### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = CNGB3)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"CNGB3"	"cyclic nucleotide gated channel beta 3"	"8"	"q21.3"	"unknown"	"NG_016980.1"	"UD_132084407089"	""	"https://www.LOVD.nl/CNGB3"	""	"1"	"2153"	"54714"	"605080"	"1"	"1"	"1"	"1"	"<font color=\"#FF0000\">This database is one of the <b>\"Eye disease\"</b> gene variant databases.</font>\r\nEstablishment of this gene variant database (LSDB) was supported by the <a href=\'http://www.LUMC.nl\' target=\'_blank\'>Leiden University Medical Center (LUMC)</a>, Leiden, Nederland."	""	"g"	"https://databases.lovd.nl/shared/refseq/CNGB3_codingDNA.html"	"1"	""	"<font color=\"#FF0000\">This database is one of the <b>\"Eye disease\"</b> gene variant databases.</font>"	"-1"	""	"-1"	"00001"	"2012-07-16 00:00:00"	"00006"	"2024-03-13 09:49:04"	"00000"	"2025-05-05 21:14:00"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00005383"	"CNGB3"	"cyclic nucleotide gated channel beta 3"	"001"	"NM_019098.4"	""	"NP_061971.3"	""	""	""	"-48"	"4299"	"2430"	"87755903"	"87586163"	""	"0000-00-00 00:00:00"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 11
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00381"	"RD"	"dystrophy, retinal (RD)"	""	""	""	""	""	"00006"	"2014-05-09 11:59:52"	"00006"	"2015-12-07 07:11:25"
"00420"	"STGD1"	"Stargardt disease, type 1 (STGD1)"	"AR"	"248200"	""	""	""	"00006"	"2014-06-16 23:00:12"	"00006"	"2020-11-19 10:59:15"
"02016"	"ACHM3"	"achromatopsia, type 3"	"AR"	"262300"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2024-09-30 14:18:16"
"02156"	"-"	"retinitis pigmentosa, X-linked, and sinorespiratory infections, with/without deafness"	""	"300455"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"04213"	"COD"	"dystrophy, cone (COD)"	""	""	""	""	""	"00006"	"2015-02-27 19:22:18"	""	""
"04214"	"-"	"retinal disease"	""	""	""	""	""	"00006"	"2015-02-27 19:48:07"	"00001"	"2023-03-09 14:26:26"
"04215"	"STGD"	"Stargardt disease (STGD)"	""	""	""	""	""	"00006"	"2015-02-27 20:01:12"	""	""
"04217"	"WEST"	"West syndrome (WEST, epileptic encephalopathy, early infantile)"	""	""	""	""	""	"00006"	"2015-03-06 11:05:39"	""	""
"04230"	"ACHM"	"achromatopsia (ACHM)"	""	""	""	""	""	"00006"	"2015-03-22 20:43:12"	""	""
"04249"	"macular dystrophy"	"dystrophy, macular"	""	""	""	""	""	"00006"	"2015-05-04 22:10:58"	"00006"	"2024-02-15 21:18:39"


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 3
"{{geneid}}"	"{{diseaseid}}"
"CNGB3"	"00420"
"CNGB3"	"02016"
"CNGB3"	"04230"


## Individuals ## Do not remove or alter this header ##
## Count = 816
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00095944"	""	""	""	"1"	""	"01769"	"{PMID:Li 2017:28418496}"	""	"F"	"yes"	"Pakistan"	""	"0"	""	""	"Pakistani"	"61036"
"00105013"	""	""	""	"1"	""	"01244"	"{PMID:de Castro-Miró 2016:28005958}"	""	"F"	"yes"	"Saudi Arabia"	""	"0"	""	""	""	"71ORG1"
"00105022"	""	""	""	"1"	""	"01244"	"{PMID:de Castro-Miró 2016:28005958}"	""	"F"	"no"	"Spain"	""	"0"	""	""	""	"22ORG1"
"00144158"	""	""	""	"1"	""	"01780"	"{PMID:Katagiri 2014:25268133}"	"index patient"	"M"	"no"	"Japan"	""	"0"	""	""	"Japanese"	""
"00155440"	""	""	""	"2"	""	"01243"	"Sharon, submitted"	""	"F"	"no"	"Israel"	""	"0"	""	""	"white;Jewish"	""
"00155441"	""	""	""	"1"	""	"01243"	"Sharon, submitted"	""	"M"	"no"	"Israel"	""	"0"	""	""	"African-N;Jewish"	""
"00155442"	""	""	""	"4"	""	"01243"	"Sharon, submitted"	""	"M"	"no"	"Israel"	""	"0"	""	""	"Jewish-Ashkenazi"	""
"00155443"	""	""	""	"1"	""	"01243"	"Sharon, submitted"	""	"M"	"no"	"Israel"	""	"0"	""	""	"white;Jewish"	""
"00155444"	""	""	""	"2"	""	"01243"	"Sharon, submitted"	""	"M"	"yes"	"Israel"	""	"0"	""	""	"beduin"	""
"00155445"	""	""	""	"2"	""	"01243"	"Sharon, submitted"	""	"M"	"no"	"Israel"	""	"0"	""	""	"Jewish-Ashkenazi"	""
"00155446"	""	""	""	"1"	""	"01243"	"Sharon, submitted"	""	"F"	"no"	"Israel"	""	"0"	""	""	"Jewish-Ashkenazi"	""
"00170849"	""	""	""	"1"	""	"00244"	"Manuscript under review (González-del Pozo et al., 2018)"	""	"M"	"?"	"Spain"	""	"0"	""	""	""	"IRD4.0_#15"
"00173732"	""	""	""	"23"	""	"00006"	"{PMID:Sundin 2000:10888875}"	"large multi-generation family, 23 affected, unaffected heterozygous carrier relatives"	"F;M"	""	"Micronesia"	""	"0"	""	""	"Pingelapese islanders"	"10888875-Fam1"
"00173733"	""	""	""	"2"	""	"00006"	"{PMID:Sundin 2000:10888875}"	"2-generation family, 2 affected brothers, unaffected heterozygous carrier parents"	"M"	"no"	"Micronesia"	""	"0"	""	""	"Pingelapese islanders"	"10888875-Fam2"
"00173737"	""	""	""	"1"	""	"00006"	"{PMID:Sundin 2000:10888875}"	"affected female"	"F"	"?"	"Micronesia"	""	"0"	""	""	"Pingelapese islanders"	"10888875-Fam3"
"00173738"	""	""	""	"1"	""	"00006"	"{PMID:Kohl 2000:10958649}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents/relatives"	"M"	""	""	""	"0"	""	""	"white"	"10958649-FamCHRO4"
"00173740"	""	""	""	"2"	""	"00006"	"{PMID:Kohl 2000:10958649}"	"2-generation family, 2 affected (2M), unaffected heterozygous carrier parents/relatives"	"M"	""	""	""	"0"	""	""	"white"	"10958649-FamCHRO12"
"00173741"	""	""	""	"1"	""	"00006"	"{PMID:Kohl 2000:10958649}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents/relatives"	"F"	""	""	""	"0"	""	""	"white"	"10958649-FamCHRO17"
"00173742"	""	""	""	"3"	""	"00006"	"{PMID:Kohl 2000:10958649}"	"2-generation family, 3 affected (F, 2M), unaffected heterozygous carrier parents/relatives"	"F;M"	""	""	""	"0"	""	""	"white"	"10958649-FamCHRO19"
"00173743"	""	""	""	"3"	""	"00006"	"{PMID:Kohl 2000:10958649}"	"2-generation family, 3 affected (3F), unaffected heterozygous carrier parents/relatives"	"F"	""	""	""	"0"	""	""	"white"	"10958649-FamCHRO56"
"00173744"	""	""	""	"2"	""	"00006"	"{PMID:Kohl 2000:10958649}"	"2-generation family, 2 affected (2M), unaffected heterozygous carrier parents/relatives"	"M"	""	""	""	"0"	""	""	"white"	"10958649-FamCHRO92"
"00173745"	""	""	""	"2"	""	"00006"	"{PMID:Kohl 2000:10958649}"	"2-generation family, 2 affected (F, M), unaffected heterozygous carrier parents/relatives"	"F;M"	""	""	""	"0"	""	""	"white"	"10958649-FamCHRO120"
"00173746"	""	""	""	"3"	""	"00006"	"{PMID:Kohl 2000:10958649}"	"2-generation family, 3 affected (F, 2?), unaffected heterozygous carrier parents/relatives"	"F"	""	""	""	"0"	""	""	"white"	"10958649-FamCHRO182"
"00173747"	""	""	""	"1"	""	"00006"	"{PMID:Kohl 2000:10958649}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents/relatives"	"M"	""	"Micronesia"	""	"0"	""	""	""	"10958649-FamCHRO183"
"00173748"	""	""	""	"1"	""	"00006"	"{PMID:Kohl 2000:10958649}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents/relatives"	"F"	""	""	""	"0"	""	""	"white"	"10958649-FamCHRO184"
"00263131"	""	""	""	"1"	""	"01807"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00294669"	""	""	""	"130"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00294670"	""	""	""	"3"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00294671"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00294672"	""	""	""	"233"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00294673"	""	""	""	"58"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00295560"	""	""	""	"1"	""	"01164"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00305204"	""	""	""	"4"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00305205"	""	""	""	"11"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00305206"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00308499"	""	""	""	"1"	""	"00004"	"{PMID:Holtan 2020:31429209}"	"1 patient with variant in heterozygous or compound heterozygous form"	""	""	"Norway"	""	"0"	""	""	""	""
"00308500"	""	""	""	"1"	""	"00004"	"{PMID:Holtan 2020:31429209}"	"1 patient with variant in heterozygous or compound heterozygous form"	""	""	"Norway"	""	"0"	""	""	""	""
"00309094"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00309095"	""	""	""	"2"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"2 IRD families"	""	""	"Israel"	""	"0"	""	""	""	""
"00309096"	""	""	""	"2"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"2 IRD families"	""	""	"Israel"	""	"0"	""	""	""	""
"00309097"	""	""	""	"5"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"5 IRD families"	""	""	"Israel"	""	"0"	""	""	""	""
"00309098"	""	""	""	"2"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"2 IRD families"	""	""	"Israel"	""	"0"	""	""	""	""
"00309099"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00309100"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00309101"	""	""	""	"2"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"2 IRD families"	""	""	"Israel"	""	"0"	""	""	""	""
"00309102"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00309103"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00319828"	""	""	""	"1"	""	"00008"	"{PMID:Eksandh 2002:12187429}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	"Sweden"	""	"0"	""	""	""	"FamDPatII1"
"00319829"	""	""	""	"1"	""	"00008"	"{PMID:Eksandh 2002:12187429}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	"Sweden"	""	"0"	""	""	""	"FamEPatII1"
"00319830"	""	""	""	"4"	""	"00008"	"{PMID:Eksandh 2002:12187429}"	"3-generation family, 4 affected (F, 3M), unaffected heterozygous carrier parents/relatives"	"M"	""	"Sweden"	""	"0"	""	""	""	"FamFPatIII1"
"00319831"	""	""	"00319830"	"1"	""	"00008"	"{PMID:Eksandh 2002:12187429}"	"sister"	"F"	""	"Sweden"	""	"0"	""	""	""	"FamFPatIII2"
"00319832"	""	""	"00319830"	"1"	""	"00008"	"{PMID:Eksandh 2002:12187429}"	"nephew"	"M"	""	"Sweden"	""	"0"	""	""	""	"FamFPatIII3"
"00319833"	""	""	""	"1"	""	"00008"	"{PMID:Eksandh 2002:12187429}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	"Sweden"	""	"0"	""	""	""	"FamGPatII1"
"00319834"	""	""	""	"1"	""	"00008"	"{PMID:Eksandh 2002:12187429}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	"Sweden"	""	"0"	""	""	""	"FamHPatII1"
"00320042"	""	""	""	"1"	""	"00008"	"{PMID:Johnson 2004:14757870}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00320043"	""	""	""	"1"	""	"00008"	"{PMID:Johnson 2004:14757870}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00320044"	""	""	""	"1"	""	"00008"	"{PMID:Johnson 2004:14757870}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00320048"	""	""	""	"1"	""	"00008"	"{PMID:Johnson 2004:14757870}"	"2nd variant not found. Probably out of the screening scope."	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00320054"	""	""	""	"1"	""	"00008"	"{PMID:Johnson 2004:14757870}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00320055"	""	""	""	"1"	""	"00008"	"{PMID:Johnson 2004:14757870}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00320057"	""	""	""	"1"	""	"00008"	"{PMID:Johnson 2004:14757870}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00320058"	""	""	""	"1"	""	"00008"	"{PMID:Johnson 2004:14757870}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00320060"	""	""	""	"1"	""	"00008"	"{PMID:Johnson 2004:14757870}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00320061"	""	""	""	"1"	""	"00008"	"{PMID:Johnson 2004:14757870}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00320063"	""	""	""	"1"	""	"00008"	"{PMID:Johnson 2004:14757870}"	"2nd variant not found. Probably out of the screening scope."	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00324248"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324251"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324255"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324256"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324258"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324259"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324262"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324263"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324264"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324266"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324268"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324269"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324271"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324272"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324273"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324274"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00324275"	""	""	""	"1"	""	"00008"	"{PMID:Nishiguchi 2005:15712225}"	""	""	""	""	""	"0"	""	""	""	""
"00325487"	""	""	""	"1"	""	"00006"	"{PMID:Zenteno 2020:31736247}"	"single patient"	""	""	"Mexico"	""	"0"	""	""	""	"3580"
"00327935"	""	""	""	"1"	""	"00000"	"{PMID:Carss 2017:28041643}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"B240061"
"00327967"	""	""	""	"1"	""	"00000"	"{PMID:Carss 2017:28041643}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"B240280"
"00328023"	""	""	""	"1"	""	"00000"	"{PMID:Carss 2017:28041643}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"Europe"	"G001290"
"00328135"	""	""	""	"1"	""	"00000"	"{PMID:Carss 2017:28041643}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"Europe"	"G005509"
"00328206"	""	""	""	"1"	""	"00000"	"{PMID:Carss 2017:28041643}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"Europe"	"G007720"
"00328311"	""	""	""	"1"	""	"00000"	"{PMID:Carss 2017:28041643}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"Europe"	"W000192"
"00328338"	""	""	""	"1"	""	"00000"	"{PMID:Carss 2017:28041643}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"Europe"	"W000373"
"00328451"	""	""	""	"1"	""	"00000"	"{PMID:Taylor 2017:28341476}"	"no family history retinal disease"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"14000069"
"00328452"	""	""	""	"1"	""	"00000"	"{PMID:Taylor 2017:28341476}"	"no family history retinal disease"	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"15003158"
"00328453"	""	""	""	"1"	""	"00000"	"{PMID:Taylor 2017:28341476}"	"no family history retinal disease"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"86795"
"00328454"	""	""	""	"1"	""	"00000"	"{PMID:Taylor 2017:28341476}"	"no family history retinal disease"	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"14012482"
"00331296"	""	""	""	"1"	""	"00000"	"{PMID:Wawrocka 2018:29769798}"	""	""	""	"Poland"	""	"0"	""	""	""	"Fam12"
"00331299"	""	""	""	"1"	""	"00000"	"{PMID:Wawrocka 2018:29769798}"	""	""	""	"Poland"	""	"0"	""	""	""	"Fam6"
"00331720"	""	""	""	"1"	""	"00000"	"{PMID:Matet 2018:29618791}"	""	"F"	"yes"	""	""	"0"	""	""	"white"	"Pat9"
"00331721"	""	""	""	"1"	""	"00000"	"{PMID:Matet 2018:29618791}"	""	"F"	"yes"	""	""	"0"	""	""	"Africa-North"	"Pat10"
"00331722"	""	""	""	"1"	""	"00000"	"{PMID:Matet 2018:29618791}"	""	"F"	"no"	""	""	"0"	""	""	"white"	"Pat11"
"00331723"	""	""	""	"1"	""	"00000"	"{PMID:Mayer 2017:28795510}, {PMID:Matet 2018:29618791}"	""	"M"	"no"	""	""	"0"	""	""	"white"	"?;Pat12"
"00331724"	""	""	""	"2"	""	"00000"	"{PMID:Mayer 2017:28795510}, {PMID:Matet 2018:29618791}"	"2-generation family, 2 affected sisters, unaffected heterozygous carrier parents/relatives"	"F"	"no"	""	""	"0"	""	""	"white"	"CHRO909-24852;Pat13"
"00331725"	""	""	"00331724"	"1"	""	"00000"	"{PMID:Mayer 2017:28795510}, {PMID:Matet 2018:29618791}"	"sister"	"F"	"no"	""	""	"0"	""	""	"white"	"CHRO909-24852;Pat15"
"00331726"	""	""	""	"1"	""	"00000"	"{PMID:Mayer 2017:28795510}, {PMID:Matet 2018:29618791}"	""	"F"	"no"	""	""	"0"	""	""	"white"	"?;Pat14"
"00332192"	""	""	""	"1"	""	"00000"	"{PMID:Bryant 2018:29343940}"	""	""	""	"United States"	""	"0"	""	""	""	"JB426"
"00332227"	""	""	""	"1"	""	"00000"	"{PMID:Bryant 2018:29343940}"	""	""	""	"United States"	""	"0"	""	""	""	"JB188"
"00332278"	""	""	""	"1"	""	"00000"	"{PMID:Porto 2017:29186038}"	"proband"	""	""	"Brazil"	""	"0"	""	""	""	"Fam5PatFBP_3"
"00332288"	""	""	""	"1"	""	"00000"	"{PMID:Porto 2017:29186038}"	"proband"	""	""	"Brazil"	""	"0"	""	""	""	"Fam33PatFBP_171"
"00332404"	""	""	""	"1"	""	"00000"	"{PMID:Rim 2017:29145603}"	""	"F"	""	"Korea"	""	"0"	""	""	""	"Pat25"
"00332451"	""	""	""	"1"	""	"00000"	"{PMID:Di Iorio 2017:29053603}"	""	""	""	"Italy"	""	"0"	""	""	""	"Pat8"
"00332452"	""	""	""	"1"	""	"00000"	"{PMID:Di Iorio 2017:29053603}"	""	""	""	"Italy"	""	"0"	""	""	""	"Pat9"
"00332453"	""	""	""	"1"	""	"00000"	"{PMID:Di Iorio 2017:29053603}"	""	""	""	"Italy"	""	"0"	""	""	""	"Pat10"
"00333337"	""	""	""	"1"	""	"00000"	"{PMID:Sheremet 2017:28980559}"	"patient"	"F"	""	"Russia"	""	"0"	""	""	""	"Pat23"
"00333430"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2017:28838317}"	""	""	""	"United States"	""	"0"	""	""	""	"RD13–08"
"00333635"	""	""	""	"1"	""	"00000"	"{PMID:Stone 2017:28559085}"	"1 affected"	"F"	""	"(United States)"	""	"0"	""	""	""	"461"
"00333985"	""	""	""	"2"	""	"00000"	"{PMID:Stone 2017:28559085}"	"family, 2 affected"	"F"	""	"(United States)"	""	"0"	""	""	""	"457"
"00333986"	""	""	""	"1"	""	"00000"	"{PMID:Stone 2017:28559085}"	"1 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"458"
"00333987"	""	""	""	"2"	""	"00000"	"{PMID:Stone 2017:28559085}"	"family, 2 affected"	"F"	""	"(United States)"	""	"0"	""	""	""	"459"
"00333988"	""	""	""	"2"	""	"00000"	"{PMID:Stone 2017:28559085}"	"family, 2 affected"	"M"	""	"(United States)"	""	"0"	""	""	""	"460"
"00334379"	""	""	""	"1"	""	"03971"	"Mena et al., 2020 submitted."	""	"M"	"no"	"Argentina"	""	""	""	""	""	""
"00334461"	""	""	""	"1"	""	"00000"	"{PMID:Habibi 2016:27874104}"	"family"	""	""	"Tunisia"	""	"0"	""	""	""	"F1"
"00334896"	""	""	""	"1"	""	"00000"	"{PMID:Li 2017:28418496}"	""	""	""	"Pakistan"	""	"0"	""	""	""	"61221"
"00335106"	""	""	""	"1"	""	"00000"	"{PMID:Haer-Wigman 2017:28224992}"	"patient"	""	"no"	"Netherlands"	""	"0"	""	""	""	"5612"
"00335107"	""	""	""	"1"	""	"00000"	"{PMID:Haer-Wigman 2017:28224992}"	"patient"	""	"no"	"Netherlands"	""	"0"	""	""	""	"9644"
"00335110"	""	""	""	"1"	""	"00000"	"{PMID:Haer-Wigman 2017:28224992}"	"patient"	""	"yes"	"Netherlands"	""	"0"	""	""	""	"5462"
"00335227"	""	""	""	"1"	""	"00000"	"{PMID:Riera 2017:28181551}"	"patient"	""	""	"Spain"	""	"0"	""	""	""	"Fi15/14"
"00335335"	""	""	""	"1"	""	"02485"	"{PMID:Bravo-Gil 2017:28157192}"	""	""	""	"Spain"	""	"0"	""	""	""	"Pat26"
"00335485"	""	""	""	"1"	""	"00000"	"{PMID:Bernardis 2016:28127548}"	" "	""	""	"Italy"	""	"0"	""	""	""	"IRD032"
"00335969"	""	""	""	"1"	""	"00000"	"{PMID:Sergouniotis 2016:27628848}"	"analysis 486 cases"	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00358969"	""	""	""	"1"	""	"00000"	"{PMID:Tiwari 2016:27353947}"	"see paper"	"F"	""	"Switzerland"	""	"0"	""	""	""	"Case71133"
"00359004"	""	""	""	"1"	""	"00000"	"{PMID:Ellingford 2016:27208204}"	"patient"	""	""	""	""	"0"	""	""	""	"12004242"
"00359011"	""	""	""	"1"	""	"00000"	"{PMID:Ellingford 2016:27208204}"	"patient"	""	""	""	""	"0"	""	""	""	"13002658"
"00359014"	""	""	""	"1"	""	"00000"	"{PMID:Ellingford 2016:27208204}"	"patient"	""	""	""	""	"0"	""	""	""	"13000861"
"00359017"	""	""	""	"1"	""	"00000"	"{PMID:Ellingford 2016:27208204}"	"patient"	""	""	""	""	"0"	""	""	""	"13002676"
"00359018"	""	""	""	"1"	""	"00000"	"{PMID:Ellingford 2016:27208204}"	"patient"	""	""	""	""	"0"	""	""	""	"13015850"
"00359019"	""	""	""	"1"	""	"00000"	"{PMID:Ellingford 2016:27208204}"	"patient"	""	""	""	""	"0"	""	""	""	"12006121"
"00359020"	""	""	""	"1"	""	"00000"	"{PMID:Ellingford 2016:27208204}"	"patient"	""	""	""	""	"0"	""	""	""	"12001563"
"00359619"	""	""	""	"1"	""	"01807"	""	""	"M"	""	""	""	"0"	""	""	""	""
"00362141"	""	""	""	"1"	""	"00006"	"{PMID:Huang 2013:23776498}, {PMID:Huang 2016:26992781}"	""	""	""	"China"	""	"0"	""	""	""	"QT455"
"00362142"	""	""	""	"1"	""	"00006"	"{PMID:Huang 2016:26992781}"	""	""	""	"China"	""	"0"	""	""	""	"QT534"
"00362143"	""	""	""	"1"	""	"00006"	"{PMID:Huang 2013:23776498}, {PMID:Huang 2016:26992781}"	""	""	""	"China"	""	"0"	""	""	""	"QT628"
"00362920"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2016:26766544}"	"family"	""	""	"Germany"	""	"0"	""	""	""	"CHRO89"
"00373342"	""	""	""	"3"	""	"00006"	"{PMID:Saqib 2015:25943428}, {DOI:Saqib 2015:10.1038/srep09965}"	"4-generation family, 3 affected (2F, M), unaffected heterozygous carrier parents/relatives"	"F;M"	"yes"	"Pakistan"	""	"0"	""	""	""	"FamMA94"
"00373872"	""	""	""	"1"	""	"00000"	"{PMID:Consugar 2015:25412400}"	""	""	""	"United States"	""	"0"	""	""	""	"OGI-494-1018"
"00373873"	""	""	""	"1"	""	"00000"	"{PMID:Consugar 2015:25412400}"	""	""	""	"United States"	""	"0"	""	""	""	"OGI-509-1049"
"00374994"	""	""	""	"1"	""	"00000"	"{PMID:Dubis 2015:25277229}"	""	"M"	""	""	""	"0"	""	""	""	"JC_1208"
"00374995"	""	""	""	"1"	""	"00000"	"{PMID:Dubis 2015:25277229}"	""	"M"	""	""	""	"0"	""	""	""	"MM_0004"
"00374996"	""	""	""	"1"	""	"00000"	"{PMID:Dubis 2015:25277229}"	""	"M"	""	""	""	"0"	""	""	""	"MM_0005"
"00374997"	""	""	""	"1"	""	"00000"	"{PMID:Dubis 2015:25277229}"	""	"F"	""	""	""	"0"	""	""	""	"MM_0029"
"00374998"	""	""	""	"1"	""	"00000"	"{PMID:Dubis 2015:25277229}"	""	"F"	""	""	""	"0"	""	""	""	"MM_0085"
"00375356"	""	""	""	"2"	""	"00000"	"{PMID:Greenberg 2014:24504161}"	"family, 2 affected"	""	""	"United States"	""	"0"	""	""	""	"Fam1Pat1"
"00375358"	""	""	""	"1"	""	"00000"	"{PMID:Greenberg 2014:24504161}"	"patient"	""	""	"United States"	""	"0"	""	""	""	"Pat4"
"00375359"	""	""	"00375356"	"1"	""	"00000"	"{PMID:Greenberg 2014:24504161}"	"sib"	""	""	"United States"	""	"0"	""	""	""	"Fam1Pat5"
"00375364"	""	""	""	"1"	""	"00000"	"{PMID:Greenberg 2014:24504161}"	"patient"	""	""	"United States"	""	"0"	""	""	""	"Pat10"
"00375365"	""	""	""	"2"	""	"00000"	"{PMID:Greenberg 2014:24504161}"	"family, 2 affected"	""	""	"United States"	""	"0"	""	""	""	"Fam2Pat11"
"00376303"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:18487375}"	""	""	""	"Finland"	""	"0"	""	""	"Finnish"	""
"00376304"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:18487375}"	""	""	""	"Finland"	""	"0"	""	""	"Finnish"	""
"00377007"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2010:20079539}"	""	"M"	""	"Netherlands"	""	"0"	""	""	""	""
"00377008"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2010:20079539}"	""	"M"	""	"Netherlands"	""	"0"	""	""	""	""
"00377009"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2010:20079539}"	""	"M"	""	"Netherlands"	""	"0"	""	""	""	""
"00377010"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2010:20079539}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00377011"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2010:20079539}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00377016"	""	""	""	"37"	""	"00000"	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00377017"	""	""	""	"10"	""	"00000"	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00377018"	""	""	""	"4"	""	"00000"	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00377019"	""	""	""	"2"	""	"00000"	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00377020"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00377021"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00377022"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00377023"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00377024"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00377025"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Netherlands"	""	"0"	""	""	""	""
"00377180"	""	""	""	"1"	""	"00000"	"Tracewska 2021, MolVis in press"	"proband"	"M"	"no"	"Poland"	""	"0"	"yes"	""	"Slavic"	"251"
"00377199"	""	""	""	"1"	""	"00000"	"Tracewska 2021, MolVis in press"	"proband"	"M"	"no"	"Poland"	""	"0"	"yes"	""	"Slavic"	"276"
"00377223"	""	""	""	"1"	""	"00000"	"Tracewska 2021, MolVis in press"	"proband"	"M"	"no"	"Poland"	""	"0"	"yes"	""	"Slavic"	"326"
"00377243"	""	""	""	"1"	""	"00000"	"Tracewska 2021, MolVis in press"	"proband"	"F"	"no"	"Poland"	""	"0"	"yes"	""	"Slavic"	"355"
"00377700"	""	""	""	"1"	""	"00000"	"{PMID:Azam 2010:20454696}"	""	"F"	"no"	"Pakistan"	""	"0"	""	""	"Pakistani"	""
"00377701"	""	""	""	"1"	""	"00000"	"{PMID:Azam 2010:20454696}"	""	"F"	"no"	"Pakistan"	""	"0"	""	""	"Pakistani"	""
"00377702"	""	""	""	"1"	""	"00000"	"{PMID:Azam 2010:20454696}"	""	"F"	"no"	"Pakistan"	""	"0"	""	""	"Pakistani"	""
"00377703"	""	""	""	"1"	""	"00000"	"{PMID:Azam 2010:20454696}"	""	"F"	"no"	"Pakistan"	""	"0"	""	""	"Pakistani"	""
"00377704"	""	""	""	"1"	""	"00000"	"{PMID:Azam 2010:20454696}"	""	"F"	"no"	"Pakistan"	""	"0"	""	""	"Pakistani"	""
"00377705"	""	""	""	"1"	""	"00000"	"{PMID:Azam 2010:20454696}"	""	"M"	"no"	"Pakistan"	""	"0"	""	""	"Pakistani"	""
"00377706"	""	""	""	"1"	""	"00000"	"{PMID:Azam 2010:20454696}"	""	"F"	"no"	"Pakistan"	""	"0"	""	""	"Pakistani"	""
"00377707"	""	""	""	"1"	""	"00000"	"{PMID:Azam 2010:20454696}"	""	"M"	"no"	"Pakistan"	""	"0"	""	""	"Pakistani"	""
"00377963"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2012:22264887}"	""	""	"no"	""	""	"0"	""	""	""	""
"00377975"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2012:22264887}"	""	""	"no"	""	""	"0"	""	""	""	""
"00377983"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2012:22264887}"	""	""	"no"	""	""	"0"	""	""	""	""
"00377984"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2012:22264887}"	""	""	"no"	""	""	"0"	""	""	""	""
"00377985"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2012:22264887}"	""	""	"no"	""	""	"0"	""	""	""	""
"00377986"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2012:22264887}"	""	""	"no"	""	""	"0"	""	""	""	""
"00377987"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2012:22264887}"	""	""	"no"	""	""	"0"	""	""	""	""
"00377988"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2012:22264887}"	""	""	"no"	""	""	"0"	""	""	""	""
"00377989"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2012:22264887}"	""	""	"no"	""	""	"0"	""	""	""	""
"00377992"	""	""	""	"1"	""	"00000"	"{PMID:Thiadens_2012:22264887}"	"novel"	""	"no"	""	""	"0"	""	""	""	""
"00380187"	""	""	""	"1"	""	"00000"	"{PMID:Ezquerra-Inchausti 2018:30337596}"	"Family RP175, II:1"	"?"	"no"	"Spain"	""	"0"	""	""	""	"II:1"
"00380872"	""	""	""	"1"	""	"00000"	"{PMID:Perez-Carro 2018:29912909}"	"family RP-0605b"	"M"	"yes"	"Spain"	""	"0"	""	""	""	"RP-0605b"
"00381123"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"M"	""	""	""	"0"	""	""	""	""
"00381124"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"M"	""	""	""	"0"	""	""	""	""
"00381125"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"F"	""	""	""	"0"	""	""	""	""
"00381126"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"F"	""	""	""	"0"	""	""	""	""
"00381127"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"F"	""	""	""	"0"	""	""	""	""
"00381128"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"M"	""	""	""	"0"	""	""	""	""
"00381129"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"F"	""	""	""	"0"	""	""	""	""
"00381130"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"M"	""	""	""	"0"	""	""	""	""
"00381131"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"M"	""	""	""	"0"	""	""	""	""
"00381132"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"M"	""	""	""	"0"	""	""	""	""
"00381133"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"M"	""	""	""	"0"	""	""	""	""
"00381134"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"M"	""	""	""	"0"	""	""	""	""
"00381135"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"F"	""	""	""	"0"	""	""	""	""
"00381136"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"F"	""	""	""	"0"	""	""	""	""
"00381137"	""	""	""	"1"	""	"00008"	"{PMID:Sundaram_2014:24148654}"	""	"M"	""	""	""	"0"	""	""	""	""
"00381795"	""	""	""	"1"	""	"00000"	"{PMID:Corton-2013:23940504}"	""	""	"no"	""	""	"0"	""	""	"Spanish"	"P-10-1367"
"00381796"	""	""	""	"1"	""	"00000"	"{PMID:Corton-2013:23940504}"	""	""	"no"	""	""	"0"	""	""	"Spanish"	"P-04-0834"
"00381963"	""	""	""	"1"	""	"00000"	"{PMID:Burkhard 2018:30418171}"	""	"M"	"no"	""	""	"0"	""	""	""	"1"
"00381964"	""	""	""	"1"	""	"00000"	"{PMID:Burkhard 2018:30418171}"	""	"M"	"no"	""	""	"0"	""	""	""	"2"
"00381965"	""	""	""	"1"	""	"00000"	"{PMID:Burkhard 2018:30418171}"	""	"F"	"no"	""	""	"0"	""	""	""	"3"
"00381966"	""	""	""	"1"	""	"00000"	"{PMID:Burkhard 2018:30418171}"	""	"M"	"no"	""	""	"0"	""	""	""	"4"
"00381967"	""	""	""	"1"	""	"00000"	"{PMID:Burkhard 2018:30418171}"	""	"F"	"no"	""	""	"0"	""	""	""	"7"
"00381968"	""	""	""	"1"	""	"00000"	"{PMID:Burkhard 2018:30418171}"	""	"F"	"no"	""	""	"0"	""	""	""	"8"
"00381969"	""	""	""	"1"	""	"00000"	"{PMID:Burkhard 2018:30418171}"	""	"F"	"no"	""	""	"0"	""	""	""	"9"
"00381970"	""	""	""	"1"	""	"00000"	"{PMID:Burkhard 2018:30418171}"	""	"F"	"no"	""	""	"0"	""	""	""	"10"
"00381971"	""	""	""	"1"	""	"00000"	"{PMID:Burkhard 2018:30418171}"	""	"F"	"no"	""	""	"0"	""	""	""	"12"
"00381972"	""	""	""	"1"	""	"00000"	"{PMID:Burkhard 2018:30418171}"	""	"M"	"no"	""	""	"0"	""	""	""	"13"
"00381973"	""	""	""	"1"	""	"00000"	"{PMID:Burkhard 2018:30418171}"	""	"F"	"no"	""	""	"0"	""	""	""	"14"
"00381974"	""	""	""	"1"	""	"00000"	"{PMID:Burkhard 2018:30418171}"	""	"M"	"no"	""	""	"0"	""	""	""	"15"
"00381975"	""	""	""	"1"	""	"00000"	"{PMID:Burkhard 2018:30418171}"	""	"M"	"no"	""	""	"0"	""	""	""	"16"
"00382128"	""	""	""	"1"	""	"00000"	"{PMID:Patel 2019:30653986}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"266"
"00382129"	""	""	""	"1"	""	"00000"	"{PMID:Patel 2019:30653986}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"271"
"00382130"	""	""	""	"1"	""	"00000"	"{PMID:Patel 2019:30653986}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"279"
"00382131"	""	""	""	"1"	""	"00000"	"{PMID:Patel 2019:30653986}"	""	"?"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"333"
"00382259"	""	""	""	"1"	""	"00000"	"{PMID:Jespersgaar 2019:30718709}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	"88"
"00382260"	""	""	""	"1"	""	"00000"	"{PMID:Jespersgaar 2019:30718709}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	"89"
"00382261"	""	""	""	"1"	""	"00000"	"{PMID:Jespersgaar 2019:30718709}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	"90"
"00382262"	""	""	""	"1"	""	"00000"	"{PMID:Jespersgaar 2019:30718709}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	"91"
"00382263"	""	""	""	"1"	""	"00000"	"{PMID:Jespersgaar 2019:30718709}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	"92"
"00382264"	""	""	""	"1"	""	"00000"	"{PMID:Jespersgaar 2019:30718709}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	"93"
"00382424"	""	""	""	"1"	""	"00000"	"{PMID:Jespersgaar 2019:30718709}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	"253"
"00382528"	""	""	""	"1"	""	"00000"	"{PMID:Jespersgaar 2019:30718709}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	"390"
"00382634"	""	""	""	"1"	""	"00000"	"{PMID:Gonzalez del Pozo 2018:30190494}"	""	"?"	"no"	"Spain"	""	"0"	""	""	""	"B (II:1)"
"00382660"	""	""	""	"1"	""	"00000"	"{PMID:Gonzalez del Pozo 2018:30190494}"	""	"?"	"no"	"Spain"	""	"0"	""	""	""	"AB (II:1)"
"00382793"	""	""	""	"1"	""	"00000"	"{PMID:Azam-2011:21987686}"	""	""	"yes"	"Pakistan"	""	"0"	""	""	"pakistani"	""
"00383418"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2019:31725702}"	""	"M"	""	""	""	"0"	""	""	""	""
"00383419"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2019:31725702}"	""	"F"	""	""	""	"0"	""	""	""	""
"00386176"	""	""	""	"1"	""	"00000"	"{PMID:Rodriguez-Munoz 2020:32036094}"	"family fRPN-132, proband"	"M"	""	"Spain"	""	"0"	""	""	""	"RPN-289"
"00386179"	""	""	""	"1"	""	"00000"	"{PMID:Rodriguez-Munoz 2020:32036094}"	"family fRPN-134, proband"	"F"	""	"Spain"	""	"0"	""	""	""	"RPN-291"
"00386201"	""	""	""	"1"	""	"00000"	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"?"	""	"Spain"	""	"0"	""	""	""	"RPN-320"
"00386212"	""	""	""	"1"	""	"00000"	"{PMID:Rodriguez-Munoz 2020:32036094}"	"family fRPN-167, proband"	"F"	""	"Spain"	""	"0"	""	""	""	"RPN-333"
"00386213"	""	""	""	"1"	""	"00000"	"{PMID:Rodriguez-Munoz 2020:32036094}"	"family fRPN-167, family member"	"F"	""	"Spain"	""	"0"	""	""	""	"RPN-334"
"00386224"	""	""	""	"1"	""	"00000"	"{PMID:Rodriguez-Munoz 2020:32036094}"	"family fRPN-183, proband"	"F"	""	"Spain"	""	"0"	""	""	""	"RPN-402"
"00386269"	""	""	""	"1"	""	"00000"	"{PMID:Rodriguez-Munoz 2020:32036094}"	"family fRPN-50, proband"	"F"	""	"Spain"	""	"0"	""	""	""	"RPN-125"
"00386274"	""	""	""	"1"	""	"00000"	"{PMID:Rodriguez-Munoz 2020:32036094}"	"family fRPN-66, proband"	"M"	""	"Spain"	""	"0"	""	""	""	"RPN-170"
"00386275"	""	""	""	"1"	""	"00000"	"{PMID:Rodriguez-Munoz 2020:32036094}"	"family fRPN-66, family member"	"M"	""	"Spain"	""	"0"	""	""	""	"RPN-171"
"00386277"	""	""	""	"1"	""	"00000"	"{PMID:Rodriguez-Munoz 2020:32036094}"	"family fRPN-68, proband"	"F"	""	"Spain"	""	"0"	""	""	""	"RPN-173"
"00386291"	""	""	""	"1"	""	"00000"	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"?"	""	"Spain"	""	"0"	""	""	""	"RP-632"
"00386699"	""	""	""	"1"	""	"00000"	"{PMID:Zampaglione 2020:32037395}"	""	"?"	""	""	""	"0"	""	""	""	"OGI1559_002774"
"00386751"	""	""	""	"1"	""	"00000"	"{PMID:Zampaglione 2020:32037395}"	""	"?"	""	""	""	"0"	""	""	""	"OGI2897_004482"
"00388482"	""	""	""	"1"	""	"00000"	"{PMID:Ellingford 2017:28378820}, {PMID:Ellingsford 2018:29074561}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"15010867"
"00388767"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 27, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"51"
"00389800"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 718, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1084"
"00389815"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 737, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1099"
"00389849"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 782, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1133"
"00389850"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 782, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1134"
"00389851"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 783, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1135"
"00389866"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 815, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1150"
"00389873"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 822, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1157"
"00389874"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 823, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1158"
"00389884"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 837, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1168"
"00389888"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 847, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1172"
"00389889"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 847, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1173"
"00389891"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 852, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1175"
"00389892"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 856, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1176"
"00389895"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 870, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1179"
"00389896"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 870, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1180"
"00389897"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 870, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1181"
"00389899"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 871, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1183"
"00389901"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 872, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1185"
"00389904"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 876, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1188"
"00389914"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 898, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1198"
"00389931"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 950, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1215"
"00389996"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1099, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1280"
"00389998"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1108, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1282"
"00389999"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1109, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1283"
"00390002"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1124, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1286"
"00390003"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1126, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1287"
"00390005"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1136, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1289"
"00390011"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1145, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1295"
"00390012"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1145, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1296"
"00390013"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1148, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1297"
"00390014"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1156, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1298"
"00390016"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1160, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1300"
"00390017"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1169, achromatopsia, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"1301"
"00390018"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1177, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1302"
"00390019"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 1183, achromatopsia, no patient Ids, consecutive numbers given"	"F"	""	"Germany"	""	"0"	""	""	""	"1303"
"00390229"	""	""	""	"1"	""	"00000"	"{PMID:Turro 2020:32581362}"	"only individuals with mutations in retinal disease genes from this publication were inserted into LOVD"	"?"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"G001290"
"00390230"	""	""	""	"1"	""	"00000"	"{PMID:Turro 2020:32581362}"	"only individuals with mutations in retinal disease genes from this publication were inserted into LOVD"	"?"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"G005509"
"00390231"	""	""	""	"1"	""	"00000"	"{PMID:Turro 2020:32581362}"	"only individuals with mutations in retinal disease genes from this publication were inserted into LOVD"	"?"	""	"(United Kingdom (Great Britain))"	""	"0"	""	""	""	"G007720"
"00390232"	""	""	""	"1"	""	"00000"	"{PMID:Turro 2020:32581362}"	"only individuals with mutations in retinal disease genes from this publication were inserted into LOVD"	"?"	""	""	""	"0"	""	""	""	"G009842"
"00390233"	""	""	""	"1"	""	"00000"	"{PMID:Turro 2020:32581362}"	"only individuals with mutations in retinal disease genes from this publication were inserted into LOVD"	"?"	""	""	""	"0"	""	""	""	"G012357"
"00390234"	""	""	""	"1"	""	"00000"	"{PMID:Turro 2020:32581362}"	"only individuals with mutations in retinal disease genes from this publication were inserted into LOVD"	"?"	""	""	""	"0"	""	""	""	"W000192"
"00390235"	""	""	""	"1"	""	"00000"	"{PMID:Turro 2020:32581362}"	"only individuals with mutations in retinal disease genes from this publication were inserted into LOVD"	"?"	""	""	""	"0"	""	""	""	"W000373"
"00390743"	""	""	""	"1"	""	"00000"	"{PMID:Habibi 2020:32641690}"	"Family F25, patient II.1"	"M"	""	"Tunisia"	""	"0"	""	""	""	"F25_II.1"
"00390869"	""	""	""	"1"	""	"00000"	"{PMID:Maggi_2021:33546218}"	""	"F"	""	"Switzerland"	""	"0"	""	""	""	""
"00390931"	""	""	""	"1"	""	"00000"	"{PMID:Maggi_2021:33546218}"	""	"M"	""	"Switzerland"	""	"0"	""	""	""	""
"00390958"	""	""	""	"1"	""	"00000"	"{PMID:Maggi_2021:33546218}"	""	"F"	""	"Switzerland"	""	"0"	""	""	""	""
"00391018"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO117"
"00391019"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO26"
"00391020"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO31"
"00391021"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO210"
"00391022"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO274"
"00391023"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO522"
"00391024"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO915"
"00391025"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO1205"
"00391026"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO1076"
"00391027"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO906"
"00391028"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO985"
"00391029"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO1097"
"00391030"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO771"
"00391031"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO667"
"00391032"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO273"
"00391033"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO658"
"00391034"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO983"
"00391035"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO1138"
"00391036"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"ZD216"
"00391037"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO1069"
"00391038"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"ZD54"
"00391039"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"MDS155"
"00391040"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO99"
"00391041"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO483"
"00391042"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO216"
"00391043"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO100"
"00391044"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO262"
"00391045"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO378"
"00391046"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO480"
"00391047"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO425"
"00391048"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"RCD246"
"00391049"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"MST137"
"00391050"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"ZD203"
"00391051"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO559"
"00391052"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO675"
"00391053"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO959"
"00391054"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	""	""	""	""	""	"0"	""	""	""	"CHRO691"
"00391055"	""	""	""	"2"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 425,CHRO 216"
"00391056"	""	""	""	"4"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 771,CHRO 1076,CHRO 985,CHRO 26"
"00391057"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 675"
"00391058"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"RCD 246"
"00391059"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 915"
"00391060"	""	""	""	"2"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 100,CHRO 262"
"00391061"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"MST 137"
"00391062"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"ZD 203"
"00391063"	""	""	""	"2"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 100,CHRO 262"
"00391064"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"RCD 246"
"00391065"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"MDS 155"
"00391066"	""	""	""	"2"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"MST 137,CHRO 559"
"00391067"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"RCD 246"
"00391068"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 216"
"00391069"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 1069"
"00391070"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 274"
"00391071"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 100"
"00391072"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 425"
"00391073"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 1097"
"00391074"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 667"
"00391075"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 522"
"00391076"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"MST 137"
"00391077"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"MST 137"
"00391078"	""	""	""	"2"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO425"
"00391079"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 1097"
"00391080"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"ZD 54"
"00391081"	""	""	""	"1"	""	"04752"	"{PMID:Weisschuh 2020:31544997}, Rawnsley 2025, submitted"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	"Germany"	""	"0"	""	""	""	"CHRO959"
"00391082"	""	""	""	"4"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"MST 137,ZD 203,CHRO 559,RCD 246"
"00391083"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"RCD 246"
"00391084"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 559"
"00391085"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 31"
"00391086"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 985"
"00391087"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 675"
"00391088"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 1205"
"00391089"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"ZD 203"
"00391090"	""	""	""	"2"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 425,CHRO 216"
"00391091"	""	""	""	"2"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 425,CHRO 216"
"00391092"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"ZD 54"
"00391093"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 274"
"00391094"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 771"
"00391095"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 915"
"00391096"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 675"
"00391097"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"ZD 203"
"00391098"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 915"
"00391099"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2020:31544997}"	"analysis complete CNGB3 gene in achromatopsia cases"	""	""	""	""	"0"	""	""	""	"CHRO 274"
"00391100"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Iraq;Turkey"	""	"0"	""	""	"Jewish"	"MOL0956-1"
"00391101"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"yes"	"Iraq"	""	"0"	""	""	"Jewish"	"MOL1029-1"
"00391102"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Iraq;Spain;Yugoslavia"	""	"0"	""	""	"Jewish-mixed"	"MOL1249-1"
"00391103"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"yes"	"Iraq"	""	"0"	""	""	"Jewish"	"MOL1269-1"
"00391104"	""	""	""	"3"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	"family, 3 affected"	""	"yes"	"Tunisia"	""	"0"	""	""	"Jewish"	"MOL1548-1"
"00391105"	""	""	"00391104"	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"yes"	"Tunisia"	""	"0"	""	""	"Jewish"	"MOL1548-2"
"00391106"	""	""	"00391104"	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"yes"	"Tunisia"	""	"0"	""	""	"Jewish"	"MOL1548-3"
"00391107"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Iraq;Romania;Poland"	""	"0"	""	""	"Jewish-mixed"	"MOL0661-1"
"00391108"	""	""	""	"2"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	"family, 2 affected"	""	"no"	"Tunisia;Turkey;Algeria"	""	"0"	""	""	"Jewish-mixed"	"MOL0831-1"
"00391109"	""	""	"00391108"	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Tunisia;Turkey;Algeria"	""	"0"	""	""	"Jewish-mixed"	"MOL0831-3"
"00391110"	""	""	""	"2"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	"family, 2 affected"	""	"no"	"Israel"	""	"0"	""	""	"Jewish-Ashkenazi"	"MOL1277-1"
"00391111"	""	""	"00391110"	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Israel"	""	"0"	""	""	"Jewish-Ashkenazi"	"MOL1277-2"
"00391112"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Iraq;Austria"	""	"0"	""	""	"Jewish-mixed"	"MOL1505-1"
"00391113"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Iraq;Morocco;Turkey"	""	"0"	""	""	"Jewish-mixed"	"MOL1848-1"
"00391114"	""	""	""	"2"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	"family, 2 affected"	""	"no"	"Egypt;Iraq"	""	"0"	""	""	"Jewish-mixed"	"MOL1894-1"
"00391115"	""	""	"00391114"	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Egypt;Iraq"	""	"0"	""	""	"Jewish-mixed"	"MOL1894-2"
"00391116"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Yemen;Bulgaria;Ukraine"	""	"0"	""	""	"Jewish-mixed"	"MOL1954-1"
"00391117"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"yes"	"Morocco"	""	"0"	""	""	"Jewish"	"MOL0686-1"
"00391118"	""	""	""	"2"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	"family, 2 affected"	""	"yes"	"Tunisia"	""	"0"	""	""	"Jewish"	"MOL0831-4"
"00391119"	""	""	"00391118"	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"yes"	"Tunisia"	""	"0"	""	""	"Jewish"	"MOL0831-5"
"00391120"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Morocco"	""	"0"	""	""	"Jewish"	"MOL1136-1"
"00391121"	""	""	""	"2"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	"family, 2 affected"	""	"no"	"Morocco"	""	"0"	""	""	"Jewish"	"MOL1391-1"
"00391122"	""	""	"00391121"	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Morocco"	""	"0"	""	""	"Jewish"	"MOL1391-2"
"00391123"	""	""	""	"2"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	"family, 2 affected"	""	"no"	"Algeria;Morocco"	""	"0"	""	""	"Jewish-mixed"	"RD175-1"
"00391124"	""	""	"00391123"	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Algeria;Morocco"	""	"0"	""	""	"Jewish-mixed"	"RD175-2"
"00391125"	""	""	""	"2"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	"family, 2 affected"	""	"no"	"Israel"	""	"0"	""	""	"Jewish-Ashkenazi"	"MOL0012-1"
"00391126"	""	""	"00391125"	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Israel"	""	"0"	""	""	"Jewish-Ashkenazi"	"MOL0012-3"
"00391127"	""	""	""	"2"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	"family, 2 affected"	""	"yes"	"Israel"	""	"0"	""	""	"Bedouin"	"MOL0360-1"
"00391128"	""	""	"00391127"	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"yes"	"Israel"	""	"0"	""	""	"Bedouin"	"MOL0360-2"
"00391129"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Georgia"	""	"0"	""	""	"Jew"	"MOL1173-1"
"00391130"	""	""	""	"2"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	"family, 2 affected"	""	"no"	"Georgia"	""	"0"	""	""	"Jew"	"MOL0663-1"
"00391131"	""	""	"00391130"	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Georgia"	""	"0"	""	""	"Jew"	"MOL0663-2"
"00391132"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Israel"	""	"0"	""	""	"Jewish-Ashkenazi"	"MOL1190-1"
"00391133"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"no"	"Israel"	""	"0"	""	""	"Jewish-Ashkenazi"	"MOL0344-1"
"00391134"	""	""	""	"1"	""	"00006"	"{PMID:Aweidah 2021:34703197}"	""	""	"yes"	"Israel"	""	"0"	""	""	"Arab;Christian"	"MOL1535-1"
"00391290"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO1060-27431"
"00391291"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO1069-27694"
"00391292"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO1076-27826"
"00391293"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO1097-28129"
"00391294"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO117-8606"
"00391295"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO210-9243"
"00391296"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO216-24045"
"00391297"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO26-26519"
"00391298"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO262-26515"
"00391299"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO274¥-10390"
"00391300"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO31-7406"
"00391301"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO317-26573"
"00391302"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO378-26574"
"00391303"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO480-15977"
"00391304"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO483-15873"
"00391305"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO522-16415"
"00391306"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO541-16860"
"00391307"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO667-19394"
"00391308"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO675-19472"
"00391309"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO745-26520"
"00391310"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO771-26494"
"00391311"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO906-27827"
"00391312"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO915-24866"
"00391313"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO959-25462"
"00391314"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO985-25801"
"00391315"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO99-26512"
"00391316"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"MDS155-20135"
"00391317"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"MST137-8706"
"00391318"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"RCD246-1859"
"00391319"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"ZD203-13696"
"00391320"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"ZD216-14225"
"00391321"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"ZD221-14803"
"00391322"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"BCM67-26535"
"00391323"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"CHRO1012-26581"
"00391324"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	""	""	"0"	""	""	""	"CHRO290-10754"
"00391325"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected parents"	"F"	""	""	""	"0"	""	""	""	"CHRO42-7872"
"00391326"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	""	""	"0"	""	""	""	"CHRO474-26514"
"00391327"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected parents"	"F"	""	""	""	"0"	""	""	""	"CHRO547-16660"
"00391328"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected parents2"	"F"	""	""	""	"0"	""	""	""	"CHRO582-17987"
"00391329"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	""	""	"0"	""	""	""	"CHRO661-19270"
"00391330"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"CHRO794-26508"
"00391331"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	""	""	"0"	""	""	""	"CHRO820-26509"
"00391332"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"CHRO887-26510"
"00391333"	""	""	""	"2"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 2 affected (F, M), unaffected heterozygous carrier parents"	"F;M"	""	""	""	"0"	""	""	""	"CHRO896-26511"
"00391334"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	""	""	"0"	""	""	""	"CHRO994-26076"
"00391335"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected parents"	"M"	""	""	""	"0"	""	""	""	"CHRO996-26158"
"00391336"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	""	""	"0"	""	""	""	"ZD525-24764"
"00391337"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2-generation family, 1 affected, unaffected parents"	"M"	""	""	""	"0"	""	""	""	"CHRO822-22727"
"00391338"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"BCM192-25281"
"00391339"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO100-26513"
"00391340"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO425-14530"
"00391341"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO559-19981"
"00391342"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO658-26672"
"00391343"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"CHRO812-22489"
"00391344"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	""	""	""	""	""	"0"	""	""	""	"ZD54-3870"
"00391379"	""	""	""	"1"	""	"00000"	"{PMID:Méjécase 2020:3278337"	""	"?"	""	"United Arab Emirates"	""	"0"	""	""	""	"47"
"00391380"	""	""	""	"1"	""	"00000"	"{PMID:Méjécase 2020:3278337"	""	"?"	""	"United Arab Emirates"	""	"0"	""	""	""	"48"
"00391389"	""	""	""	"6"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"4 families, 6 affected"	""	""	""	""	"0"	""	""	""	"CHRO1060-27431"
"00391390"	""	""	""	"262"	""	"00006"	"{PMID:Mayer 2017:28795510}, includes data {PMID:Kohl 2005:15657609}"	"229 families, 262 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27694"
"00391391"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27695"
"00391392"	""	""	""	"2"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 2 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27696"
"00391393"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27697"
"00391394"	""	""	""	"2"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 2 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27698"
"00391395"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27699"
"00391396"	""	""	""	"6"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"6 families, 6 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27700"
"00391397"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27701"
"00391398"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27702"
"00391399"	""	""	""	"4"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"4 families, 4 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27703"
"00391400"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"3 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27704"
"00391401"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27705"
"00391402"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"3 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27706"
"00391403"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27707"
"00391404"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27708"
"00391405"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27709"
"00391406"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27710"
"00391407"	""	""	""	"2"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2 families, 2 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27711"
"00391408"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27712"
"00391409"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27713"
"00391410"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27714"
"00391411"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27715"
"00391412"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27716"
"00391413"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27717"
"00391414"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27718"
"00391415"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27719"
"00391416"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27720"
"00391417"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27721"
"00391418"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27722"
"00391419"	""	""	""	"9"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"9 families, 9 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27723"
"00391420"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27724"
"00391421"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27725"
"00391422"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27726"
"00391423"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27727"
"00391424"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27728"
"00391425"	""	""	""	"2"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2 families, 2 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27729"
"00391426"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27730"
"00391427"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27731"
"00391428"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27732"
"00391429"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27733"
"00391430"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27734"
"00391431"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27735"
"00391432"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"3 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27736"
"00391433"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27737"
"00391434"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27738"
"00391435"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27739"
"00391436"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27740"
"00391437"	""	""	""	"24"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"21 families, 24 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27741"
"00391438"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27742"
"00391439"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27743"
"00391440"	""	""	""	"12"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"12 families, 12 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27744"
"00391441"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27745"
"00391442"	""	""	""	"9"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"8 families, 9 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27746"
"00391443"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27747"
"00391444"	""	""	""	"6"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"6 families, 6 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27748"
"00391445"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27749"
"00391446"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27750"
"00391447"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27751"
"00391448"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27752"
"00391449"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27753"
"00391450"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27754"
"00391451"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27755"
"00391452"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27756"
"00391453"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"3 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27757"
"00391454"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27758"
"00391455"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27759"
"00391456"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27760"
"00391457"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27761"
"00391458"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"3 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27762"
"00391459"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27763"
"00391460"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27764"
"00391461"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27765"
"00391462"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"1 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27766"
"00391463"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27767"
"00391464"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27768"
"00391465"	""	""	""	"12"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"10 families, 12 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27769"
"00391466"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27770"
"00391467"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27771"
"00391468"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27772"
"00391469"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27773"
"00391470"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27774"
"00391471"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27775"
"00391472"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27776"
"00391473"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27777"
"00391474"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27778"
"00391475"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27779"
"00391476"	""	""	""	"4"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2 families, 4 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27780"
"00391477"	""	""	""	"4"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2 families, 4 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27781"
"00391478"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27782"
"00391479"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27783"
"00391480"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27784"
"00391481"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27785"
"00391482"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27786"
"00391483"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27787"
"00391484"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27788"
"00391485"	""	""	""	"2"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"2 families, 2 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27789"
"00391486"	""	""	""	"2"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"1 families, 2 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27790"
"00391487"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27791"
"00391488"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27792"
"00391489"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27793"
"00391490"	""	""	""	"1"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"family, 1 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27794"
"00391491"	""	""	""	"3"	""	"00006"	"{PMID:Mayer 2017:28795510}"	"3 families, 3 affected"	""	""	""	""	"0"	""	""	""	"CHRO1069-27795"
"00391492"	""	""	""	"1"	""	"00006"	"{PMID:Rojas 2002:12357335}"	"6-generation family, 6 affected (2F, 4M), unaffected heterozygous carrier parents/relatives"	"F;M"	"yes"	"Chile"	""	"0"	""	""	"Hispanic"	"family"
"00391494"	""	""	""	"5"	""	"00006"	"{PMID:Michaelides 2004:15161866}"	"6-generation family, 5 affected (3F, 2M), unaffected heterozygous carrier parents/relatives"	"F;M"	"yes"	"Pakistan"	""	"0"	""	""	""	"FamPatIVI2"
"00391495"	""	""	"00391494"	"3"	""	"00006"	"{PMID:Michaelides 2004:15161866}"	"aunt, mother and brother of PatVI2"	"F;M"	"yes"	"Pakistan"	""	"0"	""	""	""	"FamPatV1/V7/VI3"
"00391543"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	"?"	""	"New Zealand"	""	"0"	""	""	"Maori"	"40"
"00391544"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	"?"	""	"New Zealand"	""	"0"	""	""	"white"	"41"
"00391545"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	"?"	""	"New Zealand"	""	"0"	""	""	"white"	"42"
"00391546"	""	""	""	"1"	""	"00000"	"{PMID:Hull 2020:32856788}"	""	"?"	""	"New Zealand"	""	"0"	""	""	"white"	"43"
"00391758"	""	""	""	"1"	""	"00000"	"{PMID:DiScipio 2020:32881472}"	""	"M"	""	""	""	"0"	""	""	""	"3.II:1"
"00391759"	""	""	""	"1"	""	"00000"	"{PMID:DiScipio 2020:32881472}"	""	"M"	""	""	""	"0"	""	""	""	"3.II:2"
"00391760"	""	""	""	"1"	""	"00000"	"{PMID:DiScipio 2020:32881472}"	""	"M"	""	""	""	"0"	""	""	""	"3.II:3"
"00391767"	""	""	""	"1"	""	"00006"	"{PMID:Varsanyi 2005:16319819}"	""	"M"	""	"Hungary"	""	"0"	""	""	""	"FamAPatII1"
"00391768"	""	""	""	"1"	""	"00006"	"{PMID:Varsanyi 2005:16319819}"	""	"M"	""	"Hungary"	""	"0"	""	""	""	"FamCPatII1"
"00391769"	""	""	""	"1"	""	"00006"	"{PMID:Varsanyi 2005:16319819}"	""	"M"	""	"Hungary"	""	"0"	""	""	""	"FamGPatI1"
"00391770"	""	""	""	"2"	""	"00006"	"{PMID:Varsanyi 2005:16319819}"	"family, 2 affected"	"F"	""	"Hungary"	""	"0"	""	""	""	"FamHPatII1"
"00391771"	""	""	"00391770"	"1"	""	"00006"	"{PMID:Varsanyi 2005:16319819}"	""	"M"	""	"Hungary"	""	"0"	""	""	""	"FamHPatII2"
"00391772"	""	""	""	"1"	""	"00006"	"{PMID:Varsanyi 2005:16319819}"	""	"M"	""	"Hungary"	""	"0"	""	""	""	"FamIPatII1"
"00391779"	""	""	""	"1"	""	"00006"	"{PMID:Wawrocka 2014:25558176}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	"Poland"	""	"0"	""	""	""	"Pat1"
"00391780"	""	""	""	"1"	""	"00006"	"{PMID:Wawrocka 2014:25558176}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	"Poland"	""	"0"	""	""	""	"Pat2"
"00391781"	""	""	""	"1"	""	"00006"	"{PMID:Wawrocka 2014:25558176}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"M"	""	"Poland"	""	"0"	""	""	""	"Pat3"
"00391782"	""	""	""	"1"	""	"00006"	"{PMID:Wawrocka 2014:25558176}"	"2-generation family, 1 affected, unaffected parents"	"F"	""	"Poland"	""	"0"	""	""	""	"Pat4"
"00391802"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"BPE-003"
"00391803"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"BPE-010"
"00391804"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"BPE-012"
"00391805"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"BPE-018"
"00391806"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"BPE-019"
"00391807"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"BPE-022"
"00391808"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-001"
"00391809"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-002"
"00391810"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"CEI-003"
"00391811"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-004"
"00391812"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-005"
"00391813"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-006"
"00391814"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"CEI-008"
"00391815"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"CEI-009"
"00391816"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"CEI-010"
"00391817"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-011"
"00391818"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-015"
"00391819"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"CEI-016"
"00391820"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"PCI-001"
"00391821"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"PCI-002"
"00391822"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"PCI-003"
"00391823"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"PCI-004"
"00391824"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"PCI-005"
"00391825"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"PCI-006"
"00391826"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"PCI-007"
"00391827"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"PCI-008"
"00391828"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"PCI-009"
"00391829"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"PCI-010"
"00391830"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"PCI-011"
"00391831"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"PCI-012"
"00391832"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"PCI-013"
"00391833"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"PCI-017"
"00391834"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"PCI-019"
"00391835"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"PCI-020"
"00391836"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"PCI-021"
"00391837"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"PCI-024"
"00391838"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"PCI-025"
"00391839"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"PCI-031"
"00391840"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"PCI-032"
"00391841"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"PCI-033"
"00391842"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"PCI-034"
"00391843"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"UFC-001"
"00391844"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"UFC-002"
"00391845"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"UFC-003"
"00391846"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"UFC-004"
"00391847"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"UFC-005"
"00391848"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"UFC-006"
"00391849"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"UFC-007"
"00391850"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"UFC-008"
"00391851"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"M"	""	"United States"	""	"0"	""	""	""	"UFC-009"
"00391852"	""	""	""	"1"	""	"00006"	"{PMID:Langlo 2014:274798146}"	""	"F"	""	"United States"	""	"0"	""	""	""	"UFC-010"
"00391872"	""	""	""	"33"	""	"00006"	"{PMID:Andersen 2021:33560291}"	"detailed phenotypic analysis 33 individuals"	"F;M"	""	"Denmark"	""	"0"	""	""	""	"cases"
"00391919"	""	""	""	"1"	""	"00000"	"{PMID:Sun 2020:32913385}"	""	"M"	""	"China"	""	"0"	""	""	""	"6184"
"00391920"	""	""	""	"1"	""	"00000"	"{PMID:Sun 2020:32913385}"	""	"F"	""	"China"	""	"0"	""	""	""	"10815"
"00391921"	""	""	""	"1"	""	"00000"	"{PMID:Sun 2020:32913385}"	""	"M"	""	"China"	""	"0"	""	""	""	"18060"
"00391922"	""	""	""	"1"	""	"00000"	"{PMID:Sun 2020:32913385}"	""	"M"	""	"China"	""	"0"	""	""	""	"9291"
"00392912"	""	""	""	"1"	""	"00000"	"{PMID:Bergant 2021:33807868}"	""	""	""	"Italy"	""	"0"	""	""	""	"P09"
"00393335"	""	""	""	"1"	""	"00000"	"{PMID:Ng 2021:33846575}"	""	"M"	"?"	"China"	""	"0"	""	""	""	"RP-026"
"00393336"	""	""	""	"1"	""	"00000"	"{PMID:Ng 2021:33846575}"	""	"F"	"?"	"China"	""	"0"	""	""	""	"RP-052"
"00393337"	""	""	""	"1"	""	"00000"	"{PMID:Ng 2021:33846575}"	""	"F"	"?"	"China"	""	"0"	""	""	""	"RP-082"
"00393977"	""	""	""	"1"	""	"00000"	"{PMID:Brunetti-Pierri_2021:33562422}"	""	""	"yes"	""	""	"0"	""	""	"Italian"	""
"00393978"	""	""	""	"1"	""	"00000"	"{PMID:Brunetti-Pierri_2021:33562422}"	""	""	"yes"	""	""	"0"	""	""	"Italian"	""
"00393979"	""	""	""	"1"	""	"00000"	"{PMID:Brunetti-Pierri_2021:33562422}"	""	""	"yes"	""	""	"0"	""	""	"Italian"	""
"00393980"	""	""	""	"1"	""	"00000"	"{PMID:Brunetti-Pierri_2021:33562422}"	""	""	"yes"	""	""	"0"	""	""	"Italian"	""
"00393981"	""	""	""	"1"	""	"00000"	"{PMID:Brunetti-Pierri_2021:33562422}"	""	""	"yes"	""	""	"0"	""	""	"Italian"	""
"00393986"	""	""	""	"1"	""	"00000"	"{PMID:Brunetti-Pierri_2021:33562422}"	""	""	"yes"	""	""	"0"	""	""	"Italian"	""
"00394355"	""	""	""	"1"	""	"00000"	"{PMID:Thorsteinsson 2021:33851411}"	""	"?"	""	"Iceland"	""	"0"	""	""	""	"A1"
"00398565"	""	""	""	"1"	""	"00000"	"{PMID:Genead 2011:21778272}"	""	"F"	""	"United States"	""	"0"	""	""	"white"	"3"
"00398567"	""	""	""	"1"	""	"00000"	"{PMID:Genead 2011:21778272}"	""	"M"	""	"United States"	""	"0"	""	""	"white"	"5"
"00398569"	""	""	""	"1"	""	"00000"	"{PMID:Genead 2011:21778272}"	""	"F"	""	"United States"	""	"0"	""	""	"white"	"7"
"00398570"	""	""	""	"1"	""	"00000"	"{PMID:Genead 2011:21778272}"	""	"M"	""	"United States"	""	"0"	""	""	"white"	"8"
"00398572"	""	""	""	"1"	""	"00000"	"{PMID:Genead 2011:21778272}"	""	"M"	""	"United States"	""	"0"	""	""	"white"	"10"
"00398629"	""	""	""	"1"	""	"00000"	"{PMID:Thomas 2012:22790432}"	""	"?"	"yes"	""	""	"0"	""	""	""	"5"
"00398632"	""	""	""	"1"	""	"00000"	"{PMID:Thomas 2012:22790432}"	""	"?"	"yes"	""	""	"0"	""	""	""	"8"
"00398639"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2013:23972307}"	""	"?"	""	""	""	"0"	""	""	""	"B1"
"00398640"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2013:23972307}"	""	"?"	""	""	""	"0"	""	""	""	"B2"
"00398641"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2013:23972307}"	""	"?"	""	""	""	"0"	""	""	""	"B3"
"00398642"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2013:23972307}"	""	"?"	""	""	""	"0"	""	""	""	"B4"
"00398643"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2013:23972307}"	""	"?"	""	""	""	"0"	""	""	""	"B5"
"00398644"	""	""	""	"1"	""	"00000"	"{PMID:Fahim 2013:23972307}"	""	"?"	""	""	""	"0"	""	""	""	"B6"
"00398652"	""	""	""	"1"	""	"00000"	"{PMID:Yang 2014:24676353}"	""	"M"	""	""	""	"0"	""	""	""	"1"
"00398654"	""	""	""	"1"	""	"00000"	"{PMID:Yang 2014:24676353}"	""	"M"	""	""	""	"0"	""	""	""	"4"
"00398655"	""	""	""	"1"	""	"00000"	"{PMID:Yang 2014:24676353}"	""	"M"	""	""	""	"0"	""	""	""	"5"
"00398657"	""	""	""	"1"	""	"00000"	"{PMID:Yang 2014:24676353}"	""	"M"	""	""	""	"0"	""	""	""	"7"
"00398658"	""	""	""	"1"	""	"00000"	"{PMID:Yang 2014:24676353}"	""	"F"	""	""	""	"0"	""	""	""	"8"
"00398659"	""	""	""	"1"	""	"00000"	"{PMID:Yang 2014:24676353}"	""	"F"	""	""	""	"0"	""	""	""	"9"
"00398767"	""	""	""	"1"	""	"00000"	"{PMID:Matet 2018:29618791}"	""	"F"	"yes"	"France"	""	"0"	""	""	"white"	"9"
"00398768"	""	""	""	"1"	""	"00000"	"{PMID:Matet 2018:29618791}"	""	"F"	"yes"	"France"	""	"0"	""	""	"Northern African"	"10"
"00398769"	""	""	""	"1"	""	"00000"	"{PMID:Matet 2018:29618791}"	""	"F"	"no"	"France"	""	"0"	""	""	"white"	"11"
"00398770"	""	""	""	"1"	""	"00000"	"{PMID:Matet 2018:29618791}"	""	"M"	"no"	"France"	""	"0"	""	""	"white"	"12"
"00398771"	""	""	""	"2"	""	"00000"	"{PMID:Matet 2018:29618791}"	"2-generation family, 2 affected sisters, unaffected heterozygous carrier parents/relatives; sibling of 15"	"F"	"no"	"France"	""	"0"	""	""	"white"	"13"
"00398772"	""	""	""	"1"	""	"00000"	"{PMID:Matet 2018:29618791}"	""	"F"	"no"	"France"	""	"0"	""	""	"white"	"14"
"00398773"	""	""	"00398771"	"1"	""	"00000"	"{PMID:Matet 2018:29618791}"	"sibling of 13"	"F"	"no"	"France"	""	"0"	""	""	"white"	"15"
"00398784"	""	""	""	"1"	""	"00000"	"{PMID:Georgiou 2019:30682209}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"KS_10337"
"00408430"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	""	"?"	""	"Finland"	""	"0"	""	""	""	"18"
"00408431"	""	""	""	"1"	""	"00000"	"{PMID:Avela 2019:31087526}"	""	"?"	""	"Finland"	""	"0"	""	""	""	"19"
"00415767"	""	""	""	"1"	""	"00000"	"{PMID:Kellner 2004:15459792}"	""	"M"	""	""	""	"0"	""	""	""	"1615"
"00415768"	""	""	""	"1"	""	"00000"	"{PMID:Kellner 2004:15459792}"	""	"M"	""	""	""	"0"	""	""	""	"1555"
"00415769"	""	""	""	"1"	""	"00000"	"{PMID:Kellner 2004:15459792}"	""	"M"	""	""	""	"0"	""	""	""	"1108"
"00415770"	""	""	""	"1"	""	"00000"	"{PMID:Kellner 2004:15459792}"	""	"M"	""	""	""	"0"	""	""	""	"1053"
"00415771"	""	""	""	"1"	""	"00000"	"{PMID:Kellner 2004:15459792}"	""	"M"	""	""	""	"0"	""	""	""	"1467"
"00415772"	""	""	""	"1"	""	"00000"	"{PMID:Kellner 2004:15459792}"	""	"M"	""	""	""	"0"	""	""	""	"F178_124"
"00415773"	""	""	""	"1"	""	"00000"	"{PMID:Kellner 2004:15459792}"	""	"M"	""	""	""	"0"	""	""	""	"F178_123"
"00415774"	""	""	""	"1"	""	"00000"	"{PMID:Kellner 2004:15459792}"	""	"F"	""	""	""	"0"	""	""	""	"F178_125"
"00415777"	""	""	""	"1"	""	"00000"	"{PMID:Kellner 2004:15459792}"	""	"F"	""	""	""	"0"	""	""	""	"569"
"00415778"	""	""	""	"1"	""	"00000"	"{PMID:Kellner 2004:15459792}"	""	"M"	""	""	""	"0"	""	""	""	"442"
"00419700"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}"	"presumed digenic inheriance with CNGB3 variant"	"M"	""	""	""	"0"	""	""	""	"070748"
"00419701"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}"	""	"M"	""	""	""	"0"	""	""	""	"070583"
"00419702"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}"	""	"F"	""	""	""	"0"	""	""	""	"070680"
"00426903"	""	""	""	"1"	""	"00000"	"{PMID:Zhu 2022:35456422}"	"family 5, individual 6"	"F"	""	""	""	"0"	""	""	""	"5_6"
"00426904"	""	""	""	"1"	""	"00000"	"{PMID:Zhu 2022:35456422}"	"family 6, individual 7"	"M"	""	""	""	"0"	""	""	""	"6_7"
"00426905"	""	""	""	"1"	""	"00000"	"{PMID:Zhu 2022:35456422}"	"family 8, individual 9"	"F"	""	""	""	"0"	""	""	""	"8_9"
"00426906"	""	""	""	"1"	""	"00000"	"{PMID:Zhu 2022:35456422}"	"family 9, individual 10"	"F"	""	""	""	"0"	""	""	""	"9_10"
"00426911"	""	""	""	"1"	""	"00000"	"{PMID:Zhu 2022:35456422}"	"family 16, individual 18"	"F"	""	""	""	"0"	""	""	""	"16_18"
"00426912"	""	""	""	"1"	""	"00000"	"{PMID:Zhu 2022:35456422}"	"family 17, individual 19"	"F"	""	""	""	"0"	""	""	""	"17_19"
"00436594"	""	""	""	"1"	""	"04552"	"Villafuerte-de la Cruz RA, et al., 2023. Submitted"	""	"F"	"no"	"Mexico"	""	""	""	"NONE"	"Hispanic"	"3667918"
"00446909"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"F"	""	"Germany"	""	"0"	""	""	""	"ACHM-1220"
"00446910"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"F"	""	"Germany"	""	"0"	""	""	""	"ACHM-1229"
"00446911"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient"	"F"	""	"Germany"	""	"0"	""	""	""	"ACHM-1261"
"00446913"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"F"	""	"Germany"	""	"0"	""	""	""	"ACHM-1272"
"00446914"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient"	"F"	""	"Germany"	""	"0"	""	""	""	"ACHM-1280"
"00446915"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"F"	""	"Germany"	""	"0"	""	""	""	"ACHM-1281"
"00446916"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"M"	""	"Germany"	""	"0"	""	""	""	"ACHM-1282"
"00446917"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"F"	""	"Germany"	""	"0"	""	""	""	"ACHM-1287"
"00446918"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"M"	""	"Germany"	""	"0"	""	""	""	"ACHM-1290"
"00446924"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"F"	""	"Germany"	""	"0"	""	""	""	"ACHM-1302"
"00447211"	""	""	""	"3"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"family, 3 affected"	"F"	""	"Germany"	""	"0"	""	""	""	"MISC-313"
"00447399"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient"	"M"	""	"Germany"	""	"0"	""	""	""	"STGD-465"
"00447485"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"M"	""	"Germany"	""	"0"	""	""	""	"ACHM-1247"
"00447562"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"M"	""	"Germany"	""	"0"	""	""	""	"MDS-398"
"00447620"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient"	"M"	""	"Germany"	""	"0"	""	""	""	"SRP-1273"
"00447657"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"F"	""	"Germany"	""	"0"	""	""	""	"BVMD-109"
"00447673"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"M"	""	"Germany"	""	"0"	""	""	""	"MDS-218"
"00447674"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"M"	""	"Germany"	""	"0"	""	""	""	"MDS-307"
"00447680"	""	""	""	"1"	""	"00006"	"{PMID:Weisschuh 2024:37734845}"	"patient, no family history"	"M"	""	"Germany"	""	"0"	""	""	""	"MDS-443"
"00450792"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"F"	""	""	""	"0"	""	""	""	"066672"
"00450793"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"F"	""	""	""	"0"	""	""	""	"067252"
"00450794"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"M"	""	""	""	"0"	""	""	""	"070753"
"00450795"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"F"	""	""	""	"0"	""	""	""	"071527"
"00450796"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"M"	""	""	""	"0"	""	""	""	"071756"
"00450797"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"F"	""	""	""	"0"	""	""	""	"071762"
"00450798"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"M"	""	""	""	"0"	""	""	""	"072220"
"00450799"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"M"	""	""	""	"0"	""	""	""	"072955"
"00450800"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"M"	""	""	""	"0"	""	""	""	"073119"
"00450801"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"F"	""	""	""	"0"	""	""	""	"073393"
"00450802"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"F"	""	""	""	"0"	""	""	""	"074101"
"00450803"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"M"	""	""	""	"0"	""	""	""	"074699"
"00450804"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"M"	""	""	""	"0"	""	""	""	"080605"
"00450805"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"M"	""	""	""	"0"	""	""	""	"080607"
"00451034"	""	""	""	"1"	""	"00006"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	""	""	"0"	""	""	""	"011600"
"00451121"	""	""	""	"1"	""	"00006"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	""	""	"0"	""	""	""	"071007"
"00451139"	""	""	""	"1"	""	"00006"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	""	""	"0"	""	""	""	"071322"
"00451229"	""	""	""	"1"	""	"00006"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	""	""	"0"	""	""	""	"072219"
"00454772"	""	""	""	"1"	""	"04752"	"Rawnsley 2025, submitted"	""	""	""	"Germany"	""	"0"	""	""	""	"CHRO1238"
"00454775"	""	""	""	"1"	""	"04752"	"Rawnsley 2025, submitted"	""	""	""	"Germany"	""	"0"	""	""	""	"CHRO1352"
"00454776"	""	""	""	"1"	""	"04752"	"Rawnsley 2025, submitted"	""	""	""	"Germany"	""	"0"	""	""	""	"CHRO1197"
"00454777"	""	""	""	"1"	""	"04752"	""	""	""	""	""	""	""	""	""	""	""
"00454945"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat92"
"00454946"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat1"
"00454947"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat6"
"00454948"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat9"
"00454949"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat11"
"00454950"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat12"
"00454951"	""	""	""	"2"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"family, 2 affected"	""	"yes"	"Denmark"	""	"0"	""	""	""	"Fam201Pat10"
"00454952"	""	""	"00454951"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"yes"	"Denmark"	""	"0"	""	""	""	"Fam201Pat21"
"00454953"	""	""	""	"2"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"family, 2 affected"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam212Pat13"
"00454954"	""	""	"00454953"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam212Pat60"
"00454955"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat14"
"00454956"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat19"
"00454957"	""	""	""	"4"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"family, 4 affected"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam205Pat15"
"00454958"	""	""	"00454957"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam205Pat20"
"00454959"	""	""	"00454957"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam205Pat94"
"00454960"	""	""	"00454957"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam205Pat27"
"00454961"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat16"
"00454962"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat17"
"00454963"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat18"
"00454964"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat22"
"00454965"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat23"
"00454966"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat24"
"00454967"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat25"
"00454968"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat26"
"00454969"	""	""	""	"4"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"family, 4 affected"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam204Pat28"
"00454970"	""	""	"00454969"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam204Pat29"
"00454971"	""	""	"00454969"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam204Pat30"
"00454972"	""	""	"00454969"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam204Pat95"
"00454973"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"yes"	"Denmark"	""	"0"	""	""	""	"Pat31"
"00454974"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat32"
"00454975"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat33"
"00454976"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat34"
"00454977"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat47"
"00454978"	""	""	""	"2"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"family, 2 affected"	""	"yes"	"Denmark"	""	"0"	""	""	""	"Fam1089Pat48"
"00454979"	""	""	"00454978"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"yes"	"Denmark"	""	"0"	""	""	""	"Fam1089Pat50"
"00454980"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat59"
"00454981"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	""	"Denmark"	""	"0"	""	""	""	"Pat97"
"00454982"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat98"
"00454983"	""	""	""	"3"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"family, 3 affected"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam217Pat2"
"00454984"	""	""	"00454983"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam217Pat37"
"00454985"	""	""	"00454983"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam217Pat38"
"00454986"	""	""	""	"2"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"family, 2 affected"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam210Pat4"
"00454987"	""	""	"00454986"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam210Pat39"
"00454988"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat8"
"00454989"	""	""	""	"2"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"family, 2 affected"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam207Pat35"
"00454990"	""	""	"00454989"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"no"	"Denmark"	""	"0"	""	""	""	"Fam207Pat36"
"00454991"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat51"
"00454992"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat69"
"00454993"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat74"
"00454994"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat80"
"00454995"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat100"
"00454996"	""	""	"00398284"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"yes"	"Denmark"	""	"0"	""	""	""	"Fam203Pat52"
"00454997"	""	""	"00398284"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"yes"	"Denmark"	""	"0"	""	""	""	"Fam203Pat54"
"00454998"	""	""	""	"2"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"family, 2 affected"	""	"yes"	"Denmark"	""	"0"	""	""	""	"Fam215Pat55"
"00454999"	""	""	"00454998"	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"sib"	""	"yes"	"Denmark"	""	"0"	""	""	""	"Fam215Pat56"
"00455000"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat72"
"00455001"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"yes"	"Denmark"	""	"0"	""	""	""	"Pat75"
"00455002"	""	""	""	"1"	""	"04752"	"{PMID:Andersen 2023:36980963}"	"patient"	""	"no"	"Denmark"	""	"0"	""	""	""	"Pat99"
"00464537"	""	""	""	"1"	""	"04752"	"{PMID:Weisschuh 2020:31544997}, Rawnsley 2025, submitted"	""	""	""	""	""	"0"	""	""	""	"CHRO216"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 816
"{{individualid}}"	"{{diseaseid}}"
"00095944"	"00381"
"00105013"	"04230"
"00105022"	"04214"
"00144158"	"04214"
"00155440"	"02016"
"00155441"	"02016"
"00155442"	"02016"
"00155443"	"02016"
"00155444"	"02016"
"00155445"	"02016"
"00155446"	"02016"
"00170849"	"04213"
"00173732"	"04230"
"00173733"	"04230"
"00173737"	"04230"
"00173738"	"04230"
"00173740"	"04230"
"00173741"	"04230"
"00173742"	"04230"
"00173743"	"04230"
"00173744"	"04230"
"00173745"	"04230"
"00173746"	"04230"
"00173747"	"04230"
"00173748"	"04230"
"00263131"	"00198"
"00294669"	"00198"
"00294670"	"00198"
"00294671"	"00198"
"00294672"	"00198"
"00294673"	"00198"
"00295560"	"00198"
"00305204"	"00198"
"00305205"	"00198"
"00305206"	"00198"
"00308499"	"04214"
"00308500"	"04214"
"00309094"	"04214"
"00309095"	"04214"
"00309096"	"04214"
"00309097"	"04214"
"00309098"	"04214"
"00309099"	"04214"
"00309100"	"04214"
"00309101"	"04214"
"00309102"	"04214"
"00309103"	"04214"
"00319828"	"04214"
"00319829"	"04214"
"00319830"	"04214"
"00319831"	"04214"
"00319832"	"04214"
"00319833"	"04214"
"00319834"	"04214"
"00320042"	"04214"
"00320043"	"04214"
"00320044"	"04214"
"00320048"	"04214"
"00320054"	"04214"
"00320055"	"04214"
"00320057"	"04214"
"00320058"	"04214"
"00320060"	"04214"
"00320061"	"04214"
"00320063"	"04214"
"00324248"	"04214"
"00324251"	"04214"
"00324255"	"04214"
"00324256"	"04214"
"00324258"	"04214"
"00324259"	"04214"
"00324262"	"04214"
"00324263"	"04214"
"00324264"	"04214"
"00324266"	"04214"
"00324268"	"04214"
"00324269"	"04214"
"00324271"	"04214"
"00324272"	"04214"
"00324273"	"04214"
"00324274"	"04214"
"00324275"	"04214"
"00325487"	"04214"
"00327935"	"04214"
"00327967"	"04214"
"00328023"	"04214"
"00328135"	"04214"
"00328206"	"04214"
"00328311"	"04214"
"00328338"	"04214"
"00328451"	"04214"
"00328452"	"04214"
"00328453"	"04214"
"00328454"	"04214"
"00331296"	"04214"
"00331299"	"04214"
"00331720"	"04214"
"00331721"	"04214"
"00331722"	"04214"
"00331723"	"04214"
"00331724"	"04214"
"00331725"	"04214"
"00331726"	"04214"
"00332192"	"04214"
"00332227"	"04214"
"00332278"	"04214"
"00332288"	"04214"
"00332404"	"04214"
"00332451"	"04214"
"00332452"	"04214"
"00332453"	"04214"
"00333337"	"04214"
"00333430"	"04214"
"00333635"	"04214"
"00333985"	"04214"
"00333986"	"04214"
"00333987"	"04214"
"00333988"	"04214"
"00334379"	"00420"
"00334461"	"04214"
"00334896"	"04214"
"00335106"	"00198"
"00335107"	"00198"
"00335110"	"00198"
"00335227"	"04214"
"00335335"	"04214"
"00335485"	"04214"
"00335969"	"04214"
"00358969"	"04214"
"00359004"	"04214"
"00359011"	"04214"
"00359014"	"04214"
"00359017"	"04214"
"00359018"	"04214"
"00359019"	"04214"
"00359020"	"04214"
"00359619"	"00198"
"00362141"	"04214"
"00362142"	"04214"
"00362143"	"04214"
"00362920"	"04214"
"00373342"	"04214"
"00373872"	"04214"
"00373873"	"04214"
"00374994"	"04214"
"00374995"	"04214"
"00374996"	"04214"
"00374997"	"04214"
"00374998"	"04214"
"00375356"	"04214"
"00375358"	"04214"
"00375359"	"04214"
"00375364"	"04214"
"00375365"	"04214"
"00376303"	"04214"
"00376304"	"04214"
"00377007"	"04214"
"00377008"	"04214"
"00377009"	"04214"
"00377010"	"04214"
"00377011"	"04214"
"00377016"	"04214"
"00377017"	"04214"
"00377018"	"04214"
"00377019"	"04214"
"00377020"	"04214"
"00377021"	"04214"
"00377022"	"04214"
"00377023"	"04214"
"00377024"	"04214"
"00377025"	"04214"
"00377180"	"04214"
"00377199"	"04214"
"00377223"	"04214"
"00377243"	"04214"
"00377700"	"04214"
"00377701"	"04214"
"00377702"	"04214"
"00377703"	"04214"
"00377704"	"04214"
"00377705"	"04214"
"00377706"	"04214"
"00377707"	"04214"
"00377963"	"04214"
"00377975"	"04214"
"00377983"	"04214"
"00377984"	"04214"
"00377985"	"04214"
"00377986"	"04214"
"00377987"	"04214"
"00377988"	"04214"
"00377989"	"04214"
"00377992"	"04214"
"00380187"	"04214"
"00380872"	"04214"
"00381123"	"04214"
"00381124"	"04214"
"00381125"	"04214"
"00381126"	"04214"
"00381127"	"04214"
"00381128"	"04214"
"00381129"	"04214"
"00381130"	"04214"
"00381131"	"04214"
"00381132"	"04214"
"00381133"	"04214"
"00381134"	"04214"
"00381135"	"04214"
"00381136"	"04214"
"00381137"	"04214"
"00381795"	"04214"
"00381796"	"04214"
"00381963"	"04214"
"00381964"	"04214"
"00381965"	"04214"
"00381966"	"04214"
"00381967"	"04214"
"00381968"	"04214"
"00381969"	"04214"
"00381970"	"04214"
"00381971"	"04214"
"00381972"	"04214"
"00381973"	"04214"
"00381974"	"04214"
"00381975"	"04214"
"00382128"	"02016"
"00382129"	"02016"
"00382130"	"02016"
"00382131"	"02016"
"00382259"	"04214"
"00382260"	"04214"
"00382261"	"04214"
"00382262"	"04214"
"00382263"	"04214"
"00382264"	"04214"
"00382424"	"04214"
"00382528"	"04214"
"00382634"	"04214"
"00382660"	"04214"
"00382793"	"04214"
"00383418"	"04214"
"00383419"	"04214"
"00386176"	"04214"
"00386179"	"04214"
"00386201"	"04214"
"00386212"	"04214"
"00386213"	"04214"
"00386224"	"04214"
"00386269"	"04214"
"00386274"	"04214"
"00386275"	"04214"
"00386277"	"04214"
"00386291"	"04214"
"00386699"	"04214"
"00386751"	"04214"
"00388482"	"04214"
"00388767"	"04214"
"00389800"	"04214"
"00389815"	"04214"
"00389849"	"04214"
"00389850"	"04214"
"00389851"	"04214"
"00389866"	"04214"
"00389873"	"04214"
"00389874"	"04214"
"00389884"	"04214"
"00389888"	"04214"
"00389889"	"04214"
"00389891"	"04214"
"00389892"	"04214"
"00389895"	"04214"
"00389896"	"04214"
"00389897"	"04214"
"00389899"	"04214"
"00389901"	"04214"
"00389904"	"04214"
"00389914"	"04214"
"00389931"	"04214"
"00389996"	"04214"
"00389998"	"04214"
"00389999"	"04214"
"00390002"	"04214"
"00390003"	"04214"
"00390005"	"04214"
"00390011"	"04214"
"00390012"	"04214"
"00390013"	"04214"
"00390014"	"04214"
"00390016"	"04214"
"00390017"	"04214"
"00390018"	"04214"
"00390019"	"04214"
"00390229"	"04214"
"00390230"	"04214"
"00390231"	"04214"
"00390232"	"04214"
"00390233"	"04214"
"00390234"	"04214"
"00390235"	"04214"
"00390743"	"04214"
"00390869"	"04214"
"00390931"	"04214"
"00390958"	"04214"
"00391018"	"04214"
"00391019"	"04214"
"00391020"	"04214"
"00391021"	"04214"
"00391022"	"04214"
"00391023"	"04214"
"00391024"	"04214"
"00391025"	"04214"
"00391026"	"04214"
"00391027"	"04214"
"00391028"	"04214"
"00391029"	"04214"
"00391030"	"04214"
"00391031"	"04214"
"00391032"	"04214"
"00391033"	"04214"
"00391034"	"04214"
"00391035"	"04214"
"00391036"	"04214"
"00391037"	"04214"
"00391038"	"04214"
"00391039"	"04214"
"00391040"	"04214"
"00391041"	"04214"
"00391042"	"04214"
"00391043"	"04214"
"00391044"	"04214"
"00391045"	"04214"
"00391046"	"04214"
"00391047"	"04214"
"00391048"	"04214"
"00391049"	"04214"
"00391050"	"04214"
"00391051"	"04214"
"00391052"	"04214"
"00391053"	"04214"
"00391054"	"04214"
"00391055"	"04214"
"00391056"	"04214"
"00391057"	"04214"
"00391058"	"04214"
"00391059"	"04214"
"00391060"	"04214"
"00391061"	"04214"
"00391062"	"04214"
"00391063"	"04214"
"00391064"	"04214"
"00391065"	"04214"
"00391066"	"04214"
"00391067"	"04214"
"00391068"	"04214"
"00391069"	"04214"
"00391070"	"04214"
"00391071"	"04214"
"00391072"	"04214"
"00391073"	"04214"
"00391074"	"04214"
"00391075"	"04214"
"00391076"	"04214"
"00391077"	"04214"
"00391078"	"04214"
"00391079"	"04214"
"00391080"	"04214"
"00391081"	"04214"
"00391082"	"04214"
"00391083"	"04214"
"00391084"	"04214"
"00391085"	"04214"
"00391086"	"04214"
"00391087"	"04214"
"00391088"	"04214"
"00391089"	"04214"
"00391090"	"04214"
"00391091"	"04214"
"00391092"	"04214"
"00391093"	"04214"
"00391094"	"04214"
"00391095"	"04214"
"00391096"	"04214"
"00391097"	"04214"
"00391098"	"04214"
"00391099"	"04214"
"00391100"	"04214"
"00391101"	"04214"
"00391102"	"04214"
"00391103"	"04214"
"00391104"	"04214"
"00391105"	"04214"
"00391106"	"04214"
"00391107"	"04214"
"00391108"	"04214"
"00391109"	"04214"
"00391110"	"04214"
"00391111"	"04214"
"00391112"	"04214"
"00391113"	"04214"
"00391114"	"04214"
"00391115"	"04214"
"00391116"	"04214"
"00391117"	"04214"
"00391118"	"04214"
"00391119"	"04214"
"00391120"	"04214"
"00391121"	"04214"
"00391122"	"04214"
"00391123"	"04214"
"00391124"	"04214"
"00391125"	"04214"
"00391126"	"04214"
"00391127"	"04214"
"00391128"	"04214"
"00391129"	"04214"
"00391130"	"04214"
"00391131"	"04214"
"00391132"	"04214"
"00391133"	"04214"
"00391134"	"04214"
"00391290"	"04214"
"00391291"	"04214"
"00391292"	"04214"
"00391293"	"04214"
"00391294"	"04214"
"00391295"	"04214"
"00391296"	"04214"
"00391297"	"04214"
"00391298"	"04214"
"00391299"	"04214"
"00391300"	"04214"
"00391301"	"04214"
"00391302"	"04214"
"00391303"	"04214"
"00391304"	"04214"
"00391305"	"04214"
"00391306"	"04214"
"00391307"	"04214"
"00391308"	"04214"
"00391309"	"04214"
"00391310"	"04214"
"00391311"	"04214"
"00391312"	"04214"
"00391313"	"04214"
"00391314"	"04214"
"00391315"	"04214"
"00391316"	"04214"
"00391317"	"04214"
"00391318"	"04214"
"00391319"	"04214"
"00391320"	"04214"
"00391321"	"04214"
"00391322"	"04214"
"00391323"	"04214"
"00391324"	"04214"
"00391325"	"04214"
"00391326"	"04214"
"00391327"	"04214"
"00391328"	"04214"
"00391329"	"04214"
"00391330"	"04214"
"00391331"	"04214"
"00391332"	"04214"
"00391333"	"04214"
"00391334"	"04214"
"00391335"	"04214"
"00391336"	"04214"
"00391337"	"04214"
"00391338"	"04214"
"00391339"	"04214"
"00391340"	"04214"
"00391341"	"04214"
"00391342"	"04214"
"00391343"	"04214"
"00391344"	"04214"
"00391379"	"04214"
"00391380"	"04214"
"00391389"	"04214"
"00391390"	"04214"
"00391391"	"04214"
"00391392"	"04214"
"00391393"	"04214"
"00391394"	"04214"
"00391395"	"04214"
"00391396"	"04214"
"00391397"	"04214"
"00391398"	"04214"
"00391399"	"04214"
"00391400"	"04214"
"00391401"	"04214"
"00391402"	"04214"
"00391403"	"04214"
"00391404"	"04214"
"00391405"	"04214"
"00391406"	"04214"
"00391407"	"04214"
"00391408"	"04214"
"00391409"	"04214"
"00391410"	"04214"
"00391411"	"04214"
"00391412"	"04214"
"00391413"	"04214"
"00391414"	"04214"
"00391415"	"04214"
"00391416"	"04214"
"00391417"	"04214"
"00391418"	"04214"
"00391419"	"04214"
"00391420"	"04214"
"00391421"	"04214"
"00391422"	"04214"
"00391423"	"04214"
"00391424"	"04214"
"00391425"	"04214"
"00391426"	"04214"
"00391427"	"04214"
"00391428"	"04214"
"00391429"	"04214"
"00391430"	"04214"
"00391431"	"04214"
"00391432"	"04214"
"00391433"	"04214"
"00391434"	"04214"
"00391435"	"04214"
"00391436"	"04214"
"00391437"	"04214"
"00391438"	"04214"
"00391439"	"04214"
"00391440"	"04214"
"00391441"	"04214"
"00391442"	"04214"
"00391443"	"04214"
"00391444"	"04214"
"00391445"	"04214"
"00391446"	"04214"
"00391447"	"04214"
"00391448"	"04214"
"00391449"	"04214"
"00391450"	"04214"
"00391451"	"04214"
"00391452"	"04214"
"00391453"	"04214"
"00391454"	"04214"
"00391455"	"04214"
"00391456"	"04214"
"00391457"	"04214"
"00391458"	"04214"
"00391459"	"04214"
"00391460"	"04214"
"00391461"	"04214"
"00391462"	"04214"
"00391463"	"04214"
"00391464"	"04214"
"00391465"	"04214"
"00391466"	"04214"
"00391467"	"04214"
"00391468"	"04214"
"00391469"	"04214"
"00391470"	"04214"
"00391471"	"04214"
"00391472"	"04214"
"00391473"	"04214"
"00391474"	"04214"
"00391475"	"04214"
"00391476"	"04214"
"00391477"	"04214"
"00391478"	"04214"
"00391479"	"04214"
"00391480"	"04214"
"00391481"	"04214"
"00391482"	"04214"
"00391483"	"04214"
"00391484"	"04214"
"00391485"	"04214"
"00391486"	"04214"
"00391487"	"04214"
"00391488"	"04214"
"00391489"	"04214"
"00391490"	"04214"
"00391491"	"04214"
"00391492"	"04214"
"00391494"	"04214"
"00391495"	"04214"
"00391543"	"04214"
"00391544"	"04214"
"00391545"	"04214"
"00391546"	"04214"
"00391758"	"04214"
"00391759"	"04215"
"00391760"	"04217"
"00391767"	"04214"
"00391768"	"04214"
"00391769"	"04214"
"00391770"	"04214"
"00391771"	"04214"
"00391772"	"04214"
"00391779"	"04214"
"00391780"	"04214"
"00391781"	"04214"
"00391782"	"04214"
"00391802"	"04214"
"00391803"	"04214"
"00391804"	"04214"
"00391805"	"04214"
"00391806"	"04214"
"00391807"	"04214"
"00391808"	"04214"
"00391809"	"04214"
"00391810"	"04214"
"00391811"	"04214"
"00391812"	"04214"
"00391813"	"04214"
"00391814"	"04214"
"00391815"	"04214"
"00391816"	"04214"
"00391817"	"04214"
"00391818"	"04214"
"00391819"	"04214"
"00391820"	"04214"
"00391821"	"04214"
"00391822"	"04214"
"00391823"	"04214"
"00391824"	"04214"
"00391825"	"04214"
"00391826"	"04214"
"00391827"	"04214"
"00391828"	"04214"
"00391829"	"04214"
"00391830"	"04214"
"00391831"	"04214"
"00391832"	"04214"
"00391833"	"04214"
"00391834"	"04214"
"00391835"	"04214"
"00391836"	"04214"
"00391837"	"04214"
"00391838"	"04214"
"00391839"	"04214"
"00391840"	"04214"
"00391841"	"04214"
"00391842"	"04214"
"00391843"	"04214"
"00391844"	"04214"
"00391845"	"04214"
"00391846"	"04214"
"00391847"	"04214"
"00391848"	"04214"
"00391849"	"04214"
"00391850"	"04214"
"00391851"	"04214"
"00391852"	"04214"
"00391872"	"04214"
"00391919"	"04214"
"00391920"	"04214"
"00391921"	"04214"
"00391922"	"04214"
"00392912"	"04214"
"00393335"	"04214"
"00393336"	"04214"
"00393337"	"04214"
"00393977"	"04214"
"00393978"	"04214"
"00393979"	"04214"
"00393980"	"04214"
"00393981"	"04214"
"00393986"	"04214"
"00394355"	"04214"
"00398565"	"04214"
"00398567"	"04214"
"00398569"	"04214"
"00398570"	"04214"
"00398572"	"04214"
"00398629"	"04214"
"00398632"	"04214"
"00398639"	"04214"
"00398640"	"04214"
"00398641"	"04214"
"00398642"	"04214"
"00398643"	"04214"
"00398644"	"04214"
"00398652"	"04214"
"00398654"	"04214"
"00398655"	"04214"
"00398657"	"04214"
"00398658"	"04214"
"00398659"	"04214"
"00398767"	"04214"
"00398768"	"04214"
"00398769"	"04214"
"00398770"	"04214"
"00398771"	"04214"
"00398772"	"04214"
"00398773"	"04214"
"00398784"	"04214"
"00408430"	"04214"
"00408431"	"04214"
"00415767"	"04214"
"00415768"	"04214"
"00415769"	"04214"
"00415770"	"04214"
"00415771"	"04214"
"00415772"	"04214"
"00415773"	"04214"
"00415774"	"04214"
"00415777"	"04214"
"00415778"	"04214"
"00419700"	"04214"
"00419701"	"04214"
"00419702"	"04214"
"00426903"	"04214"
"00426904"	"04214"
"00426905"	"04214"
"00426906"	"04214"
"00426911"	"04214"
"00426912"	"04214"
"00436594"	"02156"
"00446909"	"00198"
"00446910"	"00198"
"00446911"	"00198"
"00446913"	"00198"
"00446914"	"00198"
"00446915"	"00198"
"00446916"	"00198"
"00446917"	"00198"
"00446918"	"00198"
"00446924"	"00198"
"00447211"	"00198"
"00447399"	"00198"
"00447485"	"00198"
"00447562"	"00198"
"00447620"	"00198"
"00447657"	"00198"
"00447673"	"00198"
"00447674"	"00198"
"00447680"	"00198"
"00450792"	"04249"
"00450793"	"04249"
"00450794"	"04249"
"00450795"	"04249"
"00450796"	"04249"
"00450797"	"04249"
"00450798"	"04249"
"00450799"	"04249"
"00450800"	"04249"
"00450801"	"04249"
"00450802"	"04249"
"00450803"	"04249"
"00450804"	"04249"
"00450805"	"04249"
"00451034"	"04249"
"00451121"	"04249"
"00451139"	"04249"
"00451229"	"04249"
"00454772"	"02016"
"00454775"	"02016"
"00454776"	"02016"
"00454777"	"02016"
"00454945"	"04230"
"00454946"	"04230"
"00454947"	"04230"
"00454948"	"04230"
"00454949"	"04230"
"00454950"	"04230"
"00454951"	"04230"
"00454952"	"04230"
"00454953"	"04230"
"00454954"	"04230"
"00454955"	"04230"
"00454956"	"04230"
"00454957"	"04230"
"00454958"	"04230"
"00454959"	"04230"
"00454960"	"04230"
"00454961"	"04230"
"00454962"	"04230"
"00454963"	"04230"
"00454964"	"04230"
"00454965"	"04230"
"00454966"	"04230"
"00454967"	"04230"
"00454968"	"04230"
"00454969"	"04230"
"00454970"	"04230"
"00454971"	"04230"
"00454972"	"04230"
"00454973"	"04230"
"00454974"	"04230"
"00454975"	"04230"
"00454976"	"04230"
"00454977"	"04230"
"00454978"	"04230"
"00454979"	"04230"
"00454980"	"04230"
"00454981"	"04230"
"00454982"	"04230"
"00454983"	"04230"
"00454984"	"04230"
"00454985"	"04230"
"00454986"	"04230"
"00454987"	"04230"
"00454988"	"04230"
"00454989"	"04230"
"00454990"	"04230"
"00454991"	"04230"
"00454992"	"04230"
"00454993"	"04230"
"00454994"	"04230"
"00454995"	"04230"
"00454996"	"04230"
"00454997"	"04230"
"00454998"	"04230"
"00454999"	"04230"
"00455000"	"04230"
"00455001"	"04230"
"00455002"	"04230"
"00464537"	"04214"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00198, 00381, 00420, 02016, 02156, 04213, 04214, 04215, 04217, 04230, 04249
## Count = 656
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000074222"	"00381"	"00095944"	"01769"	"Familial, autosomal recessive"	""	"progressive RD"	""	""	""	""	""	""	""	""	""	""	""
"0000082905"	"04230"	"00105013"	"01244"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000082936"	"04214"	"00105022"	"01244"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000116936"	"04214"	"00144158"	"01780"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000127940"	"02016"	"00155440"	"01243"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000127941"	"02016"	"00155441"	"01243"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000127942"	"02016"	"00155442"	"01243"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000127943"	"02016"	"00155443"	"01243"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000127944"	"02016"	"00155444"	"01243"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000127945"	"02016"	"00155445"	"01243"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000127946"	"02016"	"00155446"	"01243"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000135710"	"04213"	"00170849"	"00244"	"Familial, autosomal recessive"	""	""	"02y"	"05y"	""	""	""	""	""	""	""	""	""
"0000138586"	"04230"	"00173732"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., total colorblindness, photophobia, nystagmus, 20/200 visual acuity, normal-appearing retina; ECG slightly lower than normal rod function, no detectable cone response"	""	""	""	""	""	""	""	""	"ACHM-3"	"achromatopsia"	""
"0000138587"	"04230"	"00173733"	"00006"	"Familial, autosomal recessive"	""	"achromatopsia, total colourblindness, photophobia, nystagmus, 20/200 visual acuity, normal-appearing retina, healthy, normal intelligence; electroretinography older brother revealed normal rod\r\nresponse, no cone response"	""	""	""	""	""	""	""	""	"ACHM-3"	"achromatopsia"	""
"0000138590"	"04230"	"00173737"	"00006"	"Familial, autosomal recessive"	"01y"	"horizontal nystagmus, marked photophobia; normal electroretinographic\r\nrod response, no detectable cone response"	""	""	""	""	""	""	""	""	"ACHM-3"	"achromatopsia"	""
"0000138591"	"04230"	"00173738"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"ACHM-3"	"achromatopsia"	""
"0000138593"	"04230"	"00173740"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"ACHM-3"	"achromatopsia"	""
"0000138594"	"04230"	"00173741"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"ACHM-3"	"achromatopsia"	""
"0000138595"	"04230"	"00173742"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"ACHM-3"	"achromatopsia"	""
"0000138596"	"04230"	"00173743"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"ACHM-3"	"achromatopsia"	""
"0000138597"	"04230"	"00173744"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"ACHM-3"	"achromatopsia"	""
"0000138598"	"04230"	"00173745"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"ACHM-3"	"achromatopsia"	""
"0000138599"	"04230"	"00173746"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"ACHM-3"	"achromatopsia"	""
"0000138600"	"04230"	"00173747"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"ACHM-3"	"achromatopsia"	""
"0000138601"	"04230"	"00173748"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"ACHM-3"	"achromatopsia"	""
"0000201570"	"00198"	"00263131"	"01807"	"Unknown"	""	"Achromatopsia (HP:0011516)"	""	""	""	""	""	""	""	""	""	""	""
"0000223125"	"00198"	"00295560"	"01164"	"Unknown"	""	"Abnormal eye physiology (HP:0012373); Achromatopsia (HP:0011516)"	""	""	""	""	""	""	""	""	""	""	""
"0000233927"	"04214"	"00308499"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000233928"	"04214"	"00308500"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000234414"	"04214"	"00309094"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000234415"	"04214"	"00309095"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000234416"	"04214"	"00309096"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000234417"	"04214"	"00309097"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000234418"	"04214"	"00309098"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000234419"	"04214"	"00309099"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000234420"	"04214"	"00309100"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000234421"	"04214"	"00309101"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000234422"	"04214"	"00309102"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000234423"	"04214"	"00309103"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000241932"	"04214"	"00319828"	"00008"	"Familial, autosomal recessive"	""	"Age: 2y"	""	""	""	""	""	""	""	""	""	"rod monochromacy (RM)"	""
"0000241933"	"04214"	"00319829"	"00008"	"Familial, autosomal recessive"	""	"Age: 2y6m"	""	""	""	""	""	""	""	""	""	"rod monochromacy (RM)"	""
"0000241934"	"04214"	"00319830"	"00008"	"Familial, autosomal recessive"	""	"Age: 13y"	""	""	""	""	""	""	""	""	""	"rod monochromacy (RM)"	""
"0000241935"	"04214"	"00319831"	"00008"	"Familial, autosomal recessive"	""	"Age: 13y"	""	""	""	""	""	""	""	""	""	"rod monochromacy (RM)"	""
"0000241936"	"04214"	"00319832"	"00008"	"Familial, autosomal recessive"	""	"Age: 21y"	""	""	""	""	""	""	""	""	""	"rod monochromacy (RM)"	""
"0000241937"	"04214"	"00319833"	"00008"	"Familial, autosomal recessive"	""	"Age: 26y"	""	""	""	""	""	""	""	""	""	"rod monochromacy (RM)"	""
"0000241938"	"04214"	"00319834"	"00008"	"Familial, autosomal recessive"	""	"Age: 36y"	""	""	""	""	""	""	""	""	""	"rod monochromacy (RM)"	""
"0000242086"	"04214"	"00320042"	"00008"	"Familial, autosomal recessive"	""	"age: 10y"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000242087"	"04214"	"00320043"	"00008"	"Familial, autosomal recessive"	""	"age: 8y"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000242088"	"04214"	"00320044"	"00008"	"Familial, autosomal recessive"	""	"age: 38y"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000242092"	"04214"	"00320048"	"00008"	"Familial, autosomal recessive"	""	"age: 44y"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000242098"	"04214"	"00320054"	"00008"	"Familial, autosomal recessive"	""	"age: 14y"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000242099"	"04214"	"00320055"	"00008"	"Familial, autosomal recessive"	""	"age: 20y"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000242101"	"04214"	"00320057"	"00008"	"Familial, autosomal recessive"	""	"age: 34y"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000242102"	"04214"	"00320058"	"00008"	"Familial, autosomal recessive"	""	"age: 36y"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000242104"	"04214"	"00320060"	"00008"	"Familial, autosomal recessive"	""	"age: 2y"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000242105"	"04214"	"00320061"	"00008"	"Familial, autosomal recessive"	""	"age: 24y"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000242107"	"04214"	"00320063"	"00008"	"Familial, autosomal recessive"	""	"age: 12y"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000242818"	"04214"	"00324248"	"00008"	"Familial"	"8y"	""	""	""	""	""	""	""	""	""	""	"macular degeneration (MD)"	""
"0000242821"	"04214"	"00324251"	"00008"	"Familial"	"31y"	""	""	""	""	""	""	""	""	""	""	"achromatopsia (ACHM)"	""
"0000242825"	"04214"	"00324255"	"00008"	"Familial"	"65y"	""	""	""	""	""	""	""	""	""	""	"achromatopsia (ACHM)"	""
"0000242826"	"04214"	"00324256"	"00008"	"Familial"	"32y"	""	""	""	""	""	""	""	""	""	""	"achromatopsia (ACHM)"	""
"0000242828"	"04214"	"00324258"	"00008"	"Familial"	"35y"	""	""	""	""	""	""	""	""	""	""	"achromatopsia (ACHM)"	""
"0000242829"	"04214"	"00324259"	"00008"	"Familial"	"7y"	""	""	""	""	""	""	""	""	""	""	"achromatopsia (ACHM)"	""
"0000242832"	"04214"	"00324262"	"00008"	"Familial"	"31y"	""	""	""	""	""	""	""	""	""	""	"achromatopsia (ACHM)"	""
"0000242833"	"04214"	"00324263"	"00008"	"Familial"	"29y"	""	""	""	""	""	""	""	""	""	""	"achromatopsia (ACHM)"	""
"0000242834"	"04214"	"00324264"	"00008"	"Familial"	"23y"	""	""	""	""	""	""	""	""	""	""	"achromatopsia (ACHM)"	""
"0000242836"	"04214"	"00324266"	"00008"	"Familial"	"31y"	""	""	""	""	""	""	""	""	""	""	"macular degeneration (MD)"	""
"0000242838"	"04214"	"00324268"	"00008"	"Familial"	"77y"	""	""	""	""	""	""	""	""	""	""	"macular malfunction (MM)"	""
"0000242839"	"04214"	"00324269"	"00008"	"Familial"	"47y"	""	""	""	""	""	""	""	""	""	""	"macular malfunction (MM)"	""
"0000242841"	"04214"	"00324271"	"00008"	"Familial"	"58y"	""	""	""	""	""	""	""	""	""	""	"macular degeneration (MD)"	""
"0000242842"	"04214"	"00324272"	"00008"	"Familial"	"35y"	""	""	""	""	""	""	""	""	""	""	"achromatopsia (ACHM)"	""
"0000242843"	"04214"	"00324273"	"00008"	"Familial"	"40y"	""	""	""	""	""	""	""	""	""	""	"achromatopsia (ACHM)"	""
"0000242844"	"04214"	"00324274"	"00008"	"Familial"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia (ACHM)"	""
"0000242845"	"04214"	"00324275"	"00008"	"Familial"	"38y"	""	""	""	""	""	""	""	""	""	""	"achromatopsia (ACHM)"	""
"0000243974"	"04214"	"00325487"	"00006"	"Unknown"	""	"retinitis pigmentosa"	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000246162"	"04214"	"00327935"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000246194"	"04214"	"00327967"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000246250"	"04214"	"00328023"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinal dystrophy"	""
"0000246362"	"04214"	"00328135"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000246433"	"04214"	"00328206"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"macular dystrophy"	""
"0000246538"	"04214"	"00328311"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000246565"	"04214"	"00328338"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis"	""
"0000246677"	"04214"	"00328451"	"00000"	"Familial, autosomal recessive"	"3y"	"cone dysfunction syndrome (HP:0030637)"	""	""	""	""	""	""	""	""	""	"cone dysfunction syndrome"	""
"0000246678"	"04214"	"00328452"	"00000"	"Familial, autosomal recessive"	"5y"	"cone dysfunction syndrome (HP:0030637)"	""	""	""	""	""	""	""	""	""	"cone dysfunction syndrome"	""
"0000246679"	"04214"	"00328453"	"00000"	"Familial, autosomal recessive"	"14y"	"cone dysfunction syndrome (HP:0030637)"	""	""	""	""	""	""	""	""	""	"cone dysfunction syndrome"	""
"0000246680"	"04214"	"00328454"	"00000"	"Familial, autosomal recessive"	"3y"	"cone dysfunction syndrome(HP:0030637), cone/cone-rod dystrophy (HP:0000548)"	""	""	""	""	""	""	""	""	""	"cone dysfunction syndrome"	""
"0000249489"	"04214"	"00331296"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000249492"	"04214"	"00331299"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000249912"	"04214"	"00331720"	"00000"	"Familial, autosomal recessive"	"12y"	"see paper; ..., detailed analysis"	""	""	""	""	""	""	""	""	""	"congenital achromatopsia"	""
"0000249913"	"04214"	"00331721"	"00000"	"Familial, autosomal recessive"	"44y"	"see paper; ..., detailed analysis"	""	""	""	""	""	""	""	""	""	"congenital achromatopsia"	""
"0000249914"	"04214"	"00331722"	"00000"	"Familial, autosomal recessive"	"29y"	"see paper; ..., detailed analysis"	""	""	""	""	""	""	""	""	""	"congenital achromatopsia"	""
"0000249915"	"04214"	"00331723"	"00000"	"Familial, autosomal recessive"	"14y"	"see paper; ..., detailed analysis"	""	""	""	""	""	""	""	""	""	"congenital achromatopsia"	""
"0000249916"	"04214"	"00331724"	"00000"	"Familial, autosomal recessive"	"21y"	"see paper; ..., detailed analysis"	""	""	""	""	""	""	""	""	""	"congenital achromatopsia"	""
"0000249917"	"04214"	"00331725"	"00000"	"Familial, autosomal recessive"	"15y"	"see paper; ..., detailed analysis"	""	""	""	""	""	""	""	""	""	"congenital achromatopsia"	""
"0000249918"	"04214"	"00331726"	"00000"	"Familial, autosomal recessive"	"32y"	"see paper; ..., detailed analysis"	""	""	""	""	""	""	""	""	""	"congenital achromatopsia"	""
"0000250379"	"04214"	"00332192"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy, achromatopsia"	""
"0000250414"	"04214"	"00332227"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000250465"	"04214"	"00332278"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis, early-onset retinal dystrophy"	""
"0000250475"	"04214"	"00332288"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis, early-onset retinal dystrophy"	""
"0000250590"	"04214"	"00332404"	"00000"	"Familial, autosomal recessive"	"12y4m"	"horizontal jerk nystagmus; fundus grossly normal; no oculodigital sign; photopic ERG absent"	""	""	""	""	""	""	""	""	"ACHM"	"achromatopsia"	""
"0000250635"	"04214"	"00332451"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"ACHM"	""
"0000250636"	"04214"	"00332452"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"ACHM"	""
"0000250637"	"04214"	"00332453"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"LCA"	""
"0000251523"	"04214"	"00333337"	"00000"	"Familial, autosomal recessive"	""	""	"7y"	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000251617"	"04214"	"00333430"	"00000"	"Unknown"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000251819"	"04214"	"00333635"	"00000"	"Familial, autosomal recessive"	"28y"	"clinical category IA2d"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000252170"	"04214"	"00333985"	"00000"	"Familial, autosomal recessive"	"52y"	"clinical category IA2d"	""	""	""	""	""	""	""	""	""	"achromatopsia v Cone Dystrophy"	""
"0000252171"	"04214"	"00333986"	"00000"	"Familial, autosomal recessive"	"75y"	"clinical category IA2d"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000252172"	"04214"	"00333987"	"00000"	"Familial, autosomal recessive"	"60y"	"clinical category IA2d"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000252173"	"04214"	"00333988"	"00000"	"Familial, autosomal recessive"	"12y"	"clinical category IA2d"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000252485"	"00420"	"00334379"	"03971"	"Familial, autosomal recessive"	""	""	"16y"	"21y"	""	""	""	""	""	""	""	""	""
"0000252550"	"04214"	"00334461"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"early-onset retinal degeneration"	""
"0000252682"	"04214"	"00334896"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000252821"	"00198"	"00335106"	"00000"	"Unknown"	""	"0y-diagnosis visual impairment"	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis"	""
"0000252822"	"00198"	"00335107"	"00000"	"Unknown"	""	"0y-diagnosis visual impairment"	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis"	""
"0000252825"	"00198"	"00335110"	"00000"	"Unknown"	""	"2y-diagnosis visual impairment"	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000252942"	"04214"	"00335227"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis vs retinitis pigmentosa vs cone–rod dystrophy"	""
"0000253049"	"04214"	"00335335"	"02485"	"Unknown"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000253430"	"04214"	"00335485"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000253884"	"04214"	"00335969"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal dystrophy"	""
"0000254267"	"04214"	"00358969"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"Leber Congenital Amaurosis"	""
"0000254301"	"04214"	"00359004"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000254308"	"04214"	"00359011"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000254311"	"04214"	"00359014"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000254314"	"04214"	"00359017"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000254315"	"04214"	"00359018"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000254316"	"04214"	"00359019"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000254317"	"04214"	"00359020"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000254892"	"00198"	"00359619"	"01807"	"Unknown"	""	"Achromatopsia (HP:0011516)"	""	""	""	""	""	""	""	""	""	""	""
"0000257555"	"04214"	"00362141"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000257556"	"04214"	"00362142"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000257557"	"04214"	"00362143"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000258286"	"04214"	"00362920"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000268623"	"04214"	"00373342"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"retinal dystrophy"	""
"0000269081"	"04214"	"00373872"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000269082"	"04214"	"00373873"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000270204"	"04214"	"00374994"	"00000"	"Familial, autosomal recessive"	"16y"	"see paper; ..., foveal hypoplasia"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000270205"	"04214"	"00374995"	"00000"	"Familial, autosomal recessive"	"23y"	"see paper; ..., foveal hypoplasia"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000270206"	"04214"	"00374996"	"00000"	"Familial, autosomal recessive"	"24y"	"see paper; ..., no foveal hypoplasia"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000270207"	"04214"	"00374997"	"00000"	"Familial, autosomal recessive"	"14y"	"see paper; ..., foveal hypoplasia"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000270208"	"04214"	"00374998"	"00000"	"Familial, autosomal recessive"	"17y"	"see paper; ..., foveal hypoplasia"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000270570"	"04214"	"00375356"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000270572"	"04214"	"00375358"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000270573"	"04214"	"00375359"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000270578"	"04214"	"00375364"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000270579"	"04214"	"00375365"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000271511"	"04214"	"00376303"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000271512"	"04214"	"00376304"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000272198"	"04214"	"00377007"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Progressive Cone Dystrophy"	""
"0000272199"	"04214"	"00377008"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Progressive Cone Dystrophy"	""
"0000272200"	"04214"	"00377009"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Progressive Cone Dystrophy"	""
"0000272201"	"04214"	"00377010"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Progressive Cone Dystrophy"	""
"0000272202"	"04214"	"00377011"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Progressive Cone Dystrophy"	""
"0000272207"	"04214"	"00377016"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000272208"	"04214"	"00377017"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000272209"	"04214"	"00377018"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000272210"	"04214"	"00377019"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000272211"	"04214"	"00377020"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000272212"	"04214"	"00377021"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000272213"	"04214"	"00377022"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000272214"	"04214"	"00377023"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000272215"	"04214"	"00377024"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000272216"	"04214"	"00377025"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000272338"	"04214"	"00377180"	"00000"	"Isolated (sporadic)"	"7y"	"see paper"	"9m"	"4y"	""	""	""	""	""	""	""	"retinal disease"	""
"0000272357"	"04214"	"00377199"	"00000"	"Familial, autosomal recessive"	"13y"	"see paper"	"9m"	"2y"	""	""	""	""	""	""	"achromatopsia, type 3 (ACHM-3)"	"retinal disease"	""
"0000272381"	"04214"	"00377223"	"00000"	"Familial, autosomal recessive"	"16y"	"see paper"	"2m"	"7y"	""	""	""	""	""	""	"achromatopsia, type 3 (ACHM-3)"	"retinal disease"	""
"0000272401"	"04214"	"00377243"	"00000"	"Isolated (sporadic)"	"30y"	"see paper"	"6m"	"16y"	""	""	""	""	""	""	""	"retinal disease"	""
"0000272851"	"04214"	"00377700"	"00000"	"Familial, autosomal recessive"	"19y"	"congenital nystagmus, photophobia and were color blind,showed the beginning of a Bull’s"	""	""	""	""	""	""	""	""	""	"retinal dystrophy,autosomal recessive a achromatopsia."	""
"0000272852"	"04214"	"00377701"	"00000"	"Familial, autosomal recessive"	""	"congenital nystagmus photophobia along with low visual acuity and were found to be color blind"	""	""	""	""	""	""	""	""	""	"retinal dystrophy,autosomal recessive a achromatopsia."	""
"0000272853"	"04214"	"00377702"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinal dystrophy,autosomal recessive a achromatopsia."	""
"0000272854"	"04214"	"00377703"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinal dystrophy,autosomal recessive a achromatopsia."	""
"0000272855"	"04214"	"00377704"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinal dystrophy,autosomal recessive a achromatopsia."	""
"0000272856"	"04214"	"00377705"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinal dystrophy,autosomal recessive a achromatopsia."	""
"0000272857"	"04214"	"00377706"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinal dystrophy,autosomal recessive a achromatopsia."	""
"0000272858"	"04214"	"00377707"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinal dystrophy,autosomal recessive a achromatopsia."	""
"0000273109"	"04214"	"00377963"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Cone distrophy"	""
"0000273121"	"04214"	"00377975"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Cone distrophy"	""
"0000273129"	"04214"	"00377983"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Cone distrophy"	""
"0000273130"	"04214"	"00377984"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Cone distrophy"	""
"0000273131"	"04214"	"00377985"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Cone distrophy"	""
"0000273132"	"04214"	"00377986"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Cone distrophy"	""
"0000273133"	"04214"	"00377987"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Cone distrophy"	""
"0000273134"	"04214"	"00377988"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Cone distrophy"	""
"0000273135"	"04214"	"00377989"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Cone distrophy"	""
"0000273138"	"04214"	"00377992"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Cone distrophy"	""
"0000274042"	"04214"	"00380187"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinal dystrophy"	""
"0000274725"	"04214"	"00380872"	"00000"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	"Retinitis pigmentosa 39"	""
"0000274974"	"04214"	"00381123"	"00000"	"Unknown"	"6y"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274975"	"04214"	"00381124"	"00000"	"Unknown"	"11y"	"Foveal hypoplasia"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274976"	"04214"	"00381125"	"00000"	"Unknown"	"11y"	"Foveal hypoplasia"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274977"	"04214"	"00381126"	"00000"	"Unknown"	"12y"	"Foveal hypoplasia"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274978"	"04214"	"00381127"	"00000"	"Unknown"	"12y"	"Foveal hypoplasia"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274979"	"04214"	"00381128"	"00000"	"Unknown"	"13y"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274980"	"04214"	"00381129"	"00000"	"Unknown"	"17y"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274981"	"04214"	"00381130"	"00000"	"Unknown"	"18y"	"Foveal hypoplasia"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274982"	"04214"	"00381131"	"00000"	"Unknown"	"19y"	"Foveal hypoplasia"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274983"	"04214"	"00381132"	"00000"	"Unknown"	"23y"	"Foveal hypoplasia"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274984"	"04214"	"00381133"	"00000"	"Unknown"	"24y"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274985"	"04214"	"00381134"	"00000"	"Unknown"	"27y"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274986"	"04214"	"00381135"	"00000"	"Unknown"	"33y"	"Foveal hypoplasia"	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274987"	"04214"	"00381136"	"00000"	"Unknown"	"33y"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000274988"	"04214"	"00381137"	"00000"	"Unknown"	"47y"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia (ACHM)"	""
"0000275637"	"04214"	"00381795"	"00000"	"Familial, autosomal recessive"	"37y"	""	"33y"	""	""	""	""	""	""	""	""	"Retinitis Pigmentosa"	""
"0000275638"	"04214"	"00381796"	"00000"	"Familial, autosomal recessive"	"2y"	""	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis (LCA), cone-rod dystrophy"	""
"0000275805"	"04214"	"00381963"	"00000"	"Familial, autosomal recessive"	"5y6m"	"visual acuity : od: 0.4 , os: 0.3; fundus: absent foveal reflex, otherwise normal; color vision: impaired; electroretinography: scotopic: normal, 30 hz flicker + , photopic: severely abnormal; photophobia: no; nystagmus : yes; progression: no"	"2y"	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000275806"	"04214"	"00381964"	"00000"	"Familial, autosomal recessive"	"11y"	"visual acuity : od: 0.2, os: 0.2; fundus: shallow foveal pit, otherwise normal; color vision: absent; electroretinography: scotopic: normal, photopic: absent; photophobia: yes; nystagmus : yes; progression: no"	"21d"	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000275807"	"04214"	"00381965"	"00000"	"Familial, autosomal recessive"	"25y"	"visual acuity : od: 0.1, os: 0.1; fundus: normal fundus; color vision: severely impaired; electroretinography: no reliable data; photophobia: yes; nystagmus : yes; progression: no"	"0y"	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000275808"	"04214"	"00381966"	"00000"	"Familial, autosomal recessive"	"41y"	"visual acuity : od: 0.1, os: 0.1; fundus: subtle oval foveal depression in each eye; color vision: absent; electroretinography: scotopic: normal, 30 hz flicker + photopic: severely abnormal and delayed; photophobia: yes; nystagmus : yes; progression: no"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000275809"	"04214"	"00381967"	"00000"	"Familial, autosomal recessive"	"48y"	"visual acuity : od: 0.6 , os: 0.8; fundus: foveal yellow spot on the right eye, regressed yellow spot with central scar on the left eye; color vision: no data; electroretinography: mferg: reduced central responses; photophobia: no; nystagmus : no; progression: mild"	"44y"	""	""	""	""	""	""	""	""	"macular dystrophy"	""
"0000275810"	"04214"	"00381968"	"00000"	"Familial, autosomal recessive"	"22y"	"visual acuity : od: 0.1, os: 0.1; fundus: minor foveal pigment mottling, otherwise normal; color vision: impaired; electroretinography: erg examination not tolerated by patient; photophobia: yes; nystagmus : yes; progression: no follow up"	""	""	""	""	""	""	""	""	""	"incomplete achromatopsia"	""
"0000275811"	"04214"	"00381969"	"00000"	"Familial, autosomal recessive"	"23y"	"visual acuity : od: 0.1, os: 0.1; fundus: no foveolar reflex, but positive wall reflex, otherwise normal; color vision: impaired; electroretinography: scotopic: normal, photopic: no responses; photophobia: yes; nystagmus : yes; progression: no"	"0y"	""	""	""	""	""	""	""	""	"oligo-cone trichromacy"	""
"0000275812"	"04214"	"00381970"	"00000"	"Familial, autosomal recessive"	"30y"	"visual acuity : od: 0.66, os: 0:5; fundus: foveal atrophy, tiny crystlline shean to degeneration of foveal atrophy, grey shean to anterior retina.; color vision: impaired; electroretinography: scotopic: , photopic: , 30 hz flicker:; photophobia: no; nystagmus : n.d.; progression: n.d."	"30y"	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000275813"	"04214"	"00381971"	"00000"	"Familial, autosomal recessive"	"14y"	"visual acuity : od: 0.1 , os: 0.2; fundus: no pathology, eccentric fixation; color vision: severely impaired; electroretinography: scotopic: normal, photopic: no response; photophobia: yes; nystagmus : yes; progression: no"	"0y"	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000275814"	"04214"	"00381972"	"00000"	"Familial, autosomal recessive"	"17y"	"visual acuity : od: 0.4, os: 0.25; fundus: normal fundus, normal oct; color vision: impaired; electroretinography: scotopic: normal, photopic: no response; photophobia: yes; nystagmus : yes; progression: no"	"3m"	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000275815"	"04214"	"00381973"	"00000"	"Familial, autosomal recessive"	"53y"	"visual acuity : od: 0.16 os: 0.125; fundus: macula dystrophic, outer periphery with pigment irregularities; color vision: severely impaired; electroretinography: scotopic: normal, photopic: no response; photophobia: yes; nystagmus : yes; progression: no"	"0y"	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000275816"	"04214"	"00381974"	"00000"	"Familial, autosomal recessive"	"56y"	"visual acuity : od: 0.1 , os: 0.1; fundus: normal, with slight pigmentary changes; color vision: severely impaired; electroretinography: scotopic: normal, photopic: severely diminished with only residual responses, 30 hz flicker: no response, ; photophobia: yes; nystagmus : no; progression: no"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000275817"	"04214"	"00381975"	"00000"	"Familial, autosomal recessive"	"57y"	"visual acuity : od: 0.06, os: 0.06; fundus: atrophic fovea, heavy rpe granularity, and pigmentary disruption; color vision: severely impaired; electroretinography: scotopic: below normal , photopic: 30 hz flicker dimished to extinct; photophobia: yes; nystagmus : yes; progression: yes"	""	""	""	""	""	""	""	""	""	"incomplete achromatopsia"	""
"0000275970"	"02016"	"00382128"	"00000"	"Familial, autosomal recessive"	""	"retinal dystrophy; MIM, 262300 or 248200"	""	""	""	""	""	""	""	""	""	"MIM, 262300 or 248200"	""
"0000275971"	"02016"	"00382129"	"00000"	"Familial, autosomal recessive"	""	"retinal dystrophy; MIM, 262300 or 248200"	""	""	""	""	""	""	""	""	""	"MIM, 262300 or 248200"	""
"0000275972"	"02016"	"00382130"	"00000"	"Familial, autosomal recessive"	""	"retinal dystrophy; MIM, 262300 or 248200"	""	""	""	""	""	""	""	""	""	"MIM, 262300 or 248200"	""
"0000275973"	"02016"	"00382131"	"00000"	"Familial, autosomal recessive"	""	"retinal dystrophy; MIM, 262300 or 248200"	""	""	""	""	""	""	""	""	""	"MIM, 262300 or 248200"	""
"0000276108"	"04214"	"00382259"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000276109"	"04214"	"00382260"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000276110"	"04214"	"00382261"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Cone-rod dystrophy"	""
"0000276111"	"04214"	"00382262"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis"	""
"0000276112"	"04214"	"00382263"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000276113"	"04214"	"00382264"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000276273"	"04214"	"00382424"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Retinitis pigmentosa"	""
"0000276377"	"04214"	"00382528"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Retinitis pigmentosa"	""
"0000276483"	"04214"	"00382634"	"00000"	"Unknown"	"2y"	"additional consang.; micronystagmus; amblyopia; hypermetropia"	""	""	""	""	""	""	""	""	""	"Cone dystrophy"	""
"0000276509"	"04214"	"00382660"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000276649"	"04214"	"00382793"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Retinitis pigmentosa"	""
"0000277203"	"04214"	"00383418"	"00000"	"Familial, autosomal recessive"	""	""	"0y"	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000277204"	"04214"	"00383419"	"00000"	"Familial, autosomal recessive"	""	""	"0y"	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000279979"	"04214"	"00386176"	"00000"	"Familial, autosomal recessive"	"15y"	""	""	"12y"	""	""	""	""	""	""	"Stargardt Disease"	""	""
"0000279982"	"04214"	"00386179"	"00000"	"Familial, autosomal recessive"	"49y"	""	""	"39y"	""	""	""	""	""	""	"Stargardt Disease"	""	""
"0000280004"	"04214"	"00386201"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000280015"	"04214"	"00386212"	"00000"	"Familial, autosomal recessive"	"53y"	""	""	"6y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000280016"	"04214"	"00386213"	"00000"	"Familial, autosomal recessive"	"49y"	""	""	"5y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000280027"	"04214"	"00386224"	"00000"	"Familial, autosomal recessive"	"14y"	""	""	"5y"	""	""	""	""	""	""	"cone-rod dystrophy"	""	""
"0000280072"	"04214"	"00386269"	"00000"	"Familial, autosomal recessive"	"51y"	""	""	"19y"	""	""	""	""	""	""	"Stargardt Disease"	""	""
"0000280077"	"04214"	"00386274"	"00000"	"Familial, autosomal recessive"	"22y"	""	""	"5y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000280078"	"04214"	"00386275"	"00000"	"Familial, autosomal recessive"	"19y"	""	""	"3y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000280080"	"04214"	"00386277"	"00000"	"Familial, autosomal recessive"	"45y"	""	""	"34y"	""	""	""	""	""	""	"retinitis pigmentosa"	""	""
"0000280094"	"04214"	"00386291"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	""
"0000280499"	"04214"	"00386699"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000280551"	"04214"	"00386751"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000282034"	"04214"	"00388482"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"blue cone monochromatism"	""
"0000282308"	"04214"	"00388767"	"00000"	"Familial, autosomal recessive"	"36y"	"age at genetic diagnosis mentioned"	""	"29y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283341"	"04214"	"00389800"	"00000"	"Familial, autosomal recessive"	"35y"	"age at genetic diagnosis mentioned"	""	"29y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283356"	"04214"	"00389815"	"00000"	"Familial, autosomal recessive"	"16y"	"age at genetic diagnosis mentioned"	""	"8y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283390"	"04214"	"00389849"	"00000"	"Familial, autosomal recessive"	"22y"	"age at genetic diagnosis mentioned"	""	"14y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283391"	"04214"	"00389850"	"00000"	"Familial, autosomal recessive"	"22y"	"age at genetic diagnosis mentioned"	""	"14y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283392"	"04214"	"00389851"	"00000"	"Familial, autosomal recessive"	"31y"	"age at genetic diagnosis mentioned"	""	"23y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283407"	"04214"	"00389866"	"00000"	"Familial, autosomal recessive"	"11y"	"age at genetic diagnosis mentioned"	""	"3y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283414"	"04214"	"00389873"	"00000"	"Familial, autosomal recessive"	"54y"	"age at genetic diagnosis mentioned"	""	"47y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283415"	"04214"	"00389874"	"00000"	"Familial, autosomal recessive"	"10y"	"age at genetic diagnosis mentioned"	""	"2y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283425"	"04214"	"00389884"	"00000"	"Familial, autosomal recessive"	"9y"	"age at genetic diagnosis mentioned"	""	"2y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283429"	"04214"	"00389888"	"00000"	"Familial, autosomal recessive"	"23y"	"age at genetic diagnosis mentioned"	""	"16y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283430"	"04214"	"00389889"	"00000"	"Familial, autosomal recessive"	"23y"	"age at genetic diagnosis mentioned"	""	"16y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283432"	"04214"	"00389891"	"00000"	"Familial, autosomal recessive"	"29y"	"age at genetic diagnosis mentioned"	""	"22y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283433"	"04214"	"00389892"	"00000"	"Familial, autosomal recessive"	"35y"	"age at genetic diagnosis mentioned"	""	"28y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283436"	"04214"	"00389895"	"00000"	"Familial, autosomal recessive"	"21y"	"age at genetic diagnosis mentioned"	""	"14y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283437"	"04214"	"00389896"	"00000"	"Familial, autosomal recessive"	"22y"	"age at genetic diagnosis mentioned"	""	"16y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283438"	"04214"	"00389897"	"00000"	"Familial, autosomal recessive"	"18y"	"age at genetic diagnosis mentioned"	""	"11y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283440"	"04214"	"00389899"	"00000"	"Familial, autosomal recessive"	"7y"	"age at genetic diagnosis mentioned"	""	"1y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283442"	"04214"	"00389901"	"00000"	"Familial, autosomal recessive"	"30y"	"age at genetic diagnosis mentioned"	""	"23y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283445"	"04214"	"00389904"	"00000"	"Familial, autosomal recessive"	"35y"	"age at genetic diagnosis mentioned"	""	"29y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283455"	"04214"	"00389914"	"00000"	"Familial, autosomal recessive"	"35y"	"age at genetic diagnosis mentioned"	""	"30y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283472"	"04214"	"00389931"	"00000"	"Familial, autosomal recessive"	"28y"	"age at genetic diagnosis mentioned"	""	"22y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283537"	"04214"	"00389996"	"00000"	"Familial, autosomal recessive"	"17y"	"age at genetic diagnosis mentioned"	""	"13y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283539"	"04214"	"00389998"	"00000"	"Familial, autosomal recessive"	"58y"	"age at genetic diagnosis mentioned"	""	"56y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283540"	"04214"	"00389999"	"00000"	"Familial, autosomal recessive"	"29y"	"age at genetic diagnosis mentioned"	""	"26y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283543"	"04214"	"00390002"	"00000"	"Familial, autosomal recessive"	"3y"	"age at genetic diagnosis mentioned"	""	"1y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283544"	"04214"	"00390003"	"00000"	"Familial, autosomal recessive"	"38y"	"age at genetic diagnosis mentioned"	""	"36y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283546"	"04214"	"00390005"	"00000"	"Familial, autosomal recessive"	"9y"	"age at genetic diagnosis mentioned"	""	"7y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283552"	"04214"	"00390011"	"00000"	"Familial, autosomal recessive"	"26y"	"age at genetic diagnosis mentioned"	""	"24y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283553"	"04214"	"00390012"	"00000"	"Familial, autosomal recessive"	"22y"	"age at genetic diagnosis mentioned"	""	"21y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283554"	"04214"	"00390013"	"00000"	"Familial, autosomal recessive"	"69y"	"age at genetic diagnosis mentioned"	""	"67y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283555"	"04214"	"00390014"	"00000"	"Familial, autosomal recessive"	"30y"	"age at genetic diagnosis mentioned"	""	"28y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283557"	"04214"	"00390016"	"00000"	"Familial, autosomal recessive"	"54y"	"age at genetic diagnosis mentioned"	""	"53y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283558"	"04214"	"00390017"	"00000"	"Familial, autosomal recessive"	"15y"	"age at genetic diagnosis mentioned"	""	"14y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283559"	"04214"	"00390018"	"00000"	"Familial, autosomal recessive"	"28y"	"age at genetic diagnosis mentioned"	""	"28y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283560"	"04214"	"00390019"	"00000"	"Familial, autosomal recessive"	"2y"	"age at genetic diagnosis mentioned"	""	"1y"	""	""	""	""	""	""	"achromatopsia"	""	""
"0000283767"	"04214"	"00390229"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000283768"	"04214"	"00390230"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000283769"	"04214"	"00390231"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	"retinal disease"	"retinal disease"	""
"0000283770"	"04214"	"00390232"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000283771"	"04214"	"00390233"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000283772"	"04214"	"00390234"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000283773"	"04214"	"00390235"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal disease"	""
"0000284231"	"04214"	"00390743"	"00000"	"Familial, autosomal recessive"	"18y"	"Visual acuity right eye/left eye: 2/10_2/10, normal fundus examination, retrofoveolar ellipsoid disruption"	"0m"	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284357"	"04214"	"00390869"	"00000"	"Unknown"	"21y-25y"	""	""	""	""	""	""	""	""	""	""	"cone dystrophy (COD)"	""
"0000284419"	"04214"	"00390931"	"00000"	"Unknown"	"21y-25y"	""	""	""	""	""	""	""	""	""	""	"cone dystrophy (COD)"	""
"0000284446"	"04214"	"00390958"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"ACHR"	""
"0000284506"	"04214"	"00391018"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284507"	"04214"	"00391019"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284508"	"04214"	"00391020"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284509"	"04214"	"00391021"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284510"	"04214"	"00391022"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284511"	"04214"	"00391023"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284512"	"04214"	"00391024"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284513"	"04214"	"00391025"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284514"	"04214"	"00391026"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284515"	"04214"	"00391027"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284516"	"04214"	"00391028"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284517"	"04214"	"00391029"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284518"	"04214"	"00391030"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284519"	"04214"	"00391031"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284520"	"04214"	"00391032"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284521"	"04214"	"00391033"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284522"	"04214"	"00391034"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284523"	"04214"	"00391035"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284524"	"04214"	"00391036"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284525"	"04214"	"00391037"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284526"	"04214"	"00391038"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284527"	"04214"	"00391039"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284528"	"04214"	"00391040"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284529"	"04214"	"00391041"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284530"	"04214"	"00391042"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284531"	"04214"	"00391043"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284532"	"04214"	"00391044"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284533"	"04214"	"00391045"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284534"	"04214"	"00391046"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284535"	"04214"	"00391047"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284536"	"04214"	"00391048"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284537"	"04214"	"00391049"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284538"	"04214"	"00391050"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284539"	"04214"	"00391051"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284540"	"04214"	"00391052"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284541"	"04214"	"00391053"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284542"	"04214"	"00391054"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284543"	"04214"	"00391100"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"28y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284544"	"04214"	"00391101"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"6m"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284545"	"04214"	"00391102"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"6y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284546"	"04214"	"00391103"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"1y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284547"	"04214"	"00391104"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"21y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284548"	"04214"	"00391105"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"6m"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284549"	"04214"	"00391106"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"17y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284550"	"04214"	"00391107"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"3y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284551"	"04214"	"00391108"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"12y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284552"	"04214"	"00391109"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"6y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284553"	"04214"	"00391110"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"6y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284554"	"04214"	"00391111"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"1y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284555"	"04214"	"00391112"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"1y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284556"	"04214"	"00391113"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"6y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284557"	"04214"	"00391114"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"13y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284558"	"04214"	"00391115"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"1y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284559"	"04214"	"00391116"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"2y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284560"	"04214"	"00391117"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"10y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284561"	"04214"	"00391118"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"6m"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284562"	"04214"	"00391119"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"12y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284563"	"04214"	"00391120"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"1y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284564"	"04214"	"00391121"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"4y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284565"	"04214"	"00391122"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"3y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284566"	"04214"	"00391123"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"4y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284567"	"04214"	"00391124"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"8y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284568"	"04214"	"00391125"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"12y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284569"	"04214"	"00391126"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"1y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284570"	"04214"	"00391127"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"6m"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284571"	"04214"	"00391128"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"5y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284572"	"04214"	"00391129"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"3y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284573"	"04214"	"00391130"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"13y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284574"	"04214"	"00391131"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"16y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284575"	"04214"	"00391132"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"20y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284576"	"04214"	"00391133"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"2y"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284577"	"04214"	"00391134"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	"6m"	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284730"	"04214"	"00391290"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284731"	"04214"	"00391291"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284732"	"04214"	"00391292"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284733"	"04214"	"00391293"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284734"	"04214"	"00391294"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284735"	"04214"	"00391295"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284736"	"04214"	"00391296"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284737"	"04214"	"00391297"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284738"	"04214"	"00391298"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284739"	"04214"	"00391299"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284740"	"04214"	"00391300"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284741"	"04214"	"00391301"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284742"	"04214"	"00391302"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284743"	"04214"	"00391303"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284744"	"04214"	"00391304"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284745"	"04214"	"00391305"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284746"	"04214"	"00391306"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284747"	"04214"	"00391307"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284748"	"04214"	"00391308"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284749"	"04214"	"00391309"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284750"	"04214"	"00391310"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284751"	"04214"	"00391311"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284752"	"04214"	"00391312"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284753"	"04214"	"00391313"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284754"	"04214"	"00391314"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284755"	"04214"	"00391315"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284756"	"04214"	"00391316"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"macular dystrophy"	""
"0000284757"	"04214"	"00391317"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000284758"	"04214"	"00391318"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000284759"	"04214"	"00391319"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000284760"	"04214"	"00391320"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000284761"	"04214"	"00391321"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000284762"	"04214"	"00391322"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"blue cone monochromatism"	""
"0000284763"	"04214"	"00391323"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284764"	"04214"	"00391324"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284765"	"04214"	"00391325"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284766"	"04214"	"00391326"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284767"	"04214"	"00391327"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284768"	"04214"	"00391328"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284769"	"04214"	"00391329"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284770"	"04214"	"00391330"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284771"	"04214"	"00391331"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284772"	"04214"	"00391332"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284773"	"04214"	"00391333"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284774"	"04214"	"00391334"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284775"	"04214"	"00391335"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284776"	"04214"	"00391336"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000284777"	"04214"	"00391337"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284778"	"04214"	"00391338"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"blue cone monochromatism"	""
"0000284779"	"04214"	"00391339"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284780"	"04214"	"00391340"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284781"	"04214"	"00391341"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284782"	"04214"	"00391342"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284783"	"04214"	"00391343"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284784"	"04214"	"00391344"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000284819"	"04214"	"00391379"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia  3 (262300)"	"Achromatopsia  3 (262300)"	""
"0000284820"	"04214"	"00391380"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia  3 (262300)"	"Achromatopsia  3 (262300)"	""
"0000284829"	"04214"	"00391492"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., complete achromatopsia"	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000284831"	"04214"	"00391494"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., complete achromatopsia, nystagmus, photophobia, poor visual acuity from early infancy, complete color-blindness, normal fundi; ERG-absent cone responses with normal rod responses"	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000284832"	"04214"	"00391495"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., progressive cone dystrophy"	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000284879"	"04214"	"00391543"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284880"	"04214"	"00391544"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284881"	"04214"	"00391545"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000284882"	"04214"	"00391546"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285081"	"04214"	"00391758"	"00000"	"Familial, autosomal recessive"	"23y"	"Nystagmus - infancy, Photophobia - infancy, visual acuity right/left eye:  20/200: 20/200, Contrast Sensitivity: 0.75:0.60, , Color vision: Strong RG & BY, deficit, Refractive error -10.50/+4.00 ×, 105:, -10.50/+4.00 × 75, Retinal exam: macular atrophy, Fundus autofluorescence: Foveal hyper-AF, Grade 1 foveal hypoplasia; Optical Coherence Tomography: Mild disruption of outer segments, in central, sub-foveal regi"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000285082"	"04215"	"00391759"	"00000"	"Familial, autosomal recessive"	"19y"	"Nystagmus - infancy, Photophobia - infancy, visual acuity right/left eye:  20/160: 20/200, Contrast Sensitivity: 0.75:0.60, , Color vision: Strong RG & BY, deficit, Refractive error -11.00/-11.00 × 75, Retinal exam: peripapillary atrophy; dull foveal reflex; peripheral lattice right eye, Fundus autofluorescence: Foveolar hypo AF; parafoveal hyper AF; Optical Coherence Tomography: Mild disruption of outer segments, in central, sub-foveal regio"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000285083"	"04217"	"00391760"	"00000"	"Familial, autosomal recessive"	"14y"	"Nystagmus - infancy, Photophobia - infancy, visual acuity right/left eye:  20/200: 20/250, Contrast Sensitivity: 0.75:0.75, , Color vision: Strong RG & moderate BY deficit, Refractive error -8.50/+1.25 × 115: -8.00/+1.00 × 70, Retinal exam: Tilted disc; dull foveal reflex; peripheral lattice; Fundus autofluorescence: subtle foveal hyper-AF, Grade 1 foveal hypoplasia; Optical Coherence Tomography: Mild disruption of outer segments, in central, sub-foveal regi"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000285090"	"04214"	"00391767"	"00006"	"Familial, autosomal recessive"	"36y"	"see paper; ..., achromatopsia, severe photobia, moderate nystagmus"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285091"	"04214"	"00391768"	"00006"	"Familial, autosomal recessive"	"10y"	"see paper; ..., achromatopsia, moderate photobia, severe nystagmus"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285092"	"04214"	"00391769"	"00006"	"Familial, autosomal recessive"	"65y"	"see paper; ..., achromatopsia, moderate photobia, slight nystagmus"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285093"	"04214"	"00391770"	"00006"	"Familial, autosomal recessive"	"12y"	"see paper; ..., achromatopsia, severe photobia, severe nystagmus"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285094"	"04214"	"00391771"	"00006"	"Familial, autosomal recessive"	"9y"	"see paper; ..., achromatopsia, severe photobia, severe nystagmus"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285095"	"04214"	"00391772"	"00006"	"Familial, autosomal recessive"	"22y"	"see paper; ..., achromatopsia, severe photobia, severe nystagmus"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285102"	"04214"	"00391779"	"00006"	"Familial, autosomal recessive"	"27y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285103"	"04214"	"00391780"	"00006"	"Familial, autosomal recessive"	"12y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285104"	"04214"	"00391781"	"00006"	"Familial, autosomal recessive"	"6y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285105"	"04214"	"00391782"	"00006"	"Familial, autosomal recessive"	"7y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285115"	"04214"	"00391802"	"00006"	"Familial, autosomal recessive"	"16y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285116"	"04214"	"00391803"	"00006"	"Familial, autosomal recessive"	"13y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285117"	"04214"	"00391804"	"00006"	"Familial, autosomal recessive"	"6y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285118"	"04214"	"00391805"	"00006"	"Familial, autosomal recessive"	"8y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285119"	"04214"	"00391806"	"00006"	"Familial, autosomal recessive"	"23y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285120"	"04214"	"00391807"	"00006"	"Familial, autosomal recessive"	"31y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285121"	"04214"	"00391808"	"00006"	"Familial, autosomal recessive"	"18y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285122"	"04214"	"00391809"	"00006"	"Familial, autosomal recessive"	"33y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285123"	"04214"	"00391810"	"00006"	"Familial, autosomal recessive"	"9y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285124"	"04214"	"00391811"	"00006"	"Familial, autosomal recessive"	"11y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285125"	"04214"	"00391812"	"00006"	"Familial, autosomal recessive"	"13y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285126"	"04214"	"00391813"	"00006"	"Familial, autosomal recessive"	"31y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285127"	"04214"	"00391814"	"00006"	"Familial, autosomal recessive"	"16y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285128"	"04214"	"00391815"	"00006"	"Familial, autosomal recessive"	"30y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285129"	"04214"	"00391816"	"00006"	"Familial, autosomal recessive"	"16y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285130"	"04214"	"00391817"	"00006"	"Familial, autosomal recessive"	"22y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285131"	"04214"	"00391818"	"00006"	"Familial, autosomal recessive"	"8y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285132"	"04214"	"00391819"	"00006"	"Familial, autosomal recessive"	"16y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285133"	"04214"	"00391820"	"00006"	"Familial, autosomal recessive"	"26y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285134"	"04214"	"00391821"	"00006"	"Familial, autosomal recessive"	"18y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285135"	"04214"	"00391822"	"00006"	"Familial, autosomal recessive"	"55y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285136"	"04214"	"00391823"	"00006"	"Familial, autosomal recessive"	"13y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285137"	"04214"	"00391824"	"00006"	"Familial, autosomal recessive"	"11y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285138"	"04214"	"00391825"	"00006"	"Familial, autosomal recessive"	"10y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285139"	"04214"	"00391826"	"00006"	"Familial, autosomal recessive"	"17y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285140"	"04214"	"00391827"	"00006"	"Familial, autosomal recessive"	"40y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285141"	"04214"	"00391828"	"00006"	"Familial, autosomal recessive"	"17y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285142"	"04214"	"00391829"	"00006"	"Familial, autosomal recessive"	"23y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285143"	"04214"	"00391830"	"00006"	"Familial, autosomal recessive"	"44y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285144"	"04214"	"00391831"	"00006"	"Familial, autosomal recessive"	"8y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285145"	"04214"	"00391832"	"00006"	"Familial, autosomal recessive"	"17y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285146"	"04214"	"00391833"	"00006"	"Familial, autosomal recessive"	"35y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285147"	"04214"	"00391834"	"00006"	"Familial, autosomal recessive"	"10y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285148"	"04214"	"00391835"	"00006"	"Familial, autosomal recessive"	"27y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285149"	"04214"	"00391836"	"00006"	"Familial, autosomal recessive"	"37y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285150"	"04214"	"00391837"	"00006"	"Familial, autosomal recessive"	"42y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285151"	"04214"	"00391838"	"00006"	"Familial, autosomal recessive"	"18y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285152"	"04214"	"00391839"	"00006"	"Familial, autosomal recessive"	"32y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285153"	"04214"	"00391840"	"00006"	"Familial, autosomal recessive"	"28y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285154"	"04214"	"00391841"	"00006"	"Familial, autosomal recessive"	"32y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285155"	"04214"	"00391842"	"00006"	"Familial, autosomal recessive"	"43y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285156"	"04214"	"00391843"	"00006"	"Familial, autosomal recessive"	"24y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285157"	"04214"	"00391844"	"00006"	"Familial, autosomal recessive"	"33y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285158"	"04214"	"00391845"	"00006"	"Familial, autosomal recessive"	"43y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285159"	"04214"	"00391846"	"00006"	"Familial, autosomal recessive"	"8y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285160"	"04214"	"00391847"	"00006"	"Familial, autosomal recessive"	"14y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285161"	"04214"	"00391848"	"00006"	"Familial, autosomal recessive"	"8y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285162"	"04214"	"00391849"	"00006"	"Familial, autosomal recessive"	"22y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285163"	"04214"	"00391850"	"00006"	"Familial, autosomal recessive"	"17y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285164"	"04214"	"00391851"	"00006"	"Familial, autosomal recessive"	"15y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285165"	"04214"	"00391852"	"00006"	"Familial, autosomal recessive"	"38y"	"see paper; ..."	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285168"	"04214"	"00391872"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., ametropia, emmetropization"	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000285209"	"04214"	"00391919"	"00000"	"Unknown"	""	"Best corrected visual acuity right/left eye: 0.3/0.3, fundus: leopard fundus, poor foveal reflex, electroretinogram responses: rod: mildly reduced, cone: extinguished, optical coherence tomography: thinning retina"	"6y"	"6y"	"poor vision"	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000285210"	"04214"	"00391920"	"00000"	"Unknown"	""	"Best corrected visual acuity right/left eye: 0.1/0.08, fundus: normal, electroretinogram responses: rod: normal, cone: extinguished"	"<1y"	"4y"	"nystagmus, photophobia"	""	""	""	""	""	""	"achromatopsia"	""
"0000285211"	"04214"	"00391921"	"00000"	"Unknown"	""	"Best corrected visual acuity right/left eye: 0.2/0.2, fundus: poor foveal reflex, electroretinogram responses: rod: moderately reduced, cone: extinguished"	"1y"	"6y"	"nystagmus, photophobia"	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000285212"	"04214"	"00391922"	"00000"	"Unknown"	""	"fundus: examination not available, electroretinogram responses: rod: extinguished, cone: extinguished"	"<1y"	"1y"	"nystagmus"	""	""	""	""	""	""	"Leber congenital amaurosis"	""
"0000286152"	"04214"	"00392912"	"00000"	"Familial, autosomal recessive"	"2y"	"early onset nystagmus"	"2m"	""	""	""	""	""	""	""	"Retinal dystrophy"	""	""
"0000286576"	"04214"	"00393335"	"00000"	"Isolated (sporadic)"	"8y"	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	"retinitis pigmentosa"	""
"0000286577"	"04214"	"00393336"	"00000"	"Isolated (sporadic)"	"50y"	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	"retinitis pigmentosa"	""
"0000286578"	"04214"	"00393337"	"00000"	"Isolated (sporadic)"	"73y"	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa"	"retinitis pigmentosa"	""
"0000287183"	"04214"	"00393977"	"00000"	"Familial, autosomal recessive"	"26y"	"Foveal HypoPlasia"	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000287184"	"04214"	"00393978"	"00000"	"Familial, autosomal recessive"	"8y"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000287185"	"04214"	"00393979"	"00000"	"Familial, autosomal recessive"	"46y"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000287186"	"04214"	"00393980"	"00000"	"Familial, autosomal recessive"	"10y"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000287187"	"04214"	"00393981"	"00000"	"Familial, autosomal recessive"	"4y"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000287192"	"04214"	"00393986"	"00000"	"Familial, autosomal recessive"	"7y"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""
"0000287559"	"04214"	"00394355"	"00000"	"Familial, autosomal recessive"	""	"Phenotype Tunnel vision on left eye, progressively worsening vision at 22 y, degeneration of photoreceptors in left eye. Right eye normal"	"22y"	""	""	""	""	""	""	""	"Achromatopsia"	""	""
"0000291684"	"04214"	"00398565"	"00000"	"Familial, autosomal recessive"	"30y"	"visual acuity right/left eye: 0.46/0.44, fundus macular appearance: blunted foveal re���ex both eyes, color vision (anomaloscope): matched (0���73), electroretinography, scotopic: normal, single-���ash b-wave: severely reduced, 32-Hz flicker: non-detectable, spectral-domain optical coherence tomography: focal inner segment/outer segment junction of the photoreceptors disruption in the fovea and foveal hypoplasia, adaptive optics cone structure: Minimal cone inner segment structure, no visible outer"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291686"	"04214"	"00398567"	"00000"	"Familial, autosomal recessive"	"15y"	"visual acuity right/left eye: 0.94/0.9, fundus macular appearance: blunted foveal re���ex both eyes, color vision (anomaloscope): matched (0���73), electroretinography, scotopic: normal, single-���ash b-wave: non-detectable, 32-Hz flicker: non-detectable, spectral-domain optical coherence tomography: focal inner segment/outer segment junction of the photoreceptors disruption in the fovea (small bubble) and foveal hypoplasia, adaptive optics cone structure: Substantial cone inner segment structure, frequent dim outer"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291688"	"04214"	"00398569"	"00000"	"Familial, autosomal recessive"	"27y"	"visual acuity right/left eye: 0.92/0.96, fundus macular appearance: central foveal hypopigmentation with mild rpe mottling both eyes, color vision (anomaloscope): matched (0���73), electroretinography, scotopic: normal, single-���ash b-wave: severely reduced, 32-Hz flicker: non-detectable, spectral-domain optical coherence tomography: inner segment/outer segment junction of the photoreceptors loss (large bubble) in the fovea, adaptive optics cone structure: No visible cone inner s"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291689"	"04214"	"00398570"	"00000"	"Familial, autosomal recessive"	"49y"	"visual acuity right/left eye: 0.8/0.72, fundus macular appearance: atrophic macular lesion both eyes, color vision (anomaloscope): matched (46���73), electroretinography, scotopic: normal, single-���ash b-wave: severely reduced, 32-Hz flicker: non-detectable, spectral-domain optical coherence tomography: loss and disruption of inner segment/outer segment junction of the photoreceptors and retinal pigment epithelium loss and thinning in the fovea and foveal hypoplasia, adaptive optics cone structure: Minimal cone inner segment structure, no visible outer segment r"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291691"	"04214"	"00398572"	"00000"	"Familial, autosomal recessive"	"55y"	"visual acuity right/left eye: 0.94/0.82, fundus macular appearance: hypopigmented lesions with mild rpe mottling, punctuate drusen both eyes, color vision (anomaloscope): matched (49���73), electroretinography, scotopic: moderately reduced amplitude, single-���ash b-wave: severely reduced, 32-Hz flicker: non-detectable, spectral-domain optical coherence tomography: focal loss and disruption of inner segment/outer segment junction of the photoreceptors and mild retinal pigment epithelium thinning in the fovea and foveal hypoplasia, adaptive optics cone structure: Minimal cone inner segment structure, occasional dim outer s"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291715"	"04214"	"00398629"	"00000"	"Familial, autosomal recessive"	"10y0m"	"nystagmus; progression in follow-up of 10 months; best-corrected visual acuity: 0.8"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291718"	"04214"	"00398632"	"00000"	"Familial, autosomal recessive"	"46y11m"	"nystagmus; no progression in follow-up of 22 months; best-corrected visual acuity: 0.38"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291726"	"04214"	"00398639"	"00000"	"Familial, autosomal recessive"	"11y"	"best corrected visual acuity: right eye, 20/300, left eye, 20/250, full-field photopic electroretinography right /left eye: a wave, b wave, flicker:8/8, 20/10, <3/<3, optical coherence tomography: preserved photoreceptors both eyes, fundus autofluorescence: hyperfluoresence focal foveal"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291727"	"04214"	"00398640"	"00000"	"Familial, autosomal recessive"	"14y"	"best corrected visual acuity: right eye, 20/125, left eye, 20/160, full-field photopic electroretinography right /left eye: a wave, b wave, flicker:5/7, 32/19, 2.2/3.4, optical coherence tomography: foveal atrophy with early cavitation both eyes, fundus autofluorescence: foveal and parafoveal hyperfluoresence"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291728"	"04214"	"00398641"	"00000"	"Familial, autosomal recessive"	"12y"	"best corrected visual acuity: right eye, 20/200, left eye, 20/200, full-field photopic electroretinography right /left eye: a wave, b wave, flicker:6/14, 32/30, nonrecordable/nonrecordable, optical coherence tomography: preserved photoreceptors both eyes, fundus autofluorescence: foveal and parafoveal hyperfluoresence"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291729"	"04214"	"00398642"	"00000"	"Familial, autosomal recessive"	"52y"	"best corrected visual acuity: right eye, 20/200, left eye, 20/100, full-field photopic electroretinography right /left eye: a wave, b wave, flicker:3/8, 6/11, 5.1/3.6, optical coherence tomography: foveal atrophy with cavitationboth eyes, fundus autofluorescence: punched-out hypofluoresence"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291730"	"04214"	"00398643"	"00000"	"Familial, autosomal recessive"	"56y"	"best corrected visual acuity: right eye, 20/200, left eye, 20/125, full-field photopic electroretinography right /left eye: a wave, b wave, flicker:nonrecordable/nonrecordable, 4.4/5.3, nonrecordable/nonrecordable, optical coherence tomography: foveal atrophy with cavitationboth eyes, fundus autofluorescence: punched-out hypofluoresence"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291731"	"04214"	"00398644"	"00000"	"Familial, autosomal recessive"	"58y"	"best corrected visual acuity: right eye, 20/100, left eye, 20/100, full-field photopic electroretinography right /left eye: a wave, b wave, flicker:nonrecordable/nonrecordable, <5/<5, nonrecordable/nonrecordable, optical coherence tomography: foveal atrophy without cavitation right eye and with cavitation left eye, fundus autofluorescence: punched-out hypofluoresence"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291735"	"04214"	"00398652"	"00000"	"Familial, autosomal recessive"	"10m"	"visual acuity left, right eye: fixes and follows, fixes and follows, retinoscopic refraction, spherical equivalent: +5.00, +3.50, fundus appearance: foveal pigment mottling, full-field electroretinography, scotopic/photopic: normal/nonrecordable, foveal hypoplasia, foveal ellipsoid zone: complete loss"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291737"	"04214"	"00398654"	"00000"	"Familial, autosomal recessive"	"3y6m"	"visual acuity left, right eye: 20/400, 20/400, retinoscopic refraction, spherical equivalent: +4.25, +3.75, fundus appearance: normal, full-field electroretinography, scotopic/photopic: normal/nonrecordable, no foveal hypoplasia, foveal ellipsoid zone: normal"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291738"	"04214"	"00398655"	"00000"	"Familial, autosomal recessive"	"4y7m"	"visual acuity left, right eye: 20/100, 20/100, retinoscopic refraction, spherical equivalent: −1.00, −1.00, fundus appearance: no foveal light reflex, full-field electroretinography, scotopic/photopic: normal/nonrecordable, foveal hypoplasia, foveal ellipsoid zone: intact but"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291740"	"04214"	"00398657"	"00000"	"Familial, autosomal recessive"	"5y10m"	"visual acuity left, right eye: 20/400, 20/400, retinoscopic refraction, spherical equivalent: +3.00, +2.75, fundus appearance: normal, full-field electroretinography, scotopic/photopic: normal/nonrecordable, no foveal hypoplasia, foveal ellipsoid zone: disrupted"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291741"	"04214"	"00398658"	"00000"	"Familial, autosomal recessive"	"6y8m"	"visual acuity left, right eye: 20/200, 20/150, retinoscopic refraction, spherical equivalent: +1.50, +1.00, fundus appearance: no foveal light reflex, full-field electroretinography, scotopic/photopic: normal/nonrecordable, no foveal hypoplasia, foveal ellipsoid zone: disrupted"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291742"	"04214"	"00398659"	"00000"	"Familial, autosomal recessive"	"7y10m"	"visual acuity left, right eye: 20/150, 20/200, retinoscopic refraction, spherical equivalent: −0.50, −0.50, fundus appearance: no foveal light reflex, full-field electroretinography, scotopic/photopic: normal/nonrecordable, foveal hypoplasia, foveal ellipsoid zone: intact but"	""	""	""	""	""	""	""	""	"achromatopsia"	""	""
"0000291851"	"04214"	"00398767"	"00000"	"Familial, autosomal recessive"	"12y"	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""	""
"0000291852"	"04214"	"00398768"	"00000"	"Familial, autosomal recessive"	"44y"	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""	""
"0000291853"	"04214"	"00398769"	"00000"	"Familial, autosomal recessive"	"29y"	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""	""
"0000291854"	"04214"	"00398770"	"00000"	"Familial, autosomal recessive"	"14y"	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""	""
"0000291855"	"04214"	"00398771"	"00000"	"Familial, autosomal recessive"	"21y"	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""	""
"0000291856"	"04214"	"00398772"	"00000"	"Familial, autosomal recessive"	"32y"	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""	""
"0000291857"	"04214"	"00398773"	"00000"	"Familial, autosomal recessive"	"15y"	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""	""
"0000291868"	"04214"	"00398784"	"00000"	"Familial, autosomal recessive"	"17y"	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""	""
"0000300546"	"04214"	"00408430"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""	""
"0000300547"	"04214"	"00408431"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"Achromatopsia"	""	""
"0000307545"	"04214"	"00415767"	"00000"	"Familial, autosomal recessive"	"12y"	"refraction/astigmatism: sc; best corrected visual acuity: 0.1; nystagmus; fundus: no foveal reflex"	""	""	""	""	""	""	""	""	"cone dystrophy"	""	""
"0000307546"	"04214"	"00415768"	"00000"	"Familial, autosomal recessive"	"17y"	"refraction/astigmatism: sc; best corrected visual acuity: 0.1; nystagmus; fundus: retinal pigment epithelium irregularities; progression: subjective"	""	""	""	""	""	""	""	""	"cone dystrophy"	""	""
"0000307547"	"04214"	"00415769"	"00000"	"Familial, autosomal recessive"	"17y"	"refraction/astigmatism: +4.0/-4.0; best corrected visual acuity: 0.05; nystagmus; fundus: normal"	""	""	""	""	""	""	""	""	"cone dystrophy"	""	""
"0000307548"	"04214"	"00415770"	"00000"	"Familial, autosomal recessive"	"31y"	"refraction/astigmatism: +1.5; best corrected visual acuity: 0.1; no nystagmus; fundus: retinal pigment epithelium irregularities; progression: subjective"	""	""	""	""	""	""	""	""	"cone dystrophy"	""	""
"0000307549"	"04214"	"00415771"	"00000"	"Familial, autosomal recessive"	"40y"	"refraction/astigmatism: +4.0/-1.0; best corrected visual acuity: 0.1; nystagmus; fundus: vessels narrow"	""	""	""	""	""	""	""	""	"cone dystrophy"	""	""
"0000307550"	"04214"	"00415772"	"00000"	"Familial, autosomal recessive"	"6y"	"refraction/astigmatism: sc; best corrected visual acuity: 0.08; nystagmus; fundus: macula grey"	""	""	""	""	""	""	""	""	"cone dystrophy"	""	""
"0000307551"	"04214"	"00415773"	"00000"	"Familial, autosomal recessive"	"19y"	"refraction/astigmatism: +2.0/-2.0; best corrected visual acuity: 0.06; nystagmus; fundus: macula grey"	""	""	""	""	""	""	""	""	"cone dystrophy"	""	""
"0000307552"	"04214"	"00415774"	"00000"	"Familial, autosomal recessive"	"19y"	"refraction/astigmatism: +1.0/-2.0; best corrected visual acuity: 0.05; no nystagmus; fundus: retinal pigment epithelium irregularitieselectroretinography"	""	""	""	""	""	""	""	""	"cone dystrophy"	""	""
"0000307555"	"04214"	"00415777"	"00000"	"Familial, autosomal recessive"	"35y"	"refraction/astigmatism: -0.5; best corrected visual acuity: 0.9; no nystagmus; fundus: normal"	""	""	""	""	""	""	""	""	"cone dystrophy"	""	""
"0000307556"	"04214"	"00415778"	"00000"	"Familial, autosomal recessive"	"65y"	"refraction/astigmatism: +1.5; best corrected visual acuity: 0.1; no nystagmus; fundus: vessels narrow, papilla pale; progression: electroretinography"	""	""	""	""	""	""	""	""	"cone dystrophy"	""	""
"0000310980"	"04214"	"00419700"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000310981"	"04214"	"00419701"	"04405"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000310982"	"04214"	"00419702"	"04405"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000318041"	"04214"	"00426903"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	"cone dystrophy"	""
"0000318042"	"04214"	"00426904"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	"cone dystrophy"	""
"0000318043"	"04214"	"00426905"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	"cone dystrophy"	""
"0000318044"	"04214"	"00426906"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	"cone dystrophy"	""
"0000318049"	"04214"	"00426911"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	"cone dystrophy"	""
"0000318050"	"04214"	"00426912"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	"cone dystrophy"	""
"0000326743"	"02156"	"00436594"	"04552"	"Familial, autosomal recessive"	"00y"	"Photophobia HP:0000613, Reduced visual acuity HP:0007663, Large central visual field defect HP:0001129, Color vision defect HP: 0000551"	"00y"	"11y"	"0y"	""	""	""	""	""	"# 608051"	"Retinal dystrophy"	""
"0000336108"	"00198"	"00446909"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000336109"	"00198"	"00446910"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000336110"	"00198"	"00446911"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000336112"	"00198"	"00446913"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000336113"	"00198"	"00446914"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000336114"	"00198"	"00446915"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000336115"	"00198"	"00446916"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000336116"	"00198"	"00446917"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000336117"	"00198"	"00446918"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000336123"	"00198"	"00446924"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000336410"	"00198"	"00447211"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"eye diseaes"	""
"0000336598"	"00198"	"00447399"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000336684"	"00198"	"00447485"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"achromatopsia"	""
"0000336761"	"00198"	"00447562"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"macular dystrophy"	""
"0000336819"	"00198"	"00447620"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa, simplex"	""
"0000336856"	"00198"	"00447657"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Best vitelliform macular dystrophy"	""
"0000336872"	"00198"	"00447673"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"macular dystrophy"	""
"0000336873"	"00198"	"00447674"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"macular dystrophy"	""
"0000336879"	"00198"	"00447680"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"macular dystrophy"	""
"0000339847"	"04249"	"00450792"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000339848"	"04249"	"00450793"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000339849"	"04249"	"00450794"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000339850"	"04249"	"00450795"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal pigment epithelium dystrophy"	""
"0000339851"	"04249"	"00450796"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000339852"	"04249"	"00450797"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"macular dystrophy"	""
"0000339853"	"04249"	"00450798"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000339854"	"04249"	"00450799"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000339855"	"04249"	"00450800"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000339856"	"04249"	"00450801"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"macular dystrophy-I"	""
"0000339857"	"04249"	"00450802"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000339858"	"04249"	"00450803"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"macular dystrophy"	""
"0000339859"	"04249"	"00450804"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone dystrophy"	""
"0000339860"	"04249"	"00450805"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000343391"	"02016"	"00454772"	"04752"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000343394"	"02016"	"00454775"	"04752"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000343395"	"02016"	"00454776"	"04752"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000343396"	"02016"	"00454777"	"04752"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000343542"	"04230"	"00454945"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343543"	"04230"	"00454946"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343544"	"04230"	"00454947"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343545"	"04230"	"00454948"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343546"	"04230"	"00454949"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343547"	"04230"	"00454950"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343548"	"04230"	"00454951"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343549"	"04230"	"00454952"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343550"	"04230"	"00454953"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343551"	"04230"	"00454954"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343552"	"04230"	"00454955"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343553"	"04230"	"00454956"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343554"	"04230"	"00454957"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343555"	"04230"	"00454958"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343556"	"04230"	"00454959"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343557"	"04230"	"00454960"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343558"	"04230"	"00454961"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343559"	"04230"	"00454962"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343560"	"04230"	"00454963"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343561"	"04230"	"00454964"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343562"	"04230"	"00454965"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343563"	"04230"	"00454966"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343564"	"04230"	"00454967"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343565"	"04230"	"00454968"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343566"	"04230"	"00454969"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343567"	"04230"	"00454970"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343568"	"04230"	"00454971"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343569"	"04230"	"00454972"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343570"	"04230"	"00454973"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343571"	"04230"	"00454974"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343572"	"04230"	"00454975"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343573"	"04230"	"00454976"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343574"	"04230"	"00454977"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343575"	"04230"	"00454978"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343576"	"04230"	"00454979"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343577"	"04230"	"00454980"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343578"	"04230"	"00454981"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343579"	"04230"	"00454982"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343580"	"04230"	"00454983"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343581"	"04230"	"00454984"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343582"	"04230"	"00454985"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343583"	"04230"	"00454986"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343584"	"04230"	"00454987"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343585"	"04230"	"00454988"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343586"	"04230"	"00454989"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343587"	"04230"	"00454990"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343588"	"04230"	"00454991"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343589"	"04230"	"00454992"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343590"	"04230"	"00454993"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343591"	"04230"	"00454994"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343592"	"04230"	"00454995"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343593"	"04230"	"00454996"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343594"	"04230"	"00454997"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343595"	"04230"	"00454998"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343596"	"04230"	"00454999"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343597"	"04230"	"00455000"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343598"	"04230"	"00455001"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000343599"	"04230"	"00455002"	"04752"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""
"0000350536"	"04214"	"00464537"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"ACHM3"	"achromatopsia"	""


## Screenings ## Do not remove or alter this header ##
## Count = 816
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000096347"	"00095944"	"1"	"01769"	"01769"	"2017-01-26 19:14:04"	""	""	"SEQ"	"DNA"	"WBC"	""
"0000105487"	"00105013"	"1"	"01244"	"01244"	"2017-06-15 10:25:12"	""	""	"SEQ-NG-I"	"DNA"	"Whole blood"	""
"0000105518"	"00105022"	"1"	"01244"	"00006"	"2017-06-16 15:57:25"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000145017"	"00144158"	"1"	"01780"	"00006"	"2017-11-28 22:45:32"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000156305"	"00155440"	"1"	"01243"	"01243"	"2018-03-18 14:37:15"	""	""	"SEQ"	"DNA"	""	""
"0000156306"	"00155441"	"1"	"01243"	"01243"	"2018-03-18 14:37:15"	""	""	"SEQ"	"DNA"	""	""
"0000156307"	"00155442"	"1"	"01243"	"01243"	"2018-03-18 14:37:15"	""	""	"SEQ"	"DNA"	""	""
"0000156308"	"00155443"	"1"	"01243"	"01243"	"2018-03-18 14:37:15"	""	""	"SEQ"	"DNA"	""	""
"0000156309"	"00155444"	"1"	"01243"	"01243"	"2018-03-18 14:37:15"	""	""	"SEQ"	"DNA"	""	""
"0000156310"	"00155445"	"1"	"01243"	"01243"	"2018-03-18 14:37:15"	""	""	"SEQ"	"DNA"	""	""
"0000156311"	"00155446"	"1"	"01243"	"01243"	"2018-03-18 14:37:15"	""	""	"SEQ"	"DNA"	""	""
"0000171731"	"00170849"	"1"	"00244"	"00244"	"2018-07-26 10:56:21"	""	""	"SEQ-NG"	"DNA"	""	"Gene Panel (79 IRD genes)"
"0000174623"	"00173732"	"1"	"00006"	"00006"	"2018-07-30 22:13:01"	""	""	"SEQ"	"DNA"	""	""
"0000174624"	"00173733"	"1"	"00006"	"00006"	"2018-07-30 22:17:26"	""	""	"SEQ"	"DNA"	""	""
"0000174628"	"00173737"	"1"	"00006"	"00006"	"2018-07-31 21:40:10"	""	""	"SEQ"	"DNA"	""	""
"0000174629"	"00173738"	"1"	"00006"	"00006"	"2018-07-31 22:28:37"	""	""	"SEQ"	"DNA"	""	""
"0000174631"	"00173740"	"1"	"00006"	"00006"	"2018-07-31 22:28:37"	""	""	"SEQ"	"DNA"	""	""
"0000174632"	"00173741"	"1"	"00006"	"00006"	"2018-07-31 22:28:37"	""	""	"SEQ"	"DNA"	""	""
"0000174633"	"00173742"	"1"	"00006"	"00006"	"2018-07-31 22:28:37"	""	""	"SEQ"	"DNA"	""	""
"0000174634"	"00173743"	"1"	"00006"	"00006"	"2018-07-31 22:28:37"	""	""	"SEQ"	"DNA"	""	""
"0000174635"	"00173744"	"1"	"00006"	"00006"	"2018-07-31 22:28:37"	""	""	"SEQ"	"DNA"	""	""
"0000174636"	"00173745"	"1"	"00006"	"00006"	"2018-07-31 22:28:37"	""	""	"SEQ"	"DNA"	""	""
"0000174637"	"00173746"	"1"	"00006"	"00006"	"2018-07-31 22:28:37"	""	""	"SEQ"	"DNA"	""	""
"0000174638"	"00173747"	"1"	"00006"	"00006"	"2018-07-31 22:28:37"	""	""	"SEQ"	"DNA"	""	""
"0000174639"	"00173748"	"1"	"00006"	"00006"	"2018-07-31 22:28:37"	""	""	"SEQ"	"DNA"	""	""
"0000264237"	"00263131"	"1"	"01807"	"01807"	"2019-08-23 11:18:50"	""	""	"SEQ"	"DNA"	""	""
"0000295837"	"00294669"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000295838"	"00294670"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000295839"	"00294671"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000295840"	"00294672"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000295841"	"00294673"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000296730"	"00295560"	"1"	"01164"	"01164"	"2020-03-18 10:48:11"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000306333"	"00305204"	"1"	"03575"	"00006"	"2020-06-24 11:55:42"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000306334"	"00305205"	"1"	"03575"	"00006"	"2020-06-24 11:55:42"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000306335"	"00305206"	"1"	"03575"	"00006"	"2020-06-24 11:55:42"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000309644"	"00308499"	"1"	"00004"	"00006"	"2020-08-27 13:01:07"	""	""	"SEQ"	"DNA"	""	""
"0000309645"	"00308500"	"1"	"00004"	"00006"	"2020-08-27 13:01:07"	""	""	"SEQ"	"DNA"	""	""
"0000310239"	"00309094"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310240"	"00309095"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310241"	"00309096"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310242"	"00309097"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310243"	"00309098"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310244"	"00309099"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310245"	"00309100"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310246"	"00309101"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310247"	"00309102"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310248"	"00309103"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000321009"	"00319828"	"1"	"00008"	"00008"	"2020-11-08 09:25:19"	""	""	"SEQ"	"DNA"	""	""
"0000321010"	"00319829"	"1"	"00008"	"00008"	"2020-11-08 09:25:19"	""	""	"SEQ"	"DNA"	""	""
"0000321011"	"00319830"	"1"	"00008"	"00008"	"2020-11-08 09:25:19"	""	""	"SEQ"	"DNA"	""	""
"0000321012"	"00319831"	"1"	"00008"	"00008"	"2020-11-08 09:25:19"	""	""	"SEQ"	"DNA"	""	""
"0000321013"	"00319832"	"1"	"00008"	"00008"	"2020-11-08 09:25:19"	""	""	"SEQ"	"DNA"	""	""
"0000321014"	"00319833"	"1"	"00008"	"00008"	"2020-11-08 09:25:19"	""	""	"SEQ"	"DNA"	""	""
"0000321015"	"00319834"	"1"	"00008"	"00008"	"2020-11-08 09:25:19"	""	""	"SEQ"	"DNA"	""	""
"0000321226"	"00320042"	"1"	"00008"	"00008"	"2020-11-19 10:13:34"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000321227"	"00320043"	"1"	"00008"	"00008"	"2020-11-19 10:13:34"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000321228"	"00320044"	"1"	"00008"	"00008"	"2020-11-19 10:13:34"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000321232"	"00320048"	"1"	"00008"	"00008"	"2020-11-19 10:13:34"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000321238"	"00320054"	"1"	"00008"	"00008"	"2020-11-19 10:13:34"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000321239"	"00320055"	"1"	"00008"	"00008"	"2020-11-19 10:13:34"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000321241"	"00320057"	"1"	"00008"	"00008"	"2020-11-19 10:13:34"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000321242"	"00320058"	"1"	"00008"	"00008"	"2020-11-19 10:13:34"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000321244"	"00320060"	"1"	"00008"	"00008"	"2020-11-19 10:13:34"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000321245"	"00320061"	"1"	"00008"	"00008"	"2020-11-19 10:13:34"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000321247"	"00320063"	"1"	"00008"	"00008"	"2020-11-19 10:13:34"	""	""	"SEQ"	"DNA"	"Blood"	""
"0000325438"	"00324248"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325441"	"00324251"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325445"	"00324255"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325446"	"00324256"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325448"	"00324258"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325449"	"00324259"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325452"	"00324262"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325453"	"00324263"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325454"	"00324264"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325456"	"00324266"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325458"	"00324268"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325459"	"00324269"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325461"	"00324271"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325462"	"00324272"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325463"	"00324273"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325464"	"00324274"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000325465"	"00324275"	"1"	"00008"	"00008"	"2020-12-04 05:00:09"	""	""	"SEQ"	"DNA"	""	""
"0000326698"	"00325487"	"1"	"00006"	"00006"	"2021-01-03 11:36:11"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"199 gene panel"
"0000329150"	"00327935"	"1"	"00000"	"00006"	"2021-01-27 12:09:59"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000329182"	"00327967"	"1"	"00000"	"00006"	"2021-01-27 12:09:59"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000329238"	"00328023"	"1"	"00000"	"00006"	"2021-01-27 12:09:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000329350"	"00328135"	"1"	"00000"	"00006"	"2021-01-27 12:09:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000329421"	"00328206"	"1"	"00000"	"00006"	"2021-01-27 12:09:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000329526"	"00328311"	"1"	"00000"	"00006"	"2021-01-27 12:09:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000329553"	"00328338"	"1"	"00000"	"00006"	"2021-01-27 12:09:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000329666"	"00328451"	"1"	"00000"	"00006"	"2021-01-28 09:35:56"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000329667"	"00328452"	"1"	"00000"	"00006"	"2021-01-28 09:35:56"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000329668"	"00328453"	"1"	"00000"	"00006"	"2021-01-28 09:35:56"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000329669"	"00328454"	"1"	"00000"	"00006"	"2021-01-28 09:35:56"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000332515"	"00331296"	"1"	"00000"	"00006"	"2021-02-11 11:33:52"	""	""	"SEQ"	"DNA"	""	""
"0000332518"	"00331299"	"1"	"00000"	"00006"	"2021-02-11 11:33:52"	""	""	"SEQ"	"DNA"	""	""
"0000332939"	"00331720"	"1"	"00000"	"00006"	"2021-02-12 17:18:57"	""	""	"SEQ"	"DNA"	""	""
"0000332940"	"00331721"	"1"	"00000"	"00006"	"2021-02-12 17:18:57"	""	""	"SEQ"	"DNA"	""	""
"0000332941"	"00331722"	"1"	"00000"	"00006"	"2021-02-12 17:18:57"	""	""	"SEQ"	"DNA"	""	""
"0000332942"	"00331723"	"1"	"00000"	"00006"	"2021-02-12 17:18:57"	""	""	"SEQ"	"DNA"	""	""
"0000332943"	"00331724"	"1"	"00000"	"00006"	"2021-02-12 17:18:57"	""	""	"SEQ"	"DNA"	""	""
"0000332944"	"00331725"	"1"	"00000"	"00006"	"2021-02-12 17:18:57"	""	""	"SEQ"	"DNA"	""	""
"0000332945"	"00331726"	"1"	"00000"	"00006"	"2021-02-12 17:18:57"	""	""	"SEQ"	"DNA"	""	""
"0000333412"	"00332192"	"1"	"00000"	"00006"	"2021-02-15 18:54:26"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000333447"	"00332227"	"1"	"00000"	"00006"	"2021-02-15 18:54:26"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000333498"	"00332278"	"1"	"00000"	"00006"	"2021-02-16 17:14:33"	""	""	"SEQ-NG"	"DNA"	""	"300-gene panel"
"0000333508"	"00332288"	"1"	"00000"	"00006"	"2021-02-16 17:14:33"	""	""	"SEQ-NG"	"DNA"	""	"300-gene panel"
"0000333628"	"00332404"	"1"	"00000"	"00006"	"2021-02-18 13:23:10"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000333675"	"00332451"	"1"	"00000"	"00006"	"2021-02-19 15:15:03"	""	""	"SEQ-NG"	"DNA"	""	"150-gene panel"
"0000333676"	"00332452"	"1"	"00000"	"00006"	"2021-02-19 15:15:03"	""	""	"SEQ-NG"	"DNA"	""	"150-gene panel"
"0000333677"	"00332453"	"1"	"00000"	"00006"	"2021-02-19 15:15:03"	""	""	"SEQ-NG"	"DNA"	""	"150-gene panel"
"0000334562"	"00333337"	"1"	"00000"	"00006"	"2021-02-24 17:21:42"	""	""	"SEQ"	"DNA"	"peripheral blood lymphocytes"	""
"0000334655"	"00333430"	"1"	"00000"	"00006"	"2021-02-25 11:52:36"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"184-gene panel"
"0000334861"	"00333635"	"1"	"00000"	"00006"	"2021-02-26 12:01:19"	""	""	"SEQ-NG"	"DNA"	""	""
"0000335211"	"00333985"	"1"	"00000"	"00006"	"2021-02-26 16:26:23"	""	""	"SEQ-NG"	"DNA"	""	""
"0000335212"	"00333986"	"1"	"00000"	"00006"	"2021-02-26 16:26:23"	""	""	"SEQ-NG"	"DNA"	""	""
"0000335213"	"00333987"	"1"	"00000"	"00006"	"2021-02-26 16:26:23"	""	""	"SEQ-NG"	"DNA"	""	""
"0000335214"	"00333988"	"1"	"00000"	"00006"	"2021-02-26 16:26:23"	""	""	"SEQ-NG"	"DNA"	""	""
"0000335607"	"00334379"	"1"	"03971"	"03971"	"2021-02-28 11:04:28"	""	""	"SEQ-NG-IT"	"DNA"	"blood"	"gene panel (ABCA4, CNGB3, ELOVL4, PROM1)"
"0000335690"	"00334461"	"1"	"00000"	"00006"	"2021-02-28 17:46:08"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000336125"	"00334896"	"1"	"00000"	"00006"	"2021-03-02 11:57:03"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000336335"	"00335106"	"1"	"00000"	"00006"	"2021-03-04 11:06:46"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000336336"	"00335107"	"1"	"00000"	"00006"	"2021-03-04 11:06:46"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000336339"	"00335110"	"1"	"00000"	"00006"	"2021-03-04 11:06:46"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000336456"	"00335227"	"1"	"00000"	"00006"	"2021-03-04 14:06:09"	""	""	"SEQ-NG"	"DNA"	""	"212-gene panel"
"0000336564"	"00335335"	"1"	"02485"	"00006"	"2021-03-04 17:06:33"	""	""	"SEQ-NG"	"DNA"	""	"68-gene panel"
"0000336714"	"00335485"	"1"	"00000"	"00006"	"2021-03-05 19:30:17"	""	""	"SEQ-NG"	"DNA"	""	"72-gene panel"
"0000337199"	"00335969"	"1"	"00000"	"00006"	"2021-03-10 17:05:56"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000360206"	"00358969"	"1"	"00000"	"00006"	"2021-03-18 12:15:00"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000360242"	"00359004"	"1"	"00000"	"00006"	"2021-03-18 16:44:20"	""	""	"SEQ"	"DNA"	""	"105-gene panel"
"0000360249"	"00359011"	"1"	"00000"	"00006"	"2021-03-18 16:44:20"	""	""	"SEQ"	"DNA"	""	"105-gene panel"
"0000360252"	"00359014"	"1"	"00000"	"00006"	"2021-03-18 16:44:20"	""	""	"SEQ"	"DNA"	""	"105-gene panel"
"0000360255"	"00359017"	"1"	"00000"	"00006"	"2021-03-18 16:44:20"	""	""	"SEQ"	"DNA"	""	"105-gene panel"
"0000360256"	"00359018"	"1"	"00000"	"00006"	"2021-03-18 16:44:20"	""	""	"SEQ"	"DNA"	""	"105-gene panel"
"0000360257"	"00359019"	"1"	"00000"	"00006"	"2021-03-18 16:44:20"	""	""	"SEQ"	"DNA"	""	"105-gene panel"
"0000360258"	"00359020"	"1"	"00000"	"00006"	"2021-03-18 16:44:20"	""	""	"SEQ"	"DNA"	""	"105-gene panel"
"0000360849"	"00359619"	"1"	"01807"	"01807"	"2021-04-02 14:25:01"	""	""	"SEQ"	"DNA"	""	""
"0000363370"	"00362141"	"1"	"00006"	"00006"	"2021-04-15 14:35:20"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000363371"	"00362142"	"1"	"00006"	"00006"	"2021-04-15 14:35:20"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000363372"	"00362143"	"1"	"00006"	"00006"	"2021-04-15 14:35:20"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000364148"	"00362920"	"1"	"00000"	"00006"	"2021-04-23 19:25:57"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000374577"	"00373342"	"1"	"00006"	"00006"	"2021-05-13 20:24:22"	""	""	"arraySNP;SEQ"	"DNA"	""	""
"0000375104"	"00373872"	"1"	"00000"	"00006"	"2021-05-21 15:01:30"	""	""	"SEQ-NG"	"DNA"	""	"238-gene panel"
"0000375105"	"00373873"	"1"	"00000"	"00006"	"2021-05-21 15:01:30"	""	""	"SEQ-NG"	"DNA"	""	"238-gene panel"
"0000376188"	"00374994"	"1"	"00000"	"00006"	"2021-05-27 19:02:46"	""	""	"SEQ"	"DNA"	""	""
"0000376189"	"00374995"	"1"	"00000"	"00006"	"2021-05-27 19:02:46"	""	""	"SEQ"	"DNA"	""	""
"0000376190"	"00374996"	"1"	"00000"	"00006"	"2021-05-27 19:02:46"	""	""	"SEQ"	"DNA"	""	""
"0000376191"	"00374997"	"1"	"00000"	"00006"	"2021-05-27 19:02:46"	""	""	"SEQ"	"DNA"	""	""
"0000376192"	"00374998"	"1"	"00000"	"00006"	"2021-05-27 19:02:46"	""	""	"SEQ"	"DNA"	""	""
"0000376553"	"00375356"	"1"	"00000"	"00006"	"2021-06-03 09:13:38"	""	""	"SEQ"	"DNA"	""	""
"0000376555"	"00375358"	"1"	"00000"	"00006"	"2021-06-03 09:13:38"	""	""	"SEQ"	"DNA"	""	""
"0000376556"	"00375359"	"1"	"00000"	"00006"	"2021-06-03 09:13:38"	""	""	"SEQ"	"DNA"	""	""
"0000376561"	"00375364"	"1"	"00000"	"00006"	"2021-06-03 09:13:38"	""	""	"SEQ"	"DNA"	""	""
"0000376562"	"00375365"	"1"	"00000"	"00006"	"2021-06-03 09:13:38"	""	""	"SEQ"	"DNA"	""	""
"0000377499"	"00376303"	"1"	"00000"	"00008"	"2021-06-19 02:19:40"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000377500"	"00376304"	"1"	"00000"	"00008"	"2021-06-19 02:19:40"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000378212"	"00377007"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378213"	"00377008"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378214"	"00377009"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378215"	"00377010"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378216"	"00377011"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378221"	"00377016"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378222"	"00377017"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378223"	"00377018"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378224"	"00377019"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378225"	"00377020"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378226"	"00377021"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378227"	"00377022"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378228"	"00377023"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378229"	"00377024"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378230"	"00377025"	"1"	"00000"	"00008"	"2021-06-29 06:08:50"	""	""	"SEQ"	"DNA"	"blood"	""
"0000378385"	"00377180"	"1"	"00000"	"03840"	"2021-07-16 14:18:12"	"00006"	"2021-08-06 16:49:30"	"SEQ-NG-I;SEQ"	"DNA"	"blood"	"targeted resequencing using MIPs library prep; 108-gene panel"
"0000378404"	"00377199"	"1"	"00000"	"03840"	"2021-07-16 14:18:12"	"00006"	"2021-08-06 16:49:30"	"SEQ-NG-I;SEQ"	"DNA"	"blood"	"targeted resequencing using MIPs library prep; 108-gene panel"
"0000378428"	"00377223"	"1"	"00000"	"03840"	"2021-07-16 14:18:12"	"00006"	"2021-08-06 16:49:30"	"SEQ-NG-I;SEQ"	"DNA"	"blood"	"targeted resequencing using MIPs library prep; 108-gene panel"
"0000378448"	"00377243"	"1"	"00000"	"03840"	"2021-07-16 14:18:12"	"00006"	"2021-08-06 16:49:30"	"SEQ-NG-I;SEQ"	"DNA"	"blood"	"targeted resequencing using MIPs library prep; 108-gene panel"
"0000378904"	"00377700"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"arraySNP; SEQ"	"DNA"	"blood"	""
"0000378905"	"00377701"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"arraySNP; SEQ"	"DNA"	"blood"	""
"0000378906"	"00377702"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"arraySNP; SEQ"	"DNA"	"blood"	""
"0000378907"	"00377703"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"arraySNP; SEQ"	"DNA"	"blood"	""
"0000378908"	"00377704"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"arraySNP; SEQ"	"DNA"	"blood"	""
"0000378909"	"00377705"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"arraySNP; SEQ"	"DNA"	"blood"	""
"0000378910"	"00377706"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"arraySNP; SEQ"	"DNA"	"blood"	""
"0000378911"	"00377707"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"arraySNP; SEQ"	"DNA"	"blood"	""
"0000379167"	"00377963"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"PCR; SEQ"	"DNA"	"blood"	""
"0000379179"	"00377975"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"PCR; SEQ"	"DNA"	"blood"	""
"0000379187"	"00377983"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"PCR; SEQ"	"DNA"	"blood"	""
"0000379188"	"00377984"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"PCR; SEQ"	"DNA"	"blood"	""
"0000379189"	"00377985"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"PCR; SEQ"	"DNA"	"blood"	""
"0000379190"	"00377986"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"PCR; SEQ"	"DNA"	"blood"	""
"0000379191"	"00377987"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"PCR; SEQ"	"DNA"	"blood"	""
"0000379192"	"00377988"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"PCR; SEQ"	"DNA"	"blood"	""
"0000379193"	"00377989"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"PCR; SEQ"	"DNA"	"blood"	""
"0000379196"	"00377992"	"1"	"00000"	"00008"	"2021-08-02 20:37:33"	""	""	"PCR; SEQ"	"DNA"	"blood"	""
"0000381389"	"00380187"	"1"	"00000"	"03840"	"2021-08-11 10:47:34"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000382086"	"00380872"	"1"	"00000"	"03840"	"2021-08-23 13:21:22"	""	""	"arraySNP"	"DNA"	"blood"	""
"0000382338"	"00381123"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382339"	"00381124"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382340"	"00381125"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382341"	"00381126"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382342"	"00381127"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382343"	"00381128"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382344"	"00381129"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382345"	"00381130"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382346"	"00381131"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382347"	"00381132"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382348"	"00381133"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382349"	"00381134"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382350"	"00381135"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382351"	"00381136"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000382352"	"00381137"	"1"	"00009"	"00008"	"2021-08-27 03:00:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000383011"	"00381795"	"1"	"00000"	"00008"	"2021-09-03 05:21:17"	""	""	"SEQ-NG"	"DNA"	"blood"	"WES"
"0000383012"	"00381796"	"1"	"00000"	"00008"	"2021-09-03 05:21:17"	""	""	"SEQ-NG"	"DNA"	"blood"	"WES"
"0000383179"	"00381963"	"1"	"00000"	"03840"	"2021-09-06 15:38:00"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383180"	"00381964"	"1"	"00000"	"03840"	"2021-09-06 15:38:00"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383181"	"00381965"	"1"	"00000"	"03840"	"2021-09-06 15:38:00"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383182"	"00381966"	"1"	"00000"	"03840"	"2021-09-06 15:38:00"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383183"	"00381967"	"1"	"00000"	"03840"	"2021-09-06 15:38:00"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383184"	"00381968"	"1"	"00000"	"03840"	"2021-09-06 15:38:00"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383185"	"00381969"	"1"	"00000"	"03840"	"2021-09-06 15:38:00"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383186"	"00381970"	"1"	"00000"	"03840"	"2021-09-06 15:38:00"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383187"	"00381971"	"1"	"00000"	"03840"	"2021-09-06 15:38:00"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383188"	"00381972"	"1"	"00000"	"03840"	"2021-09-06 15:38:00"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383189"	"00381973"	"1"	"00000"	"03840"	"2021-09-06 15:38:00"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383190"	"00381974"	"1"	"00000"	"03840"	"2021-09-06 15:38:00"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383191"	"00381975"	"1"	"00000"	"03840"	"2021-09-06 15:38:00"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383344"	"00382128"	"1"	"00000"	"03840"	"2021-09-07 10:12:12"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383345"	"00382129"	"1"	"00000"	"03840"	"2021-09-07 10:12:12"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000383346"	"00382130"	"1"	"00000"	"03840"	"2021-09-07 10:12:12"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383347"	"00382131"	"1"	"00000"	"03840"	"2021-09-07 10:12:12"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000383473"	"00382259"	"1"	"00000"	"03840"	"2021-09-09 12:39:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383474"	"00382260"	"1"	"00000"	"03840"	"2021-09-09 12:39:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383475"	"00382261"	"1"	"00000"	"03840"	"2021-09-09 12:39:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383476"	"00382262"	"1"	"00000"	"03840"	"2021-09-09 12:39:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383477"	"00382263"	"1"	"00000"	"03840"	"2021-09-09 12:39:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383478"	"00382264"	"1"	"00000"	"03840"	"2021-09-09 12:39:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383638"	"00382424"	"1"	"00000"	"03840"	"2021-09-09 12:39:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383742"	"00382528"	"1"	"00000"	"03840"	"2021-09-09 12:39:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000383848"	"00382634"	"1"	"00000"	"03840"	"2021-09-09 12:59:34"	""	""	"SEQ-NG"	"DNA"	"blood"	"solved"
"0000383874"	"00382660"	"1"	"00000"	"03840"	"2021-09-09 12:59:34"	""	""	"SEQ-NG"	"DNA"	"blood"	"unsolved: single allele variant in autosomal recessive disease"
"0000384009"	"00382793"	"1"	"00000"	"00008"	"2021-09-13 01:01:20"	""	""	"arraySNP"	"DNA"	""	""
"0000384643"	"00383418"	"1"	"00000"	"03840"	"2021-09-29 09:58:40"	""	""	"?"	"DNA"	""	"retrospective study"
"0000384644"	"00383419"	"1"	"00000"	"03840"	"2021-09-29 09:58:40"	""	""	"?"	"DNA"	""	"retrospective study"
"0000387405"	"00386176"	"1"	"00000"	"03840"	"2021-10-20 11:58:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000387408"	"00386179"	"1"	"00000"	"03840"	"2021-10-20 11:58:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000387430"	"00386201"	"1"	"00000"	"03840"	"2021-10-20 11:58:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000387441"	"00386212"	"1"	"00000"	"03840"	"2021-10-20 11:58:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000387442"	"00386213"	"1"	"00000"	"03840"	"2021-10-20 11:58:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000387453"	"00386224"	"1"	"00000"	"03840"	"2021-10-20 11:58:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000387498"	"00386269"	"1"	"00000"	"03840"	"2021-10-20 11:58:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000387503"	"00386274"	"1"	"00000"	"03840"	"2021-10-20 11:58:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000387504"	"00386275"	"1"	"00000"	"03840"	"2021-10-20 11:58:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000387506"	"00386277"	"1"	"00000"	"03840"	"2021-10-20 11:58:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000387520"	"00386291"	"1"	"00000"	"03840"	"2021-10-20 11:58:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000387927"	"00386699"	"1"	"00000"	"03840"	"2021-10-26 11:33:19"	""	""	"SEQ-NG-I;SEQ"	"DNA"	"blood"	""
"0000387979"	"00386751"	"1"	"00000"	"03840"	"2021-10-26 11:33:19"	""	""	"SEQ-NG-I;SEQ"	"DNA"	"blood"	""
"0000389723"	"00388482"	"1"	"00000"	"00008"	"2021-11-04 08:27:28"	""	""	"SEQ-NG"	"DNA"	""	"CNV gene panel next-generation sequencing"
"0000390010"	"00388767"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391043"	"00389800"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET3 targeted sequencing panel - see paper"
"0000391058"	"00389815"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391092"	"00389849"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391093"	"00389850"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391094"	"00389851"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391109"	"00389866"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391116"	"00389873"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET2 targeted sequencing panel - see paper"
"0000391117"	"00389874"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET2 targeted sequencing panel - see paper"
"0000391127"	"00389884"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391131"	"00389888"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET2 targeted sequencing panel - see paper"
"0000391132"	"00389889"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391134"	"00389891"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET3 targeted sequencing panel - see paper"
"0000391135"	"00389892"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET3 targeted sequencing panel - see paper"
"0000391138"	"00389895"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391139"	"00389896"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391140"	"00389897"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391142"	"00389899"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391144"	"00389901"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET3 targeted sequencing panel - see paper"
"0000391147"	"00389904"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET3 targeted sequencing panel - see paper"
"0000391157"	"00389914"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391174"	"00389931"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET4 targeted sequencing panel - see paper"
"0000391239"	"00389996"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET7 targeted sequencing panel - see paper"
"0000391241"	"00389998"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391242"	"00389999"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391245"	"00390002"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391246"	"00390003"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391248"	"00390005"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391254"	"00390011"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391255"	"00390012"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391256"	"00390013"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391257"	"00390014"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET8 targeted sequencing panel - see paper"
"0000391259"	"00390016"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ"	"DNA"	"blood"	"Sanger sequencing"
"0000391260"	"00390017"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET9 targeted sequencing panel - see paper"
"0000391261"	"00390018"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET9 targeted sequencing panel - see paper"
"0000391262"	"00390019"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET9 targeted sequencing panel - see paper"
"0000391470"	"00390229"	"1"	"00000"	"03840"	"2021-11-10 12:02:36"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"whole genome sequencing"
"0000391471"	"00390230"	"1"	"00000"	"03840"	"2021-11-10 12:02:36"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"whole genome sequencing"
"0000391472"	"00390231"	"1"	"00000"	"03840"	"2021-11-10 12:02:36"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"whole genome sequencing"
"0000391473"	"00390232"	"1"	"00000"	"03840"	"2021-11-10 12:02:36"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"whole genome sequencing"
"0000391474"	"00390233"	"1"	"00000"	"03840"	"2021-11-10 12:02:36"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"whole genome sequencing"
"0000391475"	"00390234"	"1"	"00000"	"03840"	"2021-11-10 12:02:36"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"whole genome sequencing"
"0000391476"	"00390235"	"1"	"00000"	"03840"	"2021-11-10 12:02:36"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"whole genome sequencing"
"0000391984"	"00390743"	"1"	"00000"	"03840"	"2021-11-11 19:27:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"whole exome sequencing"
"0000392110"	"00390869"	"1"	"00000"	"00008"	"2021-11-11 21:56:08"	""	""	"SEQ"	"DNA"	""	""
"0000392172"	"00390931"	"1"	"00000"	"00008"	"2021-11-11 21:56:08"	""	""	"SEQ"	"DNA"	""	""
"0000392199"	"00390958"	"1"	"00000"	"00008"	"2021-11-11 21:56:08"	""	""	"PCRlr"	"DNA"	""	""
"0000392259"	"00391018"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392260"	"00391019"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392261"	"00391020"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392262"	"00391021"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392263"	"00391022"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392264"	"00391023"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392265"	"00391024"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392266"	"00391025"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392267"	"00391026"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392268"	"00391027"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392269"	"00391028"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392270"	"00391029"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392271"	"00391030"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392272"	"00391031"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392273"	"00391032"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392274"	"00391033"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392275"	"00391034"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392276"	"00391035"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392277"	"00391036"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392278"	"00391037"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392279"	"00391038"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392280"	"00391039"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392281"	"00391040"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392282"	"00391041"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392283"	"00391042"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392284"	"00391043"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392285"	"00391044"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392286"	"00391045"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392287"	"00391046"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392288"	"00391047"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392289"	"00391048"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392290"	"00391049"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392291"	"00391050"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392292"	"00391051"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392293"	"00391052"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392294"	"00391053"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392295"	"00391054"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392296"	"00391055"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392297"	"00391056"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392298"	"00391057"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392299"	"00391058"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392300"	"00391059"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392301"	"00391060"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392302"	"00391061"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392303"	"00391062"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392304"	"00391063"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392305"	"00391064"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392306"	"00391065"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392307"	"00391066"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392308"	"00391067"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392309"	"00391068"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392310"	"00391069"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392311"	"00391070"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392312"	"00391071"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392313"	"00391072"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392314"	"00391073"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392315"	"00391074"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392316"	"00391075"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392317"	"00391076"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392318"	"00391077"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392319"	"00391078"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392320"	"00391079"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392321"	"00391080"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392322"	"00391081"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392323"	"00391082"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392324"	"00391083"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392325"	"00391084"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392326"	"00391085"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392327"	"00391086"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392328"	"00391087"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392329"	"00391088"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392330"	"00391089"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392331"	"00391090"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392332"	"00391091"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392333"	"00391092"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392334"	"00391093"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392335"	"00391094"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392336"	"00391095"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392337"	"00391096"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392338"	"00391097"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392339"	"00391098"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392340"	"00391099"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""
"0000392341"	"00391100"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392342"	"00391101"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392343"	"00391102"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392344"	"00391103"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392345"	"00391104"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392346"	"00391105"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392347"	"00391106"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392348"	"00391107"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392349"	"00391108"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392350"	"00391109"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392351"	"00391110"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392352"	"00391111"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392353"	"00391112"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392354"	"00391113"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392355"	"00391114"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392356"	"00391115"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392357"	"00391116"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392358"	"00391117"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392359"	"00391118"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392360"	"00391119"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392361"	"00391120"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392362"	"00391121"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392363"	"00391122"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392364"	"00391123"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392365"	"00391124"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392366"	"00391125"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392367"	"00391126"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392368"	"00391127"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392369"	"00391128"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392370"	"00391129"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392371"	"00391130"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392372"	"00391131"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392373"	"00391132"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392374"	"00391133"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392375"	"00391134"	"1"	"00006"	"00006"	"2021-11-12 17:45:05"	""	""	"SEQ"	"DNA"	""	""
"0000392532"	"00391290"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392533"	"00391291"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392534"	"00391292"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392535"	"00391293"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392536"	"00391294"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392537"	"00391295"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392538"	"00391296"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392539"	"00391297"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392540"	"00391298"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392541"	"00391299"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392542"	"00391300"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392543"	"00391301"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392544"	"00391302"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392545"	"00391303"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392546"	"00391304"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392547"	"00391305"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392548"	"00391306"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392549"	"00391307"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392550"	"00391308"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392551"	"00391309"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392552"	"00391310"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392553"	"00391311"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392554"	"00391312"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392555"	"00391313"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392556"	"00391314"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392557"	"00391315"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392558"	"00391316"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392559"	"00391317"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392560"	"00391318"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392561"	"00391319"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392562"	"00391320"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392563"	"00391321"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392564"	"00391322"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392565"	"00391323"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392566"	"00391324"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392567"	"00391325"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392568"	"00391326"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392569"	"00391327"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392570"	"00391328"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392571"	"00391329"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392572"	"00391330"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392573"	"00391331"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392574"	"00391332"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392575"	"00391333"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392576"	"00391334"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392577"	"00391335"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392578"	"00391336"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392579"	"00391337"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392580"	"00391338"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392581"	"00391339"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392582"	"00391340"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392583"	"00391341"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392584"	"00391342"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392585"	"00391343"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392586"	"00391344"	"1"	"00006"	"00006"	"2021-11-15 17:28:17"	""	""	"SEQ"	"DNA"	""	""
"0000392621"	"00391379"	"1"	"00000"	"03840"	"2021-11-15 18:02:17"	""	""	"SEQ-NG"	"DNA"	""	"retrospective case note review, targeted gene panel testing"
"0000392622"	"00391380"	"1"	"00000"	"03840"	"2021-11-15 18:02:17"	""	""	"SEQ-NG"	"DNA"	""	"retrospective case note review, targeted gene panel testing"
"0000392631"	"00391389"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392632"	"00391390"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392633"	"00391391"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392634"	"00391392"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392635"	"00391393"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392636"	"00391394"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392637"	"00391395"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392638"	"00391396"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392639"	"00391397"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392640"	"00391398"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392641"	"00391399"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392642"	"00391400"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392643"	"00391401"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392644"	"00391402"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392645"	"00391403"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392646"	"00391404"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392647"	"00391405"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392648"	"00391406"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392649"	"00391407"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392650"	"00391408"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392651"	"00391409"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392652"	"00391410"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392653"	"00391411"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392654"	"00391412"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392655"	"00391413"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392656"	"00391414"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392657"	"00391415"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392658"	"00391416"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392659"	"00391417"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392660"	"00391418"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392661"	"00391419"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392662"	"00391420"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392663"	"00391421"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392664"	"00391422"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392665"	"00391423"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392666"	"00391424"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392667"	"00391425"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392668"	"00391426"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392669"	"00391427"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392670"	"00391428"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392671"	"00391429"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392672"	"00391430"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392673"	"00391431"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392674"	"00391432"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392675"	"00391433"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392676"	"00391434"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392677"	"00391435"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392678"	"00391436"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392679"	"00391437"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392680"	"00391438"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392681"	"00391439"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392682"	"00391440"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392683"	"00391441"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392684"	"00391442"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392685"	"00391443"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392686"	"00391444"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392687"	"00391445"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392688"	"00391446"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392689"	"00391447"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392690"	"00391448"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392691"	"00391449"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392692"	"00391450"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392693"	"00391451"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392694"	"00391452"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392695"	"00391453"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392696"	"00391454"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392697"	"00391455"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392698"	"00391456"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392699"	"00391457"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392700"	"00391458"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392701"	"00391459"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392702"	"00391460"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392703"	"00391461"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392704"	"00391462"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392705"	"00391463"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392706"	"00391464"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392707"	"00391465"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392708"	"00391466"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392709"	"00391467"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392710"	"00391468"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392711"	"00391469"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392712"	"00391470"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392713"	"00391471"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392714"	"00391472"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392715"	"00391473"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392716"	"00391474"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392717"	"00391475"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392718"	"00391476"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392719"	"00391477"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392720"	"00391478"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392721"	"00391479"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392722"	"00391480"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392723"	"00391481"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392724"	"00391482"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392725"	"00391483"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392726"	"00391484"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392727"	"00391485"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392728"	"00391486"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392729"	"00391487"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392730"	"00391488"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392731"	"00391489"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392732"	"00391490"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392733"	"00391491"	"1"	"00006"	"00006"	"2021-11-15 18:05:49"	""	""	"SEQ"	"DNA"	""	""
"0000392734"	"00391492"	"1"	"00006"	"00006"	"2021-11-15 19:03:43"	""	""	"SEQ"	"DNA"	""	""
"0000392736"	"00391494"	"1"	"00006"	"00006"	"2021-11-15 19:20:22"	""	""	"SEQ"	"DNA"	""	""
"0000392737"	"00391495"	"1"	"00006"	"00006"	"2021-11-15 19:23:40"	""	""	"SEQ"	"DNA"	""	""
"0000392785"	"00391543"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392786"	"00391544"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392787"	"00391545"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000392788"	"00391546"	"1"	"00000"	"03840"	"2021-11-17 14:55:16"	""	""	"?"	"DNA"	"blood"	"NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families"
"0000393001"	"00391758"	"1"	"00000"	"03840"	"2021-11-18 15:02:57"	""	""	"SEQ-NG"	"DNA"	"blood"	"Panel-based testing"
"0000393002"	"00391759"	"1"	"00000"	"03840"	"2021-11-18 15:02:57"	""	""	"SEQ-NG"	"DNA"	"blood"	"Panel-based testing"
"0000393003"	"00391760"	"1"	"00000"	"03840"	"2021-11-18 15:02:57"	""	""	"SEQ-NG"	"DNA"	"blood"	"Panel-based testing"
"0000393010"	"00391767"	"1"	"00006"	"00006"	"2021-11-18 17:37:21"	""	""	"SEQ"	"DNA"	""	""
"0000393011"	"00391768"	"1"	"00006"	"00006"	"2021-11-18 17:37:21"	""	""	"SEQ"	"DNA"	""	""
"0000393012"	"00391769"	"1"	"00006"	"00006"	"2021-11-18 17:37:21"	""	""	"SEQ"	"DNA"	""	""
"0000393013"	"00391770"	"1"	"00006"	"00006"	"2021-11-18 17:37:21"	""	""	"SEQ"	"DNA"	""	""
"0000393014"	"00391771"	"1"	"00006"	"00006"	"2021-11-18 17:37:21"	""	""	"SEQ"	"DNA"	""	""
"0000393015"	"00391772"	"1"	"00006"	"00006"	"2021-11-18 17:37:21"	""	""	"SEQ"	"DNA"	""	""
"0000393022"	"00391779"	"1"	"00006"	"00006"	"2021-11-18 19:55:52"	""	""	"SEQ"	"DNA"	""	""
"0000393023"	"00391780"	"1"	"00006"	"00006"	"2021-11-18 19:55:52"	""	""	"SEQ"	"DNA"	""	""
"0000393024"	"00391781"	"1"	"00006"	"00006"	"2021-11-18 19:55:52"	""	""	"SEQ"	"DNA"	""	""
"0000393025"	"00391782"	"1"	"00006"	"00006"	"2021-11-18 19:55:52"	""	""	"SEQ"	"DNA"	""	""
"0000393045"	"00391802"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393046"	"00391803"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393047"	"00391804"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393048"	"00391805"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393049"	"00391806"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393050"	"00391807"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393051"	"00391808"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393052"	"00391809"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393053"	"00391810"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393054"	"00391811"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393055"	"00391812"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393056"	"00391813"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393057"	"00391814"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393058"	"00391815"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393059"	"00391816"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393060"	"00391817"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393061"	"00391818"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393062"	"00391819"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393063"	"00391820"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393064"	"00391821"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393065"	"00391822"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393066"	"00391823"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393067"	"00391824"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393068"	"00391825"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393069"	"00391826"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393070"	"00391827"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393071"	"00391828"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393072"	"00391829"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393073"	"00391830"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393074"	"00391831"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393075"	"00391832"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393076"	"00391833"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393077"	"00391834"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393078"	"00391835"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393079"	"00391836"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393080"	"00391837"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393081"	"00391838"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393082"	"00391839"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393083"	"00391840"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393084"	"00391841"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393085"	"00391842"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393086"	"00391843"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393087"	"00391844"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393088"	"00391845"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393089"	"00391846"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393090"	"00391847"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393091"	"00391848"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393092"	"00391849"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393093"	"00391850"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393094"	"00391851"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393095"	"00391852"	"1"	"00006"	"00006"	"2021-11-19 11:19:46"	""	""	"SEQ"	"DNA"	""	""
"0000393113"	"00391872"	"1"	"00006"	"00006"	"2021-11-19 13:01:04"	""	""	"SEQ"	"DNA"	""	""
"0000393161"	"00391919"	"1"	"00000"	"03840"	"2021-11-19 15:06:39"	""	""	"SEQ-NG"	"DNA"	"blood"	"Whole-exome or targeted sequencing"
"0000393162"	"00391920"	"1"	"00000"	"03840"	"2021-11-19 15:06:39"	""	""	"SEQ-NG"	"DNA"	"blood"	"Whole-exome or targeted sequencing"
"0000393163"	"00391921"	"1"	"00000"	"03840"	"2021-11-19 15:06:39"	""	""	"SEQ-NG"	"DNA"	"blood"	"Whole-exome or targeted sequencing"
"0000393164"	"00391922"	"1"	"00000"	"03840"	"2021-11-19 15:06:39"	""	""	"SEQ-NG"	"DNA"	"blood"	"Whole-exome or targeted sequencing"
"0000394159"	"00392912"	"1"	"00000"	"03840"	"2021-11-25 10:23:18"	""	""	"SEQ"	"DNA"	"blood"	"whole genome sequencing after negative exome"
"0000394583"	"00393335"	"1"	"00000"	"03840"	"2021-11-29 11:52:56"	""	""	"SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000394584"	"00393336"	"1"	"00000"	"03840"	"2021-11-29 11:52:56"	""	""	"SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000394585"	"00393337"	"1"	"00000"	"03840"	"2021-11-29 11:52:56"	""	""	"SEQ"	"DNA"	"blood"	"whole exome sequencing"
"0000395225"	"00393977"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"PCR;SEQ"	"DNA"	"blood"	""
"0000395226"	"00393978"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"PCR;SEQ"	"DNA"	"blood"	""
"0000395227"	"00393979"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"PCR;SEQ"	"DNA"	"blood"	""
"0000395228"	"00393980"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"PCR;SEQ"	"DNA"	"blood"	""
"0000395229"	"00393981"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"PCR;SEQ"	"DNA"	"blood"	""
"0000395234"	"00393986"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"PCR;SEQ"	"DNA"	"blood"	""
"0000395602"	"00394355"	"1"	"00000"	"03840"	"2021-12-01 10:17:04"	""	""	"SEQ-NG"	"DNA"	""	"retrospective analysis"
"0000399811"	"00398565"	"1"	"00000"	"03840"	"2022-01-06 18:51:58"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399813"	"00398567"	"1"	"00000"	"03840"	"2022-01-06 18:51:58"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399815"	"00398569"	"1"	"00000"	"03840"	"2022-01-06 18:51:58"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399816"	"00398570"	"1"	"00000"	"03840"	"2022-01-06 18:51:58"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399818"	"00398572"	"1"	"00000"	"03840"	"2022-01-06 18:51:58"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399874"	"00398629"	"1"	"00000"	"03840"	"2022-01-07 14:40:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399877"	"00398632"	"1"	"00000"	"03840"	"2022-01-07 14:40:16"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399884"	"00398639"	"1"	"00000"	"03840"	"2022-01-07 19:12:05"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399885"	"00398640"	"1"	"00000"	"03840"	"2022-01-07 19:12:05"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399886"	"00398641"	"1"	"00000"	"03840"	"2022-01-07 19:12:05"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399887"	"00398642"	"1"	"00000"	"03840"	"2022-01-07 19:12:05"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399888"	"00398643"	"1"	"00000"	"03840"	"2022-01-07 19:12:05"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399889"	"00398644"	"1"	"00000"	"03840"	"2022-01-07 19:12:05"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399893"	"00398652"	"1"	"00000"	"03840"	"2022-01-08 20:21:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399895"	"00398654"	"1"	"00000"	"03840"	"2022-01-08 20:21:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399896"	"00398655"	"1"	"00000"	"03840"	"2022-01-08 20:21:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399898"	"00398657"	"1"	"00000"	"03840"	"2022-01-08 20:21:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399899"	"00398658"	"1"	"00000"	"03840"	"2022-01-08 20:21:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000399900"	"00398659"	"1"	"00000"	"03840"	"2022-01-08 20:21:17"	""	""	"SEQ"	"DNA"	"blood"	""
"0000400008"	"00398767"	"1"	"00000"	"03840"	"2022-01-12 12:43:53"	""	""	"SEQ-NG"	"DNA"	""	"tagreted next-generation sequencing"
"0000400009"	"00398768"	"1"	"00000"	"03840"	"2022-01-12 12:43:53"	""	""	"SEQ-NG"	"DNA"	""	"tagreted next-generation sequencing"
"0000400010"	"00398769"	"1"	"00000"	"03840"	"2022-01-12 12:43:53"	""	""	"SEQ-NG"	"DNA"	""	"tagreted next-generation sequencing"
"0000400011"	"00398770"	"1"	"00000"	"03840"	"2022-01-12 12:43:53"	""	""	"SEQ-NG"	"DNA"	""	"tagreted next-generation sequencing"
"0000400012"	"00398771"	"1"	"00000"	"03840"	"2022-01-12 12:43:53"	""	""	"SEQ-NG"	"DNA"	""	"tagreted next-generation sequencing"
"0000400013"	"00398772"	"1"	"00000"	"03840"	"2022-01-12 12:43:53"	""	""	"SEQ-NG"	"DNA"	""	"tagreted next-generation sequencing"
"0000400014"	"00398773"	"1"	"00000"	"03840"	"2022-01-12 12:43:53"	""	""	"SEQ-NG"	"DNA"	""	"tagreted next-generation sequencing"
"0000400025"	"00398784"	"1"	"00000"	"03840"	"2022-01-12 13:54:16"	""	""	"?"	"DNA"	""	"retrospective research"
"0000409687"	"00408430"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000409688"	"00408431"	"1"	"00000"	"03840"	"2022-04-21 15:58:46"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"targeted gene analysis or a next-generation sequencing-based gene panel"
"0000417048"	"00415767"	"1"	"00000"	"03840"	"2022-08-15 20:20:14"	""	""	"?"	"DNA"	""	""
"0000417049"	"00415768"	"1"	"00000"	"03840"	"2022-08-15 20:20:14"	""	""	"?"	"DNA"	""	""
"0000417050"	"00415769"	"1"	"00000"	"03840"	"2022-08-15 20:20:14"	""	""	"?"	"DNA"	""	""
"0000417051"	"00415770"	"1"	"00000"	"03840"	"2022-08-15 20:20:14"	""	""	"?"	"DNA"	""	""
"0000417052"	"00415771"	"1"	"00000"	"03840"	"2022-08-15 20:20:14"	""	""	"?"	"DNA"	""	""
"0000417053"	"00415772"	"1"	"00000"	"03840"	"2022-08-15 20:20:14"	""	""	"?"	"DNA"	""	""
"0000417054"	"00415773"	"1"	"00000"	"03840"	"2022-08-15 20:20:14"	""	""	"?"	"DNA"	""	""
"0000417055"	"00415774"	"1"	"00000"	"03840"	"2022-08-15 20:20:14"	""	""	"?"	"DNA"	""	""
"0000417058"	"00415777"	"1"	"00000"	"03840"	"2022-08-15 20:20:14"	""	""	"?"	"DNA"	""	""
"0000417059"	"00415778"	"1"	"00000"	"03840"	"2022-08-15 20:20:14"	""	""	"?"	"DNA"	""	""
"0000421005"	"00419700"	"1"	"04405"	"00006"	"2022-10-21 12:50:15"	""	""	"MIPsm"	"DNA"	""	"smMIPs 105 iMD/AMD genes"
"0000421006"	"00419701"	"1"	"04405"	"00006"	"2022-10-21 12:50:15"	""	""	"MIPsm"	"DNA"	""	"smMIPs 105 iMD/AMD genes"
"0000421007"	"00419702"	"1"	"04405"	"00006"	"2022-10-21 12:50:15"	""	""	"MIPsm"	"DNA"	""	"smMIPs 105 iMD/AMD genes"
"0000428223"	"00426903"	"1"	"00000"	"03840"	"2022-12-03 18:53:15"	""	""	"SEQ-NG;SEQ"	"DNA"	"saliva"	"panel-based next generation sequencing"
"0000428224"	"00426904"	"1"	"00000"	"03840"	"2022-12-03 18:53:15"	""	""	"SEQ-NG;SEQ"	"DNA"	"saliva"	"panel-based next generation sequencing"
"0000428225"	"00426905"	"1"	"00000"	"03840"	"2022-12-03 18:53:15"	""	""	"SEQ-NG;SEQ"	"DNA"	"saliva"	"panel-based next generation sequencing"
"0000428226"	"00426906"	"1"	"00000"	"03840"	"2022-12-03 18:53:15"	""	""	"SEQ-NG;SEQ"	"DNA"	"saliva"	"panel-based next generation sequencing"
"0000428231"	"00426911"	"1"	"00000"	"03840"	"2022-12-03 18:53:15"	""	""	"SEQ-NG;SEQ"	"DNA"	"saliva"	"panel-based next generation sequencing"
"0000428232"	"00426912"	"1"	"00000"	"03840"	"2022-12-03 18:53:15"	""	""	"SEQ-NG;SEQ"	"DNA"	"saliva"	"panel-based next generation sequencing"
"0000438130"	"00436594"	"1"	"04552"	"04552"	"2023-09-26 19:45:47"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000448486"	"00446909"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448487"	"00446910"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448488"	"00446911"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448490"	"00446913"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448491"	"00446914"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448492"	"00446915"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448493"	"00446916"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448494"	"00446917"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448495"	"00446918"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448501"	"00446924"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448788"	"00447211"	"1"	"00006"	"00006"	"2024-01-26 09:49:02"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000448976"	"00447399"	"1"	"00006"	"00006"	"2024-01-26 10:23:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000449062"	"00447485"	"1"	"00006"	"00006"	"2024-01-26 10:23:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000449139"	"00447562"	"1"	"00006"	"00006"	"2024-01-26 10:23:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000449197"	"00447620"	"1"	"00006"	"00006"	"2024-01-26 10:23:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000449234"	"00447657"	"1"	"00006"	"00006"	"2024-01-26 10:23:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000449250"	"00447673"	"1"	"00006"	"00006"	"2024-01-26 10:23:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000449251"	"00447674"	"1"	"00006"	"00006"	"2024-01-26 10:23:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000449257"	"00447680"	"1"	"00006"	"00006"	"2024-01-26 10:23:59"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000452390"	"00450792"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452391"	"00450793"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452392"	"00450794"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452393"	"00450795"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452394"	"00450796"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452395"	"00450797"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452396"	"00450798"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452397"	"00450799"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452398"	"00450800"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452399"	"00450801"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452400"	"00450802"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452401"	"00450803"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452402"	"00450804"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452403"	"00450805"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452633"	"00451034"	"1"	"00006"	"00006"	"2024-05-31 11:39:36"	""	""	"SEQ"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452720"	"00451121"	"1"	"00006"	"00006"	"2024-05-31 11:39:36"	""	""	"SEQ"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452738"	"00451139"	"1"	"00006"	"00006"	"2024-05-31 11:39:36"	""	""	"SEQ"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000452828"	"00451229"	"1"	"00006"	"00006"	"2024-05-31 11:39:36"	""	""	"SEQ"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"
"0000456384"	"00454772"	"1"	"04752"	"04752"	"2024-09-26 15:26:12"	""	""	"SEQ"	"DNA"	""	""
"0000456387"	"00454775"	"1"	"04752"	"04752"	"2024-09-26 15:48:23"	""	""	"SEQ"	"DNA"	""	""
"0000456388"	"00454776"	"1"	"04752"	"04752"	"2024-09-26 15:52:47"	""	""	"SEQ"	"DNA"	""	""
"0000456389"	"00454777"	"1"	"04752"	"04752"	"2024-09-26 15:55:58"	""	""	"SEQ"	"DNA"	""	""
"0000456558"	"00454945"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456559"	"00454946"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456560"	"00454947"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456561"	"00454948"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456562"	"00454949"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456563"	"00454950"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456564"	"00454951"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456565"	"00454952"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456566"	"00454953"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456567"	"00454954"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456568"	"00454955"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456569"	"00454956"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456570"	"00454957"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456571"	"00454958"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456572"	"00454959"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456573"	"00454960"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456574"	"00454961"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456575"	"00454962"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456576"	"00454963"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456577"	"00454964"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456578"	"00454965"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456579"	"00454966"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456580"	"00454967"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456581"	"00454968"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456582"	"00454969"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456583"	"00454970"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456584"	"00454971"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456585"	"00454972"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456586"	"00454973"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456587"	"00454974"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456588"	"00454975"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456589"	"00454976"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456590"	"00454977"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456591"	"00454978"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456592"	"00454979"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456593"	"00454980"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456594"	"00454981"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456595"	"00454982"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456596"	"00454983"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456597"	"00454984"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456598"	"00454985"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456599"	"00454986"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456600"	"00454987"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456601"	"00454988"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456602"	"00454989"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456603"	"00454990"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456604"	"00454991"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456605"	"00454992"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456606"	"00454993"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456607"	"00454994"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456608"	"00454995"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456609"	"00454996"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456610"	"00454997"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456611"	"00454998"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456612"	"00454999"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456613"	"00455000"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456614"	"00455001"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	"00006"	"2024-09-30 16:25:32"	"arrayCGH;SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000456615"	"00455002"	"1"	"04752"	"00006"	"2024-09-30 16:23:56"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000466175"	"00464537"	"1"	"00006"	"00006"	"2021-11-12 16:51:08"	""	""	"SEQ"	"DNA"	""	""


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 771
"{{screeningid}}"	"{{geneid}}"
"0000096347"	"CNGB3"
"0000105518"	"CNGB3"
"0000105518"	"CRB1"
"0000105518"	"ROM1"
"0000145017"	"EYS"
"0000156305"	"CNGB3"
"0000156306"	"CNGB3"
"0000156307"	"CNGB3"
"0000156308"	"CNGB3"
"0000156309"	"CNGB3"
"0000156310"	"CNGB3"
"0000156311"	"CNGB3"
"0000171731"	"ABCA4"
"0000171731"	"CNGB3"
"0000174623"	"CNGB3"
"0000174624"	"CNGB3"
"0000174628"	"CNGB3"
"0000174629"	"CNGB3"
"0000174631"	"CNGB3"
"0000174632"	"CNGB3"
"0000174633"	"CNGB3"
"0000174634"	"CNGB3"
"0000174635"	"CNGB3"
"0000174636"	"CNGB3"
"0000174637"	"CNGB3"
"0000174638"	"CNGB3"
"0000174639"	"CNGB3"
"0000309644"	"CNGB3"
"0000309645"	"CNGB3"
"0000310239"	"CNGB3"
"0000310240"	"CNGB3"
"0000310241"	"CNGB3"
"0000310242"	"CNGB3"
"0000310243"	"CNGB3"
"0000310244"	"CNGB3"
"0000310245"	"CNGB3"
"0000310246"	"CNGB3"
"0000310247"	"CNGB3"
"0000310248"	"CNGB3"
"0000321009"	"CNGA3"
"0000321009"	"CNGB3"
"0000321010"	"CNGA3"
"0000321010"	"CNGB3"
"0000321011"	"CNGA3"
"0000321011"	"CNGB3"
"0000321012"	"CNGA3"
"0000321012"	"CNGB3"
"0000321013"	"CNGA3"
"0000321013"	"CNGB3"
"0000321014"	"CNGA3"
"0000321014"	"CNGB3"
"0000321015"	"CNGA3"
"0000321015"	"CNGB3"
"0000321226"	"CNGA3"
"0000321226"	"CNGB3"
"0000321227"	"CNGA3"
"0000321227"	"CNGB3"
"0000321228"	"CNGA3"
"0000321228"	"CNGB3"
"0000321232"	"CNGA3"
"0000321232"	"CNGB3"
"0000321238"	"CNGA3"
"0000321238"	"CNGB3"
"0000321239"	"CNGA3"
"0000321239"	"CNGB3"
"0000321241"	"CNGA3"
"0000321241"	"CNGB3"
"0000321242"	"CNGA3"
"0000321242"	"CNGB3"
"0000321244"	"CNGA3"
"0000321244"	"CNGB3"
"0000321245"	"CNGA3"
"0000321245"	"CNGB3"
"0000321247"	"CNGA3"
"0000321247"	"CNGB3"
"0000325438"	"CNGA3"
"0000325438"	"CNGB3"
"0000325438"	"GNAT2"
"0000325441"	"CNGA3"
"0000325441"	"CNGB3"
"0000325441"	"GNAT2"
"0000325445"	"CNGA3"
"0000325445"	"CNGB3"
"0000325445"	"GNAT2"
"0000325446"	"CNGA3"
"0000325446"	"CNGB3"
"0000325446"	"GNAT2"
"0000325448"	"CNGA3"
"0000325448"	"CNGB3"
"0000325448"	"GNAT2"
"0000325449"	"CNGA3"
"0000325449"	"CNGB3"
"0000325449"	"GNAT2"
"0000325452"	"CNGA3"
"0000325452"	"CNGB3"
"0000325452"	"GNAT2"
"0000325453"	"CNGA3"
"0000325453"	"CNGB3"
"0000325453"	"GNAT2"
"0000325454"	"CNGA3"
"0000325454"	"CNGB3"
"0000325454"	"GNAT2"
"0000325456"	"CNGA3"
"0000325456"	"CNGB3"
"0000325456"	"GNAT2"
"0000325458"	"CNGA3"
"0000325458"	"CNGB3"
"0000325458"	"GNAT2"
"0000325459"	"CNGA3"
"0000325459"	"CNGB3"
"0000325459"	"GNAT2"
"0000325461"	"CNGA3"
"0000325461"	"CNGB3"
"0000325461"	"GNAT2"
"0000325462"	"CNGA3"
"0000325462"	"CNGB3"
"0000325462"	"GNAT2"
"0000325463"	"CNGA3"
"0000325463"	"CNGB3"
"0000325463"	"GNAT2"
"0000325464"	"CNGA3"
"0000325464"	"CNGB3"
"0000325464"	"GNAT2"
"0000325465"	"CNGA3"
"0000325465"	"CNGB3"
"0000325465"	"GNAT2"
"0000326698"	"LRAT"
"0000329150"	"CNGB3"
"0000329182"	"CNGB3"
"0000329238"	"CNGB3"
"0000329350"	"CNGB3"
"0000329421"	"CNGB3"
"0000329526"	"CNGB3"
"0000329553"	"CNGB3"
"0000329666"	"CNGB3"
"0000329667"	"CNGB3"
"0000329668"	"CNGB3"
"0000329669"	"CNGB3"
"0000332515"	"CNGB3"
"0000332518"	"CNGB3"
"0000332939"	"CNGB3"
"0000332940"	"CNGB3"
"0000332941"	"CNGB3"
"0000332942"	"CNGB3"
"0000332943"	"CNGB3"
"0000332944"	"CNGB3"
"0000332945"	"CNGB3"
"0000333498"	"CNGB3"
"0000333508"	"CNGB3"
"0000333628"	"CNGB3"
"0000333675"	"CNGB3"
"0000333676"	"CNGB3"
"0000333677"	"CNGB3"
"0000334562"	"CNGB3"
"0000334861"	"CNGB3"
"0000335211"	"CNGB3"
"0000335212"	"CNGB3"
"0000335213"	"CNGB3"
"0000335214"	"CNGB3"
"0000335690"	"CNGB3"
"0000336125"	"CNGB3"
"0000336335"	"CNGB3"
"0000336336"	"CNGB3"
"0000336339"	"CNGB3"
"0000336339"	"CRX"
"0000336456"	"CNGB3"
"0000336564"	"CNGB3"
"0000336714"	"CNGB3"
"0000337199"	"CNGB3"
"0000363370"	"CNGB3"
"0000363371"	"CNGB3"
"0000363372"	"CNGB3"
"0000364148"	"CNGB3"
"0000374577"	"CNGB3"
"0000375104"	"CNGB3"
"0000375105"	"CNGB3"
"0000376188"	"CNGB3"
"0000376189"	"CNGB3"
"0000376190"	"CNGB3"
"0000376191"	"CNGB3"
"0000376192"	"CNGB3"
"0000376553"	"CNGB3"
"0000376555"	"CNGB3"
"0000376556"	"CNGB3"
"0000376561"	"CNGB3"
"0000376562"	"CNGB3"
"0000377499"	"CNGB3"
"0000377500"	"CNGB3"
"0000378212"	"CNGB3"
"0000378213"	"CNGB3"
"0000378214"	"CNGB3"
"0000378215"	"CNGB3"
"0000378216"	"CNGB3"
"0000378221"	"CNGA3"
"0000378221"	"CNGB3"
"0000378221"	"GNAT2"
"0000378222"	"CNGA3"
"0000378222"	"CNGB3"
"0000378222"	"GNAT2"
"0000378223"	"CNGA3"
"0000378223"	"CNGB3"
"0000378223"	"GNAT2"
"0000378224"	"CNGA3"
"0000378224"	"CNGB3"
"0000378224"	"GNAT2"
"0000378225"	"CNGA3"
"0000378225"	"CNGB3"
"0000378225"	"GNAT2"
"0000378226"	"CNGA3"
"0000378226"	"CNGB3"
"0000378226"	"GNAT2"
"0000378227"	"CNGA3"
"0000378227"	"CNGB3"
"0000378227"	"GNAT2"
"0000378228"	"CNGA3"
"0000378228"	"CNGB3"
"0000378228"	"GNAT2"
"0000378229"	"CNGA3"
"0000378229"	"CNGB3"
"0000378229"	"GNAT2"
"0000378230"	"CNGA3"
"0000378230"	"CNGB3"
"0000378230"	"GNAT2"
"0000378385"	"CNGB3"
"0000378404"	"CNGB3"
"0000378428"	"CNGB3"
"0000378448"	"CNGB3"
"0000378904"	"CNGB3"
"0000378905"	"CNGB3"
"0000378906"	"CNGB3"
"0000378907"	"CNGB3"
"0000378908"	"CNGB3"
"0000378909"	"CNGB3"
"0000378910"	"CNGB3"
"0000378911"	"CNGB3"
"0000379167"	"CNGB3"
"0000379179"	"CNGB3"
"0000379187"	"CNGB3"
"0000379188"	"CNGB3"
"0000379189"	"CNGB3"
"0000379190"	"CNGB3"
"0000379191"	"CNGB3"
"0000379192"	"CNGB3"
"0000379193"	"CNGB3"
"0000379196"	"CNGB3"
"0000381389"	"CNGB3"
"0000382086"	"USH2A"
"0000382338"	"CNGB3"
"0000382339"	"CNGB3"
"0000382340"	"CNGB3"
"0000382341"	"CNGB3"
"0000382342"	"CNGB3"
"0000382343"	"CNGB3"
"0000382344"	"CNGB3"
"0000382345"	"CNGB3"
"0000382346"	"CNGB3"
"0000382347"	"CNGB3"
"0000382348"	"CNGB3"
"0000382349"	"CNGB3"
"0000382350"	"CNGB3"
"0000382351"	"CNGB3"
"0000382352"	"CNGB3"
"0000383011"	"CNGB3"
"0000383012"	"CNGB3"
"0000383179"	"CNGB3"
"0000383180"	"CNGB3"
"0000383181"	"CNGB3"
"0000383182"	"CNGB3"
"0000383183"	"CNGA3"
"0000383184"	"CNGA3"
"0000383185"	"CNGA3"
"0000383186"	"CNGA3"
"0000383187"	"CNGA3"
"0000383188"	"CNGA3"
"0000383189"	"CNGA3"
"0000383190"	"CNGA3"
"0000383191"	"CNGA3"
"0000383344"	"CNGB3"
"0000383345"	"CNGB3"
"0000383346"	"CNGB3"
"0000383347"	"CNGB3"
"0000383473"	"CNGB3"
"0000383474"	"CNGB3"
"0000383475"	"CNGB3"
"0000383476"	"CNGB3"
"0000383477"	"CNGB3"
"0000383478"	"CNGB3"
"0000383638"	"CNGB3"
"0000383742"	"CNGB3"
"0000383848"	"CNGB3"
"0000383874"	"CNGB3"
"0000384009"	"CNGB3"
"0000384643"	"CNGB3"
"0000384644"	"CNGB3"
"0000387405"	"ABCA4"
"0000387408"	"ABCA4"
"0000387430"	"ABCA4"
"0000387441"	"CNGB3"
"0000387442"	"CNGB3"
"0000387453"	"C21orf2"
"0000387498"	"ABCA4"
"0000387503"	"CNGB3"
"0000387504"	"CNGB3"
"0000387506"	"USH2A"
"0000387520"	"CNGB3"
"0000387927"	"CNGB3"
"0000387979"	"CNGB3"
"0000389723"	"CNGB3"
"0000390010"	"CNGB3"
"0000391043"	"CNGB3"
"0000391058"	"CNGB3"
"0000391092"	"CNGB3"
"0000391093"	"CNGB3"
"0000391094"	"CNGB3"
"0000391109"	"CNGB3"
"0000391116"	"CNGB3"
"0000391117"	"CNGB3"
"0000391127"	"CNGB3"
"0000391131"	"CNGB3"
"0000391132"	"CNGB3"
"0000391134"	"CNGB3"
"0000391135"	"CNGB3"
"0000391138"	"CNGB3"
"0000391139"	"CNGB3"
"0000391140"	"CNGB3"
"0000391142"	"CNGB3"
"0000391144"	"CNGB3"
"0000391147"	"CNGB3"
"0000391157"	"CNGB3"
"0000391174"	"CNGB3"
"0000391239"	"CNGB3"
"0000391241"	"CNGB3"
"0000391242"	"CNGB3"
"0000391245"	"CNGB3"
"0000391246"	"CNGB3"
"0000391248"	"CNGB3"
"0000391254"	"CNGB3"
"0000391255"	"CNGB3"
"0000391256"	"CNGB3"
"0000391257"	"CNGB3"
"0000391259"	"CNGB3"
"0000391260"	"CNGB3"
"0000391261"	"CNGB3"
"0000391262"	"CNGB3"
"0000391470"	"CNGB3"
"0000391471"	"CNGB3"
"0000391472"	"CNGB3"
"0000391473"	"CNGB3"
"0000391474"	"CNGB3"
"0000391475"	"CNGB3"
"0000391476"	"CNGB3"
"0000391984"	"CNGB3"
"0000392110"	"CNGB3"
"0000392172"	"CNGB3"
"0000392199"	"CNGB3"
"0000392259"	"CNGB3"
"0000392260"	"CNGB3"
"0000392261"	"CNGB3"
"0000392262"	"CNGB3"
"0000392263"	"CNGB3"
"0000392264"	"CNGB3"
"0000392265"	"CNGB3"
"0000392266"	"CNGB3"
"0000392267"	"CNGB3"
"0000392268"	"CNGB3"
"0000392269"	"CNGB3"
"0000392270"	"CNGB3"
"0000392271"	"CNGB3"
"0000392272"	"CNGB3"
"0000392273"	"CNGB3"
"0000392274"	"CNGB3"
"0000392275"	"CNGB3"
"0000392276"	"CNGB3"
"0000392277"	"CNGB3"
"0000392278"	"CNGB3"
"0000392279"	"CNGB3"
"0000392280"	"CNGB3"
"0000392281"	"CNGB3"
"0000392282"	"CNGB3"
"0000392283"	"CNGB3"
"0000392284"	"CNGB3"
"0000392285"	"CNGB3"
"0000392286"	"CNGB3"
"0000392287"	"CNGB3"
"0000392288"	"CNGB3"
"0000392289"	"CNGB3"
"0000392290"	"CNGB3"
"0000392291"	"CNGB3"
"0000392292"	"CNGB3"
"0000392293"	"CNGB3"
"0000392294"	"CNGB3"
"0000392295"	"CNGB3"
"0000392296"	"CNGB3"
"0000392297"	"CNGB3"
"0000392298"	"CNGB3"
"0000392299"	"CNGB3"
"0000392300"	"CNGB3"
"0000392301"	"CNGB3"
"0000392302"	"CNGB3"
"0000392303"	"CNGB3"
"0000392304"	"CNGB3"
"0000392305"	"CNGB3"
"0000392306"	"CNGB3"
"0000392307"	"CNGB3"
"0000392308"	"CNGB3"
"0000392309"	"CNGB3"
"0000392310"	"CNGB3"
"0000392311"	"CNGB3"
"0000392312"	"CNGB3"
"0000392313"	"CNGB3"
"0000392314"	"CNGB3"
"0000392315"	"CNGB3"
"0000392316"	"CNGB3"
"0000392317"	"CNGB3"
"0000392318"	"CNGB3"
"0000392319"	"CNGB3"
"0000392320"	"CNGB3"
"0000392321"	"CNGB3"
"0000392322"	"CNGB3"
"0000392323"	"CNGB3"
"0000392324"	"CNGB3"
"0000392325"	"CNGB3"
"0000392326"	"CNGB3"
"0000392327"	"CNGB3"
"0000392328"	"CNGB3"
"0000392329"	"CNGB3"
"0000392330"	"CNGB3"
"0000392331"	"CNGB3"
"0000392332"	"CNGB3"
"0000392333"	"CNGB3"
"0000392334"	"CNGB3"
"0000392335"	"CNGB3"
"0000392336"	"CNGB3"
"0000392337"	"CNGB3"
"0000392338"	"CNGB3"
"0000392339"	"CNGB3"
"0000392340"	"CNGB3"
"0000392341"	"CNGB3"
"0000392342"	"CNGB3"
"0000392343"	"CNGB3"
"0000392344"	"CNGB3"
"0000392345"	"CNGB3"
"0000392346"	"CNGB3"
"0000392347"	"CNGB3"
"0000392348"	"CNGB3"
"0000392349"	"CNGB3"
"0000392350"	"CNGB3"
"0000392351"	"CNGB3"
"0000392352"	"CNGB3"
"0000392353"	"CNGB3"
"0000392354"	"CNGB3"
"0000392355"	"CNGB3"
"0000392356"	"CNGB3"
"0000392357"	"CNGB3"
"0000392358"	"CNGB3"
"0000392359"	"CNGB3"
"0000392360"	"CNGB3"
"0000392361"	"CNGB3"
"0000392362"	"CNGB3"
"0000392363"	"CNGB3"
"0000392364"	"CNGB3"
"0000392365"	"CNGB3"
"0000392366"	"CNGB3"
"0000392367"	"CNGB3"
"0000392368"	"CNGB3"
"0000392369"	"CNGB3"
"0000392370"	"CNGB3"
"0000392371"	"CNGB3"
"0000392372"	"CNGB3"
"0000392373"	"CNGB3"
"0000392374"	"CNGB3"
"0000392375"	"CNGB3"
"0000392532"	"CNGB3"
"0000392533"	"CNGB3"
"0000392534"	"CNGB3"
"0000392535"	"CNGB3"
"0000392536"	"CNGB3"
"0000392537"	"CNGB3"
"0000392538"	"CNGB3"
"0000392539"	"CNGB3"
"0000392540"	"CNGB3"
"0000392541"	"CNGB3"
"0000392542"	"CNGB3"
"0000392543"	"CNGB3"
"0000392544"	"CNGB3"
"0000392545"	"CNGB3"
"0000392546"	"CNGB3"
"0000392547"	"CNGB3"
"0000392548"	"CNGB3"
"0000392549"	"CNGB3"
"0000392550"	"CNGB3"
"0000392551"	"CNGB3"
"0000392552"	"CNGB3"
"0000392553"	"CNGB3"
"0000392554"	"CNGB3"
"0000392555"	"CNGB3"
"0000392556"	"CNGB3"
"0000392557"	"CNGB3"
"0000392558"	"CNGB3"
"0000392559"	"CNGB3"
"0000392560"	"CNGB3"
"0000392561"	"CNGB3"
"0000392562"	"CNGB3"
"0000392563"	"CNGB3"
"0000392564"	"CNGB3"
"0000392565"	"CNGB3"
"0000392566"	"CNGB3"
"0000392567"	"CNGB3"
"0000392568"	"CNGB3"
"0000392569"	"CNGB3"
"0000392570"	"CNGB3"
"0000392571"	"CNGB3"
"0000392572"	"CNGB3"
"0000392573"	"CNGB3"
"0000392574"	"CNGB3"
"0000392575"	"CNGB3"
"0000392576"	"CNGB3"
"0000392577"	"CNGB3"
"0000392578"	"CNGB3"
"0000392579"	"CNGB3"
"0000392580"	"CNGB3"
"0000392581"	"CNGB3"
"0000392582"	"CNGB3"
"0000392583"	"CNGB3"
"0000392584"	"CNGB3"
"0000392585"	"CNGB3"
"0000392586"	"CNGB3"
"0000392621"	"CNGB3"
"0000392622"	"CNGB3"
"0000392631"	"CNGB3"
"0000392632"	"CNGB3"
"0000392633"	"CNGB3"
"0000392634"	"CNGB3"
"0000392635"	"CNGB3"
"0000392636"	"CNGB3"
"0000392637"	"CNGB3"
"0000392638"	"CNGB3"
"0000392639"	"CNGB3"
"0000392640"	"CNGB3"
"0000392641"	"CNGB3"
"0000392642"	"CNGB3"
"0000392643"	"CNGB3"
"0000392644"	"CNGB3"
"0000392645"	"CNGB3"
"0000392646"	"CNGB3"
"0000392647"	"CNGB3"
"0000392648"	"CNGB3"
"0000392649"	"CNGB3"
"0000392650"	"CNGB3"
"0000392651"	"CNGB3"
"0000392652"	"CNGB3"
"0000392653"	"CNGB3"
"0000392654"	"CNGB3"
"0000392655"	"CNGB3"
"0000392656"	"CNGB3"
"0000392657"	"CNGB3"
"0000392658"	"CNGB3"
"0000392659"	"CNGB3"
"0000392660"	"CNGB3"
"0000392661"	"CNGB3"
"0000392662"	"CNGB3"
"0000392663"	"CNGB3"
"0000392664"	"CNGB3"
"0000392665"	"CNGB3"
"0000392666"	"CNGB3"
"0000392667"	"CNGB3"
"0000392668"	"CNGB3"
"0000392669"	"CNGB3"
"0000392670"	"CNGB3"
"0000392671"	"CNGB3"
"0000392672"	"CNGB3"
"0000392673"	"CNGB3"
"0000392674"	"CNGB3"
"0000392675"	"CNGB3"
"0000392676"	"CNGB3"
"0000392677"	"CNGB3"
"0000392678"	"CNGB3"
"0000392679"	"CNGB3"
"0000392680"	"CNGB3"
"0000392681"	"CNGB3"
"0000392682"	"CNGB3"
"0000392683"	"CNGB3"
"0000392684"	"CNGB3"
"0000392685"	"CNGB3"
"0000392686"	"CNGB3"
"0000392687"	"CNGB3"
"0000392688"	"CNGB3"
"0000392689"	"CNGB3"
"0000392690"	"CNGB3"
"0000392691"	"CNGB3"
"0000392692"	"CNGB3"
"0000392693"	"CNGB3"
"0000392694"	"CNGB3"
"0000392695"	"CNGB3"
"0000392696"	"CNGB3"
"0000392697"	"CNGB3"
"0000392698"	"CNGB3"
"0000392699"	"CNGB3"
"0000392700"	"CNGB3"
"0000392701"	"CNGB3"
"0000392702"	"CNGB3"
"0000392703"	"CNGB3"
"0000392704"	"CNGB3"
"0000392705"	"CNGB3"
"0000392706"	"CNGB3"
"0000392707"	"CNGB3"
"0000392708"	"CNGB3"
"0000392709"	"CNGB3"
"0000392710"	"CNGB3"
"0000392711"	"CNGB3"
"0000392712"	"CNGB3"
"0000392713"	"CNGB3"
"0000392714"	"CNGB3"
"0000392715"	"CNGB3"
"0000392716"	"CNGB3"
"0000392717"	"CNGB3"
"0000392718"	"CNGB3"
"0000392719"	"CNGB3"
"0000392720"	"CNGB3"
"0000392721"	"CNGB3"
"0000392722"	"CNGB3"
"0000392723"	"CNGB3"
"0000392724"	"CNGB3"
"0000392725"	"CNGB3"
"0000392726"	"CNGB3"
"0000392727"	"CNGB3"
"0000392728"	"CNGB3"
"0000392729"	"CNGB3"
"0000392730"	"CNGB3"
"0000392731"	"CNGB3"
"0000392732"	"CNGB3"
"0000392733"	"CNGB3"
"0000392734"	"CNGB3"
"0000392736"	"CNGB3"
"0000392737"	"CNGB3"
"0000392785"	"CNGB3"
"0000392786"	"CNGB3"
"0000392787"	"CNGB3"
"0000392788"	"CNGB3"
"0000393001"	"CNGB3"
"0000393002"	"CNGB3"
"0000393003"	"CNGB3"
"0000393010"	"CNGB3"
"0000393011"	"CNGB3"
"0000393012"	"CNGB3"
"0000393013"	"CNGB3"
"0000393014"	"CNGB3"
"0000393015"	"CNGB3"
"0000393022"	"CNGB3"
"0000393023"	"CNGB3"
"0000393024"	"CNGB3"
"0000393025"	"CNGB3"
"0000393045"	"CNGB3"
"0000393046"	"CNGB3"
"0000393047"	"CNGB3"
"0000393048"	"CNGB3"
"0000393049"	"CNGB3"
"0000393050"	"CNGB3"
"0000393051"	"CNGB3"
"0000393052"	"CNGB3"
"0000393053"	"CNGB3"
"0000393054"	"CNGB3"
"0000393055"	"CNGB3"
"0000393056"	"CNGB3"
"0000393057"	"CNGB3"
"0000393058"	"CNGB3"
"0000393059"	"CNGB3"
"0000393060"	"CNGB3"
"0000393061"	"CNGB3"
"0000393062"	"CNGB3"
"0000393063"	"CNGB3"
"0000393064"	"CNGB3"
"0000393065"	"CNGB3"
"0000393066"	"CNGB3"
"0000393067"	"CNGB3"
"0000393068"	"CNGB3"
"0000393069"	"CNGB3"
"0000393070"	"CNGB3"
"0000393071"	"CNGB3"
"0000393072"	"CNGB3"
"0000393073"	"CNGB3"
"0000393074"	"CNGB3"
"0000393075"	"CNGB3"
"0000393076"	"CNGB3"
"0000393077"	"CNGB3"
"0000393078"	"CNGB3"
"0000393079"	"CNGB3"
"0000393080"	"CNGB3"
"0000393081"	"CNGB3"
"0000393082"	"CNGB3"
"0000393083"	"CNGB3"
"0000393084"	"CNGB3"
"0000393085"	"CNGB3"
"0000393086"	"CNGB3"
"0000393087"	"CNGB3"
"0000393088"	"CNGB3"
"0000393089"	"CNGB3"
"0000393090"	"CNGB3"
"0000393091"	"CNGB3"
"0000393092"	"CNGB3"
"0000393093"	"CNGB3"
"0000393094"	"CNGB3"
"0000393095"	"CNGB3"
"0000393113"	"CNGB3"
"0000393161"	"CNGB3"
"0000393162"	"CNGB3"
"0000393163"	"CNGB3"
"0000393164"	"CNGB3"
"0000394159"	"CNGB3"
"0000394583"	"CNGB3"
"0000394584"	"CNGB3"
"0000394585"	"CNGB3"
"0000395225"	"CNGB3"
"0000395226"	"CNGB3"
"0000395227"	"CNGB3"
"0000395228"	"CNGB3"
"0000395229"	"CNGB3"
"0000395234"	"CNGB3"
"0000395602"	"CNGB3"
"0000399811"	"CNGB3"
"0000399813"	"CNGB3"
"0000399815"	"CNGB3"
"0000399816"	"CNGB3"
"0000399818"	"CNGB3"
"0000399874"	"CNGB3"
"0000399877"	"CNGB3"
"0000399884"	"CNGB3"
"0000399885"	"CNGB3"
"0000399886"	"CNGB3"
"0000399887"	"CNGB3"
"0000399888"	"CNGB3"
"0000399889"	"CNGB3"
"0000399893"	"CNGA3"
"0000399895"	"CNGB3"
"0000399896"	"CNGB3"
"0000399898"	"CNGB3"
"0000399899"	"CNGB3"
"0000399900"	"CNGB3"
"0000400008"	"CNGB3"
"0000400009"	"CNGB3"
"0000400010"	"CNGB3"
"0000400011"	"CNGB3"
"0000400012"	"CNGB3"
"0000400013"	"CNGB3"
"0000400014"	"CNGB3"
"0000400025"	"CNGA3"
"0000409687"	"CNGB3"
"0000409688"	"CNGB3"
"0000417048"	"CNGB3"
"0000417049"	"CNGB3"
"0000417050"	"CNGB3"
"0000417051"	"CNGB3"
"0000417052"	"CNGB3"
"0000417053"	"CNGB3"
"0000417054"	"CNGB3"
"0000417055"	"CNGB3"
"0000417058"	"CNGB3"
"0000417059"	"CNGB3"
"0000428223"	"CNGB3"
"0000428224"	"CNGB3"
"0000428225"	"CNGB3"
"0000428226"	"CNGB3"
"0000428231"	"CNGB3"
"0000428232"	"CNGB3"
"0000438130"	"CNGB3"
"0000456384"	"CNGA3"
"0000456384"	"CNGB3"
"0000456387"	"CNGB3"
"0000456388"	"CNGB3"
"0000456389"	"CNGB3"
"0000466175"	"CNGB3"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 1260
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000158339"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"01769"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Li 2017:28418496}"	""	"1148delC"	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000170921"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"01244"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:de Castro-Miró 2016:28005958}"	""	"1148delC"	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000170963"	"0"	"70"	"8"	"87616430"	"87616430"	"subst"	"6.1066E-5"	"01244"	"CNGB3_000002"	"g.87616430C>A"	""	"{PMID:de Castro-Miró 2016:28005958}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86604202C>A"	""	"VUS"	"ACMG"
"0000246736"	"0"	"10"	"8"	"87680417"	"87680417"	"del"	"0"	"02330"	"CNGB3_000021"	"g.87680417del"	""	""	""	"CNGB3(NM_019098.5):c.494-11delT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86668189del"	""	"benign"	""
"0000246753"	"0"	"30"	"8"	"87738897"	"87738897"	"subst"	"8.94891E-5"	"02330"	"CNGB3_000024"	"g.87738897A>C"	""	""	""	"CNGB3(NM_019098.5):c.212-12T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86726669A>C"	""	"likely benign"	""
"0000248743"	"0"	"10"	"8"	"87679303"	"87679303"	"subst"	"0.892062"	"02325"	"CNGB3_000017"	"g.87679303A>C"	""	""	""	"CNGB3(NM_019098.5):c.702T>G (p.C234W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86667075A>C"	""	"benign"	""
"0000264709"	"0"	"10"	"8"	"87644966"	"87644966"	"subst"	"4.07017E-6"	"02330"	"CNGB3_000011"	"g.87644966C>T"	""	""	""	"CNGB3(NM_019098.5):c.1320+14G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86632738C>T"	""	"benign"	""
"0000264710"	"0"	"30"	"8"	"87641244"	"87641244"	"subst"	"0.0016682"	"02330"	"CNGB3_000008"	"g.87641244G>A"	""	""	""	"CNGB3(NM_019098.5):c.1383C>T (p.D461=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86629016G>A"	""	"likely benign"	""
"0000264711"	"0"	"10"	"8"	"87638255"	"87638255"	"subst"	"0.000646899"	"02330"	"CNGB3_000007"	"g.87638255T>C"	""	""	""	"CNGB3(NM_019098.4):c.1534A>G (p.I512V), CNGB3(NM_019098.5):c.1534A>G (p.I512V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86626027T>C"	""	"benign"	""
"0000264712"	"0"	"10"	"8"	"87591316"	"87591316"	"subst"	"0.00173158"	"02330"	"CNGB3_000005"	"g.87591316G>A"	""	""	""	"CNGB3(NM_019098.5):c.1928+18C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86579088G>A"	""	"benign"	""
"0000264713"	"0"	"50"	"8"	"87588154"	"87588154"	"subst"	"0.000304952"	"02330"	"CNGB3_000004"	"g.87588154C>A"	""	""	""	"CNGB3(NM_019098.5):c.2308G>T (p.V770F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86575926C>A"	""	"VUS"	""
"0000264714"	"0"	"10"	"8"	"87588042"	"87588042"	"subst"	"0.0035786"	"02330"	"CNGB3_000003"	"g.87588042G>C"	""	""	""	"CNGB3(NM_019098.4):c.2420C>G (p.A807G), CNGB3(NM_019098.5):c.2420C>G (p.A807G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86575814G>C"	""	"benign"	""
"0000266857"	"0"	"10"	"8"	"87751866"	"87751866"	"del"	"0"	"02325"	"CNGB3_000025"	"g.87751866del"	""	""	""	"CNGB3(NM_019098.5):c.211+34delA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86739638del"	""	"benign"	""
"0000268154"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"02329"	"CNGB3_000001"	"g.87656009del"	""	""	""	"CNGB3(NM_019098.4):c.1148delC (p.(Thr383Ilefs*13)), CNGB3(NM_019098.4):c.1148delC (p.T383Ifs*13), CNGB3(NM_019098.5):c.1148delC (p.T383Ifs*13)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000273675"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"01943"	"CNGB3_000001"	"g.87656009del"	""	""	""	"CNGB3(NM_019098.4):c.1148delC (p.(Thr383Ilefs*13)), CNGB3(NM_019098.4):c.1148delC (p.T383Ifs*13), CNGB3(NM_019098.5):c.1148delC (p.T383Ifs*13)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000273676"	"0"	"10"	"8"	"87641271"	"87641271"	"subst"	"0.0135323"	"01943"	"CNGB3_000010"	"g.87641271C>T"	""	""	""	"CNGB3(NM_019098.4):c.1356G>A (p.Q452=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86629043C>T"	""	"benign"	""
"0000273677"	"0"	"50"	"8"	"87641260"	"87641260"	"subst"	"0.000166853"	"01943"	"CNGB3_000009"	"g.87641260C>T"	""	""	""	"CNGB3(NM_019098.4):c.1367G>A (p.R456H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86629032C>T"	""	"VUS"	""
"0000273678"	"0"	"30"	"8"	"87638255"	"87638255"	"subst"	"0.000646899"	"01943"	"CNGB3_000007"	"g.87638255T>C"	""	""	""	"CNGB3(NM_019098.4):c.1534A>G (p.I512V), CNGB3(NM_019098.5):c.1534A>G (p.I512V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86626027T>C"	""	"likely benign"	""
"0000273679"	"0"	"30"	"8"	"87616370"	"87616370"	"subst"	"0.000304962"	"01943"	"CNGB3_000006"	"g.87616370T>A"	""	""	""	"CNGB3(NM_019098.4):c.1732A>T (p.T578S), CNGB3(NM_019098.5):c.1732A>T (p.T578S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86604142T>A"	""	"likely benign"	""
"0000273680"	"0"	"30"	"8"	"87751911"	"87751911"	"subst"	"3.66892E-5"	"01943"	"CNGB3_000026"	"g.87751911C>T"	""	""	""	"CNGB3(NM_019098.4):c.183G>A (p.T61=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86739683C>T"	""	"likely benign"	""
"0000273681"	"0"	"50"	"8"	"87738778"	"87738778"	"subst"	"0.00044698"	"01943"	"CNGB3_000023"	"g.87738778C>T"	""	""	""	"CNGB3(NM_019098.4):c.319G>A (p.G107R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86726550C>T"	""	"VUS"	""
"0000273682"	"0"	"30"	"8"	"87755813"	"87755813"	"subst"	"0.00029649"	"01943"	"CNGB3_000028"	"g.87755813C>G"	""	""	""	"CNGB3(NM_019098.4):c.43G>C (p.G15R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86743585C>G"	""	"likely benign"	""
"0000273683"	"0"	"50"	"8"	"87683176"	"87683176"	"subst"	"1.62476E-5"	"01943"	"CNGB3_000022"	"g.87683176T>A"	""	""	""	"CNGB3(NM_019098.4):c.489A>T (p.Q163H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86670948T>A"	""	"VUS"	""
"0000273684"	"0"	"50"	"8"	"87679358"	"87679358"	"subst"	"0"	"01943"	"CNGB3_000018"	"g.87679358C>A"	""	""	""	"CNGB3(NM_019098.4):c.647G>T (p.R216L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86667130C>A"	""	"VUS"	""
"0000273685"	"0"	"10"	"8"	"87755776"	"87755776"	"subst"	"0.0185582"	"01943"	"CNGB3_000027"	"g.87755776T>C"	""	""	""	"CNGB3(NM_019098.4):c.80A>G (p.N27S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86743548T>C"	""	"benign"	""
"0000273686"	"0"	"90"	"8"	"87666257"	"87666257"	"subst"	"0"	"01943"	"CNGB3_000016"	"g.87666257T>A"	""	""	""	"CNGB3(NM_019098.4):c.886A>T (p.T296S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86654029T>A"	""	"pathogenic"	""
"0000273687"	"0"	"90"	"8"	"87666248"	"87666257"	"del"	"0"	"01943"	"CNGB3_000015"	"g.87666248_87666257del"	""	""	""	"CNGB3(NM_019098.4):c.887_896delCTTCTACAAA (p.T296Nfs*9)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86654020_86654029del"	""	"pathogenic"	""
"0000273688"	"0"	"90"	"8"	"87666247"	"87666251"	"del"	"0"	"01943"	"CNGB3_000014"	"g.87666247_87666251del"	""	""	""	"CNGB3(NM_019098.4):c.893_897delCAAAA (p.T298Ifs*12)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86654019_86654023del"	""	"pathogenic"	""
"0000332190"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"01804"	"CNGB3_000001"	"g.87656009del"	""	""	""	"CNGB3(NM_019098.4):c.1148delC (p.(Thr383Ilefs*13)), CNGB3(NM_019098.4):c.1148delC (p.T383Ifs*13), CNGB3(NM_019098.5):c.1148delC (p.T383Ifs*13)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000332191"	"0"	"90"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"01804"	"CNGB3_000013"	"g.87656917A>C"	""	""	""	"CNGB3(NM_019098.4):c.991-3T>G (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86644689A>C"	""	"pathogenic"	""
"0000336846"	"0"	"10"	"8"	"87751870"	"87751870"	"subst"	"0.0562061"	"02327"	"CNGB3_000047"	"g.87751870A>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86739642A>C"	""	"benign"	""
"0000338839"	"0"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"02327"	"CNGB3_000034"	"g.87638210C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic"	""
"0000338840"	"0"	"90"	"8"	"87641146"	"87641146"	"subst"	"0"	"02327"	"CNGB3_000035"	"g.87641146C>T"	""	""	""	"CNGB3(NM_019098.4):c.1480+1G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86628918C>T"	""	"pathogenic"	""
"0000338841"	"0"	"90"	"8"	"87656916"	"87656916"	"subst"	"0"	"02327"	"CNGB3_000039"	"g.87656916T>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86644688T>G"	""	"pathogenic"	""
"0000338842"	"0"	"10"	"8"	"87755891"	"87755891"	"subst"	"0.0580135"	"02327"	"CNGB3_000049"	"g.87755891A>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86743663A>C"	""	"benign"	""
"0000340503"	"0"	"10"	"8"	"87588248"	"87588248"	"subst"	"0.0874398"	"02327"	"CNGB3_000030"	"g.87588248T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86576020T>C"	""	"benign"	""
"0000341599"	"0"	"30"	"8"	"87588042"	"87588042"	"subst"	"0.0035786"	"02327"	"CNGB3_000003"	"g.87588042G>C"	""	""	""	"CNGB3(NM_019098.4):c.2420C>G (p.A807G), CNGB3(NM_019098.5):c.2420C>G (p.A807G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86575814G>C"	""	"likely benign"	""
"0000342204"	"0"	"10"	"8"	"87680282"	"87680282"	"subst"	"0.0144075"	"02327"	"CNGB3_000045"	"g.87680282C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86668054C>T"	""	"benign"	""
"0000342503"	"0"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"02327"	"CNGB3_000044"	"g.87679181_87679188del"	""	""	""	"CNGB3(NM_019098.5):c.819_826delCAGACTCC (p.R274Vfs*13)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic"	""
"0000343686"	"0"	"10"	"8"	"87755776"	"87755776"	"subst"	"0.0185582"	"02327"	"CNGB3_000027"	"g.87755776T>C"	""	""	""	"CNGB3(NM_019098.4):c.80A>G (p.N27S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86743548T>C"	""	"benign"	""
"0000344324"	"0"	"10"	"8"	"87679303"	"87679303"	"subst"	"0.892062"	"02327"	"CNGB3_000017"	"g.87679303A>C"	""	""	""	"CNGB3(NM_019098.5):c.702T>G (p.C234W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86667075A>C"	""	"benign"	""
"0000344480"	"0"	"90"	"8"	"87738796"	"87738796"	"subst"	"0"	"02327"	"CNGB3_000046"	"g.87738796G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86726568G>A"	""	"pathogenic"	""
"0000344848"	"0"	"10"	"8"	"87641271"	"87641271"	"subst"	"0.0135323"	"02327"	"CNGB3_000010"	"g.87641271C>T"	""	""	""	"CNGB3(NM_019098.4):c.1356G>A (p.Q452=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86629043C>T"	""	"benign"	""
"0000345539"	"0"	"10"	"8"	"87588198"	"87588198"	"subst"	"0.0871969"	"02327"	"CNGB3_000029"	"g.87588198T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86575970T>C"	""	"benign"	""
"0000346155"	"0"	"90"	"8"	"87623836"	"87623836"	"del"	"0"	"02327"	"CNGB3_000033"	"g.87623836del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86611608del"	""	"pathogenic"	""
"0000346676"	"0"	"10"	"8"	"87660100"	"87660100"	"subst"	"0.0695281"	"02327"	"CNGB3_000040"	"g.87660100T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86647872T>C"	""	"benign"	""
"0000349010"	"0"	"90"	"8"	"87644996"	"87644996"	"subst"	"0"	"02327"	"CNGB3_000036"	"g.87644996G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86632768G>A"	""	"pathogenic"	""
"0000349425"	"0"	"10"	"8"	"87666251"	"87666251"	"subst"	"0.660821"	"02327"	"CNGB3_000043"	"g.87666251T>G"	""	""	""	"CNGB3(NM_019098.4):c.892A>C (p.T298P), CNGB3(NM_019098.5):c.892A>C (p.T298P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86654023T>G"	""	"benign"	""
"0000349485"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"02327"	"CNGB3_000001"	"g.87656009del"	""	""	""	"CNGB3(NM_019098.4):c.1148delC (p.(Thr383Ilefs*13)), CNGB3(NM_019098.4):c.1148delC (p.T383Ifs*13), CNGB3(NM_019098.5):c.1148delC (p.T383Ifs*13)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000350077"	"0"	"50"	"8"	"87645107"	"87645107"	"subst"	"4.8842E-5"	"02327"	"CNGB3_000038"	"g.87645107T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86632879T>C"	""	"VUS"	""
"0000350256"	"0"	"50"	"8"	"87755825"	"87755825"	"subst"	"0"	"02327"	"CNGB3_000048"	"g.87755825C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86743597C>T"	""	"VUS"	""
"0000351398"	"0"	"10"	"8"	"87616311"	"87616311"	"subst"	"0.0119397"	"02327"	"CNGB3_000032"	"g.87616311T>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86604083T>A"	""	"benign"	""
"0000351399"	"0"	"90"	"8"	"87660117"	"87660117"	"subst"	"0"	"02327"	"CNGB3_000041"	"g.87660117T>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.86647889T>G"	""	"pathogenic"	""
"0000358227"	"11"	"90"	"8"	"87588080"	"87588080"	"del"	"0"	"01243"	"CNGB3_000050"	"g.87588080del"	""	"Sharon, submitted"	""	""	"Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000358228"	"3"	"90"	"8"	"87656008"	"87656008"	"del"	"0"	"01243"	"CNGB3_000001"	"g.87656008del"	""	"Sharon, submitted"	""	"1148delC"	"Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000358229"	"0"	"90"	"8"	"87656008"	"87656008"	"del"	"0"	"01243"	"CNGB3_000001"	"g.87656008del"	""	"Sharon, submitted"	""	"1148delC"	"Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000358230"	"3"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"01243"	"CNGB3_000051"	"g.87656899C>A"	""	"Sharon, submitted"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	""	"pathogenic"	""
"0000358231"	"3"	"70"	"8"	"87679223"	"87679223"	"subst"	"0"	"01243"	"CNGB3_000053"	"g.87679223A>G"	""	"Sharon, submitted"	""	""	"Variant Error [EREF/ESYNTAX]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000358232"	"3"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"01243"	"CNGB3_000054"	"g.87679362C>G"	""	"Sharon, submitted"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667134C>G"	""	"pathogenic"	""
"0000358233"	"0"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"01243"	"CNGB3_000054"	"g.87679362C>G"	""	"Sharon, submitted"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667134C>G"	""	"pathogenic"	""
"0000358431"	"21"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"01243"	"CNGB3_000051"	"g.87656899C>A"	""	"Sharon, submitted"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	""	"pathogenic"	""
"0000358432"	"0"	"90"	"8"	"87679178"	"87679178"	"del"	"0"	"01243"	"CNGB3_000052"	"g.87679178del"	""	"Sharon, submitted"	""	""	"Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000358433"	"0"	"70"	"8"	"87683198"	"87683198"	"subst"	"6.09201E-5"	"01243"	"CNGB3_000055"	"g.87683198G>A"	""	"Sharon, submitted"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86670970G>A"	""	"likely pathogenic"	""
"0000392083"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00244"	"CNGB3_000001"	"g.87656009del"	""	""	""	"1148dekC"	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000394431"	"3"	"90"	"8"	"87644996"	"87644996"	"subst"	"0"	"00006"	"CNGB3_000036"	"g.87644996G>A"	""	"{PMID:Sundin 2000:10888875}, {OMIM605080:0001}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86632768G>A"	""	"pathogenic (recessive)"	""
"0000394432"	"21"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundin 2000:10888875}, {OMIM605080:0002}"	""	"1148delC"	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000394433"	"11"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Sundin 2000:10888875}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000394455"	"11"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundin 2000:10888875}"	""	"1148delC"	"no variant 2nd allele reported"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000394456"	"3"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Kohl 2000:10958649}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic (recessive)"	""
"0000394457"	"11"	"90"	"8"	"87680283"	"87680283"	"subst"	"2.8434E-5"	"00006"	"CNGB3_000077"	"g.87680283G>A"	""	"{PMID:Kohl 2000:10958649}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86668055G>A"	""	"pathogenic (recessive)"	""
"0000394458"	"21"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Kohl 2000:10958649}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000394459"	"11"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Kohl 2000:10958649}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000394460"	"3"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00006"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Kohl 2000:10958649}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	""	"pathogenic (recessive)"	""
"0000394461"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Kohl 2000:10958649}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000394462"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Kohl 2000:10958649}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000394463"	"11"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Kohl 2000:10958649}"	""	"1148delC"	"no variant 2nd allele reported"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000394464"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Kohl 2000:10958649}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000394465"	"3"	"90"	"8"	"87644996"	"87644996"	"subst"	"0"	"00006"	"CNGB3_000036"	"g.87644996G>A"	""	"{PMID:Kohl 2000:10958649}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632768G>A"	""	"pathogenic (recessive)"	""
"0000394466"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Kohl 2000:10958649}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000394467"	"21"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Kohl 2000:10958649}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000535371"	"0"	"30"	"8"	"87588042"	"87588042"	"subst"	"0.0035786"	"01943"	"CNGB3_000003"	"g.87588042G>C"	""	""	""	"CNGB3(NM_019098.4):c.2420C>G (p.A807G), CNGB3(NM_019098.5):c.2420C>G (p.A807G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86575814G>C"	""	"likely benign"	""
"0000535372"	"0"	"70"	"8"	"87588241"	"87588241"	"del"	"0"	"02330"	"CNGB3_000057"	"g.87588241del"	""	""	""	"CNGB3(NM_019098.5):c.2221delG (p.D741Ifs*88)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86576013del"	""	"likely pathogenic"	""
"0000535373"	"0"	"50"	"8"	"87591428"	"87591428"	"subst"	"3.25214E-5"	"02330"	"CNGB3_000058"	"g.87591428C>A"	""	""	""	"CNGB3(NM_019098.5):c.1834G>T (p.G612W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86579200C>A"	""	"VUS"	""
"0000535374"	"0"	"30"	"8"	"87616370"	"87616370"	"subst"	"0.000304962"	"02330"	"CNGB3_000006"	"g.87616370T>A"	""	""	""	"CNGB3(NM_019098.4):c.1732A>T (p.T578S), CNGB3(NM_019098.5):c.1732A>T (p.T578S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86604142T>A"	""	"likely benign"	""
"0000535375"	"0"	"70"	"8"	"87616430"	"87616430"	"subst"	"6.1066E-5"	"01943"	"CNGB3_000002"	"g.87616430C>A"	""	""	""	"CNGB3(NM_019098.4):c.1672G>T (p.G558C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86604202C>A"	""	"likely pathogenic"	""
"0000535376"	"0"	"30"	"8"	"87623851"	"87623851"	"subst"	"2.03381E-5"	"02330"	"CNGB3_000059"	"g.87623851C>T"	""	""	""	"CNGB3(NM_019098.5):c.1627G>A (p.V543I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86611623C>T"	""	"likely benign"	""
"0000535377"	"0"	"30"	"8"	"87641188"	"87641188"	"subst"	"0.000528773"	"02330"	"CNGB3_000060"	"g.87641188C>T"	""	""	""	"CNGB3(NM_019098.4):c.1439G>A (p.R480Q), CNGB3(NM_019098.5):c.1439G>A (p.R480Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86628960C>T"	""	"likely benign"	""
"0000535378"	"0"	"50"	"8"	"87641216"	"87641216"	"subst"	"2.03421E-5"	"01943"	"CNGB3_000061"	"g.87641216T>C"	""	""	""	"CNGB3(NM_019098.4):c.1411A>G (p.I471V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86628988T>C"	""	"VUS"	""
"0000535379"	"0"	"70"	"8"	"87641222"	"87641222"	"subst"	"0.000577673"	"01943"	"CNGB3_000062"	"g.87641222A>C"	""	""	""	"CNGB3(NM_019098.4):c.1405T>G (p.Y469D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86628994A>C"	""	"likely pathogenic"	""
"0000535380"	"0"	"50"	"8"	"87641225"	"87641225"	"subst"	"0"	"01943"	"CNGB3_000063"	"g.87641225T>G"	""	""	""	"CNGB3(NM_019098.4):c.1402A>C (p.N468H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86628997T>G"	""	"VUS"	""
"0000535383"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"02330"	"CNGB3_000001"	"g.87656009del"	""	""	""	"CNGB3(NM_019098.4):c.1148delC (p.(Thr383Ilefs*13)), CNGB3(NM_019098.4):c.1148delC (p.T383Ifs*13), CNGB3(NM_019098.5):c.1148delC (p.T383Ifs*13)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86643781del"	""	"pathogenic"	""
"0000535384"	"0"	"50"	"8"	"87656061"	"87656061"	"subst"	"8.15607E-6"	"02330"	"CNGB3_000064"	"g.87656061T>C"	""	""	""	"CNGB3(NM_019098.5):c.1096A>G (p.I366V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86643833T>C"	""	"VUS"	""
"0000535385"	"0"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"02327"	"CNGB3_000056"	"g.87656899C>A"	""	""	""	"CNGB3(NM_019098.4):c.1006G>T (p.E336*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86644671C>A"	""	"pathogenic"	""
"0000535386"	"0"	"50"	"8"	"87656899"	"87656899"	"subst"	"0"	"02330"	"CNGB3_000065"	"g.87656899C>T"	""	""	""	"CNGB3(NM_019098.5):c.1006G>A (p.E336K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86644671C>T"	""	"VUS"	""
"0000535387"	"0"	"90"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"02327"	"CNGB3_000013"	"g.87656917A>C"	""	""	""	"CNGB3(NM_019098.4):c.991-3T>G (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86644689A>C"	""	"pathogenic"	""
"0000535388"	"0"	"30"	"8"	"87660106"	"87660106"	"subst"	"0.000572307"	"01943"	"CNGB3_000066"	"g.87660106C>T"	""	""	""	"CNGB3(NM_019098.4):c.913G>A (p.A305T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86647878C>T"	""	"likely benign"	""
"0000535389"	"0"	"10"	"8"	"87666251"	"87666251"	"subst"	"0.660821"	"01943"	"CNGB3_000043"	"g.87666251T>G"	""	""	""	"CNGB3(NM_019098.4):c.892A>C (p.T298P), CNGB3(NM_019098.5):c.892A>C (p.T298P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86654023T>G"	""	"benign"	""
"0000535390"	"0"	"10"	"8"	"87666251"	"87666251"	"subst"	"0.660821"	"02325"	"CNGB3_000043"	"g.87666251T>G"	""	""	""	"CNGB3(NM_019098.4):c.892A>C (p.T298P), CNGB3(NM_019098.5):c.892A>C (p.T298P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86654023T>G"	""	"benign"	""
"0000535391"	"0"	"90"	"8"	"87666253"	"87666257"	"del"	"0"	"01943"	"CNGB3_000067"	"g.87666253_87666257del"	""	""	""	"CNGB3(NM_019098.4):c.886_890delACTTC (p.T296Yfs*14)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86654025_86654029del"	""	"pathogenic"	""
"0000535392"	"0"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"02330"	"CNGB3_000044"	"g.87679181_87679188del"	""	""	""	"CNGB3(NM_019098.5):c.819_826delCAGACTCC (p.R274Vfs*13)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86666953_86666960del"	""	"pathogenic"	""
"0000535393"	"0"	"30"	"8"	"87679267"	"87679267"	"subst"	"2.43686E-5"	"01943"	"CNGB3_000068"	"g.87679267G>A"	""	""	""	"CNGB3(NM_019098.4):c.738C>T (p.T246=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86667039G>A"	""	"likely benign"	""
"0000535396"	"0"	"50"	"8"	"87738814"	"87738814"	"subst"	"0"	"01943"	"CNGB3_000071"	"g.87738814T>G"	""	""	""	"CNGB3(NM_019098.4):c.283A>C (p.T95P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86726586T>G"	""	"VUS"	""
"0000535397"	"0"	"10"	"8"	"87738888"	"87738888"	"subst"	"0.00307462"	"02330"	"CNGB3_000072"	"g.87738888A>G"	""	""	""	"CNGB3(NM_019098.5):c.212-3T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86726660A>G"	""	"benign"	""
"0000594737"	"0"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"01807"	"CNGB3_000034"	"g.87638210C>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic"	""
"0000611716"	"0"	"50"	"8"	"87591429"	"87591429"	"subst"	"0"	"01943"	"CNGB3_000074"	"g.87591429G>T"	""	""	""	"CNGB3(NM_019098.4):c.1833C>A (p.H611Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86579201G>T"	""	"VUS"	""
"0000611717"	"0"	"90"	"8"	"87679359"	"87679359"	"subst"	"2.03616E-5"	"02327"	"CNGB3_000075"	"g.87679359G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86667131G>A"	""	"pathogenic"	""
"0000622096"	"0"	"30"	"8"	"87755779"	"87755779"	"subst"	"1.62479E-5"	"01943"	"CNGB3_000076"	"g.87755779C>T"	""	""	""	"CNGB3(NM_019098.4):c.77G>A (p.R26Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86743551C>T"	""	"likely benign"	""
"0000652526"	"1"	"50"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"03575"	"CNGB3_000037"	"g.87645092C>T"	"130/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 130 heterozygous; {DB:CLININrs147876778}"	"Germline"	""	"rs147876778"	"0"	""	""	"g.86632864C>T"	""	"VUS"	""
"0000652527"	"1"	"50"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"03575"	"CNGB3_000001"	"g.87656009del"	"3/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; {DB:CLININrs397515360}"	"Germline"	""	"rs397515360"	"0"	""	""	"g.86643781del"	""	"VUS"	""
"0000652528"	"1"	"70"	"8"	"87680283"	"87680283"	"subst"	"2.8434E-5"	"03575"	"CNGB3_000077"	"g.87680283G>A"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs267606739}"	"Germline"	""	"rs267606739"	"0"	""	""	"g.86668055G>A"	""	"likely pathogenic"	""
"0000652529"	"1"	"30"	"8"	"87751870"	"87751870"	"subst"	"0.0562061"	"03575"	"CNGB3_000047"	"g.87751870A>C"	"233/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"233 heterozygous; {DB:CLININrs66881636}"	"Germline"	""	"rs66881636"	"0"	""	""	"g.86739642A>C"	""	"likely benign"	""
"0000652530"	"1"	"50"	"8"	"87755776"	"87755776"	"subst"	"0.0185582"	"03575"	"CNGB3_000027"	"g.87755776T>C"	"58/2792 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 58 heterozygous; {DB:CLININrs35807406}"	"Germline"	""	"rs35807406"	"0"	""	""	"g.86743548T>C"	""	"VUS"	""
"0000653428"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"01164"	"CNGB3_000001"	"g.87656009del"	""	""	""	""	"ACMG: PVS1,PM3,PP1; compound heterozygous with CNGB3: c.819_826del p(.Arg274Valfs*13) on other allele; Sundin et al. 2000. Nat Genet 25: 289; Kohl et al. 2005. Eur J Hum Genet 13: 302-8; Wiszniewski et al. 2007. Hum Genet 121: 433-9; Jespersgaard et al. 2019. Sci Rep 9: 1219; Liu et al. 2013. Mol 19: 1268"	"Germline"	""	"rs397515360"	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000656157"	"0"	"90"	"8"	"87641146"	"87641146"	"subst"	"0"	"01943"	"CNGB3_000035"	"g.87641146C>T"	""	""	""	"CNGB3(NM_019098.4):c.1480+1G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.86628918C>T"	""	"pathogenic"	""
"0000670021"	"3"	"50"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"03575"	"CNGB3_000037"	"g.87645092C>T"	"4/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 4 homozygous; {DB:CLININrs147876778}"	"Germline"	""	"rs147876778"	"0"	""	""	"g.86632864C>T"	""	"VUS"	""
"0000670022"	"3"	"30"	"8"	"87751870"	"87751870"	"subst"	"0.0562061"	"03575"	"CNGB3_000047"	"g.87751870A>C"	"11/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"11 homozygous; {DB:CLININrs66881636}"	"Germline"	""	"rs66881636"	"0"	""	""	"g.86739642A>C"	""	"likely benign"	""
"0000670023"	"3"	"50"	"8"	"87755776"	"87755776"	"subst"	"0.0185582"	"03575"	"CNGB3_000027"	"g.87755776T>C"	"1/2792 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 1 homozygous; {DB:CLININrs35807406}"	"Germline"	""	"rs35807406"	"0"	""	""	"g.86743548T>C"	""	"VUS"	""
"0000678445"	"0"	"30"	"8"	"87588303"	"87588303"	"subst"	"0.000408366"	"01943"	"CNGB3_000078"	"g.87588303T>C"	""	""	""	"CNGB3(NM_019098.4):c.2159A>G (p.Q720R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000678446"	"0"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"01943"	"CNGB3_000051"	"g.87656899C>A"	""	""	""	"CNGB3(NM_019098.4):c.1006G>T (p.E336*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000678447"	"0"	"30"	"8"	"87679192"	"87679192"	"subst"	"0"	"01943"	"CNGB3_000079"	"g.87679192G>T"	""	""	""	"CNGB3(NM_019098.4):c.813C>A (p.I271=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000684517"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00004"	"CNGB3_000001"	"g.87656009del"	"1/899 cases"	"{PMID:Holtan 2020:31429209}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000684518"	"1"	"70"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00004"	"CNGB3_000034"	"g.87638210C>T"	"1/899 cases"	"{PMID:Holtan 2020:31429209}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	""	"likely pathogenic"	""
"0000685150"	"0"	"90"	"8"	"87588134"	"87588134"	"del"	"0"	"00004"	"CNGB3_000050"	"g.87588134del"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000685151"	"0"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00004"	"CNGB3_000037"	"g.87645092C>T"	"2/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000685152"	"0"	"90"	"8"	"87645093"	"87645093"	"subst"	"1.62725E-5"	"00004"	"CNGB3_000080"	"g.87645093G>A"	"2/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000685153"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00004"	"CNGB3_000001"	"g.87656009del"	"5/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000685154"	"0"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00004"	"CNGB3_000051"	"g.87656899C>A"	"2/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000685155"	"0"	"90"	"8"	"87679186"	"87679186"	"del"	"0"	"00004"	"CNGB3_000052"	"g.87679186del"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	"c.819del"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000685156"	"0"	"70"	"8"	"87679223"	"87679223"	"subst"	"8.12288E-6"	"00004"	"CNGB3_000081"	"g.87679223T>C"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000685157"	"0"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"00004"	"CNGB3_000054"	"g.87679362C>G"	"2/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000685158"	"0"	"70"	"8"	"87683198"	"87683198"	"subst"	"6.09201E-5"	"00004"	"CNGB3_000055"	"g.87683198G>A"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000685159"	"0"	"90"	"8"	"87755742"	"87755751"	"del"	"0"	"00004"	"CNGB3_000082"	"g.87755742_87755751del"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	"c.105_114delTCAGTCTCAG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000690324"	"0"	"30"	"8"	"87588079"	"87588079"	"subst"	"3.67146E-5"	"01943"	"CNGB3_000083"	"g.87588079C>T"	""	""	""	"CNGB3(NM_019098.4):c.2383G>A (p.G795R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000703781"	"2"	"90"	"8"	"87641167"	"87641167"	"subst"	"0"	"00008"	"CNGB3_000084"	"g.87641167C>T"	""	"{PMID:Eksandh 2002:12187429}"	""	"1148delC (T383X)"	""	"Germline"	"?"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000703782"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Eksandh 2002:12187429}"	""	"1148delC"	""	"Germline"	"?"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000703783"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Eksandh 2002:12187429}"	""	"1148delC"	""	"Germline"	"?"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000703784"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Eksandh 2002:12187429}"	""	"1148delC"	""	"Germline"	"?"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000703785"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Eksandh 2002:12187429}"	""	"1148delC"	""	"Germline"	"?"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000703786"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Eksandh 2002:12187429}"	""	"1148delC"	""	"Germline"	"?"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000703787"	"1"	"90"	"8"	"87679179"	"87679186"	"del"	"5.28172E-5"	"00008"	"CNGB3_000044"	"g.87679179_87679186del"	""	"{PMID:Eksandh 2002:12187429}"	""	"819-826del8"	""	"Germline"	"?"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000703788"	"2"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00008"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Eksandh 2002:12187429}"	""	"1578+1G>A"	""	"Germline"	"?"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704032"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00008"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Johnson 2004:14757870}"	""	"1148delC/595delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704033"	"2"	"90"	"8"	"87680295"	"87680295"	"del"	"0"	"00008"	"CNGB3_000087"	"g.87680295del"	""	"{PMID:Johnson 2004:14757870}"	""	"1148delC/595delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704034"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00008"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Johnson 2004:14757870}"	""	"1148delC/595delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704035"	"2"	"90"	"8"	"87680295"	"87680295"	"del"	"0"	"00008"	"CNGB3_000087"	"g.87680295del"	""	"{PMID:Johnson 2004:14757870}"	""	"1148delC/595delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704036"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00008"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Johnson 2004:14757870}"	""	"1148delC/1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704040"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00008"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Johnson 2004:14757870}"	""	"1148delC/?"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704047"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00008"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Johnson 2004:14757870}"	""	"1148delC/1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704048"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00008"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Johnson 2004:14757870}"	""	"1148delC/1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704050"	"3"	"90"	"8"	"87638215"	"87638216"	"inv"	"0"	"00008"	"CNGB3_000086"	"g.87638215_87638216inv"	""	"{PMID:Johnson 2004:14757870}"	""	"Phe525Asn/Phe525Asn"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704051"	"3"	"90"	"8"	"87638215"	"87638216"	"inv"	"0"	"00008"	"CNGB3_000086"	"g.87638215_87638216inv"	""	"{PMID:Johnson 2004:14757870}"	""	"Phe525Asn/Phe525Asn"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704052"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00008"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Johnson 2004:14757870}"	""	"1148delC/1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704054"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00008"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Johnson 2004:14757870}"	""	"1148delC/1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704055"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00008"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Johnson 2004:14757870}"	""	"1148delC/1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000704057"	"1"	"30"	"8"	"87660100"	"87660100"	"subst"	"0.0695281"	"00008"	"CNGB3_000040"	"g.87660100T>C"	""	"{PMID:Johnson 2004:14757870}"	""	"Ile307Val/?*"	""	"Germline"	""	""	"0"	""	""	""	""	"likely benign"	""
"0000708432"	"2"	"70"	"8"	"87641222"	"87641222"	"subst"	"0.000577673"	"00008"	"CNGB3_000062"	"g.87641222A>C"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.Y469D"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708434"	"2"	"70"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.T383fsb"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708439"	"2"	"70"	"8"	"87623843"	"87623843"	"subst"	"0"	"00008"	"CNGB3_000089"	"g.87623843A>T"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.Y545X"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708442"	"2"	"70"	"8"	"87591479"	"87591479"	"subst"	"0"	"00008"	"CNGB3_000088"	"g.87591479G>A"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.L595F"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708445"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.T383fsb"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708448"	"1"	"70"	"8"	"87679179"	"87679186"	"del"	"5.28172E-5"	"00008"	"CNGB3_000044"	"g.87679179_87679186del"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.P273fs"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708452"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.T383fsb"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708453"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.T383fsb"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708455"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.T383fsb"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708456"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.T383fsb"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708459"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.T383fsb"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708460"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.T383fsb"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708461"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.T383fsb"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708463"	"3"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00008"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.R403Q"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708465"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.T383fsb"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708466"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.T383fsb"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708468"	"1"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00008"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.R403Q"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708469"	"3"	"70"	"8"	"87683274"	"87683274"	"subst"	"4.06154E-6"	"00008"	"CNGB3_000090"	"g.87683274G>A"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.Q131X"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708470"	"1"	"70"	"8"	"87616430"	"87616430"	"subst"	"6.1066E-5"	"00008"	"CNGB3_000002"	"g.87616430C>A"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.G558C"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708471"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.T383fsb"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000708472"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0"	"00008"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Nishiguchi 2005:15712225}"	""	"p.T383fsb"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000710355"	"1"	"50"	"8"	"87683268"	"87683268"	"subst"	"4.06124E-6"	"00006"	"CNGB3_000091"	"g.87683268G>A"	"1/143 cases"	"{PMID:Zenteno 2020:31736247}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86671040G>A"	""	"VUS"	""
"0000713273"	"3"	"90"	"8"	"87591452"	"87591452"	"subst"	"8.13544E-6"	"00000"	"CNGB3_000093"	"g.87591452G>A"	""	"{PMID:Carss 2017:28041643}"	""	"8:87591452G>A ENST00000320005.5:c.1810C>T (Arg604Ter)"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000713305"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Carss 2017:28041643}"	""	"8:87656008AG>A ENST00000320005.5:c.1148delC (Thr383IlefsTer13)"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000713361"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Carss 2017:28041643}"	""	"8:87656008AG>A ENST00000320005.5:c.1148delC (Thr383IlefsTer13)"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000713473"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Carss 2017:28041643}"	""	"8:87656008AG>A ENST00000320005.5:c.1148delC (Thr383IlefsTer13)"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000713544"	"3"	"90"	"8"	"87590916"	"87590916"	"subst"	"0"	"00000"	"CNGB3_000092"	"g.87590916C>T"	""	"{PMID:Carss 2017:28041643}"	""	"8:87590916C>T ENST00000320005.5:c.2103+1G>A"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000713649"	"0"	"90"	"8"	"87645015"	"87645015"	"del"	"4.07637E-6"	"00000"	"CNGB3_000095"	"g.87645015del"	""	"{PMID:Carss 2017:28041643}"	""	"8:87645014GA>G ENST00000320005.5:c.1285delT (Ser429LeufsTer9)"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000713676"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Carss 2017:28041643}"	""	"8:87656008AG>A ENST00000320005.5:c.1148delC (Thr383IlefsTer13)"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000713890"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Carss 2017:28041643}"	""	"8:87656008AG>A ENST00000320005.5:c.1148delC (Thr383IlefsTer13)"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000713905"	"0"	"90"	"8"	"87679179"	"87679186"	"del"	"5.28172E-5"	"00000"	"CNGB3_000044"	"g.87679179_87679186del"	""	"{PMID:Carss 2017:28041643}"	""	"8:87679178TGGAGTCTG>T ENST00000320005.5:c.819_826delCAGACTCC (Arg274ValfsTer13)"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000714023"	"2"	"70"	"8"	"87666242"	"87666242"	"subst"	"0"	"00000"	"CNGB3_000097"	"g.87666242G>A"	""	"{PMID:Taylor 2017:28341476}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86654014G>A"	""	"likely pathogenic (recessive)"	""
"0000714024"	"3"	"70"	"8"	"87660117"	"87660117"	"subst"	"0"	"00000"	"CNGB3_000096"	"g.87660117T>A"	""	"{PMID:Taylor 2017:28341476}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86647889T>A"	""	"likely pathogenic (recessive)"	""
"0000714025"	"2"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Taylor 2017:28341476}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic (recessive)"	""
"0000714026"	"2"	"70"	"8"	"87751904"	"87751904"	"del"	"0"	"00000"	"CNGB3_000098"	"g.87751904del"	""	"{PMID:Taylor 2017:28341476}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86739676del"	""	"likely pathogenic (recessive)"	""
"0000714091"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Taylor 2017:28341476}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic (recessive)"	""
"0000714092"	"1"	"70"	"8"	"87641201"	"87641201"	"subst"	"0"	"00000"	"CNGB3_000094"	"g.87641201G>A"	""	"{PMID:Taylor 2017:28341476}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628973G>A"	""	"likely pathogenic (recessive)"	""
"0000714093"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Taylor 2017:28341476}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic (recessive)"	""
"0000722094"	"0"	"30"	"8"	"87591429"	"87591429"	"subst"	"9.35081E-5"	"01943"	"CNGB3_000099"	"g.87591429G>A"	""	""	""	"CNGB3(NM_019098.4):c.1833C>T (p.H611=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000722095"	"0"	"50"	"8"	"87656853"	"87656853"	"subst"	"1.23006E-5"	"01943"	"CNGB3_000101"	"g.87656853T>C"	""	""	""	"CNGB3(NM_019098.4):c.1052A>G (p.Y351C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000722096"	"0"	"50"	"8"	"87679245"	"87679245"	"subst"	"1.21841E-5"	"01943"	"CNGB3_000102"	"g.87679245G>A"	""	""	""	"CNGB3(NM_019098.4):c.760C>T (p.L254F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000722097"	"0"	"90"	"8"	"87680277"	"87680277"	"del"	"0"	"02329"	"CNGB3_000069"	"g.87680277del"	""	""	""	"CNGB3(NM_019098.5):c.615delA (p.K205Nfs*6)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000722098"	"0"	"30"	"8"	"87738876"	"87738876"	"subst"	"4.06524E-6"	"01943"	"CNGB3_000104"	"g.87738876G>A"	""	""	""	"CNGB3(NM_019098.4):c.221C>T (p.S74F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000729793"	"3"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Wawrocka 2018:29769798}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000729796"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Wawrocka 2018:29769798}"	""	""	"no variant 2nd chromosome identified"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic (recessive)"	""
"0000730319"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Matet 2018:29618791}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000730320"	"3"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00000"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Matet 2018:29618791}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	""	"pathogenic (recessive)"	""
"0000730321"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Matet 2018:29618791}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000730322"	"3"	"90"	"8"	"87751965"	"87751965"	"subst"	"0"	"00000"	"CNGB3_000105"	"g.87751965C>A"	""	"{PMID:Mayer 2017:28795510}, {PMID:Matet 2018:29618791}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86739737C>A"	"SCV000575840"	"pathogenic (recessive)"	"ACMG"
"0000730323"	"11"	"90"	"8"	"87755725"	"87755725"	"subst"	"0"	"00000"	"CNGB3_000106"	"g.87755725A>G"	""	"{PMID:Mayer 2017:28795510}, {PMID:Matet 2018:29618791}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86743497A>G"	"SCV000575839"	"pathogenic (recessive)"	"ACMG"
"0000730324"	"11"	"90"	"8"	"87755725"	"87755725"	"subst"	"0"	"00000"	"CNGB3_000106"	"g.87755725A>G"	""	"{PMID:Mayer 2017:28795510}, {PMID:Matet 2018:29618791}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86743497A>G"	"SCV000575839"	"pathogenic (recessive)"	"ACMG"
"0000730325"	"1"	"90"	"8"	"87755853"	"87755853"	"subst"	"0"	"00000"	"CNGB3_000107"	"g.87755853C>T"	""	"{PMID:Mayer 2017:28795510}, {PMID:Matet 2018:29618791}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86743625C>T"	"SCV000575804"	"pathogenic (recessive)"	"ACMG"
"0000730330"	"2"	"90"	"8"	"87645057"	"87645057"	"subst"	"0"	"00000"	"CNGB3_000100"	"g.87645057G>A"	""	"{PMID:Matet 2018:29618791}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632829G>A"	""	"pathogenic (recessive)"	""
"0000730331"	"21"	"90"	"8"	"87735908"	"87741415"	"del"	"0"	"00000"	"CNGB3_000103"	"g.87735908_87741415del"	""	"{PMID:Mayer 2017:28795510}, {PMID:Matet 2018:29618791}"	""	"del ex3 (g.86723677_86729184del)"	""	"Germline"	"yes"	""	"0"	""	""	"g.86723680_86729187del"	"SCV000575862"	"pathogenic (recessive)"	"ACMG"
"0000730332"	"21"	"90"	"8"	"87735908"	"87741415"	"del"	"0"	"00000"	"CNGB3_000103"	"g.87735908_87741415del"	""	"{PMID:Mayer 2017:28795510}, {PMID:Matet 2018:29618791}"	""	"del ex3 (g.86723677_86729184del)"	""	"Germline"	"yes"	""	"0"	""	""	"g.86723680_86729187del"	"SCV000575862"	"pathogenic (recessive)"	"ACMG"
"0000730333"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}, {PMID:Matet 2018:29618791}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0000730986"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Bryant 2018:29343940}"	""	""	""	"Germline"	""	"rs397515360"	"0"	""	""	"g.86643781del"	""	"likely pathogenic (recessive)"	""
"0000731022"	"1"	"50"	"8"	"87588302"	"87588323"	"del"	"0"	"00000"	"CNGB3_000108"	"g.87588302_87588323del"	""	"{PMID:Bryant 2018:29343940}"	""	"2139_2160del"	""	"Germline"	""	""	"0"	""	""	"g.86576074_86576095del"	""	"VUS"	""
"0000731037"	"2"	"70"	"8"	"87644994"	"87644994"	"subst"	"4.06924E-6"	"00000"	"CNGB3_000110"	"g.87644994T>G"	""	"{PMID:Bryant 2018:29343940}"	""	""	""	"Germline"	""	"rs748354081"	"0"	""	""	"g.86632766T>G"	""	"likely pathogenic (recessive)"	""
"0000731152"	"1"	"90"	"8"	"87680283"	"87680283"	"subst"	"2.8434E-5"	"00000"	"CNGB3_000077"	"g.87680283G>A"	""	"{PMID:Porto 2017:29186038}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000731162"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Porto 2017:29186038}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000731174"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Porto 2017:29186038}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000731330"	"3"	"70"	"8"	"87591332"	"87591332"	"subst"	"0"	"00000"	"CNGB3_000109"	"g.87591332A>G"	""	"{PMID:Rim 2017:29145603}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86579104A>G"	""	"likely pathogenic"	""
"0000731424"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:DiIorio 2017:29053603}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic (recessive)"	""
"0000731425"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:DiIorio 2017:29053603}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic (recessive)"	""
"0000731426"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:DiIorio 2017:29053603}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic (recessive)"	""
"0000731448"	"2"	"70"	"8"	"87660049"	"87660049"	"subst"	"0"	"00000"	"CNGB3_000111"	"g.87660049T>C"	""	"{PMID:DiIorio 2017:29053603}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86647821T>C"	""	"likely pathogenic (recessive)"	""
"0000731449"	"2"	"70"	"8"	"87660049"	"87660049"	"subst"	"0"	"00000"	"CNGB3_000111"	"g.87660049T>C"	""	"{PMID:DiIorio 2017:29053603}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86647821T>C"	""	"likely pathogenic (recessive)"	""
"0000731450"	"2"	"70"	"8"	"87645022"	"87645022"	"del"	"0"	"00000"	"CNGB3_000095"	"g.87645022del"	""	"{PMID:DiIorio 2017:29053603}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632794del"	""	"likely pathogenic (recessive)"	""
"0000732393"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sheremet 2017:28980559}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000732422"	"2"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Sheremet 2017:28980559}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic"	""
"0000732587"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Wang 2017:28838317}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000732868"	"0"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Stone 2017:28559085}"	""	"1148delC"	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000733220"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Stone 2017:28559085}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000733221"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Stone 2017:28559085}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000733222"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Stone 2017:28559085}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000733223"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Stone 2017:28559085}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000733644"	"2"	"70"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Stone 2017:28559085}"	""	"IVS13+1G>A"	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	""	"likely pathogenic"	""
"0000734253"	"0"	"50"	"8"	"87638261"	"87638261"	"subst"	"0"	"03971"	"CNGB3_000112"	"g.87638261G>A"	""	"Mena et al., 2020 submitted"	""	""	""	"Germline"	"?"	""	""	""	""	""	""	"VUS"	"ACMG"
"0000734408"	"3"	"90"	"8"	"87680283"	"87680283"	"subst"	"2.8434E-5"	"00000"	"CNGB3_000077"	"g.87680283G>A"	""	"{PMID:Habibi 2016:27874104}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86668055G>A"	""	"pathogenic (recessive)"	""
"0000735176"	"3"	"50"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Li 2017:28418496}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"VUS"	""
"0000735610"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Haer-Wigman 2017:28224992}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000735611"	"0"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Haer-Wigman 2017:28224992}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic"	""
"0000735732"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Haer-Wigman 2017:28224992}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000735733"	"0"	"90"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"00000"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Haer-Wigman 2017:28224992}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644689A>C"	""	"pathogenic"	""
"0000735736"	"0"	"50"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Haer-Wigman 2017:28224992}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"VUS"	""
"0000735738"	"0"	"50"	"8"	"87616430"	"87616430"	"subst"	"6.1066E-5"	"00000"	"CNGB3_000002"	"g.87616430C>A"	""	"{PMID:Haer-Wigman 2017:28224992}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86604202C>A"	""	"VUS"	""
"0000735831"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Riera 2017:28181551}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000735989"	"1"	"70"	"8"	"87623851"	"87623851"	"subst"	"2.03381E-5"	"02485"	"CNGB3_000059"	"g.87623851C>T"	""	"{PMID:Bravo-Gil 2017:28157192}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86611623C>T"	""	"likely pathogenic"	""
"0000736204"	"1"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Bernardis 2016:28127548}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic"	""
"0000736257"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Bernardis 2016:28127548}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000736829"	"0"	"50"	"8"	"87588303"	"87588323"	"del"	"0"	"00000"	"CNGB3_000031"	"g.87588303_87588323del"	"1/486 individuals"	"{PMID:Sergouniotis 2016:27628848}"	""	""	"no genotypes reported"	"Germline"	""	"rs746549330"	"0"	""	""	"g.86576075_86576095del"	""	"VUS"	""
"0000760049"	"0"	"50"	"8"	"87588042"	"87588042"	"subst"	"0.0035786"	"00000"	"CNGB3_000003"	"g.87588042G>C"	""	"{PMID:Tiwari 2016:27353947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86575814G>C"	""	"VUS"	""
"0000760134"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Ellingford 2016:27208204}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000760141"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Ellingford 2016:27208204}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000760144"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Ellingford 2016:27208204}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000760147"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Ellingford 2016:27208204}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000760148"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Ellingford 2016:27208204}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000760149"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Ellingford 2016:27208204}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000760150"	"0"	"70"	"8"	"87616320"	"87616320"	"subst"	"4.06709E-6"	"00000"	"CNGB3_000113"	"g.87616320C>G"	""	"{PMID:Ellingford 2016:27208204}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86604092C>G"	""	"likely pathogenic"	""
"0000760420"	"0"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Ellingford 2016:27208204}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000760961"	"0"	"70"	"8"	"87645123"	"87645123"	"subst"	"0"	"01807"	"CNGB3_000114"	"g.87645123T>A"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000763947"	"3"	"70"	"8"	"87616328"	"87616328"	"dup"	"0"	"00006"	"CNGB3_000115"	"g.87616328dup"	""	"{PMID:Huang 2013:23776498}, {PMID:Huang 2016:26992781}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86604100dup"	""	"likely pathogenic (recessive)"	""
"0000763948"	"1"	"70"	"8"	"87679325"	"87679325"	"subst"	"4.0625E-5"	"00006"	"CNGB3_000117"	"g.87679325A>G"	""	"{PMID:Huang 2016:26992781}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667097A>G"	""	"likely pathogenic (recessive)"	""
"0000763949"	"3"	"70"	"8"	"87755726"	"87755726"	"subst"	"8.12526E-6"	"00006"	"CNGB3_000118"	"g.87755726C>T"	""	"{PMID:Huang 2013:23776498}, {PMID:Huang 2016:26992781}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86743498C>T"	""	"likely pathogenic (recessive)"	""
"0000764016"	"2"	"70"	"8"	"87645029"	"87645029"	"subst"	"0"	"00006"	"CNGB3_000116"	"g.87645029A>C"	""	"{PMID:Huang 2016:26992781}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632801A>C"	""	"likely pathogenic (recessive)"	""
"0000764910"	"3"	"70"	"8"	"87641196"	"87641197"	"delins"	"0"	"00000"	"CNGB3_000119"	"g.87641196_87641197delinsG"	""	"{PMID:Weisschuh 2016:26766544}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628968_86628969delinsG"	""	"likely pathogenic (recessive)"	""
"0000785368"	"3"	"90"	"8"	"87679359"	"87679359"	"subst"	"2.03616E-5"	"00006"	"CNGB3_000075"	"g.87679359G>A"	""	"{PMID:Saqib 2015:25943428}, {DOI:Saqib 2015:10.1038/srep09965}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000786399"	"1"	"90"	"8"	"87641230"	"87641230"	"subst"	"0"	"00000"	"CNGB3_000120"	"g.87641230A>T"	""	"{PMID:Consugar 2015:25412400}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86629002A>T"	""	"pathogenic (recessive)"	""
"0000786400"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Consugar 2015:25412400}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000786472"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Consugar 2015:25412400}"	""	"1148delC"	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000787766"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Dubis 2015:25277229}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000787767"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Dubis 2015:25277229}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000787768"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Dubis 2015:25277229}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000787769"	"1"	"90"	"8"	"87680295"	"87680295"	"del"	"0"	"00000"	"CNGB3_000087"	"g.87680295del"	""	"{PMID:Dubis 2015:25277229}"	""	"595delG"	""	"Germline"	""	""	"0"	""	""	"g.86668067del"	""	"pathogenic (recessive)"	""
"0000787770"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Dubis 2015:25277229}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000787774"	"2"	"90"	"8"	"87680282"	"87680283"	"ins"	"0"	"00000"	"CNGB3_000121"	"g.87680282_87680283insA"	""	"{PMID:Dubis 2015:25277229}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86668054_86668055insA"	""	"pathogenic (recessive)"	""
"0000788180"	"3"	"90"	"8"	"87641195"	"87641195"	"subst"	"2.03383E-5"	"00000"	"CNGB3_000122"	"g.87641195G>A"	""	"{PMID:Greenberg 2014:24504161}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628967G>A"	""	"pathogenic"	""
"0000788182"	"1"	"50"	"8"	"87656104"	"87656104"	"subst"	"0"	"00000"	"CNGB3_000123"	"g.87656104G>C"	""	"{PMID:Greenberg 2014:24504161}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86643876G>C"	""	"VUS"	""
"0000788183"	"3"	"90"	"8"	"87641195"	"87641195"	"subst"	"2.03383E-5"	"00000"	"CNGB3_000122"	"g.87641195G>A"	""	"{PMID:Greenberg 2014:24504161}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628967G>A"	""	"pathogenic"	""
"0000788188"	"1"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00000"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Greenberg 2014:24504161}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	""	"pathogenic"	""
"0000788189"	"1"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Greenberg 2014:24504161}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0000788197"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Greenberg 2014:24504161}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000788334"	"0"	"50"	"8"	"87679304"	"87679304"	"subst"	"0"	"00000"	"CNGB3_000124"	"g.87679304C>A"	""	"{PMID:Katagiri 2014:25268133}"	""	"G701T"	""	"Germline"	""	""	"0"	""	""	"g.86667076C>A"	""	"VUS"	""
"0000789857"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Avela 2019:31087526}"	""	"c.1148delC"	"Check also: Sundin 2000"	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000789858"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Avela 2019:31087526}"	""	"c.1148delC"	"Check also: Sundin 2000"	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790897"	"0"	"70"	"8"	"87666247"	"87666257"	"delins"	"0"	"00000"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Thiadens_2010:20079539}"	""	"c.886_896del11insT (p.R296YfsX9)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790898"	"0"	"70"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"00000"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Thiadens_2010:20079539}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790899"	"0"	"70"	"8"	"87679179"	"87679186"	"del"	"5.28172E-5"	"00000"	"CNGB3_000044"	"g.87679179_87679186del"	""	"{PMID:Thiadens_2010:20079539}"	""	"c.819_826del8 (p.R274VfsX12)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790900"	"0"	"70"	"8"	"87666247"	"87666257"	"delins"	"0"	"00000"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Thiadens_2010:20079539}"	""	"c.886_896del11insT (p.R296YfsX9)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790901"	"3"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Thiadens_2010:20079539}"	""	"c.1208G>A (p.R403Q)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790904"	"0"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Thiadens_2010:20079539}"	""	"c.1148delC (p.T383IfsX13)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790905"	"0"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Thiadens_2010:20079539}"	""	"c.1208G>A (p.R403Q)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790910"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Thiadens_2009:19592100}"	""	"c.1148delC (p.T383IfsX13)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790911"	"0"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Thiadens_2009:19592100}"	""	"c.1148delC (p.T383IfsX13)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790912"	"0"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Thiadens_2009:19592100}"	""	"c.1148delC (p.T383IfsX13)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790913"	"0"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Thiadens_2009:19592100}"	""	"c.1148delC (p.T383IfsX13)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790914"	"3"	"70"	"8"	"87623835"	"87623835"	"del"	"0"	"00000"	"CNGB3_000033"	"g.87623835del"	""	"{PMID:Thiadens_2009:19592100}"	""	"c.1642delG (p.G548VfsX35)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790915"	"3"	"70"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"00000"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790916"	"0"	"70"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"00000"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790917"	"0"	"70"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"00000"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790921"	"0"	"70"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"00000"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Thiadens_2009:19592100}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790922"	"0"	"70"	"8"	"87666247"	"87666257"	"delins"	"0"	"00000"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Thiadens_2009:19592100}"	""	"c.886_896del11insT (p.R296YfsX9)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790923"	"0"	"70"	"8"	"87679179"	"87679186"	"del"	"5.28172E-5"	"00000"	"CNGB3_000044"	"g.87679179_87679186del"	""	"{PMID:Thiadens_2009:19592100}"	""	"c.819_826del8 (p.R274VfsX12)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790924"	"0"	"70"	"8"	"87666247"	"87666257"	"delins"	"0"	"00000"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Thiadens_2009:19592100}"	""	"c.886_896del11insT (p.R296YfsX9)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000790925"	"0"	"70"	"8"	"87679179"	"87679186"	"del"	"5.28172E-5"	"00000"	"CNGB3_000044"	"g.87679179_87679186del"	""	"{PMID:Thiadens_2009:19592100}"	""	"c.819_826del8 (p.R274VfsX12)"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000791140"	"0"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	"0 (in-house database, ~5000 samples)"	"Tracewska 2021, MolVis in press"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic"	"ACMG"
"0000791159"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	"0,00136 (in-house database, ~5000 samples)"	"Tracewska 2021, MolVis in press"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000791183"	"10"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	"0 (in-house database, ~5000 samples)"	"Tracewska 2021, MolVis in press"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic"	"ACMG"
"0000791203"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	"0,00136 (in-house database, ~5000 samples)"	"Tracewska 2021, MolVis in press"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000791252"	"21"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	"0 (in-house database, ~5000 samples)"	"Tracewska 2021, MolVis in press"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic"	"ACMG"
"0000791894"	"3"	"90"	"8"	"87591437"	"87591437"	"del"	"0"	"00000"	"CNGB3_000125"	"g.87591437delC"	""	"{PMID:Azam 2010:20454696}"	""	"c.1825delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000791895"	"3"	"90"	"8"	"87591437"	"87591437"	"del"	"0"	"00000"	"CNGB3_000125"	"g.87591437delC"	""	"{PMID:Azam 2010:20454696}"	""	"c.1825delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000791896"	"0"	"90"	"8"	"87591437"	"87591437"	"del"	"0"	"00000"	"CNGB3_000125"	"g.87591437delC"	""	"{PMID:Azam 2010:20454696}"	""	"c.1825delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000791897"	"0"	"90"	"8"	"87591437"	"87591437"	"del"	"0"	"00000"	"CNGB3_000125"	"g.87591437delC"	""	"{PMID:Azam 2010:20454696}"	""	"c.1825delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000791898"	"0"	"90"	"8"	"87591437"	"87591437"	"del"	"0"	"00000"	"CNGB3_000125"	"g.87591437delC"	""	"{PMID:Azam 2010:20454696}"	""	"c.1825delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000791899"	"0"	"90"	"8"	"87591437"	"87591437"	"del"	"0"	"00000"	"CNGB3_000125"	"g.87591437delC"	""	"{PMID:Azam 2010:20454696}"	""	"c.1825delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000791900"	"0"	"90"	"8"	"87591437"	"87591437"	"del"	"0"	"00000"	"CNGB3_000125"	"g.87591437delC"	""	"{PMID:Azam 2010:20454696}"	""	"c.1825delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000791901"	"0"	"90"	"8"	"87591437"	"87591437"	"del"	"0"	"00000"	"CNGB3_000125"	"g.87591437delC"	""	"{PMID:Azam 2010:20454696}"	""	"c.1825delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000792280"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0"	"00000"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Thiadens_2012:22264887}"	""	"c.1148delC"	""	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000792292"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0"	"00000"	"CNGB3_000085"	"g.87656009delG"	""	"{PMID:Thiadens_2012:22264887}"	""	"c.1148delC"	""	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000792301"	"0"	"90"	"8"	"87679179"	"87679186"	"del"	"0"	"00000"	"CNGB3_000127"	"g.87679179_87679186del8"	""	"{PMID:Thiadens_2012:22264887}"	""	"c.819_826del8"	""	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000792302"	"0"	"90"	"8"	"87667153"	"87667153"	"delins"	"0"	"00000"	"CNGB3_000126"	"g.87667153delinsA"	""	"{PMID:Thiadens_2012:22264887}"	""	"c.886-896del11insT"	""	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000792303"	"0"	"90"	"8"	"87667153"	"87667153"	"delins"	"0"	"00000"	"CNGB3_000126"	"g.87667153delinsA"	""	"{PMID:Thiadens_2012:22264887}"	""	"c.886-896del11insT"	""	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000792304"	"0"	"90"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"00000"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Thiadens_2012:22264887}"	""	"c.991-3T>G"	""	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000792305"	"0"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Thiadens_2012:22264887}"	""	"c.1208G>A"	""	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000792306"	"0"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Thiadens_2012:22264887}"	""	"c.1208G>A"	""	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000792307"	"0"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Thiadens_2012:22264887}"	""	"c.1208G>A"	"normal 2nd chromosome"	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000792310"	"0"	"90"	"8"	"87588079"	"87588079"	"subst"	"3.67146E-5"	"00000"	"CNGB3_000083"	"g.87588079C>T"	""	"{PMID:Thiadens_2012:22264887}"	""	"c.2383G>A"	""	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000794819"	"21"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Ezquerra-Inchausti 2018:30337596}"	""	"NM_019098, c.1148del, p.Thr383IlefsTer13"	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000794820"	"10"	"70"	"8"	"87679152"	"87679152"	"subst"	"0"	"00000"	"CNGB3_000128"	"g.87679152C>G"	""	"{PMID:Ezquerra-Inchausti 2018:30337596}"	""	"NM_019098, c.852+1G>C,"	""	"Germline"	"yes"	""	"0"	""	""	"g.86666924C>G"	""	"likely pathogenic"	""
"0000795862"	"3"	"70"	"8"	"87679152"	"87679152"	"subst"	"0"	"00000"	"CNGB3_000128"	"g.87679152C>G"	""	"{PMID:Perez-Carro 2018:29912909}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86666924C>G"	""	"likely pathogenic"	""
"0000796108"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796109"	"0"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1578+1G>A"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796110"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796111"	"0"	"90"	"8"	"87680295"	"87680295"	"del"	"0"	"00000"	"CNGB3_000087"	"g.87680295del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.595delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796112"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796113"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796114"	"0"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00000"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1006G>T"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796115"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796116"	"0"	"90"	"8"	"87680295"	"87680295"	"del"	"0"	"00000"	"CNGB3_000087"	"g.87680295del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.595delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796117"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796118"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796119"	"0"	"90"	"8"	"87680295"	"87680295"	"del"	"0"	"00000"	"CNGB3_000087"	"g.87680295del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.595delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796120"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796121"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796122"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796123"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796124"	"0"	"90"	"8"	"87680282"	"87680283"	"ins"	"0"	"00000"	"CNGB3_000121"	"g.87680282_87680283insA"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.607-608insT"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796125"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796126"	"0"	"90"	"8"	"87591409"	"87591409"	"del"	"0"	"00000"	"CNGB3_000129"	"g.87591409del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1853delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796127"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796128"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796129"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Sundaram_2014:24148654}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796992"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Corton-2013:23940504}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796993"	"0"	"90"	"8"	"87616436"	"87616436"	"subst"	"0"	"00000"	"CNGB3_000130"	"g.87616436C>A"	""	"{PMID:Corton-2013:23940504}"	""	"c.1666G.T"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000796994"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Corton-2013:23940504}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000797228"	"11"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC];[1208G>A], p.[T383Ifs*13];[R403Q], CNGA3: c.[=];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000797229"	"11"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC];[1208G>A], p.[T383Ifs*13];[R403Q], CNGA3: c.[=];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000797230"	"11"	"90"	"8"	"87755744"	"87755744"	"subst"	"0"	"00000"	"CNGB3_000134"	"g.87755744G>A"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[112C>T];[1208G>A;1673G>T], p.[Q38*];[R403Q;G558V], CNGA3: c.[=];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86743516G>A"	""	"pathogenic"	""
"0000797231"	"11"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC];[1208G>A], p.[T383Ifs*13];[R403Q], CNGA3: c.[=];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000797232"	"0"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1208G>A];[(1208G>A)], p.[R403Q];[(R403Q)], CNGA3: c.[-37-1G>C];[=]"	""	"Germline"	"?"	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0000797233"	"3"	"90"	"2"	"87645092"	"87645092"	"subst"	"0"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1208G>A];[(1208G>A)], p.[R403Q];[(R403Q)], CNGA3: c.[869G>A];[=], p.[R290H];[=]"	""	"Germline"	"?"	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0000797234"	"3"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1208G>A];[(1208G>A)], p.[R403Q];[(R403Q)], CNGA3: c.[1777G>A];[=], p.[E593K];[=], IMPG1: c.[378C>T];[=], p.[W126*];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0000797235"	"3"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1208G>A];[(1208G>A)], p.[R403Q];[R403Q], CNGA3: c.[829C>T];[=]"	""	"Germline"	"?"	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0000797236"	"21"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC];[1208G>A], p.[T383Ifs*13];[R403Q]CNGA3: c.[1217T>C];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000797237"	"11"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC];[1208G>A], p.[R403Q];[T383Ifs*13]CNGA3: c.[667C>T];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000797238"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC];[1578+1G>A], p.[R403Q];[?] Splice defectCNGA3: c.[1320G>A];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000797239"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC(;)1208G>A], p.[T383Ifs*13(;)R403Q] CNGA3: c.[1306C>T];[=]"	""	"Germline"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000797240"	"11"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[819_826del];[1208G>A], p.[R274Vfs*13];[R403Q]CNGA3: c.[1279C>T];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic"	""
"0000797241"	"21"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC];[1208G>A], p.[T383Ifs*13];[R403Q], CNGA3: c.[=];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0000797242"	"21"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC];[1208G>A], p.[T383Ifs*13];[R403Q], CNGA3: c.[=];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0000797243"	"21"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[112C>T];[1208G>A;1673G>T], p.[Q38*];[R403Q;G558V], CNGA3: c.[=];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0000797244"	"21"	"90"	"8"	"87616429"	"87616429"	"subst"	"0"	"00000"	"CNGB3_000133"	"g.87616429C>A"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[112C>T];[1208G>A;1673G>T], p.[Q38*];[R403Q;G558V], CNGA3: c.[=];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86604201C>A"	""	"pathogenic"	""
"0000797245"	"20"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC];[1208G>A], p.[T383Ifs*13];[R403Q], CNGA3: c.[=];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0000797246"	"10"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC];[1208G>A], p.[T383Ifs*13];[R403Q], CNGA3: c.[1217T>C];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0000797247"	"21"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC];[1208G>A], p.[R403Q];[T383Ifs*13], CNGA3: c.[667C>T];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0000797248"	"0"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC];[1578+1G>A], p.[R403Q];[?] Splice defect, CNGA3: c.[1320G>A];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic"	""
"0000797249"	"0"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[1148delC(;)1208G>A], p.[T383Ifs*13(;)R403Q],  CNGA3: c.[1306C>T];[=]"	""	"Germline"	"?"	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0000797250"	"21"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Burkhard 2018:30418171}"	""	"CNGB3: c.[819_826del];[1208G>A], p.[R274Vfs*13];[R403Q], CNGA3: c.[1279C>T];[=]"	""	"Germline"	"yes"	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0000797405"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Patel 2019:30653986}"	""	"c.1148del; p.Thr383Ilefs*13"	"confirmed with Sanger sequencing; homozygous"	"Germline"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000797406"	"0"	"70"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Patel 2019:30653986}"	""	"c.1578+1G-->A, c.819_826del; p.?, p.Arg274Valfs*13"	"confirmed with Sanger sequencing; potentially compound heterozygous"	"Germline"	"?"	""	"0"	""	""	"g.86625982C>T"	""	"likely pathogenic"	""
"0000797407"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Patel 2019:30653986}"	""	"c.1148del; p.Thr383Ilefs*13"	"no Sanger sequencing; homozygous"	"Germline"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000797408"	"21"	"70"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Patel 2019:30653986}"	""	"c.1578+1G-->A, c.1148del; p.?, p.Thr383Ilefs*13"	"confirmed with Sanger sequencing; potentially compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86625982C>T"	""	"likely pathogenic"	""
"0000797451"	"0"	"70"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Patel 2019:30653986}"	""	"c.1578+1G-->A, c.819_826del; p.?, p.Arg274Valfs*13"	"confirmed with Sanger sequencing; potentially compound heterozygous"	"Germline"	"?"	""	"0"	""	""	"g.86666953_86666960del"	""	"likely pathogenic"	""
"0000797452"	"11"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Patel 2019:30653986}"	""	"c.1578+1G-->A, c.1148del; p.?, p.Thr383Ilefs*13"	"confirmed with Sanger sequencing; potentially compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000797580"	"3"	"70"	"8"	"87616402"	"87616402"	"subst"	"4.06702E-6"	"00000"	"CNGB3_000132"	"g.87616402C>T"	""	"{PMID:Jespersgaar 2019:30718709}"	""	"CNGB3 c.1700G>A, p.(Gly567Glu), c.1700G>A, p.(Gly567Glu)"	"homozygous"	"Germline"	"?"	""	"0"	""	""	"g.86604174C>T"	""	"likely pathogenic"	"ACMG"
"0000797581"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Jespersgaar 2019:30718709}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13), c.1148del, p.(Thr383Ilefs*13)"	"homozygous"	"Germline"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000797582"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Jespersgaar 2019:30718709}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13), c.1148del, p.(Thr383Ilefs*13), ABCA4 c.2588G>C, p.(Gly863Ala)"	"homozygous"	"Germline"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000797583"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Jespersgaar 2019:30718709}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13), c.1148del, p.(Thr383Ilefs*13), RGS9 c.895T>C, p.(Trp299Arg)"	"homozygous"	"Germline"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000797585"	"0"	"90"	"8"	"87641195"	"87641195"	"subst"	"2.03383E-5"	"00000"	"CNGB3_000122"	"g.87641195G>A"	""	"{PMID:Jespersgaar 2019:30718709}"	""	"CNGB3 c.1432C>T, p.(Arg478*), c.1148del, p.(Thr383Ilefs*13)"	""	"Germline"	"?"	""	"0"	""	""	"g.86628967G>A"	""	"pathogenic"	"ACMG"
"0000797586"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Jespersgaar 2019:30718709}"	""	"CNGB3 c.1432C>T, p.(Arg478*), c.1148del, p.(Thr383Ilefs*13)"	""	"Germline"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000797587"	"3"	"70"	"8"	"0"	"0"	""	"0"	"00000"	"RP1_000000"	"g.?"	""	"{PMID:Jespersgaar 2019:30718709}"	""	"CNGB3 c.(211+1_212-1) _(338+1_339-1)del, c.(211+1_212-1) _(338+1_339-1)del"	"homozygous"	"Germline"	"?"	""	"0"	""	""	"g.?"	""	"likely pathogenic"	"ACMG"
"0000797823"	"0"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Jespersgaar 2019:30718709}"	""	"RPGR c.1731dup, p.(Ala578Serfs*5), CNGB3 c.1578+1G>A, p.(?)"	""	"Germline"	"?"	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic"	"ACMG"
"0000797986"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Jespersgaar 2019:30718709}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13)"	"single heterozygous variant (recessive)"	"Germline"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000798128"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Gonzalez del Pozo 2018:30190494}"	""	"M3: c.1148del; p.Thr383Ilefs*13"	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000798178"	"0"	"30"	"8"	"87588042"	"87588042"	"subst"	"0.0035786"	"00000"	"CNGB3_000003"	"g.87588042G>C"	""	"{PMID:Gonzalez del Pozo 2018:30190494}"	""	"m38: c.2420C>G; p.Ala807Gly"	""	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86575814G>C"	""	"likely benign"	""
"0000798426"	"3"	"50"	"8"	"87591437"	"87591437"	"del"	"0"	"00000"	"CNGB3_000131"	"g.87591437del"	""	"{PMID:Azam-2011:21987686}"	""	"c.1825delG"	""	"Unknown"	""	""	"0"	""	""	""	""	"VUS"	""
"0000803749"	"0"	"30"	"8"	"87591084"	"87591084"	"subst"	"0.000113772"	"02330"	"CNGB3_000135"	"g.87591084A>G"	""	""	""	"CNGB3(NM_019098.5):c.1936T>C (p.L646=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000803750"	"0"	"50"	"8"	"87591364"	"87591364"	"subst"	"0.000337261"	"01943"	"CNGB3_000136"	"g.87591364T>C"	""	""	""	"CNGB3(NM_019098.4):c.1898A>G (p.D633G), CNGB3(NM_019098.5):c.1898A>G (p.(Asp633Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000803751"	"0"	"50"	"8"	"87638279"	"87638279"	"subst"	"0.000638881"	"01943"	"CNGB3_000137"	"g.87638279T>C"	""	""	""	"CNGB3(NM_019098.4):c.1510A>G (p.T504A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000803752"	"0"	"50"	"8"	"87641188"	"87641188"	"subst"	"0.000528773"	"01943"	"CNGB3_000060"	"g.87641188C>T"	""	""	""	"CNGB3(NM_019098.4):c.1439G>A (p.R480Q), CNGB3(NM_019098.5):c.1439G>A (p.R480Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000803753"	"0"	"30"	"8"	"87679357"	"87679357"	"subst"	"0"	"01943"	"CNGB3_000138"	"g.87679357T>C"	""	""	""	"CNGB3(NM_019098.4):c.648A>G (p.R216=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000803754"	"0"	"30"	"8"	"87680407"	"87680407"	"subst"	"0"	"02330"	"CNGB3_000139"	"g.87680407A>G"	""	""	""	"CNGB3(NM_019098.5):c.494-11T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000811403"	"3"	"70"	"8"	"87683292"	"87683295"	"del"	"0"	"00000"	"CNGB3_000141"	"g.87683292_87683295del"	""	"{PMID:Khan 2019:31725702}"	""	"Allele 1 c.372_375del  (p.Ile124Metfs*12), Allele 2 c.372_375del  (p.Ile124Metfs*12)"	"homozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86671064_86671067del"	""	"likely pathogenic"	""
"0000811404"	"3"	"70"	"8"	"87644982"	"87644982"	"subst"	"0"	"00000"	"CNGB3_000140"	"g.87644982G>A"	""	"{PMID:Khan 2019:31725702}"	""	"Allele 1 c.1318C>T (p.Gln440*), Allele 2 c.1318C>T (p.Gln440*)"	"homozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86632754G>A"	""	"likely pathogenic"	""
"0000815325"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"CNGB3:NM_019098 c.1148delC, p.T383fs"	"heterozygous, individual solved, variant causal"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000815326"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"c.1148del; p.(Thr383Ilefs*13)"	"heterozygous, individual solved, variant causal"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000815387"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"CNGB3:NM_019098 c.1148delC, p.T383fs"	"heterozygous, individual solved, variant causal"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000815388"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"c.1148del; p.(Thr383Ilefs*13)"	"heterozygous, individual solved, variant causal"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000815404"	"0"	"50"	"8"	"87679274"	"87679274"	"subst"	"8.12282E-6"	"00000"	"CNGB3_000142"	"g.87679274T>C"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"CNGB3:NM_019098 c.A731G, p.Y244C"	"heterozygous, individual unsolved, causality of variants unknown"	"Germline"	"?"	""	"0"	""	""	"g.86667046T>C"	""	"VUS"	"ACMG"
"0000815457"	"0"	"50"	"8"	"87588042"	"87588042"	"subst"	"0.0035786"	"00000"	"CNGB3_000003"	"g.87588042G>C"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"CNGB3:NM_019098 c.C2420G, p.A807G"	"heterozygous, individual solved, variant non-causal"	"Germline"	"?"	""	"0"	""	""	"g.86575814G>C"	""	"VUS"	"ACMG"
"0000815463"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"CNGB3:NM_019098 c.1148delC, p.T383fs"	"heterozygous, individual solved, variant non-causal"	"Germline"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000815474"	"0"	"90"	"8"	"87751961"	"87751961"	"subst"	"0"	"00000"	"CNGB3_000144"	"g.87751961C>A"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"CNGB3:NM_019098 c.G133T, p.E45X"	"heterozygous, individual solved, variant causal"	"Germline"	"yes"	""	"0"	""	""	"g.86739733C>A"	""	"pathogenic"	"ACMG"
"0000815476"	"0"	"90"	"8"	"87751961"	"87751961"	"subst"	"0"	"00000"	"CNGB3_000144"	"g.87751961C>A"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"c.133G>T; p.(Glu45*)"	"heterozygous, individual solved, variant causal"	"Germline"	"yes"	""	"0"	""	""	"g.86739733C>A"	""	"pathogenic"	"ACMG"
"0000815488"	"0"	"50"	"8"	"87679328"	"87679328"	"subst"	"0.000117817"	"00000"	"CNGB3_000143"	"g.87679328G>T"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"CNGB3:NM_019098 c.C677A, p.T226N"	"heterozygous, individual solved, variant non-causal"	"Germline"	"?"	""	"0"	""	""	"g.86667100G>T"	""	"VUS"	"ACMG"
"0000815530"	"0"	"50"	"8"	"87588042"	"87588042"	"subst"	"0.0035786"	"00000"	"CNGB3_000003"	"g.87588042G>C"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"CNGB3:NM_019098 c.C2420G, p.A807G"	"heterozygous, individual solved, variant non-causal"	"Germline"	"?"	""	"0"	""	""	"g.86575814G>C"	""	"VUS"	"ACMG"
"0000815535"	"0"	"90"	"8"	"87641195"	"87641195"	"subst"	"2.03383E-5"	"00000"	"CNGB3_000122"	"g.87641195G>A"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"CNGB3:NM_019098 c.C1432T, p.R478X"	"heterozygous, individual solved, variant causal"	"Germline"	"yes"	""	"0"	""	""	"g.86628967G>A"	""	"pathogenic"	"ACMG"
"0000815537"	"0"	"90"	"8"	"87641195"	"87641195"	"subst"	"2.03383E-5"	"00000"	"CNGB3_000122"	"g.87641195G>A"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"c.1432C>T; p.(Arg478*)"	"heterozygous, individual solved, variant causal"	"Germline"	"yes"	""	"0"	""	""	"g.86628967G>A"	""	"pathogenic"	"ACMG"
"0000815540"	"0"	"90"	"8"	"87679152"	"87679152"	"subst"	"0"	"00000"	"CNGB3_000128"	"g.87679152C>G"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"CNGB3:NM_019098 c.852+1G>C, p.?"	"heterozygous, individual solved, variant non-causal"	"Germline"	"?"	""	"0"	""	""	"g.86666924C>G"	""	"pathogenic"	"ACMG"
"0000815595"	"0"	"50"	"8"	"87588042"	"87588042"	"subst"	"0.0035786"	"00000"	"CNGB3_000003"	"g.87588042G>C"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"CNGB3:NM_019098 c.C2420G, p.A807G"	"heterozygous, individual unsolved, causality of variants unknown"	"Germline"	"?"	""	"0"	""	""	"g.86575814G>C"	""	"VUS"	"ACMG"
"0000816085"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Zampaglione 2020:32037395}"	""	"CNGB3 c.1148del, p.Thr383IlefsTer13"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000816137"	"3"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Zampaglione 2020:32037395}"	""	"CNGB3 c.1578+1G>A"	"homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic"	""
"0000816414"	"0"	"70"	"8"	"87666247"	"87666257"	"delins"	"0"	"00000"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Zampaglione 2020:32037395}"	""	"c.886_896delinsT, p.Thr296TyrfsTer9"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86654019_86654029delinsA"	""	"likely pathogenic"	""
"0000816450"	"0"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Zampaglione 2020:32037395}"	""	"c.1578+1G>A"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic"	""
"0000818950"	"1"	"70"	"8"	"87655978"	"87656915"	"del"	"0"	"00000"	"CNGB3_000145"	"g.(87645122_87655978)_(87656915_87660028)del"	""	"{PMID:Ellingford 2017:28378820}, {PMID:Ellingsford 2018:29074561}"	""	"chr8:87655974–87656919"	""	"Germline"	"yes"	""	"0"	""	""	"g.(86632894_86643750)_(86644687_86647800)del"	""	"likely pathogenic"	""
"0000818951"	"2"	"70"	"8"	"87660028"	"87660028"	"subst"	"0"	"00000"	"CNGB3_000146"	"g.87660028C>A"	""	"{PMID:Ellingsford 2018:29074561}"	""	"c.990+1G>T"	""	"Germline"	"yes"	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000819355"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820388"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.607C>T/p.R203*"	"solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820403"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820437"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820438"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820439"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820454"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820461"	"1"	"70"	"8"	"0"	"0"	""	"0"	"00000"	"RP1_000000"	"g.?"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1 :Deletion exon 4-18, variant 2 :Deletion exon 4-18"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.?"	""	"likely pathogenic"	""
"0000820462"	"1"	"70"	"8"	"87656094"	"87656094"	"subst"	"2.04108E-5"	"00000"	"CNGB3_000178"	"g.87656094G>A"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1063C>T/p.R355*, variant 2: c.1579-2A>G/p.?"	"solved, compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643866G>A"	""	"likely pathogenic"	""
"0000820472"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820476"	"1"	"70"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.819_826del/p.P274Pfs*14, variant 2: c.1148del/p.T383Ifs*13"	"error in annotation,  protein change should be p.(Arg274Valfs*13) and not p.(Pro274Profs*14), solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86666953_86666960del"	""	"likely pathogenic"	""
"0000820477"	"1"	"70"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.819_826del/p.P274Pfs*14, variant 2: c.1148del/p.T383Ifs*13"	"error in annotation,  protein change should be p.(Arg274Valfs*13) and not p.(Pro274Profs*14), solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86666953_86666960del"	""	"likely pathogenic"	""
"0000820479"	"1"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1208G>A/p.R403Q, variant 2: c.1208G>A/p.R403Q"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86632864C>T"	""	"likely pathogenic"	""
"0000820480"	"1"	"70"	"8"	"87588241"	"87588241"	"del"	"0"	"00000"	"CNGB3_000057"	"g.87588241del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.2221del/p.D741Ifs*88, variant 2: c.2221del/p.D741Ifs*88"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86576013del"	""	"likely pathogenic"	""
"0000820483"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820484"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820485"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820487"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820489"	"1"	"70"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.819_826del/p.P274Pfs*14, variant 2: c.1006G>T/p.E336*"	"error in annotation,  protein change should be p.(Arg274Valfs*13) and not p.(Pro274Profs*14), solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86666953_86666960del"	""	"likely pathogenic"	""
"0000820492"	"1"	"70"	"8"	"87680247"	"87680247"	"subst"	"0"	"00000"	"CNGB3_000185"	"g.87680247C>G"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.643G>C/p.D215H, variant 2: c.1148del/p.T383Ifs*13"	"solved, compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86668019C>G"	""	"likely pathogenic"	""
"0000820502"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820519"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.791_794del/p.Y264Ffs*14"	"solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820584"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1578+1G>A/p.?"	"solved, compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820586"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820587"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820590"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820591"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820593"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820599"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820600"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820601"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820602"	"1"	"70"	"8"	"87645093"	"87645093"	"subst"	"1.62725E-5"	"00000"	"CNGB3_000080"	"g.87645093G>A"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1207C>T/p.R403*, variant 2: c.1207C>T/p.R403*"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86632865G>A"	""	"likely pathogenic"	""
"0000820604"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1148del/p.T383Ifs*13"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820605"	"1"	"70"	"8"	"87656849"	"87656849"	"subst"	"0"	"00000"	"CNGB3_000179"	"g.87656849C>G"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1055+1G>C/p.?, variant 2 :Deletion exon 15"	"solved, compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86644621C>G"	""	"likely pathogenic"	""
"0000820606"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1579-1G>A/p.?"	"solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820607"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.819_826del/p.R274Vfs*13"	"solved, compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820892"	"1"	"70"	"8"	"87680283"	"87680283"	"subst"	"2.8434E-5"	"00000"	"CNGB3_000077"	"g.87680283G>A"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.607C>T/p.R203*"	"solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86668055G>A"	""	"likely pathogenic"	""
"0000820927"	"1"	"70"	"8"	"87623901"	"87623901"	"subst"	"4.08227E-6"	"00000"	"CNGB3_000166"	"g.87623901T>C"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1063C>T/p.R355*, variant 2: c.1579-2A>G/p.?"	"solved, compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86611673T>C"	""	"likely pathogenic"	""
"0000820933"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.819_826del/p.P274Pfs*14, variant 2: c.1148del/p.T383Ifs*13"	"solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820934"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.819_826del/p.P274Pfs*14, variant 2: c.1148del/p.T383Ifs*13"	"solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820937"	"1"	"70"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00000"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.819_826del/p.P274Pfs*14, variant 2: c.1006G>T/p.E336*"	"solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86644671C>A"	""	"likely pathogenic"	""
"0000820938"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.643G>C/p.D215H, variant 2: c.1148del/p.T383Ifs*13"	"solved, compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000820955"	"1"	"70"	"8"	"87679213"	"87679216"	"del"	"0"	"00000"	"CNGB3_000184"	"g.87679213_87679216del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.791_794del/p.Y264Ffs*14"	"solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86666985_86666988del"	""	"likely pathogenic"	""
"0000820987"	"1"	"70"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1578+1G>A/p.?"	"solved, compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86625982C>T"	""	"likely pathogenic"	""
"0000820992"	"1"	"70"	"8"	"0"	"0"	""	"0"	"00000"	"RP1_000000"	"g.?"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1055+1G>C/p.?, variant 2 :Deletion exon 15"	"solved, compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.?"	""	"likely pathogenic"	""
"0000820993"	"1"	"70"	"8"	"87623900"	"87623900"	"subst"	"0"	"00000"	"CNGB3_000165"	"g.87623900C>T"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.1579-1G>A/p.?"	"solved, compound heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86611672C>T"	""	"likely pathogenic"	""
"0000820994"	"1"	"70"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNGB3, variant 1: c.1148del/p.T383Ifs*13, variant 2: c.819_826del/p.R274Vfs*13"	"solved, compound heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86666953_86666960del"	""	"likely pathogenic"	""
"0000821219"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Turro 2020:32581362}"	""	"CNGB3 c.1148delC, p.Thr383IlefsTer13"	"homozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000821220"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Turro 2020:32581362}"	""	"CNGB3 c.1148delC, p.Thr383IlefsTer13"	"homozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000821221"	"3"	"70"	"8"	"87590916"	"87590916"	"subst"	"0"	"00000"	"CNGB3_000092"	"g.87590916C>T"	""	"{PMID:Turro 2020:32581362}"	""	"CNGB3 c.2103+1G>A,"	"homozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86578688C>T"	""	"likely pathogenic"	""
"0000821222"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Turro 2020:32581362}"	""	"CNGB3 c.1148delC, p.Thr383IlefsTer13"	"homozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000821223"	"3"	"70"	"8"	"87645041"	"87645041"	"del"	"0"	"00000"	"CNGB3_000173"	"g.87645041del"	""	"{PMID:Turro 2020:32581362}"	""	"CNGB3 c.1260delT, p.Ile420MetfsTer6"	"homozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86632813del"	""	"likely pathogenic"	""
"0000821224"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Turro 2020:32581362}"	""	"CNGB3 c.1148delC, p.Thr383IlefsTer13"	"heterozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000821225"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Turro 2020:32581362}"	""	"CNGB3 c.1148delC, p.Thr383IlefsTer13"	"heterozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000821540"	"0"	"70"	"8"	"87645022"	"87645022"	"del"	"0"	"00000"	"CNGB3_000095"	"g.87645022del"	""	"{PMID:Turro 2020:32581362}"	""	"CNGB3 c.1285delT, p.Ser429LeufsTer9"	"heterozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86632794del"	""	"likely pathogenic"	""
"0000821541"	"0"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Turro 2020:32581362}"	""	"CNGB3 c.819_826delCAGACTCC, p.Arg274ValfsTer13"	"heterozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic"	""
"0000822057"	"3"	"70"	"8"	"87591452"	"87591452"	"subst"	"8.13544E-6"	"00000"	"CNGB3_000093"	"g.87591452G>A"	""	"{PMID:Habibi 2020:32641690}"	""	"CNGB3 c.[1810C > T];[1810C > T], p.[R604*];[R604*]"	"homozygous"	"Germline"	"?"	""	"0"	""	""	"g.86579224G>A"	""	"likely pathogenic"	""
"0000822245"	"0"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Maggi_2021:33546218}"	""	"c.1148del"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000822246"	"0"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Maggi_2021:33546218}"	""	"c.1148del"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000822360"	"0"	"70"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Maggi_2021:33546218}"	""	"c.1578+1G>A"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000822361"	"0"	"70"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Maggi_2021:33546218}"	""	"c.1578+1G>A"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000822403"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Maggi_2021:33546218}"	""	"c.1148del"	""	"Germline"	"?"	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000822404"	"1"	"70"	"8"	"87655989"	"87655990"	"ins"	"0"	"00000"	"CNGB3_000177"	"g.87655989_87655990insG"	""	"{PMID:Maggi_2021:33546218}"	""	"c.1167_1168insC"	""	"Germline"	"?"	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000822514"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000822515"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822516"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822517"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822518"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822519"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822520"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822521"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822522"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822523"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822524"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822525"	"1"	"90"	"8"	"87679359"	"87679359"	"subst"	"2.03616E-5"	"00006"	"CNGB3_000075"	"g.87679359G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86667131G>A"	""	"pathogenic (recessive)"	""
"0000822526"	"1"	"90"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"00006"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86644689A>C"	""	"pathogenic (recessive)"	""
"0000822527"	"1"	"90"	"8"	"87755854"	"87755854"	"subst"	"0"	"00006"	"CNGB3_000207"	"g.87755854A>G"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86743626A>G"	""	"pathogenic (recessive)"	""
"0000822528"	"1"	"90"	"8"	"87623843"	"87623843"	"subst"	"0"	"00006"	"CNGB3_000089"	"g.87623843A>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	"c.1635A>T"	""	"Germline"	""	""	"0"	""	""	"g.86611615A>T"	""	"pathogenic (recessive)"	""
"0000822529"	"1"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"00006"	"CNGB3_000054"	"g.87679362C>G"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667134C>G"	""	"pathogenic (recessive)"	""
"0000822530"	"1"	"90"	"8"	"87655974"	"87655974"	"subst"	"0"	"00006"	"CNGB3_000176"	"g.87655974C>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86643746C>A"	""	"pathogenic (recessive)"	""
"0000822531"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000822532"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822533"	"1"	"90"	"8"	"87645109"	"87645111"	"del"	"0"	"00006"	"CNGB3_000174"	"g.87645109_87645111del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86632881_86632883del"	""	"pathogenic (recessive)"	""
"0000822534"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000822535"	"1"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"00006"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	""	"pathogenic (recessive)"	""
"0000822536"	"1"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"00006"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86654019_86654029delinsA"	""	"pathogenic (recessive)"	""
"0000822537"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822538"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822539"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822540"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822541"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822542"	"1"	"90"	"8"	"87738832"	"87738832"	"subst"	"0"	"00006"	"CNGB3_000200"	"g.87738832G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86726604G>A"	""	"pathogenic (recessive)"	""
"0000822543"	"1"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic (recessive)"	""
"0000822544"	"1"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic (recessive)"	""
"0000822545"	"1"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic (recessive)"	""
"0000822546"	"1"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic (recessive)"	""
"0000822547"	"1"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic (recessive)"	""
"0000822548"	"1"	"90"	"8"	"87641230"	"87641230"	"subst"	"0.00213178"	"00006"	"CNGB3_000171"	"g.87641230A>G"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86629002A>G"	""	"pathogenic (recessive)"	""
"0000822549"	"1"	"90"	"8"	"87641222"	"87641222"	"subst"	"0.000577673"	"00006"	"CNGB3_000062"	"g.87641222A>C"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86628994A>C"	""	"pathogenic (recessive)"	""
"0000822550"	"1"	"90"	"8"	"87616321"	"87616321"	"subst"	"0"	"00006"	"CNGB3_000158"	"g.87616321C>G"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86604093C>G"	""	"pathogenic (recessive)"	""
"0000822551"	"0"	"30"	"8"	"87753125"	"87753125"	"subst"	"0"	"00006"	"CNGB3_000206"	"g.87753125T>G"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86740897T>G"	""	"likely benign"	""
"0000822552"	"0"	"30"	"8"	"87749798"	"87749798"	"subst"	"0"	"00006"	"CNGB3_000205"	"g.87749798A>C"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86737570A>C"	""	"likely benign"	""
"0000822553"	"0"	"30"	"8"	"87749434"	"87749434"	"subst"	"0"	"00006"	"CNGB3_000204"	"g.87749434C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86737206C>T"	""	"likely benign"	""
"0000822554"	"0"	"30"	"8"	"87744232"	"87744232"	"subst"	"0"	"00006"	"CNGB3_000203"	"g.87744232C>G"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86732004C>G"	""	"likely benign"	""
"0000822555"	"0"	"30"	"8"	"87743434"	"87743434"	"subst"	"0"	"00006"	"CNGB3_000202"	"g.87743434A>G"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86731206A>G"	""	"likely benign"	""
"0000822556"	"0"	"30"	"8"	"87742484"	"87742484"	"subst"	"0"	"00006"	"CNGB3_000201"	"g.87742484A>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	""	""	"0"	""	""	"g.86730256A>T"	""	"likely benign"	""
"0000822557"	"0"	"30"	"8"	"87738294"	"87738294"	"subst"	"0"	"00006"	"CNGB3_000199"	"g.87738294C>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86726066C>A"	""	"likely benign"	""
"0000822558"	"0"	"30"	"8"	"87736939"	"87736939"	"subst"	"0"	"00006"	"CNGB3_000198"	"g.87736939C>G"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86724711C>G"	""	"likely benign"	""
"0000822559"	"0"	"30"	"8"	"87734032"	"87734032"	"subst"	"0"	"00006"	"CNGB3_000197"	"g.87734032C>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86721804C>A"	""	"likely benign"	""
"0000822560"	"0"	"30"	"8"	"87726509"	"87726509"	"subst"	"0"	"00006"	"CNGB3_000196"	"g.87726509G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86714281G>A"	""	"likely benign"	""
"0000822561"	"0"	"30"	"8"	"87724047"	"87724047"	"subst"	"0"	"00006"	"CNGB3_000195"	"g.87724047C>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86711819C>A"	""	"likely benign"	""
"0000822562"	"0"	"30"	"8"	"87722596"	"87722596"	"subst"	"0"	"00006"	"CNGB3_000194"	"g.87722596C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86710368C>T"	""	"likely benign"	""
"0000822563"	"0"	"30"	"8"	"87720038"	"87720038"	"subst"	"0"	"00006"	"CNGB3_000193"	"g.87720038G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86707810G>A"	""	"likely benign"	""
"0000822564"	"0"	"30"	"8"	"87695745"	"87695750"	"dup"	"0"	"00006"	"CNGB3_000192"	"g.87695745_87695750dup"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86683517_86683522dup"	""	"likely benign"	""
"0000822565"	"0"	"30"	"8"	"87693212"	"87693212"	"subst"	"0"	"00006"	"CNGB3_000191"	"g.87693212G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86680984G>A"	""	"likely benign"	""
"0000822566"	"0"	"30"	"8"	"87688863"	"87688863"	"subst"	"0"	"00006"	"CNGB3_000190"	"g.87688863C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86676635C>T"	""	"likely benign"	""
"0000822567"	"0"	"30"	"8"	"87685919"	"87685919"	"subst"	"0"	"00006"	"CNGB3_000189"	"g.87685919T>C"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86673691T>C"	""	"likely benign"	""
"0000822568"	"0"	"30"	"8"	"87684360"	"87684360"	"subst"	"0"	"00006"	"CNGB3_000188"	"g.87684360G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86672132G>A"	""	"likely benign"	""
"0000822569"	"0"	"30"	"8"	"87684086"	"87684086"	"subst"	"0"	"00006"	"CNGB3_000187"	"g.87684086G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86671858G>A"	""	"likely benign"	""
"0000822570"	"0"	"30"	"8"	"87681478"	"87681478"	"subst"	"0"	"00006"	"CNGB3_000186"	"g.87681478G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86669250G>A"	""	"likely benign"	""
"0000822571"	"0"	"30"	"8"	"87676221"	"87676221"	"subst"	"0"	"00006"	"CNGB3_000183"	"g.87676221T>C"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86663993T>C"	""	"likely benign"	""
"0000822572"	"0"	"30"	"8"	"87670113"	"87670113"	"subst"	"0"	"00006"	"CNGB3_000182"	"g.87670113G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86657885G>A"	""	"likely benign"	""
"0000822573"	"0"	"30"	"8"	"87667142"	"87667142"	"subst"	"0"	"00006"	"CNGB3_000181"	"g.87667142C>G"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86654914C>G"	""	"likely benign"	""
"0000822574"	"0"	"30"	"8"	"87664529"	"87664529"	"subst"	"0"	"00006"	"CNGB3_000180"	"g.87664529C>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86652301C>A"	""	"likely benign"	""
"0000822575"	"0"	"30"	"8"	"87645167"	"87645167"	"subst"	"7.45644E-5"	"00006"	"CNGB3_000175"	"g.87645167G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632939G>A"	""	"likely benign"	""
"0000822576"	"0"	"30"	"8"	"87644330"	"87644330"	"subst"	"0"	"00006"	"CNGB3_000172"	"g.87644330G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632102G>A"	""	"likely benign"	""
"0000822577"	"1"	"30"	"8"	"87638199"	"87638199"	"subst"	"8.19357E-6"	"00006"	"CNGB3_000170"	"g.87638199A>G"	""	"{PMID:Weisschuh 2020:31544997}, Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, BP7_strong, BP4_supp; consequence on splicing predicted from in vitro mini-gene splicing assay"	"Germline"	""	""	"0"	""	""	"g.86625971A>G"	""	"likely benign"	""
"0000822578"	"0"	"30"	"8"	"87635442"	"87635442"	"subst"	"0"	"00006"	"CNGB3_000169"	"g.87635442G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86623214G>A"	""	"likely benign"	""
"0000822579"	"0"	"30"	"8"	"87634640"	"87634640"	"subst"	"0"	"00006"	"CNGB3_000168"	"g.87634640A>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86622412A>T"	""	"likely benign"	""
"0000822580"	"0"	"30"	"8"	"87630642"	"87630642"	"subst"	"0"	"00006"	"CNGB3_000167"	"g.87630642T>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86618414T>A"	""	"likely benign"	""
"0000822581"	"0"	"30"	"8"	"87620197"	"87620197"	"subst"	"0"	"00006"	"CNGB3_000163"	"g.87620197T>C"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86607969T>C"	""	"likely benign"	""
"0000822582"	"0"	"30"	"8"	"87620085"	"87620085"	"subst"	"0"	"00006"	"CNGB3_000162"	"g.87620085C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86607857C>T"	""	"likely benign"	""
"0000822583"	"0"	"30"	"8"	"87619917"	"87619917"	"subst"	"0"	"00006"	"CNGB3_000161"	"g.87619917C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86607689C>T"	""	"likely benign"	""
"0000822584"	"0"	"30"	"8"	"87612373"	"87612373"	"subst"	"0"	"00006"	"CNGB3_000157"	"g.87612373C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86600145C>T"	""	"likely benign"	""
"0000822585"	"0"	"30"	"8"	"87608415"	"87608415"	"subst"	"0"	"00006"	"CNGB3_000156"	"g.87608415C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86596187C>T"	""	"likely benign"	""
"0000822586"	"0"	"30"	"8"	"87603585"	"87603585"	"subst"	"0"	"00006"	"CNGB3_000155"	"g.87603585G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86591357G>A"	""	"likely benign"	""
"0000822587"	"0"	"30"	"8"	"87600731"	"87600731"	"subst"	"0"	"00006"	"CNGB3_000154"	"g.87600731A>G"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86588503A>G"	""	"likely benign"	""
"0000822588"	"0"	"30"	"8"	"87598861"	"87598861"	"subst"	"0"	"00006"	"CNGB3_000153"	"g.87598861A>G"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86586633A>G"	""	"likely benign"	""
"0000822589"	"0"	"30"	"8"	"87598722"	"87598725"	"del"	"0"	"00006"	"CNGB3_000152"	"g.87598722_87598725del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86586494_86586497del"	""	"likely benign"	""
"0000822590"	"0"	"30"	"8"	"87598563"	"87598564"	"del"	"0"	"00006"	"CNGB3_000151"	"g.87598563_87598564del"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86586335_86586336del"	""	"likely benign"	""
"0000822591"	"0"	"30"	"8"	"87594392"	"87594392"	"subst"	"0"	"00006"	"CNGB3_000150"	"g.87594392A>G"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86582164A>G"	""	"likely benign"	""
"0000822592"	"0"	"30"	"8"	"87593915"	"87593915"	"subst"	"0"	"00006"	"CNGB3_000149"	"g.87593915T>C"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86581687T>C"	""	"likely benign"	""
"0000822593"	"0"	"30"	"8"	"87592652"	"87592652"	"subst"	"0"	"00006"	"CNGB3_000148"	"g.87592652C>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86580424C>A"	""	"likely benign"	""
"0000822594"	"0"	"30"	"8"	"87591316"	"87591316"	"subst"	"0.00173158"	"00006"	"CNGB3_000005"	"g.87591316G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86579088G>A"	""	"likely benign"	""
"0000822595"	"0"	"30"	"8"	"87588554"	"87588554"	"subst"	"0"	"00006"	"CNGB3_000147"	"g.87588554C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86576326C>T"	""	"likely benign"	""
"0000822596"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	"yes"	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822597"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822598"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822599"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	"yes"	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822600"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	"yes"	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822601"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	"yes"	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822602"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822603"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	"yes"	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822604"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822605"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	"yes"	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822606"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	"yes"	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822607"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	"yes"	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822608"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	"yes"	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822609"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	"yes"	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822610"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822611"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822612"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	"yes"	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822613"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	"SCV000926194"	"pathogenic (recessive)"	""
"0000822614"	"2"	"90"	"8"	"87618576"	"87618576"	"subst"	"0"	"00006"	"CNGB3_000160"	"g.87618576G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	""	""	"0"	""	""	"g.86606348G>A"	"SCV000926195"	"pathogenic (recessive)"	""
"0000822615"	"2"	"90"	"8"	"87618576"	"87618576"	"subst"	"0"	"00006"	"CNGB3_000160"	"g.87618576G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	"effect variant predicted form mini-gene splicing analysis in HEK293T cells"	"Germline"	"yes"	""	"0"	""	""	"g.86606348G>A"	"SCV000926195"	"pathogenic (recessive)"	""
"0000822616"	"2"	"90"	"8"	"87680283"	"87680283"	"subst"	"2.8434E-5"	"00006"	"CNGB3_000077"	"g.87680283G>A"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86668055G>A"	""	"pathogenic (recessive)"	""
"0000822617"	"2"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"00006"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	""	"pathogenic (recessive)"	""
"0000822618"	"2"	"90"	"8"	"87641196"	"87641197"	"delins"	"0"	"00006"	"CNGB3_000119"	"g.87641196_87641197delinsG"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628968_86628969delinsG"	""	"pathogenic (recessive)"	""
"0000822619"	"2"	"90"	"8"	"87623845"	"87623845"	"subst"	"0"	"00006"	"CNGB3_000164"	"g.87623845A>C"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86611617A>C"	""	"pathogenic (recessive)"	""
"0000822620"	"2"	"90"	"8"	"87645029"	"87645029"	"subst"	"0"	"00006"	"CNGB3_000116"	"g.87645029A>C"	""	"{PMID:Weisschuh 2020:31544997}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.86632801A>C"	""	"pathogenic (recessive)"	""
"0000822621"	"3"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822622"	"3"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822623"	"3"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822624"	"3"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822625"	"3"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822626"	"3"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822627"	"3"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822628"	"1"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"00006"	"CNGB3_000054"	"g.87679362C>G"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667134C>G"	""	"pathogenic (recessive)"	""
"0000822629"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822630"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822631"	"1"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"00006"	"CNGB3_000054"	"g.87679362C>G"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667134C>G"	""	"pathogenic (recessive)"	""
"0000822632"	"1"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"00006"	"CNGB3_000054"	"g.87679362C>G"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667134C>G"	""	"pathogenic (recessive)"	""
"0000822633"	"1"	"90"	"8"	"87683198"	"87683198"	"subst"	"6.09201E-5"	"00006"	"CNGB3_000055"	"g.87683198G>A"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86670970G>A"	""	"pathogenic (recessive)"	""
"0000822634"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822635"	"1"	"90"	"8"	"87683198"	"87683198"	"subst"	"6.09201E-5"	"00006"	"CNGB3_000055"	"g.87683198G>A"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86670970G>A"	""	"pathogenic (recessive)"	""
"0000822636"	"1"	"90"	"8"	"87683198"	"87683198"	"subst"	"6.09201E-5"	"00006"	"CNGB3_000055"	"g.87683198G>A"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86670970G>A"	""	"pathogenic (recessive)"	""
"0000822637"	"1"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic (recessive)"	""
"0000822638"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822639"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822640"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822641"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822642"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822643"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822644"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822645"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822646"	"3"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"00006"	"CNGB3_000054"	"g.87679362C>G"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667134C>G"	""	"pathogenic (recessive)"	""
"0000822647"	"3"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"00006"	"CNGB3_000054"	"g.87679362C>G"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667134C>G"	""	"pathogenic (recessive)"	""
"0000822648"	"3"	"90"	"8"	"87679223"	"87679223"	"subst"	"8.12288E-6"	"00006"	"CNGB3_000081"	"g.87679223T>C"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666995T>C"	""	"pathogenic (recessive)"	""
"0000822649"	"3"	"90"	"8"	"87679223"	"87679223"	"subst"	"8.12288E-6"	"00006"	"CNGB3_000081"	"g.87679223T>C"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666995T>C"	""	"pathogenic (recessive)"	""
"0000822650"	"3"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00006"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	""	"pathogenic (recessive)"	""
"0000822651"	"1"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00006"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	""	"pathogenic (recessive)"	""
"0000822652"	"1"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00006"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	""	"pathogenic (recessive)"	""
"0000822653"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000822654"	"1"	"90"	"8"	"87683198"	"87683198"	"subst"	"6.09201E-5"	"00006"	"CNGB3_000055"	"g.87683198G>A"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86670970G>A"	""	"pathogenic (recessive)"	""
"0000822655"	"3"	"90"	"8"	"87755742"	"87755751"	"del"	"0"	"00006"	"CNGB3_000082"	"g.87755742_87755751del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.105_114delTCAGTCTCAG"	""	"Germline"	""	""	"0"	""	""	"g.86743514_86743523del"	""	"pathogenic (recessive)"	""
"0000822656"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822657"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822658"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822659"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822660"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822661"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822662"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822663"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822664"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822665"	"2"	"90"	"8"	"87617644"	"87617644"	"subst"	"0"	"00006"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"pathogenic (recessive)"	""
"0000822666"	"2"	"90"	"8"	"87588136"	"87588136"	"del"	"0"	"00006"	"CNGB3_000050"	"g.87588136del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.2328delC"	""	"Germline"	""	""	"0"	""	""	"g.86575908del"	""	"pathogenic (recessive)"	""
"0000822667"	"2"	"90"	"8"	"87588136"	"87588136"	"del"	"0"	"00006"	"CNGB3_000050"	"g.87588136del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.2328delC"	""	"Germline"	""	""	"0"	""	""	"g.86575908del"	""	"pathogenic (recessive)"	""
"0000822668"	"2"	"90"	"8"	"87679188"	"87679188"	"del"	"0"	"00006"	"CNGB3_000052"	"g.87679188del"	""	"{PMID:Aweidah 2021:34703197}"	""	"c.819delC"	""	"Germline"	""	""	"0"	""	""	"g.86666960del"	""	"pathogenic (recessive)"	""
"0000822669"	"2"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"00006"	"CNGB3_000054"	"g.87679362C>G"	""	"{PMID:Aweidah 2021:34703197}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667134C>G"	""	"pathogenic (recessive)"	""
"0000822860"	"0"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (no qPCR analysis)"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	"SCV000575809"	"likely pathogenic (recessive)"	""
"0000822861"	"0"	"50"	"8"	"87645109"	"87645111"	"del"	"0"	"00006"	"CNGB3_000174"	"g.87645109_87645111del"	""	"{PMID:Mayer 2017:28795510}"	""	"c.1190_1192delGTT¥"	"no variant 2nd chromosome (no qPCR analysis)"	"Germline"	""	""	"0"	""	""	"g.86632881_86632883del"	"SCV000575790"	"VUS"	""
"0000822862"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (no qPCR analysis)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822863"	"0"	"90"	"8"	"87679359"	"87679359"	"subst"	"2.03616E-5"	"00006"	"CNGB3_000075"	"g.87679359G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (no qPCR analysis)"	"Germline"	""	""	"0"	""	""	"g.86667131G>A"	"SCV000575825"	"pathogenic (recessive)"	""
"0000822864"	"0"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"c.819_826del8"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000822865"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822866"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822867"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822868"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822869"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822870"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822871"	"0"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	"SCV000575809"	"likely pathogenic (recessive)"	""
"0000822872"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822873"	"0"	"90"	"8"	"87738832"	"87738832"	"subst"	"0"	"00006"	"CNGB3_000200"	"g.87738832G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (no qPCR analysis)"	"Germline"	""	""	"0"	""	""	"g.86726604G>A"	"SCV000575821"	"pathogenic (recessive)"	""
"0000822874"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822875"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (no qPCR analysis)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822876"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822877"	"0"	"90"	"8"	"87755854"	"87755854"	"subst"	"0"	"00006"	"CNGB3_000207"	"g.87755854A>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86743626A>G"	"SCV000575803"	"pathogenic (recessive)"	""
"0000822878"	"0"	"50"	"8"	"87641230"	"87641230"	"subst"	"0.00213178"	"00006"	"CNGB3_000171"	"g.87641230A>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86629002A>G"	"SCV000575812"	"VUS"	""
"0000822879"	"0"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	"SCV000575809"	"likely pathogenic (recessive)"	""
"0000822880"	"0"	"70"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"00006"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86644689A>C"	"SCV000575846"	"likely pathogenic (recessive)"	""
"0000822881"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (no qPCR analysis)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822882"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822883"	"0"	"70"	"8"	"87641222"	"87641222"	"subst"	"0.000577673"	"00006"	"CNGB3_000062"	"g.87641222A>C"	""	"{PMID:Mayer 2017:28795510}"	""	"c.1405T>G"	"no variant 2nd chromosome (no qPCR analysis)"	"Germline"	""	""	"0"	""	""	"g.86628994A>C"	"SCV000575813"	"likely pathogenic (recessive)"	""
"0000822884"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (no qPCR analysis)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822885"	"0"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"00006"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	"SCV000575787"	"pathogenic (recessive)"	""
"0000822886"	"0"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"00006"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	"SCV000575787"	"pathogenic (recessive)"	""
"0000822887"	"0"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	"SCV000575809"	"likely pathogenic (recessive)"	""
"0000822888"	"0"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	"SCV000575809"	"likely pathogenic (recessive)"	""
"0000822889"	"0"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	"SCV000575809"	"likely pathogenic (recessive)"	""
"0000822890"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822891"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822892"	"21"	"70"	"8"	"87679199"	"87679199"	"subst"	"0"	"00006"	"CNGB3_000246"	"g.87679199A>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666971A>G"	"SCV000575807"	"likely pathogenic (recessive)"	""
"0000822893"	"21"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	"SCV000575851"	"pathogenic (recessive)"	""
"0000822894"	"21"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"c.819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000822895"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822896"	"21"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00006"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	"SCV000575829"	"pathogenic (recessive)"	""
"0000822897"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822898"	"1"	"90"	"8"	"87591447"	"87591447"	"del"	"4.06643E-6"	"00006"	"CNGB3_000216"	"g.87591447del"	""	"{PMID:Mayer 2017:28795510}"	""	"c.1815delT"	""	"Germline"	""	""	"0"	""	""	"g.86579219del"	"SCV000575800"	"pathogenic (recessive)"	""
"0000822899"	"11"	"90"	"8"	"87638255"	"87638255"	"delins"	"0"	"00006"	"CNGB3_000227"	"g.87638255delinsAC"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86626027delinsAC"	"SCV000575798"	"pathogenic (recessive)"	""
"0000822900"	"11"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822901"	"11"	"90"	"8"	"87755761"	"87755761"	"dup"	"0"	"00006"	"CNGB3_000263"	"g.87755761dup"	""	"{PMID:Mayer 2017:28795510}"	""	"c.95dupA"	""	"Germline"	""	""	"0"	""	""	"g.86743533dup"	"SCV000575775"	"pathogenic (recessive)"	""
"0000822902"	"21"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822903"	"21"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822904"	"11"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822905"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822906"	"11"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822907"	"3"	"90"	"8"	"87586163"	"87683327"	"del"	"0"	"00006"	"CNGB3_000211"	"g.(?_87586163)_(87683327_87738758)del"	""	"{PMID:Mayer 2017:28795510}"	""	"del ex4-18"	""	"Germline"	""	""	"0"	""	""	"g.(?_86573935)_(86671099_86726530)del"	"SCV000575865"	"pathogenic (recessive)"	""
"0000822908"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (no qPCR analysis)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822909"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822910"	"0"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	"SCV000575851"	"pathogenic (recessive)"	""
"0000822911"	"0"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (no qPCR analysis)"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	"SCV000575809"	"likely pathogenic (recessive)"	""
"0000822912"	"0"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"00006"	"CNGB3_000054"	"g.87679362C>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86667134C>G"	"SCV000575843"	"pathogenic (recessive)"	""
"0000822913"	"0"	"50"	"8"	"87656104"	"87656104"	"subst"	"0"	"00006"	"CNGB3_000123"	"g.87656104G>C"	""	"{PMID:Mayer 2017:28795510}"	""	"c.1056-3C>G"	"no variant 2nd chromosome (no qPCR analysis)"	"Germline"	""	""	"0"	""	""	"g.86643876G>C"	"SCV000575847"	"VUS"	""
"0000822914"	"0"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"00006"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Mayer 2017:28795510}"	""	""	"no variant 2nd chromosome (qPCR analysis negative)"	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	"SCV000575787"	"pathogenic (recessive)"	""
"0000822915"	"11"	"90"	"8"	"87664544"	"87675142"	"dup"	"0"	"00006"	"CNGB3_000243"	"g.87664544_87675142dup"	""	"{PMID:Mayer 2017:28795510}"	""	"dup ex7 (86,652,314_86,662,912dup)"	""	"Germline"	""	""	"0"	""	""	"g.86652316_86662914dup"	"SCV000575866"	"pathogenic (recessive)"	""
"0000822916"	"11"	"90"	"8"	"87610806"	"87619100"	"del"	"0"	"00006"	"CNGB3_000219"	"g.87610806_87619100del"	""	"{PMID:Mayer 2017:28795510}"	""	"del ex15 (g.86598577_86606871del)"	""	"Germline"	""	""	"0"	""	""	"g.86598578_86606872del"	"SCV000575869"	"pathogenic (recessive)"	""
"0000822917"	"11"	"90"	"8"	"87599688"	"87662939"	"delins"	"0"	"00006"	"CNGB3_000218"	"g.87599688_87662939delins[KY923049.2:g.1_466inv]"	""	"{PMID:Mayer 2017:28795510}"	""	"del ex8-15 (g.86587460_86650711delinsKY923049.2 g.1_466)"	"inserted sequence 0.994 identical to NC_000008.11:g.85003630_85004075"	"Germline"	""	""	"0"	""	""	"g.86587460_86650711delins[KY923049.2:g.1_466inv]"	"SCV000575867"	"pathogenic (recessive)"	""
"0000822918"	"2"	"90"	"8"	"87586163"	"87623900"	"del"	"0"	"00006"	"CNGB3_000210"	"g.(?_87586163)_(87623900_87638210)del"	""	"{PMID:Mayer 2017:28795510}"	""	"del ex14-18"	""	"Germline"	""	""	"0"	""	""	"g.(?_86573935)_(86611672_86625982)del"	"SCV000575868"	"pathogenic (recessive)"	""
"0000822919"	"11"	"90"	"8"	"87723573"	"87723574"	"ins"	"0"	"00006"	"CNGB3_000257"	"g.87723573_87723574ins[ATGGTATACACGTGTATACAC;87624822_87723573]"	""	"{PMID:Mayer 2017:28795510}"	""	"dup ex4-7 (g.86688947_86688948insMF045863.1 g.1_36978)"	""	"Germline"	""	""	"0"	""	""	"g.86688947_86688948ins[ATGGTATACACGTGTATACAC;86651991_86688947]"	"SCV000575863"	"pathogenic (recessive)"	""
"0000822920"	"2"	"90"	"8"	"87723573"	"87723574"	"ins"	"0"	"00006"	"CNGB3_000257"	"g.87723573_87723574ins[ATGGTATACACGTGTATACAC;87624822_87723573]"	""	"{PMID:Mayer 2017:28795510}"	""	"dup ex4-7 (g.86688947_86688948insMF045863.1 g.1_36978)"	""	"Germline"	""	""	"0"	""	""	"g.86688947_86688948ins[ATGGTATACACGTGTATACAC;86651991_86688947]"	"SCV000575863"	"pathogenic (recessive)"	""
"0000822921"	"2"	"90"	"8"	"87723573"	"87723574"	"ins"	"0"	"00006"	"CNGB3_000257"	"g.87723573_87723574ins[ATGGTATACACGTGTATACAC;87624822_87723573]"	""	"{PMID:Mayer 2017:28795510}"	""	"dup ex4-7 (g.86688947_86688948insMF045863.1 g.1_36978)"	""	"Germline"	""	""	"0"	""	""	"g.86688947_86688948ins[ATGGTATACACGTGTATACAC;86651991_86688947]"	"SCV000575863"	"pathogenic (recessive)"	""
"0000822922"	"21"	"90"	"8"	"87723573"	"87723574"	"ins"	"0"	"00006"	"CNGB3_000258"	"g.87723573_87723574ins[AAGCTCTGTCTTTGCCTG;87624822_87723573]"	""	"{PMID:Mayer 2017:28795510}"	""	"dup ex4-13 (g.86,711,345_86,711,346insMF045864.2 g.1_98770)"	""	"Germline"	""	""	"0"	""	""	"g.86711345_86711346ins[AAGCTCTGTCTTTGCCTG;86612594_86711345]"	"SCV000575864"	"pathogenic (recessive)"	""
"0000822923"	"21"	"90"	"8"	"87664544"	"87675142"	"dup"	"0"	"00006"	"CNGB3_000243"	"g.87664544_87675142dup"	""	"{PMID:Mayer 2017:28795510}"	""	"dup ex7 (86,652,314_86,662,912dup)"	""	"Germline"	""	""	"0"	""	""	"g.86652316_86662914dup"	"SCV000575866"	"pathogenic (recessive)"	""
"0000822924"	"21"	"90"	"8"	"87664544"	"87675142"	"dup"	"0"	"00006"	"CNGB3_000243"	"g.87664544_87675142dup"	""	"{PMID:Mayer 2017:28795510}"	""	"dup ex7 (86,652,314_86,662,912dup)"	""	"Germline"	""	""	"0"	""	""	"g.86652316_86662914dup"	"SCV000575866"	"pathogenic (recessive)"	""
"0000822925"	"11"	"90"	"8"	"87664544"	"87675142"	"dup"	"0"	"00006"	"CNGB3_000243"	"g.87664544_87675142dup"	""	"{PMID:Mayer 2017:28795510}"	""	"dup ex7 (86,652,314_86,662,912dup)"	""	"Germline"	""	""	"0"	""	""	"g.86652316_86662914dup"	"SCV000575866"	"pathogenic (recessive)"	""
"0000822926"	"11"	"90"	"8"	"87664544"	"87675142"	"dup"	"0"	"00006"	"CNGB3_000243"	"g.87664544_87675142dup"	""	"{PMID:Mayer 2017:28795510}"	""	"dup ex7 (86,652,314_86,662,912dup)"	""	"Germline"	""	""	"0"	""	""	"g.86652316_86662914dup"	"SCV000575866"	"pathogenic (recessive)"	""
"0000822927"	"21"	"90"	"8"	"87590194"	"87595219"	"del"	"0"	"00006"	"CNGB3_000213"	"g.87590194_87595219del"	""	"{PMID:Mayer 2017:28795510}"	""	"del ex16-17 (86577950_86582975del)"	""	"Germline"	""	""	"0"	""	""	"g.86577966_86582991del"	"SCV000575870"	"pathogenic (recessive)"	""
"0000822928"	"2"	"90"	"8"	"87755726"	"87755903"	"del"	"0"	"00006"	"CNGB3_000262"	"g.(87751965_87755726)_(87755903_?)del"	""	"{PMID:Mayer 2017:28795510}"	""	"del ex1"	""	"Germline"	""	""	"0"	""	""	"g.(86739737_86743498)_(86743675_?)del"	"SCV000575861"	"pathogenic (recessive)"	""
"0000822929"	"21"	"90"	"8"	"87664544"	"87675142"	"dup"	"0"	"00006"	"CNGB3_000243"	"g.87664544_87675142dup"	""	"{PMID:Mayer 2017:28795510}"	""	"dup ex7 (86,652,314_86,662,912dup)"	""	"Germline"	""	""	"0"	""	""	"g.86652316_86662914dup"	"SCV000575866"	"pathogenic (recessive)"	""
"0000822964"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Méjécase 2020:32783370}"	""	"CNGB3 c.1148del p.(Thr38311efs * 13)"	"homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000822965"	"3"	"70"	"8"	"87656094"	"87656094"	"subst"	"2.04108E-5"	"00000"	"CNGB3_000178"	"g.87656094G>A"	""	"{PMID:Méjécase 2020:32783370}"	""	"CNGB3 c.1063C>T p.(Arg355 *)"	"homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643866G>A"	""	"likely pathogenic"	""
"0000822983"	"3"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00006"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	"SCV000575829"	"pathogenic (recessive)"	""
"0000822984"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}, includes data {PMID:Kohl 2005:15657609}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000822985"	"3"	"90"	"8"	"87645022"	"87645022"	"dup"	"0"	"00006"	"CNGB3_000233"	"g.87645022dup"	""	"{PMID:Mayer 2017:28795510}"	""	"1285dupT"	""	"Germline"	""	""	"0"	""	""	"g.86632794dup"	"SCV000575792"	"pathogenic (recessive)"	""
"0000822986"	"3"	"90"	"8"	"87641196"	"87641197"	"delins"	"0"	"00006"	"CNGB3_000119"	"g.87641196_87641197delinsG"	""	"{PMID:Mayer 2017:28795510}"	""	"1430_1431delinsC#"	""	"Germline"	""	""	"0"	""	""	"g.86628968_86628969delinsG"	"SCV000575795"	"pathogenic (recessive)"	""
"0000822987"	"3"	"70"	"8"	"87641180"	"87641180"	"subst"	"0"	"00006"	"CNGB3_000229"	"g.87641180A>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628952A>C"	"SCV000575814"	"likely pathogenic (recessive)"	""
"0000822988"	"3"	"90"	"8"	"87641146"	"87641146"	"subst"	"0"	"00006"	"CNGB3_000035"	"g.87641146C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628918C>T"	"SCV000575850"	"pathogenic (recessive)"	""
"0000822989"	"3"	"90"	"8"	"87638274"	"87638274"	"del"	"0"	"00006"	"CNGB3_000228"	"g.87638274del"	""	"{PMID:Mayer 2017:28795510}"	""	"1516delG"	""	"Germline"	""	""	"0"	""	""	"g.86626046del"	"SCV000575797"	"pathogenic (recessive)"	""
"0000822990"	"3"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	"SCV000575851"	"pathogenic (recessive)"	""
"0000822991"	"3"	"90"	"8"	"87588241"	"87588241"	"del"	"0"	"00006"	"CNGB3_000057"	"g.87588241del"	""	"{PMID:Mayer 2017:28795510}"	""	"2221delG"	""	"Germline"	""	""	"0"	""	""	"g.86576013del"	"SCV000575801"	"pathogenic (recessive)"	""
"0000822992"	"3"	"90"	"8"	"87588103"	"87588103"	"del"	"0"	"00006"	"CNGB3_000212"	"g.87588103del"	""	"{PMID:Mayer 2017:28795510}"	""	"2359delA"	""	"Germline"	""	""	"0"	""	""	"g.86575875del"	"SCV000575802"	"pathogenic (recessive)"	""
"0000822993"	"3"	"70"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"00006"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644689A>C"	"SCV000575846"	"likely pathogenic (recessive)"	""
"0000822994"	"3"	"90"	"8"	"87656094"	"87656094"	"subst"	"2.04108E-5"	"00006"	"CNGB3_000178"	"g.87656094G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643866G>A"	"SCV000575830"	"pathogenic (recessive)"	""
"0000822995"	"3"	"90"	"8"	"87656038"	"87656038"	"subst"	"0"	"00006"	"CNGB3_000237"	"g.87656038C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643810C>T"	"SCV000575831"	"pathogenic (recessive)"	""
"0000822996"	"3"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	"SCV000575809"	"likely pathogenic (recessive)"	""
"0000822997"	"3"	"90"	"8"	"87644996"	"87644996"	"subst"	"0"	"00006"	"CNGB3_000036"	"g.87644996G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632768G>A"	"SCV000575810"	"pathogenic (recessive)"	""
"0000822998"	"3"	"90"	"8"	"87641195"	"87641195"	"subst"	"2.03383E-5"	"00006"	"CNGB3_000122"	"g.87641195G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628967G>A"	"SCV000575836"	"pathogenic (recessive)"	""
"0000822999"	"3"	"90"	"8"	"87755826"	"87755826"	"dup"	"0"	"00006"	"CNGB3_000264"	"g.87755826dup"	""	"{PMID:Mayer 2017:28795510}"	""	"31dupG"	""	"Germline"	""	""	"0"	""	""	"g.86743598dup"	"SCV000575774"	"pathogenic (recessive)"	""
"0000823000"	"3"	"90"	"8"	"87680283"	"87680283"	"subst"	"2.8434E-5"	"00006"	"CNGB3_000077"	"g.87680283G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86668055G>A"	"SCV000575824"	"pathogenic (recessive)"	""
"0000823001"	"3"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"00006"	"CNGB3_000054"	"g.87679362C>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667134C>G"	"SCV000575843"	"pathogenic (recessive)"	""
"0000823002"	"3"	"90"	"8"	"87679359"	"87679359"	"subst"	"2.03616E-5"	"00006"	"CNGB3_000075"	"g.87679359G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667131G>A"	"SCV000575825"	"pathogenic (recessive)"	""
"0000823003"	"3"	"90"	"8"	"87679299"	"87679303"	"delins"	"0"	"00006"	"CNGB3_000249"	"g.87679299_87679303delinsAAAAAC"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667071_86667075delinsAAAAAC"	"SCV000575782"	"pathogenic (recessive)"	""
"0000823004"	"3"	"90"	"8"	"87679303"	"87679303"	"subst"	"0"	"00006"	"CNGB3_000250"	"g.87679303A>T"	""	"{PMID:Mayer 2017:28795510}"	""	"originally reported as Trp234*"	""	"Germline"	""	""	"0"	""	""	"g.86667075A>T"	"SCV000575826"	"pathogenic (recessive)"	""
"0000823005"	"3"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823006"	"3"	"90"	"8"	"87679152"	"87679152"	"subst"	"0"	"00006"	"CNGB3_000128"	"g.87679152C>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666924C>G"	"SCV000575844"	"pathogenic (recessive)"	""
"0000823007"	"3"	"90"	"8"	"87660117"	"87660117"	"subst"	"0"	"00006"	"CNGB3_000096"	"g.87660117T>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86647889T>A"	"SCV000575845"	"pathogenic (recessive)"	""
"0000823008"	"1"	"90"	"8"	"87751886"	"87751886"	"subst"	"4.27947E-6"	"00006"	"CNGB3_000261"	"g.87751886G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86739658G>A"	"SCV000575820"	"pathogenic (recessive)"	""
"0000823009"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823010"	"1"	"90"	"8"	"87683274"	"87683274"	"subst"	"4.06154E-6"	"00006"	"CNGB3_000090"	"g.87683274G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86671046G>A"	"SCV000575823"	"pathogenic (recessive)"	""
"0000823011"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823012"	"1"	"90"	"8"	"87656905"	"87656905"	"dup"	"0"	"00006"	"CNGB3_000239"	"g.87656905dup"	""	"{PMID:Mayer 2017:28795510}"	""	"1005dupT"	""	"Germline"	""	""	"0"	""	""	"g.86644677dup"	"SCV000575788"	"pathogenic (recessive)"	""
"0000823013"	"1"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00006"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	"SCV000575829"	"pathogenic (recessive)"	""
"0000823014"	"1"	"90"	"8"	"87656103"	"87656103"	"subst"	"4.08293E-6"	"00006"	"CNGB3_000238"	"g.87656103T>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643875T>C"	"SCV000575848"	"pathogenic (recessive)"	""
"0000823015"	"1"	"90"	"8"	"87656094"	"87656094"	"subst"	"2.04108E-5"	"00006"	"CNGB3_000178"	"g.87656094G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643866G>A"	"SCV000575830"	"pathogenic (recessive)"	""
"0000823016"	"1"	"90"	"8"	"87755744"	"87755744"	"subst"	"0"	"00006"	"CNGB3_000134"	"g.87755744G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86743516G>A"	"SCV000575819"	"pathogenic (recessive)"	""
"0000823017"	"1"	"90"	"8"	"87751886"	"87751886"	"subst"	"4.27947E-6"	"00006"	"CNGB3_000261"	"g.87751886G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86739658G>A"	"SCV000575820"	"pathogenic (recessive)"	""
"0000823018"	"1"	"90"	"8"	"87738842"	"87738842"	"del"	"0"	"00006"	"CNGB3_000260"	"g.87738842del"	""	"{PMID:Mayer 2017:28795510}"	""	"257delC"	""	"Germline"	""	""	"0"	""	""	"g.86726614del"	"SCV000575777"	"pathogenic (recessive)"	""
"0000823019"	"1"	"90"	"8"	"87755828"	"87755828"	"dup"	"0"	"00006"	"CNGB3_000265"	"g.87755828dup"	""	"{PMID:Mayer 2017:28795510}"	""	"29dupA"	""	"Germline"	""	""	"0"	""	""	"g.86743600dup"	"SCV000575773"	"pathogenic (recessive)"	""
"0000823020"	"1"	"70"	"8"	"87683198"	"87683198"	"subst"	"6.09201E-5"	"00006"	"CNGB3_000055"	"g.87683198G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86670970G>A"	"SCV000575805"	"likely pathogenic (recessive)"	""
"0000823021"	"1"	"90"	"8"	"87680301"	"87680302"	"del"	"0"	"00006"	"CNGB3_000253"	"g.87680301_87680302del"	""	"{PMID:Mayer 2017:28795510}"	""	"589_590delTT"	""	"Germline"	""	""	"0"	""	""	"g.86668073_86668074del"	"SCV000575780"	"pathogenic (recessive)"	""
"0000823022"	"1"	"90"	"8"	"87680283"	"87680283"	"subst"	"2.8434E-5"	"00006"	"CNGB3_000077"	"g.87680283G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86668055G>A"	"SCV000575824"	"pathogenic (recessive)"	""
"0000823023"	"1"	"90"	"8"	"87680245"	"87680245"	"subst"	"4.06204E-6"	"00006"	"CNGB3_000252"	"g.87680245A>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86668017A>G"	"SCV000575842"	"pathogenic (recessive)"	""
"0000823024"	"1"	"70"	"8"	"87680247"	"87680247"	"subst"	"0"	"00006"	"CNGB3_000185"	"g.87680247C>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86668019C>G"	"SCV000575806"	"likely pathogenic (recessive)"	""
"0000823025"	"1"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"00006"	"CNGB3_000054"	"g.87679362C>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667134C>G"	"SCV000575843"	"pathogenic (recessive)"	""
"0000823026"	"1"	"90"	"8"	"87679359"	"87679359"	"subst"	"2.03616E-5"	"00006"	"CNGB3_000075"	"g.87679359G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667131G>A"	"SCV000575825"	"pathogenic (recessive)"	""
"0000823027"	"1"	"90"	"8"	"87679323"	"87679323"	"dup"	"0"	"00006"	"CNGB3_000251"	"g.87679323dup"	""	"{PMID:Mayer 2017:28795510}"	""	"682dupG"	""	"Germline"	""	""	"0"	""	""	"g.86667095dup"	"SCV000575781"	"pathogenic (recessive)"	""
"0000823028"	"1"	"90"	"8"	"87679299"	"87679299"	"delins"	"0"	"00006"	"CNGB3_000248"	"g.87679299delinsAA"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667071delinsAA"	"SCV000575783"	"pathogenic (recessive)"	""
"0000823029"	"1"	"90"	"8"	"87679249"	"87679249"	"subst"	"4.06144E-6"	"00006"	"CNGB3_000247"	"g.87679249G>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667021G>C"	"SCV000575827"	"pathogenic (recessive)"	""
"0000823030"	"1"	"90"	"8"	"87679213"	"87679216"	"del"	"0"	"00006"	"CNGB3_000184"	"g.87679213_87679216del"	""	"{PMID:Mayer 2017:28795510}"	""	"791_794delACCT"	""	"Germline"	""	""	"0"	""	""	"g.86666985_86666988del"	"SCV000575784"	"pathogenic (recessive)"	""
"0000823031"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823032"	"1"	"90"	"8"	"87679152"	"87679152"	"subst"	"0"	"00006"	"CNGB3_000128"	"g.87679152C>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666924C>G"	"SCV000575844"	"pathogenic (recessive)"	""
"0000823033"	"1"	"90"	"8"	"87666261"	"87666261"	"subst"	"0"	"00006"	"CNGB3_000244"	"g.87666261G>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86654033G>C"	"SCV000575828"	"pathogenic (recessive)"	""
"0000823034"	"1"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"00006"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	"SCV000575787"	"pathogenic (recessive)"	""
"0000823035"	"1"	"90"	"8"	"87660093"	"87660093"	"subst"	"0"	"00006"	"CNGB3_000242"	"g.87660093G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86647865G>A"	"SCV000575808"	"pathogenic (recessive)"	""
"0000823036"	"1"	"70"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"00006"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644689A>C"	"SCV000575846"	"likely pathogenic (recessive)"	""
"0000823037"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823038"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823039"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823040"	"1"	"90"	"8"	"87755744"	"87755744"	"subst"	"0"	"00006"	"CNGB3_000134"	"g.87755744G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86743516G>A"	"SCV000575819"	"pathogenic (recessive)"	""
"0000823041"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823042"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823043"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823044"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823045"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823046"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823047"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823048"	"1"	"90"	"8"	"87751886"	"87751886"	"subst"	"4.27947E-6"	"00006"	"CNGB3_000261"	"g.87751886G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86739658G>A"	"SCV000575820"	"pathogenic (recessive)"	""
"0000823049"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823050"	"1"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"00006"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	"SCV000575787"	"pathogenic (recessive)"	""
"0000823051"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823052"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823053"	"1"	"90"	"8"	"87751904"	"87751904"	"del"	"0"	"00006"	"CNGB3_000098"	"g.87751904del"	""	"{PMID:Mayer 2017:28795510}"	""	"190delG"	""	"Germline"	""	""	"0"	""	""	"g.86739676del"	"SCV000575776"	"pathogenic (recessive)"	""
"0000823054"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823055"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823056"	"1"	"90"	"8"	"87738796"	"87738796"	"subst"	"0"	"00006"	"CNGB3_000046"	"g.87738796G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86726568G>A"	"SCV000575822"	"pathogenic (recessive)"	""
"0000823057"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823058"	"1"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00006"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	"SCV000575829"	"pathogenic (recessive)"	""
"0000823059"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823060"	"1"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	"SCV000575809"	"likely pathogenic (recessive)"	""
"0000823061"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823062"	"1"	"90"	"8"	"87755854"	"87755854"	"subst"	"0"	"00006"	"CNGB3_000207"	"g.87755854A>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86743626A>G"	"SCV000575803"	"pathogenic (recessive)"	""
"0000823063"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823064"	"1"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	"SCV000575851"	"pathogenic (recessive)"	""
"0000823065"	"1"	"90"	"8"	"87656094"	"87656094"	"subst"	"2.04108E-5"	"00006"	"CNGB3_000178"	"g.87656094G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643866G>A"	"SCV000575830"	"pathogenic (recessive)"	""
"0000823066"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823067"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823068"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823069"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823070"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823071"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823072"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823073"	"1"	"90"	"8"	"87641195"	"87641195"	"subst"	"2.03383E-5"	"00006"	"CNGB3_000122"	"g.87641195G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628967G>A"	"SCV000575836"	"pathogenic (recessive)"	""
"0000823074"	"1"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"00006"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	"SCV000575787"	"pathogenic (recessive)"	""
"0000823075"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823076"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823077"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823078"	"1"	"90"	"8"	"87683271"	"87683272"	"delins"	"0"	"00006"	"CNGB3_000256"	"g.87683271_87683272delinsTCACCAGGA"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86671043_86671044delinsTCACCAGGA"	"SCV000575779"	"pathogenic (recessive)"	""
"0000823079"	"1"	"70"	"8"	"87683198"	"87683198"	"subst"	"6.09201E-5"	"00006"	"CNGB3_000055"	"g.87683198G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86670970G>A"	"SCV000575805"	"likely pathogenic (recessive)"	""
"0000823080"	"1"	"90"	"8"	"87755744"	"87755744"	"subst"	"0"	"00006"	"CNGB3_000134"	"g.87755744G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86743516G>A"	"SCV000575819"	"pathogenic (recessive)"	""
"0000823081"	"1"	"90"	"8"	"87738796"	"87738796"	"subst"	"0"	"00006"	"CNGB3_000046"	"g.87738796G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86726568G>A"	"SCV000575822"	"pathogenic (recessive)"	""
"0000823082"	"1"	"90"	"8"	"87679323"	"87679323"	"dup"	"0"	"00006"	"CNGB3_000251"	"g.87679323dup"	""	"{PMID:Mayer 2017:28795510}"	""	"682dupG"	""	"Germline"	""	""	"0"	""	""	"g.86667095dup"	"SCV000575781"	"pathogenic (recessive)"	""
"0000823083"	"1"	"90"	"8"	"87738816"	"87738819"	"del"	"0"	"00006"	"CNGB3_000259"	"g.87738816_87738819del"	""	"{PMID:Mayer 2017:28795510}"	""	"281_284delCAAC"	""	"Germline"	""	""	"0"	""	""	"g.86726588_86726591del"	"SCV000575778"	"pathogenic (recessive)"	""
"0000823084"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823085"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823086"	"2"	"90"	"8"	"87656905"	"87656905"	"dup"	"0"	"00006"	"CNGB3_000239"	"g.87656905dup"	""	"{PMID:Mayer 2017:28795510}"	""	"1005dupT"	""	"Germline"	""	""	"0"	""	""	"g.86644677dup"	"SCV000575788"	"pathogenic (recessive)"	""
"0000823087"	"2"	"90"	"8"	"87656905"	"87656905"	"dup"	"0"	"00006"	"CNGB3_000239"	"g.87656905dup"	""	"{PMID:Mayer 2017:28795510}"	""	"1005dupT"	""	"Germline"	""	""	"0"	""	""	"g.86644677dup"	"SCV000575788"	"pathogenic (recessive)"	""
"0000823088"	"2"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00006"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	"SCV000575829"	"pathogenic (recessive)"	""
"0000823089"	"2"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00006"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	"SCV000575829"	"pathogenic (recessive)"	""
"0000823090"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823091"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823092"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823093"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823094"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823095"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823096"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823097"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823098"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823099"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823100"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823101"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823102"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823103"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823104"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823105"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823106"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823107"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823108"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823109"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823110"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823111"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823112"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823113"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823114"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Mayer 2017:28795510}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	"SCV000575789"	"pathogenic (recessive)"	""
"0000823115"	"2"	"90"	"8"	"87645106"	"87645106"	"subst"	"0"	"00006"	"CNGB3_000235"	"g.87645106A>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632878A>C"	"SCV000575832"	"pathogenic (recessive)"	""
"0000823116"	"2"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	"SCV000575809"	"likely pathogenic (recessive)"	""
"0000823117"	"2"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	"SCV000575809"	"likely pathogenic (recessive)"	""
"0000823118"	"2"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	"SCV000575809"	"likely pathogenic (recessive)"	""
"0000823119"	"2"	"90"	"8"	"87645057"	"87645057"	"subst"	"0"	"00006"	"CNGB3_000100"	"g.87645057G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632829G>A"	"SCV000575833"	"pathogenic (recessive)"	""
"0000823120"	"2"	"90"	"8"	"87645045"	"87645045"	"subst"	"4.06981E-6"	"00006"	"CNGB3_000234"	"g.87645045C>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632817C>A"	"SCV000575834"	"pathogenic (recessive)"	""
"0000823121"	"2"	"90"	"8"	"87645022"	"87645022"	"del"	"0"	"00006"	"CNGB3_000095"	"g.87645022del"	""	"{PMID:Mayer 2017:28795510}"	""	"1285delT"	""	"Germline"	""	""	"0"	""	""	"g.86632794del"	"SCV000575791"	"pathogenic (recessive)"	""
"0000823122"	"2"	"90"	"8"	"87645022"	"87645022"	"dup"	"0"	"00006"	"CNGB3_000233"	"g.87645022dup"	""	"{PMID:Mayer 2017:28795510}"	""	"1285dupT"	""	"Germline"	""	""	"0"	""	""	"g.86632794dup"	"SCV000575792"	"pathogenic (recessive)"	""
"0000823123"	"2"	"90"	"8"	"87645022"	"87645022"	"dup"	"0"	"00006"	"CNGB3_000233"	"g.87645022dup"	""	"{PMID:Mayer 2017:28795510}"	""	"1285dupT"	""	"Germline"	""	""	"0"	""	""	"g.86632794dup"	"SCV000575792"	"pathogenic (recessive)"	""
"0000823124"	"2"	"90"	"8"	"87645003"	"87645004"	"del"	"0"	"00006"	"CNGB3_000232"	"g.87645003_87645004del"	""	"{PMID:Mayer 2017:28795510}"	""	"1299_1300delGT"	""	"Germline"	""	""	"0"	""	""	"g.86632775_86632776del"	"SCV000575793"	"pathogenic (recessive)"	""
"0000823125"	"2"	"90"	"8"	"87644996"	"87644996"	"subst"	"0"	"00006"	"CNGB3_000036"	"g.87644996G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632768G>A"	"SCV000575810"	"pathogenic (recessive)"	""
"0000823126"	"2"	"50"	"8"	"87644976"	"87644976"	"subst"	"0"	"00006"	"CNGB3_000231"	"g.87644976T>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632748T>C"	"SCV000575849"	"VUS"	""
"0000823127"	"2"	"90"	"8"	"87641262"	"87641262"	"del"	"0"	"00006"	"CNGB3_000230"	"g.87641262del"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86629034del"	"SCV000575794"	"pathogenic (recessive)"	""
"0000823128"	"2"	"70"	"8"	"87641230"	"87641230"	"subst"	"0"	"00006"	"CNGB3_000120"	"g.87641230A>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86629002A>T"	"SCV000575811"	"likely pathogenic (recessive)"	""
"0000823129"	"2"	"90"	"8"	"87641201"	"87641201"	"subst"	"0"	"00006"	"CNGB3_000094"	"g.87641201G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628973G>A"	"SCV000575835"	"pathogenic (recessive)"	""
"0000823130"	"2"	"90"	"8"	"87641195"	"87641195"	"subst"	"2.03383E-5"	"00006"	"CNGB3_000122"	"g.87641195G>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628967G>A"	"SCV000575836"	"pathogenic (recessive)"	""
"0000823131"	"2"	"70"	"8"	"87641180"	"87641180"	"subst"	"0"	"00006"	"CNGB3_000229"	"g.87641180A>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628952A>C"	"SCV000575814"	"likely pathogenic (recessive)"	""
"0000823132"	"2"	"90"	"8"	"87641167"	"87641167"	"subst"	"0"	"00006"	"CNGB3_000084"	"g.87641167C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628939C>T"	"SCV000575837"	"pathogenic (recessive)"	""
"0000823133"	"2"	"70"	"8"	"87641180"	"87641180"	"subst"	"0"	"00006"	"CNGB3_000229"	"g.87641180A>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628952A>C"	"SCV000575814"	"likely pathogenic (recessive)"	""
"0000823134"	"2"	"70"	"8"	"87641180"	"87641180"	"subst"	"0"	"00006"	"CNGB3_000229"	"g.87641180A>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628952A>C"	"SCV000575814"	"likely pathogenic (recessive)"	""
"0000823135"	"2"	"90"	"8"	"87638220"	"87638223"	"dup"	"0"	"00006"	"CNGB3_000226"	"g.87638220_87638223dup"	""	"{PMID:Mayer 2017:28795510}"	""	"1566_1569dupCGAC"	""	"Germline"	""	""	"0"	""	""	"g.86625992_86625995dup"	"SCV000575799"	"pathogenic (recessive)"	""
"0000823136"	"2"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	"SCV000575851"	"pathogenic (recessive)"	""
"0000823137"	"2"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	"SCV000575851"	"pathogenic (recessive)"	""
"0000823138"	"2"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	"SCV000575851"	"pathogenic (recessive)"	""
"0000823139"	"2"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	"SCV000575851"	"pathogenic (recessive)"	""
"0000823140"	"2"	"90"	"8"	"87638210"	"87638210"	"subst"	"0"	"00006"	"CNGB3_000225"	"g.87638210C>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>A"	"SCV000575852"	"pathogenic (recessive)"	""
"0000823141"	"2"	"90"	"8"	"87623900"	"87623900"	"subst"	"0"	"00006"	"CNGB3_000165"	"g.87623900C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86611672C>T"	"SCV000575854"	"pathogenic (recessive)"	""
"0000823142"	"2"	"90"	"8"	"87623900"	"87623900"	"subst"	"0"	"00006"	"CNGB3_000165"	"g.87623900C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86611672C>T"	"SCV000575854"	"pathogenic (recessive)"	""
"0000823143"	"2"	"90"	"8"	"87623901"	"87623901"	"subst"	"4.08227E-6"	"00006"	"CNGB3_000166"	"g.87623901T>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86611673T>C"	"SCV000575853"	"pathogenic (recessive)"	""
"0000823144"	"2"	"90"	"8"	"87623843"	"87623843"	"subst"	"0"	"00006"	"CNGB3_000089"	"g.87623843A>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86611615A>T"	"SCV000575838"	"pathogenic (recessive)"	""
"0000823145"	"2"	"70"	"8"	"87616444"	"87616444"	"subst"	"0"	"00006"	"CNGB3_000223"	"g.87616444A>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86604216A>C"	"SCV000575855"	"likely pathogenic (recessive)"	""
"0000823146"	"2"	"70"	"8"	"87616351"	"87616351"	"subst"	"0"	"00006"	"CNGB3_000222"	"g.87616351A>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86604123A>G"	"SCV000575816"	"likely pathogenic (recessive)"	""
"0000823147"	"2"	"90"	"8"	"87616321"	"87616321"	"del"	"0"	"00006"	"CNGB3_000221"	"g.87616321del"	""	"{PMID:Mayer 2017:28795510}"	""	"1781+1delG"	""	"Germline"	""	""	"0"	""	""	"g.86604093del"	"SCV000575856"	"pathogenic (recessive)"	""
"0000823148"	"2"	"90"	"8"	"87616320"	"87616320"	"subst"	"0"	"00006"	"CNGB3_000220"	"g.87616320C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86604092C>T"	"SCV000575857"	"pathogenic (recessive)"	""
"0000823149"	"2"	"90"	"8"	"87616320"	"87616320"	"subst"	"4.06709E-6"	"00006"	"CNGB3_000113"	"g.87616320C>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86604092C>G"	"SCV000575858"	"pathogenic (recessive)"	""
"0000823150"	"2"	"90"	"8"	"87591482"	"87591482"	"subst"	"0"	"00006"	"CNGB3_000217"	"g.87591482T>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86579254T>G"	"SCV000575859"	"pathogenic (recessive)"	""
"0000823151"	"2"	"90"	"8"	"87591447"	"87591447"	"del"	"4.06643E-6"	"00006"	"CNGB3_000216"	"g.87591447del"	""	"{PMID:Mayer 2017:28795510}"	""	"1815delT"	""	"Germline"	""	""	"0"	""	""	"g.86579219del"	"SCV000575800"	"pathogenic (recessive)"	""
"0000823152"	"2"	"90"	"8"	"87591447"	"87591447"	"del"	"4.06643E-6"	"00006"	"CNGB3_000216"	"g.87591447del"	""	"{PMID:Mayer 2017:28795510}"	""	"1815delT"	""	"Germline"	""	""	"0"	""	""	"g.86579219del"	"SCV000575800"	"pathogenic (recessive)"	""
"0000823153"	"2"	"70"	"8"	"87591439"	"87591439"	"subst"	"0"	"00006"	"CNGB3_000215"	"g.87591439A>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86579211A>T"	"SCV000575817"	"likely pathogenic (recessive)"	""
"0000823154"	"2"	"90"	"8"	"87590916"	"87590916"	"subst"	"0"	"00006"	"CNGB3_000092"	"g.87590916C>T"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86578688C>T"	"SCV000575860"	"pathogenic (recessive)"	""
"0000823155"	"2"	"50"	"8"	"87590917"	"87590917"	"subst"	"2.43912E-5"	"00006"	"CNGB3_000214"	"g.87590917C>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86578689C>G"	"SCV000575818"	"VUS"	""
"0000823156"	"2"	"90"	"8"	"87680398"	"87680398"	"subst"	"0"	"00006"	"CNGB3_000255"	"g.87680398T>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86668170T>A"	"SCV000575841"	"pathogenic (recessive)"	""
"0000823157"	"2"	"90"	"8"	"87679362"	"87679362"	"subst"	"3.25882E-5"	"00006"	"CNGB3_000054"	"g.87679362C>G"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86667134C>G"	"SCV000575843"	"pathogenic (recessive)"	""
"0000823158"	"2"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823159"	"2"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823160"	"2"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Mayer 2017:28795510}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	"SCV000575785"	"pathogenic (recessive)"	""
"0000823161"	"2"	"90"	"8"	"87666270"	"87666270"	"delins"	"0"	"00006"	"CNGB3_000245"	"g.87666270delinsGTTTG"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86654042delinsGTTTG"	"SCV000575786"	"pathogenic (recessive)"	""
"0000823162"	"2"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"00006"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	"SCV000575787"	"pathogenic (recessive)"	""
"0000823163"	"2"	"70"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"00006"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644689A>C"	"SCV000575846"	"likely pathogenic (recessive)"	""
"0000823164"	"2"	"50"	"8"	"87616429"	"87616429"	"subst"	"0"	"00006"	"CNGB3_000133"	"g.87616429C>A"	""	"{PMID:Mayer 2017:28795510}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86604201C>A"	"SCV000575815"	"VUS"	""
"0000823165"	"3"	"50"	"8"	"87683223"	"87683223"	"subst"	"8.12216E-6"	"00006"	"CNGB3_000208"	"g.87683223T>C"	""	"{PMID:Rojas 2002:12357335}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"VUS"	""
"0000823166"	"3"	"90"	"8"	"87683218"	"87683219"	"ins"	"4.06105E-6"	"00006"	"CNGB3_000209"	"g.87683218_87683219insA"	""	"{PMID:Rojas 2002:12357335}"	""	"492_493insT"	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000823169"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Michaelides 2004:15161866}"	""	"1148delC"	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000823170"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Michaelides 2004:15161866}"	""	"1148delC"	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000823171"	"2"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Michaelides 2004:15161866}"	""	"R403Q"	""	"Germline"	"yes"	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000823220"	"0"	"70"	"8"	"87656915"	"87656917"	"del"	"0"	"00000"	"CNGB3_000277"	"g.87656915_87656917del"	""	"{PMID:Hull 2020:32856788}"	""	"CNBG3 nucleotide 1, protein 1:c.991-3delTAG, p.? nucleotide 2, protein 2:c.1148delC, p.Thr383Ilefs*13"	"heterozygous, ACMG classified, novel (Table 2)"	"Germline"	"?"	""	"0"	""	""	"g.86644687_86644689del"	""	"likely pathogenic"	"ACMG"
"0000823221"	"3"	"50"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Hull 2020:32856788}"	""	"CNBG3 nucleotide 1, protein 1:c.1148delC, p.Thr383Ilefs*13"	"homozygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"VUS"	""
"0000823222"	"3"	"50"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Hull 2020:32856788}"	""	"CNBG3 nucleotide 1, protein 1:c.1148delC, p.Thr383Ilefs*13"	"homozygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"?"	""	"0"	""	""	"g.86643781del"	""	"VUS"	""
"0000823223"	"0"	"50"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Hull 2020:32856788}"	""	"CNBG3 nucleotide 1, protein 1:c.1148delC, p.Thr383Ilefs*13 nucleotide 2, protein 2:c.1578+1G>A, p.?"	"heterozygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"?"	""	"0"	""	""	"g.86643781del"	""	"VUS"	""
"0000823271"	"0"	"50"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Hull 2020:32856788}"	""	"CNBG3 nucleotide 1, protein 1:c.991-3delTAG, p.? nucleotide 2, protein 2:c.1148delC, p.Thr383Ilefs*13"	"heterozygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"?"	""	"0"	""	""	"g.86643781del"	""	"VUS"	""
"0000823273"	"0"	"50"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Hull 2020:32856788}"	""	"CNBG3 nucleotide 1, protein 1:c.1148delC, p.Thr383Ilefs*13 nucleotide 2, protein 2:c.1578+1G>A, p.?"	"heterozygous, ACMG unclassified - no access to supplementary table 2"	"Germline"	"?"	""	"0"	""	""	"g.86625982C>T"	""	"VUS"	""
"0000823568"	"21"	"90"	"8"	"36494957"	"36494957"	"subst"	"0"	"00000"	"CNGB3_000001"	"g.36494957C>T"	""	"{PMID:DiScipio 2020:32881472}"	""	"CNGB3; Transcript NM_019098.4; c.852+4751A>T; g.8:87674402T>A"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.38339074C>T"	""	"pathogenic (recessive)"	"ACMG"
"0000823569"	"21"	"90"	"8"	"87674402"	"87674402"	"subst"	"0"	"00000"	"CNGB3_000001"	"g.87674402T>A"	""	"{PMID:DiScipio 2020:32881472}"	""	"CNGB3; Transcript NM_019098.4; c.852+4751A>T; g.8:87674402T>A"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86662174T>A"	""	"pathogenic (recessive)"	"ACMG"
"0000823570"	"21"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:DiScipio 2020:32881472}"	""	"CNGB3; Transcript NM_019098.4; c.852+4751A>T; g.8:87674402T>A"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0000823572"	"11"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:DiScipio 2020:32881472}"	""	"CNGB3; Transcript NM_019098.4; c.1148delC"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0000823573"	"11"	"90"	"8"	"87674402"	"87674402"	"subst"	"0"	"00000"	"CNGB3_000001"	"g.87674402T>A"	""	"{PMID:DiScipio 2020:32881472}"	""	"CNGB3; Transcript NM_019098.4; c.1148delC"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86662174T>A"	""	"pathogenic (recessive)"	"ACMG"
"0000823574"	"11"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:DiScipio 2020:32881472}"	""	"CNGB3; Transcript NM_019098.4; c.1148delC"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0000823582"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Varsanyi 2005:16319819}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823583"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Varsanyi 2005:16319819}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823584"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Varsanyi 2005:16319819}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823585"	"1"	"90"	"8"	"87755744"	"87755744"	"subst"	"0"	"00006"	"CNGB3_000134"	"g.87755744G>A"	""	"{PMID:Varsanyi 2005:16319819}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86743516G>A"	""	"pathogenic (recessive)"	""
"0000823586"	"1"	"90"	"8"	"87755744"	"87755744"	"subst"	"0"	"00006"	"CNGB3_000134"	"g.87755744G>A"	""	"{PMID:Varsanyi 2005:16319819}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86743516G>A"	""	"pathogenic (recessive)"	""
"0000823587"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Varsanyi 2005:16319819}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000823591"	"2"	"90"	"8"	"87616444"	"87616444"	"subst"	"0"	"00006"	"CNGB3_000223"	"g.87616444A>C"	""	"{PMID:Varsanyi 2005:16319819}"	""	""	"effect on splicing predicted from minigene splicing assay"	"Germline"	""	""	"0"	""	""	"g.86604216A>C"	""	"pathogenic (recessive)"	""
"0000823592"	"2"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Varsanyi 2005:16319819}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000823593"	"2"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Varsanyi 2005:16319819}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000823594"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Varsanyi 2005:16319819}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823601"	"21"	"90"	"8"	"87623900"	"87623900"	"subst"	"0"	"00006"	"CNGB3_000165"	"g.87623900C>T"	""	"{PMID:Wawrocka 2014:25558176}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86611672C>T"	""	"pathogenic (recessive)"	""
"0000823602"	"21"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Wawrocka 2014:25558176}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000823603"	"21"	"90"	"8"	"87683271"	"87683272"	"delins"	"0"	"00006"	"CNGB3_000256"	"g.87683271_87683272delinsTCACCAGGA"	""	"{PMID:Wawrocka 2014:25558176}"	""	"393_394delGCinsTCCTGGTGA"	""	"Germline"	""	""	"0"	""	""	"g.86671043_86671044delinsTCACCAGGA"	""	"pathogenic (recessive)"	""
"0000823604"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Wawrocka 2014:25558176}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823608"	"11"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Wawrocka 2014:25558176}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic (recessive)"	""
"0000823609"	"11"	"90"	"8"	"87645106"	"87645106"	"subst"	"0"	"00006"	"CNGB3_000235"	"g.87645106A>C"	""	"{PMID:Wawrocka 2014:25558176}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632878A>C"	""	"pathogenic (recessive)"	""
"0000823610"	"11"	"90"	"8"	"87680398"	"87680398"	"subst"	"0"	"00006"	"CNGB3_000255"	"g.87680398T>A"	""	"{PMID:Wawrocka 2014:25558176}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86668170T>A"	""	"pathogenic (recessive)"	""
"0000823611"	"2"	"90"	"8"	"87641262"	"87641262"	"del"	"0"	"00006"	"CNGB3_000230"	"g.87641262del"	""	"{PMID:Wawrocka 2014:25558176}"	""	"1366delC"	""	"Germline"	""	""	"0"	""	""	"g.86629034del"	""	"pathogenic (recessive)"	""
"0000823631"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823632"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823633"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823634"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823635"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823636"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823637"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823638"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823639"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823640"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823641"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823642"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823643"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823644"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823645"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823646"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823647"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823648"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823649"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823650"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823651"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823652"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823653"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823654"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823655"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823656"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823657"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823658"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823659"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823660"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823661"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823662"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823663"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823664"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Langlo 2014:274798146}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000823665"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823666"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823667"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823668"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823669"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823670"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823671"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823672"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823673"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823674"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823675"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823676"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823677"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823678"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823679"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823680"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823681"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Langlo 2014:274798146}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823682"	"1"	"90"	"8"	"87645045"	"87645045"	"subst"	"4.06981E-6"	"00006"	"CNGB3_000234"	"g.87645045C>A"	""	"{PMID:Langlo 2014:274798146}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632817C>A"	""	"pathogenic (recessive)"	""
"0000823683"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Langlo 2014:274798146}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000823684"	"1"	"70"	"8"	"87616351"	"87616351"	"subst"	"0"	"00006"	"CNGB3_000222"	"g.87616351A>G"	""	"{PMID:Langlo 2014:274798146}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86604123A>G"	""	"likely pathogenic (recessive)"	""
"0000823685"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Langlo 2014:274798146}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000823686"	"1"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"00006"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Langlo 2014:274798146}"	""	"886_896del11insT"	""	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	""	"pathogenic (recessive)"	""
"0000823687"	"1"	"90"	"8"	"87644994"	"87644994"	"subst"	"4.06924E-6"	"00006"	"CNGB3_000110"	"g.87644994T>G"	""	"{PMID:Langlo 2014:274798146}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632766T>G"	""	"pathogenic (recessive)"	""
"0000823688"	"0"	"90"	"8"	"87680387"	"87680387"	"subst"	"7.3163E-5"	"00006"	"CNGB3_000254"	"g.87680387G>A"	""	"{PMID:Langlo 2014:274798146}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86668159G>A"	""	"pathogenic (recessive)"	""
"0000823689"	"1"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00006"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Langlo 2014:274798146}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	""	"pathogenic (recessive)"	""
"0000823690"	"1"	"70"	"8"	"87660036"	"87660036"	"subst"	"0"	"00006"	"CNGB3_000241"	"g.87660036A>T"	""	"{PMID:Langlo 2014:274798146}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86647808A>T"	""	"likely pathogenic (recessive)"	""
"0000823691"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Langlo 2014:274798146}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000823692"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"00006"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Langlo 2014:274798146}"	""	"819_826del8"	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic (recessive)"	""
"0000823693"	"1"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00006"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Langlo 2014:274798146}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644671C>A"	""	"pathogenic (recessive)"	""
"0000823694"	"1"	"90"	"8"	"87616320"	"87616320"	"subst"	"4.06709E-6"	"00006"	"CNGB3_000113"	"g.87616320C>G"	""	"{PMID:Langlo 2014:274798146}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86604092C>G"	""	"pathogenic (recessive)"	""
"0000823695"	"1"	"70"	"8"	"87660036"	"87660036"	"subst"	"0"	"00006"	"CNGB3_000241"	"g.87660036A>T"	""	"{PMID:Langlo 2014:274798146}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86647808A>T"	""	"likely pathogenic (recessive)"	""
"0000823696"	"1"	"90"	"8"	"87641195"	"87641195"	"subst"	"2.03383E-5"	"00006"	"CNGB3_000122"	"g.87641195G>A"	""	"{PMID:Langlo 2014:274798146}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628967G>A"	""	"pathogenic (recessive)"	""
"0000823697"	"1"	"90"	"8"	"87644976"	"87644976"	"subst"	"0"	"00006"	"CNGB3_000231"	"g.87644976T>C"	""	"{PMID:Langlo 2014:274798146}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632748T>C"	""	"pathogenic (recessive)"	""
"0000823698"	"2"	"90"	"8"	"87623876"	"87623876"	"subst"	"0"	"00006"	"CNGB3_000224"	"g.87623876A>C"	""	"{PMID:Langlo 2014:274798146}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86611648A>C"	""	"pathogenic (recessive)"	""
"0000823728"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2021:33560291}"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0000823816"	"1"	"70"	"8"	"87755853"	"87755853"	"subst"	"0"	"00000"	"CNGB3_000107"	"g.87755853C>T"	""	"{PMID:Sun 2020:32913385}"	""	"CNGB3 c.[3G>A];[680T>C]"	"heterozygous; protein change not reported"	"Unknown"	"yes"	""	"0"	""	""	"g.86743625C>T"	""	"likely pathogenic"	""
"0000823817"	"2"	"70"	"8"	"87679325"	"87679325"	"subst"	"4.0625E-5"	"00000"	"CNGB3_000117"	"g.87679325A>G"	""	"{PMID:Sun 2020:32913385}"	""	"CNGB3 c.[3G>A];[680T>C]"	"heterozygous; protein change not reported"	"Unknown"	"yes"	""	"0"	""	""	"g.86667097A>G"	""	"likely pathogenic"	""
"0000823818"	"1"	"70"	"8"	"87755845"	"87755845"	"subst"	"4.06151E-6"	"00000"	"CNGB3_000266"	"g.87755845G>T"	""	"{PMID:Sun 2020:32913385}"	""	"CNGB3 c.[11C>A];[11C>A]"	"homozygous; protein change not reported"	"Unknown"	"yes"	""	"0"	""	""	"g.86743617G>T"	""	"likely pathogenic"	""
"0000823819"	"1"	"70"	"8"	"87679325"	"87679325"	"subst"	"4.0625E-5"	"00000"	"CNGB3_000117"	"g.87679325A>G"	""	"{PMID:Sun 2020:32913385}"	""	"CNGB3 c.[680T>C];[1155G>T]"	"heterozygous; protein change not reported"	"Unknown"	"yes"	""	"0"	""	""	"g.86667097A>G"	""	"likely pathogenic"	""
"0000823820"	"2"	"70"	"8"	"87656002"	"87656002"	"subst"	"0"	"00000"	"CNGB3_000236"	"g.87656002C>A"	""	"{PMID:Sun 2020:32913385}"	""	"CNGB3 c.[680T>C];[1155G>T]"	"heterozygous; protein change not reported"	"Unknown"	"yes"	""	"0"	""	""	"g.86643774C>A"	""	"likely pathogenic"	""
"0000823821"	"1"	"70"	"8"	"87656094"	"87656094"	"subst"	"2.04108E-5"	"00000"	"CNGB3_000178"	"g.87656094G>A"	""	"{PMID:Sun 2020:32913385}"	""	"CNGB3 c.[1063C>T];[1063C>T]"	"homozygous; protein change not reported"	"Unknown"	"yes"	""	"0"	""	""	"g.86643866G>A"	""	"likely pathogenic"	""
"0000825070"	"0"	"70"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Bergant 2021:33807868}"	""	"NM_019098.5(CNGB3):c.819_826del (het)CNGB3 EX7 DUP"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86666953_86666960del"	""	"likely pathogenic"	""
"0000825074"	"0"	"70"	"8"	"87664541"	"87675143"	"dup"	"0"	"00000"	"CNGB3_000267"	"g.87664541_87675143dup"	""	"{PMID:Bergant 2021:33807868}"	""	"NM_019098.5(CNGB3):c.819_826del (het)CNGB3 EX7 DUP"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86652313_86662915dup"	"SCV001481173"	"likely pathogenic"	""
"0000825513"	"0"	"50"	"8"	"87638258"	"87638258"	"subst"	"0.000179035"	"00000"	"CNGB3_000269"	"g.87638258C>T"	""	"{PMID:Ng 2021:33846575}"	""	"CNGB3 c.1531G>A, p.A511T"	"no zygosity and pathogenicity classification indicated"	"Unknown"	"?"	""	"0"	""	""	"g.86626030C>T"	""	"VUS"	""
"0000825514"	"0"	"50"	"8"	"87588136"	"87588136"	"subst"	"6.91766E-5"	"00000"	"CNGB3_000268"	"g.87588136G>A"	""	"{PMID:Ng 2021:33846575}"	""	"CNGB3 c.2326C>T, p.P776S"	"no zygosity and pathogenicity classification indicated"	"Unknown"	"?"	""	"0"	""	""	"g.86575908G>A"	""	"VUS"	""
"0000825515"	"0"	"50"	"8"	"87638258"	"87638258"	"subst"	"0.000179035"	"00000"	"CNGB3_000269"	"g.87638258C>T"	""	"{PMID:Ng 2021:33846575}"	""	"CNGB3 c.1531G>A, p.A511T"	"no zygosity and pathogenicity classification indicated"	"Unknown"	"?"	""	"0"	""	""	"g.86626030C>T"	""	"VUS"	""
"0000826472"	"3"	"50"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Brunetti-Pierri_2021:33562422}"	""	"c.1148delC"	""	"Unknown"	""	""	"0"	""	""	""	""	"VUS"	""
"0000826473"	"3"	"50"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Brunetti-Pierri_2021:33562422}"	""	"c.1148delC"	""	"Unknown"	""	""	"0"	""	""	""	""	"VUS"	""
"0000826474"	"3"	"50"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Brunetti-Pierri_2021:33562422}"	""	"c.1148delC"	""	"Unknown"	""	""	"0"	""	""	""	""	"VUS"	""
"0000826475"	"3"	"50"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Brunetti-Pierri_2021:33562422}"	""	"c.1148delC"	""	"Unknown"	""	""	"0"	""	""	""	""	"VUS"	""
"0000826476"	"3"	"50"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Brunetti-Pierri_2021:33562422}"	""	"c.1148delC"	""	"Unknown"	""	""	"0"	""	""	""	""	"VUS"	""
"0000826477"	"3"	"50"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Brunetti-Pierri_2021:33562422}"	""	"c.1148delC"	""	"Unknown"	""	""	"0"	""	""	""	""	"VUS"	""
"0000826478"	"0"	"50"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Brunetti-Pierri_2021:33562422}"	""	"c.1148delC"	""	"Unknown"	""	""	"0"	""	""	""	""	"VUS"	""
"0000826479"	"0"	"50"	"8"	"87660049"	"87660049"	"subst"	"0"	"00000"	"CNGB3_000111"	"g.87660049T>C"	""	"{PMID:Brunetti-Pierri_2021:33562422}"	""	"c.970A>G"	""	"Unknown"	""	""	"0"	""	""	""	""	"VUS"	""
"0000826480"	"0"	"50"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Brunetti-Pierri_2021:33562422}"	""	"c.1148delC"	""	"Unknown"	""	""	"0"	""	""	""	""	"VUS"	""
"0000826481"	"0"	"50"	"8"	"87660049"	"87660049"	"subst"	"0"	"00000"	"CNGB3_000111"	"g.87660049T>C"	""	"{PMID:Brunetti-Pierri_2021:33562422}"	""	"c.970A>G"	""	"Unknown"	""	""	"0"	""	""	""	""	"VUS"	""
"0000826490"	"0"	"50"	"8"	"87656850"	"87656850"	"subst"	"0"	"00000"	"CNGB3_000270"	"g.87656850C>T"	""	"{PMID:Brunetti-Pierri_2021:33562422}"	""	"c.1055G>A"	""	"Unknown"	""	""	"0"	""	""	""	""	"VUS"	""
"0000826990"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Thorsteinsson 2021:33851411}"	""	"CNGB3 c.1148del, p.Thr383llefs*13"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	""
"0000832442"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Genead 2011:21778272}"	""	"allele 1: c.1148delC - p.Thr383fs, allele 2: Not found -"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832444"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Genead 2011:21778272}"	""	"allele 1: c.1148delC - p.Thr383fs, allele 2: c.1148delC - p.Thr383fs"	"homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832446"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Genead 2011:21778272}"	""	"allele 1: c.1148delC - p.Thr383fs, allele 2: c.1148delC - p.Thr383fs"	"homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832447"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Genead 2011:21778272}"	""	"allele 1: c.1148delC - p.Thr383fs, allele 2: c.1148delC - p.Thr383fs"	"homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832449"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Genead 2011:21778272}"	""	"allele 1: c.1148delC - p.Thr383fs, allele 2: Not found -"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832522"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Thomas 2012:22790432}"	""	"allele 1: c.1148delC, p.T383IfsX13, allele 2: c.1426C>T, p.Q476X"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832525"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Thomas 2012:22790432}"	""	"allele 1: c.1148delC, p.T383IfsX13, allele 2: c.1148delC, p.T383IfsX13"	"homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832528"	"2"	"70"	"8"	"87641201"	"87641201"	"subst"	"0"	"00000"	"CNGB3_000094"	"g.87641201G>A"	""	"{PMID:Thomas 2012:22790432}"	""	"allele 1: c.1148delC, p.T383IfsX13, allele 2: c.1426C>T, p.Q476X"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86628973G>A"	""	"likely pathogenic"	""
"0000832537"	"1"	"70"	"8"	"87616320"	"87616320"	"subst"	"0"	"00000"	"CNGB3_000220"	"g.87616320C>T"	""	"{PMID:Fahim 2013:23972307}"	""	"c.1781+1G>A (Splice Defect)/c.1148delC (p.Thr383fsX)"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86604092C>T"	""	"likely pathogenic"	""
"0000832538"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Fahim 2013:23972307}"	""	"c.1148delC (p.Thr383fsX) /c.1148delC (p.Thr383fsX)"	"homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832539"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Fahim 2013:23972307}"	""	"c.1148delC (p.Thr383fsX) /c.1148delC (p.Thr383fsX)"	"homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832540"	"1"	"70"	"8"	"87666247"	"87666257"	"delins"	"0"	"00000"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Fahim 2013:23972307}"	""	"c.886_896del11insT (p.Arg296fsX) /c.1148delC (p.Thr383fsX)"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86654019_86654029delinsA"	""	"likely pathogenic"	""
"0000832541"	"1"	"70"	"8"	"87666247"	"87666257"	"delins"	"0"	"00000"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Fahim 2013:23972307}"	""	"c.886_896del11insT (p.Arg296fsX) /c.1148delC (p.Thr383fsX)"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86654019_86654029delinsA"	""	"likely pathogenic"	""
"0000832542"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Fahim 2013:23972307}"	""	"c.1148delC (p.Thr383fsX) /c.1148delC (p.Thr383fsX)"	"homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832547"	"2"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Fahim 2013:23972307}"	""	"c.1781+1G>A (Splice Defect)/c.1148delC (p.Thr383fsX)"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832548"	"2"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Fahim 2013:23972307}"	""	"c.886_896del11insT (p.Arg296fsX) /c.1148delC (p.Thr383fsX)"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832549"	"2"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Fahim 2013:23972307}"	""	"c.886_896del11insT (p.Arg296fsX) /c.1148delC (p.Thr383fsX)"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832557"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Yang 2014:24676353}"	""	"CNGB3 homozygous c.1148delC"	""	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832558"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Yang 2014:24676353}"	""	"CNGB3 homozygous c.1148delC"	""	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832560"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Yang 2014:24676353}"	""	"CNGB3 homozygous c.1148delC"	""	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832561"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Yang 2014:24676353}"	""	"CNGB3 homozygous c.1148delC"	""	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832562"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Yang 2014:24676353}"	""	"CNGB3 homozygous c.1148delC"	""	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832563"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Yang 2014:24676353}"	""	"CNGA3 heterozygous p.D260N:c.778G>A; CNGB3 heterozygous c.1148delC, p.R403Q:c.1208G>A"	""	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832564"	"2"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00000"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Yang 2014:24676353}"	""	"CNGA3 heterozygous p.D260N:c.778G>A; CNGB3 heterozygous c.1148delC, p.R403Q:c.1208G>A"	""	"Unknown"	"?"	""	"0"	""	""	"g.86632864C>T"	""	"likely pathogenic"	""
"0000832725"	"0"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 c.1148delC, (p.Thr383Ilefs*13)"	""	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832726"	"0"	"70"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00000"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 c.1006G>T, (p.Glu336*)"	""	"Unknown"	"?"	""	"0"	""	""	"g.86644671C>A"	""	"likely pathogenic"	""
"0000832727"	"0"	"70"	"8"	"87679181"	"87679188"	"del"	"0"	"00000"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 c.819_826del, (p.Arg274Valfs*13)"	""	"Unknown"	"?"	""	"0"	""	""	"g.86666953_86666960del"	""	"likely pathogenic"	""
"0000832728"	"0"	"70"	"8"	"87751965"	"87751965"	"subst"	"0"	"00000"	"CNGB3_000105"	"g.87751965C>A"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 c.130-1G>T, p.(?)"	""	"Unknown"	"?"	""	"0"	""	""	"g.86739737C>A"	""	"likely pathogenic"	""
"0000832729"	"0"	"70"	"8"	"87755725"	"87755725"	"subst"	"0"	"00000"	"CNGB3_000106"	"g.87755725A>G"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 c.129+2T>C, p.(?)"	""	"Unknown"	"?"	""	"0"	""	""	"g.86743497A>G"	""	"likely pathogenic"	""
"0000832730"	"0"	"70"	"8"	"87755853"	"87755853"	"subst"	"0"	"00000"	"CNGB3_000107"	"g.87755853C>T"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 c.3G>A, (p.Met1?)"	""	"Unknown"	"?"	""	"0"	""	""	"g.86743625C>T"	""	"likely pathogenic"	""
"0000832731"	"0"	"70"	"8"	"87755725"	"87755725"	"subst"	"0"	"00000"	"CNGB3_000106"	"g.87755725A>G"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 c.129+2T>C, p.(?)"	""	"Unknown"	"?"	""	"0"	""	""	"g.86743497A>G"	""	"likely pathogenic"	""
"0000832741"	"0"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 c.1148delC, (p.Thr383Ilefs*13)"	""	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832742"	"0"	"70"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00000"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 c.1006G>T, (p.Glu336*)"	""	"Unknown"	"?"	""	"0"	""	""	"g.86644671C>A"	""	"likely pathogenic"	""
"0000832743"	"0"	"70"	"8"	"87645057"	"87645057"	"subst"	"0"	"00000"	"CNGB3_000100"	"g.87645057G>A"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 c.1243C>T, (p.Gln415*)"	""	"Unknown"	"?"	""	"0"	""	""	"g.86632829G>A"	""	"likely pathogenic"	""
"0000832744"	"0"	"70"	"8"	"87751965"	"87751965"	"subst"	"0"	"00000"	"CNGB3_000105"	"g.87751965C>A"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 c.130-1G>T, p.(?)"	""	"Unknown"	"?"	""	"0"	""	""	"g.86739737C>A"	""	"likely pathogenic"	""
"0000832745"	"0"	"70"	"8"	"0"	"0"	""	"0"	"00000"	"RP1_000000"	"g.?"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 ex 3 deletion, p.(?)"	""	"Unknown"	"?"	""	"0"	""	""	"g.?"	""	"likely pathogenic"	""
"0000832746"	"0"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 c.1148delC, (p.Thr383Ilefs*13)"	""	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000832747"	"0"	"70"	"8"	"0"	"0"	""	"0"	"00000"	"RP1_000000"	"g.?"	""	"{PMID:Matet 2018:29618791}"	""	"CNGB3 ex 3 deletion, p.(?)"	""	"Unknown"	"?"	""	"0"	""	""	"g.?"	""	"likely pathogenic"	""
"0000832773"	"0"	"70"	"8"	"87683192"	"87683192"	"subst"	"0"	"00000"	"CNGB3_000271"	"g.87683192G>T"	""	"{PMID:Georgiou 2019:30682209}"	""	"CNGB3 473C>A, Pro158His"	"heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86670964G>T"	""	"likely pathogenic"	""
"0000846891"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Avela 2019:31087526}"	""	"CNGB3 c.1148delC"	"no protein annotation; homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000846892"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Avela 2019:31087526}"	""	"CNGB3 c.1148delC"	"no protein annotation; homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000852003"	"0"	"30"	"8"	"87641259"	"87641259"	"subst"	"0.000590064"	"01943"	"CNGB3_000273"	"g.87641259G>A"	""	""	""	"CNGB3(NM_019098.4):c.1368C>T (p.R456=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000852004"	"0"	"50"	"8"	"87660045"	"87660045"	"subst"	"0"	"02327"	"CNGB3_000274"	"g.87660045G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000852005"	"0"	"50"	"8"	"87683280"	"87683280"	"subst"	"3.65551E-5"	"01943"	"CNGB3_000275"	"g.87683280C>T"	""	""	""	"CNGB3(NM_019098.4):c.385G>A (p.D129N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000861294"	"0"	"30"	"8"	"87638297"	"87638297"	"subst"	"0.000847396"	"02330"	"CNGB3_000272"	"g.87638297A>T"	""	""	""	"CNGB3(NM_019098.5):c.1492T>A (p.L498M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000871754"	"1"	"70"	"8"	"87588052"	"87588052"	"subst"	"5.28812E-5"	"00006"	"CNGB3_000276"	"g.87588052T>A"	""	"{PMID:Bryant 2018:29343940}"	""	""	"no variant 2nd chromosome"	"Germline"	""	"rs151039691"	"0"	""	""	""	""	"likely pathogenic"	""
"0000876549"	"1"	"70"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"00000"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Kellner 2004:15459792}"	""	"CNGB3 991-3T>G (splice site)"	"no nucleotide annotation, extrapolated from protein and databases; heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86644689A>C"	""	"likely pathogenic"	""
"0000876550"	"3"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Kellner 2004:15459792}"	""	"CNGB3 T383 fs"	"no nucleotide annotation, extrapolated from protein and databases; homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000876551"	"0"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Kellner 2004:15459792}"	""	"CNGB3 T383 fs"	"no nucleotide annotation, extrapolated from protein and databases; single heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000876552"	"1"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Kellner 2004:15459792}"	""	"CNGB3 T383 fs"	"no nucleotide annotation, extrapolated from protein and databases; heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000876553"	"1"	"70"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00000"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Kellner 2004:15459792}"	""	"CNGB3 E336X"	"no nucleotide annotation, extrapolated from protein and databases; heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86644671C>A"	""	"likely pathogenic"	""
"0000876554"	"3"	"70"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00000"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Kellner 2004:15459792}"	""	"CNGB3 E336X"	"no nucleotide annotation, extrapolated from protein and databases; homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86644671C>A"	""	"likely pathogenic"	""
"0000876555"	"3"	"70"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00000"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Kellner 2004:15459792}"	""	"CNGB3 E336X"	"no nucleotide annotation, extrapolated from protein and databases; homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86644671C>A"	""	"likely pathogenic"	""
"0000876556"	"3"	"70"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00000"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Kellner 2004:15459792}"	""	"CNGB3 E336X"	"no nucleotide annotation, extrapolated from protein and databases; homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.86644671C>A"	""	"likely pathogenic"	""
"0000876559"	"0"	"70"	"8"	"0"	"0"	""	"0"	"00000"	"RP1_000000"	"g.?"	""	"{PMID:Kellner 2004:15459792}"	""	"CNGB3 R296fs"	"no nucleotide annotation, extrapolated from protein and databases; probably c.886_890del, but c.886_896delinsT also possible; single heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.?"	""	"likely pathogenic"	""
"0000876560"	"0"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Kellner 2004:15459792}"	""	"CNGB3 T383fs"	"no nucleotide annotation, extrapolated from protein and databases; single heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000876565"	"2"	"70"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Kellner 2004:15459792}"	""	"CNGB3 l383fs"	"no nucleotide annotation, extrapolated from protein and databases; heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86643781del"	""	"likely pathogenic"	""
"0000876566"	"2"	"70"	"8"	"87679299"	"87679299"	"delins"	"0"	"00000"	"CNGB3_000248"	"g.87679299delinsAA"	""	"{PMID:Kellner 2004:15459792}"	""	"CNGB3 I236 fs"	"no nucleotide annotation, extrapolated from protein and databases; heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86667071delinsAA"	""	"likely pathogenic"	""
"0000876567"	"2"	"70"	"8"	"87683274"	"87683274"	"subst"	"4.06154E-6"	"00000"	"CNGB3_000090"	"g.87683274G>A"	""	"{PMID:Kellner 2004:15459792}"	""	"CNGB3 Q131X"	"no nucleotide annotation, extrapolated from protein and databases; heterozygous"	"Unknown"	"?"	""	"0"	""	""	"g.86671046G>A"	""	"likely pathogenic"	""
"0000881425"	"3"	"50"	"8"	"87588052"	"87588052"	"subst"	"5.28812E-5"	"04405"	"CNGB3_000276"	"g.87588052T>A"	""	"{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86575824T>A"	""	"VUS"	"ACMG"
"0000881457"	"2"	"50"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"04405"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"VUS"	"ACMG"
"0000881458"	"2"	"50"	"8"	"87591418"	"87591418"	"subst"	"4.47089E-5"	"04405"	"CNGB3_000278"	"g.87591418T>C"	""	"{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86579190T>C"	""	"VUS"	"ACMG"
"0000881466"	"1"	"70"	"8"	"87666247"	"87666257"	"delins"	"0"	"04405"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}"	""	"c.[886A>T;887_896del]"	""	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	""	"likely pathogenic"	"ACMG"
"0000888464"	"0"	"90"	"8"	"87679313"	"87679313"	"subst"	"0"	"02330"	"CNGB3_000279"	"g.87679313C>T"	""	""	""	"CNGB3(NM_019098.5):c.692G>A (p.W231*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000888465"	"0"	"30"	"8"	"87683343"	"87683343"	"del"	"0"	"02330"	"CNGB3_000280"	"g.87683343del"	""	""	""	"CNGB3(NM_019098.5):c.339-10delT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000905857"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Zhu 2022:35456422}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13)"	"homozygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000905858"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Zhu 2022:35456422}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13)"	"homozygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000905860"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Zhu 2022:35456422}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13)"	"homozygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000905861"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Zhu 2022:35456422}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13)"	"homozygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000905862"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Zhu 2022:35456422}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13)"	"homozygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000905863"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Zhu 2022:35456422}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13)"	"homozygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000905865"	"0"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00000"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Zhu 2022:35456422}"	""	"CNGB3 c.1578+1G>A, p.?"	"compound heterozygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic"	"ACMG"
"0000905866"	"0"	"90"	"8"	"87656899"	"87656899"	"subst"	"3.78097E-5"	"00000"	"CNGB3_000051"	"g.87656899C>A"	""	"{PMID:Zhu 2022:35456422}"	""	"CNGB3 c.1006G>T, p.(Glu336*)"	"compound heterozygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86644671C>A"	""	"pathogenic"	"ACMG"
"0000905881"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Zhu 2022:35456422}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13)"	"homozygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000905882"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Zhu 2022:35456422}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13)"	"homozygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000905883"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Zhu 2022:35456422}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13)"	"homozygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000905884"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00000"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Zhu 2022:35456422}"	""	"CNGB3 c.1148del, p.(Thr383Ilefs*13)"	"homozygous, probably causal"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000929484"	"0"	"50"	"8"	"87641309"	"87641309"	"subst"	"0"	"02327"	"CNGB3_000281"	"g.87641309A>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000929485"	"0"	"10"	"8"	"87680407"	"87680407"	"subst"	"0"	"02327"	"CNGB3_000139"	"g.87680407A>G"	""	""	""	"CNGB3(NM_019098.5):c.494-11T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000933671"	"0"	"90"	"8"	"87591452"	"87591452"	"subst"	"8.13544E-6"	"04552"	"CNGB3_000093"	"g.87591452G>A"	""	"Villafuerte-de la Cruz RA, et al., 2023. Submitted"	""	""	""	"Germline"	"yes"	"rs200805087"	"0"	""	""	""	"{CV:438042}"	"pathogenic"	"ACMG"
"0000933672"	"0"	"90"	"8"	"87679303"	"87679304"	"delins"	"0"	"04552"	"CNGB3_000282"	"g.87679303_87679304delinsCT"	""	"Villafuerte-de la Cruz RA, et al., 2023. Submitted"	""	""	""	"Germline"	"yes"	"rs1823755123"	"0"	""	""	"g.86667075_86667076delinsCT"	"{CV:935306}"	"pathogenic"	"ACMG"
"0000949120"	"0"	"30"	"8"	"87588303"	"87588323"	"del"	"0"	"02330"	"CNGB3_000031"	"g.87588303_87588323del"	""	""	""	"CNGB3(NM_019098.5):c.2179_2199delCAAAAAGAAAATGAAGATAAA (p.Q727_K733del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000949121"	"0"	"90"	"8"	"87680283"	"87680283"	"subst"	"2.8434E-5"	"02327"	"CNGB3_000077"	"g.87680283G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000957972"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5, PS4_MODERATE"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"5225"	"pathogenic (recessive)"	"ACMG"
"0000957973"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5, PS4_MODERATE"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"5225"	"pathogenic (recessive)"	"ACMG"
"0000957974"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5, PS4_MODERATE"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"5225"	"pathogenic (recessive)"	"ACMG"
"0000957977"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5, PS4_MODERATE"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"5225"	"pathogenic (recessive)"	"ACMG"
"0000957978"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5, PS4_MODERATE"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"5225"	"pathogenic (recessive)"	"ACMG"
"0000957979"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5, PS4_MODERATE"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"5225"	"pathogenic (recessive)"	"ACMG"
"0000957980"	"0"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5"	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic (recessive)"	"ACMG"
"0000957981"	"11"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5, PS4_MODERATE"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"5225"	"pathogenic (recessive)"	"ACMG"
"0000957987"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5, PS4_MODERATE"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"5225"	"pathogenic (recessive)"	"ACMG"
"0000958274"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5, PS4_MODERATE"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0000958389"	"0"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"00006"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5"	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	"189031"	"pathogenic (recessive)"	"ACMG"
"0000958390"	"0"	"70"	"8"	"87664544"	"87675142"	"dup"	"0"	"00006"	"CNGB3_000243"	"g.87664544_87675142dup"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1"	"Germline"	""	""	"0"	""	""	"g.86652316_86662914dup"	""	"likely pathogenic (recessive)"	"ACMG"
"0000958392"	"3"	"50"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PP5, BS1, BS2, BP6"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"VUS"	"ACMG"
"0000958393"	"0"	"50"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PP5, BS1, BS2, BP6"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"VUS"	"ACMG"
"0000958395"	"0"	"50"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PP5, BS1, BS2, BP6"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"VUS"	"ACMG"
"0000958396"	"21"	"90"	"8"	"87645123"	"87645123"	"subst"	"0"	"00006"	"CNGB3_000114"	"g.87645123T>A"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5"	"Germline"	""	""	"0"	""	""	"g.86632895T>A"	"371304"	"pathogenic (recessive)"	"ACMG"
"0000958588"	"0"	"50"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PP5, BS1, BS2, BP6"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"VUS"	"ACMG"
"0000958829"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5, PS4_MODERATE"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0000958906"	"3"	"50"	"8"	"87591428"	"87591428"	"subst"	"0"	"00006"	"CNGB3_000283"	"g.87591428C>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PM2"	"Germline"	""	""	"0"	""	""	"g.86579200C>T"	""	"VUS"	"ACMG"
"0000959001"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5, PS4_MODERATE; no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0000959017"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5, PS4_MODERATE; no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86643781del"	"5225"	"pathogenic (recessive)"	"ACMG"
"0000959024"	"0"	"50"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PP3, PP5, BS1, BS2, BP6; no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"VUS"	"ACMG"
"0000959196"	"0"	"70"	"8"	"87666247"	"87666253"	"del"	"0"	"00006"	"CNGB3_000285"	"g.87666247_87666253del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1"	"Germline"	""	""	"0"	""	""	"g.86654019_86654025del"	""	"likely pathogenic (recessive)"	"ACMG"
"0000959262"	"0"	"50"	"8"	"87645132"	"87645132"	"subst"	"0"	"00006"	"CNGB3_000284"	"g.87645132A>C"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, BP7"	"Germline"	""	""	"0"	""	""	"g.86632904A>C"	""	"VUS"	"ACMG"
"0000959408"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, PVS1, PP5, PS4_MODERATE"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0000959454"	"0"	"50"	"8"	"87638255"	"87638255"	"subst"	"0.000646899"	"00006"	"CNGB3_000007"	"g.87638255T>C"	""	"{PMID:Weisschuh 2024:37734845}"	""	""	"ACMG PM2, BS2_SUPPORTING; no variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.86626027T>C"	""	"VUS"	"ACMG"
"0000978289"	"0"	"50"	"8"	"87679225"	"87679225"	"subst"	"0"	"01804"	"CNGB3_000286"	"g.87679225A>T"	""	""	""	"CNGB3(NM_019098.5):c.780T>A (p.(Cys260Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000986373"	"1"	"90"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"04405"	"CNGB3_000013"	"g.87656917A>C"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86644689A>C"	""	"pathogenic"	"ACMG"
"0000986374"	"1"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"04405"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	""	"pathogenic"	"ACMG"
"0000986375"	"3"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"04405"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"likely pathogenic"	"ACMG"
"0000986376"	"1"	"50"	"8"	"87588303"	"87588323"	"del"	"0"	"04405"	"CNGB3_000031"	"g.87588303_87588323del"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86576075_86576095del"	""	"VUS"	"ACMG"
"0000986377"	"3"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"04405"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"likely pathogenic"	"ACMG"
"0000986378"	"3"	"50"	"8"	"87616374"	"87616374"	"subst"	"0"	"04405"	"CNGB3_000288"	"g.87616374A>C"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86604146A>C"	""	"VUS"	"ACMG"
"0000986379"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04405"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000986380"	"1"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"04405"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"likely pathogenic"	"ACMG"
"0000986381"	"3"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"04405"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"likely pathogenic"	"ACMG"
"0000986382"	"3"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"04405"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"likely pathogenic"	"ACMG"
"0000986383"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04405"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000986384"	"1"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"04405"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"likely pathogenic"	"ACMG"
"0000986385"	"1"	"90"	"8"	"87679181"	"87679188"	"del"	"0"	"04405"	"CNGB3_000044"	"g.87679181_87679188del"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86666953_86666960del"	""	"pathogenic"	"ACMG"
"0000986386"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04405"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000986904"	"2"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"04405"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"likely pathogenic"	"ACMG"
"0000986905"	"2"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"04405"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"likely pathogenic"	"ACMG"
"0000986906"	"2"	"50"	"8"	"87588052"	"87588052"	"subst"	"5.28812E-5"	"04405"	"CNGB3_000276"	"g.87588052T>A"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86575824T>A"	""	"VUS"	"ACMG"
"0000986907"	"2"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"04405"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic"	"ACMG"
"0000986908"	"2"	"50"	"8"	"87617644"	"87617644"	"subst"	"0"	"04405"	"CNGB3_000159"	"g.87617644C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86605416C>T"	""	"VUS"	"ACMG"
"0000986909"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04405"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000986910"	"2"	"90"	"8"	"87638210"	"87638210"	"subst"	"1.63325E-5"	"04405"	"CNGB3_000034"	"g.87638210C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625982C>T"	""	"pathogenic"	"ACMG"
"0000987065"	"0"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"00006"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	"case unsolved"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic"	"ACMG"
"0000987173"	"0"	"90"	"8"	"87591036"	"87591038"	"dup"	"0"	"00006"	"CNGB3_000287"	"g.87591036_87591038dup"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"(Arg661dup)"	"case unsolved"	"Germline"	""	""	"0"	""	""	"g.86578808_86578810dup"	""	"pathogenic"	"ACMG"
"0000987299"	"0"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	"no variant 2nd chromosome, case unsolved"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"likely pathogenic"	"ACMG"
"0000987314"	"0"	"70"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"00006"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	"no variant 2nd chromosome, case unsolved"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"likely pathogenic"	"ACMG"
"0000997346"	"0"	"50"	"8"	"87623856"	"87623856"	"subst"	"4.06696E-6"	"01804"	"CNGB3_000289"	"g.87623856T>G"	""	""	""	"CNGB3(NM_019098.4):c.1622A>C (p.(Lys541Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001010046"	"0"	"70"	"8"	"87751884"	"87751884"	"subst"	"0"	"04752"	"CNGB3_000293"	"g.87751884T>C"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PM3_supp,PVS1_strong; possible digenic, triallelic inheritance; consequence on splicing predicted from in vitro mini-gene splicing assay"	"Germline"	""	""	"0"	""	""	"g.86739656T>C"	""	"likely pathogenic"	"ACMG"
"0001010049"	"1"	"70"	"8"	"87660121"	"87660121"	"subst"	"0"	"04752"	"CNGB3_000292"	"g.87660121G>C"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_supp, PVS1_strong; consequence on splicing predicted from in vitro mini-gene splicing assay"	"Germline"	""	""	"0"	""	""	"g.86647893G>C"	""	"likely pathogenic (recessive)"	""
"0001010050"	"2"	"90"	"8"	"87635702"	"87635702"	"subst"	"0"	"04752"	"CNGB3_000290"	"g.87635702C>G"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_supp, PVS1; consequence on splicing predicted from in vitro mini-gene splicing assay"	"Germline"	""	""	"0"	""	""	"g.86623474C>G"	""	"pathogenic (recessive)"	""
"0001010051"	"1"	"90"	"8"	"87644977"	"87644977"	"subst"	"0"	"04752"	"CNGB3_000291"	"g.87644977T>G"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_mod, PM3, PVS1; consequence on splicing predicted from in vitro mini-gene splicing assay"	"Germline"	""	""	"0"	""	""	"g.86632749T>G"	""	"pathogenic (recessive)"	""
"0001010052"	"0"	"30"	"8"	"87638199"	"87638199"	"subst"	"8.19357E-6"	"04752"	"CNGB3_000170"	"g.87638199A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.86625971A>G"	""	"likely benign"	""
"0001010244"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010245"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010246"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010247"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010248"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010249"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010250"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010251"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010252"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010253"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010254"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010255"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010256"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010257"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010258"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010259"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010260"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010261"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010262"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010263"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010264"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010265"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010266"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010267"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010268"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010269"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010270"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010271"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010272"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010273"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010274"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010275"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010276"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010277"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010278"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010279"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010280"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010281"	"3"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010282"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010283"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010284"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010285"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010286"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010287"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010288"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010289"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010290"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010291"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010292"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010293"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010294"	"1"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"{PMID:Andersen 2023:36980963}"	""	"1148delC"	"ACMG PVS1, PS4, PM3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	"ACMG"
"0001010295"	"3"	"90"	"8"	"87641196"	"87641197"	"delins"	"0"	"04752"	"CNGB3_000119"	"g.87641196_87641197delinsG"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PVS1, PM2_sup, PM3"	"Germline"	""	""	"0"	""	""	"g.86628968_86628969delinsG"	""	"pathogenic (recessive)"	"ACMG"
"0001010296"	"3"	"90"	"8"	"87641196"	"87641197"	"delins"	"0"	"04752"	"CNGB3_000119"	"g.87641196_87641197delinsG"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PVS1, PM2_sup, PM3"	"Germline"	""	""	"0"	""	""	"g.86628968_86628969delinsG"	""	"pathogenic (recessive)"	"ACMG"
"0001010297"	"3"	"90"	"8"	"87679303"	"87679303"	"subst"	"0"	"04752"	"CNGB3_000250"	"g.87679303A>T"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PVS1, PM2_sup, PM3"	"Germline"	""	""	"0"	""	""	"g.86667075A>T"	""	"pathogenic (recessive)"	"ACMG"
"0001010298"	"3"	"90"	"8"	"87679303"	"87679303"	"subst"	"0"	"04752"	"CNGB3_000250"	"g.87679303A>T"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PVS1, PM2_sup, PM3"	"Germline"	""	""	"0"	""	""	"g.86667075A>T"	""	"pathogenic (recessive)"	"ACMG"
"0001010299"	"3"	"70"	"8"	"87616402"	"87616402"	"subst"	"4.06702E-6"	"04752"	"CNGB3_000132"	"g.87616402C>T"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PP3_strong, PM2_sup, PM3_sup, PS4_sup"	"Germline"	""	""	"0"	""	""	"g.86604174C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001010300"	"3"	"70"	"8"	"87736031"	"87742065"	"del"	"0"	"04752"	"CNGB3_000294"	"g.(87683327_87736031)_(87742065_87751882)del"	""	"{PMID:Andersen 2023:36980963}"	""	"arr[hg19]8q21.3 (87736031-87742065=x0"	""	"Germline"	""	""	"0"	""	""	"g.(86671099_86723803)_(86729837_86739654)del"	""	"likely pathogenic (recessive)"	"ACMG"
"0001010301"	"1"	"90"	"8"	"87679303"	"87679303"	"subst"	"0"	"04752"	"CNGB3_000250"	"g.87679303A>T"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PVS1, PM2_sup, PM3"	"Germline"	""	""	"0"	""	""	"g.86667075A>T"	""	"pathogenic (recessive)"	"ACMG"
"0001010321"	"2"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"04752"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PS4_strong, PM3_very strong, PS3_mod, BS"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001010323"	"2"	"90"	"8"	"87641195"	"87641195"	"subst"	"2.03383E-5"	"04752"	"CNGB3_000122"	"g.87641195G>A"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PVS1, PS4, PM2_sup, PM3"	"Germline"	""	""	"0"	""	""	"g.86628967G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001010324"	"2"	"90"	"8"	"87641195"	"87641195"	"subst"	"2.03383E-5"	"04752"	"CNGB3_000122"	"g.87641195G>A"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PVS1, PS4, PM2_sup, PM3"	"Germline"	""	""	"0"	""	""	"g.86628967G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001010325"	"2"	"90"	"8"	"87641195"	"87641195"	"subst"	"2.03383E-5"	"04752"	"CNGB3_000122"	"g.87641195G>A"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PVS1, PS4, PM2_sup PM3"	"Germline"	""	""	"0"	""	""	"g.86628967G>A"	""	"pathogenic (recessive)"	"ACMG"
"0001010326"	"2"	"50"	"8"	"87683198"	"87683198"	"subst"	"6.09201E-5"	"04752"	"CNGB3_000055"	"g.87683198G>A"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PS4_mod, PM2_sup, BP4"	"Germline"	""	""	"0"	""	""	"g.86670970G>A"	""	"VUS"	"ACMG"
"0001010327"	"2"	"50"	"8"	"87683198"	"87683198"	"subst"	"6.09201E-5"	"04752"	"CNGB3_000055"	"g.87683198G>A"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PS4_mod, PM2_sup, BP4"	"Germline"	""	""	"0"	""	""	"g.86670970G>A"	""	"VUS"	"ACMG"
"0001010328"	"2"	"90"	"8"	"87645003"	"87645004"	"del"	"0"	"04752"	"CNGB3_000232"	"g.87645003_87645004del"	""	"{PMID:Andersen 2023:36980963}"	""	"1299_1300delGT"	"ACMG PVS1, PS4_sup, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86632775_86632776del"	""	"pathogenic (recessive)"	"ACMG"
"0001010329"	"2"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"04752"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Andersen 2023:36980963}"	""	"886_896del11insT"	"ACMG PVS1, PS4_mod, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	""	"pathogenic (recessive)"	"ACMG"
"0001010330"	"2"	"90"	"8"	"87666247"	"87666257"	"delins"	"0"	"04752"	"CNGB3_000042"	"g.87666247_87666257delinsA"	""	"{PMID:Andersen 2023:36980963}"	""	"886_896del11insT"	"ACMG PVS1, PS4_mod, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86654019_86654029delinsA"	""	"pathogenic (recessive)"	"ACMG"
"0001010331"	"2"	"90"	"8"	"87680301"	"87680302"	"del"	"0"	"04752"	"CNGB3_000253"	"g.87680301_87680302del"	""	"{PMID:Andersen 2023:36980963}"	""	"589_590delTT"	"ACMG PVS1, PS4_sup, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86668073_86668074del"	""	"pathogenic (recessive)"	"ACMG"
"0001010332"	"2"	"90"	"8"	"87641196"	"87641196"	"del"	"0"	"04752"	"CNGB3_000295"	"g.87641196del"	""	"{PMID:Andersen 2023:36980963}"	""	"1431delG"	"ACMG PVS1, PM2_sup, PM3"	"Germline"	""	""	"0"	""	""	"g.86628968del"	""	"pathogenic (recessive)"	"ACMG"
"0001010333"	"2"	"70"	"8"	"87616402"	"87616402"	"subst"	"4.06702E-6"	"04752"	"CNGB3_000132"	"g.87616402C>T"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PS4_sup, PP3_strong, PM2_sup"	"Germline"	""	""	"0"	""	""	"g.86604174C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0001010334"	"2"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"04752"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PS4_strong, PM3_very strong, PS3_mod, BS"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001010335"	"2"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"04752"	"CNGB3_000037"	"g.87645092C>T"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PS4_strong, PM3_very strong, PS3_mod, BS"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic (recessive)"	"ACMG"
"0001010336"	"2"	"90"	"8"	"87679249"	"87679249"	"subst"	"4.06144E-6"	"04752"	"CNGB3_000247"	"g.87679249G>C"	""	"{PMID:Andersen 2023:36980963}"	""	""	"ACMG PVS1, PM2_sup, PS4_sup"	"Germline"	""	""	"0"	""	""	"g.86667021G>C"	""	"pathogenic (recessive)"	"ACMG"
"0001025548"	"0"	"50"	"8"	"87588152"	"87588155"	"del"	"0"	"02330"	"CNGB3_000296"	"g.87588152_87588155del"	""	""	""	"CNGB3(NM_019098.5):c.2309_2312delTTAG (p.V770Efs*58)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001025549"	"0"	"70"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"01943"	"CNGB3_000013"	"g.87656917A>C"	""	""	""	"CNGB3(NM_019098.4):c.991-3T>G (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001030046"	"0"	"90"	"8"	"87645092"	"87645092"	"subst"	"0.00470274"	"04752"	"CNGB3_000037"	"g.87645092C>T"	""	"Rawnsley 2025, submitted"	""	""	"possible digenic, triallelic inheritance"	"Germline"	""	""	"0"	""	""	"g.86632864C>T"	""	"pathogenic"	""
"0001030047"	"1"	"70"	"8"	"87664529"	"87664529"	"subst"	"0"	"04752"	"CNGB3_000180"	"g.87664529C>A"	""	"{PMID:Weisschuh 2020:31544997}, Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PM3_mod, PP3_supp, PVS1_strong; consequence on splicing predicted from in vitro mini-gene splicing assay"	"Germline"	""	""	"0"	""	""	"g.86652301C>A"	""	"likely pathogenic (recessive)"	""
"0001030048"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"Rawnsley 2025, submitted"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0001030051"	"0"	"50"	"8"	"87645047"	"87645047"	"subst"	"0"	"04752"	"CNGB3_000297"	"g.87645047A>T"	""	"Rawnsley 2025, submitted"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86632819A>T"	""	"VUS"	""
"0001030052"	"2"	"90"	"8"	"87656009"	"87656009"	"del"	"0.0017362"	"04752"	"CNGB3_000001"	"g.87656009del"	""	"Rawnsley 2025, submitted"	""	"1148delC"	""	"Germline"	""	""	"0"	""	""	"g.86643781del"	""	"pathogenic (recessive)"	""
"0001030053"	"2"	"70"	"8"	"87641222"	"87641222"	"subst"	"0.000577673"	"04752"	"CNGB3_000062"	"g.87641222A>C"	""	"Rawnsley 2025, submitted"	""	""	""	"Germline"	""	""	"0"	""	""	"g.86628994A>C"	""	"likely pathogenic (recessive)"	""
"0001030054"	"0"	"70"	"8"	"87680247"	"87680247"	"subst"	"0"	"04752"	"CNGB3_000185"	"g.87680247C>G"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_supp, PM3_mod, PVS1_mod; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86668019C>G"	""	"NA"	""
"0001030055"	"0"	"70"	"8"	"87660030"	"87660030"	"subst"	"0"	"04752"	"CNGB3_000303"	"g.87660030T>C"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_mod, PVS1_strong; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86647802T>C"	""	"NA"	""
"0001030056"	"0"	"90"	"8"	"87656917"	"87656917"	"subst"	"1.35803E-5"	"04752"	"CNGB3_000013"	"g.87656917A>C"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_mod, PM3_very strong, PVS1; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86644689A>C"	""	"NA"	""
"0001030057"	"0"	"90"	"8"	"87656917"	"87656917"	"del"	"0"	"04752"	"CNGB3_000302"	"g.87656917del"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_supp, PVS1; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86644689del"	""	"NA"	""
"0001030058"	"0"	"90"	"8"	"87656850"	"87656850"	"subst"	"0"	"04752"	"CNGB3_000270"	"g.87656850C>T"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_supp, PVS1; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86644622C>T"	""	"NA"	""
"0001030059"	"0"	"70"	"8"	"87656104"	"87656104"	"subst"	"0"	"04752"	"CNGB3_000123"	"g.87656104G>C"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_mod, PVS1_strong; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86643876G>C"	""	"NA"	""
"0001030060"	"0"	"90"	"8"	"87655974"	"87655974"	"subst"	"0"	"04752"	"CNGB3_000176"	"g.87655974C>A"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_mod, PM3_mod, PVS1_strong; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86643746C>A"	""	"NA"	""
"0001030061"	"0"	"50"	"8"	"87655973"	"87655973"	"subst"	"4.49112E-5"	"04752"	"CNGB3_000301"	"g.87655973A>G"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_supp; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86643745A>G"	""	"NA"	""
"0001030062"	"0"	"30"	"8"	"87655970"	"87655970"	"subst"	"0.000343157"	"04752"	"CNGB3_000300"	"g.87655970A>G"	""	"Rawnsley 2025, submitted"	""	""	"ACMG BP4_supp, BP7_strong; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86643742A>G"	""	"NA"	""
"0001030063"	"0"	"90"	"8"	"87645132"	"87645132"	"subst"	"0"	"04752"	"CNGB3_000284"	"g.87645132A>C"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_supp, PM3_supp, PVS1; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86632904A>C"	""	"NA"	""
"0001030064"	"0"	"90"	"8"	"87644976"	"87644976"	"subst"	"0"	"04752"	"CNGB3_000231"	"g.87644976T>C"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_supp, PM3_supp, PVS1; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86632748T>C"	""	"NA"	""
"0001030065"	"0"	"70"	"8"	"87616324"	"87616324"	"subst"	"4.06616E-6"	"04752"	"CNGB3_000299"	"g.87616324A>C"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PP3_strong, PM2_mod; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86604096A>C"	""	"NA"	""
"0001030066"	"0"	"90"	"8"	"87616321"	"87616321"	"subst"	"0"	"04752"	"CNGB3_000158"	"g.87616321C>G"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_mod, PM3_mod, PVS1; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86604093C>G"	""	"NA"	""
"0001030067"	"0"	"70"	"8"	"87590917"	"87590917"	"subst"	"2.43912E-5"	"04752"	"CNGB3_000214"	"g.87590917C>G"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_supp, PM3, PVS1_strong; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86578689C>G"	""	"NA"	""
"0001030068"	"0"	"50"	"8"	"87590913"	"87590913"	"subst"	"1.21966E-5"	"04752"	"CNGB3_000298"	"g.87590913T>C"	""	"Rawnsley 2025, submitted"	""	""	"ACMG PM2_mod, PP3_supp; consequence on splicing predicted from in vitro mini-gene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.86578685T>C"	""	"NA"	""
"0001037068"	"0"	"50"	"8"	"87591364"	"87591364"	"subst"	"0.000337261"	"01804"	"CNGB3_000136"	"g.87591364T>C"	""	""	""	"CNGB3(NM_019098.4):c.1898A>G (p.D633G), CNGB3(NM_019098.5):c.1898A>G (p.(Asp633Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes CNGB3
## Count = 1260
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000158339"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000170921"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000170963"	"00005383"	"70"	"1672"	"0"	"1672"	"0"	"c.1672G>T"	"r.(?)"	"p.(Gly558Cys)"	"15"
"0000246736"	"00005383"	"10"	"494"	"-11"	"494"	"-11"	"c.494-11del"	"r.(=)"	"p.(=)"	""
"0000246753"	"00005383"	"30"	"212"	"-12"	"212"	"-12"	"c.212-12T>G"	"r.(=)"	"p.(=)"	""
"0000248743"	"00005383"	"10"	"702"	"0"	"702"	"0"	"c.702T>G"	"r.(?)"	"p.(Cys234Trp)"	""
"0000264709"	"00005383"	"10"	"1320"	"14"	"1320"	"14"	"c.1320+14G>A"	"r.(=)"	"p.(=)"	""
"0000264710"	"00005383"	"30"	"1383"	"0"	"1383"	"0"	"c.1383C>T"	"r.(?)"	"p.(Asp461=)"	""
"0000264711"	"00005383"	"10"	"1534"	"0"	"1534"	"0"	"c.1534A>G"	"r.(?)"	"p.(Ile512Val)"	""
"0000264712"	"00005383"	"10"	"1928"	"18"	"1928"	"18"	"c.1928+18C>T"	"r.(=)"	"p.(=)"	""
"0000264713"	"00005383"	"50"	"2308"	"0"	"2308"	"0"	"c.2308G>T"	"r.(?)"	"p.(Val770Phe)"	""
"0000264714"	"00005383"	"10"	"2420"	"0"	"2420"	"0"	"c.2420C>G"	"r.(?)"	"p.(Ala807Gly)"	""
"0000266857"	"00005383"	"10"	"211"	"34"	"211"	"34"	"c.211+34del"	"r.(=)"	"p.(=)"	""
"0000268154"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000273675"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000273676"	"00005383"	"10"	"1356"	"0"	"1356"	"0"	"c.1356G>A"	"r.(?)"	"p.(Gln452=)"	""
"0000273677"	"00005383"	"50"	"1367"	"0"	"1367"	"0"	"c.1367G>A"	"r.(?)"	"p.(Arg456His)"	""
"0000273678"	"00005383"	"30"	"1534"	"0"	"1534"	"0"	"c.1534A>G"	"r.(?)"	"p.(Ile512Val)"	""
"0000273679"	"00005383"	"30"	"1732"	"0"	"1732"	"0"	"c.1732A>T"	"r.(?)"	"p.(Thr578Ser)"	""
"0000273680"	"00005383"	"30"	"183"	"0"	"183"	"0"	"c.183G>A"	"r.(?)"	"p.(Thr61=)"	""
"0000273681"	"00005383"	"50"	"319"	"0"	"319"	"0"	"c.319G>A"	"r.(?)"	"p.(Gly107Arg)"	""
"0000273682"	"00005383"	"30"	"43"	"0"	"43"	"0"	"c.43G>C"	"r.(?)"	"p.(Gly15Arg)"	""
"0000273683"	"00005383"	"50"	"489"	"0"	"489"	"0"	"c.489A>T"	"r.(?)"	"p.(Gln163His)"	""
"0000273684"	"00005383"	"50"	"647"	"0"	"647"	"0"	"c.647G>T"	"r.(?)"	"p.(Arg216Leu)"	""
"0000273685"	"00005383"	"10"	"80"	"0"	"80"	"0"	"c.80A>G"	"r.(?)"	"p.(Asn27Ser)"	""
"0000273686"	"00005383"	"90"	"886"	"0"	"886"	"0"	"c.886A>T"	"r.(?)"	"p.(Thr296Ser)"	""
"0000273687"	"00005383"	"90"	"887"	"0"	"896"	"0"	"c.887_896del"	"r.(?)"	"p.(Thr296AsnfsTer9)"	""
"0000273688"	"00005383"	"90"	"893"	"0"	"897"	"0"	"c.893_897del"	"r.(?)"	"p.(Thr298IlefsTer12)"	""
"0000332190"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000332191"	"00005383"	"90"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl?"	"p.?"	""
"0000336846"	"00005383"	"10"	"211"	"13"	"211"	"13"	"c.211+13T>G"	"r.(=)"	"p.(=)"	""
"0000338839"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl?"	"p.?"	""
"0000338840"	"00005383"	"90"	"1480"	"1"	"1480"	"1"	"c.1480+1G>A"	"r.spl?"	"p.?"	""
"0000338841"	"00005383"	"90"	"991"	"-2"	"991"	"-2"	"c.991-2A>C"	"r.spl?"	"p.?"	""
"0000338842"	"00005383"	"10"	"-36"	"0"	"-36"	"0"	"c.-36T>G"	"r.(?)"	"p.(=)"	""
"0000340503"	"00005383"	"10"	"2214"	"0"	"2214"	"0"	"c.2214A>G"	"r.(?)"	"p.(Glu738=)"	""
"0000341599"	"00005383"	"30"	"2420"	"0"	"2420"	"0"	"c.2420C>G"	"r.(?)"	"p.(Ala807Gly)"	""
"0000342204"	"00005383"	"10"	"608"	"0"	"608"	"0"	"c.608G>A"	"r.(?)"	"p.(Arg203Gln)"	""
"0000342503"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000343686"	"00005383"	"10"	"80"	"0"	"80"	"0"	"c.80A>G"	"r.(?)"	"p.(Asn27Ser)"	""
"0000344324"	"00005383"	"10"	"702"	"0"	"702"	"0"	"c.702T>G"	"r.(?)"	"p.(Cys234Trp)"	""
"0000344480"	"00005383"	"90"	"301"	"0"	"301"	"0"	"c.301C>T"	"r.(?)"	"p.(Gln101Ter)"	""
"0000344848"	"00005383"	"10"	"1356"	"0"	"1356"	"0"	"c.1356G>A"	"r.(?)"	"p.(Gln452=)"	""
"0000345539"	"00005383"	"10"	"2264"	"0"	"2264"	"0"	"c.2264A>G"	"r.(?)"	"p.(Glu755Gly)"	""
"0000346155"	"00005383"	"90"	"1643"	"0"	"1643"	"0"	"c.1643del"	"r.(?)"	"p.(Gly548ValfsTer37)"	""
"0000346676"	"00005383"	"10"	"919"	"0"	"919"	"0"	"c.919A>G"	"r.(?)"	"p.(Ile307Val)"	""
"0000349010"	"00005383"	"90"	"1304"	"0"	"1304"	"0"	"c.1304C>T"	"r.(?)"	"p.(Ser435Phe)"	""
"0000349425"	"00005383"	"10"	"892"	"0"	"892"	"0"	"c.892A>C"	"r.(?)"	"p.(Thr298Pro)"	""
"0000349485"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000350077"	"00005383"	"50"	"1193"	"0"	"1193"	"0"	"c.1193A>G"	"r.(?)"	"p.(Tyr398Cys)"	""
"0000350256"	"00005383"	"50"	"31"	"0"	"31"	"0"	"c.31G>A"	"r.(?)"	"p.(Val11Met)"	""
"0000351398"	"00005383"	"10"	"1781"	"10"	"1781"	"10"	"c.1781+10A>T"	"r.(=)"	"p.(=)"	""
"0000351399"	"00005383"	"90"	"904"	"-2"	"904"	"-2"	"c.904-2A>C"	"r.spl?"	"p.?"	""
"0000358227"	"00005383"	"90"	"2328"	"0"	"2328"	"0"	"c.2328del"	"r.(?)"	"p.(Pro776fs*51)"	"18"
"0000358228"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*12)"	"10"
"0000358229"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*12)"	"10"
"0000358230"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336*)"	"9"
"0000358231"	"00005383"	"70"	""	"0"	""	"0"	"c.782A<G"	"r.(?)"	"p.(Asp261Gly)"	"6"
"0000358232"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	"5i"
"0000358233"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	"5i"
"0000358431"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336*)"	"9"
"0000358432"	"00005383"	"90"	"819"	"0"	"819"	"0"	"c.819del"	"r.(?)"	"p.(Pro273fs*5)"	"6"
"0000358433"	"00005383"	"90"	"467"	"0"	"467"	"0"	"c.467C>T"	"r.(?)"	"p.(Ser156Phe)"	"4"
"0000392083"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000394431"	"00005383"	"90"	"1304"	"0"	"1304"	"0"	"c.1304C>T"	"r.(?)"	"p.(Ser435Phe)"	""
"0000394432"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000394433"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	""
"0000394455"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000394456"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	"13i"
"0000394457"	"00005383"	"90"	"607"	"0"	"607"	"0"	"c.607C>T"	"r.(?)"	"p.(Arg203*)"	"5"
"0000394458"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000394459"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000394460"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336*)"	"9"
"0000394461"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000394462"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000394463"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000394464"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000394465"	"00005383"	"90"	"1304"	"0"	"1304"	"0"	"c.1304C>T"	"r.(?)"	"p.(Ser435Phe)"	"11"
"0000394466"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000394467"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	"6"
"0000535371"	"00005383"	"30"	"2420"	"0"	"2420"	"0"	"c.2420C>G"	"r.(?)"	"p.(Ala807Gly)"	""
"0000535372"	"00005383"	"70"	"2221"	"0"	"2221"	"0"	"c.2221del"	"r.(?)"	"p.(Asp741IlefsTer88)"	""
"0000535373"	"00005383"	"50"	"1834"	"0"	"1834"	"0"	"c.1834G>T"	"r.(?)"	"p.(Gly612Trp)"	""
"0000535374"	"00005383"	"30"	"1732"	"0"	"1732"	"0"	"c.1732A>T"	"r.(?)"	"p.(Thr578Ser)"	""
"0000535375"	"00005383"	"70"	"1672"	"0"	"1672"	"0"	"c.1672G>T"	"r.(?)"	"p.(Gly558Cys)"	""
"0000535376"	"00005383"	"30"	"1627"	"0"	"1627"	"0"	"c.1627G>A"	"r.(?)"	"p.(Val543Ile)"	""
"0000535377"	"00005383"	"30"	"1439"	"0"	"1439"	"0"	"c.1439G>A"	"r.(?)"	"p.(Arg480Gln)"	""
"0000535378"	"00005383"	"50"	"1411"	"0"	"1411"	"0"	"c.1411A>G"	"r.(?)"	"p.(Ile471Val)"	""
"0000535379"	"00005383"	"70"	"1405"	"0"	"1405"	"0"	"c.1405T>G"	"r.(?)"	"p.(Tyr469Asp)"	""
"0000535380"	"00005383"	"50"	"1402"	"0"	"1402"	"0"	"c.1402A>C"	"r.(?)"	"p.(Asn468His)"	""
"0000535383"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000535384"	"00005383"	"50"	"1096"	"0"	"1096"	"0"	"c.1096A>G"	"r.(?)"	"p.(Ile366Val)"	""
"0000535385"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	""
"0000535386"	"00005383"	"50"	"1006"	"0"	"1006"	"0"	"c.1006G>A"	"r.(?)"	"p.(Glu336Lys)"	""
"0000535387"	"00005383"	"90"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl?"	"p.?"	""
"0000535388"	"00005383"	"30"	"913"	"0"	"913"	"0"	"c.913G>A"	"r.(?)"	"p.(Ala305Thr)"	""
"0000535389"	"00005383"	"10"	"892"	"0"	"892"	"0"	"c.892A>C"	"r.(?)"	"p.(Thr298Pro)"	""
"0000535390"	"00005383"	"10"	"892"	"0"	"892"	"0"	"c.892A>C"	"r.(?)"	"p.(Thr298Pro)"	""
"0000535391"	"00005383"	"90"	"886"	"0"	"890"	"0"	"c.886_890del"	"r.(?)"	"p.(Thr296TyrfsTer14)"	""
"0000535392"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000535393"	"00005383"	"30"	"738"	"0"	"738"	"0"	"c.738C>T"	"r.(?)"	"p.(Thr246=)"	""
"0000535396"	"00005383"	"50"	"283"	"0"	"283"	"0"	"c.283A>C"	"r.(?)"	"p.(Thr95Pro)"	""
"0000535397"	"00005383"	"10"	"212"	"-3"	"212"	"-3"	"c.212-3T>C"	"r.spl?"	"p.?"	""
"0000594737"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	""
"0000611716"	"00005383"	"50"	"1833"	"0"	"1833"	"0"	"c.1833C>A"	"r.(?)"	"p.(His611Gln)"	""
"0000611717"	"00005383"	"90"	"646"	"0"	"646"	"0"	"c.646C>T"	"r.(?)"	"p.(Arg216Ter)"	""
"0000622096"	"00005383"	"30"	"77"	"0"	"77"	"0"	"c.77G>A"	"r.(?)"	"p.(Arg26Gln)"	""
"0000652526"	"00005383"	"50"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000652527"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000652528"	"00005383"	"70"	"607"	"0"	"607"	"0"	"c.607C>T"	"r.(?)"	"p.(Arg203*)"	""
"0000652529"	"00005383"	"30"	"211"	"13"	"211"	"13"	"c.211+13T>G"	"r.(=)"	"p.(=)"	""
"0000652530"	"00005383"	"50"	"80"	"0"	"80"	"0"	"c.80A>G"	"r.(?)"	"p.(Asn27Ser)"	""
"0000653428"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000656157"	"00005383"	"90"	"1480"	"1"	"1480"	"1"	"c.1480+1G>A"	"r.spl?"	"p.?"	""
"0000670021"	"00005383"	"50"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000670022"	"00005383"	"30"	"211"	"13"	"211"	"13"	"c.211+13T>G"	"r.(=)"	"p.(=)"	""
"0000670023"	"00005383"	"50"	"80"	"0"	"80"	"0"	"c.80A>G"	"r.(?)"	"p.(Asn27Ser)"	""
"0000678445"	"00005383"	"30"	"2159"	"0"	"2159"	"0"	"c.2159A>G"	"r.(?)"	"p.(Gln720Arg)"	""
"0000678446"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	""
"0000678447"	"00005383"	"30"	"813"	"0"	"813"	"0"	"c.813C>A"	"r.(?)"	"p.(Ile271=)"	""
"0000684517"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000684518"	"00005383"	"70"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	""
"0000685150"	"00005383"	"90"	"2328"	"0"	"2328"	"0"	"c.2328del"	"r.(?)"	"p.(Arg777Glufs*52)"	""
"0000685151"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000685152"	"00005383"	"90"	"1207"	"0"	"1207"	"0"	"c.1207C>T"	"r.(?)"	"p.(Arg403*)"	""
"0000685153"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000685154"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336*)"	""
"0000685155"	"00005383"	"90"	"819"	"0"	"819"	"0"	"c.819del"	"r.(?)"	"p.(Arg274Aspfs*5)"	""
"0000685156"	"00005383"	"70"	"782"	"0"	"782"	"0"	"c.782A>G"	"r.(?)"	"p.(Asp261Gly)"	""
"0000685157"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	""
"0000685158"	"00005383"	"70"	"467"	"0"	"467"	"0"	"c.467C>T"	"r.(?)"	"p.(Ser156Phe)"	""
"0000685159"	"00005383"	"90"	"105"	"0"	"114"	"0"	"c.105_114del"	"r.(?)"	"p.(Gln36Lysfs*44)"	""
"0000690324"	"00005383"	"30"	"2383"	"0"	"2383"	"0"	"c.2383G>A"	"r.(?)"	"p.(Gly795Arg)"	""
"0000703781"	"00005383"	"50"	"1460"	"0"	"1460"	"0"	"c.1460G>A"	"r.(?)"	"p.(Trp487*)"	"12"
"0000703782"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000703783"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000703784"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000703785"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000703786"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000703787"	"00005383"	"50"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	"6"
"0000703788"	"00005383"	"50"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl?"	"p.?"	"13i"
"0000704032"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000704033"	"00005383"	"90"	"595"	"0"	"595"	"0"	"c.595del"	"r.(?)"	"p.(Glu199Serfs*3)"	"5"
"0000704034"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000704035"	"00005383"	"90"	"595"	"0"	"595"	"0"	"c.595del"	"r.(?)"	"p.(Glu199Serfs*3)"	"5"
"0000704036"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000704040"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000704047"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000704048"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000704050"	"00005383"	"90"	"1573"	"0"	"1574"	"0"	"c.1573_1574inv"	"r.(?)"	"p.(Phe525Asn)"	"13"
"0000704051"	"00005383"	"90"	"1573"	"0"	"1574"	"0"	"c.1573_1574inv"	"r.(?)"	"p.(Phe525Asn)"	"13"
"0000704052"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000704054"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000704055"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000704057"	"00005383"	"30"	"919"	"0"	"919"	"0"	"c.919A>G"	"r.(?)"	"p.(Ile307Val)"	"8"
"0000708432"	"00005383"	"70"	"1405"	"0"	"1405"	"0"	"c.1405T>G"	"r.(?)"	"p.(Tyr469Asp)"	"12"
"0000708434"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000708439"	"00005383"	"70"	"1635"	"0"	"1635"	"0"	"c.1635T>A"	"r.(?)"	"p.(Tyr545*)"	"14"
"0000708442"	"00005383"	"70"	"1783"	"0"	"1783"	"0"	"c.1783C>T"	"r.(?)"	"p.(Leu595Phe)"	"16"
"0000708445"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000708448"	"00005383"	"70"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	"6"
"0000708452"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000708453"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000708455"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000708456"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000708459"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000708460"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000708461"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000708463"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000708465"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000708466"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000708468"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000708469"	"00005383"	"70"	"391"	"0"	"391"	"0"	"c.391C>T"	"r.(?)"	"p.(Gln131*)"	"4"
"0000708470"	"00005383"	"70"	"1672"	"0"	"1672"	"0"	"c.1672G>T"	"r.(?)"	"p.(Gly558Cys)"	"15"
"0000708471"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000708472"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000710355"	"00005383"	"50"	"397"	"0"	"397"	"0"	"c.397C>T"	"r.(?)"	"p.(His133Tyr)"	""
"0000713273"	"00005383"	"90"	"1810"	"0"	"1810"	"0"	"c.1810C>T"	"r.(?)"	"p.(Arg604*)"	""
"0000713305"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000713361"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000713473"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000713544"	"00005383"	"90"	"2103"	"1"	"2103"	"1"	"c.2103+1G>A"	"r.spl?"	"p.?"	""
"0000713649"	"00005383"	"90"	"1285"	"0"	"1285"	"0"	"c.1285del"	"r.(?)"	"p.(Ser429Leufs*9)"	""
"0000713676"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000713890"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000713905"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	""
"0000714023"	"00005383"	"70"	"901"	"0"	"901"	"0"	"c.901C>T"	"r.(?)"	"p.(Gln301*)"	""
"0000714024"	"00005383"	"70"	"904"	"-2"	"904"	"-2"	"c.904-2A>T"	"r.spl"	"p.?"	""
"0000714025"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000714026"	"00005383"	"70"	"190"	"0"	"190"	"0"	"c.190del"	"r.(?)"	"p.(Glu64Serfs*19)"	""
"0000714091"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000714092"	"00005383"	"70"	"1426"	"0"	"1426"	"0"	"c.1426C>T"	"r.(?)"	"p.(Gln476*)"	""
"0000714093"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000722094"	"00005383"	"30"	"1833"	"0"	"1833"	"0"	"c.1833C>T"	"r.(?)"	"p.(His611=)"	""
"0000722095"	"00005383"	"50"	"1052"	"0"	"1052"	"0"	"c.1052A>G"	"r.(?)"	"p.(Tyr351Cys)"	""
"0000722096"	"00005383"	"50"	"760"	"0"	"760"	"0"	"c.760C>T"	"r.(?)"	"p.(Leu254Phe)"	""
"0000722097"	"00005383"	"90"	"615"	"0"	"615"	"0"	"c.615del"	"r.(?)"	"p.(Lys205AsnfsTer6)"	""
"0000722098"	"00005383"	"30"	"221"	"0"	"221"	"0"	"c.221C>T"	"r.(?)"	"p.(Ser74Phe)"	""
"0000729793"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	""
"0000729796"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000730319"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000730320"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336*)"	""
"0000730321"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	""
"0000730322"	"00005383"	"90"	"130"	"-1"	"130"	"-1"	"c.130-1G>T"	"r.spl"	"p.?"	""
"0000730323"	"00005383"	"90"	"129"	"2"	"129"	"2"	"c.129+2T>C"	"r.spl"	"p.?"	""
"0000730324"	"00005383"	"90"	"129"	"2"	"129"	"2"	"c.129+2T>C"	"r.spl"	"p.?"	""
"0000730325"	"00005383"	"90"	"3"	"0"	"3"	"0"	"c.3G>A"	"r.(?)"	"p.(Met1?)"	""
"0000730330"	"00005383"	"90"	"1243"	"0"	"1243"	"0"	"c.1243C>T"	"r.(?)"	"p.(Gln415*)"	""
"0000730331"	"00005383"	"90"	"212"	"-2527"	"338"	"2854"	"c.212-2527_338+2854del"	"r.(?)"	"p.(Asp71Alafs*12)"	"2i_3i"
"0000730332"	"00005383"	"90"	"212"	"-2527"	"338"	"2854"	"c.212-2527_338+2854del"	"r.(?)"	"p.(Asp71Alafs*12)"	"2i_3i"
"0000730333"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000730986"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000731022"	"00005383"	"50"	"2142"	"0"	"2163"	"0"	"c.2142_2163del"	"r.(?)"	"p.(Glu715Lysfs*107)"	""
"0000731037"	"00005383"	"70"	"1306"	"0"	"1306"	"0"	"c.1306A>C"	"r.(?)"	"p.(Ser436Arg)"	""
"0000731152"	"00005383"	"90"	"607"	"0"	"607"	"0"	"c.607C>T"	"r.(?)"	"p.(Arg203*)"	""
"0000731162"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000731174"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000731330"	"00005383"	"70"	"1928"	"2"	"1928"	"2"	"c.1928+2T>C"	"r.spl"	"p.?"	""
"0000731424"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000731425"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000731426"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000731448"	"00005383"	"70"	"970"	"0"	"970"	"0"	"c.970A>G"	"r.(?)"	"p.(Arg324Gly)"	""
"0000731449"	"00005383"	"70"	"970"	"0"	"970"	"0"	"c.970A>G"	"r.(?)"	"p.(Arg324Gly)"	""
"0000731450"	"00005383"	"70"	"1285"	"0"	"1285"	"0"	"c.1285del"	"r.(?)"	"p.(Ser429Leufs*9)"	""
"0000732393"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000732422"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	"6"
"0000732587"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000732868"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000733220"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000733221"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000733222"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000733223"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000733644"	"00005383"	"70"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	""
"0000734253"	"00005383"	"50"	"1528"	"0"	"1528"	"0"	"c.1528C>T"	"r.(?)"	"p.(Leu510Phe)"	""
"0000734408"	"00005383"	"90"	"607"	"0"	"607"	"0"	"c.607C>T"	"r.(?)"	"p.(Arg203*)"	""
"0000735176"	"00005383"	"50"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000735610"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000735611"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	""
"0000735732"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000735733"	"00005383"	"90"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl?"	"p.?"	""
"0000735736"	"00005383"	"50"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000735738"	"00005383"	"50"	"1672"	"0"	"1672"	"0"	"c.1672G>T"	"r.(?)"	"p.(Gly558Cys)"	""
"0000735831"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000735989"	"00005383"	"70"	"1627"	"0"	"1627"	"0"	"c.1627G>A"	"r.(?)"	"p.(Val543Ile)"	"14"
"0000736204"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	"13i"
"0000736257"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000736829"	"00005383"	"50"	"2179"	"0"	"2199"	"0"	"c.2179_2199del"	"r.(?)"	"p.(Gln727_Lys733del)"	""
"0000760049"	"00005383"	"50"	"2420"	"0"	"2420"	"0"	"c.2420C>G"	"r.(?)"	"p.(Ala807Gly)"	""
"0000760134"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000760141"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000760144"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000760147"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000760148"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000760149"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000760150"	"00005383"	"70"	"1781"	"1"	"1781"	"1"	"c.1781+1G>C"	"r.spl"	"p.?"	""
"0000760420"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000760961"	"00005383"	"70"	"1179"	"-2"	"1179"	"-2"	"c.1179-2A>T"	"r.spl"	"p.?"	""
"0000763947"	"00005383"	"70"	"1774"	"0"	"1774"	"0"	"c.1774dup"	"r.(?)"	"p.(Glu592GlyfsTer44)"	""
"0000763948"	"00005383"	"70"	"680"	"0"	"680"	"0"	"c.680T>C"	"r.(?)"	"p.(Leu227Pro)"	""
"0000763949"	"00005383"	"70"	"129"	"1"	"129"	"1"	"c.129+1G>A"	"r.spl"	"p.?"	""
"0000764016"	"00005383"	"70"	"1271"	"0"	"1271"	"0"	"c.1271T>G"	"r.(?)"	"p.(Leu424Arg)"	""
"0000764910"	"00005383"	"70"	"1430"	"0"	"1431"	"0"	"c.1430_1431delinsC"	"r.(?)"	"p.(Lys477ThrfsTer17)"	""
"0000785368"	"00005383"	"90"	"646"	"0"	"646"	"0"	"c.646C>T"	"r.(?)"	"p.(Arg216*)"	""
"0000786399"	"00005383"	"90"	"1397"	"0"	"1397"	"0"	"c.1397T>A"	"r.(?)"	"p.(Met466Lys)"	""
"0000786400"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000786472"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000787766"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000787767"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000787768"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000787769"	"00005383"	"90"	"595"	"0"	"595"	"0"	"c.595del"	"r.(?)"	"p.(Glu199SerfsTer3)"	""
"0000787770"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000787774"	"00005383"	"90"	"607"	"0"	"608"	"0"	"c.607_608insT"	"r.(?)"	"p.(Arg203LeufsTer3)"	""
"0000788180"	"00005383"	"90"	"1432"	"0"	"1432"	"0"	"c.1432C>T"	"r.(?)"	"p.(Arg478Ter)"	""
"0000788182"	"00005383"	"50"	"1056"	"-3"	"1056"	"-3"	"c.1056-3C>G"	"r.spl?"	"p.?"	""
"0000788183"	"00005383"	"90"	"1432"	"0"	"1432"	"0"	"c.1432C>T"	"r.(?)"	"p.(Arg478Ter)"	""
"0000788188"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	""
"0000788189"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000788197"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000788334"	"00005383"	"50"	"701"	"0"	"701"	"0"	"c.701G>T"	"r.(?)"	"p.(Cys234Phe)"	"6"
"0000789857"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000789858"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000790897"	"00005383"	"70"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296Tyrfs*9)"	"7"
"0000790898"	"00005383"	"70"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl?"	"p.?"	"8i"
"0000790899"	"00005383"	"70"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	"6"
"0000790900"	"00005383"	"70"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296Tyrfs*9)"	"7"
"0000790901"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000790904"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000790905"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000790910"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000790911"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000790912"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000790913"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000790914"	"00005383"	"70"	"1643"	"0"	"1643"	"0"	"c.1643del"	"r.(?)"	"p.(Gly548Valfs*37)"	"14"
"0000790915"	"00005383"	"70"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl?"	"p.?"	"8i"
"0000790916"	"00005383"	"70"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl?"	"p.?"	"8i"
"0000790917"	"00005383"	"70"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl?"	"p.?"	"8i"
"0000790921"	"00005383"	"70"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl?"	"p.?"	"8i"
"0000790922"	"00005383"	"70"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296Tyrfs*9)"	"7"
"0000790923"	"00005383"	"70"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	"6"
"0000790924"	"00005383"	"70"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296Tyrfs*9)"	"7"
"0000790925"	"00005383"	"70"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	"6"
"0000791140"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	"6"
"0000791159"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000791183"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	"6"
"0000791203"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.spl"	"p.(Thr383Ilefs*13)"	"10"
"0000791252"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.(?)"	"13i"
"0000791894"	"00005383"	"90"	"1825"	"0"	"1825"	"0"	"c.1825delG"	"r.(?)"	"p.(Val609Trpfs*9)"	"16"
"0000791895"	"00005383"	"90"	"1825"	"0"	"1825"	"0"	"c.1825delG"	"r.(?)"	"p.(Val609Trpfs*9)"	"16"
"0000791896"	"00005383"	"90"	"1825"	"0"	"1825"	"0"	"c.1825delG"	"r.(?)"	"p.(Val609Trpfs*9)"	"16"
"0000791897"	"00005383"	"90"	"1825"	"0"	"1825"	"0"	"c.1825delG"	"r.(?)"	"p.(Val609Trpfs*9)"	"16"
"0000791898"	"00005383"	"90"	"1825"	"0"	"1825"	"0"	"c.1825delG"	"r.(?)"	"p.(Val609Trpfs*9)"	"16"
"0000791899"	"00005383"	"90"	"1825"	"0"	"1825"	"0"	"c.1825delG"	"r.(?)"	"p.(Val609Trpfs*9)"	"16"
"0000791900"	"00005383"	"90"	"1825"	"0"	"1825"	"0"	"c.1825delG"	"r.(?)"	"p.(Val609Trpfs*9)"	"16"
"0000791901"	"00005383"	"90"	"1825"	"0"	"1825"	"0"	"c.1825delG"	"r.(?)"	"p.(Val609Trpfs*9)"	"16"
"0000792280"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000792292"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000792301"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del8"	"r.(?)"	"p.(Arg274Valfs*13)"	"6"
"0000792302"	"00005383"	"90"	"886"	"-896"	"886"	"-896"	"c.886-896del11insT"	"r.(?)"	"p.(Thr296Tyrfs*9)"	"6i"
"0000792303"	"00005383"	"90"	"886"	"-896"	"886"	"-896"	"c.886-896del11insT"	"r.(?)"	"p.(Thr296Tyrfs*9)"	"6i"
"0000792304"	"00005383"	"90"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl?"	"p.?"	"8i"
"0000792305"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000792306"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000792307"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000792310"	"00005383"	"90"	"2383"	"0"	"2383"	"0"	"c.2383G>A"	"r.(?)"	"p.(Gly795Arg)"	"18"
"0000794819"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000794820"	"00005383"	"70"	"852"	"1"	"852"	"1"	"c.852+1G>C"	"r.spl"	"p.(?)"	""
"0000795862"	"00005383"	"70"	"852"	"1"	"852"	"1"	"c.852+1G>C"	"r.spl"	"p.(?)"	"6i"
"0000796108"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796109"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl?"	"p.?"	"13i"
"0000796110"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796111"	"00005383"	"90"	"595"	"0"	"595"	"0"	"c.595del"	"r.(?)"	"p.(Glu199Serfs*3)"	"5"
"0000796112"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796113"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796114"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336*)"	"9"
"0000796115"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796116"	"00005383"	"90"	"595"	"0"	"595"	"0"	"c.595del"	"r.(?)"	"p.(Glu199Serfs*3)"	"5"
"0000796117"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796118"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796119"	"00005383"	"90"	"595"	"0"	"595"	"0"	"c.595del"	"r.(?)"	"p.(Glu199Serfs*3)"	"5"
"0000796120"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796121"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796122"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796123"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796124"	"00005383"	"90"	"607"	"0"	"608"	"0"	"c.607_608insT"	"r.(?)"	"p.(Arg203Leufs*3)"	"5"
"0000796125"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796126"	"00005383"	"90"	"1853"	"0"	"1853"	"0"	"c.1853del"	"r.(?)"	"p.(Thr618Ilefs*2)"	"16"
"0000796127"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796128"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796129"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796992"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000796993"	"00005383"	"90"	"1666"	"0"	"1666"	"0"	"c.1666G>T"	"r.(?)"	"p.(Glu556*)"	"15"
"0000796994"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000797228"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797229"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797230"	"00005383"	"90"	"112"	"0"	"112"	"0"	"c.112C>T"	"r.(?)"	"p.(Gln38*)"	""
"0000797231"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797232"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000797233"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000797234"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000797235"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000797236"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797237"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797238"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797239"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797240"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	""
"0000797241"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000797242"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000797243"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000797244"	"00005383"	"90"	"1673"	"0"	"1673"	"0"	"c.1673G>T"	"r.(?)"	"p.(Gly558Val)"	""
"0000797245"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000797246"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000797247"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000797248"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.(?)"	""
"0000797249"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000797250"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000797405"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797406"	"00005383"	"70"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.(?)"	""
"0000797407"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797408"	"00005383"	"70"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.(?)"	""
"0000797451"	"00005383"	"70"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	""
"0000797452"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797580"	"00005383"	"70"	"1700"	"0"	"1700"	"0"	"c.1700G>A"	"r.(?)"	"p.(Gly567Glu)"	""
"0000797581"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797582"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797583"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797585"	"00005383"	"90"	"1432"	"0"	"1432"	"0"	"c.1432C>T"	"r.(?)"	"p.(Arg478*)"	""
"0000797586"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000797587"	"00005383"	"70"	"212"	"-1"	"338"	"1"	"c.(211+1_212-1)_(338+1_339-1)del"	"r.(?)"	"p.(?)"	""
"0000797823"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.(?)"	""
"0000797986"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000798128"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000798178"	"00005383"	"30"	"2420"	"0"	"2420"	"0"	"c.2420C>G"	"r.(?)"	"p.(Ala807Gly)"	""
"0000798426"	"00005383"	"50"	"1825"	"0"	"1825"	"0"	"c.1825del"	"r.(?)"	"p.(Val609Trpfs*9)"	"16"
"0000803749"	"00005383"	"30"	"1936"	"0"	"1936"	"0"	"c.1936T>C"	"r.(?)"	"p.(Leu646=)"	""
"0000803750"	"00005383"	"50"	"1898"	"0"	"1898"	"0"	"c.1898A>G"	"r.(?)"	"p.(Asp633Gly)"	""
"0000803751"	"00005383"	"50"	"1510"	"0"	"1510"	"0"	"c.1510A>G"	"r.(?)"	"p.(Thr504Ala)"	""
"0000803752"	"00005383"	"50"	"1439"	"0"	"1439"	"0"	"c.1439G>A"	"r.(?)"	"p.(Arg480Gln)"	""
"0000803753"	"00005383"	"30"	"648"	"0"	"648"	"0"	"c.648A>G"	"r.(?)"	"p.(Arg216=)"	""
"0000803754"	"00005383"	"30"	"494"	"-11"	"494"	"-11"	"c.494-11T>C"	"r.(=)"	"p.(=)"	""
"0000811403"	"00005383"	"70"	"372"	"0"	"375"	"0"	"c.372_375del"	"r.(?)"	"p.(Ile124Metfs*12)"	""
"0000811404"	"00005383"	"70"	"1318"	"0"	"1318"	"0"	"c.1318C>T"	"r.(?)"	"p.(Gln440*)"	""
"0000815325"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000815326"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000815387"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000815388"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000815404"	"00005383"	"50"	"731"	"0"	"731"	"0"	"c.731A>G"	"r.(?)"	"p.(Tyr244Cys)"	""
"0000815457"	"00005383"	"50"	"2420"	"0"	"2420"	"0"	"c.2420C>G"	"r.(?)"	"p.(Ala807Gly)"	""
"0000815463"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000815474"	"00005383"	"90"	"133"	"0"	"133"	"0"	"c.133G>T"	"r.(?)"	"p.(Glu45Ter)"	""
"0000815476"	"00005383"	"90"	"133"	"0"	"133"	"0"	"c.133G>T"	"r.(?)"	"p.(Glu45Ter)"	""
"0000815488"	"00005383"	"50"	"677"	"0"	"677"	"0"	"c.677C>A"	"r.(?)"	"p.(Thr226Asn)"	""
"0000815530"	"00005383"	"50"	"2420"	"0"	"2420"	"0"	"c.2420C>G"	"r.(?)"	"p.(Ala807Gly)"	""
"0000815535"	"00005383"	"90"	"1432"	"0"	"1432"	"0"	"c.1432C>T"	"r.(?)"	"p.(Arg478*)"	""
"0000815537"	"00005383"	"90"	"1432"	"0"	"1432"	"0"	"c.1432C>T"	"r.(?)"	"p.(Arg478*)"	""
"0000815540"	"00005383"	"90"	"852"	"1"	"852"	"1"	"c.852+1G>C"	"r.spl"	"p.(?)"	""
"0000815595"	"00005383"	"50"	"2420"	"0"	"2420"	"0"	"c.2420C>G"	"r.(?)"	"p.(Ala807Gly)"	""
"0000816085"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000816137"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.(?)"	""
"0000816414"	"00005383"	"70"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296Tyrfs*9)"	""
"0000816450"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.(?)"	""
"0000818950"	"00005383"	"70"	"991"	"-1"	"1178"	"1"	"c.(990+1_991-1)_(1178+1_1179-1)del"	"r.?"	"p.?"	"8i_10i"
"0000818951"	"00005383"	"70"	"990"	"1"	"990"	"1"	"c.990+1G>T"	"r.spl"	"p.?"	"8i"
"0000819355"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820388"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820403"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820437"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820438"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820439"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820454"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820461"	"00005383"	"70"	"339"	"-1"	"4299"	"0"	"c.(338+1_339-1)_(*1869_?)del"	"r.spl"	"p.(?)"	""
"0000820462"	"00005383"	"70"	"1063"	"0"	"1063"	"0"	"c.1063C>T"	"r.(?)"	"p.(Arg355*)"	""
"0000820472"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820476"	"00005383"	"70"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	""
"0000820477"	"00005383"	"70"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	""
"0000820479"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000820480"	"00005383"	"70"	"2221"	"0"	"2221"	"0"	"c.2221del"	"r.(?)"	"p.(Asp741Ilefs*88)"	""
"0000820483"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820484"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820485"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820487"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820489"	"00005383"	"70"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	""
"0000820492"	"00005383"	"70"	"643"	"0"	"643"	"0"	"c.643G>C"	"r.(?)"	"p.(Asp215His)"	""
"0000820502"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820519"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820584"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820586"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820587"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820590"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820591"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820593"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820599"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820600"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820601"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820602"	"00005383"	"70"	"1207"	"0"	"1207"	"0"	"c.1207C>T"	"r.(?)"	"p.(Arg403*)"	""
"0000820604"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820605"	"00005383"	"70"	"1055"	"1"	"1055"	"1"	"c.1055+1G>C"	"r.spl"	"p.(?)"	""
"0000820606"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820607"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820892"	"00005383"	"70"	"607"	"0"	"607"	"0"	"c.607C>T"	"r.(?)"	"p.(Arg203*)"	""
"0000820927"	"00005383"	"70"	"1579"	"-2"	"1579"	"-2"	"c.1579-2A>G"	"r.spl"	"p.(?)"	""
"0000820933"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820934"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820937"	"00005383"	"70"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336*)"	""
"0000820938"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000820955"	"00005383"	"70"	"791"	"0"	"794"	"0"	"c.791_794del"	"r.(?)"	"p.(Tyr264Phefs*14)"	""
"0000820987"	"00005383"	"70"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.(?)"	""
"0000820992"	"00005383"	"70"	"1663"	"-1"	"1781"	"1"	"c.(1662+1_1663-1)_(1781+1_1782-1)del"	"r.spl"	"p.(?)"	""
"0000820993"	"00005383"	"70"	"1579"	"-1"	"1579"	"-1"	"c.1579-1G>A"	"r.spl"	"p.(?)"	""
"0000820994"	"00005383"	"70"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	""
"0000821219"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000821220"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000821221"	"00005383"	"70"	"2103"	"1"	"2103"	"1"	"c.2103+1G>A"	"r.spl"	"p.(?)"	""
"0000821222"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000821223"	"00005383"	"70"	"1260"	"0"	"1260"	"0"	"c.1260del"	"r.(?)"	"p.(Ile420Metfs*6)"	""
"0000821224"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000821225"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000821540"	"00005383"	"70"	"1285"	"0"	"1285"	"0"	"c.1285del"	"r.(?)"	"p.(Ser429Leufs*9)"	""
"0000821541"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	""
"0000822057"	"00005383"	"70"	"1810"	"0"	"1810"	"0"	"c.1810C>T"	"r.(?)"	"p.(Arg604*)"	""
"0000822245"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000822246"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000822360"	"00005383"	"70"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl?"	"p.?"	"13i"
"0000822361"	"00005383"	"70"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl?"	"p.?"	"13i"
"0000822403"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000822404"	"00005383"	"70"	"1167"	"0"	"1168"	"0"	"c.1167_1168insC"	"r.(?)"	"p.(Glu390Argfs*30)"	"10"
"0000822514"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000822515"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822516"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822517"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822518"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822519"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822520"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822521"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822522"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822523"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822524"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822525"	"00005383"	"90"	"646"	"0"	"646"	"0"	"c.646C>T"	"r.(?)"	"p.(Arg216Ter)"	""
"0000822526"	"00005383"	"90"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl?"	"p.?"	""
"0000822527"	"00005383"	"90"	"2"	"0"	"2"	"0"	"c.2T>C"	"r.(?)"	"p.(Met1?)"	""
"0000822528"	"00005383"	"90"	"1635"	"0"	"1635"	"0"	"c.1635T>A"	"r.(?)"	"p.(Tyr545Ter)"	""
"0000822529"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	""
"0000822530"	"00005383"	"90"	"1178"	"5"	"1178"	"5"	"c.1178+5G>T"	"r.spl?"	"p.?"	""
"0000822531"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000822532"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822533"	"00005383"	"90"	"1190"	"0"	"1192"	"0"	"c.1190_1192del"	"r.(?)"	"p.(Cys397del)"	""
"0000822534"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000822535"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	""
"0000822536"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	""
"0000822537"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822538"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822539"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822540"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822541"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822542"	"00005383"	"90"	"265"	"0"	"265"	"0"	"c.265C>T"	"r.(?)"	"p.(Gln89Ter)"	""
"0000822543"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	""
"0000822544"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000822545"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000822546"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000822547"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000822548"	"00005383"	"90"	"1397"	"0"	"1397"	"0"	"c.1397T>C"	"r.(?)"	"p.(Met466Thr)"	""
"0000822549"	"00005383"	"90"	"1405"	"0"	"1405"	"0"	"c.1405T>G"	"r.(?)"	"p.(Tyr469Asp)"	""
"0000822550"	"00005383"	"90"	"1781"	"0"	"1781"	"0"	"c.1781G>C"	"r.(?)"	"p.(Ser594Thr)"	""
"0000822551"	"00005383"	"30"	"130"	"-1161"	"130"	"-1161"	"c.130-1161A>C"	"r.(?)"	"p.(=)"	""
"0000822552"	"00005383"	"30"	"211"	"2085"	"211"	"2085"	"c.211+2085T>G"	"r.(?)"	"p.(=)"	""
"0000822553"	"00005383"	"30"	"211"	"2449"	"211"	"2449"	"c.211+2449G>A"	"r.(?)"	"p.(=)"	""
"0000822554"	"00005383"	"30"	"212"	"-5347"	"212"	"-5347"	"c.212-5347G>C"	"r.(?)"	"p.(=)"	""
"0000822555"	"00005383"	"30"	"212"	"-4549"	"212"	"-4549"	"c.212-4549T>C"	"r.(?)"	"p.(=)"	""
"0000822556"	"00005383"	"30"	"212"	"-3599"	"212"	"-3599"	"c.212-3599T>A"	"r.(=)"	"p.(=)"	""
"0000822557"	"00005383"	"30"	"338"	"465"	"338"	"465"	"c.338+465G>T"	"r.(?)"	"p.(=)"	""
"0000822558"	"00005383"	"30"	"338"	"1820"	"338"	"1820"	"c.338+1820G>C"	"r.(?)"	"p.(=)"	""
"0000822559"	"00005383"	"30"	"338"	"4727"	"338"	"4727"	"c.338+4727G>T"	"r.(?)"	"p.(=)"	""
"0000822560"	"00005383"	"30"	"338"	"12250"	"338"	"12250"	"c.338+12250C>T"	"r.(?)"	"p.(=)"	""
"0000822561"	"00005383"	"30"	"338"	"14712"	"338"	"14712"	"c.338+14712G>T"	"r.(?)"	"p.(=)"	""
"0000822562"	"00005383"	"30"	"338"	"16163"	"338"	"16163"	"c.338+16163G>A"	"r.(?)"	"p.(=)"	""
"0000822563"	"00005383"	"30"	"338"	"18721"	"338"	"18721"	"c.338+18721C>T"	"r.(?)"	"p.(=)"	""
"0000822564"	"00005383"	"30"	"339"	"-12423"	"339"	"-12418"	"c.339-12423_339-12418dup"	"r.(?)"	"p.(=)"	""
"0000822565"	"00005383"	"30"	"339"	"-9886"	"339"	"-9886"	"c.339-9886C>T"	"r.(?)"	"p.(=)"	""
"0000822566"	"00005383"	"30"	"339"	"-5537"	"339"	"-5537"	"c.339-5537G>A"	"r.(?)"	"p.(=)"	""
"0000822567"	"00005383"	"30"	"339"	"-2593"	"339"	"-2593"	"c.339-2593A>G"	"r.(?)"	"p.(=)"	""
"0000822568"	"00005383"	"30"	"339"	"-1034"	"339"	"-1034"	"c.339-1034C>T"	"r.(?)"	"p.(=)"	""
"0000822569"	"00005383"	"30"	"339"	"-760"	"339"	"-760"	"c.339-760C>T"	"r.(?)"	"p.(=)"	""
"0000822570"	"00005383"	"30"	"494"	"-1082"	"494"	"-1082"	"c.494-1082C>T"	"r.(?)"	"p.(=)"	""
"0000822571"	"00005383"	"30"	"852"	"2932"	"852"	"2932"	"c.852+2932A>G"	"r.(?)"	"p.(=)"	""
"0000822572"	"00005383"	"30"	"853"	"-3823"	"853"	"-3823"	"c.853-3823C>T"	"r.(?)"	"p.(=)"	""
"0000822573"	"00005383"	"30"	"853"	"-852"	"853"	"-852"	"c.853-852G>C"	"r.(?)"	"p.(=)"	""
"0000822574"	"00005383"	"30"	"903"	"1711"	"903"	"1711"	"c.903+1711G>T"	"r.(?)"	"p.(=)"	""
"0000822575"	"00005383"	"30"	"1179"	"-46"	"1179"	"-46"	"c.1179-46C>T"	"r.(?)"	"p.(=)"	""
"0000822576"	"00005383"	"30"	"1320"	"650"	"1320"	"650"	"c.1320+650C>T"	"r.(?)"	"p.(=)"	""
"0000822577"	"00005383"	"30"	"1578"	"12"	"1578"	"12"	"c.1578+12T>C"	"r.[(=,1481_1578del)"	"p.[(=,Asp494fs)]"	"13i"
"0000822578"	"00005383"	"30"	"1578"	"2769"	"1578"	"2769"	"c.1578+2769C>T"	"r.(?)"	"p.(=)"	""
"0000822579"	"00005383"	"30"	"1578"	"3571"	"1578"	"3571"	"c.1578+3571T>A"	"r.(?)"	"p.(=)"	""
"0000822580"	"00005383"	"30"	"1579"	"-6743"	"1579"	"-6743"	"c.1579-6743A>T"	"r.(?)"	"p.(=)"	""
"0000822581"	"00005383"	"30"	"1662"	"3619"	"1662"	"3619"	"c.1662+3619A>G"	"r.(?)"	"p.(=)"	""
"0000822582"	"00005383"	"30"	"1663"	"-3646"	"1663"	"-3646"	"c.1663-3646G>A"	"r.(?)"	"p.(=)"	""
"0000822583"	"00005383"	"30"	"1663"	"-3478"	"1663"	"-3478"	"c.1663-3478G>A"	"r.(?)"	"p.(=)"	""
"0000822584"	"00005383"	"30"	"1781"	"3948"	"1781"	"3948"	"c.1781+3948G>A"	"r.(?)"	"p.(=)"	""
"0000822585"	"00005383"	"30"	"1781"	"7906"	"1781"	"7906"	"c.1781+7906G>A"	"r.(?)"	"p.(=)"	""
"0000822586"	"00005383"	"30"	"1782"	"-12105"	"1782"	"-12105"	"c.1782-12105C>T"	"r.(?)"	"p.(=)"	""
"0000822587"	"00005383"	"30"	"1782"	"-9251"	"1782"	"-9251"	"c.1782-9251T>C"	"r.(?)"	"p.(=)"	""
"0000822588"	"00005383"	"30"	"1782"	"-7381"	"1782"	"-7381"	"c.1782-7381T>C"	"r.(?)"	"p.(=)"	""
"0000822589"	"00005383"	"30"	"1782"	"-7245"	"1782"	"-7242"	"c.1782-7245_1782-7242del"	"r.(?)"	"p.(=)"	""
"0000822590"	"00005383"	"30"	"1782"	"-7084"	"1782"	"-7083"	"c.1782-7084_1782-7083del"	"r.(?)"	"p.(=)"	""
"0000822591"	"00005383"	"30"	"1782"	"-2912"	"1782"	"-2912"	"c.1782-2912T>C"	"r.(?)"	"p.(=)"	""
"0000822592"	"00005383"	"30"	"1782"	"-2435"	"1782"	"-2435"	"c.1782-2435A>G"	"r.(?)"	"p.(=)"	""
"0000822593"	"00005383"	"30"	"1782"	"-1172"	"1782"	"-1172"	"c.1782-1172G>T"	"r.(?)"	"p.(=)"	""
"0000822594"	"00005383"	"30"	"1928"	"18"	"1928"	"18"	"c.1928+18C>T"	"r.(?)"	"p.(=)"	""
"0000822595"	"00005383"	"30"	"2104"	"-196"	"2104"	"-196"	"c.2104-196G>A"	"r.(?)"	"p.(=)"	""
"0000822596"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822597"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822598"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822599"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822600"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822601"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822602"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822603"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822604"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822605"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822606"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822607"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822608"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822609"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822610"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822611"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822612"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822613"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.[(1662_1663ins1663-1242_1663-1209,=)]"	"p.[(Gly555Leufs*33,=)]"	""
"0000822614"	"00005383"	"90"	"1663"	"-2137"	"1663"	"-2137"	"c.1663-2137C>T"	"r.[(1662_1663ins1663-2238_1663-2139,=)]"	"p.(Gly555Alafs*9)"	""
"0000822615"	"00005383"	"90"	"1663"	"-2137"	"1663"	"-2137"	"c.1663-2137C>T"	"r.[(1662_1663ins1663-2238_1663-2139,=)]"	"p.(Gly555Alafs*9)"	""
"0000822616"	"00005383"	"90"	"607"	"0"	"607"	"0"	"c.607C>T"	"r.(?)"	"p.(Arg203Ter)"	""
"0000822617"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	""
"0000822618"	"00005383"	"90"	"1430"	"0"	"1431"	"0"	"c.1430_1431delinsC"	"r.(?)"	"p.(Lys477ThrfsTer17)"	""
"0000822619"	"00005383"	"90"	"1633"	"0"	"1633"	"0"	"c.1633T>G"	"r.(?)"	"p.(Tyr545Asp)"	""
"0000822620"	"00005383"	"90"	"1271"	"0"	"1271"	"0"	"c.1271T>G"	"r.(?)"	"p.(Leu424Arg)"	""
"0000822621"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822622"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822623"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822624"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822625"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822626"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822627"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822628"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	""
"0000822629"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822630"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822631"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	""
"0000822632"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	""
"0000822633"	"00005383"	"90"	"467"	"0"	"467"	"0"	"c.467C>T"	"r.(?)"	"p.(Ser156Phe)"	""
"0000822634"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822635"	"00005383"	"90"	"467"	"0"	"467"	"0"	"c.467C>T"	"r.(?)"	"p.(Ser156Phe)"	""
"0000822636"	"00005383"	"90"	"467"	"0"	"467"	"0"	"c.467C>T"	"r.(?)"	"p.(Ser156Phe)"	""
"0000822637"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	""
"0000822638"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822639"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822640"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822641"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822642"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822643"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822644"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822645"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822646"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	""
"0000822647"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	""
"0000822648"	"00005383"	"90"	"782"	"0"	"782"	"0"	"c.782A>G"	"r.(?)"	"p.(Asp261Gly)"	""
"0000822649"	"00005383"	"90"	"782"	"0"	"782"	"0"	"c.782A>G"	"r.(?)"	"p.(Asp261Gly)"	""
"0000822650"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	""
"0000822651"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	""
"0000822652"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	""
"0000822653"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000822654"	"00005383"	"90"	"467"	"0"	"467"	"0"	"c.467C>T"	"r.(?)"	"p.(Ser156Phe)"	""
"0000822655"	"00005383"	"90"	"105"	"0"	"114"	"0"	"c.105_114del"	"r.(?)"	"p.(Gln36LysfsTer44)"	""
"0000822656"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822657"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822658"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822659"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822660"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822661"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822662"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822663"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822664"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822665"	"00005383"	"90"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	""
"0000822666"	"00005383"	"90"	"2328"	"0"	"2328"	"0"	"c.2328del"	"r.(?)"	"p.(Arg777GlufsTer52)"	""
"0000822667"	"00005383"	"90"	"2328"	"0"	"2328"	"0"	"c.2328del"	"r.(?)"	"p.(Arg777GlufsTer52)"	""
"0000822668"	"00005383"	"90"	"819"	"0"	"819"	"0"	"c.819del"	"r.(?)"	"p.(Arg274AspfsTer5)"	""
"0000822669"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	""
"0000822860"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000822861"	"00005383"	"50"	"1190"	"0"	"1192"	"0"	"c.1190_1192del"	"r.(?)"	"p.(Cys397del)"	"11"
"0000822862"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822863"	"00005383"	"90"	"646"	"0"	"646"	"0"	"c.646C>T"	"r.(?)"	"p.(Arg216Ter)"	"6"
"0000822864"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000822865"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822866"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822867"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822868"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822869"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822870"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822871"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000822872"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822873"	"00005383"	"90"	"265"	"0"	"265"	"0"	"c.265C>T"	"r.(?)"	"p.(Gln89Ter)"	"3"
"0000822874"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822875"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822876"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822877"	"00005383"	"90"	"2"	"0"	"2"	"0"	"c.2T>C"	"p.?"	"p.(Met1?)"	"1"
"0000822878"	"00005383"	"50"	"1397"	"0"	"1397"	"0"	"c.1397T>C"	"r.(?)"	"p.(Met466Thr)"	"12"
"0000822879"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000822880"	"00005383"	"70"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl"	"p.?"	"8i"
"0000822881"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822882"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822883"	"00005383"	"70"	"1405"	"0"	"1405"	"0"	"c.1405T>G"	"r.(?)"	"p.(Tyr469Asp)"	"12"
"0000822884"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822885"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	"7"
"0000822886"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	"7"
"0000822887"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000822888"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000822889"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000822890"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822891"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822892"	"00005383"	"70"	"806"	"0"	"806"	"0"	"c.806T>C"	"r.(?)"	"p.(Leu269Pro)"	"6"
"0000822893"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	"13i"
"0000822894"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000822895"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822896"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	"9"
"0000822897"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822898"	"00005383"	"90"	"1815"	"0"	"1815"	"0"	"c.1815del"	"r.(?)"	"p.(Ala606ProfsTer12)"	"16"
"0000822899"	"00005383"	"90"	"1534"	"0"	"1534"	"0"	"c.1534delinsGT"	"r.(?)"	"p.(Ile512ValfsTer2)"	"13"
"0000822900"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822901"	"00005383"	"90"	"95"	"0"	"95"	"0"	"c.95dup"	"r.(?)"	"p.(His32GlnfsTer4)"	"1"
"0000822902"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822903"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822904"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822905"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822906"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822907"	"00005383"	"90"	""	"0"	""	"0"	"c.(338+1_339-1)_*1869{0}"	"r.?"	"p.?"	"3i_18_"
"0000822908"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822909"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822910"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	"13i"
"0000822911"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000822912"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	"5i"
"0000822913"	"00005383"	"50"	"1056"	"-3"	"1056"	"-3"	"c.1056-3C>G"	"r.spl"	"p.?"	"9i"
"0000822914"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	"7"
"0000822915"	"00005383"	"90"	"852"	"4013"	"903"	"1698"	"c.852+4013_903+1698dup"	"r.?"	"p.?"	"6i_7i"
"0000822916"	"00005383"	"90"	"1663"	"-2660"	"1781"	"5516"	"c.1663-2660_1781+5516del"	"r.?"	"p..?"	"14i_15i"
"0000822917"	"00005383"	"90"	"904"	"-2824"	"1782"	"-8208"	"c.904-2824_1782-8208delins[KY923049.2:g.1_466]"	"r.?"	"p.?"	"7i_15i"
"0000822918"	"00005383"	"90"	""	"0"	""	"0"	"c.(1578+1_1579-1)_*1869{0}"	"r.?"	"p.?"	"13i_18_"
"0000822919"	"00005383"	"90"	"903"	"2021"	"903"	"2022"	"c.903+2021_903+2022ins[GTGTATACACGTGTATACCAT;339-17849_903+2021]"	"r.?"	"p.?"	"3i_7i"
"0000822920"	"00005383"	"90"	"903"	"2021"	"903"	"2022"	"c.903+2021_903+2022ins[GTGTATACACGTGTATACCAT;339-17849_903+2021]"	"r.?"	"p.?"	"3i_7i"
"0000822921"	"00005383"	"90"	"903"	"2021"	"903"	"2022"	"c.903+2021_903+2022ins[GTGTATACACGTGTATACCAT;339-17849_903+2021]"	"r.?"	"p.?"	"3i_7i"
"0000822922"	"00005383"	"90"	"1579"	"-924"	"1579"	"-923"	"c.1579-923_1579-924ins[caggcaaagacagagctt;338+15186_1579-923]"	"r.?"	"p.?"	"3i_13i"
"0000822923"	"00005383"	"90"	"852"	"4013"	"903"	"1698"	"c.852+4013_903+1698dup"	"r.?"	"p.?"	"6i_7i"
"0000822924"	"00005383"	"90"	"852"	"4013"	"903"	"1698"	"c.852+4013_903+1698dup"	"r.?"	"p.?"	"6i_7i"
"0000822925"	"00005383"	"90"	"852"	"4013"	"903"	"1698"	"c.852+4013_903+1698dup"	"r.?"	"p.?"	"6i_7i"
"0000822926"	"00005383"	"90"	"852"	"4013"	"903"	"1698"	"c.852+4013_903+1698dup"	"r.?"	"p.?"	"6i_7i"
"0000822927"	"00005383"	"90"	"1782"	"-3723"	"2103"	"739"	"c.1782-3723_2103+739del"	"r.?"	"p.?"	"15i_17i"
"0000822928"	"00005383"	"90"	""	"0"	""	"0"	"c.-48_(129+1_130-1){0}"	"r.0?"	"p.0?"	"_1_1i"
"0000822929"	"00005383"	"90"	"852"	"4013"	"903"	"1698"	"c.852+4013_903+1698dup"	"r.?"	"p.?"	"6i_7i"
"0000822964"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000822965"	"00005383"	"70"	"1063"	"0"	"1063"	"0"	"c.1063C>T"	"r.(?)"	"p.(Arg355*)"	""
"0000822983"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	"9"
"0000822984"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000822985"	"00005383"	"90"	"1285"	"0"	"1285"	"0"	"c.1285dup"	"r.(?)"	"p.(Ser429PhefsTer33)"	"11"
"0000822986"	"00005383"	"90"	"1430"	"0"	"1431"	"0"	"c.1430_1431delinsC"	"r.(?)"	"p.(Lys477ThrfsTer17)"	"12"
"0000822987"	"00005383"	"70"	"1447"	"0"	"1447"	"0"	"c.1447T>G"	"r.(?)"	"p.(Tyr483Asp)"	"12"
"0000822988"	"00005383"	"90"	"1480"	"1"	"1480"	"1"	"c.1480+1G>A"	"r.spl"	"p.?"	"12i"
"0000822989"	"00005383"	"90"	"1516"	"0"	"1516"	"0"	"c.1516del"	"r.(?)"	"p.(Val506SerfsTer3)"	"13"
"0000822990"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	"13i"
"0000822991"	"00005383"	"90"	"2221"	"0"	"2221"	"0"	"c.2221del"	"r.(?)"	"p.(Asp741IlefsTer88)"	"18"
"0000822992"	"00005383"	"90"	"2359"	"0"	"2359"	"0"	"c.2359del"	"r.(?)"	"p.(Ser787AlafsTer42)"	"18"
"0000822993"	"00005383"	"70"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl"	"p.?"	"8i"
"0000822994"	"00005383"	"90"	"1063"	"0"	"1063"	"0"	"c.1063C>T"	"r.(?)"	"p.(Arg355Ter)"	"10"
"0000822995"	"00005383"	"90"	"1119"	"0"	"1119"	"0"	"c.1119G>A"	"r.(?)"	"p.(Trp373Ter)"	"10"
"0000822996"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000822997"	"00005383"	"90"	"1304"	"0"	"1304"	"0"	"c.1304C>T"	"r.(?)"	"p.(Ser435Phe)"	"11"
"0000822998"	"00005383"	"90"	"1432"	"0"	"1432"	"0"	"c.1432C>T"	"r.(?)"	"p.(Arg478Ter)"	"12"
"0000822999"	"00005383"	"90"	"31"	"0"	"31"	"0"	"c.31dup"	"r.(?)"	"p.(Val11GlyfsTer9)"	"1"
"0000823000"	"00005383"	"90"	"607"	"0"	"607"	"0"	"c.607C>T"	"r.(?)"	"p.(Arg203Ter)"	"5"
"0000823001"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	"5i"
"0000823002"	"00005383"	"90"	"646"	"0"	"646"	"0"	"c.646C>T"	"r.(?)"	"p.(Arg216Ter)"	"6"
"0000823003"	"00005383"	"90"	"702"	"0"	"706"	"0"	"c.702_706delinsGTTTTT"	"r.(?)"	"p.(Cys234TrpfsTer28)"	"6"
"0000823004"	"00005383"	"90"	"702"	"0"	"702"	"0"	"c.702T>A"	"r.(?)"	"p.(Cys234Ter)"	"6"
"0000823005"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823006"	"00005383"	"90"	"852"	"1"	"852"	"1"	"c.852+1G>C"	"r.spl"	"p.?"	"6i"
"0000823007"	"00005383"	"90"	"904"	"-2"	"904"	"-2"	"c.904-2A>T"	"r.spl"	"p.?"	"7i"
"0000823008"	"00005383"	"90"	"208"	"0"	"208"	"0"	"c.208C>T"	"r.(?)"	"p.(Gln70Ter)"	"2"
"0000823009"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823010"	"00005383"	"90"	"391"	"0"	"391"	"0"	"c.391C>T"	"r.(?)"	"p.(Gln131Ter)"	"4"
"0000823011"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823012"	"00005383"	"90"	"1005"	"0"	"1005"	"0"	"c.1005dup"	"r.(?)"	"p.(Glu336Ter)"	"9"
"0000823013"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	"9"
"0000823014"	"00005383"	"90"	"1056"	"-2"	"1056"	"-2"	"c.1056-2A>G"	"r.spl"	"p.?"	"9i"
"0000823015"	"00005383"	"90"	"1063"	"0"	"1063"	"0"	"c.1063C>T"	"r.(?)"	"p.(Arg355Ter)"	"10"
"0000823016"	"00005383"	"90"	"112"	"0"	"112"	"0"	"c.112C>T"	"r.(?)"	"p.(Gln38Ter)"	"1"
"0000823017"	"00005383"	"90"	"208"	"0"	"208"	"0"	"c.208C>T"	"r.(?)"	"p.(Gln70Ter)"	"2"
"0000823018"	"00005383"	"90"	"257"	"0"	"257"	"0"	"c.257del"	"r.(?)"	"p.(Pro86LeufsTer39)"	"3"
"0000823019"	"00005383"	"90"	"29"	"0"	"29"	"0"	"c.29dup"	"r.(?)"	"p.(Val11GlyfsTer9)"	"1"
"0000823020"	"00005383"	"70"	"467"	"0"	"467"	"0"	"c.467C>T"	"r.(?)"	"p.(Ser156Phe)"	"4"
"0000823021"	"00005383"	"90"	"589"	"0"	"590"	"0"	"c.589_590del"	"r.(?)"	"p.(Leu197AsnfsTer8)"	"5"
"0000823022"	"00005383"	"90"	"607"	"0"	"607"	"0"	"c.607C>T"	"r.(?)"	"p.(Arg203Ter)"	"5"
"0000823023"	"00005383"	"90"	"643"	"2"	"643"	"2"	"c.643+2T>C"	"r.spl"	"p.?"	"5i"
"0000823024"	"00005383"	"70"	"643"	"0"	"643"	"0"	"c.643G>C"	"r.(?)"	"p.(Asp215His)"	"5"
"0000823025"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	"5i"
"0000823026"	"00005383"	"90"	"646"	"0"	"646"	"0"	"c.646C>T"	"r.(?)"	"p.(Arg216Ter)"	"6"
"0000823027"	"00005383"	"90"	"682"	"0"	"682"	"0"	"c.682dup"	"r.(?)"	"p.(Ala228GlyfsTer3)"	"6"
"0000823028"	"00005383"	"90"	"706"	"0"	"706"	"0"	"c.706delinsTT"	"r.(?)"	"p.(Ile236PhefsTer26)"	"6"
"0000823029"	"00005383"	"90"	"756"	"0"	"756"	"0"	"c.756C>G"	"r.(?)"	"p.(Tyr252Ter)"	"6"
"0000823030"	"00005383"	"90"	"791"	"0"	"794"	"0"	"c.791_794del"	"r.(?)"	"p.(Tyr264PhefsTer14)"	"6"
"0000823031"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823032"	"00005383"	"90"	"852"	"1"	"852"	"1"	"c.852+1G>C"	"r.spl"	"p.?"	"6i"
"0000823033"	"00005383"	"90"	"882"	"0"	"882"	"0"	"c.882C>G"	"r.(?)"	"p.(Tyr294Ter)"	"7"
"0000823034"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	"7"
"0000823035"	"00005383"	"90"	"926"	"0"	"926"	"0"	"c.926C>T"	"r.(?)"	"p.(Pro309Leu)"	"8"
"0000823036"	"00005383"	"70"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl"	"p.?"	"8i"
"0000823037"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823038"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823039"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823040"	"00005383"	"90"	"112"	"0"	"112"	"0"	"c.112C>T"	"r.(?)"	"p.(Gln38Ter)"	"1"
"0000823041"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823042"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823043"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823044"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823045"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823046"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823047"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823048"	"00005383"	"90"	"208"	"0"	"208"	"0"	"c.208C>T"	"r.(?)"	"p.(Gln70Ter)"	"2"
"0000823049"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823050"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	"7"
"0000823051"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823052"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823053"	"00005383"	"90"	"190"	"0"	"190"	"0"	"c.190del"	"r.(?)"	"p.(Glu64SerfsTer19)"	"2"
"0000823054"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823055"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823056"	"00005383"	"90"	"301"	"0"	"301"	"0"	"c.301C>T"	"r.(?)"	"p.(Gln101Ter)"	"3"
"0000823057"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823058"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	"9"
"0000823059"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823060"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000823061"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823062"	"00005383"	"90"	"2"	"0"	"2"	"0"	"c.2T>C"	"p.?"	"p.(Met1?)"	"1"
"0000823063"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823064"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	"13i"
"0000823065"	"00005383"	"90"	"1063"	"0"	"1063"	"0"	"c.1063C>T"	"r.(?)"	"p.(Arg355Ter)"	"10"
"0000823066"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823067"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823068"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823069"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823070"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823071"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823072"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823073"	"00005383"	"90"	"1432"	"0"	"1432"	"0"	"c.1432C>T"	"r.(?)"	"p.(Arg478Ter)"	"12"
"0000823074"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	"7"
"0000823075"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823076"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823077"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823078"	"00005383"	"90"	"393"	"0"	"394"	"0"	"c.393_394delinsTCCTGGTGA"	"r.(?)"	"p.(Gln131HisfsTer50)"	"4"
"0000823079"	"00005383"	"70"	"467"	"0"	"467"	"0"	"c.467C>T"	"r.(?)"	"p.(Ser156Phe)"	"4"
"0000823080"	"00005383"	"90"	"112"	"0"	"112"	"0"	"c.112C>T"	"r.(?)"	"p.(Gln38Ter)"	"1"
"0000823081"	"00005383"	"90"	"301"	"0"	"301"	"0"	"c.301C>T"	"r.(?)"	"p.(Gln101Ter)"	"3"
"0000823082"	"00005383"	"90"	"682"	"0"	"682"	"0"	"c.682dup"	"r.(?)"	"p.(Ala228GlyfsTer3)"	"6"
"0000823083"	"00005383"	"90"	"281"	"0"	"284"	"0"	"c.281_284del"	"r.(?)"	"p.(Pro94LeufsTer30)"	"3"
"0000823084"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823085"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823086"	"00005383"	"90"	"1005"	"0"	"1005"	"0"	"c.1005dup"	"r.(?)"	"p.(Glu336Ter)"	"9"
"0000823087"	"00005383"	"90"	"1005"	"0"	"1005"	"0"	"c.1005dup"	"r.(?)"	"p.(Glu336Ter)"	"9"
"0000823088"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	"9"
"0000823089"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	"9"
"0000823090"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823091"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823092"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823093"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823094"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823095"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823096"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823097"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823098"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823099"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823100"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823101"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823102"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823103"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823104"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823105"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823106"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823107"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823108"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823109"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823110"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823111"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823112"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823113"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823114"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000823115"	"00005383"	"90"	"1194"	"0"	"1194"	"0"	"c.1194T>G"	"r.(?)"	"p.(Tyr398Ter)"	"11"
"0000823116"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000823117"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000823118"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11i"
"0000823119"	"00005383"	"90"	"1243"	"0"	"1243"	"0"	"c.1243C>T"	"r.(?)"	"p.(Gln415Ter)"	"11"
"0000823120"	"00005383"	"90"	"1255"	"0"	"1255"	"0"	"c.1255G>T"	"r.(?)"	"p.(Glu419Ter)"	"11"
"0000823121"	"00005383"	"90"	"1285"	"0"	"1285"	"0"	"c.1285del"	"r.(?)"	"p.(Ser429LeufsTer9)"	"11"
"0000823122"	"00005383"	"90"	"1285"	"0"	"1285"	"0"	"c.1285dup"	"r.(?)"	"p.(Ser429PhefsTer33)"	"11"
"0000823123"	"00005383"	"90"	"1285"	"0"	"1285"	"0"	"c.1285dup"	"r.(?)"	"p.(Ser429PhefsTer33)"	"11"
"0000823124"	"00005383"	"90"	"1299"	"0"	"1300"	"0"	"c.1299_1300del"	"r.(?)"	"p.(Phe434LeufsTer27)"	"11"
"0000823125"	"00005383"	"90"	"1304"	"0"	"1304"	"0"	"c.1304C>T"	"r.(?)"	"p.(Ser435Phe)"	"11i"
"0000823126"	"00005383"	"50"	"1320"	"4"	"1320"	"4"	"c.1320+4A>G"	"r.spl?"	"p.?"	"11i"
"0000823127"	"00005383"	"90"	"1366"	"0"	"1366"	"0"	"c.1366delC"	"r.(?)"	"p.(Arg456AlafsTer11)"	"12"
"0000823128"	"00005383"	"70"	"1397"	"0"	"1397"	"0"	"c.1397T>A"	"r.(?)"	"p.(Met466Lys)"	"12"
"0000823129"	"00005383"	"90"	"1426"	"0"	"1426"	"0"	"c.1426C>T"	"r.(?)"	"p.(Gln476Ter)"	"12"
"0000823130"	"00005383"	"90"	"1432"	"0"	"1432"	"0"	"c.1432C>T"	"r.(?)"	"p.(Arg478Ter)"	"12"
"0000823131"	"00005383"	"70"	"1447"	"0"	"1447"	"0"	"c.1447T>G"	"r.(?)"	"p.(Tyr483Asp)"	"12"
"0000823132"	"00005383"	"90"	"1460"	"0"	"1460"	"0"	"c.1460G>A"	"r.(?)"	"p.(Trp487Ter)"	"12"
"0000823133"	"00005383"	"70"	"1447"	"0"	"1447"	"0"	"c.1447T>G"	"r.(?)"	"p.(Tyr483Asp)"	"12"
"0000823134"	"00005383"	"70"	"1447"	"0"	"1447"	"0"	"c.1447T>G"	"r.(?)"	"p.(Tyr483Asp)"	"12"
"0000823135"	"00005383"	"90"	"1566"	"0"	"1569"	"0"	"c.1566_1569dup"	"r.(?)"	"p.(Leu524ArgfsTer7)"	"13"
"0000823136"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	"13i"
"0000823137"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	"13i"
"0000823138"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	"13i"
"0000823139"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	"13i"
"0000823140"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>T"	"r.spl"	"p.?"	"13i"
"0000823141"	"00005383"	"90"	"1579"	"-1"	"1579"	"-1"	"c.1579-1G>A"	"r.spl"	"p.?"	"13i"
"0000823142"	"00005383"	"90"	"1579"	"-1"	"1579"	"-1"	"c.1579-1G>A"	"r.spl"	"p.?"	"13i"
"0000823143"	"00005383"	"90"	"1579"	"-2"	"1579"	"-2"	"c.1579-2A>G"	"r.spl"	"p.?"	"13i"
"0000823144"	"00005383"	"90"	"1635"	"0"	"1635"	"0"	"c.1635T>A"	"r.(?)"	"p.(Tyr545Ter)"	"14"
"0000823145"	"00005383"	"70"	"1663"	"-5"	"1663"	"-5"	"c.1663-5T>G"	"r.spl?"	"p.?"	"14i"
"0000823146"	"00005383"	"70"	"1751"	"0"	"1751"	"0"	"c.1751T>C"	"r.(?)"	"p.(Leu584Pro)"	"15"
"0000823147"	"00005383"	"90"	"1781"	"1"	"1781"	"1"	"c.1781+1del"	"r.spl"	"p.?"	"15i"
"0000823148"	"00005383"	"90"	"1781"	"1"	"1781"	"1"	"c.1781+1G>A"	"r.spl"	"p.?"	"15i"
"0000823149"	"00005383"	"90"	"1781"	"1"	"1781"	"1"	"c.1781+1G>C"	"r.spl"	"p.?"	"15i"
"0000823150"	"00005383"	"90"	"1782"	"-2"	"1782"	"-2"	"c.1782-2A>C"	"r.spl"	"p.?"	"15i"
"0000823151"	"00005383"	"90"	"1815"	"0"	"1815"	"0"	"c.1815del"	"r.(?)"	"p.(Ala606ProfsTer12)"	"16"
"0000823152"	"00005383"	"90"	"1815"	"0"	"1815"	"0"	"c.1815del"	"r.(?)"	"p.(Ala606ProfsTer12)"	"16"
"0000823153"	"00005383"	"70"	"1823"	"0"	"1823"	"0"	"c.1823T>A"	"r.(?)"	"p.(Val608Glu)"	"16"
"0000823154"	"00005383"	"90"	"2103"	"1"	"2103"	"1"	"c.2103+1G>A"	"r.spl"	"p.?"	"17i"
"0000823155"	"00005383"	"50"	"2103"	"0"	"2103"	"0"	"c.2103G>C"	"r.(?)"	"p.(Gln701His)"	"17"
"0000823156"	"00005383"	"90"	"494"	"-2"	"494"	"-2"	"c.494-2A>T"	"r.spl"	"p.?"	"4i"
"0000823157"	"00005383"	"90"	"644"	"-1"	"644"	"-1"	"c.644-1G>C"	"r.spl"	"p.?"	"5i"
"0000823158"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823159"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823160"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000823161"	"00005383"	"90"	"873"	"0"	"873"	"0"	"c.873delinsCAAAC"	"r.(?)"	"p.(Arg291SerfsTer22)"	"7"
"0000823162"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	"7"
"0000823163"	"00005383"	"70"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl"	"p.?"	"8i"
"0000823164"	"00005383"	"50"	"1673"	"0"	"1673"	"0"	"c.1673G>T"	"r.(?)"	"p.(Gly558Val)"	"15i"
"0000823165"	"00005383"	"50"	"442"	"0"	"442"	"0"	"c.442A>G"	"r.(?)"	"p.(Lys148Glu)"	""
"0000823166"	"00005383"	"90"	"446"	"0"	"447"	"0"	"c.446_447insT"	"r.(?)"	"p.(Lys149Asnfs*30)"	""
"0000823169"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000823170"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000823171"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000823220"	"00005383"	"70"	"991"	"-3"	"991"	"-1"	"c.991-3_991-1delTAG"	"r.spl"	"p.(?)"	""
"0000823221"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000823222"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000823223"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000823271"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000823273"	"00005383"	"50"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl?"	"p.?"	""
"0000823568"	"00005383"	"90"	"852"	"4751"	"852"	"4751"	"c.852+4751A>T"	"r.spl"	"p.(?)"	"c.852+4751A>T"
"0000823569"	"00005383"	"90"	"852"	"4751"	"852"	"4751"	"c.852+4751A>T"	"r.spl"	"p.(?)"	"c.852+4751A>T"
"0000823570"	"00005383"	"90"	"852"	"4751"	"852"	"4751"	"c.852+4751A>T"	"r.spl"	"p.(?)"	"c.852+4751A>T"
"0000823572"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"c.1148del"
"0000823573"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"c.1148del"
"0000823574"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"c.1148del"
"0000823582"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823583"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823584"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823585"	"00005383"	"90"	"112"	"0"	"112"	"0"	"c.112C>T"	"r.(?)"	"p.(Gln38Ter)"	""
"0000823586"	"00005383"	"90"	"112"	"0"	"112"	"0"	"c.112C>T"	"r.(?)"	"p.(Gln38Ter)"	""
"0000823587"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000823591"	"00005383"	"90"	"1663"	"-5"	"1663"	"-5"	"c.1663-5T>G"	"r.(1662_1663ins1663-4_1663-1)"	"p.(Gly527Valfs23*)"	""
"0000823592"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000823593"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000823594"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823601"	"00005383"	"90"	"1579"	"-1"	"1579"	"-1"	"c.1579-1G>A"	"r.spl"	"p.?"	""
"0000823602"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000823603"	"00005383"	"90"	"393"	"0"	"394"	"0"	"c.393_394delinsTCCTGGTGA"	"r.(?)"	"p.(Gln131HisfsTer50)"	""
"0000823604"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823608"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	""
"0000823609"	"00005383"	"90"	"1194"	"0"	"1194"	"0"	"c.1194T>G"	"r.(?)"	"p.(Tyr398Ter)"	""
"0000823610"	"00005383"	"90"	"494"	"-2"	"494"	"-2"	"c.494-2A>T"	"r.spl"	"p.?"	""
"0000823611"	"00005383"	"90"	"1366"	"0"	"1366"	"0"	"c.1366del"	"r.(?)"	"p.(Arg456AlafsTer11)"	""
"0000823631"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823632"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823633"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823634"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823635"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823636"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823637"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823638"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823639"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823640"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823641"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823642"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823643"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823644"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823645"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823646"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823647"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823648"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823649"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823650"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823651"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823652"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823653"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823654"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823655"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823656"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823657"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823658"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823659"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823660"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823661"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823662"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823663"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823664"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000823665"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823666"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823667"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823668"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823669"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823670"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823671"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823672"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823673"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823674"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823675"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823676"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823677"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823678"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823679"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823680"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823681"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000823682"	"00005383"	"90"	"1255"	"0"	"1255"	"0"	"c.1255G>T"	"r.(?)"	"p.(Glu419Ter)"	""
"0000823683"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000823684"	"00005383"	"70"	"1751"	"0"	"1751"	"0"	"c.1751T>C"	"r.(?)"	"p.(Leu584Pro)"	""
"0000823685"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000823686"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	""
"0000823687"	"00005383"	"90"	"1306"	"0"	"1306"	"0"	"c.1306A>C"	"r.(?)"	"p.(Ser436Arg)"	""
"0000823688"	"00005383"	"90"	"503"	"0"	"503"	"0"	"c.503C>T"	"r.(?)"	"p.(Thr168Met)"	""
"0000823689"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	""
"0000823690"	"00005383"	"70"	"983"	"0"	"983"	"0"	"c.983T>A"	"r.(?)"	"p.(Met328Lys)"	""
"0000823691"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000823692"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000823693"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	""
"0000823694"	"00005383"	"90"	"1781"	"1"	"1781"	"1"	"c.1781+1G>C"	"r.spl"	"p.?"	""
"0000823695"	"00005383"	"70"	"983"	"0"	"983"	"0"	"c.983T>A"	"r.(?)"	"p.(Met328Lys)"	""
"0000823696"	"00005383"	"90"	"1432"	"0"	"1432"	"0"	"c.1432C>T"	"r.(?)"	"p.(Arg478Ter)"	""
"0000823697"	"00005383"	"90"	"1320"	"4"	"1320"	"4"	"c.1320+4A>G"	"r.spl"	"p.?"	""
"0000823698"	"00005383"	"90"	"1602"	"0"	"1602"	"0"	"c.1602T>G"	"r.(?)"	"p.(Tyr534Ter)"	""
"0000823728"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000823816"	"00005383"	"70"	"3"	"0"	"3"	"0"	"c.3G>A"	"r.(?)"	"p.(Met1?)"	""
"0000823817"	"00005383"	"70"	"680"	"0"	"680"	"0"	"c.680T>C"	"r.(?)"	"p.(Leu227Pro)"	""
"0000823818"	"00005383"	"70"	"11"	"0"	"11"	"0"	"c.11C>A"	"r.(?)"	"p.(Ser4*)"	""
"0000823819"	"00005383"	"70"	"680"	"0"	"680"	"0"	"c.680T>C"	"r.(?)"	"p.(Leu227Pro)"	""
"0000823820"	"00005383"	"70"	"1155"	"0"	"1155"	"0"	"c.1155G>T"	"r.(?)"	"p.(Trp385Cys)"	""
"0000823821"	"00005383"	"70"	"1063"	"0"	"1063"	"0"	"c.1063C>T"	"r.(?)"	"p.(Arg355*)"	""
"0000825070"	"00005383"	"70"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	""
"0000825074"	"00005383"	"70"	"852"	"4010"	"903"	"1699"	"c.852+4010_903+1699dup"	"r.spl"	"p.(?)"	""
"0000825513"	"00005383"	"50"	"1531"	"0"	"1531"	"0"	"c.1531G>A"	"r.(?)"	"p.(Ala511Thr)"	""
"0000825514"	"00005383"	"50"	"2326"	"0"	"2326"	"0"	"c.2326C>T"	"r.(?)"	"p.(Pro776Ser)"	""
"0000825515"	"00005383"	"50"	"1531"	"0"	"1531"	"0"	"c.1531G>A"	"r.(?)"	"p.(Ala511Thr)"	""
"0000826472"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000826473"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000826474"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000826475"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000826476"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000826477"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000826478"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000826479"	"00005383"	"50"	"970"	"0"	"970"	"0"	"c.970A>G"	"r.(?)"	"p.(Arg324Gly)"	"8"
"0000826480"	"00005383"	"50"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000826481"	"00005383"	"50"	"970"	"0"	"970"	"0"	"c.970A>G"	"r.(?)"	"p.(Arg324Gly)"	"8"
"0000826490"	"00005383"	"50"	"1055"	"0"	"1055"	"0"	"c.1055G>A"	"r.(?)"	"p.(Arg352Lys)"	"9"
"0000826990"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832442"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000832444"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000832446"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000832447"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000832449"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	"10"
"0000832522"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832525"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832528"	"00005383"	"70"	"1426"	"0"	"1426"	"0"	"c.1426C>T"	"r.(?)"	"p.(Gln476*)"	""
"0000832537"	"00005383"	"70"	"1781"	"1"	"1781"	"1"	"c.1781+1G>A"	"r.spl"	"p.?"	""
"0000832538"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832539"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832540"	"00005383"	"70"	"886"	"0"	"896"	"0"	"c.886_896del11insT"	"r.(?)"	"p.(Thr296Tyrfs*9)"	""
"0000832541"	"00005383"	"70"	"886"	"0"	"896"	"0"	"c.886_896del11insT"	"r.(?)"	"p.(Thr296Tyrfs*9)"	""
"0000832542"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832547"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832548"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832549"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832557"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832558"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832560"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832561"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832562"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832563"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832564"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000832725"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832726"	"00005383"	"70"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336*)"	""
"0000832727"	"00005383"	"70"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274Valfs*13)"	""
"0000832728"	"00005383"	"70"	"130"	"-1"	"130"	"-1"	"c.130-1G>T"	"r.spl"	"p.(?)"	""
"0000832729"	"00005383"	"70"	"129"	"2"	"129"	"2"	"c.129+2T>C"	"r.spl"	"p.(?)"	""
"0000832730"	"00005383"	"70"	"3"	"0"	"3"	"0"	"c.3G>A"	"r.0?"	"p.(Met1?)"	""
"0000832731"	"00005383"	"70"	"129"	"2"	"129"	"2"	"c.129+2T>C"	"r.(?)"	"p.(?)"	""
"0000832741"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832742"	"00005383"	"70"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336*)"	""
"0000832743"	"00005383"	"70"	"1243"	"0"	"1243"	"0"	"c.1243C>T"	"r.(?)"	"p.(Gln415*)"	""
"0000832744"	"00005383"	"70"	"130"	"-1"	"130"	"-1"	"c.130-1G>T"	"r.spl"	"p.(?)"	""
"0000832745"	"00005383"	"70"	"212"	"-1"	"338"	"1"	"c.(211+1_212-1)_(338+1_339-1)del"	"r.spl"	"p.(?)"	""
"0000832746"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148delC"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000832747"	"00005383"	"70"	"212"	"-1"	"338"	"1"	"c.(211+1_212-1)_(338+1_339-1)del"	"r.spl"	"p.(?)"	""
"0000832773"	"00005383"	"70"	"473"	"0"	"473"	"0"	"c.473C>A"	"r.(?)"	"p.(Pro158His)"	"p.(Pro158His)"
"0000846891"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000846892"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000852003"	"00005383"	"30"	"1368"	"0"	"1368"	"0"	"c.1368C>T"	"r.(?)"	"p.(Arg456=)"	""
"0000852004"	"00005383"	"50"	"974"	"0"	"974"	"0"	"c.974C>T"	"r.(?)"	"p.(Ala325Val)"	""
"0000852005"	"00005383"	"50"	"385"	"0"	"385"	"0"	"c.385G>A"	"r.(?)"	"p.(Asp129Asn)"	""
"0000861294"	"00005383"	"30"	"1492"	"0"	"1492"	"0"	"c.1492T>A"	"r.(?)"	"p.(Leu498Met)"	""
"0000871754"	"00005383"	"70"	"2410"	"0"	"2410"	"0"	"c.2410A>T"	"r.(?)"	"p.(Lys804*)"	""
"0000876549"	"00005383"	"70"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl"	"p.?"	""
"0000876550"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000876551"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000876552"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000876553"	"00005383"	"70"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	""
"0000876554"	"00005383"	"70"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	""
"0000876555"	"00005383"	"70"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	""
"0000876556"	"00005383"	"70"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336Ter)"	""
"0000876559"	"00005383"	"70"	"0"	"0"	"0"	"0"	"c.?"	"r.(?)"	"p.?"	""
"0000876560"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000876565"	"00005383"	"70"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000876566"	"00005383"	"70"	"706"	"0"	"706"	"0"	"c.706delinsTT"	"r.(?)"	"p.(Ile236PhefsTer26)"	""
"0000876567"	"00005383"	"70"	"391"	"0"	"391"	"0"	"c.391C>T"	"r.(?)"	"p.(Gln131Ter)"	""
"0000881425"	"00005383"	"50"	"2410"	"0"	"2410"	"0"	"c.2410A>T"	"r.(?)"	"p.(Lys804*)"	""
"0000881457"	"00005383"	"50"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000881458"	"00005383"	"50"	"1844"	"0"	"1844"	"0"	"c.1844A>G"	"r.(?)"	"p.(Asn615Ser)"	""
"0000881466"	"00005383"	"70"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296Tyrfs*9)"	""
"0000888464"	"00005383"	"90"	"692"	"0"	"692"	"0"	"c.692G>A"	"r.(?)"	"p.(Trp231*)"	""
"0000888465"	"00005383"	"30"	"339"	"-10"	"339"	"-10"	"c.339-10del"	"r.(=)"	"p.(=)"	""
"0000905857"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000905858"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000905860"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000905861"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000905862"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000905863"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000905865"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	""
"0000905866"	"00005383"	"90"	"1006"	"0"	"1006"	"0"	"c.1006G>T"	"r.(?)"	"p.(Glu336*)"	""
"0000905881"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000905882"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000905883"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000905884"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0000929484"	"00005383"	"50"	"1321"	"-3"	"1321"	"-3"	"c.1321-3T>G"	"r.spl?"	"p.?"	""
"0000929485"	"00005383"	"10"	"494"	"-11"	"494"	"-11"	"c.494-11T>C"	"r.(=)"	"p.(=)"	""
"0000933671"	"00005383"	"90"	"1810"	"0"	"1810"	"0"	"c.1810C>T"	"r.(?)"	"p.(Arg604*)"	""
"0000933672"	"00005383"	"90"	"701"	"0"	"702"	"0"	"c.701_702delinsAG"	"r.(?)"	"p.(Cys234*)"	""
"0000949120"	"00005383"	"30"	"2179"	"0"	"2199"	"0"	"c.2179_2199del"	"r.(?)"	"p.(Gln727_Lys733del)"	""
"0000949121"	"00005383"	"90"	"607"	"0"	"607"	"0"	"c.607C>T"	"r.(?)"	"p.(Arg203*)"	""
"0000957972"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000957973"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000957974"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000957977"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000957978"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000957979"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000957980"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	""
"0000957981"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000957987"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000958274"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000958389"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	""
"0000958390"	"00005383"	"70"	"852"	"4013"	"903"	"1698"	"c.852+4013_903+1698dup"	"r.?"	"p.?"	""
"0000958392"	"00005383"	"50"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000958393"	"00005383"	"50"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000958395"	"00005383"	"50"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000958396"	"00005383"	"90"	"1179"	"-2"	"1179"	"-2"	"c.1179-2A>T"	"r.spl"	"p.?"	""
"0000958588"	"00005383"	"50"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000958829"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000958906"	"00005383"	"50"	"1834"	"0"	"1834"	"0"	"c.1834G>A"	"r.(?)"	"p.(Gly612Arg)"	""
"0000959001"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000959017"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000959024"	"00005383"	"50"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000959196"	"00005383"	"70"	"890"	"0"	"896"	"0"	"c.890_896del"	"r.(?)"	"p.(Ser297TyrfsTer9)"	""
"0000959262"	"00005383"	"50"	"1179"	"-11"	"1179"	"-11"	"c.1179-11T>G"	"r.spl?"	"p.?"	""
"0000959408"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000959454"	"00005383"	"50"	"1534"	"0"	"1534"	"0"	"c.1534A>G"	"r.(?)"	"p.(Ile512Val)"	""
"0000978289"	"00005383"	"50"	"780"	"0"	"780"	"0"	"c.780T>A"	"r.(?)"	"p.(Cys260*)"	""
"0000986373"	"00005383"	"90"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl"	"p.?"	"8i"
"0000986374"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	"7"
"0000986375"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000986376"	"00005383"	"50"	"2179"	"0"	"2199"	"0"	"c.2179_2199del"	"r.(?)"	"p.(Gln727_Lys733del)"	"18"
"0000986377"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000986378"	"00005383"	"50"	"1728"	"0"	"1728"	"0"	"c.1728T>G"	"r.(?)"	"p.(Asp576Glu)"	"15"
"0000986379"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000986380"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000986381"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000986382"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000986383"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000986384"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000986385"	"00005383"	"90"	"819"	"0"	"826"	"0"	"c.819_826del"	"r.(?)"	"p.(Arg274ValfsTer13)"	"6"
"0000986386"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000986904"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000986905"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	"11"
"0000986906"	"00005383"	"50"	"2410"	"0"	"2410"	"0"	"c.2410A>T"	"r.(?)"	"p.(Lys804Ter)"	"18"
"0000986907"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	"13i"
"0000986908"	"00005383"	"50"	"1663"	"-1205"	"1663"	"-1205"	"c.1663-1205G>A"	"r.spl"	"p.?"	"14i"
"0000986909"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	"10"
"0000986910"	"00005383"	"90"	"1578"	"1"	"1578"	"1"	"c.1578+1G>A"	"r.spl"	"p.?"	"13i"
"0000987065"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0000987173"	"00005383"	"90"	"1982"	"0"	"1984"	"0"	"c.1982_1984dup"	"r.(?)"	"p.(Asp661_Leu662insHis)"	""
"0000987299"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000987314"	"00005383"	"70"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0000997346"	"00005383"	"50"	"1622"	"0"	"1622"	"0"	"c.1622A>C"	"r.(?)"	"p.(Lys541Thr)"	""
"0001010046"	"00005383"	"70"	"210"	"0"	"210"	"0"	"c.210A>G"	"r.[(130_211del,=)]"	"p.[(Glu44fs,Gln70=)]"	"2"
"0001010049"	"00005383"	"70"	"904"	"-6"	"904"	"-6"	"c.904-6C>G"	"r.(904_990del)"	"p.(Leu302_Lys330del)"	"7i"
"0001010050"	"00005383"	"90"	"1578"	"2509"	"1578"	"2509"	"c.1578+2509G>C"	"r.(1578_1579ins1578+2512_1578+2609)"	"p.(Gly527Aspfs*24)"	"13i"
"0001010051"	"00005383"	"90"	"1320"	"3"	"1320"	"3"	"c.1320+3A>C"	"r.(1179_1320del)"	"p.(Tyr394Ter)"	"10i"
"0001010052"	"00005383"	"30"	"1578"	"12"	"1578"	"12"	"c.1578+12T>C"	"r.(?)"	"p.(=)"	""
"0001010244"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010245"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010246"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010247"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010248"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010249"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010250"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010251"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010252"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010253"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010254"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010255"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010256"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010257"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010258"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010259"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010260"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010261"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010262"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010263"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010264"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010265"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010266"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010267"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010268"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010269"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010270"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010271"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010272"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010273"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010274"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010275"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010276"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010277"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010278"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010279"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010280"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010281"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010282"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010283"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010284"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010285"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010286"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010287"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010288"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010289"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010290"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010291"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010292"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010293"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010294"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383IlefsTer13)"	""
"0001010295"	"00005383"	"90"	"1430"	"0"	"1431"	"0"	"c.1430_1431delinsC"	"r.(?)"	"p.(Lys477ThrfsTer17)"	""
"0001010296"	"00005383"	"90"	"1430"	"0"	"1431"	"0"	"c.1430_1431delinsC"	"r.(?)"	"p.(Lys477ThrfsTer17)"	""
"0001010297"	"00005383"	"90"	"702"	"0"	"702"	"0"	"c.702T>A"	"r.(?)"	"p.(Cys234Ter)"	""
"0001010298"	"00005383"	"90"	"702"	"0"	"702"	"0"	"c.702T>A"	"r.(?)"	"p.(Cys234Ter)"	""
"0001010299"	"00005383"	"70"	"1700"	"0"	"1700"	"0"	"c.1700G>A"	"r.(?)"	"p.(Gly567Glu)"	""
"0001010300"	"00005383"	"70"	"212"	"-3180"	"338"	"2728"	"c.(211+1_212-3180)_(338+2728_339-1)del"	"r.?"	"p.?"	"2i_3i"
"0001010301"	"00005383"	"90"	"702"	"0"	"702"	"0"	"c.702T>A"	"r.(?)"	"p.(Cys234Ter)"	""
"0001010321"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0001010323"	"00005383"	"90"	"1432"	"0"	"1432"	"0"	"c.1432C>T"	"r.(?)"	"p.(Arg478Ter)"	""
"0001010324"	"00005383"	"90"	"1432"	"0"	"1432"	"0"	"c.1432C>T"	"r.(?)"	"p.(Arg478Ter)"	""
"0001010325"	"00005383"	"90"	"1432"	"0"	"1432"	"0"	"c.1432C>T"	"r.(?)"	"p.(Arg478Ter)"	""
"0001010326"	"00005383"	"50"	"467"	"0"	"467"	"0"	"c.467C>T"	"r.(?)"	"p.(Ser156Phe)"	""
"0001010327"	"00005383"	"50"	"467"	"0"	"467"	"0"	"c.467C>T"	"r.(?)"	"p.(Ser156Phe)"	""
"0001010328"	"00005383"	"90"	"1299"	"0"	"1300"	"0"	"c.1299_1300del"	"r.(?)"	"p.(Phe434LeufsTer27)"	""
"0001010329"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	""
"0001010330"	"00005383"	"90"	"886"	"0"	"896"	"0"	"c.886_896delinsT"	"r.(?)"	"p.(Thr296TyrfsTer9)"	""
"0001010331"	"00005383"	"90"	"589"	"0"	"590"	"0"	"c.589_590del"	"r.(?)"	"p.(Leu197AsnfsTer8)"	""
"0001010332"	"00005383"	"90"	"1431"	"0"	"1431"	"0"	"c.1431del"	"r.(?)"	"p.(Lys477AsnfsTer17)"	""
"0001010333"	"00005383"	"70"	"1700"	"0"	"1700"	"0"	"c.1700G>A"	"r.(?)"	"p.(Gly567Glu)"	""
"0001010334"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0001010335"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0001010336"	"00005383"	"90"	"756"	"0"	"756"	"0"	"c.756C>G"	"r.(?)"	"p.(Tyr252Ter)"	""
"0001025548"	"00005383"	"50"	"2309"	"0"	"2312"	"0"	"c.2309_2312del"	"r.(?)"	"p.(Val770Glufs*58)"	""
"0001025549"	"00005383"	"70"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.spl?"	"p.?"	""
"0001030046"	"00005383"	"90"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Arg403Gln)"	""
"0001030047"	"00005383"	"70"	"903"	"1711"	"903"	"1711"	"c.903+1711G>T"	"r.[(903_904ins903+1729_903+1760,=)]"	"p.[(Leu302Serfs*17,=)]"	"7i"
"0001030048"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(1148del)"	"p.(Thr383IlefsTer13)"	""
"0001030051"	"00005383"	"50"	"1253"	"0"	"1253"	"0"	"c.1253T>A"	"r.(?)"	"p.(Phe418Tyr)"	""
"0001030052"	"00005383"	"90"	"1148"	"0"	"1148"	"0"	"c.1148del"	"r.(?)"	"p.(Thr383Ilefs*13)"	""
"0001030053"	"00005383"	"70"	"1405"	"0"	"1405"	"0"	"c.1405T>G"	"r.(?)"	"p.(Tyr469Asp)"	""
"0001030054"	"00005383"	"70"	"643"	"0"	"643"	"0"	"c.643G>C"	"r.494_643del"	"p.Ala165_Thr214del"	"5"
"0001030055"	"00005383"	"70"	"989"	"0"	"989"	"0"	"c.989A>G"	"r.904_990del"	"p.Leu302_Lys330del"	"8"
"0001030056"	"00005383"	"90"	"991"	"-3"	"991"	"-3"	"c.991-3T>G"	"r.990_991insAG"	"p.Tyr331SerfsTer12"	"8i"
"0001030057"	"00005383"	"90"	"991"	"-3"	"991"	"-3"	"c.991-3del"	"r.991_1055del"	"p.Tyr331SerfsTer15"	"8i"
"0001030058"	"00005383"	"90"	"1055"	"0"	"1055"	"0"	"c.1055G>A"	"r.991_1055del"	"p.Tyr331SerfsTer15"	"9"
"0001030059"	"00005383"	"70"	"1056"	"-3"	"1056"	"-3"	"c.1056-3C>G"	"r.1056_1178del"	"p.Val353_Glu393del"	"9i"
"0001030060"	"00005383"	"90"	"1178"	"5"	"1178"	"5"	"c.1178+5G>T"	"r.[1056_1178del,991_1178del]"	"p.[Val353_Glu393del,Tyr331ValfsTer26]"	"10i"
"0001030061"	"00005383"	"50"	"1178"	"6"	"1178"	"6"	"c.1178+6T>C"	"r.[=,1056_1178del,991_1178del]"	"p.[=,Val353_Glu393del,Tyr331ValfsTer26]"	"10i"
"0001030062"	"00005383"	"30"	"1178"	"9"	"1178"	"9"	"c.1178+9T>C"	"r.="	"p.="	"10i"
"0001030063"	"00005383"	"90"	"1179"	"-11"	"1179"	"-11"	"c.1179-11T>G"	"r.1179_1320del"	"p.Tyr394Ter"	"10i"
"0001030064"	"00005383"	"90"	"1320"	"4"	"1320"	"4"	"c.1320+4A>G"	"r.1179_1320del"	"p.Tyr394Ter"	"11i"
"0001030065"	"00005383"	"70"	"1778"	"0"	"1778"	"0"	"c.1778T>G"	"r.[=,1730_1781del,1663_1781del]"	"p.[Ile593Ser,Gly577AlafsTer3,Gly555ProfsTer41]"	"15"
"0001030066"	"00005383"	"90"	"1781"	"0"	"1781"	"0"	"c.1781G>C"	"r.[1663_1781del,1730_1781del]"	"p.[Gly555ProfsTer41,Gly577AlafsTer3]"	"15"
"0001030067"	"00005383"	"70"	"2103"	"0"	"2103"	"0"	"c.2103G>C"	"r.[2103_2104ins2103+1_2103+51,2103_2104ins2103+1_2103+8,1782_2103del]"	"p.[Gln701_Gln809delinsHVIRWSEWTAVMEKAPD*,Gln701HisfsTer131,Ser594fs]"	"17"
"0001030068"	"00005383"	"70"	"2103"	"4"	"2103"	"4"	"c.2103+4A>G"	"r.[=,2103_2104ins2103+1_2103+5,11782_2103del]"	"p.[=,Gln701_Gln809delinsHVIRWSEWTAVMEKAPD*,Ser594fs]"	"17i"
"0001037068"	"00005383"	"50"	"1898"	"0"	"1898"	"0"	"c.1898A>G"	"r.(?)"	"p.(Asp633Gly)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 1138
"{{screeningid}}"	"{{variantid}}"
"0000096347"	"0000158339"
"0000105487"	"0000170921"
"0000105518"	"0000170963"
"0000145017"	"0000788334"
"0000156305"	"0000358227"
"0000156305"	"0000358431"
"0000156306"	"0000358228"
"0000156307"	"0000358229"
"0000156307"	"0000358432"
"0000156308"	"0000358230"
"0000156309"	"0000358231"
"0000156310"	"0000358232"
"0000156311"	"0000358233"
"0000156311"	"0000358433"
"0000171731"	"0000392083"
"0000174623"	"0000394431"
"0000174624"	"0000394432"
"0000174624"	"0000394433"
"0000174628"	"0000394455"
"0000174629"	"0000394456"
"0000174631"	"0000394457"
"0000174631"	"0000394458"
"0000174632"	"0000394459"
"0000174632"	"0000394467"
"0000174633"	"0000394460"
"0000174634"	"0000394461"
"0000174635"	"0000394462"
"0000174636"	"0000394463"
"0000174637"	"0000394464"
"0000174638"	"0000394465"
"0000174639"	"0000394466"
"0000264237"	"0000594737"
"0000295837"	"0000652526"
"0000295838"	"0000652527"
"0000295839"	"0000652528"
"0000295840"	"0000652529"
"0000295841"	"0000652530"
"0000296730"	"0000653428"
"0000306333"	"0000670021"
"0000306334"	"0000670022"
"0000306335"	"0000670023"
"0000309644"	"0000684517"
"0000309645"	"0000684518"
"0000310239"	"0000685150"
"0000310240"	"0000685151"
"0000310241"	"0000685152"
"0000310242"	"0000685153"
"0000310243"	"0000685154"
"0000310244"	"0000685155"
"0000310245"	"0000685156"
"0000310246"	"0000685157"
"0000310247"	"0000685158"
"0000310248"	"0000685159"
"0000321009"	"0000703781"
"0000321010"	"0000703782"
"0000321011"	"0000703783"
"0000321012"	"0000703784"
"0000321013"	"0000703785"
"0000321014"	"0000703786"
"0000321015"	"0000703787"
"0000321015"	"0000703788"
"0000321226"	"0000704032"
"0000321226"	"0000704033"
"0000321227"	"0000704034"
"0000321227"	"0000704035"
"0000321228"	"0000704036"
"0000321232"	"0000704040"
"0000321238"	"0000704047"
"0000321239"	"0000704048"
"0000321241"	"0000704050"
"0000321242"	"0000704051"
"0000321242"	"0000704052"
"0000321244"	"0000704054"
"0000321245"	"0000704055"
"0000321247"	"0000704057"
"0000325438"	"0000708432"
"0000325438"	"0000708445"
"0000325441"	"0000708434"
"0000325441"	"0000708448"
"0000325445"	"0000708452"
"0000325446"	"0000708453"
"0000325448"	"0000708455"
"0000325449"	"0000708456"
"0000325452"	"0000708459"
"0000325453"	"0000708460"
"0000325454"	"0000708439"
"0000325454"	"0000708461"
"0000325456"	"0000708463"
"0000325458"	"0000708465"
"0000325459"	"0000708466"
"0000325461"	"0000708442"
"0000325461"	"0000708468"
"0000325462"	"0000708469"
"0000325463"	"0000708470"
"0000325464"	"0000708471"
"0000325465"	"0000708472"
"0000326698"	"0000710355"
"0000329150"	"0000713273"
"0000329182"	"0000713305"
"0000329238"	"0000713361"
"0000329350"	"0000713473"
"0000329421"	"0000713544"
"0000329526"	"0000713649"
"0000329526"	"0000713890"
"0000329553"	"0000713676"
"0000329553"	"0000713905"
"0000329666"	"0000714023"
"0000329666"	"0000714091"
"0000329667"	"0000714024"
"0000329668"	"0000714025"
"0000329668"	"0000714092"
"0000329669"	"0000714026"
"0000329669"	"0000714093"
"0000332515"	"0000729793"
"0000332518"	"0000729796"
"0000332939"	"0000730319"
"0000332940"	"0000730320"
"0000332941"	"0000730321"
"0000332941"	"0000730330"
"0000332942"	"0000730322"
"0000332943"	"0000730323"
"0000332943"	"0000730331"
"0000332944"	"0000730324"
"0000332944"	"0000730332"
"0000332945"	"0000730325"
"0000332945"	"0000730333"
"0000333412"	"0000730986"
"0000333412"	"0000731037"
"0000333447"	"0000731022"
"0000333447"	"0000871754"
"0000333498"	"0000731152"
"0000333498"	"0000731174"
"0000333508"	"0000731162"
"0000333628"	"0000731330"
"0000333675"	"0000731424"
"0000333675"	"0000731448"
"0000333676"	"0000731425"
"0000333676"	"0000731449"
"0000333677"	"0000731426"
"0000333677"	"0000731450"
"0000334562"	"0000732393"
"0000334562"	"0000732422"
"0000334655"	"0000732587"
"0000334861"	"0000732868"
"0000335211"	"0000733220"
"0000335211"	"0000733644"
"0000335212"	"0000733221"
"0000335213"	"0000733222"
"0000335214"	"0000733223"
"0000335607"	"0000734253"
"0000335690"	"0000734408"
"0000336125"	"0000735176"
"0000336335"	"0000735610"
"0000336335"	"0000735732"
"0000336336"	"0000735611"
"0000336336"	"0000735733"
"0000336339"	"0000735736"
"0000336339"	"0000735738"
"0000336456"	"0000735831"
"0000336564"	"0000735989"
"0000336714"	"0000736204"
"0000336714"	"0000736257"
"0000337199"	"0000736829"
"0000360206"	"0000760049"
"0000360242"	"0000760134"
"0000360249"	"0000760141"
"0000360252"	"0000760144"
"0000360255"	"0000760147"
"0000360256"	"0000760148"
"0000360257"	"0000760149"
"0000360258"	"0000760150"
"0000360258"	"0000760420"
"0000360849"	"0000760961"
"0000363370"	"0000763947"
"0000363371"	"0000763948"
"0000363371"	"0000764016"
"0000363372"	"0000763949"
"0000364148"	"0000764910"
"0000374577"	"0000785368"
"0000375104"	"0000786399"
"0000375104"	"0000786472"
"0000375105"	"0000786400"
"0000376188"	"0000787766"
"0000376189"	"0000787767"
"0000376190"	"0000787768"
"0000376190"	"0000787774"
"0000376191"	"0000787769"
"0000376192"	"0000787770"
"0000376553"	"0000788180"
"0000376555"	"0000788182"
"0000376556"	"0000788183"
"0000376561"	"0000788188"
"0000376561"	"0000788197"
"0000376562"	"0000788189"
"0000377499"	"0000789857"
"0000377500"	"0000789858"
"0000378212"	"0000790897"
"0000378212"	"0000790898"
"0000378213"	"0000790899"
"0000378213"	"0000790900"
"0000378214"	"0000790901"
"0000378215"	"0000790904"
"0000378216"	"0000790905"
"0000378221"	"0000790910"
"0000378222"	"0000790911"
"0000378222"	"0000790921"
"0000378223"	"0000790912"
"0000378223"	"0000790922"
"0000378224"	"0000790913"
"0000378224"	"0000790923"
"0000378225"	"0000790914"
"0000378226"	"0000790915"
"0000378227"	"0000790916"
"0000378228"	"0000790917"
"0000378229"	"0000790924"
"0000378230"	"0000790925"
"0000378385"	"0000791140"
"0000378404"	"0000791159"
"0000378428"	"0000791183"
"0000378428"	"0000791252"
"0000378448"	"0000791203"
"0000378904"	"0000791894"
"0000378905"	"0000791895"
"0000378906"	"0000791896"
"0000378907"	"0000791897"
"0000378908"	"0000791898"
"0000378909"	"0000791899"
"0000378910"	"0000791900"
"0000378911"	"0000791901"
"0000379167"	"0000792280"
"0000379179"	"0000792292"
"0000379187"	"0000792301"
"0000379188"	"0000792302"
"0000379189"	"0000792303"
"0000379190"	"0000792304"
"0000379191"	"0000792305"
"0000379192"	"0000792306"
"0000379193"	"0000792307"
"0000379196"	"0000792310"
"0000381389"	"0000794819"
"0000381389"	"0000794820"
"0000382086"	"0000795862"
"0000382338"	"0000796108"
"0000382338"	"0000796109"
"0000382339"	"0000796110"
"0000382340"	"0000796111"
"0000382340"	"0000796112"
"0000382341"	"0000796113"
"0000382341"	"0000796114"
"0000382342"	"0000796115"
"0000382343"	"0000796116"
"0000382343"	"0000796117"
"0000382344"	"0000796118"
"0000382345"	"0000796119"
"0000382345"	"0000796120"
"0000382346"	"0000796121"
"0000382347"	"0000796122"
"0000382348"	"0000796123"
"0000382348"	"0000796124"
"0000382349"	"0000796125"
"0000382349"	"0000796126"
"0000382350"	"0000796127"
"0000382351"	"0000796128"
"0000382352"	"0000796129"
"0000383011"	"0000796992"
"0000383011"	"0000796993"
"0000383012"	"0000796994"
"0000383179"	"0000797228"
"0000383179"	"0000797241"
"0000383180"	"0000797229"
"0000383180"	"0000797242"
"0000383181"	"0000797230"
"0000383181"	"0000797243"
"0000383181"	"0000797244"
"0000383182"	"0000797231"
"0000383182"	"0000797245"
"0000383183"	"0000797232"
"0000383184"	"0000797233"
"0000383185"	"0000797234"
"0000383186"	"0000797235"
"0000383187"	"0000797236"
"0000383187"	"0000797246"
"0000383188"	"0000797237"
"0000383188"	"0000797247"
"0000383189"	"0000797238"
"0000383189"	"0000797248"
"0000383190"	"0000797239"
"0000383190"	"0000797249"
"0000383191"	"0000797240"
"0000383191"	"0000797250"
"0000383344"	"0000797405"
"0000383345"	"0000797406"
"0000383345"	"0000797451"
"0000383346"	"0000797407"
"0000383347"	"0000797408"
"0000383347"	"0000797452"
"0000383473"	"0000797580"
"0000383474"	"0000797581"
"0000383475"	"0000797582"
"0000383476"	"0000797583"
"0000383477"	"0000797585"
"0000383477"	"0000797586"
"0000383478"	"0000797587"
"0000383638"	"0000797823"
"0000383742"	"0000797986"
"0000383848"	"0000798128"
"0000383874"	"0000798178"
"0000384009"	"0000798426"
"0000384643"	"0000811403"
"0000384644"	"0000811404"
"0000387405"	"0000815457"
"0000387408"	"0000815463"
"0000387430"	"0000815595"
"0000387441"	"0000815325"
"0000387441"	"0000815474"
"0000387442"	"0000815326"
"0000387442"	"0000815476"
"0000387453"	"0000815488"
"0000387498"	"0000815530"
"0000387503"	"0000815387"
"0000387503"	"0000815535"
"0000387504"	"0000815388"
"0000387504"	"0000815537"
"0000387506"	"0000815540"
"0000387520"	"0000815404"
"0000387927"	"0000816085"
"0000387927"	"0000816414"
"0000387979"	"0000816137"
"0000387979"	"0000816450"
"0000389723"	"0000818950"
"0000389723"	"0000818951"
"0000390010"	"0000819355"
"0000391043"	"0000820388"
"0000391043"	"0000820892"
"0000391058"	"0000820403"
"0000391092"	"0000820437"
"0000391093"	"0000820438"
"0000391094"	"0000820439"
"0000391109"	"0000820454"
"0000391116"	"0000820461"
"0000391117"	"0000820462"
"0000391117"	"0000820927"
"0000391127"	"0000820472"
"0000391131"	"0000820476"
"0000391131"	"0000820933"
"0000391132"	"0000820477"
"0000391132"	"0000820934"
"0000391134"	"0000820479"
"0000391135"	"0000820480"
"0000391138"	"0000820483"
"0000391139"	"0000820484"
"0000391140"	"0000820485"
"0000391142"	"0000820487"
"0000391144"	"0000820489"
"0000391144"	"0000820937"
"0000391147"	"0000820492"
"0000391147"	"0000820938"
"0000391157"	"0000820502"
"0000391174"	"0000820519"
"0000391174"	"0000820955"
"0000391239"	"0000820584"
"0000391239"	"0000820987"
"0000391241"	"0000820586"
"0000391242"	"0000820587"
"0000391245"	"0000820590"
"0000391246"	"0000820591"
"0000391248"	"0000820593"
"0000391254"	"0000820599"
"0000391255"	"0000820600"
"0000391256"	"0000820601"
"0000391257"	"0000820602"
"0000391259"	"0000820604"
"0000391260"	"0000820605"
"0000391260"	"0000820992"
"0000391261"	"0000820606"
"0000391261"	"0000820993"
"0000391262"	"0000820607"
"0000391262"	"0000820994"
"0000391470"	"0000821219"
"0000391471"	"0000821220"
"0000391472"	"0000821221"
"0000391473"	"0000821222"
"0000391474"	"0000821223"
"0000391475"	"0000821224"
"0000391475"	"0000821540"
"0000391476"	"0000821225"
"0000391476"	"0000821541"
"0000391984"	"0000822057"
"0000392110"	"0000822245"
"0000392110"	"0000822246"
"0000392172"	"0000822360"
"0000392172"	"0000822361"
"0000392199"	"0000822403"
"0000392199"	"0000822404"
"0000392259"	"0000822514"
"0000392259"	"0000822596"
"0000392260"	"0000822515"
"0000392260"	"0000822597"
"0000392261"	"0000822516"
"0000392261"	"0000822598"
"0000392262"	"0000822517"
"0000392262"	"0000822599"
"0000392263"	"0000822518"
"0000392263"	"0000822600"
"0000392264"	"0000822519"
"0000392264"	"0000822601"
"0000392265"	"0000822520"
"0000392265"	"0000822602"
"0000392266"	"0000822521"
"0000392266"	"0000822603"
"0000392267"	"0000822522"
"0000392267"	"0000822604"
"0000392268"	"0000822523"
"0000392268"	"0000822605"
"0000392269"	"0000822524"
"0000392269"	"0000822606"
"0000392270"	"0000822525"
"0000392270"	"0000822607"
"0000392271"	"0000822526"
"0000392271"	"0000822608"
"0000392272"	"0000822527"
"0000392272"	"0000822609"
"0000392273"	"0000822528"
"0000392273"	"0000822610"
"0000392274"	"0000822529"
"0000392274"	"0000822611"
"0000392275"	"0000822530"
"0000392275"	"0000822612"
"0000392276"	"0000822531"
"0000392276"	"0000822613"
"0000392277"	"0000822532"
"0000392277"	"0000822614"
"0000392278"	"0000822533"
"0000392278"	"0000822615"
"0000392279"	"0000822534"
"0000392280"	"0000822535"
"0000392281"	"0000822536"
"0000392281"	"0000822616"
"0000392282"	"0000822537"
"0000392282"	"0000822617"
"0000392283"	"0000822538"
"0000392284"	"0000822539"
"0000392285"	"0000822540"
"0000392286"	"0000822541"
"0000392286"	"0000822618"
"0000392287"	"0000822542"
"0000392287"	"0000822619"
"0000392288"	"0000822543"
"0000392289"	"0000822544"
"0000392290"	"0000822545"
"0000392291"	"0000822546"
"0000392292"	"0000822547"
"0000392293"	"0000822548"
"0000392294"	"0000822549"
"0000392295"	"0000822550"
"0000392295"	"0000822620"
"0000392296"	"0000822551"
"0000392297"	"0000822552"
"0000392298"	"0000822553"
"0000392299"	"0000822554"
"0000392300"	"0000822555"
"0000392301"	"0000822556"
"0000392302"	"0000822557"
"0000392303"	"0000822558"
"0000392304"	"0000822559"
"0000392305"	"0000822560"
"0000392306"	"0000822561"
"0000392307"	"0000822562"
"0000392308"	"0000822563"
"0000392309"	"0000822564"
"0000392310"	"0000822565"
"0000392311"	"0000822566"
"0000392312"	"0000822567"
"0000392313"	"0000822568"
"0000392314"	"0000822569"
"0000392315"	"0000822570"
"0000392316"	"0000822571"
"0000392317"	"0000822572"
"0000392318"	"0000822573"
"0000392319"	"0000822574"
"0000392320"	"0000822575"
"0000392321"	"0000822576"
"0000392322"	"0000822577"
"0000392322"	"0001030053"
"0000392323"	"0000822578"
"0000392324"	"0000822579"
"0000392325"	"0000822580"
"0000392326"	"0000822581"
"0000392327"	"0000822582"
"0000392328"	"0000822583"
"0000392329"	"0000822584"
"0000392330"	"0000822585"
"0000392331"	"0000822586"
"0000392332"	"0000822587"
"0000392333"	"0000822588"
"0000392334"	"0000822589"
"0000392335"	"0000822590"
"0000392336"	"0000822591"
"0000392337"	"0000822592"
"0000392338"	"0000822593"
"0000392339"	"0000822594"
"0000392340"	"0000822595"
"0000392341"	"0000822621"
"0000392342"	"0000822622"
"0000392343"	"0000822623"
"0000392344"	"0000822624"
"0000392345"	"0000822625"
"0000392346"	"0000822626"
"0000392347"	"0000822627"
"0000392348"	"0000822628"
"0000392348"	"0000822656"
"0000392349"	"0000822629"
"0000392349"	"0000822657"
"0000392350"	"0000822630"
"0000392350"	"0000822658"
"0000392351"	"0000822631"
"0000392351"	"0000822659"
"0000392352"	"0000822632"
"0000392352"	"0000822660"
"0000392353"	"0000822633"
"0000392353"	"0000822661"
"0000392354"	"0000822634"
"0000392354"	"0000822662"
"0000392355"	"0000822635"
"0000392355"	"0000822663"
"0000392356"	"0000822636"
"0000392356"	"0000822664"
"0000392357"	"0000822637"
"0000392357"	"0000822665"
"0000392358"	"0000822638"
"0000392359"	"0000822639"
"0000392360"	"0000822640"
"0000392361"	"0000822641"
"0000392362"	"0000822642"
"0000392363"	"0000822643"
"0000392364"	"0000822644"
"0000392365"	"0000822645"
"0000392366"	"0000822646"
"0000392367"	"0000822647"
"0000392368"	"0000822648"
"0000392369"	"0000822649"
"0000392370"	"0000822650"
"0000392371"	"0000822651"
"0000392371"	"0000822666"
"0000392372"	"0000822652"
"0000392372"	"0000822667"
"0000392373"	"0000822653"
"0000392373"	"0000822668"
"0000392374"	"0000822654"
"0000392374"	"0000822669"
"0000392375"	"0000822655"
"0000392532"	"0000822860"
"0000392533"	"0000822861"
"0000392534"	"0000822862"
"0000392535"	"0000822863"
"0000392536"	"0000822864"
"0000392537"	"0000822865"
"0000392538"	"0000822866"
"0000392539"	"0000822867"
"0000392540"	"0000822868"
"0000392541"	"0000822869"
"0000392542"	"0000822870"
"0000392543"	"0000822871"
"0000392544"	"0000822872"
"0000392545"	"0000822873"
"0000392546"	"0000822874"
"0000392547"	"0000822875"
"0000392548"	"0000822876"
"0000392549"	"0000822877"
"0000392550"	"0000822878"
"0000392551"	"0000822879"
"0000392552"	"0000822880"
"0000392553"	"0000822881"
"0000392554"	"0000822882"
"0000392555"	"0000822883"
"0000392556"	"0000822884"
"0000392557"	"0000822885"
"0000392558"	"0000822886"
"0000392559"	"0000822887"
"0000392560"	"0000822888"
"0000392561"	"0000822889"
"0000392562"	"0000822890"
"0000392563"	"0000822891"
"0000392564"	"0000822892"
"0000392564"	"0000822915"
"0000392565"	"0000822893"
"0000392565"	"0000822916"
"0000392566"	"0000822894"
"0000392566"	"0000822917"
"0000392567"	"0000822895"
"0000392567"	"0000822918"
"0000392568"	"0000822896"
"0000392568"	"0000822919"
"0000392569"	"0000822897"
"0000392569"	"0000822920"
"0000392570"	"0000822898"
"0000392570"	"0000822921"
"0000392571"	"0000822899"
"0000392571"	"0000822922"
"0000392572"	"0000822900"
"0000392572"	"0000822923"
"0000392573"	"0000822901"
"0000392573"	"0000822924"
"0000392574"	"0000822902"
"0000392574"	"0000822925"
"0000392575"	"0000822903"
"0000392575"	"0000822926"
"0000392576"	"0000822904"
"0000392576"	"0000822927"
"0000392577"	"0000822905"
"0000392577"	"0000822928"
"0000392578"	"0000822906"
"0000392578"	"0000822929"
"0000392579"	"0000822907"
"0000392580"	"0000822908"
"0000392581"	"0000822909"
"0000392582"	"0000822910"
"0000392583"	"0000822911"
"0000392584"	"0000822912"
"0000392585"	"0000822913"
"0000392586"	"0000822914"
"0000392621"	"0000822964"
"0000392622"	"0000822965"
"0000392631"	"0000822983"
"0000392632"	"0000822984"
"0000392633"	"0000822985"
"0000392634"	"0000822986"
"0000392635"	"0000822987"
"0000392636"	"0000822988"
"0000392637"	"0000822989"
"0000392638"	"0000822990"
"0000392639"	"0000822991"
"0000392640"	"0000822992"
"0000392641"	"0000822993"
"0000392642"	"0000822994"
"0000392643"	"0000822995"
"0000392644"	"0000822996"
"0000392645"	"0000822997"
"0000392646"	"0000822998"
"0000392647"	"0000822999"
"0000392648"	"0000823000"
"0000392649"	"0000823001"
"0000392650"	"0000823002"
"0000392651"	"0000823003"
"0000392652"	"0000823004"
"0000392653"	"0000823005"
"0000392654"	"0000823006"
"0000392655"	"0000823007"
"0000392656"	"0000823008"
"0000392656"	"0000823086"
"0000392657"	"0000823009"
"0000392657"	"0000823087"
"0000392658"	"0000823010"
"0000392658"	"0000823088"
"0000392659"	"0000823011"
"0000392659"	"0000823089"
"0000392660"	"0000823012"
"0000392660"	"0000823090"
"0000392661"	"0000823013"
"0000392661"	"0000823091"
"0000392662"	"0000823014"
"0000392662"	"0000823092"
"0000392663"	"0000823015"
"0000392663"	"0000823093"
"0000392664"	"0000823016"
"0000392664"	"0000823094"
"0000392665"	"0000823017"
"0000392665"	"0000823095"
"0000392666"	"0000823018"
"0000392666"	"0000823096"
"0000392667"	"0000823019"
"0000392667"	"0000823097"
"0000392668"	"0000823020"
"0000392668"	"0000823098"
"0000392669"	"0000823021"
"0000392669"	"0000823099"
"0000392670"	"0000823022"
"0000392670"	"0000823100"
"0000392671"	"0000823023"
"0000392671"	"0000823101"
"0000392672"	"0000823024"
"0000392672"	"0000823102"
"0000392673"	"0000823025"
"0000392673"	"0000823103"
"0000392674"	"0000823026"
"0000392674"	"0000823104"
"0000392675"	"0000823027"
"0000392675"	"0000823105"
"0000392676"	"0000823028"
"0000392676"	"0000823106"
"0000392677"	"0000823029"
"0000392677"	"0000823107"
"0000392678"	"0000823030"
"0000392678"	"0000823108"
"0000392679"	"0000823031"
"0000392679"	"0000823109"
"0000392680"	"0000823032"
"0000392680"	"0000823110"
"0000392681"	"0000823033"
"0000392681"	"0000823111"
"0000392682"	"0000823034"
"0000392682"	"0000823112"
"0000392683"	"0000823035"
"0000392683"	"0000823113"
"0000392684"	"0000823036"
"0000392684"	"0000823114"
"0000392685"	"0000823037"
"0000392685"	"0000823115"
"0000392686"	"0000823038"
"0000392686"	"0000823116"
"0000392687"	"0000823039"
"0000392687"	"0000823117"
"0000392688"	"0000823040"
"0000392688"	"0000823118"
"0000392688"	"0000823164"
"0000392689"	"0000823041"
"0000392689"	"0000823119"
"0000392690"	"0000823042"
"0000392690"	"0000823120"
"0000392691"	"0000823043"
"0000392691"	"0000823121"
"0000392692"	"0000823044"
"0000392692"	"0000823122"
"0000392693"	"0000823045"
"0000392693"	"0000823123"
"0000392694"	"0000823046"
"0000392694"	"0000823124"
"0000392695"	"0000823047"
"0000392695"	"0000823125"
"0000392696"	"0000823048"
"0000392696"	"0000823126"
"0000392697"	"0000823049"
"0000392697"	"0000823127"
"0000392698"	"0000823050"
"0000392698"	"0000823128"
"0000392699"	"0000823051"
"0000392699"	"0000823129"
"0000392700"	"0000823052"
"0000392700"	"0000823130"
"0000392701"	"0000823053"
"0000392701"	"0000823131"
"0000392702"	"0000823054"
"0000392702"	"0000823132"
"0000392703"	"0000823055"
"0000392703"	"0000823133"
"0000392704"	"0000823056"
"0000392704"	"0000823134"
"0000392705"	"0000823057"
"0000392705"	"0000823135"
"0000392706"	"0000823058"
"0000392706"	"0000823136"
"0000392707"	"0000823059"
"0000392707"	"0000823137"
"0000392708"	"0000823060"
"0000392708"	"0000823138"
"0000392709"	"0000823061"
"0000392709"	"0000823139"
"0000392710"	"0000823062"
"0000392710"	"0000823140"
"0000392711"	"0000823063"
"0000392711"	"0000823141"
"0000392712"	"0000823064"
"0000392712"	"0000823142"
"0000392713"	"0000823065"
"0000392713"	"0000823143"
"0000392714"	"0000823066"
"0000392714"	"0000823144"
"0000392715"	"0000823067"
"0000392715"	"0000823145"
"0000392716"	"0000823068"
"0000392716"	"0000823146"
"0000392717"	"0000823069"
"0000392717"	"0000823147"
"0000392718"	"0000823070"
"0000392718"	"0000823148"
"0000392719"	"0000823071"
"0000392719"	"0000823149"
"0000392720"	"0000823072"
"0000392720"	"0000823150"
"0000392721"	"0000823073"
"0000392721"	"0000823151"
"0000392722"	"0000823074"
"0000392722"	"0000823152"
"0000392723"	"0000823075"
"0000392723"	"0000823153"
"0000392724"	"0000823076"
"0000392724"	"0000823154"
"0000392725"	"0000823077"
"0000392725"	"0000823155"
"0000392726"	"0000823078"
"0000392726"	"0000823156"
"0000392727"	"0000823079"
"0000392727"	"0000823157"
"0000392728"	"0000823080"
"0000392728"	"0000823158"
"0000392729"	"0000823081"
"0000392729"	"0000823159"
"0000392730"	"0000823082"
"0000392730"	"0000823160"
"0000392731"	"0000823083"
"0000392731"	"0000823161"
"0000392732"	"0000823084"
"0000392732"	"0000823162"
"0000392733"	"0000823085"
"0000392733"	"0000823163"
"0000392734"	"0000823165"
"0000392734"	"0000823166"
"0000392736"	"0000823169"
"0000392737"	"0000823170"
"0000392737"	"0000823171"
"0000392785"	"0000823220"
"0000392785"	"0000823271"
"0000392786"	"0000823221"
"0000392787"	"0000823222"
"0000392788"	"0000823223"
"0000392788"	"0000823273"
"0000393001"	"0000823568"
"0000393001"	"0000823572"
"0000393002"	"0000823569"
"0000393002"	"0000823573"
"0000393003"	"0000823570"
"0000393003"	"0000823574"
"0000393010"	"0000823582"
"0000393011"	"0000823583"
"0000393012"	"0000823584"
"0000393012"	"0000823591"
"0000393013"	"0000823585"
"0000393013"	"0000823592"
"0000393014"	"0000823586"
"0000393014"	"0000823593"
"0000393015"	"0000823587"
"0000393015"	"0000823594"
"0000393022"	"0000823601"
"0000393022"	"0000823608"
"0000393023"	"0000823602"
"0000393023"	"0000823609"
"0000393024"	"0000823603"
"0000393024"	"0000823610"
"0000393025"	"0000823604"
"0000393025"	"0000823611"
"0000393045"	"0000823631"
"0000393045"	"0000823682"
"0000393046"	"0000823632"
"0000393047"	"0000823633"
"0000393048"	"0000823634"
"0000393048"	"0000823683"
"0000393049"	"0000823635"
"0000393049"	"0000823684"
"0000393050"	"0000823636"
"0000393051"	"0000823637"
"0000393052"	"0000823638"
"0000393052"	"0000823685"
"0000393053"	"0000823639"
"0000393054"	"0000823640"
"0000393054"	"0000823686"
"0000393055"	"0000823641"
"0000393056"	"0000823642"
"0000393057"	"0000823643"
"0000393058"	"0000823644"
"0000393059"	"0000823645"
"0000393059"	"0000823687"
"0000393060"	"0000823646"
"0000393061"	"0000823647"
"0000393062"	"0000823648"
"0000393063"	"0000823649"
"0000393064"	"0000823650"
"0000393065"	"0000823651"
"0000393066"	"0000823652"
"0000393067"	"0000823653"
"0000393068"	"0000823654"
"0000393068"	"0000823688"
"0000393068"	"0000823698"
"0000393069"	"0000823655"
"0000393070"	"0000823656"
"0000393071"	"0000823657"
"0000393072"	"0000823658"
"0000393072"	"0000823689"
"0000393073"	"0000823659"
"0000393073"	"0000823690"
"0000393074"	"0000823660"
"0000393074"	"0000823691"
"0000393075"	"0000823661"
"0000393075"	"0000823692"
"0000393076"	"0000823662"
"0000393077"	"0000823663"
"0000393077"	"0000823693"
"0000393078"	"0000823664"
"0000393078"	"0000823694"
"0000393079"	"0000823665"
"0000393079"	"0000823695"
"0000393080"	"0000823666"
"0000393081"	"0000823667"
"0000393081"	"0000823696"
"0000393082"	"0000823668"
"0000393083"	"0000823669"
"0000393084"	"0000823670"
"0000393085"	"0000823671"
"0000393086"	"0000823672"
"0000393087"	"0000823673"
"0000393088"	"0000823674"
"0000393089"	"0000823675"
"0000393089"	"0000823697"
"0000393090"	"0000823676"
"0000393091"	"0000823677"
"0000393092"	"0000823678"
"0000393093"	"0000823679"
"0000393094"	"0000823680"
"0000393095"	"0000823681"
"0000393113"	"0000823728"
"0000393161"	"0000823816"
"0000393161"	"0000823817"
"0000393162"	"0000823818"
"0000393163"	"0000823819"
"0000393163"	"0000823820"
"0000393164"	"0000823821"
"0000394159"	"0000825070"
"0000394159"	"0000825074"
"0000394583"	"0000825513"
"0000394584"	"0000825514"
"0000394585"	"0000825515"
"0000395225"	"0000826472"
"0000395225"	"0000826473"
"0000395226"	"0000826474"
"0000395226"	"0000826475"
"0000395227"	"0000826476"
"0000395227"	"0000826477"
"0000395228"	"0000826478"
"0000395228"	"0000826479"
"0000395229"	"0000826480"
"0000395229"	"0000826481"
"0000395234"	"0000826490"
"0000395602"	"0000826990"
"0000399811"	"0000832442"
"0000399813"	"0000832444"
"0000399815"	"0000832446"
"0000399816"	"0000832447"
"0000399818"	"0000832449"
"0000399874"	"0000832522"
"0000399874"	"0000832528"
"0000399877"	"0000832525"
"0000399884"	"0000832537"
"0000399884"	"0000832547"
"0000399885"	"0000832538"
"0000399886"	"0000832539"
"0000399887"	"0000832540"
"0000399887"	"0000832548"
"0000399888"	"0000832541"
"0000399888"	"0000832549"
"0000399889"	"0000832542"
"0000399893"	"0000832563"
"0000399893"	"0000832564"
"0000399895"	"0000832557"
"0000399896"	"0000832558"
"0000399898"	"0000832560"
"0000399899"	"0000832561"
"0000399900"	"0000832562"
"0000400008"	"0000832725"
"0000400008"	"0000832741"
"0000400009"	"0000832726"
"0000400009"	"0000832742"
"0000400010"	"0000832727"
"0000400010"	"0000832743"
"0000400011"	"0000832728"
"0000400011"	"0000832744"
"0000400012"	"0000832729"
"0000400012"	"0000832745"
"0000400013"	"0000832730"
"0000400013"	"0000832746"
"0000400014"	"0000832731"
"0000400014"	"0000832747"
"0000400025"	"0000832773"
"0000409687"	"0000846891"
"0000409688"	"0000846892"
"0000417048"	"0000876549"
"0000417048"	"0000876565"
"0000417049"	"0000876550"
"0000417050"	"0000876551"
"0000417051"	"0000876552"
"0000417051"	"0000876566"
"0000417052"	"0000876553"
"0000417052"	"0000876567"
"0000417053"	"0000876554"
"0000417054"	"0000876555"
"0000417055"	"0000876556"
"0000417058"	"0000876559"
"0000417059"	"0000876560"
"0000421005"	"0000881457"
"0000421006"	"0000881458"
"0000421006"	"0000881466"
"0000421007"	"0000881425"
"0000428223"	"0000905857"
"0000428223"	"0000905858"
"0000428224"	"0000905860"
"0000428224"	"0000905861"
"0000428225"	"0000905862"
"0000428225"	"0000905863"
"0000428226"	"0000905865"
"0000428226"	"0000905866"
"0000428231"	"0000905881"
"0000428231"	"0000905882"
"0000428232"	"0000905883"
"0000428232"	"0000905884"
"0000438130"	"0000933671"
"0000438130"	"0000933672"
"0000448486"	"0000957972"
"0000448486"	"0000958389"
"0000448487"	"0000957973"
"0000448487"	"0000958390"
"0000448488"	"0000957974"
"0000448490"	"0000958392"
"0000448491"	"0000957977"
"0000448491"	"0000958393"
"0000448492"	"0000957978"
"0000448493"	"0000957979"
"0000448494"	"0000957980"
"0000448494"	"0000958395"
"0000448495"	"0000957981"
"0000448495"	"0000958396"
"0000448501"	"0000957987"
"0000448788"	"0000958274"
"0000448788"	"0000958588"
"0000448976"	"0000959196"
"0000449062"	"0000958829"
"0000449062"	"0000959262"
"0000449139"	"0000958906"
"0000449197"	"0000959408"
"0000449234"	"0000959001"
"0000449250"	"0000959017"
"0000449251"	"0000959454"
"0000449257"	"0000959024"
"0000452390"	"0000986373"
"0000452390"	"0000986904"
"0000452391"	"0000986374"
"0000452391"	"0000986905"
"0000452392"	"0000986375"
"0000452393"	"0000986376"
"0000452393"	"0000986906"
"0000452394"	"0000986377"
"0000452395"	"0000986378"
"0000452396"	"0000986379"
"0000452397"	"0000986380"
"0000452397"	"0000986907"
"0000452398"	"0000986381"
"0000452399"	"0000986382"
"0000452400"	"0000986383"
"0000452401"	"0000986384"
"0000452401"	"0000986908"
"0000452402"	"0000986385"
"0000452402"	"0000986909"
"0000452403"	"0000986386"
"0000452403"	"0000986910"
"0000452633"	"0000987299"
"0000452720"	"0000987065"
"0000452738"	"0000987314"
"0000452828"	"0000987173"
"0000456384"	"0001010046"
"0000456384"	"0001030046"
"0000456387"	"0001010049"
"0000456387"	"0001010050"
"0000456387"	"0001030051"
"0000456388"	"0001010051"
"0000456388"	"0001030052"
"0000456389"	"0001010052"
"0000456558"	"0001010244"
"0000456558"	"0001010321"
"0000456559"	"0001010245"
"0000456560"	"0001010246"
"0000456561"	"0001010247"
"0000456562"	"0001010248"
"0000456563"	"0001010249"
"0000456564"	"0001010250"
"0000456565"	"0001010251"
"0000456566"	"0001010252"
"0000456567"	"0001010253"
"0000456568"	"0001010254"
"0000456569"	"0001010255"
"0000456570"	"0001010256"
"0000456571"	"0001010257"
"0000456572"	"0001010258"
"0000456573"	"0001010259"
"0000456574"	"0001010260"
"0000456575"	"0001010261"
"0000456576"	"0001010262"
"0000456577"	"0001010263"
"0000456578"	"0001010264"
"0000456579"	"0001010265"
"0000456580"	"0001010266"
"0000456581"	"0001010267"
"0000456582"	"0001010268"
"0000456583"	"0001010269"
"0000456584"	"0001010270"
"0000456585"	"0001010271"
"0000456586"	"0001010272"
"0000456587"	"0001010273"
"0000456588"	"0001010274"
"0000456589"	"0001010275"
"0000456590"	"0001010276"
"0000456591"	"0001010277"
"0000456592"	"0001010278"
"0000456593"	"0001010279"
"0000456594"	"0001010280"
"0000456595"	"0001010281"
"0000456596"	"0001010282"
"0000456596"	"0001010323"
"0000456597"	"0001010283"
"0000456597"	"0001010324"
"0000456598"	"0001010284"
"0000456598"	"0001010325"
"0000456599"	"0001010285"
"0000456599"	"0001010326"
"0000456600"	"0001010286"
"0000456600"	"0001010327"
"0000456601"	"0001010287"
"0000456601"	"0001010328"
"0000456602"	"0001010288"
"0000456602"	"0001010329"
"0000456603"	"0001010289"
"0000456603"	"0001010330"
"0000456604"	"0001010290"
"0000456604"	"0001010331"
"0000456605"	"0001010291"
"0000456605"	"0001010332"
"0000456606"	"0001010292"
"0000456606"	"0001010333"
"0000456607"	"0001010293"
"0000456607"	"0001010334"
"0000456608"	"0001010294"
"0000456608"	"0001010335"
"0000456609"	"0001010295"
"0000456610"	"0001010296"
"0000456611"	"0001010297"
"0000456612"	"0001010298"
"0000456613"	"0001010299"
"0000456614"	"0001010300"
"0000456615"	"0001010301"
"0000456615"	"0001010336"
"0000466175"	"0001030047"
"0000466175"	"0001030048"