### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = CNNM4)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"CNNM4"	"cyclin M4"	"2"	"q11.2"	"unknown"	"NG_016608.1"	"UD_132118228138"	""	"https://www.LOVD.nl/CNNM4"	""	"1"	"105"	"26504"	"607805"	"1"	"1"	"1"	"1"	"<font color=\"#FF0000\">This database is one of the <b>\"Eye disease\"</b> gene variant databases.</font>\r\n\\Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by <a href=\'http://www.variome.org\' target=\'_blank\'>Global Variome</a>."	""	"g"	"https://databases.lovd.nl/shared/refseq/CNNM4_codingDNA.html"	"1"	""	"<font color=\"#FF0000\">This database is one of the <b>\"Eye disease\"</b> gene variant databases.</font>"	"-1"	""	"-1"	"00001"	"2012-07-16 00:00:00"	"00006"	"2020-11-13 09:16:50"	"00006"	"2024-05-30 14:19:34"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00005397"	"CNNM4"	"cyclin M4"	"001"	"NM_020184.3"	""	"NP_064569.3"	""	""	""	"-98"	"4702"	"2328"	"97426639"	"97477628"	""	"0000-00-00 00:00:00"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 7
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00058"	"CORD"	"dystrophy, cone-rod (CORD)"	""	""	""	""	""	"00006"	"2012-09-22 11:31:25"	"00006"	"2020-08-30 09:43:59"
"00115"	"CRMCC"	"microangiopathy, cerebroretinal, with calcifications and cysts (CRMCC, Coats plus syndrome)"	"AR"	"612199"	""	""	""	"00001"	"2013-03-08 10:55:44"	"00006"	"2021-12-10 21:51:32"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"01718"	"Jalili"	"Jalili syndrome"	"AR"	"217080"	""	"autosomal recessive"	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"04214"	"-"	"retinal disease"	""	""	""	""	""	"00006"	"2015-02-27 19:48:07"	"00001"	"2023-03-09 14:26:26"
"04249"	"macular dystrophy"	"dystrophy, macular"	""	""	""	""	""	"00006"	"2015-05-04 22:10:58"	"00006"	"2024-02-15 21:18:39"
"05650"	"AI"	"amelogenesis imperfecta (AI)"	""	""	""	""	""	"00006"	"2019-09-11 22:21:30"	""	""


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 1
"{{geneid}}"	"{{diseaseid}}"
"CNNM4"	"01718"


## Individuals ## Do not remove or alter this header ##
## Count = 85
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00000390"	""	""	""	"1"	""	"00015"	"{PMID:Linnankivi 2006:16943371}, {PMID:Polvi 2012:22387016}"	"F8:II-1, patient 12 in Linnankivi et al. 2006"	"M"	"no"	"Finland"	">22y"	""	""	""	"Finnish"	""
"00059790"	""	""	""	"1"	""	"00039"	"{PMID:Abu-Safieh-2013:23105016}"	""	""	""	""	""	"0"	""	""	""	""
"00155447"	""	""	""	"1"	""	"01243"	"Sharon, submitted"	""	"F"	"yes"	"Israel"	""	"0"	""	""	"Arab-Muslim"	""
"00155448"	""	""	""	"1"	""	"01243"	"{PMID:Beryozkin 2015:26306921}, {PMID:Sharon 2019:31456290}"	"family"	"F"	"yes"	"Israel"	""	"0"	""	""	"Druze"	"MOL0367"
"00292855"	""	""	""	"62"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00309104"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"1 IRD family"	""	""	"Israel"	""	"0"	""	""	""	""
"00309105"	""	""	""	"1"	""	"00004"	"{PMID:Sharon 2019:31456290}"	"family"	""	""	"Israel"	""	"0"	""	""	""	""
"00335970"	""	""	""	"1"	""	"00000"	"{PMID:Sergouniotis 2016:27628848}"	"analysis 486 cases"	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	""
"00358982"	""	""	""	"1"	""	"00000"	"{PMID:Tiwari 2016:27353947}"	"see paper"	"M"	""	"Switzerland"	""	"0"	""	""	""	"Case71780"
"00363616"	""	""	""	"1"	""	"00000"	"{PMID:Patel 2016:26355662}"	""	""	""	"Saudi Arabia"	""	"0"	""	""	""	"10DG0615"
"00363658"	""	""	""	"1"	""	"00000"	"{PMID:Patel 2016:26355662}"	""	""	""	"Saudi Arabia"	""	"0"	""	""	""	"11DG1725"
"00363866"	""	""	""	"1"	""	"01243"	"{PMID:Sharon 2019:31456290}"	"family"	""	""	"Israel"	""	"0"	""	""	""	""
"00372503"	""	""	""	"1"	""	"00000"	"{PMID:Wang 2015:26047050}"	"index case"	""	""	"China"	""	"0"	""	""	""	"88"
"00373507"	""	""	""	"1"	""	"00000"	"{PMID:Liu 2015:25611614}"	""	""	""	"China"	""	"0"	""	""	""	"RH5"
"00376860"	""	""	""	"1"	""	"00000"	"{PMID:Coppieters 2014:24625443}"	"see paper"	""	"yes"	"Algeria"	""	"0"	""	""	""	"Fam7"
"00380141"	""	""	""	"1"	""	"00000"	"{PMID:Patel 2018:30054919}"	""	""	"likely"	"Qatar"	""	"0"	""	""	""	"13DG1743"
"00382529"	""	""	""	"1"	""	"00000"	"{PMID:Jespersgaar 2019:30718709}"	""	"?"	""	"Denmark"	""	"0"	""	""	""	"391"
"00383420"	""	""	""	"1"	""	"00000"	"{PMID:Khan 2019:31725702}"	""	"M"	""	""	""	"0"	""	""	""	""
"00385052"	""	""	""	"1"	""	"00000"	"{PMID:Xu 2020:31630094}"	""	"?"	"no"	"China"	""	"0"	""	""	""	"19885"
"00385882"	""	""	""	"1"	""	"00006"	"{PMID:Prasad 2016:26502894}"	""	"M"	"yes"	""	""	"0"	""	""	""	"V2.05"
"00386299"	""	""	""	"1"	""	"00000"	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"?"	""	"Spain"	""	"0"	""	""	""	"RP-677"
"00389682"	""	""	""	"1"	""	"00000"	"{PMID:Weisschuh 2020:32531858}"	"Filing key number: 432, cone-rod dystrophy, no patient Ids, consecutive numbers given"	"M"	""	"Germany"	""	"0"	""	""	""	"966"
"00393755"	""	""	""	"1"	""	"00000"	"{PMID:Liu-2020:33090715}"	""	"M"	""	""	""	"0"	""	""	""	""
"00413172"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Gaza A, no pedigree, 2 affected adults analysed, no numbers - consecutive given"	"?"	"yes"	"Israel"	""	"0"	""	""	""	"1"
"00413173"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Kosovo"	"?"	"no"	"Kosovo"	""	"0"	""	""	""	"?"
"00413174"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Gaza B"	"M"	"yes"	"Israel"	""	"0"	""	""	""	"V:1"
"00413175"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Gaza B"	"F"	"yes"	"Israel"	""	"0"	""	""	""	"V:3"
"00413176"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Gaza B"	"F"	"yes"	"Israel"	""	"0"	""	""	""	"V:4"
"00413177"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Guatemala"	"M"	"no"	"Guatemala"	""	"0"	""	""	""	"II:3"
"00413178"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Guatemala"	"M"	"no"	"Guatemala"	""	"0"	""	""	""	"II:4"
"00413179"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Guatemala"	"M"	"no"	"Guatemala"	""	"0"	""	""	""	"II:5"
"00413180"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Guatemala"	"M"	"no"	"Guatemala"	""	"0"	""	""	""	"II:6"
"00413181"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Turkey"	"F"	"yes"	"Turkey"	""	"0"	""	""	""	"II:2"
"00413182"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Turkey"	"F"	"yes"	"Turkey"	""	"0"	""	""	""	"II:3"
"00413183"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Iran"	"M"	"yes"	"Iran"	""	"0"	""	""	""	"IV:1"
"00413184"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Iran"	"F"	"yes"	"Iran"	""	"0"	""	""	""	"IV:2"
"00413185"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Iran"	"M"	"yes"	"Iran"	""	"0"	""	""	""	"IV:3"
"00413186"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Iran"	"M"	"yes"	"Iran"	""	"0"	""	""	""	"V:1"
"00413187"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Scotland"	"M"	"no"	"Scotland"	""	"0"	""	""	""	"III:1"
"00413188"	""	""	""	"1"	""	"00000"	"{PMID:Parry 2009:19200525}"	"family Gaza A, no pedigree, 2 affected adults analysed, no numbers - consecutive given"	"?"	"yes"	"Israel"	""	"0"	""	""	""	"2"
"00413189"	""	""	""	"1"	""	"00000"	"{PMID:Polok 2009:19200527}"	"Family A, sister of II:4"	"F"	"no"	"Kosovo"	""	"0"	""	""	""	"II:1"
"00413190"	""	""	""	"1"	""	"00000"	"{PMID:Polok 2009:19200527}"	"Family A, brother 2 of II:1"	"M"	"no"	"Kosovo"	""	"0"	""	""	""	"II:4"
"00413199"	""	""	""	"1"	""	"00000"	"{PMID:Polok 2009:19200527}"	"Family B, sister of V:8"	"F"	"yes"	"Lebanon"	""	"0"	""	""	""	"V:6"
"00413200"	""	""	""	"1"	""	"00000"	"{PMID:Polok 2009:19200527}"	"Family B, sister of V:6"	"F"	"yes"	"Lebanon"	""	"0"	""	""	""	"V:8"
"00413201"	""	""	""	"1"	""	"00000"	"{PMID:Polok 2009:19200527}"	"Family B, cousin of V:6 and V:8"	"M"	"yes"	"Lebanon"	""	"0"	""	""	""	"V:1"
"00413202"	""	""	""	"1"	""	"00000"	"{PMID:Polok 2009:19200527}"	"Family C, isolated patient"	"F"	""	""	""	"0"	""	""	""	"?"
"00413203"	""	""	""	"1"	""	"00000"	"{PMID:Jalili 2010:20706282}"	"six-generation Arab family in Gaza City"	"M"	"yes"	"Israel"	""	"0"	""	""	""	"VI:1"
"00413204"	""	""	""	"1"	""	"00000"	"{PMID:Jalili 2010:20706282}"	"six-generation Arab family in Gaza City"	"F"	"yes"	"Israel"	""	"0"	""	""	""	"VI:5"
"00413205"	""	""	""	"1"	""	"00000"	"{PMID:Jalili 2010:20706282}"	"six-generation Arab family in Gaza City"	"F"	"yes"	"Israel"	""	"0"	""	""	""	"VI:6"
"00413208"	""	""	""	"1"	""	"00000"	"{PMID:Zobor 2012:21728811}"	""	"F"	"yes"	"Kosovo"	""	"0"	""	""	"Kosovan"	"?"
"00413210"	""	""	""	"1"	""	"00000"	"{PMID:Luder 2013:24194943}"	"Kosovan family, no patient numbering - consecutive numbers given; brother of 2"	"M"	"no"	""	""	"0"	""	""	"Kosovan"	"1"
"00413211"	""	""	""	"1"	""	"00000"	"{PMID:Luder 2013:24194943}"	"Kosovan family, no patient numbering - consecutive numbers given; brother of 1"	"M"	"no"	""	""	"0"	""	""	"Kosovan"	"2"
"00413212"	""	""	""	"1"	""	"00000"	"{PMID:Gerth-Kahlert 2015:25613845}"	"Kosovan family, sister of III:5"	"F"	"no"	""	""	"0"	""	""	"Kosovan"	"III:4"
"00413213"	""	""	""	"1"	""	"00000"	"{PMID:Gerth-Kahlert 2015:25613845}"	"Kosovan family, sister of III:4"	"F"	"no"	""	""	"0"	""	""	"Kosovan"	"III:5"
"00413214"	""	""	""	"1"	""	"00000"	"{PMID:Topcu 2017:27070327}"	"Turkish family, sister of V-2 and V-3"	"F"	"yes"	"Turkey"	""	"0"	""	""	""	"V-1"
"00413215"	""	""	""	"1"	""	"00000"	"{PMID:Topcu 2017:27070327}"	"Turkish family, sister of V-1 and V-3"	"F"	"yes"	"Turkey"	""	"0"	""	""	""	"V-2"
"00413216"	""	""	""	"1"	""	"00000"	"{PMID:Topcu 2017:27070327}"	"Turkish family, sister of V-2 and V-1"	"F"	"yes"	"Turkey"	""	"0"	""	""	""	"V-3"
"00413217"	""	""	""	"1"	""	"00000"	"{PMID:Rahimi-Aliabadi 2016:27419834}"	"Iranian family"	"F"	"yes"	"Iran"	""	"0"	""	""	""	"IV.22"
"00413218"	""	""	""	"1"	""	"00000"	"{PMID:Rahimi-Aliabadi 2016:27419834}"	"Iranian family"	"F"	"yes"	"Iran"	""	"0"	""	""	""	"V.9"
"00413219"	""	""	""	"1"	""	"00000"	"{PMID:Rahimi-Aliabadi 2016:27419834}"	"Iranian family"	"M"	"yes"	"Iran"	""	"0"	""	""	""	"V.20"
"00413220"	""	""	""	"1"	""	"00000"	"{PMID:Rahimi-Aliabadi 2016:27419834}"	"Iranian family"	"M"	"yes"	"Iran"	""	"0"	""	""	""	"V.8"
"00413221"	""	""	""	"1"	""	"00000"	"{PMID:Cherkaoui Jaouad 2017:28246031}"	"Moroccan family; proband\'s sister 1"	"F"	"yes"	"Morocco"	""	"0"	""	""	""	"IV-2"
"00413222"	""	""	""	"1"	""	"00000"	"{PMID:Cherkaoui Jaouad 2017:28246031}"	"Moroccan family; proband"	"F"	"yes"	"Morocco"	""	"0"	""	""	""	"IV-3"
"00413223"	""	""	""	"1"	""	"00000"	"{PMID:Cherkaoui Jaouad 2017:28246031}"	"Moroccan family; proband\'s sister 2"	"F"	"yes"	"Morocco"	""	"0"	""	""	""	"IV-4"
"00413224"	""	""	""	"1"	""	"00000"	"{PMID:Wawrocka 2017:28586144}"	"Polish family, consanguineous; third cousin parents"	"M"	"yes"	"Poland"	""	"0"	""	""	"Polish"	"p1"
"00413225"	""	""	""	"1"	""	"00000"	"{PMID:Wawrocka 2017:28586144}"	"Polish family, consanguineous; third cousin parents"	"M"	"yes"	"Poland"	""	"0"	""	""	"Polish"	"p2"
"00413226"	""	""	""	"1"	""	"00000"	"{PMID:Wawrocka 2017:28586144}"	"Polish family, consanguineous; third cousin parents"	"M"	"yes"	"Poland"	""	"0"	""	""	"Polish"	"p3"
"00413227"	""	""	""	"1"	""	"00000"	"{PMID:Li 2018:29322253}"	"two-generation Amish family; proband"	"M"	""	"United States"	""	"0"	""	""	"Amish"	"II:2"
"00413228"	""	""	""	"1"	""	"00000"	"{PMID:Li 2018:29322253}"	"two-generation Amish family; proband\'s sister 1"	"F"	""	"United States"	""	"0"	""	""	"Amish"	"II:5"
"00413229"	""	""	""	"1"	""	"00000"	"{PMID:Li 2018:29322253}"	"two-generation Amish family; proband\'s sister 4"	"F"	""	"United States"	""	"0"	""	""	"Amish"	"II:8"
"00413231"	""	""	""	"1"	""	"00000"	"{PMID:Hirji 2018:29421294}"	""	"M"	"no"	""	""	"0"	""	""	"Kosovan"	"3"
"00413232"	""	""	""	"1"	""	"00000"	"{PMID:Hirji 2018:29421294}"	""	"M"	"yes"	""	""	"0"	""	""	"Pakistani"	"4"
"00413233"	""	""	""	"1"	""	"00000"	"{PMID:Hirji 2018:29421294}"	""	"M"	"no"	""	""	"0"	""	""	"English/Irish/German"	"5"
"00413234"	""	""	""	"1"	""	"00000"	"{PMID:Hirji 2018:29421294}"	"cousin of Patient 7"	"F"	"yes"	""	""	"0"	""	""	"Afghani"	"6"
"00413235"	""	""	""	"1"	""	"00000"	"{PMID:Hirji 2018:29421294}"	"cousin of Patient 6"	"M"	"yes"	""	""	"0"	""	""	"Afghani"	"7"
"00413236"	""	""	""	"1"	""	"00000"	"{PMID:Maia 2018:29421602}"	"Family A, parents third cousins; proband (single case)"	"F"	"yes"	"Brazil"	""	"0"	""	""	""	"A-1"
"00413237"	""	""	""	"1"	""	"00000"	"{PMID:Maia 2018:29421602}"	"Family B; proband (single case)"	"F"	"no"	"Brazil"	""	"0"	""	""	""	"B-1"
"00413242"	""	""	""	"1"	""	"00000"	"{PMID:Parveen 2019:31347285}"	"Pakistani family, proband"	"F"	"yes"	""	""	"0"	""	""	"Pakistani"	"IV-3"
"00413243"	""	""	""	"1"	""	"00000"	"{PMID:Parveen 2019:31347285}"	"Pakistani family, proband\'s sister 1"	"F"	"yes"	""	""	"0"	""	""	"Pakistani"	"IV-4"
"00413244"	""	""	""	"1"	""	"00000"	"{PMID:Parveen 2019:31347285}"	"Pakistani family, proband\'s sister 2"	"F"	"yes"	""	""	"0"	""	""	"Pakistani"	"IV-5"
"00419703"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}"	""	"M"	""	""	""	"0"	""	""	""	"070898"
"00421391"	""	""	""	"1"	""	"00000"	"{PMID:Prasov 2020:32022389}"	""	"F"	""	"United States"	""	"0"	""	""	"Guatemalan"	"Patient 1"
"00421392"	""	""	""	"1"	""	"00000"	"{PMID:Prasov 2020:32022389}"	""	"M"	""	"United States"	""	"0"	""	""	"Guatemalan"	"Patient 2"
"00421393"	""	""	""	"1"	""	"00000"	"{PMID:Prasov 2020:32022389}"	""	"M"	""	"United States"	""	"0"	""	""	"Puerto Rican/white"	"Patient 3"
"00450806"	""	""	""	"1"	""	"04405"	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	"M"	""	""	""	"0"	""	""	""	"073373"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 85
"{{individualid}}"	"{{diseaseid}}"
"00000390"	"00115"
"00059790"	"00058"
"00155447"	"01718"
"00155448"	"01718"
"00292855"	"00198"
"00309104"	"04214"
"00309105"	"04214"
"00335970"	"04214"
"00358982"	"04214"
"00363616"	"04214"
"00363658"	"04214"
"00363866"	"04214"
"00372503"	"04214"
"00373507"	"04214"
"00376860"	"04214"
"00380141"	"04214"
"00382529"	"04214"
"00383420"	"04214"
"00385052"	"04214"
"00385882"	"05650"
"00386299"	"04214"
"00389682"	"04214"
"00393755"	"04214"
"00413172"	"04214"
"00413173"	"04214"
"00413174"	"04214"
"00413175"	"04214"
"00413176"	"04214"
"00413177"	"04214"
"00413178"	"04214"
"00413179"	"04214"
"00413180"	"04214"
"00413181"	"04214"
"00413182"	"04214"
"00413183"	"04214"
"00413184"	"04214"
"00413185"	"04214"
"00413186"	"04214"
"00413187"	"04214"
"00413188"	"04214"
"00413189"	"04214"
"00413190"	"04214"
"00413199"	"04214"
"00413200"	"04214"
"00413201"	"04214"
"00413202"	"04214"
"00413203"	"04214"
"00413204"	"04214"
"00413205"	"04214"
"00413208"	"04214"
"00413210"	"04214"
"00413211"	"04214"
"00413212"	"04214"
"00413213"	"04214"
"00413214"	"04214"
"00413215"	"04214"
"00413216"	"04214"
"00413217"	"04214"
"00413218"	"04214"
"00413219"	"04214"
"00413220"	"04214"
"00413221"	"04214"
"00413222"	"04214"
"00413223"	"04214"
"00413224"	"04214"
"00413225"	"04214"
"00413226"	"04214"
"00413227"	"04214"
"00413228"	"04214"
"00413229"	"04214"
"00413231"	"04214"
"00413232"	"04214"
"00413233"	"04214"
"00413234"	"04214"
"00413235"	"04214"
"00413236"	"04214"
"00413237"	"04214"
"00413242"	"04214"
"00413243"	"04214"
"00413244"	"04214"
"00419703"	"04214"
"00421391"	"04214"
"00421392"	"04214"
"00421393"	"04214"
"00450806"	"04249"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00058, 00115, 00198, 01718, 04214, 04249, 05650
## Count = 84
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000000079"	"00115"	"00000390"	"00015"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000046282"	"00058"	"00059790"	"00039"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000127947"	"01718"	"00155447"	"01243"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Jalili syndrome"	""
"0000127948"	"01718"	"00155448"	"01243"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Jalili syndrome"	""
"0000234424"	"04214"	"00309104"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Jalili syndrome"	""
"0000234425"	"04214"	"00309105"	"00004"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Jalili syndrome"	""
"0000253885"	"04214"	"00335970"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"retinal dystrophy"	""
"0000254280"	"04214"	"00358982"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"macular dystrophy"	""
"0000258966"	"04214"	"00363616"	"00000"	"Familial"	""	"non-syndromic"	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis"	""
"0000259008"	"04214"	"00363658"	"00000"	"Isolated (sporadic)"	""	"non-syndromic"	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa, cone-rod dystrophy"	""
"0000259205"	"04214"	"00363866"	"01243"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000267818"	"04214"	"00372503"	"00000"	"Unknown"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"Leber congenital amaurosis"	""
"0000268783"	"04214"	"00373507"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"retinitis pigmentosa, macula degeneration"	""
"0000272071"	"04214"	"00376860"	"00000"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000273996"	"04214"	"00380141"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"dystrophy, cone-rod (CORD)"	""
"0000276378"	"04214"	"00382529"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Retinitis pigmentosa"	""
"0000277205"	"04214"	"00383420"	"00000"	"Familial, autosomal recessive"	""	""	"0y"	""	""	""	""	""	""	""	""	"Jalili syndrome"	""
"0000278836"	"04214"	"00385052"	"00000"	"Isolated (sporadic)"	"8y"	"nyctalopia, nystagmus, no oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: 0.1/0.1"	"5m"	""	""	""	""	""	""	""	"Leber congenital amaurosis"	"Leber congenital amaurosis"	""
"0000279685"	"05650"	"00385882"	"00006"	"Familial, autosomal recessive"	"6y"	"isolated amelogenesis imperfecta"	""	""	""	""	""	""	""	""	""	"amelogenesis imperfecta"	""
"0000280102"	"04214"	"00386299"	"00000"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"Stargardt disease"	""
"0000283223"	"04214"	"00389682"	"00000"	"Familial, autosomal recessive"	"29y"	"age at genetic diagnosis mentioned"	""	"23y"	""	""	""	""	""	""	"cone-rod dystrophy"	""	""
"0000286961"	"04214"	"00393755"	"00000"	"Isolated (sporadic)"	"8y"	""	""	""	""	""	""	""	""	""	""	"Cone-rod Dystrophy (CORD)"	""
"0000305153"	"04214"	"00413172"	"00000"	"Familial, autosomal recessive"	""	"adult: pulp chamber and root canals diminish in size with time in teeth that exhibit posteruptive loss of coronal tissue including occlusal attrition; fundus: varying degrees of macular atrophy were observed in all affected individuals; early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305154"	"04214"	"00413173"	"00000"	"Familial, autosomal recessive"	""	"ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305155"	"04214"	"00413174"	"00000"	"Familial, autosomal recessive"	""	"some teeth at the time of eruption, such as the lower-left permanent incisor illustrated in a 6-year-old, had a near-normal crown morphology and were a paler cream color compared to that of teeth present in the mouth for much longer; ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305156"	"04214"	"00413175"	"00000"	"Familial, autosomal recessive"	""	"ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305157"	"04214"	"00413176"	"00000"	"Familial, autosomal recessive"	""	"ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305158"	"04214"	"00413177"	"00000"	"Familial, autosomal recessive"	"12y"	"lower permanent incisors: mild surface pitting and enamel surface crazing; otherwise relatively normal morphology compared to that of the more recently erupted upper-left permanent canine tooth virtually devoid of enamel in 12-year-old; coronal aspects of permanent upper-central incisor teeth almost completely lost; X-ray: pulp chambers and root canals in permanent teeth are initially obvious, particularly in taurodont teeth; ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305159"	"04214"	"00413178"	"00000"	"Familial, autosomal recessive"	""	"ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305160"	"04214"	"00413179"	"00000"	"Familial, autosomal recessive"	""	"ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305161"	"04214"	"00413180"	"00000"	"Familial, autosomal recessive"	""	"ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305162"	"04214"	"00413181"	"00000"	"Familial, autosomal recessive"	"5y"	"deciduous teeth: small, microdont, yellow, and almost devoid of enamel; X-ray: diminished enamel volume involving all erupted teeth due to posteruptive loss related to enamel hypomineralization and variable hypoplasia. Permanent teeth are taurodont, especially the upper first molar teeth, characterized by bulbous crowns, large pulp chambers, and thinner roots than expected. The deciduous molar teeth, which exhibit significant occlusal attrition, have pulp chambers that are largely radio-opaque, likely to represent dentine; ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305163"	"04214"	"00413182"	"00000"	"Familial, autosomal recessive"	"6y"	"X-ray: erupted deciduous molar and permanent first molar teeth; the forming, unerupted lower permanent premolar and second molar crowns have near-normal morphology with some surface irregularities; ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305164"	"04214"	"00413183"	"00000"	"Familial, autosomal recessive"	"24y"	"by 24y virtually no enamel remains; ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305165"	"04214"	"00413184"	"00000"	"Familial, autosomal recessive"	""	"ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305166"	"04214"	"00413185"	"00000"	"Familial, autosomal recessive"	""	"ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305167"	"04214"	"00413186"	"00000"	"Familial, autosomal recessive"	""	"ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305168"	"04214"	"00413187"	"00000"	"Familial, autosomal recessive"	"6y"	"gross attrition of occlusal surfaces of the primary molar teeth by age 6 years, in the absence of gross enamel loss from nonocclusal surfaces; the labial surfaces of the erupting upper permanent central incisors irregular, with early posteruptive enamel loss; X-ray: erupted deciduous molar and permanent first molar teeth; the forming, unerupted lower permanent premolar and second molar crowns have near-normal morphology with some surface irregularities; ocular findings: early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia;  marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305169"	"04214"	"00413188"	"00000"	"Familial, autosomal recessive"	""	"fundus: varying degrees of macular atrophy were observed in all affected individuals; early and progressive loss of visual acuity with worsening central vision followed by failure of peripheral vision; marked photophobia; marked impairment of color vision apparent early in life; electroretinography: early loss of cone and rod function, with cones being more severely affected"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305170"	"04214"	"00413189"	"00000"	"Familial, autosomal recessive"	""	"cone-rod dystrophy with amelogenesis imperfecta; photophobia, pendular nystagmus; highly hypermetropic, low visual acuity - best corrected visual acuity right, left eye: 20/200, 20/100; fundus: optic disk pallor, narrow vessels, macular atrophy with pigment mottling, and peripheral deep white dot deposits mainly in the lower and nasal retina; peripheral bone spicules concomitant with a superior and temporal scotoma on static perimetry; fundus autofluorescence: markedly decreased macular autofluorescence due to atrophy as well as severe retinal pigment epithelium changes in the inferior and nasal peripheral retina with levels of increased and decreased autofluorescence; optical coherence tomography: decreased foveal and retinal thickness, attenuation of retinal lamination suggesting extensive loss of retinal cells, and hyperreflectivity in the choroid due to retinal pigment epithelium and choriocapillaris atrophy; electroretinogram: full-field - nonrecordable; scotopic conditions, b-wave amplitudes markedly reduced, slightly delayed culmination time of the b-wave; 7 year follow up - the remaining scotopic b-wave dropped by 40% of the lower limit for the age; teeth: decidual and permanent teeth affected, dysplastic and yellow and brown in color, showing no enamel layer and numerous carious lesions, mandibular cyst that contained the two lower incisors and one premolar; neurological and cognitive examination: normal"	"14y"	""	"poor vision"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305171"	"04214"	"00413190"	"00000"	"Familial, autosomal recessive"	""	"cone-rod dystrophy with amelogenesis imperfecta; photophobia, pendular nystagmus; highly hypermetropic, low visual acuity - best corrected visual acuity, both eyes: 20/320); fundus: optic disk pallor, narrow vessels, macular atrophy with pigment mottling, and peripheral deep white dot deposits mainly in the lower and nasal retina; full-field - nonrecordable; scotopic conditions, b-wave amplitudes severely reduced, slightly delayed culmination time of the b-wave; teeth: decidual and permanent teeth affected, dysplastic and yellow and brown in color, showing no enamel layer and numerous carious lesions; neurological and cognitive examination: normal"	"7y"	""	"poor vision"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305180"	"04214"	"00413199"	"00000"	"Familial, autosomal recessive"	""	"cone-rod dystrophy with amelogenesis imperfecta; 2y: major complaints: photophobia and difficulties seeing in darkness; decidual and permanent teeth were yellow and brown, showing no enamel layer, with numerous carious lesions consistent with a hypoplastic, hypomineralized AI; 2y electroretinogram: scotopic response within the normal range, photopic response severely attenuated; 12y: bilateral rapid nystagmus and low vision, full-field photoscopic electroretinogram: nonrecordable; scotopic conditions, electroretinogram responses: markedly reduced b-wave amplitudes; neurological and cognitive examination: normal"	"2m"	""	"bilateral nystagmus"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305181"	"04214"	"00413200"	"00000"	"Familial, autosomal recessive"	""	"cone-rod dystrophy with amelogenesis imperfecta; 2y: major complaints: photophobia and difficulties seeing in darkness; decidual and permanent teeth were yellow and brown, showing no enamel layer, with numerous carious consistent with a hypoplastic, hypomineralized AI; 6y: bilateral rapid nystagmus and low vision, full-field photoscopic electroretinogram: nonrecordable; scotopic conditions, electroretinogram responses: markedly reduced b-wave amplitudes; neurological and cognitive examination: normal"	"2m"	""	"bilateral nystagmus"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305182"	"04214"	"00413201"	"00000"	"Familial, autosomal recessive"	""	"cone-rod dystrophy with amelogenesis imperfecta; 2y: major complaints: photophobia and difficulties seeing in darkness; decidual and permanent teeth were yellow and brown, showing no enamel layer; neurological and cognitive examination: normal"	"2m"	""	"bilateral nystagmus"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305183"	"04214"	"00413202"	"00000"	"Isolated (sporadic)"	""	"cone-rod dystrophy with amelogenesis imperfecta; 6y, legally blind (visual acuity 10/200 both eyes); very intense photoaversion that caused difficulties in moving in daylight; in dim light, she could move easily and was able to read; seeing only saturated colors; 9y - special school for sight-disabled children; adolescence - lost her central vision; 16y: night blindness, difficulties in moving in dim light; 20y: severely handicapped; teeth: abnormal enamel from early childhood, rapidly lost her milk teeth, severe alteration of the enamel on her adult teeth; 24y, very significant erosion of all teeth with absence of enamel, resulting in a dark yellow color, hypersensitivity, and teeth cavities - all teeth were devitalized and capped with ceramic prostheses. 38y: vision limited to light perception both eyes; refraction was obtained only in left eye: 1.25 (15deg; 1.50); bilateral subcapsular posterior cataract; intraocular pressure: normal at 18 mm Hg on both eyes; fundus: a bilateral macular atrophy and typical bone spicule-shaped pigment deposits in the midperiphery of the retina, retinal vasculature highly attenuated, optic discs pale; no detectable visual field at Goldmann perimetry; electroretinogram: no response; neurological and cognitive examination: normal"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305184"	"04214"	"00413203"	"00000"	"Familial, autosomal recessive"	"10y"	"best corrected visual acuity: 6/60; near acuity: N12; 2-4 dioptres of hypermetropia; visual acuity variable with the levels of illumination, being more compromised under outdoor, bright daylight illumination, marked photophobia causing habitual orbicularis spasm; no night blindness; fine nystagmus increasing in amplitude under bright outdoor illumination; slight latent deviation for both near and distance with diplopia experienced before recovery together with a tendency to deviate on elevation; colour vision: absent; anterior segments and pupillary reactions: normal; fundi: normal with minor retinal epithelial defects at the periphery confirmed by fluorescein angiography, a few vitreous cells; peripheral fields with Goldman perimetry: full; electrophysiology: electroretinogram cone responses (flicker) totally extinguished; rod responses to low-intensity blue light: flat, with high-intensity blue and white light stimuli - extinguished; electrooculography Arden ratios: grossly reduced; visual evoked potentresponses: normal; dental findings amelogenesis imperfecta was associated with anterior open bite and small premaxilla; decay and significant degree of calculus formation; otherwise healthy with no other associated medical conditions; educationally normal and scored above average in their school marks; benefited from plain glass red-tinted filter with significant increase in comfort, improvement of photophobia, and enhanced contrast sensitivity - appreciable impact on their image perception, particularly outdoors"	"5y"	""	"visual difficulties"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305185"	"04214"	"00413204"	"00000"	"Familial, autosomal recessive"	"6y"	"best corrected visual acuity: 5/60; 2-4 dioptres of hypermetropia; visual acuity variable with the levels of illumination, being more compromised under outdoor, bright daylight illumination, marked photophobia causing habitual orbicularis spasm; no night blindness; fine nystagmus increasing in amplitude under bright outdoor illumination; colour vision: absent; anterior segments and pupillary reactions: normal; fundi: normal, a few vitreous cells; no peripheral contraction by the confrontation method; electrophysiology: electroretinogram cone responses (flicker) barely recordable, rod responses to low-intensity blue light: flat, but recordable with high-intensity blue and white light stimuli, significantly reduced; electrooculography Arden ratios: grossly reduced; visual evoked potential responses: normal; dental findings amelogenesis imperfecta was associated with anterior open bite and small premaxilla; decay; otherwise healthy with no other associated medical conditions; educationally normal and scored abe average in their school marks; benefited from plain glass red-tinted filter with significant increase in comfort, improvement of photophobia, and enhanced contrast sensitivity - appreciable impact on their image perception, particularly outdoors"	"5y"	""	"visual difficulties"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305186"	"04214"	"00413205"	"00000"	"Familial, autosomal recessive"	"5y"	"best corrected visual acuity: 2/60; near acuity: N8; 2-4 dioptres of hypermetropia; visual acuity variable with the levels of illumination, being more compromised under outdoor, bright daylight illumination, marked photophobia causing habitual orbicularis spasm; no night blindness; latent nystagmus manifested only under bright conditions; colour vision: absent; anterior segments and pupillary reactions: normal; fundi: normal, a few vitreous cells; no peripheral contraction by the confrontation method; electrophysiology: electroretinogram cone responses (flicker) grossly impaired, rod responses to low-intensity blue light: flat, but recordable with high-intensity blue and white light stimuli, significantly reduced; electrooculography Arden ratios: grossly reduced; visual evoked potential responses: normal; dental findings amelogenesis imperfecta was associated with anterior open bite and small premaxilla; decay; otherwise healthy with no other associated medical conditions; educationally normal and scored abe average in their school marks; benefited from plain glass red-tinted filter with significant increase in comfort, improvement of photophobia, and enhanced contrast sensitivity - appreciable impact on their image perception, particularly outdoors"	"3y"	""	"dental anomaly"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305189"	"04214"	"00413208"	"00000"	"Familial, autosomal recessive"	"9y"	"cafe-au-lait macule on the chest; freckling in the axillary region, a right anterior chest wall deformity due to protrusion of the costal cartilages adjacent to the sternum reduced visual acuity on both eyes; earliest childhood - nystagmus, reduced visual acuity and photophobia, night vision normal; symptoms non-progressive; 9y:best corrected visual acuity (refraction) right, left eye: 0.05 (-0,25/sph-3,25 cyl 20deg), 0.125 (-1,5 sph-1,75 cyl 125deg); kinetic perimetry: central scotoma and a slight constriction of the visual field for III4e on both eyes; color vision Lanthony Panel D-15 saturated test: severe color confusions most likely along the scotopic axis; anterior segment: Lisch nodules on both eyes and a relative afferent pupillary defect on the right eye; fundus: bilateral optic disc atrophy, more pronounced in the right eye; magnetic resonance imaging confirmed bilateral optic nerve atrophy and optic pathway gliomas (right>left eye), lesions with T2 signal intensities of the basal ganglia on T2 - tpical for NF1; retinal pigment epithelium atrophy in the macula on both eyes resembling a bull\'s eye maculopathy; full field electroretinography: almost normal scotopic responses with slightly delayed implicit times, no detectable photopic responses; multifocal electroretinography: no reproducible responses; yellowish-brownish discoloration of the teeth; retrospectively, surface of the teeth was rough and became stained soon after eruption and showed a brownish color somewhat later - the primary teeth were so soft, that one could peel off the enamel with the nails; features characteristic for amelogenesis imperf"	""	""	""	""	""	""	""	""	"Jalili Syndrome and neurofibromatosis type 1"	""	""
"0000305191"	"04214"	"00413210"	"00000"	"Familial, autosomal recessive"	""	"ophthalmic findings: photophobia, reduced vision, strabismus and jiggling eyes since very early childhood; best corrected visual acuity: 20/200 in both eyes without progression over the observed time period (4 to 8y); cycloplegic etinoscopy: high hyperopia of +8.0 Dpt to +9.0 Dpt; orthoptic evaluation: fully accommodative esotropia; ophthalmoscopy: macular changes (Bull\'s eye maculopathy) and a pale optic disc; electroretinogram 8y: reduced rod responses and nonrecordable cone responses; dental findings: all primary teeth opaque yellow-brown; radiographically, enamel could not be distinguished from dentin; at the time of eruption, the pulp chambers of the permanent molars appeared rather large, but once teeth had arrived in occlusion, the size of the pulp cavities became inconspicuous; microscopically, enamel existed in all teeth, but was significantly reduced in thickness to values between 83% and 6% of control measurements, mineral density of enamel was also significantly reduced - on the average by about0-15%; mineral deficiency was not uniform, but varied markedly between and within affected teeth and seemed to be particularly prominent in the middle parts of the enamel layer; borders between prisms were much wider and mineralized less densely than in healthy enamel; concentration of Ca in the enamel significantly reduced, although the Ca/P molar ratio was significantly elevated; Mg/P molar ratio significantly increased, largely due to an abnormally high Mg content; large parts of the enamel surface along the entire crowns of affected teeth were covered with thin, mineralized deposits with a layered structure and a degree of mineralization between those of enamel and dentin covered invariably by a thick layer of dental plaque; the proportions of peritubular and intertubular dentin as well as the course and proportion of dentinal tubules were similar, the mineral density was significantly reduced in both types of affected dentin; mineralization deficiency was less pronounced than in enamel and seemed to concern particularly the peripheral and middle parts of the dentin; Ca concentration did not differ significantly from that of control teeth, but the Ca/P molar ratio was significantly raised, and unlike in enamel, the Mg/P molar ratio was significantly reduced due to a marked reduction in the Mg content"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305192"	"04214"	"00413211"	"00000"	"Familial, autosomal recessive"	""	"ophthalmic findings: photophobia, reduced vision, strabismus and jiggling eyes since very early childhood; best corrected visual acuity: 20/200 in both eyes without progression over the observed time period (3 to 5y); cycloplegic etinoscopy: high hyperopia of +8.0 Dpt to +9.0 Dpt; orthoptic evaluation: fully accommodative esotropia; horizontal pendular-jerk nystagmus; ophthalmoscopy: macular changes (Bull\'s eye maculopathy) and a pale optic disc; dental findings: all primary teeth opaque yellow-brown, groove-shaped enamel hypoplasias; radiographically, enamel could not be distinguished from dentin; at the time of eruption, the pulp chambers of the permanent molars appeared rather large, but once teeth had arrived in occlusion, the size of the pulp cavities became inconspicuous; microscopically, enamel existed in all teeth, but was significantly reduced in thickness to values between 83% and 6% of control measurements, mineral density of enamel was also significantly reduced - on the average by about 10-15%;ineral deficiency was not uniform, but varied markedly between and within affected teeth and seemed to be particularly prominent in the middle parts of the enamel layer; borders between prisms were much wider and mineralized less densely than in healthy enamel; concentration of Ca in the enamel significantly reduced, although the Ca/P molar ratio was significantly elevated; Mg/P molar ratio significantly increased, largely due to an abnormally high Mg content; large parts of the enamel surface along the entire crowns of affected teeth were covered with thin, mineralized deposits with a layered structure and a degree of mineralization between those of enamel and dentin covered invariably by a thick layer of dental plaque; the proportions of peritubular and intertubular dentin as well as the course and proportion of dentinal tubules were similar, the mineral density was significantly reduced in both types of affected dentin; mineralization deficiency was less pronounced than in enamel and seemed to concern particularly the peripheral and middle parts of the dentin; Ca concentration did not differ significantly from that of control teeth, but the Ca/P molar ratio was significantly raised, and unlike in enamel, the Mg/P molar ratio was significantly reduced due to a marked reduction in the Mg content"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305193"	"04214"	"00413212"	"00000"	"Familial, autosomal recessive"	"15y"	"fundus: diffuse retinal dystrophy; optic atrophy; best corrected visual acuity right, left eye: 20/200, 20/400; refraction: 0.5 to + 2.0; kinetic visual fields: central scotoma and retained peripheral field sensitivity to large isopters (blue: V:4e; green: I:4e) with the exception of the left eye; electroretinogram: scotopic: reduced, delayed, photopic: nonrecordable - cone-rod dysfunction. optical coherence tomography: thinning of the outer retinal layers, in particular the outer nuclear layer and the outer photoreceptor segments; amelogenesis imperfecta"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305194"	"04214"	"00413213"	"00000"	"Familial, autosomal recessive"	"16y"	"fundus: severe bull\'s eye maculopathy; optic atrophy; best corrected visual acuity right, left eye: 20/200, 20/400; refraction: 0.5 to + 2.0; kinetic visual fields: central scotoma and retained peripheral field sensitivity to large isopters (blue: V:4e; green: I:4e); electroretinogram: scotopic: reduced, delayed, photopic: nonrecordable - cone-rod dysfunction. optical coherence tomography: thinning of the outer retinal layers, in particular the outer nuclear layer and the outer photoreceptor segments; amelogenesis im"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305195"	"04214"	"00413214"	"00000"	"Familial, autosomal recessive"	"14y"	"best corrected visual acuity: 20/200; hypermetropia of 5-6 diopters with cycloplegic refraction; no night blindness; outdoor photophobia, no indoor photophobia; infantile esotropia - underwent surgery for bilateral medial rectus recession (1y); fundus: normal; multifocal electroretinogram: scotopic, mesopic, photopic, and oscillatory potentials and 30-Hz flicker electroretinography responses: cone cells did not respond, rod cells showed an impaired response; intraocular pressure: ~10-15 mmHg; dental examination: enamel hypoplasia, amelogenesis imperfecta - yellow-brown discoloration of the teeth, a rough dentin surface, and diastema of the teeth, hypomineralized type, pulp chamber and root: normal in size; permanent dentition stage and laminate veneers with discoloration and marginal mismatch; multiple diastema as a consequence of defective enamel development; a significant degree of calculus as a result of poor oral hygiene and periodontitis; radiographic examination: various degrees of secondary decay of teeth 36, 26, 25, 15, 16, and 14 and approximal decay of teeth 46, 45, and 35"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305196"	"04214"	"00413215"	"00000"	"Familial, autosomal recessive"	"12y"	"best corrected visual acuity: 20/200; hypermetropia of 5-6 diopters with cycloplegic refraction; no night blindness; outdoor photophobia, no indoor photophobia; exotropia and nystagmus that was shown to be increasing by a cover/uncover test; fundus: normal; optical coherence tomography: clear thinning of the outer nuclear layer and the fovea, ellipsoid zone disrupted; multifocal electroretinogram: scotopic, mesopic, photopic, and oscillatory potentials and 30-Hz flicker electroretinography responses: cone cells did not respond, rod cells showed an impaired response; intraocular pressure right/left eye: 21 / 22 mmHg; corneal diameter: 12 mm; dental examination: enamel hypoplasia, amelogenesis imperfecta - yellow-brown discoloration of the teeth, a rough dentin surface, and diastema of the teeth, hypomineralized type, pulp chamber and root: normal in size; mixed dentition stage; multiple diastema; teeth 26 and 46 had previously been restored with stainless steel crowns; tooth 36 had been extracted due to decay; lesion in the apices of the lower right second premolar and first molar in a radiographic investigation, which was thought to involve idiopathic osteosclerosis; teeth 31 and 41 had undergone root canal treatment; teeth 18 and 28 were congenitally missing, 38 and 48 impacted in the mandible"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305197"	"04214"	"00413216"	"00000"	"Familial, autosomal recessive"	"8y"	"best corrected visual acuity: 20/200; hypermetropia of 5-6 diopters with cycloplegic refraction; no night blindness; outdoor photophobia, no indoor photophobia; fundus: normal; optical coherence tomography: clear thinning of the outer nuclear layer and the fovea; multifocal electroretinogram: scotopic, mesopic, photopic, and oscillatory potentials and 30-Hz flicker electroretinography responses: cone cells did not respond, rod cells showed an impaired response; intraocular pressure: ~10-15 mmHg; dental examination: enamel hypoplasia, amelogenesis imperfecta - yellow-brown discoloration of the teeth, a rough dentin surface, and diastema of the teeth, hypomineralized type, pulp chamber and root: normal in size; mixed dentition and mildly affected teeth; 11, 21, 16, 26, 31, 36, 41, and 46 at the stage of eruption, 21 and 41 - hypomineralized regions; radiographic examination: deciduous tooth germs were present in the maxilla and mandible"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305198"	"04214"	"00413217"	"00000"	"Familial, autosomal recessive"	"39y"	"best corrected visual acuity right, left eye: hand movement; refraction: sphere+1.5/cylinder - 1.5 x 180 D, sphere+2/cylinder - 1.5 x 180 D ; macula:macular coloboma, pigment clumps around it; retinal mid-periphery:pigment clumps, attenuated vesselsoptic discwaxy pallor disc; electroretinogram, scotopic rod:flat; maximal combined rod and cone electroretinogram:flat; photopic and 30 hz flicker cone electroretinogram:flat; electrooculography arden ratios:extingui"	"0m"	""	"nystagmus, photophobia, severe visual impairment"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305199"	"04214"	"00413218"	"00000"	"Familial, autosomal recessive"	"32y"	"best corrected visual acuity right, left eye: counting fingers; refraction: sphere+2.5/cylinder - 4 x 180D, sphere+2.5/cylinder - 4 x 180D ; macula:severe macular atrophy (beaten bronze); retinal mid-periphery:pigment clumps and diffuse whitish dots, attenuated vesselsoptic discmoderate optic atrophy; electroretinogram, scotopic rod:flat; maximal combined rod and cone electroretinogram:flat; photopic and 30 hz flicker cone electroretinogram:flat; electrooculography arden ratios:subno"	"0m"	""	"nystagmus, photophobia, severe visual impairment"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305200"	"04214"	"00413219"	"00000"	"Familial, autosomal recessive"	"27y"	"best corrected visual acuity right, left eye: counting fingers; refraction: sphere +1.5/cylinder - 2 x 50D, sphere+1/cylinder - 1.5 x 140D; macula:macular coloboma, pigment clumps around macular it; retinal mid-periphery:pigment clumps, attenuated vesselsoptic discwaxy pallor disc; electroretinogram, scotopic rod:flat; maximal combined rod and cone electroretinogram:flat; photopic and 30 hz flicker cone electroretinogram:flat; electrooculography arden ratios:extingui"	"0m"	""	"nystagmus, photophobia, severe visual impairment"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305201"	"04214"	"00413220"	"00000"	"Familial, autosomal recessive"	"25y"	"best corrected visual acuity right, left eye: 20/150, 20/120; refraction: SD - 0.75, SD - 0.5; macula:mild macular atrophy in both the eyes; retinal mid-periphery:pigment clumps, attenuated vesselsoptic discmild optic atrophy; electroretinogram, scotopic rod:flat; maximal combined rod and cone electroretinogram:decreased amplitudes; photopic and 30 hz flicker cone electroretinogram:decreased amplitudes; electrooculography arden ratios:subnorm"	"<5y"	""	"latent nystagmus, photophobia, moderate visual impairment"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305202"	"04214"	"00413221"	"00000"	"Familial, autosomal recessive"	"22y"	"progressive deterioration of central vision with later development of difficulties with night vision; enamel defect amelogenesis imperfecta; dental examination: dentition was thin layer in morphology with a generally yellow brown color in permanent teeth; enamel of the teeth almost absent, but the exposed dentin was not sensitive; no other pathological signs and no mental delay"	""	""	"nystagmus, photophobia and reduced visual acuity"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305203"	"04214"	"00413222"	"00000"	"Familial, autosomal recessive"	"21y"	"progressive deterioration of central vision with later development of difficulties with night vision; 20y: reduced visual acuity, ophthalmoscopy: macular changes (geographic atrophy); fundus autofluorescence: a window effect of the macular region due to the atrophy of the underlying retinal pigment epithelium; optical coherence tomography: decreased foveal and retinal thickness; electroretinogram: reduced rod responses and non-recordable cone responses; enamel defect amelogenesis imperfecta; dental examination: dentition was thin layer in morphology with a generally yellow brown color in permanent teeth; enamel of the teeth almost absent, but the exposed dentin was not sensitive; no other pathological signs and no mental delay"	""	""	"nystagmus, photophobia and reduced visual acuity"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305204"	"04214"	"00413223"	"00000"	"Familial, autosomal recessive"	"16y"	"progressive deterioration of central vision with later development of difficulties with night vision; enamel defect amelogenesis imperfecta; dental examination: dentition was thin layer in morphology with a generally yellow brown color in permanent teeth; enamel of the teeth almost absent, but the exposed dentin was not sensitive; no other pathological signs and no mental delay"	""	""	"nystagmus, photophobia and reduced visual acuity"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305205"	"04214"	"00413224"	"00000"	"Familial, autosomal recessive"	"30y"	"5-6y: presented with low visual acuity (0.05-0.1), hypermetropic astigmatism (of 2.5-3.0 cyl D), total inability to distinguish colors, and visual field constriction; fundi: pale optic discs and round, dystrophic changes in the central maculae with pigment rearrangements; visual acuity gradually decreased to counting fingers from 1.5 m - 20y, and hand movements - 25y; >20y: extensive retinochoroidal atrophy of both maculae, narrowing of the retinal vessels, secondary optic nerve atrophy, and pigment deposits in the peripheral retina; bilateral posterior subcapsular cataracts; night vision getting worse, but still better than in bright light; concentric narrowing of the visual fields (7-10deg); optical coherence tomography: flat foveae profile, photoreceptor atrophy, disturbed retinal layer structure; flash electroretinogram: totally extinguished photopic and scotopic responses, multifocal electroretinogram: no central maculae responses; ocular ultrasound: optic disc drusen and vitreous focal condensations; tooth enamel hypoplasia in early childhood; lost their permanent teeth shortly after 20y; apparent muscular overgrowth of the legs not observed in the other family members; neurological examination: patient denied muscular weakness, cramps, myalgia, gait difficulties, rigidity, sensation abnormalities, fasciculations, respiratory problems, hearing impairment, dysphagia, or tendency to fall; continued to work as a professional physiotherapist; nystagmus, mild contractures of the knees and Achilles tendons, weakened deep tendon reflexes from biceps and brachioradialis, symmetric overgrowth of the legs, particularly in the quadriceps and calves, weak patellar Achilles tendon reflexes, and impaired heel walking due to Achilles tendon contractures; the rest of the neurological examination normal; increased creatine kinase concentration in blood (1,051 U/L, normal 38-174 U/L), mild elevation of transaminases (ALT 58 IU/L, normal 10-41 U/L; AST 44 IU/L,normal10-37IU/L), lactic acid and LDH: normal; motor and sensory nerve conduction velocities: normal; evoked compound motor action potentials and sensory nerve action potentials: normal; needle electromyography of the right deltoid, tibialis anterior, and vastus lateralis muscles: increased recruitment pattern, with spontaneous activity demonstrated as pseudomyotonic discharges; motor unit action potentials duration of all the muscles shortened, while amplitudes remained normal - the electromyographic examination demonstrated myopathic involvement"	"0m"	""	"congenital nystagmus, photophobia appeared later in infancy"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305206"	"04214"	"00413225"	"00000"	"Familial, autosomal recessive"	"25y"	"5-6y: presented with low visual acuity (0.05-0.1), hypermetropic astigmatism (of 2.5-3.0 cyl D), total inability to distinguish colors, and visual field constriction; fundi: pale optic discs and round, dystrophic changes in the central maculae with pigment rearrangements; visual acuity gradually decreased to counting fingers from 1.5 m - 20y, and hand movements - 25y; >20y: extensive retinochoroidal atrophy of both maculae, narrowing of the retinal vessels, secondary optic nerve atrophy, and pigment deposits in the peripheral retina; bilateral posterior subcapsular cataracts; night vision getting worse, but still better than in bright light; concentric narrowing of the visual fields (7-10deg); optical coherence tomography: flat foveae profile, photoreceptor atrophy, disturbed retinal layer structure; flash electroretinogram: totally extinguished photopic and scotopic responses, multifocal electroretinogram: no central maculae responses; ocular ultrasound: optic disc drusen and vitreous focal condensations; tooth enamel hypoplasia in early childhood; lost their permanent teeth shortly after 20y; apparent muscular overgrowth of the legs not observed in the other family members"	"0m"	""	"congenital nystagmus, photophobia appeared later in infancy"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305207"	"04214"	"00413226"	"00000"	"Familial, autosomal recessive"	"23y"	"5-6y: presented with low visual acuity (0.05-0.1), hypermetropic astigmatism (of 2.5-3.0 cyl D), total inability to distinguish colors, and visual field constriction; fundi: pale optic discs and round, dystrophic changes in the central maculae with pigment rearrangements; visual acuity gradually decreased to counting fingers from 1.5 m - 20y, and hand movements - 25y; >20y: extensive retinochoroidal atrophy of both maculae, narrowing of the retinal vessels, secondary optic nerve atrophy, and pigment deposits in the peripheral retina; bilateral posterior subcapsular cataracts; night vision getting worse, but still better than in bright light; concentric narrowing of the visual fields (7-10deg); optical coherence tomography: flat foveae profile, photoreceptor atrophy, disturbed retinal layer structure; flash electroretinogram: totally extinguished photopic and scotopic responses, multifocal electroretinogram: no central maculae responses; ocular ultrasound: optic disc drusen and vitreous focal condensations; tooth enamel hypoplasia in early childhood; amelogenesis imperfecta (hypomineralization coexisting with hypoplasia) - teeth had a characteristic yellow-brown color, with clear enamel defects, abraded incisors were abraded; radiology: characteristic foci of hypomineralization of hard tooth structure, excessive resorption (shortening) of the incisor roots, and periodontitis; bone resorption visible at the mesial root of tooth 46 and between the roots of teeth 44 and 45; apparent muscular overgrowth of the legs not observed in the other family members"	"0m"	""	"congenital nystagmus, photophobia appeared later in infancy"	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000305208"	"04214"	"00413227"	"00000"	"Familial, autosomal recessive"	""	"best corrected visual acuity: 20/400; fundus: large area of atrophy occupying the macula in both eyes with a pigmented edge; optic nerve head pale,retinal blood vessels attenuated, area of vitreous condensation inferior to the left optic nerve head; teeth: all extracted, wears dentures"	"0m"	""	""	"mutant protein increases the rate of apoptosis"	""	""	""	""	"Jalili Syndrome"	"Leber congenital amaurosis"	""
"0000305209"	"04214"	"00413228"	"00000"	"Familial, autosomal recessive"	""	"best corrected visual acuity: 6/200; fundus: optic nerve atrophic, macular atrophy and pigment mottling as well as diffuse atrophic lesions along the vascular arcades and into the periphery; teeth: all extracted, wears dentures"	"0m"	""	""	"mutant protein increases the rate of apoptosis"	""	""	""	""	"Jalili Syndrome"	"Leber congenital amaurosis"	""
"0000305210"	"04214"	"00413229"	"00000"	"Familial, autosomal recessive"	""	"best corrected visual acuity: 2/200 fundus: optic nerve atrophic, macular atrophy and pigment mottling as well as diffuse atrophic lesions along the vascular arcades and into the periphery; teeth: all extracted, wears dentures"	"0m"	""	""	"mutant protein increases the rate of apoptosis"	""	""	""	""	"Jalili Syndrome"	"Leber congenital amaurosis"	""
"0000305212"	"04214"	"00413231"	"00000"	"Familial, autosomal recessive"	"10y"	"nystagmus; photophobia; best corrected visual acuity at presentation right; left eye: 20/200, 20/200, at follow-up visit: 20/126, 20/126; electroretinogram: findings in keeping with a cone-rod dystrophy with severe macular involvement bilaterally; repeat electroretinogram 5y later : undetectable pattern electroretinograms, rod electroretinograms, and single flash cone electroretinograms, with a deterioration in the bright flash electroretinogram; recent spectral domain optical coherence tomography:profound loss of outer retinal architecture at the central macula in both eyes; initial fundus autofluorescence imaging 9y: perifoveal ring of hyperautofluorescence in both eyes; 5y later - significant increase in the size of the rings bilaterally"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	"Leber congenital amaurosis"	""
"0000305213"	"04214"	"00413232"	"00000"	"Familial, autosomal recessive"	"2y6m"	"nystagmus; photophobia; best corrected visual acuity at presentation right; left eye: 20/98, 20/98, at follow-up visit: 20/200, 20/252; retina: normal, optic discs appeared slightly pale; electrophysiological assessment (limited by patient cooperation): no consistent retinal responses evident for either eye to mixed rod-cone stimuli; pattern reversal visual evoked potentials: not evident"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	"Leber congenital amaurosis"	""
"0000305214"	"04214"	"00413233"	"00000"	"Familial, autosomal recessive"	"4y"	"nystagmus; photophobia; best corrected visual acuity at presentation right; left eye: 20/246, 20/200, at follow-up visit: 20/200, 20/200; enamel hypoplasia - multiple dental extractions and crowns; fundus: tilted optic discs, loss of the foveal light reflex, mild vascular attenuation bilaterally; follow-up 3y later: kinetic perimetry: normal responses to the V4e and III4e isopters, constriction to the I4e, I3e, and I2e isopters bilaterally, as well as enlarged blind spots; spectral domain optical coherence tomography: severe outer retinal atrophy bilaterally; fundus autofluorescence: perivascular hyperautofluorescence in the posterior pole, distinct parafoveal ring of hyperautofluorescence surrounding a hypoautofluorescent fovea; multifocal electroretinogram: unrecordable macular cone responses in both eyes; full-field electroretinogram: demonstrated normal dark adaptation 0.01 recordings but reduction of both the b- and a-wave to the dark adaptation 6.0 response; cone-driven responses (both light adaptation 6.0 and 30 Hz flicker): severely reduced in each eye"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	"Leber congenital amaurosis"	""
"0000305215"	"04214"	"00413234"	"00000"	"Familial, autosomal recessive"	"38y"	"nystagmus; photophobia; best corrected visual acuity at presentation right; left eye: 20/200, 20/200, at follow-up visit: light perception, light perception; fundus: pale discs, severe macular atrophy, attenuated vessels, peripheral retinal pigmentary changes bilaterally; spectral domain optical coherence tomography: extremely disrupted central retinal layers with evidence of traction and foveal schisis in both eyes; fundus autofluorescence:marked hypoautofluorescence centrally; dental history was in keeping with a diagnosis of amelogenesis imperfecta; milk teeth began developing at 7m, yellowish in color at the time; permanent teeth, also with yellowish coloration, removed and replaced with artificial dentition at 26y"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	"Leber congenital amaurosis"	""
"0000305216"	"04214"	"00413235"	"00000"	"Familial, autosomal recessive"	"11y"	"nystagmus; no photophobia; best corrected visual acuity at presentation right; left eye: 20/317, 20/480, at follow-up visit: 20/1002, 20/796; Goldmann visual field: constricted to the central 20 degrees to the IV4e target; full-field electroretinogram: nondetectable rod and cone responses; fundus: bilateral macular atrophy with scalloped patchy deep retinal atrophy outside the arcades; follow-up 27y: evidence of progressive visual field loss on Goldmann perimetry (binocular central fields of 5 degrees to IV4e target); progressive macular atrophy on spectral domain optical coherence tomography, with additional peripheral retinal pigment migration in the periphery since last review"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	"Leber congenital amaurosis"	""
"0000305217"	"04214"	"00413236"	"00000"	"Familial, autosomal recessive"	"13y"	"normal gestation, birth weight of 2950 g (-0.63 SD), length of 46.0 cm (-1.69 SD), and head circumference of 34 cm (0.10 SD); 5y: visual impairment, ophthalmological evaluation: absence of recordable scotopic responses leading to diagnosis of Leber\'s congenital amaurosis; best-corrected visual acuity right, left eye: 20/640, 20/ 1600; refractive error: +5.00 sphere in both eyes; 8y: reevaluated with the complains of photophobia, pendular nystagmus and achromatopsia; fundus: retinal dystrophy with decreased macular reflex; macular pigmentation mobilization; optical coherence tomography: a significant reduction in the thickness of the neurosensory retina in the macula and the absence of the outer layer of the subfoveal photoreceptors ; electroretinogram pointed out for a complete absence of cone and rod responses; patient complained also about her teeth, and the ophthalmologist referred the patient for dental evaluation; oral examination: a mixed dentition, with generalized diastema and primary and permanent teeth with yellowish discoloration, rough surfaces and conspicuous and irregular defects, characterizing hypoplastic amelogenesis imperfecta; 13y: weight was 43000 g (−0.35 SD), height 156.0 cm (−0.19 SD), and head circumference was 53 cm (−0.31 SD); motor and cognitive development:"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	"Leber congenital amaurosis"	""
"0000305218"	"04214"	"00413237"	"00000"	"Familial, autosomal recessive"	"9y"	"birth weight of 3500 g (+0.57 SD) and length of 51.0 cm (+0.99 SD), previous diagnosis of retinal dystrophy; nystagmus, photophobia and reduced visual acuity since the first years of life; ophthalmologic examination: macular and optic atrophy, decreased retinal thickness and reduced cone responses, but normal rod responses; oral examination: generalized yellow to yellowish-brown teeth with rough surfaces and some irregular defects; 9y: weight was of 21600 g (+0.95 SD), length was 114.5 cm (+0.80 SD), and head circumference was 51.8 cm (+0.49 SD); the father (37-year-old) showed strabismus and inability to see clearly with right eye since childhood; had reduced visual acuity and refractive error of +4.00 in the right eye; color vision testing and pupillary reflexes: normal, but fundus examination showed generalized depigmentation with bilateral pale disk, optical coherence tomography: thickening of the inner nuclear layer with hyporeflective cysts near the fovea and the ellipsoid zone appeared to be preserved in both eyes; optic disc OCT: diffuse reduction of the nerve fiber layer in both eyes;  multifocal electroretinogram: no abnormalities; although partially edentulous, the teeth were of normal aspect and consistency"	""	""	"nystagmus, photophobia and reduced visual acuity"	""	""	""	""	""	"Jalili Syndrome"	"retinal dystrophy"	""
"0000305223"	"04214"	"00413242"	"00000"	"Familial, autosomal recessive"	"13y"	"photophobia, amblyopia, atrophic macular degeneration, gradual progression of the optic disc, and fine pendular nystagmus; light-adapted electroretinogram: cone dystrophy while the dark- adapted electroretinogram: severely impaired rod response; teeth: hypomaturative/hypoplastic amelogenesis imperfecta with yellow to brown discoloration; orthopantomography: coincided with the clinical pictures, showing grossly carious teeth; maxilla contained a total of 10 teeth, malformed, discolored, and periodontally involved; mandibular arch - four teeth in similar conditions; mandibular ridge - resorbed due to the loss of teeth; no pathological findings, cyst or tumor, were apparent in the mandible or max"	""	""	""	"conformational stability is considerably reduced compared to its wild type, ultimately leading to a lack of ATP-binding capability of CNN"	""	""	""	""	"Jalili Syndrome"	""	""
"0000305224"	"04214"	"00413243"	"00000"	"Familial, autosomal recessive"	"11y"	"photophobia, amblyopia, atrophic macular degeneration, gradual progression of the optic disc, and fine pendular nystagmus; light-adapted electroretinogram: cone dystrophy while the dark- adapted electroretinogram: severely impaired rod response; teeth: hypomaturative/hypoplastic amelogenesis imperfecta with yellow to brown discolora"	""	""	""	"conformational stability is considerably reduced compared to its wild type, ultimately leading to a lack of ATP-binding capability of CNN"	""	""	""	""	"Jalili Syndrome"	""	""
"0000305225"	"04214"	"00413244"	"00000"	"Familial, autosomal recessive"	"9y"	"photophobia, amblyopia, atrophic macular degeneration, gradual progression of the optic disc, and fine pendular nystagmus; light-adapted electroretinogram: cone dystrophy while the dark- adapted electroretinogram: severely impaired rod response; teeth: hypomaturative/hypoplastic amelogenesis imperfecta with yellow to brown discolora"	""	""	""	"conformational stability is considerably reduced compared to its wild type, ultimately leading to a lack of ATP-binding capability of CNN"	""	""	""	""	"Jalili Syndrome"	""	""
"0000310983"	"04214"	"00419703"	"04405"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy"	""
"0000312630"	"04214"	"00421391"	"00000"	"Familial, autosomal recessive"	"15y"	"presented with poor central vision, nystagmus, and light sensitivity; Snellen ; best corrected visual acuity right, left eye: at distance of 20/250, 20/200; auto-refraction: myopic refraction with astigmatism: -2.75 + 2.25 x 103 and -3.00 + 3.00 x 076 in the right and left eye, respectively; high frequency, low amplitude horizontal nystagmus and orthophoria; anterior segment exam: unremarkable; fundus exam: notable for bull\'s eye maculopathy and granular pigment changes in the periphery; spectral domain optical coherence tomography: loss of the ellipsoid zone in the fovea, and fundus autofluorescence: a bull\'s eye pattern of hyper- and hypo-autofluorescence; Farnsworth D15 color vision: multiple axis errors (achromatic pattern; Goldmann visual field: loss of the I1e isopter in each eye, with preservation of I4e and V4e isopters; scotopic electroretinography: diminished amplitudes (~50%) and mildly delayed implicit times, photopic bright flash and flicker electroretinogram responses: unrecordable; dental exam and dental radiographs (bitewings, anterior and posterior periapical radiographs, and panoramic radiograph): an entirely restored dentition with crowns on all molar teeth and composite restorations on the anterior teeth; pulp chambers: slightly enlarged on some teeth (20, 23, 26, 29), others exhibit appearance within normal limits for this age, enamel is thin or absent on the non-restored surfaces of the teeth; periapical and bitewing radiographs reveal isolated residual enamel on nonrestored and under restored surfaces,"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000312631"	"04214"	"00421392"	"00000"	"Familial, autosomal recessive"	"16y"	"poor central vision and light sensitivity; best corrected visual acuity right, left eye: at distance 20/200, 20/160; refraction right, left eye: +1.00 + 4.50x109, - 0.25 + 4.25x069; mild end-gaze nystagmus and orthophoria; anterior segment exam: unremarkable; fundus exam: bull\'s eye maculopathy, perivascular, segmental pigment deposition in the inferior retina, and mild vascular attenuation; optical coherence tomography: loss of the ellipsoid zone in the fovea, fundus autofluorescence imaging: hypofluorescent sector corresponding to the areas of retinal atrophy and pigment deposition; color vision testing by Farnsworth D15: multiple axis errors; Goldmann visual fields: superior constriction, and loss of the I1e isopter centrally, consistent with the retinal changes inferiorly; scotopic electroretinogram: mildly diminished amp delayed implicit times, photopic bright flash and flicker electroretinogram: extinguished; dental examination: crowns on multiple teeth and the absence of enamel; no systemic abnormalities"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000312632"	"04214"	"00421393"	"00000"	"Familial, autosomal recessive"	"3y"	"light sensitivity and multiple congenital anomalies; best corrected visual acuity: 2.4cy/cm by Teller acuity cards (approximately 20/360 Snellen equivalent); cycloplegic refraction: myopia with astigmatism in both eyes: -3.25 + 2.25 x 090 and - 3.25 + 2.50 x 095; anterior segment exam: unremarkable; fundus exam: diffuse granular pigment changes and bull\'s eye maculopathy, with typical corresponding bull\'s eye pattern on fundus autofluorescence; optical coherence tomography: loss of the ellipsoid zone at the fovea; dental exam: crowns on multiple molar teeth and yellow/opaque appearance of the anterior teeth with thinning and complete absence of enamel on some teeth; systemic evaluation notable for spastic paraplegia, developmental delay, and fatty liver; the patient dependent on tracheostomy for respiration and gastrostomy tube for feeding"	""	""	""	""	""	""	""	""	"Jalili Syndrome"	""	""
"0000339861"	"04249"	"00450806"	"04405"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"cone-rod dystrophy (AR)"	""


## Screenings ## Do not remove or alter this header ##
## Count = 85
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000000414"	"00000390"	"1"	"00015"	"00015"	"2013-03-11 14:20:59"	"00015"	"2013-03-14 14:51:12"	"PCR;SEQ"	"DNA"	""	""
"0000059777"	"00059790"	"1"	"00039"	"00039"	"2012-09-19 09:30:14"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000156312"	"00155447"	"1"	"01243"	"01243"	"2018-03-18 14:37:15"	""	""	"SEQ"	"DNA"	""	""
"0000156313"	"00155448"	"1"	"01243"	"01243"	"2018-03-18 14:37:15"	""	""	"SEQ"	"DNA"	""	""
"0000294023"	"00292855"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000310249"	"00309104"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000310250"	"00309105"	"1"	"00004"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000337200"	"00335970"	"1"	"00000"	"00006"	"2021-03-10 17:05:56"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000360219"	"00358982"	"1"	"00000"	"00006"	"2021-03-18 12:15:00"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000364844"	"00363616"	"1"	"00000"	"00006"	"2021-04-29 16:11:05"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000364886"	"00363658"	"1"	"00000"	"00006"	"2021-04-29 16:11:05"	""	""	"SEQ-NG"	"DNA"	""	"gene panel"
"0000365094"	"00363866"	"1"	"01243"	"00006"	"2020-08-28 13:59:40"	""	""	"SEQ"	"DNA"	""	""
"0000373736"	"00372503"	"1"	"00000"	"00006"	"2021-05-08 09:43:10"	""	""	"SEQ-NG"	"DNA"	""	"163-gene panel"
"0000374742"	"00373507"	"1"	"00000"	"00006"	"2021-05-14 19:24:06"	""	""	"SEQ-NG"	"DNA"	""	"316-gene panel"
"0000378065"	"00376860"	"1"	"00000"	"00006"	"2021-06-25 17:40:07"	""	""	"SEQ"	"DNA"	""	"WES"
"0000381343"	"00380141"	"1"	"00000"	"03840"	"2021-08-10 09:47:12"	""	""	"SEQ-NG"	"DNA"	""	"322 eye disease gene panel (negative), WES"
"0000383743"	"00382529"	"1"	"00000"	"03840"	"2021-09-09 12:39:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"125 genes associated with inherited retinal disorders, see paper supplemental data"
"0000384645"	"00383420"	"1"	"00000"	"03840"	"2021-09-29 09:58:40"	""	""	"?"	"DNA"	""	"retrospective study"
"0000386281"	"00385052"	"1"	"00000"	"03840"	"2021-10-06 17:52:46"	""	""	"SEQ-NG"	"DNA"	""	"targeted next-generation sequencing"
"0000387110"	"00385882"	"1"	"00006"	"00006"	"2021-10-18 13:33:16"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"disease gene panel"
"0000387528"	"00386299"	"1"	"00000"	"03840"	"2021-10-20 11:58:39"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000390925"	"00389682"	"1"	"00000"	"03840"	"2021-11-08 10:11:04"	""	""	"SEQ-NG"	"DNA"	"blood"	"RET3 targeted sequencing panel - see paper"
"0000395003"	"00393755"	"1"	"00000"	"00008"	"2021-11-30 07:46:38"	""	""	"SEQ-NG"	"DNA"	""	"hereditary eye disease enrichment panel (HEDEP)"
"0000414442"	"00413172"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414443"	"00413173"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414444"	"00413174"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414445"	"00413175"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414446"	"00413176"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414447"	"00413177"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414448"	"00413178"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414449"	"00413179"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414450"	"00413180"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414451"	"00413181"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414452"	"00413182"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414453"	"00413183"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414454"	"00413184"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414455"	"00413185"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414456"	"00413186"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414457"	"00413187"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414458"	"00413188"	"1"	"00000"	"03840"	"2022-07-11 18:32:10"	""	""	"SEQ"	"DNA"	""	""
"0000414459"	"00413189"	"1"	"00000"	"03840"	"2022-07-11 19:52:20"	""	""	"arraySNP;SEQ"	"DNA"	""	""
"0000414460"	"00413190"	"1"	"00000"	"03840"	"2022-07-11 19:52:20"	""	""	"arraySNP;SEQ"	"DNA"	""	""
"0000414469"	"00413199"	"1"	"00000"	"03840"	"2022-07-11 19:57:32"	""	""	"arraySNP;SEQ"	"DNA"	""	""
"0000414470"	"00413200"	"1"	"00000"	"03840"	"2022-07-11 19:57:32"	""	""	"arraySNP;SEQ"	"DNA"	""	""
"0000414471"	"00413201"	"1"	"00000"	"03840"	"2022-07-11 19:57:32"	""	""	"arraySNP;SEQ"	"DNA"	""	""
"0000414472"	"00413202"	"1"	"00000"	"03840"	"2022-07-11 19:57:32"	""	""	"arraySNP;SEQ"	"DNA"	""	""
"0000414473"	"00413203"	"1"	"00000"	"03840"	"2022-07-12 09:44:27"	""	""	"?"	"DNA"	""	"clinical description retrospective study"
"0000414474"	"00413204"	"1"	"00000"	"03840"	"2022-07-12 09:44:27"	""	""	"?"	"DNA"	""	"clinical description retrospective study"
"0000414475"	"00413205"	"1"	"00000"	"03840"	"2022-07-12 09:44:27"	""	""	"?"	"DNA"	""	"clinical description retrospective study"
"0000414479"	"00413208"	"1"	"00000"	"03840"	"2022-07-12 11:03:45"	""	""	"SEQ"	"DNA"	""	""
"0000414481"	"00413210"	"1"	"00000"	"03840"	"2022-07-12 11:24:57"	""	""	"SEQ"	"DNA"	""	""
"0000414482"	"00413211"	"1"	"00000"	"03840"	"2022-07-12 11:24:57"	""	""	"SEQ"	"DNA"	""	""
"0000414483"	"00413212"	"1"	"00000"	"03840"	"2022-07-12 12:16:50"	""	""	"SEQ"	"DNA"	""	""
"0000414484"	"00413213"	"1"	"00000"	"03840"	"2022-07-12 12:16:50"	""	""	"SEQ"	"DNA"	""	""
"0000414485"	"00413214"	"1"	"00000"	"03840"	"2022-07-12 13:17:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000414486"	"00413215"	"1"	"00000"	"03840"	"2022-07-12 13:17:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000414487"	"00413216"	"1"	"00000"	"03840"	"2022-07-12 13:17:42"	""	""	"SEQ"	"DNA"	"blood"	""
"0000414488"	"00413217"	"1"	"00000"	"03840"	"2022-07-12 13:44:29"	""	""	"SEQ"	"DNA"	"blood"	""
"0000414489"	"00413218"	"1"	"00000"	"03840"	"2022-07-12 13:44:29"	""	""	"SEQ"	"DNA"	"blood"	""
"0000414490"	"00413219"	"1"	"00000"	"03840"	"2022-07-12 13:44:29"	""	""	"SEQ"	"DNA"	"blood"	""
"0000414491"	"00413220"	"1"	"00000"	"03840"	"2022-07-12 13:44:29"	""	""	"SEQ"	"DNA"	"blood"	""
"0000414492"	"00413221"	"1"	"00000"	"03840"	"2022-07-12 14:25:39"	""	""	"SEQ"	"DNA"	"blood"	""
"0000414493"	"00413222"	"1"	"00000"	"03840"	"2022-07-12 14:25:39"	""	""	"SEQ"	"DNA"	"blood"	""
"0000414494"	"00413223"	"1"	"00000"	"03840"	"2022-07-12 14:25:39"	""	""	"SEQ"	"DNA"	"blood"	""
"0000414495"	"00413224"	"1"	"00000"	"03840"	"2022-07-12 15:08:53"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	"exome sequencing"
"0000414496"	"00413225"	"1"	"00000"	"03840"	"2022-07-12 15:08:53"	""	""	"SEQ"	"DNA"	"blood"	"exome sequencing"
"0000414497"	"00413226"	"1"	"00000"	"03840"	"2022-07-12 15:08:53"	""	""	"SEQ"	"DNA"	"blood"	"exome sequencing"
"0000414498"	"00413227"	"1"	"00000"	"03840"	"2022-07-12 15:32:20"	""	""	"STR;SEQ"	"DNA"	"blood"	""
"0000414499"	"00413228"	"1"	"00000"	"03840"	"2022-07-12 15:32:20"	""	""	"STR;SEQ"	"DNA"	"blood"	""
"0000414500"	"00413229"	"1"	"00000"	"03840"	"2022-07-12 15:32:20"	""	""	"STR;SEQ"	"DNA"	"blood"	""
"0000414503"	"00413231"	"1"	"00000"	"03840"	"2022-07-12 17:17:28"	""	""	"?"	"DNA"	""	"retrospective multicenter observational study"
"0000414504"	"00413232"	"1"	"00000"	"03840"	"2022-07-12 17:17:28"	""	""	"?"	"DNA"	""	"retrospective multicenter observational study"
"0000414505"	"00413233"	"1"	"00000"	"03840"	"2022-07-12 17:17:28"	""	""	"?"	"DNA"	""	"retrospective multicenter observational study"
"0000414506"	"00413234"	"1"	"00000"	"03840"	"2022-07-12 17:17:28"	""	""	"?"	"DNA"	""	"retrospective multicenter observational study"
"0000414507"	"00413235"	"1"	"00000"	"03840"	"2022-07-12 17:17:28"	""	""	"?"	"DNA"	""	"retrospective multicenter observational study"
"0000414508"	"00413236"	"1"	"00000"	"03840"	"2022-07-12 19:02:10"	""	""	"SEQ"	"DNA"	"buccal mucosa cells"	""
"0000414509"	"00413237"	"1"	"00000"	"03840"	"2022-07-12 19:02:10"	""	""	"SEQ"	"DNA"	"buccal mucosa cells"	""
"0000414514"	"00413242"	"1"	"00000"	"03840"	"2022-07-13 10:15:02"	""	""	"SEQ"	"DNA"	"blood"	""
"0000414515"	"00413243"	"1"	"00000"	"03840"	"2022-07-13 10:15:02"	""	""	"SEQ"	"DNA"	"blood"	""
"0000414516"	"00413244"	"1"	"00000"	"03840"	"2022-07-13 10:15:02"	""	""	"SEQ"	"DNA"	"blood"	""
"0000421008"	"00419703"	"1"	"04405"	"00006"	"2022-10-21 12:50:15"	""	""	"MIPsm"	"DNA"	""	"smMIPs 105 iMD/AMD genes"
"0000422702"	"00421391"	"1"	"00000"	"03840"	"2022-11-04 13:33:06"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"581 gene panel from Molecular Vision Lab (MVL Panel v1)"
"0000422703"	"00421392"	"1"	"00000"	"03840"	"2022-11-04 13:33:06"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"Molecular Vision Lab NGS Retinal Dystrophy SmartPanel v11 (281 genes)"
"0000422704"	"00421393"	"1"	"00000"	"03840"	"2022-11-04 13:33:06"	""	""	"SEQ-NG;SEQ"	"DNA"	""	"clinical whole exome sequencing"
"0000452404"	"00450806"	"1"	"04405"	"00006"	"2024-03-27 11:47:00"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"smMIP-based 105 iMD/AMD genes"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 79
"{{screeningid}}"	"{{geneid}}"
"0000000414"	"CTC1"
"0000059777"	"CNNM4"
"0000156312"	"CNNM4"
"0000156313"	"CNNM4"
"0000310249"	"CNNM4"
"0000310250"	"CNNM4"
"0000337200"	"CNNM4"
"0000364844"	"CNNM4"
"0000364886"	"CNNM4"
"0000365094"	"CNNM4"
"0000373736"	"CNNM4"
"0000374742"	"CNNM4"
"0000383743"	"CNNM4"
"0000384645"	"CNNM4"
"0000386281"	"CNNM4"
"0000387110"	"CNNM4"
"0000387528"	"CNNM4"
"0000390925"	"CNNM4"
"0000395003"	"CNNM4"
"0000414442"	"CNNM4"
"0000414443"	"CNNM4"
"0000414444"	"CNNM4"
"0000414445"	"CNNM4"
"0000414446"	"CNNM4"
"0000414447"	"CNNM4"
"0000414448"	"CNNM4"
"0000414449"	"CNNM4"
"0000414450"	"CNNM4"
"0000414451"	"CNNM4"
"0000414452"	"CNNM4"
"0000414453"	"CNNM4"
"0000414454"	"CNNM4"
"0000414455"	"CNNM4"
"0000414456"	"CNNM4"
"0000414457"	"CNNM4"
"0000414458"	"CNNM4"
"0000414459"	"CNNM4"
"0000414460"	"CNNM4"
"0000414469"	"CNNM4"
"0000414470"	"CNNM4"
"0000414471"	"CNNM4"
"0000414472"	"CNNM4"
"0000414473"	"CNNM4"
"0000414474"	"CNNM4"
"0000414475"	"CNNM4"
"0000414479"	"CNNM4"
"0000414481"	"CNNM4"
"0000414482"	"CNNM4"
"0000414483"	"CNNM4"
"0000414484"	"CNNM4"
"0000414485"	"CNNM4"
"0000414486"	"CNNM4"
"0000414487"	"CNNM4"
"0000414488"	"CNNM4"
"0000414489"	"CNNM4"
"0000414490"	"CNNM4"
"0000414491"	"CNNM4"
"0000414492"	"CNNM4"
"0000414493"	"CNNM4"
"0000414494"	"CNNM4"
"0000414495"	"CNNM4"
"0000414496"	"CNNM4"
"0000414497"	"CNNM4"
"0000414498"	"CNNM4"
"0000414499"	"CNNM4"
"0000414500"	"CNNM4"
"0000414503"	"CNNM4"
"0000414504"	"CNNM4"
"0000414505"	"CNNM4"
"0000414506"	"CNNM4"
"0000414507"	"CNNM4"
"0000414508"	"CNNM4"
"0000414509"	"CNNM4"
"0000414514"	"CNNM4"
"0000414515"	"CNNM4"
"0000414516"	"CNNM4"
"0000422702"	"CNNM4"
"0000422703"	"CNNM4"
"0000422704"	"CNNM4"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 133
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000090893"	"3"	"90"	"2"	"97462830"	"97462830"	"subst"	"4.06167E-6"	"00039"	"CNNM4_000001"	"g.97462830C>T"	""	"{PMID:Abu-Safieh-2013:23105016}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.96797093C>T"	""	"pathogenic"	""
"0000256546"	"0"	"50"	"2"	"97427508"	"97427508"	"subst"	"4.07721E-6"	"01943"	"CNNM4_000003"	"g.97427508A>C"	""	""	""	"CNNM4(NM_020184.3):c.772A>C (p.T258P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96761771A>C"	""	"VUS"	""
"0000264716"	"0"	"10"	"2"	"97462846"	"97462846"	"subst"	"0.000544277"	"02330"	"CNNM4_000007"	"g.97462846C>T"	""	""	""	"CNNM4(NM_020184.3):c.1500C>T (p.I500=), CNNM4(NM_020184.4):c.1500C>T (p.I500=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96797109C>T"	""	"benign"	""
"0000264717"	"0"	"10"	"2"	"97463234"	"97463234"	"subst"	"0.000942126"	"02330"	"CNNM4_000008"	"g.97463234G>A"	""	""	""	"CNNM4(NM_020184.4):c.1547-16G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96797497G>A"	""	"benign"	""
"0000264718"	"0"	"10"	"2"	"97464972"	"97464972"	"subst"	"0.000739459"	"02330"	"CNNM4_000009"	"g.97464972G>A"	""	""	""	"CNNM4(NM_020184.3):c.1851+9G>A, CNNM4(NM_020184.4):c.1851+9G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96799235G>A"	""	"benign"	""
"0000264719"	"0"	"10"	"2"	"97474484"	"97474484"	"subst"	"0.000334334"	"02330"	"CNNM4_000011"	"g.97474484G>A"	""	""	""	"CNNM4(NM_020184.4):c.2130+5G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96808747G>A"	""	"benign"	""
"0000264720"	"0"	"10"	"2"	"97475080"	"97475080"	"subst"	"0.000122958"	"02330"	"CNNM4_000012"	"g.97475080C>T"	""	""	""	"CNNM4(NM_020184.4):c.2154C>T (p.N718=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96809343C>T"	""	"benign"	""
"0000264721"	"0"	"10"	"2"	"97475128"	"97475128"	"subst"	"0.00011813"	"02330"	"CNNM4_000013"	"g.97475128C>T"	""	""	""	"CNNM4(NM_020184.4):c.2202C>T (p.D734=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96809391C>T"	""	"benign"	""
"0000264722"	"0"	"10"	"2"	"97427675"	"97427675"	"subst"	"1.62487E-5"	"02330"	"CNNM4_000005"	"g.97427675C>A"	""	""	""	"CNNM4(NM_020184.4):c.939C>A (p.T313=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96761938C>A"	""	"benign"	""
"0000273693"	"0"	"30"	"2"	"97462777"	"97462777"	"subst"	"2.84393E-5"	"01943"	"CNNM4_000006"	"g.97462777G>A"	""	""	""	"CNNM4(NM_020184.3):c.1431G>A (p.K477=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96797040G>A"	""	"likely benign"	""
"0000273694"	"0"	"30"	"2"	"97464972"	"97464972"	"subst"	"0.000739459"	"01943"	"CNNM4_000009"	"g.97464972G>A"	""	""	""	"CNNM4(NM_020184.3):c.1851+9G>A, CNNM4(NM_020184.4):c.1851+9G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96799235G>A"	""	"likely benign"	""
"0000273695"	"0"	"30"	"2"	"97465384"	"97465384"	"subst"	"0.0166074"	"01943"	"CNNM4_000010"	"g.97465384C>T"	""	""	""	"CNNM4(NM_020184.3):c.1947C>T (p.S649=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96799647C>T"	""	"likely benign"	""
"0000273696"	"0"	"30"	"2"	"97426805"	"97426805"	"subst"	"0"	"01943"	"CNNM4_000002"	"g.97426805G>A"	""	""	""	"CNNM4(NM_020184.3):c.69G>A (p.A23=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96761068G>A"	""	"likely benign"	""
"0000273697"	"0"	"30"	"2"	"97427667"	"97427667"	"subst"	"0"	"01943"	"CNNM4_000004"	"g.97427667C>T"	""	""	""	"CNNM4(NM_020184.3):c.931C>T (p.L311=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96761930C>T"	""	"likely benign"	""
"0000327170"	"0"	"30"	"2"	"97482487"	"97482487"	"subst"	"0"	"01804"	"CNNM3_000001"	"g.97482487C>T"	""	""	""	"CNNM3(NM_017623.4):c.473C>T (p.(Ala158Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96816750C>T"	""	"likely benign"	""
"0000344946"	"0"	"70"	"2"	"97475075"	"97475075"	"subst"	"8.1986E-6"	"02327"	"CNNM4_000014"	"g.97475075C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.96809338C>T"	""	"likely pathogenic"	""
"0000358234"	"3"	"70"	"2"	"97427443"	"97427443"	"subst"	"0"	"01243"	"CNNM4_000015"	"g.97427443G>A"	""	"Sharon, submitted"	""	""	""	"Germline"	""	""	"0"	""	""	"g.96761706G>A"	""	"likely pathogenic"	""
"0000358235"	"3"	"70"	"2"	"97462840"	"97462840"	"subst"	"0"	"01243"	"CNNM4_000016"	"g.97462840C>A"	""	"{PMID:Beryozkin 2015:26306921}, {PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.96797103C>A"	""	"likely pathogenic (recessive)"	""
"0000517178"	"0"	"50"	"2"	"97426765"	"97426791"	"del"	"0"	"01943"	"CNNM4_000017"	"g.97426765_97426791del"	""	""	""	"CNNM4(NM_020184.3):c.29_55delCGGTCGGCGGACCGGCCCGCGGGCGCC (p.P10_R18del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96761028_96761054del"	""	"VUS"	""
"0000517179"	"0"	"50"	"2"	"97426842"	"97426842"	"subst"	"0.000209005"	"02330"	"CNNM4_000018"	"g.97426842C>T"	""	""	""	"CNNM4(NM_020184.4):c.106C>T (p.R36W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96761105C>T"	""	"VUS"	""
"0000517180"	"0"	"70"	"2"	"97426977"	"97426977"	"dup"	"0"	"02330"	"CNNM4_000019"	"g.97426977dup"	""	""	""	"CNNM4(NM_020184.4):c.241dupT (p.Y81Lfs*153)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96761240dup"	""	"likely pathogenic"	""
"0000517181"	"0"	"30"	"2"	"97427135"	"97427135"	"subst"	"0.00455256"	"01943"	"CNNM4_000020"	"g.97427135G>A"	""	""	""	"CNNM4(NM_020184.3):c.399G>A (p.V133=), CNNM4(NM_020184.4):c.399G>A (p.V133=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96761398G>A"	""	"likely benign"	""
"0000517182"	"0"	"50"	"2"	"97427143"	"97427143"	"subst"	"0"	"01943"	"CNNM4_000021"	"g.97427143C>A"	""	""	""	"CNNM4(NM_020184.3):c.407C>A (p.T136N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96761406C>A"	""	"VUS"	""
"0000517183"	"0"	"30"	"2"	"97427147"	"97427147"	"subst"	"1.62684E-5"	"01943"	"CNNM4_000022"	"g.97427147G>A"	""	""	""	"CNNM4(NM_020184.3):c.411G>A (p.K137=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96761410G>A"	""	"likely benign"	""
"0000517184"	"0"	"30"	"2"	"97427529"	"97427529"	"subst"	"0"	"01943"	"CNNM4_000023"	"g.97427529A>C"	""	""	""	"CNNM4(NM_020184.3):c.793A>C (p.I265L, p.(Ile265Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96761792A>C"	""	"likely benign"	""
"0000517185"	"0"	"30"	"2"	"97427529"	"97427529"	"subst"	"0"	"01804"	"CNNM4_000023"	"g.97427529A>C"	""	""	""	"CNNM4(NM_020184.3):c.793A>C (p.I265L, p.(Ile265Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96761792A>C"	""	"likely benign"	""
"0000517186"	"0"	"30"	"2"	"97427531"	"97427531"	"subst"	"2.44071E-5"	"01943"	"CNNM4_000024"	"g.97427531C>T"	""	""	""	"CNNM4(NM_020184.3):c.795C>T (p.I265=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96761794C>T"	""	"likely benign"	""
"0000517187"	"0"	"50"	"2"	"97428073"	"97428073"	"subst"	"0"	"01943"	"CNNM4_000025"	"g.97428073A>G"	""	""	""	"CNNM4(NM_020184.3):c.1337A>G (p.N446S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96762336A>G"	""	"VUS"	""
"0000517188"	"0"	"30"	"2"	"97462846"	"97462846"	"subst"	"0.000544277"	"01943"	"CNNM4_000007"	"g.97462846C>T"	""	""	""	"CNNM4(NM_020184.3):c.1500C>T (p.I500=), CNNM4(NM_020184.4):c.1500C>T (p.I500=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96797109C>T"	""	"likely benign"	""
"0000517189"	"0"	"30"	"2"	"97474415"	"97474415"	"subst"	"0"	"01943"	"CNNM4_000026"	"g.97474415C>T"	""	""	""	"CNNM4(NM_020184.3):c.2066C>T (p.S689F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96808678C>T"	""	"likely benign"	""
"0000608162"	"0"	"30"	"2"	"97462840"	"97462840"	"subst"	"2.84303E-5"	"01943"	"CNNM4_000028"	"g.97462840C>T"	""	""	""	"CNNM4(NM_020184.3):c.1494C>T (p.D498=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96797103C>T"	""	"likely benign"	""
"0000621133"	"0"	"30"	"2"	"97427004"	"97427004"	"subst"	"0"	"02330"	"CNNM4_000027"	"g.97427004C>T"	""	""	""	"CNNM4(NM_020184.4):c.268C>T (p.L90=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96761267C>T"	""	"likely benign"	""
"0000650712"	"1"	"50"	"2"	"97465384"	"97465384"	"subst"	"0.0166074"	"03575"	"CNNM4_000010"	"g.97465384C>T"	"62/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 62 heterozygous, no homozygous; {DB:CLININrs41286594}"	"Germline"	""	"rs41286594"	"0"	""	""	"g.96799647C>T"	""	"VUS"	""
"0000654743"	"0"	"50"	"2"	"97464862"	"97464862"	"subst"	"4.06207E-6"	"01943"	"CNNM4_000029"	"g.97464862G>A"	""	""	""	"CNNM4(NM_020184.3):c.1750G>A (p.V584I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.96799125G>A"	""	"VUS"	""
"0000685160"	"0"	"70"	"2"	"97427443"	"97427443"	"subst"	"0"	"00004"	"CNNM4_000015"	"g.97427443G>A"	"1/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000685161"	"0"	"90"	"2"	"97462840"	"97462840"	"subst"	"0"	"00004"	"CNNM4_000016"	"g.97462840C>A"	"3/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000719094"	"0"	"50"	"2"	"97465379"	"97465379"	"subst"	"4.01011E-5"	"01943"	"CNNM4_000030"	"g.97465379C>A"	""	""	""	"CNNM4(NM_020184.3):c.1942C>A (p.P648T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000736830"	"0"	"50"	"2"	"97475129"	"97475137"	"del"	"0"	"00000"	"CNNM4_000031"	"g.97475129_97475137del"	"1/486 individuals"	"{PMID:Sergouniotis 2016:27628848}"	""	""	"no genotypes reported"	"Germline"	""	"rs550956407"	"0"	""	""	"g.96809392_96809400del"	""	"VUS"	""
"0000760103"	"0"	"50"	"2"	"97427709"	"97427709"	"subst"	"0"	"00000"	"CNNM4_000032"	"g.97427709G>A"	""	"{PMID:Tiwari 2016:27353947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.96761972G>A"	""	"VUS"	""
"0000765786"	"0"	"70"	"2"	"97427470"	"97427470"	"subst"	"0"	"00000"	"CNNM4_000033"	"g.97427470C>T"	""	"{PMID:Patel 2016:26355662}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.96761733C>T"	""	"likely pathogenic"	""
"0000765828"	"0"	"70"	"2"	"97462830"	"97462830"	"subst"	"4.06167E-6"	"00000"	"CNNM4_000001"	"g.97462830C>T"	""	"{PMID:Patel 2016:26355662}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.96797093C>T"	""	"likely pathogenic"	""
"0000766048"	"0"	"90"	"2"	"97462840"	"97462840"	"subst"	"0"	"01243"	"CNNM4_000016"	"g.97462840C>A"	"3/2420 IRD families"	"{PMID:Sharon 2019:31456290}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000783885"	"3"	"70"	"2"	"97427633"	"97427633"	"dup"	"0"	"00000"	"CNNM4_000034"	"g.97427633dup"	""	"{PMID:Wang 2015:26047050}"	""	"896_897insT"	""	"Germline"	""	""	"0"	""	""	"g.96761896dup"	""	"likely pathogenic"	""
"0000785567"	"3"	"50"	"2"	"97427207"	"97427220"	"del"	"0"	"00000"	"CNNM4_000035"	"g.97427207_97427220del"	""	"{PMID:Liu 2015:25611614}"	""	"c.469_482del"	"variant found in controls"	"Germline"	"no"	""	"0"	""	""	"g.96761470_96761483del"	""	"VUS"	""
"0000790734"	"3"	"70"	"2"	"97426925"	"97426925"	"del"	"0"	"00000"	"CNNM4_000036"	"g.97426925del"	""	"{PMID:Coppieters 2014:24625443}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.96761188del"	""	"likely pathogenic"	""
"0000794744"	"3"	"70"	"2"	"97427245"	"97427245"	"subst"	"0"	"00000"	"CNNM4_000037"	"g.97427245T>C"	""	"{PMID:Patel 2018:30054919}"	""	"NM_020184.3:c.509T>C;p.(Leu170Pro)"	""	"Germline"	"yes"	""	"0"	""	""	"g.96761508T>C"	""	"likely pathogenic (recessive)"	"ACMG"
"0000797987"	"3"	"50"	"2"	"97474484"	"97474484"	"subst"	"0.000334334"	"00000"	"CNNM4_000011"	"g.97474484G>A"	""	"{PMID:Jespersgaar 2019:30718709}"	""	"CNNM4 c.2130+5G>A, p.(?), c.2130+5G>A, p.(?)"	"homozygous"	"Germline"	"?"	""	"0"	""	""	"g.96808747G>A"	""	"VUS"	"ACMG"
"0000800860"	"0"	"50"	"2"	"97427170"	"97427170"	"subst"	"0.000532728"	"01943"	"CNNM4_000038"	"g.97427170T>C"	""	""	""	"CNNM4(NM_020184.3):c.434T>C (p.M145T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000800861"	"0"	"30"	"2"	"97427517"	"97427517"	"subst"	"1.6289E-5"	"01943"	"CNNM4_000039"	"g.97427517C>T"	""	""	""	"CNNM4(NM_020184.3):c.781C>T (p.L261=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000800862"	"0"	"50"	"2"	"97465293"	"97465293"	"subst"	"3.24347E-5"	"01943"	"CNNM4_000040"	"g.97465293A>C"	""	""	""	"CNNM4(NM_020184.3):c.1856A>C (p.K619T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000811405"	"3"	"70"	"2"	"97427245"	"97427245"	"subst"	"0"	"00000"	"CNNM4_000037"	"g.97427245T>C"	""	"{PMID:Khan 2019:31725702}"	""	"Allele 1 c.509T>C  p.(Leu170Pro), Allele 2 c.509T>C  p.(Leu170Pro)"	"homozygous"	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.96761508T>C"	""	"likely pathogenic"	""
"0000813688"	"1"	"90"	"2"	"97464925"	"97464925"	"subst"	"1.21819E-5"	"00000"	"CNNM4_000041"	"g.97464925C>T"	""	"{PMID:Xu 2020:31630094}"	""	"CNNM4 NM_020184: g.38287C>T, c.1813C>T, p.R605X"	""	"Germline"	"yes"	""	"0"	""	""	"g.96799188C>T"	""	"pathogenic"	"ACMG"
"0000813767"	"2"	"90"	"2"	"97474320"	"97474324"	"dup"	"0"	"00000"	"CNNM4_000042"	"g.97474320_97474324dup"	""	"{PMID:Xu 2020:31630094}"	""	"CNNM4 NM_020184: g.47673_47674insCACCC, c.1962_1963insCACCC, p.P656Hfs80"	""	"Germline"	"yes"	""	"0"	""	""	"g.96808583_96808587dup"	""	"pathogenic"	"ACMG"
"0000814971"	"3"	"90"	"2"	"97462841"	"97462841"	"subst"	"8.12308E-6"	"00006"	"CNNM4_000044"	"g.97462841G>A"	""	"{PMID:Prasad 2016:26502894}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.96797104G>A"	""	"pathogenic (recessive)"	""
"0000815412"	"0"	"50"	"2"	"97474388"	"97474388"	"subst"	"0"	"00000"	"CNNM4_000045"	"g.97474388C>T"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"CNNM4:NM_020184 c.C2039T, p.A680V"	"heterozygous, individual unsolved, causality of variants unknown"	"Germline"	"?"	""	"0"	""	""	"g.96808651C>T"	""	"VUS"	"ACMG"
"0000815572"	"0"	"50"	"2"	"97427011"	"97427013"	"del"	"0"	"00000"	"CNNM4_000043"	"g.97427011_97427013del"	""	"{PMID:Rodriguez-Munoz 2020:32036094}"	""	"CNNM4:NM_020184 c.273_275del, p.S92del"	"error in annotation:c.273_275del normalised to c.275_277del, heterozygous, individual unsolved, causality of variants unknown"	"Germline"	"?"	""	"0"	""	""	"g.96761274_96761276del"	""	"VUS"	"ACMG"
"0000820270"	"1"	"70"	"2"	"97428048"	"97428048"	"dup"	"0"	"00000"	"CNNM4_000046"	"g.97428048dup"	""	"{PMID:Weisschuh 2020:32531858}"	""	"CNNM4, variant 1: c.1312dup/p.L438Pfs*9, variant 2: c.1312dup/p.L438Pfs*9"	"solved, homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.96762311dup"	""	"likely pathogenic"	""
"0000826148"	"0"	"70"	"2"	"97427505"	"97427505"	"del"	"0"	"00000"	"CNNM4_000047"	"g.97427505del"	""	"{PMID:Liu-2020:33090715}"	""	"c.767delC"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (recessive)"	""
"0000826149"	"0"	"70"	"2"	"97464925"	"97464925"	"subst"	"1.21819E-5"	"00000"	"CNNM4_000041"	"g.97464925C>T"	""	"{PMID:Liu-2020:33090715}"	""	"c.1813C>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (recessive)"	""
"0000850072"	"0"	"30"	"2"	"97475181"	"97475181"	"subst"	"0.000121863"	"01943"	"CNNM4_000048"	"g.97475181T>G"	""	""	""	"CNNM4(NM_020184.3):c.2255T>G (p.V752G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000872111"	"3"	"70"	"2"	"97427335"	"97427335"	"subst"	"4.06184E-6"	"00000"	"CNNM4_000051"	"g.97427335C>A"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.599C>A, Ser200Tyr"	"homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.96761598C>A"	""	"likely pathogenic (recessive)"	""
"0000872112"	"3"	"70"	"2"	"97428048"	"97428048"	"dup"	"0"	"00000"	"CNNM4_000046"	"g.97428048dup"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.1312dupC, Leu438ProfsX9"	"homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.96762311dup"	""	"likely pathogenic (recessive)"	""
"0000872113"	"3"	"70"	"2"	"97464925"	"97464925"	"subst"	"1.21819E-5"	"00000"	"CNNM4_000041"	"g.97464925C>T"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.1813C>T, Arg605X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799188C>T"	""	"likely pathogenic (recessive)"	""
"0000872114"	"3"	"70"	"2"	"97464925"	"97464925"	"subst"	"1.21819E-5"	"00000"	"CNNM4_000041"	"g.97464925C>T"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.1813C>T, Arg605X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799188C>T"	""	"likely pathogenic (recessive)"	""
"0000872115"	"3"	"70"	"2"	"97464925"	"97464925"	"subst"	"1.21819E-5"	"00000"	"CNNM4_000041"	"g.97464925C>T"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.1813C>T, Arg605X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799188C>T"	""	"likely pathogenic (recessive)"	""
"0000872116"	"1"	"70"	"2"	"97475075"	"97475075"	"subst"	"8.1986E-6"	"00000"	"CNNM4_000014"	"g.97475075C>T"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.2149C>T, Gln717X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96809338C>T"	""	"likely pathogenic (recessive)"	""
"0000872117"	"1"	"70"	"2"	"97475075"	"97475075"	"subst"	"8.1986E-6"	"00000"	"CNNM4_000014"	"g.97475075C>T"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.2149C>T, Gln717X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96809338C>T"	""	"likely pathogenic (recessive)"	""
"0000872118"	"1"	"70"	"2"	"97475075"	"97475075"	"subst"	"8.1986E-6"	"00000"	"CNNM4_000014"	"g.97475075C>T"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.2149C>T, Gln717X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96809338C>T"	""	"likely pathogenic (recessive)"	""
"0000872119"	"1"	"70"	"2"	"97475075"	"97475075"	"subst"	"8.1986E-6"	"00000"	"CNNM4_000014"	"g.97475075C>T"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.2149C>T, Gln717X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96809338C>T"	""	"likely pathogenic (recessive)"	""
"0000872120"	"3"	"70"	"2"	"97427322"	"97427322"	"subst"	"0"	"00000"	"CNNM4_000050"	"g.97427322T>C"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.586T>C, Ser196Pro"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761585T>C"	""	"likely pathogenic (recessive)"	""
"0000872121"	"3"	"70"	"2"	"97427322"	"97427322"	"subst"	"0"	"00000"	"CNNM4_000050"	"g.97427322T>C"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.586T>C, Ser196Pro"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761585T>C"	""	"likely pathogenic (recessive)"	""
"0000872122"	"3"	"70"	"2"	"0"	"0"	""	"0"	"00000"	"SNRNP200_000007"	"g.?"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.1-?_1403+?del, p.?"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.?"	""	"likely pathogenic (recessive)"	""
"0000872123"	"3"	"70"	"2"	"0"	"0"	""	"0"	"00000"	"SNRNP200_000007"	"g.?"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.1-?_1403+?del, p.?"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.?"	""	"likely pathogenic (recessive)"	""
"0000872124"	"3"	"70"	"2"	"0"	"0"	""	"0"	"00000"	"SNRNP200_000007"	"g.?"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.1-?_1403+?del, p.?"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.?"	""	"likely pathogenic (recessive)"	""
"0000872125"	"3"	"70"	"2"	"0"	"0"	""	"0"	"00000"	"SNRNP200_000007"	"g.?"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.1-?_1403+?del, p.?"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.?"	""	"likely pathogenic (recessive)"	""
"0000872126"	"1"	"70"	"2"	"97427707"	"97427707"	"subst"	"0"	"00000"	"CNNM4_000052"	"g.97427707T>C"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.971T>C, Leu324Pro"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761970T>C"	""	"likely pathogenic (recessive)"	""
"0000872127"	"3"	"70"	"2"	"97427335"	"97427335"	"subst"	"4.06184E-6"	"00000"	"CNNM4_000051"	"g.97427335C>A"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.599C>A, Ser200Tyr"	"homozygous"	"Unknown"	"?"	""	"0"	""	""	"g.96761598C>A"	""	"likely pathogenic (recessive)"	""
"0000872128"	"2"	"70"	"2"	"97426800"	"97426883"	"del"	"0"	"00000"	"CNNM4_000049"	"g.97426800_97426883del"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.62_145del, Leu21HisfsX185"	"heterozygous; error in annotation, 3\' rule, deletion coordinates corrected"	"Germline"	"yes"	""	"0"	""	""	"g.96761063_96761146del"	""	"likely pathogenic (recessive)"	""
"0000872129"	"2"	"70"	"2"	"97426800"	"97426883"	"del"	"0"	"00000"	"CNNM4_000049"	"g.97426800_97426883del"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.62_145del, Leu21HisfsX185"	"heterozygous; error in annotation, 3\' rule, deletion coordinates corrected"	"Germline"	"yes"	""	"0"	""	""	"g.96761063_96761146del"	""	"likely pathogenic (recessive)"	""
"0000872130"	"2"	"70"	"2"	"97426800"	"97426883"	"del"	"0"	"00000"	"CNNM4_000049"	"g.97426800_97426883del"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.62_145del, Leu21HisfsX185"	"heterozygous; error in annotation, 3\' rule, deletion coordinates corrected"	"Germline"	"yes"	""	"0"	""	""	"g.96761063_96761146del"	""	"likely pathogenic (recessive)"	""
"0000872131"	"2"	"70"	"2"	"97426800"	"97426883"	"del"	"0"	"00000"	"CNNM4_000049"	"g.97426800_97426883del"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.62_145del, Leu21HisfsX185"	"heterozygous; error in annotation, 3\' rule, deletion coordinates corrected"	"Germline"	"yes"	""	"0"	""	""	"g.96761063_96761146del"	""	"likely pathogenic (recessive)"	""
"0000872132"	"2"	"70"	"2"	"97464802"	"97464802"	"subst"	"0"	"00000"	"CNNM4_000059"	"g.97464802C>T"	""	"{PMID:Parry 2009:19200525}"	""	"CNNM4 c.1690C>T, Gln564X"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799065C>T"	""	"likely pathogenic (recessive)"	""
"0000872133"	"3"	"70"	"2"	"97428048"	"97428048"	"dup"	"0"	"00000"	"CNNM4_000046"	"g.97428048dup"	""	"{PMID:Polok 2009:19200527}"	""	"CNNM4 c.1312 dupC"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762311dup"	""	"likely pathogenic (recessive)"	""
"0000872134"	"3"	"70"	"2"	"97428048"	"97428048"	"dup"	"0"	"00000"	"CNNM4_000046"	"g.97428048dup"	""	"{PMID:Polok 2009:19200527}"	""	"CNNM4 c.1312 dupC"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762311dup"	""	"likely pathogenic (recessive)"	""
"0000872145"	"3"	"70"	"2"	"97427443"	"97427443"	"subst"	"0"	"00000"	"CNNM4_000015"	"g.97427443G>A"	""	"{PMID:Polok 2009:19200527}"	""	"CNNM4 c.707G->A (p.R236Q)"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761706G>A"	""	"likely pathogenic (recessive)"	""
"0000872146"	"3"	"70"	"2"	"97427443"	"97427443"	"subst"	"0"	"00000"	"CNNM4_000015"	"g.97427443G>A"	""	"{PMID:Polok 2009:19200527}"	""	"CNNM4 c.707G->A (p.R236Q)"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761706G>A"	""	"likely pathogenic (recessive)"	""
"0000872147"	"3"	"70"	"2"	"97427443"	"97427443"	"subst"	"0"	"00000"	"CNNM4_000015"	"g.97427443G>A"	""	"{PMID:Polok 2009:19200527}"	""	"CNNM4 c.707G->A (p.R236Q)"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761706G>A"	""	"likely pathogenic (recessive)"	""
"0000872148"	"3"	"70"	"2"	"97427707"	"97427707"	"subst"	"0"	"00000"	"CNNM4_000052"	"g.97427707T>C"	""	"{PMID:Polok 2009:19200527}"	""	"CNNM4 c.971T->C (p.L324P)"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761970T>C"	""	"likely pathogenic (recessive)"	""
"0000872149"	"3"	"70"	"2"	"97464925"	"97464925"	"subst"	"1.21819E-5"	"00000"	"CNNM4_000041"	"g.97464925C>T"	""	"{PMID:Jalili 2010:20706282}"	""	"CNNM4 c.1813C>T, Arg605X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799188C>T"	""	"likely pathogenic (recessive)"	""
"0000872150"	"3"	"70"	"2"	"97464925"	"97464925"	"subst"	"1.21819E-5"	"00000"	"CNNM4_000041"	"g.97464925C>T"	""	"{PMID:Jalili 2010:20706282}"	""	"CNNM4 c.1813C>T, Arg605X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799188C>T"	""	"likely pathogenic (recessive)"	""
"0000872151"	"3"	"70"	"2"	"97464925"	"97464925"	"subst"	"1.21819E-5"	"00000"	"CNNM4_000041"	"g.97464925C>T"	""	"{PMID:Jalili 2010:20706282}"	""	"CNNM4 c.1813C>T, Arg605X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799188C>T"	""	"likely pathogenic (recessive)"	""
"0000872154"	"3"	"70"	"2"	"97428048"	"97428048"	"dup"	"0"	"00000"	"CNNM4_000046"	"g.97428048dup"	""	"{PMID:Zobor 2012:21728811}"	""	"CNNM4 c.1312dupC, p.Leu438ProfsX9"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762311dup"	""	"likely pathogenic (recessive)"	""
"0000872156"	"3"	"70"	"2"	"97428048"	"97428048"	"dup"	"0"	"00000"	"CNNM4_000046"	"g.97428048dup"	""	"{PMID:Luder 2013:24194943}"	""	"CNNM4 c.1312dupC, p.Leu438ProfsX9"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762311dup"	""	"likely pathogenic (recessive)"	""
"0000872157"	"3"	"70"	"2"	"97428048"	"97428048"	"dup"	"0"	"00000"	"CNNM4_000046"	"g.97428048dup"	""	"{PMID:Luder 2013:24194943}"	""	"CNNM4 c.1312dupC, p.Leu438ProfsX9"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762311dup"	""	"likely pathogenic (recessive)"	""
"0000872162"	"3"	"70"	"2"	"97428048"	"97428048"	"dup"	"0"	"00000"	"CNNM4_000046"	"g.97428048dup"	""	"{PMID:Gerth-Kahlert 2015:25613845}"	""	"CNNM4 c.1312dupC, p.L438Pfs*9"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762311dup"	""	"likely pathogenic (recessive)"	""
"0000872163"	"3"	"70"	"2"	"97428048"	"97428048"	"dup"	"0"	"00000"	"CNNM4_000046"	"g.97428048dup"	""	"{PMID:Gerth-Kahlert 2015:25613845}"	""	"CNNM4 c.1312dupC, p.L438Pfs*9"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762311dup"	""	"likely pathogenic (recessive)"	""
"0000872164"	"3"	"70"	"2"	"97464893"	"97464893"	"subst"	"1.21871E-5"	"00000"	"CNNM4_000061"	"g.97464893A>G"	""	"{PMID:Topcu 2017:27070327}"	""	"CNNM4 c.1781A>G (p.N594S)"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799156A>G"	""	"likely pathogenic (recessive)"	""
"0000872165"	"3"	"70"	"2"	"97464893"	"97464893"	"subst"	"1.21871E-5"	"00000"	"CNNM4_000061"	"g.97464893A>G"	""	"{PMID:Topcu 2017:27070327}"	""	"CNNM4 c.1781A>G (p.N594S)"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799156A>G"	""	"likely pathogenic (recessive)"	""
"0000872166"	"3"	"70"	"2"	"97464893"	"97464893"	"subst"	"1.21871E-5"	"00000"	"CNNM4_000061"	"g.97464893A>G"	""	"{PMID:Topcu 2017:27070327}"	""	"CNNM4 c.1781A>G (p.N594S)"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799156A>G"	""	"likely pathogenic (recessive)"	""
"0000872167"	"3"	"70"	"2"	"97427827"	"97427827"	"del"	"0"	"00000"	"CNNM4_000054"	"g.97427827del"	""	"{PMID:Rahimi-Aliabadi 2016:27419834}"	""	"CNNM4 c.1091delG"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762090del"	""	"likely pathogenic (recessive)"	""
"0000872168"	"3"	"70"	"2"	"97427827"	"97427827"	"del"	"0"	"00000"	"CNNM4_000054"	"g.97427827del"	""	"{PMID:Rahimi-Aliabadi 2016:27419834}"	""	"CNNM4 c.1091delG"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762090del"	""	"likely pathogenic (recessive)"	""
"0000872169"	"3"	"70"	"2"	"97427827"	"97427827"	"del"	"0"	"00000"	"CNNM4_000054"	"g.97427827del"	""	"{PMID:Rahimi-Aliabadi 2016:27419834}"	""	"CNNM4 c.1091delG"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762090del"	""	"likely pathogenic (recessive)"	""
"0000872170"	"3"	"70"	"2"	"97427827"	"97427827"	"del"	"0"	"00000"	"CNNM4_000054"	"g.97427827del"	""	"{PMID:Rahimi-Aliabadi 2016:27419834}"	""	"CNNM4 c.1091delG"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762090del"	""	"likely pathogenic (recessive)"	""
"0000872171"	"3"	"70"	"2"	"97464793"	"97464793"	"subst"	"0"	"00000"	"CNNM4_000058"	"g.97464793G>C"	""	"{PMID:Cherkaoui Jaouad 2017:28246031}"	""	"CNNM4 c.1682-1G > C"	"substitution resulting in deletion of AG in cDNA and subsequent frameshift; homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799056G>C"	""	"likely pathogenic (recessive)"	""
"0000872172"	"3"	"70"	"2"	"97464793"	"97464793"	"subst"	"0"	"00000"	"CNNM4_000058"	"g.97464793G>C"	""	"{PMID:Cherkaoui Jaouad 2017:28246031}"	""	"CNNM4 c.1682-1G > C"	"substitution resulting in deletion of AG in cDNA and subsequent frameshift; homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799056G>C"	""	"likely pathogenic (recessive)"	""
"0000872173"	"3"	"70"	"2"	"97464793"	"97464793"	"subst"	"0"	"00000"	"CNNM4_000058"	"g.97464793G>C"	""	"{PMID:Cherkaoui Jaouad 2017:28246031}"	""	"CNNM4 c.1682-1G > C"	"substitution resulting in deletion of AG in cDNA and subsequent frameshift; homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799056G>C"	""	"likely pathogenic (recessive)"	""
"0000872174"	"3"	"70"	"2"	"97427812"	"97427812"	"subst"	"0"	"00000"	"CNNM4_000053"	"g.97427812T>C"	""	"{PMID:Wawrocka 2017:28586144}"	""	"CNNM4 c.1076T>C, p.(Leu359Pro)"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762075T>C"	""	"likely pathogenic (recessive)"	""
"0000872175"	"3"	"70"	"2"	"97427812"	"97427812"	"subst"	"0"	"00000"	"CNNM4_000053"	"g.97427812T>C"	""	"{PMID:Wawrocka 2017:28586144}"	""	"CNNM4 c.1076T>C, p.(Leu359Pro)"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762075T>C"	""	"likely pathogenic (recessive)"	""
"0000872176"	"3"	"70"	"2"	"97427812"	"97427812"	"subst"	"0"	"00000"	"CNNM4_000053"	"g.97427812T>C"	""	"{PMID:Wawrocka 2017:28586144}"	""	"CNNM4 c.1076T>C, p.(Leu359Pro)"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762075T>C"	""	"likely pathogenic (recessive)"	""
"0000872177"	"3"	"70"	"2"	"97464925"	"97464925"	"subst"	"1.21819E-5"	"00000"	"CNNM4_000041"	"g.97464925C>T"	""	"{PMID:Li 2018:29322253}"	""	"CNNM4 c.C1813T, p.R605X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799188C>T"	""	"likely pathogenic (recessive)"	""
"0000872178"	"3"	"70"	"2"	"97464925"	"97464925"	"subst"	"1.21819E-5"	"00000"	"CNNM4_000041"	"g.97464925C>T"	""	"{PMID:Li 2018:29322253}"	""	"CNNM4 c.C1813T, p.R605X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799188C>T"	""	"likely pathogenic (recessive)"	""
"0000872179"	"3"	"70"	"2"	"97464925"	"97464925"	"subst"	"1.21819E-5"	"00000"	"CNNM4_000041"	"g.97464925C>T"	""	"{PMID:Li 2018:29322253}"	""	"CNNM4 c.C1813T, p.R605X"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799188C>T"	""	"likely pathogenic (recessive)"	""
"0000872185"	"3"	"70"	"2"	"97428048"	"97428048"	"dup"	"0"	"00000"	"CNNM4_000046"	"g.97428048dup"	""	"{PMID:Hirji 2018:29421294}"	""	"CNNM4 c.1312dupC, p.Leu438Profs*9"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762311dup"	""	"likely pathogenic (recessive)"	""
"0000872186"	"3"	"70"	"2"	"97427962"	"97427962"	"subst"	"0"	"00000"	"CNNM4_000056"	"g.97427962C>T"	""	"{PMID:Hirji 2018:29421294}"	""	"CNNM4 c.1226C>T, p.Pro409Leu"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762225C>T"	""	"likely pathogenic (recessive)"	""
"0000872187"	"1"	"70"	"2"	"97428048"	"97428048"	"del"	"0"	"00000"	"CNNM4_000057"	"g.97428048del"	""	"{PMID:Hirji 2018:29421294}"	""	"CNNM4 c.1307delC, p.Leu438Serfs*41"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762311del"	""	"likely pathogenic (recessive)"	""
"0000872188"	"2"	"70"	"2"	"97464802"	"97464802"	"subst"	"0"	"00000"	"CNNM4_000059"	"g.97464802C>T"	""	"{PMID:Hirji 2018:29421294}"	""	"CNNM4 c.C1690T, p.Gln564*"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799065C>T"	""	"likely pathogenic (recessive)"	""
"0000872189"	"3"	"70"	"2"	"97427470"	"97427470"	"subst"	"0"	"00000"	"CNNM4_000033"	"g.97427470C>T"	""	"{PMID:Hirji 2018:29421294}"	""	"CNNM4 c.C734T, p.Ser245Leu"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761733C>T"	""	"likely pathogenic (recessive)"	""
"0000872190"	"3"	"70"	"2"	"97427470"	"97427470"	"subst"	"0"	"00000"	"CNNM4_000033"	"g.97427470C>T"	""	"{PMID:Hirji 2018:29421294}"	""	"CNNM4 c.C734T, p.Ser245Leu"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761733C>T"	""	"likely pathogenic (recessive)"	""
"0000872191"	"3"	"70"	"2"	"97427707"	"97427707"	"subst"	"0"	"00000"	"CNNM4_000052"	"g.97427707T>C"	""	"{PMID:Maia 2018:29421602}"	""	"CNNM4 c.971T>C, Leu324Pro"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761970T>C"	""	"likely pathogenic (recessive)"	""
"0000872192"	"21"	"70"	"2"	"97427707"	"97427707"	"subst"	"0"	"00000"	"CNNM4_000052"	"g.97427707T>C"	""	"{PMID:Maia 2018:29421602}"	""	"CNNM4 c.971T>C, Leu324Pro"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761970T>C"	""	"likely pathogenic (recessive)"	""
"0000872193"	"11"	"70"	"2"	"97464855"	"97464855"	"subst"	"0"	"00000"	"CNNM4_000060"	"g.97464855C>G"	""	"{PMID:Maia 2018:29421602}"	""	"CNNM4 c.971T>C, Leu324Pro"	"heterozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96799118C>G"	""	"likely pathogenic (recessive)"	""
"0000872198"	"3"	"70"	"2"	"97427956"	"97427956"	"subst"	"0"	"00000"	"CNNM4_000055"	"g.97427956G>T"	""	"{PMID:Parveen 2019:31347285}"	""	"CNNM4 c.1220G>T, p.Arg407Leu"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762219G>T"	""	"likely pathogenic (recessive)"	""
"0000872199"	"3"	"70"	"2"	"97427956"	"97427956"	"subst"	"0"	"00000"	"CNNM4_000055"	"g.97427956G>T"	""	"{PMID:Parveen 2019:31347285}"	""	"CNNM4 c.1220G>T, p.Arg407Leu"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762219G>T"	""	"likely pathogenic (recessive)"	""
"0000872200"	"3"	"70"	"2"	"97427956"	"97427956"	"subst"	"0"	"00000"	"CNNM4_000055"	"g.97427956G>T"	""	"{PMID:Parveen 2019:31347285}"	""	"CNNM4 c.1220G>T, p.Arg407Leu"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96762219G>T"	""	"likely pathogenic (recessive)"	""
"0000881426"	"3"	"50"	"2"	"97427335"	"97427335"	"subst"	"4.06184E-6"	"04405"	"CNNM4_000051"	"g.97427335C>A"	""	"{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.96761598C>A"	""	"VUS"	"ACMG"
"0000885440"	"0"	"30"	"2"	"97427135"	"97427135"	"subst"	"0.00455256"	"02330"	"CNNM4_000020"	"g.97427135G>A"	""	""	""	"CNNM4(NM_020184.3):c.399G>A (p.V133=), CNNM4(NM_020184.4):c.399G>A (p.V133=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000885441"	"0"	"30"	"2"	"97427492"	"97427492"	"subst"	"0.000232997"	"02330"	"CNNM4_000064"	"g.97427492G>C"	""	""	""	"CNNM4(NM_020184.4):c.756G>C (p.L252=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000897842"	"3"	"70"	"2"	"97427442"	"97427442"	"subst"	"0"	"00000"	"CNNM4_000063"	"g.97427442C>T"	""	"{PMID:Prasov 2020:32022389}"	""	"CNNM4 c.706C > T, p.Arg236Trp"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761705C>T"	""	"likely pathogenic (recessive)"	""
"0000897843"	"3"	"70"	"2"	"97427442"	"97427442"	"subst"	"0"	"00000"	"CNNM4_000063"	"g.97427442C>T"	""	"{PMID:Prasov 2020:32022389}"	""	"CNNM4 c.706C > T, p.Arg236Trp"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761705C>T"	""	"likely pathogenic (recessive)"	""
"0000897844"	"3"	"90"	"2"	"97427015"	"97427015"	"del"	"0"	"00000"	"CNNM4_000062"	"g.97427015del"	""	"{PMID:Prasov 2020:32022389}"	""	"CNNM4 c.279delC p.Phe93Leufs*31"	"homozygous"	"Germline"	"yes"	""	"0"	""	""	"g.96761278del"	""	"pathogenic (recessive)"	""
"0000962325"	"0"	"50"	"2"	"97427470"	"97427470"	"subst"	"0"	"02327"	"CNNM4_000033"	"g.97427470C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000962326"	"0"	"30"	"2"	"97474305"	"97474305"	"subst"	"5.69203E-5"	"02330"	"CNNM4_000065"	"g.97474305C>T"	""	""	""	"CNNM4(NM_020184.4):c.1956C>T (p.S652=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000986387"	"3"	"50"	"2"	"97427218"	"97427218"	"subst"	"0"	"04405"	"CNNM4_000066"	"g.97427218T>C"	""	"{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.96761481T>C"	""	"VUS"	"ACMG"


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes CNNM4
## Count = 133
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000090893"	"00005397"	"90"	"1484"	"0"	"1484"	"0"	"c.1484C>T"	"r.(?)"	"p.(Thr495Ile)"	"2"
"0000256546"	"00005397"	"50"	"772"	"0"	"772"	"0"	"c.772A>C"	"r.(?)"	"p.(Thr258Pro)"	""
"0000264716"	"00005397"	"10"	"1500"	"0"	"1500"	"0"	"c.1500C>T"	"r.(?)"	"p.(Ile500=)"	""
"0000264717"	"00005397"	"10"	"1547"	"-16"	"1547"	"-16"	"c.1547-16G>A"	"r.(=)"	"p.(=)"	""
"0000264718"	"00005397"	"10"	"1851"	"9"	"1851"	"9"	"c.1851+9G>A"	"r.(=)"	"p.(=)"	""
"0000264719"	"00005397"	"10"	"2130"	"5"	"2130"	"5"	"c.2130+5G>A"	"r.spl?"	"p.?"	""
"0000264720"	"00005397"	"10"	"2154"	"0"	"2154"	"0"	"c.2154C>T"	"r.(?)"	"p.(Asn718=)"	""
"0000264721"	"00005397"	"10"	"2202"	"0"	"2202"	"0"	"c.2202C>T"	"r.(?)"	"p.(Asp734=)"	""
"0000264722"	"00005397"	"10"	"939"	"0"	"939"	"0"	"c.939C>A"	"r.(?)"	"p.(Thr313=)"	""
"0000273693"	"00005397"	"30"	"1431"	"0"	"1431"	"0"	"c.1431G>A"	"r.(?)"	"p.(Lys477=)"	""
"0000273694"	"00005397"	"30"	"1851"	"9"	"1851"	"9"	"c.1851+9G>A"	"r.(=)"	"p.(=)"	""
"0000273695"	"00005397"	"30"	"1947"	"0"	"1947"	"0"	"c.1947C>T"	"r.(?)"	"p.(Ser649=)"	""
"0000273696"	"00005397"	"30"	"69"	"0"	"69"	"0"	"c.69G>A"	"r.(?)"	"p.(Ala23=)"	""
"0000273697"	"00005397"	"30"	"931"	"0"	"931"	"0"	"c.931C>T"	"r.(?)"	"p.(Leu311=)"	""
"0000327170"	"00005397"	"30"	"9561"	"0"	"9561"	"0"	"c.*7233C>T"	"r.(=)"	"p.(=)"	""
"0000344946"	"00005397"	"70"	"2149"	"0"	"2149"	"0"	"c.2149C>T"	"r.(?)"	"p.(Gln717Ter)"	""
"0000358234"	"00005397"	"70"	"707"	"0"	"707"	"0"	"c.707G>A"	"r.(?)"	"p.(Arg236Gln)"	"1"
"0000358235"	"00005397"	"70"	"1494"	"0"	"1494"	"0"	"c.1494C>A"	"r.(?)"	"p.(Asp498Glu)"	"2"
"0000517178"	"00005397"	"50"	"29"	"0"	"55"	"0"	"c.29_55del"	"r.(?)"	"p.(Pro10_Arg18del)"	""
"0000517179"	"00005397"	"50"	"106"	"0"	"106"	"0"	"c.106C>T"	"r.(?)"	"p.(Arg36Trp)"	""
"0000517180"	"00005397"	"70"	"241"	"0"	"241"	"0"	"c.241dup"	"r.(?)"	"p.(Tyr81LeufsTer153)"	""
"0000517181"	"00005397"	"30"	"399"	"0"	"399"	"0"	"c.399G>A"	"r.(?)"	"p.(Val133=)"	""
"0000517182"	"00005397"	"50"	"407"	"0"	"407"	"0"	"c.407C>A"	"r.(?)"	"p.(Thr136Asn)"	""
"0000517183"	"00005397"	"30"	"411"	"0"	"411"	"0"	"c.411G>A"	"r.(?)"	"p.(Lys137=)"	""
"0000517184"	"00005397"	"30"	"793"	"0"	"793"	"0"	"c.793A>C"	"r.(?)"	"p.(Ile265Leu)"	""
"0000517185"	"00005397"	"30"	"793"	"0"	"793"	"0"	"c.793A>C"	"r.(?)"	"p.(Ile265Leu)"	""
"0000517186"	"00005397"	"30"	"795"	"0"	"795"	"0"	"c.795C>T"	"r.(?)"	"p.(Ile265=)"	""
"0000517187"	"00005397"	"50"	"1337"	"0"	"1337"	"0"	"c.1337A>G"	"r.(?)"	"p.(Asn446Ser)"	""
"0000517188"	"00005397"	"30"	"1500"	"0"	"1500"	"0"	"c.1500C>T"	"r.(?)"	"p.(Ile500=)"	""
"0000517189"	"00005397"	"30"	"2066"	"0"	"2066"	"0"	"c.2066C>T"	"r.(?)"	"p.(Ser689Phe)"	""
"0000608162"	"00005397"	"30"	"1494"	"0"	"1494"	"0"	"c.1494C>T"	"r.(?)"	"p.(Asp498=)"	""
"0000621133"	"00005397"	"30"	"268"	"0"	"268"	"0"	"c.268C>T"	"r.(?)"	"p.(Leu90=)"	""
"0000650712"	"00005397"	"50"	"1947"	"0"	"1947"	"0"	"c.1947C>T"	"r.(=)"	"p.(=)"	""
"0000654743"	"00005397"	"50"	"1750"	"0"	"1750"	"0"	"c.1750G>A"	"r.(?)"	"p.(Val584Ile)"	""
"0000685160"	"00005397"	"70"	"707"	"0"	"707"	"0"	"c.707G>A"	"r.(?)"	"p.(Arg236Gln)"	""
"0000685161"	"00005397"	"90"	"1494"	"0"	"1494"	"0"	"c.1494C>A"	"r.(?)"	"p.(Asp498Glu)"	""
"0000719094"	"00005397"	"50"	"1942"	"0"	"1942"	"0"	"c.1942C>A"	"r.(?)"	"p.(Pro648Thr)"	""
"0000736830"	"00005397"	"50"	"2203"	"0"	"2211"	"0"	"c.2203_2211del"	"r.(?)"	"p.(Gly735_Thr737del)"	""
"0000760103"	"00005397"	"50"	"973"	"0"	"973"	"0"	"c.973G>A"	"r.(?)"	"p.(Asp325Asn)"	""
"0000765786"	"00005397"	"70"	"734"	"0"	"734"	"0"	"c.734C>T"	"r.(?)"	"p.(Ser245Leu)"	""
"0000765828"	"00005397"	"70"	"1484"	"0"	"1484"	"0"	"c.1484C>T"	"r.(?)"	"p.(Thr495Ile)"	""
"0000766048"	"00005397"	"90"	"1494"	"0"	"1494"	"0"	"c.1494C>A"	"r.(?)"	"p.(Asp498Glu)"	""
"0000783885"	"00005397"	"70"	"897"	"0"	"897"	"0"	"c.897dup"	"r.(?)"	"p.(Ala300CysfsTer22)"	""
"0000785567"	"00005397"	"50"	"471"	"0"	"484"	"0"	"c.471_484del"	"r.(?)"	"p.(Asp157GlufsTer72)"	""
"0000790734"	"00005397"	"70"	"189"	"0"	"189"	"0"	"c.189del"	"r.(?)"	"p.(Asp63GlufsTer12)"	""
"0000794744"	"00005397"	"70"	"509"	"0"	"509"	"0"	"c.509T>C"	"r.(?)"	"p.(Leu170Pro)"	""
"0000797987"	"00005397"	"50"	"2130"	"5"	"2130"	"5"	"c.2130+5G>A"	"r.spl?"	"p.(?)"	""
"0000800860"	"00005397"	"50"	"434"	"0"	"434"	"0"	"c.434T>C"	"r.(?)"	"p.(Met145Thr)"	""
"0000800861"	"00005397"	"30"	"781"	"0"	"781"	"0"	"c.781C>T"	"r.(?)"	"p.(Leu261=)"	""
"0000800862"	"00005397"	"50"	"1856"	"0"	"1856"	"0"	"c.1856A>C"	"r.(?)"	"p.(Lys619Thr)"	""
"0000811405"	"00005397"	"70"	"509"	"0"	"509"	"0"	"c.509T>C"	"r.(?)"	"p.(Leu170Pro)"	""
"0000813688"	"00005397"	"90"	"1813"	"0"	"1813"	"0"	"c.1813C>T"	"r.(?)"	"p.(Arg605*)"	""
"0000813767"	"00005397"	"90"	"1962"	"0"	"1963"	"0"	"c.1962_1963insCACCC"	"r.(?)"	"p.(Leu659Profs*77)"	""
"0000814971"	"00005397"	"90"	"1495"	"0"	"1495"	"0"	"c.1495G>A"	"r.(?)"	"p.(Val499Met)"	""
"0000815412"	"00005397"	"50"	"2039"	"0"	"2039"	"0"	"c.2039C>T"	"r.(?)"	"p.(Ala680Val)"	""
"0000815572"	"00005397"	"50"	"275"	"0"	"277"	"0"	"c.275_277del"	"r.(?)"	"p.(Ser92del)"	""
"0000820270"	"00005397"	"70"	"1312"	"0"	"1312"	"0"	"c.1312dup"	"r.(?)"	"p.(Leu438Profs*9)"	""
"0000826148"	"00005397"	"70"	"769"	"0"	"769"	"0"	"c.769del"	"r.(?)"	"p.(Leu257Serfs*5)"	"1"
"0000826149"	"00005397"	"70"	"1813"	"0"	"1813"	"0"	"c.1813C>T"	"r.(?)"	"p.(Arg605*)"	"4"
"0000850072"	"00005397"	"30"	"2255"	"0"	"2255"	"0"	"c.2255T>G"	"r.(?)"	"p.(Val752Gly)"	""
"0000872111"	"00005397"	"70"	"599"	"0"	"599"	"0"	"c.599C>A"	"r.(?)"	"p.(Ser200Tyr)"	""
"0000872112"	"00005397"	"70"	"1312"	"0"	"1312"	"0"	"c.1312dup"	"r.(?)"	"p.(Leu438Profs*9)"	""
"0000872113"	"00005397"	"70"	"1813"	"0"	"1813"	"0"	"c.1813C>T"	"r.(?)"	"p.(Arg605*)"	""
"0000872114"	"00005397"	"70"	"1813"	"0"	"1813"	"0"	"c.1813C>T"	"r.(?)"	"p.(Arg605*)"	""
"0000872115"	"00005397"	"70"	"1813"	"0"	"1813"	"0"	"c.1813C>T"	"r.(?)"	"p.(Arg605*)"	""
"0000872116"	"00005397"	"70"	"2149"	"0"	"2149"	"0"	"c.2149C>T"	"r.(?)"	"p.(Gln717*)"	""
"0000872117"	"00005397"	"70"	"2149"	"0"	"2149"	"0"	"c.2149C>T"	"r.(?)"	"p.(Gln717*)"	""
"0000872118"	"00005397"	"70"	"2149"	"0"	"2149"	"0"	"c.2149C>T"	"r.(?)"	"p.(Gln717*)"	""
"0000872119"	"00005397"	"70"	"2149"	"0"	"2149"	"0"	"c.2149C>T"	"r.(?)"	"p.(Gln717*)"	""
"0000872120"	"00005397"	"70"	"586"	"0"	"586"	"0"	"c.586T>C"	"r.(?)"	"p.(Ser196Pro)"	""
"0000872121"	"00005397"	"70"	"586"	"0"	"586"	"0"	"c.586T>C"	"r.(?)"	"p.(Ser196Pro)"	""
"0000872122"	"00005397"	"70"	"1"	"-1"	"1403"	"1"	"c.1-?_1403+?del"	"r.(?)"	"p.?"	""
"0000872123"	"00005397"	"70"	"1"	"-1"	"1403"	"1"	"c.1-?_1403+?del"	"r.(?)"	"p.?"	""
"0000872124"	"00005397"	"70"	"1"	"-1"	"1403"	"1"	"c.1-?_1403+?del"	"r.(?)"	"p.?"	""
"0000872125"	"00005397"	"70"	"1"	"-1"	"1403"	"1"	"c.1-?_1403+?del"	"r.(?)"	"p.?"	""
"0000872126"	"00005397"	"70"	"971"	"0"	"971"	"0"	"c.971T>C"	"r.(?)"	"p.(Leu324Pro)"	""
"0000872127"	"00005397"	"70"	"599"	"0"	"599"	"0"	"c.599C>A"	"r.(?)"	"p.(Ser200Tyr)"	""
"0000872128"	"00005397"	"70"	"64"	"0"	"147"	"0"	"c.64_147del"	"r.(?)"	"p.(Ala22_Met49del)"	""
"0000872129"	"00005397"	"70"	"64"	"0"	"147"	"0"	"c.64_147del"	"r.(?)"	"p.(Ala22_Met49del)"	""
"0000872130"	"00005397"	"70"	"64"	"0"	"147"	"0"	"c.64_147del"	"r.(?)"	"p.(Ala22_Met49del)"	""
"0000872131"	"00005397"	"70"	"64"	"0"	"147"	"0"	"c.64_147del"	"r.(?)"	"p.(Ala22_Met49del)"	""
"0000872132"	"00005397"	"70"	"1690"	"0"	"1690"	"0"	"c.1690C>T"	"r.(?)"	"p.(Gln564*)"	""
"0000872133"	"00005397"	"70"	"1312"	"0"	"1312"	"0"	"c.1312dupC"	"r.(?)"	"p.(Leu438Profs*9)"	""
"0000872134"	"00005397"	"70"	"1312"	"0"	"1312"	"0"	"c.1312dupC"	"r.(?)"	"p.(Leu438Profs*9)"	""
"0000872145"	"00005397"	"70"	"707"	"0"	"707"	"0"	"c.707G>A"	"r.(?)"	"p.(Arg236Gln)"	""
"0000872146"	"00005397"	"70"	"707"	"0"	"707"	"0"	"c.707G>A"	"r.(?)"	"p.(Arg236Gln)"	""
"0000872147"	"00005397"	"70"	"707"	"0"	"707"	"0"	"c.707G>A"	"r.(?)"	"p.(Arg236Gln)"	""
"0000872148"	"00005397"	"70"	"971"	"0"	"971"	"0"	"c.971T>C"	"r.(?)"	"p.(Leu324Pro)"	""
"0000872149"	"00005397"	"70"	"1813"	"0"	"1813"	"0"	"c.1813C>T"	"r.(?)"	"p.(Arg605*)"	""
"0000872150"	"00005397"	"70"	"1813"	"0"	"1813"	"0"	"c.1813C>T"	"r.(?)"	"p.(Arg605*)"	""
"0000872151"	"00005397"	"70"	"1813"	"0"	"1813"	"0"	"c.1813C>T"	"r.(?)"	"p.(Arg605*)"	""
"0000872154"	"00005397"	"70"	"1312"	"0"	"1312"	"0"	"c.1312dup"	"r.(?)"	"p.(Leu438Profs*9)"	""
"0000872156"	"00005397"	"70"	"1312"	"0"	"1312"	"0"	"c.1312dup"	"r.(?)"	"p.(Leu438Profs*9)"	""
"0000872157"	"00005397"	"70"	"1312"	"0"	"1312"	"0"	"c.1312dup"	"r.(?)"	"p.(Leu438Profs*9)"	""
"0000872162"	"00005397"	"70"	"1312"	"0"	"1312"	"0"	"c.1312dup"	"r.(?)"	"p.(Leu438Profs*9)"	""
"0000872163"	"00005397"	"70"	"1312"	"0"	"1312"	"0"	"c.1312dup"	"r.(?)"	"p.(Leu438Profs*9)"	""
"0000872164"	"00005397"	"70"	"1781"	"0"	"1781"	"0"	"c.1781A>G"	"r.(?)"	"p.(Asn594Ser)"	"4"
"0000872165"	"00005397"	"70"	"1781"	"0"	"1781"	"0"	"c.1781A>G"	"r.(?)"	"p.(Asn594Ser)"	"4"
"0000872166"	"00005397"	"70"	"1781"	"0"	"1781"	"0"	"c.1781A>G"	"r.(?)"	"p.(Asn594Ser)"	"4"
"0000872167"	"00005397"	"70"	"1091"	"0"	"1091"	"0"	"c.1091delG"	"r.(?)"	"p.(Gly364Valfs*10)"	"1"
"0000872168"	"00005397"	"70"	"1091"	"0"	"1091"	"0"	"c.1091delG"	"r.(?)"	"p.(Gly364Valfs*10)"	"1"
"0000872169"	"00005397"	"70"	"1091"	"0"	"1091"	"0"	"c.1091delG"	"r.(?)"	"p.(Gly364Valfs*10)"	"1"
"0000872170"	"00005397"	"70"	"1091"	"0"	"1091"	"0"	"c.1091delG"	"r.(?)"	"p.(Gly364Valfs*10)"	"1"
"0000872171"	"00005397"	"70"	"1682"	"-1"	"1682"	"-1"	"c.1682-1G>C"	"r.spl"	"p.(Glu561Glyfs*5)"	"4"
"0000872172"	"00005397"	"70"	"1682"	"-1"	"1682"	"-1"	"c.1682-1G>C"	"r.spl"	"p.(Glu561Glyfs*5)"	"4"
"0000872173"	"00005397"	"70"	"1682"	"-1"	"1682"	"-1"	"c.1682-1G>C"	"r.spl"	"p.(Glu561Glyfs*5)"	"4"
"0000872174"	"00005397"	"70"	"1076"	"0"	"1076"	"0"	"c.1076T>C"	"r.(?)"	"p.(Leu359Pro)"	"4"
"0000872175"	"00005397"	"70"	"1076"	"0"	"1076"	"0"	"c.1076T>C"	"r.(?)"	"p.(Leu359Pro)"	"4"
"0000872176"	"00005397"	"70"	"1076"	"0"	"1076"	"0"	"c.1076T>C"	"r.(?)"	"p.(Leu359Pro)"	"4"
"0000872177"	"00005397"	"70"	"1813"	"0"	"1813"	"0"	"c.1813C>T"	"r.(?)"	"p.(Arg605*)"	""
"0000872178"	"00005397"	"70"	"1813"	"0"	"1813"	"0"	"c.1813C>T"	"r.(?)"	"p.(Arg605*)"	""
"0000872179"	"00005397"	"70"	"1813"	"0"	"1813"	"0"	"c.1813C>T"	"r.(?)"	"p.(Arg605*)"	""
"0000872185"	"00005397"	"70"	"1312"	"0"	"1312"	"0"	"c.1312dup"	"r.(?)"	"p.(Leu438Profs*9)"	""
"0000872186"	"00005397"	"70"	"1226"	"0"	"1226"	"0"	"c.1226C>T"	"r.(?)"	"p.(Pro409Leu)"	""
"0000872187"	"00005397"	"70"	"1312"	"0"	"1312"	"0"	"c.1312del"	"r.(?)"	"p.(Leu438Serfs*41)"	""
"0000872188"	"00005397"	"70"	"1690"	"0"	"1690"	"0"	"c.1690C>T"	"r.(?)"	"p.(Gln564*)"	""
"0000872189"	"00005397"	"70"	"734"	"0"	"734"	"0"	"c.734C>T"	"r.(?)"	"p.(Ser245Leu)"	""
"0000872190"	"00005397"	"70"	"734"	"0"	"734"	"0"	"c.734C>T"	"r.(?)"	"p.(Ser245Leu)"	""
"0000872191"	"00005397"	"70"	"971"	"0"	"971"	"0"	"c.971T>C"	"r.(?)"	"p.(Leu324Pro)"	""
"0000872192"	"00005397"	"70"	"971"	"0"	"971"	"0"	"c.971T>C"	"r.(?)"	"p.(Leu324Pro)"	""
"0000872193"	"00005397"	"70"	"1743"	"0"	"1743"	"0"	"c.1743C>G"	"r.(?)"	"p.(Tyr581*)"	""
"0000872198"	"00005397"	"70"	"1220"	"0"	"1220"	"0"	"c.1220G>T"	"r.(?)"	"p.(Arg407Leu)"	""
"0000872199"	"00005397"	"70"	"1220"	"0"	"1220"	"0"	"c.1220G>T"	"r.(?)"	"p.(Arg407Leu)"	""
"0000872200"	"00005397"	"70"	"1220"	"0"	"1220"	"0"	"c.1220G>T"	"r.(?)"	"p.(Arg407Leu)"	""
"0000881426"	"00005397"	"50"	"599"	"0"	"599"	"0"	"c.599C>A"	"r.(?)"	"p.(Ser200Tyr)"	""
"0000885440"	"00005397"	"30"	"399"	"0"	"399"	"0"	"c.399G>A"	"r.(?)"	"p.(Val133=)"	""
"0000885441"	"00005397"	"30"	"756"	"0"	"756"	"0"	"c.756G>C"	"r.(?)"	"p.(Leu252=)"	""
"0000897842"	"00005397"	"70"	"706"	"0"	"706"	"0"	"c.706C>T"	"r.(?)"	"p.(Arg236Trp)"	""
"0000897843"	"00005397"	"70"	"706"	"0"	"706"	"0"	"c.706C>T"	"r.(?)"	"p.(Arg236Trp)"	""
"0000897844"	"00005397"	"90"	"279"	"0"	"279"	"0"	"c.279delC"	"r.(?)"	"p.(Phe93Leufs*31)"	""
"0000962325"	"00005397"	"50"	"734"	"0"	"734"	"0"	"c.734C>T"	"r.(?)"	"p.(Ser245Leu)"	""
"0000962326"	"00005397"	"30"	"1956"	"0"	"1956"	"0"	"c.1956C>T"	"r.(?)"	"p.(=)"	""
"0000986387"	"00005397"	"50"	"482"	"0"	"482"	"0"	"c.482T>C"	"r.(?)"	"p.(Leu161Pro)"	"1"


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 94
"{{screeningid}}"	"{{variantid}}"
"0000000414"	"0000815572"
"0000059777"	"0000090893"
"0000156312"	"0000358234"
"0000156313"	"0000358235"
"0000294023"	"0000650712"
"0000310249"	"0000685160"
"0000310250"	"0000685161"
"0000337200"	"0000736830"
"0000360219"	"0000760103"
"0000364844"	"0000765786"
"0000364886"	"0000765828"
"0000365094"	"0000766048"
"0000373736"	"0000783885"
"0000374742"	"0000785567"
"0000378065"	"0000790734"
"0000381343"	"0000794744"
"0000383743"	"0000797987"
"0000384645"	"0000811405"
"0000386281"	"0000813688"
"0000386281"	"0000813767"
"0000387110"	"0000814971"
"0000387528"	"0000815412"
"0000390925"	"0000820270"
"0000395003"	"0000826148"
"0000395003"	"0000826149"
"0000414442"	"0000872111"
"0000414443"	"0000872112"
"0000414444"	"0000872113"
"0000414445"	"0000872114"
"0000414446"	"0000872115"
"0000414447"	"0000872116"
"0000414447"	"0000872128"
"0000414448"	"0000872117"
"0000414448"	"0000872129"
"0000414449"	"0000872118"
"0000414449"	"0000872130"
"0000414450"	"0000872119"
"0000414450"	"0000872131"
"0000414451"	"0000872120"
"0000414452"	"0000872121"
"0000414453"	"0000872122"
"0000414454"	"0000872123"
"0000414455"	"0000872124"
"0000414456"	"0000872125"
"0000414457"	"0000872126"
"0000414457"	"0000872132"
"0000414458"	"0000872127"
"0000414459"	"0000872133"
"0000414460"	"0000872134"
"0000414469"	"0000872145"
"0000414470"	"0000872146"
"0000414471"	"0000872147"
"0000414472"	"0000872148"
"0000414473"	"0000872149"
"0000414474"	"0000872150"
"0000414475"	"0000872151"
"0000414479"	"0000872154"
"0000414481"	"0000872156"
"0000414482"	"0000872157"
"0000414483"	"0000872162"
"0000414484"	"0000872163"
"0000414485"	"0000872164"
"0000414486"	"0000872165"
"0000414487"	"0000872166"
"0000414488"	"0000872167"
"0000414489"	"0000872168"
"0000414490"	"0000872169"
"0000414491"	"0000872170"
"0000414492"	"0000872171"
"0000414493"	"0000872172"
"0000414494"	"0000872173"
"0000414495"	"0000872174"
"0000414496"	"0000872175"
"0000414497"	"0000872176"
"0000414498"	"0000872177"
"0000414499"	"0000872178"
"0000414500"	"0000872179"
"0000414503"	"0000872185"
"0000414504"	"0000872186"
"0000414505"	"0000872187"
"0000414505"	"0000872188"
"0000414506"	"0000872189"
"0000414507"	"0000872190"
"0000414508"	"0000872191"
"0000414509"	"0000872192"
"0000414509"	"0000872193"
"0000414514"	"0000872198"
"0000414515"	"0000872199"
"0000414516"	"0000872200"
"0000421008"	"0000881426"
"0000422702"	"0000897842"
"0000422703"	"0000897843"
"0000422704"	"0000897844"
"0000452404"	"0000986387"