### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = COL4A3) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "COL4A3" "collagen, type IV, alpha 3 (Goodpasture antigen)" "2" "q36-q37" "no" "LRG_230" "UD_132118387287" "" "http://www.LOVD.nl/COL4A3" "LRG_230t1 \r\n\r\nUK Alport genetic testing of COL4A3, COL4A4, COL4A5 " "1" "2204" "1285" "120070" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/COL4A3_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2010-08-31 00:00:00" "00006" "2016-12-31 15:57:36" "00006" "2026-02-04 17:46:38" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00005463" "COL4A3" "collagen, type IV, alpha 3 (Goodpasture antigen)" "001" "NM_000091.4" "" "NP_000082.2" "" "" "" "-162" "7935" "5013" "228029281" "228179508" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 14 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00399" "NPHS" "nephrotic syndrome (NPHS)" "" "" "" "" "" "00006" "2014-06-06 10:05:35" "00006" "2018-07-03 16:45:22" "01076" "-" "Alport syndrome, mental retardation, midface hypoplasia, and elliptocytosis" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "" "" "01169" "ATS3A" "Alport syndrome, type 3A, autosomal dominant" "AD" "104200" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2024-02-15 12:42:26" "01361" "BFH;TMN" "hematuria, benign, familial" "AD" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2024-02-15 12:39:15" "01644" "ATS2" "Alport syndrome, type 2, autosomal recessive" "AR" "203780" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2024-02-15 12:37:44" "03381" "cancer, gastric" "cancer, gastric (Neoplasm of stomach)" "" "613659" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2017-07-14 15:28:09" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05086" "HL" "hearing loss (HL)" "" "" "" "" "" "00006" "2015-10-23 11:41:05" "00006" "2015-10-23 11:43:00" "05132" "ATS" "Alport syndrome" "" "" "" "" "" "00006" "2016-02-19 02:06:46" "00006" "2024-02-15 12:57:15" "05362" "LIS" "lissencephaly" "" "" "" "" "" "00006" "2017-12-29 12:16:43" "00006" "2023-11-27 09:41:55" "05396" "FSGS" "glomerulosclerosis, segmental, focal (FSGS)" "" "" "" "" "" "00006" "2018-02-16 17:34:10" "" "" "07069" "BFH2" "hematuria, benign, familial, type 2" "AD" "620320" "" "" "" "00006" "2024-02-15 12:41:19" "" "" "07070" "ATS3B" "Alport syndrome, type 3B, autosomal recessive" "AR" "620536" "" "" "" "00006" "2024-02-15 12:43:19" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 5 "{{geneid}}" "{{diseaseid}}" "COL4A3" "01169" "COL4A3" "01361" "COL4A3" "05132" "COL4A3" "07069" "COL4A3" "07070" ## Individuals ## Do not remove or alter this header ## ## Count = 698 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00018452" "" "" "" "1" "" "00746" "{PMID:Bullich 2015:25407002}, {DOI:Bullich 2015:10.1038/ejhg.2014.252}" "" "" "" "Spain" "" "0" "" "" "" "" "00018453" "" "" "" "1" "" "00746" "{PMID:Bullich 2015:25407002}, {DOI:Bullich 2015:10.1038/ejhg.2014.252}" "" "" "" "Spain" "" "0" "" "" "" "" "00018844" "" "" "" "1" "" "00746" "{PMID:Bullich 2015:25407002}, {DOI:Bullich 2015:10.1038/ejhg.2014.252}" "" "" "" "Spain" "" "0" "" "" "" "" "00091300" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Spain" "" "0" "" "" "" "" "00091301" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "F" "" "Italy" "" "0" "" "" "" "" "00091302" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "M" "" "Italy" "" "0" "" "" "" "" "00091303" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "F" "" "Spain" "" "0" "" "" "" "" "00091304" "" "" "" "1" "" "00687" "{PMID:Badenas 2002:11961012}" "" "" "" "Spain" "" "0" "" "" "" "" "00091305" "" "" "" "1" "" "00687" "{PMID:Slajpah 2007:17396119}" "" "" "" "Slovenia" "" "0" "" "" "" "" "00091306" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091307" "" "" "" "26" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091308" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "" "" "Italy" "" "0" "" "" "" "" "00091309" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Spain" "" "0" "" "" "" "" "00091310" "" "" "" "1" "" "00687" "{PMID:Badenas 2002:11961012}" "" "" "" "Spain" "" "0" "" "" "" "" "00091311" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Spain" "" "0" "" "" "" "" "00091312" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091313" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Spain" "" "0" "" "" "" "" "00091314" "" "" "" "1" "" "00687" "{PMID:Voskarides 2007:17942953}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091315" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091316" "" "" "" "1" "" "00687" "{PMID:Nagel 2005:15954103}" "" "" "" "" "" "0" "" "" "" "" "00091317" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091318" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091319" "" "" "" "1" "" "00687" "{PMID:Hoefele 2010:20177710}" "" "M" "" "Italy" "" "0" "" "" "" "" "00091320" "" "" "" "1" "" "00687" "{PMID:Nagel 2005:15954103}" "" "" "" "" "" "0" "" "" "" "" "00091321" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091322" "" "" "" "1" "" "00687" "{PMID:Badenas 2002:11961012}" "" "" "" "Spain" "" "0" "" "" "" "" "00091323" "" "" "" "1" "" "00687" "{PMID:Badenas 2002:11961012}" "" "" "" "Spain" "" "0" "" "" "" "" "00091324" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091325" "" "" "" "1" "" "00687" "{PMID:Hoefele 2010:20177710}" "" "M" "" "Italy" "" "0" "" "" "" "" "00091326" "" "" "" "1" "" "00687" "{PMID:Slajpah 2007:17396119}" "" "" "" "Slovenia" "" "0" "" "" "" "" "00091327" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Spain" "" "0" "" "" "" "" "00091328" "" "" "" "14" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091329" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "" "" "Italy" "" "0" "" "" "" "" "00091330" "" "" "" "1" "" "00687" "{PMID:Voskarides 2007:17942953}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091331" "" "" "" "1" "" "00687" "{PMID:Badenas 2002:11961012}" "" "" "" "Spain" "" "0" "" "" "" "" "00091332" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091333" "" "" "" "1" "" "00687" "{PMID:Voskarides 2007:17942953}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091334" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "F;M" "" "" "" "0" "" "" "" "" "00091335" "" "" "" "1" "" "00687" "{PMID:Badenas 2002:11961012}" "" "" "" "Spain" "" "0" "" "" "" "" "00091336" "" "" "" "1" "" "00687" "{PMID:Slajpah 2007:17396119}" "" "" "" "Slovenia" "" "0" "" "" "" "" "00091337" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Spain" "" "0" "" "" "" "" "00091338" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "" "" "Italy" "" "0" "" "" "" "" "00091339" "" "" "" "11" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091340" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091341" "" "" "" "1" "" "00687" "{PMID:Voskarides 2007:17942953}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091342" "" "" "" "1" "" "00687" "{PMID:Nagel 2005:15954103}" "" "" "" "" "" "0" "" "" "" "" "00091343" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091344" "" "" "" "10" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091345" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "" "" "Italy" "" "0" "" "" "" "" "00091346" "" "" "" "1" "" "00687" "{PMID:Badenas 2002:11961012}" "" "" "" "Spain" "" "0" "" "" "" "" "00091347" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091348" "" "" "" "1" "" "00687" "{PMID:Van der Loop (2000) Kidney Int 58, 1870:11044206}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "Irish" "" "00091349" "" "" "" "5" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091350" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Spain" "" "0" "" "" "" "" "00091351" "" "" "" "1" "" "00687" "{PMID:Slajpah 2007:17396119}" "" "" "" "Slovenia" "" "0" "" "" "" "" "00091352" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091353" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "" "" "Italy" "" "0" "" "" "" "" "00091354" "" "" "" "1" "" "00687" "{PMID:Rana 2007:17216251}" "" "" "" "Australia" "" "0" "" "" "" "" "00091355" "" "" "" "1" "" "00687" "{PMID:Rana 2007:17216251}" "" "" "" "Australia" "" "0" "" "" "" "" "00091356" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "consanguineous" "M" "" "Spain" "" "0" "" "" "" "" "00091357" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "F" "" "Spain" "" "0" "" "" "" "" "00091358" "" "" "" "1" "" "00687" "{PMID:Rana 2007:17216251}" "" "M" "" "Italy" "" "0" "" "" "" "" "00091359" "" "" "" "1" "" "00687" "{PMID:Badenas 2002:11961012}" "" "" "" "Spain" "" "0" "" "" "" "" "00091360" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "" "" "Italy" "" "0" "" "" "" "" "00091361" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Spain" "" "0" "" "" "" "" "00091362" "" "" "" "1" "" "00687" "{PMID:Slajpah 2007:17396119}" "" "" "" "Slovenia" "" "0" "" "" "" "" "00091363" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091364" "" "" "" "1" "" "00687" "{PMID:Slajpah 2007:17396119}" "" "" "" "Slovenia" "" "0" "" "" "" "" "00091365" "" "" "" "1" "" "00687" "{PMID:Longo 2006:16338941}" "consanguineous" "M" "" "" "" "0" "" "" "Iraq;Jewish" "" "00091366" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "F" "" "Australia" "" "0" "" "" "" "" "00091367" "" "" "" "1" "" "00687" "{PMID:Nagel 2005:15954103}" "" "" "" "" "" "0" "" "" "" "" "00091368" "" "" "" "35" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091369" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Spain" "" "0" "" "" "" "" "00091370" "" "" "" "1" "" "00687" "{PMID:Slajpah 2007:17396119}" "" "" "" "Slovenia" "" "0" "" "" "" "" "00091371" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "Australia" "" "0" "" "" "" "" "00091372" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "Australia" "" "0" "" "" "" "" "00091373" "" "" "" "1" "" "00687" "{PMID:Hou 2007:17726307}" "" "M" "" "China" "" "0" "" "" "Han chinese" "" "00091374" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "F" "" "" "" "0" "" "" "" "" "00091375" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091376" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "Australia" "" "0" "" "" "" "" "00091377" "" "" "" "1" "" "00687" "{PMID:Rana 2007:17216251}" "" "" "" "" "" "0" "" "" "" "" "00091378" "" "" "" "1" "" "00687" "{PMID:Nagel 2005:15954103}" "" "" "" "" "" "0" "" "" "" "" "00091379" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "Australia" "" "0" "" "" "" "" "00091380" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "F" "" "Spain" "" "0" "" "" "" "" "00091381" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091382" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Spain" "" "0" "" "" "" "" "00091383" "" "" "" "1" "" "00687" "{PMID:Voskarides 2007:17942953}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091384" "" "" "" "1" "" "00687" "{PMID:Nagel 2005:15954103}" "" "" "" "" "" "0" "" "" "" "" "00091385" "" "" "" "3" "" "00687" "{PMID:Voskarides 2007:17942953}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091386" "" "" "" "4" "" "00687" "{PMID:Pierides 2009:19357112}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091387" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091388" "" "" "" "2" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091389" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091390" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "" "" "Italy" "" "0" "" "" "" "" "00091391" "" "" "" "1" "" "00687" "{PMID:Badenas 2002:11961012}" "" "" "" "Spain" "" "0" "" "" "" "" "00091392" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "Italy" "" "0" "" "" "" "" "00091393" "" "" "" "1" "" "00687" "{PMID:Badenas 2002:11961012}" "" "" "" "Spain" "" "0" "" "" "" "" "00091394" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "F" "" "Spain" "" "0" "" "" "" "" "00091395" "" "" "" "1" "" "00687" "{PMID:Slajpah 2007:17396119}" "" "" "" "Slovenia" "" "0" "" "" "" "" "00091396" "" "" "" "1" "" "00687" "{PMID:Pescucci 2004:15086897}" "" "M" "" "Italy" "" "0" "" "" "" "" "00091397" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091398" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "F" "" "Italy" "" "0" "" "" "" "" "00091399" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091400" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "adopted, family not studied" "F" "" "Italy" "" "0" "" "" "" "" "00091401" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091402" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "" "" "Italy" "" "0" "" "" "" "" "00091403" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "M" "" "" "" "0" "" "" "" "" "00091404" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091405" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091406" "" "" "" "1" "" "00687" "{PMID:Nagel 2005:15954103}" "" "" "" "" "" "0" "" "" "" "" "00091407" "" "" "" "1" "" "00687" "{PMID:Slajpah 2007:17396119}" "" "F" "" "Slovenia" "" "0" "" "" "" "" "00091408" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091409" "" "" "" "1" "" "00687" "{PMID:Voskarides 2007:17942953}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091410" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "F" "" "Italy" "" "0" "" "" "" "" "00091411" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091412" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "F" "" "Spain" "" "0" "" "" "" "" "00091413" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "consanguineous" "M" "" "Spain" "" "0" "" "" "" "" "00091414" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091415" "" "" "" "1" "" "00687" "{PMID:Nagel 2005:15954103}" "" "" "" "" "" "0" "" "" "" "" "00091416" "" "" "" "1" "" "00687" "{PMID:Pescucci 2004:15086897}" "" "M" "" "Italy" "" "0" "" "" "" "" "00091417" "" "" "" "1" "" "00687" "{PMID:Voskarides 2007:17942953}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091418" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091419" "" "" "" "3" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091420" "" "" "" "1" "" "00687" "{PMID:Badenas 2002:11961012}" "" "" "" "Spain" "" "0" "" "" "" "" "00091421" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091422" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Spain" "" "0" "" "" "" "" "00091423" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091424" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091425" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091426" "" "" "" "7" "" "00687" "{PMID:Voskarides 2008:18439107}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091427" "" "" "" "6" "" "00687" "{PMID:Pierides 2009:19357112}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091428" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "Italy" "" "0" "" "" "" "" "00091429" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091430" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "M" "" "Spain" "" "0" "" "" "" "" "00091431" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091432" "" "" "" "1" "" "00687" "{PMID:Lemmink 1994:7987301}" "" "" "" "" "" "0" "" "" "" "" "00091433" "" "" "" "1" "" "00687" "{PMID:Lemmink 1994:7987301}" "" "" "" "" "" "0" "" "" "" "" "00091434" "" "" "" "1" "" "00687" "{PMID:Lemmink 1994:7987301}" "" "" "" "" "" "0" "" "" "" "" "00091435" "" "" "" "1" "" "00687" "{PMID:Van der Loop (2000) Kidney Int 58, 1870:11044206}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "Irish" "" "00091436" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Spain" "" "0" "" "" "" "" "00091437" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091438" "" "" "" "1" "" "00687" "{PMID:Badenas 2002:11961012}" "" "" "" "Spain" "" "0" "" "" "" "" "00091439" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091440" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "" "" "Italy" "" "0" "" "" "" "" "00091441" "" "" "" "1" "" "00687" "{PMID:Ding 1995:7780062}" "2-generation family, affected female, unaffected heterozygous carrier parents" "F" "" "" "" "0" "" "" "" "" "00091442" "" "" "" "1" "" "00687" "{PMID:Mochizuki 1994:7987396}" "" "F" "" "Netherlands" "" "0" "" "" "" "" "00091443" "" "" "" "1" "" "00687" "{PMID:Lemmink 1994:7987301}" "" "" "" "" "" "0" "" "" "" "" "00091444" "" "" "" "1" "" "00687" "{PMID:Mochizuki 1994:7987396}" "consanguineous" "F" "" "" "" "0" "" "" "Belgian" "" "00091445" "" "" "" "1" "" "00687" "{PMID:Lemmink 1994:7987301}" "" "" "" "" "" "0" "" "" "" "" "00091446" "" "" "" "1" "" "00687" "{PMID:Knebelman 1995:7633417}" "" "M" "" "France" "" "0" "" "" "" "" "00091447" "" "" "" "1" "" "00687" "{PMID:Knebelman 1995:7633417}" "" "F" "" "France" "" "0" "" "" "" "" "00091448" "" "" "" "1" "" "00687" "{PMID:Longo 2002:12028435}" "" "" "" "Italy" "" "0" "" "" "" "" "00091449" "" "" "" "4" "" "00687" "{PMID:Longo 2002:12028435}" "" "" "" "Italy" "" "0" "" "" "" "" "00091450" "" "" "" "1" "" "00687" "{PMID:Voskarides 2007:17942953}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091451" "" "" "" "1" "" "00687" "{PMID:Wang 2004:14871398}" "" "" "" "" "" "0" "" "" "" "" "00091452" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Spain" "" "0" "" "" "" "" "00091453" "" "" "" "1" "" "00687" "{PMID:Nagel 2005:15954103}" "" "" "" "" "" "0" "" "" "" "" "00091454" "" "" "" "2" "" "00687" "{PMID:Cook 2008:18436078}" "" "F" "" "United States" "" "0" "" "" "African American" "" "00091455" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091456" "" "" "" "1" "" "00687" "{PMID:Nagel 2005:15954103}" "" "" "" "" "" "0" "" "" "" "" "00091457" "" "" "" "2" "" "00687" "{PMID:Cook 2008:18436078}" "Father is a carrier-asymptomatic)" "F" "" "United States" "" "0" "" "" "African American" "" "00091458" "" "" "" "1" "" "00687" "{PMID:Tazon Vega 2003:14582039}" "consanguineous" "F" "" "Spain" "" "0" "" "" "" "" "00091459" "" "" "" "1" "" "00687" "{PMID:Voskarides 2007:17942953}" "" "" "" "Cyprus" "" "0" "" "" "Greek-Cypriot" "" "00091460" "" "" "" "1" "" "00687" "{PMID:Heidet 2001:11134255}" "" "" "" "" "" "0" "" "" "" "" "00091461" "" "" "" "1" "" "00687" "{PMID:Hoefele 2010:20177710}" "" "M" "" "Italy" "" "0" "" "" "" "" "00091462" "" "" "" "1" "" "00687" "{PMID:Hoefele 2010:20177710}" "" "M" "" "Italy" "" "0" "" "" "" "" "00091463" "" "" "" "1" "" "00687" "{PMID:Hoefele 2010:20177710}" "" "M" "" "Italy" "" "0" "" "" "" "" "00091464" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091465" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091466" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091467" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091468" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091469" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091470" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091471" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091472" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091473" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091474" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091475" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091476" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091477" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091478" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091479" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091480" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091481" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091482" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091483" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091484" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091485" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091486" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091487" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091488" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091489" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091490" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091491" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091492" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091493" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091494" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091495" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091496" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091497" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091498" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091499" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091500" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091501" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091502" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091503" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091504" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091505" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091506" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091507" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091508" "" "" "" "1" "" "00687" "" "" "" "" "" "" "0" "" "" "" "" "00091509" "" "" "" "1" "" "01545" "" "COL4A3 variant present in mother (haematuria), sister (haematuria, mild proteinuria and FSGS), brother (ESRF and FSGS), daughter (haematuria)." "F" "" "" "" "0" "" "" "Britain/Spain" "" "00091510" "" "" "" "1" "" "01545" "+" "Additional relatives with deafness and haematuria." "F" "" "" "" "0" "" "" "British" "" "00091511" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "M" "" "" "" "0" "" "" "English" "" "00091512" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "F" "" "" "" "0" "" "" "English" "" "00091513" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "F" "" "" "" "0" "" "" "" "" "00091514" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "M" "" "" "" "0" "" "" "" "" "00091515" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "Dec‚Äôd" "M" "" "" "" "0" "" "" "" "" "00091516" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "M" "" "" "" "0" "" "" "" "" "00091517" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "M" "" "" "" "0" "" "" "English" "" "00091518" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "M" "" "" "" "0" "" "" "" "" "00091519" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "F" "" "" "" "0" "" "" "" "" "00091520" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "F" "" "" "" "0" "" "" "" "" "00091521" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "F" "" "" "" "0" "" "" "" "" "00091522" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Mixed British" "" "00091523" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "F" "" "" "" "0" "" "" "English" "" "00091524" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "M" "" "India" "" "0" "" "" "Punjabi" "" "00091525" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "M" "" "" "" "0" "" "" "" "" "00091526" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "M" "" "Australia" "" "0" "" "" "Tasmanian, British origin" "" "00091527" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "F" "" "Australia" "" "0" "" "" "British" "" "00091528" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "F" "" "Australia" "" "0" "" "" "British" "" "00091529" "" "" "" "1" "" "00466" "{PMID:Storey 2013:24052634}" "" "F" "" "Australia" "" "0" "" "" "British" "" "00091530" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091531" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091532" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091533" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091534" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091535" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091536" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091537" "" "" "" "1" "" "00687" "Judy Savige" "" "M" "" "" "" "0" "" "" "British" "" "00091538" "" "" "" "1" "" "00687" "Judy Sacvige" "" "M" "" "" "" "0" "" "" "British" "" "00091539" "" "" "" "1" "" "00687" "Judy Savige" "" "M" "" "" "" "0" "" "" "British" "" "00091540" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091541" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091542" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091543" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091544" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091545" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091546" "" "" "" "1" "" "00687" "Judy Savige" "" "" "" "" "" "0" "" "" "" "" "00091547" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091548" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091549" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091550" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091551" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091552" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091553" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091554" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091555" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091556" "" "" "" "1" "" "00687" "Judy Savige" "" "F" "" "" "" "0" "" "" "British" "" "00091557" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091558" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091559" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091560" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091561" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091562" "" "" "" "1" "" "00687" "Matonagel" "kam nur in Verbindung mit zwei heterozygoten COL4A3 Mutationen vor" "" "" "" "" "0" "" "" "" "" "00091563" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091564" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091565" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091566" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091567" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091568" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091569" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091570" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091571" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091572" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091573" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091574" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091575" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091576" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091577" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091578" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091579" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091580" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091581" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091582" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091583" "" "" "" "1" "" "00687" "Judy Savige" "" "M" "" "Italy" "" "0" "" "" "" "" "00091584" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091585" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091586" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091587" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091588" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091589" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091590" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091591" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091592" "" "" "" "1" "" "00687" "Judy Savige" "" "F" "" "" "" "0" "" "" "British" "" "00091593" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091594" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091595" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091596" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091597" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091598" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091599" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091600" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091601" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091602" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091603" "" "" "" "1" "" "00687" "Judy Savige" "" "M" "" "" "" "0" "" "" "British" "" "00091604" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091605" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091606" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091607" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091608" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091609" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091610" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091611" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091612" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091613" "" "" "" "1" "" "00687" "Judy Savige" "" "F" "" "" "" "0" "" "" "British" "" "00091614" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091615" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091616" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091617" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091618" "" "" "" "1" "" "00687" "Judy Savige" "" "F" "" "" "" "0" "" "" "British" "" "00091619" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091620" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091621" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091622" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091623" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091624" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091625" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091626" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091627" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091628" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091629" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091630" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091631" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091632" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091633" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091634" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091635" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091636" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091637" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091638" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091639" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091640" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091641" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091642" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091643" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091644" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091645" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091646" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091647" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091648" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091649" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091650" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091651" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091652" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091653" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091654" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091655" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091656" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091657" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091658" "" "" "" "1" "" "00687" "Matonagel" "kam nur in Verbindung mit zwei heterozygoten COL4A3 Mutationen vor" "" "" "" "" "0" "" "" "" "" "00091659" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091660" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091661" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091662" "" "" "" "1" "" "00687" "Matonagel" "" "" "" "" "" "0" "" "" "" "" "00091663" "" "" "" "1" "" "00687" "Judy Savige" "" "F" "" "" "" "0" "" "" "British" "" "00091664" "" "" "" "1" "" "01548" "" "" "F" "" "Hungary" "" "0" "" "" "" "" "00091666" "" "" "" "1" "" "01548" "" "" "F" "" "Hungary" "" "0" "" "" "" "" "00091667" "" "" "" "1" "" "01548" "" "" "M" "" "Hungary" "" "0" "" "" "" "" "00091668" "" "" "" "1" "" "01548" "" "" "F" "" "Hungary" "" "0" "" "" "" "" "00103989" "" "" "" "1" "" "00587" "{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}" "54 patients from 53 families with genetically unexplained diffuse-type and intestinal-type gastric cancer" "" "" "" "" "0" "" "" "" "Vogelaar-005A" "00152713" "" "" "" "1" "" "02367" "" "" "F" "no" "Czech Republic" "23y" "0" "" "" "" "" "00152714" "" "" "" "1" "" "02367" "" "" "F" "no" "Czech Republic" "39y" "0" "" "" "" "" "00152716" "" "" "" "2" "" "02367" "" "" "F" "no" "Czech Republic" "52y" "0" "" "" "" "" "00153301" "" "" "" "1" "" "02367" "" "3-generation family, 8 affected (4F, 4M)" "F" "yes" "Czech Republic" "46y" "0" "" "" "" "" "00153308" "" "" "" "2" "" "02367" "" "3-generation family" "F" "no" "Czech Republic" "09y" "" "" "" "white" "" "00153319" "" "" "" "1" "" "02367" "" "sporadic case" "F" "no" "Czech Republic" "06y" "" "" "" "" "" "00153325" "" "" "" "1" "" "02367" "" "" "F" "?" "Czech Republic" "30y" "" "" "" "white" "" "00153395" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153400" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153401" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153402" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153405" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153408" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153409" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153412" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153413" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153414" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153421" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153428" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153429" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153431" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153432" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153436" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153437" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153440" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153442" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153445" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153453" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153455" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153456" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153459" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153461" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153462" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153463" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153468" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153472" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153480" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153481" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153483" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153484" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153485" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153494" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153500" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153503" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153505" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153507" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153523" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153531" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153540" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153553" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153554" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153559" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153562" "" "" "" "1" "" "00687" "" "" "F" "" "Germany" "" "0" "" "" "" "" "00153564" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153569" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153571" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153582" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153583" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153584" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153587" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153588" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153592" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153594" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153603" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153605" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153606" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153607" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153609" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153617" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153619" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153624" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153631" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153638" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153640" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153645" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153646" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153647" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153652" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153662" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153663" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153665" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153669" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153671" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153672" "" "" "" "1" "" "00687" "" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153680" "" "" "" "1" "" "00687" "" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153681" "" "" "" "1" "" "00687" "{PMID:Uzak 2013:23297803}" "Diagnosed at 11 years. Three of her relatives also diagnosed as Alport syndrome, progressed to ESRD" "M" "" "Turkey" "" "0" "" "" "Turkish" "" "00153682" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "M" "" "Germany" "" "0" "" "" "" "" "00153683" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153684" "" "" "" "1" "" "00687" "{PMID:Chatterjee 2013:24130771}, {DOI:Chatterjee 2013:10.1371/journal.pone.0076360}" "25 yo with FH of haematuria. Presented at age 2 yo, developed proteinuria at 7. Renal biopsy confirmed Alport syndrome. By age 10, she had a hearing loss. At 21, macular flecks. This deletion has been reported previously in Alport syndrome. The 24 bp deletion removes 8 aa from the signal peptide, possibly altering COL4A3 secretion, as predicted by three different programs." "F" "" "Italy" "" "0" "" "" "Italian" "" "00153685" "" "" "" "3" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "3-generation family, 3 affecteds (3M), father and paternal uncle died with ESRF" "M" "" "" "" "0" "" "" "Europe" "" "00153686" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00153687" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00153688" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00153689" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153690" "" "" "" "1" "" "00687" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Hungary" "" "0" "" "" "Hungarian" "" "00153691" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00153692" "" "" "" "1" "" "00687" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Hungary" "" "0" "" "" "Hungarian" "" "00153693" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153694" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153695" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "Mother, maternal grandmother, and several maternal uncles on dialysis" "F" "" "Germany" "" "0" "" "" "" "" "00153696" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153697" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153698" "" "" "" "1" "" "00687" "{PMID:Rosado 2015:26277931}, {DOI:Rosado 2015:10.1159/000368519}" "Hematuria at age of 2, proteinuria and CKD at 32, hearing loss at 46. Son had hematuria and proteinuria at 6, and hearing loss and anterior lenticonus at 9, CKD at 19" "F" "" "Spain" "" "0" "" "" "Spanish" "" "00153699" "" "" "" "1" "" "00687" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Hungary" "" "0" "" "" "Hungarian" "" "00153700" "" "" "" "1" "" "00687" "{PMID:Malone 2014:25229338}, {DOI:Malone 2014:10.1038/ki.2014.305}" "two affected siblings (2F)" "F" "" "United States" "" "0" "" "" "white" "" "00153701" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153702" "" "" "" "1" "" "00687" "" "" "F" "" "China" "" "0" "" "" "Chinese" "" "00153703" "" "" "" "1" "" "00687" "{PMID:Malone 2014:25229338}, {DOI:Malone 2014:10.1038/ki.2014.305}" "" "F" "" "United States" "" "0" "" "" "white" "" "00153704" "" "" "" "1" "" "00687" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Hungary" "" "0" "" "" "Hungarian" "" "00153705" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153706" "" "" "" "1" "" "00687" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Hungary" "" "0" "" "" "Hungarian" "" "00153707" "" "" "" "1" "" "00687" "" "" "M" "" "Germany" "" "0" "" "" "African American" "" "00153708" "" "" "" "1" "" "00687" "" "" "F" "" "Germany" "" "0" "" "" "European" "" "00153709" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00153710" "" "" "" "1" "" "00687" "" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00153711" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Italy" "" "0" "" "" "Italian" "" "00153712" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153713" "" "" "" "1" "" "00687" "" "" "F" "" "China" "" "0" "" "" "Chinese" "" "00153714" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153715" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "F" "" "" "" "0" "" "" "Europe" "" "00153716" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "F" "" "" "" "0" "" "" "Europe" "" "00153717" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "Maternal cousin on dialysis; several maternal family members with Thin basement membrane nephropathy" "F" "" "Spain" "" "0" "" "" "" "" "00153718" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153719" "" "" "" "1" "" "00687" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Hungary" "" "0" "" "" "Hungarian" "" "00153720" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153721" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Italy" "" "0" "" "" "Italian" "" "00153722" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00153723" "" "" "" "1" "" "00687" "{PMID:Adam 2014:24944784}, {DOI:Adam 2014:10.1093/ckj/sft144}" "Index case, her sister and two of her three daughters were heterozygotes for this variant" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153724" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153725" "" "" "" "1" "" "00687" "" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00153726" "" "" "" "1" "" "00687" "" "" "F" "" "Germany" "" "0" "" "" "European" "" "00153727" "" "" "" "1" "" "00687" "{PMID:Sirisena 2015:26194984}, {DOI:Sirisena 2015:10.1111/nep.12430}" "The third degree consanguineous parents each had a heterozygous form. 3 younger sisters of the proband (aged 11, 10 and 4.5 years) had haematuria and proteinuria with normal renal function." "M" "" "Sri Lanka" "" "0" "" "" "Sri Lankan" "" "00153728" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "M" "yes" "Turkey" "" "0" "" "" "" "" "00153729" "" "" "" "1" "" "00687" "" "" "F" "" "Germany" "" "0" "" "" "German" "" "00153730" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Italy" "" "0" "" "" "Italian" "" "00153731" "" "" "" "1" "" "00687" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Hungary" "" "0" "" "" "Hungarian" "" "00153732" "" "" "" "1" "" "00687" "" "" "F" "" "China" "" "0" "" "" "Chinese" "" "00153733" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153734" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153735" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00153736" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "Brother with Thin basement membrane nephropathy" "F" "" "Germany" "" "0" "" "" "" "" "00153737" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "Her mother at 64 yo with c.1504+1g>a, hematuria, no hearing loss; her father aged 80 with c.1293_1310del; p.Lys434_Gly439del, ESRD at 64. 7 paternal family members with c.1293_1310del; p.Lys434_Gly439del mutation 3 ESRD at 50, 60 and 64; 4 CRF at 47, 69, 70 and 80. None of the 7 had a hearing loss" "F" "" "" "" "0" "" "" "Europe" "" "00153738" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "F" "" "" "" "0" "" "" "Europe" "" "00153739" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153740" "" "" "" "1" "" "00687" "" "" "M" "" "Germany" "" "0" "" "" "European" "" "00153741" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "His sister aged 60 has the same digenic mutations with hearing loss and had pre-emptive renal transplantation at 50 years. His two daughters, 23 and 20 years, each has one of the mutations, intermittent haematuria, no hearing loss" "M" "" "" "" "0" "" "" "Europe" "" "00153742" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "F" "" "" "" "0" "" "" "Europe" "" "00153743" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153744" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "Brother with Alport syndrome" "M" "" "Germany" "" "0" "" "" "" "" "00153745" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "F" "" "Germany" "" "0" "" "" "" "" "00153746" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "Maternal family members clinically and genetically unremarkable, paternal side not available" "F" "" "Germany" "" "0" "" "" "" "" "00153748" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Italy" "" "0" "" "" "Italian" "" "00153749" "" "" "" "1" "" "00687" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Hungary" "" "0" "" "" "Hungarian" "" "00153750" "" "" "" "1" "" "00687" "" "" "F" "" "Germany" "" "0" "" "" "German" "" "00153751" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00153752" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153753" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "Daughter with Thin basement membrane nephropathy" "F" "" "Germany" "" "0" "" "" "" "" "00153754" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00153755" "" "" "" "1" "" "00687" "" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00153756" "" "" "" "1" "" "00687" "" "" "F" "" "Germany" "" "0" "" "" "Asian (Arab)" "" "00153757" "" "" "" "1" "" "00687" "" "" "F" "" "Germany" "" "0" "" "" "Asian (Arab)" "" "00153758" "" "" "" "1" "" "00687" "" "" "M" "" "Germany" "" "0" "" "" "European" "" "00153759" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "Father with ESRD at 50 years" "M" "" "Germany" "" "0" "" "" "" "" "00153760" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153761" "" "" "" "1" "" "00687" "" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00153762" "" "" "" "1" "" "00687" "{PMID:Malone 2014:25229338}, {DOI:Malone 2014:10.1038/ki.2014.305}" "" "F" "" "United States" "" "0" "" "" "white" "" "00153763" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "Her mother had c.2065g>a, hematuria, no hearing loss; her father had c.1459+1g>a, no hematuria, no hearing loss." "F" "" "" "" "0" "" "" "Europe" "" "00153764" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "F" "" "" "" "0" "" "" "Europe" "" "00153765" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153766" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00153767" "" "" "" "1" "" "00687" "" "" "M" "" "Germany" "" "0" "" "" "German" "" "00153768" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153769" "" "" "" "1" "" "00687" "{PMID:Lin 2014:25381091}, {DOI:Lin 2014:10.1186/1471-2369-15-175}" "hematuria and proteinuria in 30s, Focal and segmental glomerulosclerosis at 39, CKD stage 4 at 45." "M" "" "China" "" "0" "" "" "Chinese" "" "00153770" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153771" "" "" "" "1" "" "00687" "" "" "M" "" "Germany" "" "0" "" "" "European" "" "00153772" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00153773" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00153774" "" "" "" "1" "" "00687" "{PMID:Uchida 2016:27904025}, {DOI:Uchida 2016:10.1620/tjem.240.251}" "Hematuria since infancy, RAAS blockade was initiated aged 9 because of proteinuria. Proband\'s father has homozygous c.4354A>T mutation and diagnosed with AR AS, ESRD at 30s. Proband\'s mother (heterozygous c.2330g>a) was asymptomatic. Proband and his elder brother and sister shared the same compound heterozygous genetic mutations in COL4A3 and had diverse clinical courses depending on the disease stage at which RAAS blockade was initiated." "M" "" "Japan" "" "0" "" "" "Japanese" "" "00153775" "" "" "" "1" "" "00687" "" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00153776" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153777" "" "" "" "1" "" "00687" "" "" "M" "" "Germany" "" "0" "" "" "European" "" "00153778" "" "" "" "1" "" "00687" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Hungary" "" "0" "" "" "Hungarian" "" "00153779" "" "" "" "1" "" "00687" "" "" "F" "" "China" "" "0" "" "" "Chinese" "" "00153780" "" "" "" "1" "" "00687" "{PMID:Gast 201610.1093/ndt/gfv325}, {DOI:Gast 2016:10.1093/ndt/gfv325}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153781" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "three siblings with Alport syndrome" "M" "" "Austria" "" "0" "" "" "" "" "00153782" "" "" "" "1" "" "00687" "" "" "F" "" "Germany" "" "0" "" "" "European" "" "00153783" "" "" "" "1" "" "00687" "" "" "F" "" "Germany" "" "0" "" "" "European" "" "00153784" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00153785" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153786" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "M" "" "" "" "0" "" "" "Europe" "" "00153787" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "F" "" "" "" "0" "" "" "Europe" "" "00153788" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153789" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "Father had ESRF, on dialysis." "F" "" "Germany" "" "0" "" "" "" "" "00153790" "" "" "" "1" "" "00687" "{PMID:Imafuku 2017:28704582}, {DOI:Imafuku 2017:10.1111/nep.13115}" "Hematuria and proteinuria at 6" "M" "" "Japan" "" "0" "" "" "" "" "00153791" "" "" "" "1" "" "00687" "" "" "M" "" "Germany" "" "0" "" "" "European" "" "00153792" "" "" "" "1" "" "00687" "" "" "F" "" "Germany" "" "0" "" "" "European" "" "00153793" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153794" "" "" "" "1" "" "00687" "" "" "F" "" "China" "" "0" "" "" "Chinese" "" "00153795" "" "" "" "1" "" "00687" "" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00153796" "" "" "" "1" "" "00687" "{PMID:Liu 2017:28542346}, {DOI:Liu 201:/10.1371/journal.pone.0177685}" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00153797" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153798" "" "" "" "1" "" "00687" "" "" "F" "" "China" "" "0" "" "" "Chinese" "" "00153799" "" "" "" "1" "" "00687" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Hungary" "" "0" "" "" "Hungarian" "" "00153800" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153801" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00153802" "" "" "" "1" "" "00687" "" "" "F" "" "Germany" "" "0" "" "" "European" "" "00153803" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Italy" "" "0" "" "" "Italian" "" "00153804" "" "" "" "1" "" "00687" "{PMID:Fu 2014:27081500}, {DOI:Fu 2014:10.1038/hgv.2014.6}" "Kidney transplant at age 22. Mother had mild proteinuria, normal renal function, normal audiogram and no ocular abnormalities. No other family member with kidney disease" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00153805" "" "" "" "1" "" "00687" "{PMID:Imafuku 2017:28704582}, {DOI:Imafuku 2017:10.1111/nep.13115}" "Hematuria at 44, proteinuria at 44" "F" "" "Japan" "" "0" "" "" "" "" "00153806" "" "" "" "1" "" "00687" "{PMID:Imafuku 2017:28704582}, {DOI:Imafuku 2017:10.1111/nep.13115}" "Hematuria at 13, proteinuria at 13" "M" "" "Japan" "" "0" "" "" "" "" "00153807" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153808" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00153809" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "Father with Thin basement membrane nephropathy and hearing loss, brother with Thin basement membrane nephropathy" "F" "" "Germany" "" "0" "" "" "" "" "00153810" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Italy" "" "0" "" "" "Italian" "" "00153811" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "Mother with Alport syndrome" "F" "" "Germany" "" "0" "" "" "" "" "00153812" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153813" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00153814" "" "" "" "1" "" "00687" "" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00153815" "" "" "" "1" "" "00687" "{PMID:Liu 2017:28542346}, {DOI:Liu 201:/10.1371/journal.pone.0177685}" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00153816" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "More severe phenotype than single mutation. Proband developed ESRF by 34 years." "F" "" "Italy" "" "0" "" "" "" "" "00153817" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "Proband developed ESRF by 52 years." "M" "" "Italy" "" "0" "" "" "" "" "00153819" "" "" "" "1" "" "00687" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Hungary" "" "0" "" "" "Hungarian" "" "00153820" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Italy" "" "0" "" "" "Italian" "" "00153821" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153822" "" "" "" "1" "" "00687" "{PMID:Liu 2017:28542346}, {DOI:Liu 201:/10.1371/journal.pone.0177685}" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00153823" "" "" "" "1" "" "00687" "{PMID:Truong 2017:26628280}, {DOI:Truong 2017:10.1007/s00467-015-3268-2}" "2-generation family, 1 affected, asymptomatic heterozygous carrier parents" "M" "" "France" "" "0" "" "" "" "" "00153824" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153825" "" "" "" "1" "" "00687" "{PMID:Imafuku 2017:28704582}, {DOI:Imafuku 2017:10.1111/nep.13115}" "Hematuria at 5, proteinuria at 7" "M" "" "Japan" "" "0" "" "" "" "" "00153826" "" "" "" "1" "" "00687" "{PMID:Rosado 2015:26277931}, {DOI:Rosado 2015:10.1159/000368519}" "" "F" "" "Spain" "" "0" "" "" "white" "" "00153827" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "Klinefelter sydnrome" "M" "" "Germany" "" "0" "" "" "" "" "00153828" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "F" "" "Germany" "" "0" "" "" "" "" "00153829" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153830" "" "" "" "1" "" "00687" "{PMID:Chatterjee 2013:24130771}, {DOI:Chatterjee 2013:10.1371/journal.pone.0076360}" "" "M" "" "Germany" "" "0" "" "" "German" "" "00153831" "" "" "" "1" "" "00687" "{PMID:Chatterjee 2013:24130771}, {DOI:Chatterjee 2013:10.1371/journal.pone.0076360}" "" "F" "" "Germany" "" "0" "" "" "German" "" "00153832" "" "" "" "1" "" "00687" "{PMID:Gast 2016:26346198}, {DOI:Gast 2016:10.1093/ndt/gfv325}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00153833" "" "" "" "1" "" "00687" "{PMID:Malone 2014:25229338}, {DOI:Malone 2014:10.1038/ki.2014.305}" "" "M" "" "United States" "" "0" "" "" "white" "" "00153834" "" "" "" "2" "" "00687" "{PMID:Kaimori 2013:28509228}, {DOI:Kaimori 2013:10.1007/s13730-012-0049-7}" "2-generation family, affected brother/sister, unaffected heterozygous carrier parents" "M" "" "Japan" "" "0" "" "" "" "28509228-Fam" "00153835" "" "" "00153834" "1" "" "00687" "{PMID:Kaimori 2013:28509228}, {DOI:Kaimori 2013:10.1007/s13730-012-0049-7}" "sister" "F" "" "Japan" "" "0" "" "" "" "28509228-FamPat2" "00153836" "" "" "" "1" "" "00687" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00153837" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "F" "" "Italy" "" "0" "" "" "" "" "00153838" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153839" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153840" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153841" "" "" "" "1" "" "00687" "" "" "M" "" "Germany" "" "0" "" "" "African American" "" "00153842" "" "" "" "1" "" "00687" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "M" "yes" "Turkey" "" "0" "" "" "" "" "00153843" "" "" "" "1" "" "00687" "{PMID:Malone 2014:25229338}, {DOI:Malone 2014:10.1038/ki.2014.305}" "" "M" "" "United States" "" "0" "" "" "white" "" "00153844" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "Father died at 21 with ESRF, index case developed ESRF at 40 with hearing loss; her mother has neither mutation" "F" "" "" "" "0" "" "" "Europe" "" "00153845" "" "" "" "1" "" "00687" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "France" "" "0" "" "" "" "" "00153870" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "proband (subject II:2) progressed toward renal insufficiency at 34 years" "F" "" "Italy" "" "0" "" "" "" "" "00153878" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "F" "" "" "" "0" "" "" "Europe" "" "00153885" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "Her mother with c.2065G>A has haematuria, no hearing loss; her father with c.1459+1G>A, has no haematuria and no hearing loss." "F" "" "" "" "0" "" "" "Europe" "" "00153890" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "M" "" "" "" "0" "" "" "Europe" "" "00153923" "" "" "" "1" "" "00687" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Hungary" "" "0" "" "" "Hungarian" "" "00153937" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "Father developed CRF at 21, ESRD at 40 with hearing loss; her mother has neither of the 2 mutations" "F" "" "" "" "0" "" "" "Europe" "" "00153948" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "F" "" "" "" "0" "" "" "Europe" "" "00153952" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "index case (subject III:1) developed renal insufficiency at 52 years" "M" "" "Italy" "" "0" "" "" "" "" "00153975" "" "" "" "1" "" "00687" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "His sister aged 60 years, has the same digenic mutations with hearing loss and had pre-emptive renal transplantation at 50 years. His two daughters, 23 and 20 years, each has one of the mutations, intermittent haematuria, no hearing loss." "M" "" "" "" "0" "" "" "Europe" "" "00153984" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "F" "" "Italy" "" "0" "" "" "" "" "00154125" "" "" "" "1" "" "00687" "{PMID:Feltran 2017:28658201}, {DOI:Feltran 2017:10.1097/TP.0000000000001846}" "" "M" "" "Brazil" "" "0" "" "" "white" "" "00154162" "" "" "" "1" "" "00687" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "Combined with a COL4A3 mutation inherited from the unaffected father. Proband presents with a severe phenotype in relation to age (8 years), with haematuria and proteinuria. Both her father (44 years) and her sister (7 years) have only a COL4A3 mutation and are asymptomatic" "F" "" "Italy" "" "0" "" "" "" "" "00154292" "" "" "" "1" "" "00687" "" "" "F" "" "" "" "0" "" "" "Okinawan, white, Japanese, Chinese, Filipino" "" "00154351" "" "" "" "1" "" "00687" "Barker, 2001" "" "F" "" "" "" "0" "" "" "" "" "00154358" "" "" "" "1" "" "00687" "King, 2006, Zhou, 1992" "" "F" "" "Scotland" "" "0" "" "" "Scottish" "" "00154484" "" "" "" "1" "" "00006" "{PMID:Zhang 2011:21143337}" "" "" "" "China" "" "0" "" "" "" "21143337-Fam5" "00218348" "" "" "" "1" "" "02476" "" "" "F" "no" "Argentina" "" "0" "" "" "" "" "00234339" "" "" "" "1" "" "02473" "" "" "F" "?" "Pakistan" "30y" "0" "" "" "" "John Sayer" "00245757" "" "" "" "3" "" "03128" "{PMID:Daga 2020:31754267}, {DOI:Daga 2020:10.1038/s41431-019-0537-8}, {PMID:Daga 2024:36653516}, {DOI:Daga 2024:10.1038/s41431-023-01287-y}" "2-generation family, affected mother/daughter/son" "F" "no" "Italy" "" "0" "" "" "" "3459/18ats" "00292622" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00292623" "" "" "" "118" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00292624" "" "" "" "22" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00292625" "" "" "" "94" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00296663" "" "" "" "1" "" "02367" "" "" "M" "?" "Czech Republic" "10y" "" "" "" "Ukrainian" "" "00296664" "" "" "" "1" "" "02367" "" "" "M" "?" "Czech Republic" "32y" "" "" "" "" "" "00296665" "" "" "" "1" "" "02367" "" "" "M" "-" "Czech Republic" "44y" "" "" "" "" "" "00301049" "" "" "" "1" "" "03641" "" "" "M" "no" "Germany" "35y" "0" "" "" "" "" "00304793" "" "" "" "4" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304794" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00327056" "" "" "" "1" "" "03611" "{PMID:Kim 2022:35864128}, {DOI:Kim 2022:10.1038/s41598-022-16661-x}" "" "" "" "Korea, South (Republic)" "" "0" "" "" "" "SB300-602" "00374274" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-3030" "00375231" "" "" "" "1" "" "04087" "" "" "F" "no" "Germany" "" "0" "" "" "" "" "00375232" "" "" "" "1" "" "04087" "" "" "M" "no" "Serbia" "" "" "" "" "" "" "00375234" "" "" "" "1" "" "04087" "" "" "M" "no" "Serbia" "" "" "" "" "" "" "00375244" "" "" "" "1" "" "04087" "" "" "M" "?" "" "" "" "" "" "" "" "00375245" "" "" "" "1" "" "04087" "" "" "M" "?" "" "" "" "" "" "" "" "00395046" "" "" "" "1" "" "00000" "{PMID:Zacchia 2021:33964006}" "" "" "" "(Italy)" "" "0" "" "" "" "K109" "00402954" "" "" "" "1" "" "04087" "" "" "M" "" "" "" "" "" "" "" "" "00402991" "" "" "" "1" "" "04087" "" "" "F" "" "" "" "" "" "" "" "13330344" "00402992" "" "" "" "1" "" "04087" "" "" "F" "" "" "" "" "" "" "" "12200453" "00402993" "" "" "" "1" "" "04087" "" "" "M" "" "" "" "" "" "" "" "10400099" "00402994" "" "" "" "1" "" "04087" "" "" "M" "" "" "" "" "" "" "" "10480239" "00402995" "" "" "" "1" "" "04087" "" "" "F" "" "" "" "" "" "" "" "10360333" "00408113" "" "" "" "1" "" "01164" "" "" "M" "?" "Germany" "" "0" "" "" "" "195317" "00410576" "" "" "" "1" "" "00006" "{PMID:Schuermans 2022:35606766}" "analysis 329 adult patients suffering from undiagnosed rare disease" "M" "" "Belgium" "" "0" "" "" "" "Pat38" "00414456" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "F" "" "China" "" "0" "" "" "" "WHP123" "00414472" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "M" "" "China" "" "0" "" "" "" "WHP139" "00418508" "" "" "" "1" "" "00006" "{PMID:He 2022:35121647}" "" "" "" "China" "" "0" "" "" "" "Fam5" "00428007" "" "" "" "1" "" "00006" "{PMID:Bournazos 2022:34906502}" "family, 1 affected" "" "" "Australia" "" "0" "" "" "" "A120" "00433382" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433383" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433384" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433385" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433386" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433387" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433388" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433389" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433390" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433391" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433392" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433393" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433394" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433395" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433396" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433397" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "" "" "" "Czech Republic" "" "0" "" "" "" "" "00433429" "" "" "" "1" "" "00006" "{PMID:Plevova 2023:36844206}" "female with one Romani parent" "" "" "Czech Republic" "" "0" "" "" "Romani" "" "00433433" "" "" "" "7" "" "00006" "{PMID:Plevova 2023:36844206}" "7 cases" "" "" "Czech Republic" "" "0" "" "" "Romani" "" "00433434" "" "" "" "13" "" "00006" "{PMID:Plevova 2023:36844206}" "13 cases" "" "" "Czech Republic" "" "0" "" "" "Romani" "" "00441514" "" "" "" "1" "" "00006" "{PMID:Boucher 2020:33229591}" "" "" "" "France" "" "0" "" "" "" "4011" "00441515" "" "" "" "1" "" "00006" "{PMID:Boucher 2020:33229591}" "" "" "" "France" "" "0" "" "" "" "6590" "00441516" "" "" "" "1" "" "00006" "{PMID:Boucher 2020:33229591}" "" "" "" "France" "" "0" "" "" "" "6673" "00444032" "" "" "" "1" "" "04609" "" "" "F" "no" "Italy" "" "" "" "" "White" "5813/21" "00444033" "" "" "" "1" "" "04609" "" "" "F" "no" "Italy" "" "" "" "" "White" "472/23" "00444034" "" "" "" "1" "" "04609" "" "" "M" "no" "Italy" "" "" "" "" "" "6927/23" "00447444" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "USHII-366" "00448551" "" "" "" "1" "" "03676" "" "" "M" "no" "Egypt" "" "" "" "" "" "" "00467542" "" "" "" "1" "" "04656" "{PMID:Khan 2024:39271758}, {DOI:Khan 2024:10.1038/s41598-024-71407-1}" "family" "F" "yes" "Pakistan" "" "0" "" "" "" "IPK1" "00472317" "" "" "" "1" "" "04908" "" "" "F" "" "(Australia)" "" "" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 698 "{{individualid}}" "{{diseaseid}}" "00018452" "00399" "00018453" "00399" "00018844" "00198" "00091300" "00198" "00091301" "01644" "00091302" "01169" "00091303" "01644" "00091304" "01361" "00091305" "00198" "00091306" "01361" "00091307" "01644" "00091308" "01644" "00091309" "00198" "00091310" "01361" "00091311" "00198" "00091312" "00198" "00091313" "00198" "00091314" "00198" "00091315" "01361" "00091316" "01644" "00091317" "01644" "00091318" "01361" "00091319" "01361" "00091320" "00198" "00091321" "00198" "00091322" "01361" "00091323" "01361" "00091324" "01361" "00091325" "01361" "00091326" "01361" "00091327" "00198" "00091328" "01644" "00091329" "00198" "00091330" "00198" "00091331" "01361" "00091332" "01361" "00091333" "00198" "00091334" "01644" "00091335" "01361" "00091336" "01361" "00091337" "00198" "00091338" "00198" "00091339" "01644" "00091340" "01361" "00091341" "00198" "00091342" "01644" "00091343" "01644" "00091344" "01644" "00091345" "01644" "00091346" "01361" "00091347" "01361" "00091348" "01169" "00091349" "01644" "00091350" "00198" "00091351" "01361" "00091352" "01361" "00091353" "01361" "00091354" "01361" "00091355" "01361" "00091356" "01644" "00091357" "01361" "00091358" "01644" "00091359" "01361" "00091360" "01644" "00091361" "00198" "00091362" "01361" "00091363" "01361" "00091364" "01361" "00091365" "01644" "00091366" "01361" "00091367" "01644" "00091368" "01644" "00091369" "00198" "00091370" "01361" "00091371" "01361" "00091372" "01361" "00091373" "01644" "00091374" "01644" "00091375" "01361" "00091376" "01361" "00091377" "01361" "00091378" "01644" "00091379" "01361" "00091380" "01644" "00091381" "01644" "00091382" "00198" "00091383" "00198" "00091384" "01644" "00091385" "01644" "00091386" "01644" "00091387" "01644" "00091388" "01644" "00091389" "01361" "00091390" "01644" "00091391" "01361" "00091392" "01361" "00091393" "01361" "00091394" "01644" "00091395" "01361" "00091396" "01169" "00091397" "01644" "00091398" "01644" "00091399" "01644" "00091400" "01361" "00091401" "01361" "00091402" "01644" "00091403" "01644" "00091404" "01361" "00091405" "01644" "00091406" "01644" "00091407" "01361" "00091408" "01644" "00091409" "00198" "00091410" "01169" "00091411" "01644" "00091412" "01644" "00091413" "01644" "00091414" "01644" "00091415" "01644" "00091416" "01169" "00091417" "00198" "00091418" "01644" "00091419" "01644" "00091420" "01361" "00091421" "00198" "00091422" "00198" "00091423" "01644" "00091424" "01644" "00091425" "01644" "00091426" "01644" "00091427" "01644" "00091428" "01644" "00091429" "01644" "00091430" "01644" "00091431" "01644" "00091432" "01644" "00091433" "01644" "00091434" "01644" "00091435" "00198" "00091436" "00198" "00091437" "01644" "00091438" "01361" "00091439" "01361" "00091440" "01644" "00091441" "01644" "00091442" "01644" "00091443" "01644" "00091444" "01644" "00091445" "01644" "00091446" "01644" "00091447" "01644" "00091448" "01644" "00091449" "01644" "00091450" "01644" "00091451" "01361" "00091452" "00198" "00091453" "01644" "00091454" "01644" "00091455" "01644" "00091456" "01644" "00091457" "01644" "00091458" "01644" "00091459" "00198" "00091460" "01644" "00091461" "01361" "00091462" "01361" "00091463" "01361" "00091464" "00198" "00091465" "00198" "00091466" "00198" "00091467" "00198" "00091468" "00198" "00091469" "00198" "00091470" "00198" "00091471" "00198" "00091472" "00198" "00091473" "00198" "00091474" "00198" "00091475" "00198" "00091476" "00198" "00091477" "00198" "00091478" "00198" "00091479" "00198" "00091480" "00198" "00091481" "00198" "00091482" "00198" "00091483" "00198" "00091484" "00198" "00091485" "00198" "00091486" "00198" "00091487" "00198" "00091488" "00198" "00091489" "00198" "00091490" "00198" "00091491" "00198" "00091492" "00198" "00091493" "00198" "00091494" "00198" "00091495" "00198" "00091496" "00198" "00091497" "00198" "00091498" "00198" "00091499" "00198" "00091500" "00198" "00091501" "00198" "00091502" "00198" "00091503" "00198" "00091504" "00198" "00091505" "00198" "00091506" "00198" "00091507" "00198" "00091508" "00198" "00091509" "01361" "00091510" "01361" "00091511" "01644" "00091512" "01644" "00091513" "01644" "00091514" "01644" "00091515" "01644" "00091516" "01644" "00091517" "01644" "00091518" "01644" "00091519" "01644" "00091520" "01644" "00091521" "01644" "00091522" "01644" "00091523" "01644" "00091524" "01644" "00091525" "01644" "00091526" "01644" "00091527" "01644" "00091528" "01644" "00091529" "01644" "00091530" "00198" "00091531" "00198" "00091532" "00198" "00091533" "00198" "00091534" "00198" "00091535" "00198" "00091536" "00198" "00091537" "00198" "00091538" "00198" "00091539" "00198" "00091540" "00198" "00091541" "00198" "00091542" "00198" "00091543" "00198" "00091544" "00198" "00091545" "00198" "00091546" "00198" "00091547" "00198" "00091548" "00198" "00091549" "00198" "00091550" "00198" "00091551" "00198" "00091552" "00198" "00091553" "00198" "00091554" "00198" "00091555" "00198" "00091556" "00198" "00091557" "00198" "00091558" "00198" "00091559" "00198" "00091560" "00198" "00091561" "00198" "00091562" "00198" "00091563" "00198" "00091564" "00198" "00091565" "00198" "00091566" "00198" "00091567" "00198" "00091568" "00198" "00091569" "00198" "00091570" "00198" "00091571" "00198" "00091572" "00198" "00091573" "00198" "00091574" "00198" "00091575" "00198" "00091576" "00198" "00091577" "00198" "00091578" "00198" "00091579" "00198" "00091580" "00198" "00091581" "00198" "00091582" "00198" "00091583" "00198" "00091584" "00198" "00091585" "00198" "00091586" "00198" "00091587" "00198" "00091588" "00198" "00091589" "00198" "00091590" "00198" "00091591" "00198" "00091592" "00198" "00091593" "00198" "00091594" "00198" "00091595" "00198" "00091596" "00198" "00091597" "00198" "00091598" "00198" "00091599" "00198" "00091600" "00198" "00091601" "00198" "00091602" "00198" "00091603" "00198" "00091604" "00198" "00091605" "00198" "00091606" "00198" "00091607" "00198" "00091608" "00198" "00091609" "00198" "00091610" "00198" "00091611" "00198" "00091612" "00198" "00091613" "00198" "00091614" "00198" "00091615" "00198" "00091616" "00198" "00091617" "00198" "00091618" "00198" "00091619" "00198" "00091620" "00198" "00091621" "00198" "00091622" "00198" "00091623" "00198" "00091624" "00198" "00091625" "00198" "00091626" "00198" "00091627" "00198" "00091628" "00198" "00091629" "00198" "00091630" "00198" "00091631" "00198" "00091632" "00198" "00091633" "00198" "00091634" "00198" "00091635" "00198" "00091636" "00198" "00091637" "00198" "00091638" "00198" "00091639" "00198" "00091640" "00198" "00091641" "00198" "00091642" "00198" "00091643" "00198" "00091644" "00198" "00091645" "00198" "00091646" "00198" "00091647" "00198" "00091648" "00198" "00091649" "00198" "00091650" "00198" "00091651" "00198" "00091652" "00198" "00091653" "00198" "00091654" "00198" "00091655" "00198" "00091656" "00198" "00091657" "00198" "00091658" "00198" "00091659" "00198" "00091660" "00198" "00091661" "00198" "00091662" "00198" "00091663" "00198" "00091664" "01644" "00091666" "01361" "00091667" "01361" "00091668" "01361" "00103989" "03381" "00152713" "05132" "00152714" "05132" "00152716" "05132" "00153301" "05132" "00153308" "05132" "00153319" "05132" "00153325" "05132" "00153395" "01644" "00153400" "01644" "00153401" "01644" "00153402" "01644" "00153405" "01644" "00153408" "01644" "00153409" "01644" "00153412" "01644" "00153413" "01644" "00153414" "01644" "00153421" "01644" "00153428" "01644" "00153429" "01644" "00153431" "01644" "00153432" "01644" "00153436" "01644" "00153437" "01644" "00153440" "01644" "00153442" "01644" "00153445" "01644" "00153453" "01644" "00153455" "01644" "00153456" "01644" "00153459" "01644" "00153461" "01644" "00153462" "01644" "00153463" "01644" "00153468" "01644" "00153472" "01644" "00153480" "01644" "00153481" "01644" "00153483" "01644" "00153484" "01644" "00153485" "01644" "00153494" "01644" "00153500" "01644" "00153503" "01644" "00153505" "01644" "00153507" "01644" "00153523" "01644" "00153531" "01644" "00153540" "01644" "00153553" "01644" "00153554" "01644" "00153559" "01644" "00153562" "01644" "00153564" "01644" "00153569" "01644" "00153571" "01644" "00153582" "01644" "00153583" "01644" "00153584" "01644" "00153587" "01644" "00153588" "01644" "00153592" "01644" "00153594" "01644" "00153603" "01644" "00153605" "01644" "00153606" "01644" "00153607" "01644" "00153609" "01644" "00153617" "01644" "00153619" "01644" "00153624" "01644" "00153631" "01644" "00153638" "01644" "00153640" "01644" "00153645" "01644" "00153646" "01644" "00153647" "01644" "00153652" "01644" "00153662" "01644" "00153663" "01644" "00153665" "01644" "00153669" "01644" "00153671" "01644" "00153672" "01644" "00153680" "01644" "00153681" "01644" "00153682" "05132" "00153683" "01644" "00153684" "01644" "00153685" "01644" "00153686" "01644" "00153687" "01644" "00153688" "01644" "00153689" "01644" "00153690" "01644" "00153691" "01644" "00153692" "01644" "00153693" "01644" "00153694" "01644" "00153695" "05132" "00153696" "01644" "00153697" "01644" "00153698" "01169" "00153699" "01644" "00153700" "05396" "00153701" "01644" "00153702" "01644" "00153703" "05396" "00153704" "01644" "00153705" "01644" "00153706" "01644" "00153707" "01644" "00153708" "01644" "00153709" "01644" "00153710" "01644" "00153711" "01644" "00153712" "01644" "00153713" "01644" "00153714" "01644" "00153715" "01644" "00153716" "01644" "00153717" "05132" "00153718" "01644" "00153719" "01644" "00153720" "01644" "00153721" "01644" "00153722" "01644" "00153723" "01361" "00153724" "01644" "00153725" "01644" "00153726" "01644" "00153727" "01644" "00153728" "05132" "00153729" "01644" "00153730" "01644" "00153731" "01644" "00153732" "01644" "00153733" "01644" "00153734" "01644" "00153735" "01644" "00153736" "01361" "00153737" "01644" "00153738" "01644" "00153739" "01644" "00153740" "01644" "00153741" "01644" "00153742" "01644" "00153743" "01644" "00153744" "05132" "00153745" "05132" "00153746" "05132" "00153748" "01644" "00153749" "01644" "00153750" "01644" "00153751" "01644" "00153752" "01644" "00153753" "05132" "00153754" "01644" "00153755" "01644" "00153756" "01644" "00153757" "01644" "00153758" "01644" "00153759" "05132" "00153760" "01644" "00153761" "01644" "00153762" "05396" "00153763" "01644" "00153764" "01644" "00153765" "01644" "00153766" "01644" "00153767" "01644" "00153768" "01644" "00153769" "05396" "00153770" "01644" "00153771" "01644" "00153772" "01644" "00153773" "01644" "00153774" "01644" "00153775" "01644" "00153776" "01644" "00153777" "01644" "00153778" "01644" "00153779" "01644" "00153780" "01644" "00153781" "05132" "00153782" "01644" "00153783" "01644" "00153784" "01644" "00153785" "01644" "00153786" "01644" "00153787" "01644" "00153788" "01644" "00153789" "05132" "00153790" "01169" "00153791" "01644" "00153792" "01644" "00153793" "01644" "00153794" "01644" "00153795" "01644" "00153796" "05132" "00153797" "01644" "00153798" "01644" "00153799" "01644" "00153800" "01644" "00153801" "01644" "00153802" "01644" "00153803" "01644" "00153804" "01644" "00153805" "01361" "00153806" "01361" "00153807" "01644" "00153808" "01644" "00153809" "01361" "00153810" "01644" "00153811" "01361" "00153812" "01644" "00153813" "01644" "00153814" "01644" "00153815" "05132" "00153816" "05132" "00153817" "05132" "00153819" "01644" "00153820" "01644" "00153821" "01644" "00153822" "05132" "00153823" "01644" "00153824" "01644" "00153825" "01361" "00153826" "01169" "00153827" "05132" "00153828" "05132" "00153829" "01644" "00153830" "01644" "00153831" "01644" "00153832" "05396" "00153833" "05396" "00153834" "01644" "00153835" "01644" "00153836" "01644" "00153837" "05132" "00153838" "01644" "00153839" "01644" "00153840" "01644" "00153841" "01644" "00153842" "05132" "00153843" "05396" "00153844" "01644" "00153845" "01169" "00153870" "05132" "00153878" "01644" "00153885" "01644" "00153890" "01644" "00153923" "01644" "00153937" "01644" "00153948" "01644" "00153952" "05132" "00153975" "01644" "00153984" "05132" "00154125" "01644" "00154162" "05132" "00154292" "01644" "00154351" "01644" "00154358" "01644" "00154484" "01644" "00218348" "05132" "00234339" "05132" "00245757" "01076" "00292622" "00198" "00292623" "00198" "00292624" "00198" "00292625" "00198" "00296663" "05132" "00296664" "01361" "00296665" "01361" "00301049" "05132" "00304793" "00198" "00304794" "00198" "00327056" "05086" "00374274" "00198" "00375231" "01644" "00375232" "01644" "00375234" "01361" "00375244" "05132" "00375245" "05132" "00395046" "04214" "00402954" "01644" "00402991" "01169" "00402992" "01169" "00402993" "01644" "00402994" "01169" "00402995" "01644" "00408113" "01361" "00410576" "00198" "00414456" "00198" "00414472" "00198" "00418508" "00198" "00428007" "00198" "00433382" "05132" "00433383" "05132" "00433384" "05132" "00433385" "05132" "00433386" "05132" "00433387" "05132" "00433388" "05132" "00433389" "05132" "00433390" "05132" "00433391" "05132" "00433392" "05132" "00433393" "05132" "00433394" "05132" "00433395" "05132" "00433396" "05132" "00433397" "05132" "00433429" "05132" "00433433" "05132" "00433434" "05132" "00441514" "05086" "00441515" "05086" "00441516" "05086" "00444032" "05132" "00444033" "05132" "00444034" "05132" "00447444" "00198" "00448551" "00399" "00467542" "05362" "00472317" "05132" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 00399, 01076, 01169, 01361, 01644, 03381, 04214, 05086, 05132, 05362, 05396, 07069, 07070 ## Count = 672 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000017013" "00198" "00018844" "00746" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017689" "00399" "00018452" "00746" "Familial, autosomal recessive" "" "congenital nephrotic syndrome, haematuria" "" "" "" "" "" "" "" "" "" "" "" "0000069747" "00198" "00091300" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069748" "01644" "00091301" "00687" "Unknown" "" "Micro-haematuria, proteinuria. CRF; hearing loss; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069749" "01169" "00091302" "00687" "Unknown" "" "Micro-haematuria, proteinuria.; no hearing loss; no ocular phenotype;" "" "" "" "" "" "" "" "" "" "" "" "0000069750" "01644" "00091303" "00687" "Unknown" "" "hearing loss; abnormal ocular" "" "" "" "" "" "" "" "" "" "" "" "0000069751" "01361" "00091304" "00687" "Unknown" "" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069752" "00198" "00091305" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069753" "01361" "00091306" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069754" "01644" "00091307" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069755" "01644" "00091308" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069756" "00198" "00091309" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069757" "01361" "00091310" "00687" "Unknown" "" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069758" "00198" "00091311" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069759" "00198" "00091312" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069760" "00198" "00091313" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069761" "00198" "00091314" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069762" "01361" "00091315" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069763" "01644" "00091316" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069764" "01644" "00091317" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069765" "01361" "00091318" "00687" "Unknown" "" "no hearing loss; no ocular phenotype;" "" "" "" "" "" "" "" "" "" "" "" "0000069766" "01361" "00091319" "00687" "Unknown" "" "Paternal Grandfather ESRD at 70; no hearing loss; no ocular phenotype;" "" "" "" "" "" "" "" "" "" "" "" "0000069767" "00198" "00091320" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069768" "00198" "00091321" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069769" "01361" "00091322" "00687" "Unknown" "" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069770" "01361" "00091323" "00687" "Unknown" "" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069771" "01361" "00091324" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069772" "01361" "00091325" "00687" "Unknown" "" "no hearing loss; no ocular phenotype;" "" "" "" "" "" "" "" "" "" "" "" "0000069773" "01361" "00091326" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069774" "00198" "00091327" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069775" "01644" "00091328" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069776" "00198" "00091329" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069777" "00198" "00091330" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069778" "01361" "00091331" "00687" "Unknown" "" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069779" "01361" "00091332" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069780" "00198" "00091333" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069781" "01644" "00091334" "00687" "Unknown" "" "20y / 25y renal failure; renal failure;" "" "" "" "" "" "" "" "" "" "" "" "0000069782" "01361" "00091335" "00687" "Unknown" "" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069783" "01361" "00091336" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069784" "00198" "00091337" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069785" "00198" "00091338" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069786" "01644" "00091339" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069787" "01361" "00091340" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069788" "00198" "00091341" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069789" "01644" "00091342" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069790" "01644" "00091343" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069791" "01644" "00091344" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069792" "01644" "00091345" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069793" "01361" "00091346" "00687" "Unknown" "" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069794" "01361" "00091347" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069795" "01169" "00091348" "00687" "Unknown" "" "Micro-haematuria, proteinuria; 35y renal failure; hearing loss; renal failure;" "" "" "" "" "" "" "" "" "" "" "" "0000069796" "01644" "00091349" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069797" "00198" "00091350" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069798" "01361" "00091351" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069799" "01361" "00091352" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069800" "01361" "00091353" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069801" "01361" "00091354" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069802" "01361" "00091355" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069803" "01644" "00091356" "00687" "Unknown" "" "37y renal failure; hearing loss; no ocular phenotype; renal failure" "" "" "" "" "" "" "" "" "" "" "" "0000069804" "01361" "00091357" "00687" "Unknown" "" "Micro-haematuria.; no hearing loss; no ocular phenotype;" "" "" "" "" "" "" "" "" "" "" "" "0000069805" "01644" "00091358" "00687" "Unknown" "" "hearing loss; abnormal ocular" "" "" "" "" "" "" "" "" "" "" "" "0000069806" "01361" "00091359" "00687" "Unknown" "" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069807" "01644" "00091360" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069808" "00198" "00091361" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069809" "01361" "00091362" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069810" "01361" "00091363" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069811" "01361" "00091364" "00687" "Unknown" "" "Hematuria" "" "" "" "" "" "" "" "" "" "" "" "0000069812" "01644" "00091365" "00687" "Unknown" "" "Micro-haematuria, proteinuria. Type III Spinal Muscular Atrophy; 15y renal failure; hearing loss; abnormal ocular; renal failure" "" "" "" "" "" "" "" "" "" "" "" "0000069813" "01361" "00091366" "00687" "Unknown" "" "micro-hematuria; no hearing loss; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069814" "01644" "00091367" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069815" "01644" "00091368" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069816" "00198" "00091369" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069817" "01361" "00091370" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069818" "01361" "00091371" "00687" "Unknown" "" "micro-hematuria; no hearing loss; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069819" "01361" "00091372" "00687" "Unknown" "" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069820" "01644" "00091373" "00687" "Unknown" "" "haematuria proteinuria; 28y renal failure; hearing loss; abnormal ocular; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069821" "01644" "00091374" "00687" "Unknown" "" "23y renal failure; renal failure;" "" "" "" "" "" "" "" "" "" "" "" "0000069822" "01361" "00091375" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069823" "01361" "00091376" "00687" "Unknown" "" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069824" "01361" "00091377" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069825" "01644" "00091378" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069826" "01361" "00091379" "00687" "Unknown" "" "micro-haematuria; no hearing loss; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069827" "01644" "00091380" "00687" "Unknown" "" "38y renal failure; no hearing loss; no ocular phenotype; renal failure" "" "" "" "" "" "" "" "" "" "" "" "0000069828" "01644" "00091381" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069829" "00198" "00091382" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069830" "00198" "00091383" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069831" "01644" "00091384" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069832" "01644" "00091385" "00687" "Unknown" "" "Microscopic hematuria." "" "" "" "" "" "" "" "" "" "" "" "0000069833" "01644" "00091386" "00687" "Unknown" "" "progressive kidney failure" "" "" "" "" "" "" "" "" "" "" "" "0000069834" "01644" "00091387" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069835" "01644" "00091388" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069836" "01361" "00091389" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069837" "01644" "00091390" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069838" "01361" "00091391" "00687" "Unknown" "" "micro-hematuria; no hearing loss; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069839" "01361" "00091392" "00687" "Unknown" "" "micro-haematuria, proteinuria.; no hearing loss; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069840" "01361" "00091393" "00687" "Unknown" "" "Micro-haematuria, Serum creatinine: 0.8mg/dL. ; no hearing loss; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069841" "01644" "00091394" "00687" "Unknown" "" "no hearing loss; no ocular phenotype;" "" "" "" "" "" "" "" "" "" "" "" "0000069842" "01361" "00091395" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069843" "01169" "00091396" "00687" "Unknown" "" "Micro-haematuria, proteinuria. CRF.; hearing loss; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069844" "01644" "00091397" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069845" "01644" "00091398" "00687" "Unknown" "" "micro-haematuria, proteinuria. CRF; hearing loss; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069846" "01644" "00091399" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069847" "01361" "00091400" "00687" "Unknown" "" "TBMN (ADAS?); micro-haematuria, proteinuria;; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069848" "01361" "00091401" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069849" "01644" "00091402" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069850" "01644" "00091403" "00687" "Unknown" "" "52y renal failure; no hearing loss; no ocular phenotype; renal failure" "" "" "" "" "" "" "" "" "" "" "" "0000069851" "01361" "00091404" "00687" "Unknown" "" "Benign Haematuria; no hearing loss; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069852" "01644" "00091405" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069853" "01644" "00091406" "00687" "Unknown" "" "Haematuria" "" "" "" "" "" "" "" "" "" "" "" "0000069854" "01361" "00091407" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069855" "01644" "00091408" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069856" "00198" "00091409" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069857" "01169" "00091410" "00687" "Unknown" "" "Micro-haematuria, proteinuria, normal renal function; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069858" "01644" "00091411" "00687" "Unknown" "" "Micro-haematuria" "" "" "" "" "" "" "" "" "" "" "" "0000069859" "01644" "00091412" "00687" "Unknown" "" "hearing loss; no ocular phenotype;" "" "" "" "" "" "" "" "" "" "" "" "0000069860" "01644" "00091413" "00687" "Unknown" "" "hearing loss; no ocular phenotype;" "" "" "" "" "" "" "" "" "" "" "" "0000069861" "01644" "00091414" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069862" "01644" "00091415" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069863" "01169" "00091416" "00687" "Unknown" "" "45y renal failure; no hearing loss; no ocular phenotype; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069864" "00198" "00091417" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069865" "01644" "00091418" "00687" "Unknown" "" "Micro-haematuria" "" "" "" "" "" "" "" "" "" "" "" "0000069866" "01644" "00091419" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069867" "01361" "00091420" "00687" "Unknown" "" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069868" "00198" "00091421" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069869" "00198" "00091422" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069870" "01644" "00091423" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069871" "01644" "00091424" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069872" "01644" "00091425" "00687" "Unknown" "" "microscopic hematuria, Proteinuria," "" "" "" "" "" "" "" "" "" "" "" "0000069873" "01644" "00091426" "00687" "Unknown" "" "progressive kidney failure" "" "" "" "" "" "" "" "" "" "" "" "0000069874" "01644" "00091427" "00687" "Unknown" "" "progressive kidney failure" "" "" "" "" "" "" "" "" "" "" "" "0000069875" "01644" "00091428" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069876" "01644" "00091429" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069877" "01644" "00091430" "00687" "Unknown" "" "34y renal failure; hearing loss; no ocular phenotype; renal failure" "" "" "" "" "" "" "" "" "" "" "" "0000069878" "01644" "00091431" "00687" "Unknown" "" "Micro-haematuria" "" "" "" "" "" "" "" "" "" "" "" "0000069879" "01644" "00091432" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069880" "01644" "00091433" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069881" "01644" "00091434" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069882" "00198" "00091435" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069883" "00198" "00091436" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069884" "01644" "00091437" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069885" "01361" "00091438" "00687" "Unknown" "" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069886" "01361" "00091439" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069887" "01644" "00091440" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069888" "01644" "00091441" "00687" "Unknown" "" "20y renal failure; hearing loss; renal failure; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069889" "01644" "00091442" "00687" "Unknown" "" "10y renal failure; hearing loss; renal failure; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069890" "01644" "00091443" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069891" "01644" "00091444" "00687" "Unknown" "" "11y renal failure; hearing loss; renal failure; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069892" "01644" "00091445" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069893" "01644" "00091446" "00687" "Unknown" "" "14y renal failure; hearing loss; renal failure;" "" "" "" "" "" "" "" "" "" "" "" "0000069894" "01644" "00091447" "00687" "Unknown" "" "15y renal failure; hearing loss; renal failure;" "" "" "" "" "" "" "" "" "" "" "" "0000069895" "01644" "00091448" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069896" "01644" "00091449" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069897" "01644" "00091450" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069898" "01361" "00091451" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069899" "00198" "00091452" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069900" "01644" "00091453" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069901" "01644" "00091454" "00687" "Unknown" "" "15y renal failure; hearing loss; renal failure; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069902" "01644" "00091455" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069903" "01644" "00091456" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069904" "01644" "00091457" "00687" "Unknown" "" "15y renal failure; hearing loss; renal failure; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069905" "01644" "00091458" "00687" "Unknown" "" "16y renal failure; hearing loss; no ocular phenotype; renal failure" "" "" "" "" "" "" "" "" "" "" "" "0000069906" "00198" "00091459" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069907" "01644" "00091460" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069908" "01361" "00091461" "00687" "Unknown" "" "no hearing loss; no ocular phenotype;" "" "" "" "" "" "" "" "" "" "" "" "0000069909" "01361" "00091462" "00687" "Unknown" "" "no hearing loss; no ocular phenotype;" "" "" "" "" "" "" "" "" "" "" "" "0000069910" "01361" "00091463" "00687" "Unknown" "" "no hearing loss; no ocular phenotype;" "" "" "" "" "" "" "" "" "" "" "" "0000069911" "00198" "00091464" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069912" "00198" "00091465" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069913" "00198" "00091466" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069914" "00198" "00091467" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069915" "00198" "00091468" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069916" "00198" "00091469" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069917" "00198" "00091470" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069918" "00198" "00091471" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069919" "00198" "00091472" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069920" "00198" "00091473" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069921" "00198" "00091474" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069922" "00198" "00091475" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069923" "00198" "00091476" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069924" "00198" "00091477" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069925" "00198" "00091478" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069926" "00198" "00091479" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069927" "00198" "00091480" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069928" "00198" "00091481" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069929" "00198" "00091482" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069930" "00198" "00091483" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069931" "00198" "00091484" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069932" "00198" "00091485" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069933" "00198" "00091486" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069934" "00198" "00091487" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069935" "00198" "00091488" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069936" "00198" "00091489" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069937" "00198" "00091490" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069938" "00198" "00091491" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069939" "00198" "00091492" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069940" "00198" "00091493" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069941" "00198" "00091494" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069942" "00198" "00091495" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069943" "00198" "00091496" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069944" "00198" "00091497" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069945" "00198" "00091498" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069946" "00198" "00091499" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069947" "00198" "00091500" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069948" "00198" "00091501" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069949" "00198" "00091502" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069950" "00198" "00091503" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069951" "00198" "00091504" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069952" "00198" "00091505" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069953" "00198" "00091506" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069954" "00198" "00091507" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069955" "00198" "00091508" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069956" "01361" "00091509" "01545" "Unknown" "" "Microscopic haematuria and <1g/day proteinuria. Biopsy shows FSGS and 20% tubular atrophy. EM: Foot process effacement, few mesangial electron dense desposits, GBMs very thin but thick in places with splitting.; no hearing loss; no ocular phenotype; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069957" "01361" "00091510" "01545" "Unknown" "" "Microscopic haematuria and deafness in Mother and son. Biopsy in son shows TBMN.; hearing loss;" "" "" "" "" "" "" "" "" "" "" "" "0000069958" "01644" "00091511" "00466" "Unknown" "44y" "37y renal failure; no hearing loss; no ocular phenotype; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069959" "01644" "00091512" "00466" "Unknown" "10y" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069960" "01644" "00091513" "00466" "Unknown" "21y" "no hearing loss; no ocular phenotype; glomerulus normal;" "" "" "" "" "" "" "" "" "" "" "" "0000069961" "01644" "00091514" "00466" "Unknown" "6y" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069962" "01644" "00091515" "00466" "Unknown" "" "26y renal failure; hearing loss; no ocular phenotype; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069963" "01644" "00091516" "00466" "Unknown" "41y" "10y renal failure; hearing loss; abnormal ocular; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069964" "01644" "00091517" "00466" "Unknown" "19y" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069965" "01644" "00091518" "00466" "Unknown" "16y" "hearing loss; no ocular phenotype; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069966" "01644" "00091519" "00466" "Unknown" "40y" "17y renal failure; hearing loss; abnormal ocular; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069967" "01644" "00091520" "00466" "Unknown" "14y" "no hearing loss; no ocular phenotype; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069968" "01644" "00091521" "00466" "Unknown" "49y" "" "" "" "" "" "" "" "" "" "" "" "" "0000069969" "01644" "00091522" "00466" "Unknown" "36y" "23y renal failure; hearing loss; abnormal ocular; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069970" "01644" "00091523" "00466" "Unknown" "17y" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069971" "01644" "00091524" "00466" "Unknown" "8y" "no hearing loss; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069972" "01644" "00091525" "00466" "Unknown" "31y" "17y renal failure; hearing loss; renal failure; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069973" "01644" "00091526" "00466" "Unknown" "34y" "23y renal failure; hearing loss; abnormal ocular; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069974" "01644" "00091527" "00466" "Unknown" "38y" "15y renal failure; hearing loss; abnormal ocular; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069975" "01644" "00091528" "00466" "Unknown" "38y" "hearing loss; no ocular phenotype; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000069976" "01644" "00091529" "00466" "Unknown" "44y" "25y renal failure; hearing loss; abnormal ocular; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069977" "00198" "00091530" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069978" "00198" "00091531" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069979" "00198" "00091532" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069980" "00198" "00091533" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069981" "00198" "00091534" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069982" "00198" "00091535" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069983" "00198" "00091536" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069984" "00198" "00091537" "00687" "Unknown" "" "23y renal failure; hearing loss; abnormal ocular; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000069985" "00198" "00091538" "00687" "Unknown" "" "25y renal failure; hearing loss; abnormal ocular; renal failure" "" "" "" "" "" "" "" "" "" "" "" "0000069986" "00198" "00091539" "00687" "Unknown" "" "33y renal failure; hearing loss; abnormal ocular; renal failure" "" "" "" "" "" "" "" "" "" "" "" "0000069987" "00198" "00091540" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069988" "00198" "00091541" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069989" "00198" "00091542" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069990" "00198" "00091543" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069991" "00198" "00091544" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069992" "00198" "00091545" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069993" "00198" "00091546" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069994" "00198" "00091547" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069995" "00198" "00091548" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069996" "00198" "00091549" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069997" "00198" "00091550" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069998" "00198" "00091551" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000069999" "00198" "00091552" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070000" "00198" "00091553" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070001" "00198" "00091554" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070002" "00198" "00091555" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070003" "00198" "00091556" "00687" "Unknown" "" "hearing loss; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000070004" "00198" "00091557" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070005" "00198" "00091558" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070006" "00198" "00091559" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070007" "00198" "00091560" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070008" "00198" "00091561" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070009" "00198" "00091562" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070010" "00198" "00091563" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070011" "00198" "00091564" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070012" "00198" "00091565" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070013" "00198" "00091566" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070014" "00198" "00091567" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070015" "00198" "00091568" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070016" "00198" "00091569" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070017" "00198" "00091570" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070018" "00198" "00091571" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070019" "00198" "00091572" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070020" "00198" "00091573" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070021" "00198" "00091574" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070022" "00198" "00091575" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070023" "00198" "00091576" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070024" "00198" "00091577" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070025" "00198" "00091578" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070026" "00198" "00091579" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070027" "00198" "00091580" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070028" "00198" "00091581" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070029" "00198" "00091582" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070030" "00198" "00091583" "00687" "Unknown" "" "38y renal failure; hearing loss; abnormal ocular; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000070031" "00198" "00091584" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070032" "00198" "00091585" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070033" "00198" "00091586" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070034" "00198" "00091587" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070035" "00198" "00091588" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070036" "00198" "00091589" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070037" "00198" "00091590" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070038" "00198" "00091591" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070039" "00198" "00091592" "00687" "Unknown" "" "25y renal failure; hearing loss; abnormal ocular; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000070040" "00198" "00091593" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070041" "00198" "00091594" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070042" "00198" "00091595" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070043" "00198" "00091596" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070044" "00198" "00091597" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070045" "00198" "00091598" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070046" "00198" "00091599" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070047" "00198" "00091600" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070048" "00198" "00091601" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070049" "00198" "00091602" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070050" "00198" "00091603" "00687" "Unknown" "" "23y renal failure; hearing loss; abnormal ocular; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000070051" "00198" "00091604" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070052" "00198" "00091605" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070053" "00198" "00091606" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070054" "00198" "00091607" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070055" "00198" "00091608" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070056" "00198" "00091609" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070057" "00198" "00091610" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070058" "00198" "00091611" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070059" "00198" "00091612" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070060" "00198" "00091613" "00687" "Unknown" "" "15y renal failure; hearing loss; abnormal ocular; renal failure; glomerulus abnormal" "" "" "" "" "" "" "" "" "" "" "" "0000070061" "00198" "00091614" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070062" "00198" "00091615" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070063" "00198" "00091616" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070064" "00198" "00091617" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070065" "00198" "00091618" "00687" "Unknown" "" "25y renal failure; hearing loss; renal failure; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000070066" "00198" "00091619" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070067" "00198" "00091620" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070068" "00198" "00091621" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070069" "00198" "00091622" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070070" "00198" "00091623" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070071" "00198" "00091624" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070072" "00198" "00091625" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070073" "00198" "00091626" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070074" "00198" "00091627" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070075" "00198" "00091628" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070076" "00198" "00091629" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070077" "00198" "00091630" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070078" "00198" "00091631" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070079" "00198" "00091632" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070080" "00198" "00091633" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070081" "00198" "00091634" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070082" "00198" "00091635" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070083" "00198" "00091636" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070084" "00198" "00091637" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070085" "00198" "00091638" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070086" "00198" "00091639" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070087" "00198" "00091640" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070088" "00198" "00091641" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070089" "00198" "00091642" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070090" "00198" "00091643" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070091" "00198" "00091644" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070092" "00198" "00091645" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070093" "00198" "00091646" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070094" "00198" "00091647" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070095" "00198" "00091648" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070096" "00198" "00091649" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070097" "00198" "00091650" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070098" "00198" "00091651" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070099" "00198" "00091652" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070100" "00198" "00091653" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070101" "00198" "00091654" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070102" "00198" "00091655" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070103" "00198" "00091656" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070104" "00198" "00091657" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070105" "00198" "00091658" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070106" "00198" "00091659" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070107" "00198" "00091660" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070108" "00198" "00091661" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070109" "00198" "00091662" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070110" "00198" "00091663" "00687" "Unknown" "" "hearing loss; no renal failure; glomerulus abnormal;" "" "" "" "" "" "" "" "" "" "" "" "0000070111" "01644" "00091664" "01548" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070113" "01361" "00091666" "01548" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070114" "01361" "00091667" "01548" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000070115" "01361" "00091668" "01548" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000081923" "03381" "00103989" "00587" "Unknown" "" "diffuse-type or intestinal-type gastric cancer" "" "" "" "" "" "" "" "" "" "" "" "0000125656" "05132" "00152713" "02367" "Familial, autosomal dominant" "15y" "microscopic and macroscopic hematuria, proteinuria accompanies infectious diseases; renal biopsy - thin basement membrane disease (TBMN) combined with focal segmental glomerulonephritis; negative family history" "06y" "23y" "6y" "" "" "" "" "" "TBMN" "Alport syndrome X-linked" "" "0000125657" "05132" "00152714" "02367" "Familial, autosomal dominant" "33y" "at 12y detected microscopic hematuria, later also proteinuria, renal biopsy at 27y, suspicion on Alport syndrome; family history without renal disease" "<12y" "39y" "<12y" "" "" "" "" "" "TBMN" "Alport syndrome X-linked" "" "0000125659" "05132" "00152716" "02367" "Familial, autosomal dominant" "52y" "the patient and her daughter - microscopic hematuria, proteinuria" "?" "52y" "?" "" "" "" "" "" "TBMN" "Alport syndrome" "" "0000125982" "05132" "00153301" "02367" "Familial, autosomal recessive" "43y" "Microscopic hematuria (HP:0002907), proteinuria (HP:0000093), sensorineural deafness, late-onset (HP:0008615)" "<10y" "11y" "Microscopic hematuria (HP:0002907)" "" "" "" "" "" "Alport syndrome" "Alport syndrome" "" "0000125989" "05132" "00153308" "02367" "Familial, autosomal recessive" "09y" "Macroscopic hematuria (HP:0012587), microscopic hematuria (HP:0002907), proteinuria (HP:0000093), sensorineural deafness, late-onset (HP:0008615)" "02y" "09y" "Macroscopic hematuria (HP:0012587)" "" "" "" "" "" "Alport syndrome" "Alport syndrome" "" "0000125990" "05132" "00153308" "02367" "Familial, autosomal dominant" "45y" "Microscopic hematuria (HP:0002907)" "03y" "" "Microscopic hematuria (HP:0002907)" "" "" "" "" "" "Thin basement membrane nephropathy" "Thin basement membrane nephropathy" "" "0000126000" "05132" "00153319" "02367" "Familial, autosomal dominant" "06y" "microscopic hematuria (HP:0002907), macroscopic hematuria (HP:0012587)" "<03y" "06y" "microscopic hematuria (HP:0002907), macroscopic hematuria (HP:0012587)" "" "" "" "" "" "Thin basement membrane nephropathy" "Alport syndrome" "" "0000126006" "05132" "00153325" "02367" "Familial, autosomal recessive" "33y" "microscopic hematuria (HP:0002907), proteinuria (HP:0000093), stage 5 chronic kidney disease (HP:0003774)" "<03y" "30y" "microscopic hematuria (HP:0002907)" "" "" "" "" "" "Alport syndrome" "Alport syndrome" "" "0000126072" "01644" "00153395" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126077" "01644" "00153400" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126078" "01644" "00153401" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126079" "01644" "00153402" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126082" "01644" "00153405" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126085" "01644" "00153408" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126086" "01644" "00153409" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126089" "01644" "00153412" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126090" "01644" "00153413" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126091" "01644" "00153414" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126098" "01644" "00153421" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126105" "01644" "00153428" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126106" "01644" "00153429" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126108" "01644" "00153431" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126109" "01644" "00153432" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126113" "01644" "00153436" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126114" "01644" "00153437" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126117" "01644" "00153440" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126119" "01644" "00153442" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126122" "01644" "00153445" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126130" "01644" "00153453" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126132" "01644" "00153455" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126133" "01644" "00153456" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126136" "01644" "00153459" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126138" "01644" "00153461" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126139" "01644" "00153462" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126140" "01644" "00153463" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126145" "01644" "00153468" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126149" "01644" "00153472" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126157" "01644" "00153480" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126158" "01644" "00153481" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126160" "01644" "00153483" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126161" "01644" "00153484" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126162" "01644" "00153485" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126171" "01644" "00153494" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126177" "01644" "00153500" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126180" "01644" "00153503" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126182" "01644" "00153505" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126184" "01644" "00153507" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126200" "01644" "00153523" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126208" "01644" "00153531" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126217" "01644" "00153540" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126230" "01644" "00153553" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126231" "01644" "00153554" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126236" "01644" "00153559" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126239" "01644" "00153562" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126241" "01644" "00153564" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126246" "01644" "00153569" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126248" "01644" "00153571" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126259" "01644" "00153582" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126260" "01644" "00153583" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126261" "01644" "00153584" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126264" "01644" "00153587" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126265" "01644" "00153588" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126269" "01644" "00153592" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126271" "01644" "00153594" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126280" "01644" "00153603" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126282" "01644" "00153605" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126283" "01644" "00153606" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126284" "01644" "00153607" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126286" "01644" "00153609" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126294" "01644" "00153617" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126296" "01644" "00153619" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126301" "01644" "00153624" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126308" "01644" "00153631" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126315" "01644" "00153638" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126317" "01644" "00153640" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126322" "01644" "00153645" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126323" "01644" "00153646" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126324" "01644" "00153647" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126329" "01644" "00153652" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126339" "01644" "00153662" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126340" "01644" "00153663" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126342" "01644" "00153665" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126346" "01644" "00153669" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126348" "01644" "00153671" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126349" "01644" "00153672" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126357" "01644" "00153680" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126358" "01644" "00153681" "00687" "Familial, autosomal recessive" "29y" "hearing loss (HP:0000365); ocular changes; 15y-renal failure (HP:0000083)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126359" "05132" "00153682" "00687" "Unknown" "35y" "hearing loss (HP:0000365); ocular changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126360" "01644" "00153683" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126361" "01644" "00153684" "00687" "Familial, autosomal recessive" "25y" "hearing loss (HP:0000365); ocular changes; GBM pathology thinning, thickening, splitting; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126362" "01644" "00153685" "00687" "Di-genic" "45y" "32y-hearing loss (HP:0000365); hematuria (HP:0000790); proteinuria (HP:0000093), end-stage renal disease; 40y-father died with ESRD, 61y-paternal uncle died with ESRD" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126363" "01644" "00153686" "00687" "Familial, autosomal recessive" "27y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology Basket-weave changes; 26y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126364" "01644" "00153687" "00687" "Familial, autosomal recessive" "21y" "hearing loss (HP:0000365); no ocular changes; GBM pathology Basket-weave changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126365" "01644" "00153688" "00687" "Familial, autosomal recessive" "18y" "hearing loss (HP:0000365); no ocular changes; GBM pathology Basket-weave changes; 11y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126366" "01644" "00153689" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126367" "01644" "00153690" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126368" "01644" "00153691" "00687" "Familial, autosomal recessive" "17y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology Basket-weave changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126369" "01644" "00153692" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126370" "01644" "00153693" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126371" "01644" "00153694" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126372" "05132" "00153695" "00687" "Unknown" "6y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790); no proteinuria (-HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126373" "01644" "00153696" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126374" "01644" "00153697" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126375" "01169" "00153698" "00687" "Familial, autosomal dominant" "48y" "hearing loss (HP:0000365); no ocular changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal dominant (ASAD)" "Alport syndrome" "" "0000126376" "01644" "00153699" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126377" "05396" "00153700" "00687" "Unknown" "8y" "8y-diagnosed, progressed to ESRF within 4y; hearing loss (HP:0000365); no ocular changes; 12y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "glomerulosclerosis, segmental, focal (FSGS)" "" "0000126378" "01644" "00153701" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126379" "01644" "00153702" "00687" "Unknown" "7y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126380" "05396" "00153703" "00687" "Unknown" "35y" "no hearing loss (-HP:0000365); no ocular changes; no GBM pathology ; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "glomerulosclerosis, segmental, focal (FSGS)" "" "0000126381" "01644" "00153704" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126382" "01644" "00153705" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126383" "01644" "00153706" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126384" "01644" "00153707" "00687" "Unknown" "28y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126385" "01644" "00153708" "00687" "Unknown" "49y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126386" "01644" "00153709" "00687" "Familial, autosomal recessive" "6y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology thinning; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126387" "01644" "00153710" "00687" "Unknown" "8y" "hearing loss (HP:0000365)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126388" "01644" "00153711" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126389" "01644" "00153712" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126390" "01644" "00153713" "00687" "Unknown" "17y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126391" "01644" "00153714" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126392" "01644" "00153715" "00687" "Unknown" "36y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126393" "01644" "00153716" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126394" "05132" "00153717" "00687" "Unknown" "35y" "hearing loss (HP:0000365); no ocular changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126395" "01644" "00153718" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126396" "01644" "00153719" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126397" "01644" "00153720" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126398" "01644" "00153721" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126399" "01644" "00153722" "00687" "Familial, autosomal recessive" "20y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology thinning; 18y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126400" "01361" "00153723" "00687" "Unknown" "47y" "hearing loss (HP:0000365); no ocular changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "thin basement membrane nephropathy" "" "0000126401" "01644" "00153724" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126402" "01644" "00153725" "00687" "Unknown" "17y" "hearing loss (HP:0000365); 11y-renal failure (HP:0000083)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126403" "01644" "00153726" "00687" "Unknown" "46y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126404" "01644" "00153727" "00687" "Familial, autosomal recessive" "14y" "hearing loss (HP:0000365); no ocular changes; 14y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126405" "05132" "00153728" "00687" "Unknown" "26y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126406" "01644" "00153729" "00687" "Unknown" "17y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126407" "01644" "00153730" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126408" "01644" "00153731" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126409" "01644" "00153732" "00687" "Unknown" "23y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126410" "01644" "00153733" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126411" "01644" "00153734" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126412" "01644" "00153735" "00687" "Familial, autosomal recessive" "7y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology Basket-weave changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126413" "01361" "00153736" "00687" "Unknown" "11y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790); no proteinuria (-HP:0000093)" "" "" "" "" "" "" "" "" "" "thin basement membrane nephropathy" "" "0000126414" "01644" "00153737" "00687" "Unknown" "36y" "no hearing loss (-HP:0000365); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126415" "01644" "00153738" "00687" "Unknown" "64y" "no hearing loss (-HP:0000365); hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126416" "01644" "00153739" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126417" "01644" "00153740" "00687" "Unknown" "42y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126418" "01644" "00153741" "00687" "Unknown" "55y" "hearing loss (HP:0000365); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126419" "01644" "00153742" "00687" "Unknown" "23y" "no hearing loss (-HP:0000365); hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126420" "01644" "00153743" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126421" "05132" "00153744" "00687" "Unknown" "4y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790); no proteinuria (-HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126422" "05132" "00153745" "00687" "Unknown" "44y" "" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126423" "05132" "00153746" "00687" "Unknown" "25y" "hearing loss (HP:0000365); no ocular changes; hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126425" "01644" "00153748" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126426" "01644" "00153749" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126427" "01644" "00153750" "00687" "Unknown" "22y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126428" "01644" "00153751" "00687" "Familial, autosomal recessive" "19y" "hearing loss (HP:0000365); no ocular changes; GBM pathology Basket-weave changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126429" "01644" "00153752" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126430" "05132" "00153753" "00687" "Unknown" "34y" "hearing loss (HP:0000365); no ocular changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126431" "01644" "00153754" "00687" "Familial, autosomal recessive" "20y" "hearing loss (HP:0000365); no ocular changes; GBM pathology Basket-weave changes; 19y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126432" "01644" "00153755" "00687" "Unknown" "7y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126433" "01644" "00153756" "00687" "Unknown" "18y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126434" "01644" "00153757" "00687" "Unknown" "15y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126435" "01644" "00153758" "00687" "Unknown" "55y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126436" "05132" "00153759" "00687" "Unknown" "69y" "hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126437" "01644" "00153760" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126438" "01644" "00153761" "00687" "Unknown" "20y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126439" "05396" "00153762" "00687" "Unknown" "36y" "hearing loss (HP:0000365); no ocular changes; GBM pathology thinning; 60y-renal failure (HP:0000083); hematuria (HP:0000790); no proteinuria (-HP:0000093)" "" "" "" "" "" "" "" "" "" "glomerulosclerosis, segmental, focal (FSGS)" "" "0000126440" "01644" "00153763" "00687" "Unknown" "3y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126441" "01644" "00153764" "00687" "Unknown" "" "no hearing loss (-HP:0000365); hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126442" "01644" "00153765" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126443" "01644" "00153766" "00687" "Familial, autosomal recessive" "2y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology thinning; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126444" "01644" "00153767" "00687" "Unknown" "32y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126445" "01644" "00153768" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126446" "05396" "00153769" "00687" "Unknown" "45y" "no hearing loss (-HP:0000365); no ocular changes; 45y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "glomerulosclerosis, segmental, focal (FSGS)" "" "0000126447" "01644" "00153770" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126448" "01644" "00153771" "00687" "Unknown" "40y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126449" "01644" "00153772" "00687" "Familial, autosomal recessive" "22y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology Basket-weave changes; 22y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126450" "01644" "00153773" "00687" "Familial, autosomal recessive" "18y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology Basket-weave changes; 11y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126451" "01644" "00153774" "00687" "Familial, autosomal recessive" "17y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790); no proteinuria (-HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126452" "01644" "00153775" "00687" "Unknown" "28y" "hearing loss (HP:0000365); 20y-renal failure (HP:0000083)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126453" "01644" "00153776" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126454" "01644" "00153777" "00687" "Unknown" "8y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126455" "01644" "00153778" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126456" "01644" "00153779" "00687" "Unknown" "6y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126457" "01644" "00153780" "00687" "Familial, autosomal recessive" "33y" "" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126458" "05132" "00153781" "00687" "Unknown" "25y" "hearing loss (HP:0000365)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126459" "01644" "00153782" "00687" "Unknown" "59y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126460" "01644" "00153783" "00687" "Unknown" "54y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126461" "01644" "00153784" "00687" "Familial, autosomal recessive" "16y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology Basket-weave changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126462" "01644" "00153785" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126463" "01644" "00153786" "00687" "Unknown" "7y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126464" "01644" "00153787" "00687" "Unknown" "45y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126465" "01644" "00153788" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126466" "05132" "00153789" "00687" "Unknown" "8y" "no hearing loss (-HP:0000365); no ocular changes; no hematuria (-HP:0000790); no proteinuria (-HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126467" "01169" "00153790" "00687" "Familial, autosomal dominant" "50y" "GBM pathology thinning, splitting, lamellation; 42y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal dominant (ASAD)" "Alport syndrome" "" "0000126468" "01644" "00153791" "00687" "Unknown" "47y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126469" "01644" "00153792" "00687" "Unknown" "38y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126470" "01644" "00153793" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126471" "01644" "00153794" "00687" "Unknown" "29y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126472" "01644" "00153795" "00687" "Unknown" "33y" "hearing loss (HP:0000365)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126473" "05132" "00153796" "00687" "Unknown" "15y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology lamellation; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126474" "01644" "00153797" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126475" "01644" "00153798" "00687" "Unknown" "35y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126476" "01644" "00153799" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126477" "01644" "00153800" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126478" "01644" "00153801" "00687" "Familial, autosomal recessive" "20y" "hearing loss (HP:0000365); no ocular changes; GBM pathology Basket-weave changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126479" "01644" "00153802" "00687" "Unknown" "54y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126480" "01644" "00153803" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126481" "01644" "00153804" "00687" "Familial, autosomal recessive" "22y" "hearing loss (HP:0000365); no ocular changes; GBM pathology thinning; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126482" "01361" "00153805" "00687" "Unknown" "69y" "GBM pathology thinning, lamellation; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "thin basement membrane nephropathy" "" "0000126483" "01361" "00153806" "00687" "Unknown" "55y" "GBM pathology thinning; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "thin basement membrane nephropathy" "" "0000126484" "01644" "00153807" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126485" "01644" "00153808" "00687" "Familial, autosomal recessive" "25y" "hearing loss (HP:0000365); no ocular changes; GBM pathology Basket-weave changes; 25y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126486" "01361" "00153809" "00687" "Unknown" "10y" "no hearing loss (-HP:0000365); no ocular changes; no hematuria (-HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "thin basement membrane nephropathy" "" "0000126487" "01644" "00153810" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126488" "01361" "00153811" "00687" "Unknown" "4y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "thin basement membrane nephropathy" "" "0000126489" "01644" "00153812" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126490" "01644" "00153813" "00687" "Familial, autosomal recessive" "19y" "hearing loss (HP:0000365); no ocular changes; GBM pathology Basket-weave changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126491" "01644" "00153814" "00687" "Unknown" "10y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126492" "05132" "00153815" "00687" "Unknown" "13y" "hearing loss (HP:0000365); no ocular changes; GBM pathology lamellation; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126493" "05132" "00153816" "00687" "Unknown" "53y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology thinning, thickening and splitting; 52y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "Alport syndrome with diffuse leiomyomatosis" "" "0000126494" "05132" "00153817" "00687" "Unknown" "37y" "no hearing loss (-HP:0000365); no ocular changes; 34y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "Alport syndrome with diffuse leiomyomatosis" "" "0000126496" "01644" "00153819" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126497" "01644" "00153820" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126498" "01644" "00153821" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126499" "05132" "00153822" "00687" "Unknown" "12y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology lamellation; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126500" "01644" "00153823" "00687" "Familial, autosomal recessive" "10y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790); no proteinuria (-HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126501" "01644" "00153824" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126502" "01361" "00153825" "00687" "Unknown" "33y" "GBM pathology thinning; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "thin basement membrane nephropathy" "" "0000126503" "01169" "00153826" "00687" "Familial, autosomal dominant" "52y" "41y-hearing loss (HP:0000365); ocular changes; 31y-renal failure (HP:0000083), 42y-retinopathy; hematuria (HP:0000790); proteinuria (HP:0000093)" "24y" "" "" "" "" "" "" "" "syndrome, Alport, autosomal dominant (ASAD)" "Alport syndrome" "" "0000126504" "05132" "00153827" "00687" "Unknown" "38y" "no hearing loss (-HP:0000365); ocular changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126505" "05132" "00153828" "00687" "Unknown" "9y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126506" "01644" "00153829" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126507" "01644" "00153830" "00687" "Unknown" "32y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126508" "01644" "00153831" "00687" "Unknown" "22y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126509" "05396" "00153832" "00687" "Unknown" "66y" "" "" "" "" "" "" "" "" "" "" "glomerulosclerosis, segmental, focal (FSGS)" "" "0000126510" "05396" "00153833" "00687" "Unknown" "36y" "no hearing loss (-HP:0000365); no ocular changes; 42y-renal failure (HP:0000083)" "" "" "" "" "" "" "" "" "" "glomerulosclerosis, segmental, focal (FSGS)" "" "0000126511" "01644" "00153834" "00687" "Familial, autosomal recessive" "" "diagnosed with Alport syndrome by kidney biopsy; 5y-hearing loss (HP:0000365); 19y-renal failure (HP:0000083); 2y-hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126512" "01644" "00153835" "00687" "Familial, autosomal recessive" "" "hearing loss (HP:0000365); 21y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126513" "01644" "00153836" "00687" "Familial, autosomal recessive" "36y" "hearing loss (HP:0000365); no ocular changes; GBM pathology Basket-weave changes; 19y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport, autosomal recessive (ASAR)" "Alport syndrome" "" "0000126514" "05132" "00153837" "00687" "Unknown" "49y" "no hearing loss (-HP:0000365); no ocular changes; 49y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "Alport syndrome with diffuse leiomyomatosis" "" "0000126515" "01644" "00153838" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126516" "01644" "00153839" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126517" "01644" "00153840" "00687" "Unknown" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126518" "01644" "00153841" "00687" "Unknown" "28y" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126519" "05132" "00153842" "00687" "Unknown" "7y" "hearing loss (HP:0000365); no ocular changes; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "syndrome, Alport (AS)" "Alport syndrome" "" "0000126520" "05396" "00153843" "00687" "Unknown" "18y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology thickening; 37y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "glomerulosclerosis, segmental, focal (FSGS)" "" "0000126521" "01644" "00153844" "00687" "Unknown" "37y" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126547" "05132" "00153870" "00687" "Unknown" "53y" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology thinning, thickening and splitting; 52y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "Alport syndrome with diffuse leiomyomatosis" "" "0000126555" "01644" "00153878" "00687" "Unknown" "36y" "no hearing loss (-HP:0000365); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126562" "01644" "00153885" "00687" "Unknown" "3y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126567" "01644" "00153890" "00687" "Unknown" "7y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126600" "01644" "00153923" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126614" "01644" "00153937" "00687" "Unknown" "37y" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126625" "01644" "00153948" "00687" "Unknown" "36y" "no hearing loss (-HP:0000365); no ocular changes; hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126629" "05132" "00153952" "00687" "Unknown" "37y" "no hearing loss (-HP:0000365); no ocular changes; 34y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "Alport syndrome with diffuse leiomyomatosis" "" "0000126652" "01644" "00153975" "00687" "Unknown" "55y" "hearing loss (HP:0000365); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126661" "05132" "00153984" "00687" "Unknown" "49y" "no hearing loss (-HP:0000365); no ocular changes; 49y-renal failure (HP:0000083); hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "Alport syndrome with diffuse leiomyomatosis" "" "0000126802" "01644" "00154125" "00687" "Unknown" "" "hearing loss (HP:0000365); no ocular changes; 15.2y-renal failure (HP:0000083)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000126839" "05132" "00154162" "00687" "Unknown" "" "no hearing loss (-HP:0000365); no ocular changes; GBM pathology thinning and splitting; hematuria (HP:0000790); proteinuria (HP:0000093)" "" "" "" "" "" "" "" "" "" "Alport syndrome with diffuse leiomyomatosis" "" "0000126969" "01644" "00154292" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000127028" "01644" "00154351" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000127035" "01644" "00154358" "00687" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000127064" "01169" "00153845" "00006" "Familial, autosomal dominant" "" "hematuria (HP:0000790)" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000127220" "01644" "00154484" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "ASAR" "Alport syndrome" "" "0000166794" "05132" "00218348" "02476" "Unknown" "" "microhematuria, moderate hearing loss / Alport syndrome" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000174759" "05132" "00234339" "02473" "Familial, autosomal recessive" "30y" "Haematuria\r\nProteinuria\r\nEnd stage renal failure\r\nDeafness" "?" "20y" "" "" "" "" "" "" "Alport syndrome" "" "" "0000185625" "01076" "00245757" "03128" "Familial, autosomal dominant" "" "Persistent microhaematuria, proteinuria, astigmatism and myopia." "" "" "" "" "" "" "" "" "" "" "" "0000224065" "05132" "00296663" "02367" "Familial, autosomal recessive" "10y" "hematuria, proteinuria" "05y" "10y" "hematuria" "" "" "" "" "" "10y" "5y" "" "0000224066" "01361" "00296665" "02367" "Familial, autosomal dominant" "44y" "hematuria" "06y" "44y" "hematuria" "" "" "" "" "" "44y" "6y" "" "0000228354" "05132" "00301049" "03641" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000269484" "00198" "00374274" "00006" "Familial, autosomal recessive" "" "Mild developmental delay, trichorrhexis nodosa and facial features indicative of autosomal recessive primary microcephaly." "" "" "" "" "" "" "" "" "" "microcephaly" "" "0000270441" "01644" "00375231" "04087" "Familial, autosomal recessive" "" "HP:0002907" "02y" "08y" "" "" "" "" "" "" "ATS2" "Alport syndrome" "" "0000270442" "01644" "00375232" "04087" "Familial, autosomal recessive" "" "HP:0002907, HP:0012593, HP:0012712" "06y" "13y" "" "" "" "" "" "" "Alport Syndrome" "" "" "0000270444" "01361" "00375234" "04087" "Unknown" "" "HP:0002907, HP:0012595" "15y" "19y" "" "" "" "" "" "" "TBMN" "" "" "0000270454" "05132" "00375244" "04087" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000270455" "05132" "00375245" "04087" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000288246" "04214" "00395046" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "" "0000295701" "01644" "00402954" "04087" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000295738" "01169" "00402991" "04087" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000295739" "01169" "00402992" "04087" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000295740" "01644" "00402993" "04087" "Familial, autosomal recessive" "" "HP:0000007" "" "" "" "" "" "" "" "" "" "" "" "0000295741" "01169" "00402994" "04087" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000295742" "01644" "00402995" "04087" "Unknown" "" "HP:0000007" "" "" "" "" "" "" "" "" "" "" "" "0000300242" "01076" "00408113" "01164" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "focal segmental glomerulosclerosis" "" "0000302679" "00198" "00410576" "00006" "Unknown" "" "see paper; ..., onset adolescence, hematuria, proteinuria, renal failure, family history" "" "" "" "" "" "" "" "" "ATS3" "" "" "0000306291" "00198" "00414456" "00000" "Unknown" "4y" "Alport Syndrome; Benign Familial Hematuria" "" "" "" "" "" "" "" "" "" "" "" "0000306307" "00198" "00414472" "00000" "Unknown" "9y" "Alport Syndrome; Benign Familial Hematuria" "" "" "" "" "" "" "" "" "" "" "" "0000318953" "00198" "00428007" "00006" "Familial, autosomal dominant" "66y" "" "" "" "" "" "" "" "" "" "Alport syndrome 3, autosomal dominant" "" "" "0000330952" "05086" "00441514" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "simplex/sporadic age-related hearing loss" "" "0000330953" "05086" "00441515" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "simplex/sporadic age-related hearing loss" "" "0000330954" "05086" "00441516" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "simplex/sporadic age-related hearing loss" "" "0000333289" "05132" "00444032" "04609" "Familial, autosomal dominant" "64y" "Microscopic haematuria and proteinuria. No nephrotic syndrome, no kidney failure, no kidney transplantation, no hearing impairment, no visual impairment" "" "64y" "" "" "" "" "" "" "Alport Syndrome" "Alport Syndrome" "" "0000333290" "05132" "00444033" "04609" "Familial, autosomal dominant" "62y" "Microscopic haematuria and proteinuria. No nephrotic syndrome, no kidney failure, no kidney transplantation, no hearing impairment, no visual impairment" "" "62y" "" "" "" "" "" "" "Alport Syndrome" "Alport Syndrome" "" "0000333291" "05132" "00444034" "04609" "Familial, autosomal dominant" "59y" "Microscopic haematuria and proteinuria. No nephrotic syndrome, no kidney failure, no kidney transplantation, presence of hearing impairment, no visual impairment" "" "59y" "" "" "" "" "" "" "Alport Syndrome" "Alport Syndrome" "" "0000336643" "00198" "00447444" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000337268" "05132" "00433429" "00006" "Unknown" "" "see paper" "" "" "" "" "" "" "" "" "" "Alport syndrome" "" "0000337272" "05132" "00433433" "00006" "Familial, autosomal recessive" "" "see paper" "" "" "" "" "" "" "" "" "ATS2" "Alport syndrome" "" "0000337273" "05132" "00433434" "00006" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "ATS3A" "Alport syndrome" "" "0000352752" "05362" "00467542" "04656" "Familial, autosomal dominant" "" "severe hearing loss" "" "" "" "" "" "" "" "" "" "hearing loss" "" "0000357120" "05132" "00472317" "04908" "Familial, autosomal dominant" "79y" "Renovascular disease, partial nephrectomy, Diabetes, no family history" "" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 698 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000018436" "00018452" "1" "00746" "00746" "2014-07-18 17:38:08" "" "" "SEQ-NG;SEQ-NG-I" "DNA" "" "" "0000018437" "00018453" "1" "00746" "00746" "2014-07-18 17:59:27" "" "" "SEQ-NG;SEQ-NG-I" "DNA" "" "" "0000018828" "00018844" "1" "00746" "00746" "2014-07-24 10:37:49" "00006" "2014-10-01 22:07:39" "RT-PCR;SEQ;SEQ-NG-I" "DNA;RNA" "" "" "0000091445" "00091300" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091446" "00091301" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091447" "00091302" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091448" "00091303" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091449" "00091304" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091450" "00091305" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091451" "00091306" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091452" "00091307" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091453" "00091308" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091454" "00091309" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091455" "00091310" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091456" "00091311" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091457" "00091312" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091458" "00091313" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091459" "00091314" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "EMC;SSCA;SEQ" "DNA" "" "" "0000091460" "00091315" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091461" "00091316" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091462" "00091317" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091463" "00091318" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091464" "00091319" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091465" "00091320" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091466" "00091321" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091467" "00091322" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091468" "00091323" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091469" "00091324" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091470" "00091325" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091471" "00091326" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091472" "00091327" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091473" "00091328" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091474" "00091329" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091475" "00091330" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "EMC;SSCA;SEQ" "DNA" "" "" "0000091476" "00091331" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091477" "00091332" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091478" "00091333" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "EMC;SSCA;SEQ" "DNA" "" "" "0000091479" "00091334" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091480" "00091335" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091481" "00091336" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091482" "00091337" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091483" "00091338" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091484" "00091339" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091485" "00091340" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091486" "00091341" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "EMC;SSCA;SEQ" "DNA" "" "" "0000091487" "00091342" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091488" "00091343" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091489" "00091344" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091490" "00091345" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091491" "00091346" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091492" "00091347" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091493" "00091348" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "RT-PCR;SEQ;DHPLC" "RNA;DNA" "" "" "0000091494" "00091349" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091495" "00091350" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091496" "00091351" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091497" "00091352" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091498" "00091353" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091499" "00091354" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091500" "00091355" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091501" "00091356" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091502" "00091357" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091503" "00091358" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091504" "00091359" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091505" "00091360" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091506" "00091361" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091507" "00091362" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091508" "00091363" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091509" "00091364" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091510" "00091365" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "DHPLC; SEQ" "DNA" "" "" "0000091511" "00091366" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091512" "00091367" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091513" "00091368" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091514" "00091369" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091515" "00091370" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091516" "00091371" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091517" "00091372" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091518" "00091373" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091519" "00091374" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091520" "00091375" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091521" "00091376" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA" "DNA" "" "" "0000091522" "00091377" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091523" "00091378" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091524" "00091379" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091525" "00091380" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091526" "00091381" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091527" "00091382" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091528" "00091383" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "EMC;SSCA;SEQ" "DNA" "" "" "0000091529" "00091384" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091530" "00091385" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "EMC;SSCA;SEQ" "DNA" "" "" "0000091531" "00091386" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091532" "00091387" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091533" "00091388" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091534" "00091389" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091535" "00091390" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091536" "00091391" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091537" "00091392" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091538" "00091393" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091539" "00091394" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091540" "00091395" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091541" "00091396" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "DHPLC; SEQ" "DNA" "" "" "0000091542" "00091397" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091543" "00091398" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091544" "00091399" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091545" "00091400" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091546" "00091401" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091547" "00091402" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091548" "00091403" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091549" "00091404" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091550" "00091405" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA; RT-PCR; SEQ" "DNA;RNA" "" "" "0000091551" "00091406" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091552" "00091407" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091553" "00091408" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091554" "00091409" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "EMC;SSCA;SEQ" "DNA" "" "" "0000091555" "00091410" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091556" "00091411" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091557" "00091412" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091558" "00091413" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091559" "00091414" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091560" "00091415" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091561" "00091416" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "DHPLC; SEQ" "DNA" "" "" "0000091562" "00091417" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "EMC;SSCA;SEQ" "DNA" "" "" "0000091563" "00091418" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091564" "00091419" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091565" "00091420" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091566" "00091421" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091567" "00091422" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091568" "00091423" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091569" "00091424" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091570" "00091425" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA; RT-PCR; SEQ" "DNA;RNA" "" "" "0000091571" "00091426" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "EMC;SSCA;SEQ" "DNA" "" "" "0000091572" "00091427" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091573" "00091428" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091574" "00091429" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091575" "00091430" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091576" "00091431" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091577" "00091432" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "RT-PCR;SSCA;SEQ" "RNA;DNA" "" "" "0000091578" "00091433" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "RT-PCR;SSCA;SEQ" "RNA;DNA" "" "" "0000091579" "00091434" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "RT-PCR;SSCA;SEQ" "RNA;DNA" "" "" "0000091580" "00091435" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "RT-PCR;SEQ;DHPLC" "RNA;DNA" "" "" "0000091581" "00091436" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091582" "00091437" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091583" "00091438" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091584" "00091439" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091585" "00091440" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091586" "00091441" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091587" "00091442" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "RT-PCR; SEQ" "RNA;DNA" "" "" "0000091588" "00091443" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "RT-PCR;SSCA;SEQ" "RNA;DNA" "" "" "0000091589" "00091444" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "RT-PCR;SEQ" "RNA;DNA" "" "" "0000091590" "00091445" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "RT-PCR;SSCA;SEQ" "DNA;RNA" "" "" "0000091591" "00091446" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "RT-PCR;SSCA;SEQ" "RNA;DNA" "" "" "0000091592" "00091447" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "RT-PCR;SSCA;SEQ" "RNA;DNA" "" "" "0000091593" "00091448" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091594" "00091449" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091595" "00091450" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "EMC;SSCA;SEQ" "DNA" "" "" "0000091596" "00091451" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;SEQ" "DNA" "" "" "0000091597" "00091452" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091598" "00091453" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091599" "00091454" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091600" "00091455" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091601" "00091456" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091602" "00091457" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091603" "00091458" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "HD;SSCA;SEQ" "DNA" "" "" "0000091604" "00091459" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "EMC;SSCA;SEQ" "DNA" "" "" "0000091605" "00091460" "1" "00687" "00687" "2011-01-05 13:36:44" "00687" "2011-05-04 02:37:19" "SSCA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000091606" "00091461" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091607" "00091462" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091608" "00091463" "1" "00687" "00687" "2011-01-05 13:35:21" "00687" "2011-05-04 02:37:19" "SEQ" "DNA" "" "" "0000091609" "00091464" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091610" "00091465" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091611" "00091466" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091612" "00091467" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091613" "00091468" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091614" "00091469" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091615" "00091470" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091616" "00091471" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091617" "00091472" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091618" "00091473" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091619" "00091474" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091620" "00091475" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091621" "00091476" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091622" "00091477" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091623" "00091478" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091624" "00091479" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091625" "00091480" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091626" "00091481" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091627" "00091482" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091628" "00091483" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091629" "00091484" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091630" "00091485" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091631" "00091486" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091632" "00091487" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091633" "00091488" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091634" "00091489" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091635" "00091490" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091636" "00091491" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091637" "00091492" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091638" "00091493" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091639" "00091494" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091640" "00091495" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091641" "00091496" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091642" "00091497" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091643" "00091498" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091644" "00091499" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091645" "00091500" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091646" "00091501" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091647" "00091502" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091648" "00091503" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091649" "00091504" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091650" "00091505" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091651" "00091506" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091652" "00091507" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091653" "00091508" "1" "00687" "00687" "2012-01-19 03:04:05" "00687" "2012-01-19 03:04:30" "SEQ" "DNA" "" "" "0000091654" "00091509" "1" "01545" "01545" "2012-09-04 09:52:51" "00687" "2013-12-22 05:16:56" "SEQ" "DNA" "" "" "0000091655" "00091510" "1" "01545" "01545" "2012-09-03 19:49:27" "00687" "2013-12-22 05:16:56" "PCR;SEQ" "DNA" "" "" "0000091656" "00091511" "1" "00466" "00466" "2012-10-12 12:17:50" "00466" "2015-03-18 11:17:54" "SEQ" "DNA" "" "" "0000091657" "00091512" "1" "00466" "00466" "2012-10-12 12:21:24" "00466" "2015-03-18 11:18:25" "SEQ" "DNA" "" "" "0000091658" "00091513" "1" "00466" "00466" "2012-10-12 12:26:06" "00466" "2015-03-18 11:21:59" "SEQ" "DNA" "" "" "0000091659" "00091514" "1" "00466" "00466" "2012-10-12 12:31:44" "00466" "2015-03-18 11:27:59" "SEQ" "DNA" "" "" "0000091660" "00091515" "1" "00466" "00466" "2012-10-12 12:45:09" "00466" "2015-03-18 11:27:32" "SEQ" "DNA" "" "" "0000091661" "00091516" "1" "00466" "00466" "2012-10-12 12:48:34" "00466" "2015-03-18 11:27:15" "SEQ" "DNA" "" "" "0000091662" "00091517" "1" "00466" "00466" "2012-10-12 12:52:12" "00466" "2015-03-18 11:24:11" "SEQ" "DNA" "" "" "0000091663" "00091518" "1" "00466" "00466" "2012-10-12 12:53:57" "00466" "2015-03-18 11:25:16" "SEQ" "DNA" "" "" "0000091664" "00091519" "1" "00466" "00466" "2012-10-12 12:56:48" "00466" "2015-03-18 11:25:32" "SEQ" "DNA" "" "" "0000091665" "00091520" "1" "00466" "00466" "2012-10-12 13:00:37" "00466" "2015-03-18 11:29:45" "SEQ" "DNA" "" "" "0000091666" "00091521" "1" "00466" "00466" "2012-10-12 13:03:51" "00466" "2015-03-18 11:30:19" "SEQ" "DNA" "" "" "0000091667" "00091522" "1" "00466" "00466" "2012-10-12 13:05:55" "00466" "2015-03-18 11:28:16" "SEQ" "DNA" "" "" "0000091668" "00091523" "1" "00466" "00466" "2012-10-12 13:09:33" "00466" "2015-03-18 11:30:45" "SEQ" "DNA" "" "" "0000091669" "00091524" "1" "00466" "00466" "2012-10-12 13:12:55" "00466" "2015-03-18 11:29:24" "SEQ" "DNA" "" "" "0000091670" "00091525" "1" "00466" "00466" "2012-10-12 13:14:55" "00466" "2015-03-18 11:29:10" "SEQ" "DNA" "" "" "0000091671" "00091526" "1" "00466" "00466" "2012-10-12 14:41:48" "00466" "2015-03-18 11:16:31" "SEQ" "DNA" "" "" "0000091672" "00091527" "1" "00466" "00466" "2012-10-12 14:43:53" "00466" "2015-03-18 11:25:50" "SEQ" "DNA" "" "" "0000091673" "00091528" "1" "00466" "00466" "2012-10-12 14:45:49" "00466" "2015-03-18 11:30:31" "SEQ" "DNA" "" "" "0000091674" "00091529" "1" "00466" "00466" "2012-10-12 14:47:28" "00466" "2015-03-18 11:26:54" "SEQ" "DNA" "" "" "0000091675" "00091530" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091676" "00091531" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091677" "00091532" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091678" "00091533" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091679" "00091534" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091680" "00091535" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091681" "00091536" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091682" "00091537" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091683" "00091538" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091684" "00091539" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091685" "00091540" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091686" "00091541" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091687" "00091542" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091688" "00091543" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091689" "00091544" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091690" "00091545" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091691" "00091546" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091692" "00091547" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091693" "00091548" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091694" "00091549" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091695" "00091550" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091696" "00091551" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091697" "00091552" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091698" "00091553" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091699" "00091554" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091700" "00091555" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091701" "00091556" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091702" "00091557" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091703" "00091558" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091704" "00091559" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091705" "00091560" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091706" "00091561" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091707" "00091562" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091708" "00091563" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091709" "00091564" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091710" "00091565" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091711" "00091566" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091712" "00091567" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091713" "00091568" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091714" "00091569" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091715" "00091570" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091716" "00091571" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091717" "00091572" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091718" "00091573" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091719" "00091574" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091720" "00091575" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091721" "00091576" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091722" "00091577" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091723" "00091578" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091724" "00091579" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091725" "00091580" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091726" "00091581" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091727" "00091582" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091728" "00091583" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091729" "00091584" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091730" "00091585" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091731" "00091586" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091732" "00091587" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091733" "00091588" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091734" "00091589" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091735" "00091590" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091736" "00091591" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091737" "00091592" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091738" "00091593" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091739" "00091594" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091740" "00091595" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091741" "00091596" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091742" "00091597" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091743" "00091598" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091744" "00091599" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091745" "00091600" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091746" "00091601" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091747" "00091602" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091748" "00091603" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091749" "00091604" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091750" "00091605" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091751" "00091606" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091752" "00091607" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091753" "00091608" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091754" "00091609" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091755" "00091610" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091756" "00091611" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091757" "00091612" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091758" "00091613" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091759" "00091614" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091760" "00091615" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091761" "00091616" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091762" "00091617" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091763" "00091618" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091764" "00091619" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091765" "00091620" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091766" "00091621" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091767" "00091622" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091768" "00091623" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091769" "00091624" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091770" "00091625" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091771" "00091626" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091772" "00091627" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091773" "00091628" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091774" "00091629" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091775" "00091630" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091776" "00091631" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091777" "00091632" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091778" "00091633" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091779" "00091634" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091780" "00091635" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091781" "00091636" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091782" "00091637" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091783" "00091638" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091784" "00091639" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091785" "00091640" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091786" "00091641" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091787" "00091642" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091788" "00091643" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091789" "00091644" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091790" "00091645" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091791" "00091646" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091792" "00091647" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091793" "00091648" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091794" "00091649" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091795" "00091650" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091796" "00091651" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091797" "00091652" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091798" "00091653" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091799" "00091654" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091800" "00091655" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091801" "00091656" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091802" "00091657" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091803" "00091658" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091804" "00091659" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091805" "00091660" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091806" "00091661" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091807" "00091662" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091808" "00091663" "1" "00687" "00687" "2013-12-23 13:30:43" "" "" "SEQ" "DNA" "" "" "0000091809" "00091664" "1" "01548" "01548" "2015-06-19 20:54:11" "" "" "SEQ" "DNA" "" "" "0000091811" "00091666" "1" "01548" "01548" "2015-06-19 21:06:55" "" "" "SEQ" "DNA" "" "" "0000091812" "00091667" "1" "01548" "01548" "2015-06-19 21:09:44" "" "" "SEQ" "DNA" "" "" "0000091813" "00091668" "1" "01548" "01548" "2015-06-19 21:13:11" "" "" "SEQ" "DNA" "" "" "0000104460" "00103989" "1" "00587" "00006" "2017-04-28 08:15:46" "" "" "SEQ-NG" "DNA" "" "" "0000153575" "00152713" "1" "02367" "02367" "2018-02-07 19:41:08" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000153576" "00152714" "1" "02367" "02367" "2018-02-07 19:53:03" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000153578" "00152716" "1" "02367" "02367" "2018-02-07 20:23:12" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000154164" "00153301" "1" "02367" "02367" "2018-02-11 21:50:20" "" "" "MLPA;SEQ-NG-I" "DNA" "blood" "" "0000154171" "00153308" "1" "02367" "02367" "2018-02-12 19:04:08" "" "" "MLPA;SEQ-NG-I" "DNA" "blood" "" "0000154182" "00153319" "1" "02367" "02367" "2018-02-14 18:54:52" "" "" "MLPA;SEQ-NG-I" "DNA" "blood" "gene panel (COL4A3, COL4A4, COL4A5, CFHR5, MYH9)" "0000154189" "00153325" "1" "02367" "02367" "2018-02-14 21:42:52" "" "" "MLPA;SEQ-NG-I" "DNA" "blood" "gene panel (COL4A3, COL4A4, COL4A5, CFHR5, MYH9)" "0000154256" "00153395" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154261" "00153400" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154262" "00153401" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154263" "00153402" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154266" "00153405" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154269" "00153408" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154270" "00153409" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154273" "00153412" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154274" "00153413" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154275" "00153414" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154282" "00153421" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154289" "00153428" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154290" "00153429" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154292" "00153431" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154293" "00153432" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154297" "00153436" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154298" "00153437" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154301" "00153440" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154303" "00153442" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154306" "00153445" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154314" "00153453" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154316" "00153455" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154317" "00153456" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154320" "00153459" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154322" "00153461" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154323" "00153462" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154324" "00153463" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154329" "00153468" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154333" "00153472" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154341" "00153480" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154342" "00153481" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154344" "00153483" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154345" "00153484" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154346" "00153485" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154355" "00153494" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154361" "00153500" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154364" "00153503" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154366" "00153505" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154368" "00153507" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154384" "00153523" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154392" "00153531" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154401" "00153540" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154414" "00153553" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154415" "00153554" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154420" "00153559" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154423" "00153562" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154425" "00153564" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154430" "00153569" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154432" "00153571" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154443" "00153582" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154444" "00153583" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154445" "00153584" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154448" "00153587" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154449" "00153588" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154453" "00153592" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154455" "00153594" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154464" "00153603" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154466" "00153605" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154467" "00153606" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154468" "00153607" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154470" "00153609" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154478" "00153617" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154480" "00153619" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154485" "00153624" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154492" "00153631" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154499" "00153638" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154501" "00153640" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154506" "00153645" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154507" "00153646" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154508" "00153647" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154513" "00153652" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154523" "00153662" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154524" "00153663" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154526" "00153665" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154530" "00153669" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154532" "00153671" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154533" "00153672" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154541" "00153680" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154542" "00153681" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154543" "00153682" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154544" "00153683" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154545" "00153684" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "WES" "0000154546" "00153685" "1" "00687" "00006" "2018-02-19 09:42:17" "00006" "2018-02-21 12:39:18" "SEQ-NG" "DNA" "blood" "" "0000154547" "00153686" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCRq;RT-PCR;SEQ" "DNA" "blood" "" "0000154548" "00153687" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCRq;RT-PCR;SEQ" "DNA" "blood" "" "0000154549" "00153688" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCRq;RT-PCR;SEQ" "DNA" "blood" "" "0000154550" "00153689" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154551" "00153690" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000154552" "00153691" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCRq;RT-PCR;SEQ" "DNA" "blood" "" "0000154553" "00153692" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000154554" "00153693" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154555" "00153694" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154556" "00153695" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154557" "00153696" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154558" "00153697" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154559" "00153698" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154560" "00153699" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000154561" "00153700" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "" "WES" "0000154562" "00153701" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154563" "00153702" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154564" "00153703" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "" "WES" "0000154565" "00153704" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000154566" "00153705" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154567" "00153706" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000154568" "00153707" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154569" "00153708" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154570" "00153709" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCRq;RT-PCR;SEQ" "DNA" "blood" "" "0000154571" "00153710" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154572" "00153711" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154573" "00153712" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154574" "00153713" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154575" "00153714" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154576" "00153715" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154577" "00153716" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154578" "00153717" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154579" "00153718" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154580" "00153719" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000154581" "00153720" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154582" "00153721" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154583" "00153722" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCRq;RT-PCR;SEQ" "DNA" "blood" "" "0000154584" "00153723" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154585" "00153724" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154586" "00153725" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154587" "00153726" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154588" "00153727" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154589" "00153728" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154590" "00153729" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154591" "00153730" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154592" "00153731" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000154593" "00153732" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154594" "00153733" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154595" "00153734" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154596" "00153735" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCRq;RT-PCR;SEQ" "DNA" "blood" "" "0000154597" "00153736" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154598" "00153737" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154599" "00153738" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154600" "00153739" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154601" "00153740" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154602" "00153741" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154603" "00153742" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154604" "00153743" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154605" "00153744" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154606" "00153745" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154607" "00153746" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154609" "00153748" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154610" "00153749" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000154611" "00153750" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154612" "00153751" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCRq;RT-PCR;SEQ" "DNA" "blood" "" "0000154613" "00153752" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154614" "00153753" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154615" "00153754" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCRq;RT-PCR;SEQ" "DNA" "blood" "" "0000154616" "00153755" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154617" "00153756" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154618" "00153757" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154619" "00153758" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154620" "00153759" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154621" "00153760" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154622" "00153761" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154623" "00153762" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "" "WES" "0000154624" "00153763" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154625" "00153764" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154626" "00153765" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154627" "00153766" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCRq;RT-PCR;SEQ" "DNA" "blood" "" "0000154628" "00153767" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154629" "00153768" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154630" "00153769" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000154631" "00153770" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154632" "00153771" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154633" "00153772" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCRq;RT-PCR;SEQ" "DNA" "blood" "" "0000154634" "00153773" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCRq;RT-PCR;SEQ" "DNA" "blood" "" "0000154635" "00153774" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154636" "00153775" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154637" "00153776" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154638" "00153777" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154639" "00153778" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000154640" "00153779" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154641" "00153780" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154642" "00153781" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154643" "00153782" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154644" "00153783" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154645" "00153784" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCRq;RT-PCR;SEQ" "DNA" "blood" "" "0000154646" "00153785" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154647" "00153786" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154648" "00153787" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154649" "00153788" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154650" "00153789" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154651" "00153790" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154652" "00153791" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154653" "00153792" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154654" "00153793" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154655" "00153794" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154656" "00153795" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154657" "00153796" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000154658" "00153797" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154659" "00153798" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154660" "00153799" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000154661" "00153800" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154662" "00153801" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCR;SEQ" "DNA" "blood" "" "0000154663" "00153802" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154664" "00153803" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154665" "00153804" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154666" "00153805" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154667" "00153806" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154668" "00153807" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154669" "00153808" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCR;SEQ" "DNA" "blood" "" "0000154670" "00153809" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154671" "00153810" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154672" "00153811" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154673" "00153812" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154674" "00153813" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCR;SEQ" "DNA" "blood" "" "0000154675" "00153814" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154676" "00153815" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000154677" "00153816" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154678" "00153817" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154680" "00153819" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000154681" "00153820" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154682" "00153821" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154683" "00153822" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000154684" "00153823" "1" "00687" "00006" "2018-02-19 09:42:17" "00006" "2018-02-21 12:51:44" "MLPA" "DNA" "" "" "0000154685" "00153824" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154686" "00153825" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154687" "00153826" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154688" "00153827" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154689" "00153828" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154690" "00153829" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154691" "00153830" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154692" "00153831" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154693" "00153832" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154694" "00153833" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "" "WES" "0000154695" "00153834" "1" "00687" "00006" "2018-02-19 09:42:17" "00006" "2018-02-21 12:24:44" "RT-PCR;SEQ" "DNA;RNA" "blood" "" "0000154696" "00153835" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154697" "00153836" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "PCR;SEQ" "DNA" "blood" "" "0000154698" "00153837" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "segregation analysis" "0000154699" "00153838" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154700" "00153839" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154701" "00153840" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154702" "00153841" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000154703" "00153842" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "blood" "" "0000154704" "00153843" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "" "WES" "0000154705" "00153844" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154706" "00153845" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000154731" "00153870" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "segregation analysis" "0000154739" "00153878" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154746" "00153885" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154751" "00153890" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154784" "00153923" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000154798" "00153937" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154809" "00153948" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154813" "00153952" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "segregation analysis" "0000154836" "00153975" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000154845" "00153984" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "segregation analysis" "0000154986" "00154125" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000155023" "00154162" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ;SEQ-NG" "DNA" "blood" "segregation analysis" "0000155153" "00154292" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000155212" "00154351" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000155219" "00154358" "1" "00687" "00006" "2018-02-19 09:42:17" "" "" "SEQ" "DNA" "" "" "0000155344" "00154484" "1" "00006" "00006" "2018-02-25 11:50:21" "" "" "SEQ" "DNA" "" "" "0000219417" "00218348" "1" "02476" "02476" "2019-01-22 19:42:29" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000235441" "00234339" "1" "02473" "02473" "2019-05-08 16:32:36" "" "" "SEQ-NG" "DNA" "" "" "0000246870" "00245757" "1" "03128" "03128" "2019-07-08 10:00:34" "" "" "SEQ-NG-IT" "DNA" "" "" "0000293790" "00292622" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293791" "00292623" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293792" "00292624" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293793" "00292625" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000297773" "00296663" "1" "02367" "02367" "2020-04-10 08:13:58" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000297774" "00296664" "1" "02367" "02367" "2020-04-10 08:22:20" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000297775" "00296665" "1" "02367" "02367" "2020-04-10 08:31:07" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000302171" "00301049" "1" "03641" "03641" "2020-05-06 14:57:16" "" "" "SEQ-NG" "DNA" "blood" "WES" "0000305922" "00304793" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305923" "00304794" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000328271" "00327056" "1" "03611" "03611" "2021-01-20 03:13:13" "" "" "SEQ-NG-I" "DNA" "" "" "0000375468" "00374274" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000376425" "00375231" "1" "04087" "04087" "2021-06-01 10:29:17" "" "" "SEQ-NG" "DNA" "Blood" "" "0000376426" "00375232" "1" "04087" "04087" "2021-06-01 11:32:25" "" "" "SEQ-NG" "DNA" "Blood" "" "0000376428" "00375234" "1" "04087" "04087" "2021-06-01 11:56:32" "" "" "SEQ-NG" "DNA" "Blood" "" "0000376438" "00375244" "1" "04087" "04087" "2021-06-01 15:01:42" "" "" "SEQ-NG" "DNA" "" "" "0000376439" "00375245" "1" "04087" "04087" "2021-06-01 15:06:00" "" "" "SEQ-NG" "DNA" "" "" "0000396292" "00395046" "1" "00000" "03840" "2021-12-03 13:19:14" "" "" "SEQ-NG" "DNA" "blood" "115 genes causing different inherited kidney diseases" "0000404195" "00402954" "1" "04087" "04087" "2022-02-15 10:51:05" "04087" "2022-02-15 13:26:57" "-" "DNA" "" "" "0000404232" "00402991" "1" "04087" "04087" "2022-02-15 11:51:01" "04087" "2022-02-15 13:28:39" "?" "DNA" "" "" "0000404233" "00402992" "1" "04087" "04087" "2022-02-15 12:04:44" "04087" "2022-02-15 13:29:23" "?" "DNA" "" "" "0000404234" "00402993" "1" "04087" "04087" "2022-02-15 13:37:36" "" "" "?" "DNA" "" "" "0000404235" "00402994" "1" "04087" "04087" "2022-02-15 13:44:05" "" "" "?" "DNA" "" "" "0000404236" "00402995" "1" "04087" "04087" "2022-02-15 13:49:30" "" "" "?" "DNA" "" "" "0000409368" "00408113" "1" "01164" "01164" "2022-04-14 09:28:24" "" "" "SEQ-NG-I" "DNA" "Blood" "WES" "0000411841" "00410576" "1" "00006" "00006" "2022-05-29 10:39:10" "" "" "SEQ" "DNA" "" "targeted gene analysis" "0000415736" "00414456" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000415752" "00414472" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000419803" "00418508" "1" "00006" "00006" "2022-09-29 15:33:30" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "blood" "WES" "0000429420" "00428007" "1" "00006" "00006" "2022-12-19 13:11:26" "" "" "RT-PCR;SEQ;SEQ-NG-RNA" "DNA;RNA" "fibroblasts" "singleton WES" "0000434836" "00433382" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434837" "00433383" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434838" "00433384" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434839" "00433385" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434840" "00433386" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434841" "00433387" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434842" "00433388" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434843" "00433389" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434844" "00433390" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434845" "00433391" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434846" "00433392" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434847" "00433393" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434848" "00433394" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434849" "00433395" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434850" "00433396" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434851" "00433397" "1" "00006" "00006" "2023-03-08 14:38:50" "" "" "SEQ" "DNA" "" "" "0000434883" "00433429" "1" "00006" "00006" "2023-03-08 15:46:37" "" "" "SEQ" "DNA" "" "" "0000434887" "00433433" "1" "00006" "00006" "2023-03-08 15:46:37" "" "" "SEQ" "DNA" "" "" "0000434888" "00433434" "1" "00006" "00006" "2023-03-08 15:46:37" "" "" "SEQ" "DNA" "" "" "0000443000" "00441514" "1" "00006" "00006" "2023-11-08 15:20:43" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000443001" "00441515" "1" "00006" "00006" "2023-11-08 15:20:43" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000443002" "00441516" "1" "00006" "00006" "2023-11-08 15:20:43" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000445529" "00444032" "1" "04609" "04609" "2023-12-11 10:42:08" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000445530" "00444033" "1" "04609" "04609" "2023-12-11 11:12:34" "" "" "SEQ-NG-I" "DNA" "Bloodc" "" "0000445531" "00444034" "1" "04609" "04609" "2023-12-11 11:33:29" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000449021" "00447444" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000450141" "00448551" "1" "03676" "03676" "2024-04-08 13:19:06" "" "" "SEQ-NG" "DNA" "Blood" "" "0000469205" "00467542" "1" "04656" "00006" "2025-10-16 12:16:39" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000473987" "00472317" "1" "04908" "04908" "2026-02-02 01:49:01" "" "" "SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 717 "{{screeningid}}" "{{geneid}}" "0000018436" "NPHS1" "0000018437" "NPHS2" "0000018828" "INF2" "0000091445" "COL4A3" "0000091446" "COL4A3" "0000091447" "COL4A3" "0000091448" "COL4A3" "0000091449" "COL4A3" "0000091450" "COL4A3" "0000091451" "COL4A3" "0000091452" "COL4A3" "0000091453" "COL4A3" "0000091454" "COL4A3" "0000091455" "COL4A3" "0000091456" "COL4A3" "0000091457" "COL4A3" "0000091458" "COL4A3" "0000091459" "COL4A3" "0000091460" "COL4A3" "0000091461" "COL4A3" "0000091462" "COL4A3" "0000091463" "COL4A3" "0000091464" "COL4A3" "0000091465" "COL4A3" "0000091466" "COL4A3" "0000091467" "COL4A3" "0000091468" "COL4A3" "0000091469" "COL4A3" "0000091470" "COL4A3" "0000091471" "COL4A3" "0000091472" "COL4A3" "0000091473" "COL4A3" "0000091474" "COL4A3" "0000091475" "COL4A3" "0000091476" "COL4A3" "0000091477" "COL4A3" "0000091478" "COL4A3" "0000091479" "COL4A3" "0000091480" "COL4A3" "0000091481" "COL4A3" "0000091482" "COL4A3" "0000091483" "COL4A3" "0000091484" "COL4A3" "0000091485" "COL4A3" "0000091486" "COL4A3" "0000091487" "COL4A3" "0000091488" "COL4A3" "0000091489" "COL4A3" "0000091490" "COL4A3" "0000091491" "COL4A3" "0000091492" "COL4A3" "0000091493" "COL4A3" "0000091494" "COL4A3" "0000091495" "COL4A3" "0000091496" "COL4A3" "0000091497" "COL4A3" "0000091498" "COL4A3" "0000091499" "COL4A3" "0000091500" "COL4A3" "0000091501" "COL4A3" "0000091502" "COL4A3" "0000091503" "COL4A3" "0000091504" "COL4A3" "0000091505" "COL4A3" "0000091506" "COL4A3" "0000091507" "COL4A3" "0000091508" "COL4A3" "0000091509" "COL4A3" "0000091510" "COL4A3" "0000091511" "COL4A3" "0000091512" "COL4A3" "0000091513" "COL4A3" "0000091514" "COL4A3" "0000091515" "COL4A3" "0000091516" "COL4A3" "0000091517" "COL4A3" "0000091518" "COL4A3" "0000091519" "COL4A3" "0000091520" "COL4A3" "0000091521" "COL4A3" "0000091522" "COL4A3" "0000091523" "COL4A3" "0000091524" "COL4A3" "0000091525" "COL4A3" "0000091526" "COL4A3" "0000091527" "COL4A3" "0000091528" "COL4A3" "0000091529" "COL4A3" "0000091530" "COL4A3" "0000091531" "COL4A3" "0000091532" "COL4A3" "0000091533" "COL4A3" "0000091534" "COL4A3" "0000091535" "COL4A3" "0000091536" "COL4A3" "0000091537" "COL4A3" "0000091538" "COL4A3" "0000091539" "COL4A3" "0000091540" "COL4A3" "0000091541" "COL4A3" "0000091542" "COL4A3" "0000091543" "COL4A3" "0000091544" "COL4A3" "0000091545" "COL4A3" "0000091546" "COL4A3" "0000091547" "COL4A3" "0000091548" "COL4A3" "0000091549" "COL4A3" "0000091550" "COL4A3" "0000091551" "COL4A3" "0000091552" "COL4A3" "0000091553" "COL4A3" "0000091554" "COL4A3" "0000091555" "COL4A3" "0000091556" "COL4A3" "0000091557" "COL4A3" "0000091558" "COL4A3" "0000091559" "COL4A3" "0000091560" "COL4A3" "0000091561" "COL4A3" "0000091562" "COL4A3" "0000091563" "COL4A3" "0000091564" "COL4A3" "0000091565" "COL4A3" "0000091566" "COL4A3" "0000091567" "COL4A3" "0000091568" "COL4A3" "0000091569" "COL4A3" "0000091570" "COL4A3" "0000091571" "COL4A3" "0000091572" "COL4A3" "0000091573" "COL4A3" "0000091574" "COL4A3" "0000091575" "COL4A3" "0000091576" "COL4A3" "0000091577" "COL4A3" "0000091578" "COL4A3" "0000091579" "COL4A3" "0000091580" "COL4A3" "0000091581" "COL4A3" "0000091582" "COL4A3" "0000091583" "COL4A3" "0000091584" "COL4A3" "0000091585" "COL4A3" "0000091586" "COL4A3" "0000091587" "COL4A3" "0000091588" "COL4A3" "0000091589" "COL4A3" "0000091590" "COL4A3" "0000091591" "COL4A3" "0000091592" "COL4A3" "0000091593" "COL4A3" "0000091594" "COL4A3" "0000091595" "COL4A3" "0000091596" "COL4A3" "0000091597" "COL4A3" "0000091598" "COL4A3" "0000091599" "COL4A3" "0000091600" "COL4A3" "0000091601" "COL4A3" "0000091602" "COL4A3" "0000091603" "COL4A3" "0000091604" "COL4A3" "0000091605" "COL4A3" "0000091606" "COL4A3" "0000091607" "COL4A3" "0000091608" "COL4A3" "0000091609" "COL4A3" "0000091610" "COL4A3" "0000091611" "COL4A3" "0000091612" "COL4A3" "0000091613" "COL4A3" "0000091614" "COL4A3" "0000091615" "COL4A3" "0000091616" "COL4A3" "0000091617" "COL4A3" "0000091618" "COL4A3" "0000091619" "COL4A3" "0000091620" "COL4A3" "0000091621" "COL4A3" "0000091622" "COL4A3" "0000091623" "COL4A3" "0000091624" "COL4A3" "0000091625" "COL4A3" "0000091626" "COL4A3" "0000091627" "COL4A3" "0000091628" "COL4A3" "0000091629" "COL4A3" "0000091630" "COL4A3" "0000091631" "COL4A3" "0000091632" "COL4A3" "0000091633" "COL4A3" "0000091634" "COL4A3" "0000091635" "COL4A3" "0000091636" "COL4A3" "0000091637" "COL4A3" "0000091638" "COL4A3" "0000091639" "COL4A3" "0000091640" "COL4A3" "0000091641" "COL4A3" "0000091642" "COL4A3" "0000091643" "COL4A3" "0000091644" "COL4A3" "0000091645" "COL4A3" "0000091646" "COL4A3" "0000091647" "COL4A3" "0000091648" "COL4A3" "0000091649" "COL4A3" "0000091650" "COL4A3" "0000091651" "COL4A3" "0000091652" "COL4A3" "0000091653" "COL4A3" "0000091654" "COL4A3" "0000091655" "COL4A3" "0000091656" "COL4A3" "0000091657" "COL4A3" "0000091658" "COL4A3" "0000091659" "COL4A3" "0000091660" "COL4A3" "0000091661" "COL4A3" "0000091662" "COL4A3" "0000091663" "COL4A3" "0000091664" "COL4A3" "0000091665" "COL4A3" "0000091666" "COL4A3" "0000091667" "COL4A3" "0000091668" "COL4A3" "0000091669" "COL4A3" "0000091670" "COL4A3" "0000091671" "COL4A3" "0000091672" "COL4A3" "0000091673" "COL4A3" "0000091674" "COL4A3" "0000091675" "COL4A3" "0000091676" "COL4A3" "0000091677" "COL4A3" "0000091678" "COL4A3" "0000091679" "COL4A3" "0000091680" "COL4A3" "0000091681" "COL4A3" "0000091682" "COL4A3" "0000091683" "COL4A3" "0000091684" "COL4A3" "0000091685" "COL4A3" "0000091686" "COL4A3" "0000091687" "COL4A3" "0000091688" "COL4A3" "0000091689" "COL4A3" "0000091690" "COL4A3" "0000091691" "COL4A3" "0000091692" "COL4A3" "0000091693" "COL4A3" "0000091694" "COL4A3" "0000091695" "COL4A3" "0000091696" "COL4A3" "0000091697" "COL4A3" "0000091698" "COL4A3" "0000091699" "COL4A3" "0000091700" "COL4A3" "0000091701" "COL4A3" "0000091702" "COL4A3" "0000091703" "COL4A3" "0000091704" "COL4A3" "0000091705" "COL4A3" "0000091706" "COL4A3" "0000091707" "COL4A3" "0000091708" "COL4A3" "0000091709" "COL4A3" "0000091710" "COL4A3" "0000091711" "COL4A3" "0000091712" "COL4A3" "0000091713" "COL4A3" "0000091714" "COL4A3" "0000091715" "COL4A3" "0000091716" "COL4A3" "0000091717" "COL4A3" "0000091718" "COL4A3" "0000091719" "COL4A3" "0000091720" "COL4A3" "0000091721" "COL4A3" "0000091722" "COL4A3" "0000091723" "COL4A3" "0000091724" "COL4A3" "0000091725" "COL4A3" "0000091726" "COL4A3" "0000091727" "COL4A3" "0000091728" "COL4A3" "0000091729" "COL4A3" "0000091730" "COL4A3" "0000091731" "COL4A3" "0000091732" "COL4A3" "0000091733" "COL4A3" "0000091734" "COL4A3" "0000091735" "COL4A3" "0000091736" "COL4A3" "0000091737" "COL4A3" "0000091738" "COL4A3" "0000091739" "COL4A3" "0000091740" "COL4A3" "0000091741" "COL4A3" "0000091742" "COL4A3" "0000091743" "COL4A3" "0000091744" "COL4A3" "0000091745" "COL4A3" "0000091746" "COL4A3" "0000091747" "COL4A3" "0000091748" "COL4A3" "0000091749" "COL4A3" "0000091750" "COL4A3" "0000091751" "COL4A3" "0000091752" "COL4A3" "0000091753" "COL4A3" "0000091754" "COL4A3" "0000091755" "COL4A3" "0000091756" "COL4A3" "0000091757" "COL4A3" "0000091758" "COL4A3" "0000091759" "COL4A3" "0000091760" "COL4A3" "0000091761" "COL4A3" "0000091762" "COL4A3" "0000091763" "COL4A3" "0000091764" "COL4A3" "0000091765" "COL4A3" "0000091766" "COL4A3" "0000091767" "COL4A3" "0000091768" "COL4A3" "0000091769" "COL4A3" "0000091770" "COL4A3" "0000091771" "COL4A3" "0000091772" "COL4A3" "0000091773" "COL4A3" "0000091774" "COL4A3" "0000091775" "COL4A3" "0000091776" "COL4A3" "0000091777" "COL4A3" "0000091778" "COL4A3" "0000091779" "COL4A3" "0000091780" "COL4A3" "0000091781" "COL4A3" "0000091782" "COL4A3" "0000091783" "COL4A3" "0000091784" "COL4A3" "0000091785" "COL4A3" "0000091786" "COL4A3" "0000091787" "COL4A3" "0000091788" "COL4A3" "0000091789" "COL4A3" "0000091790" "COL4A3" "0000091791" "COL4A3" "0000091792" "COL4A3" "0000091793" "COL4A3" "0000091794" "COL4A3" "0000091795" "COL4A3" "0000091796" "COL4A3" "0000091797" "COL4A3" "0000091798" "COL4A3" "0000091799" "COL4A3" "0000091800" "COL4A3" "0000091801" "COL4A3" "0000091802" "COL4A3" "0000091803" "COL4A3" "0000091804" "COL4A3" "0000091805" "COL4A3" "0000091806" "COL4A3" "0000091807" "COL4A3" "0000091808" "COL4A3" "0000091809" "COL4A3" "0000091811" "COL4A3" "0000091812" "COL4A3" "0000091813" "COL4A3" "0000153575" "CFHR5" "0000153575" "COL4A3" "0000153575" "COL4A4" "0000153575" "COL4A5" "0000153576" "CFHR5" "0000153576" "COL4A3" "0000153576" "COL4A4" "0000153576" "COL4A5" "0000153578" "CFHR5" "0000153578" "COL4A3" "0000153578" "COL4A4" "0000153578" "COL4A5" "0000154164" "CFHR5" "0000154164" "COL4A3" "0000154164" "COL4A4" "0000154164" "COL4A5" "0000154171" "CFHR5" "0000154171" "COL4A3" "0000154171" "COL4A4" "0000154171" "COL4A5" "0000154182" "COL4A3" "0000154182" "COL4A4" "0000154182" "COL4A5" "0000154189" "CFHR5" "0000154189" "COL4A3" "0000154189" "COL4A4" "0000154189" "COL4A5" "0000154256" "COL4A3" "0000154261" "COL4A3" "0000154262" "COL4A3" "0000154263" "COL4A3" "0000154266" "COL4A3" "0000154269" "COL4A3" "0000154270" "COL4A3" "0000154273" "COL4A3" "0000154274" "COL4A3" "0000154275" "COL4A3" "0000154282" "COL4A3" "0000154289" "COL4A3" "0000154290" "COL4A3" "0000154292" "COL4A3" "0000154293" "COL4A3" "0000154297" "COL4A3" "0000154298" "COL4A3" "0000154301" "COL4A3" "0000154303" "COL4A3" "0000154306" "COL4A3" "0000154314" "COL4A3" "0000154316" "COL4A3" "0000154317" "COL4A3" "0000154320" "COL4A3" "0000154322" "COL4A3" "0000154323" "COL4A3" "0000154324" "COL4A3" "0000154329" "COL4A3" "0000154333" "COL4A3" "0000154341" "COL4A3" "0000154342" "COL4A3" "0000154344" "COL4A3" "0000154345" "COL4A3" "0000154346" "COL4A3" "0000154355" "COL4A3" "0000154361" "COL4A3" "0000154364" "COL4A3" "0000154366" "COL4A3" "0000154368" "COL4A3" "0000154384" "COL4A3" "0000154392" "COL4A3" "0000154401" "COL4A3" "0000154414" "COL4A3" "0000154415" "COL4A3" "0000154420" "COL4A3" "0000154423" "COL4A3" "0000154425" "COL4A3" "0000154430" "COL4A3" "0000154432" "COL4A3" "0000154443" "COL4A5" "0000154444" "COL4A3" "0000154445" "COL4A3" "0000154448" "COL4A3" "0000154449" "COL4A3" "0000154453" "COL4A3" "0000154455" "COL4A3" "0000154464" "COL4A3" "0000154466" "COL4A3" "0000154467" "COL4A3" "0000154468" "COL4A3" "0000154470" "COL4A3" "0000154478" "COL4A3" "0000154480" "COL4A3" "0000154485" "COL4A3" "0000154492" "COL4A3" "0000154499" "COL4A3" "0000154501" "COL4A3" "0000154506" "COL4A5" "0000154507" "COL4A3" "0000154508" "COL4A3" "0000154513" "COL4A3" "0000154523" "COL4A4" "0000154524" "COL4A3" "0000154526" "COL4A3" "0000154530" "COL4A3" "0000154532" "COL4A4" "0000154533" "COL4A3" "0000154541" "COL4A3" "0000154542" "COL4A3" "0000154543" "COL4A3" "0000154544" "COL4A3" "0000154545" "COL4A3" "0000154546" "COL4A3" "0000154546" "COL4A4" "0000154547" "COL4A3" "0000154548" "COL4A3" "0000154549" "COL4A3" "0000154550" "COL4A3" "0000154551" "COL4A3" "0000154552" "COL4A3" "0000154553" "COL4A3" "0000154554" "COL4A3" "0000154555" "COL4A3" "0000154556" "COL4A3" "0000154557" "COL4A3" "0000154558" "COL4A3" "0000154559" "COL4A3" "0000154560" "COL4A3" "0000154561" "COL4A3" "0000154562" "COL4A3" "0000154563" "COL4A3" "0000154564" "COL4A3" "0000154565" "COL4A3" "0000154566" "COL4A3" "0000154567" "COL4A3" "0000154568" "COL4A3" "0000154569" "COL4A3" "0000154570" "COL4A3" "0000154571" "COL4A3" "0000154572" "COL4A3" "0000154573" "COL4A3" "0000154574" "COL4A3" "0000154575" "COL4A3" "0000154576" "COL4A3" "0000154577" "COL4A3" "0000154578" "COL4A3" "0000154579" "COL4A3" "0000154580" "COL4A3" "0000154581" "COL4A3" "0000154582" "COL4A3" "0000154583" "COL4A3" "0000154584" "COL4A3" "0000154585" "COL4A3" "0000154586" "COL4A3" "0000154587" "COL4A3" "0000154588" "COL4A3" "0000154589" "COL4A3" "0000154590" "COL4A3" "0000154591" "COL4A3" "0000154592" "COL4A3" "0000154593" "COL4A3" "0000154594" "COL4A3" "0000154595" "COL4A3" "0000154596" "COL4A3" "0000154597" "COL4A3" "0000154598" "COL4A3" "0000154599" "COL4A3" "0000154600" "COL4A3" "0000154601" "COL4A3" "0000154602" "COL4A3" "0000154603" "COL4A3" "0000154604" "COL4A3" "0000154605" "COL4A3" "0000154606" "COL4A3" "0000154607" "COL4A3" "0000154609" "COL4A3" "0000154610" "COL4A3" "0000154611" "COL4A3" "0000154612" "COL4A3" "0000154613" "COL4A3" "0000154614" "COL4A3" "0000154615" "COL4A3" "0000154616" "COL4A3" "0000154617" "COL4A3" "0000154618" "COL4A3" "0000154619" "COL4A3" "0000154620" "COL4A3" "0000154621" "COL4A3" "0000154622" "COL4A3" "0000154623" "COL4A3" "0000154624" "COL4A3" "0000154625" "COL4A3" "0000154626" "COL4A3" "0000154627" "COL4A3" "0000154628" "COL4A3" "0000154629" "COL4A3" "0000154630" "COL4A3" "0000154631" "COL4A3" "0000154632" "COL4A3" "0000154633" "COL4A3" "0000154634" "COL4A3" "0000154635" "COL4A3" "0000154636" "COL4A3" "0000154637" "COL4A3" "0000154638" "COL4A3" "0000154639" "COL4A3" "0000154640" "COL4A3" "0000154641" "COL4A3" "0000154642" "COL4A3" "0000154643" "COL4A3" "0000154644" "COL4A3" "0000154645" "COL4A3" "0000154646" "COL4A3" "0000154647" "COL4A3" "0000154648" "COL4A3" "0000154649" "COL4A3" "0000154650" "COL4A3" "0000154651" "COL4A3" "0000154652" "COL4A3" "0000154653" "COL4A3" "0000154654" "COL4A3" "0000154655" "COL4A3" "0000154656" "COL4A3" "0000154657" "COL4A3" "0000154658" "COL4A3" "0000154659" "COL4A3" "0000154660" "COL4A3" "0000154661" "COL4A3" "0000154662" "COL4A3" "0000154663" "COL4A3" "0000154664" "COL4A3" "0000154665" "COL4A3" "0000154666" "COL4A3" "0000154667" "COL4A3" "0000154668" "COL4A3" "0000154669" "COL4A3" "0000154670" "COL4A3" "0000154671" "COL4A3" "0000154672" "COL4A3" "0000154673" "COL4A3" "0000154674" "COL4A3" "0000154675" "COL4A3" "0000154676" "COL4A3" "0000154677" "COL4A3" "0000154678" "COL4A3" "0000154680" "COL4A3" "0000154681" "COL4A3" "0000154682" "COL4A3" "0000154683" "COL4A3" "0000154684" "COL4A3" "0000154685" "COL4A3" "0000154686" "COL4A3" "0000154687" "COL4A3" "0000154688" "COL4A3" "0000154689" "COL4A3" "0000154690" "COL4A3" "0000154691" "COL4A3" "0000154692" "COL4A3" "0000154693" "COL4A3" "0000154694" "COL4A3" "0000154695" "COL4A3" "0000154695" "COL4A4" "0000154695" "COL4A5" "0000154696" "COL4A3" "0000154697" "COL4A3" "0000154698" "COL4A3" "0000154699" "COL4A3" "0000154700" "COL4A3" "0000154701" "COL4A3" "0000154702" "COL4A3" "0000154703" "COL4A3" "0000154704" "COL4A3" "0000154705" "COL4A3" "0000154706" "COL4A4" "0000154731" "COL4A4" "0000154739" "COL4A4" "0000154746" "COL4A4" "0000154751" "COL4A4" "0000154784" "COL4A4" "0000154798" "COL4A4" "0000154809" "COL4A4" "0000154813" "COL4A4" "0000154836" "COL4A4" "0000154845" "COL4A4" "0000154986" "COL4A5" "0000155023" "COL4A5" "0000155153" "COL4A5" "0000155212" "COL4A5" "0000155219" "COL4A5" "0000155344" "COL4A3" "0000219417" "COL4A3" "0000235441" "COL4A3" "0000235441" "COL4A4" "0000235441" "COL4A5" "0000246870" "COL4A3" "0000246870" "COL4A4" "0000246870" "COL4A5" "0000297773" "CFHR5" "0000297773" "COL4A3" "0000297773" "COL4A4" "0000297773" "COL4A5" "0000297773" "COL4A6" "0000297773" "MYH9" "0000297774" "CFHR5" "0000297774" "COL4A3" "0000297774" "COL4A4" "0000297774" "COL4A5" "0000297774" "COL4A6" "0000297774" "MYH9" "0000297775" "CFHR5" "0000297775" "COL4A3" "0000297775" "COL4A4" "0000297775" "COL4A5" "0000297775" "COL4A6" "0000297775" "MYH9" "0000375468" "COL4A3" "0000396292" "COL4A3" "0000409368" "COL4A3" "0000415736" "COL4A3" "0000415752" "COL4A3" "0000434836" "COL4A3" "0000434837" "COL4A3" "0000434838" "COL4A3" "0000434839" "COL4A3" "0000434840" "COL4A3" "0000434841" "COL4A3" "0000434842" "COL4A3" "0000434843" "COL4A3" "0000434844" "COL4A3" "0000434845" "COL4A3" "0000434846" "COL4A3" "0000434847" "COL4A3" "0000434848" "COL4A3" "0000434849" "COL4A3" "0000434850" "COL4A3" "0000434851" "COL4A3" "0000434883" "COL4A4" "0000434887" "COL4A3" "0000434888" "COL4A3" "0000445529" "COL4A3" "0000445529" "COL4A4" "0000445529" "COL4A5" "0000445530" "COL4A3" "0000445530" "COL4A4" "0000445530" "COL4A5" "0000445531" "COL4A3" "0000445531" "COL4A4" "0000445531" "COL4A5" "0000450141" "COL4A3" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 1163 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000038900" "11" "70" "2" "228163475" "228163475" "subst" "0.000382058" "00746" "COL4A3_000085" "g.228163475G>A" "" "{PMID:Bullich 2015:25407002}, {DOI:Bullich 2015:10.1038/ejhg.2014.252}" "" "" "father had non-nephrotic range proteinuria and hematuria at 39y, renal biopsy showed focal and segmental glomerulosclerosis, 51y-reached ESRD, two carrier uncles (haematuria at 61y/56y)" "Germline" "" "" "0" "" "" "g.227298759G>A" "" "likely pathogenic" "" "0000038903" "0" "70" "2" "228173656" "228173656" "subst" "0" "00746" "COL4A3_000400" "g.228173656T>C" "" "{PMID:Bullich 2015:25407002}, {DOI:Bullich 2015:10.1038/ejhg.2014.252}" "" "" "" "Unknown" "" "" "0" "" "" "g.227308940T>C" "" "likely pathogenic" "" "0000039310" "11" "70" "2" "228168732" "228168732" "subst" "0" "00746" "COL4A3_000401" "g.228168732C>A" "" "{PMID:Bullich 2015:25407002}, {DOI:Bullich 2015:10.1038/ejhg.2014.252}" "" "" "" "Germline" "" "" "0" "" "" "g.227304016C>A" "" "likely pathogenic" "" "0000149573" "0" "30" "2" "228029433" "228029433" "subst" "0.000379902" "00687" "COL4A3_000001" "g.228029433C>T" "" "{PMID:Tazon Vega 2003:14582039}" "" "1-10C>T 3\'UTR" "" "Germline" "" "" "0" "" "" "g.227164717C>T" "" "likely benign" "" "0000149574" "0" "97" "2" "228029443" "228029443" "subst" "0" "00687" "COL4A3_000002" "g.228029443A>T" "" "{PMID:Longo 2002:12028435}" "" "M1L" "nonsense; Compound heterozygous;" "Germline" "" "" "0" "" "" "g.227164727A>T" "" "pathogenic" "" "0000149575" "0" "97" "2" "228029482" "228029505" "del" "0" "00687" "COL4A3_000003" "g.228029482_228029505del" "" "{PMID:Longo 2002:12028435}" "" "40del24" "" "Germline" "" "" "0" "" "" "g.227164766_227164789del" "" "pathogenic" "" "0000149576" "0" "97" "2" "228029482" "228029505" "del" "0" "00687" "COL4A3_000003" "g.228029482_228029505del" "" "{PMID:Tazon Vega 2003:14582039}" "" "40_63delCTGCCGCTCCTGCTGGTGCTCCTG (del LPLLLVLL)" "Compound heterozygous" "Germline" "" "" "0" "" "" "g.227164766_227164789del" "" "pathogenic" "" "0000149577" "0" "00" "2" "228102723" "228102723" "subst" "4.0621E-6" "00687" "COL4A3_000004" "g.228102723G>A" "" "{PMID:Badenas 2002:11961012}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227238007G>A" "" "" "" "0000149578" "0" "00" "2" "228102723" "228102723" "subst" "4.0621E-6" "00687" "COL4A3_000004" "g.228102723G>A" "" "{PMID:Slajpah 2007:17396119}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227238007G>A" "" "" "" "0000149579" "0" "00" "2" "228102723" "228102723" "subst" "4.0621E-6" "00687" "COL4A3_000004" "g.228102723G>A" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227238007G>A" "" "" "" "0000149580" "0" "13" "2" "228102723" "228102723" "subst" "0.284083" "00687" "COL4A3_000005" "g.228102723G>C" "" "{PMID:Heidet 2001:11134255}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227238007G>C" "" "benign" "" "0000149581" "0" "13" "2" "228102723" "228102723" "subst" "0.284083" "00687" "COL4A3_000005" "g.228102723G>C" "" "{PMID:Longo 2002:12028435}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227238007G>C" "" "benign" "" "0000149582" "0" "13" "2" "228102723" "228102723" "subst" "0.284083" "00687" "COL4A3_000005" "g.228102723G>C" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227238007G>C" "" "benign" "" "0000149583" "0" "00" "2" "228102752" "228102752" "subst" "0.309262" "00687" "COL4A3_000006" "g.228102752C>A" "" "{PMID:Badenas 2002:11961012}" "" "" "" "Germline" "" "" "0" "" "" "g.227238036C>A" "" "" "" "0000149584" "0" "00" "2" "228102752" "228102752" "subst" "0.309262" "00687" "COL4A3_000006" "g.228102752C>A" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Germline" "" "" "0" "" "" "g.227238036C>A" "" "" "" "0000149585" "0" "00" "2" "228102752" "228102752" "subst" "0.309262" "00687" "COL4A3_000006" "g.228102752C>A" "" "{PMID:Wang 2004:14871398}" "" "" "" "Germline" "" "" "0" "" "" "g.227238036C>A" "" "" "" "0000149586" "0" "00" "2" "228104936" "228104936" "subst" "0.00165397" "00687" "COL4A3_000007" "g.228104936G>T" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Germline" "" "" "0" "" "" "g.227240220G>T" "" "" "" "0000149587" "0" "30" "2" "228109784" "228109784" "subst" "0" "00687" "COL4A3_000008" "g.228109784C>T" "" "{PMID:Voskarides 2007:17942953}" "" "" "Intronic" "Germline" "" "" "0" "" "" "g.227245068C>T" "" "likely benign" "" "0000149588" "0" "00" "2" "228110691" "228110691" "subst" "0.00485981" "00687" "COL4A3_000009" "g.228110691C>A" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227245975C>A" "" "" "" "0000149589" "0" "97" "2" "228110696" "228110696" "subst" "0" "00687" "COL4A3_000010" "g.228110696C>A" "" "{PMID:Nagel 2005:15954103}" "" "" "Nonsense" "Germline" "" "" "0" "" "" "g.227245980C>A" "" "pathogenic" "" "0000149590" "0" "97" "2" "228111403" "228111403" "dup" "0" "00687" "COL4A3_000011" "g.228111403dup" "" "{PMID:Heidet 2001:11134255}" "" "c.389_390insT" "Insertion; Heterozygous." "Germline" "" "" "0" "" "" "g.227246687dup" "" "pathogenic" "" "0000149591" "0" "00" "2" "228111435" "228111435" "subst" "0.833927" "00687" "COL4A3_000012" "g.228111435T>C" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227246719T>C" "" "" "" "0000149592" "0" "97" "2" "228119415" "228119415" "subst" "0" "00687" "COL4A3_000016" "g.228119415G>A" "" "{PMID:Hoefele 2010:20177710}" "" "" "Missense;" "Germline" "" "" "0" "" "" "g.227254699G>A" "" "pathogenic" "" "0000149593" "0" "70" "2" "228111447" "228111447" "subst" "0" "00687" "COL4A3_000013" "g.228111447G>A" "" "{PMID:Nagel 2005:15954103}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227246731G>A" "" "likely pathogenic" "" "0000149594" "0" "00" "2" "228113163" "228113163" "subst" "0" "00687" "COL4A3_000014" "g.228113163C>A" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227248447C>A" "" "" "" "0000149595" "0" "00" "2" "228113163" "228113163" "subst" "0" "00687" "COL4A3_000014" "g.228113163C>A" "" "{PMID:Badenas 2002:11961012}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227248447C>A" "" "" "" "0000149596" "0" "00" "2" "228113175" "228113175" "subst" "0.834079" "00687" "COL4A3_000015" "g.228113175A>G" "" "{PMID:Badenas 2002:11961012}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227248459A>G" "" "" "" "0000149597" "0" "00" "2" "228113175" "228113175" "subst" "0.834079" "00687" "COL4A3_000015" "g.228113175A>G" "" "{PMID:Wang 2004:14871398}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227248459A>G" "" "" "" "0000149598" "3" "13" "2" "228113175" "228113175" "subst" "0.834079" "00687" "COL4A3_000015" "g.228113175A>G" "" "{PMID:Hoefele 2010:20177710}" "" "" "missense. Homozygous" "Germline" "" "" "0" "" "" "g.227248459A>G" "" "benign" "" "0000149599" "0" "13" "2" "228113175" "228113175" "subst" "0.834079" "00687" "COL4A3_000015" "g.228113175A>G" "" "{PMID:Slajpah 2007:17396119}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227248459A>G" "" "benign" "" "0000149600" "0" "13" "2" "228113175" "228113175" "subst" "0.834079" "00687" "COL4A3_000015" "g.228113175A>G" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227248459A>G" "" "benign" "" "0000149601" "0" "13" "2" "228113175" "228113175" "subst" "0.834079" "00687" "COL4A3_000015" "g.228113175A>G" "" "{PMID:Heidet 2001:11134255}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227248459A>G" "" "benign" "" "0000149602" "0" "13" "2" "228113175" "228113175" "subst" "0.834079" "00687" "COL4A3_000015" "g.228113175A>G" "" "{PMID:Longo 2002:12028435}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227248459A>G" "" "benign" "" "0000149603" "0" "13" "2" "228113175" "228113175" "subst" "0.834079" "00687" "COL4A3_000015" "g.228113175A>G" "" "{PMID:Voskarides 2007:17942953}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227248459A>G" "" "benign" "" "0000149604" "0" "00" "2" "228119421" "228119421" "subst" "0" "00687" "COL4A3_000017" "g.228119421C>G" "" "{PMID:Badenas 2002:11961012}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227254705C>G" "" "" "" "0000149605" "0" "00" "2" "228119421" "228119421" "subst" "0" "00687" "COL4A3_000017" "g.228119421C>G" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227254705C>G" "" "" "" "0000149606" "0" "30" "2" "228119461" "228119461" "subst" "0.0967128" "00687" "COL4A3_000018" "g.228119461G>A" "" "{PMID:Voskarides 2007:17942953}" "" "" "Intronic" "Germline" "" "" "0" "" "" "g.227254745G>A" "" "likely benign" "" "0000149607" "0" "97" "2" "228120743" "228120743" "subst" "4.06421E-6" "00687" "COL4A3_000019" "g.228120743G>A" "" "{PMID:Heidet 2001:11134255}" "" "" "Missense. Compound heterozygous" "Germline" "" "" "0" "" "" "g.227256027G>A" "" "pathogenic" "" "0000149608" "0" "00" "2" "228121101" "228121101" "subst" "0.168924" "00687" "COL4A3_000020" "g.228121101G>T" "" "{PMID:Badenas 2002:11961012}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227256385G>T" "" "" "" "0000149609" "0" "13" "2" "228121101" "228121101" "subst" "0.168924" "00687" "COL4A3_000020" "g.228121101G>T" "" "{PMID:Slajpah 2007:17396119}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227256385G>T" "" "benign" "" "0000149610" "0" "13" "2" "228121101" "228121101" "subst" "0.168924" "00687" "COL4A3_000020" "g.228121101G>T" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "missense" "Germline" "" "" "0" "" "" "g.227256385G>T" "" "benign" "" "0000149611" "0" "13" "2" "228121101" "228121101" "subst" "0.168924" "00687" "COL4A3_000020" "g.228121101G>T" "" "{PMID:Longo 2002:12028435}" "" "" "missense" "Germline" "" "" "0" "" "" "g.227256385G>T" "" "benign" "" "0000149612" "0" "00" "2" "228121101" "228121101" "subst" "0.168924" "00687" "COL4A3_000020" "g.228121101G>T" "" "{PMID:Heidet 2001:11134255}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227256385G>T" "" "" "" "0000149613" "0" "00" "2" "228121101" "228121101" "subst" "0.168924" "00687" "COL4A3_000020" "g.228121101G>T" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227256385G>T" "" "" "" "0000149614" "0" "30" "2" "228122249" "228122249" "subst" "0" "00687" "COL4A3_000021" "g.228122249T>C" "" "{PMID:Voskarides 2007:17942953}" "" "" "Intronic\r\nVariant Error [EREF/EINVALIDBOUNDARY]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.227257533T>C" "" "likely benign" "" "0000149615" "0" "97" "2" "228124590" "228124590" "subst" "0" "00687" "COL4A3_000022" "g.228124590C>T" "" "{PMID:Nagel 2005:15954103}" "" "" "Nonsense" "Germline" "" "" "0" "" "" "g.227259874C>T" "" "pathogenic" "" "0000149616" "3" "97" "2" "228128561" "228128561" "subst" "1.62628E-5" "00687" "COL4A3_000024" "g.228128561C>T" "" "{PMID:Heidet 2001:11134255}" "" "" "nonsense; Homozygous" "Germline" "" "" "0" "" "" "g.227263845C>T" "" "pathogenic" "" "0000149617" "0" "00" "2" "228128568" "228128568" "subst" "0.0939043" "00687" "COL4A3_000026" "g.228128568G>A" "" "{PMID:Heidet 2001:11134255}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227263852G>A" "" "" "" "0000149618" "0" "00" "2" "228128568" "228128568" "subst" "0.0939043" "00687" "COL4A3_000026" "g.228128568G>A" "" "{PMID:Longo 2002:12028435}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227263852G>A" "" "" "" "0000149619" "0" "00" "2" "228128568" "228128568" "subst" "0.0939043" "00687" "COL4A3_000026" "g.228128568G>A" "" "{PMID:Badenas 2002:11961012}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227263852G>A" "" "" "" "0000149620" "0" "00" "2" "228128568" "228128568" "subst" "0.0939043" "00687" "COL4A3_000026" "g.228128568G>A" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227263852G>A" "" "" "" "0000149621" "0" "97" "2" "228128660" "228128660" "subst" "0" "00687" "COL4A3_000027" "g.228128660G>A" "" "{PMID:Van der Loop (2000) Kidney Int 58, 1870:11044206}" "" "" "splice site; skipping exon 21" "Germline" "" "" "0" "" "" "g.227263944G>A" "" "pathogenic" "" "0000149622" "0" "00" "2" "228131169" "228131169" "subst" "0.09636" "00687" "COL4A3_000028" "g.228131169A>G" "" "{PMID:Heidet 2001:11134255}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227266453A>G" "" "" "" "0000149623" "0" "00" "2" "228131169" "228131169" "subst" "0.09636" "00687" "COL4A3_000028" "g.228131169A>G" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227266453A>G" "" "" "" "0000149624" "0" "00" "2" "228131169" "228131169" "subst" "0.09636" "00687" "COL4A3_000028" "g.228131169A>G" "" "{PMID:Slajpah 2007:17396119}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227266453A>G" "" "" "" "0000149625" "0" "00" "2" "228131169" "228131169" "subst" "0.09636" "00687" "COL4A3_000028" "g.228131169A>G" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227266453A>G" "" "" "" "0000149626" "0" "00" "2" "228131169" "228131169" "subst" "0.09636" "00687" "COL4A3_000028" "g.228131169A>G" "" "{PMID:Longo 2002:12028435}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227266453A>G" "" "" "" "0000149627" "0" "13" "2" "228131182" "228131182" "subst" "0" "00687" "COL4A3_000029" "g.228131182C>A" "" "{PMID:Rana 2007:17216251}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227266466C>A" "" "benign" "" "0000149628" "0" "13" "2" "228131203" "228131203" "subst" "0" "00687" "COL4A3_000030" "g.228131203C>A" "" "{PMID:Rana 2007:17216251}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227266487C>A" "" "benign" "" "0000149629" "3" "70" "2" "228131208" "228131208" "subst" "0" "00687" "COL4A3_000031" "g.228131208G>T" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "missense; homozygous" "Germline" "" "" "0" "" "" "g.227266492G>T" "" "likely pathogenic" "" "0000149630" "0" "70" "2" "228131208" "228131208" "subst" "0" "00687" "COL4A3_000031" "g.228131208G>T" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "missense; heterozygous" "Germline" "" "" "0" "" "" "g.227266492G>T" "" "likely pathogenic" "" "0000149631" "0" "97" "2" "228131704" "228131704" "subst" "0" "00687" "COL4A3_000032" "g.228131704T>A" "" "{PMID:Rana 2007:17216251}" "" "" "intronic/ splice site; homozygous" "Germline" "" "" "0" "" "" "g.227266988T>A" "" "pathogenic" "" "0000149632" "0" "00" "2" "228131752" "228131752" "subst" "0.0951863" "00687" "COL4A3_000033" "g.228131752G>A" "" "{PMID:Badenas 2002:11961012}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227267036G>A" "" "" "" "0000149633" "0" "13" "2" "228131752" "228131752" "subst" "0.0951863" "00687" "COL4A3_000033" "g.228131752G>A" "" "{PMID:Longo 2002:12028435}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227267036G>A" "" "benign" "" "0000149634" "0" "13" "2" "228131752" "228131752" "subst" "0.0951863" "00687" "COL4A3_000033" "g.228131752G>A" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227267036G>A" "" "benign" "" "0000149635" "0" "13" "2" "228131752" "228131752" "subst" "0.0951863" "00687" "COL4A3_000033" "g.228131752G>A" "" "{PMID:Slajpah 2007:17396119}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227267036G>A" "" "benign" "" "0000149636" "0" "00" "2" "228131752" "228131752" "subst" "0.0951863" "00687" "COL4A3_000033" "g.228131752G>A" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227267036G>A" "" "" "" "0000149637" "0" "70" "2" "228131759" "228131759" "subst" "0" "00687" "COL4A3_000034" "g.228131759G>T" "" "{PMID:Slajpah 2007:17396119}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227267043G>T" "" "likely pathogenic" "" "0000149638" "3" "97" "2" "228131806" "228131806" "subst" "0" "00687" "COL4A3_000035" "g.228131806T>A" "" "{PMID:Longo 2006:16338941}" "" "" "intronic/ splice site; homozygous" "Germline" "" "" "0" "" "" "g.227267090T>A" "" "pathogenic" "" "0000149639" "0" "97" "2" "228135504" "228135504" "subst" "0" "00687" "COL4A3_000036" "g.228135504G>T" "" "{PMID:Wang 2004:14871398}" "" "" "missense" "Germline" "" "" "0" "" "" "g.227270788G>T" "" "pathogenic" "" "0000149640" "0" "70" "2" "228135505" "228135505" "subst" "8.12321E-6" "00687" "COL4A3_000037" "g.228135505G>A" "" "{PMID:Nagel 2005:15954103}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227270789G>A" "" "likely pathogenic" "" "0000149641" "0" "00" "2" "228135631" "228135631" "subst" "0.469174" "00687" "COL4A3_000038" "g.228135631C>T" "" "{PMID:Heidet 2001:11134255}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227270915C>T" "" "" "" "0000149642" "0" "00" "2" "228135631" "228135631" "subst" "0.469174" "00687" "COL4A3_000038" "g.228135631C>T" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227270915C>T" "" "" "" "0000149643" "0" "00" "2" "228135631" "228135631" "subst" "0.469174" "00687" "COL4A3_000038" "g.228135631C>T" "" "{PMID:Slajpah 2007:17396119}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227270915C>T" "" "" "" "0000149644" "0" "97" "2" "228135660" "228135660" "subst" "0" "00687" "COL4A3_000039" "g.228135660G>T" "" "{PMID:Wang 2004:14871398}" "" "" "missense" "Germline" "" "" "0" "" "" "g.227270944G>T" "" "pathogenic" "" "0000149645" "0" "97" "2" "228137692" "228137692" "subst" "0" "00687" "COL4A3_000040" "g.228137692G>C" "" "{PMID:Wang 2004:14871398}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227272976G>C" "" "pathogenic" "" "0000149646" "0" "97" "2" "228162549" "228162549" "subst" "0" "00687" "COL4A3_000081" "g.228162549G>A" "" "{PMID:Hou 2007:17726307}" "" "" "" "Germline" "" "" "0" "" "" "g.227297833G>A" "" "pathogenic" "" "0000149647" "0" "97" "2" "228159760" "228159760" "subst" "8.12493E-6" "00687" "COL4A3_000067" "g.228159760G>A" "" "{PMID:Heidet 2001:11134255}" "" "" "Compound heterozygous" "Germline" "" "" "0" "" "" "g.227295044G>A" "" "pathogenic" "" "0000149648" "0" "00" "2" "228142214" "228142214" "subst" "0" "00687" "COL4A3_000043" "g.228142214T>A" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227277498T>A" "" "" "" "0000149649" "0" "70" "2" "228142227" "228142227" "subst" "0.000106774" "00687" "COL4A3_000044" "g.228142227G>A" "" "{PMID:Wang 2004:14871398}" "" "" "Missense; Polymorphism" "Germline" "" "" "0" "" "" "g.227277511G>A" "" "likely pathogenic" "" "0000149650" "0" "13" "2" "228144591" "228144591" "subst" "0" "00687" "COL4A3_000045" "g.228144591C>G" "" "{PMID:Rana 2007:17216251}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227279875C>G" "" "benign" "" "0000149651" "0" "70" "2" "228144598" "228144598" "subst" "0" "00687" "COL4A3_000046" "g.228144598G>A" "" "{PMID:Nagel 2005:15954103}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227279882G>A" "" "likely pathogenic" "" "0000149652" "0" "70" "2" "228145145" "228145145" "subst" "0" "00687" "COL4A3_000047" "g.228145145C>T" "" "{PMID:Wang 2004:14871398}" "" "" "Intronic/ splice site" "Germline" "" "" "0" "" "" "g.227280429C>T" "" "likely pathogenic" "" "0000149653" "0" "70" "2" "228145271" "228145271" "subst" "0" "00687" "COL4A3_000048" "g.228145271G>A" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227280555G>A" "" "likely pathogenic" "" "0000149654" "0" "97" "2" "228145651" "228145651" "dup" "0" "00687" "COL4A3_000049" "g.228145651dup" "" "{PMID:Heidet 2001:11134255}" "" "" "Insertion; Homozygous" "Germline" "" "" "0" "" "" "g.227280935dup" "" "pathogenic" "" "0000149655" "0" "50" "2" "228147093" "228147093" "subst" "0.0119505" "00687" "COL4A3_000050" "g.228147093A>G" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227282377A>G" "" "VUS" "" "0000149656" "0" "30" "2" "228147093" "228147093" "subst" "0.0119505" "00687" "COL4A3_000050" "g.228147093A>G" "" "{PMID:Voskarides 2007:17942953}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227282377A>G" "" "likely benign" "" "0000149657" "0" "70" "2" "228147149" "228147149" "subst" "4.06151E-6" "00687" "COL4A3_000051" "g.228147149G>A" "" "{PMID:Nagel 2005:15954103}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227282433G>A" "" "likely pathogenic" "" "0000149658" "0" "97" "2" "228147203" "228147203" "subst" "0" "00687" "COL4A3_000052" "g.228147203G>T" "" "{PMID:Voskarides 2007:17942953}" "" "" "missense;" "Germline" "" "" "0" "" "" "g.227282487G>T" "" "pathogenic" "" "0000149659" "0" "97" "2" "228147203" "228147203" "subst" "0" "00687" "COL4A3_000052" "g.228147203G>T" "" "{PMID:Pierides 2009:19357112}" "" "" "missense" "Germline" "" "" "0" "" "" "g.227282487G>T" "" "pathogenic" "" "0000149660" "0" "97" "2" "228147213" "228147214" "delins" "0" "00687" "COL4A3_000053" "g.228147213_228147214delinsT" "" "{PMID:Heidet 2001:11134255}" "" "2621_2622delGAinsT" "Insertion/deletion; Homozygous" "Germline" "" "" "0" "" "" "g.227282497_227282498delinsT" "" "pathogenic" "" "0000149661" "0" "97" "2" "228147213" "228147214" "delins" "0" "00687" "COL4A3_000053" "g.228147213_228147214delinsT" "" "{PMID:Heidet 2001:11134255}" "" "2621_2622delGAinsT" "Insertion/deletion; Heterozygous" "Germline" "" "" "0" "" "" "g.227282497_227282498delinsT" "" "pathogenic" "" "0000149662" "0" "00" "2" "228148523" "228148523" "subst" "0" "00687" "COL4A3_000054" "g.228148523C>A" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227283807C>A" "" "" "" "0000149663" "0" "00" "2" "228149006" "228149006" "subst" "0.000479655" "00687" "COL4A3_000055" "g.228149006C>T" "" "{PMID:Longo 2002:12028435}" "" "" "same sense" "Germline" "" "" "0" "" "" "g.227284290C>T" "" "" "" "0000149664" "0" "97" "2" "228153938" "228153938" "subst" "2.03482E-5" "00687" "COL4A3_000056" "g.228153938G>T" "" "{PMID:Badenas 2002:11961012}" "" "" "missense" "Germline" "" "" "0" "" "" "g.227289222G>T" "" "pathogenic" "" "0000149665" "0" "97" "2" "228153965" "228153965" "subst" "0" "00687" "COL4A3_000057" "g.228153965G>A" "" "{PMID:Wang 2004:14871398}" "" "" "intronic/ splice site" "Germline" "" "" "0" "" "" "g.227289249G>A" "" "pathogenic" "" "0000149666" "0" "97" "2" "228154778" "228154778" "subst" "0" "00687" "COL4A3_000058" "g.228154778G>A" "" "{PMID:Badenas 2002:11961012}" "" "" "missense; heterozygous" "Germline" "" "" "0" "" "" "g.227290062G>A" "" "pathogenic" "" "0000149667" "0" "70" "2" "228154778" "228154778" "subst" "0" "00687" "COL4A3_000058" "g.228154778G>A" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "Compound heterozygous" "Germline" "" "" "0" "" "" "g.227290062G>A" "" "likely pathogenic" "" "0000149668" "0" "70" "2" "228154778" "228154778" "subst" "0" "00687" "COL4A3_000058" "g.228154778G>A" "" "{PMID:Slajpah 2007:17396119}" "" "" "" "Germline" "" "" "0" "" "" "g.227290062G>A" "" "likely pathogenic" "" "0000149669" "0" "97" "2" "228155526" "228155526" "subst" "0" "00687" "COL4A3_000060" "g.228155526G>T" "" "{PMID:Pescucci 2004:15086897}" "" "" "missense; heterozygous" "Germline" "" "" "0" "" "" "g.227290810G>T" "" "pathogenic" "" "0000149670" "0" "97" "2" "228173683" "228173686" "del" "0" "00687" "COL4A3_000104" "g.228173683_228173686del" "" "{PMID:Heidet 2001:11134255}" "" "4530_4533delATGT" "Compound heterozygous" "Germline" "" "" "0" "" "" "g.227308967_227308970del" "" "pathogenic" "" "0000149671" "0" "97" "2" "228159254" "228159280" "del" "0" "00687" "COL4A3_000066" "g.228159254_228159280del" "" "{PMID:Longo 2002:12028435}" "" "3386del27" "Compound heterozygous" "Germline" "" "" "0" "" "" "g.227294538_227294564del" "" "pathogenic" "" "0000149672" "0" "90" "2" "228157906" "228157906" "subst" "0" "00687" "COL4A3_000063" "g.228157906G>T" "" "{PMID:Heidet 2001:11134255}" "" "" "intronic/ splice site; Heterozygous" "Germline" "" "" "0" "" "" "g.227293190G>T" "" "pathogenic" "" "0000149673" "0" "97" "2" "228158017" "228158025" "del" "0" "00687" "COL4A3_000064" "g.228158017_228158025del" "" "{PMID:Longo 2002:12028435}" "" "3321del9" "" "Germline" "" "" "0" "" "" "g.227293301_227293309del" "" "pathogenic" "" "0000149674" "0" "00" "2" "228158021" "228158021" "subst" "0.00431634" "00687" "COL4A3_000065" "g.228158021C>T" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227293305C>T" "" "" "" "0000149675" "0" "30" "2" "228158021" "228158021" "subst" "0.00431634" "00687" "COL4A3_000065" "g.228158021C>T" "" "{PMID:Longo 2002:12028435}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227293305C>T" "" "likely benign" "" "0000149676" "0" "70" "2" "228159760" "228159760" "subst" "8.12493E-6" "00687" "COL4A3_000067" "g.228159760G>A" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "Heterozygous" "Germline" "" "" "0" "" "" "g.227295044G>A" "" "likely pathogenic" "" "0000149677" "0" "70" "2" "228159978" "228159978" "subst" "0" "00687" "COL4A3_000068" "g.228159978C>G" "" "{PMID:Wang 2004:14871398}" "" "" "" "Germline" "" "" "0" "" "" "g.227295262C>G" "" "likely pathogenic" "" "0000149678" "0" "97" "2" "228160000" "228160000" "del" "0" "00687" "COL4A3_000069" "g.228160000del" "" "{PMID:Heidet 2001:11134255}" "" "c.3533delC" "Deletion; Homozygous." "Germline" "" "" "0" "" "" "g.227295284del" "" "pathogenic" "" "0000149679" "0" "97" "2" "228160016" "228160016" "dup" "0" "00687" "COL4A3_000070" "g.228160016dup" "" "{PMID:Nagel 2005:15954103}" "" "c.3547_3548insG" "insertion" "Germline" "" "" "0" "" "" "g.227295300dup" "" "pathogenic" "" "0000149680" "0" "70" "2" "228160015" "228160017" "dup" "0" "00687" "COL4A3_000071" "g.228160015_228160017dup" "" "{PMID:Slajpah 2007:17396119}" "" "c.3547-3548insGGA" "insertion" "Germline" "" "" "0" "" "" "g.227295299_227295301dup" "" "likely pathogenic" "" "0000149681" "0" "90" "2" "228160033" "228160033" "del" "0" "00687" "COL4A3_000072" "g.228160033del" "" "{PMID:Heidet 2001:11134255}" "" "c.3565+1delG" "Compound heterozygous" "Germline" "" "" "0" "" "" "g.227295317del" "" "pathogenic" "" "0000149682" "0" "30" "2" "228162280" "228162280" "subst" "0" "00687" "COL4A3_000073" "g.228162280T>G" "" "{PMID:Voskarides 2007:17942953}" "" "" "Intronic" "Germline" "" "" "0" "" "" "g.227297564T>G" "" "likely benign" "" "0000149683" "0" "97" "2" "228162416" "228162416" "subst" "0" "00687" "COL4A3_000074" "g.228162416G>A" "" "{PMID:Longo 2002:12028435}" "" "" "missense; heterozygous" "Germline" "" "" "0" "" "" "g.227297700G>A" "" "pathogenic" "" "0000149684" "3" "97" "2" "228162444" "228162444" "subst" "0" "00687" "COL4A3_000075" "g.228162444G>A" "" "{PMID:Heidet 2001:11134255}" "" "" "missense; homozygous" "Germline" "" "" "0" "" "" "g.227297728G>A" "" "pathogenic" "" "0000149685" "0" "70" "2" "228162446" "228162446" "del" "0" "00687" "COL4A3_000076" "g.228162446del" "" "{PMID:Tazon Vega 2003:14582039}" "" "c.3622delG" "Compound heterozygous" "Germline" "" "" "0" "" "" "g.227297730del" "" "likely pathogenic" "" "0000149686" "3" "97" "2" "228162467" "228162467" "subst" "0" "00687" "COL4A3_000077" "g.228162467C>T" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "nonsense; Homozygous" "Germline" "" "" "0" "" "" "g.227297751C>T" "" "pathogenic" "" "0000149687" "0" "70" "2" "228162468" "228162468" "subst" "0.000155006" "00687" "COL4A3_000078" "g.228162468G>A" "" "{PMID:Heidet 2001:11134255}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227297752G>A" "" "likely pathogenic" "" "0000149688" "0" "70" "2" "228162470" "228162470" "subst" "0" "00687" "COL4A3_000079" "g.228162470G>A" "" "{PMID:Nagel 2005:15954103}" "" "" "missense" "Germline" "" "" "0" "" "" "g.227297754G>A" "" "likely pathogenic" "" "0000149689" "0" "97" "2" "228162479" "228162479" "subst" "0" "00687" "COL4A3_000080" "g.228162479G>T" "" "{PMID:Pescucci 2004:15086897}" "" "" "missense; Heterozygous" "Germline" "" "" "0" "" "" "g.227297763G>T" "" "pathogenic" "" "0000149690" "0" "30" "2" "228162641" "228162641" "subst" "0" "00687" "COL4A3_000082" "g.228162641C>T" "" "{PMID:Voskarides 2007:17942953}" "" "" "Intronic" "Germline" "" "" "0" "" "" "g.227297925C>T" "" "likely benign" "" "0000149691" "0" "90" "2" "228163396" "228163396" "subst" "0" "00687" "COL4A3_000083" "g.228163396A>T" "" "{PMID:Heidet 2001:11134255}" "" "" "intronic/ splice site; Heterozygous" "Germline" "" "" "0" "" "" "g.227298680A>T" "" "pathogenic" "" "0000149692" "0" "00" "2" "228163453" "228163453" "subst" "0.0450209" "00687" "COL4A3_000084" "g.228163453C>A" "" "{PMID:Heidet 2001:11134255}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227298737C>A" "" "" "" "0000149693" "0" "00" "2" "228163453" "228163453" "subst" "0.0450209" "00687" "COL4A3_000084" "g.228163453C>A" "" "{PMID:Badenas 2002:11961012}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227298737C>A" "" "" "" "0000149694" "0" "00" "2" "228163453" "228163453" "subst" "0.0450209" "00687" "COL4A3_000084" "g.228163453C>A" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227298737C>A" "" "" "" "0000149695" "0" "00" "2" "228163453" "228163453" "subst" "0.0450209" "00687" "COL4A3_000084" "g.228163453C>A" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227298737C>A" "" "" "" "0000149696" "0" "90" "2" "228163475" "228163475" "subst" "0.000382058" "00687" "COL4A3_000085" "g.228163475G>A" "" "{PMID:Heidet 2001:11134255}" "" "" "missense; Heterozygous" "Germline" "" "" "0" "" "" "g.227298759G>A" "" "pathogenic" "" "0000149697" "3" "90" "2" "228168574" "228168574" "subst" "0" "00687" "COL4A3_000086" "g.228168574G>A" "" "{PMID:Heidet 2001:11134255}" "" "" "intronic/ splice site; homozygous" "Germline" "" "" "0" "" "" "g.227303858G>A" "" "pathogenic" "" "0000149698" "3" "90" "2" "228168620" "228168620" "subst" "8.12552E-6" "00687" "COL4A3_000088" "g.228168620G>A" "" "{PMID:Heidet 2001:11134255}" "" "" "missense; homozygous" "Germline" "" "" "0" "" "" "g.227303904G>A" "" "pathogenic" "" "0000149699" "0" "97" "2" "228168620" "228168620" "subst" "8.12552E-6" "00687" "COL4A3_000088" "g.228168620G>A" "" "{PMID:Voskarides 2008:18439107}" "" "" "missense" "Germline" "" "" "0" "" "" "g.227303904G>A" "" "pathogenic" "" "0000149700" "0" "97" "2" "228168620" "228168620" "subst" "8.12552E-6" "00687" "COL4A3_000088" "g.228168620G>A" "" "{PMID:Pierides 2009:19357112}" "" "" "missense; heterozygous" "Germline" "" "" "0" "" "" "g.227303904G>A" "" "pathogenic" "" "0000149701" "0" "30" "2" "228168748" "228168748" "subst" "0.0063374" "00687" "COL4A3_000089" "g.228168748C>A" "" "{PMID:Heidet 2001:11134255}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227304032C>A" "" "likely benign" "" "0000149702" "3" "70" "2" "228168748" "228168748" "subst" "0.0063374" "00687" "COL4A3_000089" "g.228168748C>A" "" "{PMID:Heidet 2001:11134255}" "" "" "missense; homozygous" "Germline" "" "" "0" "" "" "g.227304032C>A" "" "likely pathogenic" "" "0000149703" "0" "70" "2" "228169782" "228169782" "subst" "0" "00687" "COL4A3_000090" "g.228169782G>T" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "missense; heterozygous" "Germline" "" "" "0" "" "" "g.227305066G>T" "" "likely pathogenic" "" "0000149704" "0" "97" "2" "228172453" "228172453" "del" "0" "00687" "COL4A3_000091" "g.228172453del" "" "{PMID:Heidet 2001:11134255}" "" "c.4279delG" "Deletion; Homozygous." "Germline" "" "" "0" "" "" "g.227307737del" "" "pathogenic" "" "0000149705" "0" "00" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "{PMID:Lemmink 1994:07987301}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "" "" "0000149706" "0" "00" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "{PMID:Lemmink 1994:07987301}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "" "" "0000149707" "0" "00" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "{PMID:Lemmink 1994:07987301}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "" "" "0000149708" "0" "00" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "{PMID:Van der Loop (2000) Kidney Int 58, 1870:11044206}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "" "" "0000149709" "0" "00" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "" "" "0000149710" "0" "00" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "{PMID:Heidet 2001:11134255}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "" "" "0000149711" "0" "00" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "{PMID:Badenas 2002:11961012}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "" "" "0000149712" "0" "00" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "" "" "0000149713" "0" "00" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "{PMID:Longo 2002:12028435}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "" "" "0000149714" "0" "97" "2" "228172630" "228172636" "del" "0" "00687" "COL4A3_000094" "g.228172630_228172636del" "" "{PMID:Ding 1995:07780062}" "" "4456_4462delGACCTTG" "" "Germline" "" "" "0" "" "" "g.227307914_227307920del" "" "pathogenic" "" "0000149715" "0" "97" "2" "228172593" "228172597" "del" "0" "00687" "COL4A3_000095" "g.228172593_228172597del" "" "{PMID:Mochizuki 1994:07987396}" "" "4415_4421delCTTTT" "Deletion. Homozygous (no consanguinity)" "Germline" "" "" "0" "" "" "g.227307877_227307881del" "" "pathogenic" "" "0000149716" "0" "97" "2" "228172593" "228172597" "del" "0" "00687" "COL4A3_000095" "g.228172593_228172597del" "" "{PMID:Lemmink 1994:07987301}" "" "delCTTTT" "deletion. Heterzygous" "Germline" "" "" "0" "" "" "g.227307877_227307881del" "" "pathogenic" "" "0000149717" "3" "97" "2" "228172614" "228172614" "subst" "0" "00687" "COL4A3_000097" "g.228172614C>T" "" "{PMID:Mochizuki 1994:07987396}" "" "" "nonsense; Homozygous" "Germline" "" "" "0" "" "" "g.227307898C>T" "" "pathogenic" "" "0000149718" "0" "97" "2" "228172614" "228172614" "subst" "0" "00687" "COL4A3_000097" "g.228172614C>T" "" "{PMID:Lemmink 1994:07987301}" "" "" "Compound heterozygous" "Germline" "" "" "0" "" "" "g.227307898C>T" "" "pathogenic" "" "0000149719" "0" "97" "2" "228176114" "228176114" "subst" "0" "00687" "COL4A3_000098" "g.228176114G>T" "" "{PMID:Knebelman 1995:07633417}" "" "RNA ins74" "" "Germline" "" "" "0" "" "" "g.227311398G>T" "" "pathogenic" "" "0000149720" "0" "97" "2" "228176114" "228176114" "subst" "0" "00687" "COL4A3_000098" "g.228176114G>T" "" "{PMID:Knebelman 1995:07633417}" "" "RNA ins74" "" "Germline" "" "" "0" "" "" "g.227311398G>T" "" "pathogenic" "" "0000149721" "0" "30" "2" "228172646" "228172646" "subst" "0" "00687" "COL4A3_000099" "g.228172646A>T" "" "{PMID:Longo 2002:12028435}" "" "" "Intronic/ Splice site" "Germline" "" "" "0" "" "" "g.227307930A>T" "" "likely benign" "" "0000149722" "0" "30" "2" "228173636" "228173636" "subst" "0.00625315" "00687" "COL4A3_000100" "g.228173636A>G" "" "{PMID:Longo 2002:12028435}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227308920A>G" "" "likely benign" "" "0000149723" "0" "30" "2" "228173636" "228173636" "subst" "0.00625315" "00687" "COL4A3_000100" "g.228173636A>G" "" "{PMID:Voskarides 2007:17942953}" "" "" "Missense" "Germline" "" "" "0" "" "" "g.227308920A>G" "" "likely benign" "" "0000149724" "0" "00" "2" "228173636" "228173636" "subst" "0.00625315" "00687" "COL4A3_000100" "g.228173636A>G" "" "{PMID:Wang 2004:14871398}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227308920A>G" "" "" "" "0000149725" "0" "00" "2" "228173636" "228173636" "subst" "0.00625315" "00687" "COL4A3_000100" "g.228173636A>G" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "Polymorphism" "Germline" "" "" "0" "" "" "g.227308920A>G" "" "" "" "0000149726" "0" "97" "2" "228173638" "228173638" "subst" "1.21983E-5" "00687" "COL4A3_000102" "g.228173638C>T" "" "{PMID:Nagel 2005:15954103}" "" "" "nonsense" "Germline" "" "" "0" "" "" "g.227308922C>T" "" "pathogenic" "" "0000149727" "0" "97" "2" "228173638" "228173638" "subst" "1.21983E-5" "00687" "COL4A3_000102" "g.228173638C>T" "" "{PMID:Cook 2008:18436078}" "" "" "nonsense" "Germline" "" "" "0" "" "" "g.227308922C>T" "" "pathogenic" "" "0000149728" "3" "97" "2" "228173660" "228173660" "subst" "0" "00687" "COL4A3_000103" "g.228173660T>G" "" "{PMID:Heidet 2001:11134255}" "" "" "nonsense; Homozygous" "Germline" "" "" "0" "" "" "g.227308944T>G" "" "pathogenic" "" "0000149729" "0" "97" "2" "228173698" "228173698" "subst" "4.06379E-6" "00687" "COL4A3_000105" "g.228173698C>T" "" "{PMID:Nagel 2005:15954103}" "" "" "nonsense" "Germline" "" "" "0" "" "" "g.227308982C>T" "" "pathogenic" "" "0000149730" "0" "97" "2" "228173698" "228173698" "subst" "4.06379E-6" "00687" "COL4A3_000105" "g.228173698C>T" "" "{PMID:Cook 2008:18436078}" "" "" "nonsense; Compound heterozygotes (with Arg1496X)" "Germline" "" "" "0" "" "" "g.227308982C>T" "" "pathogenic" "" "0000149731" "3" "70" "2" "228173922" "228173922" "subst" "8.12519E-6" "00687" "COL4A3_000107" "g.228173922G>A" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "missense; homozygous" "Germline" "" "" "0" "" "" "g.227309206G>A" "" "likely pathogenic" "" "0000149732" "0" "30" "2" "228175425" "228175425" "del" "0" "00687" "COL4A3_000109" "g.228175425del" "" "{PMID:Voskarides 2007:17942953}" "" "c.4756-67delA" "Intronic" "Germline" "" "" "0" "" "" "g.227310709del" "" "likely benign" "" "0000149733" "0" "97" "2" "228176554" "228176554" "subst" "0.000365663" "00687" "COL4A3_000110" "g.228176554C>T" "" "{PMID:Heidet 2001:11134255}" "" "" "missense; Heterozygous" "Germline" "" "" "0" "" "" "g.227311838C>T" "" "pathogenic" "" "0000149734" "3" "13" "2" "228111435" "228111435" "subst" "0.833927" "00687" "COL4A3_000012" "g.228111435T>C" "" "{PMID:Hoefele 2010:20177710}" "" "" "missense. Homozygous" "Germline" "" "" "0" "" "" "g.227246719T>C" "" "benign" "" "0000149735" "0" "13" "2" "228121101" "228121101" "subst" "0.168924" "00687" "COL4A3_000020" "g.228121101G>T" "" "{PMID:Hoefele 2010:20177710}" "" "" "missense. Heterozygous" "Germline" "" "" "0" "" "" "g.227256385G>T" "" "benign" "" "0000149736" "0" "13" "2" "228128540" "228128540" "subst" "0.767892" "00687" "COL4A3_000023" "g.228128540C>T" "" "{PMID:Hoefele 2010:20177710}" "" "" "Polymorphism. Heterozygous" "Germline" "" "" "0" "" "" "g.227263824C>T" "" "benign" "" "0000149737" "0" "00" "2" "228029463" "228029463" "subst" "7.60855E-5" "00687" "COL4A3_000178" "g.228029463C>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227164747C>A" "" "" "" "0000149738" "0" "70" "2" "228029513" "228029513" "subst" "0.000809091" "00687" "COL4A3_000179" "g.228029513C>G" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227164797C>G" "" "likely pathogenic" "" "0000149739" "0" "70" "2" "228029515" "228029515" "subst" "0.00144312" "00687" "COL4A3_000180" "g.228029515C>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227164799C>T" "" "likely pathogenic" "" "0000149740" "0" "90" "2" "228104886" "228104886" "subst" "2.49736E-5" "00687" "COL4A3_000181" "g.228104886G>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227240170G>A" "" "pathogenic" "" "0000149741" "0" "00" "2" "228104936" "228104936" "subst" "0.000231472" "00687" "COL4A3_000182" "g.228104936G>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227240220G>A" "" "" "" "0000149742" "0" "70" "2" "228104947" "228104947" "subst" "0" "00687" "COL4A3_000183" "g.228104947A>G" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227240231A>G" "" "likely pathogenic" "" "0000149743" "0" "00" "2" "228111412" "228111412" "subst" "0.00521223" "00687" "COL4A3_000184" "g.228111412G>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227246696G>A" "" "" "" "0000149744" "0" "70" "2" "228113184" "228113184" "subst" "6.50158E-5" "00687" "COL4A3_000185" "g.228113184T>C" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227248468T>C" "" "likely pathogenic" "" "0000149745" "0" "70" "2" "228113222" "228113222" "subst" "4.0661E-5" "00687" "COL4A3_000186" "g.228113222G>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227248506G>A" "" "likely pathogenic" "" "0000149746" "0" "70" "2" "228118052" "228118052" "subst" "2.8459E-5" "00687" "COL4A3_000187" "g.228118052G>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227253336G>A" "" "likely pathogenic" "" "0000149747" "0" "70" "2" "228118867" "228118867" "subst" "0.0230539" "00687" "COL4A3_000188" "g.228118867G>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227254151G>A" "" "likely pathogenic" "" "0000149748" "0" "70" "2" "228128655" "228128655" "subst" "9.34602E-5" "00687" "COL4A3_000189" "g.228128655C>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227263939C>T" "" "likely pathogenic" "" "0000149749" "0" "00" "2" "228131140" "228131140" "subst" "8.12797E-6" "00687" "COL4A3_000190" "g.228131140C>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227266424C>A" "" "" "" "0000149750" "0" "00" "2" "228131170" "228131170" "subst" "0.000800442" "00687" "COL4A3_000191" "g.228131170C>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227266454C>T" "" "" "" "0000149751" "0" "00" "2" "228131215" "228131215" "subst" "0.00127275" "00687" "COL4A3_000192" "g.228131215T>C" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227266499T>C" "" "" "" "0000149752" "0" "70" "2" "228134637" "228134637" "subst" "8.53319E-5" "00687" "COL4A3_000193" "g.228134637G>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227269921G>A" "" "likely pathogenic" "" "0000149753" "0" "70" "2" "228137792" "228137792" "subst" "0.000250664" "00687" "COL4A3_000194" "g.228137792C>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227273076C>T" "" "likely pathogenic" "" "0000149754" "0" "00" "2" "228145625" "228145625" "subst" "3.1266E-5" "00687" "COL4A3_000195" "g.228145625T>C" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227280909T>C" "" "" "" "0000149755" "0" "77" "2" "228145709" "228145709" "subst" "0.00321214" "00687" "COL4A3_000196" "g.228145709G>C" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227280993G>C" "" "likely pathogenic" "" "0000149756" "0" "00" "2" "228148541" "228148541" "subst" "0.0044196" "00687" "COL4A3_000197" "g.228148541C>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227283825C>T" "" "" "" "0000149757" "0" "00" "2" "228153870" "228153870" "subst" "0.000802411" "00687" "COL4A3_000198" "g.228153870C>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227289154C>T" "" "" "" "0000149758" "0" "77" "2" "228154765" "228154765" "subst" "0.000560511" "00687" "COL4A3_000199" "g.228154765C>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227290049C>T" "" "likely pathogenic" "" "0000149759" "0" "77" "2" "228155511" "228155511" "subst" "1.62499E-5" "00687" "COL4A3_000200" "g.228155511G>C" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227290795G>C" "" "likely pathogenic" "" "0000149760" "0" "97" "2" "228155592" "228155592" "subst" "8.22896E-5" "00687" "COL4A3_000201" "g.228155592C>G" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227290876C>G" "" "pathogenic" "" "0000149761" "0" "00" "2" "228155593" "228155593" "subst" "8.22504E-6" "00687" "COL4A3_000202" "g.228155593G>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227290877G>A" "" "" "" "0000149762" "0" "00" "2" "228157954" "228157954" "subst" "0.00431364" "00687" "COL4A3_000203" "g.228157954G>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227293238G>A" "" "" "" "0000149763" "0" "00" "2" "228159696" "228159696" "subst" "8.13795E-6" "00687" "COL4A3_000204" "g.228159696A>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227294980A>T" "" "" "" "0000149764" "0" "70" "2" "228159737" "228159737" "subst" "0.000288447" "00687" "COL4A3_000205" "g.228159737G>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227295021G>A" "" "likely pathogenic" "" "0000149765" "0" "70" "2" "228159736" "228159736" "subst" "8.12539E-6" "00687" "COL4A3_000206" "g.228159736C>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227295020C>A" "" "likely pathogenic" "" "0000149766" "0" "70" "2" "228162525" "228162525" "subst" "5.73539E-6" "00687" "COL4A3_000207" "g.228162525T>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227297809T>A" "" "likely pathogenic" "" "0000149767" "0" "00" "2" "228163402" "228163402" "subst" "8.12513E-6" "00687" "COL4A3_000208" "g.228163402G>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227298686G>T" "" "" "" "0000149768" "0" "00" "2" "228163471" "228163471" "subst" "0.000345455" "00687" "COL4A3_000209" "g.228163471C>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227298755C>T" "" "" "" "0000149769" "0" "70" "2" "228167788" "228167788" "subst" "0" "00687" "COL4A3_000210" "g.228167788G>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227303072G>A" "" "likely pathogenic" "" "0000149770" "0" "00" "2" "228167810" "228167810" "subst" "0.000207135" "00687" "COL4A3_000211" "g.228167810G>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227303094G>A" "" "" "" "0000149771" "0" "00" "2" "228167816" "228167816" "subst" "0.000117779" "00687" "COL4A3_000212" "g.228167816A>G" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227303100A>G" "" "" "" "0000149772" "0" "00" "2" "228172553" "228172553" "subst" "0.000987139" "00687" "COL4A3_000213" "g.228172553T>C" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227307837T>C" "" "" "" "0000149773" "0" "00" "2" "228172571" "228172571" "subst" "0.000101583" "00687" "COL4A3_000214" "g.228172571A>C" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227307855A>C" "" "" "" "0000149774" "0" "00" "2" "228172622" "228172622" "subst" "2.84588E-5" "00687" "COL4A3_000215" "g.228172622C>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227307906C>T" "" "" "" "0000149775" "0" "00" "2" "228173634" "228173634" "subst" "0.00037006" "00687" "COL4A3_000216" "g.228173634G>A" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227308918G>A" "" "" "" "0000149776" "0" "97" "2" "228173666" "228173666" "subst" "0" "00687" "COL4A3_000217" "g.228173666G>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227308950G>T" "" "pathogenic" "" "0000149777" "0" "00" "2" "228173986" "228173986" "subst" "0.000897739" "00687" "COL4A3_000218" "g.228173986A>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227309270A>T" "" "" "" "0000149778" "0" "90" "2" "228175587" "228175587" "subst" "0" "00687" "COL4A3_000219" "g.228175587T>G" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227310871T>G" "" "pathogenic" "" "0000149779" "0" "00" "2" "228175629" "228175629" "subst" "0.00322998" "00687" "COL4A3_000220" "g.228175629C>T" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227310913C>T" "" "" "" "0000149780" "0" "70" "2" "228176548" "228176548" "subst" "1.62517E-5" "00687" "COL4A3_000221" "g.228176548A>G" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227311832A>G" "" "likely pathogenic" "" "0000149781" "0" "90" "2" "228176549" "228176549" "subst" "0" "00687" "COL4A3_000222" "g.228176549T>C" "" "1000 genome; NCBI" "" "" "" "Germline" "" "" "0" "" "" "g.227311833T>C" "" "pathogenic" "" "0000149782" "21" "50" "2" "228137692" "228137692" "subst" "0" "01545" "COL4A3_000040" "g.228137692G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227272976G>C" "" "VUS" "" "0000149783" "0" "50" "2" "228145177" "228145177" "subst" "0" "01545" "COL4A3_000223" "g.228145177G>A" "" "" "" "G2083A" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.227280461G>A" "" "VUS" "" "0000149784" "11" "70" "2" "228112293" "228112293" "subst" "0" "00466" "COL4A3_000225" "g.228112293G>C" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227247577G>C" "" "likely pathogenic" "" "0000149785" "21" "90" "2" "228118029" "228118030" "del" "0" "00466" "COL4A3_000228" "g.228118029_228118030del" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227253313_227253314del" "" "pathogenic" "" "0000149786" "0" "70" "2" "228137824" "228137824" "subst" "2.0616E-5" "00466" "COL4A3_000042" "g.228137824G>A" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227273108G>A" "" "likely pathogenic" "" "0000149787" "21" "90" "2" "228162404" "228162404" "del" "0" "00466" "COL4A3_000231" "g.228162404del" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227297688del" "" "pathogenic" "" "0000149788" "0" "70" "2" "228159733" "228159733" "subst" "0" "00466" "COL4A3_000233" "g.228159733G>C" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227295017G>C" "" "likely pathogenic" "" "0000149789" "0" "90" "2" "228155603" "228155603" "subst" "0" "00466" "COL4A3_000234" "g.228155603G>A" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227290887G>A" "" "pathogenic" "" "0000149790" "21" "70" "2" "228142227" "228142227" "subst" "0.000106774" "00466" "COL4A3_000044" "g.228142227G>A" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227277511G>A" "" "likely pathogenic" "" "0000149791" "10" "70" "2" "228147159" "228147159" "subst" "0" "00466" "COL4A3_000236" "g.228147159G>A" "" "{PMID:Storey 2013:24052634}" "" "" "apparent homozygous" "Germline" "" "" "0" "" "" "g.227282443G>A" "" "likely pathogenic" "" "0000149792" "0" "90" "2" "228147213" "228147214" "delins" "0" "00466" "COL4A3_000053" "g.228147213_228147214delinsT" "" "{PMID:Storey 2013:24052634}" "" "2621_2622delGAinsT" "" "Germline" "" "" "0" "" "" "g.227282497_227282498delinsT" "" "pathogenic" "" "0000149793" "11" "70" "2" "228176554" "228176554" "subst" "0.000365663" "00466" "COL4A3_000110" "g.228176554C>T" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227311838C>T" "" "likely pathogenic" "" "0000149794" "21" "70" "2" "228176554" "228176554" "subst" "0.000365663" "00466" "COL4A3_000110" "g.228176554C>T" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227311838C>T" "" "likely pathogenic" "" "0000149795" "0" "70" "2" "228163406" "228163406" "subst" "4.0622E-6" "00466" "COL4A3_000241" "g.228163406G>C" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227298690G>C" "" "likely pathogenic" "" "0000149796" "10" "70" "2" "228176567" "228176567" "subst" "2.43809E-5" "00466" "COL4A3_000242" "g.228176567G>A" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227311851G>A" "" "likely pathogenic" "" "0000149797" "21" "70" "2" "228172581" "228172581" "subst" "0" "00466" "COL4A3_000243" "g.228172581G>T" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227307865G>T" "" "likely pathogenic" "" "0000149798" "10" "90" "2" "228172520" "228172526" "del" "0" "00466" "COL4A3_000245" "g.228172520_228172526del" "" "{PMID:Storey 2013:24052634}" "" "" "apparent homozygous" "Germline" "" "" "0" "" "" "g.227307804_227307810del" "" "pathogenic" "" "0000149799" "1" "90" "2" "228104876" "228104876" "dup" "0" "00466" "COL4A3_000246" "g.228104876dup" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227240160dup" "" "pathogenic" "" "0000149800" "0" "90" "2" "228147213" "228147214" "delins" "0" "00466" "COL4A3_000053" "g.228147213_228147214delinsT" "" "{PMID:Storey 2013:24052634}" "" "2621_2622delGAinsT" "" "Germline" "" "" "0" "" "" "g.227282497_227282498delinsT" "" "pathogenic" "" "0000149801" "0" "70" "2" "228176554" "228176554" "subst" "0.000365663" "00466" "COL4A3_000110" "g.228176554C>T" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227311838C>T" "" "likely pathogenic" "" "0000149802" "10" "90" "2" "228148948" "228148958" "del" "0" "00466" "COL4A3_000240" "g.228148948_228148958del" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227284232_227284242del" "" "pathogenic" "" "0000149803" "0" "00" "2" "228029444" "228029444" "subst" "0" "00687" "COL4A3_000250" "g.228029444T>C" "" "" "" "Met1Thr" "" "Germline" "" "" "0" "" "" "g.227164728T>C" "" "" "" "0000149804" "0" "00" "2" "228029445" "228029445" "subst" "0" "00687" "COL4A3_000251" "g.228029445G>A" "" "" "" "Met1Ile" "" "Germline" "" "" "0" "" "" "g.227164729G>A" "" "" "" "0000149805" "0" "00" "2" "228029461" "228029461" "subst" "0" "00687" "COL4A3_000252" "g.228029461C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227164745C>A" "" "" "" "0000149806" "0" "00" "2" "228029482" "228029505" "del" "0" "00687" "COL4A3_000003" "g.228029482_228029505del" "" "" "" "40_63delCTGCCGCTCCTGCTGGTGCTCCTG" "" "Germline" "" "" "0" "" "" "g.227164766_227164789del" "" "" "" "0000149807" "0" "00" "2" "228029482" "228029508" "del" "0" "00687" "COL4A3_000254" "g.228029482_228029508del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227164766_227164792del" "" "" "" "0000149808" "0" "00" "2" "228102692" "228102692" "dup" "0" "00687" "COL4A3_000255" "g.228102692dup" "" "" "" "c.95_96insC" "" "Germline" "" "" "0" "" "" "g.227237976dup" "" "" "" "0000149809" "0" "00" "2" "228102723" "228102723" "subst" "0.284083" "00687" "COL4A3_000005" "g.228102723G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227238007G>C" "" "" "" "0000149810" "0" "00" "2" "228104876" "228104876" "dup" "0" "00687" "COL4A3_000246" "g.228104876dup" "" "" "" "162_163insT" "" "Germline" "" "" "0" "" "" "g.227240160dup" "" "" "" "0000149811" "0" "00" "2" "228104876" "228104876" "dup" "0" "00687" "COL4A3_000246" "g.228104876dup" "" "" "" "162_163insT" "" "Germline" "" "" "0" "" "" "g.227240160dup" "" "" "" "0000149812" "0" "00" "2" "228104876" "228104876" "dup" "0" "00687" "COL4A3_000246" "g.228104876dup" "" "" "" "162_163insT" "" "Germline" "" "" "0" "" "" "g.227240160dup" "" "" "" "0000149813" "0" "00" "2" "228104936" "228104936" "subst" "0.00165397" "00687" "COL4A3_000007" "g.228104936G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227240220G>T" "" "" "" "0000149814" "0" "00" "2" "228109062" "228109062" "subst" "8.53596E-5" "00687" "COL4A3_000259" "g.228109062G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227244346G>A" "" "" "" "0000149815" "0" "00" "2" "228110691" "228110691" "subst" "0.00485981" "00687" "COL4A3_000009" "g.228110691C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227245975C>A" "" "" "" "0000149816" "0" "00" "2" "228110691" "228110691" "subst" "0.00485981" "00687" "COL4A3_000009" "g.228110691C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227245975C>A" "" "" "" "0000149817" "0" "99" "2" "228110696" "228110696" "subst" "0" "00687" "COL4A3_000010" "g.228110696C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227245980C>A" "" "pathogenic" "" "0000149818" "0" "90" "2" "228111404" "228111404" "subst" "8.13378E-6" "00687" "COL4A3_000248" "g.228111404G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227246688G>T" "" "pathogenic" "" "0000149819" "0" "00" "2" "228111407" "228111407" "subst" "4.0664E-6" "00687" "COL4A3_000262" "g.228111407C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227246691C>T" "" "" "" "0000149820" "0" "00" "2" "228111412" "228111412" "subst" "0.00521223" "00687" "COL4A3_000184" "g.228111412G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227246696G>A" "" "" "" "0000149821" "0" "00" "2" "228111415" "228111415" "del" "0" "00687" "COL4A3_000264" "g.228111415del" "" "" "" "c.400delT" "" "Germline" "" "" "0" "" "" "g.227246699del" "" "" "" "0000149822" "0" "00" "2" "228111435" "228111435" "subst" "0" "00687" "COL4A3_000265" "g.228111435C>T" "" "" "" "" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.227246719C>T" "" "" "" "0000149823" "0" "00" "2" "228111454" "228111454" "subst" "2.43948E-5" "00687" "COL4A3_000266" "g.228111454G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227246738G>A" "" "" "" "0000149824" "0" "00" "2" "228112275" "228112275" "subst" "1.21862E-5" "00687" "COL4A3_000267" "g.228112275G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227247559G>T" "" "" "" "0000149825" "0" "00" "2" "228112275" "228112275" "subst" "1.21862E-5" "00687" "COL4A3_000267" "g.228112275G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227247559G>T" "" "" "" "0000149826" "0" "00" "2" "228113175" "228113175" "subst" "0" "00687" "COL4A3_000268" "g.228113175G>A" "" "" "" "" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.227248459G>A" "" "" "" "0000149827" "0" "00" "2" "228113200" "228113200" "subst" "4.06392E-6" "00687" "COL4A3_000269" "g.228113200A>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227248484A>T" "" "" "" "0000149828" "0" "00" "2" "228113212" "228113212" "dup" "0" "00687" "COL4A3_000270" "g.228113212dup" "" "" "" "c.520insG" "" "Germline" "" "" "0" "" "" "g.227248496dup" "" "" "" "0000149829" "0" "00" "2" "228113236" "228113236" "subst" "0" "00687" "COL4A3_000249" "g.228113236G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227248520G>T" "" "" "" "0000149830" "0" "00" "2" "228115913" "228115913" "subst" "6.91102E-5" "00687" "COL4A3_000272" "g.228115913T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227251197T>C" "" "" "" "0000149831" "0" "00" "2" "228118022" "228118022" "subst" "0" "00687" "COL4A3_000273" "g.228118022G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227253306G>A" "" "" "" "0000149832" "0" "00" "2" "228118051" "228118051" "subst" "4.8786E-5" "00687" "COL4A3_000274" "g.228118051C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227253335C>T" "" "" "" "0000149833" "0" "00" "2" "228118302" "228118302" "del" "0" "00687" "COL4A3_000229" "g.228118302del" "" "" "" "c.709delC" "" "Germline" "" "" "0" "" "" "g.227253586del" "" "" "" "0000149834" "0" "00" "2" "228118354" "228118354" "subst" "4.07123E-6" "00687" "COL4A3_000276" "g.228118354G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227253638G>A" "" "" "" "0000149835" "0" "00" "2" "228118867" "228118867" "subst" "0.0230539" "00687" "COL4A3_000188" "g.228118867G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227254151G>A" "" "" "" "0000149836" "0" "00" "2" "228119415" "228119415" "subst" "0" "00687" "COL4A3_000016" "g.228119415G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227254699G>A" "" "" "" "0000149837" "0" "00" "2" "228119431" "228119431" "subst" "0" "00687" "COL4A3_000277" "g.228119431G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227254715G>A" "" "" "" "0000149838" "0" "00" "2" "228120751" "228120751" "subst" "2.03178E-5" "00687" "COL4A3_000278" "g.228120751G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227256035G>A" "" "" "" "0000149839" "0" "00" "2" "228121067" "228121067" "subst" "1.21958E-5" "00687" "COL4A3_000279" "g.228121067G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227256351G>A" "" "" "" "0000149840" "0" "00" "2" "228121096" "228121096" "subst" "2.43902E-5" "00687" "COL4A3_000280" "g.228121096G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227256380G>A" "" "" "" "0000149841" "0" "00" "2" "228121101" "228121101" "subst" "0.168924" "00687" "COL4A3_000020" "g.228121101G>T" "" "" "" "" "probably relevant only found in AlbisNr/Name (5269/Pare" "Germline" "" "" "0" "" "" "g.227256385G>T" "" "" "" "0000149842" "0" "00" "2" "228124518" "228124518" "del" "0" "00687" "COL4A3_000281" "g.228124518del" "" "" "" "c.1038delT" "" "Germline" "" "" "0" "" "" "g.227259802del" "" "" "" "0000149843" "0" "00" "2" "228124590" "228124590" "subst" "0" "00687" "COL4A3_000022" "g.228124590C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227259874C>T" "" "" "" "0000149844" "0" "00" "2" "228125815" "228125815" "subst" "0" "00687" "COL4A3_000282" "g.228125815G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227261099G>A" "" "" "" "0000149845" "0" "00" "2" "228125815" "228125815" "subst" "0" "00687" "COL4A3_000282" "g.228125815G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227261099G>A" "" "" "" "0000149846" "0" "00" "2" "228128554" "228128554" "del" "0" "00687" "COL4A3_000283" "g.228128554del" "" "" "" "c.1209delA" "" "Germline" "" "" "0" "" "" "g.227263838del" "" "" "" "0000149847" "0" "00" "2" "228128554" "228128554" "del" "0" "00687" "COL4A3_000283" "g.228128554del" "" "" "" "c.1209delA" "" "Germline" "" "" "0" "" "" "g.227263838del" "" "" "" "0000149848" "0" "00" "2" "228128561" "228128561" "subst" "1.62628E-5" "00687" "COL4A3_000024" "g.228128561C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227263845C>T" "" "" "" "0000149849" "0" "00" "2" "228128564" "228128564" "subst" "0" "00687" "COL4A3_000025" "g.228128564G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227263848G>C" "" "" "" "0000149850" "0" "00" "2" "228128564" "228128564" "subst" "0" "00687" "COL4A3_000025" "g.228128564G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227263848G>C" "" "" "" "0000149851" "0" "00" "2" "228128568" "228128568" "subst" "0.0939043" "00687" "COL4A3_000026" "g.228128568G>A" "" "" "" "" "probably relevant only found in Albis No 5271 (Kristin Mckenzie)" "Germline" "" "" "0" "" "" "g.227263852G>A" "" "" "" "0000149852" "0" "00" "2" "228131169" "228131169" "subst" "0.09636" "00687" "COL4A3_000028" "g.228131169A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227266453A>G" "" "" "" "0000149853" "0" "00" "2" "228131169" "228131170" "inv" "0" "00687" "COL4A3_000287" "g.228131169_228131170inv" "" "" "" "1352-1353AC>GT" "" "Germline" "" "" "0" "" "" "g.227266453_227266454inv" "" "" "" "0000149854" "0" "00" "2" "228131179" "228131179" "subst" "0.000158458" "00687" "COL4A3_000288" "g.228131179A>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227266463A>T" "" "" "" "0000149855" "0" "00" "2" "228131185" "228131185" "subst" "0" "00687" "COL4A3_000289" "g.228131185T>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227266469T>A" "" "" "" "0000149856" "0" "00" "2" "228131704" "228131704" "subst" "0" "00687" "COL4A3_000032" "g.228131704T>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227266988T>A" "" "" "" "0000149857" "0" "00" "2" "228131752" "228131752" "subst" "0.0951863" "00687" "COL4A3_000033" "g.228131752G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227267036G>A" "" "" "" "0000149858" "0" "00" "2" "228131783" "228131783" "subst" "0.000706806" "00687" "COL4A3_000290" "g.228131783C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227267067C>T" "" "" "" "0000149859" "0" "00" "2" "228131783" "228131783" "subst" "0.000706806" "00687" "COL4A3_000290" "g.228131783C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227267067C>T" "" "" "" "0000149860" "0" "00" "2" "228131801" "228131801" "subst" "0" "00687" "COL4A3_000291" "g.228131801C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227267085C>A" "" "" "" "0000149861" "0" "00" "2" "228135504" "228135504" "subst" "0" "00687" "COL4A3_000036" "g.228135504G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227270788G>T" "" "" "" "0000149862" "0" "00" "2" "228135631" "228135631" "subst" "0.469174" "00687" "COL4A3_000038" "g.228135631C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227270915C>T" "" "" "" "0000149863" "0" "00" "2" "228137711" "228137711" "subst" "0" "00687" "COL4A3_000292" "g.228137711G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227272995G>A" "" "" "" "0000149864" "0" "00" "2" "228137761" "228137761" "subst" "8.20863E-6" "00687" "COL4A3_000293" "g.228137761G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227273045G>A" "" "" "" "0000149865" "0" "00" "2" "228137761" "228137761" "subst" "0" "00687" "COL4A3_000294" "g.228137761G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227273045G>T" "" "" "" "0000149866" "0" "00" "2" "228137761" "228137761" "subst" "8.20863E-6" "00687" "COL4A3_000293" "g.228137761G>A" "" "" "" "GGA>AGA" "" "Germline" "" "" "0" "" "" "g.227273045G>A" "" "" "" "0000149867" "0" "00" "2" "228137792" "228137792" "subst" "0.000250664" "00687" "COL4A3_000194" "g.228137792C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227273076C>T" "" "" "" "0000149868" "0" "00" "2" "228137815" "228137815" "subst" "8.23744E-6" "00687" "COL4A3_000296" "g.228137815G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227273099G>A" "" "" "" "0000149869" "0" "00" "2" "228137833" "228137833" "subst" "8.26071E-6" "00687" "COL4A3_000297" "g.228137833G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227273117G>A" "" "" "" "0000149870" "0" "00" "2" "228142165" "228142165" "subst" "0" "00687" "COL4A3_000298" "g.228142165G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227277449G>A" "" "" "" "0000149871" "0" "00" "2" "228142198" "228142198" "subst" "3.68041E-5" "00687" "COL4A3_000299" "g.228142198C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227277482C>T" "" "" "" "0000149872" "0" "00" "2" "228142227" "228142227" "subst" "0.000106774" "00687" "COL4A3_000044" "g.228142227G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227277511G>A" "" "" "" "0000149873" "0" "00" "2" "228144590" "228144590" "subst" "0" "00687" "COL4A3_000300" "g.228144590G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227279874G>T" "" "" "" "0000149874" "0" "00" "2" "228144598" "228144598" "subst" "0" "00687" "COL4A3_000046" "g.228144598G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227279882G>A" "" "" "" "0000149875" "0" "00" "2" "228144607" "228144607" "subst" "0" "00687" "COL4A3_000301" "g.228144607G>A" "" "" "" "IVS29+1G>A" "" "Germline" "" "" "0" "" "" "g.227279891G>A" "" "" "" "0000149876" "0" "00" "2" "228145245" "228145262" "del" "0" "00687" "COL4A3_000247" "g.228145245_228145262del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280529_227280546del" "" "" "" "0000149877" "0" "00" "2" "228145261" "228145261" "subst" "0" "00687" "COL4A3_000302" "g.228145261G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280545G>T" "" "" "" "0000149878" "0" "00" "2" "228145261" "228145261" "subst" "0" "00687" "COL4A3_000303" "g.228145261G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280545G>A" "" "" "" "0000149879" "0" "00" "2" "228145261" "228145261" "subst" "0" "00687" "COL4A3_000304" "g.228145261G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280545G>C" "" "" "" "0000149880" "0" "00" "2" "228145262" "228145262" "subst" "0" "00687" "COL4A3_000305" "g.228145262G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280546G>A" "" "" "" "0000149881" "0" "00" "2" "228147090" "228147090" "subst" "4.06233E-6" "00687" "COL4A3_000306" "g.228147090G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227282374G>A" "" "" "" "0000149882" "0" "00" "2" "228147093" "228147093" "subst" "0.0119505" "00687" "COL4A3_000050" "g.228147093A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227282377A>G" "" "" "" "0000149883" "0" "00" "2" "228147093" "228147093" "subst" "0.0119505" "00687" "COL4A3_000050" "g.228147093A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227282377A>G" "" "" "" "0000149884" "0" "00" "2" "228147093" "228147093" "subst" "0.0119505" "00687" "COL4A3_000050" "g.228147093A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227282377A>G" "" "" "" "0000149885" "0" "00" "2" "228147149" "228147149" "subst" "4.06151E-6" "00687" "COL4A3_000051" "g.228147149G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227282433G>A" "" "" "" "0000149886" "0" "00" "2" "228147213" "228147214" "delins" "0" "00687" "COL4A3_000053" "g.228147213_228147214delinsT" "" "" "" "2621_2622delGAinsT" "" "Germline" "" "" "0" "" "" "g.227282497_227282498delinsT" "" "" "" "0000149887" "0" "00" "2" "228148541" "228148541" "subst" "0.0044196" "00687" "COL4A3_000197" "g.228148541C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227283825C>T" "" "" "" "0000149888" "0" "00" "2" "228148543" "228148543" "dup" "0" "00687" "COL4A3_000307" "g.228148543dup" "" "" "" "c.2717_2718insC" "" "Germline" "" "" "0" "" "" "g.227283827dup" "" "" "" "0000149889" "0" "00" "2" "228148934" "228148934" "subst" "0" "00687" "COL4A3_000308" "g.228148934T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227284218T>C" "" "" "" "0000149890" "0" "00" "2" "228148948" "228148957" "del" "0" "00687" "COL4A3_000309" "g.228148948_228148957del" "" "" "" "2768_2777delTAAAGGGCCA" "" "Germline" "" "" "0" "" "" "g.227284232_227284241del" "" "" "" "0000149891" "0" "00" "2" "228148948" "228148968" "del" "0" "00687" "COL4A3_000310" "g.228148948_228148968del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227284232_227284252del" "" "" "" "0000149892" "0" "00" "2" "228149006" "228149006" "subst" "0.000479655" "00687" "COL4A3_000055" "g.228149006C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227284290C>T" "" "" "" "0000149893" "0" "00" "2" "228153911" "228153911" "subst" "0" "00687" "COL4A3_000311" "g.228153911G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227289195G>A" "" "" "" "0000149894" "0" "00" "2" "228155602" "228155602" "subst" "0" "00687" "COL4A3_000312" "g.228155602G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227290886G>A" "" "" "" "0000149895" "0" "00" "2" "228155505" "228155505" "subst" "0" "00687" "COL4A3_000313" "g.228155505C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227290789C>T" "" "" "" "0000149896" "0" "00" "2" "228155561" "228155561" "subst" "0" "00687" "COL4A3_000314" "g.228155561G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227290845G>A" "" "" "" "0000149897" "0" "00" "2" "228157938" "228157942" "del" "0" "00687" "COL4A3_000315" "g.228157938_228157942del" "" "" "" "3239_3244delAAAG" "" "Germline" "" "" "0" "" "" "g.227293222_227293226del" "" "" "" "0000149898" "0" "00" "2" "228157954" "228157954" "subst" "0.00431364" "00687" "COL4A3_000203" "g.228157954G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227293238G>A" "" "" "" "0000149899" "0" "00" "2" "228158006" "228158006" "subst" "4.06497E-6" "00687" "COL4A3_000316" "g.228158006G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227293290G>C" "" "" "" "0000149900" "0" "00" "2" "228158006" "228158006" "subst" "4.06497E-6" "00687" "COL4A3_000316" "g.228158006G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227293290G>C" "" "" "" "0000149901" "0" "00" "2" "228158021" "228158021" "subst" "0.00431634" "00687" "COL4A3_000065" "g.228158021C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227293305C>T" "" "" "" "0000149902" "0" "00" "2" "228159275" "228159275" "subst" "0" "00687" "COL4A3_000317" "g.228159275G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227294559G>C" "" "" "" "0000149903" "0" "00" "2" "228159284" "228159284" "subst" "0" "00687" "COL4A3_000318" "g.228159284C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227294568C>T" "" "" "" "0000149904" "0" "00" "2" "228159286" "228159286" "subst" "0" "00687" "COL4A3_000319" "g.228159286G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227294570G>C" "" "" "" "0000149905" "0" "00" "2" "228159733" "228159733" "subst" "0" "00687" "COL4A3_000233" "g.228159733G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227295017G>C" "" "" "" "0000149906" "0" "00" "2" "228159760" "228159760" "subst" "8.12493E-6" "00687" "COL4A3_000067" "g.228159760G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227295044G>A" "" "" "" "0000149907" "0" "00" "2" "228160015" "228160015" "subst" "0" "00687" "COL4A3_000320" "g.228160015G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227295299G>A" "" "" "" "0000149908" "0" "00" "2" "228162416" "228162416" "subst" "0" "00687" "COL4A3_000074" "g.228162416G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227297700G>A" "" "" "" "0000149909" "0" "00" "2" "228162416" "228162416" "subst" "0" "00687" "COL4A3_000074" "g.228162416G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227297700G>A" "" "" "" "0000149910" "0" "00" "2" "228162418" "228162418" "subst" "0" "00687" "COL4A3_000323" "g.228162418T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227297702T>G" "" "" "" "0000149911" "0" "00" "2" "228162451" "228162451" "subst" "0" "00687" "COL4A3_000324" "g.228162451G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227297735G>T" "" "" "" "0000149912" "0" "00" "2" "228162468" "228162468" "subst" "0.000155006" "00687" "COL4A3_000078" "g.228162468G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227297752G>A" "" "" "" "0000149913" "0" "00" "2" "228162575" "228162575" "subst" "0" "00687" "COL4A3_000326" "g.228162575G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227297859G>A" "" "" "" "0000149914" "0" "00" "2" "228163406" "228163406" "subst" "4.0622E-6" "00687" "COL4A3_000241" "g.228163406G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227298690G>C" "" "" "" "0000149915" "0" "00" "2" "228163419" "228163419" "subst" "4.0626E-6" "00687" "COL4A3_000327" "g.228163419C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227298703C>T" "" "" "" "0000149916" "0" "00" "2" "228163453" "228163453" "subst" "0.0450209" "00687" "COL4A3_000084" "g.228163453C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227298737C>A" "" "" "" "0000149917" "0" "00" "2" "228163466" "228163466" "subst" "0" "00687" "COL4A3_000328" "g.228163466G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227298750G>A" "" "" "" "0000149918" "0" "00" "2" "228163479" "228163479" "subst" "0" "00687" "COL4A3_000329" "g.228163479C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227298763C>A" "" "" "" "0000149919" "0" "00" "2" "228163529" "228163529" "subst" "0" "00687" "COL4A3_000330" "g.228163529G>T" "" "" "" "IVS43+1G>T" "" "Germline" "" "" "0" "" "" "g.227298813G>T" "" "" "" "0000149920" "0" "00" "2" "228167827" "228167827" "subst" "0" "00687" "COL4A3_000331" "g.228167827G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227303111G>T" "" "" "" "0000149921" "0" "00" "2" "228168741" "228168741" "subst" "8.1283E-6" "00687" "COL4A3_000332" "g.228168741G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227304025G>A" "" "" "" "0000149922" "0" "00" "2" "228169755" "228169755" "subst" "2.03345E-5" "00687" "COL4A3_000333" "g.228169755G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227305039G>A" "" "" "" "0000149923" "0" "00" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "" "" "0000149924" "0" "00" "2" "228172638" "228172638" "subst" "0" "00687" "COL4A3_000334" "g.228172638A>G" "" "" "" "IVS48+3A>G" "" "Germline" "" "" "0" "" "" "g.227307922A>G" "" "" "" "0000149925" "0" "00" "2" "228173636" "228173636" "subst" "0.00625315" "00687" "COL4A3_000100" "g.228173636A>G" "" "" "" "" "probably relevant only found in" "Germline" "" "" "0" "" "" "g.227308920A>G" "" "" "" "0000149926" "0" "00" "2" "228173646" "228173646" "subst" "0.000581339" "00687" "COL4A3_000336" "g.228173646C>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227308930C>G" "" "" "" "0000149927" "0" "00" "2" "228173662" "228173662" "subst" "0.000247901" "00687" "COL4A3_000337" "g.228173662T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227308946T>C" "" "" "" "0000149928" "0" "00" "2" "228173928" "228173928" "subst" "7.71831E-5" "00687" "COL4A3_000338" "g.228173928T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227309212T>G" "" "" "" "0000149929" "0" "00" "2" "228173944" "228173944" "subst" "0.00235602" "00687" "COL4A3_000339" "g.228173944G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227309228G>A" "" "" "" "0000149930" "0" "00" "2" "228173944" "228173944" "subst" "0" "00687" "COL4A3_000340" "g.228173944G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227309228G>C" "" "" "" "0000149931" "0" "00" "2" "228173986" "228173986" "subst" "0.000897739" "00687" "COL4A3_000218" "g.228173986A>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227309270A>T" "" "" "" "0000149932" "0" "00" "2" "228173995" "228173995" "subst" "2.43754E-5" "00687" "COL4A3_000342" "g.228173995C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227309279C>T" "" "" "" "0000149933" "0" "00" "2" "228174012" "228174012" "subst" "0" "00687" "COL4A3_000343" "g.228174012G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227309296G>C" "" "" "" "0000149934" "0" "00" "2" "228175544" "228175544" "subst" "0" "00687" "COL4A3_000344" "g.228175544C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227310828C>T" "" "" "" "0000149935" "0" "00" "2" "228175581" "228175581" "del" "0" "00687" "COL4A3_000345" "g.228175581del" "" "" "" "c.4844delA" "" "Germline" "" "" "0" "" "" "g.227310865del" "" "" "" "0000149936" "0" "00" "2" "228175627" "228175627" "subst" "0" "00687" "COL4A3_000346" "g.228175627C>T" "" "" "" "" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.227310911C>T" "" "" "" "0000149937" "0" "90" "2" "228118053" "228118053" "subst" "0" "01548" "COL4A3_000347" "g.228118053G>A" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227253337G>A" "" "pathogenic" "" "0000149939" "0" "90" "2" "228118356" "228118356" "subst" "0" "01548" "COL4A3_000349" "g.228118356T>C" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227253640T>C" "" "pathogenic" "" "0000149940" "0" "90" "2" "228159278" "228159278" "subst" "0" "01548" "COL4A3_000350" "g.228159278G>A" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227294562G>A" "" "pathogenic" "" "0000149941" "0" "90" "2" "228118354" "228118354" "subst" "0" "01548" "COL4A3_000351" "g.228118354G>T" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227253638G>T" "" "pathogenic" "" "0000149942" "0" "97" "2" "228155501" "228155501" "subst" "8.12493E-6" "00687" "COL4A3_000059" "g.228155501C>T" "" "{PMID:Longo 2002:12028435}" "" "" "" "Germline" "" "" "0" "" "" "g.227290785C>T" "" "pathogenic" "" "0000149943" "0" "97" "2" "228172489" "228172489" "del" "0" "00687" "COL4A3_000092" "g.228172489del" "" "{PMID:Tazon Vega 2003:14582039}" "" "c.4316delC" "" "Germline" "" "" "0" "" "" "g.227307773del" "" "pathogenic" "" "0000149944" "0" "97" "2" "228128564" "228128564" "subst" "0" "00687" "COL4A3_000025" "g.228128564G>C" "" "{PMID:Heidet 2001:11134255}" "" "" "" "Germline" "" "" "0" "" "" "g.227263848G>C" "" "pathogenic" "" "0000149945" "0" "13" "2" "228137808" "228137808" "subst" "0" "00687" "COL4A3_000041" "g.228137808G>A" "" "{PMID:Hou 2007:17726307}" "" "" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.227273092G>A" "" "benign" "" "0000149946" "0" "97" "2" "228137824" "228137824" "subst" "2.0616E-5" "00687" "COL4A3_000042" "g.228137824G>A" "" "{PMID:Heidet 2001:11134255}" "" "" "" "Germline" "" "" "0" "" "" "g.227273108G>A" "" "pathogenic" "" "0000149947" "0" "70" "2" "228172597" "228172597" "subst" "4.06461E-6" "00687" "COL4A3_000096" "g.228172597T>C" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Germline" "" "" "0" "" "" "g.227307881T>C" "" "likely pathogenic" "" "0000149948" "0" "97" "2" "228155540" "228155540" "subst" "0" "00687" "COL4A3_000061" "g.228155540C>T" "" "{PMID:Heidet 2001:11134255}" "" "" "" "Germline" "" "" "0" "" "" "g.227290824C>T" "" "pathogenic" "" "0000149949" "0" "97" "2" "228155601" "228155601" "dup" "0" "00687" "COL4A3_000062" "g.228155601dup" "" "{PMID:Longo 2002:12028435}" "" "c.3209insA" "" "Germline" "" "" "0" "" "" "g.227290885dup" "" "pathogenic" "" "0000149950" "0" "70" "2" "228168608" "228168608" "subst" "6.09573E-5" "00687" "COL4A3_000087" "g.228168608T>C" "" "{PMID:Heidet 2001:11134255}" "" "" "" "Germline" "" "" "0" "" "" "g.227303892T>C" "" "likely pathogenic" "" "0000149951" "0" "97" "2" "228172614" "228172614" "subst" "0" "00687" "COL4A3_000097" "g.228172614C>T" "" "{PMID:Tazon Vega 2003:14582039}" "" "" "" "Germline" "" "" "0" "" "" "g.227307898C>T" "" "pathogenic" "" "0000149952" "0" "97" "2" "228173723" "228173723" "subst" "0" "00687" "COL4A3_000106" "g.228173723C>G" "" "{PMID:Lemmink 1994:07987301}" "" "" "" "Germline" "" "" "0" "" "" "g.227309007C>G" "" "pathogenic" "" "0000149953" "0" "97" "2" "228173940" "228173940" "subst" "0" "00687" "COL4A3_000108" "g.228173940G>T" "" "{PMID:Knebelman 1995:07633417}" "" "" "Variant Error [EREF/EINVALIDBOUNDARY]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.227309224G>T" "" "pathogenic" "" "0000149954" "0" "97" "2" "228173940" "228173940" "subst" "0" "00687" "COL4A3_000108" "g.228173940G>T" "" "{PMID:Knebelman 1995:07633417}" "" "" "Variant Error [EREF/EINVALIDBOUNDARY]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.227309224G>T" "" "pathogenic" "" "0000149955" "21" "90" "2" "228142227" "228142227" "subst" "0.000106774" "01545" "COL4A3_000044" "g.228142227G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227277511G>A" "" "pathogenic" "" "0000149956" "0" "90" "2" "228142227" "228142227" "subst" "0.000106774" "01545" "COL4A3_000044" "g.228142227G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227277511G>A" "" "pathogenic" "" "0000149957" "0" "90" "2" "228145177" "228145177" "subst" "0" "01545" "COL4A3_000223" "g.228145177G>A" "" "" "" "" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.227280461G>A" "" "pathogenic" "" "0000149958" "21" "70" "2" "228118856" "228118856" "subst" "0" "00466" "COL4A3_000226" "g.228118856G>A" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227254140G>A" "" "likely pathogenic" "" "0000149959" "11" "90" "2" "228141110" "228141110" "dup" "0" "00466" "COL4A3_000227" "g.228141110dup" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227276394dup" "" "pathogenic" "" "0000149960" "0" "90" "2" "228118302" "228118302" "del" "0" "00466" "COL4A3_000229" "g.228118302del" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227253586del" "" "pathogenic" "" "0000149961" "11" "90" "2" "228124564" "228124564" "del" "0" "00466" "COL4A3_000230" "g.228124564del" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227259848del" "" "pathogenic" "" "0000149962" "0" "90" "2" "228142175" "228142182" "dup" "0" "00466" "COL4A3_000232" "g.228142175_228142182dup" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227277459_227277466dup" "" "pathogenic" "" "0000149963" "0" "90" "2" "228142175" "228142182" "dup" "0" "00466" "COL4A3_000232" "g.228142175_228142182dup" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227277459_227277466dup" "" "pathogenic" "" "0000149964" "11" "70" "2" "228145686" "228145686" "subst" "0" "00466" "COL4A3_000235" "g.228145686G>A" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227280970G>A" "" "likely pathogenic" "" "0000149965" "20" "70" "2" "228147159" "228147159" "subst" "0" "00466" "COL4A3_000236" "g.228147159G>A" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227282443G>A" "" "likely pathogenic" "" "0000149966" "0" "90" "2" "228163512" "228163512" "del" "0" "00466" "COL4A3_000238" "g.228163512del" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227298796del" "" "pathogenic" "" "0000149967" "21" "90" "2" "228148571" "228148579" "del" "0" "00466" "COL4A3_000239" "g.228148571_228148579del" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227283855_227283863del" "" "pathogenic" "" "0000149968" "11" "90" "2" "228148948" "228148958" "del" "0" "00466" "COL4A3_000240" "g.228148948_228148958del" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227284232_227284242del" "" "pathogenic" "" "0000149969" "0" "90" "2" "228148948" "228148958" "del" "0" "00466" "COL4A3_000240" "g.228148948_228148958del" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227284232_227284242del" "" "pathogenic" "" "0000149970" "21" "70" "2" "228159733" "228159733" "subst" "0" "00466" "COL4A3_000233" "g.228159733G>C" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227295017G>C" "" "likely pathogenic" "" "0000149971" "10" "90" "2" "228168737" "228168737" "del" "0" "00466" "COL4A3_000244" "g.228168737del" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227304021del" "" "pathogenic" "" "0000149972" "20" "90" "2" "228172520" "228172526" "del" "0" "00466" "COL4A3_000245" "g.228172520_228172526del" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227307804_227307810del" "" "pathogenic" "" "0000149973" "2" "70" "2" "228145245" "228145262" "del" "0" "00466" "COL4A3_000247" "g.228145245_228145262del" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227280529_227280546del" "" "likely pathogenic" "" "0000149974" "0" "90" "2" "228111404" "228111404" "subst" "8.13378E-6" "00466" "COL4A3_000248" "g.228111404G>T" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227246688G>T" "" "pathogenic" "" "0000149975" "0" "70" "2" "228113236" "228113236" "subst" "0" "00466" "COL4A3_000249" "g.228113236G>T" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227248520G>T" "" "likely pathogenic" "" "0000149976" "20" "90" "2" "228148948" "228148958" "del" "0" "00466" "COL4A3_000240" "g.228148948_228148958del" "" "{PMID:Storey 2013:24052634}" "" "" "" "Germline" "" "" "0" "" "" "g.227284232_227284242del" "" "pathogenic" "" "0000149981" "2" "90" "2" "228159751" "228159751" "subst" "0" "01548" "COL4A3_000348" "g.228159751G>T" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227295035G>T" "" "pathogenic" "" "0000169201" "0" "70" "2" "228172593" "228172597" "del" "0" "00587" "COL4A3_000095" "g.228172593_228172597del" "" "{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}" "" "NM_000091.3(COL4A3):c.4420_4424del p.(Leu1474Cysfs*34)" "variant could not be associated with disease phenotype" "Germline" "" "" "0" "" "" "g.227307877_227307881del" "" "likely pathogenic" "" "0000248998" "0" "10" "2" "228113175" "228113175" "subst" "0.834079" "02325" "COL4A3_000015" "g.228113175A>G" "" "" "" "COL4A3(NM_000091.5):c.485A>G (p.E162G), MFF-DT(NR_102371.1):n.1593-10285T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227248459A>G" "" "benign" "" "0000251007" "0" "10" "2" "228173986" "228173986" "subst" "0.000897739" "02326" "COL4A3_000218" "g.228173986A>T" "" "" "" "COL4A3(NM_000091.4):c.4707A>T (p.P1569=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227309270A>T" "" "benign" "" "0000251080" "0" "10" "2" "228131169" "228131169" "subst" "0.09636" "02326" "COL4A3_000028" "g.228131169A>G" "" "" "" "COL4A3(NM_000091.4):c.1352A>G (p.H451R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227266453A>G" "" "benign" "" "0000251109" "0" "10" "2" "228147093" "228147093" "subst" "0.0119505" "02326" "COL4A3_000050" "g.228147093A>G" "" "" "" "COL4A3(NM_000091.4):c.2501A>G (p.K834R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227282377A>G" "" "benign" "" "0000251283" "0" "10" "2" "228115847" "228115847" "subst" "0.0431689" "02326" "COL4A3_000405" "g.228115847A>C" "" "" "" "COL4A3(NM_000091.4):c.547-9A>C, COL4A3(NM_000091.5):c.547-9A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227251131A>C" "" "benign" "" "0000251284" "0" "10" "2" "228148385" "228148385" "subst" "0" "02326" "COL4A3_000418" "g.228148385A>G" "" "" "" "COL4A3(NM_000091.4):c.2657-98A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227283669A>G" "" "benign" "" "0000251285" "0" "10" "2" "228175425" "228175425" "del" "0" "02326" "COL4A3_000430" "g.228175425del" "" "" "" "COL4A3(NM_000091.4):c.4756-67delA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227310709del" "" "benign" "" "0000254897" "0" "30" "2" "228173636" "228173636" "subst" "0.00625315" "01943" "COL4A3_000100" "g.228173636A>G" "" "" "" "COL4A3(NM_000091.4):c.4484A>G (p.Q1495R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227308920A>G" "" "likely benign" "" "0000256365" "0" "50" "2" "228173675" "228173675" "subst" "0.000215377" "01943" "COL4A3_000595" "g.228173675A>G" "" "" "" "COL4A3(NM_000091.4):c.4523A>G (p.N1508S, p.(Asn1508Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227308959A>G" "" "VUS" "" "0000256456" "0" "50" "2" "228116076" "228116076" "subst" "0" "01943" "COL4A3_000406" "g.228116076A>G" "" "" "" "COL4A3(NM_000091.4):c.634A>G (p.R212G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227251360A>G" "" "VUS" "" "0000266978" "0" "10" "2" "228128540" "228128540" "subst" "0.767892" "02325" "COL4A3_000023" "g.228128540C>T" "" "" "" "COL4A3(NM_000091.5):c.1195C>T (p.L399=), MFF-DT(NR_102371.1):n.1486+845G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227263824C>T" "" "benign" "" "0000266981" "0" "10" "2" "228159675" "228159676" "del" "0" "02325" "COL4A3_000425" "g.228159675_228159676del" "" "" "" "COL4A3(NM_000091.4):c.3419-5_3419-4delTT, COL4A3(NM_000091.5):c.3419-5_3419-4delTT, MFF-DT(NR_102371.1):n.243+10514_243+10515delAA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227294959_227294960del" "" "benign" "" "0000270383" "0" "10" "2" "228125778" "228125778" "subst" "0.00863247" "02326" "COL4A3_000410" "g.228125778T>C" "" "" "" "COL4A3(NM_000091.4):c.1115-20T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227261062T>C" "" "benign" "" "0000270384" "0" "10" "2" "228102723" "228102723" "subst" "0.284083" "02326" "COL4A3_000005" "g.228102723G>C" "" "" "" "COL4A3(NM_000091.4):c.127G>C (p.G43R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227238007G>C" "" "benign" "" "0000270385" "0" "10" "2" "228142111" "228142111" "subst" "0" "02326" "COL4A3_000412" "g.228142111T>C" "" "" "" "COL4A3(NM_000091.4):c.2021-54T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227277395T>C" "" "benign" "" "0000270387" "0" "10" "2" "228147016" "228147017" "del" "0" "02326" "COL4A3_000417" "g.228147016_228147017del" "" "" "" "COL4A3(NM_000091.4):c.2489-65_2489-64delAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227282300_227282301del" "" "benign" "" "0000270388" "0" "10" "2" "228147014" "228147017" "del" "0" "02326" "COL4A3_000415" "g.228147014_228147017del" "" "" "" "COL4A3(NM_000091.4):c.2489-67_2489-64delATAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227282298_227282301del" "" "benign" "" "0000270389" "0" "10" "2" "228147012" "228147017" "del" "0" "02326" "COL4A3_000414" "g.228147012_228147017del" "" "" "" "COL4A3(NM_000091.4):c.2489-69_2489-64delATATAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227282296_227282301del" "" "benign" "" "0000270390" "0" "10" "2" "228146991" "228146992" "ins" "0" "02326" "COL4A3_000413" "g.228146991_228146992insTAT" "" "" "" "COL4A3(NM_000091.4):c.2489-89_2489-84delATATATinsTATATATAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227282275_227282276insTAT" "" "benign" "" "0000270391" "0" "10" "2" "228148541" "228148541" "subst" "0.0044196" "02326" "COL4A3_000197" "g.228148541C>T" "" "" "" "COL4A3(NM_000091.4):c.2715C>T (p.P905=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227283825C>T" "" "benign" "" "0000270392" "0" "70" "2" "228149061" "228149061" "subst" "0" "02326" "COL4A3_000420" "g.228149061G>C" "" "" "" "COL4A3(NM_000091.4):c.2881G>C (p.G961R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227284345G>C" "" "likely pathogenic" "" "0000270393" "0" "70" "2" "228153946" "228153946" "subst" "4.07697E-6" "02326" "COL4A3_000421" "g.228153946G>A" "" "" "" "COL4A3(NM_000091.4):c.2962G>A (p.G988R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227289230G>A" "" "likely pathogenic" "" "0000270394" "0" "10" "2" "228110643" "228110643" "subst" "0.0429124" "02326" "COL4A3_000403" "g.228110643C>T" "" "" "" "COL4A3(NM_000091.4):c.325-27C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227245927C>T" "" "benign" "" "0000270395" "0" "10" "2" "228158021" "228158021" "subst" "0.00431634" "02326" "COL4A3_000065" "g.228158021C>T" "" "" "" "COL4A3(NM_000091.4):c.3325C>T (p.P1109S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227293305C>T" "" "benign" "" "0000270396" "0" "10" "2" "228159666" "228159666" "subst" "0" "02326" "COL4A3_000424" "g.228159666T>G" "" "" "" "COL4A3(NM_000091.4):c.3419-14T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227294950T>G" "" "benign" "" "0000270397" "0" "10" "2" "228159676" "228159676" "del" "0" "02326" "COL4A3_000423" "g.228159676del" "" "" "" "COL4A3(NM_000091.4):c.3419-4delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227294960del" "" "benign" "" "0000270398" "0" "10" "2" "228159943" "228159943" "subst" "0.0022035" "02326" "COL4A3_000427" "g.228159943G>A" "" "" "" "COL4A3(NM_000091.4):c.3518-42G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227295227G>A" "" "benign" "" "0000270399" "0" "10" "2" "228162641" "228162641" "subst" "0" "02326" "COL4A3_000082" "g.228162641C>T" "" "" "" "COL4A3(NM_000091.4):c.3751+66C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227297925C>T" "" "benign" "" "0000270400" "0" "10" "2" "228163453" "228163453" "subst" "0.0450209" "02326" "COL4A3_000084" "g.228163453C>A" "" "" "" "COL4A3(NM_000091.4):c.3807C>A (p.(Asp1269Glu), p.D1269E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227298737C>A" "" "benign" "" "0000270401" "0" "10" "2" "228167669" "228167669" "subst" "0" "02326" "COL4A3_000428" "g.228167669C>T" "" "" "" "COL4A3(NM_000091.4):c.3883-85C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227302953C>T" "" "benign" "" "0000270402" "0" "10" "2" "228169955" "228169955" "subst" "0" "02326" "COL4A3_000429" "g.228169955G>A" "" "" "" "COL4A3(NM_000091.4):c.4252+156G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227305239G>A" "" "benign" "" "0000270403" "0" "10" "2" "228113106" "228113106" "subst" "0.0427385" "02326" "COL4A3_000404" "g.228113106G>T" "" "" "" "COL4A3(NM_000091.4):c.469-53G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227248390G>T" "" "benign" "" "0000270404" "0" "10" "2" "228118122" "228118122" "subst" "0.00799239" "02326" "COL4A3_000407" "g.228118122G>A" "" "" "" "COL4A3(NM_000091.4):c.687+69G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227253406G>A" "" "benign" "" "0000270405" "0" "90" "2" "228118314" "228118314" "subst" "0" "02326" "COL4A3_000408" "g.228118314G>A" "" "" "" "COL4A3(NM_000091.4):c.725G>A (p.G242E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227253598G>A" "" "pathogenic" "" "0000270406" "0" "10" "2" "228102680" "228102680" "subst" "0.0170294" "02326" "COL4A3_000402" "g.228102680C>T" "" "" "" "COL4A3(NM_000091.4):c.88-4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227237964C>T" "" "benign" "" "0000270407" "0" "10" "2" "228122239" "228122239" "subst" "0" "02326" "COL4A3_000409" "g.228122239T>C" "" "" "" "COL4A3(NM_000091.4):c.988-80T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227257523T>C" "" "benign" "" "0000274179" "0" "30" "2" "228141094" "228141094" "subst" "0" "01943" "COL4A3_000411" "g.228141094C>T" "" "" "" "COL4A3(NM_000091.4):c.1928-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227276378C>T" "" "likely benign" "" "0000274180" "0" "30" "2" "228104936" "228104936" "subst" "0.00165397" "01943" "COL4A3_000007" "g.228104936G>T" "" "" "" "COL4A3(NM_000091.4):c.222G>T (p.P74=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227240220G>T" "" "likely benign" "" "0000274181" "0" "50" "2" "228149028" "228149028" "subst" "0.000236062" "01943" "COL4A3_000419" "g.228149028G>A" "" "" "" "COL4A3(NM_000091.4):c.2848G>A (p.V950I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227284312G>A" "" "VUS" "" "0000274182" "0" "50" "2" "228155573" "228155573" "subst" "4.07571E-6" "01943" "COL4A3_000422" "g.228155573G>T" "" "" "" "COL4A3(NM_000091.4):c.3181G>T (p.G1061C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227290857G>T" "" "VUS" "" "0000274183" "0" "30" "2" "228157954" "228157954" "subst" "0.00431364" "01943" "COL4A3_000203" "g.228157954G>A" "" "" "" "COL4A3(NM_000091.4):c.3258G>A (p.G1086=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227293238G>A" "" "likely benign" "" "0000274184" "0" "30" "2" "228159677" "228159677" "del" "7.50482E-5" "01943" "COL4A3_000426" "g.228159677del" "" "" "" "COL4A3(NM_000091.4):c.3419-3delC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227294961del" "" "likely benign" "" "0000274185" "0" "30" "2" "228172594" "228172594" "subst" "0.00270685" "01943" "COL4A3_000093" "g.228172594T>C" "" "" "" "COL4A3(NM_000091.4):c.4421T>C (p.L1474P, p.(Leu1474Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227307878T>C" "" "likely benign" "" "0000274186" "0" "30" "2" "228173646" "228173646" "subst" "0.000581339" "01943" "COL4A3_000336" "g.228173646C>G" "" "" "" "COL4A3(NM_000091.4):c.4494C>G (p.T1498=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227308930C>G" "" "likely benign" "" "0000274187" "0" "30" "2" "228175629" "228175629" "subst" "0.00322998" "01943" "COL4A3_000220" "g.228175629C>T" "" "" "" "COL4A3(NM_000091.4):c.4893C>T (p.F1631=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227310913C>T" "" "likely benign" "" "0000282272" "0" "10" "2" "228111435" "228111435" "subst" "0.833927" "02325" "COL4A3_000012" "g.228111435T>C" "" "" "" "COL4A3(NM_000091.5):c.422T>C (p.L141P), MFF-DT(NR_102371.1):n.1593-8545A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227246719T>C" "" "benign" "" "0000282273" "0" "10" "2" "228102752" "228102752" "subst" "0.309262" "02325" "COL4A3_000006" "g.228102752C>A" "" "" "" "COL4A3(NM_000091.5):c.144+12C>A, MFF-DT(NR_102371.1):n.1681+50G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227238036C>A" "" "benign" "" "0000282274" "0" "10" "2" "228135631" "228135631" "subst" "0.469174" "02325" "COL4A3_000038" "g.228135631C>T" "" "" "" "COL4A3(NM_000091.5):c.1721C>T (p.P574L), MFF-DT(NR_102371.1):n.423-2146G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227270915C>T" "" "benign" "" "0000339696" "0" "10" "2" "228128540" "228128540" "subst" "0.767892" "02327" "COL4A3_000023" "g.228128540C>T" "" "" "" "COL4A3(NM_000091.5):c.1195C>T (p.L399=), MFF-DT(NR_102371.1):n.1486+845G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227263824C>T" "" "benign" "" "0000341794" "0" "90" "2" "228162467" "228162467" "subst" "0" "02327" "COL4A3_000077" "g.228162467C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227297751C>T" "" "pathogenic" "" "0000342041" "0" "70" "2" "228176554" "228176554" "subst" "0.000365663" "02327" "COL4A3_000110" "g.228176554C>T" "" "" "" "COL4A3(NM_000091.4):c.4981C>T (p.(Arg1661Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227311838C>T" "" "likely pathogenic" "" "0000345630" "0" "50" "2" "228155544" "228155544" "subst" "4.06497E-6" "02327" "COL4A3_000436" "g.228155544G>C" "" "" "" "COL4A3(NM_000091.4):c.3152G>C (p.G1051A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227290828G>C" "" "VUS" "" "0000346162" "0" "70" "2" "228135589" "228135589" "subst" "0" "02327" "COL4A3_000431" "g.228135589G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227270873G>T" "" "likely pathogenic" "" "0000346191" "0" "70" "2" "228137746" "228137746" "subst" "0" "02327" "COL4A3_000432" "g.228137746G>A" "" "" "" "COL4A3(NM_000091.4):c.1840G>A (p.G614R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227273030G>A" "" "likely pathogenic" "" "0000346263" "0" "50" "2" "228145207" "228145207" "subst" "0" "02327" "COL4A3_000433" "g.228145207G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227280491G>C" "" "VUS" "" "0000346280" "0" "50" "2" "228145668" "228145668" "subst" "0" "02327" "COL4A3_000434" "g.228145668G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227280952G>A" "" "VUS" "" "0000346328" "0" "50" "2" "228148981" "228148981" "subst" "0" "02327" "COL4A3_000435" "g.228148981G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227284265G>A" "" "VUS" "" "0000348749" "0" "50" "2" "228175508" "228175508" "subst" "4.87559E-5" "02327" "COL4A3_000437" "g.228175508C>T" "" "" "" "COL4A3(NM_000091.5):c.4772C>T (p.(Ser1591Phe), p.S1591F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.227310792C>T" "" "VUS" "" "0000352765" "0" "90" "2" "228135496" "228135496" "subst" "0" "02367" "COL4A3_000440" "g.228135496G>A" "" "" "" "" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.227270780G>A" "" "pathogenic" "" "0000352766" "0" "90" "2" "228135487" "228135487" "subst" "0" "02367" "COL4A3_000438" "g.228135487G>T" "" "" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.227270771G>T" "" "pathogenic" "" "0000352768" "0" "90" "2" "228135643" "228135643" "subst" "0" "02367" "COL4A3_000439" "g.228135643G>T" "" "" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.227270927G>T" "" "pathogenic" "" "0000353641" "3" "90" "2" "228111428" "228111428" "subst" "0" "02367" "COL4A3_000441" "g.228111428G>C" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.227246712G>C" "" "pathogenic" "" "0000353651" "10" "90" "2" "228137798" "228137798" "subst" "0" "02367" "COL4A3_000443" "g.228137798G>T" "" "" "" "" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.227273082G>T" "" "pathogenic" "" "0000353652" "21" "90" "2" "228135643" "228135643" "subst" "0" "02367" "COL4A3_000439" "g.228135643G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.227270927G>T" "" "pathogenic" "" "0000353666" "0" "90" "2" "228162432" "228162432" "del" "0" "02367" "COL4A3_000444" "g.228162432del" "" "" "" "" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.227297716del" "" "pathogenic" "" "0000353673" "0" "90" "2" "228124594" "228124594" "subst" "0" "02367" "COL4A3_000442" "g.228124594G>A" "" "" "" "" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.227259878G>A" "" "pathogenic" "" "0000353743" "1" "90" "2" "228131185" "228131185" "subst" "0" "00687" "COL4A3_000289" "g.228131185T>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227266469T>A" "" "pathogenic" "" "0000353748" "1" "50" "2" "228118049" "228118049" "subst" "0" "00687" "COL4A3_000477" "g.228118049A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227253333A>G" "" "VUS" "" "0000353749" "1" "70" "2" "228145686" "228145686" "subst" "0" "00687" "COL4A3_000235" "g.228145686G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280970G>A" "" "likely pathogenic" "" "0000353750" "1" "70" "2" "228113210" "228113210" "subst" "4.06521E-6" "00687" "COL4A3_000472" "g.228113210G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227248494G>A" "" "likely pathogenic" "" "0000353753" "1" "50" "2" "228119363" "228119363" "subst" "0" "00687" "COL4A3_000482" "g.228119363T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227254647T>G" "" "VUS" "" "0000353756" "1" "70" "2" "228137729" "228137729" "subst" "0" "00687" "COL4A3_000519" "g.228137729G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227273013G>T" "" "likely pathogenic" "" "0000353757" "1" "90" "2" "228148948" "228148958" "del" "0" "00687" "COL4A3_000240" "g.228148948_228148958del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227284232_227284242del" "" "pathogenic" "" "0000353760" "1" "70" "2" "228145686" "228145686" "subst" "0" "00687" "COL4A3_000235" "g.228145686G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280970G>A" "" "likely pathogenic" "" "0000353761" "1" "70" "2" "228163406" "228163406" "subst" "4.0622E-6" "00687" "COL4A3_000241" "g.228163406G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227298690G>C" "" "likely pathogenic" "" "0000353762" "1" "70" "2" "228120770" "228120770" "subst" "0" "00687" "COL4A3_000485" "g.228120770G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227256054G>T" "" "likely pathogenic" "" "0000353769" "1" "90" "2" "228157906" "228163529" "del" "0" "00687" "COL4A3_000447" "g.(228155603_228157906)_(228163529_228167753)del" "" "" "" "ex 38-43del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000353776" "3" "70" "2" "228145686" "228145686" "subst" "0" "00687" "COL4A3_000235" "g.228145686G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280970G>A" "" "likely pathogenic" "" "0000353777" "3" "70" "2" "228147159" "228147159" "subst" "0" "00687" "COL4A3_000236" "g.228147159G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227282443G>A" "" "likely pathogenic" "" "0000353779" "1" "70" "2" "228145686" "228145686" "subst" "0" "00687" "COL4A3_000235" "g.228145686G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280970G>A" "" "likely pathogenic" "" "0000353780" "1" "70" "2" "228142227" "228142227" "subst" "0.000106774" "00687" "COL4A3_000044" "g.228142227G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227277511G>A" "" "likely pathogenic" "" "0000353784" "1" "70" "2" "228175589" "228175589" "subst" "0" "00687" "COL4A3_000602" "g.228175589G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227310873G>T" "" "likely pathogenic" "" "0000353785" "1" "50" "2" "228154783" "228154783" "subst" "0" "00687" "COL4A3_000556" "g.228154783A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227290067A>G" "" "VUS" "" "0000353788" "1" "90" "2" "228029482" "228029505" "del" "0" "00687" "COL4A3_000003" "g.228029482_228029505del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227164766_227164789del" "" "pathogenic" "" "0000353790" "1" "70" "2" "228135523" "228135523" "subst" "0" "00687" "COL4A3_000513" "g.228135523G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227270807G>C" "" "likely pathogenic" "" "0000353793" "1" "70" "2" "228162390" "228162390" "subst" "0" "00687" "COL4A3_000570" "g.228162390G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227297674G>A" "" "likely pathogenic" "" "0000353801" "1" "70" "2" "228145686" "228145686" "subst" "0" "00687" "COL4A3_000235" "g.228145686G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280970G>A" "" "likely pathogenic" "" "0000353803" "1" "70" "2" "228159733" "228159733" "subst" "0" "00687" "COL4A3_000233" "g.228159733G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227295017G>C" "" "likely pathogenic" "" "0000353804" "1" "70" "2" "228163406" "228163406" "subst" "4.0622E-6" "00687" "COL4A3_000241" "g.228163406G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227298690G>C" "" "likely pathogenic" "" "0000353807" "1" "90" "2" "228112294" "228112301" "del" "0" "00687" "COL4A3_000471" "g.228112294_228112301del" "" "" "" "462_468+1delACAAAAGG" "" "Germline" "" "" "0" "" "" "g.227247578_227247585del" "" "pathogenic" "" "0000353809" "1" "70" "2" "228160013" "228160015" "dup" "0" "00687" "COL4A3_000568" "g.228160013_228160015dup" "" "" "" "3546_3548dupAGG" "" "Germline" "" "" "0" "" "" "g.227295297_227295299dup" "" "likely pathogenic" "" "0000353810" "1" "00" "2" "228131787" "228131787" "subst" "0" "00687" "COL4A3_000503" "g.228131787G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227267071G>A" "" "VUS" "" "0000353811" "1" "70" "2" "228128529" "228128529" "subst" "0" "00687" "COL4A3_000495" "g.228128529G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227263813G>A" "" "likely pathogenic" "" "0000353816" "1" "70" "2" "228162398" "228162398" "subst" "0" "00687" "COL4A3_000571" "g.228162398G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227297682G>C" "" "likely pathogenic" "" "0000353820" "1" "70" "2" "228135496" "228135496" "subst" "0" "00687" "COL4A3_000512" "g.228135496G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227270780G>T" "" "likely pathogenic" "" "0000353828" "1" "70" "2" "228109666" "228112301" "dup" "0" "00687" "COL4A3_000450" "g.(228109081_228109666)_(228112301_228113158)dup" "" "" "" "ex5-8 dup" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000353829" "1" "50" "2" "228125838" "228125838" "subst" "0" "00687" "COL4A3_000494" "g.228125838G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227261122G>A" "" "VUS" "" "0000353831" "1" "70" "2" "228145255" "228145272" "del" "0" "00687" "COL4A3_000532" "g.228145255_228145272del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280539_227280556del" "" "likely pathogenic" "" "0000353832" "1" "50" "2" "228135663" "228135663" "subst" "0" "00687" "COL4A3_000517" "g.228135663G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227270947G>C" "" "VUS" "" "0000353833" "3" "70" "2" "228144562" "228144562" "subst" "0" "00687" "COL4A3_000529" "g.228144562G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227279846G>A" "" "likely pathogenic" "" "0000353842" "1" "70" "2" "228145686" "228145686" "subst" "0" "00687" "COL4A3_000235" "g.228145686G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280970G>A" "" "likely pathogenic" "" "0000353848" "1" "70" "2" "228145686" "228145686" "subst" "0" "00687" "COL4A3_000235" "g.228145686G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280970G>A" "" "likely pathogenic" "" "0000353851" "1" "90" "2" "228135669" "228135669" "subst" "0" "00687" "COL4A3_000518" "g.228135669G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227270953G>T" "" "pathogenic" "" "0000353853" "1" "70" "2" "228163406" "228163406" "subst" "4.0622E-6" "00687" "COL4A3_000241" "g.228163406G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227298690G>C" "" "likely pathogenic" "" "0000353855" "1" "70" "2" "228145714" "228145714" "subst" "0" "00687" "COL4A3_000541" "g.228145714G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280998G>A" "" "likely pathogenic" "" "0000353871" "1" "70" "2" "228159760" "228159760" "subst" "8.12493E-6" "00687" "COL4A3_000067" "g.228159760G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227295044G>A" "" "likely pathogenic" "" "0000353879" "1" "70" "2" "228163406" "228163406" "subst" "4.0622E-6" "00687" "COL4A3_000241" "g.228163406G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227298690G>C" "" "likely pathogenic" "" "0000353888" "1" "50" "2" "228128601" "228128601" "subst" "4.06253E-5" "00687" "COL4A3_000498" "g.228128601C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227263885C>A" "" "VUS" "" "0000353901" "1" "50" "2" "228029417" "228029417" "subst" "0.000181327" "00687" "COL4A3_000456" "g.228029417G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227164701G>T" "" "VUS" "" "0000353902" "1" "70" "2" "228145645" "228145645" "subst" "0" "00687" "COL4A3_000540" "g.228145645G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280929G>A" "" "likely pathogenic" "" "0000353907" "1" "70" "2" "228122337" "228122337" "subst" "0" "00687" "COL4A3_000490" "g.228122337G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227257621G>T" "" "likely pathogenic" "" "0000353910" "1" "70" "2" "228176554" "228176554" "subst" "0.000365663" "00687" "COL4A3_000110" "g.228176554C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227311838C>T" "" "likely pathogenic" "" "0000353912" "1" "50" "2" "228029485" "228029496" "del" "0" "00687" "COL4A3_000460" "g.228029485_228029496del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227164769_227164780del" "" "VUS" "" "0000353917" "1" "90" "2" "228172520" "228172526" "del" "0" "00687" "COL4A3_000245" "g.228172520_228172526del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227307804_227307810del" "" "pathogenic" "" "0000353919" "1" "70" "2" "228145306" "228145306" "subst" "0" "00687" "COL4A3_000535" "g.228145306G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280590G>A" "" "likely pathogenic" "" "0000353931" "1" "70" "2" "228120751" "228120751" "subst" "2.03178E-5" "00687" "COL4A3_000278" "g.228120751G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227256035G>A" "" "likely pathogenic" "" "0000353932" "1" "70" "2" "228145686" "228145686" "subst" "0" "00687" "COL4A3_000235" "g.228145686G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280970G>A" "" "likely pathogenic" "" "0000353935" "1" "70" "2" "228175539" "228175539" "del" "8.12704E-6" "00687" "COL4A3_000600" "g.228175539del" "" "" "" "4803delT" "" "Germline" "" "" "0" "" "" "g.227310823del" "" "likely pathogenic" "" "0000353936" "1" "70" "2" "228128660" "228128660" "subst" "0" "00687" "COL4A3_000027" "g.228128660G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227263944G>A" "" "likely pathogenic" "" "0000353940" "1" "70" "2" "228142227" "228142227" "subst" "0.000106774" "00687" "COL4A3_000044" "g.228142227G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227277511G>A" "" "likely pathogenic" "" "0000353942" "1" "70" "2" "228167826" "228167826" "subst" "0" "00687" "COL4A3_000583" "g.228167826G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227303110G>A" "" "likely pathogenic" "" "0000353951" "1" "70" "2" "228145686" "228145686" "subst" "0" "00687" "COL4A3_000235" "g.228145686G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280970G>A" "" "likely pathogenic" "" "0000353953" "1" "70" "2" "228128529" "228128529" "subst" "0" "00687" "COL4A3_000495" "g.228128529G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227263813G>A" "" "likely pathogenic" "" "0000353954" "1" "70" "2" "228125816" "228125816" "subst" "0" "00687" "COL4A3_000492" "g.228125816G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227261100G>A" "" "likely pathogenic" "" "0000353955" "1" "70" "2" "228134653" "228134653" "subst" "0" "00687" "COL4A3_000506" "g.228134653G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227269937G>A" "" "likely pathogenic" "" "0000353957" "1" "70" "2" "228137761" "228137761" "subst" "8.20863E-6" "00687" "COL4A3_000293" "g.228137761G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227273045G>A" "" "likely pathogenic" "" "0000353965" "1" "50" "2" "228029468" "228029468" "subst" "5.12698E-5" "00687" "COL4A3_000459" "g.228029468C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227164752C>T" "" "VUS" "" "0000353967" "1" "50" "2" "228154812" "228154812" "subst" "4.06303E-6" "00687" "COL4A3_000557" "g.228154812A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227290096A>G" "" "VUS" "" "0000353972" "1" "70" "2" "228159205" "228159287" "del" "0" "00687" "COL4A3_000448" "g.(228158034_228159205)_(228159287_228159679)del" "" "" "" "ex39 del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000353979" "1" "50" "2" "228167820" "228167820" "subst" "4.46766E-5" "00687" "COL4A3_000582" "g.228167820G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227303104G>A" "" "VUS" "" "0000353986" "1" "70" "2" "228147159" "228147159" "subst" "0" "00687" "COL4A3_000236" "g.228147159G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227282443G>A" "" "likely pathogenic" "" "0000353988" "1" "70" "2" "228172426" "228172426" "subst" "0" "00687" "COL4A3_000588" "g.228172426G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227307710G>A" "" "likely pathogenic" "" "0000353994" "1" "70" "2" "228145686" "228145686" "subst" "0" "00687" "COL4A3_000235" "g.228145686G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280970G>A" "" "likely pathogenic" "" "0000353995" "1" "50" "2" "228121132" "228121132" "subst" "0.00221356" "00687" "COL4A3_000487" "g.228121132C>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227256416C>G" "" "VUS" "" "0000354000" "1" "70" "2" "228118856" "228118856" "subst" "0" "00687" "COL4A3_000226" "g.228118856G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227254140G>A" "" "likely pathogenic" "" "0000354011" "1" "70" "2" "228162507" "228162507" "subst" "0" "00687" "COL4A3_000574" "g.228162507G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227297791G>A" "" "likely pathogenic" "" "0000354013" "1" "50" "2" "228173634" "228173634" "subst" "0.00037006" "00687" "COL4A3_000216" "g.228173634G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227308918G>A" "" "VUS" "" "0000354017" "1" "70" "2" "228162507" "228162507" "subst" "0" "00687" "COL4A3_000574" "g.228162507G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227297791G>A" "" "likely pathogenic" "" "0000354020" "1" "70" "2" "228173638" "228173638" "subst" "1.21983E-5" "00687" "COL4A3_000102" "g.228173638C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227308922C>T" "" "likely pathogenic" "" "0000354028" "1" "70" "2" "228118856" "228118856" "subst" "0" "00687" "COL4A3_000226" "g.228118856G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227254140G>A" "" "likely pathogenic" "" "0000354029" "1" "00" "2" "228029444" "228029444" "subst" "0" "00687" "COL4A3_000250" "g.228029444T>C" "" "{PMID:Uzak 2013:23297803}" "" "p.Met1Thr" "" "Germline" "" "" "0" "" "" "g.227164728T>C" "" "VUS" "" "0000354030" "1" "00" "2" "228029444" "228029444" "subst" "0" "00687" "COL4A3_000457" "g.228029444T>A" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "p.Met1Lys" "" "Germline" "" "" "0" "" "" "g.227164728T>A" "" "VUS" "" "0000354031" "1" "00" "2" "228029444" "228029444" "subst" "0" "00687" "COL4A3_000458" "g.228029444T>G" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "p.Met1Arg" "" "Germline" "" "" "0" "" "" "g.227164728T>G" "" "VUS" "" "0000354032" "1" "00" "2" "228029482" "228029505" "del" "0" "00687" "COL4A3_000003" "g.228029482_228029505del" "" "{PMID:Chatterjee 2013:24130771}, {DOI:Chatterjee 2013:10.1371/journal.pone.0076360}" "" "30_53del" "" "Germline" "" "" "0" "" "" "g.227164766_227164789del" "" "VUS" "" "0000354033" "1" "90" "2" "228029442" "228029530" "del" "0" "00687" "COL4A3_000446" "g.(?_228029442)_(228029530_228102683)del" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "del ex1" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000354034" "1" "90" "2" "228029482" "228029505" "del" "0" "00687" "COL4A3_000003" "g.228029482_228029505del" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227164766_227164789del" "" "pathogenic" "" "0000354035" "1" "90" "2" "228029482" "228029505" "del" "0" "00687" "COL4A3_000003" "g.228029482_228029505del" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227164766_227164789del" "" "pathogenic" "" "0000354036" "3" "90" "2" "228029482" "228029505" "del" "0" "00687" "COL4A3_000003" "g.228029482_228029505del" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227164766_227164789del" "" "pathogenic" "" "0000354037" "1" "00" "2" "228102684" "228174034" "dup" "0" "00687" "COL4A3_000461" "g.228102684_228174034dup" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "88-?_4755+?dup" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000354038" "1" "10" "2" "228102723" "228102723" "subst" "0.284083" "00687" "COL4A3_000005" "g.228102723G>C" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227238007G>C" "" "benign" "" "0000354039" "1" "00" "2" "228104874" "228104874" "subst" "0" "00687" "COL4A3_000463" "g.228104874A>G" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "Variant Error [EREF/EINVALIDBOUNDARY]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000354040" "1" "10" "2" "228102752" "228102752" "subst" "0.309262" "00687" "COL4A3_000006" "g.228102752C>A" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227238036C>A" "" "benign" "" "0000354041" "1" "00" "2" "228104859" "228104859" "subst" "0" "00687" "COL4A3_000462" "g.228104859G>C" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227240143G>C" "" "VUS" "" "0000354042" "1" "00" "2" "228104886" "228104886" "subst" "0" "00687" "COL4A3_000464" "g.228104886G>C" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227240170G>C" "" "VUS" "" "0000354043" "1" "00" "2" "228109073" "228109073" "subst" "0" "00687" "COL4A3_000465" "g.228109073G>T" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227244357G>T" "" "VUS" "" "0000354044" "1" "00" "2" "228110690" "228110690" "del" "0" "00687" "COL4A3_000467" "g.228110690del" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "c.345delG" "" "Germline" "" "" "0" "" "" "g.227245974del" "" "VUS" "" "0000354045" "1" "00" "2" "228110691" "228110691" "subst" "0.00485981" "00687" "COL4A3_000009" "g.228110691C>A" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227245975C>A" "" "VUS" "" "0000354046" "1" "00" "2" "228110690" "228110690" "del" "0" "00687" "COL4A3_000467" "g.228110690del" "" "{PMID:Rosado 2015:26277931}, {DOI:Rosado 2015:10.1159/000368519}" "" "345delG" "" "Germline" "" "" "0" "" "" "g.227245974del" "" "VUS" "" "0000354047" "1" "00" "2" "228111435" "228111435" "subst" "0.833927" "00687" "COL4A3_000012" "g.228111435T>C" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227246719T>C" "" "VUS" "" "0000354048" "1" "00" "2" "228111406" "228111406" "del" "0" "00687" "COL4A3_000468" "g.228111406del" "" "{PMID:Malone 2014:25229338}, {DOI:Malone 2014:10.1038/ki.2014.305}" "" "del393G" "" "Germline" "" "" "0" "" "" "g.227246690del" "" "VUS" "" "0000354049" "1" "00" "2" "228111445" "228111453" "delins" "0" "00687" "COL4A3_000469" "g.228111445_228111453delinsGATTA" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227246729_227246737delinsGATTA" "" "VUS" "" "0000354050" "1" "90" "2" "228111456" "228111456" "subst" "0" "00687" "COL4A3_000470" "g.228111456T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227246740T>C" "" "pathogenic" "" "0000354051" "1" "00" "2" "228112275" "228112275" "subst" "1.21862E-5" "00687" "COL4A3_000267" "g.228112275G>T" "" "{PMID:Malone 2014:25229338}, {DOI:Malone 2014:10.1038/ki.2014.305}" "" "" "" "Germline" "" "" "0" "" "" "g.227247559G>T" "" "VUS" "" "0000354052" "1" "30" "2" "228113175" "228113175" "subst" "0.834079" "00687" "COL4A3_000015" "g.228113175A>G" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227248459A>G" "" "likely benign" "" "0000354053" "1" "00" "2" "228113237" "228113237" "subst" "0" "00687" "COL4A3_000473" "g.228113237G>T" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227248521G>T" "" "VUS" "" "0000354054" "1" "30" "2" "228115847" "228115847" "subst" "0.0431689" "00687" "COL4A3_000405" "g.228115847A>C" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227251131A>C" "" "likely benign" "" "0000354055" "1" "90" "2" "228116052" "228116087" "del" "0" "00687" "COL4A3_000475" "g.228116052_228116087del" "" "" "" "ex 11del" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000354056" "1" "90" "2" "228116052" "228116087" "del" "0" "00687" "COL4A3_000475" "g.228116052_228116087del" "" "" "" "ex 11del" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000354057" "1" "00" "2" "228118278" "228118278" "subst" "0" "00687" "COL4A3_000478" "g.228118278G>A" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227253562G>A" "" "VUS" "" "0000354058" "1" "90" "2" "228118314" "228118314" "del" "0" "00687" "COL4A3_000479" "g.228118314del" "" "" "" "725delG" "" "Germline" "" "" "0" "" "" "g.227253598del" "" "pathogenic" "" "0000354059" "1" "00" "2" "228118840" "228118840" "subst" "0" "00687" "COL4A3_000480" "g.228118840G>T" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Germline" "" "" "0" "" "" "g.227254124G>T" "" "VUS" "" "0000354060" "1" "00" "2" "228118867" "228118867" "subst" "0" "00687" "COL4A3_000481" "g.228118867G>T" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227254151G>T" "" "VUS" "" "0000354061" "1" "90" "2" "228119381" "228119381" "subst" "0" "00687" "COL4A3_000483" "g.228119381G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227254665G>A" "" "pathogenic" "" "0000354062" "1" "00" "2" "228120742" "228124593" "del" "0" "00687" "COL4A3_000484" "g.228120742_228124593del" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "889-?_1114+?del" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000354063" "1" "00" "2" "228120751" "228120751" "subst" "2.03178E-5" "00687" "COL4A3_000278" "g.228120751G>A" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "Mother c.898g>a; p.Gly300Arg in COL4A3, with hematuria; father c.3452G>C; p.Gly1151Ala in COL4A4, with hematuria" "Germline" "" "" "0" "" "" "g.227256035G>A" "" "VUS" "" "0000354064" "1" "00" "2" "228120751" "228120751" "subst" "2.03178E-5" "00687" "COL4A3_000278" "g.228120751G>A" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227256035G>A" "" "VUS" "" "0000354065" "1" "00" "2" "228120751" "228120751" "subst" "2.03178E-5" "00687" "COL4A3_000278" "g.228120751G>A" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227256035G>A" "" "VUS" "" "0000354066" "1" "00" "2" "228121059" "228121059" "subst" "0" "00687" "COL4A3_000486" "g.228121059G>C" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227256343G>C" "" "VUS" "" "0000354067" "1" "30" "2" "228121101" "228121101" "subst" "0.168924" "00687" "COL4A3_000020" "g.228121101G>T" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227256385G>T" "" "likely benign" "" "0000354068" "1" "00" "2" "228122313" "228122313" "subst" "1.62567E-5" "00687" "COL4A3_000488" "g.228122313C>T" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227257597C>T" "" "VUS" "" "0000354069" "1" "00" "2" "228122337" "228122337" "subst" "0" "00687" "COL4A3_000490" "g.228122337G>T" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Germline" "" "" "0" "" "" "g.227257621G>T" "" "VUS" "" "0000354070" "1" "00" "2" "228124539" "228124539" "subst" "0" "00687" "COL4A3_000491" "g.228124539G>T" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227259823G>T" "" "VUS" "" "0000354071" "1" "00" "2" "0" "0" "subst" "0" "00687" "COL4A3_000493" "g.?" "" "{PMID:Adam 2014:24944784}, {DOI:Adam 2014:10.1093/ckj/sft144}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000354072" "1" "90" "2" "228128495" "228131805" "del" "0" "00687" "COL4A3_000451" "g.(228125834_228128495)_(228131805_228134625)del" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "1151-?_1504+?del" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000354073" "1" "90" "2" "228128561" "228128561" "subst" "1.62628E-5" "00687" "COL4A3_000024" "g.228128561C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227263845C>T" "" "pathogenic" "" "0000354074" "1" "90" "2" "228128564" "228128564" "subst" "0" "00687" "COL4A3_000025" "g.228128564G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227263848G>C" "" "pathogenic" "" "0000354075" "1" "00" "2" "228128564" "228128564" "subst" "0" "00687" "COL4A3_000496" "g.228128564G>T" "" "{PMID:Sirisena 2015:26194984}, {DOI:Sirisena 2015:10.1111/nep.12430}" "" "" "" "Germline" "" "" "0" "" "" "g.227263848G>T" "" "VUS" "" "0000354076" "1" "00" "2" "228128564" "228128564" "subst" "0" "00687" "COL4A3_000497" "g.228128564G>A" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227263848G>A" "" "VUS" "" "0000354077" "3" "50" "2" "228128633" "228128633" "subst" "0" "00687" "COL4A3_000499" "g.228128633G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227263917G>A" "" "VUS" "" "0000354078" "1" "00" "2" "228131171" "228131171" "subst" "4.06296E-6" "00687" "COL4A3_000501" "g.228131171G>A" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Germline" "" "" "0" "" "" "g.227266455G>A" "" "VUS" "" "0000354079" "1" "10" "2" "228131169" "228131169" "subst" "0.09636" "00687" "COL4A3_000028" "g.228131169A>G" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227266453A>G" "" "benign" "" "0000354080" "1" "90" "2" "228131171" "228131171" "subst" "4.06296E-6" "00687" "COL4A3_000501" "g.228131171G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227266455G>A" "" "pathogenic" "" "0000354081" "1" "00" "2" "228131171" "228131171" "subst" "4.06296E-6" "00687" "COL4A3_000501" "g.228131171G>A" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227266455G>A" "" "VUS" "" "0000354082" "1" "00" "2" "228131180" "228131180" "subst" "0" "00687" "COL4A3_000502" "g.228131180G>T" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227266464G>T" "" "VUS" "" "0000354083" "1" "00" "2" "228131171" "228131171" "subst" "4.06296E-6" "00687" "COL4A3_000501" "g.228131171G>A" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227266455G>A" "" "VUS" "" "0000354084" "1" "00" "2" "228131783" "228131783" "subst" "0.000706806" "00687" "COL4A3_000290" "g.228131783C>T" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227267067C>T" "" "VUS" "" "0000354085" "1" "00" "2" "228131805" "228131805" "subst" "0" "00687" "COL4A3_000504" "g.228131805G>A" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227267089G>A" "" "VUS" "" "0000354086" "1" "00" "2" "228131805" "228131805" "subst" "0" "00687" "COL4A3_000504" "g.228131805G>A" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227267089G>A" "" "VUS" "" "0000354087" "1" "00" "2" "228131805" "228131805" "subst" "0" "00687" "COL4A3_000504" "g.228131805G>A" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227267089G>A" "" "VUS" "" "0000354088" "1" "90" "2" "228134648" "228134648" "subst" "0" "00687" "COL4A3_000505" "g.228134648G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227269932G>C" "" "pathogenic" "" "0000354089" "1" "00" "2" "228134679" "228134679" "subst" "0" "00687" "COL4A3_000507" "g.228134679G>C" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227269963G>C" "" "VUS" "" "0000354090" "1" "00" "2" "228134679" "228134679" "subst" "0" "00687" "COL4A3_000507" "g.228134679G>C" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227269963G>C" "" "VUS" "" "0000354091" "1" "00" "2" "228134679" "228134679" "subst" "0" "00687" "COL4A3_000507" "g.228134679G>C" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227269963G>C" "" "VUS" "" "0000354092" "1" "00" "2" "228134680" "228134680" "subst" "0" "00687" "COL4A3_000508" "g.228134680G>A" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227269964G>A" "" "VUS" "" "0000354093" "1" "00" "2" "228135504" "228135504" "subst" "0" "00687" "COL4A3_000036" "g.228135504G>T" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227270788G>T" "" "VUS" "" "0000354094" "1" "00" "2" "228135597" "228135597" "subst" "0" "00687" "COL4A3_000514" "g.228135597G>A" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227270881G>A" "" "VUS" "" "0000354096" "1" "00" "2" "228135624" "228135624" "subst" "0" "00687" "COL4A3_000516" "g.228135624G>A" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Germline" "" "" "0" "" "" "g.227270908G>A" "" "VUS" "" "0000354097" "1" "10" "2" "228135631" "228135631" "subst" "0.469174" "00687" "COL4A3_000038" "g.228135631C>T" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227270915C>T" "" "benign" "" "0000354098" "3" "50" "2" "228137737" "228137737" "subst" "0" "00687" "COL4A3_000520" "g.228137737G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227273021G>A" "" "VUS" "" "0000354099" "1" "00" "2" "228137750" "228137750" "dup" "0" "00687" "COL4A3_000521" "g.228137750dup" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "1843insC" "" "Germline" "" "" "0" "" "" "g.227273034dup" "" "VUS" "" "0000354100" "1" "00" "2" "228137761" "228137761" "subst" "8.20863E-6" "00687" "COL4A3_000293" "g.228137761G>A" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227273045G>A" "" "VUS" "" "0000354101" "1" "00" "2" "228137798" "228137798" "subst" "0" "00687" "COL4A3_000443" "g.228137798G>T" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227273082G>T" "" "VUS" "" "0000354102" "3" "90" "2" "228137824" "228137824" "subst" "2.0616E-5" "00687" "COL4A3_000042" "g.228137824G>A" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227273108G>A" "" "VUS" "" "0000354103" "1" "90" "2" "228137833" "228137833" "subst" "8.26071E-6" "00687" "COL4A3_000297" "g.228137833G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227273117G>A" "" "pathogenic" "" "0000354104" "1" "90" "2" "228137833" "228137833" "subst" "8.26071E-6" "00687" "COL4A3_000297" "g.228137833G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227273117G>A" "" "pathogenic" "" "0000354105" "1" "90" "2" "228137833" "228137833" "subst" "8.26071E-6" "00687" "COL4A3_000297" "g.228137833G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227273117G>A" "" "pathogenic" "" "0000354106" "1" "90" "2" "228141149" "228141149" "subst" "0" "00687" "COL4A3_000522" "g.228141149G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227276433G>C" "" "pathogenic" "" "0000354107" "1" "00" "2" "228141157" "228141157" "subst" "0" "00687" "COL4A3_000523" "g.228141157G>A" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227276441G>A" "" "VUS" "" "0000354108" "1" "00" "2" "228141195" "228141195" "subst" "0" "00687" "COL4A3_000524" "g.228141195T>C" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227276479T>C" "" "VUS" "" "0000354109" "1" "90" "2" "228142164" "228142164" "subst" "0" "00687" "COL4A3_000525" "g.228142164G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227277448G>A" "" "pathogenic" "" "0000354110" "1" "00" "2" "228142227" "228142227" "subst" "0.000106774" "00687" "COL4A3_000044" "g.228142227G>A" "" "{PMID:Malone 2014:25229338}, {DOI:Malone 2014:10.1038/ki.2014.305}" "" "" "" "Germline" "" "" "0" "" "" "g.227277511G>A" "" "VUS" "" "0000354111" "1" "00" "2" "228142209" "228142209" "subst" "0" "00687" "COL4A3_000526" "g.228142209G>A" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227277493G>A" "" "VUS" "" "0000354112" "1" "00" "2" "228142209" "228142209" "subst" "0" "00687" "COL4A3_000526" "g.228142209G>A" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227277493G>A" "" "VUS" "" "0000354113" "1" "00" "2" "228142209" "228142209" "subst" "0" "00687" "COL4A3_000526" "g.228142209G>A" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227277493G>A" "" "VUS" "" "0000354114" "1" "00" "2" "228142269" "228142269" "subst" "0" "00687" "COL4A3_000527" "g.228142269G>T" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227277553G>T" "" "VUS" "" "0000354115" "3" "70" "2" "228144508" "228144508" "subst" "0" "00687" "COL4A3_000528" "g.228144508G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227279792G>C" "" "likely pathogenic" "" "0000354116" "1" "00" "2" "228144580" "228144580" "subst" "0" "00687" "COL4A3_000530" "g.228144580G>A" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227279864G>A" "" "VUS" "" "0000354117" "1" "00" "2" "0" "0" "subst" "0" "00687" "COL4A3_000531" "g.?" "" "{PMID:Lin 2014:25381091}, {DOI:Lin 2014:10.1186/1471-2369-15-175}" "" "" "c.G2290A (COL4A3 novel)+c.A1448G(FN1) digenic mutation," "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000354118" "1" "00" "2" "228145255" "228145272" "del" "0" "00687" "COL4A3_000532" "g.228145255_228145272del" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227280539_227280556del" "" "VUS" "" "0000354119" "1" "90" "2" "228145261" "228145261" "subst" "0" "00687" "COL4A3_000302" "g.228145261G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280545G>T" "" "pathogenic" "" "0000354120" "1" "00" "2" "228145262" "228145262" "subst" "0" "00687" "COL4A3_000305" "g.228145262G>A" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227280546G>A" "" "VUS" "" "0000354121" "1" "00" "2" "228145262" "228145262" "subst" "0" "00687" "COL4A3_000305" "g.228145262G>A" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227280546G>A" "" "VUS" "" "0000354122" "1" "00" "2" "228145262" "228145262" "subst" "0" "00687" "COL4A3_000305" "g.228145262G>A" "" "{PMID:Uchida 2016:27904025}, {DOI:Uchida 2016:10.1620/tjem.240.251}" "" "" "" "Germline" "" "" "0" "" "" "g.227280546G>A" "" "VUS" "" "0000354123" "1" "90" "2" "228145303" "228145303" "subst" "0" "00687" "COL4A3_000533" "g.228145303C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280587C>T" "" "pathogenic" "" "0000354124" "1" "00" "2" "228145609" "228147248" "del" "0" "00687" "COL4A3_000536" "g.228145609_228147248del" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "2375-?_2656+?del" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000354125" "1" "90" "2" "228145618" "228145618" "subst" "0" "00687" "COL4A3_000538" "g.228145618G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280902G>A" "" "pathogenic" "" "0000354126" "1" "10" "2" "228145613" "228145613" "subst" "0" "00687" "COL4A3_000537" "g.228145613T>C" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "benign" "" "0000354127" "1" "90" "2" "228145641" "228145641" "subst" "0" "00687" "COL4A3_000539" "g.228145641C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280925C>T" "" "pathogenic" "" "0000354128" "1" "00" "2" "228145686" "228145686" "subst" "0" "00687" "COL4A3_000235" "g.228145686G>A" "" "{PMID:Gast 201610.1093/ndt/gfv325}, {DOI:Gast 2016:10.1093/ndt/gfv325}" "" "" "" "Germline" "" "" "0" "" "" "g.227280970G>A" "" "VUS" "" "0000354129" "1" "00" "2" "228147081" "228147081" "subst" "0" "00687" "COL4A3_000542" "g.228147081G>A" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227282365G>A" "" "VUS" "" "0000354130" "1" "90" "2" "228147123" "228147123" "subst" "4.06147E-6" "00687" "COL4A3_000543" "g.228147123C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227282407C>T" "" "pathogenic" "" "0000354131" "1" "90" "2" "228148498" "228148498" "subst" "2.84296E-5" "00687" "COL4A3_000545" "g.228148498T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227283782T>C" "" "pathogenic" "" "0000354132" "1" "00" "2" "228148524" "228148540" "del" "0" "00687" "COL4A3_000546" "g.228148524_228148540del" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227283808_227283824del" "" "VUS" "" "0000354133" "1" "00" "2" "228148563" "228148563" "subst" "0" "00687" "COL4A3_000547" "g.228148563G>A" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227283847G>A" "" "VUS" "" "0000354134" "1" "00" "2" "228148573" "228148573" "subst" "0" "00687" "COL4A3_000548" "g.228148573G>T" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227283857G>T" "" "VUS" "" "0000354135" "1" "00" "2" "228148573" "228148573" "subst" "0" "00687" "COL4A3_000548" "g.228148573G>T" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227283857G>T" "" "VUS" "" "0000354136" "1" "00" "2" "228148948" "228148958" "del" "0" "00687" "COL4A3_000240" "g.228148948_228148958del" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227284232_227284242del" "" "VUS" "" "0000354137" "1" "00" "2" "228148977" "228148977" "subst" "0" "00687" "COL4A3_000549" "g.228148977A>G" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227284261A>G" "" "VUS" "" "0000354138" "1" "00" "2" "228149043" "228149043" "subst" "8.15574E-6" "00687" "COL4A3_000551" "g.228149043G>A" "" "{PMID:Imafuku 2017:28704582}, {DOI:Imafuku 2017:10.1111/nep.13115}" "" "" "" "Germline" "" "" "0" "" "" "g.227284327G>A" "" "VUS" "" "0000354139" "1" "90" "2" "228149062" "228149062" "subst" "0" "00687" "COL4A3_000552" "g.228149062G>A" "" "" "" "IVS34+1g>a" "" "Germline" "" "" "0" "" "" "g.227284346G>A" "" "pathogenic" "" "0000354140" "1" "90" "2" "228149062" "228149062" "subst" "0" "00687" "COL4A3_000552" "g.228149062G>A" "" "" "" "IVS34+1g>a" "" "Germline" "" "" "0" "" "" "g.227284346G>A" "" "pathogenic" "" "0000354141" "1" "00" "2" "228154639" "228154639" "subst" "0" "00687" "COL4A3_000554" "g.228154639C>T" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227289923C>T" "" "VUS" "" "0000354142" "1" "90" "2" "228154724" "228154724" "subst" "0" "00687" "COL4A3_000555" "g.228154724G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227290008G>A" "" "pathogenic" "" "0000354143" "1" "90" "2" "228154724" "228154724" "subst" "0" "00687" "COL4A3_000555" "g.228154724G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227290008G>A" "" "pathogenic" "" "0000354144" "1" "00" "2" "228154724" "228154724" "subst" "0" "00687" "COL4A3_000555" "g.228154724G>A" "" "{PMID:Liu 2017:28542346}, {DOI:Liu 201:/10.1371/journal.pone.0177685}" "" "" "Digenic mutations, both pathogenic, age at presentation 14" "Germline" "" "" "0" "" "" "g.227290008G>A" "" "VUS" "" "0000354145" "1" "00" "2" "228155507" "228155507" "subst" "0" "00687" "COL4A3_000558" "g.228155507G>C" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227290791G>C" "" "VUS" "" "0000354146" "1" "90" "2" "228155543" "228155543" "subst" "0" "00687" "COL4A3_000559" "g.228155543G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227290827G>A" "" "pathogenic" "" "0000354147" "1" "10" "2" "228158021" "228158021" "subst" "0.00431634" "00687" "COL4A3_000065" "g.228158021C>T" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227293305C>T" "" "benign" "" "0000354148" "1" "00" "2" "228157934" "228157934" "subst" "4.06161E-6" "00687" "COL4A3_000560" "g.228157934G>A" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227293218G>A" "" "VUS" "" "0000354149" "3" "90" "2" "228157962" "228157962" "subst" "0" "00687" "COL4A3_000452" "g.228157962G>A" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227293246G>A" "" "pathogenic" "" "0000354150" "1" "90" "2" "228159205" "228159205" "subst" "0" "00687" "COL4A3_000562" "g.228159205G>A" "" "" "" "IVS38-1g>a" "" "Germline" "" "" "0" "" "" "g.227294489G>A" "" "pathogenic" "" "0000354151" "1" "00" "2" "228157935" "228157935" "subst" "4.06161E-6" "00687" "COL4A3_000561" "g.228157935G>C" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Germline" "" "" "0" "" "" "g.227293219G>C" "" "VUS" "" "0000354152" "1" "00" "2" "228157962" "228157962" "subst" "0" "00687" "COL4A3_000452" "g.228157962G>A" "" "{PMID:Fu 2014:27081500}, {DOI:Fu 2014:10.1038/hgv.2014.6}" "" "" "Novel homozygous missense mutation in COL4A3, due to Uniparental disomy; plus maternal isodisomy of the telomeric end of chromosome 2q. Mother is a heterozygous carrier of mutation, and father had only wild-type. Semiquantitative PCR showed that the proband has two copies of maternal mutation." "Germline" "" "" "0" "" "" "g.227293246G>A" "" "VUS" "" "0000354153" "1" "00" "2" "228159725" "228159725" "subst" "0" "00687" "COL4A3_000566" "g.228159725G>A" "" "{PMID:Imafuku 2017:28704582}, {DOI:Imafuku 2017:10.1111/nep.13115}" "" "" "" "Germline" "" "" "0" "" "" "g.227295009G>A" "" "VUS" "" "0000354154" "1" "00" "2" "228159725" "228159725" "subst" "0" "00687" "COL4A3_000566" "g.228159725G>A" "" "{PMID:Imafuku 2017:28704582}, {DOI:Imafuku 2017:10.1111/nep.13115}" "" "" "" "Germline" "" "" "0" "" "" "g.227295009G>A" "" "VUS" "" "0000354155" "1" "00" "2" "228159715" "228159715" "subst" "0" "00687" "COL4A3_000564" "g.228159715G>C" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227294999G>C" "" "VUS" "" "0000354156" "1" "00" "2" "0" "0" "subst" "0" "00687" "COL4A3_000567" "g.?" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000354157" "1" "00" "2" "228159715" "228159715" "subst" "0" "00687" "COL4A3_000565" "g.228159715G>T" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227294999G>T" "" "VUS" "" "0000354158" "1" "00" "2" "228162389" "228162389" "subst" "0" "00687" "COL4A3_000569" "g.228162389G>A" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Germline" "" "" "0" "" "" "g.227297673G>A" "" "VUS" "" "0000354159" "1" "00" "2" "228162399" "228162399" "subst" "0" "00687" "COL4A3_000572" "g.228162399G>A" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227297683G>A" "" "VUS" "" "0000354160" "1" "00" "2" "228162498" "228162498" "subst" "0" "00687" "COL4A3_000573" "g.228162498G>T" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227297782G>T" "" "VUS" "" "0000354161" "1" "00" "2" "228162887" "228168402" "del" "0" "00687" "COL4A3_000576" "g.228162887_228168402del" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "del ex43-44" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000354162" "1" "90" "2" "228163415" "228163415" "subst" "0" "00687" "COL4A3_000577" "g.228163415G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227298699G>A" "" "pathogenic" "" "0000354163" "1" "00" "2" "228163415" "228163415" "subst" "0" "00687" "COL4A3_000577" "g.228163415G>A" "" "{PMID:Liu 2017:28542346}, {DOI:Liu 201:/10.1371/journal.pone.0177685}" "" "" "" "Germline" "" "" "0" "" "" "g.227298699G>A" "" "VUS" "" "0000354164" "1" "00" "2" "228163475" "228163475" "subst" "0.000382058" "00687" "COL4A3_000085" "g.228163475G>A" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "COL4A3 and COL4A4 mutations in cis, inherited together on the same chromosome." "Germline" "" "" "0" "" "" "g.227298759G>A" "" "VUS" "" "0000354165" "1" "00" "2" "228163475" "228163475" "subst" "0.000382058" "00687" "COL4A3_000085" "g.228163475G>A" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "COL4A3 and COL4A4 mutations in cis, inherited together on the same chromosome. More severe phenotype than single mutation." "Germline" "" "" "0" "" "" "g.227298759G>A" "" "VUS" "" "0000354167" "1" "10" "2" "228163453" "228163453" "subst" "0.0450209" "00687" "COL4A3_000084" "g.228163453C>A" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227298737C>A" "" "benign" "" "0000354168" "1" "00" "2" "228163533" "228163533" "subst" "0" "00687" "COL4A3_000579" "g.228163533G>A" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Germline" "" "" "0" "" "" "g.227298817G>A" "" "VUS" "" "0000354169" "1" "00" "2" "228167754" "228169799" "dup" "0" "00687" "COL4A3_000580" "g.228167754_228169799dup" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "3883-?_4252+?dup" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000354170" "1" "90" "2" "228167817" "228167817" "subst" "0" "00687" "COL4A3_000581" "g.228167817G>A" "" "{PMID:Liu 2017:28542346}, {DOI:Liu 201:/10.1371/journal.pone.0177685}" "" "" "" "Germline" "" "" "0" "" "" "g.227303101G>A" "" "pathogenic" "" "0000354171" "3" "90" "2" "228167753" "228169800" "dup" "0" "00687" "COL4A3_000449" "g.(228163529_228167753)_(228169800_228172425)dup" "" "{PMID:Truong 2017:26628280}, {DOI:Truong 2017:10.1007/s00467-015-3268-2}" "" "ex44-47 dup" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000354172" "1" "00" "2" "228168862" "228168862" "subst" "0" "00687" "COL4A3_000585" "g.228168862T>A" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227304146T>A" "" "VUS" "" "0000354173" "1" "00" "2" "228169754" "228169754" "subst" "4.06702E-6" "00687" "COL4A3_000586" "g.228169754G>A" "" "{PMID:Imafuku 2017:28704582}, {DOI:Imafuku 2017:10.1111/nep.13115}" "" "" "" "Germline" "" "" "0" "" "" "g.227305038G>A" "" "VUS" "" "0000354174" "1" "00" "2" "228169782" "228169782" "subst" "0" "00687" "COL4A3_000090" "g.228169782G>T" "" "{PMID:Rosado 2015:26277931}, {DOI:Rosado 2015:10.1159/000368519}" "" "" "" "Germline" "" "" "0" "" "" "g.227305066G>T" "" "VUS" "" "0000354175" "1" "00" "2" "228169782" "228169782" "subst" "0" "00687" "COL4A3_000587" "g.228169782G>A" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227305066G>A" "" "VUS" "" "0000354176" "1" "00" "2" "228172453" "228172453" "subst" "0" "00687" "COL4A3_000590" "g.228172453G>A" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227307737G>A" "" "VUS" "" "0000354177" "1" "00" "2" "228172537" "228172537" "del" "0" "00687" "COL4A3_000592" "g.228172537del" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "4364delC" "" "Germline" "" "" "0" "" "" "g.227307821del" "" "VUS" "" "0000354178" "3" "70" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "{PMID:Chatterjee 2013:24130771}, {DOI:Chatterjee 2013:10.1371/journal.pone.0076360}" "" "" "" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "likely pathogenic" "" "0000354179" "3" "70" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "{PMID:Chatterjee 2013:24130771}, {DOI:Chatterjee 2013:10.1371/journal.pone.0076360}" "" "" "" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "likely pathogenic" "" "0000354180" "1" "95" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "{PMID:Gast 2016:26346198}, {DOI:Gast 2016:10.1093/ndt/gfv325}" "" "" "variant considered pathogenic by submitter" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "pathogenic" "" "0000354181" "1" "00" "2" "0" "0" "subst" "0" "00687" "COL4A3_000593" "g.?" "" "{PMID:Malone 2014:25229338}, {DOI:Malone 2014:10.1038/ki.2014.305}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000354182" "3" "90" "2" "228173092" "228173092" "subst" "0" "00687" "COL4A3_000445" "g.228173092C>G" "" "{PMID:Kaimori 2013:28509228}, {DOI:Kaimori 2013:10.1007/s13730-012-0049-7}" "" "4463-523C>G, 139 bp RNA insertion intron 48" "" "Germline" "yes" "" "0" "" "" "g.227308376C>G" "" "pathogenic" "" "0000354183" "3" "90" "2" "228173092" "228173092" "subst" "0" "00687" "COL4A3_000445" "g.228173092C>G" "" "{PMID:Kaimori 2013:28509228}, {DOI:Kaimori 2013:10.1007/s13730-012-0049-7}" "" "4463-523C>G, 139 bp RNA insertion intron 48" "" "Germline" "yes" "" "0" "" "" "g.227308376C>G" "" "pathogenic" "" "0000354184" "3" "90" "2" "228173092" "228173092" "subst" "0" "00687" "COL4A3_000445" "g.228173092C>G" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "4463-523C>G" "" "Germline" "" "" "0" "" "" "g.227308376C>G" "" "VUS" "" "0000354185" "1" "00" "2" "228173675" "228173675" "subst" "0.000215377" "00687" "COL4A3_000595" "g.228173675A>G" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "The two mutations in COL4A3 and COL4A4 were inherited independently, probably indicating an in trans configuration. This kind of transmission mimics the AR inheritance with a 25% probability of having another child with the same genotype. However, the severity of the phenotype is intermediate between AD and AR form. The index case with two heterozygous mutations developed renal impairment at 40 years and ESRF at 49 years.His brother aged 47 years, had one mutation in COL4A4, with haematuria and proteinuria and normal renal function." "Germline" "" "" "0" "" "" "g.227308959A>G" "" "VUS" "" "0000354186" "1" "00" "2" "228173654" "228173654" "subst" "0" "00687" "COL4A3_000594" "g.228173654C>A" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227308938C>A" "" "VUS" "" "0000354187" "1" "00" "2" "228173987" "228173987" "subst" "0" "00687" "COL4A3_000454" "g.228173987T>C" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227309271T>C" "" "VUS" "" "0000354188" "1" "00" "2" "228174022" "228174022" "subst" "0" "00687" "COL4A3_000598" "g.228174022T>G" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "" "" "Germline" "" "" "0" "" "" "g.227309306T>G" "" "VUS" "" "0000354189" "1" "90" "2" "228175555" "228175555" "subst" "4.06352E-6" "00687" "COL4A3_000601" "g.228175555G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227310839G>T" "" "pathogenic" "" "0000354190" "1" "00" "2" "228175623" "228175624" "del" "0" "00687" "COL4A3_000603" "g.228175623_228175624del" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "4887_4888delCA" "" "Germline" "" "" "0" "" "" "g.227310907_227310908del" "" "VUS" "" "0000354191" "1" "00" "2" "228176554" "228176554" "subst" "0.000365663" "00687" "COL4A3_000110" "g.228176554C>T" "" "{PMID:Malone 2014:25229338}, {DOI:Malone 2014:10.1038/ki.2014.305}" "" "" "" "Germline" "" "" "0" "" "" "g.227311838C>T" "" "VUS" "" "0000354192" "1" "00" "2" "228176567" "228176567" "subst" "2.43809E-5" "00687" "COL4A3_000242" "g.228176567G>A" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227311851G>A" "" "VUS" "" "0000354193" "11" "90" "2" "228004876" "228029530" "del" "0" "00687" "COL4A4_000408" "g.(227985865_228004876)_(228029530_228102683)del" "" "{PMID:Moriniere 2014:24854265}, {DOI:Moriniere 2014:10.1681/ASN.2013080912}" "" "del ex1 COL4A3, ex1-4 COL4A4" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000354271" "0" "31" "2" "228147093" "228147093" "subst" "0.0119505" "00687" "COL4A3_000050" "g.228147093A>G" "" "{PMID:Kovacs 2016:26934356}, {DOI:Kovacs 2016:10.1371/journal.pone.0149241}" "" "" "" "Germline" "" "" "0" "" "" "g.227282377A>G" "" "likely benign" "" "0000354740" "0" "90" "2" "228172593" "228172597" "del" "0" "00687" "COL4A3_000095" "g.228172593_228172597del" "" "" "" "4420_4424delCTTTT" "" "Germline" "" "" "0" "" "" "g.227307877_227307881del" "" "pathogenic" "" "0000354741" "0" "90" "2" "228147192" "228147193" "delins" "0" "00687" "COL4A3_000544" "g.228147192_228147193delinsA" "" "" "" "2600_2601delTGinsA" "" "Germline" "" "" "0" "" "" "g.227282476_227282477delinsA" "" "pathogenic" "" "0000354747" "0" "70" "2" "228172435" "228172435" "subst" "0" "00687" "COL4A3_000589" "g.228172435G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227307719G>T" "" "likely pathogenic" "" "0000354749" "0" "90" "2" "228172614" "228172614" "subst" "0" "00687" "COL4A3_000097" "g.228172614C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227307898C>T" "" "pathogenic" "" "0000354750" "0" "90" "2" "228141110" "228141110" "dup" "0" "00687" "COL4A3_000227" "g.228141110dup" "" "" "" "1937dupG" "" "Germline" "" "" "0" "" "" "g.227276394dup" "" "pathogenic" "" "0000354754" "0" "70" "2" "228135490" "228135490" "del" "0" "00687" "COL4A3_000511" "g.228135490del" "" "" "" "1580delT" "" "Germline" "" "" "0" "" "" "g.227270774del" "" "likely pathogenic" "" "0000354756" "0" "50" "2" "228135474" "228135474" "subst" "0" "00687" "COL4A3_000510" "g.228135474G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227270758G>C" "" "VUS" "" "0000354758" "0" "70" "2" "228147159" "228147159" "subst" "0" "00687" "COL4A3_000236" "g.228147159G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227282443G>A" "" "likely pathogenic" "" "0000354777" "0" "50" "2" "228173979" "228173979" "subst" "4.46817E-5" "00687" "COL4A3_000597" "g.228173979T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227309263T>G" "" "VUS" "" "0000354781" "0" "90" "2" "228147213" "228147214" "delins" "0" "00687" "COL4A3_000053" "g.228147213_228147214delinsT" "" "" "" "2621_2622delGAinsT" "" "Germline" "" "" "0" "" "" "g.227282497_227282498delinsT" "" "pathogenic" "" "0000354793" "0" "50" "2" "228113248" "228113248" "subst" "4.07614E-6" "00687" "COL4A3_000474" "g.228113248C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227248532C>T" "" "VUS" "" "0000354795" "0" "50" "2" "228159701" "228159701" "subst" "0.000215622" "00687" "COL4A3_000563" "g.228159701C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227294985C>T" "" "VUS" "" "0000354797" "0" "50" "2" "228125838" "228125838" "subst" "0" "00687" "COL4A3_000494" "g.228125838G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227261122G>A" "" "VUS" "" "0000354802" "0" "50" "2" "228118037" "228118037" "subst" "0" "00687" "COL4A3_000476" "g.228118037G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227253321G>A" "" "VUS" "" "0000354804" "0" "50" "2" "228122331" "228122331" "subst" "3.25095E-5" "00687" "COL4A3_000489" "g.228122331G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227257615G>C" "" "VUS" "" "0000354807" "0" "50" "2" "228110674" "228110674" "subst" "2.43803E-5" "00687" "COL4A3_000466" "g.228110674C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227245958C>T" "" "VUS" "" "0000354812" "0" "90" "2" "228145304" "228145310" "del" "0" "00687" "COL4A3_000534" "g.228145304_228145310del" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "2372_2374+4delGAGGTAC" "" "Germline" "" "" "0" "" "" "g.227280588_227280594del" "" "pathogenic" "" "0000354814" "2" "90" "2" "228175664" "228175664" "subst" "0" "00687" "COL4A3_000453" "g.228175664G>A" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227310948G>A" "" "pathogenic" "" "0000354815" "2" "90" "2" "228173987" "228173987" "subst" "0" "00687" "COL4A3_000454" "g.228173987T>C" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227309271T>C" "" "pathogenic" "" "0000354816" "0" "90" "2" "228175529" "228175529" "subst" "5.68874E-5" "00687" "COL4A3_000599" "g.228175529T>G" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227310813T>G" "" "pathogenic" "" "0000354817" "0" "90" "2" "228148986" "228148986" "subst" "4.06332E-6" "00687" "COL4A3_000550" "g.228148986C>T" "" "{PMID:Malone 2014:25229338}, {DOI:Malone 2014:10.1038/ki.2014.305}" "" "del393G" "" "Germline" "" "" "0" "" "" "g.227284270C>T" "" "pathogenic" "" "0000354819" "0" "90" "2" "228135466" "228135480" "del" "0" "00687" "COL4A3_000509" "g.228135466_228135480del" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "1476-20_6del15bp" "" "Germline" "" "" "0" "" "" "g.227270750_227270764del" "" "pathogenic" "" "0000354821" "0" "90" "2" "228137761" "228137761" "subst" "8.20863E-6" "00687" "COL4A3_000293" "g.228137761G>A" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227273045G>A" "" "pathogenic" "" "0000354822" "0" "00" "2" "228029482" "228029505" "del" "0" "00687" "COL4A3_000003" "g.228029482_228029505del" "" "" "" "40_63delCTGCCGCTCCTGCTGGTGCTCCTG" "" "Germline" "" "" "0" "" "" "g.227164766_227164789del" "" "VUS" "" "0000354824" "3" "00" "2" "228176554" "228176554" "subst" "0.000365663" "00687" "COL4A3_000110" "g.228176554C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227311838C>T" "" "VUS" "" "0000354825" "0" "90" "2" "228163467" "228163467" "dup" "0" "00687" "COL4A3_000578" "g.228163467dup" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "3821insG" "" "Germline" "" "" "0" "" "" "g.227298751dup" "" "pathogenic" "" "0000354830" "3" "70" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "likely pathogenic" "" "0000354831" "0" "90" "2" "228162511" "228162511" "del" "0" "00687" "COL4A3_000575" "g.228162511del" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "3687delG" "" "Germline" "" "" "0" "" "" "g.227297795del" "" "pathogenic" "" "0000354832" "0" "90" "2" "228176554" "228176554" "subst" "0.000365663" "00687" "COL4A3_000110" "g.228176554C>T" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227311838C>T" "" "pathogenic" "" "0000354833" "0" "00" "2" "228145303" "228145303" "subst" "0" "00687" "COL4A3_000533" "g.228145303C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227280587C>T" "" "VUS" "" "0000354837" "0" "90" "2" "228175529" "228175529" "subst" "5.68874E-5" "00687" "COL4A3_000599" "g.228175529T>G" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227310813T>G" "" "pathogenic" "" "0000354838" "3" "70" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "likely pathogenic" "" "0000354840" "0" "90" "2" "228172527" "228172527" "subst" "0" "00687" "COL4A3_000591" "g.228172527A>T" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227307811A>T" "" "pathogenic" "" "0000354841" "0" "90" "2" "228175529" "228175529" "subst" "5.68874E-5" "00687" "COL4A3_000599" "g.228175529T>G" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227310813T>G" "" "pathogenic" "" "0000354842" "0" "00" "2" "228172527" "228172527" "subst" "0" "00687" "COL4A3_000591" "g.228172527A>T" "" "{PMID:Uchida 2016:27904025}, {DOI:Uchida 2016:10.1620/tjem.240.251}" "" "" "" "Germline" "" "" "0" "" "" "g.227307811A>T" "" "VUS" "" "0000354843" "0" "90" "2" "228176554" "228176554" "subst" "0.000365663" "00687" "COL4A3_000110" "g.228176554C>T" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227311838C>T" "" "pathogenic" "" "0000354845" "0" "90" "2" "228168708" "228168708" "subst" "0" "00687" "COL4A3_000584" "g.228168708A>G" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227303992A>G" "" "pathogenic" "" "0000354847" "0" "90" "2" "228172594" "228172594" "subst" "0.00270685" "00687" "COL4A3_000093" "g.228172594T>C" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227307878T>C" "" "pathogenic" "" "0000354849" "0" "00" "2" "228175529" "228175529" "subst" "5.68874E-5" "00687" "COL4A3_000599" "g.228175529T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227310813T>G" "" "VUS" "" "0000354850" "0" "00" "2" "228159760" "228159760" "subst" "8.12493E-6" "00687" "COL4A3_000067" "g.228159760G>A" "" "{PMID:Liu 2017:28542346}, {DOI:Liu 201:/10.1371/journal.pone.0177685}" "" "" "" "Germline" "" "" "0" "" "" "g.227295044G>A" "" "VUS" "" "0000354852" "0" "90" "2" "228175529" "228175529" "subst" "5.68874E-5" "00687" "COL4A3_000599" "g.228175529T>G" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227310813T>G" "" "pathogenic" "" "0000354853" "0" "90" "2" "228175529" "228175529" "subst" "5.68874E-5" "00687" "COL4A3_000599" "g.228175529T>G" "" "{PMID:Oka 2014:24633401}, {DOI:Oka 2014:10.1007/s00467-014-2797-4}" "" "" "" "Germline" "" "" "0" "" "" "g.227310813T>G" "" "pathogenic" "" "0000354857" "0" "90" "2" "228173711" "228173713" "del" "0" "00687" "COL4A3_000596" "g.228173711_228173713del" "" "{PMID:Weber 2016:26809805}, {DOI:Weber 2016:10.1007/s00467-015-3302-4}" "" "4559_4561delCAT" "" "Germline" "" "" "0" "" "" "g.227308995_227308997del" "" "pathogenic" "" "0000354858" "3" "00" "2" "228144508" "228144508" "subst" "0" "00687" "COL4A3_000528" "g.228144508G>C" "" "{PMID:Chatterjee 2013:24130771}, {DOI:Chatterjee 2013:10.1371/journal.pone.0076360}" "" "" "" "Germline" "" "" "0" "" "" "g.227279792G>C" "" "VUS" "" "0000354859" "3" "00" "2" "228137737" "228137737" "subst" "0" "00687" "COL4A3_000520" "g.228137737G>A" "" "{PMID:Chatterjee 2013:24130771}, {DOI:Chatterjee 2013:10.1371/journal.pone.0076360}" "" "" "" "Germline" "" "" "0" "" "" "g.227273021G>A" "" "VUS" "" "0000354866" "0" "00" "2" "228163475" "228163475" "subst" "0.000382058" "00687" "COL4A3_000085" "g.228163475G>A" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Germline" "" "" "0" "" "" "g.227298759G>A" "" "VUS" "" "0000354868" "0" "70" "2" "228131805" "228131805" "subst" "0" "00687" "COL4A3_000504" "g.228131805G>A" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227267089G>A" "" "likely pathogenic" "" "0000354869" "0" "00" "2" "228142209" "228142209" "subst" "0" "00687" "COL4A3_000526" "g.228142209G>A" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227277493G>A" "" "VUS" "" "0000354871" "0" "70" "2" "228148573" "228148573" "subst" "0" "00687" "COL4A3_000548" "g.228148573G>T" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227283857G>T" "" "likely pathogenic" "" "0000354888" "0" "00" "2" "228176567" "228176567" "subst" "2.43809E-5" "00687" "COL4A3_000242" "g.228176567G>A" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227311851G>A" "" "VUS" "" "0000354890" "0" "00" "2" "228120751" "228120751" "subst" "2.03178E-5" "00687" "COL4A3_000278" "g.228120751G>A" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227256035G>A" "" "VUS" "" "0000354891" "0" "00" "2" "228163475" "228163475" "subst" "0.000382058" "00687" "COL4A3_000085" "g.228163475G>A" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Germline" "" "" "0" "" "" "g.227298759G>A" "" "VUS" "" "0000354895" "0" "00" "2" "228134679" "228134679" "subst" "0" "00687" "COL4A3_000507" "g.228134679G>C" "" "{PMID:Mencarelli 2015:25575550}, {DOI:Mencarelli 2015:10.1136/jmedgenet-2014-102822}" "" "" "" "Germline" "" "" "0" "" "" "g.227269963G>C" "" "VUS" "" "0000354897" "0" "00" "2" "228173675" "228173675" "subst" "0.000215377" "00687" "COL4A3_000595" "g.228173675A>G" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Germline" "" "" "0" "" "" "g.227308959A>G" "" "VUS" "" "0000354901" "0" "00" "2" "228135607" "228135607" "subst" "0" "00687" "COL4A3_000515" "g.228135607G>C" "" "{PMID:Feltran 2017:28658201}, {DOI:Feltran 2017:10.1097/TP.0000000000001846}" "" "" "" "Germline" "" "" "0" "" "" "g.227270891G>C" "" "VUS" "" "0000354906" "0" "00" "2" "228163475" "228163475" "subst" "0.000382058" "00687" "COL4A3_000085" "g.228163475G>A" "" "{PMID:Fallerini 2014:24033287}, (DOI:Fallerini 2014:10.1111/cge.12258}" "" "" "" "Germline" "" "" "0" "" "" "g.227298759G>A" "" "VUS" "" "0000354911" "0" "50" "2" "228131147" "228131147" "subst" "1.62536E-5" "00687" "COL4A3_000500" "g.228131147C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227266431C>T" "" "VUS" "" "0000354914" "0" "50" "2" "228153871" "228153871" "subst" "0.00011048" "00687" "COL4A3_000553" "g.228153871G>A" "" "Barker, 2001" "" "" "" "Germline" "" "" "0" "" "" "g.227289155G>A" "" "VUS" "" "0000354915" "0" "90" "2" "228159760" "228159760" "subst" "8.12493E-6" "00687" "COL4A3_000067" "g.228159760G>A" "" "King, 2006, Zhou, 1992" "" "" "" "Germline" "" "" "0" "" "" "g.227295044G>A" "" "pathogenic" "" "0000355057" "1" "90" "2" "228147099" "228147099" "subst" "0" "00006" "COL4A3_000455" "g.228147099G>A" "" "{PMID:Zhang 2011:21143337}" "" "G836Q" "" "Germline" "" "" "0" "" "" "g.227282383G>A" "" "pathogenic" "" "0000355058" "2" "90" "2" "0" "0" "" "0" "00006" "COL4A3_000000" "g.?" "" "{PMID:Zhang 2011:21143337}" "" "805_828delGAGCCTGGACCTCCTGGACCCTCA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000454264" "11" "70" "2" "228173928" "228173928" "subst" "7.71831E-5" "02476" "COL4A3_000338" "g.228173928T>G" "" "" "" "g.149648T>G" "" "Germline" "" "rs200655479" "0" "" "" "g.227309212T>G" "" "likely pathogenic" "" "0000478196" "21" "90" "2" "228125838" "228125838" "subst" "0" "02473" "COL4A3_000494" "g.228125838G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.227261122G>A" "" "pathogenic (recessive)" "" "0000478197" "11" "90" "2" "228168732" "228168732" "subst" "0" "02473" "COL4A3_000604" "g.228168732C>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.227304016C>T" "" "pathogenic (recessive)" "" "0000499677" "21" "90" "2" "228147159" "228147159" "subst" "0" "03128" "COL4A3_000236" "g.228147159G>A" "" "{PMID:Daga 2020:31754267}, {DOI:Daga 2020:10.1038/s41431-019-0537-8}, {PMID:Daga 2024:36653516}, {DOI:Daga 2024:10.1038/s41431-023-01287-y}" "" "" "" "Germline" "" "" "0" "" "" "g.227282443G>A" "" "pathogenic (dominant)" "" "0000514944" "0" "30" "2" "228115908" "228115908" "subst" "6.50412E-5" "01804" "COL4A3_000605" "g.228115908C>T" "" "" "" "COL4A3(NM_000091.4):c.599C>T (p.(Pro200Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227251192C>T" "" "likely benign" "" "0000514946" "0" "70" "2" "228118314" "228118314" "subst" "0" "02327" "COL4A3_000408" "g.228118314G>A" "" "" "" "COL4A3(NM_000091.4):c.725G>A (p.G242E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227253598G>A" "" "likely pathogenic" "" "0000514947" "0" "30" "2" "228118345" "228118345" "subst" "3.66214E-5" "01943" "COL4A3_000606" "g.228118345T>A" "" "" "" "COL4A3(NM_000091.4):c.756T>A (p.D252E, p.(Asp252Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227253629T>A" "" "likely benign" "" "0000514948" "0" "30" "2" "228118867" "228118867" "subst" "0.0230539" "01804" "COL4A3_000188" "g.228118867G>A" "" "" "" "COL4A3(NM_000091.4):c.805G>A (p.(Glu269Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227254151G>A" "" "likely benign" "" "0000514949" "0" "10" "2" "228118986" "228118986" "dup" "0" "02326" "COL4A3_000607" "g.228118986dup" "" "" "" "COL4A3(NM_000091.4):c.828+96dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227254270dup" "" "benign" "" "0000514950" "0" "50" "2" "228119381" "228119381" "subst" "0" "01804" "COL4A3_000483" "g.228119381G>A" "" "" "" "COL4A3(NM_000091.4):c.838G>A (p.(Gly280Arg), p.G280R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227254665G>A" "" "VUS" "" "0000514951" "0" "30" "2" "228121053" "228121053" "subst" "0.000101647" "01943" "COL4A3_000608" "g.228121053C>A" "" "" "" "COL4A3(NM_000091.4):c.934-6C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227256337C>A" "" "likely benign" "" "0000514952" "0" "30" "2" "228121067" "228121067" "subst" "1.21958E-5" "01943" "COL4A3_000279" "g.228121067G>A" "" "" "" "COL4A3(NM_000091.4):c.942G>A (p.K314=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227256351G>A" "" "likely benign" "" "0000514953" "0" "50" "2" "228124570" "228124570" "subst" "8.12764E-6" "01943" "COL4A3_000609" "g.228124570C>T" "" "" "" "COL4A3(NM_000091.4):c.1091C>T (p.P364L), COL4A3(NM_000091.5):c.1091C>T (p.(Pro364Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227259854C>T" "" "VUS" "" "0000514954" "0" "70" "2" "228137833" "228137833" "subst" "8.26071E-6" "02327" "COL4A3_000297" "g.228137833G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227273117G>A" "" "likely pathogenic" "" "0000514955" "0" "70" "2" "228142227" "228142227" "subst" "0.000106774" "01804" "COL4A3_000044" "g.228142227G>A" "" "" "" "COL4A3(NM_000091.4):c.2083G>A (p.(Gly695Arg), p.G695R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227277511G>A" "" "likely pathogenic" "" "0000514956" "0" "90" "2" "228142227" "228142227" "subst" "0.000106774" "02326" "COL4A3_000044" "g.228142227G>A" "" "" "" "COL4A3(NM_000091.4):c.2083G>A (p.(Gly695Arg), p.G695R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227277511G>A" "" "pathogenic" "" "0000514957" "0" "10" "2" "228147014" "228147017" "dup" "0" "02326" "COL4A3_000610" "g.228147014_228147017dup" "" "" "" "COL4A3(NM_000091.4):c.2489-67_2489-64dupATAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227282298_227282301dup" "" "benign" "" "0000514959" "0" "30" "2" "228147181" "228147181" "subst" "0" "01943" "COL4A3_000611" "g.228147181T>C" "" "" "" "COL4A3(NM_000091.4):c.2589T>C (p.H863=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227282465T>C" "" "likely benign" "" "0000514960" "0" "30" "2" "228147228" "228147228" "subst" "5.68967E-5" "01804" "COL4A3_000612" "g.228147228C>T" "" "" "" "COL4A3(NM_000091.4):c.2636C>T (p.P879L, p.(Pro879Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227282512C>T" "" "likely benign" "" "0000514961" "0" "30" "2" "228148498" "228148498" "subst" "2.84296E-5" "01804" "COL4A3_000545" "g.228148498T>C" "" "" "" "COL4A3(NM_000091.4):c.2672T>C (p.(Ile891Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227283782T>C" "" "likely benign" "" "0000514962" "0" "10" "2" "228159675" "228159676" "del" "0" "02326" "COL4A3_000425" "g.228159675_228159676del" "" "" "" "COL4A3(NM_000091.4):c.3419-5_3419-4delTT, COL4A3(NM_000091.5):c.3419-5_3419-4delTT, MFF-DT(NR_102371.1):n.243+10514_243+10515delAA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227294959_227294960del" "" "benign" "" "0000514963" "0" "30" "2" "228159677" "228159677" "subst" "0" "01804" "COL4A3_000613" "g.228159677C>T" "" "" "" "COL4A3(NM_000091.4):c.3419-3C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227294961C>T" "" "likely benign" "" "0000514964" "0" "30" "2" "228159678" "228159678" "subst" "0" "01804" "COL4A3_000614" "g.228159678A>T" "" "" "" "COL4A3(NM_000091.4):c.3419-2A>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227294962A>T" "" "likely benign" "" "0000514965" "0" "30" "2" "228159680" "228159680" "subst" "0" "01804" "COL4A3_000615" "g.228159680G>T" "" "" "" "COL4A3(NM_000091.4):c.3419G>T (p.(Gly1140Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227294964G>T" "" "likely benign" "" "0000514966" "0" "30" "2" "228159682" "228159682" "subst" "0" "01804" "COL4A3_000616" "g.228159682C>T" "" "" "" "COL4A3(NM_000091.4):c.3421C>T (p.(Leu1141Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227294966C>T" "" "likely benign" "" "0000514967" "0" "50" "2" "228160020" "228160020" "subst" "0.000182771" "01943" "COL4A3_000617" "g.228160020C>T" "" "" "" "COL4A3(NM_000091.4):c.3553C>T (p.P1185S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227295304C>T" "" "VUS" "" "0000514968" "0" "30" "2" "228162381" "228162381" "subst" "0.00123244" "01943" "COL4A3_000618" "g.228162381T>C" "" "" "" "COL4A3(NM_000091.4):c.3566-9T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227297665T>C" "" "likely benign" "" "0000514969" "0" "30" "2" "228163453" "228163453" "subst" "0.0450209" "01804" "COL4A3_000084" "g.228163453C>A" "" "" "" "COL4A3(NM_000091.4):c.3807C>A (p.(Asp1269Glu), p.D1269E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227298737C>A" "" "likely benign" "" "0000514970" "0" "10" "2" "228163453" "228163453" "subst" "0.0450209" "02327" "COL4A3_000084" "g.228163453C>A" "" "" "" "COL4A3(NM_000091.4):c.3807C>A (p.(Asp1269Glu), p.D1269E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227298737C>A" "" "benign" "" "0000514971" "0" "50" "2" "228163475" "228163475" "subst" "0.000382058" "01943" "COL4A3_000085" "g.228163475G>A" "" "" "" "COL4A3(NM_000091.4):c.3829G>A (p.G1277S), COL4A3(NM_000091.5):c.3829G>A (p.(Gly1277Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227298759G>A" "" "VUS" "" "0000514972" "0" "50" "2" "228163475" "228163475" "subst" "0.000382058" "02327" "COL4A3_000085" "g.228163475G>A" "" "" "" "COL4A3(NM_000091.4):c.3829G>A (p.G1277S), COL4A3(NM_000091.5):c.3829G>A (p.(Gly1277Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227298759G>A" "" "VUS" "" "0000514973" "0" "30" "2" "228168748" "228168748" "subst" "0.0063374" "01804" "COL4A3_000089" "g.228168748C>A" "" "" "" "COL4A3(NM_000091.4):c.4041C>A (p.(Asp1347Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227304032C>A" "" "likely benign" "" "0000514974" "0" "50" "2" "228169758" "228169758" "subst" "4.06742E-6" "01943" "COL4A3_000619" "g.228169758C>T" "" "" "" "COL4A3(NM_000091.4):c.4211C>T (p.P1404L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227305042C>T" "" "VUS" "" "0000514975" "0" "90" "2" "228169782" "228169782" "subst" "0" "02327" "COL4A3_000587" "g.228169782G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227305066G>A" "" "pathogenic" "" "0000514976" "0" "50" "2" "228173726" "228173726" "subst" "0" "02327" "COL4A3_000620" "g.228173726C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227309010C>T" "" "VUS" "" "0000514977" "0" "50" "2" "228173943" "228173943" "subst" "4.8746E-5" "01943" "COL4A3_000621" "g.228173943C>T" "" "" "" "COL4A3(NM_000091.4):c.4664C>T (p.A1555V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227309227C>T" "" "VUS" "" "0000514978" "0" "30" "2" "228173944" "228173944" "subst" "0.00235602" "01943" "COL4A3_000339" "g.228173944G>A" "" "" "" "COL4A3(NM_000091.4):c.4665G>A (p.A1555=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227309228G>A" "" "likely benign" "" "0000607686" "0" "30" "2" "228029433" "228029433" "subst" "0.000379902" "02327" "COL4A3_000001" "g.228029433C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227164717C>T" "" "likely benign" "" "0000607687" "0" "30" "2" "228029475" "228029475" "subst" "0" "02327" "COL4A3_000622" "g.228029475G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227164759G>T" "" "likely benign" "" "0000607688" "0" "50" "2" "228029482" "228029505" "del" "0" "02327" "COL4A3_000003" "g.228029482_228029505del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227164766_227164789del" "" "VUS" "" "0000607689" "0" "10" "2" "228102680" "228102680" "subst" "0.0170294" "02327" "COL4A3_000402" "g.228102680C>T" "" "" "" "COL4A3(NM_000091.4):c.88-4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227237964C>T" "" "benign" "" "0000607690" "0" "10" "2" "228102723" "228102723" "subst" "0.284083" "02327" "COL4A3_000005" "g.228102723G>C" "" "" "" "COL4A3(NM_000091.4):c.127G>C (p.G43R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227238007G>C" "" "benign" "" "0000607691" "0" "10" "2" "228102752" "228102752" "subst" "0.309262" "02327" "COL4A3_000006" "g.228102752C>A" "" "" "" "COL4A3(NM_000091.5):c.144+12C>A, MFF-DT(NR_102371.1):n.1681+50G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227238036C>A" "" "benign" "" "0000607692" "0" "30" "2" "228102779" "228102779" "subst" "0" "02327" "COL4A3_000623" "g.228102779A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227238063A>T" "" "likely benign" "" "0000607693" "0" "90" "2" "228104898" "228104898" "dup" "0" "02327" "COL4A3_000624" "g.228104898dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227240182dup" "" "pathogenic" "" "0000607694" "0" "10" "2" "228104936" "228104936" "subst" "0.00165397" "02327" "COL4A3_000007" "g.228104936G>T" "" "" "" "COL4A3(NM_000091.4):c.222G>T (p.P74=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227240220G>T" "" "benign" "" "0000607695" "0" "10" "2" "228110643" "228110643" "subst" "0.0429124" "02327" "COL4A3_000403" "g.228110643C>T" "" "" "" "COL4A3(NM_000091.4):c.325-27C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227245927C>T" "" "benign" "" "0000607696" "0" "30" "2" "228110686" "228110686" "subst" "0" "02327" "COL4A3_000625" "g.228110686C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227245970C>T" "" "likely benign" "" "0000607697" "0" "70" "2" "228110689" "228110689" "subst" "4.06362E-6" "02327" "COL4A3_000626" "g.228110689G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227245973G>C" "" "likely pathogenic" "" "0000607698" "0" "50" "2" "228110691" "228110691" "subst" "0.00485981" "02327" "COL4A3_000009" "g.228110691C>A" "" "" "" "COL4A3(NM_000091.5):c.346C>A (p.P116T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227245975C>A" "" "VUS" "" "0000607699" "0" "10" "2" "228111435" "228111435" "subst" "0.833927" "02327" "COL4A3_000012" "g.228111435T>C" "" "" "" "COL4A3(NM_000091.5):c.422T>C (p.L141P), MFF-DT(NR_102371.1):n.1593-8545A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227246719T>C" "" "benign" "" "0000607700" "0" "50" "2" "228111459" "228111459" "subst" "0" "02327" "COL4A3_000627" "g.228111459G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227246743G>T" "" "VUS" "" "0000607701" "0" "50" "2" "228112246" "228112246" "subst" "0" "02327" "COL4A3_000628" "g.228112246A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227247530A>G" "" "VUS" "" "0000607702" "0" "70" "2" "228112275" "228112275" "subst" "1.21862E-5" "02327" "COL4A3_000267" "g.228112275G>T" "" "" "" "COL4A3(NM_000091.5):c.443G>T (p.G148V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227247559G>T" "" "likely pathogenic" "" "0000607703" "0" "10" "2" "228113175" "228113175" "subst" "0.834079" "02327" "COL4A3_000015" "g.228113175A>G" "" "" "" "COL4A3(NM_000091.5):c.485A>G (p.E162G), MFF-DT(NR_102371.1):n.1593-10285T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227248459A>G" "" "benign" "" "0000607704" "0" "70" "2" "228113210" "228113210" "subst" "0" "02327" "COL4A3_000629" "g.228113210G>T" "" "" "" "COL4A3(NM_000091.4):c.520G>T (p.G174W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227248494G>T" "" "likely pathogenic" "" "0000607705" "0" "10" "2" "228115847" "228115847" "subst" "0.0431689" "02327" "COL4A3_000405" "g.228115847A>C" "" "" "" "COL4A3(NM_000091.4):c.547-9A>C, COL4A3(NM_000091.5):c.547-9A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227251131A>C" "" "benign" "" "0000607706" "0" "70" "2" "228115856" "228115856" "subst" "0" "02327" "COL4A3_000630" "g.228115856G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227251140G>T" "" "likely pathogenic" "" "0000607707" "0" "70" "2" "228115902" "228115902" "dup" "0" "02327" "COL4A3_000631" "g.228115902dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227251186dup" "" "likely pathogenic" "" "0000607708" "0" "30" "2" "228116016" "228116016" "subst" "7.76543E-5" "02327" "COL4A3_000632" "g.228116016T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227251300T>A" "" "likely benign" "" "0000607709" "0" "50" "2" "228118036" "228118036" "subst" "0" "01804" "COL4A3_000633" "g.228118036G>A" "" "" "" "COL4A3(NM_000091.4):c.670G>A (p.(Gly224Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227253320G>A" "" "VUS" "" "0000607710" "0" "90" "2" "228118302" "228118302" "del" "0" "02327" "COL4A3_000229" "g.228118302del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227253586del" "" "pathogenic" "" "0000607711" "0" "70" "2" "228118305" "228118305" "subst" "0" "02327" "COL4A3_000634" "g.228118305G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227253589G>A" "" "likely pathogenic" "" "0000607712" "0" "30" "2" "228118327" "228118327" "subst" "0" "02327" "COL4A3_000635" "g.228118327G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227253611G>A" "" "likely benign" "" "0000607713" "0" "30" "2" "228118815" "228118815" "subst" "0.024748" "02327" "COL4A3_000636" "g.228118815G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227254099G>A" "" "likely benign" "" "0000607714" "0" "30" "2" "228118867" "228118867" "subst" "0.0230539" "02327" "COL4A3_000188" "g.228118867G>A" "" "" "" "COL4A3(NM_000091.4):c.805G>A (p.(Glu269Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227254151G>A" "" "likely benign" "" "0000607715" "0" "10" "2" "228118910" "228118910" "subst" "0.0582021" "02327" "COL4A3_000637" "g.228118910A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227254194A>G" "" "benign" "" "0000607716" "0" "30" "2" "228119357" "228119357" "subst" "0.000406547" "02327" "COL4A3_000638" "g.228119357C>T" "" "" "" "COL4A3(NM_000091.4):c.829-15C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227254641C>T" "" "likely benign" "" "0000607717" "0" "70" "2" "228119432" "228119432" "subst" "0" "02327" "COL4A3_000639" "g.228119432G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227254716G>A" "" "likely pathogenic" "" "0000607718" "0" "10" "2" "228119461" "228119461" "subst" "0.0967128" "02327" "COL4A3_000018" "g.228119461G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227254745G>A" "" "benign" "" "0000607719" "0" "10" "2" "228120703" "228120703" "subst" "0.0555465" "02327" "COL4A3_000640" "g.228120703T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227255987T>C" "" "benign" "" "0000607720" "0" "70" "2" "228120751" "228120751" "subst" "2.03178E-5" "02327" "COL4A3_000278" "g.228120751G>A" "" "" "" "COL4A3(NM_000091.4):c.898G>A (p.G300R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227256035G>A" "" "likely pathogenic" "" "0000607721" "0" "10" "2" "228120800" "228120800" "subst" "0.0271174" "02327" "COL4A3_000641" "g.228120800T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227256084T>C" "" "benign" "" "0000607722" "0" "30" "2" "228121053" "228121053" "subst" "0.000101647" "02327" "COL4A3_000608" "g.228121053C>A" "" "" "" "COL4A3(NM_000091.4):c.934-6C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227256337C>A" "" "likely benign" "" "0000607723" "0" "30" "2" "228121132" "228121132" "subst" "0.00221356" "02327" "COL4A3_000487" "g.228121132C>G" "" "" "" "COL4A3(NM_000091.4):c.987+20C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227256416C>G" "" "likely benign" "" "0000607724" "0" "10" "2" "228121147" "228121147" "subst" "0.101936" "02327" "COL4A3_000642" "g.228121147T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227256431T>G" "" "benign" "" "0000607725" "0" "30" "2" "228124491" "228124491" "subst" "0.00314225" "02327" "COL4A3_000643" "g.228124491G>A" "" "" "" "COL4A3(NM_000091.4):c.1030-18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227259775G>A" "" "likely benign" "" "0000607726" "0" "90" "2" "228124590" "228124590" "subst" "0" "02327" "COL4A3_000022" "g.228124590C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227259874C>T" "" "pathogenic" "" "0000607727" "0" "30" "2" "228125784" "228125784" "subst" "8.13167E-6" "02327" "COL4A3_000644" "g.228125784T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227261068T>G" "" "likely benign" "" "0000607729" "0" "70" "2" "228128519" "228128519" "subst" "0" "02327" "COL4A3_000646" "g.228128519G>A" "" "" "" "COL4A3(NM_000091.4):c.1174G>A (p.G392R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227263803G>A" "" "likely pathogenic" "" "0000607730" "0" "10" "2" "228128568" "228128568" "subst" "0.0939043" "02327" "COL4A3_000026" "g.228128568G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227263852G>A" "" "benign" "" "0000607731" "0" "10" "2" "228131169" "228131169" "subst" "0.09636" "02327" "COL4A3_000028" "g.228131169A>G" "" "" "" "COL4A3(NM_000091.4):c.1352A>G (p.H451R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227266453A>G" "" "benign" "" "0000607732" "0" "70" "2" "228131171" "228131171" "subst" "4.06296E-6" "02327" "COL4A3_000501" "g.228131171G>A" "" "" "" "COL4A3(NM_000091.4):c.1354G>A (p.G452R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227266455G>A" "" "likely pathogenic" "" "0000607733" "0" "30" "2" "228131179" "228131179" "subst" "0.000158458" "02327" "COL4A3_000288" "g.228131179A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227266463A>T" "" "likely benign" "" "0000607734" "0" "70" "2" "228131728" "228131728" "subst" "0" "02327" "COL4A3_000647" "g.228131728T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227267012T>A" "" "likely pathogenic" "" "0000607735" "0" "10" "2" "228131752" "228131752" "subst" "0.0951863" "02327" "COL4A3_000033" "g.228131752G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227267036G>A" "" "benign" "" "0000607736" "0" "30" "2" "228131783" "228131783" "subst" "0.000706806" "02327" "COL4A3_000290" "g.228131783C>T" "" "" "" "COL4A3(NM_000091.4):c.1483C>T (p.H495Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227267067C>T" "" "likely benign" "" "0000607737" "0" "30" "2" "228131827" "228131827" "subst" "0" "02327" "COL4A3_000648" "g.228131827T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227267111T>C" "" "likely benign" "" "0000607738" "0" "30" "2" "228134637" "228134637" "subst" "8.53319E-5" "02327" "COL4A3_000193" "g.228134637G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227269921G>A" "" "likely benign" "" "0000607739" "0" "30" "2" "228134648" "228134648" "subst" "0" "02327" "COL4A3_000505" "g.228134648G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227269932G>C" "" "likely benign" "" "0000607740" "0" "70" "2" "228134661" "228134661" "subst" "0" "02327" "COL4A3_000649" "g.228134661G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227269945G>C" "" "likely pathogenic" "" "0000607741" "0" "10" "2" "228135631" "228135631" "subst" "0.469174" "02327" "COL4A3_000038" "g.228135631C>T" "" "" "" "COL4A3(NM_000091.5):c.1721C>T (p.P574L), MFF-DT(NR_102371.1):n.423-2146G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227270915C>T" "" "benign" "" "0000607742" "0" "50" "2" "228135662" "228135662" "subst" "1.62905E-5" "01943" "COL4A3_000650" "g.228135662C>T" "" "" "" "COL4A3(NM_000091.4):c.1752C>T (p.G584=), COL4A3(NM_000091.5):c.1752C>T (p.(Gly584=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227270946C>T" "" "VUS" "" "0000607743" "0" "90" "2" "228137824" "228137824" "subst" "2.0616E-5" "02327" "COL4A3_000042" "g.228137824G>A" "" "" "" "COL4A3(NM_000091.4):c.1918G>A (p.G640R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227273108G>A" "" "pathogenic" "" "0000607744" "0" "50" "2" "228142266" "228142266" "subst" "0" "02327" "COL4A3_000651" "g.228142266A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227277550A>G" "" "VUS" "" "0000607745" "0" "70" "2" "228144518" "228144518" "subst" "0" "02327" "COL4A3_000652" "g.228144518G>T" "" "" "" "COL4A3(NM_000091.4):c.2135G>T (p.G712V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227279802G>T" "" "likely pathogenic" "" "0000607746" "0" "50" "2" "228145195" "228145195" "subst" "2.43714E-5" "02327" "COL4A3_000653" "g.228145195C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227280479C>T" "" "VUS" "" "0000607747" "0" "30" "2" "228145216" "228145216" "subst" "0" "02327" "COL4A3_000654" "g.228145216G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227280500G>C" "" "likely benign" "" "0000607748" "0" "90" "2" "228145303" "228145303" "subst" "0" "02327" "COL4A3_000533" "g.228145303C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227280587C>T" "" "pathogenic" "" "0000607749" "0" "30" "2" "228147073" "228147073" "subst" "0.000382353" "02327" "COL4A3_000655" "g.228147073G>A" "" "" "" "COL4A3(NM_000091.4):c.2489-8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227282357G>A" "" "likely benign" "" "0000607750" "0" "70" "2" "228148482" "228148482" "subst" "0" "02327" "COL4A3_000656" "g.228148482G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227283766G>T" "" "likely pathogenic" "" "0000607751" "0" "30" "2" "228148488" "228148488" "subst" "7.31119E-5" "02327" "COL4A3_000657" "g.228148488G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227283772G>A" "" "likely benign" "" "0000607752" "0" "90" "2" "228148517" "228148517" "del" "0" "02327" "COL4A3_000658" "g.228148517del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227283801del" "" "pathogenic" "" "0000607753" "0" "70" "2" "228148537" "228148537" "subst" "0" "02327" "COL4A3_000659" "g.228148537G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227283821G>A" "" "likely pathogenic" "" "0000607754" "0" "70" "2" "228148945" "228148945" "subst" "0" "02327" "COL4A3_000660" "g.228148945G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227284229G>T" "" "likely pathogenic" "" "0000607755" "0" "70" "2" "228148999" "228148999" "subst" "0" "02327" "COL4A3_000661" "g.228148999G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227284283G>A" "" "likely pathogenic" "" "0000607756" "0" "30" "2" "228149006" "228149006" "subst" "0.000479655" "02327" "COL4A3_000055" "g.228149006C>T" "" "" "" "COL4A3(NM_000091.4):c.2826C>T (p.P942=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227284290C>T" "" "likely benign" "" "0000607757" "0" "70" "2" "228149061" "228149061" "subst" "0" "02327" "COL4A3_000420" "g.228149061G>C" "" "" "" "COL4A3(NM_000091.4):c.2881G>C (p.G961R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227284345G>C" "" "likely pathogenic" "" "0000607758" "0" "70" "2" "228149062" "228149062" "subst" "0" "02327" "COL4A3_000662" "g.228149062G>T" "" "" "" "COL4A3(NM_000091.4):c.2881+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227284346G>T" "" "likely pathogenic" "" "0000607759" "0" "30" "2" "228153870" "228153870" "subst" "0.000802411" "02327" "COL4A3_000198" "g.228153870C>T" "" "" "" "COL4A3(NM_000091.4):c.2886C>T (p.F962=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227289154C>T" "" "likely benign" "" "0000607760" "0" "90" "2" "228154800" "228154800" "del" "0" "02327" "COL4A3_000663" "g.228154800del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227290084del" "" "pathogenic" "" "0000607761" "0" "70" "2" "228155481" "228155481" "subst" "0" "02327" "COL4A3_000664" "g.228155481G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227290765G>T" "" "likely pathogenic" "" "0000607762" "0" "90" "2" "228155566" "228155566" "subst" "0" "02327" "COL4A3_000665" "g.228155566T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227290850T>G" "" "pathogenic" "" "0000607763" "0" "50" "2" "228155574" "228155574" "subst" "0.000211946" "02327" "COL4A3_000666" "g.228155574G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227290858G>A" "" "VUS" "" "0000607764" "0" "30" "2" "228157951" "228157951" "subst" "7.31131E-5" "02327" "COL4A3_000667" "g.228157951G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227293235G>A" "" "likely benign" "" "0000607765" "0" "30" "2" "228157954" "228157954" "subst" "0.00431364" "02327" "COL4A3_000203" "g.228157954G>A" "" "" "" "COL4A3(NM_000091.4):c.3258G>A (p.G1086=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227293238G>A" "" "likely benign" "" "0000607766" "0" "30" "2" "228157975" "228157975" "subst" "8.1246E-6" "01943" "COL4A3_000668" "g.228157975T>C" "" "" "" "COL4A3(NM_000091.4):c.3279T>C (p.H1093=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227293259T>C" "" "likely benign" "" "0000607767" "0" "90" "2" "228158004" "228158004" "dup" "0" "02327" "COL4A3_000669" "g.228158004dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227293288dup" "" "pathogenic" "" "0000607768" "0" "30" "2" "228158021" "228158021" "subst" "0.00431634" "02327" "COL4A3_000065" "g.228158021C>T" "" "" "" "COL4A3(NM_000091.4):c.3325C>T (p.P1109S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227293305C>T" "" "likely benign" "" "0000607769" "0" "50" "2" "228158024" "228158024" "subst" "8.12909E-6" "02327" "COL4A3_000670" "g.228158024G>C" "" "" "" "COL4A3(NM_000091.4):c.3328G>C (p.G1110R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227293308G>C" "" "VUS" "" "0000607770" "0" "70" "2" "228158035" "228158035" "subst" "4.06597E-6" "02327" "COL4A3_000671" "g.228158035T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227293319T>C" "" "likely pathogenic" "" "0000607771" "0" "70" "2" "228159270" "228159287" "del" "0" "02327" "COL4A3_000672" "g.228159270_228159287del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227294554_227294571del" "" "likely pathogenic" "" "0000607772" "0" "10" "2" "228159641" "228159641" "subst" "0.124033" "02327" "COL4A3_000673" "g.228159641C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227294925C>T" "" "benign" "" "0000607773" "0" "10" "2" "228159665" "228159665" "subst" "0" "02327" "COL4A3_000674" "g.228159665T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227294949T>G" "" "benign" "" "0000607774" "0" "70" "2" "228159751" "228159751" "subst" "0" "02327" "COL4A3_000675" "g.228159751G>A" "" "" "" "COL4A3(NM_000091.4):c.3490G>A (p.G1164S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227295035G>A" "" "likely pathogenic" "" "0000607775" "0" "30" "2" "228162451" "228162451" "subst" "0.00272322" "02327" "COL4A3_000676" "g.228162451G>A" "" "" "" "COL4A3(NM_000091.4):c.3627G>A (p.M1209I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227297735G>A" "" "likely benign" "" "0000607776" "0" "30" "2" "228162468" "228162468" "subst" "0.000155006" "01943" "COL4A3_000078" "g.228162468G>A" "" "" "" "COL4A3(NM_000091.4):c.3644G>A (p.R1215Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227297752G>A" "" "likely benign" "" "0000607777" "0" "30" "2" "228162547" "228162547" "subst" "0" "02327" "COL4A3_000677" "g.228162547T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227297831T>C" "" "likely benign" "" "0000607778" "0" "70" "2" "228162557" "228162557" "subst" "0" "02327" "COL4A3_000678" "g.228162557G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227297841G>A" "" "likely pathogenic" "" "0000607779" "0" "10" "2" "228162641" "228162641" "subst" "0" "02327" "COL4A3_000082" "g.228162641C>T" "" "" "" "COL4A3(NM_000091.4):c.3751+66C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227297925C>T" "" "benign" "" "0000607780" "0" "30" "2" "228163538" "228163538" "subst" "0.000298312" "02327" "COL4A3_000679" "g.228163538G>A" "" "" "" "COL4A3(NM_000091.4):c.3882+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227298822G>A" "" "likely benign" "" "0000607781" "0" "30" "2" "228168714" "228168714" "subst" "0" "02327" "COL4A3_000680" "g.228168714T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227303998T>A" "" "likely benign" "" "0000607782" "0" "30" "2" "228168741" "228168741" "subst" "8.1283E-6" "01943" "COL4A3_000332" "g.228168741G>A" "" "" "" "COL4A3(NM_000091.4):c.4034G>A (p.R1345H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227304025G>A" "" "likely benign" "" "0000607783" "0" "30" "2" "228168748" "228168748" "subst" "0.0063374" "02327" "COL4A3_000089" "g.228168748C>A" "" "" "" "COL4A3(NM_000091.4):c.4041C>A (p.(Asp1347Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227304032C>A" "" "likely benign" "" "0000607785" "0" "30" "2" "228169795" "228169795" "subst" "0" "02327" "COL4A3_000682" "g.228169795G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227305079G>A" "" "likely benign" "" "0000607786" "0" "30" "2" "228169826" "228169826" "subst" "0.00176546" "02327" "COL4A3_000683" "g.228169826G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227305110G>A" "" "likely benign" "" "0000607787" "0" "10" "2" "228172375" "228172375" "subst" "0.0453801" "02327" "COL4A3_000684" "g.228172375G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227307659G>A" "" "benign" "" "0000607788" "0" "50" "2" "228172543" "228172543" "subst" "4.06223E-6" "02327" "COL4A3_000685" "g.228172543T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227307827T>C" "" "VUS" "" "0000607789" "0" "70" "2" "228172552" "228172552" "subst" "0" "02327" "COL4A3_000686" "g.228172552G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227307836G>C" "" "likely pathogenic" "" "0000607790" "0" "30" "2" "228172571" "228172571" "subst" "0.000101583" "02327" "COL4A3_000214" "g.228172571A>C" "" "" "" "COL4A3(NM_000091.4):c.4398A>C (p.P1466=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227307855A>C" "" "likely benign" "" "0000607791" "0" "70" "2" "228172592" "228172592" "del" "0" "02327" "COL4A3_000687" "g.228172592del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227307876del" "" "likely pathogenic" "" "0000607792" "0" "90" "2" "228172593" "228172597" "del" "0" "02327" "COL4A3_000095" "g.228172593_228172597del" "" "" "" "COL4A3(NM_000091.4):c.4420_4424delCTTTT (p.L1474Cfs*34)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227307877_227307881del" "" "pathogenic" "" "0000607793" "0" "50" "2" "228172594" "228172594" "subst" "0.00270685" "01804" "COL4A3_000093" "g.228172594T>C" "" "" "" "COL4A3(NM_000091.4):c.4421T>C (p.L1474P, p.(Leu1474Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227307878T>C" "" "VUS" "" "0000607794" "0" "70" "2" "228172614" "228172614" "subst" "0" "02327" "COL4A3_000097" "g.228172614C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227307898C>T" "" "likely pathogenic" "" "0000607795" "0" "30" "2" "228173636" "228173636" "subst" "0.00625315" "02327" "COL4A3_000100" "g.228173636A>G" "" "" "" "COL4A3(NM_000091.4):c.4484A>G (p.Q1495R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227308920A>G" "" "likely benign" "" "0000607796" "0" "30" "2" "228173646" "228173646" "subst" "0.000581339" "02327" "COL4A3_000336" "g.228173646C>G" "" "" "" "COL4A3(NM_000091.4):c.4494C>G (p.T1498=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227308930C>G" "" "likely benign" "" "0000607797" "0" "50" "2" "228173943" "228173943" "subst" "4.8746E-5" "02327" "COL4A3_000621" "g.228173943C>T" "" "" "" "COL4A3(NM_000091.4):c.4664C>T (p.A1555V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227309227C>T" "" "VUS" "" "0000607798" "0" "30" "2" "228173944" "228173944" "subst" "0.00235602" "02327" "COL4A3_000339" "g.228173944G>A" "" "" "" "COL4A3(NM_000091.4):c.4665G>A (p.A1555=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227309228G>A" "" "likely benign" "" "0000607799" "0" "90" "2" "228175539" "228175539" "del" "8.12704E-6" "02327" "COL4A3_000600" "g.228175539del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227310823del" "" "pathogenic" "" "0000607800" "0" "30" "2" "228175629" "228175629" "subst" "0.00322998" "02327" "COL4A3_000220" "g.228175629C>T" "" "" "" "COL4A3(NM_000091.4):c.4893C>T (p.F1631=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227310913C>T" "" "likely benign" "" "0000607801" "0" "70" "2" "228176555" "228176555" "subst" "2.43782E-5" "02327" "COL4A3_000688" "g.228176555G>A" "" "" "" "COL4A3(NM_000091.5):c.4982G>A (p.(Arg1661His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227311839G>A" "" "likely pathogenic" "" "0000620979" "0" "50" "2" "228147228" "228147228" "subst" "5.68967E-5" "01943" "COL4A3_000612" "g.228147228C>T" "" "" "" "COL4A3(NM_000091.4):c.2636C>T (p.P879L, p.(Pro879Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227282512C>T" "" "VUS" "" "0000650479" "1" "30" "2" "228110691" "228110691" "subst" "0.00485981" "03575" "COL4A3_000009" "g.228110691C>A" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous, no homozygous; {DB:CLININrs115324397}" "Germline" "" "rs115324397" "0" "" "" "g.227245975C>A" "" "likely benign" "" "0000650480" "1" "30" "2" "228118867" "228118867" "subst" "0.0230539" "03575" "COL4A3_000188" "g.228118867G>A" "118/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "118 heterozygous; {DB:CLININrs80109666}" "Germline" "" "rs80109666" "0" "" "" "g.227254151G>A" "" "likely benign" "" "0000650481" "1" "30" "2" "228147093" "228147093" "subst" "0.0119505" "03575" "COL4A3_000050" "g.228147093A>G" "22/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "22 heterozygous, no homozygous; {DB:CLININrs56226424}" "Germline" "" "rs56226424" "0" "" "" "g.227282377A>G" "" "likely benign" "" "0000650482" "1" "30" "2" "228163453" "228163453" "subst" "0.0450209" "03575" "COL4A3_000084" "g.228163453C>A" "94/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "94 heterozygous; {DB:CLININrs57611801}" "Germline" "" "rs57611801" "0" "" "" "g.227298737C>A" "" "likely benign" "" "0000654579" "0" "30" "2" "228102732" "228102732" "subst" "0.000166537" "02326" "COL4A3_000689" "g.228102732G>A" "" "" "" "COL4A3(NM_000091.4):c.136G>A (p.G46R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227238016G>A" "" "likely benign" "" "0000654580" "0" "50" "2" "228147195" "228147195" "subst" "0" "02327" "COL4A3_000690" "g.228147195G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227282479G>C" "" "VUS" "" "0000654581" "0" "30" "2" "228157954" "228157954" "subst" "0.00431364" "02326" "COL4A3_000203" "g.228157954G>A" "" "" "" "COL4A3(NM_000091.4):c.3258G>A (p.G1086=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227293238G>A" "" "likely benign" "" "0000654582" "0" "30" "2" "228162381" "228162381" "subst" "0.00123244" "02326" "COL4A3_000618" "g.228162381T>C" "" "" "" "COL4A3(NM_000091.4):c.3566-9T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227297665T>C" "" "likely benign" "" "0000654583" "0" "30" "2" "228172571" "228172571" "subst" "0.000101583" "01943" "COL4A3_000214" "g.228172571A>C" "" "" "" "COL4A3(NM_000091.4):c.4398A>C (p.P1466=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227307855A>C" "" "likely benign" "" "0000654584" "0" "30" "2" "228173944" "228173944" "subst" "1.62484E-5" "01943" "COL4A3_000691" "g.228173944G>T" "" "" "" "COL4A3(NM_000091.4):c.4665G>T (p.A1555=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.227309228G>T" "" "likely benign" "" "0000660436" "3" "90" "2" "228029482" "228029505" "del" "0" "02367" "COL4A3_000003" "g.228029482_228029505del" "" "" "" "" "" "Germline" "yes" "rs876657397" "0" "" "" "g.227164766_227164789del" "" "pathogenic (recessive)" "" "0000660437" "0" "90" "2" "228131198" "228131198" "subst" "0" "02367" "COL4A3_000692" "g.228131198G>C" "" "" "" "" "" "Germline/De novo (untested)" "" "rs1135401954" "0" "" "" "g.227266482G>C" "" "pathogenic (dominant)" "" "0000660438" "11" "90" "2" "228141194" "228141194" "subst" "0" "02367" "COL4A3_000693" "g.228141194G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.227276478G>T" "" "pathogenic (dominant)" "" "0000665278" "21" "90" "2" "228144508" "228144508" "subst" "0" "03641" "COL4A3_000528" "g.228144508G>C" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.227279792G>C" "" "likely pathogenic" "" "0000665279" "11" "70" "2" "228172594" "228172594" "subst" "0.00270685" "03641" "COL4A3_000093" "g.228172594T>C" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.227307878T>C" "" "likely pathogenic" "" "0000669610" "3" "30" "2" "228118867" "228118867" "subst" "0.0230539" "03575" "COL4A3_000188" "g.228118867G>A" "4/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "4 homozygous; {DB:CLININrs80109666}" "Germline" "" "rs80109666" "0" "" "" "g.227254151G>A" "" "likely benign" "" "0000669611" "3" "30" "2" "228163453" "228163453" "subst" "0.0450209" "03575" "COL4A3_000084" "g.228163453C>A" "3/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 homozygous; {DB:CLININrs57611801}" "Germline" "" "rs57611801" "0" "" "" "g.227298737C>A" "" "likely benign" "" "0000676536" "0" "30" "2" "228153870" "228153870" "subst" "0.000802411" "01943" "COL4A3_000198" "g.228153870C>T" "" "" "" "COL4A3(NM_000091.4):c.2886C>T (p.F962=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000676537" "0" "90" "2" "228155544" "228155544" "subst" "4.06497E-6" "02326" "COL4A3_000436" "g.228155544G>C" "" "" "" "COL4A3(NM_000091.4):c.3152G>C (p.G1051A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000676538" "0" "30" "2" "228173636" "228173636" "subst" "0.00625315" "02326" "COL4A3_000100" "g.228173636A>G" "" "" "" "COL4A3(NM_000091.4):c.4484A>G (p.Q1495R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000688675" "0" "50" "2" "228111402" "228111402" "subst" "0" "02327" "COL4A3_000694" "g.228111402G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000688676" "0" "30" "2" "228121132" "228121132" "subst" "0.00221356" "02326" "COL4A3_000487" "g.228121132C>G" "" "" "" "COL4A3(NM_000091.4):c.987+20C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000688677" "0" "90" "2" "228128661" "228128661" "subst" "0" "02326" "COL4A3_000695" "g.228128661G>A" "" "" "" "COL4A3(NM_000091.4):c.1315+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000688678" "0" "50" "2" "228135577" "228135577" "subst" "1.62475E-5" "01943" "COL4A3_000696" "g.228135577C>T" "" "" "" "COL4A3(NM_000091.4):c.1667C>T (p.P556L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000688679" "0" "30" "2" "228135578" "228135578" "subst" "4.06164E-5" "01943" "COL4A3_000697" "g.228135578G>A" "" "" "" "COL4A3(NM_000091.4):c.1668G>A (p.P556=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000688680" "0" "70" "2" "228162480" "228162480" "subst" "0" "02326" "COL4A3_000698" "g.228162480G>C" "" "" "" "COL4A3(NM_000091.4):c.3656G>C (p.G1219A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000688681" "0" "50" "2" "228172594" "228172594" "subst" "0.00270685" "02326" "COL4A3_000093" "g.228172594T>C" "" "" "" "COL4A3(NM_000091.4):c.4421T>C (p.L1474P, p.(Leu1474Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000712219" "0" "50" "2" "228149007" "228149007" "subst" "8.12962E-6" "03611" "COL4A3_000699" "g.228149007G>A" "" "{PMID:Kim 2022:35864128}, {DOI:Kim 2022:10.1038/s41598-022-16661-x}" "" "" "ACMG PM1, PM2, PP3" "Germline/De novo (untested)" "" "" "0" "" "" "g.227284291G>A" "" "VUS" "ACMG" "0000718575" "0" "10" "2" "228104760" "228104760" "subst" "0" "02327" "COL4A3_000700" "g.228104760C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718576" "0" "10" "2" "228109784" "228109784" "subst" "0" "02327" "COL4A3_000008" "g.228109784C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718577" "0" "10" "2" "228111412" "228111412" "subst" "0.00521223" "02327" "COL4A3_000184" "g.228111412G>A" "" "" "" "COL4A3(NM_000091.4):c.399G>A (p.G133=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718578" "0" "30" "2" "228118345" "228118345" "subst" "3.66214E-5" "02327" "COL4A3_000606" "g.228118345T>A" "" "" "" "COL4A3(NM_000091.4):c.756T>A (p.D252E, p.(Asp252Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000718579" "0" "10" "2" "228118403" "228118403" "subst" "0.815033" "02327" "COL4A3_000701" "g.228118403T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718580" "0" "10" "2" "228121101" "228121101" "subst" "0.168924" "02327" "COL4A3_000020" "g.228121101G>T" "" "" "" "COL4A3(NM_000091.5):c.976G>T (p.D326Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718581" "0" "10" "2" "228131215" "228131215" "subst" "0.00127275" "02327" "COL4A3_000192" "g.228131215T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718582" "0" "90" "2" "228137824" "228137824" "subst" "2.0616E-5" "02326" "COL4A3_000042" "g.228137824G>A" "" "" "" "COL4A3(NM_000091.4):c.1918G>A (p.G640R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000718583" "0" "10" "2" "228144706" "228144706" "subst" "0" "02327" "COL4A3_000702" "g.228144706G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718584" "0" "10" "2" "228145543" "228145543" "subst" "0" "02327" "COL4A3_000703" "g.228145543C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718585" "0" "10" "2" "228147093" "228147093" "subst" "0.0119505" "02327" "COL4A3_000050" "g.228147093A>G" "" "" "" "COL4A3(NM_000091.4):c.2501A>G (p.K834R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718586" "0" "30" "2" "228149006" "228149006" "subst" "0.000479655" "02326" "COL4A3_000055" "g.228149006C>T" "" "" "" "COL4A3(NM_000091.4):c.2826C>T (p.P942=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000718587" "0" "10" "2" "228149107" "228149107" "subst" "0.88168" "02327" "COL4A3_000704" "g.228149107A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718588" "0" "30" "2" "228162468" "228162468" "subst" "0.000155006" "02326" "COL4A3_000078" "g.228162468G>A" "" "" "" "COL4A3(NM_000091.4):c.3644G>A (p.R1215Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000718589" "0" "30" "2" "228172553" "228172553" "subst" "0.000987139" "02326" "COL4A3_000213" "g.228172553T>C" "" "" "" "COL4A3(NM_000091.4):c.4380T>C (p.C1460=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000718590" "0" "50" "2" "228173662" "228173662" "subst" "0.000247901" "01943" "COL4A3_000337" "g.228173662T>C" "" "" "" "COL4A3(NM_000091.4):c.4510T>C (p.F1504L, p.(Phe1504Leu)), COL4A3(NM_000091.5):c.4510T>C (p.F1504L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718591" "0" "10" "2" "228176901" "228176901" "subst" "0" "02327" "COL4A3_000705" "g.228176901A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718592" "0" "10" "2" "228177479" "228177479" "subst" "0" "02327" "COL4A3_000706" "g.228177479C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718593" "0" "10" "2" "228177751" "228177751" "subst" "0" "02327" "COL4A3_000707" "g.228177751G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718594" "0" "10" "2" "228177825" "228177825" "subst" "0" "02327" "COL4A3_000708" "g.228177825C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718595" "0" "10" "2" "228178780" "228178780" "subst" "0" "02327" "COL4A3_000709" "g.228178780A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000718596" "0" "10" "2" "228179238" "228179238" "subst" "0" "02327" "COL4A3_000710" "g.228179238G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000786819" "3" "70" "2" "228118891" "228118891" "subst" "0" "00006" "COL4A3_000711" "g.228118891G>T" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.227254175G>T" "" "likely pathogenic" "" "0000788030" "11" "90" "2" "228167753" "228169800" "dup" "0" "04087" "COL4A3_000712" "g.(228163529_228167753)_(228169800_228172425)dup" "" "" "" "duplication ex44-47" "" "Germline" "no" "" "0" "" "" "g.(227298813_227303037)_(227305084_227307709)dup" "" "pathogenic" "ACMG" "0000788032" "21" "90" "2" "228160013" "228160015" "dup" "0" "04087" "COL4A3_000568" "g.228160013_228160015dup" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.227295297_227295299dup" "" "likely pathogenic" "ACMG" "0000788033" "0" "90" "2" "228122337" "228122337" "subst" "0" "04087" "COL4A3_000490" "g.228122337G>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000788043" "0" "70" "2" "228112275" "228112275" "subst" "1.21862E-5" "04087" "COL4A3_000267" "g.228112275G>T" "" "" "" "" "" "Germline" "?" "" "" "" "" "" "" "likely pathogenic" "ACMG" "0000788044" "0" "70" "2" "228142227" "228142227" "subst" "0.000106774" "04087" "COL4A3_000044" "g.228142227G>A" "" "" "" "" "" "Germline" "?" "" "" "" "" "" "" "likely pathogenic" "ACMG" "0000800449" "0" "70" "2" "228119406" "228119406" "subst" "0" "02326" "COL4A3_000714" "g.228119406G>T" "" "" "" "COL4A3(NM_000091.4):c.863G>T (p.G288V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000800450" "0" "30" "2" "228120724" "228120724" "subst" "0" "02327" "COL4A3_000715" "g.228120724G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800451" "0" "30" "2" "228121053" "228121053" "subst" "0.000101647" "02326" "COL4A3_000608" "g.228121053C>A" "" "" "" "COL4A3(NM_000091.4):c.934-6C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800452" "0" "50" "2" "228131783" "228131783" "subst" "0.000706806" "01943" "COL4A3_000290" "g.228131783C>T" "" "" "" "COL4A3(NM_000091.4):c.1483C>T (p.H495Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800453" "0" "70" "2" "228137746" "228137746" "subst" "0" "02326" "COL4A3_000432" "g.228137746G>A" "" "" "" "COL4A3(NM_000091.4):c.1840G>A (p.G614R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000800454" "0" "50" "2" "228142198" "228142198" "subst" "3.68041E-5" "01943" "COL4A3_000299" "g.228142198C>T" "" "" "" "COL4A3(NM_000091.4):c.2054C>T (p.P685L, p.(Pro685Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800455" "0" "30" "2" "228149006" "228149006" "subst" "0.000479655" "01943" "COL4A3_000055" "g.228149006C>T" "" "" "" "COL4A3(NM_000091.4):c.2826C>T (p.P942=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800456" "0" "30" "2" "228154765" "228154765" "subst" "0.000560511" "02326" "COL4A3_000199" "g.228154765C>T" "" "" "" "COL4A3(NM_000091.4):c.3031C>T (p.R1011C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800457" "0" "30" "2" "228155610" "228155610" "subst" "0.000117554" "01943" "COL4A3_000716" "g.228155610G>A" "" "" "" "COL4A3(NM_000091.4):c.3210+8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800458" "0" "30" "2" "228162380" "228162380" "subst" "0.00069998" "02326" "COL4A3_000717" "g.228162380T>C" "" "" "" "COL4A3(NM_000091.4):c.3566-10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800459" "0" "50" "2" "228167820" "228167820" "subst" "4.46766E-5" "02327" "COL4A3_000582" "g.228167820G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800460" "0" "30" "2" "228172467" "228172467" "subst" "8.1248E-6" "01943" "COL4A3_000718" "g.228172467C>A" "" "" "" "COL4A3(NM_000091.4):c.4294C>A (p.R1432S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800461" "0" "30" "2" "228173646" "228173646" "subst" "0.000581339" "02326" "COL4A3_000336" "g.228173646C>G" "" "" "" "COL4A3(NM_000091.4):c.4494C>G (p.T1498=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800462" "0" "50" "2" "228173662" "228173662" "subst" "0.000247901" "02325" "COL4A3_000337" "g.228173662T>C" "" "" "" "COL4A3(NM_000091.4):c.4510T>C (p.F1504L, p.(Phe1504Leu)), COL4A3(NM_000091.5):c.4510T>C (p.F1504L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000827861" "0" "50" "2" "228159682" "228159682" "subst" "0" "00000" "COL4A3_000720" "g.228159682C>A" "" "{PMID:Zacchia 2021:33964006}" "" "COL4A3 c.3421C>A, p.L1141I" "heterozygous; unsolved" "Unknown" "?" "" "0" "" "" "g.227294966C>A" "" "VUS" "ACMG" "0000827901" "0" "50" "2" "228159677" "228159677" "subst" "0" "00000" "COL4A3_000719" "g.228159677C>A" "" "{PMID:Zacchia 2021:33964006}" "" "COL4A3 c.3419-3C>A, spl" "heterozygous; unsolved" "Unknown" "?" "" "0" "" "" "g.227294961C>A" "" "VUS" "ACMG" "0000827902" "0" "50" "2" "228172415" "228172415" "subst" "7.72823E-5" "00000" "COL4A3_000721" "g.228172415G>C" "" "{PMID:Zacchia 2021:33964006}" "" "COL4A3 c.4253-11G>C, spl" "heterozygous; unsolved" "Unknown" "?" "" "0" "" "" "g.227307699G>C" "" "VUS" "ACMG" "0000839838" "0" "90" "2" "228145304" "228145310" "del" "0" "04087" "COL4A3_000534" "g.228145304_228145310del" "" "" "" "2372_2374+4delGAGGTAC" "" "Germline" "yes" "" "0" "" "" "g.227280588_227280594del" "" "likely pathogenic" "ACMG" "0000839851" "0" "90" "2" "228109073" "228109073" "subst" "0" "04087" "COL4A3_000465" "g.228109073G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000839852" "2" "90" "2" "228120751" "228120751" "subst" "2.03178E-5" "04087" "COL4A3_000278" "g.228120751G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000839853" "0" "90" "2" "228147081" "228147081" "subst" "0" "04087" "COL4A3_000542" "g.228147081G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000839854" "0" "90" "2" "228169782" "228169782" "subst" "0" "04087" "COL4A3_000587" "g.228169782G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000839855" "0" "90" "2" "228172453" "228172453" "subst" "0" "04087" "COL4A3_000590" "g.228172453G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000839905" "0" "90" "2" "228029444" "228029444" "subst" "0" "04087" "COL4A3_000457" "g.228029444T>A" "" "" "" "Met1Lys" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000842622" "0" "70" "2" "228157958" "228157958" "subst" "0" "03779" "COL4A3_000722" "g.228157958C>T" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000846524" "20" "70" "2" "228147090" "228147090" "subst" "4.06233E-6" "01164" "COL4A3_000306" "g.228147090G>A" "" "" "" "" "ACMG: PM1_STR, PM5, PM2_SUP, PP3" "Germline" "yes" "" "" "" "" "" "" "likely pathogenic (dominant)" "ACMG" "0000849776" "0" "30" "2" "228102758" "228102758" "subst" "0.000251877" "02326" "COL4A3_000723" "g.228102758T>G" "" "" "" "COL4A3(NM_000091.4):c.144+18T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000849777" "0" "30" "2" "228104936" "228104936" "subst" "0.00165397" "02326" "COL4A3_000007" "g.228104936G>T" "" "" "" "COL4A3(NM_000091.4):c.222G>T (p.P74=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000849778" "0" "10" "2" "228111412" "228111412" "subst" "0.00521223" "02326" "COL4A3_000184" "g.228111412G>A" "" "" "" "COL4A3(NM_000091.4):c.399G>A (p.G133=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000849779" "0" "30" "2" "228113203" "228113203" "subst" "6.09667E-5" "02326" "COL4A3_000724" "g.228113203C>T" "" "" "" "COL4A3(NM_000091.4):c.513C>T (p.G171=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000849780" "0" "70" "2" "228157944" "228157944" "subst" "0" "02326" "COL4A3_000726" "g.228157944G>A" "" "" "" "COL4A3(NM_000091.4):c.3248G>A (p.G1083E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000849781" "0" "30" "2" "228163471" "228163471" "subst" "0.000345455" "02326" "COL4A3_000209" "g.228163471C>T" "" "" "" "COL4A3(NM_000091.4):c.3825C>T (p.H1275=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000849782" "0" "50" "2" "228172599" "228172599" "subst" "0" "01943" "COL4A3_000727" "g.228172599G>A" "" "" "" "COL4A3(NM_000091.4):c.4426G>A (p.V1476I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000858391" "0" "90" "2" "228113210" "228113210" "subst" "0" "02326" "COL4A3_000629" "g.228113210G>T" "" "" "" "COL4A3(NM_000091.4):c.520G>T (p.G174W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000858392" "0" "30" "2" "228118041" "228118041" "subst" "5.69194E-5" "01943" "COL4A3_000725" "g.228118041T>G" "" "" "" "COL4A3(NM_000091.4):c.675T>G (p.H225Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858393" "0" "10" "2" "228162451" "228162451" "subst" "0.00272322" "02326" "COL4A3_000676" "g.228162451G>A" "" "" "" "COL4A3(NM_000091.4):c.3627G>A (p.M1209I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000858394" "0" "50" "2" "228173750" "228173750" "subst" "4.06266E-6" "02326" "COL4A3_000728" "g.228173750T>C" "" "" "" "COL4A3(NM_000091.4):c.4598T>C (p.M1533T), COL4A3(NM_000091.5):c.4598T>C (p.(Met1533Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000869078" "0" "70" "2" "228168740" "228168740" "subst" "0" "00006" "COL4A3_000729" "g.228168740C>G" "" "{PMID:Schuermans 2022:35606766}" "" "" "ACMG PM1, PM2, PP2, BP4, PP4" "Germline/De novo (untested)" "" "" "0" "" "" "g.227304024C>G" "" "likely pathogenic (recessive)" "" "0000873615" "0" "70" "2" "228124585" "228124585" "subst" "0" "00000" "COL4A3_000730" "g.228124585G>A" "223" "{PMID:Sun 2018:30076350}" "" "COL4A3(NM_000091.4):c.1106G>A(p.G369D)" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.227259869G>A" "" "likely pathogenic" "" "0000873637" "0" "70" "2" "228173943" "228173943" "subst" "4.8746E-5" "00000" "COL4A3_000621" "g.228173943C>T" "239" "{PMID:Sun 2018:30076350}" "" "COL4A3(NM_000091.4):c.4664C>T( p.A1555V); COL4A4(NM_000092.4):c.870G>T(p.K290N )" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.227309227C>T" "" "likely pathogenic" "" "0000879970" "0" "70" "2" "228118354" "228118354" "subst" "4.07123E-6" "00006" "COL4A3_000276" "g.228118354G>A" "" "{PMID:He 2022:35121647}" "" "" "ACMG PM2, PP1, PP4, PM4" "Germline/De novo (untested)" "" "" "0" "" "" "g.227253638G>A" "" "likely pathogenic" "ACMG" "0000884984" "0" "30" "2" "228029513" "228029513" "subst" "0.000809091" "02326" "COL4A3_000179" "g.228029513C>G" "" "" "" "COL4A3(NM_000091.4):c.71C>G (p.A24G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000884985" "0" "30" "2" "228029515" "228029515" "subst" "0.00144312" "02326" "COL4A3_000180" "g.228029515C>T" "" "" "" "COL4A3(NM_000091.4):c.73C>T (p.P25S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000884986" "0" "30" "2" "228110691" "228110691" "subst" "0.00485981" "02325" "COL4A3_000009" "g.228110691C>A" "" "" "" "COL4A3(NM_000091.5):c.346C>A (p.P116T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000884987" "0" "30" "2" "228121101" "228121101" "subst" "0.168924" "02325" "COL4A3_000020" "g.228121101G>T" "" "" "" "COL4A3(NM_000091.5):c.976G>T (p.D326Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000884988" "0" "30" "2" "228128562" "228128562" "subst" "2.03269E-5" "02326" "COL4A3_000731" "g.228128562G>A" "" "" "" "COL4A3(NM_000091.4):c.1217G>A (p.R406Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000884989" "0" "30" "2" "228134615" "228134615" "subst" "0.00219124" "02326" "COL4A3_000732" "g.228134615T>C" "" "" "" "COL4A3(NM_000091.4):c.1505-11T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000884990" "0" "10" "2" "228135471" "228135471" "subst" "0.0460597" "02327" "COL4A3_000733" "g.228135471T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000884991" "0" "30" "2" "228141097" "228141097" "subst" "3.65791E-5" "02327" "COL4A3_000734" "g.228141097T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000884992" "0" "50" "2" "228141146" "228141146" "subst" "1.21886E-5" "02327" "COL4A3_000735" "g.228141146C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000884993" "0" "70" "2" "228145713" "228145713" "subst" "6.24002E-6" "02327" "COL4A3_000736" "g.228145713G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000884994" "0" "70" "2" "228147186" "228147186" "subst" "0" "02326" "COL4A3_000737" "g.228147186G>A" "" "" "" "COL4A3(NM_000091.4):c.2594G>A (p.G865D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000884995" "0" "10" "2" "228159666" "228159666" "subst" "0" "02327" "COL4A3_000424" "g.228159666T>G" "" "" "" "COL4A3(NM_000091.4):c.3419-14T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000884996" "0" "30" "2" "228159676" "228159676" "dup" "0" "02326" "COL4A3_000738" "g.228159676dup" "" "" "" "COL4A3(NM_000091.4):c.3419-4dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000884997" "0" "90" "2" "228159751" "228159751" "subst" "0" "02326" "COL4A3_000675" "g.228159751G>A" "" "" "" "COL4A3(NM_000091.4):c.3490G>A (p.G1164S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000884998" "0" "70" "2" "228162399" "228162399" "subst" "0" "02327" "COL4A3_000572" "g.228162399G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000884999" "0" "30" "2" "228167810" "228167810" "subst" "0.000207135" "02326" "COL4A3_000211" "g.228167810G>A" "" "" "" "COL4A3(NM_000091.4):c.3939G>A (p.G1313=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885000" "0" "50" "2" "228168795" "228168795" "subst" "0" "02326" "COL4A3_000681" "g.228168795C>G" "" "" "" "COL4A3(NM_000091.4):c.4088C>G (p.P1363R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000908893" "0" "90" "2" "228149062" "228149062" "subst" "0" "00006" "COL4A3_000552" "g.228149062G>A" "" "{PMID:Bournazos 2022:34906502}" "" "" "" "De novo" "" "" "0" "" "" "g.227284346G>A" "" "pathogenic (dominant)" "" "0000911618" "0" "70" "2" "228111420" "228111420" "subst" "0" "02326" "COL4A3_000739" "g.228111420G>T" "" "" "" "COL4A3(NM_000091.4):c.407G>T (p.G136V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000911619" "0" "70" "2" "228128519" "228128519" "subst" "0" "02326" "COL4A3_000646" "g.228128519G>A" "" "" "" "COL4A3(NM_000091.4):c.1174G>A (p.G392R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000911620" "0" "30" "2" "228128655" "228128655" "subst" "9.34602E-5" "02327" "COL4A3_000189" "g.228128655C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000911621" "0" "90" "2" "228131171" "228131171" "subst" "4.06296E-6" "02326" "COL4A3_000501" "g.228131171G>A" "" "" "" "COL4A3(NM_000091.4):c.1354G>A (p.G452R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000911622" "0" "50" "2" "228131759" "228131759" "subst" "0.000101548" "02326" "COL4A3_000740" "g.228131759G>A" "" "" "" "COL4A3(NM_000091.4):c.1459G>A (p.G487S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000911623" "0" "70" "2" "228145261" "228145261" "subst" "0" "02326" "COL4A3_000302" "g.228145261G>T" "" "" "" "COL4A3(NM_000091.4):c.2329G>T (p.G777C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000911624" "0" "90" "2" "228149062" "228149062" "subst" "0" "02326" "COL4A3_000662" "g.228149062G>T" "" "" "" "COL4A3(NM_000091.4):c.2881+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000911625" "0" "90" "2" "228163475" "228163475" "subst" "0.000382058" "02326" "COL4A3_000085" "g.228163475G>A" "" "" "" "COL4A3(NM_000091.4):c.3829G>A (p.G1277S), COL4A3(NM_000091.5):c.3829G>A (p.(Gly1277Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000911626" "0" "30" "2" "228163538" "228163538" "subst" "0.000298312" "02326" "COL4A3_000679" "g.228163538G>A" "" "" "" "COL4A3(NM_000091.4):c.3882+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000911627" "0" "90" "2" "228172521" "228172521" "subst" "0" "02327" "COL4A3_000741" "g.228172521C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000911628" "0" "90" "2" "228172593" "228172597" "del" "0" "02326" "COL4A3_000095" "g.228172593_228172597del" "" "" "" "COL4A3(NM_000091.4):c.4420_4424delCTTTT (p.L1474Cfs*34)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000920732" "0" "10" "2" "228104760" "228104760" "subst" "0" "00006" "COL4A3_000700" "g.228104760C>T" "" "{PMID:Plevova 2023:36844206}" "" "45-99C>T" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs7579991" "0" "" "" "g.227240044C>T" "" "benign" "" "0000920733" "0" "10" "2" "228109627" "228109628" "ins" "0" "00006" "COL4A3_000742" "g.228109627_228109628insG" "" "{PMID:Plevova 2023:36844206}" "" "280-39_40insG" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "" "0" "" "" "g.227244911_227244912insG" "" "benign" "" "0000920734" "0" "10" "2" "228109784" "228109784" "subst" "0" "00006" "COL4A3_000008" "g.228109784C>T" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs6750210" "0" "" "" "g.227245068C>T" "" "benign" "" "0000920735" "0" "10" "2" "228111435" "228111435" "subst" "0.833927" "00006" "COL4A3_000012" "g.228111435T>C" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs10178458" "0" "" "" "g.227246719T>C" "" "benign" "" "0000920736" "0" "10" "2" "228111600" "228111600" "subst" "0.823226" "00006" "COL4A3_000743" "g.228111600G>T" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs10168566" "0" "" "" "g.227246884G>T" "" "benign" "" "0000920737" "0" "10" "2" "228111604" "228111604" "subst" "0.821993" "00006" "COL4A3_000744" "g.228111604G>T" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs10168567" "0" "" "" "g.227246888G>T" "" "benign" "" "0000920738" "0" "10" "2" "228112186" "228112186" "subst" "0" "00006" "COL4A3_000745" "g.228112186A>G" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs4321358" "0" "" "" "g.227247470A>G" "" "benign" "" "0000920739" "0" "10" "2" "228112439" "228112439" "subst" "0" "00006" "COL4A3_000746" "g.228112439C>T" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs12612699" "0" "" "" "g.227247723C>T" "" "benign" "" "0000920740" "0" "10" "2" "228113175" "228113175" "subst" "0.834079" "00006" "COL4A3_000015" "g.228113175A>G" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs6436669" "0" "" "" "g.227248459A>G" "" "benign" "" "0000920741" "0" "10" "2" "228118403" "228118403" "subst" "0.815033" "00006" "COL4A3_000701" "g.228118403T>G" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs12621551" "0" "" "" "g.227253687T>G" "" "benign" "" "0000920742" "0" "10" "2" "228121147" "228121147" "subst" "0.101936" "00006" "COL4A3_000642" "g.228121147T>G" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs73993878" "0" "" "" "g.227256431T>G" "" "benign" "" "0000920743" "0" "10" "2" "228135426" "228135426" "subst" "0" "00006" "COL4A3_000747" "g.228135426G>A" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs6436672" "0" "" "" "g.227270710G>A" "" "benign" "" "0000920744" "0" "10" "2" "228128540" "228128540" "subst" "0.767892" "00006" "COL4A3_000023" "g.228128540C>T" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs10205042" "0" "" "" "g.227263824C>T" "" "benign" "" "0000920745" "0" "10" "2" "228144706" "228144706" "subst" "0" "00006" "COL4A3_000702" "g.228144706G>T" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs6729152" "0" "" "" "g.227279990G>T" "" "benign" "" "0000920746" "0" "10" "2" "228145388" "228145388" "subst" "0" "00006" "COL4A3_000748" "g.228145388A>G" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "" "0" "" "" "g.227280672A>G" "" "benign" "" "0000920747" "0" "10" "2" "228149107" "228149107" "subst" "0.88168" "00006" "COL4A3_000704" "g.228149107A>G" "" "{PMID:Plevova 2023:36844206}" "" "" "variant in COL4A4:c.1598G>A homozygote" "Germline" "" "rs6436672" "0" "" "" "g.227284391A>G" "" "benign" "" "0000920783" "3" "90" "2" "228111428" "228111428" "subst" "0" "00006" "COL4A3_000441" "g.228111428G>C" "" "{PMID:Plevova 2023:36844206}" "" "" "" "Germline" "" "" "0" "" "" "g.227246712G>C" "" "pathogenic (recessive)" "" "0000920784" "1" "90" "2" "228111428" "228111428" "subst" "0" "00006" "COL4A3_000441" "g.228111428G>C" "" "{PMID:Plevova 2023:36844206}" "" "" "" "Germline" "" "" "0" "" "" "g.227246712G>C" "" "pathogenic (dominant)" "" "0000920785" "2" "90" "2" "228111428" "228111428" "subst" "0" "00006" "COL4A3_000441" "g.228111428G>C" "" "{PMID:Plevova 2023:36844206}" "" "" "possible digenic inheritance" "Germline" "" "" "0" "" "" "g.227246712G>C" "" "pathogenic (dominant)" "" "0000923640" "0" "30" "2" "228115882" "228115882" "subst" "0.000170723" "02326" "COL4A3_000749" "g.228115882T>C" "" "" "" "COL4A3(NM_000091.4):c.573T>C (p.P191=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000923641" "0" "70" "2" "228119381" "228119381" "subst" "0" "02326" "COL4A3_000483" "g.228119381G>A" "" "" "" "COL4A3(NM_000091.4):c.838G>A (p.(Gly280Arg), p.G280R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000923642" "0" "90" "2" "228141110" "228141110" "dup" "0" "02326" "COL4A3_000227" "g.228141110dup" "" "" "" "COL4A3(NM_000091.4):c.1937dupG (p.E647Rfs*45)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000923643" "0" "50" "2" "228153963" "228153963" "subst" "0" "02327" "COL4A3_000750" "g.228153963A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000923644" "0" "70" "2" "228158034" "228158034" "subst" "4.0659E-6" "02327" "COL4A3_000751" "g.228158034G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000923645" "0" "70" "2" "228162416" "228162416" "subst" "0" "02326" "COL4A3_000074" "g.228162416G>A" "" "" "" "COL4A3(NM_000091.4):c.3592G>A (p.(Gly1198Ser), p.G1198S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000923646" "0" "90" "2" "228162444" "228162444" "subst" "0" "02326" "COL4A3_000075" "g.228162444G>A" "" "" "" "COL4A3(NM_000091.4):c.3620G>A (p.G1207E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000923647" "0" "50" "2" "228173675" "228173675" "subst" "0.000215377" "02327" "COL4A3_000595" "g.228173675A>G" "" "" "" "COL4A3(NM_000091.4):c.4523A>G (p.N1508S, p.(Asn1508Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000923648" "0" "50" "2" "228175508" "228175508" "subst" "4.87559E-5" "02325" "COL4A3_000437" "g.228175508C>T" "" "" "" "COL4A3(NM_000091.5):c.4772C>T (p.(Ser1591Phe), p.S1591F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000928547" "0" "30" "2" "228109731" "228109731" "subst" "0.000134312" "02326" "COL4A3_000752" "g.228109731C>T" "" "" "" "COL4A3(NM_000091.4):c.324+20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000928548" "0" "50" "2" "228135662" "228135662" "subst" "1.62905E-5" "02327" "COL4A3_000650" "g.228135662C>T" "" "" "" "COL4A3(NM_000091.4):c.1752C>T (p.G584=), COL4A3(NM_000091.5):c.1752C>T (p.(Gly584=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000928549" "0" "70" "2" "228145261" "228145261" "subst" "0" "02327" "COL4A3_000302" "g.228145261G>T" "" "" "" "COL4A3(NM_000091.4):c.2329G>T (p.G777C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000928550" "0" "30" "2" "228147073" "228147073" "subst" "0.000382353" "02326" "COL4A3_000655" "g.228147073G>A" "" "" "" "COL4A3(NM_000091.4):c.2489-8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000928551" "0" "90" "2" "228172583" "228172583" "del" "0" "02327" "COL4A3_000753" "g.228172583del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000944359" "0" "90" "2" "228112275" "228112275" "subst" "1.21862E-5" "00006" "COL4A3_000267" "g.228112275G>T" "" "{PMID:Boucher 2020:33229591}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.227247559G>T" "" "pathogenic (dominant)" "" "0000944360" "0" "70" "2" "228162515" "228162515" "subst" "0" "00006" "COL4A3_000754" "g.228162515G>A" "" "{PMID:Boucher 2020:33229591}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.227297799G>A" "" "likely pathogenic (dominant)" "" "0000944361" "0" "70" "2" "228173927" "228173928" "ins" "0" "00006" "COL4A3_000755" "g.228173927_228173928insAC" "" "{PMID:Boucher 2020:33229591}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.227309211_227309212insAC" "" "likely pathogenic (dominant)" "" "0000947780" "0" "90" "2" "228112275" "228112275" "subst" "1.21862E-5" "02325" "COL4A3_000267" "g.228112275G>T" "" "" "" "COL4A3(NM_000091.5):c.443G>T (p.G148V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000947781" "0" "90" "2" "228118840" "228118840" "subst" "0" "02327" "COL4A3_000480" "g.228118840G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000947782" "0" "30" "2" "228119357" "228119357" "subst" "0.000406547" "02326" "COL4A3_000638" "g.228119357C>T" "" "" "" "COL4A3(NM_000091.4):c.829-15C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000947783" "0" "30" "2" "228124491" "228124491" "subst" "0.00314225" "02326" "COL4A3_000643" "g.228124491G>A" "" "" "" "COL4A3(NM_000091.4):c.1030-18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000947784" "0" "70" "2" "228128520" "228128522" "del" "0" "02326" "COL4A3_000756" "g.228128520_228128522del" "" "" "" "COL4A3(NM_000091.4):c.1175_1177delGAG (p.G392del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000947785" "0" "30" "2" "228147063" "228147063" "subst" "0.00122199" "02326" "COL4A3_000757" "g.228147063T>A" "" "" "" "COL4A3(NM_000091.4):c.2489-18T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000947786" "0" "50" "2" "228154757" "228154757" "subst" "0" "02326" "COL4A3_000758" "g.228154757C>A" "" "" "" "COL4A3(NM_000091.4):c.3023C>A (p.P1008Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000947787" "0" "70" "2" "228158024" "228158024" "subst" "8.12909E-6" "02326" "COL4A3_000670" "g.228158024G>C" "" "" "" "COL4A3(NM_000091.4):c.3328G>C (p.G1110R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000947788" "0" "50" "2" "228173960" "228173960" "subst" "4.06197E-6" "02326" "COL4A3_000759" "g.228173960C>T" "" "" "" "COL4A3(NM_000091.4):c.4681C>T (p.H1561Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000952542" "0" "90" "2" "228118354" "228118354" "subst" "4.07123E-6" "04609" "COL4A3_000276" "g.228118354G>A" "" "" "" "" "" "Germline" "yes" "rs869025328" "0" "" "" "g.227253638G>A" "" "pathogenic (dominant)" "other" "0000952543" "0" "90" "2" "228118354" "228118354" "subst" "4.07123E-6" "04609" "COL4A3_000276" "g.228118354G>A" "" "" "" "" "" "Germline" "yes" "rs869025328" "0" "" "" "g.227253638G>A" "" "pathogenic (dominant)" "" "0000952544" "0" "90" "2" "228118354" "228118354" "subst" "4.07123E-6" "04609" "COL4A3_000276" "g.228118354G>A" "" "" "" "" "" "Germline" "yes" "rs869025328" "0" "" "" "g.227253638G>A" "" "pathogenic (dominant)" "" "0000959245" "0" "50" "2" "228176554" "228176554" "subst" "0.000365663" "00006" "COL4A3_000110" "g.228176554C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PP3" "Germline" "" "" "0" "" "" "g.227311838C>T" "" "VUS" "ACMG" "0000961949" "0" "30" "2" "228118345" "228118345" "subst" "3.66214E-5" "02326" "COL4A3_000606" "g.228118345T>A" "" "" "" "COL4A3(NM_000091.4):c.756T>A (p.D252E, p.(Asp252Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000961950" "0" "90" "2" "228120751" "228120751" "subst" "2.03178E-5" "02326" "COL4A3_000278" "g.228120751G>A" "" "" "" "COL4A3(NM_000091.4):c.898G>A (p.G300R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000961951" "0" "70" "2" "228125815" "228125815" "subst" "0" "02326" "COL4A3_000282" "g.228125815G>A" "" "" "" "COL4A3(NM_000091.4):c.1132G>A (p.G378R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000961952" "0" "70" "2" "228145608" "228145608" "subst" "0" "02326" "COL4A3_000760" "g.228145608G>A" "" "" "" "COL4A3(NM_000091.4):c.2375-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000961953" "0" "70" "2" "228159983" "228159983" "subst" "0" "02326" "COL4A3_000761" "g.228159983A>G" "" "" "" "COL4A3(NM_000091.4):c.3518-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000961954" "0" "30" "2" "228173944" "228173944" "subst" "0.00235602" "02326" "COL4A3_000339" "g.228173944G>A" "" "" "" "COL4A3(NM_000091.4):c.4665G>A (p.A1555=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000972100" "11" "90" "2" "228144508" "228144508" "subst" "0" "03676" "COL4A3_000762" "g.228144508G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.227279792G>A" "" "pathogenic (dominant)" "ACMG" "0000975052" "0" "30" "2" "228029485" "228029496" "del" "0" "01804" "COL4A3_000460" "g.228029485_228029496del" "" "" "" "COL4A3(NM_000091.5):c.43_54del (p.(Pro15_Leu18del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000975053" "0" "50" "2" "228102732" "228102732" "subst" "0.000166537" "02327" "COL4A3_000689" "g.228102732G>A" "" "" "" "COL4A3(NM_000091.4):c.136G>A (p.G46R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975054" "0" "70" "2" "228109035" "228109035" "subst" "0" "02326" "COL4A3_000763" "g.228109035G>A" "" "" "" "COL4A3(NM_000091.4):c.235-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000975055" "0" "50" "2" "228124570" "228124570" "subst" "8.12764E-6" "01804" "COL4A3_000609" "g.228124570C>T" "" "" "" "COL4A3(NM_000091.4):c.1091C>T (p.P364L), COL4A3(NM_000091.5):c.1091C>T (p.(Pro364Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975056" "0" "30" "2" "228128677" "228128677" "subst" "8.13292E-6" "02327" "COL4A3_000764" "g.228128677G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000975057" "0" "30" "2" "228134676" "228134676" "subst" "0" "02326" "COL4A3_000765" "g.228134676A>G" "" "" "" "COL4A3(NM_000091.4):c.1555A>G (p.T519A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000975058" "0" "50" "2" "228141151" "228141151" "subst" "1.62493E-5" "01804" "COL4A3_000766" "g.228141151C>A" "" "" "" "COL4A3(NM_000091.5):c.1978C>A (p.(Pro660Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975059" "0" "50" "2" "228144569" "228144569" "subst" "0" "01804" "COL4A3_000767" "g.228144569C>A" "" "" "" "COL4A3(NM_000091.5):c.2186C>A (p.(Pro729His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975060" "0" "50" "2" "228149039" "228149039" "subst" "0" "01804" "COL4A3_000768" "g.228149039C>G" "" "" "" "COL4A3(NM_000091.5):c.2859C>G (p.(Asp953Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975061" "0" "70" "2" "228163475" "228163475" "subst" "0.000382058" "01804" "COL4A3_000085" "g.228163475G>A" "" "" "" "COL4A3(NM_000091.4):c.3829G>A (p.G1277S), COL4A3(NM_000091.5):c.3829G>A (p.(Gly1277Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000975062" "0" "50" "2" "228175508" "228175508" "subst" "4.87559E-5" "01804" "COL4A3_000437" "g.228175508C>T" "" "" "" "COL4A3(NM_000091.5):c.4772C>T (p.(Ser1591Phe), p.S1591F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975063" "0" "90" "2" "228176554" "228176554" "subst" "0.000365663" "01804" "COL4A3_000110" "g.228176554C>T" "" "" "" "COL4A3(NM_000091.4):c.4981C>T (p.(Arg1661Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000975064" "0" "70" "2" "228176555" "228176555" "subst" "2.43782E-5" "01804" "COL4A3_000688" "g.228176555G>A" "" "" "" "COL4A3(NM_000091.5):c.4982G>A (p.(Arg1661His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000992603" "0" "50" "2" "228104886" "228104886" "subst" "2.49736E-5" "01804" "COL4A3_000181" "g.228104886G>A" "" "" "" "COL4A3(NM_000091.4):c.172G>A (p.(Gly58Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992604" "0" "30" "2" "228112288" "228112288" "subst" "0" "01804" "COL4A3_000769" "g.228112288G>T" "" "" "" "COL4A3(NM_000091.4):c.456G>T (p.(Leu152Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992605" "0" "30" "2" "228116068" "228116068" "subst" "0" "01804" "COL4A3_000770" "g.228116068T>C" "" "" "" "COL4A3(NM_000091.4):c.626T>C (p.(Met209Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992606" "0" "30" "2" "228118345" "228118345" "subst" "3.66214E-5" "01804" "COL4A3_000606" "g.228118345T>A" "" "" "" "COL4A3(NM_000091.4):c.756T>A (p.D252E, p.(Asp252Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992607" "0" "70" "2" "228118354" "228118354" "subst" "4.07123E-6" "02327" "COL4A3_000276" "g.228118354G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000992608" "0" "50" "2" "228124551" "228124551" "subst" "0" "01804" "COL4A3_000771" "g.228124551A>T" "" "" "" "COL4A3(NM_000091.4):c.1072A>T (p.(Thr358Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992609" "0" "50" "2" "228128601" "228128601" "subst" "4.06253E-5" "01804" "COL4A3_000498" "g.228128601C>A" "" "" "" "COL4A3(NM_000091.4):c.1256C>A (p.(Ser419Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992610" "0" "50" "2" "228128601" "228128601" "subst" "4.06253E-5" "02327" "COL4A3_000498" "g.228128601C>A" "" "" "" "COL4A3(NM_000091.4):c.1256C>A (p.(Ser419Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992611" "0" "30" "2" "228137793" "228137793" "subst" "1.23289E-5" "02327" "COL4A3_000772" "g.228137793G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992612" "0" "30" "2" "228142198" "228142198" "subst" "3.68041E-5" "01804" "COL4A3_000299" "g.228142198C>T" "" "" "" "COL4A3(NM_000091.4):c.2054C>T (p.P685L, p.(Pro685Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992613" "0" "30" "2" "228145292" "228145292" "subst" "1.21857E-5" "01804" "COL4A3_000773" "g.228145292T>C" "" "" "" "COL4A3(NM_000091.4):c.2360T>C (p.(Leu787Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992614" "0" "90" "2" "228145686" "228145686" "subst" "0" "02326" "COL4A3_000235" "g.228145686G>A" "" "" "" "COL4A3(NM_000091.4):c.2452G>A (p.G818R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000992615" "0" "70" "2" "228147080" "228147080" "subst" "0" "02327" "COL4A3_000774" "g.228147080G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000992616" "0" "70" "2" "228148545" "228148545" "subst" "0" "02327" "COL4A3_000775" "g.228148545G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000992617" "0" "70" "2" "228154742" "228154742" "subst" "0" "01804" "COL4A3_000776" "g.228154742G>A" "" "" "" "COL4A3(NM_000091.4):c.3008G>A (p.(Gly1003Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000992618" "0" "50" "2" "228159284" "228159284" "subst" "0" "02327" "COL4A3_000318" "g.228159284C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992619" "0" "50" "2" "228162416" "228162416" "subst" "0" "01804" "COL4A3_000074" "g.228162416G>A" "" "" "" "COL4A3(NM_000091.4):c.3592G>A (p.(Gly1198Ser), p.G1198S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992620" "0" "30" "2" "228163496" "228163496" "subst" "2.03292E-5" "01804" "COL4A3_000777" "g.228163496A>G" "" "" "" "COL4A3(NM_000091.4):c.3850A>G (p.(Thr1284Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992621" "0" "50" "2" "228169701" "228169701" "subst" "4.0699E-6" "01804" "COL4A3_000778" "g.228169701G>A" "" "" "" "COL4A3(NM_000091.4):c.4154G>A (p.(Gly1385Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992622" "0" "50" "2" "228173662" "228173662" "subst" "0.000247901" "01804" "COL4A3_000337" "g.228173662T>C" "" "" "" "COL4A3(NM_000091.4):c.4510T>C (p.F1504L, p.(Phe1504Leu)), COL4A3(NM_000091.5):c.4510T>C (p.F1504L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992623" "0" "30" "2" "228173675" "228173675" "subst" "0.000215377" "01804" "COL4A3_000595" "g.228173675A>G" "" "" "" "COL4A3(NM_000091.4):c.4523A>G (p.N1508S, p.(Asn1508Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992624" "0" "50" "2" "228176567" "228176567" "subst" "2.43809E-5" "01804" "COL4A3_000242" "g.228176567G>A" "" "" "" "COL4A3(NM_000091.4):c.4994G>A (p.(Cys1665Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001013683" "0" "90" "2" "228148536" "228148536" "subst" "0" "02326" "COL4A3_000779" "g.228148536G>A" "" "" "" "COL4A3(NM_000091.4):c.2710G>A (p.G904R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001013684" "0" "70" "2" "228159716" "228159739" "del" "0" "02326" "COL4A3_000780" "g.228159716_228159739del" "" "" "" "COL4A3(NM_000091.4):c.3455_3478delGTATAAGAGGTGACCAAGGACGTG (p.G1152_R1159del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001024551" "0" "30" "2" "228029487" "228029487" "subst" "0.00078714" "02326" "COL4A3_000781" "g.228029487G>A" "" "" "" "COL4A3(NM_000091.4):c.45G>A (p.P15=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001024552" "0" "70" "2" "228135504" "228135504" "subst" "4.06184E-6" "02326" "COL4A3_000782" "g.228135504G>C" "" "" "" "COL4A3(NM_000091.4):c.1594G>C (p.G532R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001024553" "0" "90" "2" "228144518" "228144518" "subst" "0" "02326" "COL4A3_000652" "g.228144518G>T" "" "" "" "COL4A3(NM_000091.4):c.2135G>T (p.G712V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001033062" "0" "50" "2" "228029459" "228029459" "subst" "0" "01804" "COL4A3_000783" "g.228029459C>A" "" "" "" "COL4A3(NM_000091.5):c.17C>A (p.(Ala6Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033063" "0" "70" "2" "228111456" "228111456" "subst" "0" "01804" "COL4A3_000470" "g.228111456T>C" "" "" "" "COL4A3(NM_000091.5):c.441+2T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001033064" "0" "30" "2" "228115847" "228115847" "subst" "0.0431689" "01804" "COL4A3_000405" "g.228115847A>C" "" "" "" "COL4A3(NM_000091.4):c.547-9A>C, COL4A3(NM_000091.5):c.547-9A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001033065" "0" "70" "2" "228135504" "228135504" "subst" "8.12367E-6" "02327" "COL4A3_000784" "g.228135504G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001033066" "0" "30" "2" "228135662" "228135662" "subst" "1.62905E-5" "01804" "COL4A3_000650" "g.228135662C>T" "" "" "" "COL4A3(NM_000091.4):c.1752C>T (p.G584=), COL4A3(NM_000091.5):c.1752C>T (p.(Gly584=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001033067" "0" "50" "2" "228168613" "228168613" "subst" "0" "01804" "COL4A3_000785" "g.228168613C>T" "" "" "" "COL4A3(NM_000091.5):c.3994C>T (p.(Pro1332Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033068" "0" "30" "2" "228176548" "228176548" "subst" "1.62517E-5" "01804" "COL4A3_000221" "g.228176548A>G" "" "" "" "COL4A3(NM_000091.5):c.4975A>G (p.(Ile1659Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001049401" "0" "70" "2" "228175618" "228175618" "subst" "0.000109795" "04656" "COL4A3_000786" "g.228175618T>G" "" "{PMID:Khan 2024:39271758}, {DOI:Khan 2024:10.1038/s41598-024-71407-1}" "" "" "ACMG LP, PS4, PM2" "Germline" "" "" "0" "" "" "g.227310902T>G" "• VCV000397613.10" "likely pathogenic" "" "0001051105" "0" "50" "2" "228115899" "228115899" "subst" "4.06458E-6" "01804" "COL4A3_000787" "g.228115899C>G" "" "" "" "COL4A3(NM_000091.5):c.590C>G (p.(Pro197Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001051106" "0" "50" "2" "228145615" "228145615" "subst" "0" "02327" "COL4A3_000788" "g.228145615C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001051107" "0" "50" "2" "228155600" "228155600" "subst" "8.25294E-6" "01804" "COL4A3_000789" "g.228155600A>G" "" "" "" "COL4A3(NM_000091.5):c.3208A>G (p.(Thr1070Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001051108" "0" "50" "2" "228163502" "228163502" "subst" "6.50703E-5" "01804" "COL4A3_000790" "g.228163502G>A" "" "" "" "COL4A3(NM_000091.5):c.3856G>A (p.(Gly1286Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001051109" "0" "50" "2" "228173750" "228173750" "subst" "4.06266E-6" "01804" "COL4A3_000728" "g.228173750T>C" "" "" "" "COL4A3(NM_000091.4):c.4598T>C (p.M1533T), COL4A3(NM_000091.5):c.4598T>C (p.(Met1533Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001051110" "0" "70" "2" "228176583" "228176600" "del" "0" "02327" "COL4A3_000791" "g.228176583_228176600del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001063799" "0" "50" "2" "228172594" "228172594" "subst" "0.00270685" "02325" "COL4A3_000093" "g.228172594T>C" "" "" "" "COL4A3(NM_000091.4):c.4421T>C (p.L1474P, p.(Leu1474Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001068016" "0" "90" "2" "228109073" "228109073" "subst" "0" "04908" "COL4A3_000792" "g.228109073G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.227244357G>A" "" "pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes COL4A3 ## Count = 1163 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000038900" "00005463" "70" "3829" "0" "3829" "0" "c.3829G>A" "r.(?)" "p.(Gly1277Ser)" "43" "0000038903" "00005463" "70" "4504" "0" "4504" "0" "c.4504T>C" "r.(?)" "p.(Phe1502Leu)" "49" "0000039310" "00005463" "70" "4028" "-3" "4028" "-3" "c.4028-3C>A" "r.4028_4153del" "p.Val1344_G1385del" "45i" "0000149573" "00005463" "30" "-10" "0" "-10" "0" "c.-10C>T" "r.(?)" "p.(=)" "1" "0000149574" "00005463" "97" "1" "0" "1" "0" "c.1A>T" "r.(?)" "p.0?" "1" "0000149575" "00005463" "97" "40" "0" "63" "0" "c.40_63del" "r.(?)" "p.(Leu14_Leu21del)" "1" "0000149576" "00005463" "97" "40" "0" "63" "0" "c.40_63del" "r.(?)" "p.(Leu14_Leu21del)" "1" "0000149577" "00005463" "00" "127" "0" "127" "0" "c.127G>A" "r.(?)" "p.(Gly43Arg)" "2" "0000149578" "00005463" "00" "127" "0" "127" "0" "c.127G>A" "r.(?)" "p.(Gly43Arg)" "2" "0000149579" "00005463" "00" "127" "0" "127" "0" "c.127G>A" "r.(?)" "p.(Gly43Arg)" "2" "0000149580" "00005463" "13" "127" "0" "127" "0" "c.127G>C" "r.(?)" "p.(Gly43Arg)" "2" "0000149581" "00005463" "13" "127" "0" "127" "0" "c.127G>C" "r.(?)" "p.(Gly43Arg)" "2" "0000149582" "00005463" "13" "127" "0" "127" "0" "c.127G>C" "r.(?)" "p.(Gly43Arg)" "2" "0000149583" "00005463" "00" "144" "12" "144" "12" "c.144+12C>A" "r.(?)" "p.(=)" "2i" "0000149584" "00005463" "00" "144" "12" "144" "12" "c.144+12C>A" "r.(?)" "p.(=)" "2i" "0000149585" "00005463" "00" "144" "12" "144" "12" "c.144+12C>A" "r.(?)" "p.(=)" "2i" "0000149586" "00005463" "00" "222" "0" "222" "0" "c.222G>T" "r.(?)" "p.(Pro74Pro)" "3" "0000149587" "00005463" "30" "324" "73" "324" "73" "c.324+73C>T" "r.(?)" "p.(=)" "5i" "0000149588" "00005463" "00" "346" "0" "346" "0" "c.346C>A" "r.(?)" "p.(Pro116Thr)" "6" "0000149589" "00005463" "97" "351" "0" "351" "0" "c.351C>A" "r.(?)" "p.(Tyr117*)" "6" "0000149590" "00005463" "97" "390" "0" "390" "0" "c.390dup" "r.(?)" "p.(Glu131*)" "7" "0000149591" "00005463" "00" "422" "0" "422" "0" "c.422T>C" "r.(?)" "p.(Leu141Pro)" "7" "0000149592" "00005463" "97" "872" "0" "872" "0" "c.872G>A" "r.(?)" "p.(Gly291Glu)" "15" "0000149593" "00005463" "70" "434" "0" "434" "0" "c.434G>A" "r.(?)" "p.(Gly145Glu)" "7" "0000149594" "00005463" "00" "473" "0" "473" "0" "c.473C>A" "r.(?)" "p.(Ala158Asp)" "9" "0000149595" "00005463" "00" "473" "0" "473" "0" "c.473C>A" "r.(?)" "p.(Ala158Asp)" "9" "0000149596" "00005463" "00" "485" "0" "485" "0" "c.485A>G" "r.(?)" "p.(Glu162Gly)" "9" "0000149597" "00005463" "00" "485" "0" "485" "0" "c.485A>G" "r.(?)" "p.(Glu162Gly)" "9" "0000149598" "00005463" "13" "485" "0" "485" "0" "c.485A>G" "r.(?)" "p.(Glu162Gly)" "9" "0000149599" "00005463" "13" "485" "0" "485" "0" "c.485A>G" "r.(?)" "p.(Glu162Gly)" "9" "0000149600" "00005463" "13" "485" "0" "485" "0" "c.485A>G" "r.(?)" "p.(Glu162Gly)" "9" "0000149601" "00005463" "13" "485" "0" "485" "0" "c.485A>G" "r.(?)" "p.(Glu162Gly)" "9" "0000149602" "00005463" "13" "485" "0" "485" "0" "c.485A>G" "r.(?)" "p.(Glu162Gly)" "9" "0000149603" "00005463" "13" "485" "0" "485" "0" "c.485A>G" "r.(?)" "p.(Glu162Gly)" "9" "0000149604" "00005463" "00" "878" "0" "878" "0" "c.878C>G" "r.(?)" "p.(Pro293Arg)" "15" "0000149605" "00005463" "00" "878" "0" "878" "0" "c.878C>G" "r.(?)" "p.(Pro293Arg)" "15" "0000149606" "00005463" "30" "888" "30" "888" "30" "c.888+30G>A" "r.(?)" "p.(=)" "15i" "0000149607" "00005463" "97" "890" "0" "890" "0" "c.890G>A" "r.(?)" "p.(Gly297Glu)" "16" "0000149608" "00005463" "00" "976" "0" "976" "0" "c.976G>T" "r.(?)" "p.(Asp326Tyr)" "17" "0000149609" "00005463" "13" "976" "0" "976" "0" "c.976G>T" "r.(?)" "p.(Asp326Tyr)" "17" "0000149610" "00005463" "13" "976" "0" "976" "0" "c.976G>T" "r.(?)" "p.(Asp326Tyr)" "17" "0000149611" "00005463" "13" "976" "0" "976" "0" "c.976G>T" "r.(?)" "p.(Asp326Tyr)" "17" "0000149612" "00005463" "00" "976" "0" "976" "0" "c.976G>T" "r.(?)" "p.(Asp326Tyr)" "17" "0000149613" "00005463" "00" "976" "0" "976" "0" "c.976G>T" "r.(?)" "p.(Asp326Tyr)" "17" "0000149614" "00005463" "30" "998" "-80" "998" "-80" "c.998-80T>C" "r.(?)" "p.(=)" "17i" "0000149615" "00005463" "97" "1111" "0" "1111" "0" "c.1111C>T" "r.(?)" "p.(Gln371*)" "19" "0000149616" "00005463" "97" "1216" "0" "1216" "0" "c.1216C>T" "r.(?)" "p.(Arg406*)" "21" "0000149617" "00005463" "00" "1223" "0" "1223" "0" "c.1223G>A" "r.(?)" "p.(Arg408His)" "21" "0000149618" "00005463" "00" "1223" "0" "1223" "0" "c.1223G>A" "r.(?)" "p.(Arg408His)" "21" "0000149619" "00005463" "00" "1223" "0" "1223" "0" "c.1223G>A" "r.(?)" "p.(Arg408His)" "21" "0000149620" "00005463" "00" "1223" "0" "1223" "0" "c.1223G>A" "r.(?)" "p.(Arg408His)" "21" "0000149621" "00005463" "97" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Gly439Ser)" "21" "0000149622" "00005463" "00" "1352" "0" "1352" "0" "c.1352A>G" "r.(?)" "p.(His451Arg)" "22" "0000149623" "00005463" "00" "1352" "0" "1352" "0" "c.1352A>G" "r.(?)" "p.(His451Arg)" "22" "0000149624" "00005463" "00" "1352" "0" "1352" "0" "c.1352A>G" "r.(?)" "p.(His451Arg)" "22" "0000149625" "00005463" "00" "1352" "0" "1352" "0" "c.1352A>G" "r.(?)" "p.(His451Arg)" "22" "0000149626" "00005463" "00" "1352" "0" "1352" "0" "c.1352A>G" "r.(?)" "p.(His451Arg)" "22" "0000149627" "00005463" "13" "1365" "0" "1365" "0" "c.1365C>A" "r.(?)" "p.(Gly455=)" "22" "0000149628" "00005463" "13" "1386" "0" "1386" "0" "c.1386C>A" "r.(?)" "p.(Ile462Ile)" "22" "0000149629" "00005463" "70" "1391" "0" "1391" "0" "c.1391G>T" "r.(?)" "p.(Gly464Val)" "22" "0000149630" "00005463" "70" "1391" "0" "1391" "0" "c.1391G>T" "r.(?)" "p.(Gly464Val)" "22" "0000149631" "00005463" "97" "1409" "-5" "1409" "-5" "c.1409-5T>A" "r.(?)" "p.?" "22i" "0000149632" "00005463" "00" "1452" "0" "1452" "0" "c.1452G>A" "r.(?)" "p.(Gly484=)" "23" "0000149633" "00005463" "13" "1452" "0" "1452" "0" "c.1452G>A" "r.(?)" "p.(Gly484=)" "23" "0000149634" "00005463" "13" "1452" "0" "1452" "0" "c.1452G>A" "r.(?)" "p.(Gly484=)" "23" "0000149635" "00005463" "13" "1452" "0" "1452" "0" "c.1452G>A" "r.(?)" "p.(Gly484=)" "23" "0000149636" "00005463" "00" "1452" "0" "1452" "0" "c.1452G>A" "r.(?)" "p.(Gly484=)" "23" "0000149637" "00005463" "70" "1459" "0" "1459" "0" "c.1459G>T" "r.(?)" "p.(Gly487Cys)" "23" "0000149638" "00005463" "97" "1504" "2" "1504" "2" "c.1504+2T>A" "r.spl" "p.?" "23i" "0000149639" "00005463" "97" "1594" "0" "1594" "0" "c.1594G>T" "r.(?)" "p.(Gly532Cys)" "25" "0000149640" "00005463" "70" "1595" "0" "1595" "0" "c.1595G>A" "r.(?)" "p.(Gly532Asp)" "25" "0000149641" "00005463" "00" "1721" "0" "1721" "0" "c.1721C>T" "r.(?)" "p.(Pro574Leu)" "25" "0000149642" "00005463" "00" "1721" "0" "1721" "0" "c.1721C>T" "r.(?)" "p.(Pro574Leu)" "25" "0000149643" "00005463" "00" "1721" "0" "1721" "0" "c.1721C>T" "r.(?)" "p.(Pro574Leu)" "25" "0000149644" "00005463" "97" "1750" "0" "1750" "0" "c.1750G>T" "r.(?)" "p.(Gly584Cys)" "25" "0000149645" "00005463" "97" "1786" "0" "1786" "0" "c.1786G>C" "r.(?)" "p.(Gly596Arg)" "26" "0000149646" "00005463" "97" "3725" "0" "3725" "0" "c.3725G>A" "r.(?)" "p.(Gly1242Asp)" "42" "0000149647" "00005463" "97" "3499" "0" "3499" "0" "c.3499G>A" "r.(?)" "p.(Gly1167Arg)" "40" "0000149648" "00005463" "00" "2070" "0" "2070" "0" "c.2070T>A" "r.(?)" "p.(Pro690=)" "28" "0000149649" "00005463" "70" "2083" "0" "2083" "0" "c.2083G>A" "r.(?)" "p.(Gly695Arg)" "28" "0000149650" "00005463" "13" "2208" "0" "2208" "0" "c.2208C>G" "r.(?)" "p.(Gly736=)" "29" "0000149651" "00005463" "70" "2215" "0" "2215" "0" "c.2215G>A" "r.(?)" "p.(Gly739Arg)" "29" "0000149652" "00005463" "70" "2224" "-11" "2224" "-11" "c.2224-11C>T" "r.(?)" "p.(=)" "29i" "0000149653" "00005463" "70" "2339" "0" "2339" "0" "c.2339G>A" "r.(?)" "p.(Gly780Glu)" "30" "0000149654" "00005463" "97" "2417" "0" "2417" "0" "c.2417dup" "r.(?)" "p.(Gly807Argfs*28)" "31" "0000149655" "00005463" "50" "2501" "0" "2501" "0" "c.2501A>G" "r.(?)" "p.(Lys834Arg)" "32" "0000149656" "00005463" "30" "2501" "0" "2501" "0" "c.2501A>G" "r.(?)" "p.(Lys834Arg)" "32" "0000149657" "00005463" "70" "2557" "0" "2557" "0" "c.2557G>A" "r.(?)" "p.(Gly853Arg)" "32" "0000149658" "00005463" "97" "2611" "0" "2611" "0" "c.2611G>T" "r.(?)" "p.(Gly871Cys)" "32" "0000149659" "00005463" "97" "2611" "0" "2611" "0" "c.2611G>T" "r.(?)" "p.(Gly871Cys)" "32" "0000149660" "00005463" "97" "2621" "0" "2622" "0" "c.2621_2622delinsT" "r.(?)" "p.(Gly874Valfs*9)" "32" "0000149661" "00005463" "97" "2621" "0" "2622" "0" "c.2621_2622delinsT" "r.(?)" "p.(Gly874Valfs*9)" "32" "0000149662" "00005463" "00" "2697" "0" "2697" "0" "c.2697C>A" "r.(?)" "p.(Ala899=)" "33" "0000149663" "00005463" "00" "2826" "0" "2826" "0" "c.2826C>T" "r.(?)" "p.(Pro942=)" "34" "0000149664" "00005463" "97" "2954" "0" "2954" "0" "c.2954G>T" "r.(?)" "p.(Gly985Val)" "35" "0000149665" "00005463" "97" "2980" "1" "2980" "1" "c.2980+1G>A" "r.spl" "p.?" "35i" "0000149666" "00005463" "97" "3044" "0" "3044" "0" "c.3044G>A" "r.(?)" "p.(Gly1015Glu)" "36" "0000149667" "00005463" "70" "3044" "0" "3044" "0" "c.3044G>A" "r.(?)" "p.(Gly1015Glu)" "36" "0000149668" "00005463" "70" "3044" "0" "3044" "0" "c.3044G>A" "r.(?)" "p.(Gly1015Glu)" "36" "0000149669" "00005463" "97" "3134" "0" "3134" "0" "c.3134G>T" "r.(?)" "p.(Gly1045Val)" "37" "0000149670" "00005463" "97" "4531" "0" "4534" "0" "c.4531_4534del" "r.(?)" "p.(Cys1511Ilefs*17)" "49" "0000149671" "00005463" "97" "3386" "0" "3412" "0" "c.3386_3412del" "r.(?)" "p.(Leu1129_Gly1137del)" "39" "0000149672" "00005463" "90" "3211" "-1" "3211" "-1" "c.3211-1G>T" "r.spl" "p.?" "37i" "0000149673" "00005463" "97" "3321" "0" "3329" "0" "c.3321_3329del" "r.(?)" "p.(Ser1108_Gly1110del)" "38" "0000149674" "00005463" "00" "3325" "0" "3325" "0" "c.3325C>T" "r.(?)" "p.(Pro1109Ser)" "38" "0000149675" "00005463" "30" "3325" "0" "3325" "0" "c.3325C>T" "r.(?)" "p.(Pro1109Ser)" "38" "0000149676" "00005463" "70" "3499" "0" "3499" "0" "c.3499G>A" "r.(?)" "p.(Gly1167Arg)" "40" "0000149677" "00005463" "70" "3518" "-7" "3518" "-7" "c.3518-7C>G" "r.(?)" "p.(=)" "40i" "0000149678" "00005463" "97" "3533" "0" "3533" "0" "c.3533del" "r.(?)" "p.(Pro1178Leufs*43)" "41" "0000149679" "00005463" "97" "3549" "0" "3549" "0" "c.3549dup" "r.(?)" "p.(Asn1184Glufs*125)" "41" "0000149680" "00005463" "70" "3548" "0" "3550" "0" "c.3548_3550dup" "r.(?)" "p.(Gly1183_Asn1184insArg)" "41" "0000149681" "00005463" "90" "3565" "1" "3565" "1" "c.3565+1del" "r.spl" "p.?" "41i" "0000149682" "00005463" "30" "3566" "-110" "3566" "-110" "c.3566-110T>G" "r.(?)" "p.(=)" "41i" "0000149683" "00005463" "97" "3592" "0" "3592" "0" "c.3592G>A" "r.(?)" "p.(Gly1198Ser)" "42" "0000149684" "00005463" "97" "3620" "0" "3620" "0" "c.3620G>A" "r.(?)" "p.(Gly1207Glu)" "42" "0000149685" "00005463" "70" "3622" "0" "3622" "0" "c.3622del" "r.(?)" "p.(Ala1208Profs*13)" "42" "0000149686" "00005463" "97" "3643" "0" "3643" "0" "c.3643C>T" "r.(?)" "p.(Arg1215*)" "42" "0000149687" "00005463" "70" "3644" "0" "3644" "0" "c.3644G>A" "r.(?)" "p.(Arg1215Gln)" "42" "0000149688" "00005463" "70" "3646" "0" "3646" "0" "c.3646G>A" "r.(?)" "p.(Gly1216Arg)" "42" "0000149689" "00005463" "97" "3655" "0" "3655" "0" "c.3655G>T" "r.(?)" "p.(Gly1219Cys)" "42" "0000149690" "00005463" "30" "3751" "66" "3751" "66" "c.3751+66C>T" "r.(?)" "p.(=)" "42i" "0000149691" "00005463" "90" "3752" "-2" "3752" "-2" "c.3752-2A>T" "r.spl" "p.?" "42i" "0000149692" "00005463" "00" "3807" "0" "3807" "0" "c.3807C>A" "r.(?)" "p.(Asp1269Glu)" "43" "0000149693" "00005463" "00" "3807" "0" "3807" "0" "c.3807C>A" "r.(?)" "p.(Asp1269Glu)" "43" "0000149694" "00005463" "00" "3807" "0" "3807" "0" "c.3807C>A" "r.(?)" "p.(Asp1269Glu)" "43" "0000149695" "00005463" "00" "3807" "0" "3807" "0" "c.3807C>A" "r.(?)" "p.(Asp1269Glu)" "43" "0000149696" "00005463" "90" "3829" "0" "3829" "0" "c.3829G>A" "r.(?)" "p.(Gly1277Ser)" "43" "0000149697" "00005463" "90" "3956" "-1" "3956" "-1" "c.3956-1G>A" "r.spl" "p.?" "44i" "0000149698" "00005463" "90" "4001" "0" "4001" "0" "c.4001G>A" "r.(?)" "p.(Gly1334Glu)" "45" "0000149699" "00005463" "97" "4001" "0" "4001" "0" "c.4001G>A" "r.(?)" "p.(Gly1334Glu)" "45" "0000149700" "00005463" "97" "4001" "0" "4001" "0" "c.4001G>A" "r.(?)" "p.(Gly1334Glu)" "45" "0000149701" "00005463" "30" "4041" "0" "4041" "0" "c.4041C>A" "r.(?)" "p.(Asp1347Glu)" "46" "0000149702" "00005463" "70" "4041" "0" "4041" "0" "c.4041C>A" "r.(?)" "p.(Asp1347Glu)" "46" "0000149703" "00005463" "70" "4235" "0" "4235" "0" "c.4235G>T" "r.(?)" "p.(Gly1412Val)" "47" "0000149704" "00005463" "97" "4280" "0" "4280" "0" "c.4280del" "r.(?)" "p.(Gly1427Valfs*2)" "48" "0000149705" "00005463" "00" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000149706" "00005463" "00" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000149707" "00005463" "00" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000149708" "00005463" "00" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000149709" "00005463" "00" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000149710" "00005463" "00" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000149711" "00005463" "00" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000149712" "00005463" "00" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000149713" "00005463" "00" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000149714" "00005463" "97" "4457" "0" "4462" "1" "c.4457_4462+1del" "r.(?)" "p.(Asp1486GlufsTer41)" "48" "0000149715" "00005463" "97" "4420" "0" "4424" "0" "c.4420_4424del" "r.(?)" "p.(Leu1474Cysfs*34)" "48" "0000149716" "00005463" "97" "4420" "0" "4424" "0" "c.4420_4424del" "r.(?)" "p.(Leu1474Cysfs*34)" "48" "0000149717" "00005463" "97" "4441" "0" "4441" "0" "c.4441C>T" "r.(?)" "p.(Arg1481*)" "48" "0000149718" "00005463" "97" "4441" "0" "4441" "0" "c.4441C>T" "r.(?)" "p.(Arg1481*)" "48" "0000149719" "00005463" "97" "4929" "-388" "4929" "-388" "c.4929-388G>T" "r.4928_4929ins4929-385_4929-312" "p.(=)" "48i" "0000149720" "00005463" "97" "4929" "-388" "4929" "-388" "c.4929-388G>T" "r.4928_4929ins4929-385_4929-312" "p.(=)" "48i" "0000149721" "00005463" "30" "4462" "11" "4462" "11" "c.4462+11A>T" "r.(?)" "p.(=)" "48i" "0000149722" "00005463" "30" "4484" "0" "4484" "0" "c.4484A>G" "r.(?)" "p.(Gln1495Arg)" "49" "0000149723" "00005463" "30" "4484" "0" "4484" "0" "c.4484A>G" "r.(?)" "p.(Gln1495Arg)" "49" "0000149724" "00005463" "00" "4484" "0" "4484" "0" "c.4484A>G" "r.(?)" "p.(Gln1495Arg)" "49" "0000149725" "00005463" "00" "4484" "0" "4484" "0" "c.4484A>G" "r.(?)" "p.(Gln1495Arg)" "49" "0000149726" "00005463" "97" "4486" "0" "4486" "0" "c.4486C>T" "r.(?)" "p.(Arg1496*)" "49" "0000149727" "00005463" "97" "4486" "0" "4486" "0" "c.4486C>T" "r.(?)" "p.(Arg1496*)" "49" "0000149728" "00005463" "97" "4508" "0" "4508" "0" "c.4508T>G" "r.(?)" "p.(Leu1503*)" "49" "0000149729" "00005463" "97" "4546" "0" "4546" "0" "c.4546C>T" "r.(?)" "p.(Arg1516*)" "49" "0000149730" "00005463" "97" "4546" "0" "4546" "0" "c.4546C>T" "r.(?)" "p.(Arg1516*)" "49" "0000149731" "00005463" "70" "4643" "0" "4643" "0" "c.4643G>A" "r.(?)" "p.(Cys1548Tyr)" "50" "0000149732" "00005463" "30" "4756" "-67" "4756" "-67" "c.4756-67del" "r.(?)" "p.(=)" "50i" "0000149733" "00005463" "97" "4981" "0" "4981" "0" "c.4981C>T" "r.(?)" "p.(Arg1661Cys)" "52" "0000149734" "00005463" "13" "422" "0" "422" "0" "c.422T>C" "r.(?)" "p.(Leu141Pro)" "7" "0000149735" "00005463" "13" "976" "0" "976" "0" "c.976G>T" "r.(?)" "p.(Asp326Tyr)" "17" "0000149736" "00005463" "13" "1195" "0" "1195" "0" "c.1195C>T" "r.(?)" "p.(Leu399=)" "21" "0000149737" "00005463" "00" "21" "0" "21" "0" "c.21C>A" "r.(?)" "p.(Pro7=)" "1" "0000149738" "00005463" "70" "71" "0" "71" "0" "c.71C>G" "r.(?)" "p.(Ala24Gly)" "1" "0000149739" "00005463" "70" "73" "0" "73" "0" "c.73C>T" "r.(?)" "p.(Pro25Ser)" "1" "0000149740" "00005463" "90" "172" "0" "172" "0" "c.172G>A" "r.(?)" "p.(Gly58Ser)" "3" "0000149741" "00005463" "00" "222" "0" "222" "0" "c.222G>A" "r.(?)" "p.(Pro74=)" "3" "0000149742" "00005463" "70" "233" "0" "233" "0" "c.233A>G" "r.(?)" "p.(Lys78Arg)" "3" "0000149743" "00005463" "00" "399" "0" "399" "0" "c.399G>A" "r.(?)" "p.(Gly133=)" "7" "0000149744" "00005463" "70" "494" "0" "494" "0" "c.494T>C" "r.(?)" "p.(Ile165Thr)" "9" "0000149745" "00005463" "70" "532" "0" "532" "0" "c.532G>A" "r.(?)" "p.(Ala178Thr)" "9" "0000149746" "00005463" "70" "686" "0" "686" "0" "c.686G>A" "r.(?)" "p.(Arg229Gln)" "12" "0000149747" "00005463" "70" "805" "0" "805" "0" "c.805G>A" "r.(?)" "p.(Glu269Lys)" "14" "0000149748" "00005463" "70" "1310" "0" "1310" "0" "c.1310C>T" "r.(?)" "p.(Pro437Leu)" "21" "0000149749" "00005463" "00" "1323" "0" "1323" "0" "c.1323C>A" "r.(?)" "p.(=)" "22" "0000149750" "00005463" "00" "1353" "0" "1353" "0" "c.1353C>T" "r.(?)" "p.(His451=)" "22" "0000149751" "00005463" "00" "1398" "0" "1398" "0" "c.1398T>C" "r.(?)" "p.(Asp466=)" "22" "0000149752" "00005463" "70" "1516" "0" "1516" "0" "c.1516G>A" "r.(?)" "p.(Ala506Thr)" "24" "0000149753" "00005463" "70" "1886" "0" "1886" "0" "c.1886C>T" "r.(?)" "p.(Thr629Met)" "26" "0000149754" "00005463" "00" "2391" "0" "2391" "0" "c.2391T>C" "r.(?)" "p.(Pro797=)" "31" "0000149755" "00005463" "77" "2475" "0" "2475" "0" "c.2475G>C" "r.(?)" "p.(Leu825Phe)" "31" "0000149756" "00005463" "00" "2715" "0" "2715" "0" "c.2715C>T" "r.(?)" "p.(Pro905=)" "33" "0000149757" "00005463" "00" "2886" "0" "2886" "0" "c.2886C>T" "r.(?)" "p.(Phe962=)" "35" "0000149758" "00005463" "77" "3031" "0" "3031" "0" "c.3031C>T" "r.(?)" "p.(Arg1011Cys)" "36" "0000149759" "00005463" "77" "3119" "0" "3119" "0" "c.3119G>C" "r.(?)" "p.(Arg1040Thr)" "37" "0000149760" "00005463" "97" "3200" "0" "3200" "0" "c.3200C>G" "r.(?)" "p.(Pro1067Arg)" "37" "0000149761" "00005463" "00" "3201" "0" "3201" "0" "c.3201G>A" "r.(?)" "p.(Pro1067=)" "37" "0000149762" "00005463" "00" "3258" "0" "3258" "0" "c.3258G>A" "r.(?)" "p.(Gly1086=)" "38" "0000149763" "00005463" "00" "3435" "0" "3435" "0" "c.3435A>T" "r.(?)" "p.(Pro1145=)" "40" "0000149764" "00005463" "70" "3476" "0" "3476" "0" "c.3476G>A" "r.(?)" "p.Arg1159His)" "40" "0000149765" "00005463" "70" "3475" "0" "3475" "0" "c.3475C>A" "r.(?)" "p.(Arg1159Ser)" "40" "0000149766" "00005463" "70" "3701" "0" "3701" "0" "c.3701T>A" "r.(?)" "p.(Ile1234Asn)" "42" "0000149767" "00005463" "00" "3756" "0" "3756" "0" "c.3756G>T" "r.(?)" "p.(Ala1252=)" "43" "0000149768" "00005463" "00" "3825" "0" "3825" "0" "c.3825C>T" "r.(?)" "p.(His1275=)" "43" "0000149769" "00005463" "70" "3917" "0" "3917" "0" "c.3917G>A" "r.(?)" "p.(Arg1306Lys)" "44" "0000149770" "00005463" "00" "3939" "0" "3939" "0" "c.3939G>A" "r.(?)" "p.(=)" "44" "0000149771" "00005463" "00" "3945" "0" "3945" "0" "c.3945A>G" "r.(?)" "p.(=)" "44" "0000149772" "00005463" "00" "4380" "0" "4380" "0" "c.4380T>C" "r.(?)" "p.(=)" "48" "0000149773" "00005463" "00" "4398" "0" "4398" "0" "c.4398A>C" "r.(?)" "p.(=)" "48" "0000149774" "00005463" "00" "4449" "0" "4449" "0" "c.4449C>T" "r.(?)" "p.(=)" "48" "0000149775" "00005463" "00" "4482" "0" "4482" "0" "c.4482G>A" "r.(?)" "p.(=)" "49" "0000149776" "00005463" "97" "4514" "0" "4514" "0" "c.4514G>T" "r.(?)" "p.(Cys1505Phe)" "49" "0000149777" "00005463" "00" "4707" "0" "4707" "0" "c.4707A>T" "r.(?)" "p.(=)" "50" "0000149778" "00005463" "90" "4851" "0" "4851" "0" "c.4851T>G" "r.(?)" "p.(His1617Gln)" "51" "0000149779" "00005463" "00" "4893" "0" "4893" "0" "c.4893C>T" "r.(?)" "p.(=)" "51" "0000149780" "00005463" "70" "4975" "0" "4975" "0" "c.4975A>G" "r.(?)" "p.(Ile1659Val)" "52" "0000149781" "00005463" "90" "4976" "0" "4976" "0" "c.4976T>C" "r.(?)" "p.(Ile1659Thr)" "52" "0000149782" "00005463" "50" "1786" "0" "1786" "0" "c.1786G>C" "r.(?)" "p.(Gly596Arg)" "26" "0000149783" "00005463" "50" "2245" "0" "2245" "0" "c.2245G>A" "r.(?)" "p.(Gly695Arg)" "28" "0000149784" "00005463" "70" "461" "0" "461" "0" "c.461G>C" "r.(?)" "p.(Gly154Ala)" "8" "0000149785" "00005463" "90" "663" "0" "664" "0" "c.663_664del" "r.(?)" "p.(Arg221Serfs*5)" "12" "0000149786" "00005463" "70" "1918" "0" "1918" "0" "c.1918G>A" "r.(?)" "p.(Gly640Arg)" "26" "0000149787" "00005463" "90" "3580" "0" "3580" "0" "c.3580del" "r.(?)" "p.(Arg1194Glyfs*27)" "42" "0000149788" "00005463" "70" "3472" "0" "3472" "0" "c.3472G>C" "r.(?)" "p.(Gly1158Arg)" "40" "0000149789" "00005463" "90" "3210" "1" "3210" "1" "c.3210+1G>A" "r.spl" "p.?" "37i" "0000149790" "00005463" "70" "2083" "0" "2083" "0" "c.2083G>A" "r.(?)" "p.(Gly695Arg)" "28" "0000149791" "00005463" "70" "2567" "0" "2567" "0" "c.2567G>A" "r.(?)" "p.(Gly856Glu)" "32" "0000149792" "00005463" "90" "2621" "0" "2622" "0" "c.2621_2622delinsT" "r.(?)" "p.(Gly874Valfs*9)" "32" "0000149793" "00005463" "70" "4981" "0" "4981" "0" "c.4981C>T" "r.(?)" "p.(Arg1661Cys)" "52" "0000149794" "00005463" "70" "4981" "0" "4981" "0" "c.4981C>T" "r.(?)" "p.(Arg1661Cys)" "52" "0000149795" "00005463" "70" "3760" "0" "3760" "0" "c.3760G>C" "r.(?)" "p.(Gly1254Arg)" "43" "0000149796" "00005463" "70" "4994" "0" "4994" "0" "c.4994G>A" "r.(?)" "p.(Cys1665Tyr)" "52" "0000149797" "00005463" "70" "4408" "0" "4408" "0" "c.4408G>T" "r.(?)" "p.(Gly1470Trp)" "48" "0000149798" "00005463" "90" "4347" "0" "4353" "0" "c.4347_4353del" "r.(?)" "p.(Arg1450Valfs*77)" "48" "0000149799" "00005463" "90" "162" "0" "162" "0" "c.162dup" "r.(?)" "p.(Gly55Trpfs*15)" "3" "0000149800" "00005463" "90" "2621" "0" "2622" "0" "c.2621_2622delinsT" "r.(?)" "p.(Gly874Valfs*9)" "32" "0000149801" "00005463" "70" "4981" "0" "4981" "0" "c.4981C>T" "r.(?)" "p.(Arg1661Cys)" "52" "0000149802" "00005463" "90" "2768" "0" "2778" "0" "c.2768_2778del" "r.(?)" "p.(Val923Glufs*13)" "34" "0000149803" "00005463" "00" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.0?" "1" "0000149804" "00005463" "00" "3" "0" "3" "0" "c.3G>A" "r.(?)" "p.0?" "1" "0000149805" "00005463" "00" "19" "0" "19" "0" "c.19C>A" "r.(?)" "p.(Pro7Thr)" "1" "0000149806" "00005463" "00" "40" "0" "63" "0" "c.40_63del" "r.(?)" "p.(Leu14_Leu21del)" "1" "0000149807" "00005463" "00" "40" "0" "66" "0" "c.40_66del" "r.(?)" "p.(Leu14_Ala22del)" "1" "0000149808" "00005463" "00" "96" "0" "96" "0" "c.96dup" "r.(?)" "p.(Cys33Leufs*2)" "2" "0000149809" "00005463" "00" "127" "0" "127" "0" "c.127G>C" "r.(?)" "p.(Gly43Arg)" "2" "0000149810" "00005463" "00" "162" "0" "162" "0" "c.162dup" "r.(?)" "p.(Gly55Trpfs*15)" "3" "0000149811" "00005463" "00" "162" "0" "162" "0" "c.162dup" "r.(?)" "p.(Gly55Trpfs*15)" "3" "0000149812" "00005463" "00" "162" "0" "162" "0" "c.162dup" "r.(?)" "p.(Gly55Trpfs*15)" "3" "0000149813" "00005463" "00" "222" "0" "222" "0" "c.222G>T" "r.(?)" "p.(=)" "3" "0000149814" "00005463" "00" "261" "0" "261" "0" "c.261G>A" "r.(?)" "p.(=)" "4" "0000149815" "00005463" "00" "346" "0" "346" "0" "c.346C>A" "r.(?)" "p.(Pro116Thr)" "6" "0000149816" "00005463" "00" "346" "0" "346" "0" "c.346C>A" "r.(?)" "p.(Pro116Thr)" "6" "0000149817" "00005463" "99" "351" "0" "351" "0" "c.351C>A" "r.(?)" "p.(Tyr117*)" "6" "0000149818" "00005463" "90" "391" "0" "391" "0" "c.391G>T" "r.(?)" "p.(Glu131*)" "7" "0000149819" "00005463" "00" "394" "0" "394" "0" "c.394C>T" "r.(?)" "p.(Gln132*)" "7" "0000149820" "00005463" "00" "399" "0" "399" "0" "c.399G>A" "r.(?)" "p.(=)" "7" "0000149821" "00005463" "00" "402" "0" "402" "0" "c.402del" "r.(?)" "p.(Pro135Glnfs*18)" "7" "0000149822" "00005463" "00" "422" "0" "422" "0" "c.422C>T" "r.(?)" "p.(Pro141Leu)" "7" "0000149823" "00005463" "00" "441" "0" "441" "0" "c.441G>A" "r.(?)" "p.(=)" "7" "0000149824" "00005463" "00" "443" "0" "443" "0" "c.443G>T" "r.(?)" "p.(Gly148Val)" "8" "0000149825" "00005463" "00" "443" "0" "443" "0" "c.443G>T" "r.(?)" "p.(Gly148Val)" "8" "0000149826" "00005463" "00" "485" "0" "485" "0" "c.485G>A" "r.(?)" "p.(Gly162Glu)" "9" "0000149827" "00005463" "00" "510" "0" "510" "0" "c.510A>T" "r.(?)" "p.(Lys170Asn)" "9" "0000149828" "00005463" "00" "522" "0" "522" "0" "c.522dup" "r.(?)" "p.(Leu175Valfs*38)" "9" "0000149829" "00005463" "00" "546" "0" "546" "0" "c.546G>T" "r.(?)" "p.(Gln182His)" "9" "0000149830" "00005463" "00" "604" "0" "604" "0" "c.604T>C" "r.(?)" "p.(Phe202Leu)" "10" "0000149831" "00005463" "00" "656" "0" "656" "0" "c.656G>A" "r.(?)" "p.(Gly219Asp)" "12" "0000149832" "00005463" "00" "685" "0" "685" "0" "c.685C>T" "r.(?)" "p.(Arg229Trp)" "12" "0000149833" "00005463" "00" "713" "0" "713" "0" "c.713del" "r.(?)" "p.(Pro238Argfs*9)" "13" "0000149834" "00005463" "00" "765" "0" "765" "0" "c.765G>A" "r.(spl?)" "p.(?)" "13" "0000149835" "00005463" "00" "805" "0" "805" "0" "c.805G>A" "r.(?)" "p.(Glu269Lys)" "14" "0000149836" "00005463" "00" "872" "0" "872" "0" "c.872G>A" "r.(?)" "p.(Gly291Glu)" "15" "0000149837" "00005463" "00" "888" "0" "888" "0" "c.888G>A" "r.(spl?)" "p.(?)" "15" "0000149838" "00005463" "00" "898" "0" "898" "0" "c.898G>A" "r.(?)" "p.(Gly300Arg)" "16" "0000149839" "00005463" "00" "942" "0" "942" "0" "c.942G>A" "r.(?)" "p.(=)" "17" "0000149840" "00005463" "00" "971" "0" "971" "0" "c.971G>A" "r.(?)" "p.(Gly324Asp)" "17" "0000149841" "00005463" "00" "976" "0" "976" "0" "c.976G>T" "r.(?)" "p.(Asp326Tyr)" "17" "0000149842" "00005463" "00" "1039" "0" "1039" "0" "c.1039del" "r.(?)" "p.(Tyr347Metfs*53)" "19" "0000149843" "00005463" "00" "1111" "0" "1111" "0" "c.1111C>T" "r.(?)" "p.(Gln371*)" "19" "0000149844" "00005463" "00" "1132" "0" "1132" "0" "c.1132G>A" "r.(?)" "p.(Gly378Arg)" "20" "0000149845" "00005463" "00" "1132" "0" "1132" "0" "c.1132G>A" "r.(?)" "p.(Gly378Arg)" "20" "0000149846" "00005463" "00" "1209" "0" "1209" "0" "c.1209del" "r.(?)" "p.(Glu405Asnfs*53)" "21" "0000149847" "00005463" "00" "1209" "0" "1209" "0" "c.1209del" "r.(?)" "p.(Glu405Asnfs*53)" "21" "0000149848" "00005463" "00" "1216" "0" "1216" "0" "c.1216C>T" "r.(?)" "p.(Arg406*)" "21" "0000149849" "00005463" "00" "1219" "0" "1219" "0" "c.1219G>C" "r.(?)" "p.(Gly407Arg)" "21" "0000149850" "00005463" "00" "1219" "0" "1219" "0" "c.1219G>C" "r.(?)" "p.(Gly407Arg)" "21" "0000149851" "00005463" "00" "1223" "0" "1223" "0" "c.1223G>A" "r.(?)" "p.(Arg408His)" "21" "0000149852" "00005463" "00" "1352" "0" "1352" "0" "c.1352A>G" "r.(?)" "p.(His451Arg)" "22" "0000149853" "00005463" "00" "1352" "0" "1353" "0" "c.1352_1353inv" "r.(?)" "p.(His451Arg)" "22" "0000149854" "00005463" "00" "1362" "0" "1362" "0" "c.1362A>T" "r.(?)" "p.(=)" "22" "0000149855" "00005463" "00" "1368" "0" "1368" "0" "c.1368T>A" "r.(?)" "p.(Tyr456*)" "22" "0000149856" "00005463" "00" "1409" "-5" "1409" "-5" "c.1409-5T>A" "r.(?)" "p.?" "22i" "0000149857" "00005463" "00" "1452" "0" "1452" "0" "c.1452G>A" "r.(?)" "p.(=)" "23" "0000149858" "00005463" "00" "1483" "0" "1483" "0" "c.1483C>T" "r.(?)" "p.(His495Tyr)" "23" "0000149859" "00005463" "00" "1483" "0" "1483" "0" "c.1483C>T" "r.(?)" "p.(His495Tyr)" "23" "0000149860" "00005463" "00" "1501" "0" "1501" "0" "c.1501C>A" "r.(?)" "p.(Pro501Thr)" "23" "0000149861" "00005463" "00" "1594" "0" "1594" "0" "c.1594G>T" "r.(?)" "p.(Gly532Cys)" "25" "0000149862" "00005463" "00" "1721" "0" "1721" "0" "c.1721C>T" "r.(?)" "p.(Pro574Leu)" "25" "0000149863" "00005463" "00" "1805" "0" "1805" "0" "c.1805G>A" "r.(?)" "p.(Gly602Asp)" "26" "0000149864" "00005463" "00" "1855" "0" "1855" "0" "c.1855G>A" "r.(?)" "p.(Gly619Arg)" "26" "0000149865" "00005463" "00" "1855" "0" "1855" "0" "c.1855G>T" "r.(?)" "p.(Gly619*)" "26" "0000149866" "00005463" "00" "1855" "0" "1855" "0" "c.1855G>A" "r.(?)" "p.(Gly619Arg)" "26" "0000149867" "00005463" "00" "1886" "0" "1886" "0" "c.1886C>T" "r.(?)" "p.(Thr629Met)" "26" "0000149868" "00005463" "00" "1909" "0" "1909" "0" "c.1909G>A" "r.(?)" "p.(Gly637Arg)" "26" "0000149869" "00005463" "00" "1927" "0" "1927" "0" "c.1927G>A" "r.(?)" "p.(Gly643Ser)" "26" "0000149870" "00005463" "00" "2021" "0" "2021" "0" "c.2021G>A" "r.(?)" "p.(Gly674Asp)" "28" "0000149871" "00005463" "00" "2054" "0" "2054" "0" "c.2054C>T" "r.(?)" "p.(Pro685Leu)" "28" "0000149872" "00005463" "00" "2083" "0" "2083" "0" "c.2083G>A" "r.(?)" "p.(Gly695Arg)" "28" "0000149873" "00005463" "00" "2207" "0" "2207" "0" "c.2207G>T" "r.(?)" "p.(Gly736Val)" "29" "0000149874" "00005463" "00" "2215" "0" "2215" "0" "c.2215G>A" "r.(?)" "p.(Gly739Arg)" "29" "0000149875" "00005463" "00" "2223" "1" "2223" "1" "c.2223+1G>A" "r.spl" "p.?" "29i" "0000149876" "00005463" "00" "2313" "0" "2330" "0" "c.2313_2330del" "r.(?)" "p.(Leu775_Gly780del)" "30" "0000149877" "00005463" "00" "2329" "0" "2329" "0" "c.2329G>T" "r.(?)" "p.(Gly777Cys)" "30" "0000149878" "00005463" "00" "2329" "0" "2329" "0" "c.2329G>A" "r.(?)" "p.(Gly777Ser)" "30" "0000149879" "00005463" "00" "2329" "0" "2329" "0" "c.2329G>C" "r.(?)" "p.(Gly777Arg)" "30" "0000149880" "00005463" "00" "2330" "0" "2330" "0" "c.2330G>A" "r.(?)" "p.(Gly777Asp)" "30" "0000149881" "00005463" "00" "2498" "0" "2498" "0" "c.2498G>A" "r.(?)" "p.(Gly833Asp)" "32" "0000149882" "00005463" "00" "2501" "0" "2501" "0" "c.2501A>G" "r.(?)" "p.(Lys834Arg)" "32" "0000149883" "00005463" "00" "2501" "0" "2501" "0" "c.2501A>G" "r.(?)" "p.(Lys834Arg)" "32" "0000149884" "00005463" "00" "2501" "0" "2501" "0" "c.2501A>G" "r.(?)" "p.(Lys834Arg)" "32" "0000149885" "00005463" "00" "2557" "0" "2557" "0" "c.2557G>A" "r.(?)" "p.(Gly853Arg)" "32" "0000149886" "00005463" "00" "2621" "0" "2622" "0" "c.2621_2622delinsT" "r.(?)" "p.(Gly874Valfs*9)" "32" "0000149887" "00005463" "00" "2715" "0" "2715" "0" "c.2715C>T" "r.(?)" "p.(=)" "33" "0000149888" "00005463" "00" "2717" "0" "2717" "0" "c.2717dup" "r.(?)" "p.(Gly907Trpfs*33)" "33" "0000149889" "00005463" "00" "2754" "0" "2754" "0" "c.2754T>C" "r.(?)" "p.(=)" "34" "0000149890" "00005463" "00" "2768" "0" "2777" "0" "c.2768_2777del" "r.(?)" "p.(Val923Glyfs*25)" "34" "0000149891" "00005463" "00" "2768" "0" "2788" "0" "c.2768_2788del" "r.(?)" "p.(Val923_Pro930delinsAla)" "34" "0000149892" "00005463" "00" "2826" "0" "2826" "0" "c.2826C>T" "r.(?)" "p.(=)" "34" "0000149893" "00005463" "00" "2927" "0" "2927" "0" "c.2927G>A" "r.(?)" "p.(Gly976Glu)" "35" "0000149894" "00005463" "00" "3210" "0" "3210" "0" "c.3210G>A" "r.(?)" "p.(=)" "37" "0000149895" "00005463" "00" "3113" "0" "3113" "0" "c.3113C>T" "r.(?)" "p.(Ala1038Val)" "37" "0000149896" "00005463" "00" "3169" "0" "3169" "0" "c.3169G>A" "r.(?)" "p.(Gly1057Ser)" "37" "0000149897" "00005463" "00" "3242" "0" "3246" "0" "c.3242_3246del" "r.(?)" "p.(Lys1081Argfs*18)" "38" "0000149898" "00005463" "00" "3258" "0" "3258" "0" "c.3258G>A" "r.(?)" "p.(=)" "38" "0000149899" "00005463" "00" "3310" "0" "3310" "0" "c.3310G>C" "r.(?)" "p.(Gly1104Arg)" "38" "0000149900" "00005463" "00" "3310" "0" "3310" "0" "c.3310G>C" "r.(?)" "p.(Gly1104Arg)" "38" "0000149901" "00005463" "00" "3325" "0" "3325" "0" "c.3325C>T" "r.(?)" "p.(Pro1109Ser)" "38" "0000149902" "00005463" "00" "3407" "0" "3407" "0" "c.3407G>C" "r.(?)" "p.(Arg1136Thr)" "39" "0000149903" "00005463" "00" "3416" "0" "3416" "0" "c.3416C>T" "r.(?)" "p.(Pro1139Leu)" "39" "0000149904" "00005463" "00" "3418" "0" "3418" "0" "c.3418G>C" "r.(?)" "p.(Gly1140Arg)" "39" "0000149905" "00005463" "00" "3472" "0" "3472" "0" "c.3472G>C" "r.(?)" "p.(Gly1158Arg)" "40" "0000149906" "00005463" "00" "3499" "0" "3499" "0" "c.3499G>A" "r.(?)" "p.(Gly1167Arg)" "40" "0000149907" "00005463" "00" "3548" "0" "3548" "0" "c.3548G>A" "r.(?)" "p.(Gly1183Glu)" "41" "0000149908" "00005463" "00" "3592" "0" "3592" "0" "c.3592G>A" "r.(?)" "p.(Gly1198Ser)" "42" "0000149909" "00005463" "00" "3592" "0" "3592" "0" "c.3592G>A" "r.(?)" "p.(Gly1198Ser)" "42" "0000149910" "00005463" "00" "3594" "0" "3594" "0" "c.3594T>G" "r.(?)" "p.(=)" "42" "0000149911" "00005463" "00" "3627" "0" "3627" "0" "c.3627G>T" "r.(?)" "p.(Met1209Ile)" "42" "0000149912" "00005463" "00" "3644" "0" "3644" "0" "c.3644G>A" "r.(?)" "p.(Arg1215Gln)" "42" "0000149913" "00005463" "00" "3751" "0" "3751" "0" "c.3751G>A" "r.(?)" "p.(Gly1251Ser)" "42" "0000149914" "00005463" "00" "3760" "0" "3760" "0" "c.3760G>C" "r.(?)" "p.(Gly1254Arg)" "43" "0000149915" "00005463" "00" "3773" "0" "3773" "0" "c.3773C>T" "r.(?)" "p.(Pro1258Leu)" "43" "0000149916" "00005463" "00" "3807" "0" "3807" "0" "c.3807C>A" "r.(?)" "p.(Asp1269Glu)" "43" "0000149917" "00005463" "00" "3820" "0" "3820" "0" "c.3820G>A" "r.(?)" "p.(Gly1274Ser)" "43" "0000149918" "00005463" "00" "3833" "0" "3833" "0" "c.3833C>A" "r.(?)" "p.(Pro1278Gln)" "43" "0000149919" "00005463" "00" "3882" "1" "3882" "1" "c.3882+1G>T" "r.spl" "p.?" "43i" "0000149920" "00005463" "00" "3955" "1" "3955" "1" "c.3955+1G>T" "r.spl" "p.?" "44i" "0000149921" "00005463" "00" "4034" "0" "4034" "0" "c.4034G>A" "r.(?)" "p.(Arg1345His)" "46" "0000149922" "00005463" "00" "4208" "0" "4208" "0" "c.4208G>A" "r.(?)" "p.(Gly1403Glu)" "47" "0000149923" "00005463" "00" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000149924" "00005463" "00" "4462" "3" "4462" "3" "c.4462+3A>G" "r.(?)" "p.?" "48i" "0000149925" "00005463" "00" "4484" "0" "4484" "0" "c.4484A>G" "r.(?)" "p.(Gln1495Arg)" "49" "0000149926" "00005463" "00" "4494" "0" "4494" "0" "c.4494C>G" "r.(?)" "p.(=)" "49" "0000149927" "00005463" "00" "4510" "0" "4510" "0" "c.4510T>C" "r.(?)" "p.(Phe1504Leu)" "49" "0000149928" "00005463" "00" "4649" "0" "4649" "0" "c.4649T>G" "r.(?)" "p.(Val1550Gly)" "50" "0000149929" "00005463" "00" "4665" "0" "4665" "0" "c.4665G>A" "r.(?)" "p.(=)" "50" "0000149930" "00005463" "00" "4665" "0" "4665" "0" "c.4665G>C" "r.(?)" "p.(=)" "50" "0000149931" "00005463" "00" "4707" "0" "4707" "0" "c.4707A>T" "r.(?)" "p.(=)" "50" "0000149932" "00005463" "00" "4716" "0" "4716" "0" "c.4716C>T" "r.(?)" "p.(=)" "50" "0000149933" "00005463" "00" "4733" "0" "4733" "0" "c.4733G>C" "r.(?)" "p.(Trp1578Ser)" "50" "0000149934" "00005463" "00" "4808" "0" "4808" "0" "c.4808C>T" "r.(?)" "p.(Ser1603Phe)" "51" "0000149935" "00005463" "00" "4845" "0" "4845" "0" "c.4845del" "r.(?)" "p.(Glu1615Aspfs*22)" "51" "0000149936" "00005463" "00" "4891" "0" "4891" "0" "c.4891C>T" "r.(?)" "p.(Arg1661Cys)" "52" "0000149937" "00005463" "90" "687" "0" "687" "0" "c.687G>A" "r.spl?" "p.(?)" "12" "0000149939" "00005463" "90" "765" "2" "765" "2" "c.765+2T>C" "r.spl?" "p.?" "13i" "0000149940" "00005463" "90" "3410" "0" "3410" "0" "c.3410G>A" "r.(?)" "p.(Gly1137Asp)" "39" "0000149941" "00005463" "90" "765" "0" "765" "0" "c.765G>T" "r.(spl?)" "p.(?)" "13" "0000149942" "00005463" "97" "3109" "0" "3109" "0" "c.3109C>T" "r.(?)" "p.(Arg1037*)" "37" "0000149943" "00005463" "97" "4316" "0" "4316" "0" "c.4316del" "r.(?)" "p.(Ala1439Glufs*90)" "48" "0000149944" "00005463" "97" "1219" "0" "1219" "0" "c.1219G>C" "r.(?)" "p.(Gly407Arg)" "21" "0000149945" "00005463" "13" "1902" "0" "1902" "0" "c.1902G>A" "r.(?)" "p.(Gly634Gly)" "26" "0000149946" "00005463" "97" "1918" "0" "1918" "0" "c.1918G>A" "r.(?)" "p.(Gly640Arg)" "26" "0000149947" "00005463" "70" "4424" "0" "4424" "0" "c.4424T>C" "r.(?)" "p.(Phe1475Ser)" "48" "0000149948" "00005463" "97" "3148" "0" "3148" "0" "c.3148C>T" "r.(?)" "p.(Gln1050*)" "37" "0000149949" "00005463" "97" "3209" "0" "3209" "0" "c.3209dup" "r.(?)" "p.(Asp1072Glyfs*7)" "37" "0000149950" "00005463" "70" "3989" "0" "3989" "0" "c.3989T>C" "r.(?)" "p.(Ile1330Thr)" "45" "0000149951" "00005463" "97" "4441" "0" "4441" "0" "c.4441C>T" "r.(?)" "p.(Arg1481*)" "48" "0000149952" "00005463" "97" "4571" "0" "4571" "0" "c.4571C>G" "r.(?)" "p.(Ser1524*)" "49" "0000149953" "00005463" "97" "4666" "-5" "4666" "-5" "c.4666-5G>T" "r.(?)" "p.(=)" "50i" "0000149954" "00005463" "97" "4666" "-5" "4666" "-5" "c.4666-5G>T" "r.(?)" "p.(=)" "50i" "0000149955" "00005463" "90" "2083" "0" "2083" "0" "c.2083G>A" "r.(?)" "p.(Gly695Arg)" "28" "0000149956" "00005463" "90" "2083" "0" "2083" "0" "c.2083G>A" "r.(?)" "p.(Gly695Arg)" "28" "0000149957" "00005463" "90" "2245" "0" "2245" "0" "c.2245G>A" "r.(?)" "?" "28" "0000149958" "00005463" "70" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Gly265Glu)" "14" "0000149959" "00005463" "90" "1937" "0" "1937" "0" "c.1937dup" "r.(?)" "p.(Glu647Argfs*45)" "27" "0000149960" "00005463" "90" "713" "0" "713" "0" "c.713del" "r.(?)" "p.(Pro238Argfs*9)" "13" "0000149961" "00005463" "90" "1085" "0" "1085" "0" "c.1085del" "r.(?)" "p.(Pro362Glnfs*38)" "19" "0000149962" "00005463" "90" "2031" "0" "2038" "0" "c.2031_2038dup" "r.(?)" "p.(Gly680Aspfs*70)" "28" "0000149963" "00005463" "90" "2031" "0" "2038" "0" "c.2031_2038dup" "r.(?)" "p.(Gly680Aspfs*70)" "28" "0000149964" "00005463" "70" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Gly818Arg)" "31" "0000149965" "00005463" "70" "2567" "0" "2567" "0" "c.2567G>A" "r.(?)" "p.(Gly856Glu)" "32" "0000149966" "00005463" "90" "3866" "0" "3866" "0" "c.3866del" "r.(?)" "p.(Gly1289Aspfs*29)" "43" "0000149967" "00005463" "90" "2745" "0" "2746" "7" "c.2745_2746+7del" "r.spl" "p.?" "33_33i" "0000149968" "00005463" "90" "2768" "0" "2778" "0" "c.2768_2778del" "r.(?)" "p.(Val923Glufs*13)" "34" "0000149969" "00005463" "90" "2768" "0" "2778" "0" "c.2768_2778del" "r.(?)" "p.(Val923Glufs*13)" "34" "0000149970" "00005463" "70" "3472" "0" "3472" "0" "c.3472G>C" "r.(?)" "p.(Gly1158Arg)" "40" "0000149971" "00005463" "90" "4030" "0" "4030" "0" "c.4030del" "r.(?)" "p.(Val1344Tyrfs*41)" "46" "0000149972" "00005463" "90" "4347" "0" "4353" "0" "c.4347_4353del" "r.(?)" "p.(Arg1450Valfs*77)" "48" "0000149973" "00005463" "70" "2313" "0" "2330" "0" "c.2313_2330del" "r.(?)" "p.(Leu775_Gly780del)" "30" "0000149974" "00005463" "90" "391" "0" "391" "0" "c.391G>T" "r.(?)" "p.(Glu131*)" "7" "0000149975" "00005463" "70" "546" "0" "546" "0" "c.546G>T" "r.(?)" "p.(Gln182His)" "9" "0000149976" "00005463" "90" "2768" "0" "2778" "0" "c.2768_2778del" "r.(?)" "p.(Val923Glufs*13)" "34" "0000149981" "00005463" "90" "3490" "0" "3490" "0" "c.3490G>T" "r.(?)" "p.(Gly1164Cys)" "40" "0000169201" "00005463" "00" "4420" "0" "4424" "0" "c.4420_4424del" "r.(?)" "p.(Leu1474Cysfs*34)" "" "0000248998" "00005463" "10" "485" "0" "485" "0" "c.485A>G" "r.(?)" "p.(Glu162Gly)" "" "0000251007" "00005463" "10" "4707" "0" "4707" "0" "c.4707A>T" "r.(?)" "p.(Pro1569=)" "" "0000251080" "00005463" "10" "1352" "0" "1352" "0" "c.1352A>G" "r.(?)" "p.(His451Arg)" "" "0000251109" "00005463" "10" "2501" "0" "2501" "0" "c.2501A>G" "r.(?)" "p.(Lys834Arg)" "" "0000251283" "00005463" "10" "547" "-9" "547" "-9" "c.547-9A>C" "r.(=)" "p.(=)" "" "0000251284" "00005463" "10" "2657" "-98" "2657" "-98" "c.2657-98A>G" "r.(=)" "p.(=)" "" "0000251285" "00005463" "10" "4756" "-67" "4756" "-67" "c.4756-67del" "r.(=)" "p.(=)" "" "0000254897" "00005463" "30" "4484" "0" "4484" "0" "c.4484A>G" "r.(?)" "p.(Gln1495Arg)" "" "0000256365" "00005463" "50" "4523" "0" "4523" "0" "c.4523A>G" "r.(?)" "p.(Asn1508Ser)" "" "0000256456" "00005463" "50" "634" "0" "634" "0" "c.634A>G" "r.(?)" "p.(Arg212Gly)" "" "0000266978" "00005463" "10" "1195" "0" "1195" "0" "c.1195C>T" "r.(?)" "p.(Leu399=)" "" "0000266981" "00005463" "10" "3419" "-5" "3419" "-4" "c.3419-5_3419-4del" "r.spl?" "p.?" "" "0000270383" "00005463" "10" "1115" "-20" "1115" "-20" "c.1115-20T>C" "r.(=)" "p.(=)" "" "0000270384" "00005463" "10" "127" "0" "127" "0" "c.127G>C" "r.(?)" "p.(Gly43Arg)" "" "0000270385" "00005463" "10" "2021" "-54" "2021" "-54" "c.2021-54T>C" "r.(=)" "p.(=)" "" "0000270387" "00005463" "10" "2489" "-65" "2489" "-64" "c.2489-65_2489-64del" "r.(=)" "p.(=)" "" "0000270388" "00005463" "10" "2489" "-67" "2489" "-64" "c.2489-67_2489-64del" "r.(=)" "p.(=)" "" "0000270389" "00005463" "10" "2489" "-69" "2489" "-64" "c.2489-69_2489-64del" "r.(=)" "p.(=)" "" "0000270390" "00005463" "10" "2489" "-90" "2489" "-89" "c.2489-90_2489-89insTAT" "r.(=)" "p.(=)" "" "0000270391" "00005463" "10" "2715" "0" "2715" "0" "c.2715C>T" "r.(?)" "p.(Pro905=)" "" "0000270392" "00005463" "70" "2881" "0" "2881" "0" "c.2881G>C" "r.(?)" "p.(Gly961Arg)" "" "0000270393" "00005463" "70" "2962" "0" "2962" "0" "c.2962G>A" "r.(?)" "p.(Gly988Arg)" "" "0000270394" "00005463" "10" "325" "-27" "325" "-27" "c.325-27C>T" "r.(=)" "p.(=)" "" "0000270395" "00005463" "10" "3325" "0" "3325" "0" "c.3325C>T" "r.(?)" "p.(Pro1109Ser)" "" "0000270396" "00005463" "10" "3419" "-14" "3419" "-14" "c.3419-14T>G" "r.(=)" "p.(=)" "" "0000270397" "00005463" "10" "3419" "-4" "3419" "-4" "c.3419-4del" "r.spl?" "p.?" "" "0000270398" "00005463" "10" "3518" "-42" "3518" "-42" "c.3518-42G>A" "r.(=)" "p.(=)" "" "0000270399" "00005463" "10" "3751" "66" "3751" "66" "c.3751+66C>T" "r.(=)" "p.(=)" "" "0000270400" "00005463" "10" "3807" "0" "3807" "0" "c.3807C>A" "r.(?)" "p.(Asp1269Glu)" "" "0000270401" "00005463" "10" "3883" "-85" "3883" "-85" "c.3883-85C>T" "r.(=)" "p.(=)" "" "0000270402" "00005463" "10" "4252" "156" "4252" "156" "c.4252+156G>A" "r.(=)" "p.(=)" "" "0000270403" "00005463" "10" "469" "-53" "469" "-53" "c.469-53G>T" "r.(=)" "p.(=)" "" "0000270404" "00005463" "10" "687" "69" "687" "69" "c.687+69G>A" "r.(=)" "p.(=)" "" "0000270405" "00005463" "90" "725" "0" "725" "0" "c.725G>A" "r.(?)" "p.(Gly242Glu)" "" "0000270406" "00005463" "10" "88" "-4" "88" "-4" "c.88-4C>T" "r.spl?" "p.?" "" "0000270407" "00005463" "10" "988" "-80" "988" "-80" "c.988-80T>C" "r.(=)" "p.(=)" "" "0000274179" "00005463" "30" "1928" "-7" "1928" "-7" "c.1928-7C>T" "r.(=)" "p.(=)" "" "0000274180" "00005463" "30" "222" "0" "222" "0" "c.222G>T" "r.(?)" "p.(Pro74=)" "" "0000274181" "00005463" "50" "2848" "0" "2848" "0" "c.2848G>A" "r.(?)" "p.(Val950Ile)" "" "0000274182" "00005463" "50" "3181" "0" "3181" "0" "c.3181G>T" "r.(?)" "p.(Gly1061Cys)" "" "0000274183" "00005463" "30" "3258" "0" "3258" "0" "c.3258G>A" "r.(?)" "p.(Gly1086=)" "" "0000274184" "00005463" "30" "3419" "-3" "3419" "-3" "c.3419-3del" "r.spl?" "p.?" "" "0000274185" "00005463" "30" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "" "0000274186" "00005463" "30" "4494" "0" "4494" "0" "c.4494C>G" "r.(?)" "p.(Thr1498=)" "" "0000274187" "00005463" "30" "4893" "0" "4893" "0" "c.4893C>T" "r.(?)" "p.(Phe1631=)" "" "0000282272" "00005463" "10" "422" "0" "422" "0" "c.422T>C" "r.(?)" "p.(Leu141Pro)" "" "0000282273" "00005463" "10" "144" "12" "144" "12" "c.144+12C>A" "r.(=)" "p.(=)" "" "0000282274" "00005463" "10" "1721" "0" "1721" "0" "c.1721C>T" "r.(?)" "p.(Pro574Leu)" "" "0000339696" "00005463" "10" "1195" "0" "1195" "0" "c.1195C>T" "r.(?)" "p.(Leu399=)" "" "0000341794" "00005463" "90" "3643" "0" "3643" "0" "c.3643C>T" "r.(?)" "p.(Arg1215Ter)" "" "0000342041" "00005463" "70" "4981" "0" "4981" "0" "c.4981C>T" "r.(?)" "p.(Arg1661Cys)" "" "0000345630" "00005463" "50" "3152" "0" "3152" "0" "c.3152G>C" "r.(?)" "p.(Gly1051Ala)" "" "0000346162" "00005463" "70" "1679" "0" "1679" "0" "c.1679G>T" "r.(?)" "p.(Gly560Val)" "" "0000346191" "00005463" "70" "1840" "0" "1840" "0" "c.1840G>A" "r.(?)" "p.(Gly614Arg)" "" "0000346263" "00005463" "50" "2275" "0" "2275" "0" "c.2275G>C" "r.(?)" "p.(Gly759Arg)" "" "0000346280" "00005463" "50" "2434" "0" "2434" "0" "c.2434G>A" "r.(?)" "p.(Gly812Ser)" "" "0000346328" "00005463" "50" "2801" "0" "2801" "0" "c.2801G>A" "r.(?)" "p.(Gly934Glu)" "" "0000348749" "00005463" "50" "4772" "0" "4772" "0" "c.4772C>T" "r.(?)" "p.(Ser1591Phe)" "" "0000352765" "00005463" "90" "1586" "0" "1586" "0" "c.1586G>A" "r.(?)" "p.(Gly529Asp)" "25" "0000352766" "00005463" "90" "1577" "0" "1577" "0" "c.1577G>T" "r.(?)" "p.(Gly526Val)" "25" "0000352768" "00005463" "90" "1733" "0" "1733" "0" "c.1733G>T" "r.(?)" "p.(Gly578Val)" "25" "0000353641" "00005463" "90" "415" "0" "415" "0" "c.415G>C" "r.(?)" "p.(Gly139Arg)" "7" "0000353651" "00005463" "90" "1892" "0" "1892" "0" "c.1892G>T" "r.(?)" "p.(Gly631Val)" "26" "0000353652" "00005463" "90" "1733" "0" "1733" "0" "c.1733G>T" "r.(?)" "p.(Gly578Val)" "25" "0000353666" "00005463" "90" "3608" "0" "3608" "0" "c.3608del" "r.(?)" "p.(Pro1203Argfs*18)" "42" "0000353673" "00005463" "90" "1114" "1" "1114" "1" "c.1114+1G>A" "r.spl" "p.?" "19i" "0000353743" "00005463" "90" "1368" "0" "1368" "0" "c.1368T>A" "r.(?)" "p.(Tyr456*)" "22" "0000353748" "00005463" "50" "683" "0" "683" "0" "c.683A>G" "r.(?)" "p.(Glu228Gly)" "12" "0000353749" "00005463" "70" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Gly818Arg)" "31" "0000353750" "00005463" "70" "520" "0" "520" "0" "c.520G>A" "r.(?)" "p.(Gly174Arg)" "9" "0000353753" "00005463" "50" "829" "-9" "829" "-9" "c.829-9T>G" "r.(?)" "p.(=)" "14i" "0000353756" "00005463" "70" "1823" "0" "1823" "0" "c.1823G>T" "r.(?)" "p.(Gly608Val)" "26" "0000353757" "00005463" "90" "2768" "0" "2778" "0" "c.2768_2778del" "r.(?)" "p.(Val923Glufs*13)" "34" "0000353760" "00005463" "70" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Gly818Arg)" "31" "0000353761" "00005463" "70" "3760" "0" "3760" "0" "c.3760G>C" "r.(?)" "p.(Gly1254Arg)" "43" "0000353762" "00005463" "70" "917" "0" "917" "0" "c.917G>T" "r.(?)" "p.(Gly306Val)" "16" "0000353769" "00005463" "90" "3211" "-1" "3882" "1" "c.(3210+1_3211-1)_(3882+1_3883-1)del" "r.?" "p.?" "37i_43i" "0000353776" "00005463" "70" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Gly818Arg)" "31" "0000353777" "00005463" "70" "2567" "0" "2567" "0" "c.2567G>A" "r.(?)" "p.(Gly856Glu)" "32" "0000353779" "00005463" "70" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Gly818Arg)" "31" "0000353780" "00005463" "70" "2083" "0" "2083" "0" "c.2083G>A" "r.(?)" "p.(Gly695Arg)" "28" "0000353784" "00005463" "70" "4853" "0" "4853" "0" "c.4853G>T" "r.(?)" "p.(Gly1618Val)" "51" "0000353785" "00005463" "50" "3049" "0" "3049" "0" "c.3049A>G" "r.(?)" "p.(Met1017Val)" "36" "0000353788" "00005463" "90" "40" "0" "63" "0" "c.40_63del" "r.(?)" "p.(Leu14_Leu21del)" "1" "0000353790" "00005463" "70" "1613" "0" "1613" "0" "c.1613G>C" "r.(?)" "p.(Gly538Ala)" "25" "0000353793" "00005463" "70" "3566" "0" "3566" "0" "c.3566G>A" "r.(?)" "p.(Gly1189Glu)" "42" "0000353801" "00005463" "70" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Gly818Arg)" "31" "0000353803" "00005463" "70" "3472" "0" "3472" "0" "c.3472G>C" "r.(?)" "p.(Gly1158Arg)" "40" "0000353804" "00005463" "70" "3760" "0" "3760" "0" "c.3760G>C" "r.(?)" "p.(Gly1254Arg)" "43" "0000353807" "00005463" "90" "462" "0" "468" "1" "c.462_468+1del" "r.spl" "p.?" "8_8i" "0000353809" "00005463" "70" "3546" "0" "3548" "0" "c.3546_3548dup" "r.(?)" "p.(Gly1183dup)" "41" "0000353810" "00005463" "00" "1487" "0" "1487" "0" "c.1487G>A" "r.(?)" "p.(Gly496Asp)" "23" "0000353811" "00005463" "70" "1184" "0" "1184" "0" "c.1184G>A" "r.(?)" "p.(Gly395Glu)" "21" "0000353816" "00005463" "70" "3574" "0" "3574" "0" "c.3574G>C" "r.(?)" "p.(Gly1192Arg)" "42" "0000353820" "00005463" "70" "1586" "0" "1586" "0" "c.1586G>T" "r.(?)" "p.(Gly529Val)" "25" "0000353828" "00005463" "70" "280" "-1" "468" "1" "c.(279+1_280-1)_(468+1_469-1)dup" "r.?" "p.?" "4i_8i" "0000353829" "00005463" "50" "1150" "5" "1150" "5" "c.1150+5G>A" "r.(?)" "p.(=)" "20i" "0000353831" "00005463" "70" "2323" "0" "2340" "0" "c.2323_2340del" "r.(?)" "p.(Leu775_Gly780del)" "30" "0000353832" "00005463" "50" "1753" "0" "1753" "0" "c.1753G>C" "r.(?)" "p.(Glu585Gln)" "25" "0000353833" "00005463" "70" "2179" "0" "2179" "0" "c.2179G>A" "r.(?)" "p.(Gly727Arg)" "29" "0000353842" "00005463" "70" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Gly818Arg)" "31" "0000353848" "00005463" "70" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Gly818Arg)" "31" "0000353851" "00005463" "90" "1758" "1" "1758" "1" "c.1758+1G>T" "r.spl" "p.?" "25i" "0000353853" "00005463" "70" "3760" "0" "3760" "0" "c.3760G>C" "r.(?)" "p.(Gly1254Arg)" "43" "0000353855" "00005463" "70" "2480" "0" "2480" "0" "c.2480G>A" "r.(?)" "p.(Gly827Glu)" "31" "0000353871" "00005463" "70" "3499" "0" "3499" "0" "c.3499G>A" "r.(?)" "p.(Gly1167Arg)" "40" "0000353879" "00005463" "70" "3760" "0" "3760" "0" "c.3760G>C" "r.(?)" "p.(Gly1254Arg)" "43" "0000353888" "00005463" "50" "1256" "0" "1256" "0" "c.1256C>A" "r.(?)" "p.(Ser419Tyr)" "21" "0000353901" "00005463" "50" "-26" "0" "-26" "0" "c.-26G>T" "r.(?)" "p.(=)" "1" "0000353902" "00005463" "70" "2411" "0" "2411" "0" "c.2411G>A" "r.(?)" "p.(Gly804Glu)" "31" "0000353907" "00005463" "70" "1006" "0" "1006" "0" "c.1006G>T" "r.(?)" "p.(Gly336Cys)" "18" "0000353910" "00005463" "70" "4981" "0" "4981" "0" "c.4981C>T" "r.(?)" "p.(Arg1661Cys)" "52" "0000353912" "00005463" "50" "43" "0" "54" "0" "c.43_54del" "r.(?)" "p.(Pro15_Leu18del)" "1" "0000353917" "00005463" "90" "4347" "0" "4353" "0" "c.4347_4353del" "r.(?)" "p.(Arg1450Valfs*77)" "48" "0000353919" "00005463" "70" "2374" "0" "2374" "0" "c.2374G>A" "r.(?)" "p.(Gly792Arg)" "30" "0000353931" "00005463" "70" "898" "0" "898" "0" "c.898G>A" "r.(?)" "p.(Gly300Arg)" "16" "0000353932" "00005463" "70" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Gly818Arg)" "31" "0000353935" "00005463" "70" "4803" "0" "4803" "0" "c.4803del" "r.(?)" "p.(Gly1602Alafs*13)" "51" "0000353936" "00005463" "70" "1315" "0" "1315" "0" "c.1315G>A" "r.(?)" "p.(Gly439Ser)" "21" "0000353940" "00005463" "70" "2083" "0" "2083" "0" "c.2083G>A" "r.(?)" "p.(Gly695Arg)" "28" "0000353942" "00005463" "70" "3955" "0" "3955" "0" "c.3955G>A" "r.(?)" "p.(Gly1319Arg)" "44" "0000353951" "00005463" "70" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Gly818Arg)" "31" "0000353953" "00005463" "70" "1184" "0" "1184" "0" "c.1184G>A" "r.(?)" "p.(Gly395Glu)" "21" "0000353954" "00005463" "70" "1133" "0" "1133" "0" "c.1133G>A" "r.(?)" "p.(Gly378Glu)" "20" "0000353955" "00005463" "70" "1532" "0" "1532" "0" "c.1532G>A" "r.(?)" "p.(Gly511Glu)" "24" "0000353957" "00005463" "70" "1855" "0" "1855" "0" "c.1855G>A" "r.(?)" "p.(Gly619Arg)" "26" "0000353965" "00005463" "50" "26" "0" "26" "0" "c.26C>T" "r.(?)" "p.(Pro9Leu)" "1" "0000353967" "00005463" "50" "3070" "8" "3070" "8" "c.3070+8A>G" "r.spl?" "p.(=)" "36i" "0000353972" "00005463" "70" "3338" "-1" "3418" "1" "c.(3337+1_3338-1)_(3418+1_3419-1)del" "r.?" "p.?" "38i_39i" "0000353979" "00005463" "50" "3949" "0" "3949" "0" "c.3949G>A" "r.(?)" "p.(Val1317Met)" "44" "0000353986" "00005463" "70" "2567" "0" "2567" "0" "c.2567G>A" "r.(?)" "p.(Gly856Glu)" "32" "0000353988" "00005463" "70" "4253" "0" "4253" "0" "c.4253G>A" "r.(?)" "p.(Gly1418Glu)" "48" "0000353994" "00005463" "70" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Gly818Arg)" "31" "0000353995" "00005463" "50" "987" "20" "987" "20" "c.987+20C>G" "r.(?)" "p.(=)" "17i" "0000354000" "00005463" "70" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Gly265Glu)" "14" "0000354011" "00005463" "70" "3683" "0" "3683" "0" "c.3683G>A" "r.(?)" "p.(Gly1228Asp)" "42" "0000354013" "00005463" "50" "4482" "0" "4482" "0" "c.4482G>A" "r.(?)" "p.(=)" "49" "0000354017" "00005463" "70" "3683" "0" "3683" "0" "c.3683G>A" "r.(?)" "p.(Gly1228Asp)" "42" "0000354020" "00005463" "70" "4486" "0" "4486" "0" "c.4486C>T" "r.(?)" "p.(Arg1496*)" "49" "0000354028" "00005463" "70" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Gly265Glu)" "14" "0000354029" "00005463" "00" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.0?" "1" "0000354030" "00005463" "00" "2" "0" "2" "0" "c.2T>A" "r.(?)" "p.0?" "1" "0000354031" "00005463" "00" "2" "0" "2" "0" "c.2T>G" "r.(?)" "p.0?" "1" "0000354032" "00005463" "00" "40" "0" "63" "0" "c.40_63del" "r.(?)" "p.(Leu14_Leu21del)" "1" "0000354033" "00005463" "90" "-1" "0" "87" "1" "c.(?_-1)_(87+1_88-1)del" "r.0?" "p.0?" "_1_1i" "0000354034" "00005463" "90" "40" "0" "63" "0" "c.40_63del" "r.(?)" "p.(Leu14_Leu21del)" "1" "0000354035" "00005463" "90" "40" "0" "63" "0" "c.40_63del" "r.(?)" "p.(Leu14_Leu21del)" "1" "0000354036" "00005463" "90" "40" "0" "63" "0" "c.40_63del" "r.(?)" "p.(Leu14_Leu21del)" "1" "0000354037" "00005463" "00" "88" "-1" "4755" "1" "c.88-?_4755+?dup" "r.?" "p.?" "1i_50i" "0000354038" "00005463" "10" "127" "0" "127" "0" "c.127G>C" "r.(?)" "p.(Gly43Arg)" "2" "0000354039" "00005463" "00" "162" "-2" "162" "-2" "c.162-2A>G" "exon 3 (90 bp) skip" "p.?" "2i" "0000354040" "00005463" "10" "144" "12" "144" "12" "c.144+12C>A" "r.(?)" "p.(=)" "2i" "0000354041" "00005463" "00" "145" "0" "145" "0" "c.145G>C" "r.(?)" "p.(Gly49Arg)" "3" "0000354042" "00005463" "00" "172" "0" "172" "0" "c.172G>C" "r.(?)" "p.(Gly58Arg)" "3" "0000354043" "00005463" "00" "272" "0" "272" "0" "c.272G>T" "r.(?)" "p.(Gly91Val)" "4" "0000354044" "00005463" "00" "345" "0" "345" "0" "c.345del" "r.(?)" "p.Pro116Leufs*37" "6" "0000354045" "00005463" "00" "346" "0" "346" "0" "c.346C>A" "r.(?)" "p.(Pro116Thr)" "6" "0000354046" "00005463" "00" "345" "0" "345" "0" "c.345del" "r.(?)" "p.(Pro116Leufs*37)" "6" "0000354047" "00005463" "00" "422" "0" "422" "0" "c.422T>C" "r.(?)" "p.(Leu141Pro)" "7" "0000354048" "00005463" "00" "393" "0" "393" "0" "c.393del" "r.(?)" "p.(Glu131Aspfs*22)" "7" "0000354049" "00005463" "00" "432" "0" "440" "0" "c.432_440delinsGATTA" "r.(?)" "p.(Gly145Ilefs*7)" "7" "0000354050" "00005463" "90" "441" "2" "441" "2" "c.441+2T>C" "r.spl" "p.?" "7i" "0000354051" "00005463" "00" "443" "0" "443" "0" "c.443G>T" "r.(?)" "p.Gly148Val" "8" "0000354052" "00005463" "30" "485" "0" "485" "0" "c.485A>G" "r.(?)" "p.(Glu162Gly)" "9" "0000354053" "00005463" "00" "546" "1" "546" "1" "c.546+1G>T" "r.spl" "p.?" "9i" "0000354054" "00005463" "30" "547" "-9" "547" "-9" "c.547-9A>C" "r.(?)" "p.(=)" "9i" "0000354055" "00005463" "90" "610" "-1" "645" "1" "c.610-?_645+?del" "r.(?)" "p.?" "10i_11i" "0000354056" "00005463" "90" "610" "-1" "645" "1" "c.610-?_645+?del" "r.(?)" "p.?" "10i_11i" "0000354057" "00005463" "00" "689" "0" "689" "0" "c.689G>A" "r.689g>a" "p.Gly230Asp" "13" "0000354058" "00005463" "90" "725" "0" "725" "0" "c.725del" "r.(?)" "p.(Gly242Glufs*5)" "13" "0000354059" "00005463" "00" "778" "0" "778" "0" "c.778G>T" "r.(?)" "p.(Glu260*)" "14" "0000354060" "00005463" "00" "805" "0" "805" "0" "c.805G>T" "r.(?)" "p.(Glu269*)" "14" "0000354061" "00005463" "90" "838" "0" "838" "0" "c.838G>A" "r.(?)" "p.(Gly280Arg)" "15" "0000354062" "00005463" "00" "889" "-1" "1114" "1" "c.889-?_1114+?del" "r.?" "p.?" "15i_19i" "0000354063" "00005463" "00" "898" "0" "898" "0" "c.898G>A" "r.(?)" "p.(Gly300Arg)" "16" "0000354064" "00005463" "00" "898" "0" "898" "0" "c.898G>A" "r.(?)" "p.(Gly300Arg)" "16" "0000354065" "00005463" "00" "898" "0" "898" "0" "c.898G>A" "r.(?)" "p.(Gly300Arg)" "16" "0000354066" "00005463" "00" "934" "0" "934" "0" "c.934G>C" "r.(?)" "p.(Gly312Arg)" "17" "0000354067" "00005463" "30" "976" "0" "976" "0" "c.976G>T" "r.(?)" "p.(Asp326Tyr)" "17" "0000354068" "00005463" "00" "988" "-6" "988" "-6" "c.988-6C>T" "r.(?)" "p.(=)" "17i" "0000354069" "00005463" "00" "1006" "0" "1006" "0" "c.1006G>T" "r.(?)" "p.(Gly336Cys)" "18" "0000354070" "00005463" "00" "1060" "0" "1060" "0" "c.1060G>T" "r.1060g>u" "p.Gly354*" "19" "0000354071" "00005463" "00" "1148" "0" "1148" "0" "c.1148G>A" "r.(?)" "p.Gly395Glu" "20" "0000354072" "00005463" "90" "1151" "-1" "1504" "1" "c.(1150+1_1151-1)_(1504+1_1505-1)del" "r.?" "p.?" "20i_23i" "0000354073" "00005463" "90" "1216" "0" "1216" "0" "c.1216C>T" "r.(?)" "p.(Arg406*)" "21" "0000354074" "00005463" "90" "1219" "0" "1219" "0" "c.1219G>C" "r.(?)" "p.(Gly407Arg)" "21" "0000354075" "00005463" "00" "1219" "0" "1219" "0" "c.1219G>T" "r.(?)" "p.(Gly407Cys)" "21" "0000354076" "00005463" "00" "1219" "0" "1219" "0" "c.1219G>A" "r.(?)" "p.(Gly407Ser)" "21" "0000354077" "00005463" "50" "1288" "0" "1288" "0" "c.1288G>A" "r.(?)" "p.(Gly430Arg)" "21" "0000354078" "00005463" "00" "1354" "0" "1354" "0" "c.1354G>A" "r.(?)" "p.(Gly452Arg)" "22" "0000354079" "00005463" "10" "1352" "0" "1352" "0" "c.1352A>G" "r.(?)" "p.(His451Arg)" "22" "0000354080" "00005463" "90" "1354" "0" "1354" "0" "c.1354G>A" "r.(?)" "p.(Gly452Arg)" "22" "0000354081" "00005463" "00" "1354" "0" "1354" "0" "c.1354G>A" "r.(?)" "p.(Gly452Arg)" "22" "0000354082" "00005463" "00" "1363" "0" "1363" "0" "c.1363G>T" "r.(?)" "p.(Gly455Cys)" "22" "0000354083" "00005463" "00" "1354" "0" "1354" "0" "c.1354G>A" "r.1354g>a" "p.Gly452Arg" "22" "0000354084" "00005463" "00" "1483" "0" "1483" "0" "c.1483C>T" "r.(?)" "p.(His495Tyr)" "23" "0000354085" "00005463" "00" "1504" "1" "1504" "1" "c.1504+1G>A" "r.spl" "p.?" "23i" "0000354086" "00005463" "00" "1504" "1" "1504" "1" "c.1504+1G>A" "r.spl" "p.?" "23i" "0000354087" "00005463" "00" "1504" "1" "1504" "1" "c.1504+1G>A" "r.spl" "p.?" "23i" "0000354088" "00005463" "90" "1527" "0" "1527" "0" "c.1527G>C" "r.(?)" "p.(Leu509Phe)" "24" "0000354089" "00005463" "00" "1558" "0" "1558" "0" "c.1558G>C" "r.(?)" "p.(Gly520Arg)" "24" "0000354090" "00005463" "00" "1558" "0" "1558" "0" "c.1558G>C" "r.(?)" "p.(Gly520Arg)" "24" "0000354091" "00005463" "00" "1558" "0" "1558" "0" "c.1558G>C" "r.(?)" "p.(Gly520Arg)" "24" "0000354092" "00005463" "00" "1559" "0" "1559" "0" "c.1559G>A" "r.(?)" "p.(Gly520Asp)" "24" "0000354093" "00005463" "00" "1594" "0" "1594" "0" "c.1594G>T" "r.spl?" "p.(Gly532Cys)" "25" "0000354094" "00005463" "00" "1687" "0" "1687" "0" "c.1687G>A" "r.(?)" "p.(Gly563Arg)" "25" "0000354096" "00005463" "00" "1714" "0" "1714" "0" "c.1714G>A" "r.(?)" "p.(Gly572Arg)" "25" "0000354097" "00005463" "10" "1721" "0" "1721" "0" "c.1721C>T" "r.(?)" "p.(Pro574Leu)" "25" "0000354098" "00005463" "50" "1831" "0" "1831" "0" "c.1831G>A" "r.(?)" "p.(Gly611Arg)" "26" "0000354099" "00005463" "00" "1844" "0" "1844" "0" "c.1844dup" "r.1843insc" "p.(Pro616Thrfs*30)" "26" "0000354100" "00005463" "00" "1855" "0" "1855" "0" "c.1855G>A" "r.(?)" "p.(Gly619Arg)" "26" "0000354101" "00005463" "00" "1892" "0" "1892" "0" "c.1892G>T" "r.(?)" "p.(Gly631Val)" "26" "0000354102" "00005463" "90" "1918" "0" "1918" "0" "c.1918G>A" "r.1918g>a" "p.Gly640Arg" "26" "0000354103" "00005463" "90" "1927" "0" "1927" "0" "c.1927G>A" "r.(?)" "p.(Gly643Ser)" "26" "0000354104" "00005463" "90" "1927" "0" "1927" "0" "c.1927G>A" "r.(?)" "p.(Gly643Ser)" "26" "0000354105" "00005463" "90" "1927" "0" "1927" "0" "c.1927G>A" "r.(?)" "p.(Gly643Ser)" "26" "0000354106" "00005463" "90" "1976" "0" "1976" "0" "c.1976G>C" "r.(?)" "p.(Gly659Ala)" "27" "0000354107" "00005463" "00" "1984" "0" "1984" "0" "c.1984G>A" "r.(?)" "p.(Gly662Arg)" "27" "0000354108" "00005463" "00" "2020" "2" "2020" "2" "c.2020+2T>C" "r.spl" "p.?" "27i" "0000354109" "00005463" "90" "2021" "-1" "2021" "-1" "c.2021-1G>A" "r.spl" "p.?" "27i" "0000354110" "00005463" "00" "2083" "0" "2083" "0" "c.2083G>A" "r.(?)" "p.Gly695Arg" "28" "0000354111" "00005463" "00" "2065" "0" "2065" "0" "c.2065G>A" "r.(?)" "p.(Gly689Arg)" "28" "0000354112" "00005463" "00" "2065" "0" "2065" "0" "c.2065G>A" "r.(?)" "p.(Gly689Arg)" "28" "0000354113" "00005463" "00" "2065" "0" "2065" "0" "c.2065G>A" "r.(?)" "p.(Gly689Arg)" "28" "0000354114" "00005463" "00" "2125" "0" "2125" "0" "c.2125G>T" "r.2125g>u" "p.Gly709*" "28" "0000354115" "00005463" "70" "2126" "-1" "2126" "-1" "c.2126-1G>C" "r.spl" "p.?" "28i" "0000354116" "00005463" "00" "2197" "0" "2197" "0" "c.2197G>A" "r.(?)" "p.(Gly733Arg)" "29" "0000354117" "00005463" "00" "2290" "0" "2290" "0" "c.2290G>A" "r.(?)" "p.Gly997Glu" "30" "0000354118" "00005463" "00" "2323" "0" "2340" "0" "c.2323_2340del" "r.(?)" "p.(Leu775_Gly780del)" "30" "0000354119" "00005463" "90" "2329" "0" "2329" "0" "c.2329G>T" "r.(?)" "p.(Gly777Cys)" "30" "0000354120" "00005463" "00" "2330" "0" "2330" "0" "c.2330G>A" "r.2330g>a" "p.Gly777Asp" "30" "0000354121" "00005463" "00" "2330" "0" "2330" "0" "c.2330G>A" "r.2330g>a" "p.Gly777Asp" "30" "0000354122" "00005463" "00" "2330" "0" "2330" "0" "c.2330G>A" "r.(?)" "p.(Gly777Asp)" "30" "0000354123" "00005463" "90" "2371" "0" "2371" "0" "c.2371C>T" "r.(?)" "p.(Arg791*)" "30" "0000354124" "00005463" "00" "2375" "-1" "2656" "1" "c.2375-?_2656+?del" "r.?" "p.?" "30i_32i" "0000354125" "00005463" "90" "2384" "0" "2384" "0" "c.2384G>A" "r.(?)" "p.(Gly795Glu)" "31" "0000354126" "00005463" "10" "2384" "-5" "2384" "-5" "c.2384-5T>C" "r.(?)" "p.(=)" "31" "0000354127" "00005463" "90" "2407" "0" "2407" "0" "c.2407C>T" "r.(?)" "p.(Gln803*)" "31" "0000354128" "00005463" "00" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Gly818Arg)" "31" "0000354129" "00005463" "00" "2489" "0" "2489" "0" "c.2489G>A" "r.(?)" "p.(Gly830Asp)" "32" "0000354130" "00005463" "90" "2531" "0" "2531" "0" "c.2531C>T" "r.(?)" "p.(Pro844Leu)" "32" "0000354131" "00005463" "90" "2672" "0" "2672" "0" "c.2672T>C" "r.(?)" "p.(Ile891Thr)" "33" "0000354132" "00005463" "00" "2698" "0" "2714" "0" "c.2698_2714del" "r.2698_2714del" "p.Ile900Profs*34" "33" "0000354133" "00005463" "00" "2737" "0" "2737" "0" "c.2737G>A" "r.(?)" "p.(Gly913Arg)" "33" "0000354134" "00005463" "00" "2746" "1" "2746" "1" "c.2746+1G>T" "r.spl" "p.?" "33i" "0000354135" "00005463" "00" "2746" "1" "2746" "1" "c.2746+1G>T" "r.spl" "p.?" "33i" "0000354136" "00005463" "00" "2768" "0" "2778" "0" "c.2768_2778del" "r.(?)" "p.(Val923Glufs*13)" "34" "0000354137" "00005463" "00" "2797" "0" "2797" "0" "c.2797A>G" "r.(?)" "p.(Lys933Glu)" "35" "0000354138" "00005463" "00" "2863" "0" "2863" "0" "c.2863G>A" "r.(?)" "p.(Gly955Arg)" "33" "0000354139" "00005463" "90" "2881" "1" "2881" "1" "c.2881+1G>A" "r.spl" "p.?" "34i" "0000354140" "00005463" "90" "2881" "1" "2881" "1" "c.2881+1G>A" "r.spl" "p.?" "34i" "0000354141" "00005463" "00" "2981" "-76" "2981" "-76" "c.2981-76C>T" "r.(?)" "p.(=)" "35i" "0000354142" "00005463" "90" "2990" "0" "2990" "0" "c.2990G>A" "r.(?)" "p.(Gly997Glu)" "36" "0000354143" "00005463" "90" "2990" "0" "2990" "0" "c.2990G>A" "r.(?)" "p.(Gly997Glu)" "36" "0000354144" "00005463" "00" "2990" "0" "2990" "0" "c.2990G>A" "r.(?)" "p.(Gly997Glu)" "36" "0000354145" "00005463" "00" "3115" "0" "3115" "0" "c.3115G>C" "r.(?)" "p.(Gly1039Arg)" "37" "0000354146" "00005463" "90" "3151" "0" "3151" "0" "c.3151G>A" "r.(?)" "p.(Gly1051Arg)" "37" "0000354147" "00005463" "10" "3325" "0" "3325" "0" "c.3325C>T" "r.(?)" "p.(Pro1109Ser)" "38" "0000354148" "00005463" "00" "3238" "0" "3238" "0" "c.3238G>A" "r.(?)" "p.(Gly1080Arg)" "38" "0000354149" "00005463" "90" "3266" "0" "3266" "0" "c.3266G>A" "r.(?)" "p.(Gly1089Asp)" "38" "0000354150" "00005463" "90" "3338" "-1" "3338" "-1" "c.3338-1G>A" "r.spl" "p.?" "38i" "0000354151" "00005463" "00" "3239" "0" "3239" "0" "c.3239G>C" "r.(?)" "p.(Gly1080Ala)" "39" "0000354152" "00005463" "00" "3266" "0" "3266" "0" "c.3266G>A" "r.(?)" "p.(Gly1089Asp)" "39" "0000354153" "00005463" "00" "3464" "0" "3464" "0" "c.3464G>A" "r.(?)" "p.(Gly1155Asp)" "40" "0000354154" "00005463" "00" "3464" "0" "3464" "0" "c.3464G>A" "r.(?)" "p.(Gly1155Asp)" "40" "0000354155" "00005463" "00" "3454" "0" "3454" "0" "c.3454G>C" "r.(?)" "p.(Gly1152Arg)" "40" "0000354156" "00005463" "00" "3464" "0" "3464" "0" "c.3464T>G" "r.(?)" "p.Gly1155Asp" "40" "0000354157" "00005463" "00" "3454" "0" "3454" "0" "c.3454G>T" "r.(?)" "p.(Gly1152Cys)" "40" "0000354158" "00005463" "00" "3566" "-1" "3566" "-1" "c.3566-1G>A" "r.spl" "p.?" "41i" "0000354159" "00005463" "00" "3575" "0" "3575" "0" "c.3575G>A" "r.(?)" "p.(Gly1192Glu)" "42" "0000354160" "00005463" "00" "3674" "0" "3674" "0" "c.3674G>T" "r.(?)" "p.(Gly1225Val)" "42" "0000354161" "00005463" "00" "3752" "-511" "3955" "576" "c.3752-511_3955+576del" "r.?" "p.?" "42i_44i" "0000354162" "00005463" "90" "3769" "0" "3769" "0" "c.3769G>A" "r.(?)" "p.(Gly1257Arg)" "43" "0000354163" "00005463" "00" "3769" "0" "3769" "0" "c.3769G>A" "r.(?)" "p.(Gly1257Arg)" "43" "0000354164" "00005463" "00" "3829" "0" "3829" "0" "c.3829G>A" "r.(?)" "p.(Gly1277Ser)" "43" "0000354165" "00005463" "00" "3829" "0" "3829" "0" "c.3829G>A" "r.(?)" "p.(Gly1277Ser)" "43" "0000354167" "00005463" "10" "3807" "0" "3807" "0" "c.3807C>A" "r.(?)" "p.(Asp1269Glu)" "43" "0000354168" "00005463" "00" "3882" "5" "3882" "5" "c.3882+5G>A" "r.spl?" "p.?" "43i" "0000354169" "00005463" "00" "3883" "-1" "4252" "1" "c.3883-?_4252+?dup" "r.(?)" "p.?" "43i_47i" "0000354170" "00005463" "90" "3946" "0" "3946" "0" "c.3946G>A" "r.(?)" "p.(Gly1316Ser)" "44" "0000354171" "00005463" "90" "3883" "-1" "4252" "1" "c.(3882+1_3883-1)_(4252+1_4253-1)dup" "r.?" "p.?" "43i_47i" "0000354172" "00005463" "00" "4153" "2" "4153" "2" "c.4153+2T>A" "r.spl" "p.?" "46i" "0000354173" "00005463" "00" "4207" "0" "4207" "0" "c.4207G>A" "r.(?)" "p.(Gly1403Arg)" "47" "0000354174" "00005463" "00" "4235" "0" "4235" "0" "c.4235G>T" "r.(?)" "p.(Gly1412Val)" "47" "0000354175" "00005463" "00" "4235" "0" "4235" "0" "c.4235G>A" "r.(?)" "p.(Gly1412Asp)" "47" "0000354176" "00005463" "00" "4280" "0" "4280" "0" "c.4280G>A" "r.(?)" "p.(Gly1427Asp)" "48" "0000354177" "00005463" "00" "4364" "0" "4364" "0" "c.4364del" "r.(?)" "p.(Thr1455Lysfs*74)" "48" "0000354178" "00005463" "70" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000354179" "00005463" "70" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000354180" "00005463" "95" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000354181" "00005463" "00" "4421" "0" "4421" "0" "c.4421C>T" "r.(?)" "p.Leu1474Pro" "48" "0000354182" "00005463" "90" "4462" "457" "4462" "457" "c.4462+457C>G" "r.4462_4463ins4462+318_4462+456" "p.Thr1489Serfs*23" "48i" "0000354183" "00005463" "90" "4462" "457" "4462" "457" "c.4462+457C>G" "r.4462_4463ins4462+318_4462+456" "p.Thr1489Serfs*23" "48i" "0000354184" "00005463" "90" "4462" "457" "4462" "457" "c.4462+457C>G" "r.(4462_4463ins_4462+318_4462+456)" "p.(=)" "48i" "0000354185" "00005463" "00" "4523" "0" "4523" "0" "c.4523A>G" "r.(?)" "p.(Asn1508Ser)" "49" "0000354186" "00005463" "00" "4502" "0" "4502" "0" "c.4502C>A" "r.(?)" "p.(Pro1501Gln)" "49" "0000354187" "00005463" "00" "4708" "0" "4708" "0" "c.4708T>C" "r.(?)" "p.(Cys1570Arg)" "50" "0000354188" "00005463" "00" "4743" "0" "4743" "0" "c.4743T>G" "r.(?)" "p.(Phe1581Leu)" "50" "0000354189" "00005463" "90" "4819" "0" "4819" "0" "c.4819G>T" "r.(?)" "p.(Glu1607*)" "51" "0000354190" "00005463" "00" "4887" "0" "4888" "0" "c.4887_4888del" "r.(?)" "p.(Tyr1629*)" "51" "0000354191" "00005463" "00" "4981" "0" "4981" "0" "c.4981C>T" "r.(?)" "p.Arg1661Cys" "52" "0000354192" "00005463" "00" "4994" "0" "4994" "0" "c.4994G>A" "r.(?)" "p.(Cys1665Tyr)" "52" "0000354193" "00005463" "90" "-1" "0" "87" "1" "c.(?_-1)_(87+1_88-1)del" "r.0?" "p.0?" "_1_1i" "0000354271" "00005463" "10" "2501" "0" "2501" "0" "c.2501A>G" "r.(?)" "p.(Lys834Arg)" "32" "0000354740" "00005463" "90" "4420" "0" "4424" "0" "c.4420_4424del" "r.(?)" "p.(Leu1474Cysfs*34)" "48" "0000354741" "00005463" "90" "2600" "0" "2601" "0" "c.2600_2601delinsA" "r.(?)" "p.(Met867Lysfs*16)" "32" "0000354747" "00005463" "70" "4262" "0" "4262" "0" "c.4262G>T" "r.(?)" "p.(Gly1421Val)" "48" "0000354749" "00005463" "90" "4441" "0" "4441" "0" "c.4441C>T" "r.(?)" "p.(Arg1481*)" "48" "0000354750" "00005463" "90" "1937" "0" "1937" "0" "c.1937dup" "r.(?)" "p.(Glu647Argfs*45)" "27" "0000354754" "00005463" "70" "1580" "0" "1580" "0" "c.1580del" "r.(?)" "p.(Phe527Serfs*50)" "25" "0000354756" "00005463" "50" "1576" "-12" "1576" "-12" "c.1576-12G>C" "r.(?)" "p.(=)" "" "0000354758" "00005463" "70" "2567" "0" "2567" "0" "c.2567G>A" "r.(?)" "p.(Gly856Glu)" "32" "0000354777" "00005463" "50" "4700" "0" "4700" "0" "c.4700T>G" "r.(?)" "p.(Ile1567Ser)" "50" "0000354781" "00005463" "90" "2621" "0" "2622" "0" "c.2621_2622delinsT" "r.(?)" "p.(Gly874Valfs*9)" "32" "0000354793" "00005463" "50" "546" "12" "546" "12" "c.546+12C>T" "r.(?)" "p.(=)" "9i" "0000354795" "00005463" "50" "3440" "0" "3440" "0" "c.3440C>T" "r.(?)" "p.(Ser1147Phe)" "40" "0000354797" "00005463" "50" "1150" "5" "1150" "5" "c.1150+5G>A" "r.(?)" "p.(=)" "20i" "0000354802" "00005463" "50" "671" "0" "671" "0" "c.671G>A" "r.(?)" "p.(Gly224Glu)" "12" "0000354804" "00005463" "50" "1000" "0" "1000" "0" "c.1000G>C" "r.(?)" "p.(Asp334His)" "18" "0000354807" "00005463" "50" "329" "0" "329" "0" "c.329C>T" "r.(?)" "p.(Thr110Ile)" "6" "0000354812" "00005463" "90" "2372" "0" "2374" "4" "c.2372_2374+4del" "r.spl" "p.?" "30_30i" "0000354814" "00005463" "90" "4928" "0" "4928" "0" "c.4928G>A" "r.spl?" "p.(Arg1643Lys)" "51" "0000354815" "00005463" "90" "4708" "0" "4708" "0" "c.4708T>C" "r.(?)" "p.(Cys1570Arg)" "50" "0000354816" "00005463" "90" "4793" "0" "4793" "0" "c.4793T>G" "r.(?)" "p.(Leu1598Arg)" "51" "0000354817" "00005463" "90" "2806" "0" "2806" "0" "c.2806C>T" "r.(?)" "p.(Gln936*)" "34" "0000354819" "00005463" "90" "1576" "-20" "1576" "-6" "c.1576-20_1576-6del" "r.(?)" "Exon25(183bp)skip" "24i" "0000354821" "00005463" "90" "1855" "0" "1855" "0" "c.1855G>A" "r.(?)" "p.(Gly619Arg)" "26" "0000354822" "00005463" "00" "40" "0" "63" "0" "c.40_63del" "r.(?)" "p.(Leu14_Leu21del)" "1" "0000354824" "00005463" "00" "4981" "0" "4981" "0" "c.4981C>T" "r.(?)" "p.(Arg1661Cys)" "52" "0000354825" "00005463" "90" "3821" "0" "3821" "0" "c.3821dup" "r.(?)" "p.(His1275Profs*34)" "43" "0000354830" "00005463" "70" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000354831" "00005463" "90" "3687" "0" "3687" "0" "c.3687del" "r.(?)" "p.(Gly1231Valfs*33)" "42" "0000354832" "00005463" "90" "4981" "0" "4981" "0" "c.4981C>T" "r.(?)" "p.(Arg1661Cys)" "52" "0000354833" "00005463" "00" "2371" "0" "2371" "0" "c.2371C>T" "r.(?)" "p.(Arg791*)" "30" "0000354837" "00005463" "90" "4793" "0" "4793" "0" "c.4793T>G" "r.(?)" "p.(Leu1598Arg)" "51" "0000354838" "00005463" "70" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000354840" "00005463" "90" "4354" "0" "4354" "0" "c.4354A>T" "r.(?)" "p.(Ser1452Cys)" "48" "0000354841" "00005463" "90" "4793" "0" "4793" "0" "c.4793T>G" "r.(?)" "p.(Leu1598Arg)" "51" "0000354842" "00005463" "00" "4354" "0" "4354" "0" "c.4354A>T" "r.(?)" "p.(Ser1452Cys)" "48" "0000354843" "00005463" "90" "4981" "0" "4981" "0" "c.4981C>T" "r.(?)" "p.(Arg1661Cys)" "52" "0000354845" "00005463" "90" "4028" "-27" "4028" "-27" "c.4028-27A>G" "r.(=)" "Exon46(126bp)skip" "45i" "0000354847" "00005463" "90" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "48" "0000354849" "00005463" "00" "4793" "0" "4793" "0" "c.4793T>G" "r.(?)" "p.(Leu1598Arg)" "51" "0000354850" "00005463" "00" "3499" "0" "3499" "0" "c.3499G>A" "r.(?)" "p.(Gly1167Arg)" "40" "0000354852" "00005463" "90" "4793" "0" "4793" "0" "c.4793T>G" "r.(?)" "p.(Leu1598Arg)" "51" "0000354853" "00005463" "90" "4793" "0" "4793" "0" "c.4793T>G" "r.(?)" "p.(Leu1598Arg)" "51" "0000354857" "00005463" "90" "4559" "0" "4561" "0" "c.4559_4561del" "r.(?)" "p.(Ser1520del)" "49" "0000354858" "00005463" "00" "2126" "-1" "2126" "-1" "c.2126-1G>C" "r.spl" "p.?" "28i" "0000354859" "00005463" "00" "1831" "0" "1831" "0" "c.1831G>A" "r.(?)" "p.(Gly611Arg)" "26" "0000354866" "00005463" "00" "3829" "0" "3829" "0" "c.3829G>A" "r.(?)" "p.(Gly1277Ser)" "43" "0000354868" "00005463" "70" "1504" "1" "1504" "1" "c.1504+1G>A" "r.spl" "p.?" "23i" "0000354869" "00005463" "00" "2065" "0" "2065" "0" "c.2065G>A" "r.(?)" "p.(Gly689Arg)" "28" "0000354871" "00005463" "70" "2746" "1" "2746" "1" "c.2746+1G>T" "r.spl" "p.?" "33i" "0000354888" "00005463" "00" "4994" "0" "4994" "0" "c.4994G>A" "r.(?)" "p.(Cys1665Tyr)" "52" "0000354890" "00005463" "00" "898" "0" "898" "0" "c.898G>A" "r.(?)" "p.(Gly300Arg)" "18" "0000354891" "00005463" "00" "3829" "0" "3829" "0" "c.3829G>A" "r.(?)" "p.(Gly1277Ser)" "43" "0000354895" "00005463" "00" "1558" "0" "1558" "0" "c.1558G>C" "r.(?)" "p.(Gly520Arg)" "24" "0000354897" "00005463" "00" "4523" "0" "4523" "0" "c.4523A>G" "r.(?)" "p.(Asn1508Ser)" "49" "0000354901" "00005463" "00" "1697" "0" "1697" "0" "c.1697G>C" "r.(?)" "p.(Gly566Ala)" "25" "0000354906" "00005463" "00" "3829" "0" "3829" "0" "c.3829G>A" "r.(?)" "p.(Gly1277Ser)" "43" "0000354911" "00005463" "50" "1330" "0" "1330" "0" "c.1330C>T" "r.(?)" "p.(Arg444Cys)" "22" "0000354914" "00005463" "50" "2887" "0" "2887" "0" "c.2887G>A" "r.(?)" "p.(Ala963Thr)" "35" "0000354915" "00005463" "90" "3499" "0" "3499" "0" "c.3499G>A" "r.(?)" "p.(Gly1167Arg)" "40" "0000355057" "00005463" "90" "2507" "0" "2507" "0" "c.2507G>A" "r.(?)" "p.(Gly836Glu)" "32" "0000355058" "00005463" "90" "0" "0" "0" "0" "c.?" "r.805_828del" "p.Glu269_Ser276del" "14" "0000454264" "00005463" "70" "4649" "0" "4649" "0" "c.4649T>G" "r.(?)" "p.(Val1550Gly)" "50" "0000478196" "00005463" "90" "1150" "5" "1150" "5" "c.1150+5G>A" "r.spl?" "p.?" "" "0000478197" "00005463" "90" "4028" "-3" "4028" "-3" "c.4028-3C>T" "r.spl?" "p.?" "" "0000499677" "00005463" "90" "2567" "0" "2567" "0" "c.2567G>A" "r.(?)" "p.(Gly856Glu)" "32" "0000514944" "00005463" "30" "599" "0" "599" "0" "c.599C>T" "r.(?)" "p.(Pro200Leu)" "" "0000514946" "00005463" "70" "725" "0" "725" "0" "c.725G>A" "r.(?)" "p.(Gly242Glu)" "" "0000514947" "00005463" "30" "756" "0" "756" "0" "c.756T>A" "r.(?)" "p.(Asp252Glu)" "" "0000514948" "00005463" "30" "805" "0" "805" "0" "c.805G>A" "r.(?)" "p.(Glu269Lys)" "" "0000514949" "00005463" "10" "828" "96" "828" "96" "c.828+96dup" "r.(=)" "p.(=)" "" "0000514950" "00005463" "50" "838" "0" "838" "0" "c.838G>A" "r.(?)" "p.(Gly280Arg)" "" "0000514951" "00005463" "30" "934" "-6" "934" "-6" "c.934-6C>A" "r.(=)" "p.(=)" "" "0000514952" "00005463" "30" "942" "0" "942" "0" "c.942G>A" "r.(?)" "p.(Lys314=)" "" "0000514953" "00005463" "50" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Pro364Leu)" "" "0000514954" "00005463" "70" "1927" "0" "1927" "0" "c.1927G>A" "r.(?)" "p.(Gly643Ser)" "" "0000514955" "00005463" "70" "2083" "0" "2083" "0" "c.2083G>A" "r.(?)" "p.(Gly695Arg)" "" "0000514956" "00005463" "90" "2083" "0" "2083" "0" "c.2083G>A" "r.(?)" "p.(Gly695Arg)" "" "0000514957" "00005463" "10" "2489" "-67" "2489" "-64" "c.2489-67_2489-64dup" "r.(=)" "p.(=)" "" "0000514959" "00005463" "30" "2589" "0" "2589" "0" "c.2589T>C" "r.(?)" "p.(His863=)" "" "0000514960" "00005463" "30" "2636" "0" "2636" "0" "c.2636C>T" "r.(?)" "p.(Pro879Leu)" "" "0000514961" "00005463" "30" "2672" "0" "2672" "0" "c.2672T>C" "r.(?)" "p.(Ile891Thr)" "" "0000514962" "00005463" "10" "3419" "-5" "3419" "-4" "c.3419-5_3419-4del" "r.spl?" "p.?" "" "0000514963" "00005463" "30" "3419" "-3" "3419" "-3" "c.3419-3C>T" "r.spl?" "p.?" "" "0000514964" "00005463" "30" "3419" "-2" "3419" "-2" "c.3419-2A>T" "r.spl?" "p.?" "" "0000514965" "00005463" "30" "3419" "0" "3419" "0" "c.3419G>T" "r.(?)" "p.(Gly1140Val)" "" "0000514966" "00005463" "30" "3421" "0" "3421" "0" "c.3421C>T" "r.(?)" "p.(Leu1141Phe)" "" "0000514967" "00005463" "50" "3553" "0" "3553" "0" "c.3553C>T" "r.(?)" "p.(Pro1185Ser)" "" "0000514968" "00005463" "30" "3566" "-9" "3566" "-9" "c.3566-9T>C" "r.(=)" "p.(=)" "" "0000514969" "00005463" "30" "3807" "0" "3807" "0" "c.3807C>A" "r.(?)" "p.(Asp1269Glu)" "" "0000514970" "00005463" "10" "3807" "0" "3807" "0" "c.3807C>A" "r.(?)" "p.(Asp1269Glu)" "" "0000514971" "00005463" "50" "3829" "0" "3829" "0" "c.3829G>A" "r.(?)" "p.(Gly1277Ser)" "" "0000514972" "00005463" "50" "3829" "0" "3829" "0" "c.3829G>A" "r.(?)" "p.(Gly1277Ser)" "" "0000514973" "00005463" "30" "4041" "0" "4041" "0" "c.4041C>A" "r.(?)" "p.(Asp1347Glu)" "" "0000514974" "00005463" "50" "4211" "0" "4211" "0" "c.4211C>T" "r.(?)" "p.(Pro1404Leu)" "" "0000514975" "00005463" "90" "4235" "0" "4235" "0" "c.4235G>A" "r.(?)" "p.(Gly1412Asp)" "" "0000514976" "00005463" "50" "4574" "0" "4574" "0" "c.4574C>T" "r.(?)" "p.(Thr1525Ile)" "" "0000514977" "00005463" "50" "4664" "0" "4664" "0" "c.4664C>T" "r.(?)" "p.(Ala1555Val)" "" "0000514978" "00005463" "30" "4665" "0" "4665" "0" "c.4665G>A" "r.(?)" "p.(Ala1555=)" "" "0000607686" "00005463" "30" "-10" "0" "-10" "0" "c.-10C>T" "r.(?)" "p.(=)" "" "0000607687" "00005463" "30" "33" "0" "33" "0" "c.33G>T" "r.(?)" "p.(Val11=)" "" "0000607688" "00005463" "50" "40" "0" "63" "0" "c.40_63del" "r.(?)" "p.(Leu14_Leu21del)" "" "0000607689" "00005463" "10" "88" "-4" "88" "-4" "c.88-4C>T" "r.spl?" "p.?" "" "0000607690" "00005463" "10" "127" "0" "127" "0" "c.127G>C" "r.(?)" "p.(Gly43Arg)" "" "0000607691" "00005463" "10" "144" "12" "144" "12" "c.144+12C>A" "r.(=)" "p.(=)" "" "0000607692" "00005463" "30" "144" "39" "144" "39" "c.144+39A>T" "r.(=)" "p.(=)" "" "0000607693" "00005463" "90" "184" "0" "184" "0" "c.184dup" "r.(?)" "p.(Gln62ProfsTer8)" "" "0000607694" "00005463" "10" "222" "0" "222" "0" "c.222G>T" "r.(?)" "p.(Pro74=)" "" "0000607695" "00005463" "10" "325" "-27" "325" "-27" "c.325-27C>T" "r.(=)" "p.(=)" "" "0000607696" "00005463" "30" "341" "0" "341" "0" "c.341C>T" "r.(?)" "p.(Thr114Ile)" "" "0000607697" "00005463" "70" "344" "0" "344" "0" "c.344G>C" "r.(?)" "p.(Gly115Ala)" "" "0000607698" "00005463" "50" "346" "0" "346" "0" "c.346C>A" "r.(?)" "p.(Pro116Thr)" "" "0000607699" "00005463" "10" "422" "0" "422" "0" "c.422T>C" "r.(?)" "p.(Leu141Pro)" "" "0000607700" "00005463" "50" "441" "5" "441" "5" "c.441+5G>T" "r.spl?" "p.?" "" "0000607701" "00005463" "50" "442" "-28" "442" "-28" "c.442-28A>G" "r.(=)" "p.(=)" "" "0000607702" "00005463" "70" "443" "0" "443" "0" "c.443G>T" "r.(?)" "p.(Gly148Val)" "" "0000607703" "00005463" "10" "485" "0" "485" "0" "c.485A>G" "r.(?)" "p.(Glu162Gly)" "" "0000607704" "00005463" "70" "520" "0" "520" "0" "c.520G>T" "r.(?)" "p.(Gly174Trp)" "" "0000607705" "00005463" "10" "547" "-9" "547" "-9" "c.547-9A>C" "r.(=)" "p.(=)" "" "0000607706" "00005463" "70" "547" "0" "547" "0" "c.547G>T" "r.(?)" "p.(Gly183Cys)" "" "0000607707" "00005463" "70" "593" "0" "593" "0" "c.593dup" "r.(?)" "p.(Pro199SerfsTer14)" "" "0000607708" "00005463" "30" "610" "-36" "610" "-36" "c.610-36T>A" "r.(=)" "p.(=)" "" "0000607709" "00005463" "50" "670" "0" "670" "0" "c.670G>A" "r.(?)" "p.(Gly224Arg)" "" "0000607710" "00005463" "90" "713" "0" "713" "0" "c.713del" "r.(?)" "p.(Pro238ArgfsTer9)" "" "0000607711" "00005463" "70" "716" "0" "716" "0" "c.716G>A" "r.(?)" "p.(Gly239Glu)" "" "0000607712" "00005463" "30" "738" "0" "738" "0" "c.738G>A" "r.(?)" "p.(Val246=)" "" "0000607713" "00005463" "30" "766" "-13" "766" "-13" "c.766-13G>A" "r.(=)" "p.(=)" "" "0000607714" "00005463" "30" "805" "0" "805" "0" "c.805G>A" "r.(?)" "p.(Glu269Lys)" "" "0000607715" "00005463" "10" "828" "20" "828" "20" "c.828+20A>G" "r.(=)" "p.(=)" "" "0000607716" "00005463" "30" "829" "-15" "829" "-15" "c.829-15C>T" "r.(=)" "p.(=)" "" "0000607717" "00005463" "70" "888" "1" "888" "1" "c.888+1G>A" "r.spl?" "p.?" "" "0000607718" "00005463" "10" "888" "30" "888" "30" "c.888+30G>A" "r.(=)" "p.(=)" "" "0000607719" "00005463" "10" "889" "-39" "889" "-39" "c.889-39T>C" "r.(=)" "p.(=)" "" "0000607720" "00005463" "70" "898" "0" "898" "0" "c.898G>A" "r.(?)" "p.(Gly300Arg)" "" "0000607721" "00005463" "10" "933" "14" "933" "14" "c.933+14T>C" "r.(=)" "p.(=)" "" "0000607722" "00005463" "30" "934" "-6" "934" "-6" "c.934-6C>A" "r.(=)" "p.(=)" "" "0000607723" "00005463" "30" "987" "20" "987" "20" "c.987+20C>G" "r.(=)" "p.(=)" "" "0000607724" "00005463" "10" "987" "35" "987" "35" "c.987+35T>G" "r.(=)" "p.(=)" "" "0000607725" "00005463" "30" "1030" "-18" "1030" "-18" "c.1030-18G>A" "r.(=)" "p.(=)" "" "0000607726" "00005463" "90" "1111" "0" "1111" "0" "c.1111C>T" "r.(?)" "p.(Gln371Ter)" "" "0000607727" "00005463" "30" "1115" "-14" "1115" "-14" "c.1115-14T>G" "r.(=)" "p.(=)" "" "0000607729" "00005463" "70" "1174" "0" "1174" "0" "c.1174G>A" "r.(?)" "p.(Gly392Arg)" "" "0000607730" "00005463" "10" "1223" "0" "1223" "0" "c.1223G>A" "r.(?)" "p.(Arg408His)" "" "0000607731" "00005463" "10" "1352" "0" "1352" "0" "c.1352A>G" "r.(?)" "p.(His451Arg)" "" "0000607732" "00005463" "70" "1354" "0" "1354" "0" "c.1354G>A" "r.(?)" "p.(Gly452Arg)" "" "0000607733" "00005463" "30" "1362" "0" "1362" "0" "c.1362A>T" "r.(?)" "p.(Pro454=)" "" "0000607734" "00005463" "70" "1428" "0" "1428" "0" "c.1428T>A" "r.(?)" "p.(Cys476Ter)" "" "0000607735" "00005463" "10" "1452" "0" "1452" "0" "c.1452G>A" "r.(?)" "p.(Gly484=)" "" "0000607736" "00005463" "30" "1483" "0" "1483" "0" "c.1483C>T" "r.(?)" "p.(His495Tyr)" "" "0000607737" "00005463" "30" "1504" "23" "1504" "23" "c.1504+23T>C" "r.(=)" "p.(=)" "" "0000607738" "00005463" "30" "1516" "0" "1516" "0" "c.1516G>A" "r.(?)" "p.(Ala506Thr)" "" "0000607739" "00005463" "30" "1527" "0" "1527" "0" "c.1527G>C" "r.(?)" "p.(Leu509Phe)" "" "0000607740" "00005463" "70" "1540" "0" "1540" "0" "c.1540G>C" "r.(?)" "p.(Gly514Arg)" "" "0000607741" "00005463" "10" "1721" "0" "1721" "0" "c.1721C>T" "r.(?)" "p.(Pro574Leu)" "" "0000607742" "00005463" "50" "1752" "0" "1752" "0" "c.1752C>T" "r.(?)" "p.(Gly584=)" "" "0000607743" "00005463" "90" "1918" "0" "1918" "0" "c.1918G>A" "r.(?)" "p.(Gly640Arg)" "" "0000607744" "00005463" "50" "2122" "0" "2122" "0" "c.2122A>G" "r.(?)" "p.(Lys708Glu)" "" "0000607745" "00005463" "70" "2135" "0" "2135" "0" "c.2135G>T" "r.(?)" "p.(Gly712Val)" "" "0000607746" "00005463" "50" "2263" "0" "2263" "0" "c.2263C>T" "r.(?)" "p.(Pro755Ser)" "" "0000607747" "00005463" "30" "2284" "0" "2284" "0" "c.2284G>C" "r.(?)" "p.(Gly762Arg)" "" "0000607748" "00005463" "90" "2371" "0" "2371" "0" "c.2371C>T" "r.(?)" "p.(Arg791Ter)" "" "0000607749" "00005463" "30" "2489" "-8" "2489" "-8" "c.2489-8G>A" "r.(=)" "p.(=)" "" "0000607750" "00005463" "70" "2657" "-1" "2657" "-1" "c.2657-1G>T" "r.spl?" "p.?" "" "0000607751" "00005463" "30" "2662" "0" "2662" "0" "c.2662G>A" "r.(?)" "p.(Asp888Asn)" "" "0000607752" "00005463" "90" "2691" "0" "2691" "0" "c.2691del" "r.(?)" "p.(Gly898GlufsTer26)" "" "0000607753" "00005463" "70" "2711" "0" "2711" "0" "c.2711G>A" "r.(?)" "p.(Gly904Glu)" "" "0000607754" "00005463" "70" "2765" "0" "2765" "0" "c.2765G>T" "r.(?)" "p.(Gly922Val)" "" "0000607755" "00005463" "70" "2819" "0" "2819" "0" "c.2819G>A" "r.(?)" "p.(Gly940Glu)" "" "0000607756" "00005463" "30" "2826" "0" "2826" "0" "c.2826C>T" "r.(?)" "p.(Pro942=)" "" "0000607757" "00005463" "70" "2881" "0" "2881" "0" "c.2881G>C" "r.(?)" "p.(Gly961Arg)" "" "0000607758" "00005463" "70" "2881" "1" "2881" "1" "c.2881+1G>T" "r.spl?" "p.?" "" "0000607759" "00005463" "30" "2886" "0" "2886" "0" "c.2886C>T" "r.(?)" "p.(Phe962=)" "" "0000607760" "00005463" "90" "3066" "0" "3066" "0" "c.3066del" "r.(?)" "p.(Met1022IlefsTer132)" "" "0000607761" "00005463" "70" "3089" "0" "3089" "0" "c.3089G>T" "r.(?)" "p.(Gly1030Val)" "" "0000607762" "00005463" "90" "3174" "0" "3174" "0" "c.3174T>G" "r.(?)" "p.(Tyr1058Ter)" "" "0000607763" "00005463" "50" "3182" "0" "3182" "0" "c.3182G>A" "r.(?)" "p.(Gly1061Asp)" "" "0000607764" "00005463" "30" "3255" "0" "3255" "0" "c.3255G>A" "r.(?)" "p.(Met1085Ile)" "" "0000607765" "00005463" "30" "3258" "0" "3258" "0" "c.3258G>A" "r.(?)" "p.(Gly1086=)" "" "0000607766" "00005463" "30" "3279" "0" "3279" "0" "c.3279T>C" "r.(?)" "p.(His1093=)" "" "0000607767" "00005463" "90" "3308" "0" "3308" "0" "c.3308dup" "r.(?)" "p.(Gly1104TrpfsTer17)" "" "0000607768" "00005463" "30" "3325" "0" "3325" "0" "c.3325C>T" "r.(?)" "p.(Pro1109Ser)" "" "0000607769" "00005463" "50" "3328" "0" "3328" "0" "c.3328G>C" "r.(?)" "p.(Gly1110Arg)" "" "0000607770" "00005463" "70" "3337" "2" "3337" "2" "c.3337+2T>C" "r.spl?" "p.?" "" "0000607771" "00005463" "70" "3402" "0" "3418" "1" "c.3402_3418+1del" "r.spl?" "p.?" "" "0000607772" "00005463" "10" "3419" "-39" "3419" "-39" "c.3419-39C>T" "r.(=)" "p.(=)" "" "0000607773" "00005463" "10" "3419" "-15" "3419" "-15" "c.3419-15T>G" "r.(=)" "p.(=)" "" "0000607774" "00005463" "70" "3490" "0" "3490" "0" "c.3490G>A" "r.(?)" "p.(Gly1164Ser)" "" "0000607775" "00005463" "30" "3627" "0" "3627" "0" "c.3627G>A" "r.(?)" "p.(Met1209Ile)" "" "0000607776" "00005463" "30" "3644" "0" "3644" "0" "c.3644G>A" "r.(?)" "p.(Arg1215Gln)" "" "0000607777" "00005463" "30" "3723" "0" "3723" "0" "c.3723T>C" "r.(?)" "p.(Arg1241=)" "" "0000607778" "00005463" "70" "3733" "0" "3733" "0" "c.3733G>A" "r.(?)" "p.(Gly1245Ser)" "" "0000607779" "00005463" "10" "3751" "66" "3751" "66" "c.3751+66C>T" "r.(=)" "p.(=)" "" "0000607780" "00005463" "30" "3882" "10" "3882" "10" "c.3882+10G>A" "r.(=)" "p.(=)" "" "0000607781" "00005463" "30" "4028" "-21" "4028" "-21" "c.4028-21T>A" "r.(=)" "p.(=)" "" "0000607782" "00005463" "30" "4034" "0" "4034" "0" "c.4034G>A" "r.(?)" "p.(Arg1345His)" "" "0000607783" "00005463" "30" "4041" "0" "4041" "0" "c.4041C>A" "r.(?)" "p.(Asp1347Glu)" "" "0000607785" "00005463" "30" "4248" "0" "4248" "0" "c.4248G>A" "r.(?)" "p.(Glu1416=)" "" "0000607786" "00005463" "30" "4252" "27" "4252" "27" "c.4252+27G>A" "r.(=)" "p.(=)" "" "0000607787" "00005463" "10" "4253" "-51" "4253" "-51" "c.4253-51G>A" "r.(=)" "p.(=)" "" "0000607788" "00005463" "50" "4370" "0" "4370" "0" "c.4370T>C" "r.(?)" "p.(Ile1457Thr)" "" "0000607789" "00005463" "70" "4379" "0" "4379" "0" "c.4379G>C" "r.(?)" "p.(Cys1460Ser)" "" "0000607790" "00005463" "30" "4398" "0" "4398" "0" "c.4398A>C" "r.(?)" "p.(Pro1466=)" "" "0000607791" "00005463" "70" "4419" "0" "4419" "0" "c.4419del" "r.(?)" "p.(Leu1474PhefsTer55)" "" "0000607792" "00005463" "90" "4420" "0" "4424" "0" "c.4420_4424del" "r.(?)" "p.(Leu1474CysfsTer34)" "" "0000607793" "00005463" "50" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "" "0000607794" "00005463" "70" "4441" "0" "4441" "0" "c.4441C>T" "r.(?)" "p.(Arg1481Ter)" "" "0000607795" "00005463" "30" "4484" "0" "4484" "0" "c.4484A>G" "r.(?)" "p.(Gln1495Arg)" "" "0000607796" "00005463" "30" "4494" "0" "4494" "0" "c.4494C>G" "r.(?)" "p.(Thr1498=)" "" "0000607797" "00005463" "50" "4664" "0" "4664" "0" "c.4664C>T" "r.(?)" "p.(Ala1555Val)" "" "0000607798" "00005463" "30" "4665" "0" "4665" "0" "c.4665G>A" "r.(?)" "p.(Ala1555=)" "" "0000607799" "00005463" "90" "4803" "0" "4803" "0" "c.4803del" "r.(?)" "p.(Gly1602AlafsTer13)" "" "0000607800" "00005463" "30" "4893" "0" "4893" "0" "c.4893C>T" "r.(?)" "p.(Phe1631=)" "" "0000607801" "00005463" "70" "4982" "0" "4982" "0" "c.4982G>A" "r.(?)" "p.(Arg1661His)" "" "0000620979" "00005463" "50" "2636" "0" "2636" "0" "c.2636C>T" "r.(?)" "p.(Pro879Leu)" "" "0000650479" "00005463" "30" "346" "0" "346" "0" "c.346C>A" "r.(?)" "p.(Pro116Thr)" "" "0000650480" "00005463" "30" "805" "0" "805" "0" "c.805G>A" "r.(?)" "p.(Glu269Lys)" "" "0000650481" "00005463" "30" "2501" "0" "2501" "0" "c.2501A>G" "r.(?)" "p.(Lys834Arg)" "" "0000650482" "00005463" "30" "3807" "0" "3807" "0" "c.3807C>A" "r.(?)" "p.(Asp1269Glu)" "" "0000654579" "00005463" "30" "136" "0" "136" "0" "c.136G>A" "r.(?)" "p.(Gly46Arg)" "" "0000654580" "00005463" "50" "2603" "0" "2603" "0" "c.2603G>C" "r.(?)" "p.(Gly868Ala)" "" "0000654581" "00005463" "30" "3258" "0" "3258" "0" "c.3258G>A" "r.(?)" "p.(Gly1086=)" "" "0000654582" "00005463" "30" "3566" "-9" "3566" "-9" "c.3566-9T>C" "r.(=)" "p.(=)" "" "0000654583" "00005463" "30" "4398" "0" "4398" "0" "c.4398A>C" "r.(?)" "p.(Pro1466=)" "" "0000654584" "00005463" "30" "4665" "0" "4665" "0" "c.4665G>T" "r.(?)" "p.(Ala1555=)" "" "0000660436" "00005463" "90" "40" "0" "63" "0" "c.40_63del" "r.(?)" "p.(Leu14_Leu21del)" "1" "0000660437" "00005463" "90" "1381" "0" "1381" "0" "c.1381G>C" "r.(?)" "p.(Gly461Arg)" "22" "0000660438" "00005463" "90" "2020" "1" "2020" "1" "c.2020+1G>T" "r.spl" "p.?" "27i" "0000665278" "00005463" "90" "2126" "-1" "2126" "-1" "c.2126-1G>C" "r.spl" "p.?" "" "0000665279" "00005463" "70" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "" "0000669610" "00005463" "30" "805" "0" "805" "0" "c.805G>A" "r.(?)" "p.(Glu269Lys)" "" "0000669611" "00005463" "30" "3807" "0" "3807" "0" "c.3807C>A" "r.(?)" "p.(Asp1269Glu)" "" "0000676536" "00005463" "30" "2886" "0" "2886" "0" "c.2886C>T" "r.(?)" "p.(Phe962=)" "" "0000676537" "00005463" "90" "3152" "0" "3152" "0" "c.3152G>C" "r.(?)" "p.(Gly1051Ala)" "" "0000676538" "00005463" "30" "4484" "0" "4484" "0" "c.4484A>G" "r.(?)" "p.(Gln1495Arg)" "" "0000688675" "00005463" "50" "389" "0" "389" "0" "c.389G>T" "r.(?)" "p.(Gly130Val)" "" "0000688676" "00005463" "30" "987" "20" "987" "20" "c.987+20C>G" "r.(=)" "p.(=)" "" "0000688677" "00005463" "90" "1315" "1" "1315" "1" "c.1315+1G>A" "r.spl?" "p.?" "" "0000688678" "00005463" "50" "1667" "0" "1667" "0" "c.1667C>T" "r.(?)" "p.(Pro556Leu)" "" "0000688679" "00005463" "30" "1668" "0" "1668" "0" "c.1668G>A" "r.(?)" "p.(Pro556=)" "" "0000688680" "00005463" "70" "3656" "0" "3656" "0" "c.3656G>C" "r.(?)" "p.(Gly1219Ala)" "" "0000688681" "00005463" "50" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "" "0000712219" "00005463" "50" "2827" "0" "2827" "0" "c.2827G>A" "r.(?)" "p.(Gly943Arg)" "" "0000718575" "00005463" "10" "145" "-99" "145" "-99" "c.145-99C>T" "r.(=)" "p.(=)" "" "0000718576" "00005463" "10" "324" "73" "324" "73" "c.324+73C>T" "r.(=)" "p.(=)" "" "0000718577" "00005463" "10" "399" "0" "399" "0" "c.399G>A" "r.(?)" "p.(Gly133=)" "" "0000718578" "00005463" "30" "756" "0" "756" "0" "c.756T>A" "r.(?)" "p.(Asp252Glu)" "" "0000718579" "00005463" "10" "765" "49" "765" "49" "c.765+49T>G" "r.(=)" "p.(=)" "" "0000718580" "00005463" "10" "976" "0" "976" "0" "c.976G>T" "r.(?)" "p.(Asp326Tyr)" "" "0000718581" "00005463" "10" "1398" "0" "1398" "0" "c.1398T>C" "r.(?)" "p.(Asp466=)" "" "0000718582" "00005463" "90" "1918" "0" "1918" "0" "c.1918G>A" "r.(?)" "p.(Gly640Arg)" "" "0000718583" "00005463" "10" "2223" "100" "2223" "100" "c.2223+100G>T" "r.(=)" "p.(=)" "" "0000718584" "00005463" "10" "2375" "-66" "2375" "-66" "c.2375-66C>T" "r.(=)" "p.(=)" "" "0000718585" "00005463" "10" "2501" "0" "2501" "0" "c.2501A>G" "r.(?)" "p.(Lys834Arg)" "" "0000718586" "00005463" "30" "2826" "0" "2826" "0" "c.2826C>T" "r.(?)" "p.(Pro942=)" "" "0000718587" "00005463" "10" "2881" "46" "2881" "46" "c.2881+46A>G" "r.(=)" "p.(=)" "" "0000718588" "00005463" "30" "3644" "0" "3644" "0" "c.3644G>A" "r.(?)" "p.(Arg1215Gln)" "" "0000718589" "00005463" "30" "4380" "0" "4380" "0" "c.4380T>C" "r.(?)" "p.(Cys1460=)" "" "0000718590" "00005463" "50" "4510" "0" "4510" "0" "c.4510T>C" "r.(?)" "p.(Phe1504Leu)" "" "0000718591" "00005463" "10" "5328" "0" "5328" "0" "c.*315A>C" "r.(=)" "p.(=)" "" "0000718592" "00005463" "10" "5906" "0" "5906" "0" "c.*893C>T" "r.(=)" "p.(=)" "" "0000718593" "00005463" "10" "6178" "0" "6178" "0" "c.*1165G>A" "r.(=)" "p.(=)" "" "0000718594" "00005463" "10" "6252" "0" "6252" "0" "c.*1239C>G" "r.(=)" "p.(=)" "" "0000718595" "00005463" "10" "7207" "0" "7207" "0" "c.*2194A>C" "r.(=)" "p.(=)" "" "0000718596" "00005463" "10" "7665" "0" "7665" "0" "c.*2652G>A" "r.(=)" "p.(=)" "" "0000786819" "00005463" "70" "828" "1" "828" "1" "c.828+1G>T" "r.spl" "p.?" "14i" "0000788030" "00005463" "90" "3883" "-1" "4252" "1" "c.(3882+1_3883-1)_(4252+1_4253-1)dup" "r.?" "p.?" "43i_47i" "0000788032" "00005463" "90" "3546" "0" "3548" "0" "c.3546_3548dup" "r.(?)" "p.(Gly1183dup)" "" "0000788033" "00005463" "90" "1006" "0" "1006" "0" "c.1006G>T" "r.(?)" "p.(Gly336Cys)" "" "0000788043" "00005463" "70" "443" "0" "443" "0" "c.443G>T" "r.(?)" "p.(Gly148Val)" "" "0000788044" "00005463" "70" "2083" "0" "2083" "0" "c.2083G>A" "r.(?)" "p.(Gly695Arg)" "" "0000800449" "00005463" "70" "863" "0" "863" "0" "c.863G>T" "r.(?)" "p.(Gly288Val)" "" "0000800450" "00005463" "30" "889" "-18" "889" "-18" "c.889-18G>A" "r.(=)" "p.(=)" "" "0000800451" "00005463" "30" "934" "-6" "934" "-6" "c.934-6C>A" "r.(=)" "p.(=)" "" "0000800452" "00005463" "50" "1483" "0" "1483" "0" "c.1483C>T" "r.(?)" "p.(His495Tyr)" "" "0000800453" "00005463" "70" "1840" "0" "1840" "0" "c.1840G>A" "r.(?)" "p.(Gly614Arg)" "" "0000800454" "00005463" "50" "2054" "0" "2054" "0" "c.2054C>T" "r.(?)" "p.(Pro685Leu)" "" "0000800455" "00005463" "30" "2826" "0" "2826" "0" "c.2826C>T" "r.(?)" "p.(Pro942=)" "" "0000800456" "00005463" "30" "3031" "0" "3031" "0" "c.3031C>T" "r.(?)" "p.(Arg1011Cys)" "" "0000800457" "00005463" "30" "3210" "8" "3210" "8" "c.3210+8G>A" "r.(=)" "p.(=)" "" "0000800458" "00005463" "30" "3566" "-10" "3566" "-10" "c.3566-10T>C" "r.(=)" "p.(=)" "" "0000800459" "00005463" "50" "3949" "0" "3949" "0" "c.3949G>A" "r.(?)" "p.(Val1317Met)" "" "0000800460" "00005463" "30" "4294" "0" "4294" "0" "c.4294C>A" "r.(?)" "p.(Arg1432Ser)" "" "0000800461" "00005463" "30" "4494" "0" "4494" "0" "c.4494C>G" "r.(?)" "p.(Thr1498=)" "" "0000800462" "00005463" "50" "4510" "0" "4510" "0" "c.4510T>C" "r.(?)" "p.(Phe1504Leu)" "" "0000827861" "00005463" "50" "3421" "0" "3421" "0" "c.3421C>A" "r.(?)" "p.(Leu1141Ile)" "" "0000827901" "00005463" "50" "3419" "-3" "3419" "-3" "c.3419-3C>A" "r.spl" "p.(?)" "" "0000827902" "00005463" "50" "4253" "-11" "4253" "-11" "c.4253-11G>C" "r.spl" "p.(?)" "" "0000839838" "00005463" "90" "2372" "0" "2374" "4" "c.2372_2374+4del" "r.spl" "p.?" "" "0000839851" "00005463" "90" "272" "0" "272" "0" "c.272G>T" "r.(?)" "p.(Gly91Val)" "4" "0000839852" "00005463" "90" "898" "0" "898" "0" "c.898G>A" "r.(?)" "p.(Gly300Arg)" "16" "0000839853" "00005463" "90" "2489" "0" "2489" "0" "c.2489G>A" "r.(?)" "p.(Gly830Asp)" "32" "0000839854" "00005463" "90" "4235" "0" "4235" "0" "c.4235G>A" "r.(?)" "p.(Gly1412Asp)" "47" "0000839855" "00005463" "90" "4280" "0" "4280" "0" "c.4280G>A" "r.(?)" "p.(Gly1427Asp)" "48" "0000839905" "00005463" "90" "2" "0" "2" "0" "c.2T>A" "r.(?)" "p.(Met1?)" "" "0000842622" "00005463" "70" "3262" "0" "3262" "0" "c.3262C>T" "r.(?)" "p.(Pro1088Ser)" "" "0000846524" "00005463" "70" "2498" "0" "2498" "0" "c.2498G>A" "r.(?)" "p.(Gly833Asp)" "" "0000849776" "00005463" "30" "144" "18" "144" "18" "c.144+18T>G" "r.(=)" "p.(=)" "" "0000849777" "00005463" "30" "222" "0" "222" "0" "c.222G>T" "r.(?)" "p.(Pro74=)" "" "0000849778" "00005463" "10" "399" "0" "399" "0" "c.399G>A" "r.(?)" "p.(Gly133=)" "" "0000849779" "00005463" "30" "513" "0" "513" "0" "c.513C>T" "r.(?)" "p.(Gly171=)" "" "0000849780" "00005463" "70" "3248" "0" "3248" "0" "c.3248G>A" "r.(?)" "p.(Gly1083Glu)" "" "0000849781" "00005463" "30" "3825" "0" "3825" "0" "c.3825C>T" "r.(?)" "p.(His1275=)" "" "0000849782" "00005463" "50" "4426" "0" "4426" "0" "c.4426G>A" "r.(?)" "p.(Val1476Ile)" "" "0000858391" "00005463" "90" "520" "0" "520" "0" "c.520G>T" "r.(?)" "p.(Gly174Trp)" "" "0000858392" "00005463" "30" "675" "0" "675" "0" "c.675T>G" "r.(?)" "p.(His225Gln)" "" "0000858393" "00005463" "10" "3627" "0" "3627" "0" "c.3627G>A" "r.(?)" "p.(Met1209Ile)" "" "0000858394" "00005463" "50" "4598" "0" "4598" "0" "c.4598T>C" "r.(?)" "p.(Met1533Thr)" "" "0000869078" "00005463" "70" "4033" "0" "4033" "0" "c.4033C>G" "r.(?)" "p.(Arg1345Gly)" "" "0000873615" "00005463" "70" "1106" "0" "1106" "0" "c.1106G>A" "r.(?)" "p.(Gly369Asp)" "" "0000873637" "00005463" "70" "4664" "0" "4664" "0" "c.4664C>T" "r.(?)" "p.(Ala1555Val)" "" "0000879970" "00005463" "70" "765" "0" "765" "0" "c.765G>A" "r.688_765del" "p.230Gly_255Thrdel" "" "0000884984" "00005463" "30" "71" "0" "71" "0" "c.71C>G" "r.(?)" "p.(Ala24Gly)" "" "0000884985" "00005463" "30" "73" "0" "73" "0" "c.73C>T" "r.(?)" "p.(Pro25Ser)" "" "0000884986" "00005463" "30" "346" "0" "346" "0" "c.346C>A" "r.(?)" "p.(Pro116Thr)" "" "0000884987" "00005463" "30" "976" "0" "976" "0" "c.976G>T" "r.(?)" "p.(Asp326Tyr)" "" "0000884988" "00005463" "30" "1217" "0" "1217" "0" "c.1217G>A" "r.(?)" "p.(Arg406Gln)" "" "0000884989" "00005463" "30" "1505" "-11" "1505" "-11" "c.1505-11T>C" "r.(=)" "p.(=)" "" "0000884990" "00005463" "10" "1576" "-15" "1576" "-15" "c.1576-15T>G" "r.(=)" "p.(=)" "" "0000884991" "00005463" "30" "1928" "-4" "1928" "-4" "c.1928-4T>C" "r.spl?" "p.?" "" "0000884992" "00005463" "50" "1973" "0" "1973" "0" "c.1973C>T" "r.(?)" "p.(Pro658Leu)" "" "0000884993" "00005463" "70" "2479" "0" "2479" "0" "c.2479G>A" "r.(?)" "p.(Gly827Arg)" "" "0000884994" "00005463" "70" "2594" "0" "2594" "0" "c.2594G>A" "r.(?)" "p.(Gly865Asp)" "" "0000884995" "00005463" "10" "3419" "-14" "3419" "-14" "c.3419-14T>G" "r.(=)" "p.(=)" "" "0000884996" "00005463" "30" "3419" "-4" "3419" "-4" "c.3419-4dup" "r.spl?" "p.?" "" "0000884997" "00005463" "90" "3490" "0" "3490" "0" "c.3490G>A" "r.(?)" "p.(Gly1164Ser)" "" "0000884998" "00005463" "70" "3575" "0" "3575" "0" "c.3575G>A" "r.(?)" "p.(Gly1192Glu)" "" "0000884999" "00005463" "30" "3939" "0" "3939" "0" "c.3939G>A" "r.(?)" "p.(Gly1313=)" "" "0000885000" "00005463" "50" "4088" "0" "4088" "0" "c.4088C>G" "r.(?)" "p.(Pro1363Arg)" "" "0000908893" "00005463" "90" "2881" "1" "2881" "1" "c.2881+1G>A" "r.2747_2881del" "p.Ser917_Gly961del" "" "0000911618" "00005463" "70" "407" "0" "407" "0" "c.407G>T" "r.(?)" "p.(Gly136Val)" "" "0000911619" "00005463" "70" "1174" "0" "1174" "0" "c.1174G>A" "r.(?)" "p.(Gly392Arg)" "" "0000911620" "00005463" "30" "1310" "0" "1310" "0" "c.1310C>T" "r.(?)" "p.(Pro437Leu)" "" "0000911621" "00005463" "90" "1354" "0" "1354" "0" "c.1354G>A" "r.(?)" "p.(Gly452Arg)" "" "0000911622" "00005463" "50" "1459" "0" "1459" "0" "c.1459G>A" "r.(?)" "p.(Gly487Ser)" "" "0000911623" "00005463" "70" "2329" "0" "2329" "0" "c.2329G>T" "r.(?)" "p.(Gly777Cys)" "" "0000911624" "00005463" "90" "2881" "1" "2881" "1" "c.2881+1G>T" "r.spl?" "p.?" "" "0000911625" "00005463" "90" "3829" "0" "3829" "0" "c.3829G>A" "r.(?)" "p.(Gly1277Ser)" "" "0000911626" "00005463" "30" "3882" "10" "3882" "10" "c.3882+10G>A" "r.(=)" "p.(=)" "" "0000911627" "00005463" "90" "4348" "0" "4348" "0" "c.4348C>T" "r.(?)" "p.(Arg1450*)" "" "0000911628" "00005463" "90" "4420" "0" "4424" "0" "c.4420_4424del" "r.(?)" "p.(Leu1474CysfsTer34)" "" "0000920732" "00005463" "10" "145" "-99" "145" "-99" "c.145-99C>T" "r.(?)" "p.?" "" "0000920733" "00005463" "10" "280" "-40" "280" "-39" "c.280-40_280-39insG" "r.(?)" "p.?" "" "0000920734" "00005463" "10" "324" "73" "324" "73" "c.324+73C>T" "r.(?)" "p.?" "" "0000920735" "00005463" "10" "422" "0" "422" "0" "c.422T>C" "r.(?)" "p.(Leu141Pro)" "" "0000920736" "00005463" "10" "441" "146" "441" "146" "c.441+146G>T" "r.(?)" "p.?" "" "0000920737" "00005463" "10" "441" "150" "441" "150" "c.441+150G>T" "r.(?)" "p.?" "" "0000920738" "00005463" "10" "442" "-88" "442" "-88" "c.442-88A>G" "r.(?)" "p.?" "" "0000920739" "00005463" "10" "468" "139" "468" "139" "c.468+139C>T" "r.(?)" "p.?" "" "0000920740" "00005463" "10" "485" "0" "485" "0" "c.485A>G" "r.(?)" "p.(Glu162Gly)" "" "0000920741" "00005463" "10" "765" "49" "765" "49" "c.765+49T>G" "r.(?)" "p.?" "" "0000920742" "00005463" "10" "987" "35" "987" "35" "c.987+35T>G" "r.(?)" "p.?" "" "0000920743" "00005463" "10" "1576" "-60" "1576" "-60" "c.1576-60G>A" "r.(?)" "p.?" "" "0000920744" "00005463" "10" "1195" "0" "1195" "0" "c.1195C>T" "r.(?)" "p.(Leu399=)" "" "0000920745" "00005463" "10" "2223" "100" "2223" "100" "c.2223+100G>T" "r.(?)" "p.?" "" "0000920746" "00005463" "10" "2374" "82" "2374" "82" "c.2374+82A>G" "r.(?)" "p.?" "" "0000920747" "00005463" "10" "2881" "46" "2881" "46" "c.2881+46A>G" "r.(?)" "p.?" "" "0000920783" "00005463" "90" "415" "0" "415" "0" "c.415G>C" "r.(?)" "p.(Gly139Arg)" "" "0000920784" "00005463" "90" "415" "0" "415" "0" "c.415G>C" "r.(?)" "p.(Gly139Arg)" "" "0000920785" "00005463" "90" "415" "0" "415" "0" "c.415G>C" "r.(?)" "p.(Gly139Arg)" "" "0000923640" "00005463" "30" "573" "0" "573" "0" "c.573T>C" "r.(?)" "p.(Pro191=)" "" "0000923641" "00005463" "70" "838" "0" "838" "0" "c.838G>A" "r.(?)" "p.(Gly280Arg)" "" "0000923642" "00005463" "90" "1937" "0" "1937" "0" "c.1937dup" "r.(?)" "p.(Glu647Argfs*45)" "" "0000923643" "00005463" "50" "2979" "0" "2979" "0" "c.2979A>C" "r.(?)" "p.(Pro993=)" "" "0000923644" "00005463" "70" "3337" "1" "3337" "1" "c.3337+1G>A" "r.spl?" "p.?" "" "0000923645" "00005463" "70" "3592" "0" "3592" "0" "c.3592G>A" "r.(?)" "p.(Gly1198Ser)" "" "0000923646" "00005463" "90" "3620" "0" "3620" "0" "c.3620G>A" "r.(?)" "p.(Gly1207Glu)" "" "0000923647" "00005463" "50" "4523" "0" "4523" "0" "c.4523A>G" "r.(?)" "p.(Asn1508Ser)" "" "0000923648" "00005463" "50" "4772" "0" "4772" "0" "c.4772C>T" "r.(?)" "p.(Ser1591Phe)" "" "0000928547" "00005463" "30" "324" "20" "324" "20" "c.324+20C>T" "r.(=)" "p.(=)" "" "0000928548" "00005463" "50" "1752" "0" "1752" "0" "c.1752C>T" "r.(?)" "p.(Gly584=)" "" "0000928549" "00005463" "70" "2329" "0" "2329" "0" "c.2329G>T" "r.(?)" "p.(Gly777Cys)" "" "0000928550" "00005463" "30" "2489" "-8" "2489" "-8" "c.2489-8G>A" "r.(=)" "p.(=)" "" "0000928551" "00005463" "90" "4410" "0" "4410" "0" "c.4410del" "r.(?)" "p.(Ser1472Leufs*57)" "" "0000944359" "00005463" "90" "443" "0" "443" "0" "c.443G>T" "r.(?)" "p.(Gly148Val)" "" "0000944360" "00005463" "70" "3691" "0" "3691" "0" "c.3691G>A" "r.(?)" "p.(Gly1231Ser)" "" "0000944361" "00005463" "70" "4648" "0" "4649" "0" "c.4648_4649insAC" "r.(?)" "p.(Val1550AspfsTer10)" "" "0000947780" "00005463" "90" "443" "0" "443" "0" "c.443G>T" "r.(?)" "p.(Gly148Val)" "" "0000947781" "00005463" "90" "778" "0" "778" "0" "c.778G>T" "r.(?)" "p.(Glu260*)" "" "0000947782" "00005463" "30" "829" "-15" "829" "-15" "c.829-15C>T" "r.(=)" "p.(=)" "" "0000947783" "00005463" "30" "1030" "-18" "1030" "-18" "c.1030-18G>A" "r.(=)" "p.(=)" "" "0000947784" "00005463" "70" "1175" "0" "1177" "0" "c.1175_1177del" "r.(?)" "p.(Gly392del)" "" "0000947785" "00005463" "30" "2489" "-18" "2489" "-18" "c.2489-18T>A" "r.(=)" "p.(=)" "" "0000947786" "00005463" "50" "3023" "0" "3023" "0" "c.3023C>A" "r.(?)" "p.(Pro1008Gln)" "" "0000947787" "00005463" "70" "3328" "0" "3328" "0" "c.3328G>C" "r.(?)" "p.(Gly1110Arg)" "" "0000947788" "00005463" "50" "4681" "0" "4681" "0" "c.4681C>T" "r.(?)" "p.(His1561Tyr)" "" "0000952542" "00005463" "90" "765" "0" "765" "0" "c.765G>A" "r.spl" "p.(?,Thr255=)" "13" "0000952543" "00005463" "90" "765" "0" "765" "0" "c.765G>A" "r.spl" "p.(?,Thr255=)" "13" "0000952544" "00005463" "90" "765" "0" "765" "0" "c.765G>A" "r.spl" "p.(?,Thr255=)" "13" "0000959245" "00005463" "50" "4981" "0" "4981" "0" "c.4981C>T" "r.(?)" "p.(Arg1661Cys)" "" "0000961949" "00005463" "30" "756" "0" "756" "0" "c.756T>A" "r.(?)" "p.(Asp252Glu)" "" "0000961950" "00005463" "90" "898" "0" "898" "0" "c.898G>A" "r.(?)" "p.(Gly300Arg)" "" "0000961951" "00005463" "70" "1132" "0" "1132" "0" "c.1132G>A" "r.(?)" "p.(Gly378Arg)" "" "0000961952" "00005463" "70" "2375" "-1" "2375" "-1" "c.2375-1G>A" "r.spl?" "p.?" "" "0000961953" "00005463" "70" "3518" "-2" "3518" "-2" "c.3518-2A>G" "r.spl?" "p.?" "" "0000961954" "00005463" "30" "4665" "0" "4665" "0" "c.4665G>A" "r.(?)" "p.(Ala1555=)" "" "0000972100" "00005463" "90" "2126" "-1" "2126" "-1" "c.2126-1G>A" "r.spl" "p.?" "" "0000975052" "00005463" "30" "43" "0" "54" "0" "c.43_54del" "r.(?)" "p.(Pro15_Leu18del)" "" "0000975053" "00005463" "50" "136" "0" "136" "0" "c.136G>A" "r.(?)" "p.(Gly46Arg)" "" "0000975054" "00005463" "70" "235" "-1" "235" "-1" "c.235-1G>A" "r.spl?" "p.?" "" "0000975055" "00005463" "50" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Pro364Leu)" "" "0000975056" "00005463" "30" "1315" "17" "1315" "17" "c.1315+17G>A" "r.(=)" "p.(=)" "" "0000975057" "00005463" "30" "1555" "0" "1555" "0" "c.1555A>G" "r.(?)" "p.(Thr519Ala)" "" "0000975058" "00005463" "50" "1978" "0" "1978" "0" "c.1978C>A" "r.(?)" "p.(Pro660Thr)" "" "0000975059" "00005463" "50" "2186" "0" "2186" "0" "c.2186C>A" "r.(?)" "p.(Pro729His)" "" "0000975060" "00005463" "50" "2859" "0" "2859" "0" "c.2859C>G" "r.(?)" "p.(Asp953Glu)" "" "0000975061" "00005463" "70" "3829" "0" "3829" "0" "c.3829G>A" "r.(?)" "p.(Gly1277Ser)" "" "0000975062" "00005463" "50" "4772" "0" "4772" "0" "c.4772C>T" "r.(?)" "p.(Ser1591Phe)" "" "0000975063" "00005463" "90" "4981" "0" "4981" "0" "c.4981C>T" "r.(?)" "p.(Arg1661Cys)" "" "0000975064" "00005463" "70" "4982" "0" "4982" "0" "c.4982G>A" "r.(?)" "p.(Arg1661His)" "" "0000992603" "00005463" "50" "172" "0" "172" "0" "c.172G>A" "r.(?)" "p.(Gly58Ser)" "" "0000992604" "00005463" "30" "456" "0" "456" "0" "c.456G>T" "r.(?)" "p.(Leu152Phe)" "" "0000992605" "00005463" "30" "626" "0" "626" "0" "c.626T>C" "r.(?)" "p.(Met209Thr)" "" "0000992606" "00005463" "30" "756" "0" "756" "0" "c.756T>A" "r.(?)" "p.(Asp252Glu)" "" "0000992607" "00005463" "70" "765" "0" "765" "0" "c.765G>A" "r.(?)" "p.(=)" "" "0000992608" "00005463" "50" "1072" "0" "1072" "0" "c.1072A>T" "r.(?)" "p.(Thr358Ser)" "" "0000992609" "00005463" "50" "1256" "0" "1256" "0" "c.1256C>A" "r.(?)" "p.(Ser419Tyr)" "" "0000992610" "00005463" "50" "1256" "0" "1256" "0" "c.1256C>A" "r.(?)" "p.(Ser419Tyr)" "" "0000992611" "00005463" "30" "1887" "0" "1887" "0" "c.1887G>A" "r.(?)" "p.(=)" "" "0000992612" "00005463" "30" "2054" "0" "2054" "0" "c.2054C>T" "r.(?)" "p.(Pro685Leu)" "" "0000992613" "00005463" "30" "2360" "0" "2360" "0" "c.2360T>C" "r.(?)" "p.(Leu787Pro)" "" "0000992614" "00005463" "90" "2452" "0" "2452" "0" "c.2452G>A" "r.(?)" "p.(Gly818Arg)" "" "0000992615" "00005463" "70" "2489" "-1" "2489" "-1" "c.2489-1G>A" "r.spl?" "p.?" "" "0000992616" "00005463" "70" "2719" "0" "2719" "0" "c.2719G>A" "r.(?)" "p.(Gly907Arg)" "" "0000992617" "00005463" "70" "3008" "0" "3008" "0" "c.3008G>A" "r.(?)" "p.(Gly1003Glu)" "" "0000992618" "00005463" "50" "3416" "0" "3416" "0" "c.3416C>T" "r.(?)" "p.(Pro1139Leu)" "" "0000992619" "00005463" "50" "3592" "0" "3592" "0" "c.3592G>A" "r.(?)" "p.(Gly1198Ser)" "" "0000992620" "00005463" "30" "3850" "0" "3850" "0" "c.3850A>G" "r.(?)" "p.(Thr1284Ala)" "" "0000992621" "00005463" "50" "4154" "0" "4154" "0" "c.4154G>A" "r.(?)" "p.(Gly1385Glu)" "" "0000992622" "00005463" "50" "4510" "0" "4510" "0" "c.4510T>C" "r.(?)" "p.(Phe1504Leu)" "" "0000992623" "00005463" "30" "4523" "0" "4523" "0" "c.4523A>G" "r.(?)" "p.(Asn1508Ser)" "" "0000992624" "00005463" "50" "4994" "0" "4994" "0" "c.4994G>A" "r.(?)" "p.(Cys1665Tyr)" "" "0001013683" "00005463" "90" "2710" "0" "2710" "0" "c.2710G>A" "r.(?)" "p.(Gly904Arg)" "" "0001013684" "00005463" "70" "3455" "0" "3478" "0" "c.3455_3478del" "r.(?)" "p.(Gly1152_Arg1159del)" "" "0001024551" "00005463" "30" "45" "0" "45" "0" "c.45G>A" "r.(?)" "p.(=)" "" "0001024552" "00005463" "70" "1594" "0" "1594" "0" "c.1594G>C" "r.(?)" "p.(Gly532Arg)" "" "0001024553" "00005463" "90" "2135" "0" "2135" "0" "c.2135G>T" "r.(?)" "p.(Gly712Val)" "" "0001033062" "00005463" "50" "17" "0" "17" "0" "c.17C>A" "r.(?)" "p.(Ala6Asp)" "" "0001033063" "00005463" "70" "441" "2" "441" "2" "c.441+2T>C" "r.spl?" "p.?" "" "0001033064" "00005463" "30" "547" "-9" "547" "-9" "c.547-9A>C" "r.(=)" "p.(=)" "" "0001033065" "00005463" "70" "1594" "0" "1594" "0" "c.1594G>A" "r.(?)" "p.(Gly532Ser)" "" "0001033066" "00005463" "30" "1752" "0" "1752" "0" "c.1752C>T" "r.(?)" "p.(Gly584=)" "" "0001033067" "00005463" "50" "3994" "0" "3994" "0" "c.3994C>T" "r.(?)" "p.(Pro1332Ser)" "" "0001033068" "00005463" "30" "4975" "0" "4975" "0" "c.4975A>G" "r.(?)" "p.(Ile1659Val)" "" "0001049401" "00005463" "70" "4882" "0" "4882" "0" "c.4882T>G" "r.(?)" "p.(Ser1628Ala)" "" "0001051105" "00005463" "50" "590" "0" "590" "0" "c.590C>G" "r.(?)" "p.(Pro197Arg)" "" "0001051106" "00005463" "50" "2381" "0" "2381" "0" "c.2381C>T" "r.(?)" "p.(Pro794Leu)" "" "0001051107" "00005463" "50" "3208" "0" "3208" "0" "c.3208A>G" "r.(?)" "p.(Thr1070Ala)" "" "0001051108" "00005463" "50" "3856" "0" "3856" "0" "c.3856G>A" "r.(?)" "p.(Gly1286Arg)" "" "0001051109" "00005463" "50" "4598" "0" "4598" "0" "c.4598T>C" "r.(?)" "p.(Met1533Thr)" "" "0001051110" "00005463" "70" "5010" "0" "5027" "0" "c.5010_*14del" "r.(?)" "p.(His1670delinsGlnGlnAsnCysTyrPheSerSer)" "" "0001063799" "00005463" "50" "4421" "0" "4421" "0" "c.4421T>C" "r.(?)" "p.(Leu1474Pro)" "" "0001068016" "00005463" "90" "272" "0" "272" "0" "c.272G>A" "r.(?)" "p.(Gly91Asp)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 782 "{{screeningid}}" "{{variantid}}" "0000018436" "0000038900" "0000018437" "0000038903" "0000018828" "0000039310" "0000091445" "0000149573" "0000091446" "0000149574" "0000091446" "0000149942" "0000091447" "0000149575" "0000091448" "0000149576" "0000091448" "0000149943" "0000091449" "0000149577" "0000091450" "0000149578" "0000091451" "0000149579" "0000091452" "0000149580" "0000091453" "0000149581" "0000091454" "0000149582" "0000091455" "0000149583" "0000091456" "0000149584" "0000091457" "0000149585" "0000091458" "0000149586" "0000091459" "0000149587" "0000091460" "0000149588" "0000091461" "0000149589" "0000091462" "0000149590" "0000091463" "0000149591" "0000091464" "0000149592" "0000091465" "0000149593" "0000091466" "0000149594" "0000091467" "0000149595" "0000091468" "0000149596" "0000091469" "0000149597" "0000091470" "0000149598" "0000091471" "0000149599" "0000091472" "0000149600" "0000091473" "0000149601" "0000091474" "0000149602" "0000091475" "0000149603" "0000091476" "0000149604" "0000091477" "0000149605" "0000091478" "0000149606" "0000091479" "0000149607" "0000091479" "0000149944" "0000091480" "0000149608" "0000091481" "0000149609" "0000091482" "0000149610" "0000091483" "0000149611" "0000091484" "0000149612" "0000091485" "0000149613" "0000091486" "0000149614" "0000091487" "0000149615" "0000091488" "0000149616" "0000091489" "0000149617" "0000091490" "0000149618" "0000091491" "0000149619" "0000091492" "0000149620" "0000091493" "0000149621" "0000091494" "0000149622" "0000091495" "0000149623" "0000091496" "0000149624" "0000091497" "0000149625" "0000091498" "0000149626" "0000091499" "0000149627" "0000091500" "0000149628" "0000091501" "0000149629" "0000091502" "0000149630" "0000091503" "0000149631" "0000091504" "0000149632" "0000091505" "0000149633" "0000091506" "0000149634" "0000091507" "0000149635" "0000091508" "0000149636" "0000091509" "0000149637" "0000091510" "0000149638" "0000091511" "0000149639" "0000091512" "0000149640" "0000091513" "0000149641" "0000091514" "0000149642" "0000091515" "0000149643" "0000091516" "0000149644" "0000091517" "0000149645" "0000091518" "0000149646" "0000091518" "0000149945" "0000091519" "0000149647" "0000091519" "0000149946" "0000091520" "0000149648" "0000091521" "0000149649" "0000091522" "0000149650" "0000091523" "0000149651" "0000091524" "0000149652" "0000091525" "0000149653" "0000091526" "0000149654" "0000091527" "0000149655" "0000091528" "0000149656" "0000091529" "0000149657" "0000091530" "0000149658" "0000091531" "0000149659" "0000091532" "0000149660" "0000091533" "0000149661" "0000091534" "0000149662" "0000091535" "0000149663" "0000091536" "0000149664" "0000091537" "0000149665" "0000091538" "0000149666" "0000091539" "0000149667" "0000091539" "0000149947" "0000091540" "0000149668" "0000091541" "0000149669" "0000091542" "0000149670" "0000091542" "0000149948" "0000091543" "0000149671" "0000091543" "0000149949" "0000091544" "0000149672" "0000091545" "0000149673" "0000091546" "0000149674" "0000091547" "0000149675" "0000091548" "0000149676" "0000091549" "0000149677" "0000091550" "0000149678" "0000091551" "0000149679" "0000091552" "0000149680" "0000091553" "0000149681" "0000091553" "0000149950" "0000091554" "0000149682" "0000091555" "0000149683" "0000091556" "0000149684" "0000091557" "0000149685" "0000091557" "0000149951" "0000091558" "0000149686" "0000091559" "0000149687" "0000091560" "0000149688" "0000091561" "0000149689" "0000091562" "0000149690" "0000091563" "0000149691" "0000091564" "0000149692" "0000091565" "0000149693" "0000091566" "0000149694" "0000091567" "0000149695" "0000091568" "0000149696" "0000091569" "0000149697" "0000091570" "0000149698" "0000091571" "0000149699" "0000091572" "0000149700" "0000091573" "0000149701" "0000091574" "0000149702" "0000091575" "0000149703" "0000091576" "0000149704" "0000091577" "0000149705" "0000091578" "0000149706" "0000091579" "0000149707" "0000091580" "0000149708" "0000091581" "0000149709" "0000091582" "0000149710" "0000091583" "0000149711" "0000091584" "0000149712" "0000091585" "0000149713" "0000091586" "0000149714" "0000091587" "0000149715" "0000091588" "0000149716" "0000091589" "0000149717" "0000091590" "0000149718" "0000091590" "0000149952" "0000091591" "0000149719" "0000091591" "0000149953" "0000091592" "0000149720" "0000091592" "0000149954" "0000091593" "0000149721" "0000091594" "0000149722" "0000091595" "0000149723" "0000091596" "0000149724" "0000091597" "0000149725" "0000091598" "0000149726" "0000091599" "0000149727" "0000091600" "0000149728" "0000091601" "0000149729" "0000091602" "0000149730" "0000091603" "0000149731" "0000091604" "0000149732" "0000091605" "0000149733" "0000091606" "0000149734" "0000091607" "0000149735" "0000091608" "0000149736" "0000091609" "0000149737" "0000091610" "0000149738" "0000091611" "0000149739" "0000091612" "0000149740" "0000091613" "0000149741" "0000091614" "0000149742" "0000091615" "0000149743" "0000091616" "0000149744" "0000091617" "0000149745" "0000091618" "0000149746" "0000091619" "0000149747" "0000091620" "0000149748" "0000091621" "0000149749" "0000091622" "0000149750" "0000091623" "0000149751" "0000091624" "0000149752" "0000091625" "0000149753" "0000091626" "0000149754" "0000091627" "0000149755" "0000091628" "0000149756" "0000091629" "0000149757" "0000091630" "0000149758" "0000091631" "0000149759" "0000091632" "0000149760" "0000091633" "0000149761" "0000091634" "0000149762" "0000091635" "0000149763" "0000091636" "0000149764" "0000091637" "0000149765" "0000091638" "0000149766" "0000091639" "0000149767" "0000091640" "0000149768" "0000091641" "0000149769" "0000091642" "0000149770" "0000091643" "0000149771" "0000091644" "0000149772" "0000091645" "0000149773" "0000091646" "0000149774" "0000091647" "0000149775" "0000091648" "0000149776" "0000091649" "0000149777" "0000091650" "0000149778" "0000091651" "0000149779" "0000091652" "0000149780" "0000091653" "0000149781" "0000091654" "0000149782" "0000091654" "0000149955" "0000091654" "0000149956" "0000091655" "0000149783" "0000091655" "0000149957" "0000091656" "0000149784" "0000091656" "0000149958" "0000091657" "0000149785" "0000091657" "0000149959" "0000091658" "0000149786" "0000091658" "0000149960" "0000091659" "0000149787" "0000091659" "0000149961" "0000091660" "0000149788" "0000091660" "0000149962" "0000091661" "0000149789" "0000091661" "0000149963" "0000091662" "0000149790" "0000091662" "0000149964" "0000091663" "0000149791" "0000091663" "0000149965" "0000091664" "0000149792" "0000091664" "0000149966" "0000091665" "0000149793" "0000091665" "0000149967" "0000091666" "0000149794" "0000091666" "0000149968" "0000091667" "0000149795" "0000091667" "0000149969" "0000091668" "0000149796" "0000091668" "0000149970" "0000091669" "0000149797" "0000091669" "0000149971" "0000091670" "0000149798" "0000091670" "0000149972" "0000091671" "0000149799" "0000091671" "0000149973" "0000091672" "0000149800" "0000091672" "0000149974" "0000091673" "0000149801" "0000091673" "0000149975" "0000091674" "0000149802" "0000091674" "0000149976" "0000091675" "0000149803" "0000091676" "0000149804" "0000091677" "0000149805" "0000091678" "0000149806" "0000091679" "0000149807" "0000091680" "0000149808" "0000091681" "0000149809" "0000091682" "0000149810" "0000091683" "0000149811" "0000091684" "0000149812" "0000091685" "0000149813" "0000091686" "0000149814" "0000091687" "0000149815" "0000091688" "0000149816" "0000091689" "0000149817" "0000091690" "0000149818" "0000091691" "0000149819" "0000091692" "0000149820" "0000091693" "0000149821" "0000091694" "0000149822" "0000091695" "0000149823" "0000091696" "0000149824" "0000091697" "0000149825" "0000091698" "0000149826" "0000091699" "0000149827" "0000091700" "0000149828" "0000091701" "0000149829" "0000091702" "0000149830" "0000091703" "0000149831" "0000091704" "0000149832" "0000091705" "0000149833" "0000091706" "0000149834" "0000091707" "0000149835" "0000091708" "0000149836" "0000091709" "0000149837" "0000091710" "0000149838" "0000091711" "0000149839" "0000091712" "0000149840" "0000091713" "0000149841" "0000091714" "0000149842" "0000091715" "0000149843" "0000091716" "0000149844" "0000091717" "0000149845" "0000091718" "0000149846" "0000091719" "0000149847" "0000091720" "0000149848" "0000091721" "0000149849" "0000091722" "0000149850" "0000091723" "0000149851" "0000091724" "0000149852" "0000091725" "0000149853" "0000091726" "0000149854" "0000091727" "0000149855" "0000091728" "0000149856" "0000091729" "0000149857" "0000091730" "0000149858" "0000091731" "0000149859" "0000091732" "0000149860" "0000091733" "0000149861" "0000091734" "0000149862" "0000091735" "0000149863" "0000091736" "0000149864" "0000091737" "0000149865" "0000091738" "0000149866" "0000091739" "0000149867" "0000091740" "0000149868" "0000091741" "0000149869" "0000091742" "0000149870" "0000091743" "0000149871" "0000091744" "0000149872" "0000091745" "0000149873" "0000091746" "0000149874" "0000091747" "0000149875" "0000091748" "0000149876" "0000091749" "0000149877" "0000091750" "0000149878" "0000091751" "0000149879" "0000091752" "0000149880" "0000091753" "0000149881" "0000091754" "0000149882" "0000091755" "0000149883" "0000091756" "0000149884" "0000091757" "0000149885" "0000091758" "0000149886" "0000091759" "0000149887" "0000091760" "0000149888" "0000091761" "0000149889" "0000091762" "0000149890" "0000091763" "0000149891" "0000091764" "0000149892" "0000091765" "0000149893" "0000091766" "0000149894" "0000091767" "0000149895" "0000091768" "0000149896" "0000091769" "0000149897" "0000091770" "0000149898" "0000091771" "0000149899" "0000091772" "0000149900" "0000091773" "0000149901" "0000091774" "0000149902" "0000091775" "0000149903" "0000091776" "0000149904" "0000091777" "0000149905" "0000091778" "0000149906" "0000091779" "0000149907" "0000091780" "0000149908" "0000091781" "0000149909" "0000091782" "0000149910" "0000091783" "0000149911" "0000091784" "0000149912" "0000091785" "0000149913" "0000091786" "0000149914" "0000091787" "0000149915" "0000091788" "0000149916" "0000091789" "0000149917" "0000091790" "0000149918" "0000091791" "0000149919" "0000091792" "0000149920" "0000091793" "0000149921" "0000091794" "0000149922" "0000091795" "0000149923" "0000091796" "0000149924" "0000091797" "0000149925" "0000091798" "0000149926" "0000091799" "0000149927" "0000091800" "0000149928" "0000091801" "0000149929" "0000091802" "0000149930" "0000091803" "0000149931" "0000091804" "0000149932" "0000091805" "0000149933" "0000091806" "0000149934" "0000091807" "0000149935" "0000091808" "0000149936" "0000091809" "0000149937" "0000091809" "0000149981" "0000091811" "0000149939" "0000091812" "0000149940" "0000091813" "0000149941" "0000104460" "0000169201" "0000153575" "0000352765" "0000153576" "0000352766" "0000153578" "0000352768" "0000154164" "0000353641" "0000154171" "0000353651" "0000154171" "0000353652" "0000154182" "0000353666" "0000154189" "0000353673" "0000154256" "0000353743" "0000154261" "0000353748" "0000154262" "0000353749" "0000154263" "0000353750" "0000154266" "0000353753" "0000154269" "0000353756" "0000154270" "0000353757" "0000154270" "0000354740" "0000154273" "0000353760" "0000154273" "0000354741" "0000154274" "0000353761" "0000154275" "0000353762" "0000154282" "0000353769" "0000154289" "0000353776" "0000154290" "0000353777" "0000154292" "0000353779" "0000154292" "0000354747" "0000154293" "0000353780" "0000154297" "0000353784" "0000154298" "0000353785" "0000154301" "0000353788" "0000154301" "0000354749" "0000154303" "0000353790" "0000154303" "0000354750" "0000154306" "0000353793" "0000154314" "0000353801" "0000154316" "0000353803" "0000154317" "0000353804" "0000154320" "0000353807" "0000154322" "0000353809" "0000154323" "0000353810" "0000154323" "0000354754" "0000154324" "0000353811" "0000154329" "0000353816" "0000154333" "0000353820" "0000154333" "0000354756" "0000154341" "0000353828" "0000154341" "0000354758" "0000154342" "0000353829" "0000154344" "0000353831" "0000154345" "0000353832" "0000154346" "0000353833" "0000154355" "0000353842" "0000154361" "0000353848" "0000154364" "0000353851" "0000154366" "0000353853" "0000154368" "0000353855" "0000154384" "0000353871" "0000154392" "0000353879" "0000154401" "0000353888" "0000154414" "0000353901" "0000154415" "0000353902" "0000154420" "0000353907" "0000154423" "0000353910" "0000154425" "0000353912" "0000154430" "0000353917" "0000154432" "0000353919" "0000154443" "0000354777" "0000154444" "0000353931" "0000154445" "0000353932" "0000154448" "0000353935" "0000154448" "0000354781" "0000154449" "0000353936" "0000154453" "0000353940" "0000154455" "0000353942" "0000154464" "0000353951" "0000154466" "0000353953" "0000154467" "0000353954" "0000154468" "0000353955" "0000154470" "0000353957" "0000154478" "0000353965" "0000154480" "0000353967" "0000154485" "0000353972" "0000154492" "0000353979" "0000154499" "0000353986" "0000154501" "0000353988" "0000154506" "0000354793" "0000154507" "0000353994" "0000154508" "0000353995" "0000154508" "0000354795" "0000154513" "0000354000" "0000154513" "0000354797" "0000154523" "0000354802" "0000154524" "0000354011" "0000154524" "0000354804" "0000154526" "0000354013" "0000154530" "0000354017" "0000154532" "0000354807" "0000154533" "0000354020" "0000154541" "0000354028" "0000154542" "0000354029" "0000154543" "0000354030" "0000154543" "0000354812" "0000154544" "0000354031" "0000154545" "0000354032" "0000154546" "0000354033" "0000154547" "0000354034" "0000154547" "0000354814" "0000154548" "0000354035" "0000154548" "0000354815" "0000154549" "0000354036" "0000154550" "0000354037" "0000154551" "0000354038" "0000154552" "0000354039" "0000154552" "0000354816" "0000154553" "0000354040" "0000154554" "0000354041" "0000154555" "0000354042" "0000154556" "0000354043" "0000154557" "0000354044" "0000154558" "0000354045" "0000154559" "0000354046" "0000154560" "0000354047" "0000154561" "0000354048" "0000154561" "0000354817" "0000154562" "0000354049" "0000154563" "0000354050" "0000154564" "0000354051" "0000154565" "0000354052" "0000154566" "0000354053" "0000154567" "0000354054" "0000154568" "0000354055" "0000154569" "0000354056" "0000154570" "0000354057" "0000154570" "0000354819" "0000154571" "0000354058" "0000154572" "0000354059" "0000154573" "0000354060" "0000154574" "0000354061" "0000154575" "0000354062" "0000154576" "0000354063" "0000154577" "0000354064" "0000154578" "0000354065" "0000154579" "0000354066" "0000154580" "0000354067" "0000154581" "0000354068" "0000154582" "0000354069" "0000154583" "0000354070" "0000154583" "0000354821" "0000154584" "0000354071" "0000154585" "0000354072" "0000154586" "0000354073" "0000154586" "0000354822" "0000154587" "0000354074" "0000154588" "0000354075" "0000154589" "0000354076" "0000154590" "0000354077" "0000154590" "0000354824" "0000154591" "0000354078" "0000154592" "0000354079" "0000154593" "0000354080" "0000154594" "0000354081" "0000154595" "0000354082" "0000154596" "0000354083" "0000154596" "0000354825" "0000154597" "0000354084" "0000154598" "0000354085" "0000154599" "0000354086" "0000154600" "0000354087" "0000154601" "0000354088" "0000154602" "0000354089" "0000154603" "0000354090" "0000154604" "0000354091" "0000154605" "0000354092" "0000154606" "0000354093" "0000154607" "0000354094" "0000154609" "0000354096" "0000154610" "0000354097" "0000154611" "0000354098" "0000154611" "0000354830" "0000154612" "0000354099" "0000154612" "0000354831" "0000154613" "0000354100" "0000154614" "0000354101" "0000154614" "0000354832" "0000154615" "0000354102" "0000154616" "0000354103" "0000154616" "0000354833" "0000154617" "0000354104" "0000154618" "0000354105" "0000154619" "0000354106" "0000154620" "0000354107" "0000154621" "0000354108" "0000154622" "0000354109" "0000154623" "0000354110" "0000154624" "0000354111" "0000154625" "0000354112" "0000154626" "0000354113" "0000154627" "0000354114" "0000154627" "0000354837" "0000154628" "0000354115" "0000154628" "0000354838" "0000154629" "0000354116" "0000154630" "0000354117" "0000154631" "0000354118" "0000154632" "0000354119" "0000154633" "0000354120" "0000154633" "0000354840" "0000154634" "0000354121" "0000154634" "0000354841" "0000154635" "0000354122" "0000154635" "0000354842" "0000154636" "0000354123" "0000154637" "0000354124" "0000154638" "0000354125" "0000154639" "0000354126" "0000154640" "0000354127" "0000154641" "0000354128" "0000154642" "0000354129" "0000154642" "0000354843" "0000154643" "0000354130" "0000154644" "0000354131" "0000154645" "0000354132" "0000154645" "0000354845" "0000154646" "0000354133" "0000154647" "0000354134" "0000154648" "0000354135" "0000154649" "0000354136" "0000154650" "0000354137" "0000154650" "0000354847" "0000154651" "0000354138" "0000154652" "0000354139" "0000154653" "0000354140" "0000154654" "0000354141" "0000154655" "0000354142" "0000154656" "0000354143" "0000154656" "0000354849" "0000154657" "0000354144" "0000154657" "0000354850" "0000154658" "0000354145" "0000154659" "0000354146" "0000154660" "0000354147" "0000154661" "0000354148" "0000154662" "0000354149" "0000154663" "0000354150" "0000154664" "0000354151" "0000154665" "0000354152" "0000154666" "0000354153" "0000154667" "0000354154" "0000154668" "0000354155" "0000154669" "0000354156" "0000154669" "0000354852" "0000154670" "0000354157" "0000154671" "0000354158" "0000154672" "0000354159" "0000154673" "0000354160" "0000154674" "0000354161" "0000154674" "0000354853" "0000154675" "0000354162" "0000154676" "0000354163" "0000154677" "0000354164" "0000154678" "0000354165" "0000154680" "0000354167" "0000154681" "0000354168" "0000154682" "0000354169" "0000154683" "0000354170" "0000154684" "0000354171" "0000154685" "0000354172" "0000154686" "0000354173" "0000154687" "0000354174" "0000154688" "0000354175" "0000154689" "0000354176" "0000154689" "0000354857" "0000154690" "0000354177" "0000154691" "0000354178" "0000154691" "0000354858" "0000154692" "0000354179" "0000154692" "0000354859" "0000154693" "0000354180" "0000154694" "0000354181" "0000154695" "0000354182" "0000154696" "0000354183" "0000154697" "0000354184" "0000154698" "0000354185" "0000154699" "0000354186" "0000154700" "0000354187" "0000154701" "0000354188" "0000154702" "0000354189" "0000154703" "0000354190" "0000154704" "0000354191" "0000154705" "0000354192" "0000154706" "0000354193" "0000154731" "0000354866" "0000154739" "0000354868" "0000154746" "0000354869" "0000154751" "0000354871" "0000154784" "0000354271" "0000154798" "0000354888" "0000154809" "0000354890" "0000154813" "0000354891" "0000154836" "0000354895" "0000154845" "0000354897" "0000154986" "0000354901" "0000155023" "0000354906" "0000155153" "0000354911" "0000155212" "0000354914" "0000155219" "0000354915" "0000155344" "0000355057" "0000155344" "0000355058" "0000219417" "0000454264" "0000235441" "0000478196" "0000235441" "0000478197" "0000246870" "0000499677" "0000293790" "0000650479" "0000293791" "0000650480" "0000293792" "0000650481" "0000293793" "0000650482" "0000297773" "0000660436" "0000297774" "0000660437" "0000297775" "0000660438" "0000302171" "0000665278" "0000302171" "0000665279" "0000305922" "0000669610" "0000305923" "0000669611" "0000328271" "0000712219" "0000375468" "0000786819" "0000376425" "0000788030" "0000376426" "0000788032" "0000376428" "0000788033" "0000376438" "0000788043" "0000376439" "0000788044" "0000396292" "0000827861" "0000396292" "0000827901" "0000396292" "0000827902" "0000404195" "0000839838" "0000404195" "0000839905" "0000404232" "0000839851" "0000404233" "0000839852" "0000404234" "0000839853" "0000404235" "0000839854" "0000404236" "0000839855" "0000409368" "0000846524" "0000411841" "0000869078" "0000415736" "0000873615" "0000415752" "0000873637" "0000419803" "0000879970" "0000429420" "0000908893" "0000434836" "0000920732" "0000434837" "0000920733" "0000434838" "0000920734" "0000434839" "0000920735" "0000434840" "0000920736" "0000434841" "0000920737" "0000434842" "0000920738" "0000434843" "0000920739" "0000434844" "0000920740" "0000434845" "0000920741" "0000434846" "0000920742" "0000434847" "0000920743" "0000434848" "0000920744" "0000434849" "0000920745" "0000434850" "0000920746" "0000434851" "0000920747" "0000434883" "0000920785" "0000434887" "0000920783" "0000434888" "0000920784" "0000443000" "0000944359" "0000443001" "0000944360" "0000443002" "0000944361" "0000445529" "0000952542" "0000445530" "0000952543" "0000445531" "0000952544" "0000449021" "0000959245" "0000450141" "0000972100" "0000469205" "0001049401" "0000473987" "0001068016"