### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = CLN3)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"CLN3" "ceroid-lipofuscinosis, neuronal 3" "16" "p12" "unknown" "NG_008654.2" "UD_132118257487" "{PMID:Kousi 2012:21990111}" "https://www.LOVD.nl/CLN3" "" "1" "2074" "1201" "607042" "1" "1" "1" "1" "An NCL gene variant database.\r\nEstablishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project.\r\nThis database was initially part of the Finnish Disease Resource (FinDis; Polvi 2013: Hum Mutat. 34: 1458-1466). We gratefully acknowledge the support of Juha Muilu acting as curator until 2015." "" "g" "http://databases.lovd.nl/shared/refseq/CLN3_codingDNA.html" "1" "" "
An NCL gene variant database\r\n
" "-1" "" "-1" "00002" "2011-04-05 00:00:00" "00006" "2019-07-21 20:25:02" "00006" "2025-11-18 12:45:55"
## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00000010" "CLN3" "ceroid-lipofuscinosis, neuronal 3, transcript variant 1" "001" "NM_001042432.1" "" "NP_001035897.1" "" "" "" "-359" "1554" "1317" "28503623" "28488600" "00002" "2012-05-11 13:11:49" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 12
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00058" "CORD" "dystrophy, cone-rod (CORD)" "" "" "" "" "" "00006" "2012-09-22 11:31:25" "00006" "2020-08-30 09:43:59"
"00068" "CLN3" "lipofuscinosis, ceroid, neuronal, type 3 (CLN3)" "AR" "204200" "" "" "" "00015" "2012-11-02 14:26:43" "00006" "2021-01-18 10:01:26"
"00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26"
"00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49"
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"00381" "RD" "dystrophy, retinal (RD)" "" "" "" "" "" "00006" "2014-05-09 11:59:52" "00006" "2015-12-07 07:11:25"
"04211" "RPar" "retinitis pigmentosa, autosomal recessive (RPar)" "" "" "" "" "" "00006" "2015-02-27 18:58:57" "" ""
"04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26"
"04215" "STGD" "Stargardt disease (STGD)" "" "" "" "" "" "00006" "2015-02-27 20:01:12" "" ""
"04249" "macular dystrophy" "dystrophy, macular" "" "" "" "" "" "00006" "2015-05-04 22:10:58" "00006" "2024-02-15 21:18:39"
"05258" "CLN" "lipofuscinosis, ceroid, neuronal (CLN)" "" "" "" "" "" "00006" "2017-04-03 15:00:30" "00006" "2017-04-04 08:43:07"
"06906" "DEE" "encephalopathy, developmental and epileptic" "" "" "" "" "" "00006" "2022-04-07 09:24:23" "" ""
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}" "{{diseaseid}}"
"CLN3" "00068"
"CLN3" "05258"
## Individuals ## Do not remove or alter this header ##
## Count = 618
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00000009" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" ""
"00000010" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" ""
"00000028" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" ""
"00000062" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" ""
"00000102" "" "" "" "1" "" "00004" "{PMID:Almomani 2011:21102627}" "" "" "" "" "" "" "" "" "" ""
"00000107" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" ""
"00001827" "" "" "" "1" "" "00102" "" "" "" "" "(United States)" "" "0" "" "" "" ""
"00050458" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" ""
"00050683" "" "" "" "2" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, affected sibling(s)" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" ""
"00113858" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "IBDC screened 81 patients, of which 46 were homoz for the 1 kb del, and 24 were het for 1 kb, with 11 not defined genetically. These data were incoporated into Munroe et al 1997a." "" "" "" "" "0" "" "" "" "7553855-?"
"00113859" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113860" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113861" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113862" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113863" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113864" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113865" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113866" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113867" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113868" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113869" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113870" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113871" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113872" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113873" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113874" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113875" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113876" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113877" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113878" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113879" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113880" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113881" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113882" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113883" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113884" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113885" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113886" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113887" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113888" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113889" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113890" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113891" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113892" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113893" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113894" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113895" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113896" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113897" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113898" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113899" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113900" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113901" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113902" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113903" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "7553855-?"
"00113904" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113905" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113906" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113907" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113908" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113909" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113910" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113911" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113912" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113913" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113914" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113915" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113916" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113917" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113918" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113919" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113920" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113921" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113922" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113923" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113924" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113925" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113926" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113927" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113928" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113929" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113930" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113931" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113932" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113933" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113934" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113935" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113936" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113937" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113938" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113939" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113940" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113941" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113942" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113943" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113944" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113945" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113946" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113947" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113948" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113949" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113950" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113951" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113952" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113953" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113954" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113955" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113956" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113957" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113958" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113959" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113960" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113961" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113962" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113963" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113964" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113965" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113966" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113967" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113968" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113969" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113970" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113971" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113972" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113973" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113974" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113975" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113976" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113977" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113978" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113979" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113980" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113981" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113982" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113983" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113984" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113985" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113986" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113987" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113988" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113989" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113990" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113991" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113992" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113993" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113994" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113995" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113996" "" "" "" "1" "" "00006" "{PMID:D. Zafeirou:}, {DB:CLN}" "" "" "" "Greece" "" "0" "" "" "Albanian" "-?"
"00113997" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "9311735-?"
"00113998" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Munroe 1997 Lauronen 1999:7553855, 9311735, 9932957}, {DB:CLN}" "" "" "" "Finland" "" "0" "" "" "" "7553855, 9311735, 9932957-?"
"00113999" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Munroe 1997 Lauronen 1999:7553855, 9311735, 9932957}, {DB:CLN}" "" "" "" "Finland" "" "0" "" "" "" "7553855, 9311735, 9932957-?"
"00114000" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Munroe 1997 Lauronen 1999:7553855, 9311735, 9932957}, {DB:CLN}" "" "" "" "Finland" "" "0" "" "" "" "7553855, 9311735, 9932957-?"
"00114001" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Munroe 1997 Lauronen 1999:7553855, 9311735, 9932957}, {DB:CLN}" "" "" "" "Finland" "" "0" "" "" "" "7553855, 9311735, 9932957-?"
"00114002" "" "" "" "1" "" "00006" "{PMID:IBDC 1995:7553855}, {DB:CLN}" "" "" "" "Morocco" "" "0" "" "" "" "7553855-?"
"00114003" "" "" "" "1" "" "00006" "{PMID:IBDC 1995:7553855}, {DB:CLN}" "" "" "" "Morocco" "" "0" "" "" "" "7553855-?"
"00114004" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "9311735-?"
"00114005" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "9311735-?"
"00114006" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "9311735-?"
"00114007" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "9311735-?"
"00114008" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114009" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114010" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Sweden" "" "0" "" "" "" "9311735-?"
"00114011" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Sweden" "" "0" "" "" "" "9311735-?"
"00114012" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Denmark" "" "0" "" "" "" "9311735-?"
"00114013" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Denmark" "" "0" "" "" "" "9311735-?"
"00114014" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "Siblings" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "9311735-?"
"00114015" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "Siblings" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "9311735-?"
"00114016" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "9311735-?"
"00114017" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "9311735-?"
"00114018" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Italy" "" "0" "" "" "" "9311735-?"
"00114019" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Munroe 1997 Lauronen 1999:7553855, 9311735, 9932957}, {DB:CLN}" "" "" "" "Finland" "" "0" "" "" "" "7553855, 9311735, 9932957-?"
"00114020" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Munroe 1997 Lauronen 1999:7553855, 9311735, 9932957}, {DB:CLN}" "" "" "" "Finland" "" "0" "" "" "" "7553855, 9311735, 9932957-?"
"00114021" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Denmark" "" "0" "" "" "" "9311735-?"
"00114022" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Denmark" "" "0" "" "" "" "9311735-?"
"00114023" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Norway" "" "0" "" "" "" "9311735-?"
"00114024" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Norway" "" "0" "" "" "" "9311735-?"
"00114025" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "9311735-?"
"00114026" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "9311735-?"
"00114027" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "9311735-?"
"00114028" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "9311735-?"
"00114029" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "9311735-?"
"00114030" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "9311735-?"
"00114031" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Finland" "" "0" "" "" "" "9311735-?"
"00114032" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Finland" "" "0" "" "" "" "9311735-?"
"00114033" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "9311735-?"
"00114034" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "9311735-?"
"00114035" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Germany" "" "0" "" "" "" "9311735-?"
"00114036" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Germany" "" "0" "" "" "" "9311735-?"
"00114037" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114038" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114039" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "9311735-?"
"00114040" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "9311735-?"
"00114041" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114042" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114043" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "Siblings" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114044" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "Siblings" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114045" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114046" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114047" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114048" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114049" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "9311735-?"
"00114050" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "9311735-?"
"00114051" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "9311735-?"
"00114052" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "9311735-?"
"00114053" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "9311735-?"
"00114054" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114055" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114056" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114057" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114058" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Italy" "" "0" "" "" "" "9311735-?"
"00114059" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "9311735-?"
"00114060" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Italy" "" "0" "" "" "" "9311735-?"
"00114061" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Italy" "" "0" "" "" "" "9311735-?"
"00114062" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Iceland" "" "0" "" "" "" "9311735-?"
"00114063" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "Iceland" "" "0" "" "" "" "9311735-?"
"00114064" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114065" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9311735-?"
"00114066" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735-?"
"00114067" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735-?"
"00114068" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735-?"
"00114069" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735-?"
"00114070" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735-?"
"00114071" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735-?"
"00114072" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735-?"
"00114073" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735-?"
"00114074" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735-?"
"00114075" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735-?"
"00114076" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735-?"
"00114077" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735-?"
"00114078" "" "" "" "1" "" "00006" "{PMID:Munroe 1997 Eksandh 2000:9311735, 10916181}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735, 10916181-?"
"00114079" "" "" "" "1" "" "00006" "{PMID:Munroe 1997 Eksandh 2000:9311735, 10916181}, {DB:CLN}" "variant 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735, 10916181-?"
"00114080" "" "" "" "1" "" "00006" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "variant 1st and 2nd allele not identified" "" "" "" "" "0" "" "" "" "9311735-?"
"00114081" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "Siblings; 2.8 kb deletion where D16S298 not deleted" "" "" "Finland" "" "0" "" "" "" "7553855, 9932957-?"
"00114082" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "Siblings; 2.8 kb deletion where D16S298 not deleted" "" "" "Finland" "" "0" "" "" "" "7553855, 9932957-?"
"00114083" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "2.8 kb deletion where D16S298 not deleted" "" "" "Finland" "" "0" "" "" "" "7553855, 9932957-?"
"00114084" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "2.8 kb deletion where D16S298 not deleted" "" "" "Finland" "" "0" "" "" "" "7553855, 9932957-?"
"00114085" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "2.8 kb deletion where D16S298 not deleted" "" "" "Finland" "" "0" "" "" "" "7553855, 9932957-?"
"00114086" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "2.8 kb deletion where D16S298 not deleted" "" "" "Finland" "" "0" "" "" "" "7553855, 9932957-?"
"00114087" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "Siblings; 2.8 kb deletion where D16S298 not deleted" "" "" "Finland" "" "0" "" "" "" "7553855, 9932957-?"
"00114088" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "Siblings; 2.8 kb deletion where D16S298 not deleted" "" "" "Finland" "" "0" "" "" "" "7553855, 9932957-?"
"00114089" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "2.8 kb deletion where D16S298 not deleted" "" "" "Finland" "" "0" "" "" "" "7553855, 9932957-?"
"00114090" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "2.8 kb deletion where D16S298 not deleted" "" "" "Finland" "" "0" "" "" "" "7553855, 9932957-?"
"00114091" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "2.8 kb deletion where D16S298 not deleted" "" "" "Finland" "" "0" "" "" "" "7553855, 9932957-?"
"00114092" "" "" "" "1" "" "00006" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "2.8 kb deletion where D16S298 not deleted" "" "" "Finland" "" "0" "" "" "" "7553855, 9932957-?"
"00114093" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114094" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114095" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114096" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114097" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114098" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114099" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114100" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114101" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114102" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114103" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114104" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114105" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114106" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114107" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114108" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114109" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114110" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114111" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114112" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114113" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114114" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114115" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114116" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114117" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114118" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114119" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114120" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114121" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114122" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114123" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114124" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114125" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114126" "" "" "" "1" "" "00006" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "9490299-?"
"00114127" "" "" "" "1" "" "00006" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "Sibs; Munroe; variant 2nd allele not identified" "" "" "Sweden" "" "0" "" "" "" "10916181-?"
"00114128" "" "" "" "1" "" "00006" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "Sibs; Munroe;" "" "" "Sweden" "" "0" "" "" "" "10916181-?"
"00114129" "" "" "" "1" "" "00006" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "" "" "" "Sweden" "" "0" "" "" "" "10916181-?"
"00114130" "" "" "" "1" "" "00006" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Sweden" "" "0" "" "" "" "10916181-?"
"00114131" "" "" "" "1" "" "00006" "{PMID:Bensaoula 2000:10964839}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "10964839-?"
"00114132" "" "" "" "1" "" "00006" "{PMID:Bensaoula 2000:10964839}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "10964839-?"
"00114133" "" "" "" "1" "" "00006" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "" "" "" "Sweden" "" "0" "" "" "" "10916181-?"
"00114134" "" "" "" "1" "" "00006" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "" "" "" "Sweden" "" "0" "" "" "" "10916181-?"
"00114135" "" "" "" "1" "" "00006" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "" "" "" "Sweden" "" "0" "" "" "" "10916181-?"
"00114136" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114137" "" "" "" "1" "" "00006" "{PMID:Pebrel-Richard 2014:23860047}, {DB:CLN}" "hemizygous 16p11.2 microdeletion unmasks 1kb mutation in CLN3" "" "" "France" "" "0" "" "" "" "23860047-?"
"00114138" "" "" "" "1" "" "00006" "{PMID:Pebrel-Richard 2014:23860047}, {DB:CLN}" "hemizygous 16p11.2 microdeletion unmasks 1kb mutation in CLN3" "" "" "France" "" "0" "" "" "" "23860047-?"
"00114139" "" "" "" "1" "" "00006" "{PMID:Drack 2013:23877479}, {DB:CLN}" "variant 2nd allele 1kb deletion" "" "" "United States" "" "0" "" "" "" "23877479-?"
"00114140" "" "" "" "1" "" "00006" "{PMID:Drack 2013:23877479}, {DB:CLN}" "variant 2nd allele 1kb deletion" "" "" "United States" "" "0" "" "" "" "23877479-?"
"00114141" "" "" "" "1" "" "00006" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "Sibs" "" "" "Portugal" "" "0" "" "" "" "12796825-?"
"00114142" "" "" "" "1" "" "00006" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "" "" "Portugal" "" "0" "" "" "" "12796825-?"
"00114143" "" "" "" "1" "" "00006" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "Sibs" "" "" "Portugal" "" "0" "" "" "" "12796825-?"
"00114144" "" "" "" "1" "" "00006" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "" "" "Portugal" "" "0" "" "" "" "12796825-?"
"00114145" "" "" "" "1" "" "00006" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "" "" "Portugal" "" "0" "" "" "" "12796825-?"
"00114146" "" "" "" "1" "" "00006" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "" "" "Portugal" "" "0" "" "" "" "12796825-?"
"00114147" "" "" "" "1" "" "00006" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "" "" "Portugal" "" "0" "" "" "" "12796825-?"
"00114148" "" "" "" "1" "" "00006" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "" "" "Portugal" "" "0" "" "" "" "12796825-?"
"00114149" "" "" "" "1" "" "00006" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Portugal" "" "0" "" "" "" "12796825-?"
"00114150" "" "" "" "1" "" "00006" "{PMID:Teixeira 2003b Bessa 2006:12796825, 16814585}, {DB:CLN}" "" "" "" "Portugal" "" "0" "" "" "" "12796825, 16814585-?"
"00114151" "" "" "" "1" "" "00006" "{PMID:Teixeira 2003b Bessa 2006:12796825, 16814585}, {DB:CLN}" "" "" "" "Portugal" "" "0" "" "" "" "12796825, 16814585-?"
"00114152" "" "" "" "1" "" "00006" "{PMID:Teixeira 2003b Bessa 2006:12796825, 16814585}, {DB:CLN}" "" "" "" "Portugal" "" "0" "" "" "" "12796825, 16814585-?"
"00114153" "" "" "" "1" "" "00006" "{PMID:Teixeira 2003b Bessa 2006:12796825, 16814585}, {DB:CLN}" "" "" "" "Portugal" "" "0" "" "" "" "12796825, 16814585-?"
"00114154" "" "" "" "1" "" "00006" "{PMID:de los Reyes 2004:15032383}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "15032383-?"
"00114155" "" "" "" "1" "" "00006" "{PMID:Leman 2005:15991331}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "15991331-?"
"00114156" "" "" "" "1" "" "00006" "{PMID:Leman 2005:15991331}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "15991331-?"
"00114157" "" "" "" "1" "" "00006" "{PMID:Kwon 2005:16087292}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "16087292-?"
"00114158" "" "" "" "1" "" "00006" "{PMID:Kwon 2005:16087292}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "16087292-?"
"00114159" "" "" "" "1" "" "00006" "{PMID:Moore 2008:18684116}, {DB:CLN}" "sibs" "" "" "Canada" "" "0" "" "" "Newfoundlander" "18684116-?"
"00114160" "" "" "" "1" "" "00006" "{PMID:Moore 2008:18684116}, {DB:CLN}" "" "" "" "Canada" "" "0" "" "" "Newfoundlander" "18684116-?"
"00114161" "" "" "" "1" "" "00006" "{PMID:Moore 2008:18684116}, {DB:CLN}" "" "" "" "Canada" "" "0" "" "" "Newfoundlander" "18684116-?"
"00114162" "" "" "" "1" "" "00006" "{PMID:Sarpong 2009:19489875}, {DB:CLN}" "sibs" "" "" "Lebanon" "" "0" "" "" "" "19489875-?"
"00114163" "" "" "" "1" "" "00006" "{PMID:Sarpong 2009:19489875}, {DB:CLN}" "" "" "" "Lebanon" "" "0" "" "" "" "19489875-?"
"00114164" "" "" "" "1" "" "00006" "{PMID:Sarpong 2009:19489875}, {DB:CLN}" "" "" "" "Lebanon" "" "0" "" "" "" "19489875-?"
"00114165" "" "" "" "1" "" "00006" "{PMID:Sarpong 2009:19489875}, {DB:CLN}" "" "" "" "Lebanon" "" "0" "" "" "" "19489875-?"
"00114166" "" "" "" "1" "" "00006" "{PMID:Sarpong 2009:19489875}, {DB:CLN}" "" "" "" "Lebanon" "" "0" "" "" "" "19489875-?"
"00114167" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114168" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114169" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114170" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114171" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114172" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114173" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114174" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114175" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114176" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114177" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114178" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114179" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114180" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114181" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114182" "" "" "" "1" "" "00006" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21499717-?"
"00114183" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Brazil" "" "0" "" "" "" "21990111-?"
"00114184" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Argentina" "" "0" "" "" "" "21990111-?"
"00114185" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Argentina" "" "0" "" "" "" "21990111-?"
"00114186" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Argentina" "" "0" "" "" "" "21990111-?"
"00114187" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Argentina" "" "0" "" "" "" "21990111-?"
"00114188" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21990111-?"
"00114189" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Spain" "" "0" "" "" "" "21990111-?"
"00114190" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Portugal" "" "0" "" "" "" "21990111-?"
"00114191" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Portugal" "" "0" "" "" "" "21990111-?"
"00114192" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Germany" "" "0" "" "" "" "21990111-?"
"00114193" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Germany" "" "0" "" "" "" "21990111-?"
"00114194" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Czech Republic" "" "0" "" "" "" "21990111-?"
"00114195" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Czech Republic" "" "0" "" "" "" "21990111-?"
"00114196" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Czech Republic" "" "0" "" "" "" "21990111-?"
"00114197" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114198" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Italy" "" "0" "" "" "" "21990111-?"
"00114199" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Italy" "" "0" "" "" "" "21990111-?"
"00114200" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Italy" "" "0" "" "" "" "21990111-?"
"00114201" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Italy" "" "0" "" "" "" "21990111-?"
"00114202" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "Sibs" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114203" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114204" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114205" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114206" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114207" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114208" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114209" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114210" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114211" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114212" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114213" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114214" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "Sibs" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114215" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114216" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "Sibs" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114217" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114218" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114219" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114220" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114221" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114222" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114223" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114224" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114225" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114226" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114227" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114228" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114229" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114230" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114231" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114232" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114233" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114234" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114235" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114236" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114237" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Turkey" "" "0" "" "" "" "21990111-?"
"00114238" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Turkey" "" "0" "" "" "" "21990111-?"
"00114239" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114240" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114241" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114242" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114243" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114244" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114245" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114246" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114247" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114248" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114249" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114250" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114251" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114252" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "21990111-?"
"00114253" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "21990111-?"
"00114254" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Belgium" "" "0" "" "" "" "21990111-?"
"00114255" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Belgium" "" "0" "" "" "" "21990111-?"
"00114256" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114257" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "21990111-?"
"00114258" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "21990111-?"
"00114259" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "21990111-?"
"00114260" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "21990111-?"
"00114261" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "21990111-?"
"00114262" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "21990111-?"
"00114263" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Sweden" "" "0" "" "" "" "21990111-?"
"00114264" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "splice defect" "" "" "Sweden" "" "0" "" "" "" "21990111-?"
"00114265" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "splice defect" "" "" "Norway" "" "0" "" "" "" "21990111-?"
"00114266" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Norway" "" "0" "" "" "" "21990111-?"
"00114267" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "21990111-?"
"00114268" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "21990111-?"
"00114269" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Belgium" "" "0" "" "" "" "21990111-?"
"00114270" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Belgium" "" "0" "" "" "" "21990111-?"
"00114271" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114272" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114273" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Canada" "" "0" "" "" "" "21990111-?"
"00114274" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Canada" "" "0" "" "" "" "21990111-?"
"00114275" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Canada" "" "0" "" "" "" "21990111-?"
"00114276" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Canada" "" "0" "" "" "" "21990111-?"
"00114277" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Canada" "" "0" "" "" "" "21990111-?"
"00114278" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Canada" "" "0" "" "" "" "21990111-?"
"00114279" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Canada" "" "0" "" "" "" "21990111-?"
"00114280" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Canada" "" "0" "" "" "" "21990111-?"
"00114281" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Canada" "" "0" "" "" "" "21990111-?"
"00114282" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Canada" "" "0" "" "" "" "21990111-?"
"00114283" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114284" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114285" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "France" "" "0" "" "" "" "21990111-?"
"00114286" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "France" "" "0" "" "" "" "21990111-?"
"00114287" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Turkey" "" "0" "" "" "" "21990111-?"
"00114288" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Belgium" "" "0" "" "" "" "21990111-?"
"00114289" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Germany" "" "0" "" "" "" "21990111-?"
"00114290" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Ireland" "" "0" "" "" "" "21990111-?"
"00114291" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Italy" "" "0" "" "" "" "21990111-?"
"00114292" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "France" "" "0" "" "" "" "21990111-?"
"00114293" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Italy" "" "0" "" "" "" "21990111-?"
"00114294" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114295" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114296" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Norway" "" "0" "" "" "" "21990111-?"
"00114297" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Norway" "" "0" "" "" "" "21990111-?"
"00114298" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Sweden" "" "0" "" "" "" "21990111-?"
"00114299" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Russia" "" "0" "" "" "" "21990111-?"
"00114300" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Russia" "" "0" "" "" "" "21990111-?"
"00114301" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Russia" "" "0" "" "" "" "21990111-?"
"00114302" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Russia" "" "0" "" "" "" "21990111-?"
"00114303" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Portugal" "" "0" "" "" "" "21990111-?"
"00114304" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Portugal" "" "0" "" "" "" "21990111-?"
"00114305" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114306" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114307" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114308" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Russia" "" "0" "" "" "" "21990111-?"
"00114309" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114310" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114311" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114312" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Netherlands" "" "0" "" "" "" "21990111-?"
"00114313" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Italy" "" "0" "" "" "" "21990111-?"
"00114314" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114315" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114316" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114317" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "United States" "" "0" "" "" "" "21990111-?"
"00114318" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "21990111-?"
"00114319" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified; splice defect" "" "" "Netherlands" "" "0" "" "" "" "21990111-?"
"00114320" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Russia" "" "0" "" "" "" "21990111-?"
"00114321" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Greece" "" "0" "" "" "" "21990111-?"
"00114322" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "variant 2nd allele not identified" "" "" "Portugal" "" "0" "" "" "" "21990111-?"
"00114323" "" "" "" "1" "" "00006" "{PMID:Mole 2001:11589012}, {DB:CLN}" "" "" "" "Turkey" "" "0" "" "" "" "11589012-?"
"00114324" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Turkey" "" "0" "" "" "" "21990111-?"
"00114325" "" "" "" "1" "" "00006" "{PMID:Mole 2001:11589012}, {DB:CLN}" "" "" "" "Netherlands" "" "0" "" "" "" "11589012-?"
"00114326" "" "" "" "1" "" "00006" "{PMID:Mole 2001:11589012}, {DB:CLN}" "" "" "" "" "" "0" "" "" "" "11589012-?"
"00114327" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Turkey" "" "0" "" "" "" "21990111-?"
"00114328" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Turkey" "" "0" "" "" "" "21990111-?"
"00114329" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Turkey" "" "0" "" "" "" "21990111-?"
"00114330" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Turkey" "" "0" "" "" "" "21990111-?"
"00114331" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Turkey" "" "0" "" "" "" "21990111-?"
"00114332" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "siblings" "" "" "Turkey" "" "0" "" "" "" "21990111-?"
"00114333" "" "" "" "1" "" "00006" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "" "" "Turkey" "" "0" "" "" "" "21990111-?"
"00114334" "" "" "" "1" "" "00006" "{PMID:Wisniewski 1998b:9450775}, {DB:CLN}" "Sibs" "" "" "Germany; Netherlands" "" "0" "" "" "" "9450775-?"
"00114335" "" "" "" "1" "" "00006" "{PMID:Wisniewski 1998b:9450775}, {DB:CLN}" "Sibs" "" "" "Germany; Netherlands" "" "0" "" "" "" "9450775-?"
"00114336" "" "" "" "1" "" "00006" "{PMID:Coppieters 2014:24625443}, {DB:CLN}" "see paper" "" "yes" "" "" "0" "" "" "" "Fam14"
"00114337" "" "" "" "1" "" "00006" "{PMID:Cortese 2014:24827497}, {DB:CLN}" "siblings; late onset seizures 7 heart failure ~40y" "" "" "Italy" "" "0" "" "" "Italian" "24827497-?"
"00114338" "" "" "" "1" "" "00006" "{PMID:Cortese 2014:24827497}, {DB:CLN}" "" "" "" "Italy" "" "0" "" "" "Italian" "24827497-?"
"00114339" "" "" "" "1" "" "00006" "{PMID:Wang 2014:24154662}, {DB:CLN}" "siblings; only blindness at 45y" "" "" "Italy" "" "0" "" "" "Sicilian" "24154662-?"
"00114341" "" "" "" "1" "" "00006" "{PMID:Wang 2014:24154662}, {DB:CLN}" "only blindness at 40y" "" "" "Italy" "" "0" "" "" "Sicilian" "24154662-?"
"00114343" "" "" "" "1" "" "00006" "{PMID:Wang 2014:24154662}, {DB:CLN}" "siblings; only blindness at 50-60y" "" "" "Canada" "" "0" "" "" "Mohawk" "24154662-?"
"00114344" "" "" "" "1" "" "00006" "{PMID:Wang 2014:24154662}, {DB:CLN}" "only blindness at 50-60y" "" "" "Canada" "" "0" "" "" "Mohawk" "24154662-?"
"00114345" "" "" "" "1" "" "00006" "{PMID:Wang 2014:24154662}, {DB:CLN}" "only blindness at 50-60y" "" "" "Canada" "" "0" "" "" "Mohawk" "24154662-?"
"00114346" "" "" "" "1" "" "00006" "{PMID:Wang 2014:24154662}, {DB:CLN}" "cousin; only blindness at 50-60y" "" "" "Canada" "" "0" "" "" "Mohawk" "24154662-?"
"00114347" "" "" "" "1" "" "00006" "{PMID:Wang 2014:24154662}, {DB:CLN}" "siblings; only blindness at 57y" "" "" "Mexico" "" "0" "" "" "" "24154662-?"
"00114349" "" "" "" "1" "" "00006" "{PMID:Wang 2014:24154662}, {DB:CLN}" "only blindness at 50-60y" "" "" "Mexico" "" "0" "" "" "" "24154662-?"
"00114351" "" "" "" "1" "" "00006" "{PMID:Wang 2014:24154662}, {DB:CLN}" "only blindness at 10y" "" "" "Mexico" "" "0" "" "" "" "24154662-?"
"00114352" "" "" "" "1" "" "00006" "{PMID:Wang 2014:24154662}, {DB:CLN}" "siblings; only blindness at 20y" "" "" "China" "" "0" "" "" "" "24154662-?"
"00114354" "" "" "" "1" "" "00006" "{PMID:Wang 2014:24154662}, {DB:CLN}" "only blindness at 20y" "" "" "China" "" "0" "" "" "" "24154662-?"
"00114356" "" "" "" "1" "" "00006" "A Moore, {DB:CLN}" "only blindness at 35y" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "-?"
"00114357" "" "" "" "1" "" "00006" "{PMID:Wisniewski 1998b:9450775}, {DB:CLN}" "" "" "" "Germany; Netherlands" "" "0" "" "" "" "9450775-?"
"00114358" "" "" "" "1" "" "00006" "{PMID:Wisniewski 1998b:9450775}, {DB:CLN}" "" "" "" "Germany; Netherlands" "" "0" "" "" "" "9450775-?"
"00114359" "" "" "" "1" "" "00006" "R Williams, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "-?"
"00114360" "" "" "" "1" "" "00006" "R Williams, {DB:CLN}" "siblings" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "-?"
"00114361" "" "" "" "1" "" "00006" "R Williams, {DB:CLN}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "-?"
"00240431" "" "" "" "1" "" "03335" "" "" "F" "" "Mexico" "" "0" "" "" "" ""
"00274199" "" "" "" "1" "" "00006" "{PMID:Pronicka 2016:27290639}" "" "M" "" "Poland" "" "0" "" "" "" "Pat88"
"00291436" "" "" "" "5" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00291437" "" "" "" "5" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00307881" "" "" "" "1" "" "03765" "" "" "F" "?" "Sweden" "" "" "" "" "" "?"
"00307884" "" "" "" "1" "" "03765" "" "" "F" "?" "(Sweden)" "" "" "" "" "" "?"
"00307885" "" "" "" "1" "" "03765" "" "" "F" "yes" "Saudi Arabia" "" "" "" "" "" "?"
"00307886" "" "" "" "1" "" "03765" "" "" "M" "yes" "Saudi Arabia" "" "" "" "" "" "?"
"00307887" "" "" "" "1" "" "03765" "" "" "M" "yes" "Egypt" "" "" "" "" "" "?"
"00307888" "" "" "" "1" "" "03765" "" "" "M" "yes" "Egypt" "" "" "" "" "" "?"
"00325511" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "" "" "Mexico" "" "0" "" "" "" "3919"
"00326995" "" "" "" "4" "" "03388" "" "" "M" "yes" "Iraq" "" "" "" "" "Kurdish" "CLN3_affected_males"
"00327979" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G001009"
"00328124" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G005260"
"00328211" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Asia-South" "G007728"
"00328283" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "W000151"
"00328295" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "W000167"
"00328327" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "W000331"
"00332190" "" "" "" "1" "" "00000" "{PMID:Bryant 2018:29343940}" "" "" "" "United States" "" "0" "" "" "" "JB9"
"00332191" "" "" "" "1" "" "00000" "{PMID:Bryant 2018:29343940}" "" "" "" "United States" "" "0" "" "" "" "JB255"
"00332200" "" "" "" "1" "" "00000" "{PMID:Bryant 2018:29343940}" "" "" "" "United States" "" "0" "" "" "" "JB307"
"00332455" "" "" "" "1" "" "00000" "{PMID:Di Iorio 2017:29053603}" "" "" "" "Italy" "" "0" "" "" "" "Pat15"
"00333814" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "10"
"00334091" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "623"
"00334092" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "624"
"00334093" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "F" "" "(United States)" "" "0" "" "" "" "625"
"00334094" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "626"
"00335099" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "family" "" "yes" "Netherlands" "" "0" "" "" "" "324"
"00335100" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "no" "Netherlands" "" "0" "" "" "" "504"
"00362914" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2016:26766544}" "family" "" "" "Germany" "" "0" "" "" "" "ARRP182"
"00374541" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-4663"
"00375414" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#006"
"00376307" "" "" "" "1" "" "00000" "{PMID:Avela 2019:18487375}" "" "" "" "Finland" "" "0" "" "" "Finnish" ""
"00376308" "" "" "" "1" "" "00000" "{PMID:Avela 2019:18487375}" "" "" "" "Finland" "" "0" "" "" "Finnish" ""
"00381232" "" "" "" "1" "" "00008" "{PMID:Wang-2013:23847139}" "patient carry mutation known cause other retinal diseases. Batten disease" "" "no" "" "" "0" "" "" "" ""
"00383479" "" "" "" "1" "" "00000" "{PMID:Dozieres-Puyravel 2020:31489614}" "" "?" "" "France" "" "0" "" "" "" "3"
"00384015" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1673"
"00384063" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2046"
"00384533" "" "" "" "1" "" "00000" "{PMID:Jilani 2019:31741823}" "" "M" "no" "" "" "0" "" "" "" "13"
"00384534" "" "" "" "1" "" "00000" "{PMID:Jilani 2019:31741823}" "proband 14, family $" "F" "no" "" "" "0" "" "" "" "14$"
"00384535" "" "" "" "1" "" "00000" "{PMID:Jilani 2019:31741823}" "sibling of proband 14, family $" "F" "no" "" "" "0" "" "" "" "15$"
"00384536" "" "" "" "1" "" "00000" "{PMID:Jilani 2019:31741823}" "" "M" "?" "" "" "0" "" "" "" "16"
"00384537" "" "" "" "1" "" "00000" "{PMID:Jilani 2019:31741823}" "" "M" "yes" "" "" "0" "" "" "" "17"
"00384538" "" "" "" "1" "" "00000" "{PMID:Jilani 2019:31741823}" "proband 18, family pi" "M" "yes" "" "" "0" "" "" "" "18pi"
"00384539" "" "" "" "1" "" "00000" "{PMID:Jilani 2019:31741823}" "sibling of proband 18, family pi" "F" "yes" "" "" "0" "" "" "" "19pi"
"00386678" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-865"
"00386821" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI617_001267"
"00387710" "" "" "" "2" "" "00006" "{PMID:Hu 2019:29302074}" "family, 2 affected individuals, first cousin parents" "" "yes" "Iran" "" "0" "" "" "Persia" "M091"
"00388496" "" "" "" "1" "" "00000" "{PMID:Ellingsford 2018:29074561}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "15010313"
"00389445" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 279, cone-rod dystrophy, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "729"
"00389540" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 337, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "824"
"00389541" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 337, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "825"
"00390025" "" "" "" "1" "" "00000" "{PMID:Ruberto 2020:32507954}" "" "?" "" "Italy" "" "0" "" "" "" "3"
"00390215" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G001009"
"00390216" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G005260"
"00390217" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G007728"
"00390218" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "W000151"
"00390219" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "W000167"
"00390220" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "W000331"
"00394360" "" "" "" "1" "" "00000" "{PMID:Thorsteinsson 2021:33851411}" "" "?" "" "Iceland" "" "0" "" "" "" "BD1"
"00396600" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" ""
"00402556" "" "" "" "1" "" "01164" "" "" "M" "no" "Germany" "" "0" "" "" "" "192476"
"00408434" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "" "?" "" "Finland" "" "0" "" "" "" "22"
"00408435" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "" "?" "" "Finland" "" "0" "" "" "" "23"
"00410165" "" "" "" "1" "" "00000" "{PMID:Licchetta 2015:26360874}" "" "" "" "Germany" "" "0" "" "" "" "?"
"00410169" "" "" "" "1" "" "00000" "{PMID:Ku 2017:28542676}" "" "F" "" "" "" "0" "" "" "" "GC18875"
"00410170" "" "" "" "1" "" "00000" "{PMID:Ku 2017:28542676}" "" "M" "" "" "" "0" "" "" "" "GC20465"
"00410171" "" "" "" "1" "" "00000" "{PMID:Ku 2017:28542676}" "" "F" "" "" "" "0" "" "" "" "GC20390"
"00410172" "" "" "" "1" "" "00000" "{PMID:Ku 2017:28542676}" "" "M" "" "" "" "0" "" "" "" "GC18983"
"00410173" "" "" "" "1" "" "00000" "{PMID:Ku 2017:28542676}" "" "F" "" "" "" "0" "" "" "" "CEI26198"
"00410174" "" "" "" "1" "" "00000" "{PMID:Ku 2017:28542676}" "" "F" "" "" "" "0" "" "" "" ""
"00410175" "" "" "" "1" "" "00000" "{PMID:Ku 2017:28542676}" "" "F" "" "" "" "0" "" "" "" ""
"00410176" "" "" "" "1" "" "00000" "{PMID:Ku 2017:28542676}" "" "F" "" "" "" "0" "" "" "" "GC20101"
"00410177" "" "" "" "1" "" "00000" "{PMID:Ku 2017:28542676}" "" "F" "" "" "" "0" "" "" "" "GC3513"
"00410178" "" "" "" "1" "" "00000" "{PMID:Ku 2017:28542676}" "" "M" "" "" "" "0" "" "" "" ""
"00410181" "" "" "" "1" "" "00000" "{PMID:Chen 2018:30446867}" "" "" "" "" "" "0" "" "" "" "?"
"00410182" "" "" "" "1" "" "00000" "{PMID:Sher 2019:30892110}" "" "M" "yes" "Pakistan" "" "0" "" "" "" "V:3"
"00410183" "" "" "" "1" "" "00000" "{PMID:Sher 2019:30892110}" "" "M" "yes" "Pakistan" "" "0" "" "" "" "V:4"
"00410184" "" "" "" "1" "" "00000" "{PMID:Sher 2019:30892110}" "" "M" "yes" "Pakistan" "" "0" "" "" "" "V:3"
"00410185" "" "" "" "1" "" "00000" "{PMID:Sher 2019:30892110}" "" "M" "yes" "Pakistan" "" "0" "" "" "" "V:4"
"00429600" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429821" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429887" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00429942" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00429948" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" ""
"00430122" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" ""
"00436411" "" "" "" "1" "" "04552" "{PMID:Garza-Garza 2023:37621118}" "2-generation family, 1 affected, unaffected heterozygous parents" "F" "no" "(Mexico)" "" "0" "yes" "None" "Hispanic" "1574554"
"00436419" "" "" "" "1" "" "04552" "Villafuerte-de la Cruz RA, et al., 2023. Submitted" "" "F" "no" "Mexico" "" "" "yes" "None" "Hispanic" "2473654"
"00438650" "" "" "" "1" "" "00006" "{PMID:Hamdan 2017:29100083}" "WGS analysis 197 individuals with unexplained DEE (unaffected parents)" "" "" "Canada" "" "0" "" "pharmaco-resistant seizures" "" "HSJ0335"
"00440447" "" "" "" "1" "" "00006" "{PMID:Nambot 2018:29095811}" "" "" "" "France" "" "0" "" "" "" "PED1674.1"
"00447054" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "CD-609"
"00447119" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "CRD-841"
"00447188" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "MDS-468"
"00450779" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "067112"
"00450780" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "070887"
"00450781" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "071214"
"00450782" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "F" "" "" "" "0" "" "" "" "072239"
"00451049" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "066725"
"00451061" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "066804"
"00451062" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "066813"
"00451294" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "073887"
"00451340" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "079509"
"00456225" "" "" "" "1" "" "00006" "{PMID:Fernandez-Marmiesse 2014:24767253}" "" "M" "" "Spain" "" "0" "" "" "" "Pat3"
"00456227" "" "" "" "1" "" "00006" "{PMID:Fernandez-Marmiesse 2014:24767253}" "" "M" "" "Spain" "" "0" "" "" "" "Pat5"
"00456262" "" "" "" "1" "" "00006" "{PMID:Fernandez-Marmiesse 2014:24767253}" "" "M" "" "Spain" "" "0" "" "" "" "Pat40"
"00456267" "" "" "" "1" "" "00006" "{PMID:Fernandez-Marmiesse 2014:24767253}" "" "M" "" "Spain" "" "0" "" "" "" "Pat45"
"00459008" "" "" "" "1" "" "00006" "{PMID:Wen 2023:36811936}" "2-generation family, 1 affected, unaffected parents" "M" "" "United States" "" "0" "" "" "" "RKK_79"
"00459009" "" "" "" "1" "" "00006" "{PMID:Wen 2023:36811936}" "4-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "yes" "United States" "" "0" "" "" "" "G369"
"00467610" "" "" "" "1" "" "04913" "" "" "M" "no" "Japan" "" "" "" "" "" "CLN3_1"
"00468761" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" ""
"00469579" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "TabS5-var5"
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 612
"{{individualid}}" "{{diseaseid}}"
"00001827" "00112"
"00050458" "00198"
"00050683" "00198"
"00113858" "05258"
"00113859" "05258"
"00113860" "05258"
"00113861" "05258"
"00113862" "05258"
"00113863" "05258"
"00113864" "05258"
"00113865" "05258"
"00113866" "05258"
"00113867" "05258"
"00113868" "05258"
"00113869" "05258"
"00113870" "05258"
"00113871" "05258"
"00113872" "05258"
"00113873" "05258"
"00113874" "05258"
"00113875" "05258"
"00113876" "05258"
"00113877" "05258"
"00113878" "05258"
"00113879" "05258"
"00113880" "05258"
"00113881" "05258"
"00113882" "05258"
"00113883" "05258"
"00113884" "05258"
"00113885" "05258"
"00113886" "05258"
"00113887" "05258"
"00113888" "05258"
"00113889" "05258"
"00113890" "05258"
"00113891" "05258"
"00113892" "05258"
"00113893" "05258"
"00113894" "05258"
"00113895" "05258"
"00113896" "05258"
"00113897" "05258"
"00113898" "05258"
"00113899" "05258"
"00113900" "05258"
"00113901" "05258"
"00113902" "05258"
"00113903" "05258"
"00113904" "05258"
"00113905" "05258"
"00113906" "05258"
"00113907" "05258"
"00113908" "05258"
"00113909" "05258"
"00113910" "05258"
"00113911" "05258"
"00113912" "05258"
"00113913" "05258"
"00113914" "05258"
"00113915" "05258"
"00113916" "05258"
"00113917" "05258"
"00113918" "05258"
"00113919" "05258"
"00113920" "05258"
"00113921" "05258"
"00113922" "05258"
"00113923" "05258"
"00113924" "05258"
"00113925" "05258"
"00113926" "05258"
"00113927" "05258"
"00113928" "05258"
"00113929" "05258"
"00113930" "05258"
"00113931" "05258"
"00113932" "05258"
"00113933" "05258"
"00113934" "05258"
"00113935" "05258"
"00113936" "05258"
"00113937" "05258"
"00113938" "05258"
"00113939" "05258"
"00113940" "05258"
"00113941" "05258"
"00113942" "05258"
"00113943" "05258"
"00113944" "05258"
"00113945" "05258"
"00113946" "05258"
"00113947" "05258"
"00113948" "05258"
"00113949" "05258"
"00113950" "05258"
"00113951" "05258"
"00113952" "05258"
"00113953" "05258"
"00113954" "05258"
"00113955" "05258"
"00113956" "05258"
"00113957" "05258"
"00113958" "05258"
"00113959" "05258"
"00113960" "05258"
"00113961" "05258"
"00113962" "05258"
"00113963" "05258"
"00113964" "05258"
"00113965" "05258"
"00113966" "05258"
"00113967" "05258"
"00113968" "05258"
"00113969" "05258"
"00113970" "05258"
"00113971" "05258"
"00113972" "05258"
"00113973" "05258"
"00113974" "05258"
"00113975" "05258"
"00113976" "05258"
"00113977" "05258"
"00113978" "05258"
"00113979" "05258"
"00113980" "05258"
"00113981" "05258"
"00113982" "05258"
"00113983" "05258"
"00113984" "05258"
"00113985" "05258"
"00113986" "05258"
"00113987" "05258"
"00113988" "05258"
"00113989" "05258"
"00113990" "05258"
"00113991" "05258"
"00113992" "05258"
"00113993" "05258"
"00113994" "05258"
"00113995" "05258"
"00113996" "05258"
"00113997" "05258"
"00113998" "05258"
"00113999" "05258"
"00114000" "05258"
"00114001" "05258"
"00114002" "05258"
"00114003" "05258"
"00114004" "05258"
"00114005" "05258"
"00114006" "05258"
"00114007" "05258"
"00114008" "05258"
"00114009" "05258"
"00114010" "05258"
"00114011" "05258"
"00114012" "05258"
"00114013" "05258"
"00114014" "05258"
"00114015" "05258"
"00114016" "05258"
"00114017" "05258"
"00114018" "05258"
"00114019" "05258"
"00114020" "05258"
"00114021" "05258"
"00114022" "05258"
"00114023" "05258"
"00114024" "05258"
"00114025" "05258"
"00114026" "05258"
"00114027" "05258"
"00114028" "05258"
"00114029" "05258"
"00114030" "05258"
"00114031" "05258"
"00114032" "05258"
"00114033" "05258"
"00114034" "05258"
"00114035" "05258"
"00114036" "05258"
"00114037" "05258"
"00114038" "05258"
"00114039" "05258"
"00114040" "05258"
"00114041" "05258"
"00114042" "05258"
"00114043" "05258"
"00114044" "05258"
"00114045" "05258"
"00114046" "05258"
"00114047" "05258"
"00114048" "05258"
"00114049" "05258"
"00114050" "05258"
"00114051" "05258"
"00114052" "05258"
"00114053" "05258"
"00114054" "05258"
"00114055" "05258"
"00114056" "05258"
"00114057" "05258"
"00114058" "05258"
"00114059" "05258"
"00114060" "05258"
"00114061" "05258"
"00114062" "05258"
"00114063" "05258"
"00114064" "05258"
"00114065" "05258"
"00114066" "05258"
"00114067" "05258"
"00114068" "05258"
"00114069" "05258"
"00114070" "05258"
"00114071" "05258"
"00114072" "05258"
"00114073" "05258"
"00114074" "05258"
"00114075" "05258"
"00114076" "05258"
"00114077" "05258"
"00114078" "05258"
"00114079" "05258"
"00114080" "05258"
"00114081" "05258"
"00114082" "05258"
"00114083" "05258"
"00114084" "05258"
"00114085" "05258"
"00114086" "05258"
"00114087" "05258"
"00114088" "05258"
"00114089" "05258"
"00114090" "05258"
"00114091" "05258"
"00114092" "05258"
"00114093" "05258"
"00114094" "05258"
"00114095" "05258"
"00114096" "05258"
"00114097" "05258"
"00114098" "05258"
"00114099" "05258"
"00114100" "05258"
"00114101" "05258"
"00114102" "05258"
"00114103" "05258"
"00114104" "05258"
"00114105" "05258"
"00114106" "05258"
"00114107" "05258"
"00114108" "05258"
"00114109" "05258"
"00114110" "05258"
"00114111" "05258"
"00114112" "05258"
"00114113" "05258"
"00114114" "05258"
"00114115" "05258"
"00114116" "05258"
"00114117" "05258"
"00114118" "05258"
"00114119" "05258"
"00114120" "05258"
"00114121" "05258"
"00114122" "05258"
"00114123" "05258"
"00114124" "05258"
"00114125" "05258"
"00114126" "05258"
"00114127" "05258"
"00114128" "05258"
"00114129" "05258"
"00114130" "05258"
"00114131" "05258"
"00114132" "05258"
"00114133" "05258"
"00114134" "05258"
"00114135" "05258"
"00114136" "00198"
"00114137" "05258"
"00114138" "05258"
"00114139" "05258"
"00114140" "05258"
"00114141" "05258"
"00114142" "05258"
"00114143" "05258"
"00114144" "05258"
"00114145" "05258"
"00114146" "05258"
"00114147" "05258"
"00114148" "05258"
"00114149" "05258"
"00114150" "05258"
"00114151" "05258"
"00114152" "05258"
"00114153" "05258"
"00114154" "05258"
"00114155" "05258"
"00114156" "05258"
"00114157" "05258"
"00114158" "05258"
"00114159" "05258"
"00114160" "05258"
"00114161" "05258"
"00114162" "05258"
"00114163" "05258"
"00114164" "05258"
"00114165" "05258"
"00114166" "05258"
"00114167" "05258"
"00114168" "05258"
"00114169" "05258"
"00114170" "05258"
"00114171" "05258"
"00114172" "05258"
"00114173" "05258"
"00114174" "05258"
"00114175" "05258"
"00114176" "05258"
"00114177" "05258"
"00114178" "05258"
"00114179" "05258"
"00114180" "05258"
"00114181" "05258"
"00114182" "05258"
"00114183" "05258"
"00114184" "05258"
"00114185" "05258"
"00114186" "05258"
"00114187" "05258"
"00114188" "05258"
"00114189" "00198"
"00114190" "00198"
"00114191" "05258"
"00114192" "05258"
"00114193" "05258"
"00114194" "00198"
"00114195" "00198"
"00114196" "00198"
"00114197" "00198"
"00114198" "05258"
"00114199" "05258"
"00114200" "05258"
"00114201" "05258"
"00114202" "00198"
"00114203" "00198"
"00114204" "00198"
"00114205" "00198"
"00114206" "00198"
"00114207" "00198"
"00114208" "00198"
"00114209" "00198"
"00114210" "00198"
"00114211" "00198"
"00114212" "00198"
"00114213" "00198"
"00114214" "00198"
"00114215" "00198"
"00114216" "00198"
"00114217" "00198"
"00114218" "00198"
"00114219" "00198"
"00114220" "00198"
"00114221" "00198"
"00114222" "00198"
"00114223" "00198"
"00114224" "00198"
"00114225" "00198"
"00114226" "00198"
"00114227" "00198"
"00114228" "00198"
"00114229" "00198"
"00114230" "00198"
"00114231" "00198"
"00114232" "00198"
"00114233" "00198"
"00114234" "00198"
"00114235" "00198"
"00114236" "00198"
"00114237" "00198"
"00114238" "00198"
"00114239" "00198"
"00114240" "00198"
"00114241" "00198"
"00114242" "00198"
"00114243" "00198"
"00114244" "00198"
"00114245" "00198"
"00114246" "00198"
"00114247" "00198"
"00114248" "00198"
"00114249" "00198"
"00114250" "00198"
"00114251" "00198"
"00114252" "00198"
"00114253" "00198"
"00114254" "00198"
"00114255" "00198"
"00114256" "00198"
"00114257" "00198"
"00114258" "00198"
"00114259" "00198"
"00114260" "00198"
"00114261" "00198"
"00114262" "00198"
"00114263" "00198"
"00114264" "00198"
"00114265" "00198"
"00114266" "00198"
"00114267" "00198"
"00114268" "00198"
"00114269" "00198"
"00114270" "00198"
"00114271" "00198"
"00114272" "00198"
"00114273" "00198"
"00114274" "00198"
"00114275" "00198"
"00114276" "00198"
"00114277" "00198"
"00114278" "00198"
"00114279" "00198"
"00114280" "00198"
"00114281" "00198"
"00114282" "00198"
"00114283" "00198"
"00114284" "00198"
"00114285" "00198"
"00114286" "00198"
"00114287" "05258"
"00114288" "00198"
"00114289" "00198"
"00114290" "05258"
"00114291" "05258"
"00114292" "00198"
"00114293" "05258"
"00114294" "00198"
"00114295" "00198"
"00114296" "00198"
"00114297" "00198"
"00114298" "00198"
"00114299" "00198"
"00114300" "00198"
"00114301" "00198"
"00114302" "00198"
"00114303" "00198"
"00114304" "00198"
"00114305" "00198"
"00114306" "05258"
"00114307" "00198"
"00114308" "00198"
"00114309" "00198"
"00114310" "00198"
"00114311" "00198"
"00114312" "05258"
"00114313" "00198"
"00114314" "05258"
"00114315" "05258"
"00114316" "00198"
"00114317" "00198"
"00114318" "00198"
"00114319" "00198"
"00114320" "00198"
"00114321" "05258"
"00114322" "00198"
"00114323" "05258"
"00114324" "00198"
"00114325" "00198"
"00114326" "00198"
"00114327" "00198"
"00114328" "00198"
"00114329" "00198"
"00114330" "00198"
"00114331" "00198"
"00114332" "00198"
"00114333" "00198"
"00114334" "05258"
"00114335" "05258"
"00114336" "05258"
"00114337" "00198"
"00114338" "00198"
"00114339" "04214"
"00114341" "04214"
"00114343" "04214"
"00114344" "04214"
"00114345" "04214"
"00114346" "04214"
"00114347" "04214"
"00114349" "04214"
"00114351" "04214"
"00114352" "00058"
"00114354" "00058"
"00114356" "04214"
"00114357" "05258"
"00114358" "05258"
"00114359" "05258"
"00114360" "05258"
"00114361" "05258"
"00240431" "00381"
"00274199" "00198"
"00291436" "00198"
"00291437" "00198"
"00307881" "00068"
"00307884" "00068"
"00307885" "00068"
"00307886" "00068"
"00307887" "00068"
"00307888" "00068"
"00325511" "04214"
"00326995" "00068"
"00327979" "04214"
"00328124" "04214"
"00328211" "04214"
"00328283" "04214"
"00328295" "04214"
"00328327" "04214"
"00332190" "04214"
"00332191" "04214"
"00332200" "04214"
"00332455" "04214"
"00333814" "04214"
"00334091" "04214"
"00334092" "04214"
"00334093" "04214"
"00334094" "04214"
"00335099" "00198"
"00335100" "00198"
"00362914" "04214"
"00374541" "00198"
"00375414" "04214"
"00376307" "04214"
"00376308" "04214"
"00381232" "04214"
"00383479" "05258"
"00384015" "04214"
"00384063" "04214"
"00384533" "05258"
"00384534" "05258"
"00384535" "05258"
"00384536" "05258"
"00384537" "05258"
"00384538" "05258"
"00384539" "05258"
"00386678" "04214"
"00386821" "04214"
"00387710" "00139"
"00388496" "04214"
"00389445" "04214"
"00389540" "04214"
"00389541" "04214"
"00390025" "04214"
"00390215" "04214"
"00390216" "04214"
"00390217" "04214"
"00390218" "04214"
"00390219" "04214"
"00390220" "04214"
"00394360" "04214"
"00396600" "04214"
"00402556" "00068"
"00408434" "04214"
"00408435" "04214"
"00410165" "04214"
"00410169" "04214"
"00410170" "04214"
"00410171" "04214"
"00410172" "04214"
"00410173" "04214"
"00410174" "04214"
"00410175" "04214"
"00410176" "04214"
"00410177" "04214"
"00410178" "04214"
"00410181" "04214"
"00410182" "00068"
"00410183" "00068"
"00410184" "00068"
"00410185" "00068"
"00429600" "00112"
"00429821" "00112"
"00429887" "00112"
"00429942" "00112"
"00429948" "00112"
"00430122" "00112"
"00436411" "04211"
"00436419" "00068"
"00438650" "06906"
"00440447" "00198"
"00447054" "00198"
"00447119" "00198"
"00447188" "00198"
"00450779" "04249"
"00450780" "04249"
"00450781" "04249"
"00450782" "04249"
"00451049" "04249"
"00451061" "04249"
"00451062" "04249"
"00451294" "04249"
"00451340" "04249"
"00456225" "00198"
"00456227" "00198"
"00456262" "00198"
"00456267" "00198"
"00459008" "00112"
"00459009" "04215"
"00467610" "00068"
"00468761" "00198"
"00469579" "00198"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00058, 00068, 00112, 00139, 00198, 00381, 04211, 04214, 04215, 04249, 05258, 06906
## Count = 611
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000037070" "00198" "00050458" "00006" "Isolated (sporadic)" "" "microcephaly, intrauterine growth retardation, global developmental delay, abnormal size of the palpebral fissures, prominent nose, short 4th metacarpal, clinodactyly of the 5th finger, cutaneous syndactyly of toes, aggressive behavior" "" "" "" "" "" "" "" "" "" "" ""
"0000037295" "00198" "00050683" "00006" "Unknown" "" "microcephaly, abnormality of the outer ear, prominent metopic ridge, narrow mouth, inferior vermis hypoplasia, delayed speech and language development" "" "" "" "" "" "" "" "" "" "" ""
"0000089340" "05258" "00113858" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089341" "05258" "00113859" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089342" "05258" "00113860" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089343" "05258" "00113861" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089344" "05258" "00113862" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089345" "05258" "00113863" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089346" "05258" "00113864" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089347" "05258" "00113865" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089348" "05258" "00113866" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089349" "05258" "00113867" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089350" "05258" "00113868" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089351" "05258" "00113869" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089352" "05258" "00113870" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089353" "05258" "00113871" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089354" "05258" "00113872" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089355" "05258" "00113873" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089356" "05258" "00113874" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089357" "05258" "00113875" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089358" "05258" "00113876" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089359" "05258" "00113877" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089360" "05258" "00113878" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089361" "05258" "00113879" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089362" "05258" "00113880" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089363" "05258" "00113881" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089364" "05258" "00113882" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089365" "05258" "00113883" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089366" "05258" "00113884" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089367" "05258" "00113885" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089368" "05258" "00113886" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089369" "05258" "00113887" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089370" "05258" "00113888" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089371" "05258" "00113889" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089372" "05258" "00113890" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089373" "05258" "00113891" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089374" "05258" "00113892" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089375" "05258" "00113893" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089376" "05258" "00113894" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089377" "05258" "00113895" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089378" "05258" "00113896" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089379" "05258" "00113897" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089380" "05258" "00113898" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089381" "05258" "00113899" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089382" "05258" "00113900" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089383" "05258" "00113901" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089384" "05258" "00113902" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089385" "05258" "00113903" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089386" "05258" "00113904" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089387" "05258" "00113905" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089388" "05258" "00113906" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089389" "05258" "00113907" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089390" "05258" "00113908" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089391" "05258" "00113909" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089392" "05258" "00113910" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089393" "05258" "00113911" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089394" "05258" "00113912" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089395" "05258" "00113913" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089396" "05258" "00113914" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089397" "05258" "00113915" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089398" "05258" "00113916" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089399" "05258" "00113917" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089400" "05258" "00113918" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089401" "05258" "00113919" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089402" "05258" "00113920" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089403" "05258" "00113921" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089404" "05258" "00113922" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089405" "05258" "00113923" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089406" "05258" "00113924" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089407" "05258" "00113925" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089408" "05258" "00113926" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089409" "05258" "00113927" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089410" "05258" "00113928" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089411" "05258" "00113929" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089412" "05258" "00113930" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089413" "05258" "00113931" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089414" "05258" "00113932" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089415" "05258" "00113933" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089416" "05258" "00113934" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089417" "05258" "00113935" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089418" "05258" "00113936" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089419" "05258" "00113937" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089420" "05258" "00113938" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089421" "05258" "00113939" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089422" "05258" "00113940" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089423" "05258" "00113941" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089424" "05258" "00113942" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089425" "05258" "00113943" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089426" "05258" "00113944" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089427" "05258" "00113945" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089428" "05258" "00113946" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089429" "05258" "00113947" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089430" "05258" "00113948" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089431" "05258" "00113949" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089432" "05258" "00113950" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089433" "05258" "00113951" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089434" "05258" "00113952" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089435" "05258" "00113953" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089436" "05258" "00113954" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089437" "05258" "00113955" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089438" "05258" "00113956" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089439" "05258" "00113957" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089440" "05258" "00113958" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089441" "05258" "00113959" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089442" "05258" "00113960" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089443" "05258" "00113961" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089444" "05258" "00113962" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089445" "05258" "00113963" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089446" "05258" "00113964" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089447" "05258" "00113965" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089448" "05258" "00113966" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089449" "05258" "00113967" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089450" "05258" "00113968" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089451" "05258" "00113969" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089452" "05258" "00113970" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089453" "05258" "00113971" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089454" "05258" "00113972" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089455" "05258" "00113973" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089456" "05258" "00113974" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089457" "05258" "00113975" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089458" "05258" "00113976" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089459" "05258" "00113977" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089460" "05258" "00113978" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089461" "05258" "00113979" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089462" "05258" "00113980" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089463" "05258" "00113981" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089464" "05258" "00113982" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089465" "05258" "00113983" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089466" "05258" "00113984" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089467" "05258" "00113985" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089468" "05258" "00113986" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089469" "05258" "00113987" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089470" "05258" "00113988" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089471" "05258" "00113989" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089472" "05258" "00113990" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089473" "05258" "00113991" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089474" "05258" "00113992" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089475" "05258" "00113993" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089476" "05258" "00113994" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089477" "05258" "00113995" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089478" "05258" "00113996" "00006" "Unknown" "" "" "08y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089479" "05258" "00113997" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089480" "05258" "00113998" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "05y06m" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089481" "05258" "00113999" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "05y06m" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089482" "05258" "00114000" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "07y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089483" "05258" "00114001" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "07y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089484" "05258" "00114002" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089485" "05258" "00114003" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089486" "05258" "00114004" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089487" "05258" "00114005" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089488" "05258" "00114006" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089489" "05258" "00114007" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089490" "05258" "00114008" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089491" "05258" "00114009" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089492" "05258" "00114010" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089493" "05258" "00114011" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089494" "05258" "00114012" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089495" "05258" "00114013" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089496" "05258" "00114014" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089497" "05258" "00114015" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089498" "05258" "00114016" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089499" "05258" "00114017" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089500" "05258" "00114018" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089501" "05258" "00114019" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "06y" "" "" "" "" "" "" "" "" "protracted juvenile NCL" ""
"0000089502" "05258" "00114020" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "06y" "" "" "" "" "" "" "" "" "protracted juvenile NCL" ""
"0000089503" "05258" "00114021" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089504" "05258" "00114022" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089505" "05258" "00114023" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089506" "05258" "00114024" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089507" "05258" "00114025" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089508" "05258" "00114026" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089509" "05258" "00114027" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089510" "05258" "00114028" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089511" "05258" "00114029" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089512" "05258" "00114030" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089513" "05258" "00114031" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "05y06m" "" "" "" "" "" "" "" "" "protracted juvenile NCL" ""
"0000089514" "05258" "00114032" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "05y06m" "" "" "" "" "" "" "" "" "protracted juvenile NCL" ""
"0000089515" "05258" "00114033" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089516" "05258" "00114034" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089517" "05258" "00114035" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089518" "05258" "00114036" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089519" "05258" "00114037" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089520" "05258" "00114038" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089521" "05258" "00114039" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089522" "05258" "00114040" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089523" "05258" "00114041" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089524" "05258" "00114042" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089525" "05258" "00114043" "00006" "Unknown" "" "" "05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089526" "05258" "00114044" "00006" "Unknown" "" "" "05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089527" "05258" "00114045" "00006" "Unknown" "" "" "05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089528" "05258" "00114046" "00006" "Unknown" "" "" "05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089529" "05258" "00114047" "00006" "Unknown" "" "" "05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089530" "05258" "00114048" "00006" "Unknown" "" "" "05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089531" "05258" "00114049" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089532" "05258" "00114050" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089533" "05258" "00114051" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089534" "05258" "00114052" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089535" "05258" "00114053" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089536" "05258" "00114054" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089537" "05258" "00114055" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089538" "05258" "00114056" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089539" "05258" "00114057" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089540" "05258" "00114058" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089541" "05258" "00114059" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089542" "05258" "00114060" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089543" "05258" "00114061" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089544" "05258" "00114062" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089545" "05258" "00114063" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089546" "05258" "00114064" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089547" "05258" "00114065" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089548" "05258" "00114066" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089549" "05258" "00114067" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089550" "05258" "00114068" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089551" "05258" "00114069" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089552" "05258" "00114070" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089553" "05258" "00114071" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089554" "05258" "00114072" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089555" "05258" "00114073" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089556" "05258" "00114074" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089557" "05258" "00114075" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089558" "05258" "00114076" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089559" "05258" "00114077" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089560" "05258" "00114078" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089561" "05258" "00114079" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089562" "05258" "00114080" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089563" "05258" "00114081" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "08y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089564" "05258" "00114082" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "08y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089565" "05258" "00114083" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "06y09m" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089566" "05258" "00114084" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "06y09m" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089567" "05258" "00114085" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "05y06m" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089568" "05258" "00114086" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "05y06m" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089569" "05258" "00114087" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "05y06m" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089570" "05258" "00114088" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "05y06m" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089571" "05258" "00114089" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "06y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089572" "05258" "00114090" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "06y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089573" "05258" "00114091" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089574" "05258" "00114092" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair" "05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089575" "05258" "00114093" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089576" "05258" "00114094" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089577" "05258" "00114095" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089578" "05258" "00114096" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089579" "05258" "00114097" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089580" "05258" "00114098" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089581" "05258" "00114099" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089582" "05258" "00114100" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089583" "05258" "00114101" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089584" "05258" "00114102" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089585" "05258" "00114103" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089586" "05258" "00114104" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089587" "05258" "00114105" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089588" "05258" "00114106" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089589" "05258" "00114107" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089590" "05258" "00114108" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089591" "05258" "00114109" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089592" "05258" "00114110" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089593" "05258" "00114111" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089594" "05258" "00114112" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089595" "05258" "00114113" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089596" "05258" "00114114" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089597" "05258" "00114115" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089598" "05258" "00114116" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089599" "05258" "00114117" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089600" "05258" "00114118" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089601" "05258" "00114119" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089602" "05258" "00114120" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089603" "05258" "00114121" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089604" "05258" "00114122" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089605" "05258" "00114123" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089606" "05258" "00114124" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089607" "05258" "00114125" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089608" "05258" "00114126" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089609" "05258" "00114127" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089610" "05258" "00114128" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089611" "05258" "00114129" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089612" "05258" "00114130" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089613" "05258" "00114131" "00006" "Unknown" "" "" "03y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089614" "05258" "00114132" "00006" "Unknown" "" "" "03y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089615" "05258" "00114133" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089616" "05258" "00114134" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089617" "05258" "00114135" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089618" "00198" "00114136" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089619" "05258" "00114137" "00006" "Unknown" "" "" "09y" "" "" "" "" "" "" "" "" "severe NCL" ""
"0000089620" "05258" "00114138" "00006" "Unknown" "" "" "09y" "" "" "" "" "" "" "" "" "severe NCL" ""
"0000089621" "05258" "00114139" "00006" "Unknown" "" "" "06y06m" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089622" "05258" "00114140" "00006" "Unknown" "" "" "06y06m" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089623" "05258" "00114141" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" ">05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089624" "05258" "00114142" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" ">05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089625" "05258" "00114143" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" ">05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089626" "05258" "00114144" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" ">05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089627" "05258" "00114145" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" ">05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089628" "05258" "00114146" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" ">05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089629" "05258" "00114147" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" ">05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089630" "05258" "00114148" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" ">05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089631" "05258" "00114149" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" ">05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089632" "05258" "00114150" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" ">05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089633" "05258" "00114151" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" ">05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089634" "05258" "00114152" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" ">05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089635" "05258" "00114153" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" ">05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089636" "05258" "00114154" "00006" "Unknown" "" "" "05m" "" "" "" "" "" "" "" "" "infantile NCL" ""
"0000089637" "05258" "00114155" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089638" "05258" "00114156" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089639" "05258" "00114157" "00006" "Unknown" "" "" "05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089640" "05258" "00114158" "00006" "Unknown" "" "" "05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089641" "05258" "00114159" "00006" "Unknown" "" "curvelineair" "06y09m" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089642" "05258" "00114160" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" "06y09m" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089643" "05258" "00114161" "00006" "Unknown" "" "fingerprint, condensed / curvilinear / rectilineair" "06y09m" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089644" "05258" "00114162" "00006" "Unknown" "" "histology protracted curvelineair, fingerprint condensed" "06y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089645" "05258" "00114163" "00006" "Unknown" "" "histology protracted curvelineair, fingerprint condensed" "07y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089646" "05258" "00114164" "00006" "Unknown" "" "histology protracted curvelineair, fingerprint condensed" "06y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089647" "05258" "00114165" "00006" "Unknown" "" "histology protracted curvelineair, fingerprint condensed" "06y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089648" "05258" "00114166" "00006" "Unknown" "" "histology protracted curvelineair, fingerprint condensed" "09y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089649" "05258" "00114167" "00006" "Unknown" "" "" "06y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089650" "05258" "00114168" "00006" "Unknown" "" "" "06y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089651" "05258" "00114169" "00006" "Unknown" "" "" "06y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089652" "05258" "00114170" "00006" "Unknown" "" "" "06y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089653" "05258" "00114171" "00006" "Unknown" "" "" "05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089654" "05258" "00114172" "00006" "Unknown" "" "" "07y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089655" "05258" "00114173" "00006" "Unknown" "" "fingerprint, condensed" "02y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089656" "05258" "00114174" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" "04y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089657" "05258" "00114175" "00006" "Unknown" "" "" "05y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089658" "05258" "00114176" "00006" "Unknown" "" "fingerprint, condensed / curvilinear" "07y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089659" "05258" "00114177" "00006" "Unknown" "" "fingerprint, condensed / granular osmiophilic deposits" "02y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089660" "05258" "00114178" "00006" "Unknown" "" "fingerprint, condensed / granular osmiophilic deposits" "02y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089661" "05258" "00114179" "00006" "Unknown" "" "" "08y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089662" "05258" "00114180" "00006" "Unknown" "" "" "06y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089663" "05258" "00114181" "00006" "Unknown" "" "" "06y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089664" "05258" "00114182" "00006" "Unknown" "" "" "06y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089665" "05258" "00114183" "00006" "Unknown" "" "fingerprint, condenseds" "16y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089666" "05258" "00114184" "00006" "Unknown" "" "CB" "19y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089667" "05258" "00114185" "00006" "Unknown" "" "CB" "14y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089668" "05258" "00114186" "00006" "Unknown" "" "CB+fingerprint, condensed" "22y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089669" "05258" "00114187" "00006" "Unknown" "" "CB+fingerprint, condensed" "22y" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089670" "05258" "00114188" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089671" "00198" "00114189" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089672" "00198" "00114190" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089673" "05258" "00114191" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089674" "05258" "00114192" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089675" "05258" "00114193" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089676" "00198" "00114194" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089677" "00198" "00114195" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089678" "00198" "00114196" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089679" "00198" "00114197" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089680" "05258" "00114198" "00006" "Unknown" "" "fingerprint, condensed" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089681" "05258" "00114199" "00006" "Unknown" "" "fingerprint, condensed" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089682" "05258" "00114200" "00006" "Unknown" "" "fingerprint, condensed" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089683" "05258" "00114201" "00006" "Unknown" "" "fingerprint, condensed" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089684" "00198" "00114202" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089685" "00198" "00114203" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089686" "00198" "00114204" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089687" "00198" "00114205" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089688" "00198" "00114206" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089689" "00198" "00114207" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089690" "00198" "00114208" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089691" "00198" "00114209" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089692" "00198" "00114210" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089693" "00198" "00114211" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089694" "00198" "00114212" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089695" "00198" "00114213" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089696" "00198" "00114214" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089697" "00198" "00114215" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089698" "00198" "00114216" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089699" "00198" "00114217" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089700" "00198" "00114218" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089701" "00198" "00114219" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089702" "00198" "00114220" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089703" "00198" "00114221" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089704" "00198" "00114222" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089705" "00198" "00114223" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089706" "00198" "00114224" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089707" "00198" "00114225" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089708" "00198" "00114226" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089709" "00198" "00114227" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089710" "00198" "00114228" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089711" "00198" "00114229" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089712" "00198" "00114230" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089713" "00198" "00114231" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089714" "00198" "00114232" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089715" "00198" "00114233" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089716" "00198" "00114234" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089717" "00198" "00114235" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089718" "00198" "00114236" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089719" "00198" "00114237" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089720" "00198" "00114238" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089721" "00198" "00114239" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089722" "00198" "00114240" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089723" "00198" "00114241" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089724" "00198" "00114242" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089725" "00198" "00114243" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089726" "00198" "00114244" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089727" "00198" "00114245" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089728" "00198" "00114246" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089729" "00198" "00114247" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089730" "00198" "00114248" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089731" "00198" "00114249" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089732" "00198" "00114250" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089733" "00198" "00114251" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089734" "00198" "00114252" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089735" "00198" "00114253" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089736" "00198" "00114254" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089737" "00198" "00114255" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089738" "00198" "00114256" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089739" "00198" "00114257" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089740" "00198" "00114258" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089741" "00198" "00114259" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089742" "00198" "00114260" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089743" "00198" "00114261" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089744" "00198" "00114262" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089745" "00198" "00114263" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089746" "00198" "00114264" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089747" "00198" "00114265" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089748" "00198" "00114266" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089749" "00198" "00114267" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089750" "00198" "00114268" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089751" "00198" "00114269" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089752" "00198" "00114270" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089753" "00198" "00114271" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089754" "00198" "00114272" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089755" "00198" "00114273" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089756" "00198" "00114274" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089757" "00198" "00114275" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089758" "00198" "00114276" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089759" "00198" "00114277" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089760" "00198" "00114278" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089761" "00198" "00114279" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089762" "00198" "00114280" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089763" "00198" "00114281" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089764" "00198" "00114282" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089765" "00198" "00114283" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089766" "00198" "00114284" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089767" "00198" "00114285" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089768" "00198" "00114286" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089769" "05258" "00114287" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089770" "00198" "00114288" "00006" "Unknown" "" "curvelinear, fingerprint, condensed" "" "" "" "" "" "" "" "" "" "" ""
"0000089771" "00198" "00114289" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089772" "05258" "00114290" "00006" "Unknown" "" "fingerprint, condensed" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089773" "05258" "00114291" "00006" "Unknown" "" "fingerprint, condensed" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089774" "00198" "00114292" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089775" "05258" "00114293" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089776" "00198" "00114294" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089777" "00198" "00114295" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089778" "00198" "00114296" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089779" "00198" "00114297" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089780" "00198" "00114298" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089781" "00198" "00114299" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089782" "00198" "00114300" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089783" "00198" "00114301" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089784" "00198" "00114302" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089785" "00198" "00114303" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089786" "00198" "00114304" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089787" "00198" "00114305" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089788" "05258" "00114306" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089789" "00198" "00114307" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089790" "00198" "00114308" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089791" "00198" "00114309" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089792" "00198" "00114310" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089793" "00198" "00114311" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089794" "05258" "00114312" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089795" "00198" "00114313" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089796" "05258" "00114314" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089797" "05258" "00114315" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089798" "00198" "00114316" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089799" "00198" "00114317" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089800" "00198" "00114318" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089801" "00198" "00114319" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089802" "00198" "00114320" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089803" "05258" "00114321" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant late infantile NCL" ""
"0000089804" "00198" "00114322" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089805" "05258" "00114323" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089806" "00198" "00114324" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089807" "00198" "00114325" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089808" "00198" "00114326" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089809" "00198" "00114327" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089810" "00198" "00114328" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089811" "00198" "00114329" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089812" "00198" "00114330" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089813" "00198" "00114331" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089814" "00198" "00114332" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089815" "00198" "00114333" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000089816" "05258" "00114334" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair/granular osmiophilic deposits" "05y" "" "" "" "" "" "" "" "" "protracted juvenile NCL" ""
"0000089817" "05258" "00114335" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair/granular osmiophilic deposits" "05y" "" "" "" "" "" "" "" "" "protracted juvenile NCL" ""
"0000089818" "05258" "00114336" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089819" "00198" "00114337" "00006" "Unknown" "" "autophagic vacuolar myopathy; Large autophagic vacuoles, no PF" "" "" "" "" "" "" "" "" "" "" ""
"0000089820" "00198" "00114338" "00006" "Unknown" "" "autophagic vacuolar myopathy; Large autophagic vacuoles, no PF" "" "" "" "" "" "" "" "" "" "" ""
"0000089821" "04214" "00114339" "00006" "Unknown" "" "retinitis pigmentosa;" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089822" "04214" "00114339" "00006" "Unknown" "" "retinitis pigmentosa;" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089823" "04214" "00114341" "00006" "Unknown" "" "retinitis pigmentosa;" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089824" "04214" "00114341" "00006" "Unknown" "" "retinitis pigmentosa;" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089825" "04214" "00114343" "00006" "Unknown" "" "retinitis pigmentosa;" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089826" "04214" "00114344" "00006" "Unknown" "" "retinitis pigmentosa;" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089827" "04214" "00114345" "00006" "Unknown" "" "retinitis pigmentosa;" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089828" "04214" "00114346" "00006" "Unknown" "" "retinitis pigmentosa;" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089829" "04214" "00114347" "00006" "Unknown" "" "retinitis pigmentosa;" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089830" "04214" "00114347" "00006" "Unknown" "" "retinitis pigmentosa;" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089831" "04214" "00114349" "00006" "Unknown" "" "retinitis pigmentosa;" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089832" "04214" "00114349" "00006" "Unknown" "" "retinitis pigmentosa;" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089833" "04214" "00114351" "00006" "Unknown" "" "retinitis pigmentosa at 10y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089834" "00058" "00114352" "00006" "Unknown" "" "cone-rod dystrophy at 20y;" "" "" "" "" "" "" "" "" "" "" ""
"0000089835" "00058" "00114352" "00006" "Unknown" "" "cone-rod dystrophy at 20y;" "" "" "" "" "" "" "" "" "" "" ""
"0000089836" "00058" "00114354" "00006" "Unknown" "" "cone-rod dystrophy at 20y;" "" "" "" "" "" "" "" "" "" "" ""
"0000089837" "00058" "00114354" "00006" "Unknown" "" "cone-rod dystrophy at 20y;" "" "" "" "" "" "" "" "" "" "" ""
"0000089838" "04214" "00114356" "00006" "Unknown" "" "retinitis pigmentosa;" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000089839" "05258" "00114357" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair/granular osmiophilic deposits" "05y" "" "" "" "" "" "" "" "" "protracted juvenile NCL" ""
"0000089840" "05258" "00114358" "00006" "Unknown" "" "histology fingerprint, condensed/curvelineair/granular osmiophilic deposits" "05y" "" "" "" "" "" "" "" "" "protracted juvenile NCL" ""
"0000089841" "05258" "00114359" "00006" "Unknown" "" "fingerprint, condensed, vac lymphocytes" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089842" "05258" "00114360" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000089843" "05258" "00114361" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "variant juvenile NCL" ""
"0000209144" "00198" "00274199" "00006" "Familial, autosomal recessive" "" "mitochondrial disease criteria score 2" "" "" "" "" "" "" "" "" "" "expected mitochondrial disorder" ""
"0000233306" "00068" "00307881" "03765" "Familial, autosomal recessive" "" "" "?" "10y03m" "" "" "" "" "" "" "" "" ""
"0000233307" "00068" "00307884" "03765" "Familial, autosomal recessive" "" "" "?" "10y03m" "" "" "" "" "" "" "" "" ""
"0000233308" "00068" "00307885" "03765" "Familial, autosomal recessive" "" "Behavioural abnormality, Anxiety, Intellectual disability, Seizures, Ataxia, Developmental regression, Attention deficit hyperactivity disorder, Schizophrenia" "06y" "12y07m" "" "" "" "" "" "" "" "" ""
"0000233309" "00068" "00307886" "03765" "Familial, autosomal recessive" "" "Visual impairment, Rod-cone dystrophy, Macular degeneration, Optic atrophy, Eczema, Atopic dermatitis, Seborrheic dermatitis, Alopecia, Macular dystrophy, Abnormal blood zinc concentration, Mixed hypo- and hyperpigmentation of the skin, Localized skin lesion" "00y09m" "04y08m" "" "" "" "" "" "" "" "" ""
"0000233310" "00068" "00307887" "03765" "Familial, autosomal recessive" "" "Abnormal retinal morphology, Visual impairment, Visual loss, Seizures, Generalized tonic-clonic seizures, Developmental regression, Abnormality of the periventricular white matter, Foveal atrophy," "06y" "09y" "" "" "" "" "" "" "" "" ""
"0000233311" "00068" "00307888" "03765" "Familial, autosomal recessive" "" "Abnormal retinal morphology, Visual impairment, Visual loss, Seizures, Generalized tonic-clonic seizures, Developmental regression, Abnormality of the periventricular white matter, Foveal atrophy" "06y" "09y" "" "" "" "" "" "" "" "" ""
"0000243998" "04214" "00325511" "00006" "Familial, autosomal recessive" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000245458" "00068" "00326995" "03388" "Familial, autosomal recessive" ">07y" "HP:0005216, HP:0002015, HP:0000488, HP:0002345, HP:0000718, HP:0000713, HP:0005216, HP:0002015, HP:0002066, HP:0003434, HP:0001337" "" "" "" "" "" "" "" "" "Batten disease" "neuronal ceroid lipofuscinosis" ""
"0000246206" "04214" "00327979" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246351" "04214" "00328124" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246438" "04214" "00328211" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246510" "04214" "00328283" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246522" "04214" "00328295" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000246554" "04214" "00328327" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000250377" "04214" "00332190" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal degeneration (Batten disease)" ""
"0000250378" "04214" "00332191" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (Batten disease)" ""
"0000250387" "04214" "00332200" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone dystrophy" ""
"0000250639" "04214" "00332455" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "EORP" ""
"0000251999" "04214" "00333814" "00000" "Familial, autosomal recessive" "22y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252276" "04214" "00334091" "00000" "Familial, autosomal recessive" "7y" "clinical category IB3" "" "" "" "" "" "" "" "" "" "Batten disease" ""
"0000252277" "04214" "00334092" "00000" "Familial, autosomal recessive" "23y" "clinical category IB3" "" "" "" "" "" "" "" "" "" "Batten disease" ""
"0000252278" "04214" "00334093" "00000" "Familial, autosomal recessive" "6y" "clinical category IB3" "" "" "" "" "" "" "" "" "" "Batten disease" ""
"0000252279" "04214" "00334094" "00000" "Familial, autosomal recessive" "6y" "clinical category IB3" "" "" "" "" "" "" "" "" "" "Batten disease" ""
"0000252814" "00198" "00335099" "00000" "Familial, autosomal recessive" "" "18y-diagnosis visual impairment" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000252815" "00198" "00335100" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000258280" "04214" "00362914" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000269751" "00198" "00374541" "00006" "Familial, autosomal recessive" "" "seizures, progressive visual blurring and cognitive impairment" "" "" "" "" "" "" "" "" "" "epilepsy, intellectual disability" ""
"0000270628" "04214" "00375414" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000271515" "04214" "00376307" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Juvenil neuronal ceroid lipofuscinosis (JNCL)" ""
"0000271516" "04214" "00376308" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Juvenil neuronal ceroid lipofuscinosis (JNCL)" ""
"0000275083" "04214" "00381232" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" ""
"0000277264" "05258" "00383479" "00000" "Familial, autosomal recessive" "" "retinal dysfunction on ERG, VEP results: normal" "" "9y10m" "" "" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 3 (CLN3)" ""
"0000277800" "04214" "00384015" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Ceroid lipofuscinosis, juvenile" ""
"0000277848" "04214" "00384063" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000278317" "05258" "00384533" "00000" "Familial, autosomal recessive" "11y" "" "4y" "" "Visual problems" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 3" "lipofuscinosis, ceroid, neuronal" ""
"0000278318" "05258" "00384534" "00000" "Familial, autosomal recessive" "18y" "" "10y" "" "Night vision problems" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 3" "lipofuscinosis, ceroid, neuronal" ""
"0000278319" "05258" "00384535" "00000" "Familial, autosomal recessive" "18y" "" "10y" "" "Visual problems" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 3" "lipofuscinosis, ceroid, neuronal" ""
"0000278320" "05258" "00384536" "00000" "Familial, autosomal recessive" "18y" "" "9y" "" "Visual impairment" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 3" "lipofuscinosis, ceroid, neuronal" ""
"0000278321" "05258" "00384537" "00000" "Familial, autosomal recessive" "18y" "" "3y" "" "Visual impairment" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 3" "lipofuscinosis, ceroid, neuronal" ""
"0000278322" "05258" "00384538" "00000" "Familial, autosomal recessive" "18y" "" "7y" "" "Cognitive decline" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 3" "lipofuscinosis, ceroid, neuronal" ""
"0000278323" "05258" "00384539" "00000" "Familial, autosomal recessive" "18y" "" "6y" "" "Visual impairment" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 3" "lipofuscinosis, ceroid, neuronal" ""
"0000280478" "04214" "00386678" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000280621" "04214" "00386821" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000281278" "00139" "00387710" "00006" "Familial, autosomal recessive" "" "syndromic intellectual disability, no microcephaly, epilepsy" "" "" "" "" "" "" "" "" "" "intellectual disability" ""
"0000282048" "04214" "00388496" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000282986" "04214" "00389445" "00000" "Familial, autosomal recessive" "23y" "age at genetic diagnosis mentioned" "" "22y" "" "" "" "" "" "" "cone-rod dystrophy" "" ""
"0000283081" "04214" "00389540" "00000" "Familial, autosomal recessive" "41y" "age at genetic diagnosis mentioned" "" "39y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" ""
"0000283082" "04214" "00389541" "00000" "Familial, autosomal recessive" "36y" "age at genetic diagnosis mentioned" "" "34y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" ""
"0000283565" "04214" "00390025" "00000" "Unknown" "11m" "Pale and tilted optic disk associated to hypoplasia, tortuous retinal vessels, non-homogeneous macula" "" "" "" "" "" "" "" "" "Retinal dystrophy" "" ""
"0000283753" "04214" "00390215" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283754" "04214" "00390216" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283755" "04214" "00390217" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283756" "04214" "00390218" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000283757" "04214" "00390219" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinal disease" "retinal disease" ""
"0000283758" "04214" "00390220" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" ""
"0000287564" "04214" "00394360" "00000" "Familial, autosomal recessive" "" "Visual impairment 5 y, diagnosed with retinal degeneration 8 y, electroretinogram consistent with RP" "5y" "8y" "" "" "" "" "" "" "Batten disease" "" ""
"0000289761" "04214" "00396600" "00000" "Familial, X-linked" "67y" "night blindness combined with right eye RD" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" ""
"0000295318" "00068" "00402556" "01164" "Isolated (sporadic)" "04y" "Seizure, Generalized-onset seizure, Myoclonic seizure, Delayed speech and language development" "" "" "" "" "" "" "" "" "" "3y" ""
"0000300550" "04214" "00408434" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "juvenile neuronal ceroid lipofuscinosis" "" ""
"0000300551" "04214" "00408435" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "juvenile neuronal ceroid lipofuscinosis" "" ""
"0000302271" "04214" "00410165" "00000" "Familial, autosomal recessive" "35y" "9y: peripheral visual field impairment, rapidly progressed toward complete bilateral blindness in two years; 28y: two generalized tonic-clonic seizures; evident cognitive decline with prominent language impairment, behavior disorders and mood depression; first evaluation (31y): neurological evaluation: slight disorientation for time and space, impairment of long-term memory, dysphasia, mild cerebellar signs and fundus: bilateral diffuse sub-atrophy. Interictal electroencephalograms: generalized background slowing and epileptic discharges over the fronto-temporal regions with a left sided emphasis, enhanced during drowsiness; no muscle potentials on surface electromyography; . Somatosensory evoked potentials after stimulation of median nerve: cortical responses with markedly increased amplitude; electroretinogram and visual-evoked potentials: absent; magnetic resonance imaging: slight cortical atrophy, neuropsychological evaluation: severe cognitive decline (Mini Mental State Examination, correct score: 10.75, cut-off <27; Brief Battery for Mental Deterioration assessment: unscorable); CPK and LDH levels: normal, electromyography; no myopathic features; electrocardiogram and echocardiogram: normal. 33y: further cognitive and motor deterioration, with seizure relapse, behavioral abnormalities and impaired ambulation; multifocal asynchronous muscle jerks, extrapyramidal signs and dysphagia; electroencephalography-electromyography polygraphic: frequent multifocal myoclonias sometimes occurring in long-lasting and pseudo-rhythmic sequences with clear-cut cortical correlates; increased CPK levels (655 U/L; cut-off <170), echocardiogram remained normal. 31y: electron microscopy of skin biopsy: cytoplasmic vacuoles containing parallel osmiophilic lamellar inclusion sometimes arranged in honeycomb-like structures recognizable as finger prints, associated with occasional granular inclusions or rectilinear profiles in at least two cellular types; muscle biopsy: autophagic vacuoles strongly reactive for the lysosomal enzyme acid phosphatase in the cytoplasm of many fibers; multiple basophilic, autofluorescent cytoplasmic inclusions also present; vacuoles showed sarcolemmal features having immunoreactivity for the sarcolemmal protein dystrophin and the human leukocyte antigen class 1 (HLA1); activity of the lysosome-associated membrane protein-2 (LAMP-2) was overexpressed and present also in the vacuoles; ultrastructural level: accumulation of amorphous-granular material with free glycogen and diffuse vacuoles containing curvilinear bodies" "9y" "" "peripheral visual field impairment" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 3 (CLN3)" "" ""
"0000302273" "04214" "00410169" "00000" "Familial, autosomal recessive" "36y" "best corrected visual acuity: 20/16; fundus: macular atrophy: absent, bone spicules: absent; fundus autofluorescence: central hypoautofluorescence: moderate, hyperautofluorescent ring: mild, peripheral hypoautofluorescence: severe; optical coherence tomography: fovea, ellipsoid zone loss: absent, outer nuclear layer loss: intermittent, parafoveal ellipsoid zone loss: severe, outer nuclear layer loss: severe; macular edema: absent; visual field: central scotoma: absent, visual field constriction: to 30deg (30y); full field electroretinography: rod: moderately reduced, cone: mildly reduced (30y); pattern electroretinography: moderately reduced; multifocal electroretinography: paracentrally: mildly reduced; centrally: spared" ">30y" "" "mild nyctalopia" "" "" "" "" "" "retinal degeneration" "" ""
"0000302274" "04214" "00410170" "00000" "Familial, autosomal recessive" "30y" "best corrected visual acuity: 20/30; fundus: macular atrophy: absent, bone spicules: absent; fundus autofluorescence: central hypoautofluorescence: mild, hyperautofluorescent ring: mild, peripheral hypoautofluorescence: moderate; optical coherence tomography: fovea, ellipsoid zone loss: intermittent, outer nuclear layer loss: mild, parafoveal ellipsoid zone loss: severe, outer nuclear layer loss: severe; macular edema: moderate; visual field: central scotoma: absent, visual field constriction: Patchy loss (27y); full field electroretinography: NA, ; pattern electroretinography: not applicable; multifocal electroretinography: not applicable" ">20y" "" "mild nyctalopia" "" "" "" "" "" "retinal degeneration" "" ""
"0000302275" "04214" "00410171" "00000" "Familial, autosomal recessive" "54y" "best corrected visual acuity: 20/20; fundus: macular atrophy: absent, bone spicules: absent; fundus autofluorescence: central hypoautofluorescence: mild, hyperautofluorescent ring: absent, peripheral hypoautofluorescence: mild; optical coherence tomography: fovea, ellipsoid zone loss: mild, outer nuclear layer loss: mild, parafoveal ellipsoid zone loss: moderate, outer nuclear layer loss: severe; macular edema: severe; visual field: central scotoma: mild, visual field constriction: to 10deg (54y); full field electroretinography: rod: not detectable, cone: mildly reduced (51y); pattern electroretinography: moderately reduced; multifocal electroretinography: paracentrally: mildly reduced, centrally: spared" ">45y" "" "mild nyctalopia" "" "" "" "" "" "retinal degeneration" "" ""
"0000302276" "04214" "00410172" "00000" "Familial, autosomal recessive" "51y" "best corrected visual acuity: 20/32; fundus: macular atrophy: absent, bone spicules: mild; fundus autofluorescence: central hypoautofluorescence: moderate, hyperautofluorescent ring: mild, peripheral hypoautofluorescence: severe; optical coherence tomography: fovea, ellipsoid zone loss: mild, outer nuclear layer loss: moderate, parafoveal ellipsoid zone loss: severe, outer nuclear layer loss: moderate; macular edema: mild; visual field: central scotoma: absent, visual field constriction: to 5deg (51y); full field electroretinography: rod: severely reduced, cone: mildly reduced (37y) rod: not detectable, cone: moderately reduced (42y); pattern electroretinography: moderately reduced; multifocal electroretinography: paracentrally: moderately reduced, centrally: spared" "30y" "" "mild nyctalopia" "" "" "" "" "" "retinal degeneration" "" ""
"0000302277" "04214" "00410173" "00000" "Familial, autosomal recessive" "24y" "best corrected visual acuity: 20/125; fundus: macular atrophy: absent, bone spicules: intermittent; fundus autofluorescence: central hypoautofluorescence: moderate, hyperautofluorescent ring: moderate, peripheral hypoautofluorescence: intermittent; optical coherence tomography: fovea, ellipsoid zone loss: severe, outer nuclear layer loss: moderate, parafoveal ellipsoid zone loss: severe, outer nuclear layer loss: moderate; macular edema: absent; visual field: central scotoma: mild, visual field constriction: nasal/inferior/superior (23y); full field electroretinography: rod: severely reduced, cone: moderately reduced (23y); pattern electroretinography: not applicable; multifocal electroretinography: not applicable" ">15y" "" "mild nyctalopia, mild visual acuity loss" "" "" "" "" "" "retinal degeneration" "" ""
"0000302278" "04214" "00410174" "00000" "Familial, autosomal recessive" "21y" "best corrected visual acuity: 20/80; fundus: macular atrophy: absent, bone spicules: moderate; fundus autofluorescence: central hypoautofluorescence: mild, hyperautofluorescent ring: mild, peripheral hypoautofluorescence: mild; optical coherence tomography: fovea, ellipsoid zone loss: moderate, outer nuclear layer loss: moderate, parafoveal ellipsoid zone loss: intermittent, outer nuclear layer loss: severe; macular edema: severe; visual field: central scotoma: absent, visual field constriction: nasal/inferior/superior (21y); full field electroretinography: rod: not detectable, cone: severely reduced (10y); pattern electroretinography: not applicable; multifocal electroretinography: not applicable" "<10y" "" "mild nyctalopia, mild visual acuity loss" "" "" "" "" "" "retinal degeneration" "" ""
"0000302279" "04214" "00410175" "00000" "Familial, autosomal recessive" "23y" "best corrected visual acuity: 20/125; fundus: macular atrophy: absent, bone spicules: intermittent; fundus autofluorescence: central hypoautofluorescence: mild, hyperautofluorescent ring: mild, peripheral hypoautofluorescence: moderate; optical coherence tomography: fovea, ellipsoid zone loss: moderate, outer nuclear layer loss: moderate, parafoveal ellipsoid zone loss: mild, outer nuclear layer loss: severe; macular edema: absent; visual field: central scotoma: absent, visual field constriction: to 30deg (23y); full field electroretinography: rod: not detectable, cone: not detectable(12y); pattern electroretinography: not applicable; multifocal electroretinography: not applicable" "<15y" "" "mild nyctalopia, mild visual acuity loss" "" "" "" "" "" "retinal degeneration" "" ""
"0000302280" "04214" "00410176" "00000" "Familial, autosomal recessive" "16y" "best corrected visual acuity: not applicable; fundus: macular atrophy: absent, bone spicules: absent; fundus autofluorescence: central hypoautofluorescence: mild, hyperautofluorescent ring: intermittent, peripheral hypoautofluorescence: moderate; optical coherence tomography: fovea, ellipsoid zone loss: severe, outer nuclear layer loss: moderate, parafoveal ellipsoid zone loss: severe, outer nuclear layer loss: moderate; macular edema: absent; visual field: central scotoma: not applicable, visual field constriction: not applicable; full field electroretinography: rod: not detectable, cone: severely reduced (16y); pattern electroretinography: severely reduced; multifocal electroretinography: not applicable" "<15y" "" "mild nyctalopia, mild visual acuity loss" "" "" "" "" "" "retinal degeneration" "" ""
"0000302281" "04214" "00410177" "00000" "Familial, autosomal recessive" "49y" "best corrected visual acuity: hand movement; fundus: macular atrophy: moderate, bone spicules: absent; fundus autofluorescence: central hypoautofluorescence: severe, hyperautofluorescent ring: absent, peripheral hypoautofluorescence: severe; optical coherence tomography: fovea, ellipsoid zone loss: severe, outer nuclear layer loss: severe, parafoveal ellipsoid zone loss: severe, outer nuclear layer loss: severe; macular edema: absent; visual field: central scotoma: severe, visual field constriction: not detectable (47y); full field electroretinography: not applicable, ; pattern electroretinography: not applicable; multifocal electroretinography: not applicable" "<10y" "" "mild nyctalopia, mild visual acuity loss" "" "" "" "" "" "retinal degeneration" "" ""
"0000302282" "04214" "00410178" "00000" "Familial, autosomal recessive" "70y" "best corrected visual acuity: light perception; fundus: macular atrophy: moderate, bone spicules: moderate; fundus autofluorescence: central hypoautofluorescence: absent, hyperautofluorescent ring: absent, peripheral hypoautofluorescence: severe; optical coherence tomography: fovea, ellipsoid zone loss: severe, outer nuclear layer loss: severe, parafoveal ellipsoid zone loss: severe, outer nuclear layer loss: severe; macular edema: absent; visual field: central scotoma: absent, visual field constriction: to 10deg (61y); full field electroretinography: rod: not detectable, cone: not detectable(41y); pattern electroretinography: not applicable; multifocal electroretinography: not applicable" "<15y" "" "mild nyctalopia, mild visual acuity loss" "" "" "" "" "" "retinal degeneration" "" ""
"0000302285" "04214" "00410181" "00000" "Familial, autosomal recessive" "50y" "onset of recent vision loss coincided with the diagnosis of an autoimmune thyroid disease; 36y: floaters, photopsia and reduced peripheral field sensitivity without visual acuity loss (6/6 in both eyes; between 37-50 years visual acuity right, left eye: declined to 6/12, 6/76; Humphrey field test: significant decline in visual field index (VFI) from 73% and 64% to 42% and 32%, in the right and left eyes; refractive error right, left eye: 0.25/- 0.50 x 34, 0.25/- 0.50 x 151; clear lens, no vitritis and normal intraocular pressure; fundus: retinal arteriolar attenuation without the typical bony pigment spicules; small round hyperpigmented lesion was noted initially in the nasal fundus, pigmented lesions and hypoautofluorescent spots increased in numbers 4 years later. Fundus autofluorescence: oval ring of increased signal in the foveal region and a preserved uniform signal in the periphery; optical coherence tomography: diffuse thinning of the outer retinal layers without macular oedema and a greater macular volume in the left eye compared to the right eye (5.83 mm3 vs. 5.72 mm3) despite lower visual acuity; a mild epiretinal membrane was present in the extrafoveal . Scotopic electroretinography response: undetectable, photopic: electronegative; scotopic response did not improve after 12 h of dark-adaptation in the left eye; photopic 30 Hz flicker and single flash (3.0 cd s/m2) electroretinography showed severe delay and reduction (Fig. 2). 13y prior full field dark-adapted electroretinography: profoundly reduced b-wave moderately reduced and delayed a-wave and b-wave with standard flash; light adapted flicker (30 Hz), single flash electroretinograms: delayed and reduced b-waves. Pattern electroretinography: only marginally reduced; recent acceleration of visual field and acuity losses and the development of an electronegative-type electroretinography." "36y" "" "" "" "" "" "" "" "retinal degeneration" "" ""
"0000302286" "00068" "00410182" "00000" "Familial, autosomal recessive" "16y" "visual failure starting at the age of 7 years leading to complete blindness at the age of twelve years, seizures, mental deterioration, aggressive behavior, moderate intellectual disability, progressive inability to walk" "7y" "" "visual impairment" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 3 (CLN3)" "" ""
"0000302287" "00068" "00410183" "00000" "Familial, autosomal recessive" "" "visual failure starting at the age of 7 years leading to complete blindness at the age of twelve years, seizures, mental deterioration, aggressive behavior, moderate intellectual disability, progressive inability to walk" "7y" "" "visual impairment" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 3 (CLN3)" "" ""
"0000302288" "00068" "00410184" "00000" "Familial, autosomal recessive" "16y" "visual failure starting at the age of 7 years leading to complete blindness at the age of twelve years, seizures, mental deterioration, aggressive behavior, moderate intellectual disability, progressive inability to walk" "7y" "" "visual impairment" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 3 (CLN3)" "" ""
"0000302289" "00068" "00410185" "00000" "Familial, autosomal recessive" "" "visual failure starting at the age of 7 years leading to complete blindness at the age of twelve years, seizures, mental deterioration, aggressive behavior, moderate intellectual disability, progressive inability to walk" "7y" "" "visual impairment" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 3 (CLN3)" "" ""
"0000320472" "00112" "00429600" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320693" "00112" "00429821" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320759" "00112" "00429887" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320814" "00112" "00429942" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320820" "00112" "00429948" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000320994" "00112" "00430122" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000326592" "04211" "00436411" "04552" "Familial, autosomal recessive" "15y" "Nyctalopia HP:0000662, Peripheral visual field loss HP:0007994, Retinitis pigmentosa HP:0000510" "13y" "24y" "Reduced visual acuity HP:0007663, Nyctalopia HP:0000662" "" "" "" "" "" "" "Retinitis pigmentosa" ""
"0000326600" "00068" "00436419" "04552" "Familial, autosomal recessive" "20y, 70y" "Reduced visual acuity HP:0007663, Nyctalopia HP:0000662, Peripheral visual field loss HP:0007994, Retinitis pigmentosa HP:0000510" "20y" "70y" "20y" "" "" "" "" "" "" "20y" ""
"0000326713" "00318" "00000102" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" ""
"0000326714" "00318" "00000102" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" ""
"0000328553" "06906" "00438650" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "developmental and epileptic encephalopathy" ""
"0000330357" "00198" "00440447" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Neuronal ceroid lipofuscinosis-3 (MIM #204200)" "" ""
"0000336253" "00198" "00447054" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone dystrophy" ""
"0000336318" "00198" "00447119" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000336387" "00198" "00447188" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "macular dystrophy" ""
"0000339834" "04249" "00450779" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy (AR)" ""
"0000339835" "04249" "00450780" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" ""
"0000339836" "04249" "00450781" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" ""
"0000339837" "04249" "00450782" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000344744" "00198" "00456225" "00006" "Familial, autosomal recessive" "" "see paper; ... (detailed)" "3y" "" "" "" "" "" "" "" "CLN3" "lysosomal storage disorder" ""
"0000344746" "00198" "00456227" "00006" "Familial, autosomal recessive" "" "see paper; ... (detailed)" "4y" "" "" "" "" "" "" "" "CLN3" "lysosomal storage disorder" ""
"0000344781" "00198" "00456262" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "lysosomal storage disorder" ""
"0000344786" "00198" "00456267" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "lysosomal storage disorder" ""
"0000347438" "00112" "00459008" "00006" "Familial, autosomal recessive" "66y" "see paper; ..., retinitis pigmentosa; non-syndromic phenotype" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000347439" "04215" "00459009" "00006" "Familial, autosomal recessive" "" "see paper; ..., deceased (pneumonia); 5y-Stargardt-like macular dystrophy; 9y-seizure; muscle weakness; neuronal ceroid lipofuscinosis; lost speech" "" "" "" "" "" "" "" "" "CLN3" "Stargardt-like macular dystrophy" ""
"0000352821" "00068" "00467610" "04913" "Familial, autosomal recessive" "" "" "" "17y" "" "" "" "" "" "" "" "CLN3" ""
"0000353914" "00198" "00468761" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the eye" ""
"0000354731" "00198" "00469579" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the eye" ""
## Screenings ## Do not remove or alter this header ##
## Count = 625
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000000009" "00000009" "1" "00004" "" "2012-05-11 13:18:37" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" ""
"0000000010" "00000010" "1" "00004" "" "2012-05-11 13:18:38" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" ""
"0000000028" "00000028" "1" "00004" "" "2012-05-11 13:18:42" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" ""
"0000000062" "00000062" "1" "00004" "" "2012-05-11 13:18:54" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" ""
"0000000102" "00000102" "1" "00004" "" "2012-05-11 13:19:45" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" ""
"0000000107" "00000107" "1" "00004" "" "2012-05-11 13:19:58" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" ""
"0000001630" "00001827" "1" "00102" "00102" "2013-08-08 23:32:32" "" "" "SEQ-NG-I" "DNA" "" ""
"0000050403" "00050458" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" ""
"0000050628" "00050683" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" ""
"0000114315" "00113858" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114316" "00113859" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114317" "00113860" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114318" "00113861" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114319" "00113862" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114320" "00113863" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114321" "00113864" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114322" "00113865" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114323" "00113866" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114324" "00113867" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114325" "00113868" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114326" "00113869" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114327" "00113870" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114328" "00113871" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114329" "00113872" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114330" "00113873" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114331" "00113874" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114332" "00113875" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114333" "00113876" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114334" "00113877" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114335" "00113878" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114336" "00113879" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114337" "00113880" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114338" "00113881" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114339" "00113882" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114340" "00113883" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114341" "00113884" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114342" "00113885" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114343" "00113886" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114344" "00113887" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114345" "00113888" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114346" "00113889" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114347" "00113890" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114348" "00113891" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114349" "00113892" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114350" "00113893" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114351" "00113894" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114352" "00113895" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114353" "00113896" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114354" "00113897" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114355" "00113898" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114356" "00113899" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114357" "00113900" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114358" "00113901" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114359" "00113902" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114360" "00113903" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114361" "00113904" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114362" "00113905" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114363" "00113906" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114364" "00113907" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114365" "00113908" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114366" "00113909" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114367" "00113910" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114368" "00113911" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114369" "00113912" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114370" "00113913" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114371" "00113914" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114372" "00113915" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114373" "00113916" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114374" "00113917" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114375" "00113918" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114376" "00113919" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114377" "00113920" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114378" "00113921" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114379" "00113922" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114380" "00113923" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114381" "00113924" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114382" "00113925" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114383" "00113926" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114384" "00113927" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114385" "00113928" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114386" "00113929" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114387" "00113930" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114388" "00113931" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114389" "00113932" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114390" "00113933" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114391" "00113934" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114392" "00113935" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114393" "00113936" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114394" "00113937" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114395" "00113938" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114396" "00113939" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114397" "00113940" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114398" "00113941" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114399" "00113942" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114400" "00113943" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114401" "00113944" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114402" "00113945" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114403" "00113946" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114404" "00113947" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114405" "00113948" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114406" "00113949" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114407" "00113950" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114408" "00113951" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114409" "00113952" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114410" "00113953" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114411" "00113954" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114412" "00113955" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114413" "00113956" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114414" "00113957" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114415" "00113958" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114416" "00113959" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114417" "00113960" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114418" "00113961" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114419" "00113962" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114420" "00113963" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114421" "00113964" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114422" "00113965" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114423" "00113966" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114424" "00113967" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114425" "00113968" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114426" "00113969" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114427" "00113970" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114428" "00113971" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114429" "00113972" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114430" "00113973" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114431" "00113974" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114432" "00113975" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114433" "00113976" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114434" "00113977" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114435" "00113978" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114436" "00113979" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114437" "00113980" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114438" "00113981" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114439" "00113982" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114440" "00113983" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114441" "00113984" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114442" "00113985" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114443" "00113986" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114444" "00113987" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114445" "00113988" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114446" "00113989" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114447" "00113990" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114448" "00113991" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114449" "00113992" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114450" "00113993" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114451" "00113994" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114452" "00113995" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114453" "00113996" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114454" "00113997" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114455" "00113998" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114456" "00113999" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114457" "00114000" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114458" "00114001" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114459" "00114002" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114460" "00114003" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114461" "00114004" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114462" "00114005" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114463" "00114006" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114464" "00114007" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114465" "00114008" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114466" "00114009" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114467" "00114010" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114468" "00114011" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114469" "00114012" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114470" "00114013" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114471" "00114014" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114472" "00114015" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114473" "00114016" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114474" "00114017" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114475" "00114018" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114476" "00114019" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114477" "00114020" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114478" "00114021" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114479" "00114022" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114480" "00114023" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114481" "00114024" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114482" "00114025" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114483" "00114026" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114484" "00114027" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114485" "00114028" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114486" "00114029" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114487" "00114030" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114488" "00114031" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114489" "00114032" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114490" "00114033" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114491" "00114034" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114492" "00114035" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114493" "00114036" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114494" "00114037" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114495" "00114038" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114496" "00114039" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114497" "00114040" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114498" "00114041" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114499" "00114042" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114500" "00114043" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114501" "00114044" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114502" "00114045" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114503" "00114046" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114504" "00114047" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114505" "00114048" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114506" "00114049" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114507" "00114050" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114508" "00114051" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114509" "00114052" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114510" "00114053" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114511" "00114054" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114512" "00114055" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114513" "00114056" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114514" "00114057" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114515" "00114058" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114516" "00114059" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114517" "00114060" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114518" "00114061" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114519" "00114062" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114520" "00114063" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114521" "00114064" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114522" "00114065" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114523" "00114066" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114524" "00114067" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114525" "00114068" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114526" "00114069" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114527" "00114070" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114528" "00114071" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114529" "00114072" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114530" "00114073" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114531" "00114074" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114532" "00114075" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114533" "00114076" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114534" "00114077" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114535" "00114078" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114536" "00114079" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114537" "00114080" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114538" "00114081" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114539" "00114082" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114540" "00114083" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114541" "00114084" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114542" "00114085" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114543" "00114086" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114544" "00114087" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114545" "00114088" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114546" "00114089" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114547" "00114090" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114548" "00114091" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114549" "00114092" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114550" "00114093" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114551" "00114094" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114552" "00114095" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114553" "00114096" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114554" "00114097" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114555" "00114098" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114556" "00114099" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114557" "00114100" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114558" "00114101" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114559" "00114102" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114560" "00114103" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114561" "00114104" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114562" "00114105" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114563" "00114106" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114564" "00114107" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114565" "00114108" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114566" "00114109" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114567" "00114110" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114568" "00114111" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114569" "00114112" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114570" "00114113" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114571" "00114114" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114572" "00114115" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114573" "00114116" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114574" "00114117" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114575" "00114118" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114576" "00114119" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114577" "00114120" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114578" "00114121" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114579" "00114122" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114580" "00114123" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114581" "00114124" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114582" "00114125" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114583" "00114126" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114584" "00114127" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114585" "00114128" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114586" "00114129" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114587" "00114130" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114588" "00114131" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114589" "00114132" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114590" "00114133" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114591" "00114134" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114592" "00114135" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114593" "00114136" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114594" "00114137" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114595" "00114138" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114596" "00114139" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114597" "00114140" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114598" "00114141" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114599" "00114142" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114600" "00114143" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114601" "00114144" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114602" "00114145" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114603" "00114146" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114604" "00114147" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114605" "00114148" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114606" "00114149" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114607" "00114150" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114608" "00114151" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114609" "00114152" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114610" "00114153" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114611" "00114154" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114612" "00114155" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114613" "00114156" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114614" "00114157" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114615" "00114158" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114616" "00114159" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114617" "00114160" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114618" "00114161" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114619" "00114162" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114620" "00114163" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114621" "00114164" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114622" "00114165" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114623" "00114166" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114624" "00114167" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114625" "00114168" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114626" "00114169" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114627" "00114170" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114628" "00114171" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114629" "00114172" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114630" "00114173" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114631" "00114174" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114632" "00114175" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114633" "00114176" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114634" "00114177" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114635" "00114178" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114636" "00114179" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114637" "00114180" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114638" "00114181" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114639" "00114182" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114640" "00114183" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114641" "00114184" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114642" "00114185" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114643" "00114186" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114644" "00114187" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114645" "00114188" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114646" "00114189" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114647" "00114190" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114648" "00114191" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114649" "00114192" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114650" "00114193" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114651" "00114194" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114652" "00114195" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114653" "00114196" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114654" "00114197" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114655" "00114198" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114656" "00114199" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114657" "00114200" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114658" "00114201" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114659" "00114202" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114660" "00114203" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114661" "00114204" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114662" "00114205" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114663" "00114206" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114664" "00114207" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114665" "00114208" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114666" "00114209" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114667" "00114210" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114668" "00114211" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114669" "00114212" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114670" "00114213" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114671" "00114214" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114672" "00114215" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114673" "00114216" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114674" "00114217" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114675" "00114218" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114676" "00114219" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114677" "00114220" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114678" "00114221" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114679" "00114222" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114680" "00114223" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114681" "00114224" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114682" "00114225" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114683" "00114226" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114684" "00114227" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114685" "00114228" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114686" "00114229" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114687" "00114230" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114688" "00114231" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114689" "00114232" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114690" "00114233" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114691" "00114234" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114692" "00114235" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114693" "00114236" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114694" "00114237" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114695" "00114238" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114696" "00114239" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114697" "00114240" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114698" "00114241" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114699" "00114242" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114700" "00114243" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114701" "00114244" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114702" "00114245" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114703" "00114246" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114704" "00114247" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114705" "00114248" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114706" "00114249" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114707" "00114250" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114708" "00114251" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114709" "00114252" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114710" "00114253" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114711" "00114254" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114712" "00114255" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114713" "00114256" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114714" "00114257" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114715" "00114258" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114716" "00114259" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114717" "00114260" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114718" "00114261" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114719" "00114262" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114720" "00114263" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114721" "00114264" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114722" "00114265" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114723" "00114266" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114724" "00114267" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114725" "00114268" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114726" "00114269" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114727" "00114270" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114728" "00114271" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114729" "00114272" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114730" "00114273" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114731" "00114274" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114732" "00114275" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114733" "00114276" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114734" "00114277" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114735" "00114278" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114736" "00114279" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114737" "00114280" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114738" "00114281" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114739" "00114282" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114740" "00114283" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114741" "00114284" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114742" "00114285" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114743" "00114286" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114744" "00114287" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114745" "00114288" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114746" "00114289" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114747" "00114290" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114748" "00114291" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114749" "00114292" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114750" "00114293" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114751" "00114294" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114752" "00114295" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114753" "00114296" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114754" "00114297" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114755" "00114298" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114756" "00114299" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114757" "00114300" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114758" "00114301" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114759" "00114302" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114760" "00114303" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114761" "00114304" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114762" "00114305" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114763" "00114306" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114764" "00114307" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114765" "00114308" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114766" "00114309" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114767" "00114310" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114768" "00114311" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114769" "00114312" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114770" "00114313" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114771" "00114314" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114772" "00114315" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114773" "00114316" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114774" "00114317" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114775" "00114318" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114776" "00114319" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114777" "00114320" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114778" "00114321" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114779" "00114322" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114780" "00114323" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114781" "00114324" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114782" "00114325" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114783" "00114326" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114784" "00114327" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114785" "00114328" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114786" "00114329" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114787" "00114330" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114788" "00114331" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114789" "00114332" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114790" "00114333" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114791" "00114334" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114792" "00114335" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114793" "00114336" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114794" "00114337" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114795" "00114338" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114796" "00114339" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114797" "00114339" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114798" "00114341" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114799" "00114341" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114800" "00114343" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114801" "00114344" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114802" "00114345" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114803" "00114346" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114804" "00114347" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114805" "00114347" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114806" "00114349" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114807" "00114349" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114808" "00114351" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114809" "00114352" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114810" "00114352" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114811" "00114354" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114812" "00114354" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114813" "00114356" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114814" "00114357" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114815" "00114358" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114816" "00114359" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114817" "00114360" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000114818" "00114361" "1" "00006" "01921" "2017-02-09 12:00:00" "" "" "SEQ" "DNA" "" ""
"0000241541" "00240431" "1" "03335" "00008" "2019-06-20 17:48:49" "" "" "SEQ-NG-I" "DNA" "blood" ""
"0000275354" "00274199" "1" "00006" "00006" "2019-12-24 17:05:37" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000292604" "00291436" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292605" "00291437" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000309021" "00307881" "1" "03765" "03765" "2020-08-20 03:18:00" "" "" "MLPA" "DNA" "DNA" ""
"0000309025" "00307884" "1" "03765" "03765" "2020-08-20 07:58:50" "" "" "MLPA" "DNA" "DNA" ""
"0000309026" "00307885" "1" "03765" "03765" "2020-08-20 08:06:16" "" "" "SEQ-NG" "DNA" "DBS" "WES"
"0000309027" "00307886" "1" "03765" "03765" "2020-08-20 08:13:29" "" "" "MLPA" "DNA" "DNA" ""
"0000309028" "00307887" "1" "03765" "03765" "2020-08-20 08:19:28" "" "" "SEQ-NG-I" "DNA" "DBS" ""
"0000309029" "00307888" "1" "03765" "03765" "2020-08-20 08:25:13" "" "" "SEQ-NG-I" "DNA" "DBS" ""
"0000326722" "00325511" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel"
"0000328208" "00326995" "1" "03388" "03388" "2021-01-18 07:44:23" "" "" "SEQ;SEQ-NG-I" "DNA" "Blood" "WES"
"0000329194" "00327979" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329339" "00328124" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES and WGS"
"0000329426" "00328211" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329498" "00328283" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329510" "00328295" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000329542" "00328327" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000333410" "00332190" "1" "00000" "00006" "2021-02-15 18:54:26" "" "" "SEQ-NG" "DNA" "" "WES"
"0000333411" "00332191" "1" "00000" "00006" "2021-02-15 18:54:26" "" "" "SEQ-NG" "DNA" "" "WES"
"0000333420" "00332200" "1" "00000" "00006" "2021-02-15 18:54:26" "" "" "SEQ-NG" "DNA" "" "WES"
"0000333679" "00332455" "1" "00000" "00006" "2021-02-19 15:15:03" "" "" "SEQ-NG" "DNA" "" "150-gene panel"
"0000335040" "00333814" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335317" "00334091" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335318" "00334092" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335319" "00334093" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000335320" "00334094" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" ""
"0000336328" "00335099" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000336329" "00335100" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000364142" "00362914" "1" "00000" "00006" "2021-04-23 19:25:57" "" "" "SEQ-NG" "DNA" "" "gene panel, WES"
"0000375735" "00374541" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel"
"0000376611" "00375414" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES"
"0000377503" "00376307" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "SEQ-NG" "DNA" "blood" ""
"0000377504" "00376308" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "SEQ-NG" "DNA" "blood" ""
"0000382447" "00381232" "1" "00009" "00008" "2021-08-27 03:00:16" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384704" "00383479" "1" "00000" "03840" "2021-09-29 11:58:04" "" "" "?" "?" "" ""
"0000385240" "00384015" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" ""
"0000385288" "00384063" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" ""
"0000385758" "00384533" "1" "00000" "03840" "2021-09-29 17:43:05" "" "" "SEQ" "DNA" "" ""
"0000385759" "00384534" "1" "00000" "03840" "2021-09-29 17:43:05" "" "" "SEQ" "DNA" "" ""
"0000385760" "00384535" "1" "00000" "03840" "2021-09-29 17:43:05" "" "" "SEQ" "DNA" "" ""
"0000385761" "00384536" "1" "00000" "03840" "2021-09-29 17:43:05" "" "" "SEQ" "DNA" "" ""
"0000385762" "00384537" "1" "00000" "03840" "2021-09-29 17:43:05" "" "" "SEQ" "DNA" "" ""
"0000385763" "00384538" "1" "00000" "03840" "2021-09-29 17:43:05" "" "" "SEQ" "DNA" "" ""
"0000385764" "00384539" "1" "00000" "03840" "2021-09-29 17:43:05" "" "" "SEQ" "DNA" "" ""
"0000387906" "00386678" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" ""
"0000388049" "00386821" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" ""
"0000388941" "00387710" "1" "00006" "00006" "2021-10-31 12:02:46" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000389737" "00388496" "1" "00000" "00008" "2021-11-04 08:27:28" "" "" "SEQ-NG" "DNA" "" "CNV gene panel next-generation sequencing"
"0000390688" "00389445" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper"
"0000390783" "00389540" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper"
"0000390784" "00389541" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing"
"0000391266" "00390025" "1" "00000" "03840" "2021-11-08 12:01:50" "" "" "arrayCGH" "DNA" "" "targeted sequencing with 1 of 4 panels of OFTALMOgenics probes"
"0000391456" "00390215" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391457" "00390216" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391458" "00390217" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391459" "00390218" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391460" "00390219" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000391461" "00390220" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000395607" "00394360" "1" "00000" "03840" "2021-12-01 10:17:04" "" "" "SEQ-NG" "DNA" "" "retrospective analysis"
"0000397843" "00396600" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000403798" "00402556" "1" "01164" "01164" "2022-02-07 13:58:03" "" "" "SEQ-NG-I" "DNA" "" ""
"0000409691" "00408434" "1" "00000" "03840" "2022-04-21 15:58:46" "" "" "SEQ-NG;SEQ;MLPA" "DNA" "" "targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409692" "00408435" "1" "00000" "03840" "2022-04-21 15:58:46" "" "" "SEQ-NG;SEQ;MLPA" "DNA" "" "targeted gene analysis or a next-generation sequencing-based gene panel"
"0000411428" "00410165" "1" "00000" "03840" "2022-05-19 13:16:10" "" "" "SEQ" "DNA" "" ""
"0000411431" "00410169" "1" "00000" "03840" "2022-05-19 14:49:43" "" "" "SEQ-NG" "DNA" "" "whole-genome sequencing or whole-exome sequencing"
"0000411432" "00410170" "1" "00000" "03840" "2022-05-19 14:49:43" "" "" "SEQ-NG" "DNA" "" "whole-genome sequencing or whole-exome sequencing"
"0000411433" "00410171" "1" "00000" "03840" "2022-05-19 14:49:43" "" "" "SEQ-NG" "DNA" "" "whole-genome sequencing or whole-exome sequencing"
"0000411434" "00410172" "1" "00000" "03840" "2022-05-19 14:49:43" "" "" "SEQ-NG" "DNA" "" "whole-genome sequencing or whole-exome sequencing"
"0000411435" "00410173" "1" "00000" "03840" "2022-05-19 14:49:43" "" "" "SEQ-NG" "DNA" "" "whole-genome sequencing or whole-exome sequencing"
"0000411436" "00410174" "1" "00000" "03840" "2022-05-19 14:49:43" "" "" "SEQ-NG" "DNA" "" "whole-genome sequencing or whole-exome sequencing"
"0000411437" "00410175" "1" "00000" "03840" "2022-05-19 14:49:43" "" "" "SEQ-NG" "DNA" "" "whole-genome sequencing or whole-exome sequencing"
"0000411438" "00410176" "1" "00000" "03840" "2022-05-19 14:49:43" "" "" "SEQ-NG" "DNA" "" "whole-genome sequencing or whole-exome sequencing"
"0000411439" "00410177" "1" "00000" "03840" "2022-05-19 14:49:43" "" "" "SEQ-NG" "DNA" "" "whole-genome sequencing or whole-exome sequencing"
"0000411440" "00410178" "1" "00000" "03840" "2022-05-19 14:49:43" "" "" "SEQ-NG" "DNA" "" "whole-genome sequencing or whole-exome sequencing"
"0000411444" "00410181" "1" "00000" "03840" "2022-05-19 17:41:47" "" "" "SEQ" "DNA" "" ""
"0000411445" "00410182" "1" "00000" "03840" "2022-05-19 18:00:19" "" "" "SEQ-NG" "DNA" "" "Epidasd545 Panel"
"0000411446" "00410183" "1" "00000" "03840" "2022-05-19 18:00:19" "" "" "SEQ-NG" "DNA" "" "Epidasd545 Panel"
"0000411447" "00410184" "1" "00000" "03840" "2022-05-19 18:31:12" "" "" "SEQ-NG" "DNA" "" "Epidasd545 Panel"
"0000411448" "00410185" "1" "00000" "03840" "2022-05-19 18:31:12" "" "" "SEQ-NG" "DNA" "" "Epidasd545 Panel"
"0000431013" "00429600" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431234" "00429821" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431300" "00429887" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431355" "00429942" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431361" "00429948" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000431535" "00430122" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing"
"0000437894" "00436411" "1" "04552" "04552" "2023-09-13 19:09:22" "" "" "SEQ-NG-I" "DNA" "Buccal swab" "Gene panel"
"0000437895" "00436411" "1" "04552" "04552" "2023-09-13 19:30:00" "04552" "2023-09-13 19:42:28" "SEQ-NG-I" "DNA" "Buccal swab" "Gene panel"
"0000437903" "00436419" "1" "04552" "04552" "2023-09-14 17:44:48" "" "" "SEQ-NG-I" "DNA" "Buccal swab" "Retinal dystrophy panel"
"0000440132" "00438650" "1" "00006" "00006" "2023-10-21 19:20:17" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS"
"0000441932" "00440447" "1" "00006" "00006" "2023-11-02 14:36:08" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000448631" "00447054" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000448696" "00447119" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000448765" "00447188" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000452377" "00450779" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000452378" "00450780" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000452379" "00450781" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000452380" "00450782" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000452648" "00451049" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000452660" "00451061" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000452661" "00451062" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000452893" "00451294" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000452939" "00451340" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes"
"0000457842" "00456225" "1" "00006" "00006" "2024-10-24 08:52:57" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000457844" "00456227" "1" "00006" "00006" "2024-10-24 08:52:57" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000457879" "00456262" "1" "00006" "00006" "2024-10-24 08:52:57" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000457884" "00456267" "1" "00006" "00006" "2024-10-24 08:52:57" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000460629" "00459008" "1" "00006" "00006" "2024-12-23 16:56:20" "" "" "SEQ-NG" "DNA" "" ""
"0000460630" "00459009" "1" "00006" "00006" "2024-12-23 17:08:31" "" "" "SEQ-NG" "DNA" "" ""
"0000469274" "00467610" "1" "04913" "04913" "2025-10-24 04:58:08" "" "" "SEQ-NG" "DNA" "" ""
"0000470429" "00468761" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000471247" "00469579" "1" "00006" "00006" "2025-11-18 12:45:53" "" "" "arrayCGH" "DNA" "" ""
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 668
"{{screeningid}}" "{{geneid}}"
"0000000009" "ACADM"
"0000000009" "ARSB"
"0000000009" "ATP7B"
"0000000009" "CFTR"
"0000000009" "CLN3"
"0000000009" "ETFB"
"0000000009" "GAN"
"0000000009" "GLB1"
"0000000009" "HEXB"
"0000000009" "IGHMBP2"
"0000000009" "MEFV"
"0000000009" "NHLRC1"
"0000000009" "NPHS1"
"0000000009" "NTRK1"
"0000000009" "PMP22"
"0000000009" "SERPINA1"
"0000000009" "WNT10A"
"0000000010" "ACADM"
"0000000010" "ATP7B"
"0000000010" "BTD"
"0000000010" "CLN3"
"0000000010" "CPT1A"
"0000000010" "DGUOK"
"0000000010" "ERCC6"
"0000000010" "ETFB"
"0000000010" "NHLRC1"
"0000000010" "PAH"
"0000000028" "ALG1"
"0000000028" "AMPD1"
"0000000028" "ATP7B"
"0000000028" "BTD"
"0000000028" "CBS"
"0000000028" "CLN3"
"0000000028" "CYP21A2"
"0000000028" "FGG"
"0000000028" "GALC"
"0000000028" "GLB1"
"0000000028" "JAK3"
"0000000028" "NPHS1"
"0000000028" "RAG2"
"0000000028" "RPGRIP1L"
"0000000028" "SERPINA1"
"0000000028" "SLC26A2"
"0000000062" "AGXT"
"0000000062" "ATP7B"
"0000000062" "CLN3"
"0000000062" "CYP21A2"
"0000000062" "ETFB"
"0000000062" "GALC"
"0000000062" "GALT"
"0000000062" "GLB1"
"0000000062" "HSPG2"
"0000000062" "IGHMBP2"
"0000000062" "MEFV"
"0000000062" "NEB"
"0000000062" "NPHS1"
"0000000062" "SERPINA1"
"0000000062" "SLC26A2"
"0000000062" "TGM1"
"0000000102" "B3GLCT"
"0000000102" "BEST1"
"0000000102" "MECP2"
"0000000102" "NF1"
"0000000102" "NSD1"
"0000000102" "RS1"
"0000000107" "ADA"
"0000000107" "BTD"
"0000000107" "CLN3"
"0000000107" "CLRN1"
"0000000107" "CYP21A2"
"0000000107" "GLB1"
"0000000107" "MEFV"
"0000000107" "MYO5A"
"0000000107" "NHLRC1"
"0000000107" "NPHS1"
"0000000107" "SERPINA1"
"0000000107" "SLC26A2"
"0000000107" "WNT10A"
"0000114315" "CLN3"
"0000114316" "CLN3"
"0000114317" "CLN3"
"0000114318" "CLN3"
"0000114319" "CLN3"
"0000114320" "CLN3"
"0000114321" "CLN3"
"0000114322" "CLN3"
"0000114323" "CLN3"
"0000114324" "CLN3"
"0000114325" "CLN3"
"0000114326" "CLN3"
"0000114327" "CLN3"
"0000114328" "CLN3"
"0000114329" "CLN3"
"0000114330" "CLN3"
"0000114331" "CLN3"
"0000114332" "CLN3"
"0000114333" "CLN3"
"0000114334" "CLN3"
"0000114335" "CLN3"
"0000114336" "CLN3"
"0000114337" "CLN3"
"0000114338" "CLN3"
"0000114339" "CLN3"
"0000114340" "CLN3"
"0000114341" "CLN3"
"0000114342" "CLN3"
"0000114343" "CLN3"
"0000114344" "CLN3"
"0000114345" "CLN3"
"0000114346" "CLN3"
"0000114347" "CLN3"
"0000114348" "CLN3"
"0000114349" "CLN3"
"0000114350" "CLN3"
"0000114351" "CLN3"
"0000114352" "CLN3"
"0000114353" "CLN3"
"0000114354" "CLN3"
"0000114355" "CLN3"
"0000114356" "CLN3"
"0000114357" "CLN3"
"0000114358" "CLN3"
"0000114359" "CLN3"
"0000114360" "CLN3"
"0000114361" "CLN3"
"0000114362" "CLN3"
"0000114363" "CLN3"
"0000114364" "CLN3"
"0000114365" "CLN3"
"0000114366" "CLN3"
"0000114367" "CLN3"
"0000114368" "CLN3"
"0000114369" "CLN3"
"0000114370" "CLN3"
"0000114371" "CLN3"
"0000114372" "CLN3"
"0000114373" "CLN3"
"0000114374" "CLN3"
"0000114375" "CLN3"
"0000114376" "CLN3"
"0000114377" "CLN3"
"0000114378" "CLN3"
"0000114379" "CLN3"
"0000114380" "CLN3"
"0000114381" "CLN3"
"0000114382" "CLN3"
"0000114383" "CLN3"
"0000114384" "CLN3"
"0000114385" "CLN3"
"0000114386" "CLN3"
"0000114387" "CLN3"
"0000114388" "CLN3"
"0000114389" "CLN3"
"0000114390" "CLN3"
"0000114391" "CLN3"
"0000114392" "CLN3"
"0000114393" "CLN3"
"0000114394" "CLN3"
"0000114395" "CLN3"
"0000114396" "CLN3"
"0000114397" "CLN3"
"0000114398" "CLN3"
"0000114399" "CLN3"
"0000114400" "CLN3"
"0000114401" "CLN3"
"0000114402" "CLN3"
"0000114403" "CLN3"
"0000114404" "CLN3"
"0000114405" "CLN3"
"0000114406" "CLN3"
"0000114407" "CLN3"
"0000114408" "CLN3"
"0000114409" "CLN3"
"0000114410" "CLN3"
"0000114411" "CLN3"
"0000114412" "CLN3"
"0000114413" "CLN3"
"0000114414" "CLN3"
"0000114415" "CLN3"
"0000114416" "CLN3"
"0000114417" "CLN3"
"0000114418" "CLN3"
"0000114419" "CLN3"
"0000114420" "CLN3"
"0000114421" "CLN3"
"0000114422" "CLN3"
"0000114423" "CLN3"
"0000114424" "CLN3"
"0000114425" "CLN3"
"0000114426" "CLN3"
"0000114427" "CLN3"
"0000114428" "CLN3"
"0000114429" "CLN3"
"0000114430" "CLN3"
"0000114431" "CLN3"
"0000114432" "CLN3"
"0000114433" "CLN3"
"0000114434" "CLN3"
"0000114435" "CLN3"
"0000114436" "CLN3"
"0000114437" "CLN3"
"0000114438" "CLN3"
"0000114439" "CLN3"
"0000114440" "CLN3"
"0000114441" "CLN3"
"0000114442" "CLN3"
"0000114443" "CLN3"
"0000114444" "CLN3"
"0000114445" "CLN3"
"0000114446" "CLN3"
"0000114447" "CLN3"
"0000114448" "CLN3"
"0000114449" "CLN3"
"0000114450" "CLN3"
"0000114451" "CLN3"
"0000114452" "CLN3"
"0000114453" "CLN3"
"0000114454" "CLN3"
"0000114455" "CLN3"
"0000114456" "CLN3"
"0000114457" "CLN3"
"0000114458" "CLN3"
"0000114459" "CLN3"
"0000114460" "CLN3"
"0000114461" "CLN3"
"0000114462" "CLN3"
"0000114463" "CLN3"
"0000114464" "CLN3"
"0000114465" "CLN3"
"0000114466" "CLN3"
"0000114467" "CLN3"
"0000114468" "CLN3"
"0000114469" "CLN3"
"0000114470" "CLN3"
"0000114471" "CLN3"
"0000114472" "CLN3"
"0000114473" "CLN3"
"0000114474" "CLN3"
"0000114475" "CLN3"
"0000114476" "CLN3"
"0000114477" "CLN3"
"0000114478" "CLN3"
"0000114479" "CLN3"
"0000114480" "CLN3"
"0000114481" "CLN3"
"0000114482" "CLN3"
"0000114483" "CLN3"
"0000114484" "CLN3"
"0000114485" "CLN3"
"0000114486" "CLN3"
"0000114487" "CLN3"
"0000114488" "CLN3"
"0000114489" "CLN3"
"0000114490" "CLN3"
"0000114491" "CLN3"
"0000114492" "CLN3"
"0000114493" "CLN3"
"0000114494" "CLN3"
"0000114495" "CLN3"
"0000114496" "CLN3"
"0000114497" "CLN3"
"0000114498" "CLN3"
"0000114499" "CLN3"
"0000114500" "CLN3"
"0000114501" "CLN3"
"0000114502" "CLN3"
"0000114503" "CLN3"
"0000114504" "CLN3"
"0000114505" "CLN3"
"0000114506" "CLN3"
"0000114507" "CLN3"
"0000114508" "CLN3"
"0000114509" "CLN3"
"0000114510" "CLN3"
"0000114511" "CLN3"
"0000114512" "CLN3"
"0000114513" "CLN3"
"0000114514" "CLN3"
"0000114515" "CLN3"
"0000114516" "CLN3"
"0000114517" "CLN3"
"0000114518" "CLN3"
"0000114519" "CLN3"
"0000114520" "CLN3"
"0000114521" "CLN3"
"0000114522" "CLN3"
"0000114523" "CLN3"
"0000114524" "CLN3"
"0000114525" "CLN3"
"0000114526" "CLN3"
"0000114527" "CLN3"
"0000114528" "CLN3"
"0000114529" "CLN3"
"0000114530" "CLN3"
"0000114531" "CLN3"
"0000114532" "CLN3"
"0000114533" "CLN3"
"0000114534" "CLN3"
"0000114535" "CLN3"
"0000114536" "CLN3"
"0000114537" "CLN3"
"0000114538" "CLN3"
"0000114539" "CLN3"
"0000114540" "CLN3"
"0000114541" "CLN3"
"0000114542" "CLN3"
"0000114543" "CLN3"
"0000114544" "CLN3"
"0000114545" "CLN3"
"0000114546" "CLN3"
"0000114547" "CLN3"
"0000114548" "CLN3"
"0000114549" "CLN3"
"0000114550" "CLN3"
"0000114551" "CLN3"
"0000114552" "CLN3"
"0000114553" "CLN3"
"0000114554" "CLN3"
"0000114555" "CLN3"
"0000114556" "CLN3"
"0000114557" "CLN3"
"0000114558" "CLN3"
"0000114559" "CLN3"
"0000114560" "CLN3"
"0000114561" "CLN3"
"0000114562" "CLN3"
"0000114563" "CLN3"
"0000114564" "CLN3"
"0000114565" "CLN3"
"0000114566" "CLN3"
"0000114567" "CLN3"
"0000114568" "CLN3"
"0000114569" "CLN3"
"0000114570" "CLN3"
"0000114571" "CLN3"
"0000114572" "CLN3"
"0000114573" "CLN3"
"0000114574" "CLN3"
"0000114575" "CLN3"
"0000114576" "CLN3"
"0000114577" "CLN3"
"0000114578" "CLN3"
"0000114579" "CLN3"
"0000114580" "CLN3"
"0000114581" "CLN3"
"0000114582" "CLN3"
"0000114583" "CLN3"
"0000114584" "CLN3"
"0000114585" "CLN3"
"0000114586" "CLN3"
"0000114587" "CLN3"
"0000114588" "CLN3"
"0000114589" "CLN3"
"0000114590" "CLN3"
"0000114591" "CLN3"
"0000114592" "CLN3"
"0000114593" "CLN3"
"0000114594" "CLN3"
"0000114595" "CLN3"
"0000114596" "CLN3"
"0000114597" "CLN3"
"0000114598" "CLN3"
"0000114599" "CLN3"
"0000114600" "CLN3"
"0000114601" "CLN3"
"0000114602" "CLN3"
"0000114603" "CLN3"
"0000114604" "CLN3"
"0000114605" "CLN3"
"0000114606" "CLN3"
"0000114607" "CLN3"
"0000114608" "CLN3"
"0000114609" "CLN3"
"0000114610" "CLN3"
"0000114611" "CLN3"
"0000114612" "CLN3"
"0000114613" "CLN3"
"0000114614" "CLN3"
"0000114615" "CLN3"
"0000114616" "CLN3"
"0000114617" "CLN3"
"0000114618" "CLN3"
"0000114619" "CLN3"
"0000114620" "CLN3"
"0000114621" "CLN3"
"0000114622" "CLN3"
"0000114623" "CLN3"
"0000114624" "CLN3"
"0000114625" "CLN3"
"0000114626" "CLN3"
"0000114627" "CLN3"
"0000114628" "CLN3"
"0000114629" "CLN3"
"0000114630" "CLN3"
"0000114631" "CLN3"
"0000114632" "CLN3"
"0000114633" "CLN3"
"0000114634" "CLN3"
"0000114635" "CLN3"
"0000114636" "CLN3"
"0000114637" "CLN3"
"0000114638" "CLN3"
"0000114639" "CLN3"
"0000114640" "CLN3"
"0000114641" "CLN3"
"0000114642" "CLN3"
"0000114643" "CLN3"
"0000114644" "CLN3"
"0000114645" "CLN3"
"0000114646" "CLN3"
"0000114647" "CLN3"
"0000114648" "CLN3"
"0000114649" "CLN3"
"0000114650" "CLN3"
"0000114651" "CLN3"
"0000114652" "CLN3"
"0000114653" "CLN3"
"0000114654" "CLN3"
"0000114655" "CLN3"
"0000114656" "CLN3"
"0000114657" "CLN3"
"0000114658" "CLN3"
"0000114659" "CLN3"
"0000114660" "CLN3"
"0000114661" "CLN3"
"0000114662" "CLN3"
"0000114663" "CLN3"
"0000114664" "CLN3"
"0000114665" "CLN3"
"0000114666" "CLN3"
"0000114667" "CLN3"
"0000114668" "CLN3"
"0000114669" "CLN3"
"0000114670" "CLN3"
"0000114671" "CLN3"
"0000114672" "CLN3"
"0000114673" "CLN3"
"0000114674" "CLN3"
"0000114675" "CLN3"
"0000114676" "CLN3"
"0000114677" "CLN3"
"0000114678" "CLN3"
"0000114679" "CLN3"
"0000114680" "CLN3"
"0000114681" "CLN3"
"0000114682" "CLN3"
"0000114683" "CLN3"
"0000114684" "CLN3"
"0000114685" "CLN3"
"0000114686" "CLN3"
"0000114687" "CLN3"
"0000114688" "CLN3"
"0000114689" "CLN3"
"0000114690" "CLN3"
"0000114691" "CLN3"
"0000114692" "CLN3"
"0000114693" "CLN3"
"0000114694" "CLN3"
"0000114695" "CLN3"
"0000114696" "CLN3"
"0000114697" "CLN3"
"0000114698" "CLN3"
"0000114699" "CLN3"
"0000114700" "CLN3"
"0000114701" "CLN3"
"0000114702" "CLN3"
"0000114703" "CLN3"
"0000114704" "CLN3"
"0000114705" "CLN3"
"0000114706" "CLN3"
"0000114707" "CLN3"
"0000114708" "CLN3"
"0000114709" "CLN3"
"0000114710" "CLN3"
"0000114711" "CLN3"
"0000114712" "CLN3"
"0000114713" "CLN3"
"0000114714" "CLN3"
"0000114715" "CLN3"
"0000114716" "CLN3"
"0000114717" "CLN3"
"0000114718" "CLN3"
"0000114719" "CLN3"
"0000114720" "CLN3"
"0000114721" "CLN3"
"0000114722" "CLN3"
"0000114723" "CLN3"
"0000114724" "CLN3"
"0000114725" "CLN3"
"0000114726" "CLN3"
"0000114727" "CLN3"
"0000114728" "CLN3"
"0000114729" "CLN3"
"0000114730" "CLN3"
"0000114731" "CLN3"
"0000114732" "CLN3"
"0000114733" "CLN3"
"0000114734" "CLN3"
"0000114735" "CLN3"
"0000114736" "CLN3"
"0000114737" "CLN3"
"0000114738" "CLN3"
"0000114739" "CLN3"
"0000114740" "CLN3"
"0000114741" "CLN3"
"0000114742" "CLN3"
"0000114743" "CLN3"
"0000114744" "CLN3"
"0000114745" "CLN3"
"0000114746" "CLN3"
"0000114747" "CLN3"
"0000114748" "CLN3"
"0000114749" "CLN3"
"0000114750" "CLN3"
"0000114751" "CLN3"
"0000114752" "CLN3"
"0000114753" "CLN3"
"0000114754" "CLN3"
"0000114755" "CLN3"
"0000114756" "CLN3"
"0000114757" "CLN3"
"0000114758" "CLN3"
"0000114759" "CLN3"
"0000114760" "CLN3"
"0000114761" "CLN3"
"0000114762" "CLN3"
"0000114763" "CLN3"
"0000114764" "CLN3"
"0000114765" "CLN3"
"0000114766" "CLN3"
"0000114767" "CLN3"
"0000114768" "CLN3"
"0000114769" "CLN3"
"0000114770" "CLN3"
"0000114771" "CLN3"
"0000114772" "CLN3"
"0000114773" "CLN3"
"0000114774" "CLN3"
"0000114775" "CLN3"
"0000114776" "CLN3"
"0000114777" "CLN3"
"0000114778" "CLN3"
"0000114779" "CLN3"
"0000114780" "CLN3"
"0000114781" "CLN3"
"0000114782" "CLN3"
"0000114783" "CLN3"
"0000114784" "CLN3"
"0000114785" "CLN3"
"0000114786" "CLN3"
"0000114787" "CLN3"
"0000114788" "CLN3"
"0000114789" "CLN3"
"0000114790" "CLN3"
"0000114791" "CLN3"
"0000114792" "CLN3"
"0000114793" "CLN3"
"0000114794" "CLN3"
"0000114795" "CLN3"
"0000114796" "CLN3"
"0000114797" "CLN3"
"0000114798" "CLN3"
"0000114799" "CLN3"
"0000114800" "CLN3"
"0000114801" "CLN3"
"0000114802" "CLN3"
"0000114803" "CLN3"
"0000114804" "CLN3"
"0000114805" "CLN3"
"0000114806" "CLN3"
"0000114807" "CLN3"
"0000114808" "CLN3"
"0000114809" "CLN3"
"0000114810" "CLN3"
"0000114811" "CLN3"
"0000114812" "CLN3"
"0000114813" "CLN3"
"0000114814" "CLN3"
"0000114815" "CLN3"
"0000114816" "CLN3"
"0000114817" "CLN3"
"0000114818" "CLN3"
"0000241541" "CLN3"
"0000275354" "CLN3"
"0000309021" "CLN3"
"0000309025" "CLN3"
"0000309026" "CLN3"
"0000309027" "CLN3"
"0000309028" "CLN3"
"0000309029" "CLN3"
"0000326722" "CLN3"
"0000328208" "CLN3"
"0000329194" "CLN3"
"0000329339" "CLN3"
"0000329426" "CLN3"
"0000329498" "CLN3"
"0000329510" "CLN3"
"0000329542" "CLN3"
"0000333679" "CLN3"
"0000335040" "CLN3"
"0000335317" "CLN3"
"0000335318" "CLN3"
"0000335319" "CLN3"
"0000335320" "CLN3"
"0000336328" "CLN3"
"0000336329" "CLN3"
"0000364142" "CLN3"
"0000375735" "CLN3"
"0000377503" "CLN3"
"0000377504" "CLN3"
"0000382447" "CLN3"
"0000384704" "CLN3"
"0000385240" "CLN3"
"0000385288" "CLN3"
"0000385758" "CLN3"
"0000385759" "CLN3"
"0000385760" "CLN3"
"0000385761" "CLN3"
"0000385762" "CLN3"
"0000385763" "CLN3"
"0000385764" "CLN3"
"0000387906" "CLN3"
"0000388049" "CLN3"
"0000388941" "CLN3"
"0000389737" "CLN3"
"0000390688" "CLN3"
"0000390783" "CLN3"
"0000390784" "CLN3"
"0000391266" "CLN3"
"0000391456" "CLN3"
"0000391457" "CLN3"
"0000391458" "CLN3"
"0000391459" "CLN3"
"0000391460" "CLN3"
"0000391461" "CLN3"
"0000395607" "CLN3"
"0000397843" "RPGR"
"0000403798" "CLN3"
"0000409691" "CLN3"
"0000409692" "CLN3"
"0000411428" "CLN3"
"0000411431" "CLN3"
"0000411432" "CLN3"
"0000411433" "CLN3"
"0000411434" "CLN3"
"0000411435" "CLN3"
"0000411436" "CLN3"
"0000411437" "CLN3"
"0000411438" "CLN3"
"0000411439" "CLN3"
"0000411440" "CLN3"
"0000411444" "CLN3"
"0000411445" "CLN3"
"0000411446" "CLN3"
"0000411447" "CLN3"
"0000411448" "CLN3"
"0000431013" "CLN3"
"0000431234" "CLN3"
"0000431300" "CLN3"
"0000431355" "CLN3"
"0000431361" "CLN3"
"0000431535" "CLN3"
"0000437894" "CLN3"
"0000437895" "CLN3"
"0000437903" "CLN3"
"0000460629" "CLN3"
"0000460630" "CLN3"
"0000469274" "CLN3"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 749
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000000601" "0" "50" "16" "28488957" "28488957" "subst" "8.15701E-6" "00002" "CLN3_000001" "g.28488957C>A" "" "" "" " INTRON 14, IVS14-1G>T, CHR16:28396458G>T" "" "Germline" "" "" "" "" "" "g.28477636C>A" "" "VUS" ""
"0000000602" "0" "50" "16" "28497286" "28498251" "del" "0" "00002" "CLN3_000002" "g.28497286_28498251del" "" "" "" " UNDEFINED; IN VICINITY OF INTRONS 6-8, EXONS7-8, CHR16:28405752_28404787" "" "Germline" "" "" "" "" "" "g.28485965_28486930del" "" "VUS" ""
"0000000603" "0" "50" "16" "28498813" "28498814" "del" "0" "00002" "CLN3_000003" "g.28498813_28498814del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.28487492_28487493del" "" "VUS" ""
"0000000604" "0" "50" "16" "28497286" "28498251" "del" "0" "00002" "CLN3_000002" "g.28497286_28498251del" "" "" "" " INTRONS 6-8, 966BPDEL, EXONS7-8DEL AND FS, CHR16:28405752_28404787DEL" "" "Germline" "" "" "" "" "" "g.28485965_28486930del" "" "VUS" ""
"0000000605" "0" "50" "16" "28497286" "28498251" "del" "0" "00002" "CLN3_000002" "g.28497286_28498251del" "" "" "" " INTRONS 6-8, 966BPDEL, EXONS7-8DEL AND FS, CHR16:28405752_28404787DEL" "" "Germline" "" "" "" "" "" "g.28485965_28486930del" "" "VUS" ""
"0000000606" "0" "50" "16" "28497286" "28498251" "del" "0" "00002" "CLN3_000002" "g.28497286_28498251del" "" "" "" " INTRONS 6-8, 966BPDEL, EXONS7-8DEL AND FS, CHR16:28405752_28404787DEL" "" "Germline" "" "" "" "" "" "g.28485965_28486930del" "" "VUS" ""
"0000000607" "0" "50" "16" "28497286" "28498251" "del" "0" "00002" "CLN3_000002" "g.28497286_28498251del" "" "" "" " INTRONS 6-8, 966BPDEL, EXONS7-8DEL AND FS, CHR16:28405752_28404787DEL" "" "Germline" "" "" "" "" "" "g.28485965_28486930del" "" "VUS" ""
"0000000608" "0" "50" "16" "28497286" "28498251" "del" "0" "00002" "CLN3_000002" "g.28497286_28498251del" "" "" "" " INTRONS 6-8, 966BPDEL, EXONS7-8DEL AND FS, CHR16:28405752_28404787DEL" "" "Germline" "" "" "" "" "" "g.28485965_28486930del" "" "VUS" ""
"0000000609" "0" "50" "16" "28493821" "28493821" "subst" "0" "00002" "CLN3_000005" "g.28493821C>A" "" "" "" "" "" "Germline" "" "" "" "" "" "g.28482500C>A" "" "VUS" ""
"0000000610" "0" "50" "16" "28493793" "28493793" "subst" "0" "00002" "CLN3_000006" "g.28493793C>T" "" "" "" " INTRON 11, IVS11G>A, CHR16:28401294G>A" "" "Germline" "" "" "" "" "" "g.28482472C>T" "" "VUS" ""
"0000019547" "0" "55" "16" "28493516" "28493516" "subst" "0" "00102" "CLN3_000008" "g.28493516G>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.28482195G>C" "" "VUS" ""
"0000019548" "0" "55" "16" "28493836" "28493836" "subst" "8.12143E-6" "00102" "CLN3_000007" "g.28493836C>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.28482515C>A" "" "VUS" ""
"0000079383" "0" "90" "16" "21530207" "29332245" "del" "0" "00006" "CLN3_000009" "g.21530207_29332245del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "decreased gene dosage" "De novo" "" "" "0" "" "" "g.21518886_29320924del" "" "pathogenic" ""
"0000079608" "0" "90" "16" "27183151" "31888684" "dup" "0" "00006" "CLN3_000010" "g.27183151_31888684dup" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "mosaicism, copy number 3 in 0.33 cells" "Somatic" "" "" "0" "" "" "g.27171830_31877363dup" "" "pathogenic" ""
"0000183645" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183646" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183647" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183648" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183649" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183650" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183651" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183652" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183653" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183654" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183655" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183656" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183657" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183658" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183659" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183660" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183661" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183662" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183663" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183664" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183665" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183666" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183667" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183668" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183669" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183670" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183671" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183672" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183673" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183674" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183675" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183676" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183677" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183678" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183679" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183680" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183681" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183682" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183683" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183684" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183685" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183686" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183687" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183688" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183689" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183690" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183691" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183692" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183693" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183694" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183695" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183696" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183697" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183698" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183699" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183700" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183701" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183702" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183703" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183704" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183705" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183706" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183707" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183708" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183709" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183710" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183711" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183712" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183713" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183714" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183715" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183716" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183717" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183718" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183719" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183720" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183721" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183722" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183723" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183724" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183725" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183726" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183727" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183728" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183729" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183730" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183731" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183732" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183733" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183734" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183735" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183736" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183737" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183738" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183739" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183740" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183741" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183742" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183743" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183744" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183745" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183746" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183747" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183748" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183749" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183750" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183751" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183752" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183753" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183754" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183755" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183756" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183757" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183758" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183759" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183760" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183761" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183762" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183763" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183764" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183765" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183766" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183767" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183768" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183769" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183770" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183771" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183772" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183773" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183774" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183775" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183776" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183777" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183778" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183779" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183780" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183781" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183782" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183783" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:D. Zafeirou:}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183784" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183785" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:IBDC 1995 Munroe 1997 Lauronen 1999:7553855, 9311735, 9932957}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183786" "2" "90" "16" "28491981" "28494795" "del" "0" "00006" "CLN3_000020" "g.28491981_28494795del2815" "" "{PMID:IBDC 1995 Munroe 1997 Lauronen 1999:7553855, 9311735, 9932957}, {DB:CLN}" "" "2.8 kb deletion, c.791-802_1056+1445del2815" "2.8 kb deletion or p.Gly264_Gln352delinsValfsX29 or p.Gly264_Leu437delinsAlaSerAspSerProAlaSerAlaSerArgValAlaGlyThrThrGly\r\nVariant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28480660_28483474del2815" "" "pathogenic" ""
"0000183787" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:IBDC 1995 Munroe 1997 Lauronen 1999:7553855, 9311735, 9932957}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183788" "2" "90" "16" "28497898" "28497898" "subst" "0" "00006" "CLN3_000048" "g.28497898C>G" "" "{PMID:IBDC 1995 Munroe 1997 Lauronen 1999:7553855, 9311735, 9932957}, {DB:CLN}" "" "c.533+1G>C" "670+1G>C; c.533+1G>C splice defect" "Germline" "" "" "0" "" "" "g.28486577C>G" "" "pathogenic" ""
"0000183789" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:IBDC 1995:7553855}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183790" "2" "90" "16" "28488804" "28498805" "del" "0" "00006" "CLN3_000011" "g.28488804_28498805del" "" "{PMID:IBDC 1995:7553855}, {DB:CLN}" "" "6 kb deletion" "deletion of 6 kb that starts between F2 and F4 and ends between GF1 and R3 primers; i08 - 3\' region, unknown 6 kb deletion; Truncated protein\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28477483_28487484del" "" "pathogenic" ""
"0000183791" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183792" "2" "70" "16" "28499055" "28499055" "subst" "0" "00006" "CLN3_000065" "g.28499055A>G" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Leu101Pro" "" "Germline" "" "" "0" "" "" "g.28487734A>G" "" "likely pathogenic" ""
"0000183793" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183794" "2" "90" "16" "28498861" "28498862" "dup" "0" "00006" "CLN3_000062" "g.28498861_28498862dup" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Arg127Profs*55" "formerly c.374-375insCC in Munroe et al 1997, and described as p.Val128GlyfsX54 in Kousi et al 2012," "Germline" "" "" "0" "" "" "g.28487540_28487541dup" "" "pathogenic" ""
"0000183795" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183796" "2" "90" "16" "28497984" "28497984" "subst" "0" "00006" "CLN3_000057" "g.28497984C>G" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "c.461-13G>C" "splice defect (confirmed by RT-PCR). Sometimes aberrant splicing to give truncated protein p.Gly154fsX2; IVS6-13G>C: two transcripts: normal and one with exon 7 missing" "Germline" "" "" "0" "" "" "g.28486663C>G" "" "pathogenic" ""
"0000183797" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183798" "2" "90" "16" "28497950" "28497950" "subst" "0" "00006" "CLN3_000053" "g.28497950G>C" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Ser161X" "" "Germline" "" "" "0" "" "" "g.28486629G>C" "" "pathogenic" ""
"0000183799" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183800" "2" "90" "16" "28497947" "28497947" "subst" "0" "00006" "CLN3_000052" "g.28497947G>C" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Ser162X" "" "Germline" "" "" "0" "" "" "g.28486626G>C" "" "pathogenic" ""
"0000183801" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183802" "2" "70" "16" "28497923" "28497923" "subst" "0" "00006" "CLN3_000050" "g.28497923A>G" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Leu170Pro" "" "Germline" "" "" "0" "" "" "g.28486602A>G" "" "likely pathogenic" ""
"0000183803" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183804" "2" "70" "16" "28497923" "28497923" "subst" "0" "00006" "CLN3_000050" "g.28497923A>G" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Leu170Pro" "" "Germline" "" "" "0" "" "" "g.28486602A>G" "" "likely pathogenic" ""
"0000183805" "1" "90" "16" "28497714" "28497714" "subst" "0" "00006" "CLN3_000038" "g.28497714G>A" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Gln211X" "" "Germline" "" "" "0" "" "" "g.28486393G>A" "" "pathogenic" ""
"0000183806" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:IBDC 1995 Munroe 1997 Lauronen 1999:7553855, 9311735, 9932957}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183807" "2" "70" "16" "28493821" "28493821" "subst" "1.62434E-5" "00006" "CLN3_000033" "g.28493821C>T" "" "{PMID:IBDC 1995 Munroe 1997 Lauronen 1999:7553855, 9311735, 9932957}, {DB:CLN}" "" "p.Glu295Lys" "nt 1020G>A" "Germline" "" "rs121434286" "0" "" "" "g.28482500C>T" "" "likely pathogenic" ""
"0000183808" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183809" "2" "90" "16" "28493503" "28493503" "subst" "4.10415E-6" "00006" "CLN3_000029" "g.28493503G>A" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Gln327X" "" "Germline" "" "" "0" "" "" "g.28482182G>A" "" "pathogenic" ""
"0000183810" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183811" "2" "70" "16" "28493494" "28493494" "subst" "0" "00006" "CLN3_000028" "g.28493494C>A" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Val330Phe" "" "Germline" "" "" "0" "" "" "g.28482173C>A" "" "likely pathogenic" ""
"0000183812" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183813" "2" "70" "16" "28493482" "28493482" "subst" "0" "00006" "CLN3_000027" "g.28493482G>A" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Arg334Cys" "" "Germline" "" "" "0" "" "" "g.28482161G>A" "" "likely pathogenic" ""
"0000183814" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183815" "2" "70" "16" "28493482" "28493482" "subst" "0" "00006" "CLN3_000027" "g.28493482G>A" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Arg334Cys" "" "Germline" "" "" "0" "" "" "g.28482161G>A" "" "likely pathogenic" ""
"0000183816" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183817" "2" "70" "16" "28493482" "28493482" "subst" "0" "00006" "CLN3_000027" "g.28493482G>A" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Arg334Cys" "" "Germline" "" "" "0" "" "" "g.28482161G>A" "" "likely pathogenic" ""
"0000183818" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183819" "2" "70" "16" "28493481" "28493481" "subst" "2.45634E-5" "00006" "CLN3_000026" "g.28493481C>T" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Arg334His" "" "Germline" "" "" "0" "" "" "g.28482160C>T" "" "likely pathogenic" ""
"0000183820" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183821" "2" "70" "16" "28493481" "28493481" "subst" "2.45634E-5" "00006" "CLN3_000026" "g.28493481C>T" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Arg334His" "" "Germline" "" "" "0" "" "" "g.28482160C>T" "" "likely pathogenic" ""
"0000183822" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183823" "2" "70" "16" "28493481" "28493481" "subst" "2.45634E-5" "00006" "CLN3_000026" "g.28493481C>T" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Arg334His" "" "Germline" "" "" "0" "" "" "g.28482160C>T" "" "likely pathogenic" ""
"0000183824" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183825" "2" "70" "16" "28493481" "28493481" "subst" "2.45634E-5" "00006" "CLN3_000026" "g.28493481C>T" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Arg334His" "" "Germline" "" "" "0" "" "" "g.28482160C>T" "" "likely pathogenic" ""
"0000183826" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183827" "2" "90" "16" "28493428" "28493428" "subst" "8.31048E-6" "00006" "CLN3_000024" "g.28493428G>A" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Gln352X" "" "Germline" "" "" "0" "" "" "g.28482107G>A" "" "pathogenic" ""
"0000183828" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183829" "2" "90" "16" "28493428" "28493428" "subst" "8.31048E-6" "00006" "CLN3_000024" "g.28493428G>A" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Gln352X" "" "Germline" "" "" "0" "" "" "g.28482107G>A" "" "pathogenic" ""
"0000183830" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183831" "2" "90" "16" "28488957" "28488957" "subst" "8.15701E-6" "00006" "CLN3_000001" "g.28488957C>A" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "c.1198-1G>T" "splice defect (confirmed by RT-PCR)" "Germline" "" "" "0" "" "" "g.28477636C>A" "" "pathogenic" ""
"0000183832" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183833" "2" "90" "16" "28488957" "28488957" "subst" "8.15701E-6" "00006" "CLN3_000001" "g.28488957C>A" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "c.1198-1G>T" "splice defect (confirmed by RT-PCR)" "Germline" "" "" "0" "" "" "g.28477636C>A" "" "pathogenic" ""
"0000183834" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183835" "2" "90" "16" "28488957" "28488957" "subst" "8.15701E-6" "00006" "CLN3_000001" "g.28488957C>A" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "c.1198-1G>T" "splice defect (confirmed by RT-PCR)" "Germline" "" "" "0" "" "" "g.28477636C>A" "" "pathogenic" ""
"0000183836" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183837" "2" "90" "16" "28488885" "28488885" "del" "0" "00006" "CLN3_000013" "g.28488885del" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Leu425SerfsX87" "" "Germline" "" "" "0" "" "" "g.28477564del" "" "pathogenic" ""
"0000183838" "3" "90" "16" "28498814" "28498814" "del" "0" "00006" "CLN3_000058" "g.28498814del" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Val142fs" "described as p.Val142LeufsX39 in Kousi et al 2012" "Germline" "" "" "0" "" "" "g.28487493del" "" "pathogenic" ""
"0000183839" "3" "90" "16" "28498814" "28498814" "del" "0" "00006" "CLN3_000058" "g.28498814del" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Val142fs" "described as p.Val142LeufsX39 in Kousi et al 2012" "Germline" "" "" "0" "" "" "g.28487493del" "" "pathogenic" ""
"0000183840" "3" "90" "16" "28498814" "28498814" "del" "0" "00006" "CLN3_000058" "g.28498814del" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Val142fs" "described as p.Val142LeufsX39 in Kousi et al 2012" "Germline" "" "" "0" "" "" "g.28487493del" "" "pathogenic" ""
"0000183841" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183842" "2" "90" "16" "28498814" "28498814" "del" "0" "00006" "CLN3_000058" "g.28498814del" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Val142fs" "" "Germline" "" "" "0" "" "" "g.28487493del" "" "pathogenic" ""
"0000183843" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183844" "2" "90" "16" "28498814" "28498814" "del" "0" "00006" "CLN3_000058" "g.28498814del" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Val142fs" "" "Germline" "" "" "0" "" "" "g.28487493del" "" "pathogenic" ""
"0000183845" "3" "90" "16" "28497786" "28497787" "del" "4.12225E-6" "00006" "CLN3_000047" "g.28497786_28497787del" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Gly187AspfsX48" "" "Germline" "" "" "0" "" "" "g.28486465_28486466del" "" "pathogenic" ""
"0000183846" "3" "90" "16" "28497763" "28497763" "dup" "0" "00006" "CLN3_000041" "g.28497763dup" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "p.Ala196GlyfsX40" "" "Germline" "" "" "0" "" "" "g.28486442dup" "" "pathogenic" ""
"0000183847" "3" "90" "16" "28493666" "28493666" "dup" "0" "00006" "CLN3_000032" "g.28493666dup" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "c.944-945insA" "" "Germline" "" "" "0" "" "" "g.28482345dup" "" "pathogenic" ""
"0000183848" "3" "90" "16" "28493666" "28493666" "dup" "0" "00006" "CLN3_000032" "g.28493666dup" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "c.944-945insA" "" "Germline" "" "" "0" "" "" "g.28482345dup" "" "pathogenic" ""
"0000183849" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion??" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183850" "2" "90" "16" "28493666" "28493666" "dup" "0" "00006" "CLN3_000032" "g.28493666dup" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "c.944-945insA" "" "Germline" "" "" "0" "" "" "g.28482345dup" "" "pathogenic" ""
"0000183851" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183852" "2" "90" "16" "28493666" "28493666" "dup" "0" "00006" "CLN3_000032" "g.28493666dup" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "c.944-945insA" "" "Germline" "" "" "0" "" "" "g.28482345dup" "" "pathogenic" ""
"0000183853" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183854" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183855" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183856" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183857" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183858" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183859" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183860" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183861" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183862" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183863" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183864" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183865" "1" "90" "16" "28488943" "28488943" "subst" "0.0755042" "00006" "CLN3_000017" "g.28488943T>C" "" "{PMID:Munroe 1997 Eksandh 2000:9311735, 10916181}, {DB:CLN}" "" "p.His404Arg" "10/94 chr Sweden" "Germline" "" "rs77595156" "0" "" "" "g.28477622T>C" "" "pathogenic" ""
"0000183866" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Munroe 1997 Eksandh 2000:9311735, 10916181}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183867" "0" "90" "16" "0" "0" "" "0" "00006" "CRYM_000000" "g.?" "" "{PMID:Munroe 1997:9311735}, {DB:CLN}" "" "not identified" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000183868" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183869" "2" "90" "16" "28493426" "28493993" "del" "0" "00006" "CLN3_000023" "g.28493426_28493993del" "" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "" "2.8 kb deletion where D16S298 not deleted" "2.8-kb genomic deletion of exons 10-13: a truncated protein of 291 amino acids, 28 of which are new; 2.8 kb deletion or p.Gly264_Gln352delinsValfsX29\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28482105_28482672del" "" "pathogenic" ""
"0000183870" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183871" "2" "90" "16" "28493426" "28493993" "del" "0" "00006" "CLN3_000023" "g.28493426_28493993del" "" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "" "2.8 kb deletion where D16S298 not deleted" "2.8-kb genomic deletion of exons 10-13: a truncated protein of 291 amino acids, 28 of which are new; 2.8 kb deletion or p.Gly264_Gln352delinsValfsX29\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28482105_28482672del" "" "pathogenic" ""
"0000183872" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183873" "2" "90" "16" "28493426" "28493993" "del" "0" "00006" "CLN3_000023" "g.28493426_28493993del" "" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "" "2.8 kb deletion where D16S298 not deleted" "2.8-kb genomic deletion of exons 10-13: a truncated protein of 291 amino acids, 28 of which are new; 2.8 kb deletion or p.Gly264_Gln352delinsValfsX29\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28482105_28482672del" "" "pathogenic" ""
"0000183874" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183875" "2" "90" "16" "28493426" "28493993" "del" "0" "00006" "CLN3_000023" "g.28493426_28493993del" "" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "" "2.8 kb deletion where D16S298 not deleted" "2.8-kb genomic deletion of exons 10-13: a truncated protein of 291 amino acids, 28 of which are new; 2.8 kb deletion or p.Gly264_Gln352delinsValfsX29\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28482105_28482672del" "" "pathogenic" ""
"0000183876" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183877" "2" "90" "16" "28493426" "28493993" "del" "0" "00006" "CLN3_000023" "g.28493426_28493993del" "" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "" "2.8 kb deletion where D16S298 not deleted" "2.8-kb genomic deletion of exons 10-13: a truncated protein of 291 amino acids, 28 of which are new; 2.8 kb deletion or p.Gly264_Gln352delinsValfsX29\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28482105_28482672del" "" "pathogenic" ""
"0000183878" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183879" "2" "90" "16" "28493426" "28493993" "del" "0" "00006" "CLN3_000023" "g.28493426_28493993del" "" "{PMID:IBDC 1995 Lauronen 1999:7553855, 9932957}, {DB:CLN}" "" "2.8 kb deletion where D16S298 not deleted" "2.8-kb genomic deletion of exons 10-13: a truncated protein of 291 amino acids, 28 of which are new; 2.8 kb deletion or p.Gly264_Gln352delinsValfsX29\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28482105_28482672del" "" "pathogenic" ""
"0000183880" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183881" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183882" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183883" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183884" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183885" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183886" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183887" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183888" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183889" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183890" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183891" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183892" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183893" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183894" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183895" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183896" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183897" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183898" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183899" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183900" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183901" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183902" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183903" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183904" "2" "70" "16" "28493821" "28493821" "subst" "1.62434E-5" "00006" "CLN3_000033" "g.28493821C>T" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "p.Glu295Lys" "" "Germline" "" "rs121434286" "0" "" "" "g.28482500C>T" "" "likely pathogenic" ""
"0000183905" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183906" "2" "70" "16" "28493821" "28493821" "subst" "1.62434E-5" "00006" "CLN3_000033" "g.28493821C>T" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "p.Glu295Lys" "" "Germline" "" "rs121434286" "0" "" "" "g.28482500C>T" "" "likely pathogenic" ""
"0000183907" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183908" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183909" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183910" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183911" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183912" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183913" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Zhong 1998b:9490299}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183914" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183915" "0" "90" "16" "28488943" "28488943" "subst" "0.0755042" "00006" "CLN3_000017" "g.28488943T>C" "" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "" "p.His404Arg" "10/94 chr Sweden" "Germline" "" "rs77595156" "0" "" "" "g.28477622T>C" "" "pathogenic" ""
"0000183916" "0" "90" "16" "28488943" "28488943" "subst" "0.0755042" "00006" "CLN3_000017" "g.28488943T>C" "" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "" "p.His404Arg" "10/94 chr Sweden" "Germline" "" "rs77595156" "0" "" "" "g.28477622T>C" "" "pathogenic" ""
"0000183917" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183918" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Bensaoula 2000:10964839}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183919" "2" "90" "16" "28498814" "28498814" "del" "0" "00006" "CLN3_000058" "g.28498814del" "" "{PMID:Bensaoula 2000:10964839}, {DB:CLN}" "" "p.Val142fs" "" "Germline" "" "" "0" "" "" "g.28487493del" "" "pathogenic" ""
"0000183920" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183921" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183922" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Eksandh 2000:10916181}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183923" "0" "90" "16" "28504365" "28504365" "subst" "0" "00006" "CLN3_000079" "g.28504365G>A" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.1-1101C>T; polymorphism" "Variant Error [EREF/ERANGE]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28493044G>A" "" "pathogenic" ""
"0000183924" "1" "90" "16" "0" "0" "" "0" "00006" "CRYM_000000" "g.?" "" "{PMID:Pebrel-Richard 2014:23860047}, {DB:CLN}" "" "1.7 Mb deletion" "hemizygous 16p11.2 microdeletion unmasks 1kb mutation in CLN3" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000183925" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Pebrel-Richard 2014:23860047}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183926" "1" "90" "16" "28489118" "28489121" "del" "0" "00006" "CLN3_000019" "g.28489118_28489121del" "" "{PMID:Drack 2013:23877479}, {DB:CLN}" "" "p.(Leu379Metfs*11)" "" "Germline" "" "" "0" "" "" "g.28477797_28477800del" "" "pathogenic" ""
"0000183927" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Drack 2013:23877479}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183928" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183929" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183930" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183931" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183932" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183933" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183934" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183935" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183936" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Teixeira 2003b:12796825}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183937" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Teixeira 2003b Bessa 2006:12796825, 16814585}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183938" "2" "90" "16" "28497780" "28497780" "del" "0" "00006" "CLN3_000043" "g.28497780del" "" "{PMID:Teixeira 2003b Bessa 2006:12796825, 16814585}, {DB:CLN}" "" "568delG" "" "Germline" "" "" "0" "" "" "g.28486459del" "" "pathogenic" ""
"0000183939" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Teixeira 2003b Bessa 2006:12796825, 16814585}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183940" "2" "90" "16" "28497780" "28497780" "del" "0" "00006" "CLN3_000043" "g.28497780del" "" "{PMID:Teixeira 2003b Bessa 2006:12796825, 16814585}, {DB:CLN}" "" "569delG" "" "Germline" "" "" "0" "" "" "g.28486459del" "" "pathogenic" ""
"0000183941" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:de los Reyes 2004:15032383}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183942" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Leman 2005:15991331}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183943" "2" "70" "16" "28493426" "28493426" "subst" "0" "00006" "CLN3_000022" "g.28493426C>G" "" "{PMID:Leman 2005:15991331}, {DB:CLN}" "" "p.Gln352His / splice defect" "p.Gln352His / splice defect" "Germline" "" "" "0" "" "" "g.28482105C>G" "" "likely pathogenic" ""
"0000183944" "2" "90" "16" "28502879" "28502879" "subst" "0" "00006" "CLN3_000077" "g.28502879C>A" "" "{PMID:Kwon 2005:16087292}, {DB:CLN}" "" "p.Glu17X" "" "Germline" "" "" "0" "" "" "g.28491558C>A" "" "pathogenic" ""
"0000183945" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kwon 2005:16087292}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183946" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Moore 2008:18684116}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183947" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Moore 2008:18684116}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183948" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Moore 2008:18684116}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183949" "3" "90" "16" "28497748" "28497748" "subst" "4.1137E-6" "00006" "CLN3_000040" "g.28497748G>T" "" "{PMID:Sarpong 2009:19489875}, {DB:CLN}" "" "p.Tyr199X" "" "Germline" "" "" "0" "" "" "g.28486427G>T" "" "pathogenic" ""
"0000183950" "3" "90" "16" "28497748" "28497748" "subst" "4.1137E-6" "00006" "CLN3_000040" "g.28497748G>T" "" "{PMID:Sarpong 2009:19489875}, {DB:CLN}" "" "p.Tyr199X" "" "Germline" "" "" "0" "" "" "g.28486427G>T" "" "pathogenic" ""
"0000183951" "3" "90" "16" "28497748" "28497748" "subst" "4.1137E-6" "00006" "CLN3_000040" "g.28497748G>T" "" "{PMID:Sarpong 2009:19489875}, {DB:CLN}" "" "p.Tyr199X" "" "Germline" "" "" "0" "" "" "g.28486427G>T" "" "pathogenic" ""
"0000183952" "3" "90" "16" "28497748" "28497748" "subst" "4.1137E-6" "00006" "CLN3_000040" "g.28497748G>T" "" "{PMID:Sarpong 2009:19489875}, {DB:CLN}" "" "p.Tyr199X" "" "Germline" "" "" "0" "" "" "g.28486427G>T" "" "pathogenic" ""
"0000183953" "3" "90" "16" "28497748" "28497748" "subst" "4.1137E-6" "00006" "CLN3_000040" "g.28497748G>T" "" "{PMID:Sarpong 2009:19489875}, {DB:CLN}" "" "p.Tyr199X" "" "Germline" "" "" "0" "" "" "g.28486427G>T" "" "pathogenic" ""
"0000183954" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183955" "2" "90" "16" "28498983" "28498983" "subst" "4.07953E-6" "00006" "CLN3_000063" "g.28498983C>T" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "p.Ser125Asn" "formerly p.Ser125Asn / splice-site affecting" "Germline" "" "" "0" "" "" "g.28487662C>T" "" "pathogenic" ""
"0000183956" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183957" "2" "90" "16" "28498983" "28498983" "subst" "4.07953E-6" "00006" "CLN3_000063" "g.28498983C>T" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "p.Ser125Asn" "formerly p.Ser125Asn / splice-site affecting" "Germline" "" "" "0" "" "" "g.28487662C>T" "" "pathogenic" ""
"0000183958" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183959" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183960" "3" "90" "16" "28497723" "28497723" "dup" "0" "00006" "CLN3_000039" "g.28497723dup" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "p.Ser208PhefsX28" "Also c.622-623insT; Originally M Milà pers comm." "Germline" "" "" "0" "" "" "g.28486402dup" "" "pathogenic" ""
"0000183961" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183962" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183963" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183964" "2" "90" "16" "28497723" "28497723" "dup" "0" "00006" "CLN3_000039" "g.28497723dup" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "p.Ser208PhefsX28" "" "Germline" "" "" "0" "" "" "g.28486402dup" "" "pathogenic" ""
"0000183965" "1" "70" "16" "28497770" "28497770" "subst" "0" "00006" "CLN3_000042" "g.28497770C>T" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "p.Gly192Glu" "" "Germline" "" "" "0" "" "" "g.28486449C>T" "" "likely pathogenic" ""
"0000183966" "3" "90" "16" "28499941" "28499941" "subst" "0" "00006" "CLN3_000066" "g.28499941G>A" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "p.Arg89X" "" "Germline" "" "" "0" "" "" "g.28488620G>A" "" "pathogenic" ""
"0000183967" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183968" "1" "90" "16" "28498987" "28498987" "dup" "0" "00006" "CLN3_000064" "g.28498987dup" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "p.Tyr124LeufsX36" "" "Germline" "" "" "0" "" "" "g.28487666dup" "" "pathogenic" ""
"0000183969" "2" "70" "16" "28493481" "28493481" "subst" "2.45634E-5" "00006" "CLN3_000026" "g.28493481C>T" "" "{PMID:Pérez-Poyato 2011:21499717}, {DB:CLN}" "" "p.Arg334His" "" "Germline" "" "" "0" "" "" "g.28482160C>T" "" "likely pathogenic" ""
"0000183970" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183971" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183972" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183973" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183974" "2" "70" "16" "28493482" "28493482" "subst" "0" "00006" "CLN3_000027" "g.28493482G>A" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Arg334Cys" "" "Germline" "" "" "0" "" "" "g.28482161G>A" "" "likely pathogenic" ""
"0000183975" "2" "10" "16" "28497785" "28497785" "subst" "0" "00006" "CLN3_000046" "g.28497785C>G" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Gly187Ala" "" "Germline" "" "" "0" "" "" "g.28486464C>G" "" "benign" ""
"0000183976" "1" "90" "16" "28497723" "28497723" "dup" "0" "00006" "CLN3_000039" "g.28497723dup" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Ser208PhefsX28" "" "Germline" "" "" "0" "" "" "g.28486402dup" "" "pathogenic" ""
"0000183977" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183978" "1" "70" "16" "28497780" "28497780" "subst" "4.12364E-6" "00006" "CLN3_000044" "g.28497780C>G" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Gly189Arg" "" "Germline" "" "" "0" "" "" "g.28486459C>G" "" "likely pathogenic" ""
"0000183979" "1" "90" "16" "28502823" "28502823" "subst" "4.06709E-6" "00006" "CLN3_000076" "g.28502823C>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Trp35X" "" "Germline" "" "" "0" "" "" "g.28491502C>T" "" "pathogenic" ""
"0000183980" "2" "90" "16" "28500606" "28500606" "subst" "0" "00006" "CLN3_000070" "g.28500606C>G" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.222+5G>C" "" "Germline" "" "" "0" "" "" "g.28489285C>G" "" "pathogenic" ""
"0000183981" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183982" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183983" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183984" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183985" "1" "70" "16" "28498837" "28498837" "subst" "0" "00006" "CLN3_000059" "g.28498837A>G" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Cys134Arg" "" "Germline" "" "" "0" "" "" "g.28487516A>G" "" "likely pathogenic" ""
"0000183986" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183987" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183988" "1" "90" "16" "28489060" "28489060" "subst" "4.06666E-6" "00006" "CLN3_000018" "g.28489060C>A" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Glu399X" "" "Germline" "" "" "0" "" "" "g.28477739C>A" "" "pathogenic" ""
"0000183989" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183990" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183991" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183992" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183993" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183994" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183995" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183996" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183997" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183998" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000183999" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184000" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184001" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184002" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184003" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184004" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184005" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184006" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184007" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184008" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184009" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184010" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184011" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184012" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184013" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184014" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184015" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184016" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184017" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184018" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184019" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184020" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184021" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184022" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184023" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184024" "3" "90" "16" "28500708" "28500708" "subst" "0" "00006" "CLN3_000073" "g.28500708C>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.126-1G>A" "" "Germline" "" "" "0" "" "" "g.28489387C>T" "" "pathogenic" ""
"0000184025" "3" "90" "16" "28499974" "28499974" "dup" "0" "00006" "CLN3_000068" "g.28499974dup" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Thr80AsnfsX12" "" "Germline" "" "" "0" "" "" "g.28488653dup" "" "pathogenic" ""
"0000184026" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184027" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184028" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184029" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184030" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184031" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184032" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184033" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184034" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184035" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184036" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184037" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184038" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184039" "1" "90" "16" "28498814" "28498814" "del" "0" "00006" "CLN3_000058" "g.28498814del" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Val142LeufsX39" "" "Germline" "" "" "0" "" "" "g.28487493del" "" "pathogenic" ""
"0000184040" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184041" "1" "90" "16" "28498814" "28498814" "del" "0" "00006" "CLN3_000058" "g.28498814del" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Val142LeufsX39" "" "Germline" "" "" "0" "" "" "g.28487493del" "" "pathogenic" ""
"0000184042" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184043" "1" "90" "16" "28498814" "28498814" "del" "0" "00006" "CLN3_000058" "g.28498814del" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Val142LeufsX39" "" "Germline" "" "" "0" "" "" "g.28487493del" "" "pathogenic" ""
"0000184044" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184045" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184046" "1" "90" "16" "28493428" "28493428" "subst" "8.31048E-6" "00006" "CLN3_000024" "g.28493428G>A" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Gln352X" "" "Germline" "" "" "0" "" "" "g.28482107G>A" "" "pathogenic" ""
"0000184047" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184048" "1" "90" "16" "28503080" "28503080" "subst" "0" "00006" "CLN3_000078" "g.28503080T>G" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Met1Leu" "" "Germline" "" "" "0" "" "" "g.28491759T>G" "" "pathogenic" ""
"0000184049" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184050" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184051" "1" "90" "16" "28493633" "28493659" "del" "0" "00006" "CLN3_000031" "g.28493633_28493659del" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Leu313_Trp321del / splice defect" "p.Leu313_Trp321del / splice defect" "Germline" "" "" "0" "" "" "g.28482312_28482338del" "" "pathogenic" ""
"0000184052" "2" "90" "16" "28493633" "28493659" "del" "0" "00006" "CLN3_000031" "g.28493633_28493659del" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Leu313_Trp321del / splice defect" "p.Leu313_Trp321del / splice defect" "Germline" "" "" "0" "" "" "g.28482312_28482338del" "" "pathogenic" ""
"0000184053" "1" "90" "16" "28499941" "28499941" "subst" "0" "00006" "CLN3_000066" "g.28499941G>A" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Arg89X" "" "Germline" "" "" "0" "" "" "g.28488620G>A" "" "pathogenic" ""
"0000184054" "1" "70" "16" "28493482" "28493482" "subst" "0" "00006" "CLN3_000027" "g.28493482G>A" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Arg334Cys" "" "Germline" "" "" "0" "" "" "g.28482161G>A" "" "likely pathogenic" ""
"0000184055" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184056" "1" "90" "16" "28502798" "28502798" "subst" "1.22179E-5" "00006" "CLN3_000074" "g.28502798C>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.125+5G>A" "" "Germline" "" "" "0" "" "" "g.28491477C>T" "" "pathogenic" ""
"0000184057" "2" "90" "16" "28498814" "28498814" "del" "0" "00006" "CLN3_000058" "g.28498814del" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Val142LeufsX39" "" "Germline" "" "" "0" "" "" "g.28487493del" "" "pathogenic" ""
"0000184058" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184059" "1" "90" "16" "28493520" "28493520" "subst" "0" "00006" "CLN3_000030" "g.28493520C>A" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.963-1G>T" "" "Germline" "" "" "0" "" "" "g.28482199C>A" "" "pathogenic" ""
"0000184060" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184061" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184062" "1" "90" "16" "28497972" "28497972" "subst" "0" "00006" "CLN3_000055" "g.28497972C>G" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.461-1G>C" "" "Germline" "" "" "0" "" "" "g.28486651C>G" "" "pathogenic" ""
"0000184063" "2" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184064" "3" "70" "16" "28493481" "28493481" "subst" "2.45634E-5" "00006" "CLN3_000026" "g.28493481C>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Arg334His" "" "Germline" "" "" "0" "" "" "g.28482160C>T" "" "likely pathogenic" ""
"0000184065" "3" "70" "16" "28493481" "28493481" "subst" "2.45634E-5" "00006" "CLN3_000026" "g.28493481C>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Arg334His" "" "Germline" "" "" "0" "" "" "g.28482160C>T" "" "likely pathogenic" ""
"0000184066" "1" "90" "16" "28495324" "28495324" "subst" "0.000193567" "00006" "CLN3_000035" "g.28495324T>G" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.790+3A>C" "" "Germline" "" "" "0" "" "" "g.28484003T>G" "" "pathogenic" ""
"0000184067" "1" "90" "16" "28488943" "28488943" "subst" "0.0755042" "00006" "CLN3_000017" "g.28488943T>C" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.His404Arg" "" "Germline" "" "rs77595156" "0" "" "" "g.28477622T>C" "" "pathogenic" ""
"0000184068" "1" "90" "16" "28488943" "28488943" "subst" "0.0755042" "00006" "CLN3_000017" "g.28488943T>C" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.His404Arg" "" "Germline" "" "rs77595156" "0" "" "" "g.28477622T>C" "" "pathogenic" ""
"0000184069" "1" "90" "16" "28488943" "28488943" "subst" "0.0755042" "00006" "CLN3_000017" "g.28488943T>C" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.His404Arg" "" "Germline" "" "rs77595156" "0" "" "" "g.28477622T>C" "" "pathogenic" ""
"0000184070" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184071" "2" "90" "16" "28498814" "28498814" "del" "0" "00006" "CLN3_000058" "g.28498814del" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Val142LeufsX39" "" "Germline" "" "" "0" "" "" "g.28487493del" "" "pathogenic" ""
"0000184072" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184073" "2" "90" "16" "28493428" "28493428" "subst" "8.31048E-6" "00006" "CLN3_000024" "g.28493428G>A" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Gln352X" "" "Germline" "" "" "0" "" "" "g.28482107G>A" "" "pathogenic" ""
"0000184074" "3" "90" "16" "28500708" "28500708" "subst" "0" "00006" "CLN3_000073" "g.28500708C>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.125-1G>A" "" "Germline" "" "" "0" "" "" "g.28489387C>T" "" "pathogenic" ""
"0000184075" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184076" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184077" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184078" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184079" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184080" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184081" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184082" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184083" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184084" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184085" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184086" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184087" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184088" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184089" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184090" "1" "90" "16" "28488837" "28495439" "del" "0" "00006" "CLN3_000012" "g.28488837_28495439del" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.678-?_1317+?del" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28477516_28484118del" "" "pathogenic" ""
"0000184091" "1" "90" "16" "28488837" "28495439" "del" "0" "00006" "CLN3_000012" "g.28488837_28495439del" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.678-?_1317+?del" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28477516_28484118del" "" "pathogenic" ""
"0000184092" "1" "90" "16" "28502823" "28502823" "subst" "4.06709E-6" "00006" "CLN3_000076" "g.28502823C>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Trp35X" "" "Germline" "" "" "0" "" "" "g.28491502C>T" "" "pathogenic" ""
"0000184093" "1" "90" "16" "28500619" "28500619" "subst" "0" "00006" "CLN3_000072" "g.28500619G>A" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Gln72X" "" "Germline" "" "" "0" "" "" "g.28489298G>A" "" "pathogenic" ""
"0000184094" "1" "90" "16" "28498987" "28498987" "dup" "0" "00006" "CLN3_000064" "g.28498987dup" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "370insT" "" "Germline" "" "" "0" "" "" "g.28487666dup" "" "pathogenic" ""
"0000184095" "1" "90" "16" "28498862" "28498862" "del" "0" "00006" "CLN3_000061" "g.28498862del" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Arg127GlyfsX54" "" "Germline" "" "" "0" "" "" "g.28487541del" "" "pathogenic" ""
"0000184096" "1" "90" "16" "28497972" "28497972" "subst" "0" "00006" "CLN3_000056" "g.28497972C>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.461-1G>A" "" "Germline" "" "" "0" "" "" "g.28486651C>T" "" "pathogenic" ""
"0000184097" "1" "70" "16" "28497960" "28497960" "subst" "0" "00006" "CLN3_000054" "g.28497960C>G" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Ala158Pro" "" "Germline" "" "" "0" "" "" "g.28486639C>G" "" "likely pathogenic" ""
"0000184098" "1" "90" "16" "28497898" "28497898" "subst" "0" "00006" "CLN3_000049" "g.28497898C>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.533+1G>A splice defect" "" "Germline" "" "" "0" "" "" "g.28486577C>T" "" "pathogenic" ""
"0000184099" "1" "90" "16" "28497785" "28497785" "subst" "0" "00006" "CLN3_000046" "g.28497785C>G" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Gly187Ala" "" "Germline" "" "" "0" "" "" "g.28486464C>G" "" "pathogenic" ""
"0000184100" "1" "90" "16" "28497748" "28497748" "subst" "4.1137E-6" "00006" "CLN3_000040" "g.28497748G>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Tyr199X" "" "Germline" "" "" "0" "" "" "g.28486427G>T" "" "pathogenic" ""
"0000184101" "1" "90" "16" "28493821" "28493821" "subst" "0" "00006" "CLN3_000005" "g.28493821C>A" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Glu295X" "" "Germline" "" "" "0" "" "" "g.28482500C>A" "" "pathogenic" ""
"0000184102" "1" "90" "16" "28493793" "28493793" "subst" "0" "00006" "CLN3_000006" "g.28493793C>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.906+5G>A" "" "Germline" "" "" "0" "" "" "g.28482472C>T" "" "pathogenic" ""
"0000184103" "1" "90" "16" "28493423" "28493423" "subst" "0" "00006" "CLN3_000021" "g.28493423T>G" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.1056+3A>C" "" "Germline" "" "" "0" "" "" "g.28482102T>G" "" "pathogenic" ""
"0000184104" "2" "70" "16" "28488907" "28488907" "subst" "4.07272E-6" "00006" "CLN3_000015" "g.28488907T>C" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Asp416Gly" "" "Germline" "" "" "0" "" "" "g.28477586T>C" "" "likely pathogenic" ""
"0000184105" "1" "90" "16" "28488957" "28488957" "subst" "8.15701E-6" "00006" "CLN3_000001" "g.28488957C>A" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.1198-1G>T" "splice defect (confirmed by RT-PCR)" "Germline" "" "" "0" "" "" "g.28477636C>A" "" "pathogenic" ""
"0000184106" "1" "90" "16" "28493633" "28493659" "del" "0" "00006" "CLN3_000031" "g.28493633_28493659del" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Leu313_Trp321del / splice defect" "p.Leu313_Trp321del / splice defect" "Germline" "" "" "0" "" "" "g.28482312_28482338del" "" "pathogenic" ""
"0000184107" "3" "90" "16" "28493436" "28493436" "del" "0" "00006" "CLN3_000025" "g.28493436del" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Leu350CysfsX27" "" "Germline" "" "" "0" "" "" "g.28482115del" "" "pathogenic" ""
"0000184108" "1" "90" "16" "28500609" "28500609" "subst" "0" "00006" "CLN3_000071" "g.28500609A>C" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "originally IVS3+2T>G" "" "Germline" "" "" "0" "" "" "g.28489288A>C" "" "pathogenic" ""
"0000184109" "1" "90" "16" "28488886" "28488886" "subst" "0" "00006" "CLN3_000014" "g.28488886G>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.Ser423X" "" "Germline" "" "" "0" "" "" "g.28477565G>T" "" "pathogenic" ""
"0000184110" "1" "90" "16" "28500708" "28500708" "subst" "0" "00006" "CLN3_000073" "g.28500708C>T" "" "{PMID:Mole 2001:11589012}, {DB:CLN}" "" "c.126-1G>A" "" "Germline" "" "" "0" "" "" "g.28489387C>T" "" "pathogenic" ""
"0000184111" "1" "90" "16" "28500708" "28500708" "subst" "0" "00006" "CLN3_000073" "g.28500708C>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "c.126-1G>A" "" "Germline" "" "" "0" "" "" "g.28489387C>T" "" "pathogenic" ""
"0000184112" "1" "90" "16" "28499970" "28499970" "subst" "0" "00006" "CLN3_000067" "g.28499970C>T" "" "{PMID:Mole 2001:11589012}, {DB:CLN}" "" "orignally IVS4-59G>A" "Variant Error [EREF/EINVALIDBOUNDARY]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28488649C>T" "" "pathogenic" ""
"0000184113" "1" "90" "16" "28499992" "28499992" "subst" "0" "00006" "CLN3_000069" "g.28499992C>T" "" "{PMID:Mole 2001:11589012}, {DB:CLN}" "" "originally IVS-81G>A" "Variant Error [EREF/EINVALIDBOUNDARY]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28488671C>T" "" "pathogenic" ""
"0000184114" "2" "90" "16" "28499970" "28499970" "subst" "0" "00006" "CLN3_000067" "g.28499970C>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "orignally IVS4-59G>A" "Variant Error [EREF/EINVALIDBOUNDARY]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28488649C>T" "" "pathogenic" ""
"0000184115" "1" "90" "16" "28488943" "28488943" "subst" "0.0755042" "00006" "CLN3_000017" "g.28488943T>C" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.His404Arg" "" "Germline" "" "rs77595156" "0" "" "" "g.28477622T>C" "" "pathogenic" ""
"0000184116" "2" "90" "16" "28499992" "28499992" "subst" "0" "00006" "CLN3_000069" "g.28499992C>T" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "originally IVS-81G>A" "Variant Error [EREF/EINVALIDBOUNDARY]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28488671C>T" "" "pathogenic" ""
"0000184117" "1" "90" "16" "28488943" "28488943" "subst" "0.0755042" "00006" "CLN3_000017" "g.28488943T>C" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.His404Arg" "" "Germline" "" "rs77595156" "0" "" "" "g.28477622T>C" "" "pathogenic" ""
"0000184118" "1" "90" "16" "28488943" "28488943" "subst" "0.0755042" "00006" "CLN3_000017" "g.28488943T>C" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.His404Arg" "" "Germline" "" "rs77595156" "0" "" "" "g.28477622T>C" "" "pathogenic" ""
"0000184119" "1" "90" "16" "28488943" "28488943" "subst" "0.0755042" "00006" "CLN3_000017" "g.28488943T>C" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.His404Arg" "" "Germline" "" "rs77595156" "0" "" "" "g.28477622T>C" "" "pathogenic" ""
"0000184120" "1" "90" "16" "28488943" "28488943" "subst" "0.0755042" "00006" "CLN3_000017" "g.28488943T>C" "" "{PMID:Kousi 2012:21990111}, {DB:CLN}" "" "p.His404Arg" "" "Germline" "" "rs77595156" "0" "" "" "g.28477622T>C" "" "pathogenic" ""
"0000184121" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Wisniewski 1998b:9450775}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184122" "2" "70" "16" "28493821" "28493821" "subst" "1.62434E-5" "00006" "CLN3_000033" "g.28493821C>T" "" "{PMID:Wisniewski 1998b:9450775}, {DB:CLN}" "" "p.Glu295Lys" "" "Germline" "" "rs121434286" "0" "" "" "g.28482500C>T" "" "likely pathogenic" ""
"0000184123" "3" "90" "16" "28495333" "28495333" "subst" "0" "00006" "CLN3_000036" "g.28495333T>A" "" "{PMID:Coppieters 2014:24625443}" "" "" "" "Germline" "" "" "0" "" "" "g.28484012T>A" "" "pathogenic (recessive)" ""
"0000184124" "1" "90" "16" "28497938" "28497938" "subst" "0" "00006" "CLN3_000051" "g.28497938C>T" "" "{PMID:Cortese 2014:24827497}, {DB:CLN}" "" "p.Gly165Glu" "" "Germline" "" "" "0" "" "" "g.28486617C>T" "" "pathogenic" ""
"0000184125" "1" "90" "16" "28497938" "28497938" "subst" "0" "00006" "CLN3_000051" "g.28497938C>T" "" "{PMID:Cortese 2014:24827497}, {DB:CLN}" "" "p.Gly165Glu" "" "Germline" "" "" "0" "" "" "g.28486617C>T" "" "pathogenic" ""
"0000184126" "2" "90" "16" "28493836" "28493836" "subst" "8.12143E-6" "00006" "CLN3_000007" "g.28493836C>A" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Val290Leu)" "blindness ony, age 45y" "Germline" "" "" "0" "" "" "g.28482515C>A" "" "pathogenic" ""
"0000184127" "1" "90" "16" "28493516" "28493516" "subst" "0" "00006" "CLN3_000008" "g.28493516G>C" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Tyr322*)" "(in Pas with blindness only)" "Germline" "" "" "0" "" "" "g.28482195G>C" "" "pathogenic" ""
"0000184128" "2" "90" "16" "28493836" "28493836" "subst" "8.12143E-6" "00006" "CLN3_000007" "g.28493836C>A" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Val290Leu)" "blindness ony, age 45y" "Germline" "" "" "0" "" "" "g.28482515C>A" "" "pathogenic" ""
"0000184129" "1" "90" "16" "28493516" "28493516" "subst" "0" "00006" "CLN3_000008" "g.28493516G>C" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Tyr322*)" "(in Pas with blindness only)" "Germline" "" "" "0" "" "" "g.28482195G>C" "" "pathogenic" ""
"0000184130" "3" "90" "16" "28488941" "28488941" "subst" "6.11805E-5" "00006" "CLN3_000016" "g.28488941G>A" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Arg405Trp)" "" "Germline" "" "" "0" "" "" "g.28477620G>A" "" "pathogenic" ""
"0000184131" "3" "90" "16" "28488941" "28488941" "subst" "6.11805E-5" "00006" "CLN3_000016" "g.28488941G>A" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Arg405Trp)" "" "Germline" "" "" "0" "" "" "g.28477620G>A" "" "pathogenic" ""
"0000184132" "3" "90" "16" "28488941" "28488941" "subst" "6.11805E-5" "00006" "CLN3_000016" "g.28488941G>A" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Arg405Trp)" "" "Germline" "" "" "0" "" "" "g.28477620G>A" "" "pathogenic" ""
"0000184133" "3" "90" "16" "28488941" "28488941" "subst" "6.11805E-5" "00006" "CLN3_000016" "g.28488941G>A" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Arg405Trp)" "" "Germline" "" "" "0" "" "" "g.28477620G>A" "" "pathogenic" ""
"0000184134" "2" "90" "16" "28502802" "28502802" "subst" "4.07153E-6" "00006" "CLN3_000075" "g.28502802C>G" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "c.125+1G>C" "(in Pas with blindess only ~60y)" "Germline" "" "" "0" "" "" "g.28491481C>G" "" "pathogenic" ""
"0000184135" "1" "90" "16" "28488941" "28488941" "subst" "6.11805E-5" "00006" "CLN3_000016" "g.28488941G>A" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Arg405Trp)" "" "Germline" "" "" "0" "" "" "g.28477620G>A" "" "pathogenic" ""
"0000184136" "2" "90" "16" "28502802" "28502802" "subst" "4.07153E-6" "00006" "CLN3_000075" "g.28502802C>G" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "c.125+1G>C" "(in Pas with blindess only ~60y)" "Germline" "" "" "0" "" "" "g.28491481C>G" "" "pathogenic" ""
"0000184137" "1" "90" "16" "28488941" "28488941" "subst" "6.11805E-5" "00006" "CLN3_000016" "g.28488941G>A" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Arg405Trp)" "" "Germline" "" "" "0" "" "" "g.28477620G>A" "" "pathogenic" ""
"0000184138" "3" "70" "16" "28497780" "28497780" "subst" "4.12364E-6" "00006" "CLN3_000044" "g.28497780C>G" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Gly189Arg)" "" "Germline" "" "" "0" "" "" "g.28486459C>G" "" "likely pathogenic" ""
"0000184139" "2" "90" "16" "28498846" "28498846" "subst" "0" "00006" "CLN3_000060" "g.28498846T>G" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Ser131Arg)" "" "Germline" "" "" "0" "" "" "g.28487525T>G" "" "pathogenic" ""
"0000184140" "1" "70" "16" "28493821" "28493821" "subst" "1.62434E-5" "00006" "CLN3_000033" "g.28493821C>T" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Glu295Lys)" "" "Germline" "" "rs121434286" "0" "" "" "g.28482500C>T" "" "likely pathogenic" ""
"0000184141" "2" "90" "16" "28498846" "28498846" "subst" "0" "00006" "CLN3_000060" "g.28498846T>G" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Ser131Arg)" "" "Germline" "" "" "0" "" "" "g.28487525T>G" "" "pathogenic" ""
"0000184142" "1" "70" "16" "28493821" "28493821" "subst" "1.62434E-5" "00006" "CLN3_000033" "g.28493821C>T" "" "{PMID:Wang 2014:24154662}, {DB:CLN}" "" "p.(Glu295Lys)" "" "Germline" "" "rs121434286" "0" "" "" "g.28482500C>T" "" "likely pathogenic" ""
"0000184143" "3" "90" "16" "28493503" "28493503" "subst" "4.10415E-6" "00006" "CLN3_000029" "g.28493503G>A" "" "A Moore, {DB:CLN}" "" "p.(Arg327Trp)" "blindness only age 35" "Germline" "" "" "0" "" "" "g.28482182G>A" "" "pathogenic" ""
"0000184144" "1" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000037" "g.28497286_28498251del966" "" "{PMID:Wisniewski 1998b:9450775}, {DB:CLN}" "" "1 kb deletion" "Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.28485965_28486930del966" "" "pathogenic" ""
"0000184145" "2" "70" "16" "28493821" "28493821" "subst" "1.62434E-5" "00006" "CLN3_000033" "g.28493821C>T" "" "{PMID:Wisniewski 1998b:9450775}, {DB:CLN}" "" "p.Glu295Lys" "" "Germline" "" "rs121434286" "0" "" "" "g.28482500C>T" "" "likely pathogenic" ""
"0000184146" "3" "90" "16" "28497780" "28497780" "subst" "0" "00006" "CLN3_000045" "g.28497780C>A" "" "R Williams, {DB:CLN}" "" "p.Gly189Trp" "" "Germline" "" "" "0" "" "" "g.28486459C>A" "" "pathogenic" ""
"0000184147" "3" "70" "16" "28493968" "28493969" "del" "0" "00006" "CLN3_000034" "g.28493968_28493969del" "" "R Williams, {DB:CLN}" "" "c.816_817del" "" "Germline" "" "" "0" "" "" "g.28482647_28482648del" "" "likely pathogenic" ""
"0000184148" "3" "70" "16" "28493968" "28493969" "del" "0" "00006" "CLN3_000034" "g.28493968_28493969del" "" "R Williams, {DB:CLN}" "" "c.816_817del" "" "Germline" "" "" "0" "" "" "g.28482647_28482648del" "" "likely pathogenic" ""
"0000251041" "0" "10" "16" "28500611" "28500611" "subst" "6.99502E-5" "02326" "CLN3_000094" "g.28500611A>G" "" "" "" "CLN3(NM_001042432.1):c.222T>C (p.H74=), CLN3(NM_001042432.2):c.222T>C (p.H74=), CLN3(NM_001286105.1):c.2T>C (p.M1?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28489290A>G" "" "benign" ""
"0000264664" "0" "90" "16" "28493428" "28493428" "subst" "8.31048E-6" "02330" "CLN3_000024" "g.28493428G>A" "" "" "" "CLN3(NM_001042432.1):c.1054C>T (p.Q352*), CLN3(NM_001042432.2):c.1054C>T (p.Q352*, p.(Gln352*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28482107G>A" "" "pathogenic" ""
"0000264665" "0" "10" "16" "28500659" "28500659" "subst" "0.000167317" "02330" "CLN3_000095" "g.28500659G>A" "" "" "" "CLN3(NM_001042432.2):c.174C>T (p.A58=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28489338G>A" "" "benign" ""
"0000264666" "0" "10" "16" "28499966" "28499966" "subst" "0.00098673" "02330" "CLN3_000092" "g.28499966C>T" "" "" "" "CLN3(NM_001042432.1):c.240G>A (p.T80=), CLN3(NM_001286105.2):c.20G>A (p.R7H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28488645C>T" "" "benign" ""
"0000264667" "0" "50" "16" "28499964" "28499964" "subst" "0.000572538" "02330" "CLN3_000091" "g.28499964G>A" "" "" "" "CLN3(NM_001042432.2):c.242C>T (p.P81L), CLN3(NM_001286105.1):c.22C>T (p.R8*), CLN3(NM_001286105.2):c.22C>T (p.R8*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28488643G>A" "" "VUS" ""
"0000264668" "0" "30" "16" "28497807" "28497807" "subst" "4.5724E-5" "02330" "CLN3_000088" "g.28497807C>T" "" "" "" "CLN3(NM_001042432.2):c.538G>A (p.V180M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28486486C>T" "" "likely benign" ""
"0000264669" "0" "10" "16" "28495346" "28495346" "subst" "0.000939101" "02330" "CLN3_000086" "g.28495346C>T" "" "" "" "CLN3(NM_001042432.1):c.771G>A (p.E257=), CLN3(NM_001042432.2):c.771G>A (p.E257=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28484025C>T" "" "benign" ""
"0000268135" "0" "10" "16" "28488944" "28488944" "subst" "0.00259034" "02329" "CLN3_000081" "g.28488944G>T" "" "" "" "CLN3(NM_000086.2):c.1210C>A (p.(His404Asn)), CLN3(NM_001042432.2):c.1210C>A (p.H404N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28477623G>T" "" "benign" ""
"0000268136" "0" "10" "16" "28488943" "28488943" "subst" "0.0755042" "02329" "CLN3_000017" "g.28488943T>C" "" "" "" "CLN3(NM_001042432.1):c.1211A>G (p.H404R), CLN3(NM_001042432.2):c.1211A>G (p.H404R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28477622T>C" "" "benign" ""
"0000268137" "0" "30" "16" "28488924" "28488924" "subst" "0.000436247" "02329" "CLN3_000080" "g.28488924C>T" "" "" "" "CLN3(NM_001042432.1):c.1230G>A (p.A410=), CLN3(NM_001042432.2):c.1230G>A (p.A410=), CLN3(NM_001286110.2):c.1068G>A (p.A356=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28477603C>T" "" "likely benign" ""
"0000268138" "0" "50" "16" "28499964" "28499964" "subst" "0.000572538" "02329" "CLN3_000091" "g.28499964G>A" "" "" "" "CLN3(NM_001042432.2):c.242C>T (p.P81L), CLN3(NM_001286105.1):c.22C>T (p.R8*), CLN3(NM_001286105.2):c.22C>T (p.R8*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28488643G>A" "" "VUS" ""
"0000268139" "0" "30" "16" "28497660" "28497660" "subst" "0.000107276" "02329" "CLN3_000087" "g.28497660C>T" "" "" "" "CLN3(NM_001042432.1):c.677+8G>A, CLN3(NM_001042432.2):c.677+8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28486339C>T" "" "likely benign" ""
"0000268140" "0" "30" "16" "28495346" "28495346" "subst" "0.000939101" "02329" "CLN3_000086" "g.28495346C>T" "" "" "" "CLN3(NM_001042432.1):c.771G>A (p.E257=), CLN3(NM_001042432.2):c.771G>A (p.E257=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28484025C>T" "" "likely benign" ""
"0000268141" "0" "30" "16" "28493953" "28493953" "subst" "0.000406171" "02329" "CLN3_000085" "g.28493953C>T" "" "" "" "CLN3(NM_001042432.1):c.831G>A (p.V277=), CLN3(NM_001042432.2):c.831G>A (p.V277=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28482632C>T" "" "likely benign" ""
"0000268142" "0" "30" "16" "28493535" "28493535" "subst" "0.000804812" "02329" "CLN3_000084" "g.28493535G>C" "" "" "" "CLN3(NM_001042432.2):c.963-16C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28482214G>C" "" "likely benign" ""
"0000270280" "0" "10" "16" "28491075" "28491075" "subst" "0" "02326" "CLN3_000083" "g.28491075G>A" "" "" "" "CLN3(NM_001042432.1):c.1057-1877C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28479754G>A" "" "benign" ""
"0000270281" "0" "10" "16" "28489266" "28489266" "subst" "0" "02326" "CLN3_000082" "g.28489266C>T" "" "" "" "CLN3(NM_001042432.1):c.1057-68G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28477945C>T" "" "benign" ""
"0000270283" "0" "10" "16" "28499991" "28499991" "subst" "4.06068E-6" "02326" "CLN3_000093" "g.28499991G>A" "" "" "" "CLN3(NM_001042432.1):c.223-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28488670G>A" "" "benign" ""
"0000270284" "0" "10" "16" "28499121" "28499121" "subst" "0" "02326" "CLN3_000089" "g.28499121C>T" "" "" "" "CLN3(NM_001042432.1):c.295-59G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28487800C>T" "" "benign" ""
"0000270285" "0" "30" "16" "28497660" "28497660" "subst" "0.000107276" "02326" "CLN3_000087" "g.28497660C>T" "" "" "" "CLN3(NM_001042432.1):c.677+8G>A, CLN3(NM_001042432.2):c.677+8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28486339C>T" "" "likely benign" ""
"0000273605" "0" "10" "16" "28488943" "28488943" "subst" "0.0755042" "01943" "CLN3_000017" "g.28488943T>C" "" "" "" "CLN3(NM_001042432.1):c.1211A>G (p.H404R), CLN3(NM_001042432.2):c.1211A>G (p.H404R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28477622T>C" "" "benign" ""
"0000273606" "0" "30" "16" "28488924" "28488924" "subst" "0.000436247" "01943" "CLN3_000080" "g.28488924C>T" "" "" "" "CLN3(NM_001042432.1):c.1230G>A (p.A410=), CLN3(NM_001042432.2):c.1230G>A (p.A410=), CLN3(NM_001286110.2):c.1068G>A (p.A356=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28477603C>T" "" "likely benign" ""
"0000273607" "0" "30" "16" "28499963" "28499963" "subst" "4.46664E-5" "01943" "CLN3_000090" "g.28499963C>T" "" "" "" "CLN3(NM_001042432.1):c.243G>A (p.P81=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28488642C>T" "" "likely benign" ""
"0000273608" "0" "30" "16" "28495346" "28495346" "subst" "0.000939101" "01943" "CLN3_000086" "g.28495346C>T" "" "" "" "CLN3(NM_001042432.1):c.771G>A (p.E257=), CLN3(NM_001042432.2):c.771G>A (p.E257=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28484025C>T" "" "likely benign" ""
"0000342836" "0" "90" "16" "28488941" "28488941" "subst" "6.11805E-5" "02327" "CLN3_000016" "g.28488941G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28477620G>A" "" "pathogenic" ""
"0000346468" "0" "10" "16" "28488943" "28488943" "subst" "0.0755042" "02327" "CLN3_000017" "g.28488943T>C" "" "" "" "CLN3(NM_001042432.1):c.1211A>G (p.H404R), CLN3(NM_001042432.2):c.1211A>G (p.H404R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28477622T>C" "" "benign" ""
"0000350293" "0" "90" "16" "28498814" "28498814" "del" "0" "02327" "CLN3_000097" "g.28498814del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.28487493del" "" "pathogenic" ""
"0000487551" "3" "70" "16" "28499940" "28499940" "subst" "1.62431E-5" "03335" "CLN3_000098" "g.28499940C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.28488619C>T" "" "likely pathogenic (recessive)" ""
"0000557736" "0" "30" "16" "28488944" "28488944" "subst" "0.00259034" "01804" "CLN3_000081" "g.28488944G>T" "" "" "" "CLN3(NM_000086.2):c.1210C>A (p.(His404Asn)), CLN3(NM_001042432.2):c.1210C>A (p.H404N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28477623G>T" "" "likely benign" ""
"0000557737" "0" "90" "16" "28493428" "28493428" "subst" "8.31048E-6" "01943" "CLN3_000024" "g.28493428G>A" "" "" "" "CLN3(NM_001042432.1):c.1054C>T (p.Q352*), CLN3(NM_001042432.2):c.1054C>T (p.Q352*, p.(Gln352*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28482107G>A" "" "pathogenic" ""
"0000557738" "0" "30" "16" "28493460" "28493460" "subst" "0" "01804" "CLN3_000099" "g.28493460C>A" "" "" "" "CLN3(NM_000086.2):c.1022G>T (p.(Arg341Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28482139C>A" "" "likely benign" ""
"0000557739" "0" "50" "16" "28493465" "28493465" "subst" "4.09169E-6" "02326" "CLN3_000100" "g.28493465G>C" "" "" "" "CLN3(NM_001042432.1):c.1017C>G (p.C339W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28482144G>C" "" "VUS" ""
"0000557740" "0" "90" "16" "28493633" "28493659" "del" "0" "02325" "CLN3_000031" "g.28493633_28493659del" "" "" "" "CLN3(NM_001042432.2):c.954_962+18delATACCGCTGGTAAGAGGAGCGAGGGCA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28482312_28482338del" "" "pathogenic" ""
"0000557741" "0" "10" "16" "28493953" "28493953" "subst" "0.000406171" "02330" "CLN3_000085" "g.28493953C>T" "" "" "" "CLN3(NM_001042432.1):c.831G>A (p.V277=), CLN3(NM_001042432.2):c.831G>A (p.V277=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28482632C>T" "" "benign" ""
"0000557742" "0" "30" "16" "28493953" "28493953" "subst" "0.000406171" "01943" "CLN3_000085" "g.28493953C>T" "" "" "" "CLN3(NM_001042432.1):c.831G>A (p.V277=), CLN3(NM_001042432.2):c.831G>A (p.V277=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28482632C>T" "" "likely benign" ""
"0000557743" "0" "30" "16" "28495340" "28495340" "subst" "4.23912E-5" "01943" "CLN3_000101" "g.28495340C>T" "" "" "" "CLN3(NM_001042432.1):c.777G>A (p.P259=), CLN3(NM_001042432.2):c.777G>A (p.P259=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28484019C>T" "" "likely benign" ""
"0000557744" "0" "30" "16" "28495340" "28495340" "subst" "4.23912E-5" "02326" "CLN3_000101" "g.28495340C>T" "" "" "" "CLN3(NM_001042432.1):c.777G>A (p.P259=), CLN3(NM_001042432.2):c.777G>A (p.P259=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28484019C>T" "" "likely benign" ""
"0000557745" "0" "30" "16" "28495340" "28495340" "subst" "4.23912E-5" "02329" "CLN3_000101" "g.28495340C>T" "" "" "" "CLN3(NM_001042432.1):c.777G>A (p.P259=), CLN3(NM_001042432.2):c.777G>A (p.P259=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28484019C>T" "" "likely benign" ""
"0000557746" "0" "10" "16" "28495349" "28495349" "subst" "0.000618496" "02330" "CLN3_000102" "g.28495349G>A" "" "" "" "CLN3(NM_001042432.1):c.768C>T (p.T256=), CLN3(NM_001042432.2):c.768C>T (p.T256=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28484028G>A" "" "benign" ""
"0000557747" "0" "30" "16" "28497660" "28497660" "subst" "0.000107276" "01943" "CLN3_000087" "g.28497660C>T" "" "" "" "CLN3(NM_001042432.1):c.677+8G>A, CLN3(NM_001042432.2):c.677+8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28486339C>T" "" "likely benign" ""
"0000557748" "0" "30" "16" "28497907" "28497907" "subst" "0" "02329" "CLN3_000103" "g.28497907G>C" "" "" "" "CLN3(NM_001042432.2):c.525C>G (p.F175L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28486586G>C" "" "likely benign" ""
"0000557749" "0" "30" "16" "28497916" "28497916" "subst" "0.000204388" "01943" "CLN3_000104" "g.28497916G>A" "" "" "" "CLN3(NM_001042432.1):c.516C>T (p.L172=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28486595G>A" "" "likely benign" ""
"0000557750" "0" "30" "16" "28497916" "28497916" "subst" "0.000204388" "02326" "CLN3_000104" "g.28497916G>A" "" "" "" "CLN3(NM_001042432.1):c.516C>T (p.L172=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28486595G>A" "" "likely benign" ""
"0000557751" "0" "10" "16" "28499030" "28499030" "subst" "2.03835E-5" "02330" "CLN3_000105" "g.28499030G>A" "" "" "" "CLN3(NM_001042432.2):c.327C>T (p.L109=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28487709G>A" "" "benign" ""
"0000557752" "0" "50" "16" "28499936" "28499936" "subst" "0.00029643" "01943" "CLN3_000106" "g.28499936A>G" "" "" "" "CLN3(NM_001042432.1):c.270T>C (p.F90=), CLN3(NM_001042432.2):c.270T>C (p.F90=), CLN3(NM_001286105.1):c.50T>C (p.L17S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28488615A>G" "" "VUS" ""
"0000557753" "0" "30" "16" "28499936" "28499936" "subst" "0.00029643" "02329" "CLN3_000106" "g.28499936A>G" "" "" "" "CLN3(NM_001042432.1):c.270T>C (p.F90=), CLN3(NM_001042432.2):c.270T>C (p.F90=), CLN3(NM_001286105.1):c.50T>C (p.L17S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28488615A>G" "" "likely benign" ""
"0000557754" "0" "30" "16" "28499966" "28499966" "subst" "0.00098673" "01943" "CLN3_000092" "g.28499966C>T" "" "" "" "CLN3(NM_001042432.1):c.240G>A (p.T80=), CLN3(NM_001286105.2):c.20G>A (p.R7H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28488645C>T" "" "likely benign" ""
"0000557755" "0" "10" "16" "28499968" "28499968" "subst" "0.000190847" "02330" "CLN3_000107" "g.28499968T>A" "" "" "" "CLN3(NM_001042432.2):c.238A>T (p.T80S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28488647T>A" "" "benign" ""
"0000557756" "0" "30" "16" "28500611" "28500611" "subst" "6.99502E-5" "02329" "CLN3_000094" "g.28500611A>G" "" "" "" "CLN3(NM_001042432.1):c.222T>C (p.H74=), CLN3(NM_001042432.2):c.222T>C (p.H74=), CLN3(NM_001286105.1):c.2T>C (p.M1?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28489290A>G" "" "likely benign" ""
"0000557757" "0" "10" "16" "28503036" "28503036" "subst" "0.00234897" "02330" "CLN3_000096" "g.28503036C>T" "" "" "" "CLN3(NM_001042432.1):c.45G>A (p.E15=), CLN3(NM_001042432.2):c.45G>A (p.E15=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28491715C>T" "" "benign" ""
"0000557758" "0" "30" "16" "28503036" "28503036" "subst" "0.00234897" "01943" "CLN3_000096" "g.28503036C>T" "" "" "" "CLN3(NM_001042432.1):c.45G>A (p.E15=), CLN3(NM_001042432.2):c.45G>A (p.E15=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28491715C>T" "" "likely benign" ""
"0000557760" "0" "30" "16" "28506822" "28506822" "subst" "9.2269E-5" "01804" "CLN3_000108" "g.28506822G>A" "" "" "" "APOBR(NM_018690.3):c.460G>A (p.(Gly154Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28495501G>A" "" "likely benign" ""
"0000557763" "0" "30" "16" "28507858" "28507858" "subst" "7.99416E-5" "01804" "CLN3_000111" "g.28507858G>A" "" "" "" "APOBR(NM_018690.3):c.1496G>A (p.(Gly499Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28496537G>A" "" "likely benign" ""
"0000615915" "0" "70" "16" "28493513" "28493513" "subst" "0" "02327" "CLN3_000114" "g.28493513C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28482192C>T" "" "likely pathogenic" ""
"0000615916" "0" "30" "16" "28493535" "28493535" "subst" "8.4717E-6" "02330" "CLN3_000115" "g.28493535G>A" "" "" "" "CLN3(NM_001286110.2):c.801-16C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28482214G>A" "" "likely benign" ""
"0000615917" "0" "90" "16" "28498824" "28498824" "del" "0" "02327" "CLN3_000116" "g.28498824del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28487503del" "" "pathogenic" ""
"0000615918" "0" "50" "16" "28498845" "28498845" "subst" "0.000264107" "01943" "CLN3_000117" "g.28498845C>T" "" "" "" "CLN3(NM_001042432.1):c.392G>A (p.S131N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28487524C>T" "" "VUS" ""
"0000615919" "0" "30" "16" "28499966" "28499966" "subst" "0.00098673" "02326" "CLN3_000092" "g.28499966C>T" "" "" "" "CLN3(NM_001042432.1):c.240G>A (p.T80=), CLN3(NM_001286105.2):c.20G>A (p.R7H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28488645C>T" "" "likely benign" ""
"0000615920" "0" "30" "16" "28500627" "28500627" "subst" "5.31554E-5" "01943" "CLN3_000118" "g.28500627G>A" "" "" "" "CLN3(NM_001042432.1):c.206C>T (p.S69L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28489306G>A" "" "likely benign" ""
"0000615921" "0" "30" "16" "28503036" "28503036" "subst" "0.00234897" "02329" "CLN3_000096" "g.28503036C>T" "" "" "" "CLN3(NM_001042432.1):c.45G>A (p.E15=), CLN3(NM_001042432.2):c.45G>A (p.E15=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28491715C>T" "" "likely benign" ""
"0000623436" "0" "30" "16" "28500611" "28500611" "subst" "6.99502E-5" "01943" "CLN3_000094" "g.28500611A>G" "" "" "" "CLN3(NM_001042432.1):c.222T>C (p.H74=), CLN3(NM_001042432.2):c.222T>C (p.H74=), CLN3(NM_001286105.1):c.2T>C (p.M1?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28489290A>G" "" "likely benign" ""
"0000629318" "11" "90" "16" "28493633" "28493659" "del" "0" "00006" "CLN3_000031" "g.28493633_28493659del" "1/113 cases" "{PMID:Pronicka 2016:27290639}" "" "954_962+18del28" "" "Germline" "" "" "0" "" "" "g.28482312_28482338del" "" "pathogenic" ""
"0000629356" "0" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000002" "g.28497286_28498251del" "1/113 cases" "{PMID:Pronicka 2016:27290639}" "" "461‑280_677+382del966" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.28485965_28486930del" "" "pathogenic" ""
"0000649293" "1" "50" "16" "28495324" "28495324" "subst" "0.000193567" "03575" "CLN3_000035" "g.28495324T>G" "5/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 5 heterozygous, no homozygous; {DB:CLININrs386833738}" "Germline" "" "rs386833738" "0" "" "" "g.28484003T>G" "" "VUS" ""
"0000649294" "1" "30" "16" "28499044" "28499044" "subst" "0.00935076" "03575" "CLN3_000119" "g.28499044T>C" "5/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "5 heterozygous, no homozygous; {DB:CLININrs11552531}" "Germline" "" "rs11552531" "0" "" "" "g.28487723T>C" "" "likely benign" ""
"0000657811" "0" "30" "16" "28495349" "28495349" "subst" "0.000618496" "02326" "CLN3_000102" "g.28495349G>A" "" "" "" "CLN3(NM_001042432.1):c.768C>T (p.T256=), CLN3(NM_001042432.2):c.768C>T (p.T256=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28484028G>A" "" "likely benign" ""
"0000657812" "0" "90" "16" "28498845" "28498846" "del" "0" "02327" "CLN3_000120" "g.28498845_28498846del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.28487524_28487525del" "" "pathogenic" ""
"0000680514" "0" "50" "16" "28489090" "28489090" "subst" "0" "01943" "CLN3_000121" "g.28489090A>T" "" "" "" "CLN3(NM_001042432.1):c.1165T>A (p.Y389N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000680515" "0" "50" "16" "28499964" "28499964" "subst" "0.000572538" "01943" "CLN3_000091" "g.28499964G>A" "" "" "" "CLN3(NM_001042432.2):c.242C>T (p.P81L), CLN3(NM_001286105.1):c.22C>T (p.R8*), CLN3(NM_001286105.2):c.22C>T (p.R8*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000683467" "3" "70" "16" "28503035" "28503623" "del" "0" "03765" "CLN3_000122" "g.28503035_28503623del" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000683471" "3" "70" "16" "28503035" "28503623" "del" "0" "03765" "CLN3_000122" "g.28503035_28503623del" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000683472" "3" "70" "16" "28497950" "28497950" "subst" "0" "03765" "CLN3_000123" "g.28497950G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000683473" "3" "70" "16" "28495327" "28495439" "del" "0" "03765" "CLN3_000124" "g.28495327_28495439del" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000683474" "3" "70" "16" "28493796" "28493796" "subst" "8.12209E-6" "03765" "CLN3_000125" "g.28493796A>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000683475" "3" "70" "16" "28493796" "28493796" "subst" "8.12209E-6" "03765" "CLN3_000125" "g.28493796A>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000692036" "0" "50" "16" "28493465" "28493465" "subst" "4.09169E-6" "01943" "CLN3_000100" "g.28493465G>C" "" "" "" "CLN3(NM_001042432.1):c.1017C>G (p.C339W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000692037" "0" "50" "16" "28497788" "28497788" "subst" "4.12235E-6" "02327" "CLN3_000126" "g.28497788G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000710314" "3" "90" "16" "28499940" "28499940" "subst" "1.62431E-5" "00006" "CLN3_000098" "g.28499940C>T" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "ACMG PS1, PM2, PP1, PP2, PP3, PP4" "Germline" "" "" "0" "" "" "g.28488619C>T" "" "pathogenic" "ACMG"
"0000712145" "3" "50" "16" "28489128" "28489128" "del" "0" "03388" "CLN3_000127" "g.28489128del" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.28477807del" "" "likely pathogenic" "ACMG"
"0000713317" "0" "90" "16" "28493851" "28493851" "subst" "4.06062E-6" "00000" "CLN3_000129" "g.28493851T>C" "" "{PMID:Carss 2017:28041643}" "" "16:28493851T>C ENST00000569430.1:c.853A>G (Ile285Val)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713462" "0" "90" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Carss 2017:28041643}" "" "16:28488941G>A ENST00000569430.1:c.1213C>T (Arg405Trp)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713549" "3" "90" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Carss 2017:28041643}" "" "16:28488941G>A ENST00000569430.1:c.1213C>T (Arg405Trp)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713621" "0" "90" "16" "28493494" "28493494" "subst" "2.04807E-5" "00000" "CLN3_000128" "g.28493494C>T" "" "{PMID:Carss 2017:28041643}" "" "16:28493494C>T ENST00000569430.1:c.988G>A (Val330Ile)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713633" "0" "90" "16" "28493942" "28493942" "subst" "6.49878E-5" "00000" "CLN3_000130" "g.28493942C>T" "" "{PMID:Carss 2017:28041643}" "" "16:28493942C>T ENST00000354630.5:c.842G>A (Arg281Gln)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000713665" "3" "90" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Carss 2017:28041643}" "" "16:28488941G>A ENST00000569430.1:c.1213C>T (Arg405Trp)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0000725707" "0" "50" "16" "28495383" "28495385" "del" "0" "01943" "CLN3_000131" "g.28495383_28495385del" "" "" "" "CLN3(NM_001042432.1):c.734_736delCAG (p.A245del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000725708" "0" "50" "16" "28497811" "28497811" "subst" "0" "01943" "CLN3_000132" "g.28497811C>G" "" "" "" "CLN3(NM_001042432.1):c.534G>C (p.R178S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000725709" "0" "30" "16" "28498823" "28498823" "subst" "4.0618E-5" "01943" "CLN3_000133" "g.28498823G>A" "" "" "" "CLN3(NM_001042432.1):c.414C>T (p.S138=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000725710" "0" "30" "16" "28500665" "28500665" "subst" "4.08293E-6" "01943" "CLN3_000134" "g.28500665C>T" "" "" "" "CLN3(NM_001042432.1):c.168G>A (p.L56=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000725711" "0" "70" "16" "28500670" "28500670" "subst" "4.08307E-6" "01943" "CLN3_000135" "g.28500670T>A" "" "" "" "CLN3(NM_001286110.1):c.1A>T (p.M1?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0000730984" "3" "70" "16" "28497748" "28497748" "subst" "4.1137E-6" "00000" "CLN3_000040" "g.28497748G>T" "" "{PMID:Bryant 2018:29343940}" "" "" "" "Germline" "" "rs267606737" "0" "" "" "g.28486427G>T" "" "likely pathogenic (recessive)" ""
"0000730985" "1" "70" "16" "28493821" "28493821" "subst" "1.62434E-5" "00000" "CLN3_000033" "g.28493821C>T" "" "{PMID:Bryant 2018:29343940}" "" "" "CNV suspected on 2nd chromosome" "Germline" "" "rs121434286" "0" "" "" "g.28482500C>T" "" "likely pathogenic (recessive)" ""
"0000731056" "0" "50" "16" "28489066" "28489066" "subst" "4.06643E-6" "00000" "CLN3_000136" "g.28489066C>T" "" "{PMID:Bryant 2018:29343940}" "" "" "" "Germline" "" "rs754468227" "0" "" "" "g.28477745C>T" "" "VUS" ""
"0000731428" "1" "70" "16" "28497784" "28497785" "del" "0" "00000" "CLN3_000137" "g.28497784_28497785del" "" "{PMID:DiIorio 2017:29053603}" "" "c.258_259del" "" "Germline" "" "" "0" "" "" "g.28486463_28486464del" "" "likely pathogenic (recessive)" ""
"0000731452" "2" "70" "16" "28497972" "28497972" "subst" "0" "00000" "CLN3_000055" "g.28497972C>G" "" "{PMID:DiIorio 2017:29053603}" "" "" "" "Germline" "" "" "0" "" "" "g.28486651C>G" "" "likely pathogenic (recessive)" ""
"0000733049" "1" "70" "16" "28497286" "28498251" "del" "0" "00000" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Stone 2017:28559085}" "" "del ex9-10, chr16:28497286-28498251del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000733326" "3" "70" "16" "28497286" "28498251" "del" "0" "00000" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Stone 2017:28559085}" "" "del ex9-10, chr16:28497286-28498251del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000733327" "3" "70" "16" "28497286" "28498251" "del" "0" "00000" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Stone 2017:28559085}" "" "del ex9-10, chr16:28497286-28498251del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000733328" "3" "70" "16" "28497286" "28498251" "del" "0" "00000" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Stone 2017:28559085}" "" "del ex9-10, chr16:28497286-28498251del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000733329" "1" "70" "16" "28497286" "28498251" "del" "0" "00000" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Stone 2017:28559085}" "" "del ex9-10, chr16:28497286-28498251del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000733519" "2" "70" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.28477620G>A" "" "likely pathogenic" ""
"0000733711" "2" "70" "16" "28499054" "28499056" "del" "0" "00000" "CLN3_000138" "g.28499054_28499056del" "" "{PMID:Stone 2017:28559085}" "" "303_305delCCT" "" "Germline" "" "" "0" "" "" "g.28487733_28487735del" "" "likely pathogenic" ""
"0000735603" "3" "90" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "yes" "" "0" "" "" "g.28477620G>A" "" "pathogenic" ""
"0000735604" "0" "90" "16" "28497898" "28498863" "del" "0" "00000" "CLN3_000139" "g.(28497812_28497898)_(28498863_28498982)del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.(28486491_28486577)_(28487542_28487661)del" "" "pathogenic" ""
"0000735726" "0" "90" "16" "28498862" "28498862" "del" "0" "00000" "CLN3_000061" "g.28498862del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "NM_000086.2:379del (Arg127fs)" "" "Germline" "" "" "0" "" "" "g.28487541del" "" "pathogenic" ""
"0000764904" "3" "70" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Weisschuh 2016:26766544}" "" "" "" "Germline" "" "" "0" "" "" "g.28477620G>A" "" "likely pathogenic (recessive)" ""
"0000787086" "3" "90" "16" "28493426" "28493993" "del" "0" "00006" "CLN3_000140" "g.(?_28493426)_(28493993_?)del" "" "{PMID:Ganapathy 2019:31069529}" "" "chr16:28493426-?_28493993+?del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000788389" "3" "50" "16" "28497950" "28497950" "subst" "0" "00000" "CLN3_000141" "g.28497950G>A" "" "{PMID:Katagiri 2014:25268133}" "" "C482T" "" "Germline" "" "" "0" "" "" "g.28486629G>A" "" "VUS" ""
"0000789863" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Avela 2019:31087526}" "" "2.8 kb deletion" "Check also: Brancati 2007" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000789864" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Avela 2019:31087526}" "" "2.8kb deletion" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000796271" "3" "90" "16" "28497748" "28497748" "subst" "4.1137E-6" "00000" "CLN3_000040" "g.28497748G>T" "" "{PMID:Wang-2013:23847139}" "" "c.597C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000807322" "0" "30" "16" "28493953" "28493953" "subst" "0.000406171" "02326" "CLN3_000085" "g.28493953C>T" "" "" "" "CLN3(NM_001042432.1):c.831G>A (p.V277=), CLN3(NM_001042432.2):c.831G>A (p.V277=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000807323" "0" "30" "16" "28498850" "28498850" "subst" "5.28369E-5" "01943" "CLN3_000142" "g.28498850G>A" "" "" "" "CLN3(NM_001042432.1):c.387C>T (p.L129=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000807324" "0" "30" "16" "28499039" "28499039" "subst" "0.000355088" "02326" "CLN3_000143" "g.28499039G>A" "" "" "" "CLN3(NM_001042432.1):c.318C>T (p.L106=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000811469" "0" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Dozieres-Puyravel 2020:31489614}" "" "large deletion" "" "Germline" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG"
"0000812181" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Martin Merida 2019:30902645}" "" "CLN3 Ex.7-8 c.(374+1_375-1)_(533+1_534-1)del, Ex.7-8 c.(374+1_375-1)_(533+1_534-1)del" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.?" "" "likely pathogenic" ""
"0000812260" "3" "70" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "CLN3 Ex.16 c.1213C>T p.(Arg405Trp), Ex.16 c.1213C>T p.(Arg405Trp)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.28477620G>A" "" "likely pathogenic" ""
"0000812876" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Jilani 2019:31741823}" "" "1.02 kb deletion" "homozygous" "Germline" "?" "" "0" "" "" "g.?" "" "likely pathogenic" ""
"0000812877" "0" "70" "16" "28493821" "28493821" "subst" "0" "00000" "CLN3_000005" "g.28493821C>A" "" "{PMID:Jilani 2019:31741823}" "" "c.883G>T, p.(Glu295*)" "Compound heterozygous" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.28482500C>A" "" "likely pathogenic" ""
"0000812878" "0" "70" "16" "28493821" "28493821" "subst" "0" "00000" "CLN3_000005" "g.28493821C>A" "" "{PMID:Jilani 2019:31741823}" "" "c.883G>T, p.(Glu295*)" "Compound heterozygous" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.28482500C>A" "" "likely pathogenic" ""
"0000812879" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Jilani 2019:31741823}" "" "1.02 kb deletion" "homozygous" "Germline" "?" "" "0" "" "" "g.?" "" "likely pathogenic" ""
"0000812880" "3" "70" "16" "28493519" "28493519" "subst" "0" "00000" "CLN3_000144" "g.28493519C>T" "" "{PMID:Jilani 2019:31741823}" "" "c.963G>A, p.(Trp321*)" "homozygous" "Germline" "?" "" "0" "" "" "g.28482198C>T" "" "likely pathogenic" ""
"0000812881" "3" "70" "16" "28493481" "28493481" "subst" "2.45634E-5" "00000" "CLN3_000026" "g.28493481C>T" "" "{PMID:Jilani 2019:31741823}" "" "c.1001G>A, p.(Arg334His)" "homozygous" "Germline" "yes" "" "0" "" "" "g.28482160C>T" "" "likely pathogenic" ""
"0000812882" "3" "70" "16" "28493481" "28493481" "subst" "2.45634E-5" "00000" "CLN3_000026" "g.28493481C>T" "" "{PMID:Jilani 2019:31741823}" "" "c.1001G>A, p.(Arg334His)" "homozygous" "Germline" "yes" "" "0" "" "" "g.28482160C>T" "" "likely pathogenic" ""
"0000812906" "0" "70" "16" "28493693" "28493693" "subst" "0" "00000" "CLN3_000145" "g.28493693A>T" "" "{PMID:Jilani 2019:31741823}" "" "c.917T>A, p.(Leu306His)" "Compound heterozygous" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.28482372A>T" "" "likely pathogenic" ""
"0000812907" "0" "70" "16" "28493693" "28493693" "subst" "0" "00000" "CLN3_000145" "g.28493693A>T" "" "{PMID:Jilani 2019:31741823}" "" "c.917T>A, p.(Leu306His)" "Compound heterozygous" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.28482372A>T" "" "likely pathogenic" ""
"0000816064" "0" "70" "16" "28497411" "28498244" "del" "0" "00000" "CLN3_000147" "g.28497411_28498244del" "" "{PMID:Zampaglione 2020:32037395}" "" "CLN3 chr16:28497411_28498244del" "range 302-832 bp in various techniques, heterozygous" "Unknown" "?" "" "0" "" "" "g.28486090_28486923del" "" "likely pathogenic" ""
"0000816207" "0" "70" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "CLN3 c.1213C>T, p.Arg405Trp" "heterozygous" "Unknown" "?" "" "0" "" "" "g.28477620G>A" "" "likely pathogenic" ""
"0000816398" "0" "50" "16" "28500627" "28500627" "subst" "5.31554E-5" "00000" "CLN3_000118" "g.28500627G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "c.206C>T, p.Ser69Leu" "In silico models disagree, heterozygous" "Unknown" "?" "" "0" "" "" "g.28489306G>A" "" "VUS" ""
"0000816506" "0" "90" "16" "28495436" "28495436" "dup" "0" "00000" "CLN3_000146" "g.28495436dup" "" "{PMID:Zampaglione 2020:32037395}" "" "c.683dup, p.Leu230ValfsTer6" "heterozygous" "Unknown" "?" "" "0" "" "" "g.28484115dup" "" "pathogenic" ""
"0000817734" "3" "90" "16" "28497899" "28497899" "del" "0" "00006" "CLN3_000148" "g.28497899del" "" "{PMID:Hu 2019:29302074}" "" "" "" "Germline" "" "" "0" "" "" "g.28486578del" "" "pathogenic (recessive)" "ACMG"
"0000818971" "1" "70" "16" "28497667" "28497972" "del" "0" "00000" "CLN3_000149" "g.(28495440_28497667)_(28497972_28498776)del" "" "{PMID:Ellingsford 2018:29074561}" "" "chr16:28497663–28497976" "variant detected in 6 unrelated cases" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000820033" "1" "70" "16" "28489056" "28489056" "subst" "0" "00000" "CLN3_000150" "g.28489056A>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CLN3, variant 1: c.1197+2T>A/p.?, variant 2: c.922_923del/p.F308Lfs*73" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.28477735A>T" "" "likely pathogenic" ""
"0000820128" "1" "70" "16" "28498987" "28498987" "del" "0" "00000" "CLN3_000153" "g.28498987del" "" "{PMID:Weisschuh 2020:32531858}" "" "CLN3, variant 1: c.370del/p.Y124Tfs*57, variant 2: c.676A>G/p.S226G" "error in annotation, indicated transcript is NM_033380.2, which is COL4A5 transcript, possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.28487666del" "" "likely pathogenic" ""
"0000820129" "1" "70" "16" "28498987" "28498987" "del" "0" "00000" "CLN3_000153" "g.28498987del" "" "{PMID:Weisschuh 2020:32531858}" "" "CLN3, variant 1: c.370del/p.Y124Tfs*57, variant 2: c.676A>G/p.S226G" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.28487666del" "" "likely pathogenic" ""
"0000820790" "1" "70" "16" "28493690" "28493691" "del" "0" "00000" "CLN3_000151" "g.28493690_28493691del" "" "{PMID:Weisschuh 2020:32531858}" "" "CLN3, variant 1: c.1197+2T>A/p.?, variant 2: c.922_923del/p.F308Lfs*73" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.28482369_28482370del" "" "likely pathogenic" ""
"0000820819" "1" "70" "16" "28497669" "28497669" "subst" "0" "00000" "CLN3_000152" "g.28497669T>C" "" "{PMID:Weisschuh 2020:32531858}" "" "CLN3, variant 1: c.370del/p.Y124Tfs*57, variant 2: c.676A>G/p.S226G" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.28486348T>C" "" "likely pathogenic" ""
"0000820820" "1" "70" "16" "28497669" "28497669" "subst" "0" "00000" "CLN3_000152" "g.28497669T>C" "" "{PMID:Weisschuh 2020:32531858}" "" "CLN3, variant 1: c.370del/p.Y124Tfs*57, variant 2: c.676A>G/p.S226G" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.28486348T>C" "" "likely pathogenic" ""
"0000820998" "0" "70" "16" "28100001" "34600000" "del" "0" "00000" "CRYM_000000" "g.28100001_34600000del" "" "{PMID:Ruberto 2020:32507954}" "" "CGH array, microdeletion in 16p11.2" "zygosity not written; probable breakpoints; pathogenic in literature; genes ANKS4B,CRYM,NPIPB3,SMG1P3,RRN3P3,MIR3680-1,MIR3680-2,SLC7A5P2,LOC101927814,METTL9,IGSF6,OTOA,OTOAP1,RRN3P1,NPIPB4,NPIPB5,UQCRC2,PDZD9,MOSMO,VWA3A,EEF2K,POLR3E,CDR2,MFSD13B,HS3ST2,USP31,SCNN1G,SCNN1B,COG7,GGA2,EARS2,UBFD1,NDUFAB1,PALB2,DCTN5,PLK1,ERN2,CHP2" "Unknown" "?" "" "0" "" "" "g.28500001_35300000del" "" "likely pathogenic" ""
"0000821205" "0" "70" "16" "28493851" "28493851" "subst" "4.06062E-6" "00000" "CLN3_000129" "g.28493851T>C" "" "{PMID:Turro 2020:32581362}" "" "CLN3 c.853A>G, p.Ile285Val" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.28482530T>C" "" "likely pathogenic" ""
"0000821206" "0" "70" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Turro 2020:32581362}" "" "CLN3 c.1213C>T, p.Arg405Trp" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.28477620G>A" "" "likely pathogenic" ""
"0000821207" "3" "70" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Turro 2020:32581362}" "" "CLN3 c.1213C>T, p.Arg405Trp" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.28477620G>A" "" "likely pathogenic" ""
"0000821208" "0" "70" "16" "28493494" "28493494" "subst" "2.04807E-5" "00000" "CLN3_000128" "g.28493494C>T" "" "{PMID:Turro 2020:32581362}" "" "CLN3 c.988G>A, p.Val330Ile" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.28482173C>T" "" "likely pathogenic" ""
"0000821209" "0" "70" "16" "28493942" "28493942" "subst" "6.49878E-5" "00000" "CLN3_000130" "g.28493942C>T" "" "{PMID:Turro 2020:32581362}" "" "CLN3 c.842G>A, p.Arg281Gln" "heterozygous, error in annotation: a retired transcript, ENST00000354630.5, has been used. The actual genomic position causes c.837+5G>A" "Germline/De novo (untested)" "?" "" "0" "" "" "g.28482621C>T" "" "likely pathogenic" ""
"0000821210" "3" "70" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Turro 2020:32581362}" "" "CLN3 c.1213C>T, p.Arg405Trp" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.28477620G>A" "" "likely pathogenic" ""
"0000821535" "0" "70" "16" "28497285" "28498251" "del" "0" "00000" "CRYM_000000" "g.28497285_28498251del" "" "{PMID:Turro 2020:32581362}" "" "chr16:g.28497285_28498251del" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "" "" "likely pathogenic" ""
"0000826995" "0" "90" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Thorsteinsson 2021:33851411}" "" "CLN3 1.02-kb, del" "heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "pathogenic" ""
"0000826996" "0" "90" "16" "28493666" "28493666" "dup" "0" "00000" "CLN3_000032" "g.28493666dup" "" "{PMID:Thorsteinsson 2021:33851411}" "" "CLN3 c.944_945dupA, p.Hys315Glnfs*381" "error in annotation, c.944dupA causes p.(His315Glnfs*67) and not p.Hys315Glnfs*381, heterozygous" "Unknown" "?" "" "0" "" "" "g.28482345dup" "" "pathogenic" ""
"0000829990" "3" "50" "16" "28493475" "28493475" "subst" "0" "00000" "CLN3_000154" "g.28493475G>T" "" "{PMID:Numa-2020:33247286}" "" "c.1007C>A:p.S336Y" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000839360" "0" "90" "16" "28497617" "28498024" "del" "0" "01164" "CLN3_000155" "g.(?_28497617)_(28498024_?)del" "" "PMID: 7553855, 21990111, 23374165, 20187884, 21228398" "" "NM_001042432.2:c.461-53_677+51del" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.(?_28486296)_(28486703_?)del" "" "pathogenic (dominant)" "ACMG"
"0000846895" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Avela 2019:31087526}" "" "CLN3 2.8 kb deletion" "homozygous" "Germline" "yes" "" "0" "" "" "g.?" "" "likely pathogenic" ""
"0000846896" "3" "70" "16" "0" "0" "" "0" "00000" "CRYM_000000" "g.?" "" "{PMID:Avela 2019:31087526}" "" "CLN3 2.8 kb deletion" "homozygous" "Germline" "yes" "" "0" "" "" "g.?" "" "likely pathogenic" ""
"0000854456" "0" "30" "16" "28489136" "28489136" "subst" "3.66184E-5" "01943" "CLN3_000156" "g.28489136G>A" "" "" "" "CLN3(NM_001042432.1):c.1119C>T (p.L373=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000854457" "0" "50" "16" "28495335" "28495335" "subst" "1.27938E-5" "01943" "CLN3_000157" "g.28495335G>A" "" "" "" "CLN3(NM_001042432.1):c.782C>T (p.S261L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000854458" "0" "50" "16" "28500657" "28500657" "subst" "0" "02327" "CLN3_000158" "g.28500657G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000868537" "0" "90" "16" "28493666" "28493666" "dup" "0" "00000" "CLN3_000032" "g.28493666dup" "" "{PMID:Licchetta 2015:26360874}" "" "CLN3 p.His315Glnfs*67 (c.944-945dupA)" "" "Unknown" "?" "" "0" "" "" "g.28482345dup" "" "pathogenic" ""
"0000868538" "0" "90" "16" "28493439" "28493444" "del" "0" "00000" "CLN3_000159" "g.28493439_28493444del" "" "{PMID:Licchetta 2015:26360874}" "" "CLN3 p.Ala349_Leu350del; c.1045_1050del" "" "Unknown" "?" "" "0" "" "" "g.28482118_28482123del" "" "pathogenic" ""
"0000868543" "3" "70" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Ku 2017:28542676}" "" "CLN3 c.1213C>T, (R405W)" "homozygous" "Germline" "yes" "" "0" "" "" "g.28477620G>A" "" "likely pathogenic" ""
"0000868544" "1" "70" "16" "28497286" "28498251" "del" "0" "00000" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Ku 2017:28542676}" "" "CLN3 1-kb del (c.461-280_677+382del966)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28485965_28486930del" "" "likely pathogenic" ""
"0000868545" "1" "70" "16" "28497286" "28498251" "del" "0" "00000" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Ku 2017:28542676}" "" "CLN3 1-kb del (c.461-280_677+382del966)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28485965_28486930del" "" "likely pathogenic" ""
"0000868546" "3" "70" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Ku 2017:28542676}" "" "CLN3 c.1213C>T, (R405W)" "homozygous" "Germline" "yes" "" "0" "" "" "g.28477620G>A" "" "likely pathogenic" ""
"0000868547" "1" "70" "16" "28497286" "28498251" "del" "0" "00000" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Ku 2017:28542676}" "" "CLN3 1-kb del (c.461-280_677+382del966)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28485965_28486930del" "" "likely pathogenic" ""
"0000868548" "1" "70" "16" "28493821" "28493821" "subst" "0" "00000" "CLN3_000005" "g.28493821C>A" "" "{PMID:Ku 2017:28542676}" "" "CLN3 c.883G>T, (E295X)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28482500C>A" "" "likely pathogenic" ""
"0000868549" "1" "70" "16" "28493821" "28493821" "subst" "0" "00000" "CLN3_000005" "g.28493821C>A" "" "{PMID:Ku 2017:28542676}" "" "CLN3 c.883G>T, (E295X)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28482500C>A" "" "likely pathogenic" ""
"0000868550" "1" "70" "16" "28497286" "28498251" "del" "0" "00000" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Ku 2017:28542676}" "" "CLN3 1-kb del (c.461-280_677+382del966)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28485965_28486930del" "" "likely pathogenic" ""
"0000868551" "1" "70" "16" "28497286" "28498251" "del" "0" "00000" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Ku 2017:28542676}" "" "CLN3 1-kb del (c.461-280_677+382del966)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28485965_28486930del" "" "likely pathogenic" ""
"0000868552" "1" "70" "16" "28497286" "28498251" "del" "0" "00000" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Ku 2017:28542676}" "" "CLN3 1-kb del (c.461-280_677+382del966)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28485965_28486930del" "" "likely pathogenic" ""
"0000868553" "2" "70" "16" "28493494" "28493494" "subst" "2.04807E-5" "00000" "CLN3_000128" "g.28493494C>T" "" "{PMID:Ku 2017:28542676}" "" "CLN3 c.988G>A, (V330I)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28482173C>T" "" "likely pathogenic" ""
"0000868554" "2" "70" "16" "28493942" "28493942" "subst" "6.49878E-5" "00000" "CLN3_000130" "g.28493942C>T" "" "{PMID:Ku 2017:28542676}" "" "CLN3 c.837+5G>A, (splice site)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28482621C>T" "" "likely pathogenic" ""
"0000868555" "2" "70" "16" "28497974" "28497974" "subst" "4.40129E-6" "00000" "CLN3_000161" "g.28497974G>C" "" "{PMID:Ku 2017:28542676}" "" "CLN3 c.461-3C>G, (splice site)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28486653G>C" "" "likely pathogenic" ""
"0000868556" "2" "70" "16" "28493693" "28493693" "subst" "0" "00000" "CLN3_000145" "g.28493693A>T" "" "{PMID:Ku 2017:28542676}" "" "CLN3 c.917T>A, (L306H)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28482372A>T" "" "likely pathogenic" ""
"0000868557" "2" "70" "16" "28493693" "28493693" "subst" "0" "00000" "CLN3_000145" "g.28493693A>T" "" "{PMID:Ku 2017:28542676}" "" "CLN3 c.917T>A, (L306H)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28482372A>T" "" "likely pathogenic" ""
"0000868558" "2" "70" "16" "28493851" "28493851" "subst" "4.06062E-6" "00000" "CLN3_000129" "g.28493851T>C" "" "{PMID:Ku 2017:28542676}" "" "CLN3 c.853A>G, (I285V)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28482530T>C" "" "likely pathogenic" ""
"0000868559" "2" "70" "16" "28488941" "28488941" "subst" "6.11805E-5" "00000" "CLN3_000016" "g.28488941G>A" "" "{PMID:Ku 2017:28542676}" "" "CLN3 c.1213C>T, (R405W)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28477620G>A" "" "likely pathogenic" ""
"0000868560" "2" "70" "16" "28498865" "28498865" "subst" "0" "00000" "CLN3_000162" "g.28498865G>C" "" "{PMID:Ku 2017:28542676}" "" "CLN3 c.375-3C>G, (splice site)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28487544G>C" "" "likely pathogenic" ""
"0000868566" "1" "70" "16" "28500658" "28500658" "subst" "2.04185E-5" "00000" "CLN3_000163" "g.28500658C>T" "" "{PMID:Chen 2018:30446867}" "" "CLN3 c.175G>A, p.(A59T)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28489337C>T" "" "likely pathogenic" ""
"0000868567" "2" "70" "16" "28497286" "28498251" "del" "0" "00000" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Chen 2018:30446867}" "" "CLN3 1.02-kb del" "heterozygous" "Germline" "yes" "" "0" "" "" "g.28485965_28486930del" "" "likely pathogenic" ""
"0000868568" "3" "70" "16" "28500652" "28500654" "del" "0" "00000" "CLN3_000160" "g.28500652_28500654del" "" "{PMID:Sher 2019:30892110}" "" "181_183delGAC (Asp61del)" "homozygous" "Germline" "yes" "" "0" "" "" "g.28489331_28489333del" "" "likely pathogenic" ""
"0000868569" "3" "70" "16" "28500652" "28500654" "del" "0" "00000" "CLN3_000160" "g.28500652_28500654del" "" "{PMID:Sher 2019:30892110}" "" "181_183delGAC (Asp61del)" "homozygous" "Germline" "yes" "" "0" "" "" "g.28489331_28489333del" "" "likely pathogenic" ""
"0000868570" "1" "70" "16" "28500652" "28500654" "del" "0" "00000" "CLN3_000160" "g.28500652_28500654del" "" "{PMID:Sher 2019:30892110}" "" "181_183delGAC (Asp61del)" "homozygous" "Germline" "yes" "" "0" "" "" "g.28489331_28489333del" "" "likely pathogenic" ""
"0000868571" "1" "70" "16" "28500652" "28500654" "del" "0" "00000" "CLN3_000160" "g.28500652_28500654del" "" "{PMID:Sher 2019:30892110}" "" "181_183delGAC (Asp61del)" "homozygous" "Germline" "yes" "" "0" "" "" "g.28489331_28489333del" "" "likely pathogenic" ""
"0000915942" "1" "90" "16" "28500658" "28500658" "subst" "2.04185E-5" "04436" "CLN3_000163" "g.28500658C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.175G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000915943" "2" "50" "16" "28493718" "28493718" "subst" "0" "04436" "CLN3_000165" "g.28493718A>T" "" "{PMID:Panneman 2023:36819107}" "" "c.907-15T>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000916283" "3" "90" "16" "0" "0" "" "0" "04436" "CRYM_000000" "g.?" "" "{PMID:Panneman 2023:36819107}" "" "c.(460+1_461-1)_(677+1_678-1)del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916382" "1" "50" "16" "0" "0" "" "0" "04436" "CRYM_000000" "g.?" "" "{PMID:Panneman 2023:36819107}" "" "c.(374+1_375-1)_(533+1_534-1)del" "" "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000916383" "2" "90" "16" "28488941" "28488941" "subst" "6.11805E-5" "04436" "CLN3_000016" "g.28488941G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.1213C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916463" "3" "90" "16" "28488941" "28488941" "subst" "6.11805E-5" "04436" "CLN3_000016" "g.28488941G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.1213C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916472" "1" "90" "16" "28500658" "28500658" "subst" "2.04185E-5" "04436" "CLN3_000163" "g.28500658C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.175G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916473" "2" "90" "16" "0" "0" "" "0" "04436" "CRYM_000000" "g.?" "" "{PMID:Panneman 2023:36819107}" "" "c.(460+1_461-1)_(677+1_678-1)del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000916740" "3" "70" "16" "28493646" "28493646" "dup" "0" "04436" "CLN3_000164" "g.28493646dup" "" "{PMID:Panneman 2023:36819107}" "" "c.962+2dup" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000933337" "11" "90" "16" "28493666" "28493666" "dup" "0" "04552" "CLN3_000032" "g.28493666dup" "" "{PMID:Garza-Garza 2023:37621118}" "" "" "" "Germline" "yes" "rs386833740" "0" "" "" "g.28482345dup" "{CV:70931}" "pathogenic (recessive)" "ACMG"
"0000933338" "21" "70" "16" "28488849" "28488849" "subst" "2.44016E-5" "04552" "CLN3_000166" "g.28488849G>C" "" "{PMID:Garza-Garza 2023:37621118}" "" "" "" "Germline" "yes" "rs1216521924" "0" "" "" "g.28477528G>C" "{CV:658557}" "VUS" "ACMG"
"0000933351" "0" "90" "16" "28503080" "28503080" "subst" "8.13306E-6" "04552" "CLN3_000168" "g.28503080T>C" "" "Villafuerte-de la Cruz RA, et al., 2023. Submitted" "" "" "" "Germline" "?" "rs386833708" "0" "" "" "NM_001042432.2:c.1A>G" "{CV:2356}" "pathogenic" "ACMG"
"0000933352" "0" "70" "16" "28497968" "28497968" "subst" "8.65868E-6" "04552" "CLN3_000167" "g.28497968A>C" "" "Villafuerte-de la Cruz RA, et al., 2023. Submitted" "" "" "" "Germline" "yes" "rs779304920" "0" "" "" "NM_001042432.2:c.464T>G" "{CV:2351}" "VUS" "ACMG"
"0000936425" "0" "50" "16" "28488883" "28488883" "subst" "4.07063E-6" "00006" "CLN3_000169" "g.28488883C>T" "" "{PMID:Hamdan 2017:29100083}" "" "NM_001286110:c.G1109A (G370E)" "" "De novo" "" "" "0" "" "" "" "" "VUS" ""
"0000939874" "1" "90" "16" "28493821" "28493821" "subst" "1.62434E-5" "00006" "CLN3_000033" "g.28493821C>T" "" "{PMID:Nambot 2018:29095811}" "" "" "" "Germline" "" "" "0" "" "" "g.28482500C>T" "" "pathogenic (recessive)" ""
"0000939904" "2" "90" "16" "28497283" "28498404" "del" "0" "00006" "CLN3_000170" "g.(?_28497283)_(28498404_?)del" "" "{PMID:Nambot 2018:29095811}" "" "chr16:28497282-28498403del" "" "Germline" "" "" "0" "" "" "g.(?_28485962)_(28487083_?)del" "" "pathogenic (recessive)" ""
"0000958117" "3" "70" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.28485965_28486930del" "" "likely pathogenic (recessive)" "ACMG"
"0000958182" "3" "70" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.28485965_28486930del" "" "likely pathogenic (recessive)" "ACMG"
"0000958251" "3" "70" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.28485965_28486930del" "" "likely pathogenic (recessive)" "ACMG"
"0000968307" "0" "30" "16" "28488924" "28488924" "subst" "0.000436247" "02330" "CLN3_000080" "g.28488924C>T" "" "" "" "CLN3(NM_001042432.1):c.1230G>A (p.A410=), CLN3(NM_001042432.2):c.1230G>A (p.A410=), CLN3(NM_001286110.2):c.1068G>A (p.A356=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000981817" "0" "90" "16" "28493428" "28493428" "subst" "8.31048E-6" "01804" "CLN3_000024" "g.28493428G>A" "" "" "" "CLN3(NM_001042432.1):c.1054C>T (p.Q352*), CLN3(NM_001042432.2):c.1054C>T (p.Q352*, p.(Gln352*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000986360" "1" "90" "16" "28497667" "28498776" "del" "0" "04405" "CLN3_000149" "g.(28498776_28497972)_(28497667_28495440)del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000986361" "3" "50" "16" "28493454" "28493454" "subst" "0" "04405" "CLN3_000171" "g.28493454C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.28482133C>T" "" "VUS" "ACMG"
"0000986362" "3" "70" "16" "28495326" "28497667" "del" "0" "04405" "CLN3_000173" "g.(28497667_28495440)_(28495326_28493994)del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000986363" "3" "90" "16" "28497748" "28497748" "subst" "4.1137E-6" "04405" "CLN3_000040" "g.28497748G>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.28486427G>T" "" "pathogenic" "ACMG"
"0000986897" "2" "70" "16" "28493838" "28493838" "subst" "0" "04405" "CLN3_000172" "g.28493838A>G" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.28482517A>G" "" "likely pathogenic" "ACMG"
"0000987005" "0" "90" "16" "28497667" "28498776" "del" "0" "00006" "CLN3_000149" "g.(28498776_28497972)_(28497667_28495440)del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "case unsolved" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000987006" "0" "90" "16" "28497667" "28498776" "del" "0" "00006" "CLN3_000149" "g.(28498776_28497972)_(28497667_28495440)del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "case unsolved" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000987238" "0" "90" "16" "28500658" "28500658" "subst" "2.04185E-5" "00006" "CLN3_000163" "g.28500658C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "case unsolved" "Germline" "" "" "0" "" "" "g.28489337C>T" "" "pathogenic" "ACMG"
"0000987303" "0" "90" "16" "28497667" "28498776" "del" "0" "00006" "CLN3_000149" "g.(28498776_28497972)_(28497667_28495440)del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "no variant 2nd chromosome, case unsolved" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0000987340" "0" "90" "16" "28497667" "28498776" "del" "0" "00006" "CLN3_000149" "g.(28498776_28497972)_(28497667_28495440)del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "464_677del" "no variant 2nd chromosome, case unsolved" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG"
"0001002178" "0" "50" "16" "28508410" "28508410" "subst" "1.38858E-5" "01804" "CLN3_000174" "g.28508410C>A" "" "" "" "APOBR(NM_018690.3):c.2048C>A (p.(Thr683Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001002179" "0" "50" "16" "28509252" "28509252" "subst" "1.23476E-5" "01804" "CLN3_000175" "g.28509252G>A" "" "" "" "APOBR(NM_018690.3):c.2890G>A (p.(Gly964Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001012389" "3" "90" "16" "28497286" "28498251" "del" "0" "00006" "CLN3_000002" "g.28497286_28498251del" "" "{PMID:Fernandez-Marmiesse 2014:24767253}" "" "461-280_677+382del966" "" "Germline" "" "" "0" "" "" "g.28485965_28486930del" "" "pathogenic (recessive)" ""
"0001012391" "3" "90" "16" "28498985" "28498986" "ins" "0" "00006" "CLN3_000177" "g.28498985_28498986insA" "" "{PMID:Fernandez-Marmiesse 2014:24767253}" "" "" "" "Germline" "" "" "0" "" "" "g.28487664_28487665insA" "" "pathogenic (recessive)" ""
"0001012426" "1" "50" "16" "28493487" "28493487" "subst" "8.18679E-6" "00006" "CLN3_000176" "g.28493487G>A" "" "{PMID:Fernandez-Marmiesse 2014:24767253}" "" "" "" "Germline" "" "" "0" "" "" "g.28482166G>A" "" "VUS" ""
"0001012431" "1" "50" "16" "28493487" "28493487" "subst" "8.18679E-6" "00006" "CLN3_000176" "g.28493487G>A" "" "{PMID:Fernandez-Marmiesse 2014:24767253}" "" "" "" "Germline" "" "" "0" "" "" "g.28482166G>A" "" "VUS" ""
"0001019646" "1" "90" "16" "28489087" "28489087" "subst" "4.06564E-5" "00006" "CLN3_000178" "g.28489087C>T" "" "{PMID:Wen 2023:36811936}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" ""
"0001019647" "2" "90" "16" "28497284" "28498250" "del" "0" "00006" "CLN3_000179" "g.28497284_28498250del" "" "{PMID:Wen 2023:36811936}" "" "(Val156Serfs*27)" "" "Germline" "" "" "0" "" "" "g.28485966_28486932del" "" "pathogenic (recessive)" ""
"0001019648" "3" "90" "16" "28494321" "28496785" "del" "0" "00006" "CLN3_000180" "g.28494321_28496785del" "" "{PMID:Wen 2023:36811936}" "" "" "" "Germline" "" "" "0" "" "" "g.28483000_28485464del" "" "pathogenic (recessive)" ""
"0001041014" "0" "50" "16" "28493652" "28493652" "subst" "1.63149E-5" "01804" "CLN3_000181" "g.28493652G>A" "" "" "" "CLN3(NM_001042432.2):c.958C>T (p.(Arg320Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001041015" "0" "30" "16" "28495346" "28495346" "subst" "0.000939101" "02326" "CLN3_000086" "g.28495346C>T" "" "" "" "CLN3(NM_001042432.1):c.771G>A (p.E257=), CLN3(NM_001042432.2):c.771G>A (p.E257=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001041016" "0" "30" "16" "28499936" "28499936" "subst" "0.00029643" "02326" "CLN3_000106" "g.28499936A>G" "" "" "" "CLN3(NM_001042432.1):c.270T>C (p.F90=), CLN3(NM_001042432.2):c.270T>C (p.F90=), CLN3(NM_001286105.1):c.50T>C (p.L17S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001049537" "11" "90" "16" "28499064" "28499064" "subst" "0" "04913" "CLN3_000182" "g.28499064A>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.28487743T>G" "" "pathogenic (recessive)" "ACMG"
"0001049664" "0" "70" "16" "28500653" "28500655" "delins" "0" "04913" "CLN3_000183" "g.28500653_28500655delinsCTCTTGTGGCTAAGGATGT" "" "" "" "c.178_180delinsACATCCTTAGCCACAAGAG" "" "Germline" "" "" "0" "" "" "g.28489332_28489334delinsCTCTTGTGGCTAAGGATGT" "" "likely pathogenic" ""
"0001055501" "0" "30" "16" "28502884" "28502884" "subst" "2.85404E-5" "01804" "CLN3_000184" "g.28502884G>A" "" "" "" "CLN3(NM_001042432.2):c.47-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001055502" "0" "50" "16" "28508224" "28508224" "subst" "0.000463777" "01804" "CLN3_000185" "g.28508224C>G" "" "" "" "APOBR(NM_018690.4):c.1862C>G (p.(Pro621Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001055503" "0" "50" "16" "28509264" "28509264" "subst" "7.00707E-5" "01804" "CLN3_000186" "g.28509264A>T" "" "" "" "APOBR(NM_018690.4):c.2902A>T (p.(Thr968Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001058551" "0" "70" "16" "28488898" "28488898" "subst" "0" "00006" "CLN3_000187" "g.28488898C>T" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.28477577C>T" "" "likely pathogenic" ""
"0001059384" "11" "90" "16" "28497667" "28497899" "del" "0" "00006" "CLN3_000188" "g.(28495440_28497667)_(28497899_28497971)del" "" "{PMID:Retterer 2016:26633542}" "" "partial del ex8-9" "" "Germline" "" "" "0" "" "" "g.(28484119_28486346)_(28486578_28486650)del" "" "pathogenic" ""
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes CLN3
## Count = 749
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}"
"0000000601" "00000010" "50" "1198" "-1" "1198" "-1" "c.1198-1G>T" "r.(=)" "p.(=)" ""
"0000000602" "00000010" "50" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.(Gly154Alafs*29)" ""
"0000000603" "00000010" "50" "423" "0" "424" "0" "c.423_424del" "r.(?)" "p.(Val142Cysfs*17)" ""
"0000000604" "00000010" "50" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.(Gly154Alafs*29)" ""
"0000000605" "00000010" "50" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.(Gly154Alafs*29)" ""
"0000000606" "00000010" "50" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.(Gly154Alafs*29)" ""
"0000000607" "00000010" "50" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.(Gly154Alafs*29)" ""
"0000000608" "00000010" "50" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.(Gly154Alafs*29)" ""
"0000000609" "00000010" "50" "883" "0" "883" "0" "c.883G>T" "r.(?)" "p.(Glu295*)" ""
"0000000610" "00000010" "50" "906" "5" "906" "5" "c.906+5G>A" "r.(=)" "p.(=)" ""
"0000019547" "00000010" "95" "966" "0" "966" "0" "c.966C>G" "r.(?)" "p.(Tyr322*)" "14"
"0000019548" "00000010" "75" "868" "0" "868" "0" "c.868G>T" "r.(?)" "p.(Val290Leu)" "12"
"0000079383" "00000010" "00" "-828981" "0" "6959947" "0" "c.-828981_*6958630del" "r.0?" "p.0?" ""
"0000079608" "00000010" "00" "-3385420" "0" "1307003" "0" "c.-3385420_*1305686dup" "" "" ""
"0000183645" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183646" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183647" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183648" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183649" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183650" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183651" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183652" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183653" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183654" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183655" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183656" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183657" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183658" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183659" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183660" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183661" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183662" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183663" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183664" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183665" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183666" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183667" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183668" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183669" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183670" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183671" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183672" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183673" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183674" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183675" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183676" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183677" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183678" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183679" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183680" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183681" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183682" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183683" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183684" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183685" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183686" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183687" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183688" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183689" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183690" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183691" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183692" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183693" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183694" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183695" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183696" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183697" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183698" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183699" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183700" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183701" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183702" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183703" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183704" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183705" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183706" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183707" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183708" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183709" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183710" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183711" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183712" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183713" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183714" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183715" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183716" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183717" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183718" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183719" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183720" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183721" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183722" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183723" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183724" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183725" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183726" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183727" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183728" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183729" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183730" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183731" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183732" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183733" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183734" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183735" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183736" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183737" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183738" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183739" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183740" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183741" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183742" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183743" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183744" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183745" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183746" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183747" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183748" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183749" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183750" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183751" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183752" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183753" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183754" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183755" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183756" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183757" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183758" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183759" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183760" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183761" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183762" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183763" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183764" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183765" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183766" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183767" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183768" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183769" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183770" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183771" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183772" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183773" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183774" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183775" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183776" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183777" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183778" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183779" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183780" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183781" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183782" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183783" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183784" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183785" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183786" "00000010" "90" "791" "-802" "1056" "1445" "c.791-802_1056+1445del2815" "r.(791_1056del)" "p.(Gly264Valfs*29)" "1i"
"0000183787" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183788" "00000010" "90" "533" "1" "533" "1" "c.533+1G>C" "r.spl?" "p.?" "1i"
"0000183789" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183790" "00000010" "90" "432" "1" "1350" "-1" "c.432+?_1350-?del" "r.?" "p.?" "1_3"
"0000183791" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183792" "00000010" "70" "302" "0" "302" "0" "c.302T>C" "r.(302u>c" "p.(Leu101Pro)" "1"
"0000183793" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183794" "00000010" "90" "378" "0" "379" "0" "c.378_379dup" "r.(?)" "p.(Arg127Profs*55)" "1"
"0000183795" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183796" "00000010" "90" "461" "-13" "461" "-13" "c.461-13G>C" "r.[=, 461_533del]" "p.[=, Val155Profs*2]" "1"
"0000183797" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183798" "00000010" "90" "482" "0" "482" "0" "c.482C>G" "r.(482c>g)" "p.(Ser161*)" "1"
"0000183799" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183800" "00000010" "90" "485" "0" "485" "0" "c.485C>G" "r.(485c>g)" "p.(Ser162*)" "1"
"0000183801" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183802" "00000010" "70" "509" "0" "509" "0" "c.509T>C" "r.(509u>c)" "p.(Leu170Pro)" "1"
"0000183803" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183804" "00000010" "70" "509" "0" "509" "0" "c.509T>C" "r.(509u>c)" "p.(Leu170Pro)" "1"
"0000183805" "00000010" "90" "631" "0" "631" "0" "c.631C>T" "r.(631c>u)" "p.(Gln211*)" "1"
"0000183806" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183807" "00000010" "70" "883" "0" "883" "0" "c.883G>A" "r.(883g>a)" "p.(Glu295Lys)" "1"
"0000183808" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183809" "00000010" "90" "979" "0" "979" "0" "c.979C>T" "r.(979c>u)" "p.(Gln327*)" "1"
"0000183810" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183811" "00000010" "70" "988" "0" "988" "0" "c.988G>T" "r.(988g>u)" "p.(Val330Phe)" "1"
"0000183812" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183813" "00000010" "70" "1000" "0" "1000" "0" "c.1000C>T" "r.(1000c>u)" "p.(Arg334Cys)" "1"
"0000183814" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183815" "00000010" "70" "1000" "0" "1000" "0" "c.1000C>T" "r.(1000c>u)" "p.(Arg334Cys)" "1"
"0000183816" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183817" "00000010" "70" "1000" "0" "1000" "0" "c.1000C>T" "r.(1000c>u)" "p.(Arg334Cys)" "1"
"0000183818" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183819" "00000010" "70" "1001" "0" "1001" "0" "c.1001G>A" "r.(1001g>a)" "p.(Arg334His)" "1"
"0000183820" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183821" "00000010" "70" "1001" "0" "1001" "0" "c.1001G>A" "r.(1001g>a)" "p.(Arg334His)" "1"
"0000183822" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183823" "00000010" "70" "1001" "0" "1001" "0" "c.1001G>A" "r.(1001g>a)" "p.(Arg334His)" "1"
"0000183824" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183825" "00000010" "70" "1001" "0" "1001" "0" "c.1001G>A" "r.(1001g>a)" "p.(Arg334His)" "1"
"0000183826" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183827" "00000010" "90" "1054" "0" "1054" "0" "c.1054C>T" "r.(1054c>u)" "p.(Gln352*)" "1"
"0000183828" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183829" "00000010" "90" "1054" "0" "1054" "0" "c.1054C>T" "r.(1054c>u)" "p.(Gln352*)" "1"
"0000183830" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183831" "00000010" "90" "1198" "-1" "1198" "-1" "c.1198-1G>T" "r.1198_1202del" "p.Thr400*" "1i"
"0000183832" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183833" "00000010" "90" "1198" "-1" "1198" "-1" "c.1198-1G>T" "r.1198_1202del" "p.Thr400*" "1i"
"0000183834" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183835" "00000010" "90" "1198" "-1" "1198" "-1" "c.1198-1G>T" "r.1198_1202del" "p.Thr400*" "1i"
"0000183836" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183837" "00000010" "90" "1272" "0" "1272" "0" "c.1272del" "r.(?)" "p.(Leu425Serfs*87)" "3"
"0000183838" "00000010" "90" "424" "0" "424" "0" "c.424del" "r.(?)" "p.(Val142Leufs*39)" "1"
"0000183839" "00000010" "90" "424" "0" "424" "0" "c.424del" "r.(?)" "p.(Val142Leufs*39)" "1"
"0000183840" "00000010" "90" "424" "0" "424" "0" "c.424del" "r.(?)" "p.(Val142Leufs*39)" "1"
"0000183841" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183842" "00000010" "90" "424" "0" "424" "0" "c.424del" "r.(?)" "p.(Val142Leufs*39)" "1"
"0000183843" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183844" "00000010" "90" "424" "0" "424" "0" "c.424del" "r.(?)" "p.(Val142Leufs*39)" "1"
"0000183845" "00000010" "90" "558" "0" "559" "0" "c.558_559del" "r.(?)" "p.(Gly187Aspfs*48)" "1"
"0000183846" "00000010" "90" "586" "0" "586" "0" "c.586dup" "r.(?)" "p.(Ala196Glyfs*40)" "1"
"0000183847" "00000010" "90" "944" "0" "944" "0" "c.944dup" "r.(?)" "p.(His315Glnfs*67)" "1"
"0000183848" "00000010" "90" "944" "0" "944" "0" "c.944dup" "r.(?)" "p.(His315Glnfs*67)" "1"
"0000183849" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183850" "00000010" "90" "944" "0" "944" "0" "c.944dup" "r.(?)" "p.(His315Glnfs*67)" "1"
"0000183851" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183852" "00000010" "90" "944" "0" "944" "0" "c.944dup" "r.(?)" "p.(His315Glnfs*67)" "1"
"0000183853" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183854" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183855" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183856" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183857" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183858" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183859" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183860" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183861" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183862" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183863" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183864" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183865" "00000010" "90" "1211" "0" "1211" "0" "c.1211A>G" "r.(1211a>g)" "p.(His404Arg)" "2"
"0000183866" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183867" "00000010" "90" "0" "0" "0" "0" "c.0" "r.0" "p.0" ""
"0000183868" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183869" "00000010" "90" "791" "-1" "1056" "-1" "c.791-?_1056-?del" "r.791_1056del" "p.(Gly264Valfs*29)" "1"
"0000183870" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183871" "00000010" "90" "791" "-1" "1056" "-1" "c.791-?_1056-?del" "r.791_1056del" "p.(Gly264Valfs*29)" "1"
"0000183872" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183873" "00000010" "90" "791" "-1" "1056" "-1" "c.791-?_1056-?del" "r.791_1056del" "p.(Gly264Valfs*29)" "1"
"0000183874" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183875" "00000010" "90" "791" "-1" "1056" "-1" "c.791-?_1056-?del" "r.791_1056del" "p.(Gly264Valfs*29)" "1"
"0000183876" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183877" "00000010" "90" "791" "-1" "1056" "-1" "c.791-?_1056-?del" "r.791_1056del" "p.(Gly264Valfs*29)" "1"
"0000183878" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183879" "00000010" "90" "791" "-1" "1056" "-1" "c.791-?_1056-?del" "r.791_1056del" "p.(Gly264Valfs*29)" "1"
"0000183880" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183881" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183882" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183883" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183884" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183885" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183886" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183887" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183888" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183889" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183890" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183891" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183892" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183893" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183894" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183895" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183896" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183897" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183898" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183899" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183900" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183901" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183902" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183903" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183904" "00000010" "70" "883" "0" "883" "0" "c.883G>A" "r.(883g>a)" "p.(Glu295Lys)" "1"
"0000183905" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183906" "00000010" "70" "883" "0" "883" "0" "c.883G>A" "r.(883g>a)" "p.(Glu295Lys)" "1"
"0000183907" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183908" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183909" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183910" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183911" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183912" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183913" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183914" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183915" "00000010" "90" "1211" "0" "1211" "0" "c.1211A>G" "r.(1211a>g)" "p.(His404Arg)" "2"
"0000183916" "00000010" "90" "1211" "0" "1211" "0" "c.1211A>G" "r.(1211a>g)" "p.(His404Arg)" "2"
"0000183917" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183918" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183919" "00000010" "90" "424" "0" "424" "0" "c.424del" "r.(?)" "p.(Val142Leufs*39)" "1"
"0000183920" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183921" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183922" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183923" "00000010" "90" "-1101" "0" "-1101" "0" "c.-1101C>T" "r.(=)" "p.(=)" "1"
"0000183924" "00000010" "90" "0" "0" "0" "0" "c.0" "r.0" "p.0" ""
"0000183925" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183926" "00000010" "90" "1135" "0" "1138" "0" "c.1135_1138del" "r.(?)" "p.(Leu379Metfs*11)" "2"
"0000183927" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183928" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183929" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183930" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183931" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183932" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183933" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183934" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183935" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183936" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183937" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183938" "00000010" "90" "569" "0" "569" "0" "c.569del" "r.(?)" "p.(Gly190Glufs*65)" "1"
"0000183939" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183940" "00000010" "90" "569" "0" "569" "0" "c.569del" "r.(?)" "p.(Gly190Glufs*65)" "1"
"0000183941" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183942" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183943" "00000010" "70" "1056" "0" "1056" "0" "c.1056G>C" "r.spl?" "p.(Gln352His)" "1"
"0000183944" "00000010" "90" "49" "0" "49" "0" "c.49G>T" "r.(49g>u)" "p.(Glu17*)" "1"
"0000183945" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183946" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183947" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183948" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183949" "00000010" "90" "597" "0" "597" "0" "c.597C>A" "r.(597c>a)" "p.(Tyr199*)" "1"
"0000183950" "00000010" "90" "597" "0" "597" "0" "c.597C>A" "r.(597c>a)" "p.(Tyr199*)" "1"
"0000183951" "00000010" "90" "597" "0" "597" "0" "c.597C>A" "r.(597c>a)" "p.(Tyr199*)" "1"
"0000183952" "00000010" "90" "597" "0" "597" "0" "c.597C>A" "r.(597c>a)" "p.(Tyr199*)" "1"
"0000183953" "00000010" "90" "597" "0" "597" "0" "c.597C>A" "r.(597c>a)" "p.(Tyr199*)" "1"
"0000183954" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183955" "00000010" "90" "374" "0" "374" "0" "c.374G>A" "r.[374g>a, spl?]" "p.[Ser125Asn, ?]" "1"
"0000183956" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183957" "00000010" "90" "374" "0" "374" "0" "c.374G>A" "r.[374g>a, spl?]" "p.[Ser125Asn, ?]" "1"
"0000183958" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183959" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183960" "00000010" "90" "622" "0" "622" "0" "c.622dup" "r.(?)" "p.(Ser208Phefs*28)" "1"
"0000183961" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183962" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183963" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183964" "00000010" "90" "622" "0" "622" "0" "c.622dup" "r.(?)" "p.(Ser208Phefs*28)" "1"
"0000183965" "00000010" "70" "575" "0" "575" "0" "c.575G>A" "r.(575g>a)" "p.(Gly192Glu)" "1"
"0000183966" "00000010" "90" "265" "0" "265" "0" "c.265C>T" "r.(265c>u)" "p.(Arg89*)" "1"
"0000183967" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183968" "00000010" "90" "370" "0" "370" "0" "c.370dup" "r.(?)" "p.(Tyr124Leufs*36)" "1"
"0000183969" "00000010" "70" "1001" "0" "1001" "0" "c.1001G>A" "r.(1001g>a)" "p.(Arg334His)" "1"
"0000183970" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183971" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183972" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183973" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183974" "00000010" "70" "1000" "0" "1000" "0" "c.1000C>T" "r.(1000c>u)" "p.(Arg334Cys)" "1"
"0000183975" "00000010" "10" "560" "0" "560" "0" "c.560G>C" "r.(560g>c)" "p.(Gly187Ala)" "1"
"0000183976" "00000010" "90" "622" "0" "622" "0" "c.622dup" "r.(?)" "p.(Ser208Phefs*28)" "1"
"0000183977" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183978" "00000010" "70" "565" "0" "565" "0" "c.565G>C" "r.(565g>c)" "p.(Gly189Arg)" "1"
"0000183979" "00000010" "90" "105" "0" "105" "0" "c.105G>A" "r.(105g>a)" "p.(Trp35*)" "1"
"0000183980" "00000010" "90" "222" "5" "222" "5" "c.222+5G>C" "r.spl?" "p.?" "1i"
"0000183981" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183982" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183983" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183984" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183985" "00000010" "70" "400" "0" "400" "0" "c.400T>C" "r.(400u>c)" "p.(Cys134Arg)" "1"
"0000183986" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183987" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183988" "00000010" "90" "1195" "0" "1195" "0" "c.1195G>T" "r.(1195g>u)" "p.(Glu399*)" "2"
"0000183989" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183990" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183991" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183992" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183993" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183994" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183995" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183996" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183997" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183998" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000183999" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184000" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184001" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184002" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184003" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184004" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184005" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184006" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184007" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184008" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184009" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184010" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184011" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184012" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184013" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184014" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184015" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184016" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184017" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184018" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184019" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184020" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184021" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184022" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184023" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184024" "00000010" "90" "126" "-1" "126" "-1" "c.126-1G>A" "r.spl?" "p.?" "1"
"0000184025" "00000010" "90" "233" "0" "233" "0" "c.233dup" "r.(?)" "p.(Thr80Asnfs*12)" "1"
"0000184026" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184027" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184028" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184029" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184030" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184031" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184032" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184033" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184034" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184035" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184036" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184037" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184038" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184039" "00000010" "90" "424" "0" "424" "0" "c.424del" "r.(?)" "p.(Val142Leufs*39)" "1"
"0000184040" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184041" "00000010" "90" "424" "0" "424" "0" "c.424del" "r.(?)" "p.(Val142Leufs*39)" "1"
"0000184042" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184043" "00000010" "90" "424" "0" "424" "0" "c.424del" "r.(?)" "p.(Val142Leufs*39)" "1"
"0000184044" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184045" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184046" "00000010" "90" "1054" "0" "1054" "0" "c.1054C>T" "r.(1054c>u)" "p.(Gln352*)" "1"
"0000184047" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184048" "00000010" "90" "1" "0" "1" "0" "c.1A>C" "r.(1a>c)" "p.0?" "1"
"0000184049" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184050" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184051" "00000010" "90" "954" "0" "962" "18" "c.954_962+18del" "r.spl" "p.(Leu313_Trp321del)" "1"
"0000184052" "00000010" "90" "954" "0" "962" "18" "c.954_962+18del" "r.spl" "p.(Leu313_Trp321del)" "1"
"0000184053" "00000010" "90" "265" "0" "265" "0" "c.265C>T" "r.(265c>u)" "p.(Arg89*)" "1"
"0000184054" "00000010" "70" "1000" "0" "1000" "0" "c.1000C>T" "r.(1000c>u)" "p.(Arg334Cys)" "1"
"0000184055" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184056" "00000010" "90" "125" "5" "125" "5" "c.125+5G>A" "r.spl?" "p.?" "1i"
"0000184057" "00000010" "90" "424" "0" "424" "0" "c.424del" "r.(?)" "p.(Val142Leufs*39)" "1"
"0000184058" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184059" "00000010" "90" "963" "-1" "963" "-1" "c.963-1G>T" "r.spl?" "p.?" "1"
"0000184060" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184061" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184062" "00000010" "90" "461" "-1" "461" "-1" "c.461-1G>C" "r.spl?" "p.?" "1"
"0000184063" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184064" "00000010" "70" "1001" "0" "1001" "0" "c.1001G>A" "r.(1001g>a)" "p.(Arg334His)" "1"
"0000184065" "00000010" "70" "1001" "0" "1001" "0" "c.1001G>A" "r.(1001g>a)" "p.(Arg334His)" "1"
"0000184066" "00000010" "90" "790" "3" "790" "3" "c.790+3A>C" "r.spl?" "p.?" "1i"
"0000184067" "00000010" "90" "1211" "0" "1211" "0" "c.1211A>G" "r.(1211a>g)" "p.(His404Arg)" "2"
"0000184068" "00000010" "90" "1211" "0" "1211" "0" "c.1211A>G" "r.(1211a>g)" "p.(His404Arg)" "2"
"0000184069" "00000010" "90" "1211" "0" "1211" "0" "c.1211A>G" "r.(1211a>g)" "p.(His404Arg)" "2"
"0000184070" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184071" "00000010" "90" "424" "0" "424" "0" "c.424del" "r.(?)" "p.(Val142Leufs*39)" "1"
"0000184072" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184073" "00000010" "90" "1054" "0" "1054" "0" "c.1054C>T" "r.(1054c>u)" "p.(Gln352*)" "1"
"0000184074" "00000010" "90" "126" "-1" "126" "-1" "c.126-1G>A" "r.spl?" "p.?" "1"
"0000184075" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184076" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184077" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184078" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184079" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184080" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184081" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184082" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184083" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184084" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184085" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184086" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184087" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184088" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184089" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184090" "00000010" "90" "678" "-1" "1317" "1" "c.678-?_1317+?del" "r.spl?" "p.?" "1_3"
"0000184091" "00000010" "90" "678" "-1" "1317" "1" "c.678-?_1317+?del" "r.spl?" "p.?" "1_3"
"0000184092" "00000010" "90" "105" "0" "105" "0" "c.105G>A" "r.(105g>a)" "p.(Trp35*)" "1"
"0000184093" "00000010" "90" "214" "0" "214" "0" "c.214C>T" "r.(214c>u)" "p.(Gln72*)" "1"
"0000184094" "00000010" "90" "370" "0" "370" "0" "c.370dup" "r.(?)" "p.(Tyr124Leufs*36)" "1"
"0000184095" "00000010" "90" "379" "0" "379" "0" "c.379del" "r.(?)" "p.(Arg127Glyfs*54)" "1"
"0000184096" "00000010" "90" "461" "-1" "461" "-1" "c.461-1G>A" "r.spl?" "p.?" "1"
"0000184097" "00000010" "70" "472" "0" "472" "0" "c.472G>C" "r.(472g>c)" "p.(Ala158Pro)" "1"
"0000184098" "00000010" "90" "533" "1" "533" "1" "c.533+1G>A" "r.spl?" "p.?" "1i"
"0000184099" "00000010" "90" "560" "0" "560" "0" "c.560G>C" "r.(560g>c)" "p.(Gly187Ala)" "1"
"0000184100" "00000010" "90" "597" "0" "597" "0" "c.597C>A" "r.(597c>a)" "p.(Tyr199*)" "1"
"0000184101" "00000010" "90" "883" "0" "883" "0" "c.883G>T" "r.(883g>u)" "p.(Glu295*)" "1"
"0000184102" "00000010" "90" "906" "5" "906" "5" "c.906+5G>A" "r.spl?" "p.?" "1i"
"0000184103" "00000010" "90" "1056" "3" "1056" "3" "c.1056+3A>C" "r.spl?" "p.?" "1i"
"0000184104" "00000010" "70" "1247" "0" "1247" "0" "c.1247A>G" "r.(1247a>g)" "p.(Asp416Gly)" "2"
"0000184105" "00000010" "90" "1198" "-1" "1198" "-1" "c.1198-1G>T" "r.1198_1202del" "p.Thr400*" "1i"
"0000184106" "00000010" "90" "954" "0" "962" "18" "c.954_962+18del" "r.spl" "p.(Leu313_Trp321del)" "1"
"0000184107" "00000010" "90" "1048" "0" "1048" "0" "c.1048del" "r.(?)" "p.(Leu350Cysfs*27)" "1"
"0000184108" "00000010" "90" "222" "2" "222" "2" "c.222+2T>G" "r.spl?" "p.?" "1i"
"0000184109" "00000010" "90" "1268" "0" "1268" "0" "c.1268C>A" "r.(1268c>a)" "p.(Ser423*)" "3"
"0000184110" "00000010" "90" "126" "-1" "126" "-1" "c.126-1G>A" "r.spl?" "p.?" "1"
"0000184111" "00000010" "90" "126" "-1" "126" "-1" "c.126-1G>A" "r.spl?" "p.?" "1"
"0000184112" "00000010" "90" "294" "-58" "294" "-58" "c.294-58G>A" "r.(=)" "p.(=)" "1"
"0000184113" "00000010" "90" "294" "-80" "294" "-80" "c.294-80G>A" "r.(=)" "p.(=)" "1"
"0000184114" "00000010" "90" "294" "-58" "294" "-58" "c.294-58G>A" "r.(=)" "p.(=)" "1"
"0000184115" "00000010" "90" "1211" "0" "1211" "0" "c.1211A>G" "r.(1211a>g)" "p.(His404Arg)" "2"
"0000184116" "00000010" "90" "294" "-80" "294" "-80" "c.294-80G>A" "r.(=)" "p.(=)" "1"
"0000184117" "00000010" "90" "1211" "0" "1211" "0" "c.1211A>G" "r.(1211a>g)" "p.(His404Arg)" "2"
"0000184118" "00000010" "90" "1211" "0" "1211" "0" "c.1211A>G" "r.(1211a>g)" "p.(His404Arg)" "2"
"0000184119" "00000010" "90" "1211" "0" "1211" "0" "c.1211A>G" "r.(1211a>g)" "p.(His404Arg)" "2"
"0000184120" "00000010" "90" "1211" "0" "1211" "0" "c.1211A>G" "r.(1211a>g)" "p.(His404Arg)" "2"
"0000184121" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184122" "00000010" "70" "883" "0" "883" "0" "c.883G>A" "r.(883g>a)" "p.(Glu295Lys)" "1"
"0000184123" "00000010" "90" "784" "0" "784" "0" "c.784A>T" "r.(?)" "p.(Lys262*)" "1"
"0000184124" "00000010" "90" "494" "0" "494" "0" "c.494G>A" "0" "p.(Gly165Glu)" "1"
"0000184125" "00000010" "90" "494" "0" "494" "0" "c.494G>A" "0" "p.(Gly165Glu)" "1"
"0000184126" "00000010" "90" "868" "0" "868" "0" "c.868G>T" "0" "p.(Val290Leu)" "1"
"0000184127" "00000010" "90" "966" "0" "966" "0" "c.966C>G" "0" "p.(Tyr322*)" "1"
"0000184128" "00000010" "90" "868" "0" "868" "0" "c.868G>T" "0" "p.(Val290Leu)" "1"
"0000184129" "00000010" "90" "966" "0" "966" "0" "c.966C>G" "0" "p.(Tyr322*)" "1"
"0000184130" "00000010" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(1213c>t)" "p.(Arg405Trp)" "2"
"0000184131" "00000010" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(1213c>t)" "p.(Arg405Trp)" "2"
"0000184132" "00000010" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(1213c>t)" "p.(Arg405Trp)" "2"
"0000184133" "00000010" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(1213c>t)" "p.(Arg405Trp)" "2"
"0000184134" "00000010" "90" "125" "1" "125" "1" "c.125+1G>C" "r.spl?" "p.?" "1i"
"0000184135" "00000010" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(1213c>t)" "p.(Arg405Trp)" "2"
"0000184136" "00000010" "90" "125" "1" "125" "1" "c.125+1G>C" "r.spl?" "p.?" "1i"
"0000184137" "00000010" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(1213c>t)" "p.(Arg405Trp)" "2"
"0000184138" "00000010" "70" "565" "0" "565" "0" "c.565G>C" "r.(565g>c)" "p.(Gly189Arg)" "1"
"0000184139" "00000010" "90" "391" "0" "391" "0" "c.391A>C" "r.(391a>c)" "p.(Ser131Arg)" "1"
"0000184140" "00000010" "70" "883" "0" "883" "0" "c.883G>A" "r.(883g>a)" "p.(Glu295Lys)" "1"
"0000184141" "00000010" "90" "391" "0" "391" "0" "c.391A>C" "r.(391a>c)" "p.(Ser131Arg)" "1"
"0000184142" "00000010" "70" "883" "0" "883" "0" "c.883G>A" "r.(883g>a)" "p.(Glu295Lys)" "1"
"0000184143" "00000010" "90" "979" "0" "979" "0" "c.979C>T" "0" "p.(Arg327Trp)" "1"
"0000184144" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del966" "r.[461_677del, 461_790del]" "p.[Gly154Alafs*29, Val155_Gly264del]" "1"
"0000184145" "00000010" "70" "883" "0" "883" "0" "c.883G>A" "r.(883g>a)" "p.(Glu295Lys)" "1"
"0000184146" "00000010" "90" "565" "0" "565" "0" "c.565G>T" "r.565g>t" "p.(Gly189Trp)" "1"
"0000184147" "00000010" "70" "816" "0" "817" "0" "c.816_817del" "r.(?)" "p.fs" "1"
"0000184148" "00000010" "70" "816" "0" "817" "0" "c.816_817del" "r.(?)" "p.fs" "1"
"0000251041" "00000010" "10" "222" "0" "222" "0" "c.222T>C" "r.(?)" "p.(His74=)" ""
"0000264664" "00000010" "90" "1054" "0" "1054" "0" "c.1054C>T" "r.(?)" "p.(Gln352Ter)" ""
"0000264665" "00000010" "10" "174" "0" "174" "0" "c.174C>T" "r.(?)" "p.(Ala58=)" ""
"0000264666" "00000010" "10" "240" "0" "240" "0" "c.240G>A" "r.(?)" "p.(Thr80=)" ""
"0000264667" "00000010" "50" "242" "0" "242" "0" "c.242C>T" "r.(?)" "p.(Pro81Leu)" ""
"0000264668" "00000010" "30" "538" "0" "538" "0" "c.538G>A" "r.(?)" "p.(Val180Met)" ""
"0000264669" "00000010" "10" "771" "0" "771" "0" "c.771G>A" "r.(?)" "p.(Glu257=)" ""
"0000268135" "00000010" "10" "1210" "0" "1210" "0" "c.1210C>A" "r.(?)" "p.(His404Asn)" ""
"0000268136" "00000010" "10" "1211" "0" "1211" "0" "c.1211A>G" "r.(?)" "p.(His404Arg)" ""
"0000268137" "00000010" "30" "1230" "0" "1230" "0" "c.1230G>A" "r.(?)" "p.(Ala410=)" ""
"0000268138" "00000010" "50" "242" "0" "242" "0" "c.242C>T" "r.(?)" "p.(Pro81Leu)" ""
"0000268139" "00000010" "30" "677" "8" "677" "8" "c.677+8G>A" "r.(=)" "p.(=)" ""
"0000268140" "00000010" "30" "771" "0" "771" "0" "c.771G>A" "r.(?)" "p.(Glu257=)" ""
"0000268141" "00000010" "30" "831" "0" "831" "0" "c.831G>A" "r.(?)" "p.(Val277=)" ""
"0000268142" "00000010" "30" "963" "-16" "963" "-16" "c.963-16C>G" "r.(=)" "p.(=)" ""
"0000270280" "00000010" "10" "1057" "-1877" "1057" "-1877" "c.1057-1877C>T" "r.(=)" "p.(=)" ""
"0000270281" "00000010" "10" "1057" "-68" "1057" "-68" "c.1057-68G>A" "r.(=)" "p.(=)" ""
"0000270283" "00000010" "10" "223" "-8" "223" "-8" "c.223-8C>T" "r.(=)" "p.(=)" ""
"0000270284" "00000010" "10" "295" "-59" "295" "-59" "c.295-59G>A" "r.(=)" "p.(=)" ""
"0000270285" "00000010" "30" "677" "8" "677" "8" "c.677+8G>A" "r.(=)" "p.(=)" ""
"0000273605" "00000010" "10" "1211" "0" "1211" "0" "c.1211A>G" "r.(?)" "p.(His404Arg)" ""
"0000273606" "00000010" "30" "1230" "0" "1230" "0" "c.1230G>A" "r.(?)" "p.(Ala410=)" ""
"0000273607" "00000010" "30" "243" "0" "243" "0" "c.243G>A" "r.(?)" "p.(Pro81=)" ""
"0000273608" "00000010" "30" "771" "0" "771" "0" "c.771G>A" "r.(?)" "p.(Glu257=)" ""
"0000342836" "00000010" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000346468" "00000010" "10" "1211" "0" "1211" "0" "c.1211A>G" "r.(?)" "p.(His404Arg)" ""
"0000350293" "00000010" "90" "424" "0" "424" "0" "c.424del" "r.(?)" "p.(Val142LeufsTer39)" ""
"0000487551" "00000010" "70" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Arg89Gln)" "1"
"0000557736" "00000010" "30" "1210" "0" "1210" "0" "c.1210C>A" "r.(?)" "p.(His404Asn)" ""
"0000557737" "00000010" "90" "1054" "0" "1054" "0" "c.1054C>T" "r.(?)" "p.(Gln352Ter)" ""
"0000557738" "00000010" "30" "1022" "0" "1022" "0" "c.1022G>T" "r.(?)" "p.(Arg341Leu)" ""
"0000557739" "00000010" "50" "1017" "0" "1017" "0" "c.1017C>G" "r.(?)" "p.(Cys339Trp)" ""
"0000557740" "00000010" "90" "954" "0" "962" "18" "c.954_962+18del" "r.spl?" "p.?" ""
"0000557741" "00000010" "10" "831" "0" "831" "0" "c.831G>A" "r.(?)" "p.(Val277=)" ""
"0000557742" "00000010" "30" "831" "0" "831" "0" "c.831G>A" "r.(?)" "p.(Val277=)" ""
"0000557743" "00000010" "30" "777" "0" "777" "0" "c.777G>A" "r.(?)" "p.(Pro259=)" ""
"0000557744" "00000010" "30" "777" "0" "777" "0" "c.777G>A" "r.(?)" "p.(Pro259=)" ""
"0000557745" "00000010" "30" "777" "0" "777" "0" "c.777G>A" "r.(?)" "p.(Pro259=)" ""
"0000557746" "00000010" "10" "768" "0" "768" "0" "c.768C>T" "r.(?)" "p.(Thr256=)" ""
"0000557747" "00000010" "30" "677" "8" "677" "8" "c.677+8G>A" "r.(=)" "p.(=)" ""
"0000557748" "00000010" "30" "525" "0" "525" "0" "c.525C>G" "r.(?)" "p.(Phe175Leu)" ""
"0000557749" "00000010" "30" "516" "0" "516" "0" "c.516C>T" "r.(?)" "p.(Leu172=)" ""
"0000557750" "00000010" "30" "516" "0" "516" "0" "c.516C>T" "r.(?)" "p.(Leu172=)" ""
"0000557751" "00000010" "10" "327" "0" "327" "0" "c.327C>T" "r.(?)" "p.(Leu109=)" ""
"0000557752" "00000010" "50" "270" "0" "270" "0" "c.270T>C" "r.(?)" "p.(Phe90=)" ""
"0000557753" "00000010" "30" "270" "0" "270" "0" "c.270T>C" "r.(?)" "p.(Phe90=)" ""
"0000557754" "00000010" "30" "240" "0" "240" "0" "c.240G>A" "r.(?)" "p.(Thr80=)" ""
"0000557755" "00000010" "10" "238" "0" "238" "0" "c.238A>T" "r.(?)" "p.(Thr80Ser)" ""
"0000557756" "00000010" "30" "222" "0" "222" "0" "c.222T>C" "r.(?)" "p.(His74=)" ""
"0000557757" "00000010" "10" "45" "0" "45" "0" "c.45G>A" "r.(?)" "p.(Glu15=)" ""
"0000557758" "00000010" "30" "45" "0" "45" "0" "c.45G>A" "r.(?)" "p.(Glu15=)" ""
"0000557760" "00000010" "30" "-3558" "0" "-3558" "0" "c.-3558C>T" "r.(?)" "p.(=)" ""
"0000557763" "00000010" "30" "-4594" "0" "-4594" "0" "c.-4594C>T" "r.(?)" "p.(=)" ""
"0000615915" "00000010" "70" "969" "0" "969" "0" "c.969G>A" "r.(?)" "p.(Gln323=)" ""
"0000615916" "00000010" "30" "963" "-16" "963" "-16" "c.963-16C>T" "r.(=)" "p.(=)" ""
"0000615917" "00000010" "90" "413" "0" "413" "0" "c.413del" "r.(?)" "p.(Ser138ThrfsTer43)" ""
"0000615918" "00000010" "50" "392" "0" "392" "0" "c.392G>A" "r.(?)" "p.(Ser131Asn)" ""
"0000615919" "00000010" "30" "240" "0" "240" "0" "c.240G>A" "r.(?)" "p.(Thr80=)" ""
"0000615920" "00000010" "30" "206" "0" "206" "0" "c.206C>T" "r.(?)" "p.(Ser69Leu)" ""
"0000615921" "00000010" "30" "45" "0" "45" "0" "c.45G>A" "r.(?)" "p.(Glu15=)" ""
"0000623436" "00000010" "30" "222" "0" "222" "0" "c.222T>C" "r.(?)" "p.(His74=)" ""
"0000629318" "00000010" "90" "954" "0" "962" "18" "c.954_962+18del" "r.spl?" "p.?" ""
"0000629356" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.(Gly154Alafs*29)" ""
"0000649293" "00000010" "50" "790" "3" "790" "3" "c.790+3A>C" "r.spl?" "p.?" ""
"0000649294" "00000010" "30" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Ile105Val)" ""
"0000657811" "00000010" "30" "768" "0" "768" "0" "c.768C>T" "r.(?)" "p.(Thr256=)" ""
"0000657812" "00000010" "90" "391" "0" "392" "0" "c.391_392del" "r.(?)" "p.(Ser131TrpfsTer28)" ""
"0000680514" "00000010" "50" "1165" "0" "1165" "0" "c.1165T>A" "r.(?)" "p.(Tyr389Asn)" ""
"0000680515" "00000010" "50" "242" "0" "242" "0" "c.242C>T" "r.(?)" "p.(Pro81Leu)" ""
"0000683467" "00000010" "70" "-359" "0" "46" "0" "c.-359_46del" "r.?" "p.?" "1_2"
"0000683471" "00000010" "70" "-359" "0" "46" "0" "c.-359_46del" "r.?" "p.?" "1_2"
"0000683472" "00000010" "70" "482" "0" "482" "0" "c.482C>A" "r.(?)" "p.(Ser161*)" "8"
"0000683473" "00000010" "70" "678" "0" "790" "0" "c.678_790del" "r.(?)" "p.(Ser226Argfs*36)" "10"
"0000683474" "00000010" "70" "906" "2" "906" "2" "c.906+2T>A" "r.spl?" "p.?" "12i"
"0000683475" "00000010" "70" "906" "2" "906" "2" "c.906+2T>A" "r.spl?" "p.?" "12i"
"0000692036" "00000010" "50" "1017" "0" "1017" "0" "c.1017C>G" "r.(?)" "p.(Cys339Trp)" ""
"0000692037" "00000010" "50" "557" "0" "557" "0" "c.557C>T" "r.(?)" "p.(Ser186Leu)" ""
"0000710314" "00000010" "90" "266" "0" "266" "0" "c.266G>A" "r.(?)" "p.(Arg89Gln)" ""
"0000712145" "00000010" "50" "1127" "0" "1127" "0" "c.1127del" "r.(?)" "p.(Leu376Argfs*15)" "14"
"0000713317" "00000010" "90" "853" "0" "853" "0" "c.853A>G" "r.(?)" "p.(Ile285Val)" ""
"0000713462" "00000010" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000713549" "00000010" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000713621" "00000010" "90" "988" "0" "988" "0" "c.988G>A" "r.(?)" "p.(Val330Ile)" ""
"0000713633" "00000010" "90" "837" "5" "837" "5" "c.837+5G>A" "r.spl?" "p.?" ""
"0000713665" "00000010" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000725707" "00000010" "50" "734" "0" "736" "0" "c.734_736del" "r.(?)" "p.(Ala245del)" ""
"0000725708" "00000010" "50" "534" "0" "534" "0" "c.534G>C" "r.(?)" "p.(Arg178Ser)" ""
"0000725709" "00000010" "30" "414" "0" "414" "0" "c.414C>T" "r.(?)" "p.(Ser138=)" ""
"0000725710" "00000010" "30" "168" "0" "168" "0" "c.168G>A" "r.(?)" "p.(Leu56=)" ""
"0000725711" "00000010" "70" "163" "0" "163" "0" "c.163A>T" "r.(?)" "p.(Met55Leu)" ""
"0000730984" "00000010" "70" "597" "0" "597" "0" "c.597C>A" "r.(?)" "p.(Tyr199*)" ""
"0000730985" "00000010" "70" "883" "0" "883" "0" "c.883G>A" "r.(?)" "p.(Glu295Lys)" ""
"0000731056" "00000010" "50" "1189" "0" "1189" "0" "c.1189G>A" "r.(?)" "p.(Ala397Thr)" ""
"0000731428" "00000010" "70" "560" "0" "561" "0" "c.560_561del" "r.(?)" "p.(Gly187Aspfs*48)" ""
"0000731452" "00000010" "70" "461" "-1" "461" "-1" "c.461-1G>C" "r.spl" "p.?" ""
"0000733049" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.?" "p.?" ""
"0000733326" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.?" "p.?" ""
"0000733327" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.?" "p.?" ""
"0000733328" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.?" "p.?" ""
"0000733329" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.?" "p.?" ""
"0000733519" "00000010" "70" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000733711" "00000010" "70" "303" "0" "305" "0" "c.303_305del" "r.(?)" "p.(Leu102del)" ""
"0000735603" "00000010" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000735604" "00000010" "90" "375" "-1" "533" "1" "c.(374+1_375-1)_(533+1_534-1)del" "r.?" "p.?" ""
"0000735726" "00000010" "90" "375" "0" "375" "0" "c.375del" "r.(?)" "p.(Arg127Glyfs*54)" ""
"0000764904" "00000010" "70" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000787086" "00000010" "90" "791" "-1" "1056" "1" "c.(790+1_791-1)_(1056+1_1057- 1)del" "r.?" "p.?" "10i_14i"
"0000788389" "00000010" "50" "482" "0" "482" "0" "c.482C>T" "r.(?)" "p.(Ser161Leu)" "8"
"0000789863" "00000010" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000789864" "00000010" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" ""
"0000796271" "00000010" "90" "597" "0" "597" "0" "c.597C>A" "r.?" "p.(Tyr199*)" "1"
"0000807322" "00000010" "30" "831" "0" "831" "0" "c.831G>A" "r.(?)" "p.(Val277=)" ""
"0000807323" "00000010" "30" "387" "0" "387" "0" "c.387C>T" "r.(?)" "p.(Leu129=)" ""
"0000807324" "00000010" "30" "318" "0" "318" "0" "c.318C>T" "r.(?)" "p.(Leu106=)" ""
"0000811469" "00000010" "70" "0" "0" "0" "0" "c.?" "r.spl" "p.(?)" ""
"0000812181" "00000010" "70" "375" "-1" "533" "1" "c.(374+1_375-1)_(533+1_534-1)del" "r.(?)" "p.(?)" "_7_8_"
"0000812260" "00000010" "70" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" "16"
"0000812876" "00000010" "70" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" ""
"0000812877" "00000010" "70" "883" "0" "883" "0" "c.883G>T" "r.(?)" "p.(Glu295*)" ""
"0000812878" "00000010" "70" "883" "0" "883" "0" "c.883G>T" "r.(?)" "p.(Glu295*)" ""
"0000812879" "00000010" "70" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" ""
"0000812880" "00000010" "70" "963" "0" "963" "0" "c.963G>A" "r.(?)" "p.(Trp321*)" ""
"0000812881" "00000010" "70" "1001" "0" "1001" "0" "c.1001G>A" "r.(?)" "p.(Arg334His)" ""
"0000812882" "00000010" "70" "1001" "0" "1001" "0" "c.1001G>A" "r.(?)" "p.(Arg334His)" ""
"0000812906" "00000010" "70" "917" "0" "917" "0" "c.917T>A" "r.(?)" "p.(Leu306His)" ""
"0000812907" "00000010" "70" "917" "0" "917" "0" "c.917T>A" "r.(?)" "p.(Leu306His)" ""
"0000816064" "00000010" "70" "461" "-273" "677" "257" "c.461-273_677+257del" "r.spl" "p.(?)" ""
"0000816207" "00000010" "70" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000816398" "00000010" "50" "206" "0" "206" "0" "c.206C>T" "r.(?)" "p.(Ser69Leu)" ""
"0000816506" "00000010" "90" "683" "0" "683" "0" "c.683dup" "r.(?)" "p.(Leu230Valfs*6)" ""
"0000817734" "00000010" "90" "533" "1" "533" "1" "c.533+1del" "r.spl" "p.?" ""
"0000818971" "00000010" "70" "461" "-1" "677" "1" "c.(460+1_461-1)_(677+1_678-1)del" "r.?" "p.?" "7i_9i"
"0000820033" "00000010" "70" "1197" "2" "1197" "2" "c.1197+2T>A" "r.spl" "p.(?)" ""
"0000820128" "00000010" "70" "370" "0" "370" "0" "c.370del" "r.(?)" "p.(Tyr124Thrfs*57)" ""
"0000820129" "00000010" "70" "370" "0" "370" "0" "c.370del" "r.(?)" "p.(Tyr124Thrfs*57)" ""
"0000820790" "00000010" "70" "922" "0" "923" "0" "c.922_923del" "r.(?)" "p.(Phe308Leufs*73)" ""
"0000820819" "00000010" "70" "676" "0" "676" "0" "c.676A>G" "r.(?)" "p.(Ser226Gly)" ""
"0000820820" "00000010" "70" "676" "0" "676" "0" "c.676A>G" "r.(?)" "p.(Ser226Gly)" ""
"0000820998" "00000010" "70" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" ""
"0000821205" "00000010" "70" "853" "0" "853" "0" "c.853A>G" "r.(?)" "p.(Ile285Val)" ""
"0000821206" "00000010" "70" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000821207" "00000010" "70" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000821208" "00000010" "70" "988" "0" "988" "0" "c.988G>A" "r.(?)" "p.(Val330Ile)" ""
"0000821209" "00000010" "70" "837" "5" "837" "5" "c.837+5G>A" "r.spl?" "p.(?)" ""
"0000821210" "00000010" "70" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000821535" "00000010" "70" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" ""
"0000826995" "00000010" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.(?)" ""
"0000826996" "00000010" "90" "944" "0" "944" "0" "c.944dupA" "r.(?)" "p.(His315Glnfs*67)" ""
"0000829990" "00000010" "50" "1007" "0" "1007" "0" "c.1007C>A" "r.(?)" "p.(Ser336Tyr)" "1"
"0000839360" "00000010" "90" "461" "-53" "677" "51" "c.(460+1_461-53)_(677+51_678-1)del" "r.?" "p.(Gly154Alafs*29)" "7i_9i"
"0000846895" "00000010" "70" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" ""
"0000846896" "00000010" "70" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" ""
"0000854456" "00000010" "30" "1119" "0" "1119" "0" "c.1119C>T" "r.(?)" "p.(Leu373=)" ""
"0000854457" "00000010" "50" "782" "0" "782" "0" "c.782C>T" "r.(?)" "p.(Ser261Leu)" ""
"0000854458" "00000010" "50" "176" "0" "176" "0" "c.176C>T" "r.(?)" "p.(Ala59Val)" ""
"0000868537" "00000010" "90" "944" "0" "944" "0" "c.944dup" "r.(?)" "p.(His315Glnfs*67)" ""
"0000868538" "00000010" "90" "1045" "0" "1050" "0" "c.1045_1050del" "r.(?)" "p.(Ala349_Leu350del)" ""
"0000868543" "00000010" "70" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000868544" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.?" ""
"0000868545" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.?" ""
"0000868546" "00000010" "70" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000868547" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.?" ""
"0000868548" "00000010" "70" "883" "0" "883" "0" "c.883G>T" "r.(?)" "p.(Glu295Ter)" ""
"0000868549" "00000010" "70" "883" "0" "883" "0" "c.883G>T" "r.(?)" "p.(Glu295Ter)" ""
"0000868550" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.?" ""
"0000868551" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.?" ""
"0000868552" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.?" ""
"0000868553" "00000010" "70" "988" "0" "988" "0" "c.988G>A" "r.(?)" "p.(Val330Ile)" ""
"0000868554" "00000010" "70" "837" "5" "837" "5" "c.837+5G>A" "r.(?)" "p.?" ""
"0000868555" "00000010" "70" "461" "-3" "461" "-3" "c.461-3C>G" "r.(?)" "p.?" ""
"0000868556" "00000010" "70" "917" "0" "917" "0" "c.917T>A" "r.(?)" "p.(Leu306His)" ""
"0000868557" "00000010" "70" "917" "0" "917" "0" "c.917T>A" "r.(?)" "p.(Leu306His)" ""
"0000868558" "00000010" "70" "853" "0" "853" "0" "c.853A>G" "r.(?)" "p.(Ile285Val)" ""
"0000868559" "00000010" "70" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" ""
"0000868560" "00000010" "70" "375" "-3" "375" "-3" "c.375-3C>G" "r.(?)" "p.?" ""
"0000868566" "00000010" "70" "175" "0" "175" "0" "c.175G>A" "r.(?)" "p.(Ala59Thr)" ""
"0000868567" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.(?)" "p.?" ""
"0000868568" "00000010" "70" "181" "0" "183" "0" "c.181_183del" "r.(?)" "p.(Asp61del)" ""
"0000868569" "00000010" "70" "181" "0" "183" "0" "c.181_183del" "r.(?)" "p.(Asp61del)" ""
"0000868570" "00000010" "70" "181" "0" "183" "0" "c.181_183del" "r.(?)" "p.(Asp61del)" ""
"0000868571" "00000010" "70" "181" "0" "183" "0" "c.181_183del" "r.(?)" "p.(Asp61del)" ""
"0000915942" "00000010" "90" "175" "0" "175" "0" "c.175G>A" "r.(?)" "p.(Ala59Thr)" "1"
"0000915943" "00000010" "50" "907" "-15" "907" "-15" "c.907-15T>A" "r.spl?" "p.(?)" "1"
"0000916283" "00000010" "90" "461" "-1" "677" "1" "c.(460+1_461-1)_(677+1_678-1)del" "r.?" "p.(Gly154Alafs*29)" ""
"0000916382" "00000010" "50" "375" "-1" "533" "1" "c.(374+1_375-1)_(533+1_534-1)del" "r.?" "p.(Ser125_Pro177del)" ""
"0000916383" "00000010" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" "2"
"0000916463" "00000010" "90" "1213" "0" "1213" "0" "c.1213C>T" "r.(?)" "p.(Arg405Trp)" "2"
"0000916472" "00000010" "90" "175" "0" "175" "0" "c.175G>A" "r.(?)" "p.(Ala59Thr)" "1"
"0000916473" "00000010" "90" "461" "-1" "677" "1" "c.(460+1_461-1)_(677+1_678-1)del" "r.?" "p.(Gly154Alafs*29)" ""
"0000916740" "00000010" "70" "962" "2" "962" "2" "c.962+2dup" "r.spl?" "p.(?)" "1i"
"0000933337" "00000010" "90" "944" "0" "944" "0" "c.944dup" "r.(?)" "p.(His315Glnfs*67)" "13"
"0000933338" "00000010" "70" "1305" "0" "1305" "0" "c.1305C>G" "r.(?)" "p.(Cys435Trp)" "16"
"0000933351" "00000010" "90" "1" "0" "1" "0" "c.1A>G" "r.(?)" "p.?" ""
"0000933352" "00000010" "70" "464" "0" "464" "0" "c.464T>G" "r.(?)" "p.(Val155Gly)" ""
"0000936425" "00000010" "50" "1271" "0" "1271" "0" "c.1271G>A" "r.(?)" "p.(Gly424Glu)" ""
"0000939874" "00000010" "90" "883" "0" "883" "0" "c.883G>A" "r.(?)" "p.(Glu295Lys)" "11"
"0000939904" "00000010" "90" "460" "376" "677" "388" "c.(?_460+376)_(677+388_?)del" "r.?" "p.?" ""
"0000958117" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.?" "p.?" ""
"0000958182" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.?" "p.?" ""
"0000958251" "00000010" "70" "461" "-280" "677" "382" "c.461-280_677+382del" "r.?" "p.?" ""
"0000968307" "00000010" "30" "1230" "0" "1230" "0" "c.1230G>A" "r.(?)" "p.(Ala410=)" ""
"0000981817" "00000010" "90" "1054" "0" "1054" "0" "c.1054C>T" "r.(?)" "p.(Gln352Ter)" ""
"0000986360" "00000010" "90" "" "0" "" "0" "c.(460+1_461-1)_(677+1_678-1))del" "r.?" "p.(Val155Glyfs*3)" "7i_9i"
"0000986361" "00000010" "50" "1028" "0" "1028" "0" "c.1028G>A" "r.(?)" "p.(Arg343His)" "11"
"0000986362" "00000010" "70" "678" "-1" "790" "1" "c.(677+1_678-1)_(790+1_791-1)del" "r.?" "p.(Ser226Argfs*36)" "9i_10i"
"0000986363" "00000010" "90" "597" "0" "597" "0" "c.597C>A" "r.(?)" "p.(Tyr199Ter)" "9"
"0000986897" "00000010" "70" "866" "0" "866" "0" "c.866T>C" "r.(?)" "p.(Val289Ala)" "9"
"0000987005" "00000010" "90" "" "0" "" "0" "c.(460+1_461-1)_(677+1_678-1))del" "r.?" "p.(Val155Glyfs*3)" ""
"0000987006" "00000010" "90" "" "0" "" "0" "c.(460+1_461-1)_(677+1_678-1))del" "r.?" "p.(Val155Glyfs*3)" ""
"0000987238" "00000010" "90" "175" "0" "175" "0" "c.175G>A" "r.(?)" "p.(Ala59Thr)" ""
"0000987303" "00000010" "90" "" "0" "" "0" "c.(460+1_461-1)_(677+1_678-1))del" "r.?" "p.(Val155Glyfs*3)" ""
"0000987340" "00000010" "90" "" "0" "" "0" "c.(460+1_461-1)_(677+1_678-1))del" "r.?" "p.(Val155Glyfs*3)" ""
"0001002178" "00000010" "50" "-5146" "0" "-5146" "0" "c.-5146G>T" "r.(?)" "p.(=)" ""
"0001002179" "00000010" "50" "-5988" "0" "-5988" "0" "c.-5988C>T" "r.(?)" "p.(=)" ""
"0001012389" "00000010" "90" "461" "-280" "677" "382" "c.461-280_677+382del" "r.spl" "p.[(Gly154AlafsTer29,Val155_Gly264del)]" ""
"0001012391" "00000010" "90" "371" "0" "372" "0" "c.371_372insT" "r.(?)" "p.(Ser125GlnfsTer35)" ""
"0001012426" "00000010" "50" "995" "0" "995" "0" "c.995C>T" "r.(?)" "p.(Ala332Val)" ""
"0001012431" "00000010" "50" "995" "0" "995" "0" "c.995C>T" "r.(?)" "p.(Ala332Val)" ""
"0001019646" "00000010" "90" "1168" "0" "1168" "0" "c.1168G>A" "r.(?)" "p.(Val390Met)" ""
"0001019647" "00000010" "90" "461" "-279" "677" "384" "c.461-279_677+384del" "r.(461_677del)" "p.(Gly154Alafs*29)" "7i_9i"
"0001019648" "00000010" "90" "677" "883" "791" "-328" "c.677+883_791-328del" "r.(678_790del)" "p.(Ser226Argfs*36)" "6i_7i"
"0001041014" "00000010" "50" "958" "0" "958" "0" "c.958C>T" "r.(?)" "p.(Arg320Cys)" ""
"0001041015" "00000010" "30" "771" "0" "771" "0" "c.771G>A" "r.(?)" "p.(Glu257=)" ""
"0001041016" "00000010" "30" "270" "0" "270" "0" "c.270T>C" "r.(?)" "p.(Phe90=)" ""
"0001049537" "00000010" "90" "295" "-2" "295" "-2" "c.295-2A>C" "r.spl" "p.?" ""
"0001049664" "00000010" "70" "178" "0" "180" "0" "c.178_180delins182_200" "r.(?)" "p.(His60ThrfsTer10)" ""
"0001055501" "00000010" "30" "47" "-3" "47" "-3" "c.47-3C>T" "r.spl?" "p.?" ""
"0001055502" "00000010" "50" "-4960" "0" "-4960" "0" "c.-4960G>C" "r.(?)" "p.(=)" ""
"0001055503" "00000010" "50" "-6000" "0" "-6000" "0" "c.-6000T>A" "r.(?)" "p.(=)" ""
"0001058551" "00000010" "70" "1256" "0" "1256" "0" "c.1256G>A" "r.(?)" "p.(Gly419Glu)" ""
"0001059384" "00000010" "90" "533" "0" "677" "1" "c.(461_533)_(677+1_678-1)del" "r.?" "p.?" "8_9i"
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 662
"{{screeningid}}" "{{variantid}}"
"0000000009" "0000000603"
"0000000009" "0000000606"
"0000000010" "0000000602"
"0000000010" "0000000604"
"0000000028" "0000000601"
"0000000028" "0000000608"
"0000000062" "0000000607"
"0000000062" "0000000609"
"0000000102" "0000868567"
"0000000107" "0000000605"
"0000000107" "0000000610"
"0000001630" "0000019547"
"0000001630" "0000019548"
"0000050403" "0000079383"
"0000050628" "0000079608"
"0000114315" "0000183645"
"0000114316" "0000183646"
"0000114317" "0000183647"
"0000114318" "0000183648"
"0000114319" "0000183649"
"0000114320" "0000183650"
"0000114321" "0000183651"
"0000114322" "0000183652"
"0000114323" "0000183653"
"0000114324" "0000183654"
"0000114325" "0000183655"
"0000114326" "0000183656"
"0000114327" "0000183657"
"0000114328" "0000183658"
"0000114329" "0000183659"
"0000114330" "0000183660"
"0000114331" "0000183661"
"0000114332" "0000183662"
"0000114333" "0000183663"
"0000114334" "0000183664"
"0000114335" "0000183665"
"0000114336" "0000183666"
"0000114337" "0000183667"
"0000114338" "0000183668"
"0000114339" "0000183669"
"0000114340" "0000183670"
"0000114341" "0000183671"
"0000114342" "0000183672"
"0000114343" "0000183673"
"0000114344" "0000183674"
"0000114345" "0000183675"
"0000114346" "0000183676"
"0000114347" "0000183677"
"0000114348" "0000183678"
"0000114349" "0000183679"
"0000114350" "0000183680"
"0000114351" "0000183681"
"0000114352" "0000183682"
"0000114353" "0000183683"
"0000114354" "0000183684"
"0000114355" "0000183685"
"0000114356" "0000183686"
"0000114357" "0000183687"
"0000114358" "0000183688"
"0000114359" "0000183689"
"0000114360" "0000183690"
"0000114361" "0000183691"
"0000114362" "0000183692"
"0000114363" "0000183693"
"0000114364" "0000183694"
"0000114365" "0000183695"
"0000114366" "0000183696"
"0000114367" "0000183697"
"0000114368" "0000183698"
"0000114369" "0000183699"
"0000114370" "0000183700"
"0000114371" "0000183701"
"0000114372" "0000183702"
"0000114373" "0000183703"
"0000114374" "0000183704"
"0000114375" "0000183705"
"0000114376" "0000183706"
"0000114377" "0000183707"
"0000114378" "0000183708"
"0000114379" "0000183709"
"0000114380" "0000183710"
"0000114381" "0000183711"
"0000114382" "0000183712"
"0000114383" "0000183713"
"0000114384" "0000183714"
"0000114385" "0000183715"
"0000114386" "0000183716"
"0000114387" "0000183717"
"0000114388" "0000183718"
"0000114389" "0000183719"
"0000114390" "0000183720"
"0000114391" "0000183721"
"0000114392" "0000183722"
"0000114393" "0000183723"
"0000114394" "0000183724"
"0000114395" "0000183725"
"0000114396" "0000183726"
"0000114397" "0000183727"
"0000114398" "0000183728"
"0000114399" "0000183729"
"0000114400" "0000183730"
"0000114401" "0000183731"
"0000114402" "0000183732"
"0000114403" "0000183733"
"0000114404" "0000183734"
"0000114405" "0000183735"
"0000114406" "0000183736"
"0000114407" "0000183737"
"0000114408" "0000183738"
"0000114409" "0000183739"
"0000114410" "0000183740"
"0000114411" "0000183741"
"0000114412" "0000183742"
"0000114413" "0000183743"
"0000114414" "0000183744"
"0000114415" "0000183745"
"0000114416" "0000183746"
"0000114417" "0000183747"
"0000114418" "0000183748"
"0000114419" "0000183749"
"0000114420" "0000183750"
"0000114421" "0000183751"
"0000114422" "0000183752"
"0000114423" "0000183753"
"0000114424" "0000183754"
"0000114425" "0000183755"
"0000114426" "0000183756"
"0000114427" "0000183757"
"0000114428" "0000183758"
"0000114429" "0000183759"
"0000114430" "0000183760"
"0000114431" "0000183761"
"0000114432" "0000183762"
"0000114433" "0000183763"
"0000114434" "0000183764"
"0000114435" "0000183765"
"0000114436" "0000183766"
"0000114437" "0000183767"
"0000114438" "0000183768"
"0000114439" "0000183769"
"0000114440" "0000183770"
"0000114441" "0000183771"
"0000114442" "0000183772"
"0000114443" "0000183773"
"0000114444" "0000183774"
"0000114445" "0000183775"
"0000114446" "0000183776"
"0000114447" "0000183777"
"0000114448" "0000183778"
"0000114449" "0000183779"
"0000114450" "0000183780"
"0000114451" "0000183781"
"0000114452" "0000183782"
"0000114453" "0000183783"
"0000114454" "0000183784"
"0000114455" "0000183785"
"0000114456" "0000183786"
"0000114457" "0000183787"
"0000114458" "0000183788"
"0000114459" "0000183789"
"0000114460" "0000183790"
"0000114461" "0000183791"
"0000114462" "0000183792"
"0000114463" "0000183793"
"0000114464" "0000183794"
"0000114465" "0000183795"
"0000114466" "0000183796"
"0000114467" "0000183797"
"0000114468" "0000183798"
"0000114469" "0000183799"
"0000114470" "0000183800"
"0000114471" "0000183801"
"0000114472" "0000183802"
"0000114473" "0000183803"
"0000114474" "0000183804"
"0000114475" "0000183805"
"0000114476" "0000183806"
"0000114477" "0000183807"
"0000114478" "0000183808"
"0000114479" "0000183809"
"0000114480" "0000183810"
"0000114481" "0000183811"
"0000114482" "0000183812"
"0000114483" "0000183813"
"0000114484" "0000183814"
"0000114485" "0000183815"
"0000114486" "0000183816"
"0000114487" "0000183817"
"0000114488" "0000183818"
"0000114489" "0000183819"
"0000114490" "0000183820"
"0000114491" "0000183821"
"0000114492" "0000183822"
"0000114493" "0000183823"
"0000114494" "0000183824"
"0000114495" "0000183825"
"0000114496" "0000183826"
"0000114497" "0000183827"
"0000114498" "0000183828"
"0000114499" "0000183829"
"0000114500" "0000183830"
"0000114501" "0000183831"
"0000114502" "0000183832"
"0000114503" "0000183833"
"0000114504" "0000183834"
"0000114505" "0000183835"
"0000114506" "0000183836"
"0000114507" "0000183837"
"0000114508" "0000183838"
"0000114509" "0000183839"
"0000114510" "0000183840"
"0000114511" "0000183841"
"0000114512" "0000183842"
"0000114513" "0000183843"
"0000114514" "0000183844"
"0000114515" "0000183845"
"0000114516" "0000183846"
"0000114517" "0000183847"
"0000114518" "0000183848"
"0000114519" "0000183849"
"0000114520" "0000183850"
"0000114521" "0000183851"
"0000114522" "0000183852"
"0000114523" "0000183853"
"0000114524" "0000183854"
"0000114525" "0000183855"
"0000114526" "0000183856"
"0000114527" "0000183857"
"0000114528" "0000183858"
"0000114529" "0000183859"
"0000114530" "0000183860"
"0000114531" "0000183861"
"0000114532" "0000183862"
"0000114533" "0000183863"
"0000114534" "0000183864"
"0000114535" "0000183865"
"0000114536" "0000183866"
"0000114537" "0000183867"
"0000114538" "0000183868"
"0000114539" "0000183869"
"0000114540" "0000183870"
"0000114541" "0000183871"
"0000114542" "0000183872"
"0000114543" "0000183873"
"0000114544" "0000183874"
"0000114545" "0000183875"
"0000114546" "0000183876"
"0000114547" "0000183877"
"0000114548" "0000183878"
"0000114549" "0000183879"
"0000114550" "0000183880"
"0000114551" "0000183881"
"0000114552" "0000183882"
"0000114553" "0000183883"
"0000114554" "0000183884"
"0000114555" "0000183885"
"0000114556" "0000183886"
"0000114557" "0000183887"
"0000114558" "0000183888"
"0000114559" "0000183889"
"0000114560" "0000183890"
"0000114561" "0000183891"
"0000114562" "0000183892"
"0000114563" "0000183893"
"0000114564" "0000183894"
"0000114565" "0000183895"
"0000114566" "0000183896"
"0000114567" "0000183897"
"0000114568" "0000183898"
"0000114569" "0000183899"
"0000114570" "0000183900"
"0000114571" "0000183901"
"0000114572" "0000183902"
"0000114573" "0000183903"
"0000114574" "0000183904"
"0000114575" "0000183905"
"0000114576" "0000183906"
"0000114577" "0000183907"
"0000114578" "0000183908"
"0000114579" "0000183909"
"0000114580" "0000183910"
"0000114581" "0000183911"
"0000114582" "0000183912"
"0000114583" "0000183913"
"0000114584" "0000183914"
"0000114585" "0000183915"
"0000114586" "0000183916"
"0000114587" "0000183917"
"0000114588" "0000183918"
"0000114589" "0000183919"
"0000114590" "0000183920"
"0000114591" "0000183921"
"0000114592" "0000183922"
"0000114593" "0000183923"
"0000114594" "0000183924"
"0000114595" "0000183925"
"0000114596" "0000183926"
"0000114597" "0000183927"
"0000114598" "0000183928"
"0000114599" "0000183929"
"0000114600" "0000183930"
"0000114601" "0000183931"
"0000114602" "0000183932"
"0000114603" "0000183933"
"0000114604" "0000183934"
"0000114605" "0000183935"
"0000114606" "0000183936"
"0000114607" "0000183937"
"0000114608" "0000183938"
"0000114609" "0000183939"
"0000114610" "0000183940"
"0000114611" "0000183941"
"0000114612" "0000183942"
"0000114613" "0000183943"
"0000114614" "0000183944"
"0000114615" "0000183945"
"0000114616" "0000183946"
"0000114617" "0000183947"
"0000114618" "0000183948"
"0000114619" "0000183949"
"0000114620" "0000183950"
"0000114621" "0000183951"
"0000114622" "0000183952"
"0000114623" "0000183953"
"0000114624" "0000183954"
"0000114625" "0000183955"
"0000114626" "0000183956"
"0000114627" "0000183957"
"0000114628" "0000183958"
"0000114629" "0000183959"
"0000114630" "0000183960"
"0000114631" "0000183961"
"0000114632" "0000183962"
"0000114633" "0000183963"
"0000114634" "0000183964"
"0000114635" "0000183965"
"0000114636" "0000183966"
"0000114637" "0000183967"
"0000114638" "0000183968"
"0000114639" "0000183969"
"0000114640" "0000183970"
"0000114641" "0000183971"
"0000114642" "0000183972"
"0000114643" "0000183973"
"0000114644" "0000183974"
"0000114645" "0000183975"
"0000114646" "0000183976"
"0000114647" "0000183977"
"0000114648" "0000183978"
"0000114649" "0000183979"
"0000114650" "0000183980"
"0000114651" "0000183981"
"0000114652" "0000183982"
"0000114653" "0000183983"
"0000114654" "0000183984"
"0000114655" "0000183985"
"0000114656" "0000183986"
"0000114657" "0000183987"
"0000114658" "0000183988"
"0000114659" "0000183989"
"0000114660" "0000183990"
"0000114661" "0000183991"
"0000114662" "0000183992"
"0000114663" "0000183993"
"0000114664" "0000183994"
"0000114665" "0000183995"
"0000114666" "0000183996"
"0000114667" "0000183997"
"0000114668" "0000183998"
"0000114669" "0000183999"
"0000114670" "0000184000"
"0000114671" "0000184001"
"0000114672" "0000184002"
"0000114673" "0000184003"
"0000114674" "0000184004"
"0000114675" "0000184005"
"0000114676" "0000184006"
"0000114677" "0000184007"
"0000114678" "0000184008"
"0000114679" "0000184009"
"0000114680" "0000184010"
"0000114681" "0000184011"
"0000114682" "0000184012"
"0000114683" "0000184013"
"0000114684" "0000184014"
"0000114685" "0000184015"
"0000114686" "0000184016"
"0000114687" "0000184017"
"0000114688" "0000184018"
"0000114689" "0000184019"
"0000114690" "0000184020"
"0000114691" "0000184021"
"0000114692" "0000184022"
"0000114693" "0000184023"
"0000114694" "0000184024"
"0000114695" "0000184025"
"0000114696" "0000184026"
"0000114697" "0000184027"
"0000114698" "0000184028"
"0000114699" "0000184029"
"0000114700" "0000184030"
"0000114701" "0000184031"
"0000114702" "0000184032"
"0000114703" "0000184033"
"0000114704" "0000184034"
"0000114705" "0000184035"
"0000114706" "0000184036"
"0000114707" "0000184037"
"0000114708" "0000184038"
"0000114709" "0000184039"
"0000114710" "0000184040"
"0000114711" "0000184041"
"0000114712" "0000184042"
"0000114713" "0000184043"
"0000114714" "0000184044"
"0000114715" "0000184045"
"0000114716" "0000184046"
"0000114717" "0000184047"
"0000114718" "0000184048"
"0000114719" "0000184049"
"0000114720" "0000184050"
"0000114721" "0000184051"
"0000114722" "0000184052"
"0000114723" "0000184053"
"0000114724" "0000184054"
"0000114725" "0000184055"
"0000114726" "0000184056"
"0000114727" "0000184057"
"0000114728" "0000184058"
"0000114729" "0000184059"
"0000114730" "0000184060"
"0000114731" "0000184061"
"0000114732" "0000184062"
"0000114733" "0000184063"
"0000114734" "0000184064"
"0000114735" "0000184065"
"0000114736" "0000184066"
"0000114737" "0000184067"
"0000114738" "0000184068"
"0000114739" "0000184069"
"0000114740" "0000184070"
"0000114741" "0000184071"
"0000114742" "0000184072"
"0000114743" "0000184073"
"0000114744" "0000184074"
"0000114745" "0000184075"
"0000114746" "0000184076"
"0000114747" "0000184077"
"0000114748" "0000184078"
"0000114749" "0000184079"
"0000114750" "0000184080"
"0000114751" "0000184081"
"0000114752" "0000184082"
"0000114753" "0000184083"
"0000114754" "0000184084"
"0000114755" "0000184085"
"0000114756" "0000184086"
"0000114757" "0000184087"
"0000114758" "0000184088"
"0000114759" "0000184089"
"0000114760" "0000184090"
"0000114761" "0000184091"
"0000114762" "0000184092"
"0000114763" "0000184093"
"0000114764" "0000184094"
"0000114765" "0000184095"
"0000114766" "0000184096"
"0000114767" "0000184097"
"0000114768" "0000184098"
"0000114769" "0000184099"
"0000114770" "0000184100"
"0000114771" "0000184101"
"0000114772" "0000184102"
"0000114773" "0000184103"
"0000114774" "0000184104"
"0000114775" "0000184105"
"0000114776" "0000184106"
"0000114777" "0000184107"
"0000114778" "0000184108"
"0000114779" "0000184109"
"0000114780" "0000184110"
"0000114781" "0000184111"
"0000114782" "0000184112"
"0000114783" "0000184113"
"0000114784" "0000184114"
"0000114785" "0000184115"
"0000114786" "0000184116"
"0000114787" "0000184117"
"0000114788" "0000184118"
"0000114789" "0000184119"
"0000114790" "0000184120"
"0000114791" "0000184121"
"0000114792" "0000184122"
"0000114793" "0000184123"
"0000114794" "0000184124"
"0000114795" "0000184125"
"0000114796" "0000184126"
"0000114797" "0000184127"
"0000114798" "0000184128"
"0000114799" "0000184129"
"0000114800" "0000184130"
"0000114801" "0000184131"
"0000114802" "0000184132"
"0000114803" "0000184133"
"0000114804" "0000184134"
"0000114805" "0000184135"
"0000114806" "0000184136"
"0000114807" "0000184137"
"0000114808" "0000184138"
"0000114809" "0000184139"
"0000114810" "0000184140"
"0000114811" "0000184141"
"0000114812" "0000184142"
"0000114813" "0000184143"
"0000114814" "0000184144"
"0000114815" "0000184145"
"0000114816" "0000184146"
"0000114817" "0000184147"
"0000114818" "0000184148"
"0000241541" "0000487551"
"0000275354" "0000629318"
"0000275354" "0000629356"
"0000292604" "0000649293"
"0000292605" "0000649294"
"0000309021" "0000683467"
"0000309025" "0000683471"
"0000309026" "0000683472"
"0000309027" "0000683473"
"0000309028" "0000683474"
"0000309029" "0000683475"
"0000326722" "0000710314"
"0000328208" "0000712145"
"0000329194" "0000713317"
"0000329339" "0000713462"
"0000329426" "0000713549"
"0000329498" "0000713621"
"0000329510" "0000713633"
"0000329542" "0000713665"
"0000333410" "0000730984"
"0000333411" "0000730985"
"0000333420" "0000731056"
"0000333679" "0000731428"
"0000333679" "0000731452"
"0000335040" "0000733049"
"0000335040" "0000733519"
"0000335317" "0000733326"
"0000335318" "0000733327"
"0000335319" "0000733328"
"0000335320" "0000733329"
"0000335320" "0000733711"
"0000336328" "0000735603"
"0000336329" "0000735604"
"0000336329" "0000735726"
"0000364142" "0000764904"
"0000375735" "0000787086"
"0000376611" "0000788389"
"0000377503" "0000789863"
"0000377504" "0000789864"
"0000382447" "0000796271"
"0000384704" "0000811469"
"0000385240" "0000812181"
"0000385288" "0000812260"
"0000385758" "0000812876"
"0000385759" "0000812877"
"0000385759" "0000812906"
"0000385760" "0000812878"
"0000385760" "0000812907"
"0000385761" "0000812879"
"0000385762" "0000812880"
"0000385763" "0000812881"
"0000385764" "0000812882"
"0000387906" "0000816064"
"0000387906" "0000816398"
"0000388049" "0000816207"
"0000388049" "0000816506"
"0000388941" "0000817734"
"0000389737" "0000818971"
"0000390688" "0000820033"
"0000390688" "0000820790"
"0000390783" "0000820128"
"0000390783" "0000820819"
"0000390784" "0000820129"
"0000390784" "0000820820"
"0000391266" "0000820998"
"0000391456" "0000821205"
"0000391457" "0000821206"
"0000391457" "0000821535"
"0000391458" "0000821207"
"0000391459" "0000821208"
"0000391460" "0000821209"
"0000391461" "0000821210"
"0000395607" "0000826995"
"0000395607" "0000826996"
"0000397843" "0000829990"
"0000403798" "0000839360"
"0000409691" "0000846895"
"0000409692" "0000846896"
"0000411428" "0000868537"
"0000411428" "0000868538"
"0000411431" "0000868543"
"0000411432" "0000868544"
"0000411432" "0000868553"
"0000411433" "0000868545"
"0000411433" "0000868554"
"0000411434" "0000868546"
"0000411435" "0000868547"
"0000411435" "0000868555"
"0000411436" "0000868548"
"0000411436" "0000868556"
"0000411437" "0000868549"
"0000411437" "0000868557"
"0000411438" "0000868550"
"0000411438" "0000868558"
"0000411439" "0000868551"
"0000411439" "0000868559"
"0000411440" "0000868552"
"0000411440" "0000868560"
"0000411444" "0000868566"
"0000411445" "0000868568"
"0000411446" "0000868569"
"0000411447" "0000868570"
"0000411448" "0000868571"
"0000431013" "0000915942"
"0000431013" "0000915943"
"0000431234" "0000916283"
"0000431300" "0000916382"
"0000431300" "0000916383"
"0000431355" "0000916463"
"0000431361" "0000916472"
"0000431361" "0000916473"
"0000431535" "0000916740"
"0000437894" "0000933337"
"0000437895" "0000933338"
"0000437903" "0000933351"
"0000437903" "0000933352"
"0000440132" "0000936425"
"0000441932" "0000939874"
"0000441932" "0000939904"
"0000448631" "0000958117"
"0000448696" "0000958182"
"0000448765" "0000958251"
"0000452377" "0000986360"
"0000452377" "0000986897"
"0000452378" "0000986361"
"0000452379" "0000986362"
"0000452380" "0000986363"
"0000452648" "0000987303"
"0000452660" "0000987005"
"0000452661" "0000987006"
"0000452893" "0000987238"
"0000452939" "0000987340"
"0000457842" "0001012389"
"0000457844" "0001012391"
"0000457879" "0001012426"
"0000457884" "0001012431"
"0000460629" "0001019646"
"0000460629" "0001019647"
"0000460630" "0001019648"
"0000469274" "0001049537"
"0000469274" "0001049664"
"0000470429" "0001058551"
"0000471247" "0001059384"