### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = CNBP) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "CNBP" "CCHC-type zinc finger, nucleic acid binding protein" "3" "q21" "unknown" "NC_000003.11" "UD_132118768519" "" "https://www.LOVD.nl/CNBP" "" "1" "13164" "7555" "116955" "1" "1" "1" "1" "Alias ZNF9\r\nEstablishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/CNBP_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2023-01-22 12:20:28" "00006" "2023-01-22 15:19:02" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00005373" "CNBP" "transcript variant 3" "004" "NM_003418.4" "" "NP_003409.1" "" "" "" "-206" "3172" "534" "128902810" "128886658" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00244" "MYOP" "myopathy (MYOP)" "" "" "" "" "" "00006" "2013-10-12 23:00:55" "00006" "2019-06-19 11:52:31" "02436" "DM2" "dystrophy, myotonic, type 2 (DM-2)" "AD" "602668" "" "" "autosomal dominant" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "CNBP" "02436" ## Individuals ## Do not remove or alter this header ## ## Count = 138 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00430528" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "analysis 24 CNBP control alleles" "" "" "United States" "" "0" "" "" "" "control" "00430529" "" "" "" "4" "" "00006" "{PMID:Liquori 2003:14505273}" "analysis 24 CNBP control alleles" "" "" "United States" "" "0" "" "" "" "control" "00430530" "" "" "" "4" "" "00006" "{PMID:Liquori 2003:14505273}" "analysis 24 CNBP control alleles" "" "" "United States" "" "0" "" "" "" "control" "00430531" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "analysis 24 CNBP control alleles" "" "" "United States" "" "0" "" "" "" "control" "00430532" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "analysis 24 CNBP control alleles" "" "" "United States" "" "0" "" "" "" "control" "00430533" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "analysis 24 CNBP control alleles" "" "" "United States" "" "0" "" "" "" "control" "00430534" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "analysis 24 CNBP control alleles" "" "" "United States" "" "0" "" "" "" "control" "00430535" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "analysis 24 CNBP control alleles" "" "" "United States" "" "0" "" "" "" "control" "00430536" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "analysis 24 CNBP control alleles" "" "" "United States" "" "0" "" "" "" "control" "00430537" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "analysis 24 CNBP control alleles" "" "" "United States" "" "0" "" "" "" "control" "00430538" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}, {PMID:Liquori 2003:14505273}" "analysis 24 CNBP control alleles" "" "" "United States" "" "0" "" "" "" "control" "00430539" "" "" "" "5" "" "00006" "{PMID:Liquori 2001:11486088}, {PMID:Liquori 2003:14505273}" "analysis 24 CNBP control alleles" "" "" "United States" "" "0" "" "" "" "control" "00430540" "" "" "" "2" "" "00006" "{PMID:Liquori 2001:11486088}, {PMID:Liquori 2003:14505273}" "analysis 24 CNBP control alleles" "" "" "United States" "" "0" "" "" "" "control" "00430541" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "analysis 228 CNBP control alleles" "" "" "" "" "0" "" "" "white" "control" "00430545" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430546" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430547" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430548" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430549" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430550" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430551" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430552" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430553" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430554" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430555" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430556" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430557" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430558" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430559" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430560" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430561" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430562" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430563" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430564" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430565" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430566" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430567" "" "" "" "1" "" "00006" "{PMID:Liquori 2001:11486088}" "analysis expanded DM2 alleles" "" "" "" "" "0" "" "" "" "" "00430568" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam1" "00430569" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam2" "00430570" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam3" "00430571" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam4" "00430572" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam5" "00430573" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam6" "00430574" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam7" "00430575" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam8" "00430576" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam9" "00430577" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam10" "00430578" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam11" "00430579" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam12" "00430580" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam13" "00430581" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam14" "00430582" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam15" "00430583" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam16" "00430584" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam17" "00430585" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam18" "00430586" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam19" "00430587" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam20" "00430588" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam21" "00430589" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam22" "00430590" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam23" "00430591" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam24" "00430592" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam25" "00430593" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam26" "00430594" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam27" "00430595" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam28" "00430596" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam29" "00430597" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam30" "00430598" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam31" "00430599" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam32" "00430600" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam33" "00430601" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam34" "00430602" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam35" "00430603" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Afghanistan" "" "0" "" "" "" "Fam36" "00430604" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam37" "00430605" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam38" "00430606" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam39" "00430607" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam40" "00430608" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam41" "00430609" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam42" "00430610" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam43" "00430611" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam44" "00430612" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam45" "00430613" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam46" "00430614" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam47" "00430615" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam48" "00430616" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam49" "00430617" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam50" "00430618" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam51" "00430619" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam52" "00430620" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam53" "00430621" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam54" "00430622" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam55" "00430623" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam56" "00430624" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam57" "00430625" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam58" "00430626" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam59" "00430627" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam60" "00430628" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "Germany" "" "0" "" "" "white" "Fam61" "00430629" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "United States" "" "0" "" "" "Europe" "Fam62" "00430630" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "United States" "" "0" "" "" "Europe" "Fam63" "00430631" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "United States" "" "0" "" "" "Europe" "Fam64" "00430632" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "United States" "" "0" "" "" "Europe" "Fam65" "00430633" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "United States" "" "0" "" "" "Europe" "Fam66" "00430634" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "United States" "" "0" "" "" "Europe" "Fam67" "00430635" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "United States" "" "0" "" "" "Europe" "Fam68" "00430636" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "United States" "" "0" "" "" "Europe" "Fam69" "00430637" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "United States" "" "0" "" "" "Europe" "Fam70" "00430638" "" "" "" "1" "" "00006" "{PMID:Liquori 2003:14505273}" "" "" "" "United States" "" "0" "" "" "Europe" "Fam71" "00430639" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "Germany" "" "0" "" "" "" "D01" "00430640" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "Switzerland" "" "0" "" "" "" "CH01" "00430641" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "Italy" "" "0" "" "" "" "I04" "00430642" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "Spain" "" "0" "" "" "" "E02" "00430643" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "Italy" "" "0" "" "" "" "I03" "00430644" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "France" "" "0" "" "" "" "F002" "00430645" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "Italy" "" "0" "" "" "" "I01" "00430646" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "United States" "" "0" "" "" "" "NY01" "00430647" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "UK02" "00430648" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "France" "" "0" "" "" "" "F01" "00430649" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "Germany" "" "0" "" "" "" "D02" "00430650" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "Germany" "" "0" "" "" "" "D03" "00430651" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "Germany" "" "0" "" "" "" "D06" "00430652" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "United States" "" "0" "" "" "" "NY02" "00430653" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "Finland" "" "0" "" "" "" "FIN01" "00430654" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "Finland" "" "0" "" "" "" "FIN02" "00430655" "" "" "" "1" "" "00006" "{PMID:Bachinski 2003:12970845}" "" "" "" "Finland" "" "0" "" "" "" "FIN03" "00430657" "" "" "" "23" "" "00006" "{PMID:Bachinski 2009:19020295}" "analysis 44 large control chromosomes" "" "" "" "" "0" "" "" "" "" "00430658" "" "" "" "1" "" "00006" "{PMID:Bachinski 2009:19020295}" "analysis 44 large control chromosomes" "" "" "" "" "0" "" "" "" "" "00430659" "" "" "" "7" "" "00006" "{PMID:Bachinski 2009:19020295}" "analysis 44 large control chromosomes" "" "" "" "" "0" "" "" "" "" "00430660" "" "" "" "5" "" "00006" "{PMID:Bachinski 2009:19020295}" "analysis 44 large control chromosomes" "" "" "" "" "0" "" "" "" "" "00430661" "" "" "" "1" "" "00006" "{PMID:Bachinski 2009:19020295}" "analysis 44 large control chromosomes" "" "" "" "" "0" "" "" "" "" "00430662" "" "" "" "1" "" "00006" "{PMID:Bachinski 2009:19020295}" "analysis 44 large control chromosomes" "" "" "" "" "0" "" "" "" "" "00430663" "" "" "" "4" "" "00006" "{PMID:Bachinski 2009:19020295}" "analysis 44 large control chromosomes" "" "" "" "" "0" "" "" "" "" "00430664" "" "" "" "1" "" "00006" "{PMID:Bachinski 2009:19020295}" "analysis 44 large control chromosomes" "" "" "" "" "0" "" "" "" "" "00430665" "" "" "" "1" "" "00006" "{PMID:Bachinski 2009:19020295}" "analysis 44 large control chromosomes" "" "" "" "" "0" "" "" "" "" "00430671" "" "" "" "1" "" "00006" "{PMID:Granger 2022:36628841}" "" "F" "" "United States" "" "0" "" "" "" "Pat6" "00430675" "" "" "" "1" "" "00006" "{PMID:Granger 2022:36628841}" "" "F" "" "United States" "" "0" "" "" "" "Pat10" "00430676" "" "" "" "1" "" "00006" "{PMID:Granger 2022:36628841}" "" "M" "" "United States" "" "0" "" "" "" "Pat11" "00430677" "" "" "" "1" "" "00006" "{PMID:Granger 2022:36628841}" "" "M" "" "United States" "" "0" "" "" "" "Pat12" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 138 "{{individualid}}" "{{diseaseid}}" "00430528" "00000" "00430529" "00000" "00430530" "00000" "00430531" "00000" "00430532" "00000" "00430533" "00000" "00430534" "00000" "00430535" "00000" "00430536" "00000" "00430537" "00000" "00430538" "00000" "00430539" "00000" "00430540" "00000" "00430541" "00000" "00430545" "02436" "00430546" "02436" "00430547" "02436" "00430548" "02436" "00430549" "02436" "00430550" "02436" "00430551" "02436" "00430552" "02436" "00430553" "02436" "00430554" "02436" "00430555" "02436" "00430556" "02436" "00430557" "02436" "00430558" "02436" "00430559" "02436" "00430560" "02436" "00430561" "02436" "00430562" "02436" "00430563" "02436" "00430564" "02436" "00430565" "02436" "00430566" "02436" "00430567" "02436" "00430568" "02436" "00430569" "02436" "00430570" "02436" "00430571" "02436" "00430572" "02436" "00430573" "02436" "00430574" "02436" "00430575" "02436" "00430576" "02436" "00430577" "02436" "00430578" "02436" "00430579" "02436" "00430580" "02436" "00430581" "02436" "00430582" "02436" "00430583" "02436" "00430584" "02436" "00430585" "02436" "00430586" "02436" "00430587" "02436" "00430588" "02436" "00430589" "02436" "00430590" "02436" "00430591" "02436" "00430592" "02436" "00430593" "02436" "00430594" "02436" "00430595" "02436" "00430596" "02436" "00430597" "02436" "00430598" "02436" "00430599" "02436" "00430600" "02436" "00430601" "02436" "00430602" "02436" "00430603" "02436" "00430604" "02436" "00430605" "02436" "00430606" "02436" "00430607" "02436" "00430608" "02436" "00430609" "02436" "00430610" "02436" "00430611" "02436" "00430612" "02436" "00430613" "02436" "00430614" "02436" "00430615" "02436" "00430616" "02436" "00430617" "02436" "00430618" "02436" "00430619" "02436" "00430620" "02436" "00430621" "02436" "00430622" "02436" "00430623" "02436" "00430624" "02436" "00430625" "02436" "00430626" "02436" "00430627" "02436" "00430628" "02436" "00430629" "02436" "00430630" "02436" "00430631" "02436" "00430632" "02436" "00430633" "02436" "00430634" "02436" "00430635" "02436" "00430636" "02436" "00430637" "02436" "00430638" "02436" "00430639" "02436" "00430640" "02436" "00430641" "02436" "00430642" "02436" "00430643" "02436" "00430644" "02436" "00430645" "02436" "00430646" "02436" "00430647" "02436" "00430648" "02436" "00430649" "02436" "00430650" "02436" "00430651" "02436" "00430652" "02436" "00430653" "02436" "00430654" "02436" "00430655" "02436" "00430657" "00000" "00430658" "00000" "00430659" "00000" "00430660" "00000" "00430661" "00000" "00430662" "00000" "00430663" "00000" "00430664" "00000" "00430665" "00000" "00430671" "00244" "00430675" "00244" "00430676" "00244" "00430677" "00244" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00244, 02436 ## Count = 115 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000321329" "02436" "00430545" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321330" "02436" "00430546" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321331" "02436" "00430547" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321332" "02436" "00430548" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321333" "02436" "00430549" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321334" "02436" "00430550" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321335" "02436" "00430551" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321336" "02436" "00430552" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321337" "02436" "00430553" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321338" "02436" "00430554" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321339" "02436" "00430555" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321340" "02436" "00430556" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321341" "02436" "00430557" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321342" "02436" "00430558" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321343" "02436" "00430559" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321344" "02436" "00430560" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321345" "02436" "00430561" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321346" "02436" "00430562" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321347" "02436" "00430563" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321348" "02436" "00430564" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321349" "02436" "00430565" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321350" "02436" "00430566" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321351" "02436" "00430567" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321352" "02436" "00430568" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321353" "02436" "00430569" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321354" "02436" "00430570" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321355" "02436" "00430571" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321356" "02436" "00430572" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321357" "02436" "00430573" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321358" "02436" "00430574" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321359" "02436" "00430575" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321360" "02436" "00430576" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321361" "02436" "00430577" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321362" "02436" "00430578" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321363" "02436" "00430579" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321364" "02436" "00430580" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321365" "02436" "00430581" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321366" "02436" "00430582" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321367" "02436" "00430583" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321368" "02436" "00430584" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321369" "02436" "00430585" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321370" "02436" "00430586" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321371" "02436" "00430587" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321372" "02436" "00430588" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321373" "02436" "00430589" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321374" "02436" "00430590" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321375" "02436" "00430591" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321376" "02436" "00430592" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321377" "02436" "00430593" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321378" "02436" "00430594" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321379" "02436" "00430595" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321380" "02436" "00430596" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321381" "02436" "00430597" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321382" "02436" "00430598" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321383" "02436" "00430599" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321384" "02436" "00430600" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321385" "02436" "00430601" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321386" "02436" "00430602" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321387" "02436" "00430603" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321388" "02436" "00430604" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321389" "02436" "00430605" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321390" "02436" "00430606" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321391" "02436" "00430607" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321392" "02436" "00430608" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321393" "02436" "00430609" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321394" "02436" "00430610" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321395" "02436" "00430611" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321396" "02436" "00430612" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321397" "02436" "00430613" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321398" "02436" "00430614" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321399" "02436" "00430615" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321400" "02436" "00430616" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321401" "02436" "00430617" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321402" "02436" "00430618" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321403" "02436" "00430619" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321404" "02436" "00430620" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321405" "02436" "00430621" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321406" "02436" "00430622" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321407" "02436" "00430623" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321408" "02436" "00430624" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321409" "02436" "00430625" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321410" "02436" "00430626" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321411" "02436" "00430627" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321412" "02436" "00430628" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321413" "02436" "00430629" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321414" "02436" "00430630" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321415" "02436" "00430631" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321416" "02436" "00430632" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321417" "02436" "00430633" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321418" "02436" "00430634" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321419" "02436" "00430635" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321420" "02436" "00430636" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321421" "02436" "00430637" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321422" "02436" "00430638" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321423" "02436" "00430639" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321424" "02436" "00430640" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321425" "02436" "00430641" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321426" "02436" "00430642" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321427" "02436" "00430643" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321428" "02436" "00430644" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321429" "02436" "00430645" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321430" "02436" "00430646" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321431" "02436" "00430647" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321432" "02436" "00430648" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321433" "02436" "00430649" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321434" "02436" "00430650" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321435" "02436" "00430651" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321436" "02436" "00430652" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321437" "02436" "00430653" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321438" "02436" "00430654" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321439" "02436" "00430655" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321446" "00244" "00430671" "00006" "Unknown" "48y" "myotonia, falls; nornal CK level; electrodiagnosis myotonic discharges" "" "" "" "" "" "" "" "DM2" "myotonic dystrophy" "0000321450" "00244" "00430675" "00006" "Unknown" "61y" "acute right upper limb weakness, right median nerve sensory deficit; electrodiagnosis right pan-brachial plexopathy, diffuse myotonic discharges" "" "" "" "" "" "" "" "DM2; Parsonage-Turner syndrome" "myotonic dystrophy" "0000321451" "00244" "00430676" "00006" "Unknown" "71y" "asymmetric limb weakness and atrophy, fasciculations, hyperreflexia; raised CK level 486 IU/L; electrodiagnosis diffuse chronic neurogenic changes, fibrillation and fasciculation potentials, myotonic discharges" "" "" "" "" "" "" "" "DM2; ALS" "myotonic dystrophy" "0000321452" "00244" "00430677" "00006" "Unknown" "68y" "bulbar and asymmetric limb weakness, fasciculations, myotonia, upper motor neuron signs later; raised CK level 654 IU/L; electrodiagnosis mixed neurogenic>myopathic changes, fasciculation and fibrillation potentials, myotonic discharges" "" "" "" "" "" "" "" "DM2; ALS" "myotonic dystrophy" ## Screenings ## Do not remove or alter this header ## ## Count = 138 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000431937" "00430528" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431938" "00430529" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431939" "00430530" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431940" "00430531" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431941" "00430532" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431942" "00430533" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431943" "00430534" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431944" "00430535" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431945" "00430536" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431946" "00430537" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431947" "00430538" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431948" "00430539" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431949" "00430540" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431950" "00430541" "1" "00006" "00006" "2023-01-22 09:01:42" "" "" "SEQ" "DNA" "" "" "0000431954" "00430545" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431955" "00430546" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431956" "00430547" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431957" "00430548" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431958" "00430549" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431959" "00430550" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431960" "00430551" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431961" "00430552" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431962" "00430553" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431963" "00430554" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431964" "00430555" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431965" "00430556" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431966" "00430557" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431967" "00430558" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431968" "00430559" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431969" "00430560" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431970" "00430561" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431971" "00430562" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431972" "00430563" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431973" "00430564" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431974" "00430565" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431975" "00430566" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431976" "00430567" "1" "00006" "00006" "2023-01-22 12:03:21" "" "" "Southern" "DNA" "" "" "0000431977" "00430568" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431978" "00430569" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431979" "00430570" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431980" "00430571" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431981" "00430572" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431982" "00430573" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431983" "00430574" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431984" "00430575" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431985" "00430576" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431986" "00430577" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431987" "00430578" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431988" "00430579" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431989" "00430580" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431990" "00430581" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431991" "00430582" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431992" "00430583" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431993" "00430584" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431994" "00430585" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431995" "00430586" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431996" "00430587" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431997" "00430588" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431998" "00430589" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000431999" "00430590" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432000" "00430591" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432001" "00430592" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432002" "00430593" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432003" "00430594" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432004" "00430595" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432005" "00430596" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432006" "00430597" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432007" "00430598" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432008" "00430599" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432009" "00430600" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432010" "00430601" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432011" "00430602" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432012" "00430603" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432013" "00430604" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432014" "00430605" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432015" "00430606" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432016" "00430607" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432017" "00430608" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432018" "00430609" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432019" "00430610" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432020" "00430611" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432021" "00430612" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432022" "00430613" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432023" "00430614" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432024" "00430615" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432025" "00430616" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432026" "00430617" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432027" "00430618" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432028" "00430619" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432029" "00430620" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432030" "00430621" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432031" "00430622" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432032" "00430623" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432033" "00430624" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432034" "00430625" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432035" "00430626" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432036" "00430627" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432037" "00430628" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432038" "00430629" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432039" "00430630" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432040" "00430631" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432041" "00430632" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432042" "00430633" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432043" "00430634" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432044" "00430635" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432045" "00430636" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432046" "00430637" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432047" "00430638" "1" "00006" "00006" "2023-01-22 12:16:45" "" "" "Southern" "DNA" "" "" "0000432048" "00430639" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432049" "00430640" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432050" "00430641" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432051" "00430642" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432052" "00430643" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432053" "00430644" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432054" "00430645" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432055" "00430646" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432056" "00430647" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432057" "00430648" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432058" "00430649" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432059" "00430650" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432060" "00430651" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432061" "00430652" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432062" "00430653" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432063" "00430654" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432064" "00430655" "1" "00006" "00006" "2023-01-22 12:37:55" "" "" "Southern" "DNA" "" "" "0000432065" "00430657" "1" "00006" "00006" "2023-01-22 13:18:19" "" "" "SEQ;Southern" "DNA" "" "" "0000432066" "00430658" "1" "00006" "00006" "2023-01-22 13:18:19" "" "" "SEQ;Southern" "DNA" "" "" "0000432067" "00430659" "1" "00006" "00006" "2023-01-22 13:18:19" "" "" "SEQ;Southern" "DNA" "" "" "0000432068" "00430660" "1" "00006" "00006" "2023-01-22 13:18:19" "" "" "SEQ;Southern" "DNA" "" "" "0000432069" "00430661" "1" "00006" "00006" "2023-01-22 13:18:19" "" "" "SEQ;Southern" "DNA" "" "" "0000432070" "00430662" "1" "00006" "00006" "2023-01-22 13:18:19" "" "" "SEQ;Southern" "DNA" "" "" "0000432071" "00430663" "1" "00006" "00006" "2023-01-22 13:18:19" "" "" "SEQ;Southern" "DNA" "" "" "0000432072" "00430664" "1" "00006" "00006" "2023-01-22 13:18:19" "" "" "SEQ;Southern" "DNA" "" "" "0000432073" "00430665" "1" "00006" "00006" "2023-01-22 13:18:19" "" "" "SEQ;Southern" "DNA" "" "" "0000432081" "00430671" "1" "00006" "00006" "2023-01-22 15:18:59" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000432085" "00430675" "1" "00006" "00006" "2023-01-22 15:18:59" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000432086" "00430676" "1" "00006" "00006" "2023-01-22 15:18:59" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000432087" "00430677" "1" "00006" "00006" "2023-01-22 15:18:59" "" "" "SEQ;SEQ-NG" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 134 "{{screeningid}}" "{{geneid}}" "0000431937" "CNBP" "0000431938" "CNBP" "0000431939" "CNBP" "0000431940" "CNBP" "0000431941" "CNBP" "0000431942" "CNBP" "0000431943" "CNBP" "0000431944" "CNBP" "0000431945" "CNBP" "0000431946" "CNBP" "0000431947" "CNBP" "0000431948" "CNBP" "0000431949" "CNBP" "0000431950" "CNBP" "0000431954" "CNBP" "0000431955" "CNBP" "0000431956" "CNBP" "0000431957" "CNBP" "0000431958" "CNBP" "0000431959" "CNBP" "0000431960" "CNBP" "0000431961" "CNBP" "0000431962" "CNBP" "0000431963" "CNBP" "0000431964" "CNBP" "0000431965" "CNBP" "0000431966" "CNBP" "0000431967" "CNBP" "0000431968" "CNBP" "0000431969" "CNBP" "0000431970" "CNBP" "0000431971" "CNBP" "0000431972" "CNBP" "0000431973" "CNBP" "0000431974" "CNBP" "0000431975" "CNBP" "0000431976" "CNBP" "0000431977" "CNBP" "0000431978" "CNBP" "0000431979" "CNBP" "0000431980" "CNBP" "0000431981" "CNBP" "0000431982" "CNBP" "0000431983" "CNBP" "0000431984" "CNBP" "0000431985" "CNBP" "0000431986" "CNBP" "0000431987" "CNBP" "0000431988" "CNBP" "0000431989" "CNBP" "0000431990" "CNBP" "0000431991" "CNBP" "0000431992" "CNBP" "0000431993" "CNBP" "0000431994" "CNBP" "0000431995" "CNBP" "0000431996" "CNBP" "0000431997" "CNBP" "0000431998" "CNBP" "0000431999" "CNBP" "0000432000" "CNBP" "0000432001" "CNBP" "0000432002" "CNBP" "0000432003" "CNBP" "0000432004" "CNBP" "0000432005" "CNBP" "0000432006" "CNBP" "0000432007" "CNBP" "0000432008" "CNBP" "0000432009" "CNBP" "0000432010" "CNBP" "0000432011" "CNBP" "0000432012" "CNBP" "0000432013" "CNBP" "0000432014" "CNBP" "0000432015" "CNBP" "0000432016" "CNBP" "0000432017" "CNBP" "0000432018" "CNBP" "0000432019" "CNBP" "0000432020" "CNBP" "0000432021" "CNBP" "0000432022" "CNBP" "0000432023" "CNBP" "0000432024" "CNBP" "0000432025" "CNBP" "0000432026" "CNBP" "0000432027" "CNBP" "0000432028" "CNBP" "0000432029" "CNBP" "0000432030" "CNBP" "0000432031" "CNBP" "0000432032" "CNBP" "0000432033" "CNBP" "0000432034" "CNBP" "0000432035" "CNBP" "0000432036" "CNBP" "0000432037" "CNBP" "0000432038" "CNBP" "0000432039" "CNBP" "0000432040" "CNBP" "0000432041" "CNBP" "0000432042" "CNBP" "0000432043" "CNBP" "0000432044" "CNBP" "0000432045" "CNBP" "0000432046" "CNBP" "0000432047" "CNBP" "0000432048" "CNBP" "0000432049" "CNBP" "0000432050" "CNBP" "0000432051" "CNBP" "0000432052" "CNBP" "0000432053" "CNBP" "0000432054" "CNBP" "0000432055" "CNBP" "0000432056" "CNBP" "0000432057" "CNBP" "0000432058" "CNBP" "0000432059" "CNBP" "0000432060" "CNBP" "0000432061" "CNBP" "0000432062" "CNBP" "0000432063" "CNBP" "0000432064" "CNBP" "0000432065" "CNBP" "0000432066" "CNBP" "0000432067" "CNBP" "0000432068" "CNBP" "0000432069" "CNBP" "0000432070" "CNBP" "0000432071" "CNBP" "0000432072" "CNBP" "0000432073" "CNBP" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 139 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000266849" "0" "10" "3" "128890350" "128890350" "subst" "0.900132" "02325" "CNBP_000001" "g.128890350G>A" "" "" "" "CNBP(NM_001127192.2):c.156C>T (p.D52=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129171507G>A" "" "benign" "" "0000917271" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000002" "g.128891420_128891575CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[8]CA[15]" "1/24 control chromosomes" "{PMID:Liquori 2003:14505273}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[8]CA[15]" "" "benign" "" "0000917272" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000002" "g.128891420_128891575CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[9]CA[16]" "4/24 control chromosomes" "{PMID:Liquori 2003:14505273}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[9]CA[16]" "" "benign" "" "0000917273" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000032" "g.128891420_128891575CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[9]CA[18]" "4/24 control chromosomes" "{PMID:Liquori 2003:14505273}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[9]CA[18]" "" "benign" "" "0000917274" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000033" "g.128891420_128891575CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[9]CA[17]" "1/24 control chromosomes" "{PMID:Liquori 2003:14505273}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[9]CA[17]" "" "benign" "" "0000917275" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000034" "g.128891420_128891575CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[10]CA[19]" "1/24 control chromosomes" "{PMID:Liquori 2003:14505273}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[10]CA[19]" "" "benign" "" "0000917276" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000003" "g.128891420_128891575CAGG[7]CAGACAGGCAGC[1]CAGG[6]CAGA[7]CA[20]" "1/24 control chromosomes" "{PMID:Liquori 2003:14505273}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[7]CAGACAGGCAGC[1]CAGG[6]CAGA[7]CA[20]" "" "benign" "" "0000917277" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000035" "g.128891420_128891575CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[9]CA[20]" "1/24 control chromosomes" "{PMID:Liquori 2003:14505273}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[9]CA[20]" "" "benign" "" "0000917278" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000036" "g.128891420_128891575CAGG[7]CAGACAGGCAGC[1]CAGG[6]CAGA[8]CA[20]" "1/24 control chromosomes" "{PMID:Liquori 2003:14505273}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[7]CAGACAGGCAGC[1]CAGG[6]CAGA[8]CA[20]" "" "benign" "" "0000917279" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000037" "g.128891420_128891575CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[11]CA[20]" "1/24 control chromosomes" "{PMID:Liquori 2003:14505273}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[7]CAGACAGGCAGC[1]CAGG[5]CAGA[11]CA[20]" "" "benign" "" "0000917280" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000038" "g.128891420_128891575CAGG[7]CAGACAGGCAGC[1]CAGG[4]CAGA[10]CA[21]" "1/24 control chromosomes" "{PMID:Liquori 2003:14505273}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[7]CAGACAGGCAGC[1]CAGG[4]CAGA[10]CA[21]" "" "benign" "" "0000917281" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000039" "g.128891420_128891575CAGG[8]CAGA[1]CAGG[3]CAGA[1]CAGG[9]CAGA[8]CA[21]" "1/24 control chromosomes" "{PMID:Liquori 2001:11486088}, {PMID:Liquori 2003:14505273}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[8]CAGA[1]CAGG[3]CAGA[1]CAGG[9]CAGA[8]CA[21]" "" "benign" "" "0000917282" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000040" "g.128891420_128891575CAGG[(4_7)]CAGACAGGCAGC[1]CAGG[5]CAGA[(4_9)]CA[(14_25)]" "5/24 control chromosomes" "{PMID:Liquori 2001:11486088}, {PMID:Liquori 2003:14505273}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(4_7)]CAGACAGGCAGC[1]CAGG[5]CAGA[(4_9)]CA[(14_25)]" "" "benign" "" "0000917283" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000041" "g.128891420_128891575CAGG[7]CAGA[1]CAGG[(3_7)]CAGA[(7_10)]CA[(15_17)]" "2/24 control chromosomes" "{PMID:Liquori 2001:11486088}, {PMID:Liquori 2003:14505273}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[7]CAGA[1]CAGG[(3_7)]CAGA[(7_10)]CA[(15_17)]" "" "benign" "" "0000917284" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000042" "g.128891420_128891575CAGG[20][7]CA[15]" "1/228 control chromosomes" "{PMID:Liquori 2003:14505273}" "" "" "possible pre-mutation allele" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[20]CAGA[7]CA[15]" "" "benign" "" "0000917290" "1" "90" "3" "" "" "" "" "00006" "CNBP_000004" "g.128891420_128891575CAGG[(100)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(100)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917291" "1" "90" "3" "" "" "" "" "00006" "CNBP_000005" "g.128891420_128891575CAGG[(500)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(500)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917292" "1" "90" "3" "" "" "" "" "00006" "CNBP_000006" "g.128891420_128891575CAGG[(1000)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(1000)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917293" "1" "90" "3" "" "" "" "" "00006" "CNBP_000007" "g.128891420_128891575CAGG[(1500)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(1500)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917294" "1" "90" "3" "" "" "" "" "00006" "CNBP_000008" "g.128891420_128891575CAGG[(2000)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(2000)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917295" "1" "90" "3" "" "" "" "" "00006" "CNBP_000009" "g.128891420_128891575CAGG[(2500)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(2500)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917296" "1" "90" "3" "" "" "" "" "00006" "CNBP_000010" "g.128891420_128891575CAGG[(3000)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(3000)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917297" "1" "90" "3" "" "" "" "" "00006" "CNBP_000011" "g.128891420_128891575CAGG[(3500)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(3500)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917298" "1" "90" "3" "" "" "" "" "00006" "CNBP_000012" "g.128891420_128891575CAGG[(4000)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(4000)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917299" "1" "90" "3" "" "" "" "" "00006" "CNBP_000013" "g.128891420_128891575CAGG[(4500)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(4500)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917300" "1" "90" "3" "" "" "" "" "00006" "CNBP_000014" "g.128891420_128891575CAGG[(5000)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(5000)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917301" "1" "90" "3" "" "" "" "" "00006" "CNBP_000015" "g.128891420_128891575CAGG[(5500)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(5500)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917302" "1" "90" "3" "" "" "" "" "00006" "CNBP_000016" "g.128891420_128891575CAGG[(6000)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(6000)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917303" "1" "90" "3" "" "" "" "" "00006" "CNBP_000017" "g.128891420_128891575CAGG[(6500)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(6500)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917304" "1" "90" "3" "" "" "" "" "00006" "CNBP_000018" "g.128891420_128891575CAGG[(7000)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(7000)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917305" "1" "90" "3" "" "" "" "" "00006" "CNBP_000019" "g.128891420_128891575CAGG[(7500)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(7500)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917306" "1" "90" "3" "" "" "" "" "00006" "CNBP_000020" "g.128891420_128891575CAGG[(8000)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(8000)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917307" "1" "90" "3" "" "" "" "" "00006" "CNBP_000021" "g.128891420_128891575CAGG[(8500)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(8500)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917308" "1" "90" "3" "" "" "" "" "00006" "CNBP_000022" "g.128891420_128891575CAGG[(9000)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(9000)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917309" "1" "90" "3" "" "" "" "" "00006" "CNBP_000023" "g.128891420_128891575CAGG[(9500)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(9500)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917310" "1" "90" "3" "" "" "" "" "00006" "CNBP_000024" "g.128891420_128891575CAGG[(10000)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(10000)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917311" "1" "90" "3" "" "" "" "" "00006" "CNBP_000025" "g.128891420_128891575CAGG[(10500)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(10500)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917312" "1" "90" "3" "" "" "" "" "00006" "CNBP_000026" "g.128891420_128891575CAGG[(11000)]CAGA[9]CA[16]" "" "{PMID:Liquori 2001:11486088}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(11000)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917313" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(100)]CAGA[9]CA[16]" "" "pathogenic (dominant)" "" "0000917314" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917315" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917316" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917317" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917318" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917319" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917320" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917321" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917322" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917323" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917324" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917325" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917326" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917327" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917328" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917329" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917330" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917331" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917332" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917333" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917334" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917335" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917336" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917337" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917338" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917339" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917340" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917341" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917342" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917343" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917344" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917345" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917346" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917347" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917348" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917349" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917350" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917351" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917352" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917353" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917354" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917355" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917356" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917357" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917358" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917359" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917360" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917361" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917362" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917363" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917364" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917365" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917366" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917367" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917368" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917369" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917370" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917371" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917372" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917373" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917374" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917375" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917376" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917377" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917378" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917379" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917380" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917381" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917382" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917383" "1" "90" "3" "" "" "" "" "00006" "CNBP_000027" "g.128891420_128891575CAGG[(exp)]CAGA[9]CA[16]" "" "{PMID:Liquori 2003:14505273}" "" "expanded" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000917384" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917385" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917386" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917387" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917388" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917389" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917390" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917391" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917392" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917393" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917394" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917395" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917396" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917397" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917398" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917399" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917400" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000043" "g.(128891420_128891575)insN[(4000_27000)]" "" "{PMID:Bachinski 2003:12970845}" "" "expanded" "" "Germline" "" "" "0" "" "" "g.(129172577_129172732)insN[(4000_27000)]" "" "pathogenic (dominant)" "" "0000917401" "1" "10" "3" "" "" "" "" "00006" "CNBP_000028" "g.128891420_128891575CAGG[(7_9)]CAGACAGGCAGC[1]CAGG[(4_7)]CAGA[(7_10)]CA[(13_26)]" "23/44 control chromosomes" "{PMID:Bachinski 2009:19020295}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(7_9)]CAGACAGGCAGC[1]CAGG[(4_7)]CAGA[(7_10)]CA[(13_26)]" "" "benign" "" "0000917402" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000044" "g.128891420_128891575CAGG[9]CAGACAGGCAGC[1]CAGG[6]4CAGA[9]CA[19]" "1/44 control chromosomes" "{PMID:Bachinski 2009:19020295}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[9]CAGACAGGCAGC[1]CAGG[6]4CAGA[9]CA[19]" "" "benign" "" "0000917403" "1" "10" "3" "" "" "" "" "00006" "CNBP_000029" "g.128891420_128891575CAGG[(6_7)]CAGACAGGCAGC[1]CAGG[7]CAGACAGGCAGC[1]CAGG[(6_9)]CAGA[(8_13)]CA[(13_21)]" "7/44 control chromosomes" "{PMID:Bachinski 2009:19020295}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(6_7)]CAGACAGGCAGC[1]CAGG[7]CAGACAGGCAGC[1]CAGG[(6_9)]CAGA[(8_13)]CA[(13_21)]" "" "benign" "" "0000917404" "1" "10" "3" "" "" "" "" "00006" "CNBP_000030" "g.128891420_128891575CAGG[(7_16)]CAGACAGGCAGC[1]CAGG[(7_15)]CAGA[(2_14)]CA[(14_20)]" "5/44 control chromosomes" "{PMID:Bachinski 2009:19020295}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(7_16)]CAGACAGGCAGC[1]CAGG[(7_15)]CAGA[(2_14)]CA[(14_20)]" "" "benign" "" "0000917405" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000045" "g.128891420_128891575CAGG[6]CAGACAGGCAGACAGGCAGC[1]CAGG[9]CAGA[9]CA[22]" "1/44 control chromosomes" "{PMID:Bachinski 2009:19020295}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[6]CAGACAGGCAGACAGGCAGC[1]CAGG[9]CAGA[9]CA[22]" "" "benign" "" "0000917406" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000046" "g.128891420_128891575CAGG[7]CAGACAGGCAGC[1]CAGG[15]CAGT[1]CAGG[9]CAGA[12]CA[13]" "1/44 control chromosomes" "{PMID:Bachinski 2009:19020295}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[7]CAGACAGGCAGC[1]CAGG[15]CAGT[1]CAGG[9]CAGA[12]CA[13]" "" "benign" "" "0000917407" "1" "10" "3" "" "" "" "" "00006" "CNBP_000031" "g.128891420_128891575CAGG[(24_32)]CAGA[(7_9)]CA[(17_20)]" "4/44 control chromosomes" "{PMID:Bachinski 2009:19020295}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[(24_32)]CAGA[(7_9)]CA[(17_20)]" "" "benign" "" "0000917408" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000047" "g.128891420_128891575CAGG[55]CAGA[7]CA[19]" "1/44 control chromosomes" "{PMID:Bachinski 2009:19020295}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[55]CAGA[7]CA[19]" "" "benign" "" "0000917409" "1" "10" "3" "128891420" "128891575" "repeat" "0" "00006" "CNBP_000048" "g.128891420_128891575CAGG[61]CAGA[7]CA[19]" "1/44 control chromosomes" "{PMID:Bachinski 2009:19020295}" "" "" "" "Germline" "" "" "0" "" "" "g.129172577_129172732CAGG[61]CAGA[7]CA[19]" "" "benign" "" "0000917416" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000049" "g.(128891420_128891575)insCAGG[14380]" "" "{PMID:Granger 2022:36628841}" "" "CCTG[14380]" "" "Germline" "" "" "0" "" "" "g.129172577_129172732insCAGG[14380]" "" "pathogenic (dominant)" "" "0000917420" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000050" "g.(128891420_128891575)insCAGG[15600]" "" "{PMID:Granger 2022:36628841}" "" "CCTG[15600]" "" "Germline" "" "" "0" "" "" "g.129172577_129172732insCAGG[15600]" "" "pathogenic (dominant)" "" "0000917421" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000050" "g.(128891420_128891575)insCAGG[15600]" "" "{PMID:Granger 2022:36628841}" "" "CCTG[15600]" "" "Germline" "" "" "0" "" "" "g.129172577_129172732insCAGG[15600]" "" "pathogenic (dominant)" "" "0000917422" "1" "90" "3" "128891420" "128891575" "ins" "0" "00006" "CNBP_000051" "g.(128891420_128891575)insCAGG[15370]" "" "{PMID:Granger 2022:36628841}" "" "CCTG[15370]" "" "Germline" "" "" "0" "" "" "g.129172577_129172732insCAGG[15370]" "" "pathogenic (dominant)" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes CNBP ## Count = 139 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "{{VariantOnTranscript/Haplotype}}" "0000266849" "00005373" "10" "156" "0" "156" "0" "c.156C>T" "r.(?)" "p.(Asp52=)" "" "" "0000917271" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[15]TCTG[8]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "r.(=)" "p.(=)" "1i" "TG[15]TCTG[8]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "0000917272" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[16]TCTG[9]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "r.(=)" "p.(=)" "1i" "TG[16]TCTG[9]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "0000917273" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[18]TCTG[9]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "r.(=)" "p.(=)" "1i" "TG[18]TCTG[9]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "0000917274" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[17]TCTG[9]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "r.(=)" "p.(=)" "1i" "TG[17]TCTG[9]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "0000917275" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[19]TCTG[10]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "r.(=)" "p.(=)" "1i" "TG[19]TCTG[10]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "0000917276" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[20]TCTG[7]CCTG[6]GCTGCCTGTCTG[1]CCTG[7]" "r.(=)" "p.(=)" "1i" "TG[20]TCTG[7]CCTG[6]GCTGCCTGTCTG[1]CCTG[7]" "0000917277" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[20]TCTG[9]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "r.(=)" "p.(=)" "1i" "TG[20]TCTG[9]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "0000917278" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[20]TCTG[8]CCTG[6]GCTGCCTGTCTG[1]CCTG[7]" "r.(=)" "p.(=)" "1i" "TG[20]TCTG[8]CCTG[6]GCTGCCTGTCTG[1]CCTG[7]" "0000917279" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[20]TCTG[11]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "r.(=)" "p.(=)" "1i" "TG[20]TCTG[11]CCTG[5]GCTGCCTGTCTG[1]CCTG[7]" "0000917280" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[21]TCTG[10]CCTG[4]GCTGCCTGTCTG[1]CCTG[7]" "r.(=)" "p.(=)" "1i" "TG[21]TCTG[10]CCTG[4]GCTGCCTGTCTG[1]CCTG[7]" "0000917281" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[21]TCTG[8]CCTG[9]TCTG[1]CCTG[3]TCTG[1]CCTG[8]" "r.(=)" "p.(=)" "1i" "TG[21]TCTG[8]CCTG[9]TCTG[1]CCTG[3]TCTG[1]CCTG[8]" "0000917282" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[(14_25)]TCTG[(4_9)]CCTG[5]GCTGCCTGTCTG[1]CCTG[(4_7)]" "r.(=)" "p.(=)" "1i" "TG[(14_25)]TCTG[(4_9)]CCTG[5]GCTGCCTGTCTG[1]CCTG[(4_7)]" "0000917283" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[(15_17)]TCTG[(7_10)]CCTG[(3_7)]TCTG[1]CCTG[7]" "r.(=)" "p.(=)" "1i" "TG[(15_17)]TCTG[(7_10)]CCTG[(3_7)]TCTG[1]CCTG[7]" "0000917284" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[15]TCTG[7]CCTG[20]" "r.(=)" "p.(=)" "1i" "TG[15]TCTG[7]CCTG[20]" "0000917290" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(100)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(100)]" "0000917291" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(500)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(500)]" "0000917292" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(1000)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(1000)]" "0000917293" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(1500)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(1500)]" "0000917294" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(2000)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(2000)]" "0000917295" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(2500)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(2500)]" "0000917296" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(3000)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(3000)]" "0000917297" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(3500)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(3500)]" "0000917298" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(4000)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(4000)]" "0000917299" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(4500)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(4500)]" "0000917300" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(5000)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(5000)]" "0000917301" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(5500)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(5500)]" "0000917302" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(6000)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(6000)]" "0000917303" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(6500)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(6500)]" "0000917304" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(7000)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(7000)]" "0000917305" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(7500)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(7500)]" "0000917306" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(8000)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(8000)]" "0000917307" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(8500)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(8500)]" "0000917308" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(9000)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(9000)]" "0000917309" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(9500)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(9500)]" "0000917310" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(10000)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(10000)]" "0000917311" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(10500)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(10500)]" "0000917312" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(11000)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(11000)]" "0000917313" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917314" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917315" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917316" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917317" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917318" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917319" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917320" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917321" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917322" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917323" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917324" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917325" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917326" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917327" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917328" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917329" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917330" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917331" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917332" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917333" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917334" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917335" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917336" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917337" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917338" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917339" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917340" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917341" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917342" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917343" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917344" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917345" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917346" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917347" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917348" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917349" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917350" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917351" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917352" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917353" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917354" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917355" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917356" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917357" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917358" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917359" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917360" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917361" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917362" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917363" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917364" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917365" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917366" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917367" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917368" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917369" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917370" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917371" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917372" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917373" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917374" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917375" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917376" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917377" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917378" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917379" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917380" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917381" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917382" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917383" "00005373" "90" "" "0" "" "0" "c.-14-961_-14-806TG[16[TCTG[9]CCTG[(exp)]" "r.?" "1i" "p.?" "TG[16[TCTG[9]CCTG[(exp)]" "0000917384" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917385" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917386" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917387" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917388" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917389" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917390" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917391" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917392" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917393" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917394" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917395" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917396" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917397" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917398" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917399" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917400" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insN[(4000_27000)]" "r.?" "1i" "p.?" "exp[(1000_6750)]" "0000917401" "00005373" "10" "" "0" "" "0" "c.-14-961_-14-806TG[(13_26)]TCTG[(7_10)]CCTG[(4_7)]GCTGCCTGTCTG[1]CCTG[(7_9)]" "r.(=)" "1i" "p.(=)" "TG[(13_26)]TCTG[(7_10)]CCTG[(4_7)]GCTGCCTGTCTG[1]CCTG[(7_9)]" "0000917402" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[19]TCTG[9]CCTG[6]GCTGCCTGGCTG[1]CCTG[9]" "r.(=)" "1i" "p.(=)" "TG[19]TCTG[9]CCTG[6]GCTGCCTGGCTG[1]CCTG[9]" "0000917403" "00005373" "10" "" "0" "" "0" "c.-14-961_-14-806TG[(13_21)]TCTG[(8_13)]CCTG[(6_9)]GCTGCCTGTCTG[1]CCTG[7]GCTGCCTGTCTG[1]CCTG[(6_7)]" "r.(=)" "1i" "p.(=)" "TG[(13_21)]TCTG[(8_13)]CCTG[(6_9)]GCTGCCTGTCTG[1]CCTG[7]GCTGCCTGTCTG[1]CCTG[(6_7)]" "0000917404" "00005373" "10" "" "0" "" "0" "c.-14-961_-14-806TG[(14_20)]TCTG[(2_14)]CCTG[(7_15)]GCTGCCTGTCTG[1]CCTG[(7_16)]" "r.(=)" "1i" "p.(=)" "TG[(14_20)]TCTG[(2_14)]CCTG[(7_15)]GCTGCCTGTCTG[1]CCTG[(7_16)]" "0000917405" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[22]TCTG[9]CCTG[9]GCTGCCTGTCTGCCTGTCTG[1]CCTG[6]" "r.(=)" "1i" "p.(=)" "TG[22]TCTG[9]CCTG[9]GCTGCCTGTCTGCCTGTCTG[1]CCTG[6]" "0000917406" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[13]TCTG[12]CCTG[9]ACTG[1]CCTG[15]GCTGCCTGTCTG[1]CCTG[7]" "r.(=)" "1i" "p.(=)" "TG[13]TCTG[12]CCTG[9]ACTG[1]CCTG[15]GCTGCCTGTCTG[1]CCTG[7]" "0000917407" "00005373" "10" "" "0" "" "0" "c.-14-961_-14-806TG[(17_20)]TCTG[(7_9)]CCTG[(24_32)]" "r.(=)" "1i" "p.(=)" "TG[(17_20)]TCTG[(7_9)]CCTG[(24_32)]" "0000917408" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[19]TCTG[7]CCTG[55]" "r.(=)" "1i" "p.(=)" "TG[19]TCTG[7]CCTG[55]" "0000917409" "00005373" "10" "-14" "-961" "-14" "-806" "c.-14-961_-14-806TG[19]TCTG[7]CCTG[61]" "r.(=)" "1i" "p.(=)" "TG[19]TCTG[7]CCTG[61]" "0000917416" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insCCTG[14380]" "r.?" "p.?" "" "CCTG[14380]" "0000917420" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insCCTG[15600]" "r.?" "p.?" "" "CCTG[15600]" "0000917421" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insCCTG[15600]" "r.?" "p.?" "" "CCTG[15600]" "0000917422" "00005373" "90" "-14" "-961" "-14" "-806" "c.(-14-961_-14-806)insCCTG[15370]" "r.?" "p.?" "" "CCTG[15370]" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 138 "{{screeningid}}" "{{variantid}}" "0000431937" "0000917271" "0000431938" "0000917272" "0000431939" "0000917273" "0000431940" "0000917274" "0000431941" "0000917275" "0000431942" "0000917276" "0000431943" "0000917277" "0000431944" "0000917278" "0000431945" "0000917279" "0000431946" "0000917280" "0000431947" "0000917281" "0000431948" "0000917282" "0000431949" "0000917283" "0000431950" "0000917284" "0000431954" "0000917290" "0000431955" "0000917291" "0000431956" "0000917292" "0000431957" "0000917293" "0000431958" "0000917294" "0000431959" "0000917295" "0000431960" "0000917296" "0000431961" "0000917297" "0000431962" "0000917298" "0000431963" "0000917299" "0000431964" "0000917300" "0000431965" "0000917301" "0000431966" "0000917302" "0000431967" "0000917303" "0000431968" "0000917304" "0000431969" "0000917305" "0000431970" "0000917306" "0000431971" "0000917307" "0000431972" "0000917308" "0000431973" "0000917309" "0000431974" "0000917310" "0000431975" "0000917311" "0000431976" "0000917312" "0000431977" "0000917313" "0000431978" "0000917314" "0000431979" "0000917315" "0000431980" "0000917316" "0000431981" "0000917317" "0000431982" "0000917318" "0000431983" "0000917319" "0000431984" "0000917320" "0000431985" "0000917321" "0000431986" "0000917322" "0000431987" "0000917323" "0000431988" "0000917324" "0000431989" "0000917325" "0000431990" "0000917326" "0000431991" "0000917327" "0000431992" "0000917328" "0000431993" "0000917329" "0000431994" "0000917330" "0000431995" "0000917331" "0000431996" "0000917332" "0000431997" "0000917333" "0000431998" "0000917334" "0000431999" "0000917335" "0000432000" "0000917336" "0000432001" "0000917337" "0000432002" "0000917338" "0000432003" "0000917339" "0000432004" "0000917340" "0000432005" "0000917341" "0000432006" "0000917342" "0000432007" "0000917343" "0000432008" "0000917344" "0000432009" "0000917345" "0000432010" "0000917346" "0000432011" "0000917347" "0000432012" "0000917348" "0000432013" "0000917349" "0000432014" "0000917350" "0000432015" "0000917351" "0000432016" "0000917352" "0000432017" "0000917353" "0000432018" "0000917354" "0000432019" "0000917355" "0000432020" "0000917356" "0000432021" "0000917357" "0000432022" "0000917358" "0000432023" "0000917359" "0000432024" "0000917360" "0000432025" "0000917361" "0000432026" "0000917362" "0000432027" "0000917363" "0000432028" "0000917364" "0000432029" "0000917365" "0000432030" "0000917366" "0000432031" "0000917367" "0000432032" "0000917368" "0000432033" "0000917369" "0000432034" "0000917370" "0000432035" "0000917371" "0000432036" "0000917372" "0000432037" "0000917373" "0000432038" "0000917374" "0000432039" "0000917375" "0000432040" "0000917376" "0000432041" "0000917377" "0000432042" "0000917378" "0000432043" "0000917379" "0000432044" "0000917380" "0000432045" "0000917381" "0000432046" "0000917382" "0000432047" "0000917383" "0000432048" "0000917384" "0000432049" "0000917385" "0000432050" "0000917386" "0000432051" "0000917387" "0000432052" "0000917388" "0000432053" "0000917389" "0000432054" "0000917390" "0000432055" "0000917391" "0000432056" "0000917392" "0000432057" "0000917393" "0000432058" "0000917394" "0000432059" "0000917395" "0000432060" "0000917396" "0000432061" "0000917397" "0000432062" "0000917398" "0000432063" "0000917399" "0000432064" "0000917400" "0000432065" "0000917401" "0000432066" "0000917402" "0000432067" "0000917403" "0000432068" "0000917404" "0000432069" "0000917405" "0000432070" "0000917406" "0000432071" "0000917407" "0000432072" "0000917408" "0000432073" "0000917409" "0000432081" "0000917416" "0000432085" "0000917420" "0000432086" "0000917421" "0000432087" "0000917422"