### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = CHKB) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "CHKB" "choline kinase beta" "22" "q13.33" "unknown" "NG_029213.1" "UD_132119146841" "" "https://www.LOVD.nl/CHKB" "" "1" "1938" "1120" "612395" "1" "1" "1" "1" "This database is one of the gene variant databases from the:" "" "g" "https://databases.lovd.nl/shared/refseq/CHKB_codingDNA.html" "1" "" "This database is one of the gene variant databases from the Leiden Muscular Dystrophy pages" "-1" "" "-1" "00000" "2011-06-28 00:00:00" "00006" "2018-11-11 10:37:06" "00000" "2025-05-05 21:14:00" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001187" "CHKB" "choline kinase beta" "001" "NM_005198.4" "" "NP_005189.2" "" "" "" "-218" "1411" "1188" "51017387" "51021428" "00000" "2012-09-13 13:17:37" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 9 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00138" "autism" "autism" "" "209850" "" "" "" "00084" "2013-06-04 18:17:33" "00006" "2015-12-08 23:54:35" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00360" "MDC" "dystrophy, muscular, congenital (MDC)" "" "" "" "" "" "00006" "2014-03-21 23:02:36" "00006" "2018-07-03 16:30:02" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02433" "MDCMC" "dystrophy, muscular, congenital, megaconial type (MDCMC)" "AR" "602541" "" "autosomal recessive" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "05121" "MD" "dystrophy, muscular (MD)" "" "" "" "" "" "00006" "2016-01-24 01:27:29" "" "" "05324" "DMD" "dystrophy, muscular, Duchenne type (DMD)" "XLR" "310200" "" "" "" "00006" "2017-09-01 17:41:21" "00006" "2021-12-10 21:51:32" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "05618" "NMD" "neuromuscular disorder (NMD)" "" "" "" "" "" "00006" "2019-07-02 19:46:12" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "CHKB" "02433" ## Individuals ## Do not remove or alter this header ## ## Count = 34 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00035204" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035205" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035206" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035207" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035208" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035209" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035210" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035211" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035212" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035213" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00035214" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00050428" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00205275" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "" "M" "" "Japan" "23y" "0" "" "" "" "" "00205276" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "" "F" "" "Japan" "13y" "0" "" "" "" "" "00205277" "" "" "" "2" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "sibling of 21665002-Pat4" "F" "" "Japan" ">28y" "0" "" "" "" "" "00205278" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "sibling of 21665002-Pat3" "M" "" "Japan" ">22y" "0" "" "" "" "" "00205279" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "" "M" "" "Turkey" ">7y" "0" "" "" "" "" "00205280" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "" "M" "" "Turkey" "2y6m" "0" "" "" "" "" "00205281" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "" "F" "" "Turkey" ">2y" "0" "" "" "" "" "00205282" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "" "M" "" "Turkey" ">13y" "0" "" "" "" "" "00205283" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "" "F" "" "Turkey" ">17y" "0" "" "" "" "" "00205284" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "" "F" "" "Turkey" ">3y3m" "0" "" "" "" "" "00205285" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "" "F" "" "Turkey" ">16y" "0" "" "" "" "" "00205286" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "" "F" "" "Turkey" ">5y" "0" "" "" "" "" "00205287" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "" "M" "" "Turkey" ">3y6m" "0" "" "" "" "" "00205288" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "" "F" "" "Turkey" ">6y4m" "0" "" "" "" "" "00205289" "" "" "" "1" "" "00006" "{PMID:Mitsuhashi 2011:21665002}" "" "M" "" "United Kingdom (Great Britain)" "8y" "0" "" "" "" "" "00205290" "" "" "" "1" "" "00006" "{PMID:Sher 2006:16371353}, {PMID:Wu 2009:19236939}" "spontaneous mouse mutant" "-" "" "" "" "0" "" "" "" "" "00274437" "" "" "" "1" "" "00006" "{PMID:Park 2017:27363342}" "" "F" "" "Korea" "" "0" "" "" "" "Pat39" "00391940" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "yes" "India" "" "0" "yes" "" "" "MDCRC/0146/B-153" "00434658" "" "" "" "1" "" "00006" "{PMID:Chen 2022:34906496}" "" "F" "" "United States" "" "0" "" "" "" "PatN7" "00442640" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat12" "00453353" "" "" "" "1" "" "00006" "{PMID:Ghasemi 2024:39103847}" "4-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "yes" "Iran" "" "0" "" "" "" "Fam4PatIV1" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 25 "{{individualid}}" "{{diseaseid}}" "00000209" "01157" "00035205" "00198" "00035206" "00198" "00050428" "00198" "00205275" "00360" "00205276" "00360" "00205277" "00360" "00205278" "00360" "00205279" "00360" "00205280" "00360" "00205281" "00360" "00205282" "00360" "00205283" "00360" "00205284" "00360" "00205285" "00360" "00205286" "00360" "00205287" "00360" "00205288" "00360" "00205289" "00360" "00205290" "00360" "00274437" "05121" "00391940" "05324" "00434658" "05611" "00442640" "05618" "00453353" "00138" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00138, 00198, 00360, 01157, 02433, 05121, 05324, 05611, 05618 ## Count = 25 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000037040" "00198" "00050428" "00006" "Isolated (sporadic)" "" "generalized hypotonia, global developmental delay" "" "" "" "" "" "" "" "" "" "" "" "0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "07y04m" "" "" "" "" "" "" "" "" "" "0000153469" "00360" "00205275" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 190-2676; floppy at birth; cardiomyopathy; no skin change; muscle (1y2m)-necrotic fiber, regenerative fiber, endomysial fibrosis, mitochondrial enlargement; seizures; walk 1y9m" "" "" "" "no detectable CHK activity muscle" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153470" "00360" "00205276" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 370; floppy at birth; cardiomyopathy; no skin change; muscle (7y3m)-necrotic fiber, regenerative fiber, endomysial fibrosis, mitochondrial enlargement; no seizures; walk 2y6m" "" "" "" "" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153471" "00360" "00205277" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 502; floppy at birth; cardiomyopathy; no skin change; muscle (8y)-necrotic fiber, regenerative fiber, endomysial fibrosis, mitochondrial enlargement; seizures; walk 1y6m" "" "" "" "no detectable CHK activity muscle" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153472" "00360" "00205278" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 230; floppy at birth; no cardiomyopathy; no skin change; muscle (4y11m)-necrotic fiber, regenerative fiber, endomysial fibrosis, mitochondrial enlargement; seizures; walk 2y6m" "" "" "" "no detectable CHK activity muscle" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153473" "00360" "00205279" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 843; not floppy at birth; no cardiomyopathy; skin change; muscle (6y)-weakly necrotic fiber, regenerative fiber, endomysial fibrosis, mitochondrial enlargement; no seizures; walk 2y6m" "" "" "" "" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153474" "00360" "00205280" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 258; floppy at birth; cardiomyopathy; no skin change; muscle (1y3m)-weakly necrotic fiber, weakly regenerative fiber, endomysial fibrosis, mitochondrial enlargement; no seizures; inability to walk (HP:0002540)" "" "" "" "" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153475" "00360" "00205281" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 368; not floppy at birth; no cardiomyopathy, patent ductus arteriosus; no skin change; muscle (9m)-no necrotic fiber, weakly regenerative fiber, endomysial fibrosis, mitochondrial enlargement; no seizures; inability to walk (HP:0002540)" "" "" "" "" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153476" "00360" "00205282" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 1122; no cardiomyopathy; no skin change; muscle (12y10m)-weakly necrotic fiber, weakly regenerative fiber, endomysial fibrosis, mitochondrial enlargement; no seizures; walk 2y" "" "" "" "" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153477" "00360" "00205283" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 2669; floppy at birth; no skin change; muscle (17y)-weakly necrotic fiber, weakly regenerative fiber, endomysial fibrosis, mitochondrial enlargement; no seizures; walk 3y" "" "" "" "" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153478" "00360" "00205284" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 497; floppy at birth; no skin change; muscle (3y)-weakly necrotic fiber, no regenerative fiber, endomysial fibrosis, mitochondrial enlargement; no seizures; inability to walk (HP:0002540)" "" "" "" "" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153479" "00360" "00205285" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 1103; floppy at birth; no cardiomyopathy, atrial septal defect; skin change; muscle (3y)-no necrotic fiber, weakly regenerative fiber, endomysial fibrosis, mitochondrial enlargement; no seizures; walk 3y" "" "" "" "" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153480" "00360" "00205286" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 467; not floppy at birth; no cardiomyopathy, mitral vavlve prolapse; skin change; muscle (4y6m)-weakly necrotic fiber, regenerative fiber, endomysial fibrosis, mitochondrial enlargement; no seizures; walk 3y6m" "" "" "" "" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153481" "00360" "00205287" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 428; floppy at birth; cardiomyopathy; skin change; muscle (3y)-necrotic fiber, regenerative fiber, endomysial fibrosis, mitochondrial enlargement; no seizures; inability to walk (HP:0002540)" "" "" "" "" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153482" "00360" "00205288" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 1606; not floppy at birth; cardiomyopathy; no skin change; muscle (4y)-necrotic fiber, regenerative fiber, endomysial fibrosis, mitochondrial enlargement; no seizures; walk 1y3m" "" "" "" "" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153483" "00360" "00205289" "00006" "Unknown" "" "intellectual disability (HP:0001249); elevated serum creatine phosphokinase (HP:003236) 607-1715; not floppy at birth; cardiomyopathy; muscle (2y2m)-necrotic fiber, no regenerative fiber, endomysial fibrosis, mitochondrial enlargement; no seizures; walk 3y4m" "" "" "" "" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000153484" "00360" "00205290" "00006" "Familial, autosomal recessive" "" "dystrophy, muscular, rostrocaudal" "" "" "" "" "" "" "" "" "MDCMC" "congenital muscular dystrophy" "" "0000156056" "00198" "00035205" "01164" "Unknown" "" "CK 10.000, proximal myasthenia, progressive" "" "" "" "" "" "" "" "" "" "myasthenia" "" "0000156057" "00198" "00035206" "01164" "Unknown" "" "CK 10.000, proximal myasthenia, progressive" "" "" "" "" "" "" "" "" "" "myasthenia" "" "0000209380" "05121" "00274437" "00006" "Familial, autosomal recessive" "" "proximal muscle weakness, facial weakness and respiratory failure; muscle myopathic pattern; elevated CK (121 IU/L); ECG or echo normal; familial" "3y" "7y" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000285230" "05324" "00391940" "03501" "Unknown" "4y" "proximal muscle weakness (HP:0003701), difficulty climbing stairs (HP:0003551)" "2y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000324907" "05611" "00434658" "00006" "Isolated (sporadic)" "11y07m" "see paper; ..., motor delay, mild truncal hypotonia, mild hemihypertrophy left side ace, bilateral clinodactyly, hyperextensibility; attention deficit hyperactivity disorder, significant difficulties in school; MRI brain retrocerebellar fluid collection consistent with enlarged magna cisterna; no seizures; no intellectual disability; developmental delay, motor delay; learning disability; attention deficit hyperactivity disorder; no seizures; no spasticity; no hypertonia; hypotonia; difficulty moving arms and legs simultaneously; no open mouth; no drooling; no meningomyelocele; no polymicrogyria ; no pachygyria; enlarged cisterna magna; facial asymmetry, left face mild hemihypertrophy; no epicanthal fold ; no dysmorphic ears; no asthma; joint hypermobility; no scoliosis; no vertebral segmentation defect; no narrow chest; no talipes equinovarus; clinodactyly; no umbilical hernia; no imperforated anus ; no rectovaginal fistula; no single kidney; MRI brain retrocerebellar fluid collection consistent with an enlarged cisterna magna" "" "" "" "" "" "" "" "" "" "" "" "0000331987" "05618" "00442640" "00006" "Familial, autosomal recessive" "9y" "Weakness: lower limb > upper limbs; proximal > distal; axial weakness, scoliosis; muscle biopsy: increase in fiber size variation, proliferation of endomysial and perimysial connective tissues, limited immunostaining for merosin and dystrophin 1,2,3 positive" "4m" "" "" "" "" "" "" "" "" "Congenital myopathy" "" "0000342016" "00138" "00453353" "00006" "Familial, autosomal recessive" "04y" "developmental delay, intellectual disability, learning disability, autism, no epilepsy, language/speech delay, no ADHD, repetitive movement and behavior, muscular dystrophy, hypotonia, abnormal gait, no obesity, no acrophobia" "" "" "" "" "" "" "" "" "MDCMC" "syndromic autism, global developmental delay, intellectual disability, muscular dystrophy" "" ## Screenings ## Do not remove or alter this header ## ## Count = 34 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000210" "00000209" "1" "00037" "00001" "2012-09-13 12:09:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000035274" "00035204" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035275" "00035205" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035276" "00035206" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035277" "00035207" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035278" "00035208" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035279" "00035209" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035280" "00035210" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035281" "00035211" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035282" "00035212" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035283" "00035213" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000035284" "00035214" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000050373" "00050428" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000206305" "00205275" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206306" "00205276" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206307" "00205277" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206308" "00205278" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206309" "00205279" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206310" "00205280" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206311" "00205281" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206312" "00205282" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206313" "00205283" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206314" "00205284" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206315" "00205285" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206316" "00205286" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206317" "00205287" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "RT-PCR;SEQ;SSCA" "DNA;RNA" "" "" "0000206318" "00205288" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206319" "00205289" "1" "00006" "00006" "2011-06-28 16:30:12" "00006" "2013-02-01 19:44:08" "SEQ;SSCA" "DNA" "" "" "0000206320" "00205290" "1" "00006" "00006" "2012-03-11 21:19:23" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000275596" "00274437" "1" "00006" "00006" "2019-12-30 09:59:36" "" "" "SEQ;SEQ-NG" "DNA" "" "69-gene panel muscular disorder" "0000393182" "00391940" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, CHKB, LAMA2, LAMA2, COL6A1, COL6A2, COL6A3, CAPN3, DYSF, FLNC, SGCB, SGCA, SGCD, SGCG, PLEC, SYNE1" "0000436130" "00434658" "1" "00006" "00006" "2023-04-07 11:11:34" "" "" "SEQ-NG" "DNA" "" "WES" "0000444124" "00442640" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000454964" "00453353" "1" "00006" "00006" "2024-08-19 11:03:41" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 28 "{{screeningid}}" "{{geneid}}" "0000035274" "CHKB" "0000035275" "CHKB" "0000035276" "CHKB" "0000035277" "CHKB" "0000035278" "CHKB" "0000035279" "CHKB" "0000035280" "CHKB" "0000035281" "CHKB" "0000035282" "CHKB" "0000035283" "CHKB" "0000035284" "CHKB" "0000206305" "CHKB" "0000206306" "CHKB" "0000206307" "CHKB" "0000206308" "CHKB" "0000206309" "CHKB" "0000206310" "CHKB" "0000206311" "CHKB" "0000206312" "CHKB" "0000206313" "CHKB" "0000206314" "CHKB" "0000206315" "CHKB" "0000206316" "CHKB" "0000206317" "CHKB" "0000206318" "CHKB" "0000206319" "CHKB" "0000206320" "CHKB" "0000275596" "CHKB" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 85 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000014062" "3" "50" "22" "51017514" "51017514" "subst" "0" "00037" "CHKB_000021" "g.51017514C>G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.50579085C>G" "" "VUS" "" "0000062393" "1" "10" "22" "51020668" "51020668" "subst" "0.657501" "01164" "CHKB_000031" "g.51020668C>A" "frequency 40-60%" "" "" "" "dbSNP: frequency 40-60%" "Germline" "" "rs86337" "0" "" "" "g.50582239C>A" "" "benign" "" "0000062394" "1" "50" "22" "51018007" "51018007" "subst" "0" "01164" "CHKB_000027" "g.51018007G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.50579578G>A" "" "VUS" "" "0000062395" "1" "50" "22" "51018008" "51018008" "subst" "0" "01164" "CHKB_000028" "g.51018008T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.50579579T>C" "" "VUS" "" "0000062396" "1" "10" "22" "51017713" "51017713" "subst" "0.119142" "01164" "CHKB_000025" "g.51017713G>A" "" "" "" "" "" "Germline" "" "rs762677" "0" "" "" "g.50579284G>A" "" "benign" "" "0000062397" "1" "10" "22" "51018911" "51018911" "subst" "0" "01164" "CHKB_000030" "g.51018911C>T" "" "" "" "" "" "Germline" "" "rs2269382" "0" "" "" "g.50580482C>T" "" "benign" "" "0000062398" "1" "50" "22" "51021271" "51021290" "del" "0" "01164" "CHKB_000012" "g.51021271_51021290del" "" "" "" "" "" "Germline" "" "rs144647670" "0" "" "" "g.50582842_50582861del" "" "VUS" "" "0000062399" "1" "10" "22" "51018579" "51018579" "subst" "0.445404" "01164" "CHKB_000029" "g.51018579A>G" "frequency up to 50%" "" "" "" "dbSNP: frequency up to 50%" "Germline" "" "rs140514" "0" "" "" "g.50580150A>G" "" "benign" "" "0000062400" "1" "10" "22" "51017394" "51017394" "subst" "0" "01164" "CHKB_000023" "g.51017394G>C" "" "" "" "" "" "Germline" "" "rs3180872" "0" "" "" "g.50578965G>C" "" "benign" "" "0000062401" "1" "10" "22" "51017353" "51017353" "subst" "0" "01164" "CHKB_000022" "g.51017353T>C" "" "" "" "" "" "Germline" "" "rs5770917" "0" "" "" "g.50578924T>C" "" "benign" "" "0000062402" "1" "10" "22" "51017794" "51017794" "subst" "0" "01164" "CHKB_000026" "g.51017794A>G" "" "" "" "" "" "Germline" "" "rs762676" "0" "" "" "g.50579365A>G" "" "benign" "" "0000062403" "1" "10" "22" "51017476" "51017476" "subst" "0" "01164" "CHKB_000024" "g.51017476A>G" "" "" "" "" "" "Germline" "" "rs1056964" "0" "" "" "g.50579047A>G" "" "benign" "" "0000079353" "0" "90" "22" "47182944" "51666786" "del" "0" "00006" "ALG12_000022" "g.47182944_51666786del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "mosaicism, hemizygous in 0.56 cells" "Somatic" "" "" "0" "" "" "" "" "pathogenic" "" "0000249436" "0" "30" "22" "51019929" "51019929" "subst" "0.000505246" "02325" "CHKB_000020" "g.51019929A>C" "" "" "" "CHKB(NM_005198.5):c.501T>G (p.I167M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50581500A>C" "" "likely benign" "" "0000266790" "0" "10" "22" "51020668" "51020668" "subst" "0.657501" "02325" "CHKB_000031" "g.51020668C>A" "" "" "" "CHKB(NM_005198.5):c.333+10G>T, CHKB-CPT1B(NR_027928.2):n.551+10G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50582239C>A" "" "benign" "" "0000266791" "0" "30" "22" "51018428" "51018428" "subst" "0.0002174" "02325" "CHKB_000016" "g.51018428G>A" "" "" "" "CHKB(NM_005198.5):c.902C>T (p.T301I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50579999G>A" "" "likely benign" "" "0000270149" "0" "30" "22" "51018179" "51018179" "subst" "1.64105E-5" "02326" "CHKB_000014" "g.51018179T>A" "" "" "" "CHKB(NM_005198.4):c.1008A>T (p.E336D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50579750T>A" "" "likely benign" "" "0000270150" "0" "30" "22" "51019001" "51019001" "subst" "0.000959677" "02326" "CHKB_000017" "g.51019001T>G" "" "" "" "CHKB(NM_005198.4):c.670A>C (p.(Asn224His), p.N224H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50580572T>G" "" "likely benign" "" "0000270151" "0" "30" "22" "51018204" "51018204" "subst" "0.00411524" "02326" "CHKB_000015" "g.51018204T>C" "" "" "" "CHKB(NM_005198.4):c.983A>G (p.Q328R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50579775T>C" "" "likely benign" "" "0000270574" "0" "10" "22" "51012854" "51012854" "subst" "0.0279326" "02326" "CHKB_000013" "g.51012854G>A" "" "" "" "CPT1B(NM_152245.3):c.886-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50574425G>A" "" "benign" "" "0000273530" "0" "30" "22" "51020762" "51020762" "subst" "0.00185723" "01943" "CHKB_000018" "g.51020762G>A" "" "" "" "CHKB(NM_005198.4):c.249C>T (p.F83=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50582333G>A" "" "likely benign" "" "0000435763" "10" "90" "22" "51018627" "51018627" "subst" "8.13789E-6" "00006" "CHKB_000001" "g.51018627A>T" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0001}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580198A>T" "" "pathogenic" "" "0000435764" "20" "90" "22" "51018627" "51018627" "subst" "8.13789E-6" "00006" "CHKB_000001" "g.51018627A>T" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0001}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580198A>T" "" "pathogenic" "" "0000435765" "10" "90" "22" "51018627" "51018627" "subst" "8.13789E-6" "00006" "CHKB_000001" "g.51018627A>T" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0001}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580198A>T" "" "pathogenic" "" "0000435766" "20" "90" "22" "51018627" "51018627" "subst" "8.13789E-6" "00006" "CHKB_000001" "g.51018627A>T" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0001}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580198A>T" "" "pathogenic" "" "0000435767" "11" "90" "22" "51021095" "51021095" "subst" "0" "00006" "CHKB_000002" "g.51021095G>T" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50582666G>T" "" "pathogenic" "" "0000435768" "11" "90" "22" "51021095" "51021095" "subst" "0" "00006" "CHKB_000002" "g.51021095G>T" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50582666G>T" "" "pathogenic" "" "0000435769" "21" "90" "22" "51019973" "51019973" "dup" "0" "00006" "CHKB_000003" "g.51019973dup" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0003}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50581544dup" "" "pathogenic" "" "0000435770" "21" "90" "22" "51019973" "51019973" "dup" "0" "00006" "CHKB_000003" "g.51019973dup" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0003}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50581544dup" "" "pathogenic" "" "0000435771" "10" "90" "22" "51019064" "51019064" "dup" "0" "00006" "CHKB_000004" "g.51019064dup" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580635dup" "" "pathogenic" "" "0000435772" "20" "90" "22" "51019064" "51019064" "dup" "0" "00006" "CHKB_000004" "g.51019064dup" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580635dup" "" "pathogenic" "" "0000435773" "10" "90" "22" "51018408" "51018408" "subst" "0" "00006" "CHKB_000005" "g.51018408G>A" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0004}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50579979G>A" "" "pathogenic" "" "0000435774" "20" "90" "22" "51018408" "51018408" "subst" "0" "00006" "CHKB_000005" "g.51018408G>A" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0004}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50579979G>A" "" "pathogenic" "" "0000435775" "10" "90" "22" "51018483" "51018483" "subst" "0" "00006" "CHKB_000006" "g.51018483C>T" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580054C>T" "" "pathogenic" "" "0000435776" "20" "90" "22" "51018483" "51018483" "subst" "0" "00006" "CHKB_000006" "g.51018483C>T" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580054C>T" "" "pathogenic" "" "0000435777" "10" "90" "22" "51017668" "51017668" "subst" "0" "00006" "CHKB_000007" "g.51017668C>A" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50579239C>A" "" "pathogenic" "" "0000435778" "20" "90" "22" "51017668" "51017668" "subst" "0" "00006" "CHKB_000007" "g.51017668C>A" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50579239C>A" "" "pathogenic" "" "0000435779" "10" "90" "22" "51019870" "51019878" "del" "0" "00006" "CHKB_000008" "g.51019870_51019878del" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50581441_50581449del" "" "pathogenic" "" "0000435780" "20" "90" "22" "51019870" "51019878" "del" "0" "00006" "CHKB_000008" "g.51019870_51019878del" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50581441_50581449del" "" "pathogenic" "" "0000435781" "10" "90" "22" "51018993" "51018993" "subst" "0" "00006" "CHKB_000009" "g.51018993C>T" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0005}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580564C>T" "" "pathogenic" "" "0000435782" "20" "90" "22" "51018993" "51018993" "subst" "0" "00006" "CHKB_000009" "g.51018993C>T" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0005}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580564C>T" "" "pathogenic" "" "0000435783" "10" "90" "22" "51018993" "51018993" "subst" "0" "00006" "CHKB_000009" "g.51018993C>T" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0005}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580564C>T" "" "pathogenic" "" "0000435784" "20" "90" "22" "51018993" "51018993" "subst" "0" "00006" "CHKB_000009" "g.51018993C>T" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0005}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580564C>T" "" "pathogenic" "" "0000435785" "10" "90" "22" "51018993" "51018993" "subst" "0" "00006" "CHKB_000009" "g.51018993C>T" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0005}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580564C>T" "" "pathogenic" "" "0000435786" "20" "90" "22" "51018993" "51018993" "subst" "0" "00006" "CHKB_000009" "g.51018993C>T" "" "{PMID:Mitsuhashi 2011:21665002}, {OMIM612395:0005}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580564C>T" "" "pathogenic" "" "0000435787" "10" "90" "22" "51018155" "51018155" "subst" "0" "00006" "CHKB_000010" "g.51018155C>T" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50579726C>T" "" "pathogenic" "" "0000435788" "20" "90" "22" "51018155" "51018155" "subst" "0" "00006" "CHKB_000010" "g.51018155C>T" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50579726C>T" "" "pathogenic" "" "0000435789" "10" "90" "22" "51018155" "51018155" "subst" "0" "00006" "CHKB_000010" "g.51018155C>T" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50579726C>T" "" "pathogenic" "" "0000435790" "20" "90" "22" "51018155" "51018155" "subst" "0" "00006" "CHKB_000010" "g.51018155C>T" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50579726C>T" "" "pathogenic" "" "0000435791" "10" "90" "22" "51018473" "51018480" "del" "0" "00006" "CHKB_000011" "g.51018473_51018480del" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580044_50580051del" "" "pathogenic" "" "0000435792" "20" "90" "22" "51018473" "51018480" "del" "0" "00006" "CHKB_000011" "g.51018473_51018480del" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "not in 210 control chromosomes" "Germline" "" "" "0" "" "" "g.50580044_50580051del" "" "pathogenic" "" "0000435793" "3" "90" "22" "0" "0" "" "0" "00006" "CHKB_000000" "g.((51017937_51018155)_51020203)del" "" "{PMID:Sher 2006:16371353}" "" "" "deletion from exon 3 to intron 9" "animal model" "" "" "0" "" "" "" "" "pathogenic" "" "0000435794" "0" "90" "22" "51018483" "51018483" "subst" "0" "00006" "CHKB_000006" "g.51018483C>T" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "cloned, purified enzyme activity <30%" "In vitro (cloned)" "" "" "0" "" "" "g.50580054C>T" "" "NA" "" "0000435795" "0" "90" "22" "51017668" "51017668" "subst" "0" "00006" "CHKB_000007" "g.51017668C>A" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "cloned, purified enzyme activity <30%" "In vitro (cloned)" "" "" "0" "" "" "g.50579239C>A" "" "NA" "" "0000435796" "0" "90" "22" "51019870" "51019878" "del" "0" "00006" "CHKB_000008" "g.51019870_51019878del" "" "{PMID:Mitsuhashi 2011:21665002}" "" "" "cloned, purified enzyme activity <30%" "In vitro (cloned)" "" "" "0" "" "" "g.50581441_50581449del" "" "NA" "" "0000572406" "0" "50" "22" "51018153" "51018153" "subst" "1.23096E-5" "01804" "CHKB_000032" "g.51018153C>G" "" "" "" "CHKB(NM_005198.4):c.1031+3G>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50579724C>G" "" "VUS" "" "0000572408" "0" "90" "22" "51018620" "51018620" "del" "0" "02327" "CHKB_000033" "g.51018620del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50580191del" "" "pathogenic" "" "0000572411" "0" "50" "22" "51020186" "51020186" "subst" "0" "02325" "CHKB_000036" "g.51020186A>C" "" "" "" "CHKB(NM_005198.5):c.439T>G (p.Y147D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50581757A>C" "" "VUS" "" "0000618653" "0" "10" "22" "51015481" "51015481" "subst" "0.443537" "02327" "CHKB_000038" "g.51015481G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50577052G>A" "" "benign" "" "0000618654" "0" "30" "22" "51018207" "51018207" "subst" "2.05153E-5" "02327" "CHKB_000039" "g.51018207G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50579778G>A" "" "likely benign" "" "0000618655" "0" "30" "22" "51019973" "51019973" "subst" "0.00155269" "02326" "CHKB_000040" "g.51019973A>G" "" "" "" "CHKB(NM_005198.4):c.457T>C (p.L153=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50581544A>G" "" "likely benign" "" "0000618656" "0" "30" "22" "51020997" "51020997" "subst" "8.72303E-6" "02327" "CHKB_000041" "g.51020997A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50582568A>G" "" "likely benign" "" "0000618657" "0" "30" "22" "51021147" "51021147" "subst" "0" "02327" "CHKB_000042" "g.51021147C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50582718C>T" "" "likely benign" "" "0000629660" "1" "70" "22" "51018840" "51018841" "dup" "0" "00006" "CHKB_000043" "g.51018840_51018841dup" "1/209 cases" "{PMID:Park 2017:27363342}" "" "682_683insTT" "no variant 2nd allele" "Germline" "" "" "0" "" "" "g.50580411_50580412dup" "" "likely pathogenic (recessive)" "" "0000658987" "0" "10" "22" "51012854" "51012854" "subst" "0.0279326" "02327" "CHKB_000013" "g.51012854G>A" "" "" "" "CPT1B(NM_152245.3):c.886-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50574425G>A" "" "benign" "" "0000658988" "0" "10" "22" "51016360" "51016360" "subst" "0.0425884" "02327" "CHKB_000044" "g.51016360G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50577931G>A" "" "benign" "" "0000658989" "0" "30" "22" "51020672" "51020672" "subst" "0" "01943" "CHKB_000045" "g.51020672C>T" "" "" "" "CHKB(NM_005198.4):c.333+6G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50582243C>T" "" "likely benign" "" "0000681941" "0" "50" "22" "51020748" "51020748" "subst" "0.000308352" "01943" "CHKB_000046" "g.51020748G>A" "" "" "" "CHKB(NM_005198.4):c.263C>T (p.P88L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728230" "0" "30" "22" "51018204" "51018204" "subst" "0.00411524" "01943" "CHKB_000015" "g.51018204T>C" "" "" "" "CHKB(NM_005198.4):c.983A>G (p.Q328R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728231" "0" "70" "22" "51019955" "51019955" "subst" "0" "02329" "CHKB_000035" "g.51019955G>A" "" "" "" "CHKB(NM_005198.5):c.475C>T (p.R159*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000809683" "0" "50" "22" "51018650" "51018652" "del" "0" "02325" "CHKB_000047" "g.51018650_51018652del" "" "" "" "CHKB(NM_005198.5):c.788_790delTGG (p.V263del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809684" "0" "90" "22" "51020208" "51020208" "del" "0" "01943" "CHKB_000048" "g.51020208del" "" "" "" "CHKB(NM_005198.4):c.419delC (p.P140Qfs*14)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000823845" "0" "90" "22" "51019901" "51019913" "del" "0" "03501" "CHKB_000049" "g.51019901_51019913del" "" "{PMID:Karthikeyan 2024:39548682}" "" "c.517_529delCAATTTCATGGCA" "Novel variant (2021)" "Germline/De novo (untested)" "" "" "0" "" "" "g.50581472_50581484del" "" "pathogenic" "" "0000856206" "0" "70" "22" "51017669" "51017699" "del" "0" "02329" "CHKB_000050" "g.51017669_51017699del" "" "" "" "CHKB(NM_005198.5):c.1114-11_1133delTCCTTCCCTAGGACTATGCCCAGTCTCGGTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000856207" "0" "70" "22" "51018156" "51018156" "subst" "8.20587E-6" "02329" "CHKB_000051" "g.51018156C>T" "" "" "" "CHKB(NM_005198.5):c.1031G>A (p.R344Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000856208" "0" "30" "22" "51021173" "51021173" "subst" "0.000393811" "01943" "CHKB_000052" "g.51021173G>A" "" "" "" "CHKB(NM_005198.4):c.38C>T (p.A13V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895822" "0" "90" "22" "51020208" "51020208" "del" "0" "02327" "CHKB_000048" "g.51020208del" "" "" "" "CHKB(NM_005198.4):c.419delC (p.P140Qfs*14)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000895823" "0" "30" "22" "51021062" "51021062" "subst" "0.00192959" "01804" "CHKB_000053" "g.51021062T>C" "" "" "" "CHKB(NM_005198.4):c.149A>G (p.(Tyr50Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000918944" "0" "90" "22" "51020764" "51020764" "dup" "0" "03779" "CHKB_000054" "g.51020764dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000922489" "0" "70" "22" "51021062" "51021062" "subst" "0.00192959" "00006" "CHKB_000053" "g.51021062T>C" "" "{PMID:Chen 2022:34906496}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "VUS" "" "0000927226" "0" "30" "22" "51019001" "51019001" "subst" "0.000959677" "01804" "CHKB_000017" "g.51019001T>G" "" "" "" "CHKB(NM_005198.4):c.670A>C (p.(Asn224His), p.N224H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000945981" "3" "90" "22" "51019074" "51019074" "del" "0" "00006" "CHKB_000019" "g.51019074del" "" "{PMID:Westra 2019:31127727}" "" "" "" "Germline" "" "" "0" "" "" "g.50580645del" "" "pathogenic (recessive)" "" "0000970545" "0" "50" "22" "51018801" "51018801" "subst" "1.2182E-5" "02327" "CHKB_000055" "g.51018801T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000989924" "3" "90" "22" "51020243" "51020243" "subst" "0" "00006" "CHKB_000057" "g.51020243C>A" "" "{PMID:Ghasemi 2024:39103847}" "" "" "ACMG PVS1, PS4, PM2, PM3, PP1, PP3" "Germline" "" "" "0" "" "" "g.50581814C>A" "SCV000923677" "pathogenic (recessive)" "ACMG" "0001006260" "0" "30" "22" "51020762" "51020762" "subst" "0.00185723" "02326" "CHKB_000018" "g.51020762G>A" "" "" "" "CHKB(NM_005198.4):c.249C>T (p.F83=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes CHKB ## Count = 85 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000014062" "00001187" "50" "1284" "0" "1284" "0" "c.*96G>C" "r.(=)" "p.(=)" "" "0000062393" "00001187" "10" "333" "10" "333" "10" "c.333+10G>T" "r.(=)" "p.(=)" "" "0000062394" "00001187" "50" "1032" "-71" "1032" "-71" "c.1032-71C>T" "r.(=)" "p.(=)" "" "0000062395" "00001187" "50" "1032" "-72" "1032" "-72" "c.1032-72A>G" "r.(=)" "p.(=)" "" "0000062396" "00001187" "10" "1114" "-29" "1114" "-29" "c.1114-29C>T" "r.(=)" "p.(=)" "" "0000062397" "00001187" "10" "678" "-66" "678" "-66" "c.678-66G>A" "r.(=)" "p.(=)" "" "0000062398" "00001187" "50" "-74" "0" "-55" "0" "c.-74_-55del" "r.(=)" "p.(=)" "" "0000062399" "00001187" "10" "818" "40" "818" "40" "c.818+40T>C" "r.(=)" "p.(=)" "" "0000062400" "00001187" "10" "1404" "0" "1404" "0" "c.*216C>G" "r.(=)" "p.(=)" "" "0000062401" "00001187" "10" "1445" "0" "1445" "0" "c.*257A>G" "r.(=)" "p.(=)" "" "0000062402" "00001187" "10" "1113" "61" "1113" "61" "c.1113+61T>C" "r.(=)" "p.(=)" "" "0000062403" "00001187" "10" "1322" "0" "1322" "0" "c.*134T>C" "r.(=)" "p.(=)" "" "0000079353" "00001187" "90" "-645576" "0" "3835854" "0" "c.-645576_*3834666del" "r.0?" "p.0?" "" "0000249436" "00001187" "30" "501" "0" "501" "0" "c.501T>G" "r.(?)" "p.(Ile167Met)" "" "0000266790" "00001187" "10" "333" "10" "333" "10" "c.333+10G>T" "r.(=)" "p.(=)" "" "0000266791" "00001187" "30" "902" "0" "902" "0" "c.902C>T" "r.(?)" "p.(Thr301Ile)" "" "0000270149" "00001187" "30" "1008" "0" "1008" "0" "c.1008A>T" "r.(?)" "p.(Glu336Asp)" "" "0000270150" "00001187" "30" "670" "0" "670" "0" "c.670A>C" "r.(?)" "p.(Asn224His)" "" "0000270151" "00001187" "30" "983" "0" "983" "0" "c.983A>G" "r.(?)" "p.(Gln328Arg)" "" "0000270574" "00001187" "10" "5944" "0" "5944" "0" "c.*4756C>T" "r.(=)" "p.(=)" "" "0000273530" "00001187" "30" "249" "0" "249" "0" "c.249C>T" "r.(?)" "p.(Phe83=)" "" "0000435763" "00001187" "90" "810" "0" "810" "0" "c.810T>A" "r.(?)" "p.(Tyr270*)" "7" "0000435764" "00001187" "90" "810" "0" "810" "0" "c.810T>A" "r.(?)" "p.(Tyr270*)" "7" "0000435765" "00001187" "90" "810" "0" "810" "0" "c.810T>A" "r.(?)" "p.(Tyr270*)" "7" "0000435766" "00001187" "90" "810" "0" "810" "0" "c.810T>A" "r.(?)" "p.(Tyr270*)" "7" "0000435767" "00001187" "90" "116" "0" "116" "0" "c.116C>A" "r.(?)" "p.(Ser39*)" "1" "0000435768" "00001187" "90" "116" "0" "116" "0" "c.116C>A" "r.(?)" "p.(Ser39*)" "1" "0000435769" "00001187" "90" "458" "0" "458" "0" "c.458dup" "r.(?)" "p.(Leu153Phefs*57)" "3" "0000435770" "00001187" "90" "458" "0" "458" "0" "c.458dup" "r.(?)" "p.(Leu153Phefs*57)" "3" "0000435771" "00001187" "90" "611" "0" "611" "0" "c.611dup" "r.(?)" "p.(Thr205Asnfs*5)" "5" "0000435772" "00001187" "90" "611" "0" "611" "0" "c.611dup" "r.(?)" "p.(Thr205Asnfs*5)" "5" "0000435773" "00001187" "90" "922" "0" "922" "0" "c.922C>T" "r.(?)" "p.(Gln308*)" "8" "0000435774" "00001187" "90" "922" "0" "922" "0" "c.922C>T" "r.(?)" "p.(Gln308*)" "8" "0000435775" "00001187" "90" "847" "0" "847" "0" "c.847G>A" "r.(?)" "p.(Glu283Lys)" "8" "0000435776" "00001187" "90" "847" "0" "847" "0" "c.847G>A" "r.(?)" "p.(Glu283Lys)" "8" "0000435777" "00001187" "90" "1130" "0" "1130" "0" "c.1130G>T" "r.(?)" "p.(Arg377Leu)" "11" "0000435778" "00001187" "90" "1130" "0" "1130" "0" "c.1130G>T" "r.(?)" "p.(Arg377Leu)" "11" "0000435779" "00001187" "90" "554" "0" "562" "0" "c.554_562del" "r.(?)" "p.(Pro185_Trp187del)" "4" "0000435780" "00001187" "90" "554" "0" "562" "0" "c.554_562del" "r.(?)" "p.(Pro185_Trp187del)" "4" "0000435781" "00001187" "90" "677" "1" "677" "1" "c.677+1G>A" "r.spl?" "p.?" "5i" "0000435782" "00001187" "90" "677" "1" "677" "1" "c.677+1G>A" "r.spl?" "p.?" "5i" "0000435783" "00001187" "90" "677" "1" "677" "1" "c.677+1G>A" "r.spl?" "p.?" "5i" "0000435784" "00001187" "90" "677" "1" "677" "1" "c.677+1G>A" "r.spl?" "p.?" "5i" "0000435785" "00001187" "90" "677" "1" "677" "1" "c.677+1G>A" "r.spl?" "p.?" "5i" "0000435786" "00001187" "90" "677" "1" "677" "1" "c.677+1G>A" "r.spl?" "p.?" "5i" "0000435787" "00001187" "90" "1031" "1" "1031" "1" "c.1031+1G>A" "r.[819_1031del, 928_1031del, 678_1031del, 968_1031del]" "p.[Gly274_Arg344del, Leu310Valfs*84, Lys227_Arg344del, Glu324Metfs*22]" "9i" "0000435788" "00001187" "90" "1031" "1" "1031" "1" "c.1031+1G>A" "r.[819_1031del, 928_1031del, 678_1031del, 968_1031del]" "p.[Gly274_Arg344del, Leu310Valfs*84, Lys227_Arg344del, Glu324Metfs*22]" "9i" "0000435789" "00001187" "90" "1031" "1" "1031" "1" "c.1031+1G>A" "r.spl?" "p.?" "9i" "0000435790" "00001187" "90" "1031" "1" "1031" "1" "c.1031+1G>A" "r.spl?" "p.?" "9i" "0000435791" "00001187" "90" "852" "0" "859" "0" "c.852_859del" "r.(?)" "p.(Trp284*)" "8" "0000435792" "00001187" "90" "852" "0" "859" "0" "c.852_859del" "r.(?)" "p.(Trp284*)" "8" "0000435793" "00001187" "90" "422" "0" "1031" "1" "c.(422_(1031+1_1032-1)del)" "r.del" "p.fs*" "3_9i" "0000435794" "00001187" "90" "847" "0" "847" "0" "c.847G>A" "r.(?)" "p.(Glu283Lys)" "8" "0000435795" "00001187" "90" "1130" "0" "1130" "0" "c.1130G>T" "r.(?)" "p.(Arg377Leu)" "11" "0000435796" "00001187" "90" "554" "0" "562" "0" "c.554_562del" "r.(?)" "p.(Pro185_Trp187del)" "4" "0000572406" "00001187" "50" "1031" "3" "1031" "3" "c.1031+3G>C" "r.spl?" "p.?" "" "0000572408" "00001187" "90" "817" "0" "817" "0" "c.817del" "r.(?)" "p.(Arg273GlyfsTer68)" "" "0000572411" "00001187" "50" "439" "0" "439" "0" "c.439T>G" "r.(?)" "p.(Tyr147Asp)" "" "0000618653" "00001187" "10" "3317" "0" "3317" "0" "c.*2129C>T" "r.(=)" "p.(=)" "" "0000618654" "00001187" "30" "980" "0" "980" "0" "c.980C>T" "r.(?)" "p.(Ser327Phe)" "" "0000618655" "00001187" "30" "457" "0" "457" "0" "c.457T>C" "r.(?)" "p.(Leu153=)" "" "0000618656" "00001187" "30" "214" "0" "214" "0" "c.214T>C" "r.(?)" "p.(Tyr72His)" "" "0000618657" "00001187" "30" "64" "0" "64" "0" "c.64G>A" "r.(?)" "p.(Gly22Ser)" "" "0000629660" "00001187" "70" "682" "0" "683" "0" "c.682_683dup" "r.(?)" "p.(Leu228Phefs*3)" "" "0000658987" "00001187" "10" "5944" "0" "5944" "0" "c.*4756C>T" "r.(=)" "p.(=)" "" "0000658988" "00001187" "10" "2438" "0" "2438" "0" "c.*1250C>T" "r.(=)" "p.(=)" "" "0000658989" "00001187" "30" "333" "6" "333" "6" "c.333+6G>A" "r.(=)" "p.(=)" "" "0000681941" "00001187" "50" "263" "0" "263" "0" "c.263C>T" "r.(?)" "p.(Pro88Leu)" "" "0000728230" "00001187" "30" "983" "0" "983" "0" "c.983A>G" "r.(?)" "p.(Gln328Arg)" "" "0000728231" "00001187" "70" "475" "0" "475" "0" "c.475C>T" "r.(?)" "p.(Arg159Ter)" "" "0000809683" "00001187" "50" "788" "0" "790" "0" "c.788_790del" "r.(?)" "p.(Val263del)" "" "0000809684" "00001187" "90" "419" "0" "419" "0" "c.419del" "r.(?)" "p.(Pro140Glnfs*14)" "" "0000823845" "00001187" "90" "517" "0" "529" "0" "c.517_529del" "r.(?)" "p.(Gln173TrpfsTer20)" "4" "0000856206" "00001187" "70" "1114" "-11" "1133" "0" "c.1114-11_1133del" "r.spl?" "p.?" "" "0000856207" "00001187" "70" "1031" "0" "1031" "0" "c.1031G>A" "r.(?)" "p.(Arg344Gln)" "" "0000856208" "00001187" "30" "38" "0" "38" "0" "c.38C>T" "r.(?)" "p.(Ala13Val)" "" "0000895822" "00001187" "90" "419" "0" "419" "0" "c.419del" "r.(?)" "p.(Pro140Glnfs*14)" "" "0000895823" "00001187" "30" "149" "0" "149" "0" "c.149A>G" "r.(?)" "p.(Tyr50Cys)" "" "0000918944" "00001187" "90" "248" "0" "248" "0" "c.248dup" "r.(?)" "p.(Arg84ProfsTer126)" "" "0000922489" "00001187" "70" "149" "0" "149" "0" "c.149A>G" "r.(?)" "p.(Tyr50Cys)" "" "0000927226" "00001187" "30" "670" "0" "670" "0" "c.670A>C" "r.(?)" "p.(Asn224His)" "" "0000945981" "00001187" "90" "598" "0" "598" "0" "c.598del" "r.(?)" "p.(Gln200ArgfsTer11)" "" "0000970545" "00001187" "50" "722" "0" "722" "0" "c.722A>G" "r.(?)" "p.(Asn241Ser)" "" "0000989924" "00001187" "90" "382" "0" "382" "0" "c.382G>T" "r.(?)" "p.(Glu128*)" "" "0001006260" "00001187" "30" "249" "0" "249" "0" "c.249C>T" "r.(?)" "p.(Phe83=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 49 "{{screeningid}}" "{{variantid}}" "0000000210" "0000014062" "0000035274" "0000062393" "0000035275" "0000062394" "0000035276" "0000062395" "0000035277" "0000062396" "0000035278" "0000062397" "0000035279" "0000062398" "0000035280" "0000062399" "0000035281" "0000062400" "0000035282" "0000062401" "0000035283" "0000062402" "0000035284" "0000062403" "0000050373" "0000079353" "0000206305" "0000435763" "0000206305" "0000435764" "0000206306" "0000435765" "0000206306" "0000435766" "0000206307" "0000435767" "0000206307" "0000435769" "0000206308" "0000435768" "0000206308" "0000435770" "0000206309" "0000435771" "0000206309" "0000435772" "0000206310" "0000435773" "0000206310" "0000435774" "0000206311" "0000435775" "0000206311" "0000435776" "0000206312" "0000435777" "0000206312" "0000435778" "0000206313" "0000435779" "0000206313" "0000435780" "0000206314" "0000435781" "0000206314" "0000435782" "0000206315" "0000435783" "0000206315" "0000435784" "0000206316" "0000435785" "0000206316" "0000435786" "0000206317" "0000435787" "0000206317" "0000435788" "0000206318" "0000435789" "0000206318" "0000435790" "0000206319" "0000435791" "0000206319" "0000435792" "0000206320" "0000435793" "0000275596" "0000629660" "0000393182" "0000823845" "0000436130" "0000922489" "0000444124" "0000945981" "0000454964" "0000989924"