024043"	"30"	"1525"	"0"	"1525"	"0"	"c.1525C>T"	"r.(?)"	"p.(Pro509Ser)"	""
"0000268115"	"00024043"	"30"	"1527"	"0"	"1527"	"0"	"c.1527C>T"	"r.(?)"	"p.(Pro509=)"	""
"0000268116"	"00024043"	"10"	"254"	"0"	"254"	"0"	"c.254C>T"	"r.(?)"	"p.(Pro85Leu)"	""
"0000268117"	"00024043"	"30"	"538"	"0"	"538"	"0"	"c.538C>T"	"r.(?)"	"p.(Arg180Cys)"	""
"0000268118"	"00024043"	"30"	"539"	"0"	"539"	"0"	"c.539G>A"	"r.(?)"	"p.(Arg180His)"	""
"0000273521"	"00024043"	"70"	"1096"	"-2"	"1096"	"-2"	"c.1096-2A>G"	"r.spl?"	"p.?"	""
"0000273523"	"00024043"	"50"	"1115"	"0"	"1115"	"0"	"c.1115C>G"	"r.(?)"	"p.(Ser372Cys)"	""
"0000273525"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	"11"
"0000273526"	"00024043"	"30"	"538"	"0"	"538"	"0"	"c.538C>T"	"r.(?)"	"p.(Arg180Cys)"	""
"0000273527"	"00024043"	"50"	"556"	"0"	"556"	"0"	"c.556A>C"	"r.(?)"	"p.(Asn186His)"	""
"0000289192"	"00024043"	"50"	"-4201"	"0"	"-4201"	"0"	"c.-4201C>G"	"r.(?)"	"p.(=)"	""
"0000328963"	"00024043"	"30"	"556"	"0"	"556"	"0"	"c.556A>C"	"r.(?)"	"p.(Asn186His)"	""
"0000328964"	"00024043"	"30"	"320"	"-5"	"320"	"-5"	"c.320-5T>A"	"r.spl?"	"p.?"	""
"0000342105"	"00024043"	"30"	"538"	"0"	"538"	"0"	"c.538C>T"	"r.(?)"	"p.(Arg180Cys)"	""
"0000349475"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	"11"
"0000352780"	"00024043"	"90"	"847"	"-1"	"1008"	"1"	"c.(846+1_847-1)_(1008+1_1009-1)del"	"r.(del)"	"p.?"	"7i_9i"
"0000352803"	"00024043"	"90"	"847"	"-1"	"1008"	"1"	"c.(846+1_847-1)_(1008+1_1009-1)del"	"r.(del)"	"p.?"	"7i_9i"
"0000355061"	"00024043"	"70"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	""
"0000355062"	"00024043"	"50"	"470"	"0"	"470"	"0"	"c.470T>C"	"r.(?)"	"p.(Ile157Thr)"	""
"0000358850"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs)"	"11"
"0000369310"	"00024043"	"30"	"908"	"18"	"908"	"18"	"c.908+18T>A"	"r.(?)"	"p.(?)"	"8i"
"0000403653"	"00024043"	"10"	"1604"	"0"	"1604"	"0"	"c.1604G>A"	"r.(?)"	"p.(Arg535His)"	"14"
"0000403654"	"00024043"	"50"	"1574"	"0"	"1574"	"0"	"c.1574G>A"	"r.(?)"	"p.(Gly525Glu)"	"14"
"0000403655"	"00024043"	"50"	"1574"	"0"	"1574"	"0"	"c.1574G>A"	"r.(?)"	"p.(Gly525Glu)"	"14"
"0000403656"	"00024043"	"50"	"1568"	"0"	"1568"	"0"	"c.1568G>A"	"r.(?)"	"p.(Arg523His)"	"14"
"0000403657"	"00024043"	"50"	"1567"	"0"	"1567"	"0"	"c.1567C>T"	"r.(?)"	"p.(Arg523Cys)"	"14"
"0000403658"	"00024043"	"50"	"1562"	"0"	"1562"	"0"	"c.1562G>A"	"r.(?)"	"p.(Arg521Gln)"	"14"
"0000403659"	"00024043"	"10"	"1561"	"0"	"1561"	"0"	"c.1561C>T"	"r.(?)"	"p.(Arg521Trp)"	"14"
"0000403660"	"00024043"	"10"	"1561"	"0"	"1561"	"0"	"c.1561C>T"	"r.(?)"	"p.(Arg521Trp)"	"14"
"0000403661"	"00024043"	"90"	"1555"	"0"	"1555"	"0"	"c.1555C>T"	"r.(?)"	"p.(Arg519*)"	"14"
"0000403662"	"00024043"	"90"	"1555"	"0"	"1555"	"0"	"c.1555C>T"	"r.(?)"	"p.(Arg519*)"	"14"
"0000403663"	"00024043"	"10"	"1513"	"0"	"1513"	"0"	"c.1513T>A"	"r.(?)"	"p.(Ser505Thr)"	"14"
"0000403664"	"00024043"	"10"	"1513"	"0"	"1513"	"0"	"c.1513T>A"	"r.(?)"	"p.(Ser505Thr)"	"14"
"0000403665"	"00024043"	"10"	"1491"	"0"	"1491"	"0"	"c.1491T>C"	"r.(?)"	"p.(=)"	"14"
"0000403666"	"00024043"	"10"	"1491"	"0"	"1491"	"0"	"c.1491T>C"	"r.(?)"	"p.(=)"	"14"
"0000403667"	"00024043"	"50"	"1466"	"0"	"1466"	"0"	"c.1466A>C"	"r.(?)"	"p.(Glu489Ala)"	"14"
"0000403668"	"00024043"	"90"	"1438"	"0"	"1438"	"0"	"c.1438G>A"	"r.(?)"	"p.(Ala480Thr)"	"13"
"0000403669"	"00024043"	"90"	"1438"	"0"	"1438"	"0"	"c.1438G>A"	"r.(?)"	"p.(Ala480Thr)"	"13"
"0000403670"	"00024043"	"90"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	"13"
"0000403671"	"00024043"	"50"	"1420"	"0"	"1420"	"0"	"c.1420C>T"	"r.(?)"	"p.(Arg474Cys)"	"13"
"0000403672"	"00024043"	"50"	"1414"	"0"	"1414"	"0"	"c.1414A>G"	"r.(?)"	"p.(Lys472Glu)"	"13"
"0000403673"	"00024043"	"50"	"1414"	"0"	"1414"	"0"	"c.1414A>G"	"r.(?)"	"p.(Lys472Glu)"	"13"
"0000403674"	"00024043"	"50"	"1402"	"0"	"1402"	"0"	"c.1402G>A"	"r.(?)"	"p.(Val468Ile)"	"13"
"0000403675"	"00024043"	"10"	"1357"	"0"	"1357"	"0"	"c.1357G>C"	"r.(?)"	"p.(Ala453Pro)"	"12"
"0000403676"	"00024043"	"10"	"1357"	"0"	"1357"	"0"	"c.1357G>C"	"r.(?)"	"p.(Ala453Pro)"	"12"
"0000403677"	"00024043"	"50"	"1307"	"0"	"1307"	"0"	"c.1307T>G"	"r.(?)"	"p.(Leu436Arg)"	"12"
"0000403678"	"00024043"	"50"	"1265"	"0"	"1265"	"0"	"c.1265G>C"	"r.(?)"	"p.(Ser422Thr)"	"11"
"0000403679"	"00024043"	"50"	"1265"	"0"	"1265"	"0"	"c.1265G>C"	"r.(?)"	"p.(Ser422Thr)"	"11"
"0000403680"	"00024043"	"50"	"1256"	"0"	"1256"	"0"	"c.1256T>A"	"r.(?)"	"p.(Ile419Asn)"	"11"
"0000403681"	"00024043"	"90"	"1238"	"0"	"1238"	"0"	"c.1238T>A"	"r.(?)"	"p.(Leu413*)"	"11"
"0000403682"	"00024043"	"50"	"1218"	"0"	"1218"	"0"	"c.1218T>G"	"r.(?)"	"p.(=)"	"11"
"0000403683"	"00024043"	"10"	"1203"	"0"	"1203"	"0"	"c.1203T>C"	"r.(?)"	"p.(=)"	"11"
"0000403684"	"00024043"	"10"	"1203"	"0"	"1203"	"0"	"c.1203T>C"	"r.(?)"	"p.(=)"	"11"
"0000403685"	"00024043"	"10"	"1195"	"0"	"1195"	"0"	"c.1195G>A"	"r.(?)"	"p.(Val399Ile)"	"11"
"0000403686"	"00024043"	"10"	"1195"	"0"	"1195"	"0"	"c.1195G>A"	"r.(?)"	"p.(Val399Ile)"	"11"
"0000403687"	"00024043"	"10"	"1176"	"0"	"1176"	"0"	"c.1176G>A"	"r.(?)"	"p.(=)"	"11"
"0000403688"	"00024043"	"10"	"1176"	"0"	"1176"	"0"	"c.1176G>A"	"r.(?)"	"p.(=)"	"11"
"0000403689"	"00024043"	"50"	"1135"	"0"	"1135"	"0"	"c.1135T>C"	"r.(?)"	"p.(Ser379Pro)"	"10"
"0000403690"	"00024043"	"50"	"1131"	"0"	"1131"	"0"	"c.1131G>A"	"r.(?)"	"p.(=)"	"10"
"0000403691"	"00024043"	"10"	"1117"	"0"	"1117"	"0"	"c.1117A>G"	"r.(?)"	"p.(Lys373Glu)"	"10"
"0000403692"	"00024043"	"50"	"1111"	"0"	"1111"	"0"	"c.1111C>T"	"r.(?)"	"p.(His371Tyr)"	"10"
"0000403693"	"00024043"	"50"	"1111"	"0"	"1111"	"0"	"c.1111C>T"	"r.(?)"	"p.(His371Tyr)"	"10"
"0000403694"	"00024043"	"50"	"1107"	"0"	"1107"	"0"	"c.1107T>C"	"r.(?)"	"p.(=)"	"10"
"0000403695"	"00024043"	"90"	"1075"	"0"	"1075"	"0"	"c.1075G>T"	"r.(?)"	"p.(Glu359*)"	"10"
"0000403696"	"00024043"	"90"	"1067"	"0"	"1067"	"0"	"c.1067C>A"	"r.(?)"	"p.(Ser356*)"	"10"
"0000403697"	"00024043"	"50"	"1032"	"0"	"1032"	"0"	"c.1032A>G"	"r.(?)"	"p.(Ile344Met)"	"10"
"0000403698"	"00024043"	"50"	"1032"	"0"	"1032"	"0"	"c.1032A>G"	"r.(?)"	"p.(Ile344Met)"	"10"
"0000403699"	"00024043"	"10"	"1023"	"0"	"1023"	"0"	"c.1023C>T"	"r.(?)"	"p.(=)"	"10"
"0000403700"	"00024043"	"50"	"980"	"0"	"980"	"0"	"c.980A>G"	"r.(?)"	"p.(Tyr327Cys)"	"9"
"0000403701"	"00024043"	"50"	"952"	"0"	"952"	"0"	"c.952C>T"	"r.(?)"	"p.(Arg318Cys)"	"9"
"0000403702"	"00024043"	"50"	"917"	"0"	"917"	"0"	"c.917G>T"	"r.(?)"	"p.(Gly306Val)"	"9"
"0000403703"	"00024043"	"50"	"917"	"0"	"917"	"0"	"c.917G>T"	"r.(?)"	"p.(Gly306Val)"	"9"
"0000403704"	"00024043"	"90"	"908"	"2"	"908"	"2"	"c.908+2del"	"r.spl"	"p.?"	"8i"
"0000403705"	"00024043"	"50"	"886"	"0"	"886"	"0"	"c.886G>T"	"r.(?)"	"p.(Asp296Tyr)"	"8"
"0000403706"	"00024043"	"50"	"886"	"0"	"886"	"0"	"c.886G>T"	"r.(?)"	"p.(Asp296Tyr)"	"8"
"0000403707"	"00024043"	"50"	"849"	"0"	"849"	"0"	"c.849T>G"	"r.(?)"	"p.(=)"	"8"
"0000403708"	"00024043"	"50"	"849"	"0"	"849"	"0"	"c.849T>G"	"r.(?)"	"p.(=)"	"8"
"0000403709"	"00024043"	"90"	"847"	"-1"	"847"	"-1"	"c.847-1G>T"	"r.spl"	"p.?"	"7i"
"0000403710"	"00024043"	"90"	"847"	"-1"	"847"	"-1"	"c.847-1G>T"	"r.spl"	"p.?"	"7i"
"0000403711"	"00024043"	"90"	"847"	"-2"	"847"	"-2"	"c.847-2A>G"	"r.spl"	"p.?"	"7i"
"0000403712"	"00024043"	"50"	"839"	"0"	"839"	"0"	"c.839T>G"	"r.(?)"	"p.(Leu280Arg)"	"7"
"0000403713"	"00024043"	"50"	"790"	"0"	"790"	"0"	"c.790G>T"	"r.(?)"	"p.(Ala264Ser)"	"6"
"0000403714"	"00024043"	"50"	"790"	"0"	"790"	"0"	"c.790G>T"	"r.(?)"	"p.(Ala264Ser)"	"6"
"0000403715"	"00024043"	"50"	"776"	"0"	"776"	"0"	"c.776G>A"	"r.(?)"	"p.(Gly259Asp)"	"6"
"0000403716"	"00024043"	"50"	"755"	"0"	"755"	"0"	"c.755G>A"	"r.(?)"	"p.(Ser252Asn)"	"6"
"0000403717"	"00024043"	"50"	"755"	"0"	"755"	"0"	"c.755G>A"	"r.(?)"	"p.(Ser252Asn)"	"6"
"0000403718"	"00024043"	"10"	"714"	"0"	"714"	"0"	"c.714C>T"	"r.(?)"	"p.(=)"	"6"
"0000403719"	"00024043"	"10"	"714"	"0"	"714"	"0"	"c.714C>T"	"r.(?)"	"p.(=)"	"6"
"0000403720"	"00024043"	"50"	"689"	"0"	"689"	"0"	"c.689C>G"	"r.(?)"	"p.(Ala230Gly)"	"6"
"0000403721"	"00024043"	"90"	"684"	"-1"	"684"	"-1"	"c.684-1G>A"	"r.spl"	"p.?"	"5i"
"0000403722"	"00024043"	"90"	"684"	"-1"	"684"	"-1"	"c.684-1G>A"	"r.spl"	"p.?"	"5i"
"0000403723"	"00024043"	"90"	"684"	"-2"	"684"	"-2"	"c.684-2A>G"	"r.spl"	"p.?"	"5i"
"0000403724"	"00024043"	"50"	"683"	"0"	"683"	"0"	"c.683G>A"	"r.(?)"	"p.(Ser228Asn)"	"5"
"0000403725"	"00024043"	"50"	"657"	"0"	"657"	"0"	"c.657A>C"	"r.(?)"	"p.(Glu219Asp)"	"5"
"0000403726"	"00024043"	"50"	"646"	"0"	"646"	"0"	"c.646T>C"	"r.(?)"	"p.(=)"	"5"
"0000403727"	"00024043"	"50"	"638"	"0"	"638"	"0"	"c.638C>A"	"r.(?)"	"p.(Pro213His)"	"5"
"0000403728"	"00024043"	"50"	"557"	"0"	"557"	"0"	"c.557A>G"	"r.(?)"	"p.(Asn186Ser)"	"4"
"0000403729"	"00024043"	"50"	"545"	"0"	"545"	"0"	"c.545C>G"	"r.(?)"	"p.(Pro182Arg)"	"4"
"0000403730"	"00024043"	"10"	"542"	"0"	"542"	"0"	"c.542G>A"	"r.(?)"	"p.(Arg181His)"	"4"
"0000403731"	"00024043"	"10"	"542"	"0"	"542"	"0"	"c.542G>A"	"r.(?)"	"p.(Arg181His)"	"4"
"0000403732"	"00024043"	"90"	"541"	"0"	"541"	"0"	"c.541C>T"	"r.(?)"	"p.(Arg181Cys)"	"4"
"0000403733"	"00024043"	"50"	"538"	"0"	"538"	"0"	"c.538C>T"	"r.(?)"	"p.(Arg180Cys)"	"4"
"0000403734"	"00024043"	"50"	"538"	"0"	"538"	"0"	"c.538C>T"	"r.(?)"	"p.(Arg180Cys)"	"4"
"0000403735"	"00024043"	"50"	"523"	"0"	"523"	"0"	"c.523G>A"	"r.(?)"	"p.(Val175Ile)"	"4"
"0000403736"	"00024043"	"50"	"507"	"0"	"507"	"0"	"c.507T>C"	"r.(?)"	"p.(=)"	"4"
"0000403737"	"00024043"	"90"	"444"	"1"	"444"	"1"	"c.444+1del"	"r.spl"	"p.?"	"3i"
"0000403738"	"00024043"	"90"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.spl"	"p.?"	"3i"
"0000403739"	"00024043"	"90"	"434"	"0"	"434"	"0"	"c.434G>A"	"r.(?)"	"p.(Arg145Gln)"	"3"
"0000403740"	"00024043"	"90"	"409"	"0"	"409"	"0"	"c.409C>T"	"r.(?)"	"p.(Arg137*)"	"3"
"0000403741"	"00024043"	"90"	"409"	"0"	"409"	"0"	"c.409C>T"	"r.(?)"	"p.(Arg137*)"	"3"
"0000403742"	"00024043"	"50"	"395"	"0"	"395"	"0"	"c.395G>A"	"r.(?)"	"p.(Arg132Lys)"	"3"
"0000403743"	"00024043"	"50"	"392"	"0"	"392"	"0"	"c.392A>G"	"r.(?)"	"p.(Lys131Arg)"	"3"
"0000403744"	"00024043"	"50"	"355"	"0"	"355"	"0"	"c.355A>C"	"r.(?)"	"p.(Lys119Gln)"	"3"
"0000403745"	"00024043"	"50"	"319"	"3973"	"319"	"3973"	"c.319+3973T>C"	"r.(?)"	"p.(?)"	"2i"
"0000403746"	"00024043"	"50"	"319"	"3966"	"319"	"3966"	"c.319+3966G>A"	"r.(?)"	"p.(?)"	"2i"
"0000403747"	"00024043"	"50"	"319"	"3943"	"319"	"3943"	"c.319+3943A>G"	"r.(?)"	"p.(?)"	"2i"
"0000403748"	"00024043"	"50"	"319"	"3935"	"319"	"3935"	"c.319+3935G>T"	"r.(?)"	"p.(?)"	"2i"
"0000403749"	"00024043"	"50"	"313"	"0"	"313"	"0"	"c.313A>G"	"r.(?)"	"p.(Asn105Asp)"	"2"
"0000403750"	"00024043"	"50"	"284"	"0"	"284"	"0"	"c.284G>A"	"r.(?)"	"p.(Arg95Gln)"	"2"
"0000403751"	"00024043"	"90"	"283"	"0"	"283"	"0"	"c.283C>T"	"r.(?)"	"p.(Arg95*)"	"2"
"0000403752"	"00024043"	"50"	"268"	"0"	"268"	"0"	"c.268C>T"	"r.(?)"	"p.(Pro90Ser)"	"2"
"0000403753"	"00024043"	"50"	"268"	"0"	"268"	"0"	"c.268C>T"	"r.(?)"	"p.(Pro90Ser)"	"2"
"0000403754"	"00024043"	"50"	"246"	"0"	"260"	"0"	"c.246_260del"	"r.(?)"	"p.(Asp82_Glu86del)"	"2"
"0000403755"	"00024043"	"10"	"252"	"0"	"252"	"0"	"c.252A>G"	"r.(?)"	"p.(=)"	"2"
"0000403756"	"00024043"	"10"	"252"	"0"	"252"	"0"	"c.252A>G"	"r.(?)"	"p.(=)"	"2"
"0000403757"	"00024043"	"50"	"215"	"0"	"215"	"0"	"c.215A>G"	"r.(?)"	"p.(Tyr72Cys)"	"2"
"0000403758"	"00024043"	"50"	"159"	"0"	"159"	"0"	"c.159T>C"	"r.(?)"	"p.(=)"	"2"
"0000403759"	"00024043"	"50"	"72"	"0"	"72"	"0"	"c.72C>T"	"r.(?)"	"p.(=)"	"2"
"0000403760"	"00024043"	"50"	"67"	"0"	"67"	"0"	"c.67G>T"	"r.(?)"	"p.(Gly23Cys)"	"2"
"0000405518"	"00024043"	"10"	"1561"	"0"	"1561"	"0"	"c.1561C>T"	"r.(?)"	"p.(Arg521Trp)"	""
"0000405519"	"00024043"	"10"	"1203"	"0"	"1203"	"0"	"c.1203T>C"	"r.(?)"	"p.(=)"	""
"0000405520"	"00024043"	"10"	"252"	"0"	"252"	"0"	"c.252A>G"	"r.(?)"	"p.(=)"	""
"0000405521"	"00024043"	"10"	"252"	"0"	"252"	"0"	"c.252A>G"	"r.(?)"	"p.(=)"	""
"0000406476"	"00024043"	"10"	"252"	"0"	"252"	"0"	"c.252A>G"	"r.(?)"	"p.(=)"	""
"0000407761"	"00024043"	"10"	"1597"	"0"	"1597"	"0"	"c.1597A>G"	"r.(?)"	"p.(Thr533Ala)"	""
"0000407762"	"00024043"	"50"	"1574"	"0"	"1574"	"0"	"c.1574G>A"	"r.(?)"	"p.(Gly525Glu)"	""
"0000407763"	"00024043"	"50"	"1562"	"0"	"1562"	"0"	"c.1562G>A"	"r.(?)"	"p.(Arg521Gln)"	""
"0000407764"	"00024043"	"50"	"1561"	"0"	"1561"	"0"	"c.1561C>T"	"r.(?)"	"p.(Arg521Trp)"	""
"0000407765"	"00024043"	"90"	"1555"	"0"	"1555"	"0"	"c.1555C>T"	"r.(?)"	"p.(Arg519*)"	""
"0000407766"	"00024043"	"50"	"1540"	"0"	"1540"	"0"	"c.1540C>A"	"r.(?)"	"p.(Gln514Lys)"	""
"0000407767"	"00024043"	"50"	"1513"	"0"	"1513"	"0"	"c.1513T>A"	"r.(?)"	"p.(Ser505Thr)"	""
"0000407768"	"00024043"	"50"	"1445"	"0"	"1445"	"0"	"c.1445G>C"	"r.(?)"	"p.(Arg482Thr)"	""
"0000407769"	"00024043"	"50"	"1438"	"0"	"1438"	"0"	"c.1438G>A"	"r.(?)"	"p.(Ala480Thr)"	""
"0000407770"	"00024043"	"50"	"1402"	"0"	"1402"	"0"	"c.1402G>A"	"r.(?)"	"p.(Val468Ile)"	""
"0000407771"	"00024043"	"50"	"1358"	"0"	"1358"	"0"	"c.1358C>T"	"r.(?)"	"p.(Ala453Val)"	""
"0000407772"	"00024043"	"50"	"1357"	"0"	"1357"	"0"	"c.1357G>C"	"r.(?)"	"p.(Ala453Pro)"	""
"0000407773"	"00024043"	"50"	"1307"	"0"	"1307"	"0"	"c.1307T>G"	"r.(?)"	"p.(Leu436Arg)"	""
"0000407774"	"00024043"	"50"	"1265"	"0"	"1265"	"0"	"c.1265G>C"	"r.(?)"	"p.(Ser422Thr)"	""
"0000407775"	"00024043"	"50"	"1255"	"0"	"1255"	"0"	"c.1255A>T"	"r.(?)"	"p.(Ile419Phe)"	""
"0000407776"	"00024043"	"10"	"1203"	"0"	"1203"	"0"	"c.1203T>C"	"r.(?)"	"p.(=)"	""
"0000407777"	"00024043"	"10"	"1195"	"0"	"1195"	"0"	"c.1195G>A"	"r.(?)"	"p.(Val399Ile)"	""
"0000407778"	"00024043"	"10"	"1176"	"0"	"1176"	"0"	"c.1176G>A"	"r.(?)"	"p.(=)"	""
"0000407779"	"00024043"	"50"	"1131"	"0"	"1131"	"0"	"c.1131G>A"	"r.(?)"	"p.(=)"	""
"0000407780"	"00024043"	"50"	"1111"	"0"	"1111"	"0"	"c.1111C>T"	"r.(?)"	"p.(His371Tyr)"	""
"0000407781"	"00024043"	"50"	"1080"	"0"	"1080"	"0"	"c.1080G>A"	"r.(?)"	"p.(=)"	""
"0000407782"	"00024043"	"50"	"1036"	"0"	"1036"	"0"	"c.1036C>T"	"r.(?)"	"p.(Arg346Cys)"	""
"0000407783"	"00024043"	"50"	"1032"	"0"	"1032"	"0"	"c.1032A>G"	"r.(?)"	"p.(Ile344Met)"	""
"0000407784"	"00024043"	"50"	"886"	"0"	"886"	"0"	"c.886G>T"	"r.(?)"	"p.(Asp296Tyr)"	""
"0000407785"	"00024043"	"50"	"857"	"0"	"857"	"0"	"c.857T>C"	"r.(?)"	"p.(Ile286Thr)"	""
"0000407786"	"00024043"	"50"	"849"	"0"	"849"	"0"	"c.849T>G"	"r.(?)"	"p.(=)"	""
"0000407787"	"00024043"	"50"	"849"	"0"	"849"	"0"	"c.849T>G"	"r.(?)"	"p.(=)"	""
"0000407788"	"00024043"	"50"	"790"	"0"	"790"	"0"	"c.790G>T"	"r.(?)"	"p.(Ala264Ser)"	""
"0000407789"	"00024043"	"50"	"755"	"0"	"755"	"0"	"c.755G>A"	"r.(?)"	"p.(Ser252Asn)"	""
"0000407790"	"00024043"	"50"	"683"	"0"	"683"	"0"	"c.683G>A"	"r.(?)"	"p.(Ser228Asn)"	""
"0000407791"	"00024043"	"50"	"657"	"0"	"657"	"0"	"c.657A>C"	"r.(?)"	"p.(Glu219Asp)"	""
"0000407792"	"00024043"	"50"	"646"	"0"	"646"	"0"	"c.646T>C"	"r.(?)"	"p.(=)"	""
"0000407793"	"00024043"	"50"	"638"	"0"	"638"	"0"	"c.638C>A"	"r.(?)"	"p.(Pro213His)"	""
"0000407794"	"00024043"	"50"	"542"	"0"	"542"	"0"	"c.542G>A"	"r.(?)"	"p.(Arg181His)"	""
"0000407795"	"00024043"	"90"	"538"	"0"	"538"	"0"	"c.538C>T"	"r.(?)"	"p.(Arg180Cys)"	""
"0000407796"	"00024043"	"90"	"538"	"0"	"538"	"0"	"c.538C>T"	"r.(?)"	"p.(Arg180Cys)"	""
"0000407797"	"00024043"	"90"	"491"	"0"	"491"	"0"	"c.491G>C"	"r.(?)"	"p.(Ser164Thr)"	""
"0000407798"	"00024043"	"10"	"410"	"0"	"410"	"0"	"c.410G>A"	"r.(?)"	"p.(Arg137Gln)"	""
"0000407799"	"00024043"	"50"	"392"	"0"	"392"	"0"	"c.392A>G"	"r.(?)"	"p.(Lys131Arg)"	""
"0000407800"	"00024043"	"50"	"346"	"0"	"346"	"0"	"c.346G>C"	"r.(?)"	"p.(Gly116Arg)"	""
"0000407801"	"00024043"	"10"	"252"	"0"	"252"	"0"	"c.252A>G"	"r.(?)"	"p.(=)"	""
"0000407802"	"00024043"	"10"	"252"	"0"	"252"	"0"	"c.252A>G"	"r.(?)"	"p.(=)"	""
"0000407803"	"00024043"	"50"	"220"	"0"	"220"	"0"	"c.220A>G"	"r.(?)"	"p.(Ile74Val)"	""
"0000407804"	"00024043"	"50"	"59"	"0"	"59"	"0"	"c.59A>G"	"r.(?)"	"p.(Gln20Arg)"	""
"0000407999"	"00024043"	"90"	"1438"	"0"	"1438"	"0"	"c.1438G>A"	"r.(?)"	"p.(Ala480Thr)"	""
"0000438778"	"00024043"	"70"	"470"	"0"	"470"	"0"	"c.470T>C"	"r.(?)"	"p.Ile157Thr"	""
"0000438783"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.Thr367Metfs*15"	""
"0000438784"	"00024043"	"70"	"470"	"0"	"470"	"0"	"c.470T>C"	"r.(?)"	"p.Ile157Thr"	""
"0000439061"	"00024043"	"70"	"470"	"0"	"470"	"0"	"c.470T>C"	"r.(?)"	"p.Ile157Thr"	""
"0000439879"	"00024043"	"50"	"1556"	"0"	"1556"	"0"	"c.1556G>T"	"r.(?)"	"p.Arg519Leu"	""
"0000440060"	"00024043"	"90"	"1368"	"0"	"1368"	"0"	"c.1368dup"	"r.(?)"	"p.Glu457Argfs*33"	""
"0000442725"	"00024043"	"50"	"842"	"0"	"842"	"0"	"c.842A>C"	"r.(?)"	"p.Asn281Thr"	""
"0000442731"	"00024043"	"50"	"1312"	"0"	"1312"	"0"	"c.1312G>T"	"r.(?)"	"p.Asp438Tyr"	""
"0000447048"	"00024043"	"90"	"792"	"272"	"847"	"0"	"c.(792+272_847del)"	"r.793_846del"	"p.Asp265_His282del"	"6i_7i"
"0000453985"	"00024043"	"90"	"684"	"-3148"	"1461"	"1814"	"c.684-3148_1461+1814dup"	"r.(685_1461dup)"	"p.?"	"5i_13i"
"0000453986"	"00024043"	"90"	"1095"	"381"	"1462"	"-1738"	"c.1095+381_1462-1738del"	"r.(?)"	"p.(Ile366_Gln487del)"	"10i_13i"
"0000453987"	"00024043"	"90"	"1095"	"381"	"1462"	"-1738"	"c.1095+381_1462-1738del"	"r.(?)"	"p.(Ile366_Gln487del)"	"10i_13i"
"0000453988"	"00024043"	"90"	"1095"	"381"	"1462"	"-1738"	"c.1095+381_1462-1738del"	"r.(?)"	"p.(Ile366_Gln487del)"	"10i_13i"
"0000453989"	"00024043"	"90"	"320"	"-1"	"592"	"1"	"c.(319+1_320-1)_(592+1_593-1)del"	"r.(320_592del)"	"p.(Glu107_Lys197del)"	"2i_4i"
"0000454001"	"00024043"	"70"	"320"	"-1"	"592"	"1"	"c.(319+1_320-1)_(592+1_593-1)del"	"r.?"	"p.?"	"2i_4i"
"0000454002"	"00024043"	"90"	"909"	"-1"	"1095"	"1"	"c.(908+1_909-1)_(1095+1_1096-1)del"	"r.?"	"p.?"	"8i_10i"
"0000454003"	"00024043"	"90"	"909"	"-1"	"1095"	"1"	"c.(908+1_909-1)_(1095+1_1096-1)del"	"r.?"	"p.?"	"8i_10i"
"0000454004"	"00024043"	"90"	"909"	"-1"	"1095"	"1"	"c.(908+1_909-1)_(1095+1_1096-1)del"	"r.?"	"p.?"	"8i_10i"
"0000454005"	"00024043"	"90"	"909"	"-1"	"1095"	"1"	"c.(908+1_909-1)_(1095+1_1096-1)del"	"r.?"	"p.?"	"8i_10i"
"0000500447"	"00024043"	"90"	"-72"	"0"	"-7"	"1"	"c.(?_-72)_(-7+1_-6-1)del"	"r.0?"	"p.0?"	"_1_1i"
"0000500448"	"00024043"	"90"	"100"	"0"	"100"	"0"	"c.100C>T"	"r.(?)"	"p.(Gln34*)"	""
"0000500449"	"00024043"	"90"	"320"	"-1"	"592"	"1"	"c.(319+1_320-1)_(592+1_593-1)del"	"r.?"	"p.(Glu107_Lys197del)"	""
"0000500450"	"00024043"	"90"	"475"	"0"	"475"	"0"	"c.475T>C"	"r.(?)"	"p.(Tyr159His)"	""
"0000500451"	"00024043"	"90"	"475"	"0"	"475"	"0"	"c.475T>C"	"r.(?)"	"p.(Tyr159His)"	""
"0000500452"	"00024043"	"90"	"480"	"0"	"481"	"0"	"c.480_481insAAA"	"r.(?)"	"p.(Ile160_Glu161insLys)"	""
"0000500453"	"00024043"	"90"	"499"	"0"	"499"	"0"	"c.499G>A"	"r.(?)"	"p.(Gly167Arg)"	""
"0000500454"	"00024043"	"90"	"499"	"0"	"499"	"0"	"c.499G>A"	"r.(?)"	"p.(Gly167Arg)"	""
"0000500455"	"00024043"	"90"	"499"	"0"	"499"	"0"	"c.499G>A"	"r.(?)"	"p.(Gly167Arg)"	""
"0000500456"	"00024043"	"90"	"507"	"0"	"507"	"0"	"c.507del"	"r.(?)"	"p.(Phe169Leufs*2)"	""
"0000500457"	"00024043"	"90"	"507"	"0"	"507"	"0"	"c.507del"	"r.(?)"	"p.(Phe169Leufs*2)"	""
"0000500458"	"00024043"	"90"	"548"	"0"	"548"	"0"	"c.548T>C"	"r.(?)"	"p.(Leu183Ser)"	""
"0000500459"	"00024043"	"90"	"549"	"0"	"549"	"0"	"c.549G>C"	"r.(?)"	"p.(Leu183Phe)"	""
"0000500460"	"00024043"	"90"	"549"	"0"	"549"	"0"	"c.549G>C"	"r.(?)"	"p.(Leu183Phe)"	""
"0000500461"	"00024043"	"90"	"549"	"0"	"549"	"0"	"c.549G>C"	"r.(?)"	"p.(Leu183Phe)"	""
"0000500462"	"00024043"	"90"	"549"	"0"	"549"	"0"	"c.549G>C"	"r.(?)"	"p.(Leu183Phe)"	""
"0000500463"	"00024043"	"90"	"592"	"3"	"592"	"3"	"c.592+3A>T"	"r.spl"	"p.Glu149fs"	""
"0000500464"	"00024043"	"90"	"592"	"3"	"592"	"3"	"c.592+3A>T"	"r.spl"	"p.Glu149fs"	""
"0000500465"	"00024043"	"90"	"794"	"0"	"846"	"1"	"c.794_846+1del"	"r.spl?"	"p.(Asp265_His282del)"	""
"0000500466"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	""
"0000500467"	"00024043"	"90"	"1188"	"0"	"1188"	"0"	"c.1188del"	"r.(?)"	"p.(Val397Phefs*17)"	""
"0000500468"	"00024043"	"90"	"1368"	"0"	"1368"	"0"	"c.1368dup"	"r.(?)"	"p.(Glu457Argfs*33)"	""
"0000500620"	"00024043"	"70"	"470"	"0"	"470"	"0"	"c.470T>C"	"r.(?)"	"p.Ile157Thr"	""
"0000500627"	"00024043"	"50"	"190"	"0"	"190"	"0"	"c.190G>A"	"r.(?)"	"p.(Glu64Lys)"	""
"0000571656"	"00024043"	"50"	"1561"	"0"	"1561"	"0"	"c.1561C>T"	"r.(?)"	"p.(Arg521Trp)"	""
"0000571658"	"00024043"	"90"	"1555"	"0"	"1555"	"0"	"c.1555C>T"	"r.(?)"	"p.(Arg519Ter)"	""
"0000571659"	"00024043"	"30"	"1542"	"11"	"1542"	"11"	"c.1542+11T>A"	"r.(=)"	"p.(=)"	""
"0000571660"	"00024043"	"50"	"1525"	"0"	"1525"	"0"	"c.1525C>T"	"r.(?)"	"p.(Pro509Ser)"	""
"0000571661"	"00024043"	"30"	"1525"	"0"	"1525"	"0"	"c.1525C>T"	"r.(?)"	"p.(Pro509Ser)"	""
"0000571662"	"00024043"	"30"	"1497"	"0"	"1497"	"0"	"c.1497G>C"	"r.(?)"	"p.(Leu499=)"	""
"0000571663"	"00024043"	"30"	"1461"	"46"	"1461"	"46"	"c.1461+46C>G"	"r.(=)"	"p.(=)"	""
"0000571664"	"00024043"	"50"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	""
"0000571665"	"00024043"	"50"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	""
"0000571666"	"00024043"	"50"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	""
"0000571667"	"00024043"	"50"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	""
"0000571668"	"00024043"	"50"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	""
"0000571669"	"00024043"	"70"	"1421"	"0"	"1421"	"0"	"c.1421G>A"	"r.(?)"	"p.(Arg474His)"	""
"0000571670"	"00024043"	"70"	"1421"	"0"	"1421"	"0"	"c.1421G>A"	"r.(?)"	"p.(Arg474His)"	""
"0000571671"	"00024043"	"30"	"1376"	"-40"	"1376"	"-40"	"c.1376-40T>C"	"r.(=)"	"p.(=)"	""
"0000571672"	"00024043"	"90"	"1368"	"0"	"1368"	"0"	"c.1368dup"	"r.(?)"	"p.(Glu457ArgfsTer33)"	""
"0000571673"	"00024043"	"10"	"1343"	"0"	"1343"	"0"	"c.1343T>G"	"r.(?)"	"p.(Ile448Ser)"	""
"0000571674"	"00024043"	"50"	"1312"	"0"	"1312"	"0"	"c.1312G>T"	"r.(?)"	"p.(Asp438Tyr)"	""
"0000571675"	"00024043"	"50"	"1312"	"0"	"1312"	"0"	"c.1312G>T"	"r.(?)"	"p.(Asp438Tyr)"	""
"0000571676"	"00024043"	"50"	"1312"	"0"	"1312"	"0"	"c.1312G>T"	"r.(?)"	"p.(Asp438Tyr)"	""
"0000571677"	"00024043"	"50"	"1265"	"0"	"1265"	"0"	"c.1265G>A"	"r.(?)"	"p.(Ser422Asn)"	""
"0000571678"	"00024043"	"30"	"1260"	"-10"	"1260"	"-10"	"c.1260-10C>G"	"r.(=)"	"p.(=)"	""
"0000571679"	"00024043"	"50"	"1226"	"0"	"1226"	"0"	"c.1226A>T"	"r.(?)"	"p.(Asp409Val)"	""
"0000571681"	"00024043"	"50"	"1216"	"0"	"1216"	"0"	"c.1216C>T"	"r.(?)"	"p.(Arg406Cys)"	""
"0000571682"	"00024043"	"70"	"1169"	"0"	"1169"	"0"	"c.1169A>G"	"r.(?)"	"p.(Tyr390Cys)"	""
"0000571683"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	""
"0000571684"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	""
"0000571685"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	""
"0000571686"	"00024043"	"50"	"1053"	"0"	"1053"	"0"	"c.1053G>T"	"r.(?)"	"p.(Glu351Asp)"	""
"0000571687"	"00024043"	"50"	"1028"	"0"	"1028"	"0"	"c.1028T>G"	"r.(?)"	"p.(Ile343Ser)"	""
"0000571688"	"00024043"	"50"	"1003"	"0"	"1003"	"0"	"c.1003G>C"	"r.(?)"	"p.(Val335Leu)"	""
"0000571689"	"00024043"	"50"	"980"	"0"	"980"	"0"	"c.980A>G"	"r.(?)"	"p.(Tyr327Cys)"	""
"0000571690"	"00024043"	"50"	"917"	"0"	"917"	"0"	"c.917G>C"	"r.(?)"	"p.(Gly306Ala)"	""
"0000571691"	"00024043"	"70"	"917"	"0"	"917"	"0"	"c.917G>C"	"r.(?)"	"p.(Gly306Ala)"	""
"0000571692"	"00024043"	"30"	"909"	"-18"	"909"	"-18"	"c.909-18C>T"	"r.(=)"	"p.(=)"	""
"0000571694"	"00024043"	"50"	"751"	"0"	"751"	"0"	"c.751A>T"	"r.(?)"	"p.(Ile251Phe)"	""
"0000571695"	"00024043"	"30"	"715"	"0"	"715"	"0"	"c.715G>A"	"r.(?)"	"p.(Glu239Lys)"	""
"0000571696"	"00024043"	"70"	"593"	"-1"	"593"	"-1"	"c.593-1G>T"	"r.spl?"	"p.?"	""
"0000571697"	"00024043"	"10"	"593"	"-79"	"593"	"-79"	"c.593-79T>C"	"r.(=)"	"p.(=)"	""
"0000571699"	"00024043"	"70"	"592"	"3"	"592"	"3"	"c.592+3A>T"	"r.spl?"	"p.?"	""
"0000571700"	"00024043"	"90"	"591"	"0"	"591"	"0"	"c.591del"	"r.(?)"	"p.(Val198PhefsTer7)"	""
"0000571701"	"00024043"	"30"	"578"	"0"	"578"	"0"	"c.578T>C"	"r.(?)"	"p.(Leu193Pro)"	""
"0000571702"	"00024043"	"30"	"556"	"0"	"556"	"0"	"c.556A>C"	"r.(?)"	"p.(Asn186His)"	""
"0000571703"	"00024043"	"50"	"541"	"0"	"541"	"0"	"c.541C>T"	"r.(?)"	"p.(Arg181Cys)"	""
"0000571704"	"00024043"	"50"	"499"	"0"	"499"	"0"	"c.499G>A"	"r.(?)"	"p.(Gly167Arg)"	""
"0000571705"	"00024043"	"70"	"483"	"0"	"485"	"0"	"c.483_485del"	"r.(?)"	"p.(Glu161del)"	""
"0000571707"	"00024043"	"70"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.spl?"	"p.?"	""
"0000571708"	"00024043"	"90"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.spl?"	"p.?"	""
"0000571709"	"00024043"	"70"	"433"	"0"	"433"	"0"	"c.433C>T"	"r.(?)"	"p.(Arg145Trp)"	""
"0000571710"	"00024043"	"30"	"410"	"0"	"410"	"0"	"c.410G>A"	"r.(?)"	"p.(Arg137Gln)"	""
"0000571711"	"00024043"	"70"	"349"	"0"	"349"	"0"	"c.349A>G"	"r.(?)"	"p.(Arg117Gly)"	""
"0000571712"	"00024043"	"70"	"349"	"0"	"349"	"0"	"c.349A>G"	"r.(?)"	"p.(Arg117Gly)"	""
"0000571713"	"00024043"	"70"	"349"	"0"	"349"	"0"	"c.349A>G"	"r.(?)"	"p.(Arg117Gly)"	""
"0000571714"	"00024043"	"70"	"349"	"0"	"349"	"0"	"c.349A>G"	"r.(?)"	"p.(Arg117Gly)"	""
"0000571715"	"00024043"	"90"	"283"	"0"	"283"	"0"	"c.283C>T"	"r.(?)"	"p.(Arg95Ter)"	""
"0000571716"	"00024043"	"30"	"252"	"0"	"252"	"0"	"c.252A>G"	"r.(?)"	"p.(Glu84=)"	""
"0000571717"	"00024043"	"10"	"252"	"0"	"252"	"0"	"c.252A>G"	"r.(?)"	"p.(Glu84=)"	""
"0000571718"	"00024043"	"10"	"252"	"0"	"252"	"0"	"c.252A>G"	"r.(?)"	"p.(Glu84=)"	""
"0000571719"	"00024043"	"10"	"252"	"0"	"252"	"0"	"c.252A>G"	"r.(?)"	"p.(Glu84=)"	""
"0000571720"	"00024043"	"50"	"190"	"0"	"190"	"0"	"c.190G>A"	"r.(?)"	"p.(Glu64Lys)"	""
"0000571721"	"00024043"	"50"	"190"	"0"	"190"	"0"	"c.190G>A"	"r.(?)"	"p.(Glu64Lys)"	""
"0000578059"	"00024043"	"00"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.[444+1_444+4ins; 444+1g>a]"	"p.R148Vfs*6"	""
"0000578116"	"00024043"	"00"	"277"	"0"	"277"	"0"	"c.277del"	"r.(?)"	"p.(Trp93Glyfs*17)"	""
"0000578117"	"00024043"	"00"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.[444+1_444+4ins; 444+1g>a]"	"p.R148Vfs*6"	""
"0000578299"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.Thr367Metfs*15"	""
"0000593707"	"00024043"	"70"	"1232"	"0"	"1232"	"0"	"c.1232G>A"	"r.(?)"	"p.(Trp411*)"	""
"0000594734"	"00024043"	"90"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.(?)"	"p.(?)"	""
"0000595719"	"00024043"	"50"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	""
"0000595737"	"00024043"	"50"	"846"	"4"	"846"	"7"	"c.846+4_846+7del"	"r.(?)"	"p.(?)"	""
"0000596840"	"00024043"	"50"	"480"	"0"	"480"	"0"	"c.480A>G"	"r.(?)"	"p.(Ile160Met)"	""
"0000597236"	"00024043"	"50"	"846"	"4"	"846"	"7"	"c.846+4_846+7del"	"r.(?)"	"p.(?)"	""
"0000598348"	"00024043"	"70"	"470"	"0"	"470"	"0"	"c.470T>C"	"r.(?)"	"p.(Ile157Thr)"	""
"0000598752"	"00024043"	"30"	"1497"	"0"	"1497"	"0"	"c.1497G>C"	"r.(?)"	"p.(Leu499=)"	""
"0000599052"	"00024043"	"10"	"319"	"379"	"319"	"379"	"c.319+379A>G"	"r.(?)"	"p.(=)"	"2i"
"0000599053"	"00024043"	"50"	"1556"	"0"	"1556"	"0"	"c.1556G>T"	"r.(?)"	"p.(Arg519Leu)"	"15"
"0000599054"	"00024043"	"10"	"319"	"379"	"319"	"379"	"c.319+379A>G"	"r.(?)"	"p.(=)"	"2i"
"0000618511"	"00024043"	"30"	"1650"	"0"	"1650"	"0"	"c.*18C>T"	"r.(=)"	"p.(=)"	""
"0000618512"	"00024043"	"30"	"1603"	"0"	"1603"	"0"	"c.1603C>T"	"r.(?)"	"p.(Arg535Cys)"	""
"0000618513"	"00024043"	"50"	"1591"	"0"	"1591"	"0"	"c.1591G>T"	"r.(?)"	"p.(Glu531Ter)"	""
"0000618514"	"00024043"	"30"	"1582"	"0"	"1582"	"0"	"c.1582G>A"	"r.(?)"	"p.(Glu528Lys)"	""
"0000618515"	"00024043"	"50"	"1561"	"0"	"1561"	"0"	"c.1561C>T"	"r.(?)"	"p.(Arg521Trp)"	""
"0000618516"	"00024043"	"50"	"1556"	"0"	"1556"	"0"	"c.1556G>T"	"r.(?)"	"p.(Arg519Leu)"	""
"0000618517"	"00024043"	"30"	"1542"	"92"	"1542"	"92"	"c.1542+92A>G"	"r.(=)"	"p.(=)"	""
"0000618518"	"00024043"	"10"	"1542"	"11"	"1542"	"11"	"c.1542+11T>A"	"r.(=)"	"p.(=)"	""
"0000618519"	"00024043"	"10"	"1542"	"11"	"1542"	"11"	"c.1542+11T>A"	"r.(=)"	"p.(=)"	""
"0000618520"	"00024043"	"10"	"1497"	"0"	"1497"	"0"	"c.1497G>C"	"r.(?)"	"p.(Leu499=)"	""
"0000618521"	"00024043"	"30"	"1376"	"-12"	"1376"	"-12"	"c.1376-12T>C"	"r.(=)"	"p.(=)"	""
"0000618522"	"00024043"	"30"	"1375"	"26"	"1375"	"26"	"c.1375+26T>C"	"r.(=)"	"p.(=)"	""
"0000618523"	"00024043"	"30"	"1336"	"0"	"1336"	"0"	"c.1336A>G"	"r.(?)"	"p.(Asn446Asp)"	""
"0000618524"	"00024043"	"50"	"1283"	"0"	"1283"	"0"	"c.1283C>T"	"r.(?)"	"p.(Ser428Phe)"	""
"0000618525"	"00024043"	"50"	"1270"	"0"	"1270"	"0"	"c.1270T>C"	"r.(?)"	"p.(Tyr424His)"	""
"0000618526"	"00024043"	"50"	"1053"	"0"	"1053"	"0"	"c.1053G>T"	"r.(?)"	"p.(Glu351Asp)"	""
"0000618527"	"00024043"	"50"	"983"	"0"	"983"	"0"	"c.983T>C"	"r.(?)"	"p.(Phe328Ser)"	""
"0000618528"	"00024043"	"50"	"917"	"0"	"917"	"0"	"c.917G>C"	"r.(?)"	"p.(Gly306Ala)"	""
"0000618529"	"00024043"	"30"	"909"	"-73"	"909"	"-73"	"c.909-73G>T"	"r.(=)"	"p.(=)"	""
"0000618530"	"00024043"	"50"	"885"	"0"	"887"	"0"	"c.885_887del"	"r.(?)"	"p.(Glu295del)"	""
"0000618532"	"00024043"	"30"	"792"	"128"	"792"	"128"	"c.792+128C>T"	"r.(=)"	"p.(=)"	""
"0000618533"	"00024043"	"10"	"593"	"-14"	"593"	"-14"	"c.593-14C>T"	"r.(=)"	"p.(=)"	""
"0000618534"	"00024043"	"50"	"556"	"0"	"556"	"0"	"c.556A>C"	"r.(?)"	"p.(Asn186His)"	""
"0000618535"	"00024043"	"30"	"539"	"0"	"539"	"0"	"c.539G>A"	"r.(?)"	"p.(Arg180His)"	""
"0000618536"	"00024043"	"50"	"539"	"0"	"539"	"0"	"c.539G>A"	"r.(?)"	"p.(Arg180His)"	""
"0000618537"	"00024043"	"50"	"507"	"0"	"507"	"0"	"c.507T>G"	"r.(?)"	"p.(Phe169Leu)"	""
"0000618539"	"00024043"	"30"	"444"	"19"	"444"	"19"	"c.444+19T>C"	"r.(=)"	"p.(=)"	""
"0000618540"	"00024043"	"70"	"444"	"1"	"444"	"1"	"c.444+1del"	"r.spl?"	"p.?"	""
"0000618541"	"00024043"	"50"	"436"	"0"	"436"	"0"	"c.436A>C"	"r.(?)"	"p.(Ile146Leu)"	""
"0000618542"	"00024043"	"70"	"349"	"0"	"349"	"0"	"c.349A>G"	"r.(?)"	"p.(Arg117Gly)"	""
"0000618543"	"00024043"	"30"	"319"	"11"	"319"	"11"	"c.319+11T>G"	"r.(=)"	"p.(=)"	""
"0000618544"	"00024043"	"50"	"277"	"0"	"277"	"0"	"c.277T>C"	"r.(?)"	"p.(Trp93Arg)"	""
"0000618545"	"00024043"	"30"	"126"	"0"	"126"	"0"	"c.126T>A"	"r.(?)"	"p.(Ser42=)"	""
"0000624273"	"00024043"	"30"	"1482"	"0"	"1482"	"0"	"c.1482G>C"	"r.(?)"	"p.(Lys494Asn)"	""
"0000624274"	"00024043"	"30"	"1345"	"0"	"1345"	"0"	"c.1345C>A"	"r.(?)"	"p.(Pro449Thr)"	""
"0000624275"	"00024043"	"30"	"847"	"-17"	"847"	"-17"	"c.847-17T>C"	"r.(=)"	"p.(=)"	""
"0000624276"	"00024043"	"30"	"593"	"-68"	"593"	"-68"	"c.593-68T>G"	"r.(=)"	"p.(=)"	""
"0000624277"	"00024043"	"70"	"499"	"0"	"499"	"0"	"c.499G>A"	"r.(?)"	"p.(Gly167Arg)"	""
"0000624278"	"00024043"	"30"	"445"	"-54"	"445"	"-54"	"c.445-54C>T"	"r.(=)"	"p.(=)"	""
"0000624279"	"00024043"	"30"	"444"	"24"	"444"	"24"	"c.444+24C>T"	"r.(=)"	"p.(=)"	""
"0000624280"	"00024043"	"50"	"239"	"0"	"239"	"0"	"c.239C>A"	"r.(?)"	"p.(Pro80His)"	""
"0000647114"	"00024043"	"70"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	""
"0000647144"	"00024043"	"70"	"470"	"0"	"470"	"0"	"c.470T>C"	"r.(?)"	"p.(Ile157Thr)"	""
"0000650938"	"00024043"	"70"	"1489"	"0"	"1489"	"0"	"c.1489del"	"r.(?)"	"p.(Asp497Ilefs*16)"	""
"0000650939"	"00024043"	"90"	"1011"	"0"	"1011"	"0"	"c.1011C>A"	"r.(?)"	"p.(Tyr337*)"	""
"0000650940"	"00024043"	"90"	"581"	"0"	"581"	"0"	"c.581del"	"r.(?)"	"p.(Ser194Thrfs*11)"	""
"0000650941"	"00024043"	"50"	"565"	"0"	"565"	"0"	"c.565A>G"	"r.(?)"	"p.(Ile189Val)"	""
"0000650942"	"00024043"	"50"	"541"	"0"	"541"	"0"	"c.541C>T"	"r.(?)"	"p.(Arg181Cys)"	""
"0000650943"	"00024043"	"90"	"409"	"0"	"409"	"0"	"c.409C>T"	"r.(?)"	"p.(Arg137*)"	""
"0000650944"	"00024043"	"50"	"190"	"0"	"190"	"0"	"c.190G>A"	"r.(?)"	"p.(Glu64Lys)"	""
"0000653048"	"00024043"	"70"	"683"	"1"	"683"	"1"	"c.683+1G>T"	"r.spl?"	"p.?"	""
"0000653049"	"00024043"	"50"	"470"	"0"	"470"	"0"	"c.470T>C"	"r.(?)"	"p.(Ile157Thr)"	""
"0000653050"	"00024043"	"70"	"433"	"0"	"433"	"0"	"c.433C>T"	"r.(?)"	"p.(Arg145Trp)"	""
"0000653051"	"00024043"	"30"	"254"	"0"	"254"	"0"	"c.254C>T"	"r.(?)"	"p.(Pro85Leu)"	""
"0000653424"	"00024043"	"50"	"397"	"0"	"397"	"0"	"c.397A>G"	"r.(?)"	"p.(Thr133Ala)"	""
"0000653426"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	""
"0000653463"	"00024043"	"50"	"190"	"0"	"190"	"0"	"c.190G>A"	"r.(?)"	"p.(Glu64Lys)"	""
"0000653547"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	""
"0000658912"	"00024043"	"50"	"1405"	"0"	"1405"	"0"	"c.1405G>A"	"r.(?)"	"p.(Val469Met)"	""
"0000658913"	"00024043"	"30"	"1260"	"-10"	"1260"	"-10"	"c.1260-10C>G"	"r.(=)"	"p.(=)"	""
"0000658914"	"00024043"	"30"	"909"	"-18"	"909"	"-18"	"c.909-18C>T"	"r.(=)"	"p.(=)"	""
"0000658915"	"00024043"	"30"	"683"	"9"	"683"	"9"	"c.683+9T>C"	"r.(=)"	"p.(=)"	""
"0000658916"	"00024043"	"10"	"593"	"-14"	"593"	"-14"	"c.593-14C>T"	"r.(=)"	"p.(=)"	""
"0000658917"	"00024043"	"70"	"499"	"0"	"499"	"0"	"c.499G>A"	"r.(?)"	"p.(Gly167Arg)"	""
"0000658918"	"00024043"	"30"	"320"	"-5"	"320"	"-5"	"c.320-5T>A"	"r.spl?"	"p.?"	""
"0000658919"	"00024043"	"50"	"-4"	"0"	"-4"	"0"	"c.-4C>T"	"r.(?)"	"p.(=)"	""
"0000659564"	"00024043"	"50"	"246"	"0"	"260"	"0"	"c.246_260del"	"r.(?)"	"p.(Asp82_Glu86del)"	""
"0000659572"	"00024043"	"70"	"85"	"0"	"85"	"0"	"c.85C>T"	"r.(?)"	"p.(Gln29*)"	""
"0000659668"	"00024043"	"70"	"1283"	"0"	"1283"	"0"	"c.1283C>T"	"r.(?)"	"p.(Ser428Phe)"	""
"0000659669"	"00024043"	"70"	"349"	"0"	"349"	"0"	"c.349A>G"	"r.(?)"	"p.(Arg117Gly)"	""
"0000659681"	"00024043"	"50"	"886"	"0"	"886"	"0"	"c.886G>T"	"r.(?)"	"p.(Asp296Tyr)"	""
"0000660109"	"00024043"	"90"	"277"	"0"	"277"	"0"	"c.277del"	"r.(?)"	"p.(Trp93Glyfs*17)"	""
"0000660678"	"00024043"	"90"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.(?)"	"p.(?)"	""
"0000664836"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	""
"0000665806"	"00024043"	"70"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	""
"0000681825"	"00024043"	"30"	"1566"	"0"	"1566"	"0"	"c.1566C>T"	"r.(?)"	"p.(Pro522=)"	""
"0000681826"	"00024043"	"50"	"1561"	"0"	"1561"	"0"	"c.1561C>T"	"r.(?)"	"p.(Arg521Trp)"	""
"0000681827"	"00024043"	"50"	"1450"	"0"	"1450"	"0"	"c.1450C>A"	"r.(?)"	"p.(Pro484Thr)"	""
"0000681828"	"00024043"	"30"	"1383"	"0"	"1383"	"0"	"c.1383C>G"	"r.(?)"	"p.(Asp461Glu)"	""
"0000681829"	"00024043"	"50"	"1376"	"-13"	"1376"	"-13"	"c.1376-13A>G"	"r.(=)"	"p.(=)"	""
"0000681830"	"00024043"	"50"	"1312"	"0"	"1312"	"0"	"c.1312G>T"	"r.(?)"	"p.(Asp438Tyr)"	""
"0000681831"	"00024043"	"30"	"1312"	"0"	"1312"	"0"	"c.1312G>T"	"r.(?)"	"p.(Asp438Tyr)"	""
"0000681832"	"00024043"	"50"	"1096"	"-4"	"1096"	"-4"	"c.1096-4T>C"	"r.spl?"	"p.?"	""
"0000681833"	"00024043"	"50"	"1053"	"0"	"1053"	"0"	"c.1053G>T"	"r.(?)"	"p.(Glu351Asp)"	""
"0000681834"	"00024043"	"70"	"1037"	"0"	"1037"	"0"	"c.1037G>A"	"r.(?)"	"p.(Arg346His)"	""
"0000681835"	"00024043"	"90"	"908"	"1"	"908"	"1"	"c.908+1G>T"	"r.spl?"	"p.?"	""
"0000681836"	"00024043"	"30"	"556"	"0"	"556"	"0"	"c.556A>C"	"r.(?)"	"p.(Asn186His)"	""
"0000681837"	"00024043"	"70"	"499"	"0"	"499"	"0"	"c.499G>A"	"r.(?)"	"p.(Gly167Arg)"	""
"0000681838"	"00024043"	"90"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.spl?"	"p.?"	""
"0000681839"	"00024043"	"90"	"444"	"1"	"444"	"1"	"c.444+1del"	"r.spl?"	"p.?"	""
"0000681840"	"00024043"	"50"	"320"	"-5"	"320"	"-5"	"c.320-5T>A"	"r.spl?"	"p.?"	""
"0000681841"	"00024043"	"30"	"254"	"0"	"254"	"0"	"c.254C>T"	"r.(?)"	"p.(Pro85Leu)"	""
"0000681842"	"00024043"	"50"	"123"	"0"	"125"	"0"	"c.123_125del"	"r.(?)"	"p.(Ser42del)"	""
"0000681843"	"00024043"	"70"	"-6"	"-2"	"-6"	"-2"	"c.-6-2A>G"	"r.spl?"	"p.?"	""
"0000682720"	"00024043"	"70"	"1072"	"0"	"1072"	"0"	"c.1072C>T"	"r.(?)"	"p.(Gln358*)"	""
"0000682721"	"00024043"	"70"	"1375"	"1"	"1375"	"1"	"c.1375+1G>A"	"r.spl?"	"p.?"	""
"0000683623"	"00024043"	"70"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	""
"0000693136"	"00024043"	"50"	"1561"	"0"	"1561"	"0"	"c.1561C>T"	"r.(?)"	"p.(Arg521Trp)"	""
"0000693137"	"00024043"	"30"	"1470"	"0"	"1470"	"0"	"c.1470C>A"	"r.(?)"	"p.(Asp490Glu)"	""
"0000693138"	"00024043"	"90"	"1435"	"0"	"1435"	"0"	"c.1435G>T"	"r.(?)"	"p.(Glu479Ter)"	""
"0000693139"	"00024043"	"30"	"1345"	"0"	"1345"	"0"	"c.1345C>A"	"r.(?)"	"p.(Pro449Thr)"	""
"0000693140"	"00024043"	"50"	"1325"	"0"	"1336"	"0"	"c.1325_1336del"	"r.(?)"	"p.(Ser442_Tyr445del)"	""
"0000693141"	"00024043"	"50"	"1270"	"0"	"1270"	"0"	"c.1270T>C"	"r.(?)"	"p.(Tyr424His)"	""
"0000693142"	"00024043"	"50"	"1265"	"0"	"1265"	"0"	"c.1265G>A"	"r.(?)"	"p.(Ser422Asn)"	""
"0000693144"	"00024043"	"70"	"1169"	"0"	"1169"	"0"	"c.1169A>G"	"r.(?)"	"p.(Tyr390Cys)"	""
"0000693145"	"00024043"	"50"	"1067"	"0"	"1067"	"0"	"c.1067C>T"	"r.(?)"	"p.(Ser356Leu)"	""
"0000693146"	"00024043"	"50"	"953"	"0"	"953"	"0"	"c.953G>A"	"r.(?)"	"p.(Arg318His)"	""
"0000693147"	"00024043"	"90"	"908"	"1"	"908"	"1"	"c.908+1G>T"	"r.spl?"	"p.?"	""
"0000693148"	"00024043"	"90"	"902"	"0"	"902"	"0"	"c.902del"	"r.(?)"	"p.(Leu301TrpfsTer3)"	""
"0000693149"	"00024043"	"50"	"715"	"0"	"715"	"0"	"c.715G>A"	"r.(?)"	"p.(Glu239Lys)"	""
"0000693150"	"00024043"	"30"	"592"	"18"	"592"	"18"	"c.592+18T>C"	"r.(=)"	"p.(=)"	""
"0000693151"	"00024043"	"50"	"507"	"0"	"507"	"0"	"c.507T>G"	"r.(?)"	"p.(Phe169Leu)"	""
"0000693152"	"00024043"	"70"	"483"	"0"	"485"	"0"	"c.483_485del"	"r.(?)"	"p.(Glu161del)"	""
"0000693153"	"00024043"	"70"	"433"	"0"	"433"	"0"	"c.433C>T"	"r.(?)"	"p.(Arg145Trp)"	""
"0000693154"	"00024043"	"50"	"320"	"-5"	"320"	"-5"	"c.320-5T>A"	"r.spl?"	"p.?"	""
"0000693155"	"00024043"	"30"	"115"	"0"	"115"	"0"	"c.115T>C"	"r.(?)"	"p.(Ser39Pro)"	""
"0000728072"	"00024043"	"30"	"1489"	"0"	"1489"	"0"	"c.1489G>A"	"r.(?)"	"p.(Asp497Asn)"	""
"0000728073"	"00024043"	"50"	"1455"	"0"	"1455"	"0"	"c.1455G>T"	"r.(?)"	"p.(Trp485Cys)"	""
"0000728074"	"00024043"	"50"	"1438"	"0"	"1438"	"0"	"c.1438G>A"	"r.(?)"	"p.(Ala480Thr)"	""
"0000728075"	"00024043"	"50"	"1382"	"0"	"1382"	"0"	"c.1382A>G"	"r.(?)"	"p.(Asp461Gly)"	""
"0000728076"	"00024043"	"50"	"1343"	"0"	"1343"	"0"	"c.1343T>G"	"r.(?)"	"p.(Ile448Ser)"	""
"0000728077"	"00024043"	"30"	"1260"	"-10"	"1260"	"-10"	"c.1260-10C>G"	"r.(=)"	"p.(=)"	""
"0000728078"	"00024043"	"30"	"1116"	"0"	"1116"	"0"	"c.1116C>T"	"r.(?)"	"p.(Ser372=)"	""
"0000728079"	"00024043"	"70"	"1037"	"0"	"1037"	"0"	"c.1037G>A"	"r.(?)"	"p.(Arg346His)"	""
"0000728080"	"00024043"	"70"	"1036"	"0"	"1036"	"0"	"c.1036C>T"	"r.(?)"	"p.(Arg346Cys)"	""
"0000728081"	"00024043"	"50"	"952"	"0"	"952"	"0"	"c.952C>T"	"r.(?)"	"p.(Arg318Cys)"	""
"0000728082"	"00024043"	"30"	"909"	"-74"	"909"	"-74"	"c.909-74T>C"	"r.(=)"	"p.(=)"	""
"0000728083"	"00024043"	"50"	"848"	"0"	"848"	"0"	"c.848C>A"	"r.(?)"	"p.(Pro283His)"	""
"0000728084"	"00024043"	"50"	"663"	"0"	"663"	"0"	"c.663C>G"	"r.(?)"	"p.(Ile221Met)"	""
"0000728085"	"00024043"	"30"	"593"	"-38"	"593"	"-38"	"c.593-38A>G"	"r.(=)"	"p.(=)"	""
"0000728086"	"00024043"	"30"	"523"	"0"	"523"	"0"	"c.523G>A"	"r.(?)"	"p.(Val175Ile)"	""
"0000728087"	"00024043"	"70"	"483"	"0"	"485"	"0"	"c.483_485del"	"r.(?)"	"p.(Glu161del)"	""
"0000728088"	"00024043"	"50"	"480"	"0"	"480"	"0"	"c.480A>G"	"r.(?)"	"p.(Ile160Met)"	""
"0000728089"	"00024043"	"90"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.spl?"	"p.?"	""
"0000728090"	"00024043"	"30"	"410"	"0"	"410"	"0"	"c.410G>A"	"r.(?)"	"p.(Arg137Gln)"	""
"0000728091"	"00024043"	"90"	"409"	"0"	"409"	"0"	"c.409C>T"	"r.(?)"	"p.(Arg137*)"	""
"0000728092"	"00024043"	"50"	"397"	"0"	"397"	"0"	"c.397A>G"	"r.(?)"	"p.(Thr133Ala)"	""
"0000728093"	"00024043"	"50"	"190"	"0"	"190"	"0"	"c.190G>A"	"r.(?)"	"p.(Glu64Lys)"	""
"0000728094"	"00024043"	"90"	"78"	"0"	"79"	"0"	"c.78_79del"	"r.(?)"	"p.(Gln27Valfs*49)"	""
"0000736973"	"00024043"	"50"	"696"	"0"	"696"	"0"	"c.696dup"	"r.(?)"	"p.(Glu233Argfs*12)"	""
"0000736974"	"00024043"	"50"	"432"	"0"	"432"	"0"	"c.432del"	"r.(?)"	"p.(Arg145Glyfs*16)"	""
"0000737201"	"00024043"	"50"	"1375"	"1"	"1375"	"2"	"c.1375+1_1375+2del"	"r.spl?"	"p.?"	""
"0000737202"	"00024043"	"50"	"655"	"0"	"655"	"0"	"c.655del"	"r.(?)"	"p.(Glu219Asnfs*16)"	""
"0000739294"	"00024043"	"50"	"1586"	"0"	"1586"	"0"	"c.1586G>A"	"r.(?)"	"p.(Gly529Asp)"	""
"0000739295"	"00024043"	"50"	"1580"	"0"	"1580"	"0"	"c.1580C>T"	"r.(?)"	"p.(Ala527Val)"	""
"0000739296"	"00024043"	"50"	"1567"	"0"	"1567"	"0"	"c.1567C>G"	"r.(?)"	"p.(Arg523Gly)"	""
"0000739297"	"00024043"	"50"	"1552"	"0"	"1552"	"0"	"c.1552A>G"	"r.(?)"	"p.(Ser518Gly)"	""
"0000739298"	"00024043"	"50"	"1530"	"0"	"1530"	"0"	"c.1530G>C"	"r.(?)"	"p.(Gln510His)"	""
"0000739299"	"00024043"	"50"	"1529"	"0"	"1529"	"0"	"c.1529A>G"	"r.(?)"	"p.(Gln510Arg)"	""
"0000739300"	"00024043"	"50"	"1519"	"0"	"1519"	"0"	"c.1519G>A"	"r.(?)"	"p.(Ala507Thr)"	""
"0000739301"	"00024043"	"50"	"1510"	"0"	"1510"	"0"	"c.1510G>C"	"r.(?)"	"p.(Glu504Gln)"	""
"0000739302"	"00024043"	"50"	"1508"	"0"	"1508"	"0"	"c.1508A>G"	"r.(?)"	"p.(Asn503Ser)"	""
"0000739303"	"00024043"	"50"	"1453"	"0"	"1453"	"0"	"c.1453T>G"	"r.(?)"	"p.(Trp485Gly)"	""
"0000739304"	"00024043"	"50"	"1448"	"0"	"1448"	"0"	"c.1448A>G"	"r.(?)"	"p.(His483Arg)"	""
"0000739305"	"00024043"	"50"	"1442"	"0"	"1442"	"0"	"c.1442T>C"	"r.(?)"	"p.(Leu481Ser)"	""
"0000739306"	"00024043"	"50"	"1414"	"0"	"1414"	"0"	"c.1414A>G"	"r.(?)"	"p.(Lys472Glu)"	""
"0000739307"	"00024043"	"50"	"1402"	"0"	"1402"	"0"	"c.1402G>A"	"r.(?)"	"p.(Val468Ile)"	""
"0000739308"	"00024043"	"50"	"1379"	"0"	"1379"	"0"	"c.1379T>C"	"r.(?)"	"p.(Leu460Pro)"	""
"0000739309"	"00024043"	"50"	"1376"	"-1"	"1376"	"-1"	"c.1376-1G>C"	"r.spl?"	"p.?"	""
"0000739310"	"00024043"	"50"	"1375"	"0"	"1375"	"0"	"c.1375G>A"	"r.(?)"	"p.(Ala459Thr)"	""
"0000739311"	"00024043"	"50"	"1356"	"0"	"1356"	"0"	"c.1356G>A"	"r.(?)"	"p.(Trp452*)"	""
"0000739312"	"00024043"	"50"	"1352"	"0"	"1352"	"0"	"c.1352T>A"	"r.(?)"	"p.(Val451Asp)"	""
"0000739313"	"00024043"	"50"	"1328"	"0"	"1328"	"0"	"c.1328G>A"	"r.(?)"	"p.(Gly443Glu)"	""
"0000739314"	"00024043"	"50"	"1226"	"0"	"1226"	"0"	"c.1226A>C"	"r.(?)"	"p.(Asp409Ala)"	""
"0000739315"	"00024043"	"50"	"1204"	"0"	"1204"	"0"	"c.1204G>A"	"r.(?)"	"p.(Ala402Thr)"	""
"0000739316"	"00024043"	"50"	"1201"	"0"	"1201"	"0"	"c.1201A>G"	"r.(?)"	"p.(Thr401Ala)"	""
"0000739317"	"00024043"	"50"	"1095"	"0"	"1095"	"0"	"c.1095G>C"	"r.(?)"	"p.(Lys365Asn)"	""
"0000739318"	"00024043"	"50"	"1076"	"0"	"1076"	"0"	"c.1076A>G"	"r.(?)"	"p.(Glu359Gly)"	""
"0000739319"	"00024043"	"50"	"1063"	"0"	"1063"	"0"	"c.1063C>G"	"r.(?)"	"p.(Leu355Val)"	""
"0000739320"	"00024043"	"50"	"1055"	"0"	"1055"	"0"	"c.1055A>G"	"r.(?)"	"p.(Asn352Ser)"	""
"0000739321"	"00024043"	"50"	"1051"	"0"	"1051"	"0"	"c.1051G>A"	"r.(?)"	"p.(Glu351Lys)"	""
"0000739322"	"00024043"	"50"	"1037"	"0"	"1037"	"0"	"c.1037G>C"	"r.(?)"	"p.(Arg346Pro)"	""
"0000739323"	"00024043"	"50"	"1032"	"0"	"1032"	"0"	"c.1032A>G"	"r.(?)"	"p.(Ile344Met)"	""
"0000739324"	"00024043"	"50"	"1028"	"0"	"1028"	"0"	"c.1028T>C"	"r.(?)"	"p.(Ile343Thr)"	""
"0000739325"	"00024043"	"50"	"1024"	"0"	"1024"	"0"	"c.1024G>A"	"r.(?)"	"p.(Gly342Ser)"	""
"0000739326"	"00024043"	"50"	"1012"	"0"	"1012"	"0"	"c.1012C>T"	"r.(?)"	"p.(Leu338Phe)"	""
"0000739327"	"00024043"	"50"	"983"	"0"	"983"	"0"	"c.983T>C"	"r.(?)"	"p.(Phe328Ser)"	""
"0000739328"	"00024043"	"50"	"980"	"0"	"980"	"0"	"c.980A>T"	"r.(?)"	"p.(Tyr327Phe)"	""
"0000739329"	"00024043"	"50"	"972"	"0"	"972"	"0"	"c.972C>G"	"r.(?)"	"p.(Cys324Trp)"	""
"0000739330"	"00024043"	"50"	"962"	"0"	"962"	"0"	"c.962A>T"	"r.(?)"	"p.(Glu321Val)"	""
"0000739331"	"00024043"	"50"	"935"	"0"	"935"	"0"	"c.935A>G"	"r.(?)"	"p.(Lys312Arg)"	""
"0000739332"	"00024043"	"50"	"902"	"0"	"902"	"0"	"c.902T>G"	"r.(?)"	"p.(Leu301Trp)"	""
"0000739333"	"00024043"	"50"	"878"	"0"	"878"	"0"	"c.878A>T"	"r.(?)"	"p.(Asp293Val)"	""
"0000739334"	"00024043"	"50"	"870"	"0"	"870"	"0"	"c.870C>G"	"r.(?)"	"p.(Asn290Lys)"	""
"0000739335"	"00024043"	"50"	"860"	"0"	"860"	"0"	"c.860A>T"	"r.(?)"	"p.(Lys287Met)"	""
"0000739336"	"00024043"	"50"	"847"	"0"	"847"	"0"	"c.847C>T"	"r.(?)"	"p.(Pro283Ser)"	""
"0000739337"	"00024043"	"50"	"844"	"0"	"844"	"0"	"c.844C>G"	"r.(?)"	"p.(His282Asp)"	""
"0000739338"	"00024043"	"50"	"842"	"0"	"842"	"0"	"c.842A>C"	"r.(?)"	"p.(Asn281Thr)"	""
"0000739339"	"00024043"	"50"	"808"	"0"	"808"	"0"	"c.808G>A"	"r.(?)"	"p.(Val270Ile)"	""
"0000739340"	"00024043"	"50"	"802"	"0"	"802"	"0"	"c.802C>G"	"r.(?)"	"p.(Leu268Val)"	""
"0000739341"	"00024043"	"50"	"793"	"-2"	"793"	"-2"	"c.793-2A>G"	"r.spl?"	"p.?"	""
"0000739342"	"00024043"	"50"	"766"	"0"	"766"	"0"	"c.766T>C"	"r.(?)"	"p.(Phe256Leu)"	""
"0000739343"	"00024043"	"50"	"765"	"0"	"765"	"0"	"c.765G>T"	"r.(?)"	"p.(Lys255Asn)"	""
"0000739344"	"00024043"	"50"	"761"	"0"	"761"	"0"	"c.761G>A"	"r.(?)"	"p.(Arg254Lys)"	""
"0000739345"	"00024043"	"50"	"736"	"0"	"736"	"0"	"c.736G>C"	"r.(?)"	"p.(Val246Leu)"	""
"0000739346"	"00024043"	"50"	"736"	"0"	"736"	"0"	"c.736G>A"	"r.(?)"	"p.(Val246Ile)"	""
"0000739347"	"00024043"	"50"	"710"	"0"	"710"	"0"	"c.710C>T"	"r.(?)"	"p.(Ala237Val)"	""
"0000739348"	"00024043"	"50"	"685"	"0"	"685"	"0"	"c.685G>A"	"r.(?)"	"p.(Gly229Ser)"	""
"0000739349"	"00024043"	"50"	"664"	"0"	"664"	"0"	"c.664A>G"	"r.(?)"	"p.(Met222Val)"	""
"0000739350"	"00024043"	"50"	"662"	"0"	"662"	"0"	"c.662T>C"	"r.(?)"	"p.(Ile221Thr)"	""
"0000739351"	"00024043"	"50"	"620"	"0"	"620"	"0"	"c.620A>T"	"r.(?)"	"p.(Asp207Val)"	""
"0000739352"	"00024043"	"50"	"607"	"0"	"607"	"0"	"c.607G>A"	"r.(?)"	"p.(Asp203Asn)"	""
"0000739353"	"00024043"	"50"	"599"	"0"	"599"	"0"	"c.599T>C"	"r.(?)"	"p.(Val200Ala)"	""
"0000739354"	"00024043"	"50"	"598"	"0"	"598"	"0"	"c.598G>A"	"r.(?)"	"p.(Val200Ile)"	""
"0000739355"	"00024043"	"50"	"587"	"0"	"587"	"0"	"c.587A>G"	"r.(?)"	"p.(Asn196Ser)"	""
"0000739356"	"00024043"	"50"	"580"	"0"	"580"	"0"	"c.580A>T"	"r.(?)"	"p.(Ser194Cys)"	""
"0000739357"	"00024043"	"50"	"580"	"0"	"580"	"0"	"c.580A>G"	"r.(?)"	"p.(Ser194Gly)"	""
"0000739358"	"00024043"	"50"	"565"	"0"	"565"	"0"	"c.565A>G"	"r.(?)"	"p.(Ile189Val)"	""
"0000739359"	"00024043"	"50"	"559"	"0"	"559"	"0"	"c.559T>C"	"r.(?)"	"p.(Ser187Pro)"	""
"0000739360"	"00024043"	"50"	"521"	"0"	"521"	"0"	"c.521T>C"	"r.(?)"	"p.(Leu174Pro)"	""
"0000739361"	"00024043"	"50"	"515"	"0"	"515"	"0"	"c.515C>T"	"r.(?)"	"p.(Thr172Ile)"	""
"0000739362"	"00024043"	"50"	"503"	"0"	"503"	"0"	"c.503C>T"	"r.(?)"	"p.(Thr168Ile)"	""
"0000739363"	"00024043"	"50"	"500"	"0"	"500"	"0"	"c.500G>A"	"r.(?)"	"p.(Gly167Glu)"	""
"0000739364"	"00024043"	"50"	"479"	"0"	"479"	"0"	"c.479T>C"	"r.(?)"	"p.(Ile160Thr)"	""
"0000739365"	"00024043"	"50"	"452"	"0"	"452"	"0"	"c.452G>A"	"r.(?)"	"p.(Gly151Asp)"	""
"0000739366"	"00024043"	"50"	"442"	"0"	"442"	"0"	"c.442A>G"	"r.(?)"	"p.(Arg148Gly)"	""
"0000739367"	"00024043"	"50"	"374"	"0"	"374"	"0"	"c.374T>C"	"r.(?)"	"p.(Phe125Ser)"	""
"0000739368"	"00024043"	"50"	"340"	"0"	"340"	"0"	"c.340T>G"	"r.(?)"	"p.(Trp114Gly)"	""
"0000739369"	"00024043"	"50"	"328"	"0"	"328"	"0"	"c.328A>G"	"r.(?)"	"p.(Asn110Asp)"	""
"0000739370"	"00024043"	"50"	"313"	"0"	"313"	"0"	"c.313A>C"	"r.(?)"	"p.(Asn105His)"	""
"0000739371"	"00024043"	"50"	"310"	"0"	"310"	"0"	"c.310G>A"	"r.(?)"	"p.(Ala104Thr)"	""
"0000739372"	"00024043"	"50"	"277"	"0"	"277"	"0"	"c.277T>C"	"r.(?)"	"p.(Trp93Arg)"	""
"0000739373"	"00024043"	"50"	"216"	"0"	"216"	"0"	"c.216T>G"	"r.(?)"	"p.(Tyr72*)"	""
"0000739374"	"00024043"	"50"	"208"	"0"	"208"	"0"	"c.208G>A"	"r.(?)"	"p.(Glu70Lys)"	""
"0000739375"	"00024043"	"50"	"170"	"0"	"170"	"0"	"c.170C>T"	"r.(?)"	"p.(Ser57Phe)"	""
"0000739376"	"00024043"	"50"	"161"	"0"	"161"	"0"	"c.161A>G"	"r.(?)"	"p.(His54Arg)"	""
"0000739377"	"00024043"	"50"	"146"	"0"	"146"	"0"	"c.146C>G"	"r.(?)"	"p.(Ser49Cys)"	""
"0000739378"	"00024043"	"50"	"106"	"0"	"106"	"0"	"c.106C>T"	"r.(?)"	"p.(Gln36*)"	""
"0000739379"	"00024043"	"50"	"94"	"0"	"94"	"0"	"c.94T>C"	"r.(?)"	"p.(Ser32Pro)"	""
"0000739380"	"00024043"	"50"	"76"	"0"	"76"	"0"	"c.76A>G"	"r.(?)"	"p.(Thr26Ala)"	""
"0000739381"	"00024043"	"50"	"71"	"0"	"71"	"0"	"c.71G>A"	"r.(?)"	"p.(Ser24Asn)"	""
"0000739382"	"00024043"	"50"	"61"	"0"	"61"	"0"	"c.61C>G"	"r.(?)"	"p.(Pro21Ala)"	""
"0000739383"	"00024043"	"50"	"60"	"0"	"60"	"0"	"c.60G>T"	"r.(?)"	"p.(Gln20His)"	""
"0000739384"	"00024043"	"50"	"58"	"0"	"58"	"0"	"c.58C>T"	"r.(?)"	"p.(Gln20*)"	""
"0000739385"	"00024043"	"50"	"11"	"0"	"11"	"0"	"c.11A>G"	"r.(?)"	"p.(Glu4Gly)"	""
"0000739386"	"00024043"	"50"	"8"	"0"	"8"	"0"	"c.8G>C"	"r.(?)"	"p.(Arg3Pro)"	""
"0000739387"	"00024043"	"50"	"-7"	"1"	"-7"	"1"	"c.-7+1G>T"	"r.spl?"	"p.?"	""
"0000742867"	"00024043"	"50"	"1475"	"0"	"1475"	"0"	"c.1475del"	"r.(?)"	"p.(Lys492Argfs*21)"	""
"0000742868"	"00024043"	"50"	"1434"	"0"	"1434"	"0"	"c.1434del"	"r.(?)"	"p.(Glu479Lysfs*3)"	""
"0000742869"	"00024043"	"50"	"1188"	"0"	"1188"	"0"	"c.1188del"	"r.(?)"	"p.(Val397Phefs*17)"	""
"0000742870"	"00024043"	"50"	"1139"	"0"	"1140"	"0"	"c.1139_1140del"	"r.(?)"	"p.(Leu380Hisfs*14)"	""
"0000742871"	"00024043"	"50"	"1116"	"0"	"1116"	"0"	"c.1116dup"	"r.(?)"	"p.(Lys373Glnfs*22)"	""
"0000742872"	"00024043"	"50"	"963"	"0"	"963"	"0"	"c.963del"	"r.(?)"	"p.(Ala322Leufs*27)"	""
"0000742873"	"00024043"	"50"	"920"	"0"	"920"	"0"	"c.920dup"	"r.(?)"	"p.(Glu308Argfs*4)"	""
"0000742874"	"00024043"	"50"	"817"	"0"	"818"	"0"	"c.817_818del"	"r.(?)"	"p.(Glu273Asnfs*16)"	""
"0000742875"	"00024043"	"50"	"629"	"0"	"632"	"0"	"c.629_632del"	"r.(?)"	"p.(Ser210Phefs*6)"	""
"0000742876"	"00024043"	"50"	"597"	"0"	"597"	"0"	"c.597del"	"r.(?)"	"p.(Phe199Leufs*6)"	""
"0000742877"	"00024043"	"50"	"507"	"0"	"507"	"0"	"c.507del"	"r.(?)"	"p.(Phe169Leufs*2)"	""
"0000742878"	"00024043"	"50"	"367"	"0"	"367"	"0"	"c.367dup"	"r.(?)"	"p.(Tyr123Leufs*4)"	""
"0000742879"	"00024043"	"50"	"247"	"0"	"247"	"0"	"c.247del"	"r.(?)"	"p.(Gln83Lysfs*27)"	""
"0000742880"	"00024043"	"50"	"219"	"0"	"223"	"0"	"c.219_223del"	"r.(?)"	"p.(Ile74*)"	""
"0000742881"	"00024043"	"50"	"159"	"0"	"160"	"0"	"c.159_160del"	"r.(?)"	"p.(His54Leufs*22)"	""
"0000743473"	"00024043"	"50"	"784"	"0"	"792"	"5"	"c.784_792+5del"	"r.spl?"	"p.?"	""
"0000743474"	"00024043"	"50"	"1442"	"0"	"1443"	"0"	"c.1442_1443del"	"r.(?)"	"p.(Leu481*)"	""
"0000743475"	"00024043"	"50"	"1205"	"0"	"1206"	"0"	"c.1205_1206delinsTC"	"r.(?)"	"p.(Ala402Val)"	""
"0000743476"	"00024043"	"50"	"1452"	"0"	"1452"	"0"	"c.1452del"	"r.(?)"	"p.(Trp485Glyfs*7)"	""
"0000743477"	"00024043"	"50"	"277"	"0"	"277"	"0"	"c.277del"	"r.(?)"	"p.(Trp93Glyfs*17)"	""
"0000746141"	"00024043"	"50"	"1621"	"0"	"1621"	"0"	"c.1621G>C"	"r.(?)"	"p.(Ala541Pro)"	""
"0000746142"	"00024043"	"50"	"1603"	"0"	"1603"	"0"	"c.1603C>T"	"r.(?)"	"p.(Arg535Cys)"	""
"0000746143"	"00024043"	"50"	"1595"	"0"	"1595"	"0"	"c.1595C>T"	"r.(?)"	"p.(Thr532Ile)"	""
"0000746144"	"00024043"	"50"	"1595"	"0"	"1595"	"0"	"c.1595C>A"	"r.(?)"	"p.(Thr532Asn)"	""
"0000746145"	"00024043"	"50"	"1585"	"0"	"1585"	"0"	"c.1585G>A"	"r.(?)"	"p.(Gly529Ser)"	""
"0000746146"	"00024043"	"50"	"1568"	"0"	"1568"	"0"	"c.1568G>T"	"r.(?)"	"p.(Arg523Leu)"	""
"0000746147"	"00024043"	"50"	"1562"	"0"	"1562"	"0"	"c.1562G>A"	"r.(?)"	"p.(Arg521Gln)"	""
"0000746148"	"00024043"	"50"	"1561"	"0"	"1561"	"0"	"c.1561C>G"	"r.(?)"	"p.(Arg521Gly)"	""
"0000746149"	"00024043"	"50"	"1546"	"0"	"1546"	"0"	"c.1546T>C"	"r.(?)"	"p.(Ser516Pro)"	""
"0000746150"	"00024043"	"50"	"1528"	"0"	"1528"	"0"	"c.1528C>T"	"r.(?)"	"p.(Gln510*)"	""
"0000746151"	"00024043"	"50"	"1520"	"0"	"1520"	"0"	"c.1520C>A"	"r.(?)"	"p.(Ala507Asp)"	""
"0000746152"	"00024043"	"50"	"1507"	"0"	"1507"	"0"	"c.1507A>C"	"r.(?)"	"p.(Asn503His)"	""
"0000746153"	"00024043"	"50"	"1493"	"0"	"1493"	"0"	"c.1493T>C"	"r.(?)"	"p.(Leu498Pro)"	""
"0000746154"	"00024043"	"50"	"1489"	"0"	"1489"	"0"	"c.1489G>T"	"r.(?)"	"p.(Asp497Tyr)"	""
"0000746155"	"00024043"	"50"	"1472"	"0"	"1472"	"0"	"c.1472T>A"	"r.(?)"	"p.(Met491Lys)"	""
"0000746156"	"00024043"	"50"	"1462"	"0"	"1462"	"0"	"c.1462G>A"	"r.(?)"	"p.(Asp488Asn)"	""
"0000746157"	"00024043"	"50"	"1454"	"0"	"1454"	"0"	"c.1454G>A"	"r.(?)"	"p.(Trp485*)"	""
"0000746158"	"00024043"	"50"	"1450"	"0"	"1450"	"0"	"c.1450C>A"	"r.(?)"	"p.(Pro484Thr)"	""
"0000746159"	"00024043"	"50"	"1447"	"0"	"1447"	"0"	"c.1447C>T"	"r.(?)"	"p.(His483Tyr)"	""
"0000746160"	"00024043"	"50"	"1438"	"0"	"1438"	"0"	"c.1438G>A"	"r.(?)"	"p.(Ala480Thr)"	""
"0000746161"	"00024043"	"50"	"1426"	"0"	"1426"	"0"	"c.1426A>G"	"r.(?)"	"p.(Thr476Ala)"	""
"0000746162"	"00024043"	"50"	"1421"	"0"	"1421"	"0"	"c.1421G>A"	"r.(?)"	"p.(Arg474His)"	""
"0000746163"	"00024043"	"50"	"1420"	"0"	"1420"	"0"	"c.1420C>A"	"r.(?)"	"p.(Arg474Ser)"	""
"0000746164"	"00024043"	"50"	"1408"	"0"	"1408"	"0"	"c.1408G>C"	"r.(?)"	"p.(Asp470His)"	""
"0000746165"	"00024043"	"50"	"1400"	"0"	"1400"	"0"	"c.1400T>G"	"r.(?)"	"p.(Leu467Trp)"	""
"0000746166"	"00024043"	"50"	"1382"	"0"	"1382"	"0"	"c.1382A>G"	"r.(?)"	"p.(Asp461Gly)"	""
"0000746167"	"00024043"	"50"	"1376"	"0"	"1376"	"0"	"c.1376C>T"	"r.(?)"	"p.(Ala459Val)"	""
"0000746168"	"00024043"	"50"	"1376"	"-2"	"1376"	"-2"	"c.1376-2A>G"	"r.spl?"	"p.?"	""
"0000746169"	"00024043"	"50"	"1354"	"0"	"1354"	"0"	"c.1354T>C"	"r.(?)"	"p.(Trp452Arg)"	""
"0000746170"	"00024043"	"50"	"1351"	"0"	"1351"	"0"	"c.1351G>A"	"r.(?)"	"p.(Val451Ile)"	""
"0000746171"	"00024043"	"50"	"1318"	"0"	"1318"	"0"	"c.1318A>C"	"r.(?)"	"p.(Ile440Leu)"	""
"0000746172"	"00024043"	"50"	"1313"	"0"	"1313"	"0"	"c.1313A>T"	"r.(?)"	"p.(Asp438Val)"	""
"0000746173"	"00024043"	"50"	"1289"	"0"	"1289"	"0"	"c.1289A>G"	"r.(?)"	"p.(His430Arg)"	""
"0000746174"	"00024043"	"50"	"1286"	"0"	"1286"	"0"	"c.1286A>G"	"r.(?)"	"p.(Glu429Gly)"	""
"0000746175"	"00024043"	"50"	"1277"	"0"	"1277"	"0"	"c.1277C>G"	"r.(?)"	"p.(Pro426Arg)"	""
"0000746176"	"00024043"	"50"	"1277"	"0"	"1277"	"0"	"c.1277C>A"	"r.(?)"	"p.(Pro426His)"	""
"0000746177"	"00024043"	"50"	"1264"	"0"	"1264"	"0"	"c.1264A>T"	"r.(?)"	"p.(Ser422Cys)"	""
"0000746178"	"00024043"	"50"	"1241"	"0"	"1241"	"0"	"c.1241G>A"	"r.(?)"	"p.(Gly414Glu)"	""
"0000746179"	"00024043"	"50"	"1238"	"0"	"1238"	"0"	"c.1238T>G"	"r.(?)"	"p.(Leu413*)"	""
"0000746180"	"00024043"	"50"	"1236"	"0"	"1236"	"0"	"c.1236T>A"	"r.(?)"	"p.(Ser412Arg)"	""
"0000746181"	"00024043"	"50"	"1226"	"0"	"1226"	"0"	"c.1226A>T"	"r.(?)"	"p.(Asp409Val)"	""
"0000746182"	"00024043"	"50"	"1225"	"0"	"1225"	"0"	"c.1225G>T"	"r.(?)"	"p.(Asp409Tyr)"	""
"0000746183"	"00024043"	"50"	"1222"	"0"	"1222"	"0"	"c.1222G>A"	"r.(?)"	"p.(Val408Met)"	""
"0000746184"	"00024043"	"50"	"1199"	"0"	"1199"	"0"	"c.1199G>A"	"r.(?)"	"p.(Gly400Glu)"	""
"0000746185"	"00024043"	"50"	"1186"	"0"	"1186"	"0"	"c.1186C>G"	"r.(?)"	"p.(Leu396Val)"	""
"0000746186"	"00024043"	"50"	"1177"	"0"	"1177"	"0"	"c.1177C>T"	"r.(?)"	"p.(Pro393Ser)"	""
"0000746187"	"00024043"	"50"	"1170"	"0"	"1170"	"0"	"c.1170C>A"	"r.(?)"	"p.(Tyr390*)"	""
"0000746188"	"00024043"	"50"	"1169"	"0"	"1169"	"0"	"c.1169A>G"	"r.(?)"	"p.(Tyr390Cys)"	""
"0000746189"	"00024043"	"50"	"1160"	"0"	"1160"	"0"	"c.1160C>T"	"r.(?)"	"p.(Thr387Ile)"	""
"0000746190"	"00024043"	"50"	"1156"	"0"	"1156"	"0"	"c.1156G>C"	"r.(?)"	"p.(Gly386Arg)"	""
"0000746191"	"00024043"	"50"	"1143"	"0"	"1143"	"0"	"c.1143G>A"	"r.(?)"	"p.(Met381Ile)"	""
"0000746192"	"00024043"	"50"	"1108"	"0"	"1108"	"0"	"c.1108G>C"	"r.(?)"	"p.(Gly370Arg)"	""
"0000746193"	"00024043"	"50"	"1095"	"2"	"1095"	"2"	"c.1095+2T>G"	"r.spl?"	"p.?"	""
"0000746194"	"00024043"	"50"	"1095"	"1"	"1095"	"1"	"c.1095+1G>A"	"r.spl?"	"p.?"	""
"0000746195"	"00024043"	"50"	"1085"	"0"	"1085"	"0"	"c.1085G>A"	"r.(?)"	"p.(Cys362Tyr)"	""
"0000746196"	"00024043"	"50"	"1084"	"0"	"1084"	"0"	"c.1084T>C"	"r.(?)"	"p.(Cys362Arg)"	""
"0000746197"	"00024043"	"50"	"1081"	"0"	"1081"	"0"	"c.1081G>C"	"r.(?)"	"p.(Asp361His)"	""
"0000746198"	"00024043"	"50"	"1078"	"0"	"1078"	"0"	"c.1078G>C"	"r.(?)"	"p.(Glu360Gln)"	""
"0000746199"	"00024043"	"50"	"1078"	"0"	"1078"	"0"	"c.1078G>A"	"r.(?)"	"p.(Glu360Lys)"	""
"0000746200"	"00024043"	"50"	"1052"	"0"	"1052"	"0"	"c.1052A>C"	"r.(?)"	"p.(Glu351Ala)"	""
"0000746201"	"00024043"	"50"	"1003"	"0"	"1003"	"0"	"c.1003G>A"	"r.(?)"	"p.(Val335Met)"	""
"0000746202"	"00024043"	"50"	"992"	"0"	"992"	"0"	"c.992T>C"	"r.(?)"	"p.(Met331Thr)"	""
"0000746203"	"00024043"	"50"	"986"	"0"	"986"	"0"	"c.986A>G"	"r.(?)"	"p.(Tyr329Cys)"	""
"0000746204"	"00024043"	"50"	"983"	"0"	"983"	"0"	"c.983T>G"	"r.(?)"	"p.(Phe328Cys)"	""
"0000746205"	"00024043"	"50"	"977"	"0"	"977"	"0"	"c.977T>C"	"r.(?)"	"p.(Leu326Pro)"	""
"0000746206"	"00024043"	"50"	"967"	"0"	"967"	"0"	"c.967A>C"	"r.(?)"	"p.(Thr323Pro)"	""
"0000746207"	"00024043"	"50"	"962"	"0"	"962"	"0"	"c.962A>C"	"r.(?)"	"p.(Glu321Ala)"	""
"0000746208"	"00024043"	"50"	"953"	"0"	"953"	"0"	"c.953G>T"	"r.(?)"	"p.(Arg318Leu)"	""
"0000746209"	"00024043"	"50"	"952"	"0"	"952"	"0"	"c.952C>T"	"r.(?)"	"p.(Arg318Cys)"	""
"0000746210"	"00024043"	"50"	"923"	"0"	"923"	"0"	"c.923A>G"	"r.(?)"	"p.(Glu308Gly)"	""
"0000746211"	"00024043"	"50"	"917"	"0"	"917"	"0"	"c.917G>A"	"r.(?)"	"p.(Gly306Glu)"	""
"0000746212"	"00024043"	"50"	"916"	"0"	"916"	"0"	"c.916G>T"	"r.(?)"	"p.(Gly306Trp)"	""
"0000746213"	"00024043"	"50"	"911"	"0"	"911"	"0"	"c.911T>C"	"r.(?)"	"p.(Met304Thr)"	""
"0000746214"	"00024043"	"50"	"910"	"0"	"910"	"0"	"c.910A>G"	"r.(?)"	"p.(Met304Val)"	""
"0000746215"	"00024043"	"50"	"908"	"1"	"908"	"1"	"c.908+1G>T"	"r.spl?"	"p.?"	""
"0000746216"	"00024043"	"50"	"904"	"0"	"904"	"0"	"c.904G>A"	"r.(?)"	"p.(Glu302Lys)"	""
"0000746217"	"00024043"	"50"	"902"	"0"	"902"	"0"	"c.902T>A"	"r.(?)"	"p.(Leu301*)"	""
"0000746218"	"00024043"	"50"	"899"	"0"	"899"	"0"	"c.899T>G"	"r.(?)"	"p.(Val300Gly)"	""
"0000746219"	"00024043"	"50"	"896"	"0"	"896"	"0"	"c.896T>G"	"r.(?)"	"p.(Ile299Ser)"	""
"0000746220"	"00024043"	"50"	"893"	"0"	"893"	"0"	"c.893A>T"	"r.(?)"	"p.(Tyr298Phe)"	""
"0000746221"	"00024043"	"50"	"892"	"0"	"892"	"0"	"c.892T>G"	"r.(?)"	"p.(Tyr298Asp)"	""
"0000746222"	"00024043"	"50"	"887"	"0"	"887"	"0"	"c.887A>G"	"r.(?)"	"p.(Asp296Gly)"	""
"0000746223"	"00024043"	"50"	"855"	"0"	"855"	"0"	"c.855C>G"	"r.(?)"	"p.(Ile285Met)"	""
"0000746224"	"00024043"	"50"	"851"	"0"	"851"	"0"	"c.851G>A"	"r.(?)"	"p.(Cys284Tyr)"	""
"0000746225"	"00024043"	"50"	"846"	"1"	"846"	"1"	"c.846+1G>T"	"r.spl?"	"p.?"	""
"0000746226"	"00024043"	"50"	"846"	"1"	"846"	"1"	"c.846+1G>C"	"r.spl?"	"p.?"	""
"0000746227"	"00024043"	"50"	"842"	"0"	"842"	"0"	"c.842A>G"	"r.(?)"	"p.(Asn281Ser)"	""
"0000746228"	"00024043"	"50"	"836"	"0"	"836"	"0"	"c.836A>G"	"r.(?)"	"p.(Lys279Arg)"	""
"0000746229"	"00024043"	"50"	"832"	"0"	"832"	"0"	"c.832A>C"	"r.(?)"	"p.(Lys278Gln)"	""
"0000746230"	"00024043"	"50"	"827"	"0"	"827"	"0"	"c.827T>C"	"r.(?)"	"p.(Ile276Thr)"	""
"0000746231"	"00024043"	"50"	"824"	"0"	"824"	"0"	"c.824A>C"	"r.(?)"	"p.(Glu275Ala)"	""
"0000746232"	"00024043"	"50"	"822"	"0"	"822"	"0"	"c.822A>G"	"r.(?)"	"p.(Ile274Met)"	""
"0000746233"	"00024043"	"50"	"817"	"0"	"817"	"0"	"c.817G>A"	"r.(?)"	"p.(Glu273Lys)"	""
"0000746234"	"00024043"	"50"	"812"	"0"	"812"	"0"	"c.812A>G"	"r.(?)"	"p.(Glu271Gly)"	""
"0000746235"	"00024043"	"50"	"797"	"0"	"797"	"0"	"c.797C>T"	"r.(?)"	"p.(Pro266Leu)"	""
"0000746236"	"00024043"	"50"	"797"	"0"	"797"	"0"	"c.797C>G"	"r.(?)"	"p.(Pro266Arg)"	""
"0000746237"	"00024043"	"50"	"793"	"-1"	"793"	"-1"	"c.793-1G>T"	"r.spl?"	"p.?"	""
"0000746238"	"00024043"	"50"	"793"	"-1"	"793"	"-1"	"c.793-1G>A"	"r.spl?"	"p.?"	""
"0000746239"	"00024043"	"50"	"792"	"2"	"792"	"2"	"c.792+2T>C"	"r.spl?"	"p.?"	""
"0000746240"	"00024043"	"50"	"792"	"1"	"792"	"1"	"c.792+1G>A"	"r.spl?"	"p.?"	""
"0000746241"	"00024043"	"50"	"790"	"0"	"790"	"0"	"c.790G>T"	"r.(?)"	"p.(Ala264Ser)"	""
"0000746242"	"00024043"	"50"	"788"	"0"	"788"	"0"	"c.788A>G"	"r.(?)"	"p.(Glu263Gly)"	""
"0000746243"	"00024043"	"50"	"787"	"0"	"787"	"0"	"c.787G>C"	"r.(?)"	"p.(Glu263Gln)"	""
"0000746244"	"00024043"	"50"	"787"	"0"	"787"	"0"	"c.787G>A"	"r.(?)"	"p.(Glu263Lys)"	""
"0000746245"	"00024043"	"50"	"784"	"0"	"784"	"0"	"c.784A>G"	"r.(?)"	"p.(Arg262Gly)"	""
"0000746246"	"00024043"	"50"	"778"	"0"	"778"	"0"	"c.778T>C"	"r.(?)"	"p.(Ser260Pro)"	""
"0000746247"	"00024043"	"50"	"751"	"0"	"751"	"0"	"c.751A>T"	"r.(?)"	"p.(Ile251Phe)"	""
"0000746248"	"00024043"	"50"	"746"	"0"	"746"	"0"	"c.746A>G"	"r.(?)"	"p.(Lys249Arg)"	""
"0000746249"	"00024043"	"50"	"740"	"0"	"740"	"0"	"c.740C>A"	"r.(?)"	"p.(Ala247Asp)"	""
"0000746250"	"00024043"	"50"	"733"	"0"	"733"	"0"	"c.733A>T"	"r.(?)"	"p.(Lys245*)"	""
"0000746251"	"00024043"	"50"	"731"	"0"	"731"	"0"	"c.731A>G"	"r.(?)"	"p.(Lys244Arg)"	""
"0000746252"	"00024043"	"50"	"727"	"0"	"727"	"0"	"c.727T>G"	"r.(?)"	"p.(Cys243Gly)"	""
"0000746253"	"00024043"	"50"	"722"	"0"	"722"	"0"	"c.722A>G"	"r.(?)"	"p.(Lys241Arg)"	""
"0000746254"	"00024043"	"50"	"721"	"0"	"721"	"0"	"c.721A>G"	"r.(?)"	"p.(Lys241Glu)"	""
"0000746255"	"00024043"	"50"	"719"	"0"	"719"	"0"	"c.719G>C"	"r.(?)"	"p.(Arg240Thr)"	""
"0000746256"	"00024043"	"50"	"718"	"0"	"718"	"0"	"c.718A>G"	"r.(?)"	"p.(Arg240Gly)"	""
"0000746257"	"00024043"	"50"	"716"	"0"	"716"	"0"	"c.716A>G"	"r.(?)"	"p.(Glu239Gly)"	""
"0000746258"	"00024043"	"50"	"707"	"0"	"707"	"0"	"c.707T>C"	"r.(?)"	"p.(Leu236Pro)"	""
"0000746259"	"00024043"	"50"	"698"	"0"	"698"	"0"	"c.698A>G"	"r.(?)"	"p.(Glu233Gly)"	""
"0000746260"	"00024043"	"50"	"695"	"0"	"695"	"0"	"c.695G>T"	"r.(?)"	"p.(Gly232Val)"	""
"0000746261"	"00024043"	"50"	"688"	"0"	"688"	"0"	"c.688G>T"	"r.(?)"	"p.(Ala230Ser)"	""
"0000746262"	"00024043"	"50"	"688"	"0"	"688"	"0"	"c.688G>C"	"r.(?)"	"p.(Ala230Pro)"	""
"0000746263"	"00024043"	"50"	"686"	"0"	"686"	"0"	"c.686G>T"	"r.(?)"	"p.(Gly229Val)"	""
"0000746264"	"00024043"	"50"	"686"	"0"	"686"	"0"	"c.686G>A"	"r.(?)"	"p.(Gly229Asp)"	""
"0000746265"	"00024043"	"50"	"685"	"0"	"685"	"0"	"c.685G>T"	"r.(?)"	"p.(Gly229Cys)"	""
"0000746266"	"00024043"	"50"	"684"	"-2"	"684"	"-2"	"c.684-2A>G"	"r.spl?"	"p.?"	""
"0000746267"	"00024043"	"50"	"677"	"0"	"677"	"0"	"c.677T>G"	"r.(?)"	"p.(Leu226Arg)"	""
"0000746268"	"00024043"	"50"	"667"	"0"	"667"	"0"	"c.667T>C"	"r.(?)"	"p.(Ser223Pro)"	""
"0000746269"	"00024043"	"50"	"641"	"0"	"641"	"0"	"c.641A>G"	"r.(?)"	"p.(Lys214Arg)"	""
"0000746270"	"00024043"	"50"	"634"	"0"	"634"	"0"	"c.634T>C"	"r.(?)"	"p.(Tyr212His)"	""
"0000746271"	"00024043"	"50"	"622"	"0"	"622"	"0"	"c.622G>T"	"r.(?)"	"p.(Asp208Tyr)"	""
"0000746272"	"00024043"	"50"	"617"	"0"	"617"	"0"	"c.617T>C"	"r.(?)"	"p.(Val206Ala)"	""
"0000746273"	"00024043"	"50"	"616"	"0"	"616"	"0"	"c.616G>A"	"r.(?)"	"p.(Val206Ile)"	""
"0000746274"	"00024043"	"50"	"611"	"0"	"611"	"0"	"c.611T>C"	"r.(?)"	"p.(Leu204Pro)"	""
"0000746275"	"00024043"	"50"	"608"	"0"	"608"	"0"	"c.608A>G"	"r.(?)"	"p.(Asp203Gly)"	""
"0000746276"	"00024043"	"50"	"601"	"0"	"601"	"0"	"c.601T>A"	"r.(?)"	"p.(Phe201Ile)"	""
"0000746277"	"00024043"	"50"	"597"	"0"	"597"	"0"	"c.597T>A"	"r.(?)"	"p.(Phe199Leu)"	""
"0000746278"	"00024043"	"50"	"595"	"0"	"595"	"0"	"c.595T>C"	"r.(?)"	"p.(Phe199Leu)"	""
"0000746279"	"00024043"	"50"	"592"	"2"	"592"	"2"	"c.592+2T>G"	"r.spl?"	"p.?"	""
"0000746280"	"00024043"	"50"	"578"	"0"	"578"	"0"	"c.578T>C"	"r.(?)"	"p.(Leu193Pro)"	""
"0000746281"	"00024043"	"50"	"565"	"0"	"565"	"0"	"c.565A>T"	"r.(?)"	"p.(Ile189Phe)"	""
"0000746282"	"00024043"	"50"	"555"	"0"	"555"	"0"	"c.555C>G"	"r.(?)"	"p.(Asn185Lys)"	""
"0000746283"	"00024043"	"50"	"549"	"0"	"549"	"0"	"c.549G>C"	"r.(?)"	"p.(Leu183Phe)"	""
"0000746284"	"00024043"	"50"	"524"	"0"	"524"	"0"	"c.524T>C"	"r.(?)"	"p.(Val175Ala)"	""
"0000746285"	"00024043"	"50"	"517"	"0"	"517"	"0"	"c.517G>A"	"r.(?)"	"p.(Glu173Lys)"	""
"0000746286"	"00024043"	"50"	"512"	"0"	"512"	"0"	"c.512A>C"	"r.(?)"	"p.(Asn171Thr)"	""
"0000746287"	"00024043"	"50"	"497"	"0"	"497"	"0"	"c.497A>G"	"r.(?)"	"p.(Asn166Ser)"	""
"0000746288"	"00024043"	"50"	"490"	"0"	"490"	"0"	"c.490A>G"	"r.(?)"	"p.(Ser164Gly)"	""
"0000746289"	"00024043"	"50"	"478"	"0"	"478"	"0"	"c.478A>G"	"r.(?)"	"p.(Ile160Val)"	""
"0000746290"	"00024043"	"50"	"476"	"0"	"476"	"0"	"c.476A>G"	"r.(?)"	"p.(Tyr159Cys)"	""
"0000746291"	"00024043"	"50"	"475"	"0"	"475"	"0"	"c.475T>C"	"r.(?)"	"p.(Tyr159His)"	""
"0000746292"	"00024043"	"50"	"470"	"0"	"470"	"0"	"c.470T>G"	"r.(?)"	"p.(Ile157Ser)"	""
"0000746293"	"00024043"	"50"	"444"	"1"	"444"	"1"	"c.444+1G>T"	"r.spl?"	"p.?"	""
"0000746294"	"00024043"	"50"	"425"	"0"	"425"	"0"	"c.425A>G"	"r.(?)"	"p.(Lys142Arg)"	""
"0000746295"	"00024043"	"50"	"422"	"0"	"422"	"0"	"c.422A>C"	"r.(?)"	"p.(Lys141Thr)"	""
"0000746296"	"00024043"	"50"	"419"	"0"	"419"	"0"	"c.419G>C"	"r.(?)"	"p.(Ser140Thr)"	""
"0000746297"	"00024043"	"50"	"419"	"0"	"419"	"0"	"c.419G>A"	"r.(?)"	"p.(Ser140Asn)"	""
"0000746298"	"00024043"	"50"	"415"	"0"	"415"	"0"	"c.415T>C"	"r.(?)"	"p.(Tyr139His)"	""
"0000746299"	"00024043"	"50"	"413"	"0"	"413"	"0"	"c.413C>T"	"r.(?)"	"p.(Thr138Ile)"	""
"0000746300"	"00024043"	"50"	"400"	"0"	"400"	"0"	"c.400G>C"	"r.(?)"	"p.(Asp134His)"	""
"0000746301"	"00024043"	"50"	"397"	"0"	"397"	"0"	"c.397A>G"	"r.(?)"	"p.(Thr133Ala)"	""
"0000746302"	"00024043"	"50"	"354"	"0"	"354"	"0"	"c.354C>A"	"r.(?)"	"p.(Asp118Glu)"	""
"0000746303"	"00024043"	"50"	"350"	"0"	"350"	"0"	"c.350G>A"	"r.(?)"	"p.(Arg117Lys)"	""
"0000746304"	"00024043"	"50"	"335"	"0"	"335"	"0"	"c.335A>G"	"r.(?)"	"p.(Asn112Ser)"	""
"0000746305"	"00024043"	"50"	"333"	"0"	"333"	"0"	"c.333C>G"	"r.(?)"	"p.(Asp111Glu)"	""
"0000746306"	"00024043"	"50"	"319"	"1"	"319"	"1"	"c.319+1G>T"	"r.spl?"	"p.?"	""
"0000746307"	"00024043"	"50"	"310"	"0"	"310"	"0"	"c.310G>T"	"r.(?)"	"p.(Ala104Ser)"	""
"0000746308"	"00024043"	"50"	"301"	"0"	"301"	"0"	"c.301G>C"	"r.(?)"	"p.(Asp101His)"	""
"0000746309"	"00024043"	"50"	"284"	"0"	"284"	"0"	"c.284G>A"	"r.(?)"	"p.(Arg95Gln)"	""
"0000746310"	"00024043"	"50"	"279"	"0"	"279"	"0"	"c.279G>A"	"r.(?)"	"p.(Trp93*)"	""
"0000746311"	"00024043"	"50"	"258"	"0"	"258"	"0"	"c.258G>T"	"r.(?)"	"p.(Glu86Asp)"	""
"0000746312"	"00024043"	"50"	"238"	"0"	"238"	"0"	"c.238C>T"	"r.(?)"	"p.(Pro80Ser)"	""
"0000746313"	"00024043"	"50"	"160"	"0"	"160"	"0"	"c.160C>T"	"r.(?)"	"p.(His54Tyr)"	""
"0000746314"	"00024043"	"50"	"151"	"0"	"151"	"0"	"c.151C>G"	"r.(?)"	"p.(Gln51Glu)"	""
"0000746315"	"00024043"	"50"	"148"	"0"	"148"	"0"	"c.148A>G"	"r.(?)"	"p.(Ser50Gly)"	""
"0000746316"	"00024043"	"50"	"146"	"0"	"146"	"0"	"c.146C>T"	"r.(?)"	"p.(Ser49Phe)"	""
"0000746317"	"00024043"	"50"	"138"	"0"	"138"	"0"	"c.138G>A"	"r.(?)"	"p.(Met46Ile)"	""
"0000746318"	"00024043"	"50"	"134"	"0"	"134"	"0"	"c.134C>G"	"r.(?)"	"p.(Thr45Arg)"	""
"0000746319"	"00024043"	"50"	"127"	"0"	"127"	"0"	"c.127A>G"	"r.(?)"	"p.(Thr43Ala)"	""
"0000746320"	"00024043"	"50"	"115"	"0"	"115"	"0"	"c.115T>C"	"r.(?)"	"p.(Ser39Pro)"	""
"0000746321"	"00024043"	"50"	"113"	"0"	"113"	"0"	"c.113T>C"	"r.(?)"	"p.(Ile38Thr)"	""
"0000746322"	"00024043"	"50"	"104"	"0"	"104"	"0"	"c.104C>G"	"r.(?)"	"p.(Ser35Cys)"	""
"0000746323"	"00024043"	"50"	"103"	"0"	"103"	"0"	"c.103T>C"	"r.(?)"	"p.(Ser35Pro)"	""
"0000746324"	"00024043"	"50"	"98"	"0"	"98"	"0"	"c.98C>G"	"r.(?)"	"p.(Ser33*)"	""
"0000746325"	"00024043"	"50"	"85"	"0"	"85"	"0"	"c.85C>T"	"r.(?)"	"p.(Gln29*)"	""
"0000746326"	"00024043"	"50"	"83"	"0"	"83"	"0"	"c.83C>G"	"r.(?)"	"p.(Ser28Cys)"	""
"0000746327"	"00024043"	"50"	"81"	"0"	"81"	"0"	"c.81G>C"	"r.(?)"	"p.(Gln27His)"	""
"0000746328"	"00024043"	"50"	"58"	"0"	"58"	"0"	"c.58C>A"	"r.(?)"	"p.(Gln20Lys)"	""
"0000746329"	"00024043"	"50"	"56"	"0"	"56"	"0"	"c.56C>G"	"r.(?)"	"p.(Ser19*)"	""
"0000746330"	"00024043"	"50"	"46"	"0"	"46"	"0"	"c.46A>G"	"r.(?)"	"p.(Ser16Gly)"	""
"0000746331"	"00024043"	"50"	"38"	"0"	"38"	"0"	"c.38A>G"	"r.(?)"	"p.(His13Arg)"	""
"0000746332"	"00024043"	"50"	"35"	"0"	"35"	"0"	"c.35C>G"	"r.(?)"	"p.(Ser12Cys)"	""
"0000746333"	"00024043"	"50"	"13"	"0"	"13"	"0"	"c.13T>C"	"r.(?)"	"p.(Ser5Pro)"	""
"0000746334"	"00024043"	"50"	"8"	"0"	"8"	"0"	"c.8G>A"	"r.(?)"	"p.(Arg3Gln)"	""
"0000746335"	"00024043"	"50"	"1"	"0"	"1"	"0"	"c.1A>G"	"r.?"	"p.?"	""
"0000750078"	"00024043"	"50"	"1368"	"0"	"1368"	"0"	"c.1368dup"	"r.(?)"	"p.(Glu457Argfs*33)"	""
"0000750079"	"00024043"	"50"	"1263"	"0"	"1263"	"0"	"c.1263del"	"r.(?)"	"p.(Ser422Valfs*15)"	""
"0000750080"	"00024043"	"50"	"1209"	"0"	"1233"	"0"	"c.1209_1233del"	"r.(?)"	"p.(Tyr404Valfs*2)"	""
"0000750081"	"00024043"	"50"	"902"	"0"	"902"	"0"	"c.902del"	"r.(?)"	"p.(Leu301Trpfs*3)"	""
"0000750082"	"00024043"	"50"	"875"	"0"	"876"	"0"	"c.875_876del"	"r.(?)"	"p.(Phe292*)"	""
"0000750276"	"00024043"	"50"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	""
"0000752022"	"00024043"	"50"	"1604"	"0"	"1604"	"0"	"c.1604G>A"	"r.(?)"	"p.(Arg535His)"	""
"0000752023"	"00024043"	"50"	"1597"	"0"	"1597"	"0"	"c.1597A>G"	"r.(?)"	"p.(Thr533Ala)"	""
"0000752024"	"00024043"	"50"	"1582"	"0"	"1582"	"0"	"c.1582G>A"	"r.(?)"	"p.(Glu528Lys)"	""
"0000752025"	"00024043"	"50"	"1567"	"0"	"1567"	"0"	"c.1567C>T"	"r.(?)"	"p.(Arg523Cys)"	""
"0000752026"	"00024043"	"50"	"1561"	"0"	"1561"	"0"	"c.1561C>T"	"r.(?)"	"p.(Arg521Trp)"	""
"0000752027"	"00024043"	"50"	"1556"	"0"	"1556"	"0"	"c.1556G>T"	"r.(?)"	"p.(Arg519Leu)"	""
"0000752028"	"00024043"	"50"	"1556"	"0"	"1556"	"0"	"c.1556G>A"	"r.(?)"	"p.(Arg519Gln)"	""
"0000752029"	"00024043"	"50"	"1542"	"0"	"1542"	"0"	"c.1542G>T"	"r.(?)"	"p.(Gln514His)"	""
"0000752030"	"00024043"	"50"	"1526"	"0"	"1526"	"0"	"c.1526C>T"	"r.(?)"	"p.(Pro509Leu)"	""
"0000752031"	"00024043"	"50"	"1525"	"0"	"1525"	"0"	"c.1525C>T"	"r.(?)"	"p.(Pro509Ser)"	""
"0000752032"	"00024043"	"50"	"1522"	"0"	"1522"	"0"	"c.1522C>G"	"r.(?)"	"p.(Leu508Val)"	""
"0000752033"	"00024043"	"50"	"1513"	"0"	"1513"	"0"	"c.1513T>A"	"r.(?)"	"p.(Ser505Thr)"	""
"0000752034"	"00024043"	"50"	"1501"	"0"	"1501"	"0"	"c.1501G>A"	"r.(?)"	"p.(Glu501Lys)"	""
"0000752035"	"00024043"	"50"	"1489"	"0"	"1489"	"0"	"c.1489G>A"	"r.(?)"	"p.(Asp497Asn)"	""
"0000752036"	"00024043"	"50"	"1486"	"0"	"1486"	"0"	"c.1486C>T"	"r.(?)"	"p.(Gln496*)"	""
"0000752037"	"00024043"	"50"	"1470"	"0"	"1470"	"0"	"c.1470C>A"	"r.(?)"	"p.(Asp490Glu)"	""
"0000752038"	"00024043"	"50"	"1459"	"0"	"1459"	"0"	"c.1459C>T"	"r.(?)"	"p.(Gln487*)"	""
"0000752039"	"00024043"	"50"	"1451"	"0"	"1451"	"0"	"c.1451C>T"	"r.(?)"	"p.(Pro484Leu)"	""
"0000752040"	"00024043"	"50"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	""
"0000752041"	"00024043"	"50"	"1420"	"0"	"1420"	"0"	"c.1420C>T"	"r.(?)"	"p.(Arg474Cys)"	""
"0000752042"	"00024043"	"50"	"1383"	"0"	"1383"	"0"	"c.1383C>G"	"r.(?)"	"p.(Asp461Glu)"	""
"0000752043"	"00024043"	"50"	"1357"	"0"	"1357"	"0"	"c.1357G>C"	"r.(?)"	"p.(Ala453Pro)"	""
"0000752044"	"00024043"	"50"	"1343"	"0"	"1343"	"0"	"c.1343T>G"	"r.(?)"	"p.(Ile448Ser)"	""
"0000752045"	"00024043"	"50"	"1336"	"0"	"1336"	"0"	"c.1336A>G"	"r.(?)"	"p.(Asn446Asp)"	""
"0000752046"	"00024043"	"50"	"1315"	"0"	"1315"	"0"	"c.1315C>T"	"r.(?)"	"p.(Gln439*)"	""
"0000752047"	"00024043"	"50"	"1312"	"0"	"1312"	"0"	"c.1312G>T"	"r.(?)"	"p.(Asp438Tyr)"	""
"0000752048"	"00024043"	"50"	"1283"	"0"	"1283"	"0"	"c.1283C>T"	"r.(?)"	"p.(Ser428Phe)"	""
"0000752049"	"00024043"	"50"	"1270"	"0"	"1270"	"0"	"c.1270T>C"	"r.(?)"	"p.(Tyr424His)"	""
"0000752050"	"00024043"	"50"	"1265"	"0"	"1265"	"0"	"c.1265G>A"	"r.(?)"	"p.(Ser422Asn)"	""
"0000752051"	"00024043"	"50"	"1243"	"0"	"1243"	"0"	"c.1243G>A"	"r.(?)"	"p.(Val415Ile)"	""
"0000752052"	"00024043"	"50"	"1235"	"0"	"1235"	"0"	"c.1235G>A"	"r.(?)"	"p.(Ser412Asn)"	""
"0000752053"	"00024043"	"50"	"1232"	"0"	"1232"	"0"	"c.1232G>A"	"r.(?)"	"p.(Trp411*)"	""
"0000752054"	"00024043"	"50"	"1225"	"0"	"1225"	"0"	"c.1225G>C"	"r.(?)"	"p.(Asp409His)"	""
"0000752055"	"00024043"	"50"	"1225"	"0"	"1225"	"0"	"c.1225G>A"	"r.(?)"	"p.(Asp409Asn)"	""
"0000752056"	"00024043"	"50"	"1217"	"0"	"1217"	"0"	"c.1217G>A"	"r.(?)"	"p.(Arg406His)"	""
"0000752057"	"00024043"	"50"	"1216"	"0"	"1216"	"0"	"c.1216C>T"	"r.(?)"	"p.(Arg406Cys)"	""
"0000752058"	"00024043"	"50"	"1215"	"0"	"1215"	"0"	"c.1215C>A"	"r.(?)"	"p.(Asn405Lys)"	""
"0000752059"	"00024043"	"50"	"1214"	"0"	"1214"	"0"	"c.1214A>G"	"r.(?)"	"p.(Asn405Ser)"	""
"0000752060"	"00024043"	"50"	"1196"	"0"	"1196"	"0"	"c.1196T>A"	"r.(?)"	"p.(Val399Asp)"	""
"0000752061"	"00024043"	"50"	"1183"	"0"	"1183"	"0"	"c.1183G>C"	"r.(?)"	"p.(Val395Leu)"	""
"0000752062"	"00024043"	"50"	"1180"	"0"	"1180"	"0"	"c.1180G>A"	"r.(?)"	"p.(Glu394Lys)"	""
"0000752063"	"00024043"	"50"	"1175"	"0"	"1175"	"0"	"c.1175C>T"	"r.(?)"	"p.(Ala392Val)"	""
"0000752064"	"00024043"	"50"	"1169"	"0"	"1169"	"0"	"c.1169A>C"	"r.(?)"	"p.(Tyr390Ser)"	""
"0000752065"	"00024043"	"50"	"1153"	"0"	"1153"	"0"	"c.1153T>C"	"r.(?)"	"p.(Cys385Arg)"	""
"0000752066"	"00024043"	"50"	"1147"	"0"	"1147"	"0"	"c.1147A>G"	"r.(?)"	"p.(Thr383Ala)"	""
"0000752067"	"00024043"	"50"	"1141"	"0"	"1141"	"0"	"c.1141A>G"	"r.(?)"	"p.(Met381Val)"	""
"0000752068"	"00024043"	"50"	"1133"	"0"	"1133"	"0"	"c.1133C>T"	"r.(?)"	"p.(Thr378Ile)"	""
"0000752069"	"00024043"	"50"	"1118"	"0"	"1118"	"0"	"c.1118A>G"	"r.(?)"	"p.(Lys373Arg)"	""
"0000752070"	"00024043"	"50"	"1111"	"0"	"1111"	"0"	"c.1111C>T"	"r.(?)"	"p.(His371Tyr)"	""
"0000752071"	"00024043"	"50"	"1096"	"0"	"1096"	"0"	"c.1096A>G"	"r.(?)"	"p.(Ile366Val)"	""
"0000752072"	"00024043"	"50"	"1091"	"0"	"1091"	"0"	"c.1091T>C"	"r.(?)"	"p.(Ile364Thr)"	""
"0000752073"	"00024043"	"50"	"1067"	"0"	"1067"	"0"	"c.1067C>T"	"r.(?)"	"p.(Ser356Leu)"	""
"0000752074"	"00024043"	"50"	"1053"	"0"	"1053"	"0"	"c.1053G>T"	"r.(?)"	"p.(Glu351Asp)"	""
"0000752075"	"00024043"	"50"	"1039"	"0"	"1039"	"0"	"c.1039G>A"	"r.(?)"	"p.(Asp347Asn)"	""
"0000752076"	"00024043"	"50"	"1037"	"0"	"1037"	"0"	"c.1037G>A"	"r.(?)"	"p.(Arg346His)"	""
"0000752077"	"00024043"	"50"	"1036"	"0"	"1036"	"0"	"c.1036C>T"	"r.(?)"	"p.(Arg346Cys)"	""
"0000752078"	"00024043"	"50"	"1033"	"0"	"1033"	"0"	"c.1033C>T"	"r.(?)"	"p.(His345Tyr)"	""
"0000752079"	"00024043"	"50"	"1022"	"0"	"1022"	"0"	"c.1022A>C"	"r.(?)"	"p.(Asn341Thr)"	""
"0000752080"	"00024043"	"50"	"1003"	"0"	"1003"	"0"	"c.1003G>C"	"r.(?)"	"p.(Val335Leu)"	""
"0000752081"	"00024043"	"50"	"980"	"0"	"980"	"0"	"c.980A>G"	"r.(?)"	"p.(Tyr327Cys)"	""
"0000752082"	"00024043"	"50"	"974"	"0"	"974"	"0"	"c.974A>T"	"r.(?)"	"p.(Lys325Met)"	""
"0000752083"	"00024043"	"50"	"973"	"0"	"973"	"0"	"c.973A>G"	"r.(?)"	"p.(Lys325Glu)"	""
"0000752084"	"00024043"	"50"	"953"	"0"	"953"	"0"	"c.953G>A"	"r.(?)"	"p.(Arg318His)"	""
"0000752085"	"00024043"	"50"	"937"	"0"	"937"	"0"	"c.937G>A"	"r.(?)"	"p.(Val313Met)"	""
"0000752086"	"00024043"	"50"	"931"	"0"	"931"	"0"	"c.931G>A"	"r.(?)"	"p.(Asp311Asn)"	""
"0000752087"	"00024043"	"50"	"920"	"0"	"920"	"0"	"c.920G>A"	"r.(?)"	"p.(Gly307Glu)"	""
"0000752088"	"00024043"	"50"	"917"	"0"	"917"	"0"	"c.917G>C"	"r.(?)"	"p.(Gly306Ala)"	""
"0000752089"	"00024043"	"50"	"916"	"0"	"916"	"0"	"c.916G>C"	"r.(?)"	"p.(Gly306Arg)"	""
"0000752090"	"00024043"	"50"	"915"	"0"	"915"	"0"	"c.915A>C"	"r.(?)"	"p.(Glu305Asp)"	""
"0000752091"	"00024043"	"50"	"906"	"0"	"906"	"0"	"c.906A>C"	"r.(?)"	"p.(Glu302Asp)"	""
"0000752092"	"00024043"	"50"	"886"	"0"	"886"	"0"	"c.886G>T"	"r.(?)"	"p.(Asp296Tyr)"	""
"0000752093"	"00024043"	"50"	"856"	"0"	"856"	"0"	"c.856A>C"	"r.(?)"	"p.(Ile286Leu)"	""
"0000752094"	"00024043"	"50"	"839"	"0"	"839"	"0"	"c.839T>G"	"r.(?)"	"p.(Leu280Arg)"	""
"0000752095"	"00024043"	"50"	"823"	"0"	"823"	"0"	"c.823G>C"	"r.(?)"	"p.(Glu275Gln)"	""
"0000752096"	"00024043"	"50"	"821"	"0"	"821"	"0"	"c.821T>G"	"r.(?)"	"p.(Ile274Arg)"	""
"0000752097"	"00024043"	"50"	"802"	"0"	"802"	"0"	"c.802C>T"	"r.(?)"	"p.(Leu268Phe)"	""
"0000752098"	"00024043"	"50"	"800"	"0"	"800"	"0"	"c.800C>G"	"r.(?)"	"p.(Ala267Gly)"	""
"0000752099"	"00024043"	"50"	"755"	"0"	"755"	"0"	"c.755G>A"	"r.(?)"	"p.(Ser252Asn)"	""
"0000752100"	"00024043"	"50"	"739"	"0"	"739"	"0"	"c.739G>A"	"r.(?)"	"p.(Ala247Thr)"	""
"0000752101"	"00024043"	"50"	"727"	"0"	"727"	"0"	"c.727T>C"	"r.(?)"	"p.(Cys243Arg)"	""
"0000752102"	"00024043"	"50"	"725"	"0"	"725"	"0"	"c.725C>T"	"r.(?)"	"p.(Thr242Ile)"	""
"0000752103"	"00024043"	"50"	"715"	"0"	"715"	"0"	"c.715G>A"	"r.(?)"	"p.(Glu239Lys)"	""
"0000752104"	"00024043"	"50"	"665"	"0"	"665"	"0"	"c.665T>C"	"r.(?)"	"p.(Met222Thr)"	""
"0000752105"	"00024043"	"50"	"661"	"0"	"661"	"0"	"c.661A>G"	"r.(?)"	"p.(Ile221Val)"	""
"0000752106"	"00024043"	"50"	"644"	"0"	"644"	"0"	"c.644C>T"	"r.(?)"	"p.(Ala215Val)"	""
"0000752107"	"00024043"	"50"	"632"	"0"	"632"	"0"	"c.632T>A"	"r.(?)"	"p.(Val211Asp)"	""
"0000752108"	"00024043"	"50"	"629"	"0"	"629"	"0"	"c.629C>T"	"r.(?)"	"p.(Ser210Leu)"	""
"0000752109"	"00024043"	"50"	"614"	"0"	"614"	"0"	"c.614C>T"	"r.(?)"	"p.(Thr205Ile)"	""
"0000752110"	"00024043"	"50"	"613"	"0"	"613"	"0"	"c.613A>T"	"r.(?)"	"p.(Thr205Ser)"	""
"0000752111"	"00024043"	"50"	"607"	"0"	"607"	"0"	"c.607G>T"	"r.(?)"	"p.(Asp203Tyr)"	""
"0000752112"	"00024043"	"50"	"604"	"0"	"604"	"0"	"c.604T>C"	"r.(?)"	"p.(Phe202Leu)"	""
"0000752113"	"00024043"	"50"	"557"	"0"	"557"	"0"	"c.557A>G"	"r.(?)"	"p.(Asn186Ser)"	""
"0000752114"	"00024043"	"50"	"556"	"0"	"556"	"0"	"c.556A>C"	"r.(?)"	"p.(Asn186His)"	""
"0000752115"	"00024043"	"50"	"548"	"0"	"548"	"0"	"c.548T>C"	"r.(?)"	"p.(Leu183Ser)"	""
"0000752116"	"00024043"	"50"	"544"	"0"	"544"	"0"	"c.544C>A"	"r.(?)"	"p.(Pro182Thr)"	""
"0000752117"	"00024043"	"50"	"542"	"0"	"542"	"0"	"c.542G>A"	"r.(?)"	"p.(Arg181His)"	""
"0000752118"	"00024043"	"50"	"541"	"0"	"541"	"0"	"c.541C>T"	"r.(?)"	"p.(Arg181Cys)"	""
"0000752119"	"00024043"	"50"	"539"	"0"	"539"	"0"	"c.539G>A"	"r.(?)"	"p.(Arg180His)"	""
"0000752120"	"00024043"	"50"	"530"	"0"	"530"	"0"	"c.530A>G"	"r.(?)"	"p.(Lys177Arg)"	""
"0000752121"	"00024043"	"50"	"520"	"0"	"520"	"0"	"c.520C>T"	"r.(?)"	"p.(Leu174Phe)"	""
"0000752122"	"00024043"	"50"	"507"	"0"	"507"	"0"	"c.507T>G"	"r.(?)"	"p.(Phe169Leu)"	""
"0000752123"	"00024043"	"50"	"499"	"0"	"499"	"0"	"c.499G>A"	"r.(?)"	"p.(Gly167Arg)"	""
"0000752124"	"00024043"	"50"	"482"	"0"	"482"	"0"	"c.482A>G"	"r.(?)"	"p.(Glu161Gly)"	""
"0000752125"	"00024043"	"50"	"480"	"0"	"480"	"0"	"c.480A>G"	"r.(?)"	"p.(Ile160Met)"	""
"0000752126"	"00024043"	"50"	"472"	"0"	"472"	"0"	"c.472G>A"	"r.(?)"	"p.(Ala158Thr)"	""
"0000752127"	"00024043"	"50"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.spl?"	"p.?"	""
"0000752128"	"00024043"	"50"	"436"	"0"	"436"	"0"	"c.436A>C"	"r.(?)"	"p.(Ile146Leu)"	""
"0000752129"	"00024043"	"50"	"434"	"0"	"434"	"0"	"c.434G>A"	"r.(?)"	"p.(Arg145Gln)"	""
"0000752130"	"00024043"	"50"	"433"	"0"	"433"	"0"	"c.433C>T"	"r.(?)"	"p.(Arg145Trp)"	""
"0000752131"	"00024043"	"50"	"428"	"0"	"428"	"0"	"c.428A>G"	"r.(?)"	"p.(His143Arg)"	""
"0000752132"	"00024043"	"50"	"410"	"0"	"410"	"0"	"c.410G>A"	"r.(?)"	"p.(Arg137Gln)"	""
"0000752133"	"00024043"	"50"	"409"	"0"	"409"	"0"	"c.409C>T"	"r.(?)"	"p.(Arg137*)"	""
"0000752134"	"00024043"	"50"	"383"	"0"	"383"	"0"	"c.383C>T"	"r.(?)"	"p.(Pro128Leu)"	""
"0000752135"	"00024043"	"50"	"368"	"0"	"368"	"0"	"c.368A>G"	"r.(?)"	"p.(Tyr123Cys)"	""
"0000752136"	"00024043"	"50"	"349"	"0"	"349"	"0"	"c.349A>G"	"r.(?)"	"p.(Arg117Gly)"	""
"0000752137"	"00024043"	"50"	"336"	"0"	"336"	"0"	"c.336C>G"	"r.(?)"	"p.(Asn112Lys)"	""
"0000752138"	"00024043"	"50"	"322"	"0"	"322"	"0"	"c.322T>C"	"r.(?)"	"p.(Cys108Arg)"	""
"0000752139"	"00024043"	"50"	"319"	"2"	"319"	"2"	"c.319+2T>A"	"r.spl?"	"p.?"	""
"0000752140"	"00024043"	"50"	"319"	"0"	"319"	"0"	"c.319G>A"	"r.(?)"	"p.(Glu107Lys)"	""
"0000752141"	"00024043"	"50"	"283"	"0"	"283"	"0"	"c.283C>T"	"r.(?)"	"p.(Arg95*)"	""
"0000752142"	"00024043"	"50"	"269"	"0"	"269"	"0"	"c.269C>T"	"r.(?)"	"p.(Pro90Leu)"	""
"0000752143"	"00024043"	"50"	"256"	"0"	"256"	"0"	"c.256G>C"	"r.(?)"	"p.(Glu86Gln)"	""
"0000752144"	"00024043"	"50"	"254"	"0"	"254"	"0"	"c.254C>T"	"r.(?)"	"p.(Pro85Leu)"	""
"0000752145"	"00024043"	"50"	"254"	"0"	"254"	"0"	"c.254C>G"	"r.(?)"	"p.(Pro85Arg)"	""
"0000752146"	"00024043"	"50"	"239"	"0"	"239"	"0"	"c.239C>A"	"r.(?)"	"p.(Pro80His)"	""
"0000752147"	"00024043"	"50"	"215"	"0"	"215"	"0"	"c.215A>G"	"r.(?)"	"p.(Tyr72Cys)"	""
"0000752148"	"00024043"	"50"	"190"	"0"	"190"	"0"	"c.190G>A"	"r.(?)"	"p.(Glu64Lys)"	""
"0000752149"	"00024043"	"50"	"176"	"0"	"176"	"0"	"c.176C>T"	"r.(?)"	"p.(Thr59Ile)"	""
"0000752150"	"00024043"	"50"	"176"	"0"	"176"	"0"	"c.176C>A"	"r.(?)"	"p.(Thr59Lys)"	""
"0000752151"	"00024043"	"50"	"157"	"0"	"157"	"0"	"c.157T>A"	"r.(?)"	"p.(Ser53Thr)"	""
"0000752152"	"00024043"	"50"	"134"	"0"	"134"	"0"	"c.134C>T"	"r.(?)"	"p.(Thr45Met)"	""
"0000752153"	"00024043"	"50"	"122"	"0"	"122"	"0"	"c.122C>T"	"r.(?)"	"p.(Ser41Phe)"	""
"0000752154"	"00024043"	"50"	"74"	"0"	"74"	"0"	"c.74T>C"	"r.(?)"	"p.(Val25Ala)"	""
"0000752155"	"00024043"	"50"	"73"	"0"	"73"	"0"	"c.73G>A"	"r.(?)"	"p.(Val25Ile)"	""
"0000752156"	"00024043"	"50"	"65"	"0"	"65"	"0"	"c.65A>G"	"r.(?)"	"p.(His22Arg)"	""
"0000752157"	"00024043"	"50"	"19"	"0"	"19"	"0"	"c.19G>A"	"r.(?)"	"p.(Val7Ile)"	""
"0000752158"	"00024043"	"50"	"14"	"0"	"14"	"0"	"c.14C>T"	"r.(?)"	"p.(Ser5Leu)"	""
"0000752159"	"00024043"	"50"	"7"	"0"	"7"	"0"	"c.7C>T"	"r.(?)"	"p.(Arg3Trp)"	""
"0000754852"	"00024043"	"50"	"1368"	"0"	"1368"	"0"	"c.1368dup"	"r.(?)"	"p.(Glu457Argfs*33)"	""
"0000754853"	"00024043"	"50"	"1263"	"0"	"1263"	"0"	"c.1263del"	"r.(?)"	"p.(Ser422Valfs*15)"	""
"0000754854"	"00024043"	"50"	"1209"	"0"	"1233"	"0"	"c.1209_1233del"	"r.(?)"	"p.(Tyr404Valfs*2)"	""
"0000754855"	"00024043"	"50"	"902"	"0"	"902"	"0"	"c.902del"	"r.(?)"	"p.(Leu301Trpfs*3)"	""
"0000754856"	"00024043"	"50"	"875"	"0"	"876"	"0"	"c.875_876del"	"r.(?)"	"p.(Phe292*)"	""
"0000755050"	"00024043"	"50"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367Metfs*15)"	""
"0000756796"	"00024043"	"50"	"1604"	"0"	"1604"	"0"	"c.1604G>A"	"r.(?)"	"p.(Arg535His)"	""
"0000756797"	"00024043"	"50"	"1597"	"0"	"1597"	"0"	"c.1597A>G"	"r.(?)"	"p.(Thr533Ala)"	""
"0000756798"	"00024043"	"50"	"1582"	"0"	"1582"	"0"	"c.1582G>A"	"r.(?)"	"p.(Glu528Lys)"	""
"0000756799"	"00024043"	"50"	"1567"	"0"	"1567"	"0"	"c.1567C>T"	"r.(?)"	"p.(Arg523Cys)"	""
"0000756800"	"00024043"	"50"	"1561"	"0"	"1561"	"0"	"c.1561C>T"	"r.(?)"	"p.(Arg521Trp)"	""
"0000756801"	"00024043"	"50"	"1556"	"0"	"1556"	"0"	"c.1556G>T"	"r.(?)"	"p.(Arg519Leu)"	""
"0000756802"	"00024043"	"50"	"1556"	"0"	"1556"	"0"	"c.1556G>A"	"r.(?)"	"p.(Arg519Gln)"	""
"0000756803"	"00024043"	"50"	"1542"	"0"	"1542"	"0"	"c.1542G>T"	"r.(?)"	"p.(Gln514His)"	""
"0000756804"	"00024043"	"50"	"1526"	"0"	"1526"	"0"	"c.1526C>T"	"r.(?)"	"p.(Pro509Leu)"	""
"0000756805"	"00024043"	"50"	"1525"	"0"	"1525"	"0"	"c.1525C>T"	"r.(?)"	"p.(Pro509Ser)"	""
"0000756806"	"00024043"	"50"	"1522"	"0"	"1522"	"0"	"c.1522C>G"	"r.(?)"	"p.(Leu508Val)"	""
"0000756807"	"00024043"	"50"	"1513"	"0"	"1513"	"0"	"c.1513T>A"	"r.(?)"	"p.(Ser505Thr)"	""
"0000756808"	"00024043"	"50"	"1501"	"0"	"1501"	"0"	"c.1501G>A"	"r.(?)"	"p.(Glu501Lys)"	""
"0000756809"	"00024043"	"50"	"1489"	"0"	"1489"	"0"	"c.1489G>A"	"r.(?)"	"p.(Asp497Asn)"	""
"0000756810"	"00024043"	"50"	"1486"	"0"	"1486"	"0"	"c.1486C>T"	"r.(?)"	"p.(Gln496*)"	""
"0000756811"	"00024043"	"50"	"1470"	"0"	"1470"	"0"	"c.1470C>A"	"r.(?)"	"p.(Asp490Glu)"	""
"0000756812"	"00024043"	"50"	"1459"	"0"	"1459"	"0"	"c.1459C>T"	"r.(?)"	"p.(Gln487*)"	""
"0000756813"	"00024043"	"50"	"1451"	"0"	"1451"	"0"	"c.1451C>T"	"r.(?)"	"p.(Pro484Leu)"	""
"0000756814"	"00024043"	"50"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	""
"0000756815"	"00024043"	"50"	"1420"	"0"	"1420"	"0"	"c.1420C>T"	"r.(?)"	"p.(Arg474Cys)"	""
"0000756816"	"00024043"	"50"	"1383"	"0"	"1383"	"0"	"c.1383C>G"	"r.(?)"	"p.(Asp461Glu)"	""
"0000756817"	"00024043"	"50"	"1357"	"0"	"1357"	"0"	"c.1357G>C"	"r.(?)"	"p.(Ala453Pro)"	""
"0000756818"	"00024043"	"50"	"1343"	"0"	"1343"	"0"	"c.1343T>G"	"r.(?)"	"p.(Ile448Ser)"	""
"0000756819"	"00024043"	"50"	"1336"	"0"	"1336"	"0"	"c.1336A>G"	"r.(?)"	"p.(Asn446Asp)"	""
"0000756820"	"00024043"	"50"	"1315"	"0"	"1315"	"0"	"c.1315C>T"	"r.(?)"	"p.(Gln439*)"	""
"0000756821"	"00024043"	"50"	"1312"	"0"	"1312"	"0"	"c.1312G>T"	"r.(?)"	"p.(Asp438Tyr)"	""
"0000756822"	"00024043"	"50"	"1283"	"0"	"1283"	"0"	"c.1283C>T"	"r.(?)"	"p.(Ser428Phe)"	""
"0000756823"	"00024043"	"50"	"1270"	"0"	"1270"	"0"	"c.1270T>C"	"r.(?)"	"p.(Tyr424His)"	""
"0000756824"	"00024043"	"50"	"1265"	"0"	"1265"	"0"	"c.1265G>A"	"r.(?)"	"p.(Ser422Asn)"	""
"0000756825"	"00024043"	"50"	"1243"	"0"	"1243"	"0"	"c.1243G>A"	"r.(?)"	"p.(Val415Ile)"	""
"0000756826"	"00024043"	"50"	"1235"	"0"	"1235"	"0"	"c.1235G>A"	"r.(?)"	"p.(Ser412Asn)"	""
"0000756827"	"00024043"	"50"	"1232"	"0"	"1232"	"0"	"c.1232G>A"	"r.(?)"	"p.(Trp411*)"	""
"0000756828"	"00024043"	"50"	"1225"	"0"	"1225"	"0"	"c.1225G>C"	"r.(?)"	"p.(Asp409His)"	""
"0000756829"	"00024043"	"50"	"1225"	"0"	"1225"	"0"	"c.1225G>A"	"r.(?)"	"p.(Asp409Asn)"	""
"0000756830"	"00024043"	"50"	"1217"	"0"	"1217"	"0"	"c.1217G>A"	"r.(?)"	"p.(Arg406His)"	""
"0000756831"	"00024043"	"50"	"1216"	"0"	"1216"	"0"	"c.1216C>T"	"r.(?)"	"p.(Arg406Cys)"	""
"0000756832"	"00024043"	"50"	"1215"	"0"	"1215"	"0"	"c.1215C>A"	"r.(?)"	"p.(Asn405Lys)"	""
"0000756833"	"00024043"	"50"	"1214"	"0"	"1214"	"0"	"c.1214A>G"	"r.(?)"	"p.(Asn405Ser)"	""
"0000756834"	"00024043"	"50"	"1196"	"0"	"1196"	"0"	"c.1196T>A"	"r.(?)"	"p.(Val399Asp)"	""
"0000756835"	"00024043"	"50"	"1183"	"0"	"1183"	"0"	"c.1183G>C"	"r.(?)"	"p.(Val395Leu)"	""
"0000756836"	"00024043"	"50"	"1180"	"0"	"1180"	"0"	"c.1180G>A"	"r.(?)"	"p.(Glu394Lys)"	""
"0000756837"	"00024043"	"50"	"1175"	"0"	"1175"	"0"	"c.1175C>T"	"r.(?)"	"p.(Ala392Val)"	""
"0000756838"	"00024043"	"50"	"1169"	"0"	"1169"	"0"	"c.1169A>C"	"r.(?)"	"p.(Tyr390Ser)"	""
"0000756839"	"00024043"	"50"	"1153"	"0"	"1153"	"0"	"c.1153T>C"	"r.(?)"	"p.(Cys385Arg)"	""
"0000756840"	"00024043"	"50"	"1147"	"0"	"1147"	"0"	"c.1147A>G"	"r.(?)"	"p.(Thr383Ala)"	""
"0000756841"	"00024043"	"50"	"1141"	"0"	"1141"	"0"	"c.1141A>G"	"r.(?)"	"p.(Met381Val)"	""
"0000756842"	"00024043"	"50"	"1133"	"0"	"1133"	"0"	"c.1133C>T"	"r.(?)"	"p.(Thr378Ile)"	""
"0000756843"	"00024043"	"50"	"1118"	"0"	"1118"	"0"	"c.1118A>G"	"r.(?)"	"p.(Lys373Arg)"	""
"0000756844"	"00024043"	"50"	"1111"	"0"	"1111"	"0"	"c.1111C>T"	"r.(?)"	"p.(His371Tyr)"	""
"0000756845"	"00024043"	"50"	"1096"	"0"	"1096"	"0"	"c.1096A>G"	"r.(?)"	"p.(Ile366Val)"	""
"0000756846"	"00024043"	"50"	"1091"	"0"	"1091"	"0"	"c.1091T>C"	"r.(?)"	"p.(Ile364Thr)"	""
"0000756847"	"00024043"	"50"	"1067"	"0"	"1067"	"0"	"c.1067C>T"	"r.(?)"	"p.(Ser356Leu)"	""
"0000756848"	"00024043"	"50"	"1053"	"0"	"1053"	"0"	"c.1053G>T"	"r.(?)"	"p.(Glu351Asp)"	""
"0000756849"	"00024043"	"50"	"1039"	"0"	"1039"	"0"	"c.1039G>A"	"r.(?)"	"p.(Asp347Asn)"	""
"0000756850"	"00024043"	"50"	"1037"	"0"	"1037"	"0"	"c.1037G>A"	"r.(?)"	"p.(Arg346His)"	""
"0000756851"	"00024043"	"50"	"1036"	"0"	"1036"	"0"	"c.1036C>T"	"r.(?)"	"p.(Arg346Cys)"	""
"0000756852"	"00024043"	"50"	"1033"	"0"	"1033"	"0"	"c.1033C>T"	"r.(?)"	"p.(His345Tyr)"	""
"0000756853"	"00024043"	"50"	"1022"	"0"	"1022"	"0"	"c.1022A>C"	"r.(?)"	"p.(Asn341Thr)"	""
"0000756854"	"00024043"	"50"	"1003"	"0"	"1003"	"0"	"c.1003G>C"	"r.(?)"	"p.(Val335Leu)"	""
"0000756855"	"00024043"	"50"	"980"	"0"	"980"	"0"	"c.980A>G"	"r.(?)"	"p.(Tyr327Cys)"	""
"0000756856"	"00024043"	"50"	"974"	"0"	"974"	"0"	"c.974A>T"	"r.(?)"	"p.(Lys325Met)"	""
"0000756857"	"00024043"	"50"	"973"	"0"	"973"	"0"	"c.973A>G"	"r.(?)"	"p.(Lys325Glu)"	""
"0000756858"	"00024043"	"50"	"953"	"0"	"953"	"0"	"c.953G>A"	"r.(?)"	"p.(Arg318His)"	""
"0000756859"	"00024043"	"50"	"937"	"0"	"937"	"0"	"c.937G>A"	"r.(?)"	"p.(Val313Met)"	""
"0000756860"	"00024043"	"50"	"931"	"0"	"931"	"0"	"c.931G>A"	"r.(?)"	"p.(Asp311Asn)"	""
"0000756861"	"00024043"	"50"	"920"	"0"	"920"	"0"	"c.920G>A"	"r.(?)"	"p.(Gly307Glu)"	""
"0000756862"	"00024043"	"50"	"917"	"0"	"917"	"0"	"c.917G>C"	"r.(?)"	"p.(Gly306Ala)"	""
"0000756863"	"00024043"	"50"	"916"	"0"	"916"	"0"	"c.916G>C"	"r.(?)"	"p.(Gly306Arg)"	""
"0000756864"	"00024043"	"50"	"915"	"0"	"915"	"0"	"c.915A>C"	"r.(?)"	"p.(Glu305Asp)"	""
"0000756865"	"00024043"	"50"	"906"	"0"	"906"	"0"	"c.906A>C"	"r.(?)"	"p.(Glu302Asp)"	""
"0000756866"	"00024043"	"50"	"886"	"0"	"886"	"0"	"c.886G>T"	"r.(?)"	"p.(Asp296Tyr)"	""
"0000756867"	"00024043"	"50"	"856"	"0"	"856"	"0"	"c.856A>C"	"r.(?)"	"p.(Ile286Leu)"	""
"0000756868"	"00024043"	"50"	"839"	"0"	"839"	"0"	"c.839T>G"	"r.(?)"	"p.(Leu280Arg)"	""
"0000756869"	"00024043"	"50"	"823"	"0"	"823"	"0"	"c.823G>C"	"r.(?)"	"p.(Glu275Gln)"	""
"0000756870"	"00024043"	"50"	"821"	"0"	"821"	"0"	"c.821T>G"	"r.(?)"	"p.(Ile274Arg)"	""
"0000756871"	"00024043"	"50"	"802"	"0"	"802"	"0"	"c.802C>T"	"r.(?)"	"p.(Leu268Phe)"	""
"0000756872"	"00024043"	"50"	"800"	"0"	"800"	"0"	"c.800C>G"	"r.(?)"	"p.(Ala267Gly)"	""
"0000756873"	"00024043"	"50"	"755"	"0"	"755"	"0"	"c.755G>A"	"r.(?)"	"p.(Ser252Asn)"	""
"0000756874"	"00024043"	"50"	"739"	"0"	"739"	"0"	"c.739G>A"	"r.(?)"	"p.(Ala247Thr)"	""
"0000756875"	"00024043"	"50"	"727"	"0"	"727"	"0"	"c.727T>C"	"r.(?)"	"p.(Cys243Arg)"	""
"0000756876"	"00024043"	"50"	"725"	"0"	"725"	"0"	"c.725C>T"	"r.(?)"	"p.(Thr242Ile)"	""
"0000756877"	"00024043"	"50"	"715"	"0"	"715"	"0"	"c.715G>A"	"r.(?)"	"p.(Glu239Lys)"	""
"0000756878"	"00024043"	"50"	"665"	"0"	"665"	"0"	"c.665T>C"	"r.(?)"	"p.(Met222Thr)"	""
"0000756879"	"00024043"	"50"	"661"	"0"	"661"	"0"	"c.661A>G"	"r.(?)"	"p.(Ile221Val)"	""
"0000756880"	"00024043"	"50"	"644"	"0"	"644"	"0"	"c.644C>T"	"r.(?)"	"p.(Ala215Val)"	""
"0000756881"	"00024043"	"50"	"632"	"0"	"632"	"0"	"c.632T>A"	"r.(?)"	"p.(Val211Asp)"	""
"0000756882"	"00024043"	"50"	"629"	"0"	"629"	"0"	"c.629C>T"	"r.(?)"	"p.(Ser210Leu)"	""
"0000756883"	"00024043"	"50"	"614"	"0"	"614"	"0"	"c.614C>T"	"r.(?)"	"p.(Thr205Ile)"	""
"0000756884"	"00024043"	"50"	"613"	"0"	"613"	"0"	"c.613A>T"	"r.(?)"	"p.(Thr205Ser)"	""
"0000756885"	"00024043"	"50"	"607"	"0"	"607"	"0"	"c.607G>T"	"r.(?)"	"p.(Asp203Tyr)"	""
"0000756886"	"00024043"	"50"	"604"	"0"	"604"	"0"	"c.604T>C"	"r.(?)"	"p.(Phe202Leu)"	""
"0000756887"	"00024043"	"50"	"557"	"0"	"557"	"0"	"c.557A>G"	"r.(?)"	"p.(Asn186Ser)"	""
"0000756888"	"00024043"	"50"	"556"	"0"	"556"	"0"	"c.556A>C"	"r.(?)"	"p.(Asn186His)"	""
"0000756889"	"00024043"	"50"	"548"	"0"	"548"	"0"	"c.548T>C"	"r.(?)"	"p.(Leu183Ser)"	""
"0000756890"	"00024043"	"50"	"544"	"0"	"544"	"0"	"c.544C>A"	"r.(?)"	"p.(Pro182Thr)"	""
"0000756891"	"00024043"	"50"	"542"	"0"	"542"	"0"	"c.542G>A"	"r.(?)"	"p.(Arg181His)"	""
"0000756892"	"00024043"	"50"	"541"	"0"	"541"	"0"	"c.541C>T"	"r.(?)"	"p.(Arg181Cys)"	""
"0000756893"	"00024043"	"50"	"539"	"0"	"539"	"0"	"c.539G>A"	"r.(?)"	"p.(Arg180His)"	""
"0000756894"	"00024043"	"50"	"530"	"0"	"530"	"0"	"c.530A>G"	"r.(?)"	"p.(Lys177Arg)"	""
"0000756895"	"00024043"	"50"	"520"	"0"	"520"	"0"	"c.520C>T"	"r.(?)"	"p.(Leu174Phe)"	""
"0000756896"	"00024043"	"50"	"507"	"0"	"507"	"0"	"c.507T>G"	"r.(?)"	"p.(Phe169Leu)"	""
"0000756897"	"00024043"	"50"	"499"	"0"	"499"	"0"	"c.499G>A"	"r.(?)"	"p.(Gly167Arg)"	""
"0000756898"	"00024043"	"50"	"482"	"0"	"482"	"0"	"c.482A>G"	"r.(?)"	"p.(Glu161Gly)"	""
"0000756899"	"00024043"	"50"	"480"	"0"	"480"	"0"	"c.480A>G"	"r.(?)"	"p.(Ile160Met)"	""
"0000756900"	"00024043"	"50"	"472"	"0"	"472"	"0"	"c.472G>A"	"r.(?)"	"p.(Ala158Thr)"	""
"0000756901"	"00024043"	"50"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.spl?"	"p.?"	""
"0000756902"	"00024043"	"50"	"436"	"0"	"436"	"0"	"c.436A>C"	"r.(?)"	"p.(Ile146Leu)"	""
"0000756903"	"00024043"	"50"	"434"	"0"	"434"	"0"	"c.434G>A"	"r.(?)"	"p.(Arg145Gln)"	""
"0000756904"	"00024043"	"50"	"433"	"0"	"433"	"0"	"c.433C>T"	"r.(?)"	"p.(Arg145Trp)"	""
"0000756905"	"00024043"	"50"	"428"	"0"	"428"	"0"	"c.428A>G"	"r.(?)"	"p.(His143Arg)"	""
"0000756906"	"00024043"	"50"	"410"	"0"	"410"	"0"	"c.410G>A"	"r.(?)"	"p.(Arg137Gln)"	""
"0000756907"	"00024043"	"50"	"409"	"0"	"409"	"0"	"c.409C>T"	"r.(?)"	"p.(Arg137*)"	""
"0000756908"	"00024043"	"50"	"383"	"0"	"383"	"0"	"c.383C>T"	"r.(?)"	"p.(Pro128Leu)"	""
"0000756909"	"00024043"	"50"	"368"	"0"	"368"	"0"	"c.368A>G"	"r.(?)"	"p.(Tyr123Cys)"	""
"0000756910"	"00024043"	"50"	"349"	"0"	"349"	"0"	"c.349A>G"	"r.(?)"	"p.(Arg117Gly)"	""
"0000756911"	"00024043"	"50"	"336"	"0"	"336"	"0"	"c.336C>G"	"r.(?)"	"p.(Asn112Lys)"	""
"0000756912"	"00024043"	"50"	"322"	"0"	"322"	"0"	"c.322T>C"	"r.(?)"	"p.(Cys108Arg)"	""
"0000756913"	"00024043"	"50"	"319"	"2"	"319"	"2"	"c.319+2T>A"	"r.spl?"	"p.?"	""
"0000756914"	"00024043"	"50"	"319"	"0"	"319"	"0"	"c.319G>A"	"r.(?)"	"p.(Glu107Lys)"	""
"0000756915"	"00024043"	"50"	"283"	"0"	"283"	"0"	"c.283C>T"	"r.(?)"	"p.(Arg95*)"	""
"0000756916"	"00024043"	"50"	"269"	"0"	"269"	"0"	"c.269C>T"	"r.(?)"	"p.(Pro90Leu)"	""
"0000756917"	"00024043"	"50"	"256"	"0"	"256"	"0"	"c.256G>C"	"r.(?)"	"p.(Glu86Gln)"	""
"0000756918"	"00024043"	"50"	"254"	"0"	"254"	"0"	"c.254C>T"	"r.(?)"	"p.(Pro85Leu)"	""
"0000756919"	"00024043"	"50"	"254"	"0"	"254"	"0"	"c.254C>G"	"r.(?)"	"p.(Pro85Arg)"	""
"0000756920"	"00024043"	"50"	"239"	"0"	"239"	"0"	"c.239C>A"	"r.(?)"	"p.(Pro80His)"	""
"0000756921"	"00024043"	"50"	"215"	"0"	"215"	"0"	"c.215A>G"	"r.(?)"	"p.(Tyr72Cys)"	""
"0000756922"	"00024043"	"50"	"190"	"0"	"190"	"0"	"c.190G>A"	"r.(?)"	"p.(Glu64Lys)"	""
"0000756923"	"00024043"	"50"	"176"	"0"	"176"	"0"	"c.176C>T"	"r.(?)"	"p.(Thr59Ile)"	""
"0000756924"	"00024043"	"50"	"176"	"0"	"176"	"0"	"c.176C>A"	"r.(?)"	"p.(Thr59Lys)"	""
"0000756925"	"00024043"	"50"	"157"	"0"	"157"	"0"	"c.157T>A"	"r.(?)"	"p.(Ser53Thr)"	""
"0000756926"	"00024043"	"50"	"134"	"0"	"134"	"0"	"c.134C>T"	"r.(?)"	"p.(Thr45Met)"	""
"0000756927"	"00024043"	"50"	"122"	"0"	"122"	"0"	"c.122C>T"	"r.(?)"	"p.(Ser41Phe)"	""
"0000756928"	"00024043"	"50"	"74"	"0"	"74"	"0"	"c.74T>C"	"r.(?)"	"p.(Val25Ala)"	""
"0000756929"	"00024043"	"50"	"73"	"0"	"73"	"0"	"c.73G>A"	"r.(?)"	"p.(Val25Ile)"	""
"0000756930"	"00024043"	"50"	"65"	"0"	"65"	"0"	"c.65A>G"	"r.(?)"	"p.(His22Arg)"	""
"0000756931"	"00024043"	"50"	"19"	"0"	"19"	"0"	"c.19G>A"	"r.(?)"	"p.(Val7Ile)"	""
"0000756932"	"00024043"	"50"	"14"	"0"	"14"	"0"	"c.14C>T"	"r.(?)"	"p.(Ser5Leu)"	""
"0000756933"	"00024043"	"50"	"7"	"0"	"7"	"0"	"c.7C>T"	"r.(?)"	"p.(Arg3Trp)"	""
"0000783227"	"00024043"	"90"	"1368"	"0"	"1368"	"0"	"c.1368dup"	"r.(?)"	"p.(Glu457Argfs*33)"	""
"0000789657"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	"11"
"0000789659"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	"11"
"0000789669"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	"11"
"0000791036"	"00024043"	"50"	"67"	"0"	"67"	"0"	"c.67G>A"	"r.(?)"	"p.(Gly23Ser)"	""
"0000809529"	"00024043"	"50"	"1582"	"0"	"1582"	"0"	"c.1582G>C"	"r.(?)"	"p.(Glu528Gln)"	""
"0000809530"	"00024043"	"50"	"1561"	"0"	"1561"	"0"	"c.1561C>T"	"r.(?)"	"p.(Arg521Trp)"	""
"0000809531"	"00024043"	"30"	"1489"	"0"	"1489"	"0"	"c.1489G>A"	"r.(?)"	"p.(Asp497Asn)"	""
"0000809532"	"00024043"	"50"	"1423"	"0"	"1423"	"0"	"c.1423T>A"	"r.(?)"	"p.(Phe475Ile)"	""
"0000809533"	"00024043"	"50"	"1390"	"0"	"1390"	"0"	"c.1390A>G"	"r.(?)"	"p.(Lys464Glu)"	""
"0000809534"	"00024043"	"90"	"1283"	"0"	"1283"	"0"	"c.1283C>T"	"r.(?)"	"p.(Ser428Phe)"	""
"0000809535"	"00024043"	"50"	"1270"	"0"	"1270"	"0"	"c.1270T>C"	"r.(?)"	"p.(Tyr424His)"	""
"0000809536"	"00024043"	"50"	"1270"	"0"	"1270"	"0"	"c.1270T>C"	"r.(?)"	"p.(Tyr424His)"	""
"0000809539"	"00024043"	"70"	"1182"	"0"	"1182"	"0"	"c.1182A>T"	"r.(?)"	"p.(Glu394Asp)"	""
"0000809540"	"00024043"	"50"	"1178"	"0"	"1178"	"0"	"c.1178C>T"	"r.(?)"	"p.(Pro393Leu)"	""
"0000809541"	"00024043"	"30"	"1176"	"0"	"1176"	"0"	"c.1176G>A"	"r.(?)"	"p.(Ala392=)"	""
"0000809542"	"00024043"	"70"	"1036"	"0"	"1036"	"0"	"c.1036C>T"	"r.(?)"	"p.(Arg346Cys)"	""
"0000809543"	"00024043"	"50"	"1022"	"0"	"1022"	"0"	"c.1022A>C"	"r.(?)"	"p.(Asn341Thr)"	""
"0000809544"	"00024043"	"30"	"909"	"-18"	"909"	"-18"	"c.909-18C>T"	"r.(=)"	"p.(=)"	""
"0000809545"	"00024043"	"50"	"853"	"0"	"853"	"0"	"c.853A>G"	"r.(?)"	"p.(Ile285Val)"	""
"0000809546"	"00024043"	"70"	"846"	"1"	"846"	"1"	"c.846+1G>C"	"r.spl?"	"p.?"	""
"0000809547"	"00024043"	"30"	"792"	"24"	"792"	"24"	"c.792+24C>T"	"r.(=)"	"p.(=)"	""
"0000809548"	"00024043"	"90"	"597"	"0"	"597"	"0"	"c.597del"	"r.(?)"	"p.(Phe199LeufsTer6)"	""
"0000809549"	"00024043"	"50"	"566"	"0"	"566"	"0"	"c.566T>A"	"r.(?)"	"p.(Ile189Asn)"	""
"0000809550"	"00024043"	"50"	"557"	"0"	"557"	"0"	"c.557A>G"	"r.(?)"	"p.(Asn186Ser)"	""
"0000809551"	"00024043"	"50"	"549"	"0"	"549"	"0"	"c.549G>C"	"r.(?)"	"p.(Leu183Phe)"	""
"0000809552"	"00024043"	"50"	"542"	"0"	"542"	"0"	"c.542G>A"	"r.(?)"	"p.(Arg181His)"	""
"0000809553"	"00024043"	"50"	"541"	"0"	"541"	"0"	"c.541C>T"	"r.(?)"	"p.(Arg181Cys)"	""
"0000809554"	"00024043"	"30"	"444"	"24"	"444"	"24"	"c.444+24C>T"	"r.(=)"	"p.(=)"	""
"0000809555"	"00024043"	"70"	"433"	"0"	"433"	"0"	"c.433C>T"	"r.(?)"	"p.(Arg145Trp)"	""
"0000809556"	"00024043"	"10"	"319"	"91"	"319"	"91"	"c.319+91G>A"	"r.(=)"	"p.(=)"	""
"0000809557"	"00024043"	"50"	"293"	"0"	"293"	"0"	"c.293C>T"	"r.(?)"	"p.(Ala98Val)"	""
"0000809558"	"00024043"	"30"	"254"	"0"	"254"	"0"	"c.254C>T"	"r.(?)"	"p.(Pro85Leu)"	""
"0000809559"	"00024043"	"10"	"254"	"0"	"254"	"0"	"c.254C>T"	"r.(?)"	"p.(Pro85Leu)"	""
"0000809560"	"00024043"	"30"	"254"	"0"	"254"	"0"	"c.254C>T"	"r.(?)"	"p.(Pro85Leu)"	""
"0000809561"	"00024043"	"90"	"58"	"0"	"58"	"0"	"c.58C>T"	"r.(?)"	"p.(Gln20*)"	""
"0000830377"	"00024043"	"50"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	"2i_4i"
"0000830378"	"00024043"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	"2i_4i"
"0000830379"	"00024043"	"50"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	"2i_4i"
"0000830380"	"00024043"	"70"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	"1i_2i"
"0000830385"	"00024043"	"50"	"0"	"0"	"0"	"0"	"c.?"	"r.?"	"p.?"	"2i_4i"
"0000833964"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	""
"0000833965"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	""
"0000833966"	"00024043"	"90"	"283"	"0"	"283"	"0"	"c.283C>T"	"r.(?)"	"p.(Arg95Ter)"	""
"0000845078"	"00024043"	"90"	"1111"	"0"	"1111"	"0"	"c.1111C>T"	"r.(?)"	"p.(His371Tyr)"	""
"0000845079"	"00024043"	"90"	"1196"	"0"	"1196"	"0"	"c.1196T>A"	"r.(?)"	"p.(Val399Asp)"	""
"0000845080"	"00024043"	"90"	"1597"	"0"	"1597"	"0"	"c.1597A>G"	"r.(?)"	"p.(Thr533Ala)"	""
"0000845081"	"00024043"	"90"	"538"	"0"	"538"	"0"	"c.538C>T"	"r.(?)"	"p.(Arg180Cys)"	""
"0000856088"	"00024043"	"50"	"1591"	"0"	"1591"	"0"	"c.1591G>T"	"r.(?)"	"p.(Glu531Ter)"	""
"0000856089"	"00024043"	"50"	"1567"	"0"	"1567"	"0"	"c.1567del"	"r.(?)"	"p.(Arg523Valfs*43)"	""
"0000856090"	"00024043"	"50"	"1556"	"0"	"1556"	"0"	"c.1556G>T"	"r.(?)"	"p.(Arg519Leu)"	""
"0000856091"	"00024043"	"90"	"1555"	"0"	"1555"	"0"	"c.1555C>T"	"r.(?)"	"p.(Arg519Ter)"	""
"0000856092"	"00024043"	"50"	"1550"	"0"	"1552"	"0"	"c.1550_1552del"	"r.(?)"	"p.(Thr517del)"	""
"0000856093"	"00024043"	"30"	"1510"	"0"	"1510"	"0"	"c.1510G>C"	"r.(?)"	"p.(Glu504Gln)"	""
"0000856094"	"00024043"	"50"	"1420"	"0"	"1420"	"0"	"c.1420C>T"	"r.(?)"	"p.(Arg474Cys)"	""
"0000856095"	"00024043"	"70"	"1420"	"0"	"1420"	"0"	"c.1420C>T"	"r.(?)"	"p.(Arg474Cys)"	""
"0000856096"	"00024043"	"30"	"1407"	"0"	"1407"	"0"	"c.1407G>A"	"r.(?)"	"p.(Val469=)"	""
"0000856097"	"00024043"	"50"	"1383"	"0"	"1383"	"0"	"c.1383C>G"	"r.(?)"	"p.(Asp461Glu)"	""
"0000856098"	"00024043"	"70"	"1376"	"-1"	"1376"	"-1"	"c.1376-1G>C"	"r.spl?"	"p.?"	""
"0000856099"	"00024043"	"30"	"1375"	"26"	"1375"	"26"	"c.1375+26T>C"	"r.(=)"	"p.(=)"	""
"0000856100"	"00024043"	"30"	"1343"	"0"	"1343"	"0"	"c.1343T>G"	"r.(?)"	"p.(Ile448Ser)"	""
"0000856101"	"00024043"	"50"	"1312"	"0"	"1312"	"0"	"c.1312G>T"	"r.(?)"	"p.(Asp438Tyr)"	""
"0000856102"	"00024043"	"30"	"1287"	"0"	"1287"	"0"	"c.1287G>A"	"r.(?)"	"p.(Glu429=)"	""
"0000856103"	"00024043"	"50"	"1260"	"-8"	"1260"	"-8"	"c.1260-8A>G"	"r.(=)"	"p.(=)"	""
"0000856104"	"00024043"	"30"	"1260"	"-10"	"1260"	"-10"	"c.1260-10C>G"	"r.(=)"	"p.(=)"	""
"0000856105"	"00024043"	"50"	"1243"	"0"	"1243"	"0"	"c.1243G>A"	"r.(?)"	"p.(Val415Ile)"	""
"0000856106"	"00024043"	"50"	"1175"	"0"	"1175"	"0"	"c.1175C>T"	"r.(?)"	"p.(Ala392Val)"	""
"0000856107"	"00024043"	"70"	"1169"	"0"	"1169"	"0"	"c.1169A>G"	"r.(?)"	"p.(Tyr390Cys)"	""
"0000856108"	"00024043"	"50"	"1067"	"0"	"1067"	"0"	"c.1067C>T"	"r.(?)"	"p.(Ser356Leu)"	""
"0000856109"	"00024043"	"70"	"1039"	"0"	"1039"	"0"	"c.1039G>A"	"r.(?)"	"p.(Asp347Asn)"	""
"0000856110"	"00024043"	"30"	"996"	"0"	"996"	"0"	"c.996C>T"	"r.(?)"	"p.(Leu332=)"	""
"0000856111"	"00024043"	"50"	"980"	"0"	"980"	"0"	"c.980A>G"	"r.(?)"	"p.(Tyr327Cys)"	""
"0000856112"	"00024043"	"30"	"909"	"-90"	"909"	"-90"	"c.909-90C>T"	"r.(=)"	"p.(=)"	""
"0000856113"	"00024043"	"50"	"751"	"0"	"751"	"0"	"c.751A>T"	"r.(?)"	"p.(Ile251Phe)"	""
"0000856114"	"00024043"	"30"	"683"	"24"	"683"	"24"	"c.683+24G>A"	"r.(=)"	"p.(=)"	""
"0000856115"	"00024043"	"70"	"592"	"3"	"592"	"3"	"c.592+3A>T"	"r.spl?"	"p.?"	""
"0000856116"	"00024043"	"50"	"538"	"0"	"538"	"0"	"c.538C>T"	"r.(?)"	"p.(Arg180Cys)"	""
"0000856117"	"00024043"	"50"	"507"	"0"	"507"	"0"	"c.507T>G"	"r.(?)"	"p.(Phe169Leu)"	""
"0000856118"	"00024043"	"50"	"494"	"0"	"494"	"0"	"c.494G>A"	"r.(?)"	"p.(Gly165Asp)"	""
"0000856119"	"00024043"	"30"	"468"	"0"	"468"	"0"	"c.468C>T"	"r.(?)"	"p.(Tyr156=)"	""
"0000856120"	"00024043"	"50"	"434"	"0"	"434"	"0"	"c.434G>A"	"r.(?)"	"p.(Arg145Gln)"	""
"0000856121"	"00024043"	"30"	"410"	"0"	"410"	"0"	"c.410G>A"	"r.(?)"	"p.(Arg137Gln)"	""
"0000856122"	"00024043"	"50"	"350"	"0"	"350"	"0"	"c.350G>A"	"r.(?)"	"p.(Arg117Lys)"	""
"0000856123"	"00024043"	"50"	"320"	"-5"	"320"	"-5"	"c.320-5T>A"	"r.spl?"	"p.?"	""
"0000856124"	"00024043"	"50"	"115"	"0"	"115"	"0"	"c.115T>C"	"r.(?)"	"p.(Ser39Pro)"	""
"0000856125"	"00024043"	"90"	"78"	"0"	"79"	"0"	"c.78_79del"	"r.(?)"	"p.(Gln27Valfs*49)"	""
"0000856126"	"00024043"	"90"	"58"	"0"	"58"	"0"	"c.58C>T"	"r.(?)"	"p.(Gln20*)"	""
"0000866762"	"00024043"	"30"	"1604"	"0"	"1604"	"0"	"c.1604G>A"	"r.(?)"	"p.(Arg535His)"	""
"0000866763"	"00024043"	"50"	"1561"	"0"	"1561"	"0"	"c.1561C>T"	"r.(?)"	"p.(Arg521Trp)"	""
"0000866764"	"00024043"	"50"	"1556"	"0"	"1556"	"0"	"c.1556G>T"	"r.(?)"	"p.(Arg519Leu)"	""
"0000866765"	"00024043"	"50"	"1556"	"0"	"1556"	"0"	"c.1556G>A"	"r.(?)"	"p.(Arg519Gln)"	""
"0000866766"	"00024043"	"30"	"1497"	"0"	"1497"	"0"	"c.1497G>C"	"r.(?)"	"p.(Leu499=)"	""
"0000866767"	"00024043"	"50"	"1470"	"0"	"1470"	"0"	"c.1470C>A"	"r.(?)"	"p.(Asp490Glu)"	""
"0000866768"	"00024043"	"30"	"1441"	"0"	"1441"	"0"	"c.1441T>C"	"r.(?)"	"p.(Leu481=)"	""
"0000866769"	"00024043"	"50"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	""
"0000866770"	"00024043"	"50"	"1376"	"-12"	"1376"	"-12"	"c.1376-12T>C"	"r.(=)"	"p.(=)"	""
"0000866771"	"00024043"	"30"	"1343"	"0"	"1343"	"0"	"c.1343T>G"	"r.(?)"	"p.(Ile448Ser)"	""
"0000866772"	"00024043"	"50"	"1283"	"0"	"1283"	"0"	"c.1283C>T"	"r.(?)"	"p.(Ser428Phe)"	""
"0000866773"	"00024043"	"50"	"1283"	"0"	"1283"	"0"	"c.1283C>T"	"r.(?)"	"p.(Ser428Phe)"	""
"0000866774"	"00024043"	"50"	"1265"	"0"	"1265"	"0"	"c.1265G>A"	"r.(?)"	"p.(Ser422Asn)"	""
"0000866775"	"00024043"	"50"	"1260"	"-8"	"1260"	"-8"	"c.1260-8A>G"	"r.(=)"	"p.(=)"	""
"0000866776"	"00024043"	"50"	"1216"	"0"	"1216"	"0"	"c.1216C>T"	"r.(?)"	"p.(Arg406Cys)"	""
"0000866778"	"00024043"	"50"	"1096"	"-6"	"1096"	"-6"	"c.1096-6T>G"	"r.(=)"	"p.(=)"	""
"0000866779"	"00024043"	"30"	"1095"	"19"	"1095"	"19"	"c.1095+19G>A"	"r.(=)"	"p.(=)"	""
"0000866780"	"00024043"	"50"	"1076"	"0"	"1076"	"0"	"c.1076A>G"	"r.(?)"	"p.(Glu359Gly)"	""
"0000866781"	"00024043"	"90"	"1072"	"0"	"1072"	"0"	"c.1072C>T"	"r.(?)"	"p.(Gln358*)"	""
"0000866782"	"00024043"	"90"	"1072"	"0"	"1072"	"0"	"c.1072C>T"	"r.(?)"	"p.(Gln358*)"	""
"0000866783"	"00024043"	"50"	"1053"	"0"	"1053"	"0"	"c.1053G>T"	"r.(?)"	"p.(Glu351Asp)"	""
"0000866784"	"00024043"	"50"	"983"	"0"	"983"	"0"	"c.983T>C"	"r.(?)"	"p.(Phe328Ser)"	""
"0000866785"	"00024043"	"50"	"973"	"0"	"973"	"0"	"c.973A>G"	"r.(?)"	"p.(Lys325Glu)"	""
"0000866786"	"00024043"	"50"	"906"	"0"	"906"	"0"	"c.906A>C"	"r.(?)"	"p.(Glu302Asp)"	""
"0000866787"	"00024043"	"50"	"727"	"0"	"727"	"0"	"c.727T>C"	"r.(?)"	"p.(Cys243Arg)"	""
"0000866788"	"00024043"	"50"	"682"	"0"	"682"	"0"	"c.682A>G"	"r.(?)"	"p.(Ser228Gly)"	""
"0000866789"	"00024043"	"50"	"578"	"0"	"578"	"0"	"c.578T>C"	"r.(?)"	"p.(Leu193Pro)"	""
"0000866790"	"00024043"	"50"	"538"	"0"	"538"	"0"	"c.538C>T"	"r.(?)"	"p.(Arg180Cys)"	""
"0000866791"	"00024043"	"50"	"507"	"0"	"507"	"0"	"c.507T>G"	"r.(?)"	"p.(Phe169Leu)"	""
"0000866792"	"00024043"	"70"	"499"	"0"	"499"	"0"	"c.499G>A"	"r.(?)"	"p.(Gly167Arg)"	""
"0000866793"	"00024043"	"70"	"499"	"0"	"499"	"0"	"c.499G>A"	"r.(?)"	"p.(Gly167Arg)"	""
"0000866794"	"00024043"	"70"	"483"	"0"	"485"	"0"	"c.483_485del"	"r.(?)"	"p.(Glu161del)"	""
"0000866795"	"00024043"	"50"	"480"	"0"	"480"	"0"	"c.480A>G"	"r.(?)"	"p.(Ile160Met)"	""
"0000866796"	"00024043"	"50"	"480"	"0"	"480"	"0"	"c.480A>G"	"r.(?)"	"p.(Ile160Met)"	""
"0000866798"	"00024043"	"30"	"445"	"-10"	"445"	"-10"	"c.445-10T>C"	"r.(=)"	"p.(=)"	""
"0000866799"	"00024043"	"30"	"444"	"20"	"444"	"20"	"c.444+20G>T"	"r.(=)"	"p.(=)"	""
"0000866800"	"00024043"	"30"	"444"	"19"	"444"	"19"	"c.444+19T>C"	"r.(=)"	"p.(=)"	""
"0000866801"	"00024043"	"90"	"409"	"0"	"409"	"0"	"c.409C>T"	"r.(?)"	"p.(Arg137*)"	""
"0000866802"	"00024043"	"50"	"239"	"0"	"239"	"0"	"c.239C>A"	"r.(?)"	"p.(Pro80His)"	""
"0000866803"	"00024043"	"30"	"215"	"0"	"215"	"0"	"c.215A>G"	"r.(?)"	"p.(Tyr72Cys)"	""
"0000866804"	"00024043"	"50"	"115"	"0"	"115"	"0"	"c.115T>C"	"r.(?)"	"p.(Ser39Pro)"	""
"0000866805"	"00024043"	"90"	"58"	"0"	"58"	"0"	"c.58C>T"	"r.(?)"	"p.(Gln20*)"	""
"0000866806"	"00024043"	"50"	"19"	"0"	"19"	"0"	"c.19G>A"	"r.(?)"	"p.(Val7Ile)"	""
"0000866807"	"00024043"	"30"	"19"	"0"	"19"	"0"	"c.19G>A"	"r.(?)"	"p.(Val7Ile)"	""
"0000866808"	"00024043"	"30"	"14"	"0"	"14"	"0"	"c.14C>T"	"r.(?)"	"p.(Ser5Leu)"	""
"0000869111"	"00024043"	"90"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.spl"	"p.?"	""
"0000869112"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	""
"0000895631"	"00024043"	"50"	"1562"	"0"	"1562"	"0"	"c.1562G>A"	"r.(?)"	"p.(Arg521Gln)"	""
"0000895632"	"00024043"	"30"	"1556"	"0"	"1556"	"0"	"c.1556G>A"	"r.(?)"	"p.(Arg519Gln)"	""
"0000895633"	"00024043"	"50"	"1455"	"0"	"1455"	"0"	"c.1455G>T"	"r.(?)"	"p.(Trp485Cys)"	""
"0000895634"	"00024043"	"30"	"1428"	"0"	"1428"	"0"	"c.1428G>A"	"r.(?)"	"p.(Thr476=)"	""
"0000895635"	"00024043"	"70"	"1421"	"0"	"1421"	"0"	"c.1421G>A"	"r.(?)"	"p.(Arg474His)"	""
"0000895636"	"00024043"	"70"	"1421"	"0"	"1421"	"0"	"c.1421G>A"	"r.(?)"	"p.(Arg474His)"	""
"0000895637"	"00024043"	"30"	"1407"	"0"	"1407"	"0"	"c.1407G>A"	"r.(?)"	"p.(Val469=)"	""
"0000895638"	"00024043"	"50"	"1383"	"0"	"1383"	"0"	"c.1383C>G"	"r.(?)"	"p.(Asp461Glu)"	""
"0000895639"	"00024043"	"30"	"1287"	"0"	"1287"	"0"	"c.1287G>A"	"r.(?)"	"p.(Glu429=)"	""
"0000895640"	"00024043"	"50"	"1270"	"0"	"1270"	"0"	"c.1270T>C"	"r.(?)"	"p.(Tyr424His)"	""
"0000895641"	"00024043"	"50"	"1244"	"0"	"1244"	"0"	"c.1244T>A"	"r.(?)"	"p.(Val415Asp)"	""
"0000895642"	"00024043"	"70"	"1234"	"0"	"1234"	"0"	"c.1234A>C"	"r.(?)"	"p.(Ser412Arg)"	""
"0000895643"	"00024043"	"50"	"1231"	"0"	"1231"	"0"	"c.1231T>A"	"r.(?)"	"p.(Trp411Arg)"	""
"0000895644"	"00024043"	"70"	"1169"	"0"	"1169"	"0"	"c.1169A>C"	"r.(?)"	"p.(Tyr390Ser)"	""
"0000895645"	"00024043"	"50"	"1160"	"0"	"1160"	"0"	"c.1160C>G"	"r.(?)"	"p.(Thr387Ser)"	""
"0000895646"	"00024043"	"90"	"1072"	"0"	"1072"	"0"	"c.1072C>T"	"r.(?)"	"p.(Gln358*)"	""
"0000895647"	"00024043"	"70"	"1039"	"0"	"1039"	"0"	"c.1039G>A"	"r.(?)"	"p.(Asp347Asn)"	""
"0000895648"	"00024043"	"50"	"1036"	"0"	"1036"	"0"	"c.1036C>A"	"r.(?)"	"p.(Arg346Ser)"	""
"0000895649"	"00024043"	"30"	"1023"	"0"	"1023"	"0"	"c.1023C>T"	"r.(?)"	"p.(Asn341=)"	""
"0000895650"	"00024043"	"50"	"1022"	"0"	"1022"	"0"	"c.1022A>C"	"r.(?)"	"p.(Asn341Thr)"	""
"0000895651"	"00024043"	"30"	"996"	"0"	"996"	"0"	"c.996C>T"	"r.(?)"	"p.(Leu332=)"	""
"0000895652"	"00024043"	"30"	"969"	"0"	"969"	"0"	"c.969C>G"	"r.(?)"	"p.(Thr323=)"	""
"0000895653"	"00024043"	"50"	"917"	"0"	"917"	"0"	"c.917G>T"	"r.(?)"	"p.(Gly306Val)"	""
"0000895654"	"00024043"	"50"	"915"	"0"	"915"	"0"	"c.915A>C"	"r.(?)"	"p.(Glu305Asp)"	""
"0000895655"	"00024043"	"50"	"902"	"0"	"902"	"0"	"c.902T>G"	"r.(?)"	"p.(Leu301Trp)"	""
"0000895656"	"00024043"	"30"	"793"	"-4"	"793"	"-4"	"c.793-4A>G"	"r.spl?"	"p.?"	""
"0000895657"	"00024043"	"50"	"751"	"0"	"751"	"0"	"c.751A>T"	"r.(?)"	"p.(Ile251Phe)"	""
"0000895658"	"00024043"	"50"	"692"	"0"	"692"	"0"	"c.692G>A"	"r.(?)"	"p.(Cys231Tyr)"	""
"0000895659"	"00024043"	"30"	"684"	"-20"	"684"	"-20"	"c.684-20A>G"	"r.(=)"	"p.(=)"	""
"0000895660"	"00024043"	"50"	"598"	"0"	"603"	"0"	"c.598_603del"	"r.(?)"	"p.(Val200_Phe201del)"	""
"0000895661"	"00024043"	"90"	"592"	"3"	"592"	"3"	"c.592+3A>T"	"r.spl?"	"p.?"	""
"0000895662"	"00024043"	"50"	"557"	"0"	"557"	"0"	"c.557A>G"	"r.(?)"	"p.(Asn186Ser)"	""
"0000895663"	"00024043"	"30"	"556"	"0"	"556"	"0"	"c.556A>C"	"r.(?)"	"p.(Asn186His)"	""
"0000895664"	"00024043"	"90"	"283"	"0"	"283"	"0"	"c.283C>T"	"r.(?)"	"p.(Arg95Ter)"	""
"0000895665"	"00024043"	"90"	"216"	"0"	"216"	"0"	"c.216T>G"	"r.(?)"	"p.(Tyr72*)"	""
"0000895666"	"00024043"	"30"	"120"	"0"	"120"	"0"	"c.120C>T"	"r.(?)"	"p.(Ser40=)"	""
"0000895667"	"00024043"	"90"	"98"	"0"	"98"	"0"	"c.98C>G"	"r.(?)"	"p.(Ser33*)"	""
"0000895668"	"00024043"	"30"	"14"	"0"	"14"	"0"	"c.14C>T"	"r.(?)"	"p.(Ser5Leu)"	""
"0000895669"	"00024043"	"50"	"14"	"0"	"14"	"0"	"c.14C>T"	"r.(?)"	"p.(Ser5Leu)"	""
"0000895670"	"00024043"	"50"	"8"	"0"	"8"	"0"	"c.8G>T"	"r.(?)"	"p.(Arg3Leu)"	""
"0000915500"	"00024043"	"30"	"1470"	"0"	"1470"	"0"	"c.1470C>A"	"r.(?)"	"p.(Asp490Glu)"	""
"0000915501"	"00024043"	"90"	"1375"	"2"	"1375"	"2"	"c.1375+2T>G"	"r.spl?"	"p.?"	""
"0000915502"	"00024043"	"70"	"1175"	"0"	"1175"	"0"	"c.1175C>T"	"r.(?)"	"p.(Ala392Val)"	""
"0000915503"	"00024043"	"90"	"1111"	"0"	"1127"	"0"	"c.1111_1127del"	"r.(?)"	"p.(His371Argfs*18)"	""
"0000915505"	"00024043"	"50"	"1053"	"0"	"1053"	"0"	"c.1053G>T"	"r.(?)"	"p.(Glu351Asp)"	""
"0000915506"	"00024043"	"30"	"1008"	"23"	"1008"	"23"	"c.1008+23T>A"	"r.(=)"	"p.(=)"	""
"0000915507"	"00024043"	"50"	"1008"	"0"	"1008"	"0"	"c.1008G>A"	"r.(?)"	"p.(Gln336=)"	""
"0000915508"	"00024043"	"50"	"904"	"0"	"904"	"0"	"c.904G>A"	"r.(?)"	"p.(Glu302Lys)"	""
"0000915509"	"00024043"	"30"	"792"	"39"	"792"	"39"	"c.792+39C>T"	"r.(=)"	"p.(=)"	""
"0000915510"	"00024043"	"50"	"593"	"-11"	"593"	"-7"	"c.593-11_593-7del"	"r.(=)"	"p.(=)"	""
"0000915511"	"00024043"	"70"	"592"	"3"	"592"	"3"	"c.592+3A>T"	"r.spl?"	"p.?"	""
"0000915512"	"00024043"	"50"	"541"	"0"	"541"	"0"	"c.541C>T"	"r.(?)"	"p.(Arg181Cys)"	""
"0000915513"	"00024043"	"30"	"538"	"0"	"538"	"0"	"c.538C>T"	"r.(?)"	"p.(Arg180Cys)"	""
"0000915514"	"00024043"	"50"	"520"	"0"	"520"	"0"	"c.520C>T"	"r.(?)"	"p.(Leu174Phe)"	""
"0000915515"	"00024043"	"30"	"444"	"24"	"444"	"24"	"c.444+24C>T"	"r.(=)"	"p.(=)"	""
"0000915516"	"00024043"	"90"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.spl?"	"p.?"	""
"0000915517"	"00024043"	"50"	"190"	"0"	"190"	"0"	"c.190G>A"	"r.(?)"	"p.(Glu64Lys)"	""
"0000915518"	"00024043"	"90"	"56"	"0"	"56"	"0"	"c.56C>G"	"r.(?)"	"p.(Ser19*)"	""
"0000915519"	"00024043"	"30"	"-6"	"-33"	"-6"	"-33"	"c.-6-33C>T"	"r.(=)"	"p.(=)"	""
"0000918150"	"00024043"	"90"	"793"	"-1"	"793"	"-1"	"c.793-1G>A"	"r.spl"	"p.?"	""
"0000920184"	"00024043"	"90"	"470"	"0"	"470"	"0"	"c.470T>C"	"r.(?)"	"p.(Ile157Thr)"	""
"0000920371"	"00024043"	"90"	"319"	"2"	"319"	"2"	"c.319+2T>A"	"r.spl"	"p.?"	""
"0000920373"	"00024043"	"90"	"847"	"-1"	"847"	"-1"	"c.847-1G>T"	"r.spl"	"p.?"	""
"0000920383"	"00024043"	"90"	"1427"	"0"	"1427"	"0"	"c.1427C>T"	"r.(?)"	"p.(Thr476Met)"	""
"0000920390"	"00024043"	"90"	"470"	"0"	"470"	"0"	"c.470T>C"	"r.(?)"	"p.(Ile157Thr)"	""
"0000920395"	"00024043"	"90"	"1111"	"0"	"1127"	"0"	"c.1111_1127dup"	"r.(?)"	"p.(Glu377Thrfs*11)"	""
"0000927126"	"00024043"	"50"	"1630"	"0"	"1630"	"0"	"c.1630T>C"	"r.(?)"	"p.(*544Argext*48)"	""
"0000927127"	"00024043"	"30"	"1567"	"0"	"1567"	"0"	"c.1567C>T"	"r.(?)"	"p.(Arg523Cys)"	""
"0000927128"	"00024043"	"50"	"1460"	"0"	"1460"	"0"	"c.1460A>G"	"r.(?)"	"p.(Gln487Arg)"	""
"0000927129"	"00024043"	"50"	"1453"	"0"	"1453"	"0"	"c.1453T>G"	"r.(?)"	"p.(Trp485Gly)"	""
"0000927130"	"00024043"	"50"	"1375"	"0"	"1375"	"0"	"c.1375G>T"	"r.(?)"	"p.(Ala459Ser)"	""
"0000927131"	"00024043"	"90"	"1232"	"0"	"1232"	"0"	"c.1232G>A"	"r.(?)"	"p.(Trp411*)"	""
"0000927132"	"00024043"	"50"	"1216"	"0"	"1216"	"0"	"c.1216C>T"	"r.(?)"	"p.(Arg406Cys)"	""
"0000927133"	"00024043"	"30"	"1095"	"19"	"1095"	"19"	"c.1095+19G>A"	"r.(=)"	"p.(=)"	""
"0000927134"	"00024043"	"50"	"1033"	"0"	"1033"	"0"	"c.1033C>T"	"r.(?)"	"p.(His345Tyr)"	""
"0000927135"	"00024043"	"50"	"908"	"0"	"908"	"0"	"c.908T>G"	"r.(?)"	"p.(Leu303Trp)"	""
"0000927136"	"00024043"	"50"	"848"	"0"	"848"	"0"	"c.848C>A"	"r.(?)"	"p.(Pro283His)"	""
"0000927137"	"00024043"	"30"	"847"	"-17"	"847"	"-17"	"c.847-17T>C"	"r.(=)"	"p.(=)"	""
"0000927138"	"00024043"	"70"	"792"	"2"	"792"	"2"	"c.792+2T>C"	"r.spl?"	"p.?"	""
"0000927139"	"00024043"	"50"	"740"	"0"	"740"	"0"	"c.740C>A"	"r.(?)"	"p.(Ala247Asp)"	""
"0000927140"	"00024043"	"90"	"733"	"0"	"733"	"0"	"c.733A>T"	"r.(?)"	"p.(Lys245*)"	""
"0000927141"	"00024043"	"50"	"663"	"0"	"663"	"0"	"c.663C>G"	"r.(?)"	"p.(Ile221Met)"	""
"0000927142"	"00024043"	"90"	"629"	"0"	"632"	"0"	"c.629_632del"	"r.(?)"	"p.(Ser210Phefs*6)"	""
"0000927143"	"00024043"	"50"	"480"	"0"	"480"	"0"	"c.480A>G"	"r.(?)"	"p.(Ile160Met)"	""
"0000927144"	"00024043"	"30"	"474"	"0"	"474"	"0"	"c.474A>C"	"r.(?)"	"p.(Ala158=)"	""
"0000927145"	"00024043"	"50"	"451"	"0"	"451"	"0"	"c.451G>T"	"r.(?)"	"p.(Gly151Cys)"	""
"0000927146"	"00024043"	"30"	"444"	"19"	"444"	"19"	"c.444+19T>C"	"r.(=)"	"p.(=)"	""
"0000927147"	"00024043"	"50"	"422"	"0"	"422"	"0"	"c.422A>C"	"r.(?)"	"p.(Lys141Thr)"	""
"0000927148"	"00024043"	"30"	"254"	"0"	"254"	"0"	"c.254C>T"	"r.(?)"	"p.(Pro85Leu)"	""
"0000927149"	"00024043"	"90"	"216"	"0"	"216"	"0"	"c.216T>G"	"r.(?)"	"p.(Tyr72*)"	""
"0000931258"	"00024043"	"30"	"1597"	"0"	"1597"	"0"	"c.1597A>G"	"r.(?)"	"p.(Thr533Ala)"	""
"0000931259"	"00024043"	"70"	"1555"	"0"	"1555"	"0"	"c.1555C>T"	"r.(?)"	"p.(Arg519Ter)"	""
"0000931260"	"00024043"	"30"	"1501"	"0"	"1501"	"0"	"c.1501G>A"	"r.(?)"	"p.(Glu501Lys)"	""
"0000931261"	"00024043"	"30"	"1489"	"0"	"1489"	"0"	"c.1489G>A"	"r.(?)"	"p.(Asp497Asn)"	""
"0000931262"	"00024043"	"50"	"1456"	"0"	"1456"	"0"	"c.1456C>T"	"r.(?)"	"p.(Leu486Phe)"	""
"0000931263"	"00024043"	"70"	"1417"	"0"	"1428"	"0"	"c.1417_1428del"	"r.(?)"	"p.(Ala473_Thr476del)"	""
"0000931264"	"00024043"	"70"	"1376"	"-1"	"1376"	"-1"	"c.1376-1G>C"	"r.spl?"	"p.?"	""
"0000931265"	"00024043"	"50"	"1351"	"0"	"1351"	"0"	"c.1351G>A"	"r.(?)"	"p.(Val451Ile)"	""
"0000931266"	"00024043"	"50"	"1180"	"0"	"1180"	"0"	"c.1180G>A"	"r.(?)"	"p.(Glu394Lys)"	""
"0000931267"	"00024043"	"90"	"1111"	"0"	"1127"	"0"	"c.1111_1127del"	"r.(?)"	"p.(His371Argfs*18)"	""
"0000931268"	"00024043"	"50"	"1003"	"0"	"1003"	"0"	"c.1003G>C"	"r.(?)"	"p.(Val335Leu)"	""
"0000931269"	"00024043"	"30"	"538"	"0"	"538"	"0"	"c.538C>T"	"r.(?)"	"p.(Arg180Cys)"	""
"0000931271"	"00024043"	"50"	"8"	"0"	"8"	"0"	"c.8G>T"	"r.(?)"	"p.(Arg3Leu)"	""
"0000935185"	"00024043"	"90"	"793"	"-1"	"793"	"-1"	"c.793-1G>A"	"r.spl"	"p.?"	""
"0000951563"	"00024043"	"50"	"1556"	"0"	"1556"	"0"	"c.1556G>T"	"r.(?)"	"p.(Arg519Leu)"	""
"0000951564"	"00024043"	"50"	"1555"	"0"	"1555"	"0"	"c.1555C>T"	"r.(?)"	"p.(Arg519Ter)"	""
"0000951565"	"00024043"	"70"	"1543"	"-9"	"1546"	"0"	"c.1543-9_1546del"	"r.spl?"	"p.?"	""
"0000951566"	"00024043"	"70"	"1461"	"5"	"1461"	"5"	"c.1461+5G>A"	"r.spl?"	"p.?"	""
"0000951567"	"00024043"	"90"	"1170"	"0"	"1170"	"0"	"c.1170C>A"	"r.(?)"	"p.(Tyr390*)"	""
"0000951568"	"00024043"	"50"	"1154"	"0"	"1154"	"0"	"c.1154G>A"	"r.(?)"	"p.(Cys385Tyr)"	""
"0000951569"	"00024043"	"50"	"861"	"0"	"861"	"0"	"c.861G>T"	"r.(?)"	"p.(Lys287Asn)"	""
"0000951570"	"00024043"	"70"	"846"	"1"	"846"	"1"	"c.846+1G>C"	"r.spl?"	"p.?"	""
"0000951571"	"00024043"	"50"	"727"	"0"	"727"	"0"	"c.727T>C"	"r.(?)"	"p.(Cys243Arg)"	""
"0000951572"	"00024043"	"90"	"597"	"0"	"597"	"0"	"c.597del"	"r.(?)"	"p.(Phe199LeufsTer6)"	""
"0000951573"	"00024043"	"10"	"593"	"-14"	"593"	"-14"	"c.593-14C>T"	"r.(=)"	"p.(=)"	""
"0000951574"	"00024043"	"90"	"528"	"0"	"528"	"0"	"c.528del"	"r.(?)"	"p.(Gly178Glufs*6)"	""
"0000951575"	"00024043"	"50"	"478"	"0"	"478"	"0"	"c.478A>G"	"r.(?)"	"p.(Ile160Val)"	""
"0000951576"	"00024043"	"50"	"476"	"0"	"476"	"0"	"c.476A>G"	"r.(?)"	"p.(Tyr159Cys)"	""
"0000951577"	"00024043"	"50"	"473"	"0"	"473"	"0"	"c.473C>T"	"r.(?)"	"p.(Ala158Val)"	""
"0000951578"	"00024043"	"90"	"283"	"0"	"283"	"0"	"c.283C>T"	"r.(?)"	"p.(Arg95Ter)"	""
"0000951579"	"00024043"	"90"	"151"	"0"	"151"	"0"	"c.151C>T"	"r.(?)"	"p.(Gln51*)"	""
"0000951580"	"00024043"	"50"	"123"	"0"	"125"	"0"	"c.123_125del"	"r.(?)"	"p.(Ser42del)"	""
"0000951581"	"00024043"	"90"	"58"	"0"	"58"	"0"	"c.58C>T"	"r.(?)"	"p.(Gln20*)"	""
"0000951915"	"00024043"	"90"	"616"	"0"	"617"	"0"	"c.616_617del"	"r.(?)"	"p.(Val206Argfs*2)"	""
"0000952207"	"00024043"	"90"	"1188"	"0"	"1188"	"0"	"c.1188del"	"r.(?)"	"p.(Val397Phefs*17)"	""
"0000952208"	"00024043"	"90"	"616"	"0"	"617"	"0"	"c.616_617del"	"r.(?)"	"p.(Val206Argfs*2)"	""
"0000970430"	"00024043"	"30"	"1650"	"0"	"1650"	"0"	"c.*18C>T"	"r.(=)"	"p.(=)"	""
"0000970431"	"00024043"	"30"	"1552"	"0"	"1552"	"0"	"c.1552A>C"	"r.(?)"	"p.(Ser518Arg)"	""
"0000970432"	"00024043"	"30"	"1428"	"0"	"1428"	"0"	"c.1428G>A"	"r.(?)"	"p.(Thr476=)"	""
"0000970433"	"00024043"	"30"	"1352"	"0"	"1352"	"0"	"c.1352T>C"	"r.(?)"	"p.(Val451Ala)"	""
"0000970434"	"00024043"	"50"	"1316"	"0"	"1316"	"0"	"c.1316A>G"	"r.(?)"	"p.(Gln439Arg)"	""
"0000970435"	"00024043"	"50"	"1265"	"0"	"1265"	"0"	"c.1265G>A"	"r.(?)"	"p.(Ser422Asn)"	""
"0000970436"	"00024043"	"30"	"1259"	"16"	"1259"	"16"	"c.1259+16A>G"	"r.(=)"	"p.(=)"	""
"0000970437"	"00024043"	"70"	"1169"	"0"	"1169"	"0"	"c.1169A>G"	"r.(?)"	"p.(Tyr390Cys)"	""
"0000970438"	"00024043"	"70"	"1169"	"0"	"1169"	"0"	"c.1169A>C"	"r.(?)"	"p.(Tyr390Ser)"	""
"0000970440"	"00024043"	"50"	"1082"	"0"	"1082"	"0"	"c.1082A>G"	"r.(?)"	"p.(Asp361Gly)"	""
"0000970441"	"00024043"	"70"	"1039"	"0"	"1039"	"0"	"c.1039G>A"	"r.(?)"	"p.(Asp347Asn)"	""
"0000970442"	"00024043"	"70"	"1037"	"0"	"1037"	"0"	"c.1037G>A"	"r.(?)"	"p.(Arg346His)"	""
"0000970443"	"00024043"	"50"	"1022"	"0"	"1022"	"0"	"c.1022A>C"	"r.(?)"	"p.(Asn341Thr)"	""
"0000970444"	"00024043"	"10"	"1008"	"192"	"1008"	"192"	"c.1008+192T>C"	"r.(=)"	"p.(=)"	""
"0000970445"	"00024043"	"50"	"847"	"0"	"847"	"0"	"c.847C>T"	"r.(?)"	"p.(Pro283Ser)"	""
"0000970446"	"00024043"	"30"	"847"	"-17"	"847"	"-17"	"c.847-17T>C"	"r.(=)"	"p.(=)"	""
"0000970447"	"00024043"	"70"	"846"	"4"	"846"	"7"	"c.846+4_846+7del"	"r.spl?"	"p.?"	""
"0000970448"	"00024043"	"50"	"746"	"0"	"746"	"0"	"c.746A>G"	"r.(?)"	"p.(Lys249Arg)"	""
"0000970450"	"00024043"	"50"	"503"	"0"	"503"	"0"	"c.503C>T"	"r.(?)"	"p.(Thr168Ile)"	""
"0000970451"	"00024043"	"50"	"401"	"0"	"401"	"0"	"c.401A>G"	"r.(?)"	"p.(Asp134Gly)"	""
"0000970452"	"00024043"	"50"	"341"	"0"	"341"	"0"	"c.341G>T"	"r.(?)"	"p.(Trp114Leu)"	""
"0000970453"	"00024043"	"30"	"308"	"0"	"308"	"0"	"c.308T>A"	"r.(?)"	"p.(Phe103Tyr)"	""
"0000970455"	"00024043"	"50"	"158"	"0"	"158"	"0"	"c.158C>G"	"r.(?)"	"p.(Ser53Cys)"	""
"0000970456"	"00024043"	"50"	"61"	"0"	"61"	"0"	"c.61C>T"	"r.(?)"	"p.(Pro21Ser)"	""
"0000972036"	"00024043"	"70"	"444"	"1"	"444"	"1"	"c.444+1G>A"	"r.(?)"	"p.(?)"	""
"0000984169"	"00024043"	"30"	"1542"	"77"	"1542"	"77"	"c.1542+77T>C"	"r.(=)"	"p.(=)"	""
"0000984170"	"00024043"	"30"	"1410"	"0"	"1410"	"0"	"c.1410T>C"	"r.(?)"	"p.(=)"	""
"0000984171"	"00024043"	"50"	"1376"	"-26"	"1376"	"-15"	"c.1376-26_1376-15del"	"r.(=)"	"p.(=)"	""
"0000984172"	"00024043"	"50"	"1336"	"0"	"1336"	"0"	"c.1336A>G"	"r.(?)"	"p.(Asn446Asp)"	""
"0000984173"	"00024043"	"90"	"1084"	"0"	"1085"	"0"	"c.1084_1085insTT"	"r.(?)"	"p.(Cys362Phefs*4)"	""
"0000984174"	"00024043"	"50"	"977"	"0"	"977"	"0"	"c.977T>C"	"r.(?)"	"p.(Leu326Pro)"	""
"0000984175"	"00024043"	"30"	"918"	"0"	"918"	"0"	"c.918G>C"	"r.(?)"	"p.(=)"	""
"0000984176"	"00024043"	"30"	"847"	"-17"	"847"	"-17"	"c.847-17T>C"	"r.(=)"	"p.(=)"	""
"0000984177"	"00024043"	"30"	"598"	"0"	"598"	"0"	"c.598G>A"	"r.(?)"	"p.(Val200Ile)"	""
"0000984178"	"00024043"	"10"	"593"	"-14"	"593"	"-14"	"c.593-14C>T"	"r.(=)"	"p.(=)"	""
"0000984179"	"00024043"	"50"	"539"	"0"	"539"	"0"	"c.539G>A"	"r.(?)"	"p.(Arg180His)"	""
"0000984180"	"00024043"	"50"	"401"	"0"	"401"	"0"	"c.401A>G"	"r.(?)"	"p.(Asp134Gly)"	""
"0000984181"	"00024043"	"30"	"348"	"0"	"348"	"0"	"c.348G>A"	"r.(?)"	"p.(=)"	""
"0001005983"	"00024043"	"50"	"1543"	"-9"	"1546"	"0"	"c.1543-9_1546del"	"r.spl?"	"p.?"	""
"0001005984"	"00024043"	"70"	"1417"	"0"	"1428"	"0"	"c.1417_1428del"	"r.(?)"	"p.(Ala473_Thr476del)"	""
"0001005985"	"00024043"	"70"	"1421"	"0"	"1421"	"0"	"c.1421G>A"	"r.(?)"	"p.(Arg474His)"	""
"0001005986"	"00024043"	"30"	"1407"	"0"	"1407"	"0"	"c.1407G>A"	"r.(?)"	"p.(Val469=)"	""
"0001005987"	"00024043"	"90"	"1279"	"0"	"1280"	"0"	"c.1279_1280insC"	"r.(?)"	"p.(Phe427Serfs*3)"	""
"0001005988"	"00024043"	"90"	"1263"	"0"	"1263"	"0"	"c.1263del"	"r.(?)"	"p.(Ser422Valfs*15)"	""
"0001005989"	"00024043"	"50"	"1204"	"0"	"1204"	"0"	"c.1204G>A"	"r.(?)"	"p.(Ala402Thr)"	""
"0001005990"	"00024043"	"70"	"1169"	"0"	"1169"	"0"	"c.1169A>G"	"r.(?)"	"p.(Tyr390Cys)"	""
"0001005991"	"00024043"	"50"	"1091"	"0"	"1091"	"0"	"c.1091T>C"	"r.(?)"	"p.(Ile364Thr)"	""
"0001005992"	"00024043"	"50"	"1051"	"0"	"1051"	"0"	"c.1051G>A"	"r.(?)"	"p.(Glu351Lys)"	""
"0001005993"	"00024043"	"70"	"1037"	"0"	"1037"	"0"	"c.1037G>A"	"r.(?)"	"p.(Arg346His)"	""
"0001005994"	"00024043"	"70"	"1036"	"0"	"1036"	"0"	"c.1036C>T"	"r.(?)"	"p.(Arg346Cys)"	""
"0001005995"	"00024043"	"50"	"1022"	"0"	"1022"	"0"	"c.1022A>C"	"r.(?)"	"p.(Asn341Thr)"	""
"0001005996"	"00024043"	"50"	"593"	"-11"	"593"	"-7"	"c.593-11_593-7del"	"r.(=)"	"p.(=)"	""
"0001005997"	"00024043"	"30"	"593"	"-2130"	"593"	"-2130"	"c.593-2130C>T"	"r.(=)"	"p.(=)"	""
"0001005998"	"00024043"	"30"	"593"	"-2152"	"593"	"-2152"	"c.593-2152dup"	"r.(=)"	"p.(=)"	""
"0001005999"	"00024043"	"50"	"215"	"0"	"215"	"0"	"c.215A>G"	"r.(?)"	"p.(Tyr72Cys)"	""
"0001006000"	"00024043"	"50"	"176"	"0"	"176"	"0"	"c.176C>A"	"r.(?)"	"p.(Thr59Lys)"	""
"0001006001"	"00024043"	"30"	"135"	"0"	"135"	"0"	"c.135G>A"	"r.(?)"	"p.(=)"	""
"0001006002"	"00024043"	"30"	"14"	"0"	"14"	"0"	"c.14C>T"	"r.(?)"	"p.(Ser5Leu)"	""
"0001008363"	"00024043"	"90"	"1100"	"0"	"1100"	"0"	"c.1100del"	"r.(?)"	"p.(Thr367MetfsTer15)"	""
"0001010979"	"00024043"	"90"	"1459"	"0"	"1459"	"0"	"c.1459C>T"	"r.(?)"	"p.(Gln487*)"	""
"0001015922"	"00024043"	"30"	"1096"	"-214"	"1096"	"-214"	"c.1096-214G>A"	"r.(=)"	"p.(=)"	""
"0001015923"	"00024043"	"50"	"1095"	"0"	"1095"	"0"	"c.1095G>C"	"r.(?)"	"p.(Lys365Asn)"	""
"0001015924"	"00024043"	"50"	"906"	"0"	"906"	"0"	"c.906A>C"	"r.(?)"	"p.(Glu302Asp)"	""
"0001015925"	"00024043"	"10"	"684"	"-107"	"684"	"-107"	"c.684-107T>G"	"r.(=)"	"p.(=)"	""
"0001015926"	"00024043"	"10"	"592"	"50"	"592"	"50"	"c.592+50A>T"	"r.(=)"	"p.(=)"	""
"0001015927"	"00024043"	"30"	"582"	"0"	"582"	"0"	"c.582C>A"	"r.(?)"	"p.(Ser194Arg)"	""
"0001015928"	"00024043"	"30"	"410"	"0"	"410"	"0"	"c.410G>A"	"r.(?)"	"p.(Arg137Gln)"	""
"0001015929"	"00024043"	"70"	"326"	"0"	"327"	"0"	"c.326_327del"	"r.(?)"	"p.(Val109Glufs*2)"	""
"0001015930"	"00024043"	"10"	"319"	"43"	"319"	"43"	"c.319+43dup"	"r.(=)"	"p.(=)"	""
"0001015931"	"00024043"	"50"	"32"	"0"	"32"	"0"	"c.32A>C"	"r.(?)"	"p.(Gln11Pro)"	""
"0001015932"	"00024043"	"50"	"7"	"0"	"7"	"0"	"c.7C>T"	"r.(?)"	"p.(Arg3Trp)"	""
"0001022155"	"00024043"	"90"	"1376"	"-1"	"1376"	"-1"	"c.1376-1G>C"	"r.[1376_1461del,1376_1392del,=]"	"p.[Ala459GlyfsTer2,Ala459GlufsTer25,=]"	"12i"
"0001022168"	"00024043"	"70"	"1376"	"-27"	"1376"	"-27"	"c.1376-27C>G"	"r.[1375_1376ins1376-26_1376-1,=]"	"p.[Ala459ValfsTer2,=]"	"12i"
"0001027381"	"00024043"	"30"	"1623"	"0"	"1623"	"0"	"c.1623T>G"	"r.(?)"	"p.(=)"	""
"0001027382"	"00024043"	"50"	"1450"	"0"	"1450"	"0"	"c.1450C>A"	"r.(?)"	"p.(Pro484Thr)"	""
"0001027383"	"00024043"	"10"	"1375"	"78"	"1375"	"78"	"c.1375+78C>G"	"r.(=)"	"p.(=)"	""
"0001027384"	"00024043"	"70"	"1375"	"2"	"1375"	"2"	"c.1375+2T>G"	"r.spl?"	"p.?"	""
"0001027385"	"00024043"	"30"	"1260"	"-16"	"1260"	"-16"	"c.1260-16C>G"	"r.(=)"	"p.(=)"	""
"0001027386"	"00024043"	"70"	"1175"	"0"	"1175"	"0"	"c.1175C>T"	"r.(?)"	"p.(Ala392Val)"	""
"0001027387"	"00024043"	"50"	"1116"	"0"	"1117"	"0"	"c.1116_1117inv"	"r.(?)"	"p.(Lys373Glu)"	""
"0001027388"	"00024043"	"70"	"1039"	"0"	"1039"	"0"	"c.1039G>A"	"r.(?)"	"p.(Asp347Asn)"	""
"0001027389"	"00024043"	"50"	"980"	"0"	"980"	"0"	"c.980A>G"	"r.(?)"	"p.(Tyr327Cys)"	""
"0001027390"	"00024043"	"30"	"978"	"0"	"978"	"0"	"c.978C>T"	"r.(?)"	"p.(=)"	""
"0001027391"	"00024043"	"50"	"967"	"0"	"967"	"0"	"c.967A>C"	"r.(?)"	"p.(Thr323Pro)"	""
"0001027392"	"00024043"	"30"	"755"	"0"	"755"	"0"	"c.755G>A"	"r.(?)"	"p.(Ser252Asn)"	""
"0001027393"	"00024043"	"90"	"726"	"0"	"727"	"0"	"c.726_727del"	"r.(?)"	"p.(Cys243*)"	""
"0001027394"	"00024043"	"90"	"664"	"0"	"664"	"0"	"c.664del"	"r.(?)"	"p.(Met222Cysfs*13)"	""
"0001027395"	"00024043"	"10"	"592"	"39"	"592"	"39"	"c.592+39dup"	"r.(=)"	"p.(=)"	""
"0001027396"	"00024043"	"50"	"541"	"0"	"541"	"0"	"c.541C>T"	"r.(?)"	"p.(Arg181Cys)"	""
"0001027397"	"00024043"	"70"	"433"	"0"	"433"	"0"	"c.433C>T"	"r.(?)"	"p.(Arg145Trp)"	""
"0001027398"	"00024043"	"30"	"319"	"3768"	"319"	"3768"	"c.319+3768T>C"	"r.(=)"	"p.(=)"	""
"0001029977"	"00024043"	"50"	"1039"	"0"	"1039"	"0"	"c.1039G>A"	"r.(1039G>A)"	"p.(Asp347Asn)"	"10"
"0001029978"	"00024043"	"50"	"593"	"-11"	"593"	"-7"	"c.593-11_593-7del"	"r.spl?"	"p.?"	"i4"
"0001043788"	"00024043"	"70"	"1417"	"0"	"1419"	"0"	"c.1417_1419del"	"r.(?)"	"p.(Ala473del)"	""
"0001043789"	"00024043"	"30"	"1376"	"-12"	"1376"	"-12"	"c.1376-12T>C"	"r.(=)"	"p.(=)"	""
"0001043790"	"00024043"	"50"	"1291"	"0"	"1291"	"0"	"c.1291A>G"	"r.(?)"	"p.(Arg431Gly)"	""
"0001043791"	"00024043"	"70"	"1260"	"-8"	"1260"	"-8"	"c.1260-8A>G"	"r.(=)"	"p.(=)"	""
"0001043793"	"00024043"	"50"	"1091"	"0"	"1091"	"0"	"c.1091T>C"	"r.(?)"	"p.(Ile364Thr)"	""
"0001043794"	"00024043"	"50"	"1024"	"0"	"1024"	"0"	"c.1024G>A"	"r.(?)"	"p.(Gly342Ser)"	""
"0001043795"	"00024043"	"50"	"953"	"0"	"953"	"0"	"c.953G>A"	"r.(?)"	"p.(Arg318His)"	""
"0001043796"	"00024043"	"30"	"847"	"-17"	"847"	"-17"	"c.847-17T>C"	"r.(=)"	"p.(=)"	""
"0001043797"	"00024043"	"50"	"847"	"-33"	"847"	"-33"	"c.847-33A>G"	"r.(=)"	"p.(=)"	""
"0001043798"	"00024043"	"50"	"686"	"0"	"686"	"0"	"c.686G>C"	"r.(?)"	"p.(Gly229Ala)"	""
"0001043799"	"00024043"	"30"	"683"	"5"	"683"	"5"	"c.683+5A>G"	"r.spl?"	"p.?"	""
"0001043800"	"00024043"	"90"	"597"	"0"	"597"	"0"	"c.597del"	"r.(?)"	"p.(Phe199LeufsTer6)"	""
"0001043801"	"00024043"	"90"	"597"	"0"	"597"	"0"	"c.597del"	"r.(?)"	"p.(Phe199LeufsTer6)"	""
"0001043802"	"00024043"	"50"	"593"	"-11"	"593"	"-7"	"c.593-11_593-7del"	"r.(=)"	"p.(=)"	""
"0001043803"	"00024043"	"50"	"503"	"0"	"503"	"0"	"c.503C>T"	"r.(?)"	"p.(Thr168Ile)"	""
"0001043804"	"00024043"	"30"	"319"	"3980"	"319"	"3980"	"c.319+3980C>T"	"r.(=)"	"p.(=)"	""
"0001046809"	"00024043"	"50"	"1611"	"0"	"1611"	"0"	"c.1611dup"	"r.(?)"	"p.(Val538Cysfs*12)"	""
"0001046810"	"00024043"	"50"	"1376"	"-13"	"1376"	"-13"	"c.1376-13A>G"	"r.(=)"	"p.(=)"	""
"0001046811"	"00024043"	"70"	"846"	"1"	"846"	"1"	"c.846+1G>C"	"r.spl?"	"p.?"	""
"0001046812"	"00024043"	"30"	"684"	"-74"	"684"	"-74"	"c.684-74G>C"	"r.(=)"	"p.(=)"	""
"0001046813"	"00024043"	"50"	"560"	"0"	"560"	"0"	"c.560C>A"	"r.(?)"	"p.(Ser187Tyr)"	""
"0001046814"	"00024043"	"50"	"507"	"0"	"507"	"0"	"c.507T>G"	"r.(?)"	"p.(Phe169Leu)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 930
"{{screeningid}}"	"{{variantid}}"
"0000046391"	"0000073915"
"0000048255"	"0000077041"
"0000048262"	"0000077048"
"0000048294"	"0000077213"
"0000048337"	"0000077235"
"0000050196"	"0000079148"
"0000054769"	"0000084779"
"0000089469"	"0000147523"
"0000090667"	"0000148796"
"0000090668"	"0000148797"
"0000090669"	"0000148798"
"0000090670"	"0000148799"
"0000090672"	"0000148801"
"0000090673"	"0000148802"
"0000090674"	"0000148803"
"0000090675"	"0000148804"
"0000090676"	"0000148805"
"0000090677"	"0000148806"
"0000090678"	"0000148807"
"0000090679"	"0000148808"
"0000090680"	"0000148809"
"0000090681"	"0000148810"
"0000090682"	"0000148811"
"0000090683"	"0000148812"
"0000090684"	"0000148813"
"0000090685"	"0000148814"
"0000090686"	"0000148815"
"0000090687"	"0000148816"
"0000090688"	"0000148817"
"0000090689"	"0000148818"
"0000090690"	"0000148819"
"0000090691"	"0000148820"
"0000090692"	"0000148821"
"0000090693"	"0000148822"
"0000090694"	"0000148823"
"0000090695"	"0000148824"
"0000090696"	"0000148825"
"0000090697"	"0000148826"
"0000090698"	"0000148827"
"0000090699"	"0000148828"
"0000090700"	"0000148829"
"0000091028"	"0000149157"
"0000111012"	"0000178000"
"0000153588"	"0000352780"
"0000153589"	"0000352803"
"0000155346"	"0000355061"
"0000155346"	"0000355062"
"0000156529"	"0000358850"
"0000165585"	"0000369310"
"0000178989"	"0000407999"
"0000180192"	"0000403653"
"0000180193"	"0000403654"
"0000180194"	"0000403655"
"0000180195"	"0000403656"
"0000180196"	"0000403657"
"0000180197"	"0000403658"
"0000180198"	"0000403659"
"0000180199"	"0000403660"
"0000180200"	"0000403661"
"0000180201"	"0000403662"
"0000180202"	"0000403663"
"0000180203"	"0000403664"
"0000180204"	"0000403665"
"0000180205"	"0000403666"
"0000180206"	"0000403667"
"0000180207"	"0000403668"
"0000180208"	"0000403669"
"0000180209"	"0000403670"
"0000180210"	"0000403671"
"0000180211"	"0000403672"
"0000180212"	"0000403673"
"0000180213"	"0000403674"
"0000180214"	"0000403675"
"0000180215"	"0000403676"
"0000180216"	"0000403677"
"0000180217"	"0000403678"
"0000180218"	"0000403679"
"0000180219"	"0000403680"
"0000180220"	"0000403681"
"0000180221"	"0000403682"
"0000180222"	"0000403683"
"0000180223"	"0000403684"
"0000180224"	"0000403685"
"0000180225"	"0000403686"
"0000180226"	"0000403687"
"0000180227"	"0000403688"
"0000180228"	"0000403689"
"0000180229"	"0000403690"
"0000180230"	"0000403691"
"0000180231"	"0000403692"
"0000180232"	"0000403693"
"0000180233"	"0000403694"
"0000180234"	"0000403695"
"0000180235"	"0000403696"
"0000180236"	"0000403697"
"0000180237"	"0000403698"
"0000180238"	"0000403699"
"0000180239"	"0000403700"
"0000180240"	"0000403701"
"0000180241"	"0000403702"
"0000180242"	"0000403703"
"0000180243"	"0000403704"
"0000180244"	"0000403705"
"0000180245"	"0000403706"
"0000180246"	"0000403707"
"0000180247"	"0000403708"
"0000180248"	"0000403709"
"0000180249"	"0000403710"
"0000180250"	"0000403711"
"0000180251"	"0000403712"
"0000180252"	"0000403713"
"0000180253"	"0000403714"
"0000180254"	"0000403715"
"0000180255"	"0000403716"
"0000180256"	"0000403717"
"0000180257"	"0000403718"
"0000180258"	"0000403719"
"0000180259"	"0000403720"
"0000180260"	"0000403721"
"0000180261"	"0000403722"
"0000180262"	"0000403723"
"0000180263"	"0000403724"
"0000180264"	"0000403725"
"0000180265"	"0000403726"
"0000180266"	"0000403727"
"0000180267"	"0000403728"
"0000180268"	"0000403729"
"0000180269"	"0000403730"
"0000180270"	"0000403731"
"0000180271"	"0000403732"
"0000180272"	"0000403733"
"0000180273"	"0000403734"
"0000180274"	"0000403735"
"0000180275"	"0000403736"
"0000180276"	"0000403737"
"0000180277"	"0000403738"
"0000180278"	"0000403739"
"0000180279"	"0000403740"
"0000180280"	"0000403741"
"0000180281"	"0000403742"
"0000180282"	"0000403743"
"0000180283"	"0000403744"
"0000180284"	"0000403745"
"0000180285"	"0000403746"
"0000180286"	"0000403747"
"0000180287"	"0000403748"
"0000180288"	"0000403749"
"0000180289"	"0000403750"
"0000180290"	"0000403751"
"0000180291"	"0000403752"
"0000180292"	"0000403753"
"0000180293"	"0000403754"
"0000180294"	"0000403755"
"0000180295"	"0000403756"
"0000180296"	"0000403757"
"0000180297"	"0000403758"
"0000180298"	"0000403759"
"0000180299"	"0000403760"
"0000181822"	"0000405518"
"0000181823"	"0000405519"
"0000181824"	"0000405520"
"0000181825"	"0000405521"
"0000182586"	"0000406476"
"0000183871"	"0000407761"
"0000183872"	"0000407762"
"0000183873"	"0000407763"
"0000183874"	"0000407764"
"0000183875"	"0000407765"
"0000183876"	"0000407766"
"0000183877"	"0000407767"
"0000183878"	"0000407768"
"0000183879"	"0000407769"
"0000183880"	"0000407770"
"0000183881"	"0000407771"
"0000183882"	"0000407772"
"0000183883"	"0000407773"
"0000183884"	"0000407774"
"0000183885"	"0000407775"
"0000183886"	"0000407776"
"0000183887"	"0000407777"
"0000183888"	"0000407778"
"0000183889"	"0000407779"
"0000183890"	"0000407780"
"0000183891"	"0000407781"
"0000183892"	"0000407782"
"0000183893"	"0000407783"
"0000183894"	"0000407784"
"0000183895"	"0000407785"
"0000183896"	"0000407786"
"0000183897"	"0000407787"
"0000183898"	"0000407788"
"0000183899"	"0000407789"
"0000183900"	"0000407790"
"0000183901"	"0000407791"
"0000183902"	"0000407792"
"0000183903"	"0000407793"
"0000183904"	"0000407794"
"0000183905"	"0000407795"
"0000183906"	"0000407796"
"0000183907"	"0000407797"
"0000183908"	"0000407798"
"0000183909"	"0000407799"
"0000183910"	"0000407800"
"0000183911"	"0000407801"
"0000183912"	"0000407802"
"0000183913"	"0000407803"
"0000183914"	"0000407804"
"0000208806"	"0000438778"
"0000208810"	"0000438783"
"0000208810"	"0000438784"
"0000208996"	"0000439061"
"0000209666"	"0000439879"
"0000209839"	"0000440060"
"0000211257"	"0000442725"
"0000211262"	"0000442731"
"0000214695"	"0000447048"
"0000219143"	"0000453985"
"0000219152"	"0000454002"
"0000219153"	"0000454003"
"0000219154"	"0000454004"
"0000219155"	"0000454005"
"0000219156"	"0000454001"
"0000219158"	"0000453986"
"0000219159"	"0000453987"
"0000219160"	"0000453988"
"0000219161"	"0000453989"
"0000247601"	"0000500447"
"0000247602"	"0000500448"
"0000247603"	"0000500449"
"0000247604"	"0000500450"
"0000247605"	"0000500451"
"0000247606"	"0000500452"
"0000247607"	"0000500453"
"0000247608"	"0000500454"
"0000247609"	"0000500455"
"0000247610"	"0000500456"
"0000247611"	"0000500457"
"0000247612"	"0000500458"
"0000247613"	"0000500459"
"0000247614"	"0000500460"
"0000247615"	"0000500461"
"0000247616"	"0000500462"
"0000247617"	"0000500463"
"0000247618"	"0000500464"
"0000247619"	"0000500465"
"0000247620"	"0000500466"
"0000247621"	"0000500467"
"0000247622"	"0000500468"
"0000247748"	"0000500620"
"0000247752"	"0000500627"
"0000249308"	"0000578059"
"0000249355"	"0000578116"
"0000249355"	"0000578117"
"0000249511"	"0000578299"
"0000263225"	"0000593707"
"0000264234"	"0000594734"
"0000265142"	"0000595719"
"0000265160"	"0000595737"
"0000266222"	"0000596840"
"0000266538"	"0000597236"
"0000267294"	"0000598348"
"0000267537"	"0000598752"
"0000267600"	"0000599054"
"0000267611"	"0000599052"
"0000267611"	"0000599053"
"0000290448"	"0000647114"
"0000290475"	"0000647144"
"0000294249"	"0000650938"
"0000294250"	"0000650939"
"0000294251"	"0000650940"
"0000294252"	"0000650941"
"0000294253"	"0000650942"
"0000294254"	"0000650943"
"0000294255"	"0000650944"
"0000296359"	"0000653048"
"0000296360"	"0000653049"
"0000296361"	"0000653050"
"0000296362"	"0000653051"
"0000296726"	"0000653424"
"0000296728"	"0000653426"
"0000296756"	"0000653463"
"0000296830"	"0000653547"
"0000296914"	"0000659564"
"0000296921"	"0000659572"
"0000297058"	"0000659668"
"0000297059"	"0000659669"
"0000297071"	"0000659681"
"0000297507"	"0000660109"
"0000297970"	"0000660678"
"0000301763"	"0000664836"
"0000302517"	"0000665806"
"0000308399"	"0000682720"
"0000308399"	"0000682721"
"0000309144"	"0000683623"
"0000337342"	"0000736973"
"0000337343"	"0000736974"
"0000337570"	"0000737201"
"0000337571"	"0000737202"
"0000339663"	"0000739294"
"0000339664"	"0000739295"
"0000339665"	"0000739296"
"0000339666"	"0000739297"
"0000339667"	"0000739298"
"0000339668"	"0000739299"
"0000339669"	"0000739300"
"0000339670"	"0000739301"
"0000339671"	"0000739302"
"0000339672"	"0000739303"
"0000339673"	"0000739304"
"0000339674"	"0000739305"
"0000339675"	"0000739306"
"0000339676"	"0000739307"
"0000339677"	"0000739308"
"0000339678"	"0000739309"
"0000339679"	"0000739310"
"0000339680"	"0000739311"
"0000339681"	"0000739312"
"0000339682"	"0000739313"
"0000339683"	"0000739314"
"0000339684"	"0000739315"
"0000339685"	"0000739316"
"0000339686"	"0000739317"
"0000339687"	"0000739318"
"0000339688"	"0000739319"
"0000339689"	"0000739320"
"0000339690"	"0000739321"
"0000339691"	"0000739322"
"0000339692"	"0000739323"
"0000339693"	"0000739324"
"0000339694"	"0000739325"
"0000339695"	"0000739326"
"0000339696"	"0000739327"
"0000339697"	"0000739328"
"0000339698"	"0000739329"
"0000339699"	"0000739330"
"0000339700"	"0000739331"
"0000339701"	"0000739332"
"0000339702"	"0000739333"
"0000339703"	"0000739334"
"0000339704"	"0000739335"
"0000339705"	"0000739336"
"0000339706"	"0000739337"
"0000339707"	"0000739338"
"0000339708"	"0000739339"
"0000339709"	"0000739340"
"0000339710"	"0000739341"
"0000339711"	"0000739342"
"0000339712"	"0000739343"
"0000339713"	"0000739344"
"0000339714"	"0000739345"
"0000339715"	"0000739346"
"0000339716"	"0000739347"
"0000339717"	"0000739348"
"0000339718"	"0000739349"
"0000339719"	"0000739350"
"0000339720"	"0000739351"
"0000339721"	"0000739352"
"0000339722"	"0000739353"
"0000339723"	"0000739354"
"0000339724"	"0000739355"
"0000339725"	"0000739356"
"0000339726"	"0000739357"
"0000339727"	"0000739358"
"0000339728"	"0000739359"
"0000339729"	"0000739360"
"0000339730"	"0000739361"
"0000339731"	"0000739362"
"0000339732"	"0000739363"
"0000339733"	"0000739364"
"0000339734"	"0000739365"
"0000339735"	"0000739366"
"0000339736"	"0000739367"
"0000339737"	"0000739368"
"0000339738"	"0000739369"
"0000339739"	"0000739370"
"0000339740"	"0000739371"
"0000339741"	"0000739372"
"0000339742"	"0000739373"
"0000339743"	"0000739374"
"0000339744"	"0000739375"
"0000339745"	"0000739376"
"0000339746"	"0000739377"
"0000339747"	"0000739378"
"0000339748"	"0000739379"
"0000339749"	"0000739380"
"0000339750"	"0000739381"
"0000339751"	"0000739382"
"0000339752"	"0000739383"
"0000339753"	"0000739384"
"0000339754"	"0000739385"
"0000339755"	"0000739386"
"0000339756"	"0000739387"
"0000343236"	"0000742867"
"0000343237"	"0000742868"
"0000343238"	"0000742869"
"0000343239"	"0000742870"
"0000343240"	"0000742871"
"0000343241"	"0000742872"
"0000343242"	"0000742873"
"0000343243"	"0000742874"
"0000343244"	"0000742875"
"0000343245"	"0000742876"
"0000343246"	"0000742877"
"0000343247"	"0000742878"
"0000343248"	"0000742879"
"0000343249"	"0000742880"
"0000343250"	"0000742881"
"0000343842"	"0000743473"
"0000343843"	"0000743474"
"0000343844"	"0000743475"
"0000343845"	"0000743476"
"0000343846"	"0000743477"
"0000346510"	"0000746141"
"0000346511"	"0000746142"
"0000346512"	"0000746143"
"0000346513"	"0000746144"
"0000346514"	"0000746145"
"0000346515"	"0000746146"
"0000346516"	"0000746147"
"0000346517"	"0000746148"
"0000346518"	"0000746149"
"0000346519"	"0000746150"
"0000346520"	"0000746151"
"0000346521"	"0000746152"
"0000346522"	"0000746153"
"0000346523"	"0000746154"
"0000346524"	"0000746155"
"0000346525"	"0000746156"
"0000346526"	"0000746157"
"0000346527"	"0000746158"
"0000346528"	"0000746159"
"0000346529"	"0000746160"
"0000346530"	"0000746161"
"0000346531"	"0000746162"
"0000346532"	"0000746163"
"0000346533"	"0000746164"
"0000346534"	"0000746165"
"0000346535"	"0000746166"
"0000346536"	"0000746167"
"0000346537"	"0000746168"
"0000346538"	"0000746169"
"0000346539"	"0000746170"
"0000346540"	"0000746171"
"0000346541"	"0000746172"
"0000346542"	"0000746173"
"0000346543"	"0000746174"
"0000346544"	"0000746175"
"0000346545"	"0000746176"
"0000346546"	"0000746177"
"0000346547"	"0000746178"
"0000346548"	"0000746179"
"0000346549"	"0000746180"
"0000346550"	"0000746181"
"0000346551"	"0000746182"
"0000346552"	"0000746183"
"0000346553"	"0000746184"
"0000346554"	"0000746185"
"0000346555"	"0000746186"
"0000346556"	"0000746187"
"0000346557"	"0000746188"
"0000346558"	"0000746189"
"0000346559"	"0000746190"
"0000346560"	"0000746191"
"0000346561"	"0000746192"
"0000346562"	"0000746193"
"0000346563"	"0000746194"
"0000346564"	"0000746195"
"0000346565"	"0000746196"
"0000346566"	"0000746197"
"0000346567"	"0000746198"
"0000346568"	"0000746199"
"0000346569"	"0000746200"
"0000346570"	"0000746201"
"0000346571"	"0000746202"
"0000346572"	"0000746203"
"0000346573"	"0000746204"
"0000346574"	"0000746205"
"0000346575"	"0000746206"
"0000346576"	"0000746207"
"0000346577"	"0000746208"
"0000346578"	"0000746209"
"0000346579"	"0000746210"
"0000346580"	"0000746211"
"0000346581"	"0000746212"
"0000346582"	"0000746213"
"0000346583"	"0000746214"
"0000346584"	"0000746215"
"0000346585"	"0000746216"
"0000346586"	"0000746217"
"0000346587"	"0000746218"
"0000346588"	"0000746219"
"0000346589"	"0000746220"
"0000346590"	"0000746221"
"0000346591"	"0000746222"
"0000346592"	"0000746223"
"0000346593"	"0000746224"
"0000346594"	"0000746225"
"0000346595"	"0000746226"
"0000346596"	"0000746227"
"0000346597"	"0000746228"
"0000346598"	"0000746229"
"0000346599"	"0000746230"
"0000346600"	"0000746231"
"0000346601"	"0000746232"
"0000346602"	"0000746233"
"0000346603"	"0000746234"
"0000346604"	"0000746235"
"0000346605"	"0000746236"
"0000346606"	"0000746237"
"0000346607"	"0000746238"
"0000346608"	"0000746239"
"0000346609"	"0000746240"
"0000346610"	"0000746241"
"0000346611"	"0000746242"
"0000346612"	"0000746243"
"0000346613"	"0000746244"
"0000346614"	"0000746245"
"0000346615"	"0000746246"
"0000346616"	"0000746247"
"0000346617"	"0000746248"
"0000346618"	"0000746249"
"0000346619"	"0000746250"
"0000346620"	"0000746251"
"0000346621"	"0000746252"
"0000346622"	"0000746253"
"0000346623"	"0000746254"
"0000346624"	"0000746255"
"0000346625"	"0000746256"
"0000346626"	"0000746257"
"0000346627"	"0000746258"
"0000346628"	"0000746259"
"0000346629"	"0000746260"
"0000346630"	"0000746261"
"0000346631"	"0000746262"
"0000346632"	"0000746263"
"0000346633"	"0000746264"
"0000346634"	"0000746265"
"0000346635"	"0000746266"
"0000346636"	"0000746267"
"0000346637"	"0000746268"
"0000346638"	"0000746269"
"0000346639"	"0000746270"
"0000346640"	"0000746271"
"0000346641"	"0000746272"
"0000346642"	"0000746273"
"0000346643"	"0000746274"
"0000346644"	"0000746275"
"0000346645"	"0000746276"
"0000346646"	"0000746277"
"0000346647"	"0000746278"
"0000346648"	"0000746279"
"0000346649"	"0000746280"
"0000346650"	"0000746281"
"0000346651"	"0000746282"
"0000346652"	"0000746283"
"0000346653"	"0000746284"
"0000346654"	"0000746285"
"0000346655"	"0000746286"
"0000346656"	"0000746287"
"0000346657"	"0000746288"
"0000346658"	"0000746289"
"0000346659"	"0000746290"
"0000346660"	"0000746291"
"0000346661"	"0000746292"
"0000346662"	"0000746293"
"0000346663"	"0000746294"
"0000346664"	"0000746295"
"0000346665"	"0000746296"
"0000346666"	"0000746297"
"0000346667"	"0000746298"
"0000346668"	"0000746299"
"0000346669"	"0000746300"
"0000346670"	"0000746301"
"0000346671"	"0000746302"
"0000346672"	"0000746303"
"0000346673"	"0000746304"
"0000346674"	"0000746305"
"0000346675"	"0000746306"
"0000346676"	"0000746307"
"0000346677"	"0000746308"
"0000346678"	"0000746309"
"0000346679"	"0000746310"
"0000346680"	"0000746311"
"0000346681"	"0000746312"
"0000346682"	"0000746313"
"0000346683"	"0000746314"
"0000346684"	"0000746315"
"0000346685"	"0000746316"
"0000346686"	"0000746317"
"0000346687"	"0000746318"
"0000346688"	"0000746319"
"0000346689"	"0000746320"
"0000346690"	"0000746321"
"0000346691"	"0000746322"
"0000346692"	"0000746323"
"0000346693"	"0000746324"
"0000346694"	"0000746325"
"0000346695"	"0000746326"
"0000346696"	"0000746327"
"0000346697"	"0000746328"
"0000346698"	"0000746329"
"0000346699"	"0000746330"
"0000346700"	"0000746331"
"0000346701"	"0000746332"
"0000346702"	"0000746333"
"0000346703"	"0000746334"
"0000346704"	"0000746335"
"0000350445"	"0000750078"
"0000350446"	"0000750079"
"0000350447"	"0000750080"
"0000350448"	"0000750081"
"0000350449"	"0000750082"
"0000350643"	"0000750276"
"0000352389"	"0000752022"
"0000352390"	"0000752023"
"0000352391"	"0000752024"
"0000352392"	"0000752025"
"0000352393"	"0000752026"
"0000352394"	"0000752027"
"0000352395"	"0000752028"
"0000352396"	"0000752029"
"0000352397"	"0000752030"
"0000352398"	"0000752031"
"0000352399"	"0000752032"
"0000352400"	"0000752033"
"0000352401"	"0000752034"
"0000352402"	"0000752035"
"0000352403"	"0000752036"
"0000352404"	"0000752037"
"0000352405"	"0000752038"
"0000352406"	"0000752039"
"0000352407"	"0000752040"
"0000352408"	"0000752041"
"0000352409"	"0000752042"
"0000352410"	"0000752043"
"0000352411"	"0000752044"
"0000352412"	"0000752045"
"0000352413"	"0000752046"
"0000352414"	"0000752047"
"0000352415"	"0000752048"
"0000352416"	"0000752049"
"0000352417"	"0000752050"
"0000352418"	"0000752051"
"0000352419"	"0000752052"
"0000352420"	"0000752053"
"0000352421"	"0000752054"
"0000352422"	"0000752055"
"0000352423"	"0000752056"
"0000352424"	"0000752057"
"0000352425"	"0000752058"
"0000352426"	"0000752059"
"0000352427"	"0000752060"
"0000352428"	"0000752061"
"0000352429"	"0000752062"
"0000352430"	"0000752063"
"0000352431"	"0000752064"
"0000352432"	"0000752065"
"0000352433"	"0000752066"
"0000352434"	"0000752067"
"0000352435"	"0000752068"
"0000352436"	"0000752069"
"0000352437"	"0000752070"
"0000352438"	"0000752071"
"0000352439"	"0000752072"
"0000352440"	"0000752073"
"0000352441"	"0000752074"
"0000352442"	"0000752075"
"0000352443"	"0000752076"
"0000352444"	"0000752077"
"0000352445"	"0000752078"
"0000352446"	"0000752079"
"0000352447"	"0000752080"
"0000352448"	"0000752081"
"0000352449"	"0000752082"
"0000352450"	"0000752083"
"0000352451"	"0000752084"
"0000352452"	"0000752085"
"0000352453"	"0000752086"
"0000352454"	"0000752087"
"0000352455"	"0000752088"
"0000352456"	"0000752089"
"0000352457"	"0000752090"
"0000352458"	"0000752091"
"0000352459"	"0000752092"
"0000352460"	"0000752093"
"0000352461"	"0000752094"
"0000352462"	"0000752095"
"0000352463"	"0000752096"
"0000352464"	"0000752097"
"0000352465"	"0000752098"
"0000352466"	"0000752099"
"0000352467"	"0000752100"
"0000352468"	"0000752101"
"0000352469"	"0000752102"
"0000352470"	"0000752103"
"0000352471"	"0000752104"
"0000352472"	"0000752105"
"0000352473"	"0000752106"
"0000352474"	"0000752107"
"0000352475"	"0000752108"
"0000352476"	"0000752109"
"0000352477"	"0000752110"
"0000352478"	"0000752111"
"0000352479"	"0000752112"
"0000352480"	"0000752113"
"0000352481"	"0000752114"
"0000352482"	"0000752115"
"0000352483"	"0000752116"
"0000352484"	"0000752117"
"0000352485"	"0000752118"
"0000352486"	"0000752119"
"0000352487"	"0000752120"
"0000352488"	"0000752121"
"0000352489"	"0000752122"
"0000352490"	"0000752123"
"0000352491"	"0000752124"
"0000352492"	"0000752125"
"0000352493"	"0000752126"
"0000352494"	"0000752127"
"0000352495"	"0000752128"
"0000352496"	"0000752129"
"0000352497"	"0000752130"
"0000352498"	"0000752131"
"0000352499"	"0000752132"
"0000352500"	"0000752133"
"0000352501"	"0000752134"
"0000352502"	"0000752135"
"0000352503"	"0000752136"
"0000352504"	"0000752137"
"0000352505"	"0000752138"
"0000352506"	"0000752139"
"0000352507"	"0000752140"
"0000352508"	"0000752141"
"0000352509"	"0000752142"
"0000352510"	"0000752143"
"0000352511"	"0000752144"
"0000352512"	"0000752145"
"0000352513"	"0000752146"
"0000352514"	"0000752147"
"0000352515"	"0000752148"
"0000352516"	"0000752149"
"0000352517"	"0000752150"
"0000352518"	"0000752151"
"0000352519"	"0000752152"
"0000352520"	"0000752153"
"0000352521"	"0000752154"
"0000352522"	"0000752155"
"0000352523"	"0000752156"
"0000352524"	"0000752157"
"0000352525"	"0000752158"
"0000352526"	"0000752159"
"0000355221"	"0000754852"
"0000355222"	"0000754853"
"0000355223"	"0000754854"
"0000355224"	"0000754855"
"0000355225"	"0000754856"
"0000355419"	"0000755050"
"0000357165"	"0000756796"
"0000357166"	"0000756797"
"0000357167"	"0000756798"
"0000357168"	"0000756799"
"0000357169"	"0000756800"
"0000357170"	"0000756801"
"0000357171"	"0000756802"
"0000357172"	"0000756803"
"0000357173"	"0000756804"
"0000357174"	"0000756805"
"0000357175"	"0000756806"
"0000357176"	"0000756807"
"0000357177"	"0000756808"
"0000357178"	"0000756809"
"0000357179"	"0000756810"
"0000357180"	"0000756811"
"0000357181"	"0000756812"
"0000357182"	"0000756813"
"0000357183"	"0000756814"
"0000357184"	"0000756815"
"0000357185"	"0000756816"
"0000357186"	"0000756817"
"0000357187"	"0000756818"
"0000357188"	"0000756819"
"0000357189"	"0000756820"
"0000357190"	"0000756821"
"0000357191"	"0000756822"
"0000357192"	"0000756823"
"0000357193"	"0000756824"
"0000357194"	"0000756825"
"0000357195"	"0000756826"
"0000357196"	"0000756827"
"0000357197"	"0000756828"
"0000357198"	"0000756829"
"0000357199"	"0000756830"
"0000357200"	"0000756831"
"0000357201"	"0000756832"
"0000357202"	"0000756833"
"0000357203"	"0000756834"
"0000357204"	"0000756835"
"0000357205"	"0000756836"
"0000357206"	"0000756837"
"0000357207"	"0000756838"
"0000357208"	"0000756839"
"0000357209"	"0000756840"
"0000357210"	"0000756841"
"0000357211"	"0000756842"
"0000357212"	"0000756843"
"0000357213"	"0000756844"
"0000357214"	"0000756845"
"0000357215"	"0000756846"
"0000357216"	"0000756847"
"0000357217"	"0000756848"
"0000357218"	"0000756849"
"0000357219"	"0000756850"
"0000357220"	"0000756851"
"0000357221"	"0000756852"
"0000357222"	"0000756853"
"0000357223"	"0000756854"
"0000357224"	"0000756855"
"0000357225"	"0000756856"
"0000357226"	"0000756857"
"0000357227"	"0000756858"
"0000357228"	"0000756859"
"0000357229"	"0000756860"
"0000357230"	"0000756861"
"0000357231"	"0000756862"
"0000357232"	"0000756863"
"0000357233"	"0000756864"
"0000357234"	"0000756865"
"0000357235"	"0000756866"
"0000357236"	"0000756867"
"0000357237"	"0000756868"
"0000357238"	"0000756869"
"0000357239"	"0000756870"
"0000357240"	"0000756871"
"0000357241"	"0000756872"
"0000357242"	"0000756873"
"0000357243"	"0000756874"
"0000357244"	"0000756875"
"0000357245"	"0000756876"
"0000357246"	"0000756877"
"0000357247"	"0000756878"
"0000357248"	"0000756879"
"0000357249"	"0000756880"
"0000357250"	"0000756881"
"0000357251"	"0000756882"
"0000357252"	"0000756883"
"0000357253"	"0000756884"
"0000357254"	"0000756885"
"0000357255"	"0000756886"
"0000357256"	"0000756887"
"0000357257"	"0000756888"
"0000357258"	"0000756889"
"0000357259"	"0000756890"
"0000357260"	"0000756891"
"0000357261"	"0000756892"
"0000357262"	"0000756893"
"0000357263"	"0000756894"
"0000357264"	"0000756895"
"0000357265"	"0000756896"
"0000357266"	"0000756897"
"0000357267"	"0000756898"
"0000357268"	"0000756899"
"0000357269"	"0000756900"
"0000357270"	"0000756901"
"0000357271"	"0000756902"
"0000357272"	"0000756903"
"0000357273"	"0000756904"
"0000357274"	"0000756905"
"0000357275"	"0000756906"
"0000357276"	"0000756907"
"0000357277"	"0000756908"
"0000357278"	"0000756909"
"0000357279"	"0000756910"
"0000357280"	"0000756911"
"0000357281"	"0000756912"
"0000357282"	"0000756913"
"0000357283"	"0000756914"
"0000357284"	"0000756915"
"0000357285"	"0000756916"
"0000357286"	"0000756917"
"0000357287"	"0000756918"
"0000357288"	"0000756919"
"0000357289"	"0000756920"
"0000357290"	"0000756921"
"0000357291"	"0000756922"
"0000357292"	"0000756923"
"0000357293"	"0000756924"
"0000357294"	"0000756925"
"0000357295"	"0000756926"
"0000357296"	"0000756927"
"0000357297"	"0000756928"
"0000357298"	"0000756929"
"0000357299"	"0000756930"
"0000357300"	"0000756931"
"0000357301"	"0000756932"
"0000357302"	"0000756933"
"0000373260"	"0000783227"
"0000377343"	"0000789657"
"0000377345"	"0000789659"
"0000377353"	"0000789669"
"0000378315"	"0000791036"
"0000398170"	"0000830377"
"0000398171"	"0000830378"
"0000398172"	"0000830379"
"0000398173"	"0000830380"
"0000398178"	"0000830385"
"0000400941"	"0000833964"
"0000400942"	"0000833965"
"0000400943"	"0000833966"
"0000408201"	"0000845078"
"0000408202"	"0000845079"
"0000408203"	"0000845080"
"0000408204"	"0000845081"
"0000411862"	"0000869111"
"0000411863"	"0000869112"
"0000431772"	"0000918150"
"0000434428"	"0000920184"
"0000434465"	"0000920371"
"0000434579"	"0000920373"
"0000434586"	"0000920383"
"0000434593"	"0000920390"
"0000434595"	"0000920395"
"0000439461"	"0000935185"
"0000445049"	"0000952207"
"0000445050"	"0000952208"
"0000445051"	"0000951915"
"0000456671"	"0001010979"
"0000462628"	"0001022155"
"0000462641"	"0001022168"
"0000466140"	"0001029977"
"0000466141"	"0001029978"