### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = COL6A2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "COL6A2" "collagen, type VI, alpha 2" "21" "q22.3" "unknown" "LRG_476" "UD_132119028891" "" "https://www.LOVD.nl/COL6A2" "" "1" "2212" "1292" "120240" "1" "1" "1" "1" "This database is one of the gene variant databases from the:The database was initiated with the help of Anne Lampe, based on the review article Lampe AK, Bushby KMD (2005). Collagen VI related muscle disorders. J. Med. Genet. 42: 673-685." "" "g" "https://databases.lovd.nl/shared/refseq/COL6A2_codingDNA.html" "1" "" "This database is one of the gene variant databases from the \"Leiden Muscular Dystrophy pages\" (LMDp)." "-1" "" "-1" "00001" "2005-02-28 00:00:00" "00006" "2019-03-03 13:06:42" "00006" "2025-12-05 13:23:08" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00005472" "COL6A2" "transcript variant 2C2" "001" "NM_001849.3" "" "NP_001840.3" "" "" "" "-82" "3357" "3060" "47518033" "47552763" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 24 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00152" "CHD" "heart disease, congenital (CHD)" "" "" "" "" "" "00008" "2013-06-19 09:27:11" "00006" "2015-01-23 22:14:45" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00244" "MYOP" "myopathy (MYOP)" "" "" "" "" "" "00006" "2013-10-12 23:00:55" "00006" "2019-06-19 11:52:31" "00360" "MDC" "dystrophy, muscular, congenital (MDC)" "" "" "" "" "" "00006" "2014-03-21 23:02:36" "00006" "2018-07-03 16:30:02" "01448" "BTHLM1A" "myopathy, Bethlem, type 1A" "AD;AR" "158810" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2025-09-09 12:19:34" "01945" "UCMD" "dystrophy, muscular, congenital, Ullrich" "AD;AR;Di" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2025-09-09 12:22:46" "01960" "-" "myosclerosis, autosomal recessive" "AR" "255600" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "03381" "cancer, gastric" "cancer, gastric (Neoplasm of stomach)" "" "613659" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2017-07-14 15:28:09" "04286" "LGMD1" "dystrophy, muscular, limb-girdle, autosomal dominant, type 1 (LGMD-1)" "" "" "" "" "" "00006" "2015-06-19 22:12:47" "00006" "2021-12-11 13:56:28" "04327" "CRS" "craniosynostosis (CRS)" "" "" "" "" "" "00006" "2015-09-12 20:59:03" "" "" "05100" "UCMD" "dystrophy, muscular, congenital, Ullrich (UCMD)" "" "" "" "" "" "00006" "2015-11-08 10:59:55" "00006" "2017-07-28 15:01:18" "05121" "MD" "dystrophy, muscular (MD)" "" "" "" "" "" "00006" "2016-01-24 01:27:29" "" "" "05123" "SMA" "atrophy, muscular, spinal (SMA)" "" "" "" "" "" "00006" "2016-01-24 01:41:54" "" "" "05126" "LGMD" "dystrophy, muscular, limb-girdle (LGMD)" "" "" "" "" "" "00006" "2016-01-26 06:05:36" "" "" "05324" "DMD" "dystrophy, muscular, Duchenne type (DMD)" "XLR" "310200" "" "" "" "00006" "2017-09-01 17:41:21" "00006" "2021-12-10 21:51:32" "05358" "BTHLM" "myopathy, Bethlem (BTHLM)" "" "" "" "" "" "00006" "2017-12-28 09:26:43" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "05618" "NMD" "neuromuscular disorder (NMD)" "" "" "" "" "" "00006" "2019-07-02 19:46:12" "" "" "05656" "LGMDD4;LGMD1I" "dystrophy, muscular, limb-girdle, autosomal dominant, type 4 (LGMDD-4, LGMD-1I)" "AD" "618129" "" "" "autosomal dominant" "00006" "2019-09-16 23:11:06" "00006" "2021-12-10 21:51:32" "06495" "RLSDF" "Rhizomelic limb shortening with dysmorphic features" "AR" "618821" "" "" "" "00006" "2021-12-10 23:20:41" "" "" "07176" "BTHLM1B" "myopathy, Bethlem, type 1B" "AD;AR" "620725" "" "" "" "00006" "2025-09-09 12:20:39" "" "" "07178" "UCMD1B" "dystrophy, Uhlrich, muscular, congenital, type 1B" "AD;AR;Di" "620727" "" "" "" "00006" "2025-09-09 12:25:47" "" "" "07210" "scoliosis" "scoliosis" "" "" "" "" "" "00006" "2025-12-05 11:13:58" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 5 "{{geneid}}" "{{diseaseid}}" "COL6A2" "01945" "COL6A2" "01960" "COL6A2" "05358" "COL6A2" "07176" "COL6A2" "07178" ## Individuals ## Do not remove or alter this header ## ## Count = 677 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00054695" "" "" "" "1" "" "01458" "{PMID:O\'Grady 2016:27159402}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Australia" ">21y" "0" "" "" "" "Pat26" "00054699" "" "" "" "1" "" "01458" "{PMID:O\'Grady 2016:27159402}" "" "F" "" "Australia" ">18y" "0" "" "" "" "Pat68" "00054700" "" "" "" "1" "" "01458" "{PMID:O\'Grady 2016:27159402}" "2-generation family, unaffected heterozygous carrier parents" "F" "" "Australia" ">12y" "0" "" "" "" "Pat69" "00054703" "" "" "" "1" "" "01458" "{PMID:O\'Grady 2016:27159402}" "" "M" "" "Australia" ">22y" "0" "" "" "" "Pat90" "00054705" "" "" "" "1" "" "01458" "{PMID:O\'Grady 2016:27159402}" "" "M" "" "Australia" ">9y" "0" "" "" "" "Pat100" "00054706" "" "" "" "1" "" "01458" "{PMID:O\'Grady 2016:27159402}" "" "F" "" "Australia" ">14y" "0" "" "" "" "Pat101" "00080893" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected parents" "" "" "" "" "0" "" "" "" "" "00081094" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected parents" "" "" "" "" "0" "" "" "" "" "00103084" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat2" "00104005" "" "" "" "1" "" "00587" "{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}" "54 patients from 53 families with genetically unexplained diffuse-type and intestinal-type gastric cancer" "" "" "" "" "0" "" "" "" "Vogelaar-135A" "00108709" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat10" "00108710" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat11" "00108711" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat12" "00108712" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat13" "00108713" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat14" "00108714" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "F" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat15" "00108715" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat16" "00108721" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat21" "00108724" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat24" "00108727" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat27" "00108728" "" "" "" "2" "" "01955" "MYO-SEQ project, UK" "2-generation family, affected mother/daughter" "F" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat28" "00108729" "" "" "" "2" "" "01955" "MYO-SEQ project, UK" "" "F" "yes" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat29" "00108730" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat3" "00108731" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat30" "00108741" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat7" "00108743" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat9" "00108757" "" "" "" "1" "" "00449" "{PMID:Giusti 2005:16130093}" "" "" "" "Turkey" "" "0" "" "" "" "P2" "00108770" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "Pat45" "00108772" "" "" "" "1" "" "00449" "{PMID:Giusti 2005:16130093}" "" "" "" "Italy" "" "0" "" "" "" "P4" "00108773" "" "" "" "1" "" "00449" "{PMID:Giusti 2005:16130093}" "" "" "yes" "Turkey" "" "0" "" "" "" "P1" "00108775" "" "" "" "1" "" "00449" "{PMID:Giusti 2005:16130093}" "" "" "" "Belgium" "" "0" "" "" "" "P5" "00108780" "" "" "" "1" "" "00449" "{PMID:Lucarini 2005:16075202}, {OMIM120240:0007}" "mother heterozygous" "" "" "" "" "0" "" "" "" "-" "00108781" "" "" "" "1" "" "00006" "{PMID:Camacho 2001:11381124}, {OMIM120240:0002}" "" "" "" "" "" "0" "" "" "" "-" "00108782" "" "" "" "1" "" "00006" "{PMID:Ishikawa 2002:12297580}" "" "" "" "" "" "0" "" "" "" "-" "00108783" "" "" "" "2" "" "00006" "{PMID:Camacho 2001:11381124}, {OMIM120240:0004}" "2 brothers" "" "" "Italy" "" "0" "" "" "" "-" "00108784" "" "" "" "1" "" "00006" "{PMID:Higuchi 2001:11506412}, {OMIM120240:0006}" "" "" "" "" "" "0" "" "" "" "-" "00108786" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108787" "" "" "" "1" "" "00006" "{PMID:Ishikawa 2004:14981181}" "" "" "" "" "" "0" "" "" "" "-" "00108788" "" "" "" "1" "" "00006" "{PMID:Camacho 2001:11381124}, {OMIM120240:0003}" "" "" "" "Italy" "" "0" "" "" "" "-" "00108789" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108790" "" "" "" "9" "" "00006" "{PMID:Scacheri 2002:11865138}, {OMIM120240:0005}" "large 3 generation family, 9 affecteds" "" "" "United States" "" "0" "" "" "white" "-" "00108791" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108792" "" "" "" "3" "" "00006" "{PMID:Lampe 2005:15689448}" "3 first degree relatives" "" "" "" "" "0" "" "" "" "?" "00108793" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108794" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108795" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "Pat47" "00108796" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108797" "" "" "" "1" "" "00006" "{PMID:Baker 2005:15563506}" "" "" "" "" "" "0" "" "" "" "-" "00108798" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108799" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108800" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108801" "" "" "" "1" "" "00006" "{PMID:Baker 2005:15563506}" "child of 15563506.a" "" "" "" "" "0" "" "" "" "15563506.b" "00108802" "" "" "" "1" "" "00006" "{PMID:Jobsis 1996:8782832}" "" "" "" "" "" "0" "" "" "" "-" "00108803" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108804" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108823" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "Australia" "" "0" "" "" "" "?" "00108824" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "United States" "" "0" "" "" "" "?" "00108825" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "United States" "" "0" "" "" "" "?" "00108826" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "F" "" "Australia" "" "0" "" "" "" "?" "00108827" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "New Zealand" "" "0" "" "" "" "?" "00108828" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "Australia" "" "0" "" "" "" "?" "00108829" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "?" "00108830" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "Australia" "" "0" "" "" "" "?" "00108840" "" "" "" "1" "" "00006" "{PMID:Jobsis 1996:8782832}" "" "" "" "" "" "0" "" "" "" "?" "00108841" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "United States" "" "0" "" "" "" "?" "00108842" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "Australia" "" "0" "" "" "" "?" "00108848" "" "" "" "1" "" "00006" "{PMID:Baker 2005:15563506}" "mother of 15563506.b" "" "" "" "" "0" "" "" "" "15563506.a" "00108850" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "" "?" "00108851" "" "" "" "1" "" "00464" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00108856" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "" "?" "00108857" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "" "?" "00108859" "" "" "" "1" "" "00464" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00108862" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00108868" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00108875" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00108877" "" "" "" "1" "" "00006" "L Medne ASHG 2010 A1669" "" "?" "" "" "" "0" "" "" "" "?" "00108878" "" "" "" "1" "" "00006" "CA Valencia ASHG 2010 A1982" "" "?" "" "(United States)" "" "0" "" "" "" "?" "00108886" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00108887" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00108891" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00108892" "" "" "" "1" "" "00464" "" "" "F" "" "Saudi Arabia" "" "0" "" "" "Arab" "?" "00108895" "" "" "" "2" "" "00464" "" "unaffected carrier parents" "M" "" "United States" "" "0" "" "" "Hispanic" "?" "00108896" "" "" "" "1" "" "00464" "" "" "M" "?" "Saudi Arabia" "" "0" "" "" "Arab" "?" "00108897" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00108900" "" "" "" "1" "" "00464" "" "" "F" "" "Saudi Arabia" "" "0" "" "" "Arab" "?" "00108901" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "white" "?" "00108902" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00108908" "" "" "" "1" "" "00464" "" "" "M" "" "Saudi Arabia" "" "0" "" "" "Arab" "?" "00109013" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109014" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109015" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109016" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109017" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109018" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109019" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109020" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109021" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109022" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109023" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109024" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109025" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109026" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109027" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109028" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109029" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109030" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109031" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109032" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109033" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109034" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109035" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109036" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109037" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109038" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109039" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109040" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109041" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109042" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109043" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109044" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109045" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109046" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109047" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109048" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109049" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109050" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109051" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109052" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109053" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109054" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109055" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109056" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109057" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109058" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109059" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109060" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109061" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109062" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109063" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109064" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109065" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109066" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109067" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109068" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109069" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109070" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109071" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109072" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109073" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109074" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109075" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109076" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109077" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109078" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109079" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109080" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109193" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00109209" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "F" "" "(United States)" ">13y" "0" "" "" "" "Gly_14" "00109229" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "M" "" "(United States)" "" "0" "" "" "" "Gly_34" "00109237" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_42" "00109238" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "M" "" "(United States)" "" "0" "" "" "" "Gly_43" "00109239" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "F" "" "(United States)" "" "0" "" "" "" "Gly_44" "00109240" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_45" "00109241" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_46" "00109242" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "F" "" "(United States)" ">17y" "0" "" "" "" "Gly_47" "00109243" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_48" "00109244" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "M" "" "(United States)" "" "0" "" "" "" "Gly_49" "00109245" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_50" "00109263" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_68" "00109274" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "F" "" "(United States)" "" "0" "" "" "" "Gly_79" "00109275" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "F" "" "(United States)" "" "0" "" "" "" "Gly_80" "00109276" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "F" "" "(United States)" "" "0" "" "" "" "Gly_81" "00109288" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_93" "00109289" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_94" "00109290" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_95" "00109291" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_96" "00109294" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "unaffacted father patient Gly_47" "M" "" "(United States)" "" "0" "" "" "" "Gly_47f" "00109298" "" "" "" "2" "" "00006" "{PMID:Foley 2011:21280092}" "2-generation family, 1 affected, unaffected carrier parents, brother carries large deletion (has global developmental delays, epilepsy)" "M" "no" "United States" "" "0" "" "" "" "?" "00109299" "" "" "" "1" "" "00006" "{PMID:Foley 2011:21280092}, Medne ASHG 2010 A1669" "2-generation family, 1 affected, unaffected carrier parents" "M" "no" "United States" "" "0" "" "" "" "?" "00109300" "" "" "" "2" "" "00006" "{PMID:Foley 2011:21280092}" "2-generation family, individual and unafected carrier father" "M" "no" "United States" "" "0" "" "" "" "?" "00109302" "" "" "" "1" "" "00472" "{PMID:Bovolenta 2010:20302629}" "" "F" "" "Italy" "" "0" "" "" "" "?" "00109303" "" "" "" "1" "" "00472" "{PMID:Gualandi 2012:22992134}" "" "" "" "Italy" "" "0" "" "" "" "?" "00109304" "" "" "" "1" "" "00472" "{PMID:Gualandi 2009:19949035}" "" "" "" "Italy" "" "0" "" "" "" "?" "00109305" "" "" "" "1" "" "00472" "{PMID:Gualandi 2009:19949035}" "" "" "" "Italy" "" "0" "" "" "" "?" "00109308" "" "" "" "1" "" "00472" "{PMID:Martoni 2009:19309692}" "" "" "" "Italy" "" "0" "" "" "" "?" "00109309" "" "" "" "1" "" "00472" "{PMID:Martoni 2009:19309692}" "" "" "" "Italy" "" "0" "" "" "" "?" "00109310" "" "" "" "1" "" "00472" "{PMID:Martoni 2009:19309692}" "" "" "" "Italy" "" "0" "" "" "" "?" "00109311" "" "" "" "2" "" "00472" "{PMID:Merlini 2008:18852439}" "2 affected brothers consanguineous family" "" "" "Italy" "" "0" "" "" "" "?" "00109312" "" "" "" "1" "" "00472" "{PMID:Merlini 2008:18852439}" "unaffected carrier parents" "" "" "Italy" "" "0" "" "" "" "?" "00109313" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109314" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109316" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109317" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109318" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109320" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109321" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109354" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109355" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109356" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109357" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109358" "" "" "" "1" "" "00472" "" "" "" "" "Germany" "" "0" "" "" "" "?" "00109359" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109360" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109361" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109362" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109363" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109364" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109365" "" "" "" "1" "" "00472" "" "" "" "" "Spain" "" "0" "" "" "" "?" "00109366" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109367" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109368" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109369" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109370" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109371" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109372" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109373" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109374" "" "" "" "1" "" "00472" "" "" "" "" "Spain" "" "0" "" "" "" "?" "00109375" "" "" "" "1" "" "00472" "" "" "" "" "Spain" "" "0" "" "" "" "?" "00109376" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109377" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109378" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109379" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109380" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109414" "" "" "" "1" "" "01700" "{PMID:Punetha 2016:27854218}" "" "F" "" "" "" "0" "" "" "" "Pat1" "00109415" "" "" "" "1" "" "02188" "" "" "F" "" "" "" "0" "" "" "" "F1P" "00174766" "" "" "" "1" "" "00006" "{PMID:Fichna 2018:29970176}" "" "M" "" "Poland" "" "0" "" "" "" "Pat196" "00207968" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00208913" "" "" "" "1" "" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "" "00219483" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219527" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219535" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219540" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219555" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219568" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219620" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219646" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219656" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219659" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219662" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219665" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219669" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219678" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219693" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219704" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219716" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219753" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219759" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219770" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219782" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219790" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219809" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219811" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219815" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219816" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219825" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219847" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219850" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219865" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219872" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219878" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219889" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219891" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219919" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219920" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219924" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219929" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219946" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219954" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219955" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219956" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219980" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220005" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220009" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220021" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220023" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220031" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220049" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220061" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220079" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220080" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220092" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220093" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220097" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220098" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220102" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220106" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220112" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220136" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220137" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220140" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220142" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220145" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220170" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220173" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220183" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220188" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220200" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220221" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220255" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220256" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220264" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220269" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220306" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220314" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220317" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220318" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220321" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220354" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220368" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220369" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220417" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220419" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220430" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220442" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220458" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220461" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220484" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220510" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220515" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220530" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220533" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220537" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220538" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220540" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220541" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220545" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220554" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220555" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220562" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220609" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220610" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220616" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220634" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220638" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220643" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220657" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220670" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220671" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220675" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220701" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220719" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220731" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220754" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220759" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220765" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220779" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220785" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220806" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220808" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220821" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220824" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220841" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220844" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220852" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220854" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220857" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220859" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220864" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220865" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220868" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220879" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220913" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220921" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220922" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220923" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220925" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220939" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220943" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220949" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220952" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220955" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220958" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220963" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220972" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220984" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220992" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220994" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221000" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221008" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221025" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221028" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221030" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221052" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221059" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221060" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221067" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221080" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221086" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221095" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221125" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221141" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221142" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221145" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221148" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221166" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221177" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221195" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221197" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221204" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221205" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221238" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221245" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221251" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221256" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221268" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221274" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221277" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221285" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221289" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221326" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221379" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221381" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221416" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221421" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221427" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221437" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221442" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221451" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221454" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221470" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221475" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221478" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221486" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221487" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221504" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221506" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221507" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221508" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221523" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221531" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221539" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221540" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221548" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221551" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221558" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221574" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221589" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221592" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221593" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221598" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221601" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221635" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221651" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221667" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221672" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221676" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221687" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221695" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221705" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221714" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221720" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221743" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221758" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221768" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221775" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221794" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221798" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221803" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221815" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221834" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221847" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221849" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221864" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221884" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221886" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221901" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221902" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221907" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221917" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221931" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221934" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221937" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221987" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222003" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222041" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222052" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222068" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222088" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222126" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222155" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222188" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222204" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222205" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222215" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222217" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222230" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222234" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222240" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222245" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222254" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222257" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222324" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222338" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222351" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222355" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222369" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222403" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222404" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222412" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222413" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222416" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222422" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222444" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222455" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222460" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222464" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222466" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222500" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222502" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222510" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222513" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222544" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222555" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222563" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222574" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222611" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222623" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222628" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222630" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222643" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222646" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222657" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222671" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222675" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222688" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222689" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222711" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00264041" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00265479" "" "" "" "1" "" "00006" "{PMID:Özyilmaz 2019:31066050}" "" "F" "" "Turkey" "" "0" "" "" "" "Pat31" "00265480" "" "" "" "1" "" "00006" "{PMID:Özyilmaz 2019:31066050}" "" "F" "" "Turkey" "" "0" "" "" "" "Pat32" "00265481" "" "" "" "1" "" "00006" "{PMID:Özyilmaz 2019:31066050}" "" "M" "" "Turkey" "" "0" "" "" "" "Pat33" "00274374" "" "" "" "1" "" "00006" "{PMID:Park 2017:27363342}" "" "F" "" "Korea" "" "0" "" "" "" "Pat76" "00288986" "" "" "" "1" "" "00006" "{PMID:Punetha 2016:27854218}" "analysis 94 myopathy cases" "" "" "" "" "0" "" "" "" "Pat40" "00288989" "" "" "" "1" "" "00006" "{PMID:Punetha 2016:27854218}" "analysis 94 myopathy cases" "" "" "" "" "0" "" "" "" "Pat43" "00289013" "" "" "" "1" "" "00006" "{PMID:Punetha 2016:27854218}" "analysis 94 myopathy cases" "" "" "" "" "0" "" "" "" "Pat68" "00293034" "" "" "" "24" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293035" "" "" "" "64" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293036" "" "" "" "175" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293037" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293038" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293039" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293040" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293041" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293043" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293044" "" "" "" "8" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293045" "" "" "" "33" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293046" "" "" "" "9" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293047" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293048" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295190" "" "" "" "6" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00296670" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00296869" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00304882" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304883" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00305776" "" "" "" "1" "" "00006" "{PMID:Yu 2017:28403181}" "analysis 180 LGMD patients" "F" "" "China" "" "0" "" "" "" "P53" "00305853" "" "" "" "1" "" "00006" "{PMID:Yu 2017:28403181}" "analysis 180 LGMD patients" "M" "" "China" "" "0" "" "" "" "P152" "00308008" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00314155" "" "" "" "2" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314156" "" "" "" "2" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314157" "" "" "" "2" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314158" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314159" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314160" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314161" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314162" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314163" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314164" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314165" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314166" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314167" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314168" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314169" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314170" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314171" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314172" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314173" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314174" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00335325" "" "" "" "1" "" "04016" "" "" "M" "no" "(United States)" "" "" "" "" "White" "" "00361987" "" "" "" "1" "" "04047" "{PMID:Saat 2021:33963534}" "" "M" "no" "Turkey" "" "0" "" "" "" "Pat9" "00361994" "" "" "" "1" "" "04047" "{PMID:Saat 2021:33963534}" "" "M" "no" "Turkey" "" "0" "" "" "" "Pat15" "00374280" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-5468" "00374281" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-5310" "00374282" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-1215" "00374283" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-1176" "00374612" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-4383" "00374701" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-0297" "00374702" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-4960" "00388669" "" "" "" "1" "" "00006" "{PMID:Chakravorty 2020:33250842}" "" "M" "" "India" "" "0" "" "" "India" "Pat35" "00388700" "" "" "" "1" "" "00006" "{PMID:Chakravorty 2020:33250842}" "" "M" "" "India" "" "0" "" "" "India" "Pat33" "00388701" "" "" "" "1" "" "00006" "{PMID:Chakravorty 2020:33250842}" "" "F" "" "India" "" "0" "" "" "India" "Pat34" "00392007" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "no" "India" "" "0" "yes" "" "" "MDCRC/1861/DBI-1503" "00392009" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "no" "India" "" "0" "yes" "" "" "MDCRC/1881/DBI-1515" "00397662" "" "" "" "1" "" "03524" "" "" "M" "" "" "" "" "" "" "" "" "00397768" "" "" "" "1" "" "00006" "{PMID:Patel 2021:34925456}" "patient" "" "" "India" "" "0" "" "" "India-W" "P52" "00397790" "" "" "" "1" "" "00006" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U7" "00397791" "" "" "" "1" "" "00006" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U6" "00397792" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U22" "00397793" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U9" "00397794" "" "" "" "1" "" "00006" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U5" "00397795" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U28" "00397796" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U25" "00397797" "" "" "" "1" "" "00006" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U1" "00397798" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U10" "00397799" "" "" "" "1" "" "00006" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U4" "00397800" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U39" "00397801" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U38" "00397802" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U18" "00397803" "" "" "" "1" "" "00006" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U19" "00397804" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U31" "00397805" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U37" "00397806" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U17" "00397807" "" "" "" "1" "" "00006" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U3" "00397808" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U33" "00397835" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "B19" "00399010" "" "" "" "1" "" "00006" "{PMID:Gonzalez-Quereda 2020:32403337}" "patient" "F" "" "Spain" "" "0" "" "" "" "P36" "00399071" "" "" "" "1" "" "00006" "{PMID:Gonzalez-Quereda 2020:32403337}" "patient" "M" "" "Spain" "" "0" "" "" "" "P144" "00404932" "" "" "" "1" "" "00006" "{PMID:Sharifi 2021:33481221}" "analysis 432 SMA families" "" "" "Iran" "" "0" "" "" "" "Fam14" "00409362" "" "" "" "1" "" "00006" "{PMID:Hong 2022:35387801}" "" "M" "" "Korea" "" "0" "" "" "" "CDC_NM7.1" "00411326" "" "" "" "2" "" "01399" "{PMID:Bryen 2022:35847480}" "8-generation family, affected sister/brother, unaffected heterozygous carrier parents (fourth cousin)/relatives" "F" "yes" "Australia" "" "0" ">43y" "" "white" "FamPatVIII:1" "00418360" "" "" "" "1" "" "00006" "{PMID:Scott 2017:27550220}" "2 generation family, 1 affected, no family history" "M" "" "United States" "" "0" "" "" "Hispanic" "Ind2" "00419929" "" "" "" "2" "" "03361" "" "2-generation family, mildly affected father and more severly affected daughter" "F" "" "France" "" "0" "" "" "" "daughter" "00428314" "" "" "" "1" "" "04448" "" "" "F" "yes" "China" "" "" "" "" "" "" "00430425" "" "" "" "1" "" "00006" "{PMID:Cavdarli 2023:36575883}" "analysis 146 neuromuscular disease patients" "F" "" "Turkey" "" "0" "" "" "" "D36" "00430475" "" "" "" "1" "" "00006" "{PMID:Cavdarli 2023:36575883}" "analysis 146 neuromuscular disease patients, unsolved" "F" "" "Turkey" "" "0" "" "" "" "U19" "00435463" "" "" "" "1" "" "00006" "{PMID:Sajan 2019:30478137}" "-generation family, 1 affected, unaffected heterozygous parents" "" "" "United States" "" "0" "" "" "" "Pat1" "00438503" "" "" "" "1" "" "00006" "{PMID:Cavdarli 2023:36575883}" "analysis 67 patients muscular dystrophy/myopathy (not DMD)" "F" "" "Turkey" "" "0" "" "" "" "D36" "00438553" "" "" "" "1" "" "00006" "{PMID:Cavdarli 2023:36575883}" "analysis 67 patients muscular dystrophy/myopathy (not DMD)" "F" "" "Turkey" "" "0" "" "" "" "U19" "00442621" "" "" "" "1" "" "00006" "{PMID:Panades de Oliveira 2019:30706156}" "patient, no family history" "M" "" "Spain" "" "0" "" "" "" "Fam7PatA" "00442646" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "F" "" "" "" "0" "" "" "" "Pat18" "00442647" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "F" "" "" "" "0" "" "" "" "Pat19" "00442648" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat20" "00442649" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat21" "00442650" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat22" "00442722" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "F" "" "" "" "0" "" "" "" "Pat94" "00442743" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat115" "00442772" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat144" "00442773" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat145" "00445010" "" "" "" "1" "" "04618" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "M" "" "France" "" "0" "" "" "" "F3" "00445011" "" "" "" "1" "" "04618" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "M" "" "France" "" "0" "" "" "" "F4" "00445012" "" "" "" "1" "" "04618" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "M" "" "France" "" "0" "" "" "" "F10" "00445013" "" "" "" "1" "" "04618" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "M" "" "France" "" "0" "" "" "" "F11" "00445022" "" "" "" "1" "" "04618" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "M" "" "France" "" "0" "" "" "" "F22" "00445139" "" "" "" "2" "" "04618" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "family, 2 affected" "F" "" "France" "" "0" "" "" "" "F5.1/5.2" "00445140" "" "" "" "1" "" "04618" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "F" "" "France" "" "0" "" "" "" "F6" "00445141" "" "" "" "1" "" "04618" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "F" "" "France" "" "0" "" "" "" "F7" "00445142" "" "" "" "1" "" "04618" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "M" "" "France" "" "0" "" "" "" "F8" "00445143" "" "" "" "1" "" "04618" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "M" "" "France" "" "0" "" "" "" "F9" "00454540" "" "" "" "3" "" "00006" "{PMID:Xie 2024:39198981}" "3-generation family, 3 affected" "M" "" "China" "" "0" "" "not treated" "" "Pat285" "00454541" "" "" "00454540" "1" "" "00006" "{PMID:Xie 2024:39198981}" "relative" "M" "" "China" "" "0" "" "not treated" "" "Pat286" "00454542" "" "" "00454540" "1" "" "00006" "{PMID:Xie 2024:39198981}" "relative" "M" "" "China" "" "0" "" "not treated" "" "Pat287" "00457809" "" "" "" "1" "" "00006" "{PMID:Morales-Rosado 2018:30549423}" "" "F" "" "United States" "" "0" "" "" "" "patient" "00458548" "" "" "" "1" "" "00454" "" "" "F" "" "Argentina" "" "" "" "" "" "#82DM" "00465821" "" "" "" "3" "" "00006" "{PMID:Alazami 2016:27023906}" "family, 3 affected" "" "" "Saudi Arabia" "" "0" "" "" "" "Fam15" "00466523" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "" "" "0" "" "" "" "Pat54" "00466524" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "" "" "0" "" "" "" "Pat55" "00466525" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat56" "00466526" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat57" "00466527" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat61" "00466528" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "" "" "0" "" "" "" "Pat63" "00466529" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat65" "00466530" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat66" "00466531" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat69" "00466532" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat71" "00466533" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat72" "00466534" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat77" "00466535" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat79" "00466536" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat81" "00466537" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat82" "00466538" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat83" "00466539" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat87" "00466540" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat94" "00466541" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat101" "00467621" "" "" "" "1" "" "00006" "{PMID:Elmas 2019:30426380}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "likely" "Turkey" "" "0" "" "" "" "Pat1" "00468218" "" "" "" "2" "" "00006" "{PMID:Ayala-Ramirez 2025:41066171}" "family, 2 affected" "M" "" "Colombia" "" "0" "" "" "" "Pat145" "00468225" "" "" "" "1" "" "00006" "{PMID:Ayala-Ramirez 2025:41066171}" "patient" "M" "" "Colombia" "" "0" "" "" "" "Pat47" "00468779" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00470702" "" "" "" "1" "" "00006" "{PMID:Horbacz 2025:41210864}" "patient, affected" "F" "" "Poland" "" "0" "" "" "" "Pat63" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 676 "{{individualid}}" "{{diseaseid}}" "00054695" "00360" "00054699" "00360" "00054700" "00360" "00054703" "00360" "00054705" "00360" "00054706" "00360" "00080893" "01945" "00081094" "01945" "00103084" "01448" "00104005" "03381" "00108709" "01448" "00108710" "01448" "00108711" "01448" "00108712" "01448" "00108713" "01448" "00108714" "01448" "00108715" "01448" "00108721" "01448" "00108724" "01448" "00108727" "01448" "00108728" "01448" "00108729" "01448" "00108730" "01448" "00108731" "01448" "00108741" "01448" "00108743" "01448" "00108757" "05100" "00108770" "05100" "00108772" "05100" "00108773" "05100" "00108775" "05100" "00108780" "05100" "00108781" "05100" "00108782" "05100" "00108783" "05100" "00108784" "05100" "00108786" "05100" "00108787" "05100" "00108788" "05100" "00108789" "01448" "00108790" "04286" "00108791" "01448" "00108792" "01448" "00108793" "05100" "00108794" "05100" "00108795" "05100" "00108796" "05100" "00108797" "05100" "00108798" "01448" "00108799" "05100" "00108800" "01448" "00108801" "05100" "00108802" "01448" "00108803" "05100" "00108804" "05100" "00108823" "01448" "00108824" "01448" "00108825" "01448" "00108826" "01448" "00108827" "01448" "00108828" "01448" "00108829" "01448" "00108830" "01448" "00108840" "01448" "00108841" "05100" "00108842" "05100" "00108848" "00000" "00108850" "01448" "00108851" "05100" "00108856" "05100" "00108857" "05100" "00108859" "00198" "00108862" "01448" "00108868" "05100" "00108875" "05100" "00108877" "05100" "00108878" "00198" "00108886" "00198" "00108887" "00198" "00108891" "00198" "00108892" "05100" "00108895" "00198" "00108896" "05100" "00108897" "05100" "00108900" "05100" "00108901" "00198" "00108902" "00198" "00108908" "05100" "00109013" "00198" "00109014" "00198" "00109015" "00198" "00109016" "00198" "00109017" "00198" "00109018" "00198" "00109019" "00198" "00109020" "00198" "00109021" "00198" "00109022" "00198" "00109023" "00198" "00109024" "00198" "00109025" "00198" "00109026" "00198" "00109027" "00198" "00109028" "00198" "00109029" "00198" "00109030" "00198" "00109031" "00198" "00109032" "00198" "00109033" "00198" "00109034" "00198" "00109035" "00198" "00109036" "00198" "00109037" "00198" "00109038" "00198" "00109039" "00198" "00109040" "00198" "00109041" "00198" "00109042" "00198" "00109043" "00198" "00109044" "00198" "00109045" "00198" "00109046" "00198" "00109047" "00198" "00109048" "00198" "00109049" "00198" "00109050" "00198" "00109051" "00198" "00109052" "00198" "00109053" "00198" "00109054" "00198" "00109055" "00198" "00109056" "00198" "00109057" "00198" "00109058" "00198" "00109059" "00198" "00109060" "00198" "00109061" "00198" "00109062" "00198" "00109063" "00198" "00109064" "00198" "00109065" "00198" "00109066" "00198" "00109067" "00198" "00109068" "00198" "00109069" "00198" "00109070" "00198" "00109071" "00198" "00109072" "00198" "00109073" "00198" "00109074" "00198" "00109075" "00198" "00109076" "00198" "00109077" "00198" "00109078" "00198" "00109079" "00198" "00109080" "00198" "00109193" "00198" "00109209" "05100" "00109229" "05100" "00109237" "00198" "00109238" "00198" "00109239" "00198" "00109240" "00198" "00109241" "00198" "00109242" "05100" "00109243" "00198" "00109244" "05100" "00109245" "00198" "00109263" "00198" "00109274" "01448" "00109275" "05100" "00109276" "01448" "00109288" "00198" "00109289" "00198" "00109290" "00198" "00109291" "00198" "00109294" "00000" "00109298" "05100" "00109299" "05100" "00109300" "00198" "00109302" "05100" "00109303" "05100" "00109304" "01448" "00109305" "01448" "00109308" "05100" "00109309" "05100" "00109310" "01448" "00109311" "00198" "00109312" "00198" "00109313" "01448" "00109314" "00198" "00109316" "05100" "00109317" "01448" "00109318" "01448" "00109320" "01448" "00109321" "05100" "00109354" "00000" "00109355" "05100" "00109356" "00198" "00109357" "00198" "00109358" "05100" "00109359" "05100" "00109360" "01448" "00109361" "05100" "00109362" "05100" "00109363" "05100" "00109364" "00000" "00109365" "00000" "00109366" "01448" "00109367" "01448" "00109368" "05100" "00109369" "01448" "00109370" "01448" "00109371" "01448" "00109372" "05100" "00109373" "00000" "00109374" "00000" "00109375" "05100" "00109376" "05100" "00109377" "01448" "00109378" "01448" "00109379" "01448" "00109380" "01448" "00109414" "00360" "00109415" "05100" "00174766" "05126" "00219483" "05126" "00219527" "05126" "00219535" "05126" "00219540" "05126" "00219555" "05126" "00219568" "05126" "00219620" "05126" "00219646" "05126" "00219656" "05126" "00219659" "05126" "00219662" "05126" "00219665" "05126" "00219669" "05126" "00219678" "05126" "00219693" "05126" "00219704" "05126" "00219716" "05126" "00219753" "04327" "00219753" "05126" "00219759" "00000" "00219759" "05126" "00219770" "05126" "00219782" "05126" "00219790" "05126" "00219809" "05126" "00219811" "05126" "00219815" "05126" "00219816" "05126" "00219825" "05126" "00219847" "05126" "00219850" "05126" "00219865" "05126" "00219872" "05126" "00219878" "05126" "00219889" "05126" "00219891" "05126" "00219919" "05126" "00219920" "05126" "00219924" "05126" "00219929" "05126" "00219946" "05126" "00219954" "05126" "00219955" "05126" "00219956" "05126" "00219980" "05126" "00220005" "05126" "00220009" "05126" "00220021" "05126" "00220023" "05126" "00220031" "05126" "00220049" "05126" "00220061" "05126" "00220079" "05126" "00220080" "05126" "00220092" "05126" "00220093" "05126" "00220097" "05126" "00220098" "05126" "00220102" "05126" "00220106" "05126" "00220112" "05126" "00220136" "05126" "00220137" "05126" "00220140" "05126" "00220142" "05126" "00220145" "05126" "00220170" "05126" "00220173" "05126" "00220183" "05126" "00220188" "05126" "00220200" "05126" "00220221" "05126" "00220255" "05126" "00220256" "05126" "00220264" "05126" "00220269" "05126" "00220306" "05126" "00220314" "05126" "00220317" "05126" "00220318" "05126" "00220321" "05126" "00220354" "05126" "00220368" "05126" "00220369" "05126" "00220417" "05126" "00220419" "05126" "00220430" "05126" "00220442" "05126" "00220458" "05126" "00220461" "05126" "00220484" "05126" "00220510" "05126" "00220515" "05126" "00220530" "05126" "00220533" "05126" "00220537" "05126" "00220538" "05126" "00220540" "05126" "00220541" "05126" "00220545" "05126" "00220554" "05126" "00220555" "05126" "00220562" "05126" "00220609" "05126" "00220610" "05126" "00220616" "05126" "00220634" "05126" "00220638" "05126" "00220643" "05126" "00220657" "05126" "00220670" "05126" "00220671" "05126" "00220675" "05126" "00220701" "05126" "00220719" "05126" "00220731" "05126" "00220754" "05126" "00220759" "05126" "00220765" "05126" "00220779" "05126" "00220785" "05126" "00220806" "05126" "00220808" "05126" "00220821" "05126" "00220824" "05126" "00220841" "05126" "00220844" "05126" "00220852" "05126" "00220854" "05126" "00220857" "05126" "00220859" "05126" "00220864" "05126" "00220865" "05126" "00220868" "05126" "00220879" "05126" "00220913" "05126" "00220921" "05126" "00220922" "05126" "00220923" "05126" "00220925" "05126" "00220939" "05126" "00220943" "05126" "00220949" "05126" "00220952" "05126" "00220955" "05126" "00220958" "05126" "00220963" "05126" "00220972" "05126" "00220984" "05126" "00220992" "05126" "00220994" "05126" "00221000" "05126" "00221008" "05126" "00221025" "05126" "00221028" "05126" "00221030" "05126" "00221052" "05126" "00221059" "05126" "00221060" "05126" "00221067" "05126" "00221080" "05126" "00221086" "05126" "00221095" "05126" "00221125" "05126" "00221141" "05126" "00221142" "05126" "00221145" "05126" "00221148" "05126" "00221166" "05126" "00221177" "05126" "00221195" "05126" "00221197" "05126" "00221204" "05126" "00221205" "05126" "00221238" "05126" "00221245" "05126" "00221251" "05126" "00221256" "05126" "00221268" "05126" "00221274" "05126" "00221277" "05126" "00221285" "05126" "00221289" "05126" "00221326" "05126" "00221379" "05126" "00221381" "05126" "00221416" "05126" "00221421" "05126" "00221427" "05126" "00221437" "05126" "00221442" "05126" "00221451" "05126" "00221454" "05126" "00221470" "05126" "00221475" "05126" "00221478" "05126" "00221486" "05126" "00221487" "05126" "00221504" "05126" "00221506" "05126" "00221507" "05126" "00221508" "05126" "00221523" "05126" "00221531" "05126" "00221539" "05126" "00221540" "05126" "00221548" "05126" "00221551" "05126" "00221558" "05126" "00221574" "05126" "00221589" "05126" "00221592" "05126" "00221593" "05126" "00221598" "05126" "00221601" "05126" "00221635" "05126" "00221651" "05126" "00221667" "05126" "00221672" "05126" "00221676" "05126" "00221687" "05126" "00221695" "05126" "00221705" "05126" "00221714" "05126" "00221720" "05126" "00221743" "05126" "00221758" "05126" "00221768" "05126" "00221775" "05126" "00221794" "05126" "00221798" "05126" "00221803" "05126" "00221815" "05126" "00221834" "05126" "00221847" "05126" "00221849" "05126" "00221864" "05126" "00221884" "05126" "00221886" "05126" "00221901" "05126" "00221902" "05126" "00221907" "05126" "00221917" "05126" "00221931" "05126" "00221934" "05126" "00221937" "05126" "00221987" "05126" "00222003" "05126" "00222041" "05126" "00222052" "05126" "00222068" "05126" "00222088" "05126" "00222126" "05126" "00222155" "05126" "00222188" "05126" "00222204" "05126" "00222205" "05126" "00222215" "05126" "00222217" "05126" "00222230" "05126" "00222234" "05126" "00222240" "05126" "00222245" "05126" "00222254" "05126" "00222257" "05126" "00222324" "05126" "00222338" "05126" "00222351" "05126" "00222355" "05126" "00222369" "05126" "00222403" "05126" "00222404" "05126" "00222412" "05126" "00222413" "05126" "00222416" "05126" "00222422" "05126" "00222444" "05126" "00222455" "05126" "00222460" "05126" "00222464" "05126" "00222466" "05126" "00222500" "05126" "00222502" "05126" "00222510" "05126" "00222513" "05126" "00222544" "05126" "00222555" "05126" "00222563" "05126" "00222574" "05126" "00222611" "05126" "00222623" "05126" "00222628" "05126" "00222630" "05126" "00222643" "05126" "00222646" "05126" "00222657" "05126" "00222671" "05126" "00222675" "05126" "00222688" "05126" "00222689" "05126" "00222711" "05126" "00265479" "00360" "00265480" "00360" "00265481" "00360" "00274374" "05121" "00288986" "05126" "00288989" "00360" "00289013" "05126" "00293034" "00198" "00293035" "00198" "00293036" "00198" "00293037" "00198" "00293038" "00198" "00293039" "00198" "00293040" "00198" "00293041" "00198" "00293043" "00198" "00293044" "00198" "00293045" "00198" "00293046" "00198" "00293047" "00198" "00293048" "00198" "00295190" "00198" "00296670" "00198" "00296869" "00198" "00304882" "00198" "00304883" "00198" "00305776" "05126" "00305853" "05126" "00308008" "00198" "00314155" "05126" "00314156" "05126" "00314157" "05126" "00314158" "05126" "00314159" "05126" "00314160" "05126" "00314161" "05126" "00314162" "05126" "00314163" "05126" "00314164" "05126" "00314165" "05126" "00314166" "05126" "00314167" "05126" "00314168" "05126" "00314169" "05126" "00314170" "05126" "00314171" "05126" "00314172" "05126" "00314173" "05126" "00314174" "05126" "00335325" "05656" "00361987" "00360" "00361994" "00360" "00374280" "00198" "00374281" "00198" "00374282" "00198" "00374283" "00198" "00374612" "00198" "00374701" "00198" "00374702" "00198" "00388669" "00244" "00388700" "00244" "00388701" "00244" "00392007" "05324" "00392009" "05324" "00397662" "05100" "00397768" "05121" "00397790" "05121" "00397791" "05121" "00397792" "05121" "00397793" "05121" "00397794" "05121" "00397795" "05121" "00397796" "05121" "00397797" "05121" "00397798" "05121" "00397799" "05121" "00397800" "05121" "00397801" "05121" "00397802" "05121" "00397803" "05121" "00397804" "05121" "00397805" "05121" "00397806" "05121" "00397807" "05121" "00397808" "05121" "00397835" "05121" "00399010" "05618" "00399071" "05618" "00404932" "05123" "00409362" "05126" "00411326" "05358" "00418360" "00152" "00419929" "05358" "00428314" "05100" "00430425" "05618" "00430475" "05618" "00435463" "06495" "00438503" "05121" "00438553" "05121" "00442621" "05358" "00442646" "05618" "00442647" "05618" "00442648" "05618" "00442649" "05618" "00442650" "05618" "00442722" "05618" "00442743" "05618" "00442772" "05618" "00442773" "05618" "00445010" "05100" "00445011" "05358" "00445012" "05358" "00445013" "05358" "00445022" "05358" "00445139" "05358" "00445140" "05358" "00445141" "05100" "00445142" "05358" "00445143" "05358" "00454540" "05121" "00454541" "05121" "00454542" "05121" "00457809" "05611" "00458548" "05126" "00465821" "00198" "00466523" "05121" "00466524" "05121" "00466525" "05121" "00466526" "05121" "00466527" "05121" "00466528" "05121" "00466529" "00244" "00466530" "00244" "00466531" "00244" "00466532" "00244" "00466533" "00244" "00466534" "00244" "00466535" "00244" "00466536" "00244" "00466537" "00244" "00466538" "00244" "00466539" "00244" "00466540" "00244" "00466541" "00244" "00467621" "00198" "00468218" "00244" "00468225" "00244" "00468779" "00198" "00470702" "07210" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00152, 00198, 00244, 00360, 01448, 01945, 01960, 03381, 04286, 04327, 05100, 05121, 05123, 05126, 05324, 05358, 05611, 05618, 05656, 06495, 07176, 07178, 07210 ## Count = 337 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000041374" "00360" "00054695" "01399" "Familial, autosomal dominant" "21y" "never walked, contractures, distal laxity; CPK normal; IHC COLVI; histology non-specific" "6m" "" "" "" "" "" "" "" "" "" "" "0000041378" "00360" "00054699" "01458" "Familial, autosomal dominant" "18y" "infantile hypotonia, congenital hip dislocation, gross motor delay, mild facial weakness, distal laxity, scoliosis, hyperkeratosis pilaris, long finger flexor contractures; CPK normal; IHC COLVI; histology dystrophic" "" "" "" "" "" "" "" "" "" "" "" "0000041379" "00360" "00054700" "01458" "Familial, autosomal recessive" "12y" "infantile hypotonia, arthrogryposis, congenital femur fracture and hip dislocation, gross motor delay, walked age 2 years, mild facial weakness, contractures, distal laxity, hyperkeratosis pilaris, restrictive lung disease ; CPK mild elevation (378); IHC COLVI; histology dystrophic" "" "" "" "" "" "" "" "" "" "" "" "0000041382" "00360" "00054703" "01458" "Familial, autosomal dominant" "22y" "generalised weakness, mild facial weakness, hypermobility and distal laxity, contractures, hyperkeratosis pilaris; CPK mild elevation (375-603); IHC COLVI; histology dystrophic" "6m" "" "" "" "" "" "" "" "" "" "" "0000041384" "00360" "00054705" "01458" "Familial, autosomal dominant" "9y" "infantile hypotonia and weakness, gross motor delay, walked age 20mo, mild facial weakness, distal laxity, contractures, hyperkeratosis pilaris, finger flexor contractures; CPK mild elevation (419); IHC COLVI; histology dystrophic" "" "" "" "" "" "" "" "" "" "" "" "0000041385" "00360" "00054706" "01458" "Familial, autosomal recessive" "14y" "infantile hypotonia, congenital hip dislocation, talipes equinovarus, proximal weakness, hypermobility, distal laxity, mild scoliosis, hyperkeratosis pilaris; CPK mild elevation (343-405); IHC COLVI; histology dystrophic" "" "" "" "" "" "" "" "" "" "" "" "0000060462" "01945" "00080893" "01758" "Familial, autosomal recessive" "" "Ullrich congenital muscular dystrophy 1 (OMIM:254090)" "" "" "" "" "" "" "" "" "" "" "" "0000060663" "01945" "00081094" "01758" "Familial, autosomal recessive" "" "Ullrich congenital muscular dystrophy 1 (OMIM:254090)" "" "" "" "" "" "" "" "" "" "" "" "0000081211" "01448" "00103084" "01955" "Unknown" "" "" "00y" "" "" "" "" "" "" "" "" "" "" "0000081939" "03381" "00104005" "00587" "Unknown" "" "diffuse-type or intestinal-type gastric cancer" "" "" "" "" "" "" "" "" "" "" "" "0000086183" "01448" "00108709" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086184" "01448" "00108710" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086185" "01448" "00108711" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086186" "01448" "00108712" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086187" "01448" "00108713" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086188" "01448" "00108714" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086189" "01448" "00108715" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086195" "01448" "00108721" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086198" "01448" "00108724" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086201" "01448" "00108727" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086202" "01448" "00108728" "01955" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086203" "01448" "00108729" "01955" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086204" "01448" "00108730" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086205" "01448" "00108731" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086215" "01448" "00108741" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086217" "01448" "00108743" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086230" "05100" "00108757" "00449" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086243" "05100" "00108770" "00006" "Unknown" "" "mild" "" "" "" "" "" "" "" "" "" "" "" "0000086245" "05100" "00108772" "00449" "Isolated (sporadic)" "" "mild" "" "" "" "" "" "" "" "" "" "" "" "0000086246" "05100" "00108773" "00449" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086248" "05100" "00108775" "00449" "Isolated (sporadic)" "" "mild" "" "" "" "" "" "" "" "" "" "" "" "0000086253" "05100" "00108780" "00449" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086254" "05100" "00108781" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086255" "05100" "00108782" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086256" "05100" "00108783" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086257" "05100" "00108784" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086259" "05100" "00108786" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086260" "05100" "00108787" "00006" "Unknown" "" "mild" "" "" "" "" "" "" "" "" "" "" "" "0000086261" "05100" "00108788" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086262" "01448" "00108789" "00006" "Unknown" "" "change in 1/78 individuals" "" "" "" "" "" "" "" "" "" "" "" "0000086263" "04286" "00108790" "00006" "Familial" "" "LGMD-AD" "" "" "" "" "" "" "" "" "" "" "" "0000086264" "01448" "00108791" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086265" "01448" "00108792" "00006" "Unknown" "" "1/3 severe" "" "" "" "" "" "" "" "" "" "" "" "0000086266" "05100" "00108793" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086267" "05100" "00108794" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086268" "05100" "00108795" "00006" "Unknown" "" "mild" "" "" "" "" "" "" "" "" "" "" "" "0000086269" "05100" "00108796" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086270" "05100" "00108797" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086271" "01448" "00108798" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086272" "05100" "00108799" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086273" "01448" "00108800" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086274" "05100" "00108801" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086275" "01448" "00108802" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086276" "05100" "00108803" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086277" "05100" "00108804" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086296" "01448" "00108823" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086297" "01448" "00108824" "00006" "Unknown" "" "CPK normal" "" "" "" "" "" "" "" "" "" "" "" "0000086298" "01448" "00108825" "00006" "Unknown" "" "CPK increased" "" "" "" "" "" "" "" "" "" "" "" "0000086299" "01448" "00108826" "00006" "Unknown" "" "CPK increased" "" "" "" "" "" "" "" "" "" "" "" "0000086300" "01448" "00108827" "00006" "Unknown" "" "CPK normal" "" "" "" "" "" "" "" "" "" "" "" "0000086301" "01448" "00108828" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086302" "01448" "00108829" "00006" "Unknown" "" "CPK normal" "" "" "" "" "" "" "" "" "" "" "" "0000086303" "01448" "00108830" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086313" "01448" "00108840" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086314" "05100" "00108841" "00006" "Unknown" "" "CPK normal" "" "" "" "" "" "" "" "" "" "" "" "0000086315" "05100" "00108842" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086321" "00000" "00108848" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086323" "01448" "00108850" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086324" "05100" "00108851" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086329" "05100" "00108856" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086330" "05100" "00108857" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086332" "00198" "00108859" "00464" "Unknown" "" "Bethlem myopathy; Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "" "" "" "0000086335" "01448" "00108862" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086341" "05100" "00108868" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086348" "05100" "00108875" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086350" "05100" "00108877" "00006" "Isolated (sporadic)" "" "MRI-brain white matter lesions (numerous patchy); delayed motor skills; roll-6m, sit-12m, c-12m, walk-4y3m" "" "" "" "" "" "" "" "" "" "" "" "0000086351" "00198" "00108878" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086359" "00198" "00108886" "00464" "Unknown" "" "collagenopathy, type VI" "" "" "" "" "" "" "" "" "" "" "" "0000086360" "00198" "00108887" "00464" "Unknown" "" "type VI collagenopathy" "" "" "" "" "" "" "" "" "" "" "" "0000086364" "00198" "00108891" "00464" "Unknown" "" "type VI collagenopathy" "" "" "" "" "" "" "" "" "" "" "" "0000086365" "05100" "00108892" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086368" "00198" "00108895" "00464" "Isolated (sporadic)" "" "collagenopathy, type VI" "" "" "" "" "" "" "" "" "" "" "" "0000086369" "05100" "00108896" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086370" "05100" "00108897" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086373" "05100" "00108900" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086374" "00198" "00108901" "00464" "Unknown" "" "collagenopathy, type VI; gross motor delays, proximal weakness, elbow contractures, hyperextensible fingers" "" "" "" "" "" "" "" "" "" "" "" "0000086375" "00198" "00108902" "00464" "Unknown" "" "collagenopathy, type VI" "" "" "" "" "" "" "" "" "" "" "" "0000086381" "05100" "00108908" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086486" "00198" "00109013" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086487" "00198" "00109014" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086488" "00198" "00109015" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086489" "00198" "00109016" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086490" "00198" "00109017" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086491" "00198" "00109018" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086492" "00198" "00109019" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086493" "00198" "00109020" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086494" "00198" "00109021" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086495" "00198" "00109022" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086496" "00198" "00109023" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086497" "00198" "00109024" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086498" "00198" "00109025" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086499" "00198" "00109026" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086500" "00198" "00109027" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086501" "00198" "00109028" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086502" "00198" "00109029" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086503" "00198" "00109030" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086504" "00198" "00109031" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086505" "00198" "00109032" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086506" "00198" "00109033" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086507" "00198" "00109034" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086508" "00198" "00109035" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086509" "00198" "00109036" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086510" "00198" "00109037" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086511" "00198" "00109038" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086512" "00198" "00109039" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086513" "00198" "00109040" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086514" "00198" "00109041" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086515" "00198" "00109042" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086516" "00198" "00109043" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086517" "00198" "00109044" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086518" "00198" "00109045" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086519" "00198" "00109046" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086520" "00198" "00109047" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086521" "00198" "00109048" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086522" "00198" "00109049" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086523" "00198" "00109050" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086524" "00198" "00109051" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086525" "00198" "00109052" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086526" "00198" "00109053" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086527" "00198" "00109054" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086528" "00198" "00109055" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086529" "00198" "00109056" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086530" "00198" "00109057" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086531" "00198" "00109058" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086532" "00198" "00109059" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086533" "00198" "00109060" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086534" "00198" "00109061" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086535" "00198" "00109062" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086536" "00198" "00109063" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086537" "00198" "00109064" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086538" "00198" "00109065" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086539" "00198" "00109066" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086540" "00198" "00109067" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086541" "00198" "00109068" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086542" "00198" "00109069" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086543" "00198" "00109070" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086544" "00198" "00109071" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086545" "00198" "00109072" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086546" "00198" "00109073" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086547" "00198" "00109074" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086548" "00198" "00109075" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086549" "00198" "00109076" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086550" "00198" "00109077" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086551" "00198" "00109078" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086552" "00198" "00109079" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086553" "00198" "00109080" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086666" "00198" "00109193" "00464" "Unknown" "" "collagenopathy, type VI" "" "" "" "" "" "" "" "" "" "" "" "0000086682" "05100" "00109209" "00537" "Isolated (sporadic)" "" "intermediate; ambulatory with assistive devices (13y); 9y-first wheelchair use; walk-12m; wheelchair-bound 9y" "" "" "" "" "" "" "" "" "" "" "" "0000086702" "05100" "00109229" "00537" "Isolated (sporadic)" "" "intermediate; wheelchair-bound >12y" "" "" "" "" "" "" "" "" "" "" "" "0000086710" "00198" "00109237" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086711" "00198" "00109238" "00537" "Isolated (sporadic)" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086712" "00198" "00109239" "00537" "Isolated (sporadic)" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086713" "00198" "00109240" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086714" "00198" "00109241" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086715" "05100" "00109242" "00537" "Isolated (sporadic)" "" "intermediate; 14y-first wheelchair use; walk-12m; wheelchair-bound 15y" "" "" "" "" "" "" "" "" "" "" "" "0000086716" "00198" "00109243" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086717" "05100" "00109244" "00537" "Isolated (sporadic)" "" "first wheelchair use 8y; walk-18m; wheelchair-bound >8y" "" "" "" "" "" "" "" "" "" "" "" "0000086718" "00198" "00109245" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086736" "00198" "00109263" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086747" "01448" "00109274" "00537" "Isolated (sporadic)" "" "walk-16m; wheelchair-bound >29y" "" "" "" "" "" "" "" "" "" "" "" "0000086748" "05100" "00109275" "00537" "Isolated (sporadic)" "" "ambulatory with assistive devices (5y); walk-28m; wheelchair-bound >5y" "" "" "" "" "" "" "" "" "" "" "" "0000086749" "01448" "00109276" "00537" "Isolated (sporadic)" "" "intermediate; ambulatory with assistive devices (46y); wheelchair-bound >46y" "" "" "" "" "" "" "" "" "" "" "" "0000086761" "00198" "00109288" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086762" "00198" "00109289" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086763" "00198" "00109290" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086764" "00198" "00109291" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086767" "00000" "00109294" "00537" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086771" "05100" "00109298" "00006" "Isolated (sporadic)" "" "see paper; moderately severe" "" "" "" "" "" "" "" "" "" "" "" "0000086772" "05100" "00109299" "00006" "Familial, autosomal recessive" "" "severe; 0d-hypotonia, hip dysplasia, contractures; respiratory insufficiency; delayed, no sit, no walk" "" "" "" "" "" "" "" "" "" "" "" "0000086773" "00198" "00109300" "00006" "Isolated (sporadic)" "" "developmental delays; see paper …" "" "" "" "" "" "" "" "" "" "" "" "0000086775" "05100" "00109302" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086776" "05100" "00109303" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086777" "01448" "00109304" "00472" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086778" "01448" "00109305" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086781" "05100" "00109308" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086782" "05100" "00109309" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086783" "01448" "00109310" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086784" "00198" "00109311" "00472" "Isolated (sporadic)" "" "myopathy, myosclerosis" "" "" "" "" "" "" "" "" "" "" "" "0000086785" "00198" "00109312" "00472" "Isolated (sporadic)" "" "myopathy, myosclerosis" "" "" "" "" "" "" "" "" "" "" "" "0000086786" "01448" "00109313" "00472" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086787" "00198" "00109314" "00472" "Isolated (sporadic)" "" "dystrophy, muscular, congenital, Ullrich (UCMD); myopathy, Bethlem (BM)" "" "" "" "" "" "" "" "" "" "" "" "0000086789" "05100" "00109316" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086790" "01448" "00109317" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086791" "01448" "00109318" "00472" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086793" "01448" "00109320" "00472" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086794" "05100" "00109321" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086827" "00000" "00109354" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086828" "05100" "00109355" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086829" "00198" "00109356" "00472" "Familial, autosomal dominant" "" "dystrophy, muscular, congenital, Ullrich (UCMD); myopathy, Bethlem (BM)" "" "" "" "" "" "" "" "" "" "" "" "0000086830" "00198" "00109357" "00472" "Isolated (sporadic)" "" "myosclerosis" "" "" "" "" "" "" "" "" "" "" "" "0000086831" "05100" "00109358" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086832" "05100" "00109359" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086833" "01448" "00109360" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086834" "05100" "00109361" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086835" "05100" "00109362" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086836" "05100" "00109363" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086837" "00000" "00109364" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086838" "00000" "00109365" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086839" "01448" "00109366" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086840" "01448" "00109367" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086841" "05100" "00109368" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086842" "01448" "00109369" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086843" "01448" "00109370" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086844" "01448" "00109371" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086845" "05100" "00109372" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086846" "00000" "00109373" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086847" "00000" "00109374" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086848" "05100" "00109375" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086849" "05100" "00109376" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086850" "01448" "00109377" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086851" "01448" "00109378" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086852" "01448" "00109379" "00472" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086853" "01448" "00109380" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086887" "00360" "00109414" "01700" "Isolated (sporadic)" "" "histopathology showed fiber type disproportion; CPK normal" "" "" "" "IHC mildly reduced COLVI staining" "" "" "" "" "" "" "" "0000086888" "05100" "00109415" "02188" "Familial, autosomal dominant" "" "hypotonia at birth; progressive weakness, contractures, finer hyper laxity; wheelchair-bound 10" "" "10y" "" "" "" "" "" "" "" "" "" "0000139593" "05126" "00174766" "00006" "Isolated (sporadic)" "14y" "onset overt symptoms early childhood; CPK raised 3x; born 35 Hbd with hypotrophy, cerebral palsy diagnosed based on MR, congenital knee contractures, delayed motor milestones, hearing impairment; ambulation preserved" "" "" "" "" "" "" "" "" "" "limb-girdle muscular dystrophy" "" "0000155737" "00198" "00207968" "01164" "Unknown" "" "HP:0003198 (Myopathy); HP:0011805 (Abnormality of muscle morphology)" "" "" "" "" "" "" "" "" "" "" "" "0000157521" "00198" "00208913" "01164" "Unknown" "" "HP:0001324 (Muscle weakness)" "" "" "" "" "" "" "" "" "" "" "" "0000203276" "00360" "00265479" "00006" "Unknown" "4y" "high CK, difficulty walking" "" "" "" "" "" "" "" "" "BTHLM-1" "CMD" "" "0000203277" "00360" "00265480" "00006" "Unknown" "10y" "high CK, difficulty walking, scoliosis, torticollis" "" "" "" "" "" "" "" "" "BTHLM-1" "CMD" "" "0000203278" "00360" "00265481" "00006" "Unknown" "7y" "high CK, proximal weakness" "" "" "" "" "" "" "" "" "" "CMD" "" "0000209317" "05121" "00274374" "00006" "Familial, autosomal dominant" "" "Diffuse muscle weakness, and contractures of ankle and finger joints; muscle myopathic pattern; elevated CK (848 IU/L); ECG or echo normal; familial" "2y" "10y" "" "" "" "" "" "" "LGMD2B" "muscular dystrophy" "" "0000222621" "05126" "00288986" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "LGMD" "" "0000222624" "00360" "00288989" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "congenital muscular dystrophy" "" "0000222648" "05126" "00289013" "00006" "Unknown" "" "LGMD, prominent scapular atrophy" "" "" "" "" "" "" "" "" "" "LGMD" "" "0000224071" "00198" "00296670" "01164" "Unknown" "" "EMG: myopathic abnormalities (HP:0003458); Scapular winging (HP:0003691); Proximal muscle weakness (HP:0003701)" "" "" "" "" "" "" "" "" "" "" "" "0000224266" "00198" "00296869" "01164" "Unknown" "" "Muscular dystrophy (HP:0003560)" "" "" "" "" "" "" "" "" "" "" "" "0000231622" "05126" "00305776" "00006" "Unknown" "12y" "mild (MRC grade ≥4/5); lower limbs more severe than upper limbs; distal weakness; neck flexor weakness (HP:0003722); elevated serum CK (max. 1555 IU/L); biopsy dystrophic; rimmed vacuole; inflammation" "2y" "" "" "   " "" "" "" "" "" "limb-girdle muscular dystrophy" "" "0000231699" "05126" "00305853" "00006" "Unknown" "29y" "moderate (MRC grade 3-4/5); lower limbs more severe than upper limbs; distal weakness; hypertrophy; contractures; elevated serum CK (max. 360 IU/L); biopsy myopathic; multi-core; inflammation" "9y" "" "" "   " "" "" "" "" "" "limb-girdle muscular dystrophy" "" "0000233431" "00198" "00308008" "01164" "Unknown" "" "Tip-toe gait (HP:0030051)" "" "" "" "" "" "" "" "" "" "" "" "0000257379" "00360" "00361987" "04047" "Unknown" "" "Hypotonia HP:0001252" "" "" "" "" "" "" "" "" "" "" "" "0000257387" "00360" "00361994" "04047" "Unknown" "" "Muscle weakness HP:0001324" "" "" "" "" "" "" "" "" "" "" "" "0000269490" "00198" "00374280" "00006" "Familial, autosomal recessive" "" "Congenital muscular dystrophy, developmental delay, hypotonia and contractures at knees and elbow" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269491" "00198" "00374281" "00006" "Familial, autosomal recessive" "" "Myopathic facies, arachnodactyly, high arched palate, hypotonia, elbow and hip contractures" "" "" "" "" "" "" "" "" "" "Ullrich muscular dystrophy" "" "0000269492" "00198" "00374282" "00006" "Familial, autosomal recessive" "" "Delayed walking, abnormal gait, recurrent falls and hypotonia" "" "" "" "" "" "" "" "" "" "Ullrich muscular dystrophy" "" "0000269493" "00198" "00374283" "00006" "Familial, autosomal recessive" "" "Myopathic facies, high arched groove palate, flexon deformity, hyperextensibility of fingers, prominent fetal finger pads, restriction of shoulder joints, narrow chest, proximal contracture." "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269822" "00198" "00374612" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "hypotonia" "" "0000269911" "00198" "00374701" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269912" "00198" "00374702" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000282209" "00244" "00388669" "00006" "Familial, autosomal dominant" "23y" "distal muscle weakness, proximal muscle weakness; CK level 152 IU/L; Vastus lateralis muscle MRI showing “sandwich” sign; Difficulty getting up from ground and toe walking;Finger flexors and tendo-achilis contractures; Most-affected muscles: Hip extensors and adductors, ankle dorsiflexors" "1d" "" "" "" "" "" "" "" "" "" "" "0000282240" "00244" "00388700" "00006" "Familial, autosomal recessive" "18y" "proximal muscle weakness; CK level 5467 IU/L; Vastus lateralis muscle MRI showing “sandwich” sign; Difficulty getting up from ground and toe walking;Finger flexors and tendo-achilis contractures; Most-affected muscles: Hip extensors and adductors, ankle dorsiflexors" "4y" "" "" "" "" "" "" "" "" "" "" "0000282241" "00244" "00388701" "00006" "Familial, autosomal recessive" "44y" "proximal muscle weakness; CK level 215 IU/L; Vastus lateralis muscle MRI showing “sandwich” sign; Difficulty getting up from ground and toe walking;Finger flexors and tendo-achilis contractures; Most-affected muscles: Hip extensors and adductors, ankle dorsiflexors" "35y" "" "" "" "" "" "" "" "" "" "" "0000285297" "05324" "00392007" "03501" "Unknown" "18y" "delayed fine motor development (HP:0010862), calf muscle hypertrophy (HP:0008981), proximal muscle weakness (HP:0003701)" "8y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000285299" "05324" "00392009" "03501" "Unknown" "23y" "calf muscle hypertrophy (HP:0008981), Gowers sign (HP:0003391), difficulty climbing stairs (HP:0003551), difficulty walking (HP:0002355), waddling gait (HP:0002515), proximal muscle weakness (HP:0003701)" "5y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000290789" "05100" "00397662" "03524" "Isolated (sporadic)" "16y" "" "" "16y" "" "" "" "" "" "" "" "" "" "0000290895" "05121" "00397768" "00006" "Familial, autosomal recessive" "40y" "CPK 95 U/L" "" "" "" "" "" "" "" "" "LGMDR22" "limb-girdle muscular dystrophy" "" "0000290917" "05121" "00397790" "00006" "Isolated (sporadic)" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290918" "05121" "00397791" "00006" "Isolated (sporadic)" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290919" "05121" "00397792" "00006" "Isolated (sporadic)" "" "mild Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290920" "05121" "00397793" "00006" "Isolated (sporadic)" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290921" "05121" "00397794" "00006" "Isolated (sporadic)" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290922" "05121" "00397795" "00006" "Isolated (sporadic)" "" "mild Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290923" "05121" "00397796" "00006" "Isolated (sporadic)" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290924" "05121" "00397797" "00006" "Isolated (sporadic)" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290925" "05121" "00397798" "00006" "Familial, autosomal recessive" "" "early severe Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290926" "05121" "00397799" "00006" "Familial, autosomal recessive" "" "early severe Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290927" "05121" "00397800" "00006" "Familial, autosomal recessive" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290928" "05121" "00397801" "00006" "Familial, autosomal recessive" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290929" "05121" "00397802" "00006" "Familial, autosomal recessive" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290930" "05121" "00397803" "00006" "Isolated (sporadic)" "" "early severe Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290931" "05121" "00397804" "00006" "Familial, autosomal recessive" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290932" "05121" "00397805" "00006" "Familial, autosomal recessive" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290933" "05121" "00397806" "00006" "Familial, autosomal recessive" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290934" "05121" "00397807" "00006" "Familial, autosomal recessive" "" "mild Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290935" "05121" "00397808" "00006" "Familial, autosomal recessive" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290962" "05121" "00397835" "00006" "Familial, autosomal recessive" "" "Bethlem myopathy" "" "" "" "" "" "" "" "" "BTHLM1" "Bethlem myopathy" "" "0000292098" "05618" "00399010" "00006" "Unknown" "" "serum CK 270 U/L; muscle biopsy dystrophic changes, COLVI reduction in muscle and skin biopsy ; hypotonia, congenital torticollis, limb- girdle weakness, multiple retractions" "<1m" "" "" "" "" "" "" "" "" "COL6-realted myopathy" "" "0000292159" "05618" "00399071" "00006" "Unknown" "" "serum CK 429 U/L; muscle biopsy dystrophic pattern; muscle weakness, hypotonia" "1d" "" "" "" "" "" "" "" "" "neuromuscular disorder" "" "0000297490" "05123" "00404932" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "spinal muscular atrophy" "" "0000301483" "05126" "00409362" "00006" "Familial, autosomal recessive" "" "see paper; ..., (HP:0006466) Ankle contracture, (HP:0003546) Exercise intolerance, (HP:0008180) Mildy elevated creatine kinase, (HP:0030951) Skeletal muscle fibrosis, (HP:0009058) Increased muscle lipid content, (HP:0003557) Increased variability in muscle fiber diameter" "" "" "" "" "" "" "" "" "LGMD2Y" "limb-girdle muscular dystrophy" "" "0000305556" "05358" "00411326" "00006" "Familial, autosomal recessive" "41y" "see paper; ..., myopathy; unremarkable pregnancy; 1d-hypotonia, soft skin, delayed motor milestones" "" "" "" "" "" "" "" "" "" "congenital myopathy" "" "0000309729" "00152" "00418360" "00006" "Familial, X-linked recessive" "5y" "atrial septal defect, left ventricular non-compaction, patent ductus arteriosu, ventricular septal defect; hypotonia; language delay; gross motor delay; feeding problems; MRI brain 3m-normal; relative macrocephaly, frontal bossing, café au lait and hypopigmented macules, planovalgus" "" "" "" "" "" "" "" "" "MRXS34" "congenital heart defect, left ventricular non-compaction" "" "0000319218" "05100" "00428314" "04448" "Isolated (sporadic)" "" "" "" "12y" "" "" "" "" "" "" "" "" "" "0000321222" "05618" "00430425" "00006" "Familial, autosomal dominant" "22y" "hyperCKemia; muscle biopsy normal" "" "" "" "" "" "" "" "" "" "neuromuscular disorder" "" "0000321272" "05618" "00430475" "00006" "Unknown" "22y" "muscle weakness, hyperCKemia muscle bx: myopathic" "" "" "" "" "" "" "" "" "" "neuromuscular disorder" "" "0000325653" "06495" "00435463" "00006" "Familial, autosomal recessive" "" "see paper; ..., birth weight 3.18kg (32nd), length 50.8cm (69th); weight 73.6kg (92nd), height 156.7 cm (17th), OFC 55.4 cm (84th), body mass index 30 kg/m2 (96th); Rhizomelic shortening and milder mesomelic shortening upper and lower extremities, short thumbs, bilateral short 5th fingers, hyperextensible fingers, bilateral middle finger clinodactyly, limited range of motion shoulder joints, chronic joint pain, juvenile idiopathic arthritis, bilateral patellofemoral joint dislocation; prominent forehead, downslanting palpebral fissures, broad nasal bridge, long philtrum; obesity, left-sided headaches, acanthosis nigricans, chronic stage 1 kidney disease, café au lait macule on upper right arm, depressed mood, occasional abdominal pain, dizziness, nausea, left-sided small branchial cleft defect covered with skin without an obvious fistula; no cardiac anomalirs" "" "<00y06m" "" "" "" "" "" "" "RLSDF" "rhizomelic shortening of limbs, dysmorphic features" "" "0000328406" "05121" "00438503" "00006" "Familial, autosomal dominant" "22y" "hyperCKemia muscle biopsy: normal" "" "" "" "" "" "" "" "" "" "muscular dystrophy/myopathy" "" "0000328456" "05121" "00438553" "00006" "Unknown" "22y" "muscle weakness, hyperCKemia muscle biopsy: myopathic" "" "" "" "" "" "" "" "" "" "muscular dystrophy/myopathy" "" "0000331968" "05358" "00442621" "00006" "Unknown" "" "CK 230 IU/L; MRI muscle typical; muscle biopsy dystrophy; weakness facial, cervical, proximal UL and LL; contractures interphalangeal; no scoliosis; cheloids; no entilatory insufficiency" "50y" "59y" "weakness" "" "" "" "" "" "BTHLM1" "Bethlem myopathy" "" "0000331993" "05618" "00442646" "00006" "Familial, autosomal recessive" "37y" "Axial muscle weakness and stiffness, contracture lower back, muscle cramps, short Achilles tendons, wrist laxity and dysphagia; muscle biopsy: presence of internal nuclei; MRI: symmetric atrophy and fatty infiltration of muscles of shoulders, back, pelvic and legs; CK = 108 U/l" "1y" "" "" "" "" "" "" "" "" "Dystrophic myopathy, myalgia, muscle cramps, choking, malignant hyperthermia" "" "0000331994" "05618" "00442647" "00006" "Familial, autosomal recessive" "57y" "Limb girdle muscle weakness; muscle biopsy: increase of fiber diameter variation; CK = 353 U/l" "48y" "" "" "" "" "" "" "" "" "Limb girdle muscle weakness" "" "0000331995" "05618" "00442648" "00006" "Isolated (sporadic)" "7y" "Bulbar, trunk and limb girdle muscle weakness, with contractures of ankles and mild scoliosis; muscle biopsy: type 1 fiber size predominance, mild dystrophic but more pronounced myopathic features with presence of internal nuclei and minicore-like structures" "4y" "" "" "" "" "" "" "" "" "Limb girdle muscle weakness" "" "0000331996" "05618" "00442649" "00006" "Familial, autosomal recessive" "3y" "Axial muscle weakness with hyperlordosis, joint hypermobility, rocker bottom feet, scaphocephaly and mild cognitive retardation; CK = 400 U/l" "1y" "" "" "" "" "" "" "" "" "Delayed motor development, hypotonia, hypermobility, muscle dystrophy, muscle weakness" "" "0000331997" "05618" "00442650" "00006" "Isolated (sporadic)" "27y" "Generalised weakness with facial weakness, scoliosis and decreased respiratory function, gastro-intestinal mobility difficulties" "" "" "" "" "" "" "" "" "" "Muscular dystrophy" "" "0000332069" "05618" "00442722" "00006" "Unknown" "" "Muscle atrophy, fibre type 2 dominance, cataract" "" "" "" "" "" "" "" "" "" "Muscle atrophy" "" "0000332090" "05618" "00442743" "00006" "Unknown" "" "Hypotonia, congenital myopathy, respiratory symptoms, marked contractures of hips, knee and ankles, decreased fetal movements, polyhydramnios" "" "" "" "" "" "" "" "" "" "hypotonia, congenital myopathy" "" "0000332119" "05618" "00442772" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "congenital myopathy" "" "0000332120" "05618" "00442773" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "congenital myopathy" "" "0000334261" "05100" "00445010" "04618" "Familial, autosomal recessive" "" "" "00y" "" "" "" "" "" "" "" "UCDM1" "Ullrich congenital muscular dystrophy" "" "0000334263" "05358" "00445011" "04618" "Familial, autosomal recessive" "49y" "congenital feet deformity\r\nwalking difficulties at 47yo" "47y" "49y" "" "" "" "" "" "" "BTHLM1" "Bethlem myopathy" "" "0000334264" "05358" "00445012" "04618" "Unknown" "" "" "" "" "" "" "" "" "" "" "BTHLM1" "Bethlem myopathy" "" "0000334265" "05358" "00445013" "04618" "Familial, autosomal recessive" "" "" "00y18m" "" "" "" "" "" "" "" "BTHLM1" "Bethlem myopathy" "" "0000334275" "05358" "00445022" "04618" "Unknown" "" "" "00y03m" "00y18m" "" "" "" "" "" "" "UCDM1" "Bethlem myopathy" "" "0000334393" "05358" "00445139" "04618" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "BTHLM1" "Bethlem myopathy" "" "0000334394" "05358" "00445140" "04618" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "BTHLM1" "Bethlem myopathy" "" "0000334395" "05100" "00445141" "04618" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "UCMD1" "Ullrich myopathy" "" "0000334396" "05358" "00445142" "04618" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "BTHLM1" "Bethlem myopathy" "" "0000334397" "05358" "00445143" "04618" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "BTHLM1" "Bethlem myopathy" "" "0000343195" "05121" "00454540" "00006" "Familial, autosomal dominant" "" "Progressive muscle weakness; positive Gowers\' sign; hypertrophy gastrocnemius; limb muscle force -5; 10m walk 5.2 sec; elevated serum CK level (1058 U/L); positive family history" "7y" "" "" "" "" "" "" "" "BTHLM1B" "BMD/DMD" "" "0000343196" "05121" "00454541" "00006" "Familial, autosomal dominant" "" "Easy to fall; positive Gowers\' sign; hypertrophy gastrocnemius; limb muscle force -4; 10m walk 6.98 sec; elevated serum CK level (686 U/L); positive family history" "7y" "" "" "" "" "" "" "" "BTHLM1B" "BMD/DMD" "" "0000343197" "05121" "00454542" "00006" "Familial, autosomal dominant" "" "Progressive muscle weakness; positive Gowers\' sign; hypertrophy gastrocnemius; limb muscle force -5; 10m walk 6.38 sec; elevated serum CK level (501 U/L); positive family history" "15y" "" "" "" "" "" "" "" "BTHLM1B" "BMD/DMD" "" "0000346258" "05611" "00457809" "00006" "Isolated (sporadic)" "25y" "see paper; ..., motor delay; delayed speech/ language development; intellectual disability; behavioral abnormality; normal movement; MRI brain abnormal; no musculature hypotonia; broad forehead; no facial asymmetry; broad nasal tip; thick lower lip vermilion; no pointed chin; ear abnormality; cardiac abnormalities; feeding difficulties; skeletal abnormalities" "" "" "" "" "" "" "" "" "GADEVS" "autoimmune myasthenia gravis, learning disability, facial dysmorphisms, delayed motor development" "" "0000351268" "00198" "00465821" "00006" "Familial, autosomal recessive" "" "see paper; ..., Extreme distal joint laxity, with proximal large joint limitation, gross motor delay with generalized hypotonia, congenital dislocation hip, microcephaly, failure to thrive" "" "" "" "" "" "" "" "" "" "joint laxity" "" "0000351886" "05121" "00466523" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "UCMD1B" "Uhlrich congenital muscular dystrophy" "" "0000351887" "05121" "00466524" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "UCMD1B" "Uhlrich congenital muscular dystrophy" "" "0000351888" "05121" "00466525" "04892" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "UCMD1B" "Uhlrich congenital muscular dystrophy" "" "0000351889" "05121" "00466526" "04892" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "UCMD1B" "Uhlrich congenital muscular dystrophy" "" "0000351890" "05121" "00466527" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "UCMD1B" "Uhlrich congenital muscular dystrophy" "" "0000351891" "05121" "00466528" "04892" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "UCMD1B" "Uhlrich congenital muscular dystrophy" "" "0000351892" "00244" "00466529" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "INT" "intermediate" "" "0000351893" "00244" "00466530" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "INT" "intermediate" "" "0000351894" "00244" "00466531" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "INT/BM" "intermediate/Bethlem myopthy" "" "0000351895" "00244" "00466532" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "INT/BM" "intermediate/Bethlem myopthy" "" "0000351896" "00244" "00466533" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "INT/BM" "intermediate/Bethlem myopthy" "" "0000351897" "00244" "00466534" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "BTHLM1B" "Bethlem myopthy" "" "0000351898" "00244" "00466535" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "BTHLM1B" "Bethlem myopthy" "" "0000351899" "00244" "00466536" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "BTHLM1B" "Bethlem myopthy" "" "0000351900" "00244" "00466537" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "BTHLM1B" "Bethlem myopthy" "" "0000351901" "00244" "00466538" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "BTHLM1B" "Bethlem myopthy" "" "0000351902" "00244" "00466539" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "BTHLM1B" "Bethlem myopthy" "" "0000351903" "00244" "00466540" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "BTHLM1B" "Bethlem myopthy" "" "0000351904" "00244" "00466541" "04892" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BTHLM1B" "Bethlem myopthy" "" "0000352833" "00198" "00467621" "00006" "Familial, autosomal recessive" "4y" "see paper; ... fetal akinesia; decreased fetal movements at intrauterine period, resistant epilepsy, neuromotor developmental delay, severe learninng disability, microcephaly, muscles weakness upper and lower limb, pes equinus varus, spasticity, contracture lower extremities, increased deep tendon reflexes, proximal muscle atrophy, strabismus; MRI hydrocephalus, thin corpus callosum; no cardiac anomalies" "1m" "" "" "" "" "" "" "" "BTHLM1B" "" "" "0000353370" "00244" "00468218" "00006" "Familial, autosomal recessive" "30y" "" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000353377" "00244" "00468225" "00006" "Familial, autosomal recessive" "16y" "" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000353932" "00198" "00468779" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the musculature" "" "0000355596" "07210" "00470702" "00006" "Isolated (sporadic)" "12y" "see paper; ... scoliosis, no other skeletal defects; no symptoms; no physical activity" "" "" "" "" "" "" "" "" "" "severe adolescent idiopathic scoliosis" "" ## Screenings ## Do not remove or alter this header ## ## Count = 677 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000054644" "00054695" "1" "01399" "01399" "2015-11-08 12:06:11" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000054648" "00054699" "1" "01458" "01458" "2015-11-08 12:06:11" "" "" "SEQ" "DNA" "" "" "0000054649" "00054700" "1" "01458" "01458" "2015-11-08 12:06:11" "" "" "SEQ" "DNA" "" "" "0000054652" "00054703" "1" "01458" "01458" "2015-11-08 12:06:11" "" "" "SEQ" "DNA" "" "" "0000054654" "00054705" "1" "01458" "01458" "2015-11-08 12:06:11" "" "" "SEQ" "DNA" "" "" "0000054655" "00054706" "1" "01458" "01458" "2015-11-08 12:06:11" "" "" "SEQ" "DNA" "" "" "0000081005" "00080893" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000081206" "00081094" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000103537" "00103084" "1" "01955" "01955" "2017-04-04 16:24:54" "" "" "SEQ-NG-I" "RNA" "blood" "" "0000104476" "00104005" "1" "00587" "00006" "2017-04-28 08:15:46" "" "" "SEQ-NG" "DNA" "" "" "0000109174" "00108709" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109175" "00108710" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109176" "00108711" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109177" "00108712" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109178" "00108713" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109179" "00108714" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109180" "00108715" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109186" "00108721" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109189" "00108724" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109192" "00108727" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109193" "00108728" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109194" "00108729" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109195" "00108730" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109196" "00108731" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109206" "00108741" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109208" "00108743" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109223" "00108757" "1" "00449" "00006" "2005-09-15 10:35:56" "00006" "2012-11-02 20:40:46" "RT-PCR;SEQ;DHPLC" "DNA;RNA" "" "" "0000109236" "00108770" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:43" "SEQ" "DNA" "" "" "0000109238" "00108772" "1" "00449" "00006" "2005-09-15 10:39:32" "00006" "2012-11-02 20:40:44" "RT-PCR;SEQ;DHPLC" "DNA;RNA" "" "" "0000109239" "00108773" "1" "00449" "00006" "2005-09-14 08:08:01" "00006" "2012-11-02 20:40:46" "RT-PCR;SEQ;DHPLC" "DNA;RNA" "" "" "0000109241" "00108775" "1" "00449" "00006" "2005-09-15 10:42:19" "00006" "2012-11-02 20:40:44" "RT-PCR;SEQ;DHPLC" "DNA;RNA" "" "" "0000109246" "00108780" "1" "00449" "00006" "2005-09-15 13:48:01" "00006" "2012-11-02 20:40:44" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109247" "00108781" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "RT-PCR;HD;SEQ" "DNA;RNA" "" "" "0000109248" "00108782" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109249" "00108783" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "RT-PCR;HD;SEQ" "DNA;RNA" "" "" "0000109250" "00108784" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109252" "00108786" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "SEQ" "DNA" "" "" "0000109253" "00108787" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109254" "00108788" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "RT-PCR;HD;SEQ" "DNA;RNA" "" "" "0000109255" "00108789" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "SEQ" "DNA" "" "" "0000109256" "00108790" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "SSCA;SEQ" "DNA" "" "" "0000109257" "00108791" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "SEQ" "DNA" "" "" "0000109258" "00108792" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "SEQ" "DNA" "" "" "0000109259" "00108793" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "SEQ" "DNA;RNA" "" "" "0000109260" "00108794" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "SEQ" "DNA" "" "" "0000109261" "00108795" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:43" "SEQ" "DNA" "" "" "0000109262" "00108796" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "SEQ" "DNA;RNA" "" "" "0000109263" "00108797" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109264" "00108798" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "SEQ" "DNA" "" "" "0000109265" "00108799" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109266" "00108800" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "SEQ" "DNA" "" "" "0000109267" "00108801" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109268" "00108802" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109269" "00108803" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "SEQ" "DNA" "" "" "0000109270" "00108804" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:44" "SEQ" "DNA;RNA" "" "" "0000109289" "00108823" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109290" "00108824" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109291" "00108825" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109292" "00108826" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109293" "00108827" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109294" "00108828" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109295" "00108829" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109296" "00108830" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109306" "00108840" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109307" "00108841" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109308" "00108842" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109314" "00108848" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109316" "00108850" "1" "00464" "00006" "2009-03-19 19:10:32" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109317" "00108851" "1" "00464" "00006" "2009-04-07 22:28:57" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109322" "00108856" "1" "00464" "00006" "2009-09-01 18:59:29" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109323" "00108857" "1" "00464" "00006" "2009-09-10 21:42:18" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109325" "00108859" "1" "00464" "00006" "2009-10-21 16:56:09" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109328" "00108862" "1" "00464" "00006" "2010-01-20 22:34:03" "00006" "2012-11-02 20:40:45" "PCR;SEQ" "DNA" "" "" "0000109334" "00108868" "1" "00464" "00006" "2010-07-06 18:46:10" "00006" "2012-11-02 20:40:45" "PCR;SEQ" "DNA" "" "" "0000109341" "00108875" "1" "00464" "00006" "2010-10-25 19:06:32" "00006" "2012-11-02 20:40:45" "PCR;SEQ" "DNA" "" "" "0000109343" "00108877" "1" "00006" "00006" "2010-11-12 15:31:17" "00006" "2012-11-02 20:40:45" "arraySNP" "DNA" "" "" "0000109344" "00108878" "1" "00006" "00006" "2010-11-12 16:02:17" "00006" "2012-11-02 20:40:44" "SEQ-NG-S;SEQ" "DNA" "" "" "0000109352" "00108886" "1" "00464" "00006" "2011-09-02 18:49:01" "00006" "2012-11-02 20:40:45" "PCR;SEQ" "DNA" "" "" "0000109353" "00108887" "1" "00464" "00006" "2011-09-02 18:51:49" "00006" "2012-11-02 20:40:45" "PCR;SEQ" "DNA" "" "" "0000109357" "00108891" "1" "00464" "00006" "2011-09-02 20:51:44" "00006" "2012-11-02 20:40:45" "PCR;SEQ" "DNA" "" "" "0000109358" "00108892" "1" "00464" "00006" "2011-09-02 20:53:39" "00006" "2012-11-02 20:40:45" "PCR;SEQ" "DNA" "" "" "0000109361" "00108895" "1" "00464" "00006" "2012-01-06 16:01:23" "00006" "2013-02-01 11:28:57" "PCR;SEQ" "DNA" "" "" "0000109362" "00108896" "1" "00464" "00006" "2012-07-30 21:46:13" "00006" "2012-08-31 12:36:40" "PCR;SEQ" "DNA" "" "" "0000109363" "00108897" "1" "00464" "00006" "2012-08-13 18:33:50" "00006" "2012-08-31 12:39:00" "PCR;SEQ" "DNA" "" "" "0000109366" "00108900" "1" "00464" "00006" "2012-10-16 22:35:45" "00006" "2012-10-19 15:18:37" "PCR;SEQ" "DNA" "" "" "0000109367" "00108901" "1" "00464" "00006" "2012-10-16 23:16:14" "00006" "2012-10-19 15:16:50" "PCR;SEQ" "DNA" "" "" "0000109368" "00108902" "1" "00464" "00006" "2012-10-17 15:07:28" "00006" "2012-10-19 15:19:48" "PCR;SEQ" "DNA" "" "" "0000109374" "00108908" "1" "00464" "00006" "2012-10-19 18:30:57" "00006" "2012-10-23 22:27:30" "PCR;SEQ" "DNA" "" "" "0000109479" "00109013" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109480" "00109014" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109481" "00109015" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109482" "00109016" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109483" "00109017" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109484" "00109018" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109485" "00109019" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109486" "00109020" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109487" "00109021" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109488" "00109022" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109489" "00109023" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109490" "00109024" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109491" "00109025" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109492" "00109026" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109493" "00109027" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109494" "00109028" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109495" "00109029" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109496" "00109030" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109497" "00109031" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109498" "00109032" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109499" "00109033" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109500" "00109034" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109501" "00109035" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109502" "00109036" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109503" "00109037" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109504" "00109038" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109505" "00109039" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109506" "00109040" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109507" "00109041" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109508" "00109042" "1" "00430" "00006" "2012-10-22 12:43:57" "" "" "SEQ" "DNA" "" "" "0000109509" "00109043" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109510" "00109044" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109511" "00109045" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109512" "00109046" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109513" "00109047" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109514" "00109048" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109515" "00109049" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109516" "00109050" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109517" "00109051" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109518" "00109052" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109519" "00109053" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109520" "00109054" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109521" "00109055" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109522" "00109056" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109523" "00109057" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109524" "00109058" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109525" "00109059" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109526" "00109060" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109527" "00109061" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109528" "00109062" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109529" "00109063" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109530" "00109064" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109531" "00109065" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109532" "00109066" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109533" "00109067" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109534" "00109068" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109535" "00109069" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109536" "00109070" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109537" "00109071" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109538" "00109072" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109539" "00109073" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109540" "00109074" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109541" "00109075" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109542" "00109076" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109543" "00109077" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109544" "00109078" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109545" "00109079" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109546" "00109080" "1" "00430" "00006" "2012-10-22 12:43:58" "" "" "SEQ" "DNA" "" "" "0000109659" "00109193" "1" "00464" "00006" "2012-11-20 16:34:39" "00006" "2012-11-20 20:34:19" "PCR;SEQ" "DNA" "" "" "0000109675" "00109209" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109695" "00109229" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109703" "00109237" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109704" "00109238" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109705" "00109239" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109706" "00109240" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109707" "00109241" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109708" "00109242" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109709" "00109243" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109710" "00109244" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109711" "00109245" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109729" "00109263" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109740" "00109274" "1" "00537" "00006" "2013-08-01 16:51:22" "" "" "PCR;SEQ" "DNA" "" "" "0000109741" "00109275" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109742" "00109276" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109754" "00109288" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109755" "00109289" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109756" "00109290" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109757" "00109291" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109760" "00109294" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109764" "00109298" "1" "00006" "00006" "2014-03-21 22:15:31" "00006" "2014-03-21 22:25:28" "arrayCNV;RT-PCR" "DNA;RNA" "" "" "0000109765" "00109299" "1" "00006" "00006" "2014-03-21 22:39:58" "" "" "arrayCNV" "DNA" "" "" "0000109766" "00109300" "1" "00006" "00006" "2014-03-21 22:37:48" "" "" "arrayCNV" "DNA" "" "" "0000109768" "00109302" "1" "00472" "00006" "2014-03-23 13:22:36" "00006" "2014-03-23 13:36:02" "arrayCGH;RT-PCR;SEQ" "DNA;RNA" "" "" "0000109769" "00109303" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109770" "00109304" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109771" "00109305" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109774" "00109308" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109775" "00109309" "1" "00472" "00006" "2014-03-23 13:22:36" "00006" "2014-03-23 13:36:39" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109776" "00109310" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109777" "00109311" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109778" "00109312" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109779" "00109313" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109780" "00109314" "1" "00472" "00006" "2014-03-23 12:57:16" "" "" "SEQ" "DNA" "" "" "0000109782" "00109316" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109783" "00109317" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109784" "00109318" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109786" "00109320" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109787" "00109321" "1" "00472" "00006" "2014-03-23 12:57:16" "" "" "SEQ" "DNA" "" "" "0000109820" "00109354" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109821" "00109355" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109822" "00109356" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109823" "00109357" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109824" "00109358" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109825" "00109359" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109826" "00109360" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109827" "00109361" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109828" "00109362" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109829" "00109363" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109830" "00109364" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109831" "00109365" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109832" "00109366" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109833" "00109367" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109834" "00109368" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109835" "00109369" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109836" "00109370" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109837" "00109371" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109838" "00109372" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109839" "00109373" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109840" "00109374" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109841" "00109375" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109842" "00109376" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109843" "00109377" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109844" "00109378" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109845" "00109379" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109846" "00109380" "1" "00472" "00006" "2014-03-23 13:22:36" "" "" "SEQ" "DNA" "" "" "0000109880" "00109414" "1" "01700" "00006" "2014-04-17 23:57:09" "00006" "2014-04-18 12:41:52" "SEQ-NG-I" "DNA" "" "" "0000109881" "00109415" "1" "02188" "00006" "2014-07-10 09:58:19" "00006" "2014-07-11 16:15:15" "PCR;SEQ" "DNA" "" "" "0000175657" "00174766" "1" "00006" "00006" "2018-08-10 19:10:48" "" "" "SEQ-NG" "DNA" "" "WES" "0000209013" "00207968" "1" "01164" "01164" "2018-12-05 09:44:56" "" "" "SEQ-NG" "DNA" "" "" "0000209968" "00208913" "1" "01164" "01164" "2018-12-20 13:06:23" "" "" "SEQ-NG" "DNA" "" "" "0000220554" "00219483" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220598" "00219527" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220606" "00219535" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220611" "00219540" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220626" "00219555" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220639" "00219568" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220691" "00219620" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220717" "00219646" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220727" "00219656" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220730" "00219659" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220733" "00219662" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220736" "00219665" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220740" "00219669" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220749" "00219678" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220764" "00219693" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220775" "00219704" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220787" "00219716" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220824" "00219753" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220830" "00219759" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220841" "00219770" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220853" "00219782" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220861" "00219790" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220880" "00219809" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220882" "00219811" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220886" "00219815" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220887" "00219816" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220896" "00219825" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220918" "00219847" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220921" "00219850" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220936" "00219865" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220943" "00219872" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220949" "00219878" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220960" "00219889" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220962" "00219891" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220990" "00219919" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220991" "00219920" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220995" "00219924" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221000" "00219929" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221017" "00219946" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221025" "00219954" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221026" "00219955" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221027" "00219956" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221051" "00219980" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221076" "00220005" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221080" "00220009" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221092" "00220021" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221094" "00220023" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221102" "00220031" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221120" "00220049" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221132" "00220061" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221150" "00220079" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221151" "00220080" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221163" "00220092" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221164" "00220093" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221168" "00220097" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221169" "00220098" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221173" "00220102" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221177" "00220106" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221183" "00220112" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221207" "00220136" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221208" "00220137" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221211" "00220140" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221213" "00220142" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221216" "00220145" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221241" "00220170" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221244" "00220173" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221254" "00220183" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221259" "00220188" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221271" "00220200" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221292" "00220221" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221326" "00220255" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221327" "00220256" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221335" "00220264" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221340" "00220269" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221377" "00220306" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221385" "00220314" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221388" "00220317" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221389" "00220318" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221392" "00220321" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221425" "00220354" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221439" "00220368" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221440" "00220369" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221488" "00220417" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221490" "00220419" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221501" "00220430" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221513" "00220442" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221529" "00220458" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221532" "00220461" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221555" "00220484" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221581" "00220510" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221586" "00220515" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221601" "00220530" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221604" "00220533" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221608" "00220537" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221609" "00220538" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221611" "00220540" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221612" "00220541" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221616" "00220545" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221625" "00220554" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221626" "00220555" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221633" "00220562" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221680" "00220609" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221681" "00220610" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221687" "00220616" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221705" "00220634" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221709" "00220638" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221714" "00220643" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221728" "00220657" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221741" "00220670" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221742" "00220671" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221746" "00220675" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221772" "00220701" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221790" "00220719" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221802" "00220731" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221825" "00220754" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221830" "00220759" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221836" "00220765" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221850" "00220779" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221856" "00220785" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221877" "00220806" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221879" "00220808" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221892" "00220821" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221895" "00220824" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221912" "00220841" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221915" "00220844" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221923" "00220852" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221925" "00220854" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221928" "00220857" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221930" "00220859" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221935" "00220864" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221936" "00220865" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221939" "00220868" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221950" "00220879" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221984" "00220913" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221992" "00220921" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221993" "00220922" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221994" "00220923" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221996" "00220925" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222010" "00220939" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222014" "00220943" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222020" "00220949" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222023" "00220952" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222026" "00220955" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222029" "00220958" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222034" "00220963" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222043" "00220972" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222055" "00220984" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222063" "00220992" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222065" "00220994" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222071" "00221000" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222079" "00221008" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222096" "00221025" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222099" "00221028" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222101" "00221030" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222123" "00221052" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222130" "00221059" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222131" "00221060" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222138" "00221067" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222151" "00221080" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222157" "00221086" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222166" "00221095" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222196" "00221125" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222212" "00221141" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222213" "00221142" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222216" "00221145" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222219" "00221148" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222237" "00221166" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222248" "00221177" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222266" "00221195" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222268" "00221197" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222275" "00221204" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222276" "00221205" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222309" "00221238" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222316" "00221245" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222322" "00221251" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222327" "00221256" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222339" "00221268" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222345" "00221274" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222348" "00221277" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222356" "00221285" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222360" "00221289" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222397" "00221326" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222450" "00221379" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222452" "00221381" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222487" "00221416" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222492" "00221421" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222498" "00221427" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222508" "00221437" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222513" "00221442" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222522" "00221451" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222525" "00221454" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222541" "00221470" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222546" "00221475" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222549" "00221478" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222557" "00221486" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222558" "00221487" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222575" "00221504" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222577" "00221506" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222578" "00221507" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222579" "00221508" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222594" "00221523" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222602" "00221531" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222610" "00221539" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222611" "00221540" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222619" "00221548" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222622" "00221551" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222629" "00221558" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222645" "00221574" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222660" "00221589" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222663" "00221592" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222664" "00221593" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222669" "00221598" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222672" "00221601" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222706" "00221635" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222722" "00221651" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222738" "00221667" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222743" "00221672" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222747" "00221676" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222758" "00221687" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222766" "00221695" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222776" "00221705" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222785" "00221714" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222791" "00221720" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222814" "00221743" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222829" "00221758" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222839" "00221768" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222846" "00221775" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222865" "00221794" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222869" "00221798" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222874" "00221803" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222886" "00221815" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222905" "00221834" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222918" "00221847" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222920" "00221849" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222935" "00221864" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222955" "00221884" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222957" "00221886" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222972" "00221901" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222973" "00221902" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222978" "00221907" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222988" "00221917" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223002" "00221931" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223005" "00221934" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223008" "00221937" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223058" "00221987" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223074" "00222003" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223112" "00222041" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223123" "00222052" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223139" "00222068" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223159" "00222088" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223197" "00222126" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223226" "00222155" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223259" "00222188" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223275" "00222204" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223276" "00222205" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223286" "00222215" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223288" "00222217" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223301" "00222230" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223305" "00222234" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223311" "00222240" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223316" "00222245" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223325" "00222254" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223328" "00222257" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223395" "00222324" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223409" "00222338" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223422" "00222351" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223426" "00222355" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223440" "00222369" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223474" "00222403" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223475" "00222404" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223483" "00222412" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223484" "00222413" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223487" "00222416" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223493" "00222422" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223515" "00222444" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223526" "00222455" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223531" "00222460" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223535" "00222464" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223537" "00222466" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223571" "00222500" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223573" "00222502" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223581" "00222510" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223584" "00222513" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223615" "00222544" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223626" "00222555" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223634" "00222563" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223645" "00222574" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223682" "00222611" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223694" "00222623" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223699" "00222628" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223701" "00222630" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223714" "00222643" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223717" "00222646" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223728" "00222657" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223742" "00222671" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223746" "00222675" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223759" "00222688" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223760" "00222689" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223782" "00222711" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000265163" "00264041" "1" "01164" "01164" "2019-09-06 17:29:18" "" "" "SEQ-NG-S" "DNA" "" "" "0000266602" "00265479" "1" "00006" "00006" "2019-09-26 11:09:23" "" "" "SEQ;SEQ-NG" "DNA" "" "CMD gene panel" "0000266603" "00265480" "1" "00006" "00006" "2019-09-26 11:09:23" "" "" "SEQ;SEQ-NG" "DNA" "" "CMD gene panel" "0000266604" "00265481" "1" "00006" "00006" "2019-09-26 11:09:23" "" "" "SEQ;SEQ-NG" "DNA" "" "CMD gene panel" "0000275533" "00274374" "1" "00006" "00006" "2019-12-30 09:59:36" "" "" "SEQ;SEQ-NG" "DNA" "" "69-gene panel muscular disorder" "0000290154" "00288986" "1" "00006" "00006" "2020-02-24 21:34:22" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000290157" "00288989" "1" "00006" "00006" "2020-02-24 21:34:22" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000290181" "00289013" "1" "00006" "00006" "2020-02-24 21:34:22" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000294202" "00293034" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294203" "00293035" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294204" "00293036" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294205" "00293037" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294206" "00293038" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294207" "00293039" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294208" "00293040" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294209" "00293041" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294211" "00293043" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294212" "00293044" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294213" "00293045" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294214" "00293046" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294215" "00293047" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000294216" "00293048" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296358" "00295190" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000297780" "00296670" "1" "01164" "01164" "2020-04-10 08:47:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000297979" "00296869" "1" "01164" "01164" "2020-04-14 14:31:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000306011" "00304882" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000306012" "00304883" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000306906" "00305776" "1" "00006" "00006" "2020-07-02 12:45:49" "" "" "SEQ;SEQ-NG" "DNA" "" "candidate 420-gene panel" "0000306983" "00305853" "1" "00006" "00006" "2020-07-02 12:45:49" "" "" "SEQ;SEQ-NG" "DNA" "" "candidate 420-gene panel" "0000309152" "00308008" "1" "01164" "01164" "2020-08-25 11:36:02" "" "" "SEQ-NG-S" "DNA" "" "" "0000315328" "00314155" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315329" "00314156" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315330" "00314157" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315331" "00314158" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315332" "00314159" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315333" "00314160" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315334" "00314161" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315335" "00314162" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315336" "00314163" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315337" "00314164" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315338" "00314165" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315339" "00314166" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315340" "00314167" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315341" "00314168" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315342" "00314169" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315343" "00314170" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315344" "00314171" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315345" "00314172" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315346" "00314173" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315347" "00314174" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000336554" "00335325" "1" "04016" "04016" "2021-03-04 16:50:59" "" "" "SEQ-NG-R" "DNA" "blood" "" "0000363215" "00361987" "1" "04047" "04047" "2021-04-13 10:39:29" "" "" "SEQ-NG" "DNA" "" "" "0000363222" "00361994" "1" "04047" "04047" "2021-04-13 12:06:39" "" "" "SEQ-NG" "DNA" "" "" "0000375474" "00374280" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375475" "00374281" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375476" "00374282" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375477" "00374283" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375806" "00374612" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375895" "00374701" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375896" "00374702" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000389911" "00388669" "1" "00006" "00006" "2021-11-04 20:51:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000389942" "00388700" "1" "00006" "00006" "2021-11-04 20:51:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000389943" "00388701" "1" "00006" "00006" "2021-11-04 20:51:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000393249" "00392007" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, COL6A2, DYSF, DYSF" "0000393251" "00392009" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, COL6A2, TCAP" "0000398900" "00397662" "1" "03524" "03524" "2021-12-27 16:27:39" "" "" "SEQ-NG" "DNA" "blood" "" "0000399010" "00397768" "1" "00006" "00006" "2021-12-29 09:36:33" "" "" "SEQ;SEQ-NG" "DNA" "" "29-gene panel" "0000399032" "00397790" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399033" "00397791" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399034" "00397792" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399035" "00397793" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399036" "00397794" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399037" "00397795" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399038" "00397796" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399039" "00397797" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399040" "00397798" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399041" "00397799" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399042" "00397800" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399043" "00397801" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399044" "00397802" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399045" "00397803" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399046" "00397804" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399047" "00397805" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399048" "00397806" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399049" "00397807" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399050" "00397808" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399077" "00397835" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000400255" "00399010" "1" "00006" "00006" "2022-01-15 16:40:49" "" "" "SEQ;SEQ-NG" "DNA" "" "166-gene panel" "0000400316" "00399071" "1" "00006" "00006" "2022-01-15 16:40:49" "" "" "SEQ;SEQ-NG" "DNA" "" "166-gene panel" "0000406170" "00404932" "1" "00006" "00006" "2022-03-10 21:18:05" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000410630" "00409362" "1" "00006" "00006" "2022-05-06 20:34:04" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WES" "0000412596" "00411326" "1" "01399" "01399" "2022-06-12 05:38:50" "" "" "IHC;PCR;RT-PCR;SEQ-NG" "DNA;RNA;protein" "blood, muscle, fibroblasts" "WES, WGS, RNAseq and IHC" "0000419655" "00418360" "1" "00006" "00006" "2022-09-28 19:38:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000421234" "00419929" "1" "03361" "03361" "2022-10-26 15:18:24" "03361" "2024-09-30 17:04:41" "SEQ-NG-IT" "DNA" "" "" "0000429726" "00428314" "1" "04448" "04448" "2022-12-31 11:12:45" "" "" "SEQ-NG" "DNA" "blood" "WES" "0000431834" "00430425" "1" "00006" "00006" "2023-01-20 11:39:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000431884" "00430475" "1" "00006" "00006" "2023-01-20 11:39:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000436941" "00435463" "1" "00006" "00006" "2023-07-31 11:07:23" "" "" "SEQ-NG" "DNA" "" "trio WES" "0000439985" "00438503" "1" "00006" "00006" "2023-10-21 14:47:26" "" "" "SEQ;SEQ-NG" "DNA" "" "47-gene panel" "0000440035" "00438553" "1" "00006" "00006" "2023-10-21 14:47:26" "" "" "SEQ;SEQ-NG" "DNA" "" "47-gene panel" "0000444105" "00442621" "1" "00006" "00006" "2023-11-23 09:55:12" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000444130" "00442646" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444131" "00442647" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444132" "00442648" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444133" "00442649" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444134" "00442650" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444206" "00442722" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000444227" "00442743" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000444256" "00442772" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000444257" "00442773" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000446579" "00445010" "1" "04618" "04618" "2023-12-29 15:47:37" "" "" "SEQ-NG" "DNA" "" "" "0000446580" "00445011" "1" "04618" "04618" "2023-12-29 15:54:06" "" "" "SEQ-NG" "DNA" "" "" "0000446581" "00445012" "1" "04618" "04618" "2023-12-29 16:02:14" "" "" "SEQ" "DNA" "" "" "0000446583" "00445013" "1" "04618" "04618" "2023-12-29 16:11:58" "" "" "SEQ-NG" "DNA" "" "" "0000446592" "00445022" "1" "04618" "04618" "2023-12-29 17:16:41" "" "" "SEQ-NG" "DNA" "" "" "0000446710" "00445139" "1" "04618" "00006" "2024-01-04 14:47:30" "" "" "SEQ" "DNA" "" "" "0000446711" "00445140" "1" "04618" "00006" "2024-01-04 14:47:30" "" "" "SEQ" "DNA" "" "" "0000446712" "00445141" "1" "04618" "00006" "2024-01-04 14:47:30" "" "" "SEQ" "DNA" "" "" "0000446713" "00445142" "1" "04618" "00006" "2024-01-04 14:47:30" "" "" "SEQ" "DNA" "" "" "0000446714" "00445143" "1" "04618" "00006" "2024-01-04 14:47:30" "" "" "SEQ" "DNA" "" "" "0000456153" "00454540" "1" "00006" "00006" "2024-09-13 17:19:08" "" "" "MLPA;SEQ-NG" "DNA" "" "" "0000456154" "00454541" "1" "00006" "00006" "2024-09-13 17:19:08" "" "" "MLPA;SEQ-NG" "DNA" "" "" "0000456155" "00454542" "1" "00006" "00006" "2024-09-13 17:19:08" "" "" "MLPA;SEQ-NG" "DNA" "" "" "0000459429" "00457809" "1" "00006" "00006" "2024-11-19 15:05:36" "" "" "SEQ;SEQ-NG" "DNA" "" "trio WES" "0000460169" "00458548" "1" "00454" "00454" "2024-12-18 14:25:12" "" "" "SEQ-NG" "DNA" "blood" "WES" "0000467472" "00465821" "1" "00006" "00006" "2025-06-07 12:17:17" "" "" "arraySNP;SEQ;SEQ-NG" "DNA" "" "WES" "0000468186" "00466523" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468187" "00466524" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468188" "00466525" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468189" "00466526" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468190" "00466527" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468191" "00466528" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468192" "00466529" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468193" "00466530" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468194" "00466531" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468195" "00466532" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468196" "00466533" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468197" "00466534" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468198" "00466535" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468199" "00466536" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468200" "00466537" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468201" "00466538" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468202" "00466539" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468203" "00466540" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468204" "00466541" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000469286" "00467621" "1" "00006" "00006" "2025-10-24 22:46:25" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000469884" "00468218" "1" "00006" "00006" "2025-11-07 14:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000469891" "00468225" "1" "00006" "00006" "2025-11-07 14:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000470447" "00468779" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000472369" "00470702" "1" "00006" "00006" "2025-12-05 11:16:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 327 "{{screeningid}}" "{{geneid}}" "0000054644" "COL6A2" "0000054648" "COL6A2" "0000054649" "COL6A2" "0000054652" "COL6A2" "0000054654" "COL6A1" "0000054654" "COL6A2" "0000054655" "COL6A2" "0000081005" "COL6A2" "0000081206" "COL6A2" "0000109174" "COL6A2" "0000109175" "COL6A2" "0000109176" "COL6A1" "0000109176" "COL6A2" "0000109177" "COL6A2" "0000109178" "COL6A2" "0000109179" "COL6A2" "0000109180" "COL6A2" "0000109186" "COL6A2" "0000109189" "COL6A2" "0000109192" "COL6A2" "0000109193" "COL6A2" "0000109194" "COL6A2" "0000109195" "COL6A2" "0000109196" "COL6A2" "0000109206" "COL6A2" "0000109208" "COL6A2" "0000109223" "COL6A1" "0000109223" "COL6A2" "0000109223" "COL6A3" "0000109236" "COL6A1" "0000109236" "COL6A2" "0000109238" "COL6A1" "0000109238" "COL6A2" "0000109238" "COL6A3" "0000109239" "COL6A1" "0000109239" "COL6A2" "0000109239" "COL6A3" "0000109241" "COL6A1" "0000109241" "COL6A2" "0000109241" "COL6A3" "0000109246" "COL6A2" "0000109247" "COL6A2" "0000109248" "COL6A2" "0000109249" "COL6A2" "0000109250" "COL6A2" "0000109252" "COL6A2" "0000109253" "COL6A2" "0000109254" "COL6A2" "0000109255" "COL6A2" "0000109256" "COL6A2" "0000109257" "COL6A2" "0000109258" "COL6A2" "0000109259" "COL6A2" "0000109260" "COL6A2" "0000109261" "COL6A1" "0000109261" "COL6A2" "0000109262" "COL6A2" "0000109263" "COL6A2" "0000109264" "COL6A2" "0000109265" "COL6A2" "0000109265" "COL6A3" "0000109266" "COL6A2" "0000109267" "COL6A2" "0000109268" "COL6A2" "0000109269" "COL6A2" "0000109270" "COL6A2" "0000109289" "COL6A1" "0000109289" "COL6A2" "0000109289" "COL6A3" "0000109290" "COL6A1" "0000109290" "COL6A2" "0000109290" "COL6A3" "0000109291" "COL6A1" "0000109291" "COL6A2" "0000109291" "COL6A3" "0000109292" "COL6A1" "0000109292" "COL6A2" "0000109292" "COL6A3" "0000109293" "COL6A1" "0000109293" "COL6A2" "0000109293" "COL6A3" "0000109294" "COL6A1" "0000109294" "COL6A2" "0000109294" "COL6A3" "0000109295" "COL6A1" "0000109295" "COL6A2" "0000109295" "COL6A3" "0000109296" "COL6A1" "0000109296" "COL6A2" "0000109296" "COL6A3" "0000109306" "COL6A2" "0000109307" "COL6A2" "0000109308" "COL6A2" "0000109314" "COL6A2" "0000109316" "COL6A2" "0000109317" "COL6A2" "0000109322" "COL6A2" "0000109323" "COL6A2" "0000109325" "COL6A2" "0000109328" "COL6A2" "0000109334" "COL6A2" "0000109341" "COL6A2" "0000109343" "COL6A2" "0000109344" "COL6A1" "0000109344" "COL6A2" "0000109352" "COL6A2" "0000109353" "COL6A2" "0000109357" "COL6A2" "0000109358" "COL6A2" "0000109361" "COL6A2" "0000109362" "COL6A2" "0000109363" "COL6A2" "0000109366" "COL6A2" "0000109367" "COL6A2" "0000109368" "COL6A2" "0000109374" "COL6A2" "0000109479" "COL6A2" "0000109480" "COL6A2" "0000109481" "COL6A2" "0000109482" "COL6A2" "0000109483" "COL6A2" "0000109484" "COL6A2" "0000109485" "COL6A2" "0000109486" "COL6A2" "0000109487" "COL6A2" "0000109488" "COL6A2" "0000109489" "COL6A2" "0000109490" "COL6A2" "0000109491" "COL6A2" "0000109492" "COL6A2" "0000109493" "COL6A2" "0000109494" "COL6A2" "0000109495" "COL6A2" "0000109496" "COL6A2" "0000109497" "COL6A2" "0000109498" "COL6A2" "0000109499" "COL6A2" "0000109500" "COL6A2" "0000109501" "COL6A2" "0000109502" "COL6A2" "0000109503" "COL6A2" "0000109504" "COL6A2" "0000109505" "COL6A2" "0000109506" "COL6A2" "0000109507" "COL6A2" "0000109508" "COL6A2" "0000109509" "COL6A2" "0000109510" "COL6A2" "0000109511" "COL6A2" "0000109512" "COL6A2" "0000109513" "COL6A2" "0000109514" "COL6A2" "0000109515" "COL6A2" "0000109516" "COL6A2" "0000109517" "COL6A2" "0000109518" "COL6A2" "0000109519" "COL6A2" "0000109520" "COL6A2" "0000109521" "COL6A2" "0000109522" "COL6A2" "0000109523" "COL6A2" "0000109524" "COL6A2" "0000109525" "COL6A2" "0000109526" "COL6A2" "0000109527" "COL6A2" "0000109528" "COL6A2" "0000109529" "COL6A2" "0000109530" "COL6A2" "0000109531" "COL6A2" "0000109532" "COL6A2" "0000109533" "COL6A2" "0000109534" "COL6A2" "0000109535" "COL6A2" "0000109536" "COL6A2" "0000109537" "COL6A2" "0000109538" "COL6A2" "0000109539" "COL6A2" "0000109540" "COL6A2" "0000109541" "COL6A2" "0000109542" "COL6A2" "0000109543" "COL6A2" "0000109544" "COL6A2" "0000109545" "COL6A2" "0000109546" "COL6A2" "0000109659" "COL6A2" "0000109675" "COL6A1" "0000109675" "COL6A2" "0000109695" "COL6A1" "0000109695" "COL6A2" "0000109703" "COL6A2" "0000109704" "COL6A2" "0000109705" "COL6A2" "0000109706" "COL6A2" "0000109707" "COL6A2" "0000109708" "COL6A2" "0000109709" "COL6A2" "0000109710" "COL6A2" "0000109710" "COL6A3" "0000109711" "COL6A2" "0000109729" "COL6A2" "0000109740" "COL6A1" "0000109740" "COL6A2" "0000109741" "COL6A2" "0000109742" "COL6A2" "0000109754" "COL6A2" "0000109755" "COL6A2" "0000109756" "COL6A2" "0000109757" "COL6A2" "0000109760" "COL6A2" "0000109764" "COL6A2" "0000109765" "COL6A1" "0000109765" "COL6A2" "0000109766" "COL6A1" "0000109766" "COL6A2" "0000109768" "COL6A2" "0000109769" "COL6A2" "0000109770" "COL6A2" "0000109771" "COL6A2" "0000109774" "COL6A2" "0000109775" "COL6A2" "0000109776" "COL6A2" "0000109777" "COL6A2" "0000109778" "COL6A2" "0000109779" "COL6A1" "0000109779" "COL6A2" "0000109780" "COL6A1" "0000109780" "COL6A2" "0000109782" "COL6A2" "0000109783" "COL6A2" "0000109784" "COL6A2" "0000109786" "COL6A2" "0000109787" "COL6A1" "0000109787" "COL6A2" "0000109820" "COL6A2" "0000109821" "COL6A2" "0000109822" "COL6A2" "0000109823" "COL6A2" "0000109824" "COL6A2" "0000109825" "COL6A2" "0000109826" "COL6A2" "0000109827" "COL6A2" "0000109828" "COL6A2" "0000109829" "COL6A2" "0000109830" "COL6A2" "0000109831" "COL6A2" "0000109832" "COL6A2" "0000109833" "COL6A2" "0000109834" "COL6A2" "0000109835" "COL6A2" "0000109836" "COL6A2" "0000109837" "COL6A2" "0000109838" "COL6A2" "0000109839" "COL6A2" "0000109840" "COL6A2" "0000109841" "COL6A2" "0000109842" "COL6A2" "0000109843" "COL6A2" "0000109844" "COL6A2" "0000109845" "COL6A2" "0000109846" "COL6A2" "0000109880" "COL6A2" "0000109881" "COL6A2" "0000266602" "COL6A2" "0000266603" "COL6A2" "0000266604" "COL6A2" "0000275533" "COL6A2" "0000290154" "COL6A2" "0000290157" "COL6A3" "0000290181" "COL6A2" "0000306906" "COL6A2" "0000306983" "COL6A2" "0000315328" "COL6A2" "0000315329" "COL6A2" "0000315330" "COL6A2" "0000315331" "COL6A2" "0000315332" "COL6A2" "0000315333" "COL6A2" "0000315334" "COL6A2" "0000315335" "COL6A2" "0000315336" "COL6A2" "0000315337" "COL6A2" "0000315338" "COL6A2" "0000315339" "COL6A2" "0000315340" "COL6A2" "0000315341" "COL6A2" "0000315342" "COL6A2" "0000315343" "COL6A2" "0000315344" "COL6A2" "0000315345" "COL6A2" "0000315346" "COL6A2" "0000315347" "COL6A2" "0000336554" "COL6A2" "0000375474" "COL6A2" "0000375475" "COL6A2" "0000375476" "COL6A2" "0000375477" "COL6A2" "0000375806" "LMNA" "0000375895" "COL6A2" "0000375896" "COL6A2" "0000399010" "COL6A2" "0000399032" "COL6A2" "0000399033" "COL6A2" "0000399034" "COL6A2" "0000399035" "COL6A2" "0000399036" "COL6A2" "0000399037" "COL6A2" "0000399038" "COL6A2" "0000399039" "COL6A2" "0000399040" "COL6A2" "0000399041" "COL6A2" "0000399042" "COL6A2" "0000399043" "COL6A2" "0000399044" "COL6A2" "0000399045" "COL6A2" "0000399046" "COL6A2" "0000399047" "COL6A2" "0000399048" "COL6A2" "0000399049" "COL6A2" "0000399050" "COL6A2" "0000399077" "COL6A2" "0000410630" "TOR1AIP1" "0000446581" "COL6A2" "0000446710" "COL6A2" "0000446711" "COL6A2" "0000446712" "COL6A2" "0000446713" "COL6A2" "0000446714" "COL6A2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 1186 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000084594" "1" "90" "21" "47536591" "47536591" "subst" "0" "01399" "COL6A2_000175" "g.47536591G>T" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "De novo" "" "" "0" "" "" "g.46116677G>T" "" "pathogenic (dominant)" "" "0000084598" "1" "90" "21" "47533989" "47533989" "subst" "0" "01458" "COL6A2_000181" "g.47533989T>C" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "De novo" "" "" "0" "" "" "g.46114075T>C" "" "pathogenic" "" "0000084599" "1" "90" "21" "47545418" "47545423" "del" "0" "01458" "COL6A2_000182" "g.47545418_47545423del" "" "{PMID:O\'Grady 2016:27159402}" "" "1855_1860delGTCATC" "" "Germline" "yes" "" "0" "" "" "g.46125504_46125509del" "" "pathogenic" "" "0000084602" "1" "90" "21" "47533971" "47533971" "subst" "0" "01458" "COL6A2_000184" "g.47533971G>A" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "De novo" "" "" "0" "" "" "g.46114057G>A" "" "pathogenic" "" "0000084605" "11" "50" "21" "47532093" "47532093" "subst" "0.00670518" "01458" "COL6A2_000070" "g.47532093G>A" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46112179G>A" "" "VUS" "" "0000084626" "2" "90" "21" "47545179" "47545179" "subst" "0" "01458" "COL6A2_000183" "g.47545179G>T" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46125265G>T" "" "pathogenic" "" "0000084627" "0" "70" "21" "47545696" "47545696" "subst" "0.00101707" "01458" "COL6A2_000016" "g.47545696C>A" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "Germline" "" "" "0" "" "" "g.46125782C>A" "" "likely pathogenic" "" "0000084629" "0" "70" "21" "47532739" "47535785" "" "0" "01458" "COL6A2_000185" "g.(47532739_47535785)?" "" "{PMID:O\'Grady 2016:27159402}" "" "736_801del66" "" "De novo" "" "" "0" "" "" "g.(46112825_46115871)?" "" "likely pathogenic" "" "0000130091" "3" "70" "21" "47546456" "47546456" "subst" "8.12896E-6" "01758" "COL6A2_000186" "g.47546456G>A" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "Germline" "" "" "0" "" "" "g.46126542G>A" "" "likely pathogenic" "ACMG" "0000130292" "3" "70" "21" "47546152" "47546152" "subst" "8.52479E-6" "01758" "COL6A2_000061" "g.47546152G>A" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "Germline" "" "" "0" "" "" "g.46126238G>A" "" "likely pathogenic" "ACMG" "0000166965" "1" "70" "21" "47549283" "47549283" "subst" "0.000802196" "01955" "COL6A2_000187" "g.47549283G>A" "" "MYO-SEQ project, UK" "" "NM_058174.2:c.2635G>A (Glu879Lys)" "The variant is predicted damaging/disease causing in Mutation Taster and FATHMM. It is rare in Exac and found in combination with abother damaging missense mutation in COL6A2. Phenotype consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.46129369G>A" "" "likely pathogenic" "" "0000166966" "2" "70" "21" "47552005" "47552005" "subst" "0.00140527" "01955" "COL6A2_000130" "g.47552005C>T" "" "MYO-SEQ project" "" "" "The variant is predicted damaging/disease causing in Polyphen and FATHMM. It is rare in Exac and found in combination with abother damaging missense mutation in COL6A2. However reported as likely benign in ClinVar. Phenotype consistent with COLVI myopathy" "Germline" "?" "" "0" "" "" "g.46132091C>T" "" "likely pathogenic" "" "0000169217" "0" "70" "21" "47536717" "47536717" "subst" "0.000317618" "00587" "COL6A2_000193" "g.47536717G>A" "" "{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}" "" "NM_001849.3(COL6A2):c.988G>A p.(Asp330Asn)" "variant could not be associated with disease phenotype" "Germline" "" "" "0" "" "" "g.46116803G>A" "" "likely pathogenic" "" "0000175275" "0" "70" "21" "47546005" "47546005" "subst" "0" "01955" "COL6A2_000199" "g.47546005T>C" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. It is not present in EXAC. Phenotype consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.46126091T>C" "" "likely pathogenic" "" "0000175276" "0" "70" "21" "47545921" "47545921" "subst" "0" "01955" "COL6A2_000198" "g.47545921C>T" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. It is not present in EXAC. Phenotype consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.46126007C>T" "" "likely pathogenic" "" "0000175277" "0" "70" "21" "47545427" "47545427" "subst" "0" "01955" "COL6A2_000196" "g.47545427G>A" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. It is not present in EXAC or other control populations. Phenotype consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.46125513G>A" "" "likely pathogenic" "" "0000175278" "1" "70" "21" "47533988" "47533988" "del" "0" "01955" "COL6A2_000192" "g.47533988del" "" "MYO-SEQ project, UK" "" "47533986AG>A" "The variant is a very rare frameshift mutation not present in EXAC or other control populations. Phenotype consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.46114074del" "" "likely pathogenic" "" "0000175279" "0" "70" "21" "47539016" "47539016" "subst" "2.48511E-5" "01955" "COL6A2_000195" "g.47539016G>A" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. Phenotype consistent with COLVI myopathy. Also has variant in another cadidate gene." "Germline" "?" "" "0" "" "" "g.46119102G>A" "" "likely pathogenic" "" "0000175280" "0" "70" "21" "47535786" "47535786" "subst" "0" "01955" "COL6A2_000050" "g.47535786G>T" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. It is not present in EXAC or other control populations. Phenotype consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.46115872G>T" "" "likely pathogenic" "" "0000175281" "0" "70" "21" "47545502" "47545502" "subst" "0" "01955" "COL6A2_000197" "g.47545502C>G" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging in mutation taster and FATHMM, possibly damaging in Polyphen. It is not present in EXAC and other control populations." "Unknown" "?" "" "0" "" "" "g.46125588C>G" "" "likely pathogenic" "" "0000175282" "0" "70" "21" "47538592" "47538592" "subst" "0" "01955" "COL6A2_000188" "g.47538592T>G" "" "MYO-SEQ project, UK" "" "" "Novel essential splice site mutation predicted damaging in mutation taster. Phenotype consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.46118678T>G" "" "likely pathogenic" "" "0000175283" "0" "70" "21" "47535960" "47535960" "subst" "0" "01955" "COL6A2_000194" "g.47535960G>T" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. It is not present in EXAC or other control populations. Phenotype consistent with COLVI myopathy." "Germline" "" "" "0" "" "" "g.46116046G>T" "" "likely pathogenic" "" "0000175284" "21" "70" "21" "47536681" "47536681" "subst" "0" "01955" "COL6A2_000191" "g.47536681C>G" "" "MYO-SEQ project, UK" "" "" "" "Germline" "yes" "" "0" "" "" "g.46116767C>G" "" "likely pathogenic" "" "0000175285" "0" "70" "21" "47536681" "47536681" "subst" "0" "01955" "COL6A2_000191" "g.47536681C>G" "" "MYO-SEQ project, UK" "" "" "" "Germline" "yes" "" "0" "" "" "g.46116767C>G" "" "likely pathogenic" "" "0000175286" "0" "70" "21" "47545827" "47545827" "subst" "4.06395E-6" "01955" "COL6A2_000017" "g.47545827G>A" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. It is not present in EXAC. Phenotype consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.46125913G>A" "" "likely pathogenic" "" "0000175287" "1" "70" "21" "47545704" "47545704" "subst" "0" "01955" "COL6A2_000066" "g.47545704C>T" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. It is not present in EXAC or other control populations. Present with another rare damaging missense mutation." "Germline" "" "" "0" "" "" "g.46125790C>T" "" "likely pathogenic" "" "0000175288" "1" "70" "21" "47545697" "47545697" "subst" "0" "01955" "COL6A2_000190" "g.47545697A>G" "" "MYO-SEQ project, UK" "" "" "The variant is predicted disease causing in mutation taster. Not present in EXAC. Found as a compound heterozygous with another damaging COL6A2 variant. Atypical phenotype for Bethlem but MRI is characteristic of Bethlem." "Germline" "?" "" "0" "" "" "g.46125783A>G" "" "likely pathogenic" "" "0000175289" "0" "70" "21" "47545921" "47545921" "subst" "0" "01955" "COL6A2_000198" "g.47545921C>T" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or diseases causing in Polyphen, Mutation Taster and FATHMM. It is not present in EXAC. Variant has already been decribed associated with COLVI myopathy. http://www.ncbi.nlm.nih.gov/pubmed/24271325, see Suppl. Table 2. Atypical with no contractures and slow progression since childhood." "Germline" "?" "" "0" "" "" "g.46126007C>T" "" "likely pathogenic" "" "0000175292" "2" "70" "21" "47546145" "47546145" "subst" "0" "01955" "COL6A2_000200" "g.47546145T>C" "" "MYO-SEQ project, UK" "" "" "The variant is predicted disease causing in Polyphen, mutation taster and FATTHM. Not present in EXAC. Found as a compound heterozygous with another damaging COL6A2 variant. Atypical Bethlem phenotype but typical MRI." "Germline" "?" "" "0" "" "" "g.46126231T>C" "" "likely pathogenic" "" "0000175293" "0" "70" "21" "47532165" "47532165" "subst" "2.04703E-5" "01955" "COL6A2_000202" "g.47532165C>T" "" "MYO-SEQ project, UK" "" "" "The variant is presdicted damaging in both polyphen and mutation taster. Appears twice in Exac. Found in combination with two COL6A1 ESS mutations." "Germline" "?" "" "0" "" "" "g.46112251C>T" "" "likely pathogenic" "" "0000175294" "0" "50" "21" "47546158" "47546158" "subst" "1.70993E-5" "01955" "COL6A2_000189" "g.47546158G>T" "" "MYO-SEQ project, UK" "" "" "" "Germline" "?" "" "0" "" "" "g.46126244G>T" "" "VUS" "" "0000175295" "0" "50" "21" "47552005" "47552005" "subst" "0.00140527" "01955" "COL6A2_000130" "g.47552005C>T" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging by polyphen and FATHMM although predicted as a polymorphism in Mutation taster and likely benign in ClinVar. Found in combination with two other variants- a damaging missense and an essential splice site. Present in Exac." "Germline" "?" "" "0" "" "" "g.46132091C>T" "" "VUS" "" "0000175296" "2" "70" "21" "47544833" "47544833" "subst" "0.00190503" "01955" "COL6A2_000142" "g.47544833C>T" "" "MYO-SEQ project, UK" "" "1769_1770delCGinsTG" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. Phenotype consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.46124919C>T" "" "likely pathogenic" "" "0000175297" "2" "70" "21" "47552224" "47552224" "subst" "0" "01955" "COL6A2_000201" "g.47552224G>C" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen and Mutation Taster but tolerated in FATHMM. It is not present in EXAC or other control populations. Present with another rare damaging missense mutation." "Germline" "" "" "0" "" "" "g.46132310G>C" "" "likely pathogenic" "" "0000175350" "10" "90" "21" "47538518" "47538518" "subst" "0" "00449" "COL6A2_000029" "g.47538518A>G" "" "{PMID:Lucarini 2005:16075202}, {OMIM120240:0007}" "" "" "multiple misspliced transcripts, normal mRNA, exon 13 skipped; protein domain TH" "Germline" "" "" "0" "" "" "g.46118604A>G" "" "pathogenic" "" "0000175351" "11" "90" "21" "47538562" "47538562" "dup" "0" "00006" "COL6A2_000006" "g.47538562dup" "" "{PMID:Camacho 2001:11381124}, {OMIM120240:0002}" "" "" "0/100 control chromosomes; protein domain TH" "Germline" "" "" "0" "" "" "g.46118648dup" "" "pathogenic" "" "0000175352" "1" "90" "21" "47539701" "47539701" "subst" "0" "00006" "COL6A2_000007" "g.47539701G>C" "" "{PMID:Ishikawa 2002:12297580}" "" "" "0/100 control chromosomes; partial insertion of intron14 in COL6A2; protein domain TH" "Germline" "" "" "0" "" "" "g.46119787G>C" "" "pathogenic" "" "0000175353" "11" "90" "21" "47545179" "47545179" "subst" "0" "00006" "COL6A2_000012" "g.47545179G>A" "" "{PMID:Camacho 2001:11381124}, {OMIM120240:0004}" "" "" "protein domain TH/C1" "Germline" "" "" "0" "" "" "g.46125265G>A" "" "pathogenic" "" "0000175354" "1" "90" "21" "47541499" "47541524" "del" "0" "00006" "COL6A2_000009" "g.47541499_47541524del" "" "{PMID:Higuchi 2001:11506412}, {OMIM120240:0006}" "" "731-756del" "protein domain TH" "Germline" "" "" "0" "" "" "g.46121585_46121610del" "" "pathogenic" "" "0000175356" "1" "90" "21" "47542428" "47542428" "subst" "0" "00006" "COL6A2_000010" "g.47542428G>C" "1/78" "{PMID:Lampe 2005:15689448}" "" "1590G>C" "protein domain TH" "Germline" "" "" "0" "" "" "g.46122514G>C" "" "pathogenic" "" "0000175357" "11" "90" "21" "47546003" "47546008" "del" "0" "00006" "COL6A2_000018" "g.47546003_47546008del" "" "{PMID:Ishikawa 2004:14981181}" "" "" "0/100 control chromosomes; protein domain C1" "Germline" "" "" "0" "" "" "g.46126089_46126094del" "" "pathogenic" "" "0000175358" "1" "90" "21" "0" "0" "" "0" "00006" "COL6A2_000008" "g.?" "" "{PMID:Camacho 2001:11381124}, {OMIM120240:0003}" "DdeI" "" "protein domain TH" "De novo" "" "" "0" "" "" "" "" "pathogenic" "" "0000175359" "1" "90" "21" "47545376" "47545376" "subst" "4.06977E-6" "00006" "COL6A2_000014" "g.47545376C>G" "" "{PMID:Lampe 2005:15689448}" "" "" "protein domain TH/C1" "Germline" "" "" "0" "" "" "g.46125462C>G" "" "pathogenic" "" "0000175360" "1" "90" "21" "47545423" "47545423" "subst" "0" "00006" "COL6A2_000015" "g.47545423G>A" "" "{PMID:Scacheri 2002:11865138}, {OMIM120240:0005}" "TaqI" "" "0/190 control chromosomes; protein domain TH/C1" "Germline" "" "" "0" "" "" "g.46125509G>A" "" "pathogenic" "" "0000175361" "1" "90" "21" "47545696" "47545696" "subst" "0.00101707" "00006" "COL6A2_000016" "g.47545696C>A" "1/77" "{PMID:Lampe 2005:15689448}" "" "" "missplicing, partial loss of exon26; protein domain C1" "Germline" "" "" "0" "" "" "g.46125782C>A" "" "pathogenic" "" "0000175362" "1" "90" "21" "47545827" "47545827" "subst" "4.06395E-6" "00006" "COL6A2_000017" "g.47545827G>A" "" "{PMID:Lampe 2005:15689448}" "" "" "no confirmatory data; protein domain C1" "Germline" "" "" "0" "" "" "g.46125913G>A" "" "pathogenic" "" "0000175363" "1" "90" "21" "47546048" "47546048" "subst" "0" "00006" "COL6A2_000019" "g.47546048C>G" "" "{PMID:Lampe 2005:15689448}" "" "" "protein domain C1" "Germline" "" "" "0" "" "" "g.46126134C>G" "" "pathogenic" "" "0000175364" "1" "90" "21" "47546058" "47546058" "subst" "4.1029E-6" "00006" "COL6A2_000020" "g.47546058T>C" "1/78" "{PMID:Lampe 2005:15689448}" "" "" "individuals, no confirmatory data; protein domain C1" "Germline" "" "" "0" "" "" "g.46126144T>C" "" "pathogenic" "" "0000175366" "11" "90" "21" "47546449" "47546492" "delins" "0" "00006" "COL6A2_000023" "g.47546449_47546492delinsN[33]" "" "{PMID:Lampe 2005:15689448}" "" "" "33 bp insertion; protein domain C1/C2" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000175367" "11" "90" "21" "47552095" "47552097" "del" "0" "00006" "COL6A2_000028" "g.47552095_47552097del" "" "{PMID:Baker 2005:15563506}" "" "" "protein domain C2" "Germline" "" "" "0" "" "" "g.46132181_46132183del" "" "pathogenic" "" "0000175368" "1" "90" "21" "47551964" "47551964" "subst" "0.00253908" "00006" "COL6A2_000025" "g.47551964G>A" "1/75" "{PMID:Lampe 2005:15689448}" "" "" "individuals, no confirmatory data; protein domain C2" "Germline" "" "" "0" "" "" "g.46132050G>A" "" "pathogenic" "" "0000175370" "1" "90" "21" "47552069" "47552070" "dup" "0" "00006" "COL6A2_000027" "g.47552069_47552070dup" "1/75" "{PMID:Lampe 2005:15689448}" "" "" "protein domain C2" "Germline" "" "" "0" "" "" "g.46132155_46132156dup" "" "pathogenic" "" "0000175371" "21" "90" "21" "47534618" "47535949" "del" "0" "00006" "COL6A2_000000" "g.47534618_47535949del" "" "{PMID:Baker 2005:15563506}" "" "" "1332 bp deletion; protein domain TH" "Germline" "" "" "0" "" "" "g.46114704_46116035del" "" "pathogenic" "" "0000175372" "1" "90" "21" "47535795" "47535795" "subst" "0" "00006" "COL6A2_000003" "g.47535795G>A" "" "{PMID:Jobsis 1996:08782832}" "StyI" "898G>A" "0/100 control chromosomes; protein domain TH" "Germline" "" "" "0" "" "" "g.46115881G>A" "" "pathogenic" "" "0000175373" "1" "90" "21" "47535831" "47535831" "subst" "0" "00006" "COL6A2_000004" "g.47535831G>A" "1/78" "{PMID:Lampe 2005:15689448}" "" "" "protein domain TH" "Germline" "" "" "0" "" "" "g.46115917G>A" "" "pathogenic" "" "0000175374" "1" "90" "21" "47536682" "47536682" "subst" "0" "00006" "COL6A2_000005" "g.47536682A>G" "1/78" "{PMID:Lampe 2005:15689448}" "" "" "protein domain TH" "Germline" "" "" "0" "" "" "g.46116768A>G" "" "pathogenic" "" "0000175410" "1" "90" "21" "47535795" "47535795" "subst" "0" "00006" "COL6A2_000003" "g.47535795G>A" "" "{PMID:Jobsis 1996:08782832}" "StyI" "898G>A" "0/100 control chromosomes; protein domain TH" "Germline" "" "" "0" "" "" "g.46115881G>A" "" "pathogenic" "" "0000175411" "1" "90" "21" "47537312" "47537312" "subst" "0" "00006" "COL6A2_000032" "g.47537312A>G" "" "{PMID:Baker 2007:17886299}" "" "" "" "Germline" "" "" "0" "" "" "g.46117398A>G" "" "pathogenic" "" "0000175412" "0" "90" "21" "47552201" "47552201" "subst" "0.00252178" "00006" "COL6A2_000041" "g.47552201C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.46132287C>T" "" "pathogenic" "" "0000175418" "1" "90" "21" "47534618" "47535949" "del" "0" "00006" "COL6A2_000000" "g.47534618_47535949del" "" "{PMID:Baker 2005:15563506}" "" "HGVS c.[=/801+631_882del]" "1332 bp deletion; protein domain TH" "Germline" "" "" "0" "" "" "g.46114704_46116035del" "" "pathogenic" "" "0000175420" "0" "50" "21" "47545423" "47545423" "subst" "0" "00464" "COL6A2_000015" "g.47545423G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46125509G>A" "" "VUS" "" "0000175421" "0" "70" "21" "47535920" "47535920" "subst" "0" "00464" "COL6A2_000043" "g.47535920C>G" "" "" "" "" "absent type VI collagen" "Germline" "" "" "0" "" "" "g.46116006C>G" "" "likely pathogenic" "" "0000175426" "0" "70" "21" "47535786" "47535786" "subst" "0" "00464" "COL6A2_000050" "g.47535786G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46115872G>T" "" "likely pathogenic" "" "0000175427" "0" "70" "21" "47537368" "47537368" "subst" "0" "00464" "COL6A2_000051" "g.47537368G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46117454G>C" "" "likely pathogenic" "" "0000175429" "0" "70" "21" "47532418" "47532422" "del" "4.15014E-6" "00464" "COL6A2_000052" "g.47532418_47532422del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46112504_46112508del" "" "likely pathogenic" "" "0000175432" "0" "70" "21" "47544835" "47544835" "del" "0" "00464" "COL6A2_000053" "g.47544835del" "" "" "" "" "mildly reduced staining of type VI collagen" "Germline" "" "" "0" "" "" "g.46124921del" "" "likely pathogenic" "" "0000175438" "0" "70" "21" "47536291" "47536291" "subst" "0" "00464" "COL6A2_000054" "g.47536291G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46116377G>A" "" "likely pathogenic" "" "0000175445" "21" "70" "21" "47535786" "47535786" "subst" "0" "00464" "COL6A2_000055" "g.47535786G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46115872G>A" "" "likely pathogenic" "" "0000175447" "1" "90" "21" "0" "0" "" "0" "00006" "COL6A2_000000" "g.?" "" "L Medne ASHG 2010 A1669" "" "" "69 Kb deletion" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000175456" "11" "70" "21" "47535968" "47535968" "subst" "0" "00464" "COL6A2_000058" "g.47535968G>A" "" "" "" "" "father appears mosaic for this variant" "Germline" "" "" "0" "" "" "g.46116054G>A" "" "likely pathogenic" "" "0000175457" "0" "70" "21" "47545904" "47545905" "del" "0" "00464" "COL6A2_000059" "g.47545904_47545905del" "" "" "" "2175_2176delGT" "" "Germline" "" "" "0" "" "" "g.46125990_46125991del" "" "likely pathogenic" "" "0000175461" "0" "50" "21" "47545467" "47545469" "del" "0" "00464" "COL6A2_000060" "g.47545467_47545469del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46125553_46125555del" "" "VUS" "" "0000175462" "0" "70" "21" "47546152" "47546152" "subst" "8.52479E-6" "00464" "COL6A2_000061" "g.47546152G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46126238G>A" "" "likely pathogenic" "" "0000175465" "11" "90" "21" "47545690" "47545690" "subst" "0.000106823" "00464" "COL6A2_000056" "g.47545690G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic" "" "0000175466" "10" "70" "21" "47546152" "47546152" "subst" "8.52479E-6" "00464" "COL6A2_000061" "g.47546152G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46126238G>A" "" "likely pathogenic" "" "0000175467" "11" "70" "21" "47551903" "47551903" "dup" "0" "00464" "COL6A2_000063" "g.47551903dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46131989dup" "" "likely pathogenic" "" "0000175470" "10" "70" "21" "47552411" "47552412" "del" "0" "00464" "COL6A2_000064" "g.47552411_47552412del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46132497_46132498del" "" "likely pathogenic" "" "0000175471" "0" "70" "21" "47541507" "47541507" "subst" "4.07528E-6" "00464" "COL6A2_000065" "g.47541507G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46121593G>A" "" "likely pathogenic" "" "0000175472" "0" "70" "21" "47535785" "47535785" "subst" "0" "00464" "COL6A2_000067" "g.47535785G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46115871G>C" "" "likely pathogenic" "" "0000175478" "10" "70" "21" "47536563" "47536564" "del" "0" "00464" "COL6A2_000068" "g.47536563_47536564del" "" "" "" "928-2_-1del" "" "Germline" "" "" "0" "" "" "g.46116649_46116650del" "" "likely pathogenic" "" "0000175583" "0" "50" "21" "47531859" "47531859" "subst" "0.0216135" "00430" "COL6A2_000069" "g.47531859G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46111945G>A" "" "VUS" "" "0000175584" "0" "50" "21" "47532093" "47532093" "subst" "0.00670518" "00430" "COL6A2_000070" "g.47532093G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46112179G>A" "" "VUS" "" "0000175585" "0" "50" "21" "47532287" "47532287" "subst" "0.00338552" "00430" "COL6A2_000071" "g.47532287C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46112373C>T" "" "VUS" "" "0000175586" "0" "10" "21" "47532440" "47532440" "subst" "0.0854267" "00430" "COL6A2_000072" "g.47532440C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46112526C>T" "" "benign" "" "0000175587" "0" "10" "21" "47532456" "47532456" "subst" "0.0211517" "00430" "COL6A2_000031" "g.47532456G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000175588" "0" "10" "21" "47532500" "47532500" "subst" "0.0388318" "00430" "COL6A2_000073" "g.47532500C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46112586C>T" "" "benign" "" "0000175589" "0" "10" "21" "47532520" "47532520" "subst" "0.00979523" "00430" "COL6A2_000074" "g.47532520G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46112606G>A" "" "benign" "" "0000175590" "0" "10" "21" "47532536" "47532536" "subst" "0.0796393" "00430" "COL6A2_000075" "g.47532536C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46112622C>T" "" "benign" "" "0000175591" "0" "50" "21" "47534032" "47534032" "subst" "0" "00430" "COL6A2_000076" "g.47534032C>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46114118C>A" "" "VUS" "" "0000175592" "0" "10" "21" "47535816" "47535816" "subst" "0.00223085" "00430" "COL6A2_000077" "g.47535816G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46115902G>A" "" "benign" "" "0000175593" "0" "10" "21" "47536546" "47536546" "subst" "0.504732" "00430" "COL6A2_000078" "g.47536546C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46116632C>T" "" "benign" "" "0000175594" "0" "50" "21" "47536676" "47536676" "subst" "4.06947E-6" "00430" "COL6A2_000079" "g.47536676C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46116762C>T" "" "VUS" "" "0000175595" "0" "50" "21" "47537872" "47537872" "subst" "0.00330313" "00430" "COL6A2_000080" "g.47537872C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46117958C>T" "" "VUS" "" "0000175596" "0" "10" "21" "47537882" "47537882" "subst" "0.529713" "00430" "COL6A2_000081" "g.47537882G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46117968G>A" "" "benign" "" "0000175597" "0" "10" "21" "47538960" "47538960" "subst" "0.784449" "00430" "COL6A2_000082" "g.47538960G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46119046G>A" "" "benign" "" "0000175598" "0" "50" "21" "47539015" "47539015" "subst" "0.0015335" "00430" "COL6A2_000083" "g.47539015C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46119101C>T" "" "VUS" "" "0000175599" "0" "10" "21" "47539790" "47539790" "subst" "0.810351" "00430" "COL6A2_000084" "g.47539790A>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46119876A>G" "" "benign" "" "0000175600" "0" "10" "21" "47540421" "47540421" "subst" "0.177793" "00430" "COL6A2_000085" "g.47540421T>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46120507T>C" "" "benign" "" "0000175601" "0" "10" "21" "47541553" "47541553" "subst" "0.12044" "00430" "COL6A2_000086" "g.47541553A>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46121639A>G" "" "benign" "" "0000175602" "0" "10" "21" "47541986" "47541986" "subst" "0.120485" "00430" "COL6A2_000087" "g.47541986T>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46122072T>C" "" "benign" "" "0000175603" "0" "50" "21" "47542052" "47542052" "subst" "0.00881776" "00430" "COL6A2_000048" "g.47542052C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46122138C>T" "" "VUS" "" "0000175604" "0" "10" "21" "47542378" "47542378" "subst" "0.0629885" "00430" "COL6A2_000088" "g.47542378C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46122464C>T" "" "benign" "" "0000175605" "0" "10" "21" "47542779" "47542779" "subst" "0.12067" "00430" "COL6A2_000089" "g.47542779C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46122865C>T" "" "benign" "" "0000175606" "0" "50" "21" "47542841" "47542841" "subst" "0.000150578" "00430" "COL6A2_000090" "g.47542841A>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46122927A>G" "" "VUS" "" "0000175607" "0" "10" "21" "47542861" "47542861" "subst" "0.814543" "00430" "COL6A2_000091" "g.47542861A>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46122947A>G" "" "benign" "" "0000175608" "0" "10" "21" "47544528" "47544528" "subst" "0.0632757" "00430" "COL6A2_000092" "g.47544528G>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46124614G>T" "" "benign" "" "0000175609" "0" "10" "21" "47544541" "47544541" "subst" "0.493105" "00430" "COL6A2_000093" "g.47544541C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46124627C>G" "" "benign" "" "0000175610" "0" "10" "21" "47544662" "47544662" "subst" "0.0960528" "00430" "COL6A2_000094" "g.47544662A>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46124748A>G" "" "benign" "" "0000175611" "0" "10" "21" "47544769" "47544769" "subst" "0.0826357" "00430" "COL6A2_000095" "g.47544769A>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46124855A>G" "" "benign" "" "0000175612" "0" "50" "21" "47544834" "47544834" "subst" "8.1408E-5" "00430" "COL6A2_000096" "g.47544834G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46124920G>A" "" "VUS" "" "0000175613" "0" "10" "21" "47544838" "47544838" "subst" "0.0741047" "00430" "COL6A2_000097" "g.47544838G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46124924G>A" "" "benign" "" "0000175614" "0" "10" "21" "47545155" "47545155" "subst" "0.802759" "00430" "COL6A2_000098" "g.47545155A>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125241A>G" "" "benign" "" "0000175615" "0" "50" "21" "47545243" "47545243" "del" "0.0289229" "00430" "COL6A2_000099" "g.47545243del" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125329del" "" "VUS" "" "0000175616" "0" "10" "21" "47545346" "47545346" "subst" "0.0742784" "00430" "COL6A2_000100" "g.47545346C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125432C>T" "" "benign" "" "0000175617" "0" "10" "21" "47545376" "47545376" "dup" "0" "00430" "COL6A2_000101" "g.47545376dup" "" "" "" "1817-3dupC" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125462dup" "" "benign" "" "0000175618" "0" "50" "21" "47545676" "47545676" "subst" "0.0557587" "00430" "COL6A2_000102" "g.47545676G>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125762G>C" "" "VUS" "" "0000175619" "0" "50" "21" "47545696" "47545696" "dup" "0" "00430" "COL6A2_000103" "g.47545696dup" "" "" "" "1970-3dupC" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125782dup" "" "VUS" "" "0000175620" "0" "50" "21" "47545727" "47545727" "subst" "0" "00430" "COL6A2_000104" "g.47545727C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125813C>G" "" "VUS" "" "0000175621" "0" "10" "21" "47545768" "47545768" "subst" "0.492076" "00430" "COL6A2_000035" "g.47545768G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000175622" "0" "10" "21" "47545823" "47545823" "subst" "0.491234" "00430" "COL6A2_000036" "g.47545823G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000175623" "0" "10" "21" "47545826" "47545826" "subst" "0.49123" "00430" "COL6A2_000037" "g.47545826C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000175624" "0" "50" "21" "47545842" "47545842" "subst" "0" "00430" "COL6A2_000105" "g.47545842T>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125928T>C" "" "VUS" "" "0000175625" "0" "10" "21" "47545865" "47545865" "subst" "0.000800566" "00430" "COL6A2_000106" "g.47545865C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125951C>T" "" "benign" "" "0000175626" "0" "10" "21" "47545889" "47545889" "subst" "0.00426333" "00430" "COL6A2_000107" "g.47545889C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125975C>G" "" "benign" "" "0000175627" "0" "10" "21" "47545892" "47545892" "subst" "0.00807094" "00430" "COL6A2_000108" "g.47545892G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125978G>A" "" "benign" "" "0000175628" "0" "10" "21" "47545913" "47545913" "subst" "0.389208" "00430" "COL6A2_000038" "g.47545913G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46125999G>A" "" "benign" "" "0000175629" "0" "10" "21" "47546382" "47546382" "subst" "0.0738001" "00430" "COL6A2_000109" "g.47546382C>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46126468C>A" "" "benign" "" "0000175630" "0" "50" "21" "47546395" "47546400" "" "0" "00430" "COL6A2_000110" "g.[47546395_47546399;47546399_47546400insA]" "" "" "" "2423-18_2423-17insCGGCCCGGCCCGGCCA" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000175631" "0" "50" "21" "47546395" "47546399" "" "0" "00430" "COL6A2_000111" "g.47546395_47546399" "" "" "" "2423-18_2423-17insCGGCCCGGCCCGGCC" "from website {DBsub-Emory}\r\nVariant Error [ESYNTAX]: This genomic variant has an error (char 32: end of input). Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000175632" "0" "10" "21" "47551833" "47551833" "subst" "0.552288" "00430" "COL6A2_000112" "g.47551833C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46131919C>T" "" "benign" "" "0000175633" "0" "10" "21" "47551890" "47551890" "subst" "0.000207947" "00430" "COL6A2_000113" "g.47551890G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46131976G>A" "" "benign" "" "0000175634" "0" "10" "21" "47551923" "47551923" "subst" "0.000369007" "00430" "COL6A2_000114" "g.47551923C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132009C>T" "" "benign" "" "0000175635" "0" "90" "21" "47551964" "47551964" "subst" "0.00253908" "00430" "COL6A2_000025" "g.47551964G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132050G>A" "" "pathogenic" "" "0000175636" "0" "50" "21" "47551988" "47551988" "subst" "0.000300171" "00430" "COL6A2_000115" "g.47551988G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132074G>A" "" "VUS" "" "0000175637" "0" "50" "21" "47552034" "47552034" "subst" "2.71553E-5" "00430" "COL6A2_000116" "g.47552034C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132120C>T" "" "VUS" "" "0000175638" "0" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00430" "COL6A2_000039" "g.47552103G>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000175639" "0" "10" "21" "47552130" "47552130" "subst" "0.0980658" "00430" "COL6A2_000040" "g.47552130A>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132216A>G" "" "benign" "" "0000175640" "0" "10" "21" "47552175" "47552175" "subst" "0.00507529" "00430" "COL6A2_000117" "g.47552175C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132261C>T" "" "benign" "" "0000175641" "0" "10" "21" "47552209" "47552209" "subst" "0.079562" "00430" "COL6A2_000118" "g.47552209G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132295G>A" "" "benign" "" "0000175642" "0" "50" "21" "47552250" "47552250" "subst" "7.51553E-5" "00430" "COL6A2_000119" "g.47552250G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132336G>A" "" "VUS" "" "0000175643" "0" "50" "21" "47552289" "47552289" "subst" "3.31967E-5" "00430" "COL6A2_000120" "g.47552289G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132375G>A" "" "VUS" "" "0000175644" "0" "10" "21" "47552292" "47552292" "subst" "0.000820685" "00430" "COL6A2_000121" "g.47552292C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132378C>T" "" "benign" "" "0000175645" "0" "10" "21" "47552385" "47552385" "subst" "0.131278" "00430" "COL6A2_000042" "g.47552385C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132471C>T" "" "benign" "" "0000175646" "0" "10" "21" "47552386" "47552386" "subst" "0.0115906" "00430" "COL6A2_000122" "g.47552386G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132472G>A" "" "benign" "" "0000175647" "0" "10" "21" "47552389" "47552389" "subst" "0.00254957" "00430" "COL6A2_000123" "g.47552389G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132475G>A" "" "benign" "" "0000175648" "0" "50" "21" "47552400" "47552400" "subst" "0.000157011" "00430" "COL6A2_000124" "g.47552400C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132486C>T" "" "VUS" "" "0000175649" "0" "50" "21" "47552404" "47552406" "del" "0" "00430" "COL6A2_000125" "g.47552404_47552406del" "" "" "" "2998_3000delAAG" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132490_46132492del" "" "VUS" "" "0000175650" "0" "10" "21" "47552449" "47552449" "subst" "0.00538973" "00430" "COL6A2_000126" "g.47552449A>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.46132535A>C" "" "benign" "" "0000175763" "0" "30" "21" "47532309" "47532309" "subst" "2.6046E-5" "00464" "COL6A2_000128" "g.47532309G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46112395G>A" "" "likely benign" "" "0000175779" "0" "50" "21" "47552005" "47552005" "subst" "0.00140527" "00537" "COL6A2_000130" "g.47552005C>T" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46132091C>T" "" "VUS" "" "0000175799" "0" "50" "21" "47531925" "47531925" "subst" "8.15627E-6" "00537" "COL6A2_000131" "g.47531925G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46112011G>A" "" "VUS" "" "0000175807" "1" "90" "21" "47535786" "47535786" "subst" "0" "00537" "COL6A2_000055" "g.47535786G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46115872G>A" "" "pathogenic" "" "0000175808" "1" "90" "21" "47535796" "47535796" "subst" "0" "00537" "COL6A2_000132" "g.47535796G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "De novo" "yes" "" "0" "" "" "g.46115882G>A" "" "pathogenic" "" "0000175809" "1" "90" "21" "47535796" "47535796" "subst" "0" "00537" "COL6A2_000132" "g.47535796G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46115882G>A" "" "pathogenic" "" "0000175810" "1" "90" "21" "47535823" "47535823" "subst" "0" "00537" "COL6A2_000133" "g.47535823G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46115909G>A" "" "pathogenic" "" "0000175811" "1" "90" "21" "47535831" "47535831" "subst" "0" "00537" "COL6A2_000004" "g.47535831G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46115917G>A" "" "pathogenic" "" "0000175812" "1" "90" "21" "47535942" "47535942" "subst" "0" "00537" "COL6A2_000134" "g.47535942G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "De novo" "yes" "" "0" "" "" "g.46116028G>A" "" "pathogenic" "" "0000175813" "1" "90" "21" "47535950" "47535950" "subst" "0" "00537" "COL6A2_000135" "g.47535950G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46116036G>A" "" "pathogenic" "" "0000175814" "1" "90" "21" "47538945" "47538945" "subst" "0" "00537" "COL6A2_000136" "g.47538945G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46119031G>A" "" "pathogenic" "" "0000175815" "1" "90" "21" "47540984" "47540984" "subst" "2.46528E-5" "00537" "COL6A2_000137" "g.47540984G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46121070G>A" "" "pathogenic" "" "0000175833" "1" "90" "21" "47536291" "47536291" "subst" "0" "00537" "COL6A2_000054" "g.47536291G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46116377G>A" "" "pathogenic" "" "0000175845" "1" "90" "21" "47536292" "47536292" "subst" "0" "00537" "COL6A2_000139" "g.47536292G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "De novo" "yes" "" "0" "" "" "g.46116378G>A" "" "pathogenic" "" "0000175846" "1" "90" "21" "47535832" "47535832" "subst" "0" "00537" "COL6A2_000140" "g.47535832G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46115918G>A" "" "pathogenic" "" "0000175858" "1" "90" "21" "47535786" "47535786" "subst" "0" "00537" "COL6A2_000055" "g.47535786G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46115872G>A" "" "pathogenic" "" "0000175859" "1" "90" "21" "47535786" "47535786" "subst" "0" "00537" "COL6A2_000055" "g.47535786G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46115872G>A" "" "pathogenic" "" "0000175860" "1" "90" "21" "47535786" "47535786" "subst" "0" "00537" "COL6A2_000050" "g.47535786G>T" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46115872G>T" "" "pathogenic" "" "0000175861" "1" "90" "21" "47536292" "47536292" "subst" "0" "00537" "COL6A2_000141" "g.47536292G>T" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46116378G>T" "" "pathogenic" "" "0000175864" "2" "90" "21" "47544833" "47544833" "subst" "0.00190503" "00537" "COL6A2_000142" "g.47544833C>T" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46124919C>T" "" "pathogenic" "" "0000175868" "11" "90" "21" "47531390" "47541533" "" "0" "00006" "COL6A2_000144" "g.(47500000_47531390)_(47541533_47552467)del" "" "{PMID:Foley 2011:21280092}" "" "" "69 kb deletion" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000175869" "21" "90" "21" "0" "0" "" "0" "00006" "COL6A1_000162" "g.(46400000_46480000)_(48085000_qter)del" "" "{PMID:Foley 2011:21280092}" "" "" "1.6 Mb deletion ADARB1_PRMT2 (incl. COL6A1, COL6A2)" "Germline" "?" "" "0" "" "" "" "" "pathogenic" "" "0000175870" "11" "90" "21" "0" "0" "" "0" "00006" "COL6A1_000161" "g.(46950000_47250000)_(48085000_qter)del" "" "{PMID:Foley 2011:21280092}" "" "" "1.09 Mb deletion PCBP3_PRMT2 (Incl. COL6A1, COL6A2)" "Germline" "?" "" "0" "" "" "" "" "pathogenic" "" "0000175872" "11" "90" "21" "0" "0" "subst" "0" "00472" "COL6A2_000147" "g.?" "" "{PMID:Bovolenta 2010:20302629}" "" "g.(46352739_46352798)_(46354892_46354936)del" "max. 2.1 Kb deletion; father carries c.2094G>A and c.2097C>T on 2nd allele of which RNA expression is >95%" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000175873" "1" "10" "21" "47532440" "47532440" "subst" "0.0854267" "00472" "COL6A2_000072" "g.47532440C>T" "" "{PMID:Gualandi 2012:22992134}" "" "P221P" "" "Germline" "?" "" "0" "" "" "g.46112526C>T" "" "benign" "" "0000175874" "1" "90" "21" "47537830" "47537830" "subst" "0" "00472" "COL6A2_000150" "g.47537830C>T" "" "{PMID:Gualandi 2009:19949035}" "" "C1178T" "no RNA expression (NMD)" "Germline" "yes" "" "0" "" "" "g.46117916C>T" "" "pathogenic" "" "0000175875" "11" "90" "21" "47546449" "47546449" "dup" "4.06332E-6" "00472" "COL6A2_000152" "g.47546449C>T" "" "{PMID:Gualandi 2009:19949035}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46126535C>T" "" "pathogenic" "" "0000175878" "1" "90" "21" "47533990" "47533990" "subst" "0" "00472" "COL6A2_000155" "g.47533990A>C" "" "{PMID:Martoni 2009:19309692}" "" "" "RNA expression 2/7" "De novo" "yes" "" "0" "" "" "g.46114076A>C" "" "pathogenic" "" "0000175879" "1" "90" "21" "47536322" "47536322" "subst" "0" "00472" "COL6A2_000156" "g.47536322G>A" "" "{PMID:Martoni 2009:19309692}" "" "" "RNA expression altered transcript 1/6.7" "Germline" "?" "" "0" "" "" "g.46116408G>A" "" "pathogenic" "" "0000175880" "11" "70" "21" "47545690" "47545690" "subst" "0.000106823" "00472" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Martoni 2009:19309692}" "" "" "RNA expression variant 1/6.5" "Germline" "yes" "" "0" "" "" "g.46125776G>A" "" "likely pathogenic" "" "0000175881" "11" "90" "21" "47546449" "47546449" "subst" "4.06332E-6" "00472" "COL6A2_000152" "g.47546449C>T" "" "{PMID:Merlini 2008:18852439}" "" "2537C>T" "" "Germline" "yes" "" "0" "" "" "g.46126535C>T" "" "pathogenic" "" "0000175882" "1" "90" "21" "47546449" "47546449" "subst" "4.06332E-6" "00472" "COL6A2_000152" "g.47546449C>T" "" "{PMID:Merlini 2008:18852439}" "" "2537C>T" "" "Germline" "yes" "" "0" "" "" "g.46126535C>T" "" "pathogenic" "" "0000175883" "11" "90" "21" "47532093" "47532093" "subst" "0.00670518" "00472" "COL6A2_000070" "g.47532093G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46112179G>A" "" "pathogenic" "" "0000175886" "11" "90" "21" "47551978" "47551978" "subst" "0" "00472" "COL6A2_000157" "g.47551978C>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46132064C>T" "" "pathogenic" "" "0000175887" "11" "90" "21" "47551895" "47551895" "dup" "6.00019E-5" "00472" "COL6A2_000153" "g.47551895G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46131981G>A" "" "pathogenic" "" "0000175890" "10" "90" "21" "47546080" "47546080" "subst" "0.00443388" "00472" "COL6A2_000021" "g.47546080G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46126166G>A" "" "pathogenic" "" "0000175924" "0" "10" "21" "47552157" "47552157" "del" "0.000633108" "00472" "COL6A2_000161" "g.47552157G>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46132243G>T" "" "benign" "" "0000175925" "1" "90" "21" "47545904" "47545905" "subst" "0" "00472" "COL6A2_000059" "g.47545904_47545905del" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46125990_46125991del" "" "pathogenic" "" "0000175926" "0" "90" "21" "47546058" "47546058" "subst" "4.1029E-6" "00472" "COL6A2_000020" "g.47546058T>C" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46126144T>C" "" "pathogenic" "" "0000175927" "1" "90" "21" "47546449" "47546449" "subst" "4.06332E-6" "00472" "COL6A2_000152" "g.47546449C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46126535C>T" "" "pathogenic" "" "0000175928" "0" "90" "21" "47546080" "47546080" "subst" "0.00443388" "00472" "COL6A2_000021" "g.47546080G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46126166G>A" "" "pathogenic" "" "0000175929" "0" "90" "21" "47539759" "47539759" "subst" "0" "00472" "COL6A2_000165" "g.47539759G>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46119845G>T" "" "pathogenic" "" "0000175930" "1" "90" "21" "47545969" "47545969" "subst" "0" "00472" "COL6A2_000166" "g.47545969T>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46126055T>A" "" "pathogenic" "" "0000175931" "1" "90" "21" "47551978" "47551978" "subst" "0" "00472" "COL6A2_000157" "g.47551978C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46132064C>T" "" "pathogenic" "" "0000175932" "3" "90" "21" "47545690" "47545690" "subst" "0.000106823" "00472" "COL6A2_000056" "g.47545690G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46125776G>A" "" "pathogenic" "" "0000175933" "1" "90" "21" "47535942" "47535942" "subst" "0" "00472" "COL6A2_000167" "g.47535942G>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46116028G>T" "" "pathogenic" "" "0000175934" "1" "90" "21" "47544833" "47544833" "subst" "0.00190503" "00472" "COL6A2_000168" "g.47544833C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46124919C>T" "" "pathogenic" "" "0000175935" "1" "90" "21" "47552005" "47552005" "subst" "0.00140527" "00472" "COL6A2_000130" "g.47552005C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46132091C>T" "" "pathogenic" "" "0000175936" "1" "90" "21" "47535950" "47535950" "subst" "0" "00472" "COL6A2_000135" "g.47535950G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46116036G>A" "" "pathogenic" "" "0000175937" "1" "90" "21" "47535786" "47535786" "subst" "0" "00472" "COL6A2_000055" "g.47535786G>A" "" "" "" "" "" "De novo" "yes" "" "0" "" "" "g.46115872G>A" "" "pathogenic" "" "0000175938" "1" "90" "21" "47535831" "47535831" "subst" "0" "00472" "COL6A2_000004" "g.47535831G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46115917G>A" "" "pathogenic" "" "0000175939" "1" "90" "21" "47545789" "47545789" "subst" "4.06455E-6" "00472" "COL6A2_000169" "g.47545789T>C" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46125875T>C" "" "pathogenic" "" "0000175940" "1" "90" "21" "47535831" "47535831" "subst" "0" "00472" "COL6A2_000004" "g.47535831G>A" "" "" "" "" "" "De novo" "yes" "" "0" "" "" "g.46115917G>A" "" "pathogenic" "" "0000175941" "1" "90" "21" "47545423" "47545423" "subst" "0" "00472" "COL6A2_000015" "g.47545423G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46125509G>A" "" "pathogenic" "" "0000175942" "1" "90" "21" "47535942" "47535942" "subst" "0" "00472" "COL6A2_000167" "g.47535942G>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46116028G>T" "" "pathogenic" "" "0000175943" "1" "90" "21" "47552191" "47552191" "subst" "0.000166165" "00472" "COL6A2_000170" "g.47552191G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46132277G>A" "" "pathogenic" "" "0000175944" "1" "90" "21" "47535959" "47535959" "subst" "0" "00472" "COL6A2_000171" "g.47535959G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46116045G>A" "" "pathogenic" "" "0000175945" "1" "90" "21" "47533990" "47533990" "subst" "0" "00472" "COL6A2_000155" "g.47533990A>C" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46114076A>C" "" "pathogenic" "" "0000175946" "1" "90" "21" "47544835" "47544835" "subst" "0" "00472" "COL6A2_000172" "g.47544835G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46124921G>A" "" "pathogenic" "" "0000175947" "1" "90" "21" "47545696" "47545696" "subst" "0.00101707" "00472" "COL6A2_000016" "g.47545696C>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46125782C>A" "" "pathogenic" "" "0000175948" "1" "90" "21" "47545827" "47545827" "subst" "4.06395E-6" "00472" "COL6A2_000017" "g.47545827G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46125913G>A" "" "pathogenic" "" "0000175949" "11" "90" "21" "47551934" "47551934" "subst" "0.000199614" "00472" "COL6A2_000173" "g.47551934G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46132020G>A" "" "pathogenic" "" "0000175950" "1" "90" "2" "47541509" "47541509" "subst" "0" "00472" "COL6A2_000174" "g.47541509G>C" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.47314370G>C" "" "pathogenic" "" "0000175984" "0" "90" "21" "47536591" "47536591" "subst" "0" "01700" "COL6A2_000175" "g.47536591G>T" "" "{PMID:Punetha 2016:27854218}" "" "" "" "De novo" "" "" "0" "" "" "g.46116677G>T" "" "pathogenic (dominant)" "" "0000175985" "11" "50" "21" "47535968" "47535968" "subst" "0" "02188" "COL6A2_000058" "g.47535968G>A" "" "" "" "" "father appears mosaic for this variant" "Germline" "?" "" "0" "" "" "g.46116054G>A" "" "VUS" "" "0000175995" "3" "10" "21" "47538960" "47538960" "subst" "0" "00449" "COL6A2_000033" "g.47538960A>G" "" "{PMID:Giusti 2005:16130093}" "" "A1196G" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.46119046A>G" "" "benign" "" "0000175996" "3" "10" "21" "47545768" "47545768" "subst" "0.492076" "00449" "COL6A2_000035" "g.47545768G>A" "" "{PMID:Giusti 2005:16130093}" "" "2039A>G" "" "Germline" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000175997" "3" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00449" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Giusti 2005:16130093}" "" "2697T>G" "" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000175998" "3" "10" "21" "47540449" "47540449" "subst" "0" "00449" "COL6A2_000044" "g.47540449G>C" "" "{PMID:Giusti 2005:16130093}" "" "C1353G" "" "Germline" "" "" "0" "" "" "g.46120535G>C" "" "benign" "" "0000176003" "1" "50" "21" "47541504" "47541504" "subst" "2.03739E-5" "00006" "COL6A2_000030" "g.47541504G>A" "" "{PMID:Lampe 2005:15689448}" "" "" "change of unknown and questionable significance; protein domain TH" "Germline" "" "" "0" "" "" "g.46121590G>A" "" "VUS" "" "0000176006" "0" "10" "21" "47538960" "47538960" "subst" "0" "00449" "COL6A2_000033" "g.47538960A>G" "" "{PMID:Giusti 2005:16130093}" "" "A1196G" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.46119046A>G" "" "benign" "" "0000176007" "0" "10" "21" "47545768" "47545768" "subst" "0.492076" "00449" "COL6A2_000035" "g.47545768G>A" "" "{PMID:Giusti 2005:16130093}" "" "2039A>G" "" "Germline" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000176008" "0" "10" "21" "47545823" "47545823" "subst" "0.491234" "00449" "COL6A2_000036" "g.47545823G>A" "" "{PMID:Giusti 2005:16130093}" "" "" "" "Germline" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000176009" "0" "10" "21" "47545826" "47545826" "subst" "0.49123" "00449" "COL6A2_000037" "g.47545826C>T" "" "{PMID:Giusti 2005:16130093}" "" "" "" "Germline" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000176010" "0" "10" "21" "47545913" "47545913" "subst" "0.389208" "00449" "COL6A2_000038" "g.47545913G>A" "" "{PMID:Giusti 2005:16130093}" "" "" "" "Germline" "" "" "0" "" "" "g.46125999G>A" "" "benign" "" "0000176011" "3" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00449" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Giusti 2005:16130093}" "" "2697T>G" "" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176012" "3" "10" "21" "47540449" "47540449" "subst" "0" "00449" "COL6A2_000044" "g.47540449G>C" "" "{PMID:Giusti 2005:16130093}" "" "C1353G" "" "Germline" "" "" "0" "" "" "g.46120535G>C" "" "benign" "" "0000176013" "0" "10" "21" "47552522" "47552522" "subst" "0" "00449" "COL6A2_000045" "g.47552522T>G" "" "{PMID:Giusti 2005:16130093}" "" "T3116G" "" "Germline" "" "" "0" "" "" "g.46132608T>G" "" "benign" "" "0000176014" "3" "10" "21" "47533963" "47533963" "subst" "0" "00449" "COL6A2_000047" "g.47533963C>G" "" "{PMID:Giusti 2005:16130093}" "" "G777C" "" "Germline" "" "" "0" "" "" "g.46114049C>G" "" "benign" "" "0000176023" "3" "10" "21" "47545768" "47545768" "subst" "0.492076" "00449" "COL6A2_000035" "g.47545768G>A" "" "{PMID:Giusti 2005:16130093}" "" "2039A>G" "" "Germline" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000176029" "3" "10" "21" "47545768" "47545768" "subst" "0.492076" "00449" "COL6A2_000035" "g.47545768G>A" "" "{PMID:Giusti 2005:16130093}" "" "2039A>G" "" "Germline" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000176030" "3" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00449" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Giusti 2005:16130093}" "" "2697T>G" "" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176031" "0" "10" "21" "47552385" "47552385" "subst" "0.131278" "00449" "COL6A2_000042" "g.47552385C>T" "" "{PMID:Giusti 2005:16130093}" "" "" "" "Germline" "" "" "0" "" "" "g.46132471C>T" "" "benign" "" "0000176032" "0" "10" "21" "47552568" "47552568" "subst" "0" "00449" "COL6A2_000046" "g.47552568C>G" "" "{PMID:Giusti 2005:16130093}" "" "C3162G" "" "Germline" "" "" "0" "" "" "g.46132654C>G" "" "benign" "" "0000176033" "0" "10" "21" "47542052" "47542052" "subst" "0.00881776" "00449" "COL6A2_000048" "g.47542052C>T" "" "{PMID:Giusti 2005:16130093}" "" "C1552T" "" "Germline" "" "" "0" "" "" "g.46122138C>T" "" "benign" "" "0000176039" "20" "90" "21" "47538518" "47538518" "subst" "0" "00449" "COL6A2_000029" "g.47538518A>G" "" "{PMID:Lucarini 2005:16075202}, {OMIM120240:0007}" "" "" "multiple misspliced transcripts, normal mRNA, exon 13 skipped; protein domain TH" "Germline" "" "" "0" "" "" "g.46118604A>G" "" "pathogenic" "" "0000176040" "21" "90" "21" "47538562" "47538562" "dup" "0" "00006" "COL6A2_000006" "g.47538562dup" "" "{PMID:Camacho 2001:11381124}, {OMIM120240:0002}" "" "" "0/100 control chromosomes; protein domain TH" "Germline" "" "" "0" "" "" "g.46118648dup" "" "pathogenic" "" "0000176041" "1" "90" "21" "47545177" "47545177" "subst" "0" "00006" "COL6A2_000013" "g.47545177C>G" "" "{PMID:Ishikawa 2002:12297580}" "" "" "0/100 control chromosomes; partial insertion of intron14 in COL6A2; protein domain TH/C1" "Germline" "" "" "0" "" "" "g.46125263C>G" "" "pathogenic" "" "0000176042" "21" "90" "21" "47541468" "47541468" "subst" "4.07491E-6" "00006" "COL6A2_000008" "g.47541468A>G" "" "{PMID:Camacho 2001:11381124}, {OMIM120240:0004}" "DdeI" "" "0/100 control chromosomes; protein domain TH" "Germline" "" "" "0" "" "" "g.46121554A>G" "" "pathogenic" "" "0000176043" "21" "90" "21" "47544839" "47544839" "subst" "0" "00006" "COL6A2_000011" "g.47544839G>A" "" "{PMID:Ishikawa 2004:14981181}" "" "" "0/100 control chromosomes; protein domain TH" "Germline" "" "" "0" "" "" "g.46124925G>A" "" "pathogenic" "" "0000176044" "1" "90" "21" "47541468" "47541468" "subst" "4.07491E-6" "00006" "COL6A2_000008" "g.47541468A>G" "" "{PMID:Camacho 2001:11381124}, {OMIM120240:0003}" "DdeI" "" "0/100 control chromosomes; protein domain TH" "De novo" "" "" "0" "" "" "g.46121554A>G" "" "pathogenic" "" "0000176045" "2" "90" "21" "47546415" "47546415" "subst" "0" "00006" "COL6A2_000022" "g.47546415A>G" "" "{PMID:Lampe 2005:15689448}" "" "" "protein domain C1/C2" "Germline" "" "" "0" "" "" "g.46126501A>G" "" "pathogenic" "" "0000176046" "1" "50" "21" "47546080" "47546080" "subst" "0.00443388" "00006" "COL6A2_000021" "g.47546080G>A" "1/78" "{PMID:Lampe 2005:15689448}" "" "" "change of unknown and questionable significance in 1/78 individuals; protein domain C1" "Germline" "" "" "0" "" "" "g.46126166G>A" "" "VUS" "" "0000176047" "21" "90" "21" "47532465" "47532466" "dup" "0" "00006" "COL6A2_000001" "g.47532465_47532466dup" "" "{PMID:Lampe 2005:15689448}" "" "" "protein domain N1" "Germline" "" "" "0" "" "" "g.46112551_46112552dup" "" "pathogenic" "" "0000176048" "21" "90" "21" "47551916" "47551916" "subst" "4.22701E-6" "00006" "COL6A2_000024" "g.47551916T>C" "" "{PMID:Baker 2005:15563506}" "" "" "protein domain C2" "Germline" "" "" "0" "" "" "g.46132002T>C" "" "pathogenic" "" "0000176049" "1" "90" "21" "47552032" "47552032" "subst" "0" "00006" "COL6A2_000026" "g.47552032C>A" "1/75" "{PMID:Lampe 2005:15689448}" "" "" "individuals, no confirmatory data; protein domain C2" "Germline" "" "" "0" "" "" "g.46132118C>A" "" "pathogenic" "" "0000176050" "2" "90" "21" "47552032" "47552032" "subst" "0" "00006" "COL6A2_000026" "g.47552032C>A" "1/75" "{PMID:Lampe 2005:15689448}" "" "" "individuals, no confirmatory data; protein domain C2" "Germline" "" "" "0" "" "" "g.46132118C>A" "" "pathogenic" "" "0000176056" "0" "10" "21" "47532456" "47532456" "subst" "0.0211517" "00006" "COL6A2_000031" "g.47532456G>A" "" "{PMID:Baker 2007:17886299}" "" "679A>G" "N1" "Germline" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000176057" "0" "10" "21" "47545768" "47545768" "subst" "0.492076" "00006" "COL6A2_000035" "g.47545768G>A" "" "{PMID:Baker 2007:17886299}" "" "2039A>G" "C1" "Germline" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000176058" "0" "10" "21" "47545823" "47545823" "subst" "0.491234" "00006" "COL6A2_000036" "g.47545823G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000176059" "0" "10" "21" "47545826" "47545826" "subst" "0.49123" "00006" "COL6A2_000037" "g.47545826C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000176060" "0" "10" "21" "47545913" "47545913" "subst" "0.389208" "00006" "COL6A2_000038" "g.47545913G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125999G>A" "" "benign" "" "0000176061" "1" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176062" "2" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176063" "0" "10" "21" "47552385" "47552385" "subst" "0.131278" "00006" "COL6A2_000042" "g.47552385C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.46132471C>T" "" "benign" "" "0000176084" "1" "10" "21" "47532456" "47532456" "subst" "0.0211517" "00006" "COL6A2_000031" "g.47532456G>A" "" "{PMID:Baker 2007:17886299}" "" "679A>G" "N1" "Germline" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000176085" "2" "10" "21" "47532456" "47532456" "subst" "0.0211517" "00006" "COL6A2_000031" "g.47532456G>A" "" "{PMID:Baker 2007:17886299}" "" "679A>G" "N1" "Germline" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000176086" "0" "10" "21" "47538960" "47538960" "subst" "0" "00006" "COL6A2_000033" "g.47538960A>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix\r\nVariant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.46119046A>G" "" "benign" "" "0000176087" "0" "10" "21" "47545768" "47545768" "subst" "0.492076" "00006" "COL6A2_000035" "g.47545768G>A" "" "{PMID:Baker 2007:17886299}" "" "2039A>G" "C1" "Germline" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000176088" "0" "10" "21" "47545823" "47545823" "subst" "0.491234" "00006" "COL6A2_000036" "g.47545823G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000176089" "0" "10" "21" "47545826" "47545826" "subst" "0.49123" "00006" "COL6A2_000037" "g.47545826C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000176090" "0" "10" "21" "47545913" "47545913" "subst" "0.389208" "00006" "COL6A2_000038" "g.47545913G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125999G>A" "" "benign" "" "0000176091" "0" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176115" "0" "10" "21" "47552089" "47552089" "subst" "0.00128523" "00006" "COL6A2_000034" "g.47552089A>C" "" "{PMID:Baker 2007:17886299}" "" "" "also in unaffected relatives; C2" "Germline" "" "" "0" "" "" "g.46132175A>C" "" "benign" "" "0000176116" "0" "10" "21" "47545768" "47545768" "subst" "0.492076" "00006" "COL6A2_000035" "g.47545768G>A" "" "{PMID:Baker 2007:17886299}" "" "2039A>G" "C1" "Germline" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000176117" "0" "10" "21" "47545823" "47545823" "subst" "0.491234" "00006" "COL6A2_000036" "g.47545823G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000176118" "0" "10" "21" "47545826" "47545826" "subst" "0.49123" "00006" "COL6A2_000037" "g.47545826C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000176119" "0" "10" "21" "47545913" "47545913" "subst" "0.389208" "00006" "COL6A2_000038" "g.47545913G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125999G>A" "" "benign" "" "0000176120" "1" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176121" "2" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176122" "1" "10" "21" "47552130" "47552130" "subst" "0.0980658" "00006" "COL6A2_000040" "g.47552130A>G" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.46132216A>G" "" "benign" "" "0000176123" "2" "10" "21" "47552130" "47552130" "subst" "0.0980658" "00006" "COL6A2_000040" "g.47552130A>G" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.46132216A>G" "" "benign" "" "0000176124" "0" "10" "21" "47552385" "47552385" "subst" "0.131278" "00006" "COL6A2_000042" "g.47552385C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.46132471C>T" "" "benign" "" "0000176156" "1" "10" "21" "47532456" "47532456" "subst" "0.0211517" "00006" "COL6A2_000031" "g.47532456G>A" "" "{PMID:Baker 2007:17886299}" "" "679A>G" "N1" "Germline" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000176157" "2" "10" "21" "47532456" "47532456" "subst" "0.0211517" "00006" "COL6A2_000031" "g.47532456G>A" "" "{PMID:Baker 2007:17886299}" "" "679A>G" "N1" "Germline" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000176158" "1" "10" "21" "47538960" "47538960" "subst" "0" "00006" "COL6A2_000033" "g.47538960A>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix\r\nVariant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.46119046A>G" "" "benign" "" "0000176159" "2" "10" "21" "47538960" "47538960" "subst" "0" "00006" "COL6A2_000033" "g.47538960A>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix\r\nVariant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.46119046A>G" "" "benign" "" "0000176160" "1" "10" "21" "47545768" "47545768" "subst" "0.492076" "00006" "COL6A2_000035" "g.47545768G>A" "" "{PMID:Baker 2007:17886299}" "" "2039A>G" "C1" "Germline" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000176161" "2" "10" "21" "47545768" "47545768" "subst" "0.492076" "00006" "COL6A2_000035" "g.47545768G>A" "" "{PMID:Baker 2007:17886299}" "" "2039A>G" "C1" "Germline" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000176162" "1" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176163" "2" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176178" "1" "10" "21" "47532456" "47532456" "subst" "0.0211517" "00006" "COL6A2_000031" "g.47532456G>A" "" "{PMID:Baker 2007:17886299}" "" "679A>G" "N1" "Germline" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000176179" "2" "10" "21" "47532456" "47532456" "subst" "0.0211517" "00006" "COL6A2_000031" "g.47532456G>A" "" "{PMID:Baker 2007:17886299}" "" "679A>G" "N1" "Germline" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000176180" "1" "10" "21" "47545823" "47545823" "subst" "0.491234" "00006" "COL6A2_000036" "g.47545823G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000176181" "2" "10" "21" "47545823" "47545823" "subst" "0.491234" "00006" "COL6A2_000036" "g.47545823G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000176182" "1" "10" "21" "47545826" "47545826" "subst" "0.49123" "00006" "COL6A2_000037" "g.47545826C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000176183" "2" "10" "21" "47545826" "47545826" "subst" "0.49123" "00006" "COL6A2_000037" "g.47545826C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000176184" "1" "10" "21" "47545913" "47545913" "subst" "0.389208" "00006" "COL6A2_000038" "g.47545913G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125999G>A" "" "benign" "" "0000176185" "2" "10" "21" "47545913" "47545913" "subst" "0.389208" "00006" "COL6A2_000038" "g.47545913G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125999G>A" "" "benign" "" "0000176186" "1" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176187" "2" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176213" "1" "10" "21" "47532456" "47532456" "subst" "0.0211517" "00006" "COL6A2_000031" "g.47532456G>A" "" "{PMID:Baker 2007:17886299}" "" "679A>G" "N1" "Germline" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000176214" "2" "10" "21" "47532456" "47532456" "subst" "0.0211517" "00006" "COL6A2_000031" "g.47532456G>A" "" "{PMID:Baker 2007:17886299}" "" "679A>G" "N1" "Germline" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000176215" "0" "10" "21" "47538960" "47538960" "subst" "0" "00006" "COL6A2_000033" "g.47538960A>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix\r\nVariant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.46119046A>G" "" "benign" "" "0000176216" "0" "10" "21" "47545768" "47545768" "subst" "0.492076" "00006" "COL6A2_000035" "g.47545768G>A" "" "{PMID:Baker 2007:17886299}" "" "2039A>G" "C1" "Germline" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000176217" "0" "10" "21" "47545823" "47545823" "subst" "0.491234" "00006" "COL6A2_000036" "g.47545823G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000176218" "0" "10" "21" "47545826" "47545826" "subst" "0.49123" "00006" "COL6A2_000037" "g.47545826C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000176219" "0" "10" "21" "47545913" "47545913" "subst" "0.389208" "00006" "COL6A2_000038" "g.47545913G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125999G>A" "" "benign" "" "0000176220" "0" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176238" "1" "10" "21" "47545823" "47545823" "subst" "0.491234" "00006" "COL6A2_000036" "g.47545823G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000176239" "2" "10" "21" "47545823" "47545823" "subst" "0.491234" "00006" "COL6A2_000036" "g.47545823G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000176240" "1" "10" "21" "47545826" "47545826" "subst" "0.49123" "00006" "COL6A2_000037" "g.47545826C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000176241" "2" "10" "21" "47545826" "47545826" "subst" "0.49123" "00006" "COL6A2_000037" "g.47545826C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000176242" "0" "10" "21" "47545913" "47545913" "subst" "0.389208" "00006" "COL6A2_000038" "g.47545913G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125999G>A" "" "benign" "" "0000176243" "1" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176244" "2" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176264" "1" "10" "21" "47532456" "47532456" "subst" "0.0211517" "00006" "COL6A2_000031" "g.47532456G>A" "" "{PMID:Baker 2007:17886299}" "" "679A>G" "N1" "Germline" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000176265" "2" "10" "21" "47532456" "47532456" "subst" "0.0211517" "00006" "COL6A2_000031" "g.47532456G>A" "" "{PMID:Baker 2007:17886299}" "" "679A>G" "N1" "Germline" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000176266" "1" "10" "21" "47545823" "47545823" "subst" "0.491234" "00006" "COL6A2_000036" "g.47545823G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000176267" "2" "10" "21" "47545823" "47545823" "subst" "0.491234" "00006" "COL6A2_000036" "g.47545823G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000176268" "1" "10" "21" "47545826" "47545826" "subst" "0.49123" "00006" "COL6A2_000037" "g.47545826C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000176269" "2" "10" "21" "47545826" "47545826" "subst" "0.49123" "00006" "COL6A2_000037" "g.47545826C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000176270" "1" "10" "21" "47545913" "47545913" "subst" "0.389208" "00006" "COL6A2_000038" "g.47545913G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125999G>A" "" "benign" "" "0000176271" "2" "10" "21" "47545913" "47545913" "subst" "0.389208" "00006" "COL6A2_000038" "g.47545913G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.46125999G>A" "" "benign" "" "0000176272" "1" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176273" "2" "10" "21" "47552103" "47552103" "subst" "0.0343517" "00006" "COL6A2_000039" "g.47552103G>T" "" "{PMID:Baker 2007:17886299}" "" "2697T>G" "C2" "Germline" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000176292" "0" "90" "21" "47546115" "47546115" "subst" "4.20539E-6" "00464" "COL6A2_000049" "g.47546115A>T" "" "" "" "" "absent type VI collagen" "Germline" "" "" "0" "" "" "g.46126201A>T" "" "pathogenic" "" "0000176294" "0" "50" "21" "47546080" "47546080" "subst" "0.00443388" "00464" "COL6A2_000021" "g.47546080G>A" "" "" "" "" "mildly reduced staining of type VI collagen" "Germline" "" "" "0" "" "" "g.46126166G>A" "" "VUS" "" "0000176295" "0" "30" "21" "47542052" "47542052" "subst" "0.00881776" "00464" "COL6A2_000048" "g.47542052C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46122138C>T" "" "likely benign" "" "0000176299" "2" "90" "21" "47545690" "47545690" "subst" "0.000106823" "00006" "COL6A2_000056" "g.47545690G>A" "" "L Medne ASHG 2010 A1669" "" "" "" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic" "" "0000176300" "1" "50" "21" "47545376" "47545376" "dup" "0" "00006" "COL6A2_000057" "g.47545376dup" "" "CA Valencia ASHG 2010 A1982" "" "IVS24-3dupC" "" "Germline" "" "" "0" "" "" "g.46125462dup" "" "VUS" "" "0000176305" "0" "70" "21" "47545690" "47545690" "subst" "0.000106823" "00464" "COL6A2_000056" "g.47545690G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "likely pathogenic" "" "0000176306" "21" "90" "21" "47546416" "47546416" "subst" "0" "00464" "COL6A2_000062" "g.47546416G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46126502G>C" "" "pathogenic" "" "0000176307" "20" "70" "21" "47546152" "47546152" "subst" "8.52479E-6" "00464" "COL6A2_000061" "g.47546152G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46126238G>A" "" "likely pathogenic" "" "0000176308" "21" "90" "21" "47546048" "47546048" "subst" "0" "00464" "COL6A2_000019" "g.47546048C>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46126134C>G" "" "pathogenic" "" "0000176309" "20" "70" "21" "47552411" "47552412" "del" "0" "00464" "COL6A2_000064" "g.47552411_47552412del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46132497_46132498del" "" "likely pathogenic" "" "0000176310" "0" "50" "21" "47545704" "47545704" "subst" "0" "00464" "COL6A2_000066" "g.47545704C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46125790C>T" "" "VUS" "" "0000176312" "20" "70" "21" "47536563" "47536564" "del" "0" "00464" "COL6A2_000068" "g.47536563_47536564del" "" "" "" "928-2_-1del" "" "Germline" "" "" "0" "" "" "g.46116649_46116650del" "" "likely pathogenic" "" "0000176313" "0" "90" "21" "47541518" "47541518" "subst" "0" "00464" "COL6A2_000127" "g.47541518C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46121604C>T" "" "pathogenic" "" "0000176314" "0" "90" "21" "47535822" "47535822" "subst" "0" "00464" "COL6A2_000129" "g.47535822G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.46115908G>A" "" "pathogenic" "" "0000176324" "11" "90" "21" "47544833" "47544833" "subst" "0.00190503" "00537" "COL6A2_000142" "g.47544833C>T" "" "{PMID:Butterfield:24038877}" "" "" "unaffected father carries this allele" "Germline" "yes" "" "0" "" "" "g.46124919C>T" "" "pathogenic" "" "0000176325" "2" "90" "2" "47545178" "47545178" "subst" "0" "00537" "COL6A2_000143" "g.47545178A>T" "" "{PMID:Butterfield:24038877}" "" "7" "Variant Error [EREF/0]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "?" "" "0" "" "" "" "" "pathogenic" "" "0000176332" "1" "30" "21" "47532284" "47532284" "subst" "0" "00537" "COL6A2_000138" "g.47532284C>T" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.46112370C>T" "" "likely benign" "" "0000176333" "21" "90" "21" "47545690" "47545690" "subst" "0.000106823" "00006" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Foley 2011:21280092}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46125776G>A" "" "pathogenic" "" "0000176334" "11" "90" "21" "47531390" "47552467" "" "0" "00006" "COL6A2_000145" "g.(47450000_47531390)_(47552467_47572000)del" "" "" "" "" "47 kb deletion" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000176337" "21" "10" "21" "47545823" "47545823" "subst" "0.491234" "00472" "COL6A2_000036" "g.47545823G>A" "" "{PMID:Bovolenta 2010:20302629}" "" "A698A" "" "Germline" "yes" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000176338" "21" "10" "21" "47545826" "47545826" "subst" "0.49123" "00472" "COL6A2_000037" "g.47545826C>T" "" "{PMID:Bovolenta 2010:20302629}" "" "G699G" "" "Germline" "yes" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000176339" "21" "90" "21" "47552353" "47552358" "del" "0" "00472" "COL6A2_000148" "g.47552353_47552358del" "" "{PMID:Bovolenta 2010:20302629}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46132439_46132444del" "" "pathogenic" "" "0000176340" "1" "90" "21" "47536614" "47536641" "del" "0" "00472" "COL6A2_000149" "g.47536614_47536641del" "" "{PMID:Gualandi 2012:22992134}" "" "954+17_22del28" "" "Germline" "?" "" "0" "" "" "g.46116700_46116727del" "" "pathogenic" "" "0000176341" "2" "10" "21" "47552017" "47552017" "subst" "9.92605E-6" "00472" "COL6A2_000151" "g.47552017G>A" "" "{PMID:Gualandi 2009:19949035}" "" "G2693A" "not in 200 control chromosomes" "Germline" "yes" "" "0" "" "" "g.46132103G>A" "" "benign" "" "0000176342" "21" "50" "21" "47551895" "47551895" "subst" "6.00019E-5" "00472" "COL6A2_000153" "g.47551895G>A" "" "{PMID:Gualandi 2009:19949035}" "" "" "not in 200 control chromosomes" "Germline" "yes" "" "0" "" "" "g.46131981G>A" "" "VUS" "" "0000176343" "21" "50" "21" "47551933" "47551933" "subst" "2.5523E-5" "00472" "COL6A2_000154" "g.47551933C>T" "" "{PMID:Gualandi 2009:19949035}" "" "" "not in 200 control chromosomes" "Germline" "yes" "" "0" "" "" "g.46132019C>T" "" "VUS" "" "0000176345" "2" "10" "21" "47538960" "47538960" "subst" "0.784449" "00472" "COL6A2_000082" "g.47538960G>A" "" "{PMID:Martoni 2009:19309692}" "" "" "RNA expression 5/7" "Germline" "yes" "" "0" "" "" "g.46119046G>A" "" "benign" "" "0000176346" "1" "90" "21" "47537830" "47537830" "subst" "0" "00472" "COL6A2_000150" "g.47537830C>T" "" "{PMID:Martoni 2009:19309692}" "" "" "RNA no expression (NMD)" "Germline" "?" "" "0" "" "" "g.46117916C>T" "" "pathogenic" "" "0000176347" "21" "70" "21" "47545690" "47545690" "subst" "0.000106823" "00472" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Martoni 2009:19309692}" "" "" "RNA expression variant 1/6.5" "Germline" "yes" "" "0" "" "" "g.46125776G>A" "" "likely pathogenic" "" "0000176348" "21" "90" "21" "47546449" "47546449" "subst" "4.06332E-6" "00472" "COL6A2_000152" "g.47546449C>T" "" "{PMID:Merlini 2008:18852439}" "" "2537C>T" "" "Germline" "yes" "" "0" "" "" "g.46126535C>T" "" "pathogenic" "" "0000176350" "21" "90" "21" "47546080" "47546080" "subst" "0.00443388" "00472" "COL6A2_000021" "g.47546080G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46126166G>A" "" "pathogenic" "" "0000176352" "21" "90" "21" "47551978" "47551978" "subst" "0" "00472" "COL6A2_000157" "g.47551978C>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46132064C>T" "" "pathogenic" "" "0000176353" "21" "90" "21" "47545690" "47545690" "subst" "0.000106823" "00472" "COL6A2_000056" "g.47545690G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46125776G>A" "" "pathogenic" "" "0000176354" "11" "90" "21" "47551933" "47551933" "subst" "2.5523E-5" "00472" "COL6A2_000154" "g.47551933C>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46132019C>T" "" "pathogenic" "" "0000176355" "21" "90" "21" "47545690" "47545690" "subst" "0.000106823" "00472" "COL6A2_000056" "g.47545690G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46125776G>A" "" "pathogenic" "" "0000176357" "21" "90" "21" "47532288" "47532288" "subst" "0.00115034" "00472" "COL6A2_000159" "g.47532288G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46112374G>A" "" "pathogenic" "" "0000176358" "21" "90" "21" "47552386" "47552386" "subst" "0.0115906" "00472" "COL6A2_000122" "g.47552386G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46132472G>A" "" "pathogenic" "" "0000176365" "1" "10" "21" "47536591" "47536591" "subst" "0" "00472" "COL6A2_000160" "g.47536591G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46116677G>A" "" "benign" "" "0000176366" "2" "90" "21" "47545904" "47545905" "del" "0" "00472" "COL6A2_000059" "g.47545904_47545905del" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46125990_46125991del" "" "pathogenic" "" "0000176367" "11" "90" "21" "47545394" "47545394" "subst" "0" "00472" "COL6A2_000162" "g.47545394G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46125480G>A" "" "pathogenic" "" "0000176368" "2" "90" "21" "47546449" "47546449" "subst" "4.06332E-6" "00472" "COL6A2_000152" "g.47546449C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46126535C>T" "" "pathogenic" "" "0000176369" "1" "90" "21" "47540432" "47540432" "dup" "0" "00472" "COL6A2_000163" "g.47540432dup" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46120518dup" "" "pathogenic" "" "0000176370" "1" "90" "21" "47532125" "47532125" "dup" "0" "00472" "COL6A2_000164" "g.47532125dup" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46112211dup" "" "pathogenic" "" "0000176371" "2" "90" "21" "47545969" "47545969" "subst" "0" "00472" "COL6A2_000166" "g.47545969T>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46126055T>A" "" "pathogenic" "" "0000176372" "2" "90" "2" "47551978" "47551978" "subst" "0" "00472" "COL6A2_000157" "g.47551978C>T" "" "" "" "" "Variant Error [EREF/0]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "?" "" "0" "" "" "" "" "pathogenic" "" "0000234517" "11" "90" "21" "47545692" "47545710" "dup" "0" "00472" "COL6A2_000158" "g.47545692_47545710dup" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.46125778_46125796dup" "" "pathogenic" "" "0000247677" "0" "10" "21" "47552130" "47552130" "subst" "0.0980658" "02330" "COL6A2_000040" "g.47552130A>G" "" "" "" "COL6A2(NM_001849.4):c.2724A>G (p.T908=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132216A>G" "" "benign" "" "0000247681" "0" "10" "21" "47542861" "47542861" "subst" "0.814543" "02330" "COL6A2_000091" "g.47542861A>G" "" "" "" "COL6A2(NM_058175.3):c.1671+10A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122947A>G" "" "benign" "" "0000247688" "0" "90" "21" "47541472" "47541472" "del" "0" "02330" "COL6A2_000216" "g.47541472del" "" "" "" "COL6A2(NM_058175.3):c.1461delA (p.S488Lfs*57)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46121558del" "" "pathogenic" "" "0000247690" "0" "50" "21" "47533945" "47533945" "subst" "0.000134046" "02330" "COL6A2_000208" "g.47533945A>G" "" "" "" "COL6A2(NM_058175.3):c.759A>G (p.E253=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46114031A>G" "" "VUS" "" "0000247691" "0" "50" "21" "47536570" "47536570" "subst" "4.47744E-5" "02330" "COL6A2_000268" "g.47536570A>T" "" "" "" "COL6A2(NM_058175.3):c.933A>T (p.E311D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46116656A>T" "" "VUS" "" "0000247694" "0" "50" "21" "47542841" "47542841" "subst" "0.000150578" "02330" "COL6A2_000090" "g.47542841A>G" "" "" "" "COL6A2(NM_058175.3):c.1661A>G (p.K554R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122927A>G" "" "VUS" "" "0000248390" "0" "10" "21" "47552130" "47552130" "subst" "0.0980658" "02325" "COL6A2_000040" "g.47552130A>G" "" "" "" "COL6A2(NM_001849.4):c.2724A>G (p.T908=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132216A>G" "" "benign" "" "0000248460" "0" "10" "21" "47542861" "47542861" "subst" "0.814543" "02325" "COL6A2_000091" "g.47542861A>G" "" "" "" "COL6A2(NM_058175.3):c.1671+10A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122947A>G" "" "benign" "" "0000256523" "0" "50" "21" "47552089" "47552089" "subst" "0.00128523" "01943" "COL6A2_000034" "g.47552089A>C" "" "" "" "COL6A2(NM_001849.3):c.2683A>C (p.S895R, p.(Ser895Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132175A>C" "" "VUS" "" "0000264824" "0" "30" "21" "47552522" "47552522" "subst" "0" "02330" "COL6A2_000045" "g.47552522T>G" "" "" "" "COL6A2(NM_001849.4):c.*56T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132608T>G" "" "likely benign" "" "0000264825" "0" "50" "21" "47537797" "47537797" "subst" "0" "02330" "COL6A2_000211" "g.47537797G>T" "" "" "" "COL6A2(NM_058175.3):c.1063G>T (p.G355C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46117883G>T" "" "VUS" "" "0000264826" "0" "50" "21" "47537804" "47537804" "subst" "0.000967731" "02330" "COL6A2_000212" "g.47537804C>G" "" "" "" "COL6A2(NM_001849.4):c.1070C>G (p.(Pro357Arg)), COL6A2(NM_058175.3):c.1070C>G (p.P357R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46117890C>G" "" "VUS" "" "0000264827" "0" "50" "21" "47538572" "47538572" "subst" "0.00250447" "02330" "COL6A2_000213" "g.47538572C>T" "" "" "" "COL6A2(NM_001849.3):c.1161C>T (p.(Ile387=)), COL6A2(NM_058175.3):c.1161C>T (p.I387=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46118658C>T" "" "VUS" "" "0000264828" "0" "50" "21" "47538573" "47538573" "subst" "0" "02330" "COL6A2_000214" "g.47538573G>A" "" "" "" "COL6A2(NM_058175.3):c.1162G>A (p.G388R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46118659G>A" "" "VUS" "" "0000264829" "0" "10" "21" "47538960" "47538960" "subst" "0.784449" "02330" "COL6A2_000082" "g.47538960G>A" "" "" "" "COL6A2(NM_058175.3):c.1196G>A (p.S399N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46119046G>A" "" "benign" "" "0000264830" "0" "50" "21" "47539015" "47539015" "subst" "0.0015335" "02330" "COL6A2_000083" "g.47539015C>T" "" "" "" "COL6A2(NM_058175.3):c.1251C>T (p.R417=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46119101C>T" "" "VUS" "" "0000264831" "0" "10" "21" "47540421" "47540421" "subst" "0.177793" "02330" "COL6A2_000085" "g.47540421T>C" "" "" "" "COL6A2(NM_058175.3):c.1333-8T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46120507T>C" "" "benign" "" "0000264832" "0" "50" "21" "47540432" "47540432" "subst" "6.85495E-5" "02330" "COL6A2_000215" "g.47540432G>C" "" "" "" "COL6A2(NM_058175.3):c.1336G>C (p.D446H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46120518G>C" "" "VUS" "" "0000264833" "0" "90" "21" "47542021" "47542021" "subst" "0" "02330" "COL6A2_000217" "g.47542021G>A" "" "" "" "COL6A2(NM_058175.3):c.1522-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122107G>A" "" "pathogenic" "" "0000264834" "0" "10" "21" "47542052" "47542052" "subst" "0.00881776" "02330" "COL6A2_000048" "g.47542052C>T" "" "" "" "COL6A2(NM_001849.3):c.1552C>T (p.(Pro518Ser)), COL6A2(NM_058175.2):c.1552C>T (p.P518S), COL6A2(NM_058175.3):c.1552C>T (p.P518S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122138C>T" "" "benign" "" "0000264835" "0" "10" "21" "47542779" "47542779" "subst" "0.12067" "02330" "COL6A2_000089" "g.47542779C>T" "" "" "" "COL6A2(NM_058175.3):c.1609-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122865C>T" "" "benign" "" "0000264836" "0" "30" "21" "47544833" "47544833" "subst" "0.00190503" "02330" "COL6A2_000142" "g.47544833C>T" "" "" "" "COL6A2(NM_001849.3):c.1769C>T (p.(Thr590Met)), COL6A2(NM_001849.4):c.1769C>T (p.T590M), COL6A2(NM_058175.2):c.1769C>T (p.T590M), COL6A2(NM_058175....)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46124919C>T" "" "likely benign" "" "0000264837" "0" "10" "21" "47544838" "47544838" "subst" "0.0741047" "02330" "COL6A2_000097" "g.47544838G>A" "" "" "" "COL6A2(NM_058175.3):c.1770+4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46124924G>A" "" "benign" "" "0000264838" "0" "10" "21" "47545243" "47545243" "del" "0.0289229" "02330" "COL6A2_000218" "g.47545243del" "" "" "" "COL6A2(NM_001849.3):c.1816+18del (p.(=)), COL6A2(NM_058175.3):c.1816+18delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125329del" "" "benign" "" "0000264840" "0" "50" "21" "47545696" "47545696" "subst" "0.00101707" "02330" "COL6A2_000016" "g.47545696C>A" "" "" "" "COL6A2(NM_001849.3):c.1970-3C>A (p.(=)), COL6A2(NM_001849.4):c.1970-3C>A, COL6A2(NM_058175.2):c.1970-3C>A, COL6A2(NM_058175.3):c.1970-3C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125782C>A" "" "VUS" "" "0000264841" "0" "50" "21" "47531979" "47531979" "subst" "2.03333E-5" "02330" "COL6A2_000204" "g.47531979T>C" "" "" "" "COL6A2(NM_058175.3):c.202T>C (p.F68L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112065T>C" "" "VUS" "" "0000264842" "0" "10" "21" "47545768" "47545768" "subst" "0.492076" "02330" "COL6A2_000035" "g.47545768G>A" "" "" "" "COL6A2(NM_058175.3):c.2039G>A (p.R680H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000264843" "0" "10" "21" "47545823" "47545823" "subst" "0.491234" "02330" "COL6A2_000036" "g.47545823G>A" "" "" "" "COL6A2(NM_058175.3):c.2094G>A (p.A698=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000264844" "0" "10" "21" "47545826" "47545826" "subst" "0.49123" "02330" "COL6A2_000037" "g.47545826C>T" "" "" "" "COL6A2(NM_058175.3):c.2097C>T (p.G699=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000264845" "0" "10" "21" "47545913" "47545913" "subst" "0.389208" "02330" "COL6A2_000038" "g.47545913G>A" "" "" "" "COL6A2(NM_058175.3):c.2184G>A (p.V728=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125999G>A" "" "benign" "" "0000264846" "0" "50" "21" "47545949" "47545949" "subst" "0.00257359" "02330" "COL6A2_000223" "g.47545949T>C" "" "" "" "COL6A2(NM_001849.3):c.2220T>C (p.(Asp740=)), COL6A2(NM_058175.2):c.2220T>C (p.D740=), COL6A2(NM_058175.3):c.2220T>C (p.D740=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46126035T>C" "" "VUS" "" "0000264849" "0" "30" "21" "47549297" "47549297" "subst" "0.00514049" "02330" "COL6A2_000230" "g.47549297C>T" "" "" "" "COL6A2(NM_058174.2):c.2649C>T (p.(Phe883=)), COL6A2(NM_058174.3):c.2649C>T (p.F883=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46129383C>T" "" "likely benign" "" "0000264851" "0" "10" "21" "47552103" "47552103" "subst" "0.0343517" "02330" "COL6A2_000039" "g.47552103G>T" "" "" "" "COL6A2(NM_001849.3):c.2697G>T (p.(Thr899=)), COL6A2(NM_001849.4):c.2697G>T (p.T899=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000264852" "0" "10" "21" "47552209" "47552209" "subst" "0.079562" "02330" "COL6A2_000118" "g.47552209G>A" "" "" "" "COL6A2(NM_001849.3):c.2803G>A (p.G935R), COL6A2(NM_001849.4):c.2803G>A (p.G935R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132295G>A" "" "benign" "" "0000264853" "0" "10" "21" "47552262" "47552262" "subst" "0.00169053" "02330" "COL6A2_000236" "g.47552262G>A" "" "" "" "COL6A2(NM_001849.3):c.2856G>A (p.(Thr952=)), COL6A2(NM_001849.4):c.2856G>A (p.T952=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132348G>A" "" "benign" "" "0000264854" "0" "10" "21" "47552385" "47552385" "subst" "0.131278" "02330" "COL6A2_000042" "g.47552385C>T" "" "" "" "COL6A2(NM_001849.4):c.2979C>T (p.R993=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132471C>T" "" "benign" "" "0000264855" "0" "10" "21" "47552388" "47552388" "subst" "0.000504567" "02330" "COL6A2_000237" "g.47552388C>T" "" "" "" "COL6A2(NM_001849.3):c.2982C>T (p.A994=), COL6A2(NM_001849.4):c.2982C>T (p.A994=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132474C>T" "" "benign" "" "0000264856" "0" "10" "21" "47532093" "47532093" "subst" "0.00670518" "02330" "COL6A2_000070" "g.47532093G>A" "" "" "" "COL6A2(NM_001849.3):c.316G>A (p.(Glu106Lys)), COL6A2(NM_058175.2):c.316G>A (p.E106K), COL6A2(NM_058175.3):c.316G>A (p.E106K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112179G>A" "" "benign" "" "0000264857" "0" "50" "21" "47532276" "47532276" "subst" "0.000722773" "02330" "COL6A2_000206" "g.47532276G>A" "" "" "" "COL6A2(NM_058175.3):c.499G>A (p.G167S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112362G>A" "" "VUS" "" "0000264858" "0" "50" "21" "47532288" "47532288" "subst" "0.00115034" "02330" "COL6A2_000159" "g.47532288G>A" "" "" "" "COL6A2(NM_001849.3):c.511G>A (p.(Gly171Arg)), COL6A2(NM_001849.4):c.511G>A (p.G171R), COL6A2(NM_058175.2):c.511G>A (p.G171R), COL6A2(NM_058175.3):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000264859" "0" "10" "21" "47532440" "47532440" "subst" "0.0854267" "02330" "COL6A2_000072" "g.47532440C>T" "" "" "" "COL6A2(NM_058175.3):c.663C>T (p.P221=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112526C>T" "" "benign" "" "0000264860" "0" "10" "21" "47532456" "47532456" "subst" "0.0211517" "02330" "COL6A2_000031" "g.47532456G>A" "" "" "" "COL6A2(NM_001849.3):c.679G>A (p.(Asp227Asn)), COL6A2(NM_058175.2):c.679G>A (p.D227N), COL6A2(NM_058175.3):c.679G>A (p.D227N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000264861" "0" "10" "21" "47532500" "47532500" "subst" "0.0388318" "02330" "COL6A2_000073" "g.47532500C>T" "" "" "" "COL6A2(NM_001849.3):c.714+9C>T (p.(=)), COL6A2(NM_058175.3):c.714+9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112586C>T" "" "benign" "" "0000264862" "0" "70" "21" "47535787" "47535787" "subst" "0" "02330" "COL6A2_000209" "g.47535787G>A" "" "" "" "COL6A2(NM_058175.3):c.803G>A (p.G268D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46115873G>A" "" "likely pathogenic" "" "0000264863" "0" "90" "21" "47535796" "47535796" "subst" "0" "02330" "COL6A2_000132" "g.47535796G>A" "" "" "" "COL6A2(NM_058175.3):c.812G>A (p.G271D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46115882G>A" "" "pathogenic" "" "0000264864" "0" "90" "21" "47535841" "47535841" "subst" "0" "02330" "COL6A2_000210" "g.47535841T>G" "" "" "" "COL6A2(NM_058175.3):c.855+2T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46115927T>G" "" "pathogenic" "" "0000264865" "0" "90" "21" "47535942" "47535942" "subst" "0" "02330" "COL6A2_000167" "g.47535942G>T" "" "" "" "COL6A2(NM_058175.3):c.875G>T (p.G292V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46116028G>T" "" "pathogenic" "" "0000264866" "0" "10" "21" "47536546" "47536546" "subst" "0.504732" "02330" "COL6A2_000078" "g.47536546C>T" "" "" "" "COL6A2(NM_058175.3):c.928-19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46116632C>T" "" "benign" "" "0000264867" "0" "50" "21" "47536676" "47536676" "subst" "4.06947E-6" "02330" "COL6A2_000079" "g.47536676C>T" "" "" "" "COL6A2(NM_058175.3):c.955-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46116762C>T" "" "VUS" "" "0000264868" "0" "50" "21" "47536717" "47536717" "subst" "0.000317618" "02330" "COL6A2_000193" "g.47536717G>A" "" "" "" "COL6A2(NM_058175.3):c.988G>A (p.D330N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46116803G>A" "" "VUS" "" "0000267001" "0" "10" "21" "47538960" "47538960" "subst" "0.784449" "02325" "COL6A2_000082" "g.47538960G>A" "" "" "" "COL6A2(NM_058175.3):c.1196G>A (p.S399N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46119046G>A" "" "benign" "" "0000267002" "0" "10" "21" "47545768" "47545768" "subst" "0.492076" "02325" "COL6A2_000035" "g.47545768G>A" "" "" "" "COL6A2(NM_058175.3):c.2039G>A (p.R680H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000267003" "0" "10" "21" "47545823" "47545823" "subst" "0.491234" "02325" "COL6A2_000036" "g.47545823G>A" "" "" "" "COL6A2(NM_058175.3):c.2094G>A (p.A698=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000267004" "0" "10" "21" "47545826" "47545826" "subst" "0.49123" "02325" "COL6A2_000037" "g.47545826C>T" "" "" "" "COL6A2(NM_058175.3):c.2097C>T (p.G699=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000267005" "0" "50" "21" "47545911" "47545911" "subst" "0.000426788" "02325" "COL6A2_000222" "g.47545911G>A" "" "" "" "COL6A2(NM_001849.3):c.2182G>A (p.(Val728Met)), COL6A2(NM_058175.2):c.2182G>A (p.V728M), COL6A2(NM_058175.3):c.2182G>A (p.V728M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125997G>A" "" "VUS" "" "0000267007" "0" "10" "21" "47552209" "47552209" "subst" "0.079562" "02325" "COL6A2_000118" "g.47552209G>A" "" "" "" "COL6A2(NM_001849.3):c.2803G>A (p.G935R), COL6A2(NM_001849.4):c.2803G>A (p.G935R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132295G>A" "" "benign" "" "0000267008" "0" "10" "21" "47532440" "47532440" "subst" "0.0854267" "02325" "COL6A2_000072" "g.47532440C>T" "" "" "" "COL6A2(NM_058175.3):c.663C>T (p.P221=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112526C>T" "" "benign" "" "0000267009" "0" "10" "21" "47536546" "47536546" "subst" "0.504732" "02325" "COL6A2_000078" "g.47536546C>T" "" "" "" "COL6A2(NM_058175.3):c.928-19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46116632C>T" "" "benign" "" "0000270498" "0" "30" "21" "47542052" "47542052" "subst" "0.00881776" "02326" "COL6A2_000048" "g.47542052C>T" "" "" "" "COL6A2(NM_001849.3):c.1552C>T (p.(Pro518Ser)), COL6A2(NM_058175.2):c.1552C>T (p.P518S), COL6A2(NM_058175.3):c.1552C>T (p.P518S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122138C>T" "" "likely benign" "" "0000270499" "0" "10" "21" "47552209" "47552209" "subst" "0.079562" "02326" "COL6A2_000118" "g.47552209G>A" "" "" "" "COL6A2(NM_001849.3):c.2803G>A (p.G935R), COL6A2(NM_001849.4):c.2803G>A (p.G935R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132295G>A" "" "benign" "" "0000270500" "0" "30" "21" "47532093" "47532093" "subst" "0.00670518" "02326" "COL6A2_000070" "g.47532093G>A" "" "" "" "COL6A2(NM_001849.3):c.316G>A (p.(Glu106Lys)), COL6A2(NM_058175.2):c.316G>A (p.E106K), COL6A2(NM_058175.3):c.316G>A (p.E106K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112179G>A" "" "likely benign" "" "0000270501" "0" "10" "21" "47532456" "47532456" "subst" "0.0211517" "02326" "COL6A2_000031" "g.47532456G>A" "" "" "" "COL6A2(NM_001849.3):c.679G>A (p.(Asp227Asn)), COL6A2(NM_058175.2):c.679G>A (p.D227N), COL6A2(NM_058175.3):c.679G>A (p.D227N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000270502" "0" "90" "21" "47535942" "47535942" "subst" "0" "02326" "COL6A2_000134" "g.47535942G>A" "" "" "" "COL6A2(NM_001849.3):c.875G>A (p.G292D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46116028G>A" "" "pathogenic" "" "0000274276" "0" "50" "21" "47544833" "47544833" "subst" "0.00190503" "01943" "COL6A2_000142" "g.47544833C>T" "" "" "" "COL6A2(NM_001849.3):c.1769C>T (p.(Thr590Met)), COL6A2(NM_001849.4):c.1769C>T (p.T590M), COL6A2(NM_058175.2):c.1769C>T (p.T590M), COL6A2(NM_058175....)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46124919C>T" "" "VUS" "" "0000274277" "0" "30" "21" "47549116" "47549116" "subst" "3.28256E-5" "01943" "COL6A2_000228" "g.47549116C>T" "" "" "" "COL6A2(NM_058174.2):c.2468C>T (p.P823L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46129202C>T" "" "likely benign" "" "0000274278" "0" "30" "21" "47552154" "47552154" "subst" "0" "01943" "COL6A2_000234" "g.47552154C>A" "" "" "" "COL6A2(NM_001849.3):c.2748C>A (p.H916Q, p.(His916Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132240C>A" "" "likely benign" "" "0000287970" "0" "30" "21" "47556977" "47556977" "subst" "3.2844E-5" "01943" "FTCD_000002" "g.47556977C>T" "" "" "" "FTCD(NM_006657.2):c.1550G>A (p.R517H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46137063C>T" "" "likely benign" "" "0000328737" "0" "30" "21" "47532288" "47532288" "subst" "0.00115034" "01804" "COL6A2_000159" "g.47532288G>A" "" "" "" "COL6A2(NM_001849.3):c.511G>A (p.(Gly171Arg)), COL6A2(NM_001849.4):c.511G>A (p.G171R), COL6A2(NM_058175.2):c.511G>A (p.G171R), COL6A2(NM_058175.3):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112374G>A" "" "likely benign" "" "0000328739" "0" "30" "21" "47532456" "47532456" "subst" "0.0211517" "01804" "COL6A2_000031" "g.47532456G>A" "" "" "" "COL6A2(NM_001849.3):c.679G>A (p.(Asp227Asn)), COL6A2(NM_058175.2):c.679G>A (p.D227N), COL6A2(NM_058175.3):c.679G>A (p.D227N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112542G>A" "" "likely benign" "" "0000328740" "0" "30" "21" "47535816" "47535816" "subst" "0.00223085" "01804" "COL6A2_000077" "g.47535816G>A" "" "" "" "COL6A2(NM_001849.3):c.832G>A (p.(Glu278Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46115902G>A" "" "likely benign" "" "0000328741" "0" "30" "21" "47542052" "47542052" "subst" "0.00881776" "01804" "COL6A2_000048" "g.47542052C>T" "" "" "" "COL6A2(NM_001849.3):c.1552C>T (p.(Pro518Ser)), COL6A2(NM_058175.2):c.1552C>T (p.P518S), COL6A2(NM_058175.3):c.1552C>T (p.P518S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122138C>T" "" "likely benign" "" "0000328742" "0" "30" "21" "47545243" "47545243" "del" "0.0289229" "01804" "COL6A2_000218" "g.47545243del" "" "" "" "COL6A2(NM_001849.3):c.1816+18del (p.(=)), COL6A2(NM_058175.3):c.1816+18delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125329del" "" "likely benign" "" "0000328744" "0" "50" "21" "47545698" "47545698" "subst" "0" "01804" "COL6A2_000220" "g.47545698G>A" "" "" "" "COL6A2(NM_001849.3):c.1970-1G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125784G>A" "" "VUS" "" "0000328745" "0" "50" "21" "47545737" "47545737" "subst" "1.22164E-5" "01804" "COL6A2_000221" "g.47545737A>G" "" "" "" "COL6A2(NM_001849.4):c.2008A>G (p.(Thr670Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125823A>G" "" "VUS" "" "0000328746" "0" "30" "21" "47545889" "47545889" "subst" "0.00426333" "01804" "COL6A2_000107" "g.47545889C>G" "" "" "" "COL6A2(NM_001849.3):c.2160C>G (p.(Arg720=)), COL6A2(NM_058175.3):c.2160C>G (p.R720=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125975C>G" "" "likely benign" "" "0000328747" "0" "30" "21" "47545963" "47545963" "subst" "6.50809E-5" "01804" "COL6A2_000224" "g.47545963G>A" "" "" "" "COL6A2(NM_001849.3):c.2234G>A (p.(Arg745Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46126049G>A" "" "likely benign" "" "0000328748" "0" "50" "21" "47546007" "47546007" "subst" "4.88337E-5" "01804" "COL6A2_000225" "g.47546007G>A" "" "" "" "COL6A2(NM_001849.3):c.2278G>A (p.(Gly760Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46126093G>A" "" "VUS" "" "0000328749" "0" "30" "21" "47546080" "47546080" "subst" "0.00443388" "01804" "COL6A2_000021" "g.47546080G>A" "" "" "" "COL6A2(NM_001849.3):c.2351G>A (p.(Arg784His)), COL6A2(NM_058175.2):c.2351G>A (p.R784H), COL6A2(NM_058175.3):c.2351G>A (p.R784H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46126166G>A" "" "likely benign" "" "0000328750" "0" "50" "21" "47549115" "47549115" "subst" "0.000422408" "01804" "COL6A2_000227" "g.47549115C>A" "" "" "" "COL6A2(NM_058174.2):c.2467C>A (p.(Pro823Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46129201C>A" "" "VUS" "" "0000328752" "0" "30" "21" "47549297" "47549297" "subst" "0.00514049" "01804" "COL6A2_000230" "g.47549297C>T" "" "" "" "COL6A2(NM_058174.2):c.2649C>T (p.(Phe883=)), COL6A2(NM_058174.3):c.2649C>T (p.F883=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46129383C>T" "" "likely benign" "" "0000328753" "0" "50" "21" "47551934" "47551934" "subst" "0.000199614" "01804" "COL6A2_000173" "g.47551934G>A" "" "" "" "COL6A2(NM_001849.3):c.2528G>A (p.(Arg843Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132020G>A" "" "VUS" "" "0000328755" "0" "50" "21" "47552006" "47552006" "subst" "0.000891636" "01804" "COL6A2_000232" "g.47552006G>A" "" "" "" "COL6A2(NM_001849.3):c.2600G>A (p.(Arg867Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132092G>A" "" "VUS" "" "0000328756" "0" "30" "21" "47552103" "47552103" "subst" "0.0343517" "01804" "COL6A2_000039" "g.47552103G>T" "" "" "" "COL6A2(NM_001849.3):c.2697G>T (p.(Thr899=)), COL6A2(NM_001849.4):c.2697G>T (p.T899=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132189G>T" "" "likely benign" "" "0000328757" "0" "30" "21" "47552175" "47552175" "subst" "0.00507529" "01804" "COL6A2_000117" "g.47552175C>T" "" "" "" "COL6A2(NM_001849.3):c.2769C>T (p.(His923=), p.H923=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132261C>T" "" "likely benign" "" "0000328758" "0" "30" "21" "47552187" "47552187" "subst" "0" "01804" "COL6A2_000235" "g.47552187C>G" "" "" "" "COL6A2(NM_001849.3):c.2781C>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132273C>G" "" "likely benign" "" "0000328759" "0" "30" "21" "47552201" "47552201" "subst" "0.00252178" "01804" "COL6A2_000041" "g.47552201C>T" "" "" "" "COL6A2(NM_001849.3):c.2795C>T (p.P932L, p.(Pro932Leu)), COL6A2(NM_001849.4):c.2795C>T (p.P932L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132287C>T" "" "likely benign" "" "0000328760" "0" "30" "21" "47552389" "47552389" "subst" "0.00254957" "01804" "COL6A2_000123" "g.47552389G>A" "" "" "" "COL6A2(NM_001849.3):c.2983G>A (p.(Ala995Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132475G>A" "" "likely benign" "" "0000328761" "0" "30" "21" "47552406" "47552406" "subst" "4.2482E-6" "01804" "COL6A2_000238" "g.47552406G>A" "" "" "" "COL6A2(NM_001849.3):c.3000G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132492G>A" "" "likely benign" "" "0000328762" "0" "50" "21" "47552423" "47552423" "subst" "0.00044732" "01804" "COL6A2_000239" "g.47552423C>T" "" "" "" "COL6A2(NM_001849.3):c.3017C>T (p.(Ala1006Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132509C>T" "" "VUS" "" "0000338190" "0" "10" "21" "47532500" "47532500" "subst" "0.0388318" "02327" "COL6A2_000073" "g.47532500C>T" "" "" "" "COL6A2(NM_001849.3):c.714+9C>T (p.(=)), COL6A2(NM_058175.3):c.714+9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112586C>T" "" "benign" "" "0000338193" "0" "10" "21" "47536546" "47536546" "subst" "0.504732" "02327" "COL6A2_000078" "g.47536546C>T" "" "" "" "COL6A2(NM_058175.3):c.928-19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46116632C>T" "" "benign" "" "0000338194" "0" "30" "21" "47536546" "47536547" "ins" "0" "02327" "COL6A2_000244" "g.47536546_47536547insT" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46116632_46116633insT" "" "likely benign" "" "0000338195" "0" "10" "21" "47540421" "47540421" "subst" "0.177793" "02327" "COL6A2_000085" "g.47540421T>C" "" "" "" "COL6A2(NM_058175.3):c.1333-8T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46120507T>C" "" "benign" "" "0000338196" "0" "10" "21" "47542075" "47542075" "subst" "0.00140745" "02327" "COL6A2_000252" "g.47542075G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122161G>A" "" "benign" "" "0000338197" "0" "10" "21" "47542779" "47542779" "subst" "0.12067" "02327" "COL6A2_000089" "g.47542779C>T" "" "" "" "COL6A2(NM_058175.3):c.1609-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122865C>T" "" "benign" "" "0000338198" "0" "90" "21" "47542852" "47542852" "subst" "0" "02327" "COL6A2_000255" "g.47542852G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122938G>A" "" "pathogenic" "" "0000338199" "0" "10" "21" "47542861" "47542861" "subst" "0.814543" "02327" "COL6A2_000091" "g.47542861A>G" "" "" "" "COL6A2(NM_058175.3):c.1671+10A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122947A>G" "" "benign" "" "0000338200" "0" "10" "21" "47544838" "47544838" "subst" "0.0741047" "02327" "COL6A2_000097" "g.47544838G>A" "" "" "" "COL6A2(NM_058175.3):c.1770+4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46124924G>A" "" "benign" "" "0000338202" "0" "30" "21" "47545696" "47545696" "subst" "0.00101707" "02327" "COL6A2_000016" "g.47545696C>A" "" "" "" "COL6A2(NM_001849.3):c.1970-3C>A (p.(=)), COL6A2(NM_001849.4):c.1970-3C>A, COL6A2(NM_058175.2):c.1970-3C>A, COL6A2(NM_058175.3):c.1970-3C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125782C>A" "" "likely benign" "" "0000338203" "0" "10" "21" "47552624" "47552624" "subst" "0" "02327" "COL6A2_000267" "g.47552624C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132710C>T" "" "benign" "" "0000340144" "0" "30" "21" "47538572" "47538572" "subst" "0.00250447" "02327" "COL6A2_000213" "g.47538572C>T" "" "" "" "COL6A2(NM_001849.3):c.1161C>T (p.(Ile387=)), COL6A2(NM_058175.3):c.1161C>T (p.I387=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46118658C>T" "" "likely benign" "" "0000340145" "0" "10" "21" "47545823" "47545823" "subst" "0.491234" "02327" "COL6A2_000036" "g.47545823G>A" "" "" "" "COL6A2(NM_058175.3):c.2094G>A (p.A698=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125909G>A" "" "benign" "" "0000340146" "0" "10" "21" "47545826" "47545826" "subst" "0.49123" "02327" "COL6A2_000037" "g.47545826C>T" "" "" "" "COL6A2(NM_058175.3):c.2097C>T (p.G699=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125912C>T" "" "benign" "" "0000340147" "0" "10" "21" "47545913" "47545913" "subst" "0.389208" "02327" "COL6A2_000038" "g.47545913G>A" "" "" "" "COL6A2(NM_058175.3):c.2184G>A (p.V728=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125999G>A" "" "benign" "" "0000340148" "0" "10" "21" "47546060" "47546060" "subst" "0.000386123" "02327" "COL6A2_000261" "g.47546060C>T" "" "" "" "COL6A2(NM_001849.3):c.2331C>T (p.(Cys777=)), COL6A2(NM_058175.2):c.2331C>T (p.C777=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46126146C>T" "" "benign" "" "0000340149" "0" "10" "21" "47552103" "47552103" "subst" "0.0343517" "02327" "COL6A2_000039" "g.47552103G>T" "" "" "" "COL6A2(NM_001849.3):c.2697G>T (p.(Thr899=)), COL6A2(NM_001849.4):c.2697G>T (p.T899=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132189G>T" "" "benign" "" "0000340150" "0" "10" "21" "47552130" "47552130" "subst" "0.0980658" "02327" "COL6A2_000040" "g.47552130A>G" "" "" "" "COL6A2(NM_001849.4):c.2724A>G (p.T908=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132216A>G" "" "benign" "" "0000340151" "0" "10" "21" "47552385" "47552385" "subst" "0.131278" "02327" "COL6A2_000042" "g.47552385C>T" "" "" "" "COL6A2(NM_001849.4):c.2979C>T (p.R993=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132471C>T" "" "benign" "" "0000340740" "0" "30" "21" "47532287" "47532287" "subst" "0.00338552" "02327" "COL6A2_000071" "g.47532287C>T" "" "" "" "COL6A2(NM_001849.3):c.510C>T (p.(Cys170=)), COL6A2(NM_058175.2):c.510C>T (p.C170=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112373C>T" "" "likely benign" "" "0000340756" "0" "10" "21" "47545892" "47545892" "subst" "0.00807094" "02327" "COL6A2_000108" "g.47545892G>A" "" "" "" "COL6A2(NM_001849.3):c.2163G>A (p.(Gln721=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125978G>A" "" "benign" "" "0000340903" "0" "10" "21" "47532440" "47532440" "subst" "0.0854267" "02327" "COL6A2_000072" "g.47532440C>T" "" "" "" "COL6A2(NM_058175.3):c.663C>T (p.P221=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112526C>T" "" "benign" "" "0000340991" "0" "10" "21" "47532260" "47532260" "subst" "0.000496124" "02327" "COL6A2_000240" "g.47532260C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112346C>T" "" "benign" "" "0000342931" "0" "50" "21" "47540454" "47540454" "subst" "7.30353E-5" "02327" "COL6A2_000248" "g.47540454G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46120540G>A" "" "VUS" "" "0000342994" "0" "10" "21" "47541477" "47541477" "subst" "0.00169113" "02327" "COL6A2_000250" "g.47541477G>A" "" "" "" "COL6A2(NM_001849.3):c.1466G>A (p.(Arg489Gln)), COL6A2(NM_058175.2):c.1466G>A (p.R489Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46121563G>A" "" "benign" "" "0000343074" "0" "90" "21" "47542795" "47542795" "subst" "1.22074E-5" "02327" "COL6A2_000254" "g.47542795C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122881C>T" "" "pathogenic" "" "0000343117" "0" "50" "21" "47544599" "47544599" "subst" "0.000753159" "02327" "COL6A2_000256" "g.47544599G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46124685G>A" "" "VUS" "" "0000343256" "0" "10" "21" "47545768" "47545768" "subst" "0.492076" "02327" "COL6A2_000035" "g.47545768G>A" "" "" "" "COL6A2(NM_058175.3):c.2039G>A (p.R680H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125854G>A" "" "benign" "" "0000343322" "0" "50" "21" "47545942" "47545942" "subst" "0" "02327" "COL6A2_000260" "g.47545942G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46126028G>C" "" "VUS" "" "0000343402" "0" "70" "21" "47551894" "47551894" "subst" "0" "02327" "COL6A2_000264" "g.47551894C>T" "" "" "" "COL6A2(NM_001849.3):c.2488C>T (p.R830W), COL6A2(NM_001849.4):c.2488C>T (p.R830W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46131980C>T" "" "likely pathogenic" "" "0000343862" "0" "50" "21" "47552409" "47552409" "subst" "0.000102174" "02327" "COL6A2_000266" "g.47552409C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132495C>A" "" "VUS" "" "0000344002" "0" "10" "21" "47532456" "47532456" "subst" "0.0211517" "02327" "COL6A2_000031" "g.47532456G>A" "" "" "" "COL6A2(NM_001849.3):c.679G>A (p.(Asp227Asn)), COL6A2(NM_058175.2):c.679G>A (p.D227N), COL6A2(NM_058175.3):c.679G>A (p.D227N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112542G>A" "" "benign" "" "0000344103" "0" "50" "21" "47540432" "47540432" "subst" "0.000430883" "02327" "COL6A2_000247" "g.47540432G>A" "" "" "" "COL6A2(NM_001849.3):c.1336G>A (p.(Asp446Asn)), COL6A2(NM_058175.3):c.1336G>A (p.D446N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46120518G>A" "" "VUS" "" "0000344104" "0" "50" "21" "47540432" "47540432" "subst" "6.85495E-5" "02327" "COL6A2_000215" "g.47540432G>C" "" "" "" "COL6A2(NM_058175.3):c.1336G>C (p.D446H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46120518G>C" "" "VUS" "" "0000344364" "0" "50" "21" "47537344" "47537344" "subst" "0" "02327" "COL6A2_000245" "g.47537344T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46117430T>G" "" "VUS" "" "0000344464" "0" "90" "21" "47546448" "47546448" "subst" "0" "02327" "COL6A2_000263" "g.47546448C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46126534C>A" "" "pathogenic" "" "0000345047" "0" "30" "21" "47532093" "47532093" "subst" "0.00670518" "02327" "COL6A2_000070" "g.47532093G>A" "" "" "" "COL6A2(NM_001849.3):c.316G>A (p.(Glu106Lys)), COL6A2(NM_058175.2):c.316G>A (p.E106K), COL6A2(NM_058175.3):c.316G>A (p.E106K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112179G>A" "" "likely benign" "" "0000345788" "0" "30" "21" "47532288" "47532288" "subst" "0.00115034" "02327" "COL6A2_000159" "g.47532288G>A" "" "" "" "COL6A2(NM_001849.3):c.511G>A (p.(Gly171Arg)), COL6A2(NM_001849.4):c.511G>A (p.G171R), COL6A2(NM_058175.2):c.511G>A (p.G171R), COL6A2(NM_058175.3):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46112374G>A" "" "likely benign" "" "0000345933" "0" "90" "21" "47535786" "47535786" "subst" "0" "02327" "COL6A2_000055" "g.47535786G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46115872G>A" "" "pathogenic" "" "0000345955" "0" "50" "21" "47535933" "47535933" "subst" "0" "02327" "COL6A2_000243" "g.47535933G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46116019G>A" "" "VUS" "" "0000346032" "0" "50" "21" "47537834" "47537834" "subst" "0" "02327" "COL6A2_000246" "g.47537834G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46117920G>A" "" "VUS" "" "0000346107" "0" "50" "21" "47541029" "47541029" "subst" "1.2336E-5" "02327" "COL6A2_000249" "g.47541029G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46121115G>A" "" "VUS" "" "0000346116" "0" "50" "21" "47541480" "47541480" "subst" "0" "02327" "COL6A2_000251" "g.47541480G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46121566G>A" "" "VUS" "" "0000346145" "0" "70" "21" "47542428" "47542428" "subst" "4.08017E-6" "02327" "COL6A2_000253" "g.47542428G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122514G>A" "" "likely pathogenic" "" "0000346175" "0" "70" "21" "47544808" "47544808" "subst" "1.22099E-5" "02327" "COL6A2_000257" "g.47544808G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46124894G>A" "" "likely pathogenic" "" "0000346229" "0" "50" "21" "47545827" "47545827" "subst" "4.06395E-6" "02327" "COL6A2_000017" "g.47545827G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125913G>A" "" "VUS" "" "0000346295" "0" "30" "21" "47551924" "47551924" "subst" "5.08182E-5" "02327" "COL6A2_000265" "g.47551924G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132010G>A" "" "likely benign" "" "0000346329" "0" "10" "21" "47552209" "47552209" "subst" "0.079562" "02327" "COL6A2_000118" "g.47552209G>A" "" "" "" "COL6A2(NM_001849.3):c.2803G>A (p.G935R), COL6A2(NM_001849.4):c.2803G>A (p.G935R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46132295G>A" "" "benign" "" "0000348486" "0" "10" "21" "47542052" "47542052" "subst" "0.00881776" "02327" "COL6A2_000048" "g.47542052C>T" "" "" "" "COL6A2(NM_001849.3):c.1552C>T (p.(Pro518Ser)), COL6A2(NM_058175.2):c.1552C>T (p.P518S), COL6A2(NM_058175.3):c.1552C>T (p.P518S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46122138C>T" "" "benign" "" "0000348981" "0" "10" "21" "47538960" "47538960" "subst" "0.784449" "02327" "COL6A2_000082" "g.47538960G>A" "" "" "" "COL6A2(NM_058175.3):c.1196G>A (p.S399N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46119046G>A" "" "benign" "" "0000349592" "0" "90" "21" "47545690" "47545690" "subst" "0.000106823" "02327" "COL6A2_000056" "g.47545690G>A" "" "" "" "COL6A2(NM_001849.3):c.1970-9G>A (p.?), COL6A2(NM_058175.2):c.1970-9G>A, COL6A2(NM_058175.3):c.1970-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic" "" "0000351217" "0" "50" "21" "47546408" "47546414" "del" "0" "02327" "COL6A2_000262" "g.47546408_47546414del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.46126494_46126500del" "" "VUS" "" "0000398521" "1" "70" "21" "47535814" "47535814" "subst" "0" "00006" "COL6A2_000269" "g.47535814G>A" "" "{PMID:Fichna 2018:29970176}" "" "" "ACMG grading: PM1, PM2, PP3, PP4; additional variants in CAV3, LAMA2, ANO5 – ITGA7, RYR1, SYNE2, TTN x3" "Germline" "" "" "0" "" "" "g.46115900G>A" "" "likely pathogenic" "ACMG" "0000439096" "0" "50" "21" "47552147" "47552149" "del" "0" "01164" "COL6A2_000270" "g.47552147_47552149del" "" "" "" "" "ACMG grading: PM4,PM2; co-occurrence with pathogenic variant in HINT1 (p.Arg37Pro) in homozygous state is regarded causative for the phenotype in the patient" "Germline" "" "rs746930351" "0" "" "" "g.46132233_46132235del" "" "VUS" "ACMG" "0000441101" "0" "50" "21" "47545783" "47545783" "subst" "4.06527E-6" "01164" "COL6A2_000271" "g.47545783C>T" "" "" "" "" "ACMG grading: PM2,PP3" "Germline" "" "rs564873527" "0" "" "" "g.46125869C>T" "" "VUS" "ACMG" "0000461681" "1" "50" "21" "47536717" "47536717" "subst" "0.000317618" "00430" "COL6A2_000193" "g.47536717G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46116803G>A" "" "VUS" "" "0000461682" "1" "50" "21" "47552299" "47552299" "subst" "0.000169972" "00430" "COL6A2_000412" "g.47552299C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in COL6A2" "Germline" "" "" "0" "" "" "g.46132385C>T" "" "VUS" "" "0000461683" "1" "50" "21" "47542843" "47542843" "subst" "0" "00430" "COL6A2_000348" "g.47542843G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in COL6A2" "Germline" "" "" "0" "" "" "g.46122929G>A" "" "VUS" "" "0000461684" "1" "50" "21" "47545696" "47545696" "subst" "0.00101707" "00430" "COL6A2_000016" "g.47545696C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in COL6A2" "Germline" "" "" "0" "" "" "g.46125782C>A" "" "VUS" "" "0000461685" "1" "50" "21" "47551942" "47551942" "subst" "4.68667E-5" "00430" "COL6A2_000381" "g.47551942G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132028G>A" "" "VUS" "" "0000461686" "1" "50" "21" "47541507" "47541507" "subst" "4.07528E-6" "00430" "COL6A2_000065" "g.47541507G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46121593G>A" "" "VUS" "" "0000461687" "1" "50" "21" "47544814" "47544814" "subst" "4.07024E-6" "00430" "COL6A2_000353" "g.47544814C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46124900C>T" "" "VUS" "" "0000461688" "1" "50" "21" "47545888" "47545888" "subst" "5.69032E-5" "00430" "COL6A2_000366" "g.47545888G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125974G>A" "" "VUS" "" "0000461689" "1" "50" "21" "47532249" "47532249" "subst" "4.19706E-5" "00430" "COL6A2_000290" "g.47532249G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112335G>A" "" "VUS" "" "0000461690" "1" "50" "21" "47532345" "47532345" "subst" "0.000177871" "00430" "COL6A2_000293" "g.47532345G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112431G>A" "" "VUS" "" "0000461691" "1" "50" "21" "47552212" "47552212" "subst" "0" "00430" "COL6A2_000404" "g.47552212G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132298G>A" "" "VUS" "" "0000461692" "1" "50" "21" "47531946" "47531946" "subst" "4.07043E-5" "00430" "COL6A2_000279" "g.47531946G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112032G>A" "" "VUS" "" "0000461693" "1" "50" "21" "47551895" "47551895" "subst" "6.00019E-5" "00430" "COL6A2_000153" "g.47551895G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46131981G>A" "" "VUS" "" "0000461694" "1" "50" "21" "47552390" "47552392" "del" "0" "00430" "COL6A2_000421" "g.47552390_47552392del" "" "{PMID:Nallamilli 2018:30564623}" "" "2984_2986delCCG" "no second variant" "Germline" "" "" "0" "" "" "g.46132476_46132478del" "" "VUS" "" "0000461695" "1" "50" "21" "47537794" "47537794" "subst" "6.21185E-5" "00430" "COL6A2_000323" "g.47537794G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46117880G>A" "" "VUS" "" "0000461696" "1" "50" "21" "47545738" "47545738" "subst" "0" "00430" "COL6A2_000362" "g.47545738C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125824C>A" "" "VUS" "" "0000461697" "1" "50" "21" "47532358" "47532358" "subst" "0" "00430" "COL6A2_000294" "g.47532358A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112444A>G" "" "VUS" "" "0000461698" "1" "50" "21" "47538540" "47538540" "subst" "0.000373821" "00430" "COL6A2_000325" "g.47538540C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46118626C>T" "" "VUS" "" "0000461699" "1" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00430" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000461700" "1" "50" "21" "47551934" "47551934" "subst" "0.000199614" "00430" "COL6A2_000173" "g.47551934G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132020G>A" "" "VUS" "" "0000461701" "1" "50" "21" "47545696" "47545696" "subst" "0.00101707" "00430" "COL6A2_000016" "g.47545696C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125782C>A" "" "VUS" "" "0000461702" "1" "50" "21" "47545696" "47545696" "subst" "0.00101707" "00430" "COL6A2_000016" "g.47545696C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125782C>A" "" "VUS" "" "0000461703" "1" "50" "21" "47552404" "47552404" "subst" "6.79365E-5" "00430" "COL6A2_000424" "g.47552404A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132490A>G" "" "VUS" "" "0000461704" "1" "50" "21" "47537804" "47537804" "subst" "0.000967731" "00430" "COL6A2_000212" "g.47537804C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46117890C>G" "" "VUS" "" "0000461705" "1" "50" "21" "47531385" "47531385" "subst" "1.64491E-5" "00430" "COL6A2_000273" "g.47531385G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46111471G>A" "" "VUS" "" "0000461706" "1" "50" "21" "47537345" "47537345" "subst" "0" "00430" "COL6A2_000318" "g.47537345G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "unknown zygosity" "Germline" "" "" "0" "" "" "g.46117431G>A" "" "VUS" "" "0000461707" "1" "50" "21" "47533977" "47533977" "subst" "0.000434641" "00430" "COL6A2_000305" "g.47533977G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46114063G>A" "" "VUS" "" "0000461708" "1" "50" "21" "47552191" "47552191" "subst" "0.000166165" "00430" "COL6A2_000170" "g.47552191G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132277G>A" "" "VUS" "" "0000461709" "1" "50" "21" "47552065" "47552065" "subst" "7.68967E-5" "00430" "COL6A2_000393" "g.47552065G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132151G>A" "" "VUS" "" "0000461710" "1" "50" "21" "47537365" "47537365" "subst" "0.000175609" "00430" "COL6A2_000320" "g.47537365C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46117451C>T" "" "VUS" "" "0000461711" "1" "50" "21" "47531953" "47531953" "subst" "0" "00430" "COL6A2_000280" "g.47531953T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112039T>C" "" "VUS" "" "0000461712" "1" "50" "21" "47552356" "47552356" "subst" "2.93051E-5" "00430" "COL6A2_000417" "g.47552356G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132442G>A" "" "VUS" "" "0000461713" "1" "50" "21" "47552366" "47552366" "subst" "8.39856E-5" "00430" "COL6A2_000418" "g.47552366C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132452C>T" "" "VUS" "" "0000461714" "1" "50" "21" "47538525" "47538525" "subst" "1.64439E-5" "00430" "COL6A2_000324" "g.47538525C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46118611C>T" "" "VUS" "" "0000461715" "1" "50" "21" "47552374" "47552374" "subst" "8.41375E-6" "00430" "COL6A2_000420" "g.47552374C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132460C>G" "" "VUS" "" "0000461716" "1" "70" "21" "47535933" "47535933" "subst" "0" "00430" "COL6A2_000243" "g.47535933G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46116019G>A" "" "likely pathogenic" "" "0000461717" "1" "50" "21" "47545696" "47545696" "subst" "0.00101707" "00430" "COL6A2_000016" "g.47545696C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46125782C>A" "" "VUS" "" "0000461718" "1" "50" "21" "47546055" "47546055" "subst" "0.000143574" "00430" "COL6A2_000373" "g.47546055G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46126141G>A" "" "VUS" "" "0000461719" "1" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00430" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000461720" "1" "50" "21" "47545899" "47545899" "subst" "0.00105677" "00430" "COL6A2_000259" "g.47545899C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46125985C>T" "" "VUS" "" "0000461721" "1" "70" "21" "0" "0" "" "0" "00430" "COL6A2_000000" "g.?" "" "{PMID:Nallamilli 2018:30564623}" "" "6193G>A (G2065S)" "no second variant" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000461722" "1" "50" "21" "47546121" "47546123" "del" "0" "00430" "COL6A2_000376" "g.47546121_47546123del" "" "{PMID:Nallamilli 2018:30564623}" "" "2392_2394delATC" "no second variant" "Germline" "" "" "0" "" "" "g.46126207_46126209del" "" "VUS" "" "0000461723" "1" "50" "21" "47552017" "47552017" "subst" "9.92605E-6" "00430" "COL6A2_000151" "g.47552017G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132103G>A" "" "VUS" "" "0000461724" "1" "50" "21" "47533979" "47533979" "subst" "0" "00430" "COL6A2_000306" "g.47533979G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46114065G>A" "" "VUS" "" "0000461725" "1" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00430" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000461726" "1" "50" "21" "47532405" "47532405" "subst" "0.000262059" "00430" "COL6A2_000298" "g.47532405G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112491G>A" "" "VUS" "" "0000461727" "1" "50" "21" "47552113" "47552113" "subst" "6.90307E-5" "00430" "COL6A2_000397" "g.47552113G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132199G>A" "" "VUS" "" "0000461728" "1" "50" "21" "47552039" "47552039" "subst" "1.65709E-5" "00430" "COL6A2_000391" "g.47552039C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132125C>T" "" "VUS" "" "0000461729" "1" "50" "21" "47542825" "47542825" "subst" "4.06918E-6" "00430" "COL6A2_000347" "g.47542825G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46122911G>A" "" "VUS" "" "0000461730" "1" "50" "21" "47551942" "47551942" "subst" "4.68667E-5" "00430" "COL6A2_000381" "g.47551942G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132028G>A" "" "VUS" "" "0000461731" "1" "50" "21" "47552062" "47552062" "subst" "0.000141687" "00430" "COL6A2_000392" "g.47552062G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132148G>A" "" "VUS" "" "0000461732" "1" "50" "21" "47552117" "47552117" "subst" "0.000343621" "00430" "COL6A2_000398" "g.47552117C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132203C>T" "" "VUS" "" "0000461733" "1" "50" "21" "47545962" "47545962" "subst" "4.06755E-5" "00430" "COL6A2_000370" "g.47545962C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46126048C>T" "" "VUS" "" "0000461734" "1" "50" "21" "47546106" "47546106" "subst" "8.37689E-6" "00430" "COL6A2_000375" "g.47546106G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46126192G>A" "" "VUS" "" "0000461735" "1" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00430" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000461736" "1" "50" "21" "47537804" "47537804" "subst" "0.000967731" "00430" "COL6A2_000212" "g.47537804C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46117890C>G" "" "VUS" "" "0000461737" "1" "70" "21" "47544835" "47544835" "del" "0" "00430" "COL6A2_000356" "g.47544835del" "" "{PMID:Nallamilli 2018:30564623}" "" "1770+1delG" "" "Germline" "" "" "0" "" "" "g.46124921del" "" "likely pathogenic" "" "0000461738" "1" "50" "21" "47552144" "47552146" "del" "0" "00430" "COL6A2_000399" "g.47552144_47552146del" "" "{PMID:Nallamilli 2018:30564623}" "" "2738_2740delCCT" "" "Germline" "" "" "0" "" "" "g.46132230_46132232del" "" "VUS" "" "0000461739" "1" "50" "21" "47552032" "47552032" "subst" "1.06691E-5" "00430" "COL6A2_000389" "g.47552032C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132118C>T" "" "VUS" "" "0000461740" "1" "50" "21" "47552035" "47552035" "subst" "5.95857E-5" "00430" "COL6A2_000390" "g.47552035G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132121G>A" "" "VUS" "" "0000461741" "1" "50" "21" "0" "0" "" "0" "00430" "COL6A2_000000" "g.?" "" "{PMID:Nallamilli 2018:30564623}" "" "350T>C (V117A)" "no second variant" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000461742" "1" "50" "21" "47545696" "47545696" "subst" "0.00101707" "00430" "COL6A2_000016" "g.47545696C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125782C>A" "" "VUS" "" "0000461743" "1" "50" "21" "47532001" "47532001" "subst" "8.13425E-6" "00430" "COL6A2_000282" "g.47532001C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112087C>T" "" "VUS" "" "0000461744" "1" "50" "21" "47552157" "47552157" "subst" "0.000633108" "00430" "COL6A2_000161" "g.47552157G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132243G>T" "" "VUS" "" "0000461745" "1" "50" "21" "47552401" "47552401" "subst" "0.000131551" "00430" "COL6A2_000423" "g.47552401G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132487G>A" "" "VUS" "" "0000461746" "1" "50" "21" "47552281" "47552281" "subst" "2.90722E-5" "00430" "COL6A2_000409" "g.47552281G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132367G>C" "" "VUS" "" "0000461747" "1" "50" "21" "47545393" "47545393" "subst" "0" "00430" "COL6A2_000359" "g.47545393T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in COL6A2" "Germline" "" "" "0" "" "" "g.46125479T>C" "" "VUS" "" "0000461748" "1" "50" "21" "47552201" "47552201" "subst" "0.00252178" "00430" "COL6A2_000041" "g.47552201C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in COL6A2" "Germline" "" "" "0" "" "" "g.46132287C>T" "" "VUS" "" "0000461749" "1" "50" "21" "47538572" "47538572" "subst" "0.00250447" "00430" "COL6A2_000213" "g.47538572C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46118658C>T" "" "VUS" "" "0000461750" "1" "50" "21" "47545845" "47545845" "subst" "0" "00430" "COL6A2_000364" "g.47545845G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46125931G>C" "" "VUS" "" "0000461751" "1" "50" "21" "47552201" "47552201" "subst" "0.00252178" "00430" "COL6A2_000041" "g.47552201C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132287C>T" "" "VUS" "" "0000461752" "1" "50" "21" "47545921" "47545921" "subst" "0" "00430" "COL6A2_000198" "g.47545921C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46126007C>T" "" "VUS" "" "0000461753" "1" "50" "21" "47536717" "47536717" "subst" "0.000317618" "00430" "COL6A2_000193" "g.47536717G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46116803G>A" "" "VUS" "" "0000461754" "1" "50" "21" "47536717" "47536717" "subst" "0.000317618" "00430" "COL6A2_000193" "g.47536717G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46116803G>A" "" "VUS" "" "0000461755" "1" "50" "21" "47551895" "47551895" "subst" "6.00019E-5" "00430" "COL6A2_000153" "g.47551895G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46131981G>A" "" "VUS" "" "0000461756" "1" "50" "21" "47552366" "47552366" "subst" "8.39856E-5" "00430" "COL6A2_000418" "g.47552366C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132452C>T" "" "VUS" "" "0000461757" "1" "50" "21" "47552341" "47552341" "subst" "0.000191803" "00430" "COL6A2_000415" "g.47552341G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132427G>A" "" "VUS" "" "0000461758" "1" "50" "21" "47541483" "47541483" "subst" "4.07495E-6" "00430" "COL6A2_000340" "g.47541483A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46121569A>G" "" "VUS" "" "0000461759" "1" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00430" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000461760" "1" "50" "21" "47552201" "47552201" "subst" "0.00252178" "00430" "COL6A2_000041" "g.47552201C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132287C>T" "" "VUS" "" "0000461761" "1" "50" "21" "47545911" "47545911" "subst" "0.000426788" "00430" "COL6A2_000222" "g.47545911G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125997G>A" "" "VUS" "" "0000461762" "1" "50" "21" "47541507" "47541507" "subst" "4.07528E-6" "00430" "COL6A2_000065" "g.47541507G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46121593G>A" "" "VUS" "" "0000461763" "1" "50" "21" "47552216" "47552216" "subst" "5.10456E-5" "00430" "COL6A2_000406" "g.47552216G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132302G>A" "" "VUS" "" "0000461764" "1" "70" "21" "47536310" "47536310" "subst" "0" "00430" "COL6A2_000314" "g.47536310G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46116396G>T" "" "likely pathogenic" "" "0000461765" "1" "50" "21" "47552201" "47552201" "subst" "0.00252178" "00430" "COL6A2_000041" "g.47552201C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132287C>T" "" "VUS" "" "0000461766" "1" "50" "21" "47538541" "47538541" "subst" "0.000123318" "00430" "COL6A2_000326" "g.47538541G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46118627G>A" "" "VUS" "" "0000461767" "1" "50" "21" "47532415" "47532415" "subst" "5.40145E-5" "00430" "COL6A2_000300" "g.47532415G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112501G>A" "" "VUS" "" "0000461768" "1" "90" "21" "47551999" "47552014" "dup" "0" "00430" "COL6A2_000385" "g.47551999_47552014dup" "" "{PMID:Nallamilli 2018:30564623}" "" "2593_2608dup16" "" "Germline" "" "" "0" "" "" "g.46132085_46132100dup" "" "pathogenic" "" "0000461769" "1" "50" "21" "47552201" "47552201" "subst" "0.00252178" "00430" "COL6A2_000041" "g.47552201C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132287C>T" "" "VUS" "" "0000461770" "1" "50" "21" "47532061" "47532061" "subst" "8.1414E-6" "00430" "COL6A2_000284" "g.47532061G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112147G>A" "" "VUS" "" "0000461771" "1" "50" "21" "47551988" "47551988" "subst" "0.000300171" "00430" "COL6A2_000115" "g.47551988G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132074G>A" "" "VUS" "" "0000461772" "1" "50" "21" "47545390" "47545390" "subst" "1.22043E-5" "00430" "COL6A2_000358" "g.47545390C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125476C>T" "" "VUS" "" "0000461773" "1" "50" "21" "47545926" "47545926" "subst" "0" "00430" "COL6A2_000369" "g.47545926G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46126012G>A" "" "VUS" "" "0000461774" "1" "90" "21" "47545423" "47545423" "subst" "0" "00430" "COL6A2_000015" "g.47545423G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125509G>A" "" "pathogenic" "" "0000461775" "1" "50" "21" "47532223" "47532223" "subst" "9.15134E-5" "00430" "COL6A2_000289" "g.47532223G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112309G>A" "" "VUS" "" "0000461776" "1" "50" "21" "47533977" "47533977" "subst" "0.000434641" "00430" "COL6A2_000305" "g.47533977G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46114063G>A" "" "VUS" "" "0000461777" "1" "50" "21" "47540432" "47540432" "subst" "6.85495E-5" "00430" "COL6A2_000215" "g.47540432G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46120518G>C" "" "VUS" "" "0000461778" "1" "50" "21" "47552236" "47552238" "del" "0" "00430" "COL6A2_000407" "g.47552236_47552238del" "" "{PMID:Nallamilli 2018:30564623}" "" "2830_2832delTTC" "no second variant" "Germline" "" "" "0" "" "" "g.46132322_46132324del" "" "VUS" "" "0000461779" "1" "90" "21" "47537368" "47537368" "subst" "0" "00430" "COL6A2_000321" "g.47537368G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46117454G>A" "" "pathogenic" "" "0000461780" "1" "50" "21" "47537326" "47537326" "subst" "0.000130769" "00430" "COL6A2_000317" "g.47537326C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46117412C>T" "" "VUS" "" "0000461781" "1" "50" "21" "47531965" "47531965" "subst" "0.000223705" "00430" "COL6A2_000281" "g.47531965C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112051C>T" "" "VUS" "" "0000461782" "1" "50" "21" "47551895" "47551895" "subst" "6.00019E-5" "00430" "COL6A2_000153" "g.47551895G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46131981G>A" "" "VUS" "" "0000461783" "1" "50" "21" "47532109" "47532109" "subst" "2.03834E-5" "00430" "COL6A2_000285" "g.47532109C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112195C>T" "" "VUS" "" "0000461784" "1" "50" "21" "47552201" "47552201" "subst" "0.00252178" "00430" "COL6A2_000041" "g.47552201C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132287C>T" "" "VUS" "" "0000461785" "1" "50" "21" "47545812" "47545812" "subst" "4.4702E-5" "00430" "COL6A2_000363" "g.47545812G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46125898G>A" "" "VUS" "" "0000461786" "1" "50" "21" "47552216" "47552216" "subst" "5.10456E-5" "00430" "COL6A2_000406" "g.47552216G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132302G>A" "" "VUS" "" "0000461787" "1" "50" "21" "47552062" "47552062" "subst" "0.000141687" "00430" "COL6A2_000392" "g.47552062G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132148G>A" "" "VUS" "" "0000461788" "1" "50" "21" "47537804" "47537804" "subst" "0.000967731" "00430" "COL6A2_000212" "g.47537804C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46117890C>G" "" "VUS" "" "0000461789" "1" "50" "21" "47532733" "47532733" "subst" "2.84634E-5" "00430" "COL6A2_000302" "g.47532733G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112819G>A" "" "VUS" "" "0000461790" "1" "50" "21" "47545206" "47545206" "subst" "2.04429E-5" "00430" "COL6A2_000357" "g.47545206G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125292G>C" "" "VUS" "" "0000461791" "1" "50" "21" "47545696" "47545696" "subst" "0.00101707" "00430" "COL6A2_000016" "g.47545696C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125782C>A" "" "VUS" "" "0000461792" "1" "90" "21" "47535932" "47535932" "subst" "0" "00430" "COL6A2_000312" "g.47535932G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46116018G>T" "" "pathogenic" "" "0000461793" "1" "90" "21" "47545423" "47545423" "subst" "0" "00430" "COL6A2_000015" "g.47545423G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46125509G>A" "" "pathogenic" "" "0000461794" "1" "90" "21" "47545423" "47545423" "subst" "0" "00430" "COL6A2_000015" "g.47545423G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46125509G>A" "" "pathogenic" "" "0000461795" "1" "50" "21" "47551991" "47551991" "subst" "0.000367304" "00430" "COL6A2_000384" "g.47551991G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132077G>A" "" "VUS" "" "0000461796" "1" "50" "21" "47533915" "47533925" "del" "0" "00430" "COL6A2_000303" "g.47533915_47533925del" "" "{PMID:Nallamilli 2018:30564623}" "" "736-7_739del11" "" "Germline" "" "" "0" "" "" "g.46114001_46114011del" "" "VUS" "" "0000461797" "1" "90" "21" "47533915" "47533925" "del" "0" "00430" "COL6A2_000303" "g.47533915_47533925del" "" "{PMID:Nallamilli 2018:30564623}" "" "736-7_739del11" "" "Germline" "" "" "0" "" "" "g.46114001_46114011del" "" "pathogenic" "" "0000461798" "1" "70" "21" "47535822" "47535822" "subst" "0" "00430" "COL6A2_000310" "g.47535822G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46115908G>C" "" "likely pathogenic" "" "0000461799" "1" "50" "21" "47542050" "47542050" "subst" "2.45262E-5" "00430" "COL6A2_000341" "g.47542050A>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46122136A>C" "" "VUS" "" "0000461800" "1" "50" "21" "47540432" "47540432" "subst" "0.000430883" "00430" "COL6A2_000247" "g.47540432G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46120518G>A" "" "VUS" "" "0000461801" "1" "50" "21" "47537357" "47537357" "subst" "0" "00430" "COL6A2_000319" "g.47537357C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46117443C>T" "" "VUS" "" "0000461802" "1" "50" "21" "47552341" "47552341" "subst" "0.000191803" "00430" "COL6A2_000415" "g.47552341G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132427G>A" "" "VUS" "" "0000461803" "1" "50" "21" "47552191" "47552191" "subst" "0.000166165" "00430" "COL6A2_000170" "g.47552191G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132277G>A" "" "VUS" "" "0000461804" "1" "50" "21" "47552281" "47552281" "subst" "2.90722E-5" "00430" "COL6A2_000409" "g.47552281G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132367G>C" "" "VUS" "" "0000461805" "1" "50" "21" "47545696" "47545696" "subst" "0.00101707" "00430" "COL6A2_000016" "g.47545696C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125782C>A" "" "VUS" "" "0000461806" "1" "50" "21" "47532420" "47532420" "subst" "4.14955E-5" "00430" "COL6A2_000301" "g.47532420G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112506G>A" "" "VUS" "" "0000461807" "1" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00430" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000461808" "1" "50" "21" "47545900" "47545900" "subst" "5.68999E-5" "00430" "COL6A2_000367" "g.47545900G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46125986G>T" "" "VUS" "" "0000461809" "1" "50" "21" "47535831" "47535831" "subst" "0" "00430" "COL6A2_000004" "g.47535831G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46115917G>A" "" "VUS" "" "0000461810" "1" "50" "21" "47545731" "47545731" "subst" "0.000105908" "00430" "COL6A2_000361" "g.47545731G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125817G>A" "" "VUS" "" "0000461811" "1" "50" "21" "47531412" "47531412" "subst" "0.000461745" "00430" "COL6A2_000274" "g.47531412G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46111498G>A" "" "VUS" "" "0000461812" "3" "70" "21" "47552017" "47552017" "subst" "9.92605E-6" "00430" "COL6A2_000151" "g.47552017G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132103G>A" "" "likely pathogenic" "" "0000461813" "1" "50" "21" "47551894" "47551894" "subst" "0" "00430" "COL6A2_000264" "g.47551894C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46131980C>T" "" "VUS" "" "0000461814" "1" "50" "21" "47552215" "47552215" "subst" "2.12708E-5" "00430" "COL6A2_000405" "g.47552215C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132301C>T" "" "VUS" "" "0000461815" "1" "50" "21" "47552151" "47552151" "subst" "4.96592E-5" "00430" "COL6A2_000400" "g.47552151G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132237G>A" "" "VUS" "" "0000461816" "1" "90" "21" "47535968" "47535968" "subst" "0" "00430" "COL6A2_000313" "g.47535968G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46116054G>C" "" "pathogenic" "" "0000461817" "1" "50" "21" "47536291" "47536291" "subst" "0" "00430" "COL6A2_000054" "g.47536291G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46116377G>A" "" "VUS" "" "0000461818" "1" "50" "21" "47540454" "47540454" "subst" "7.30353E-5" "00430" "COL6A2_000248" "g.47540454G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46120540G>A" "" "VUS" "" "0000461819" "1" "50" "21" "47541040" "47541043" "del" "2.05661E-5" "00430" "COL6A2_000339" "g.47541040_47541043del" "" "{PMID:Nallamilli 2018:30564623}" "" "1458+3_1458+6delCAGT" "" "Germline" "" "" "0" "" "" "g.46121126_46121129del" "" "VUS" "" "0000461820" "1" "50" "21" "47545972" "47545972" "subst" "8.54437E-5" "00430" "COL6A2_000371" "g.47545972G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46126058G>A" "" "VUS" "" "0000461821" "1" "50" "21" "47540432" "47540432" "subst" "0.000430883" "00430" "COL6A2_000247" "g.47540432G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46120518G>A" "" "VUS" "" "0000461822" "1" "90" "21" "47541038" "47541038" "subst" "0" "00430" "COL6A2_000338" "g.47541038G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46121124G>A" "" "pathogenic" "" "0000461823" "1" "50" "21" "47552254" "47552254" "subst" "0.000171171" "00430" "COL6A2_000408" "g.47552254G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132340G>A" "" "VUS" "" "0000461824" "1" "50" "21" "47552368" "47552368" "subst" "0" "00430" "COL6A2_000419" "g.47552368C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132454C>G" "" "VUS" "" "0000461825" "1" "50" "21" "47544578" "47544578" "subst" "8.13815E-6" "00430" "COL6A2_000349" "g.47544578C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46124664C>T" "" "VUS" "" "0000461826" "1" "50" "21" "47544598" "47544598" "subst" "1.62835E-5" "00430" "COL6A2_000351" "g.47544598C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46124684C>T" "" "VUS" "" "0000461827" "1" "50" "21" "47552397" "47552397" "subst" "0" "00430" "COL6A2_000422" "g.47552397C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132483C>G" "" "VUS" "" "0000461828" "1" "50" "21" "47545696" "47545696" "subst" "0.00101707" "00430" "COL6A2_000016" "g.47545696C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125782C>A" "" "VUS" "" "0000461829" "1" "50" "21" "47539720" "47539720" "subst" "0" "00430" "COL6A2_000331" "g.47539720G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46119806G>A" "" "VUS" "" "0000461830" "1" "50" "21" "47536591" "47536591" "subst" "0" "00430" "COL6A2_000160" "g.47536591G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46116677G>A" "" "VUS" "" "0000461831" "1" "50" "21" "47531412" "47531412" "subst" "0.000461745" "00430" "COL6A2_000274" "g.47531412G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46111498G>A" "" "VUS" "" "0000461832" "1" "50" "21" "47551962" "47551962" "subst" "2.5748E-5" "00430" "COL6A2_000382" "g.47551962C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132048C>T" "" "VUS" "" "0000461833" "1" "50" "21" "47552191" "47552191" "subst" "0.000166165" "00430" "COL6A2_000170" "g.47552191G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132277G>A" "" "VUS" "" "0000461834" "1" "70" "21" "47536683" "47536683" "subst" "0" "00430" "COL6A2_000315" "g.47536683G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46116769G>A" "" "likely pathogenic" "" "0000461835" "1" "90" "21" "47545432" "47545432" "subst" "4.06716E-6" "00430" "COL6A2_000360" "g.47545432G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46125518G>A" "" "pathogenic" "" "0000461836" "1" "90" "21" "47535921" "47535921" "subst" "0" "00430" "COL6A2_000311" "g.47535921A>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46116007A>C" "" "pathogenic" "" "0000461837" "1" "50" "21" "47537804" "47537804" "subst" "0.000967731" "00430" "COL6A2_000212" "g.47537804C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46117890C>G" "" "VUS" "" "0000461838" "1" "50" "21" "47533977" "47533977" "subst" "0.000434641" "00430" "COL6A2_000305" "g.47533977G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46114063G>A" "" "VUS" "" "0000461839" "3" "90" "21" "47540964" "47540973" "del" "0" "00430" "COL6A2_000336" "g.47540964_47540973del" "" "{PMID:Nallamilli 2018:30564623}" "" "" "variant apparently homozygous" "Germline" "" "" "0" "" "" "g.46121050_46121059del" "" "pathogenic" "" "0000461840" "1" "90" "21" "47545423" "47545423" "subst" "0" "00430" "COL6A2_000015" "g.47545423G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125509G>A" "" "pathogenic" "" "0000461841" "1" "50" "21" "47552013" "47552013" "subst" "0.00103584" "00430" "COL6A2_000387" "g.47552013C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132099C>T" "" "VUS" "" "0000461842" "1" "50" "21" "47533977" "47533977" "subst" "0.000434641" "00430" "COL6A2_000305" "g.47533977G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46114063G>A" "" "VUS" "" "0000461843" "1" "90" "21" "47544815" "47544815" "del" "0" "00430" "COL6A2_000354" "g.47544815del" "" "{PMID:Nallamilli 2018:30564623}" "" "1751delC" "" "Germline" "" "" "0" "" "" "g.46124901del" "" "pathogenic" "" "0000461844" "1" "50" "21" "47546080" "47546080" "subst" "0" "00430" "COL6A2_000374" "g.47546080G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46126166G>C" "" "VUS" "" "0000461845" "1" "90" "21" "47535784" "47535784" "subst" "0" "00430" "COL6A2_000308" "g.47535784A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46115870A>G" "" "pathogenic" "" "0000461846" "1" "50" "21" "47552366" "47552366" "subst" "8.39856E-5" "00430" "COL6A2_000418" "g.47552366C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132452C>T" "" "VUS" "" "0000461847" "1" "50" "21" "47552366" "47552366" "subst" "8.39856E-5" "00430" "COL6A2_000418" "g.47552366C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132452C>T" "" "VUS" "" "0000461848" "1" "50" "21" "47532213" "47532213" "subst" "2.48192E-5" "00430" "COL6A2_000288" "g.47532213C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112299C>T" "" "VUS" "" "0000461849" "1" "50" "21" "47532213" "47532213" "subst" "2.48192E-5" "00430" "COL6A2_000288" "g.47532213C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112299C>T" "" "VUS" "" "0000461850" "1" "50" "21" "47540452" "47540452" "subst" "0" "00430" "COL6A2_000335" "g.47540452C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46120538C>T" "" "VUS" "" "0000461851" "1" "50" "21" "47540432" "47540432" "subst" "0.000430883" "00430" "COL6A2_000247" "g.47540432G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46120518G>A" "" "VUS" "" "0000461852" "1" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00430" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000461853" "1" "50" "21" "47532322" "47532322" "subst" "4.28453E-5" "00430" "COL6A2_000292" "g.47532322A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112408A>G" "" "VUS" "" "0000461854" "1" "50" "21" "47532404" "47532404" "subst" "8.3248E-5" "00430" "COL6A2_000297" "g.47532404C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112490C>T" "" "VUS" "" "0000461855" "1" "50" "21" "47552341" "47552341" "subst" "0.000191803" "00430" "COL6A2_000415" "g.47552341G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132427G>A" "" "VUS" "" "0000461856" "3" "50" "21" "47552300" "47552300" "subst" "4.14604E-6" "00430" "COL6A2_000413" "g.47552300G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "variant apparently homozygous" "Germline" "" "" "0" "" "" "g.46132386G>C" "" "VUS" "" "0000461857" "1" "50" "21" "47544595" "47544595" "subst" "2.84937E-5" "00430" "COL6A2_000350" "g.47544595C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46124681C>T" "" "VUS" "" "0000461858" "1" "50" "21" "47539015" "47539015" "subst" "0.0015335" "00430" "COL6A2_000083" "g.47539015C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46119101C>T" "" "VUS" "" "0000461859" "1" "50" "21" "47551889" "47551889" "subst" "0" "00430" "COL6A2_000380" "g.47551889C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46131975C>T" "" "VUS" "" "0000461860" "1" "50" "21" "47540419" "47540419" "subst" "0.000925702" "00430" "COL6A2_000332" "g.47540419C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46120505C>G" "" "VUS" "" "0000461861" "1" "50" "21" "47551933" "47551933" "subst" "2.5523E-5" "00430" "COL6A2_000154" "g.47551933C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132019C>T" "" "VUS" "" "0000461862" "1" "50" "21" "47532187" "47532187" "subst" "8.21787E-6" "00430" "COL6A2_000287" "g.47532187C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112273C>T" "" "VUS" "" "0000461863" "1" "50" "21" "47542422" "47542422" "subst" "0.000187587" "00430" "COL6A2_000345" "g.47542422G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46122508G>A" "" "VUS" "" "0000461864" "1" "50" "21" "47542410" "47542410" "subst" "0" "00430" "COL6A2_000344" "g.47542410G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46122496G>C" "" "VUS" "" "0000461865" "1" "50" "21" "47551981" "47551981" "subst" "0.000250743" "00430" "COL6A2_000231" "g.47551981G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132067G>A" "" "VUS" "" "0000461866" "1" "50" "21" "47551988" "47551988" "subst" "0.000300171" "00430" "COL6A2_000115" "g.47551988G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132074G>A" "" "VUS" "" "0000461867" "1" "50" "21" "47545696" "47545696" "subst" "0.00101707" "00430" "COL6A2_000016" "g.47545696C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125782C>A" "" "VUS" "" "0000461868" "1" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00430" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000461869" "1" "90" "21" "47542795" "47542795" "subst" "1.22074E-5" "00430" "COL6A2_000254" "g.47542795C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46122881C>T" "" "pathogenic" "" "0000461870" "1" "90" "21" "47545690" "47545690" "subst" "0.000106823" "00430" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic" "" "0000461871" "1" "50" "21" "47546454" "47546454" "subst" "6.909E-5" "00430" "COL6A2_000379" "g.47546454A>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46126540A>C" "" "VUS" "" "0000461872" "1" "50" "21" "47533976" "47533976" "subst" "1.62485E-5" "00430" "COL6A2_000304" "g.47533976C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46114062C>T" "" "VUS" "" "0000461873" "1" "50" "21" "47531953" "47531953" "subst" "0" "00430" "COL6A2_000280" "g.47531953T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112039T>C" "" "VUS" "" "0000461874" "1" "50" "21" "47552117" "47552117" "subst" "0.000343621" "00430" "COL6A2_000398" "g.47552117C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132203C>T" "" "VUS" "" "0000461875" "1" "50" "21" "47544826" "47544826" "subst" "0.000101766" "00430" "COL6A2_000355" "g.47544826G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46124912G>A" "" "VUS" "" "0000461876" "1" "50" "21" "47532345" "47532345" "subst" "0.000177871" "00430" "COL6A2_000293" "g.47532345G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112431G>A" "" "VUS" "" "0000461877" "1" "90" "21" "47537368" "47537368" "subst" "0" "00430" "COL6A2_000051" "g.47537368G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46117454G>C" "" "pathogenic" "" "0000461878" "1" "90" "21" "47537312" "47537313" "inv" "0" "00430" "COL6A2_000316" "g.47537312_47537313inv" "" "{PMID:Nallamilli 2018:30564623}" "" "1000-2_1000-1delinsCT" "no second variant" "Germline" "" "" "0" "" "" "g.46117398_46117399inv" "" "pathogenic" "" "0000461879" "1" "50" "21" "47552191" "47552191" "subst" "0.000166165" "00430" "COL6A2_000170" "g.47552191G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132277G>A" "" "VUS" "" "0000461880" "1" "50" "21" "47532414" "47532414" "subst" "1.66186E-5" "00430" "COL6A2_000299" "g.47532414C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112500C>T" "" "VUS" "" "0000461881" "1" "90" "21" "47535950" "47535950" "subst" "0" "00430" "COL6A2_000135" "g.47535950G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46116036G>A" "" "pathogenic" "" "0000461882" "1" "50" "21" "47552062" "47552062" "subst" "0.000141687" "00430" "COL6A2_000392" "g.47552062G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132148G>A" "" "VUS" "" "0000461883" "1" "50" "21" "47552299" "47552299" "subst" "0.000169972" "00430" "COL6A2_000412" "g.47552299C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132385C>T" "" "VUS" "" "0000461884" "1" "50" "21" "47551991" "47551991" "subst" "0.000367304" "00430" "COL6A2_000384" "g.47551991G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132077G>A" "" "VUS" "" "0000461885" "1" "90" "21" "47535942" "47535942" "subst" "0" "00430" "COL6A2_000167" "g.47535942G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46116028G>T" "" "pathogenic" "" "0000461886" "3" "50" "21" "47552300" "47552300" "subst" "4.14604E-6" "00430" "COL6A2_000413" "g.47552300G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "variant apparently homozygous" "Germline" "" "" "0" "" "" "g.46132386G>C" "" "VUS" "" "0000461887" "1" "50" "21" "47552299" "47552299" "subst" "0.000169972" "00430" "COL6A2_000412" "g.47552299C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132385C>T" "" "VUS" "" "0000461888" "1" "50" "21" "47544826" "47544826" "subst" "0.000101766" "00430" "COL6A2_000355" "g.47544826G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46124912G>A" "" "VUS" "" "0000461889" "1" "50" "21" "47552335" "47552335" "subst" "0" "00430" "COL6A2_000414" "g.47552335G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132421G>A" "" "VUS" "" "0000461890" "1" "50" "21" "47552117" "47552117" "subst" "0.000343621" "00430" "COL6A2_000398" "g.47552117C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132203C>T" "" "VUS" "" "0000461891" "1" "50" "21" "47551981" "47551981" "subst" "0.000250743" "00430" "COL6A2_000231" "g.47551981G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132067G>A" "" "VUS" "" "0000461892" "1" "50" "21" "47542072" "47542072" "subst" "3.69122E-5" "00430" "COL6A2_000343" "g.47542072C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46122158C>T" "" "VUS" "" "0000461893" "1" "50" "21" "47552410" "47552410" "subst" "2.97877E-5" "00430" "COL6A2_000425" "g.47552410T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132496T>C" "" "VUS" "" "0000461894" "1" "90" "21" "47545690" "47545690" "subst" "0.000106823" "00430" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic" "" "0000461895" "1" "90" "21" "47545690" "47545690" "subst" "0.000106823" "00430" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic" "" "0000461896" "1" "50" "21" "47540432" "47540432" "subst" "6.85495E-5" "00430" "COL6A2_000215" "g.47540432G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46120518G>C" "" "VUS" "" "0000461897" "1" "50" "21" "47533977" "47533977" "subst" "0.000434641" "00430" "COL6A2_000305" "g.47533977G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46114063G>A" "" "VUS" "" "0000461898" "1" "50" "21" "47552014" "47552014" "subst" "0.000117738" "00430" "COL6A2_000388" "g.47552014G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132100G>A" "" "VUS" "" "0000461899" "1" "50" "21" "47552468" "47552468" "subst" "7.87882E-5" "00430" "COL6A2_000430" "g.47552468G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132554G>A" "" "VUS" "" "0000461900" "1" "50" "21" "47552157" "47552157" "subst" "0.000633108" "00430" "COL6A2_000161" "g.47552157G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132243G>T" "" "VUS" "" "0000461901" "1" "50" "21" "47531515" "47531515" "subst" "4.17844E-5" "00430" "COL6A2_000277" "g.47531515G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46111601G>T" "" "VUS" "" "0000461902" "1" "50" "21" "47552155" "47552155" "subst" "3.99095E-5" "00430" "COL6A2_000402" "g.47552155G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132241G>A" "" "VUS" "" "0000461903" "1" "50" "21" "47545696" "47545696" "subst" "0.00101707" "00430" "COL6A2_000016" "g.47545696C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46125782C>A" "" "VUS" "" "0000461904" "1" "50" "21" "47552356" "47552356" "subst" "2.93051E-5" "00430" "COL6A2_000417" "g.47552356G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132442G>A" "" "VUS" "" "0000461905" "1" "50" "21" "47538541" "47538541" "subst" "0.000123318" "00430" "COL6A2_000326" "g.47538541G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46118627G>A" "" "VUS" "" "0000461906" "1" "50" "21" "47540419" "47540419" "subst" "0.000925702" "00430" "COL6A2_000332" "g.47540419C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46120505C>G" "" "VUS" "" "0000461907" "1" "50" "21" "47540444" "47540444" "subst" "7.7372E-5" "00430" "COL6A2_000334" "g.47540444G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46120530G>C" "" "VUS" "" "0000461908" "1" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00430" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000461909" "1" "50" "21" "47545926" "47545926" "subst" "0" "00430" "COL6A2_000369" "g.47545926G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46126012G>A" "" "VUS" "" "0000461910" "1" "50" "21" "47533977" "47533977" "subst" "0.000434641" "00430" "COL6A2_000305" "g.47533977G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46114063G>A" "" "VUS" "" "0000461911" "1" "90" "21" "47537786" "47537786" "subst" "0" "00430" "COL6A2_000322" "g.47537786A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46117872A>G" "" "pathogenic" "" "0000461912" "1" "50" "21" "47546429" "47546429" "subst" "0" "00430" "COL6A2_000378" "g.47546429T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46126515T>C" "" "VUS" "" "0000461913" "1" "50" "21" "47540442" "47540442" "subst" "2.16511E-5" "00430" "COL6A2_000333" "g.47540442C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46120528C>G" "" "VUS" "" "0000461914" "1" "50" "21" "47545911" "47545911" "subst" "0.000426788" "00430" "COL6A2_000222" "g.47545911G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46125997G>A" "" "VUS" "" "0000461915" "1" "50" "21" "47540419" "47540419" "subst" "0.000925702" "00430" "COL6A2_000332" "g.47540419C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46120505C>G" "" "VUS" "" "0000461916" "1" "50" "21" "47552154" "47552154" "subst" "0" "00430" "COL6A2_000234" "g.47552154C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132240C>A" "" "VUS" "" "0000461917" "1" "50" "21" "47545696" "47545696" "subst" "0.00101707" "00430" "COL6A2_000016" "g.47545696C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46125782C>A" "" "VUS" "" "0000461918" "1" "50" "21" "47540432" "47540432" "subst" "0.000430883" "00430" "COL6A2_000247" "g.47540432G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46120518G>A" "" "VUS" "" "0000461919" "1" "50" "21" "47532345" "47532345" "subst" "0.000177871" "00430" "COL6A2_000293" "g.47532345G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112431G>A" "" "VUS" "" "0000461920" "1" "50" "21" "47532373" "47532373" "subst" "0" "00430" "COL6A2_000295" "g.47532373A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112459A>G" "" "VUS" "" "0000461921" "1" "50" "21" "47532006" "47532006" "subst" "0" "00430" "COL6A2_000283" "g.47532006T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112092T>C" "" "VUS" "" "0000461922" "1" "50" "21" "47545972" "47545972" "subst" "8.54437E-5" "00430" "COL6A2_000371" "g.47545972G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46126058G>A" "" "VUS" "" "0000461923" "1" "50" "21" "47552108" "47552128" "del" "0" "00430" "COL6A2_000396" "g.47552108_47552128del" "" "{PMID:Nallamilli 2018:30564623}" "" "2702_2722del21" "" "Germline" "" "" "0" "" "" "g.46132194_46132214del" "" "VUS" "" "0000461924" "1" "50" "21" "47552204" "47552204" "subst" "0.000157105" "00430" "COL6A2_000403" "g.47552204G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132290G>A" "" "VUS" "" "0000461925" "1" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00430" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000461926" "1" "50" "21" "47552452" "47552452" "subst" "3.5251E-5" "00430" "COL6A2_000429" "g.47552452C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132538C>T" "" "VUS" "" "0000461927" "1" "50" "21" "47552343" "47552343" "subst" "0.000129326" "00430" "COL6A2_000416" "g.47552343C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132429C>T" "" "VUS" "" "0000461928" "1" "50" "21" "47531511" "47531511" "del" "0.000128508" "00430" "COL6A2_000276" "g.47531511del" "" "{PMID:Nallamilli 2018:30564623}" "" "115+6delA" "" "Germline" "" "" "0" "" "" "g.46111597del" "" "VUS" "" "0000461929" "1" "70" "21" "47535832" "47535832" "subst" "0" "00430" "COL6A2_000140" "g.47535832G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46115918G>A" "" "likely pathogenic" "" "0000461930" "1" "50" "21" "47532270" "47532270" "subst" "0" "00430" "COL6A2_000291" "g.47532270G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112356G>A" "" "VUS" "" "0000461931" "1" "50" "21" "47552335" "47552335" "subst" "0" "00430" "COL6A2_000414" "g.47552335G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132421G>A" "" "VUS" "" "0000461932" "1" "50" "21" "47552011" "47552011" "subst" "0.000154704" "00430" "COL6A2_000386" "g.47552011G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132097G>T" "" "VUS" "" "0000461933" "1" "50" "21" "47552341" "47552341" "subst" "0.000191803" "00430" "COL6A2_000415" "g.47552341G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132427G>A" "" "VUS" "" "0000461934" "1" "50" "21" "47533977" "47533977" "subst" "0.000434641" "00430" "COL6A2_000305" "g.47533977G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46114063G>A" "" "VUS" "" "0000461935" "3" "50" "21" "47552300" "47552300" "subst" "4.14604E-6" "00430" "COL6A2_000413" "g.47552300G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "variant apparently homozygous" "Germline" "" "" "0" "" "" "g.46132386G>C" "" "VUS" "" "0000461936" "1" "50" "21" "47552431" "47552431" "subst" "0.000263335" "00430" "COL6A2_000426" "g.47552431G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132517G>A" "" "VUS" "" "0000461937" "1" "50" "21" "47552067" "47552067" "subst" "0.000244048" "00430" "COL6A2_000394" "g.47552067G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132153G>A" "" "VUS" "" "0000461938" "1" "50" "21" "47537804" "47537804" "subst" "0.000967731" "00430" "COL6A2_000212" "g.47537804C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46117890C>G" "" "VUS" "" "0000461939" "1" "50" "21" "47552154" "47552154" "subst" "3.56011E-5" "00430" "COL6A2_000401" "g.47552154C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132240C>T" "" "VUS" "" "0000461940" "1" "50" "21" "47531484" "47531484" "subst" "2.04424E-5" "00430" "COL6A2_000275" "g.47531484G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46111570G>A" "" "VUS" "" "0000461941" "1" "50" "21" "47544613" "47544613" "subst" "0.000240373" "00430" "COL6A2_000352" "g.47544613G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46124699G>C" "" "VUS" "" "0000461942" "1" "50" "21" "47551988" "47551988" "subst" "0.000300171" "00430" "COL6A2_000115" "g.47551988G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132074G>A" "" "VUS" "" "0000461943" "1" "90" "21" "47533982" "47533993" "del" "0" "00430" "COL6A2_000307" "g.47533982_47533993del" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46114068_46114079del" "" "pathogenic" "" "0000461944" "1" "50" "21" "47551973" "47551973" "subst" "4.34171E-6" "00430" "COL6A2_000383" "g.47551973T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132059T>C" "" "VUS" "" "0000461945" "1" "50" "21" "47552285" "47552285" "subst" "2.07524E-5" "00430" "COL6A2_000410" "g.47552285C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132371C>T" "" "VUS" "" "0000461946" "1" "50" "21" "47531412" "47531412" "subst" "0.000461745" "00430" "COL6A2_000274" "g.47531412G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46111498G>A" "" "VUS" "" "0000461947" "1" "50" "21" "47542443" "47542443" "subst" "0.000167519" "00430" "COL6A2_000346" "g.47542443G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46122529G>A" "" "VUS" "" "0000461948" "1" "50" "21" "47552401" "47552401" "subst" "0.000131551" "00430" "COL6A2_000423" "g.47552401G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132487G>A" "" "VUS" "" "0000461949" "1" "50" "21" "47545911" "47545913" "delins" "0" "00430" "COL6A2_000368" "g.47545911_47545913delinsATA" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125997_46125999delinsATA" "" "VUS" "" "0000461950" "1" "50" "21" "47552288" "47552288" "subst" "0.000232388" "00430" "COL6A2_000272" "g.47552288C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "2882C>T;2998_3000delAAG" "no second variant" "Germline" "" "" "0" "" "" "g.46132374C>T" "" "VUS" "" "0000461951" "1" "50" "21" "47532163" "47532163" "subst" "0" "00430" "COL6A2_000286" "g.47532163G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46112249G>A" "" "VUS" "" "0000461952" "1" "50" "21" "47539709" "47539723" "del" "0" "00430" "COL6A2_000330" "g.47539709_47539723del" "" "{PMID:Nallamilli 2018:30564623}" "" "1277_1291del15" "no second variant" "Germline" "" "" "0" "" "" "g.46119795_46119809del" "" "VUS" "" "0000461953" "1" "50" "21" "47552366" "47552366" "subst" "8.39856E-5" "00430" "COL6A2_000418" "g.47552366C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132452C>T" "" "VUS" "" "0000461954" "1" "50" "21" "47541504" "47541504" "subst" "2.03739E-5" "00430" "COL6A2_000030" "g.47541504G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46121590G>A" "" "VUS" "" "0000461955" "1" "50" "21" "47552431" "47552431" "subst" "0.000263335" "00430" "COL6A2_000426" "g.47552431G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132517G>A" "" "VUS" "" "0000461956" "1" "50" "21" "47544826" "47544826" "subst" "0.000101766" "00430" "COL6A2_000355" "g.47544826G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46124912G>A" "" "VUS" "" "0000461957" "1" "50" "21" "47533977" "47533977" "subst" "0.000434641" "00430" "COL6A2_000305" "g.47533977G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46114063G>A" "" "VUS" "" "0000461958" "1" "50" "21" "47552440" "47552440" "subst" "6.97192E-5" "00430" "COL6A2_000428" "g.47552440G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132526G>A" "" "VUS" "" "0000461959" "1" "50" "21" "47539033" "47539033" "subst" "4.18975E-5" "00430" "COL6A2_000329" "g.47539033G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46119119G>A" "" "VUS" "" "0000461960" "1" "50" "21" "47545973" "47545973" "subst" "5.29036E-5" "00430" "COL6A2_000372" "g.47545973C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46126059C>T" "" "VUS" "" "0000461961" "1" "50" "21" "47552286" "47552286" "subst" "0.000456549" "00430" "COL6A2_000411" "g.47552286G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132372G>A" "" "VUS" "" "0000461962" "1" "50" "21" "47552093" "47552093" "subst" "0" "00430" "COL6A2_000395" "g.47552093A>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132179A>C" "" "VUS" "" "0000461963" "1" "90" "21" "47537312" "47537313" "inv" "0" "00430" "COL6A2_000316" "g.47537312_47537313inv" "" "{PMID:Nallamilli 2018:30564623}" "" "1000-2_1000-1delinsCT" "no second variant" "Germline" "" "" "0" "" "" "g.46117398_46117399inv" "" "pathogenic" "" "0000461964" "1" "50" "21" "47542443" "47542443" "subst" "0.000167519" "00430" "COL6A2_000346" "g.47542443G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46122529G>A" "" "VUS" "" "0000461965" "1" "50" "21" "47540432" "47540432" "subst" "6.85495E-5" "00430" "COL6A2_000215" "g.47540432G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46120518G>C" "" "VUS" "" "0000461966" "1" "50" "21" "47536570" "47536570" "subst" "4.47744E-5" "00430" "COL6A2_000268" "g.47536570A>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46116656A>T" "" "VUS" "" "0000461967" "1" "50" "21" "47540982" "47540982" "subst" "0" "00430" "COL6A2_000337" "g.47540982G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46121068G>T" "" "VUS" "" "0000461968" "3" "50" "21" "47552300" "47552300" "subst" "4.14604E-6" "00430" "COL6A2_000413" "g.47552300G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "variant apparently homozygous" "Germline" "" "" "0" "" "" "g.46132386G>C" "" "VUS" "" "0000461969" "1" "50" "21" "47531944" "47531944" "subst" "0" "00430" "COL6A2_000278" "g.47531944G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112030G>A" "" "VUS" "" "0000461970" "1" "50" "21" "47542422" "47542422" "subst" "0.000187587" "00430" "COL6A2_000345" "g.47542422G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46122508G>A" "" "VUS" "" "0000461971" "1" "50" "21" "47552204" "47552204" "subst" "0.000157105" "00430" "COL6A2_000403" "g.47552204G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132290G>A" "" "VUS" "" "0000461972" "1" "90" "21" "47545423" "47545423" "subst" "0" "00430" "COL6A2_000015" "g.47545423G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125509G>A" "" "pathogenic" "" "0000461973" "1" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00430" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000461974" "1" "50" "21" "47536717" "47536717" "subst" "0.000317618" "00430" "COL6A2_000193" "g.47536717G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46116803G>A" "" "VUS" "" "0000461975" "1" "50" "21" "47552117" "47552117" "subst" "0.000343621" "00430" "COL6A2_000398" "g.47552117C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132203C>T" "" "VUS" "" "0000461976" "1" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00430" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000461977" "1" "50" "21" "47536717" "47536717" "subst" "0.000317618" "00430" "COL6A2_000193" "g.47536717G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46116803G>A" "" "VUS" "" "0000461978" "3" "50" "21" "47531958" "47531958" "subst" "0" "00430" "COL6A2_000203" "g.47531958T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "variant apparently homozygous" "Germline" "" "" "0" "" "" "g.46112044T>C" "" "VUS" "" "0000461979" "1" "50" "21" "47532405" "47532405" "subst" "0.000262059" "00430" "COL6A2_000298" "g.47532405G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112491G>A" "" "VUS" "" "0000461980" "1" "50" "21" "47545858" "47545858" "subst" "0" "00430" "COL6A2_000365" "g.47545858C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125944C>A" "" "VUS" "" "0000461981" "1" "90" "21" "47545423" "47545423" "subst" "0" "00430" "COL6A2_000015" "g.47545423G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125509G>A" "" "pathogenic" "" "0000461982" "1" "50" "21" "47538562" "47538562" "subst" "4.13918E-6" "00430" "COL6A2_000327" "g.47538562C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46118648C>T" "" "VUS" "" "0000461983" "1" "50" "21" "47542443" "47542443" "subst" "0.000167519" "00430" "COL6A2_000346" "g.47542443G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46122529G>A" "" "VUS" "" "0000461984" "1" "50" "21" "47552014" "47552014" "subst" "0.000117738" "00430" "COL6A2_000388" "g.47552014G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132100G>A" "" "VUS" "" "0000461985" "1" "90" "21" "47538943" "47538943" "subst" "0" "00430" "COL6A2_000328" "g.47538943G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46119029G>C" "" "pathogenic" "" "0000461986" "1" "90" "21" "47552017" "47552017" "subst" "9.92605E-6" "00430" "COL6A2_000151" "g.47552017G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46132103G>A" "" "pathogenic" "" "0000461987" "1" "90" "21" "47535814" "47535814" "del" "0" "00430" "COL6A2_000309" "g.47535814del" "" "{PMID:Nallamilli 2018:30564623}" "" "830delG" "" "Germline" "" "" "0" "" "" "g.46115900del" "" "pathogenic" "" "0000461988" "1" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00430" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112374G>A" "" "VUS" "" "0000461989" "1" "90" "21" "47545423" "47545423" "subst" "0" "00430" "COL6A2_000015" "g.47545423G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46125509G>A" "" "pathogenic" "" "0000461990" "1" "90" "21" "47535968" "47535968" "subst" "0" "00430" "COL6A2_000058" "g.47535968G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant; possible somatic mosaicism or technical issues" "Germline" "" "" "0" "" "" "g.46116054G>A" "" "pathogenic" "" "0000461991" "1" "50" "21" "47544834" "47544834" "subst" "8.1408E-5" "00430" "COL6A2_000096" "g.47544834G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46124920G>A" "" "VUS" "" "0000461992" "1" "50" "21" "47532382" "47532382" "subst" "1.25564E-5" "00430" "COL6A2_000296" "g.47532382G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46112468G>A" "" "VUS" "" "0000461993" "1" "50" "21" "47533977" "47533977" "subst" "0.000434641" "00430" "COL6A2_000305" "g.47533977G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46114063G>A" "" "VUS" "" "0000461994" "1" "90" "21" "47542061" "47542061" "subst" "1.22809E-5" "00430" "COL6A2_000342" "g.47542061C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46122147C>T" "" "pathogenic" "" "0000461995" "1" "50" "21" "47540984" "47540984" "subst" "2.46528E-5" "00430" "COL6A2_000137" "g.47540984G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46121070G>A" "" "VUS" "" "0000461996" "1" "50" "21" "47546139" "47546139" "subst" "0.000110338" "00430" "COL6A2_000377" "g.47546139G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46126225G>A" "" "VUS" "" "0000461997" "1" "90" "21" "47544815" "47544815" "del" "0" "00430" "COL6A2_000354" "g.47544815del" "" "{PMID:Nallamilli 2018:30564623}" "" "1751delC" "" "Germline" "" "" "0" "" "" "g.46124901del" "" "pathogenic" "" "0000461998" "1" "50" "21" "47546080" "47546080" "subst" "0" "00430" "COL6A2_000374" "g.47546080G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.46126166G>C" "" "VUS" "" "0000461999" "1" "50" "21" "47551895" "47551895" "subst" "6.00019E-5" "00430" "COL6A2_000153" "g.47551895G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46131981G>A" "" "VUS" "" "0000462000" "1" "50" "21" "47552435" "47552435" "subst" "4.32893E-6" "00430" "COL6A2_000427" "g.47552435T>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.46132521T>G" "" "VUS" "" "0000462001" "1" "50" "21" "47552404" "47552406" "del" "0" "00430" "COL6A2_000125" "g.47552404_47552406del" "" "{PMID:Nallamilli 2018:30564623}" "" "2998_3000delAAG" "" "Germline" "" "" "0" "" "" "g.46132490_46132492del" "" "VUS" "" "0000571016" "0" "50" "21" "47532066" "47532066" "subst" "8.14379E-6" "01804" "COL6A2_000431" "g.47532066G>A" "" "" "" "COL6A2(NM_001849.3):c.289G>A (p.(Gly97Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46112152G>A" "" "VUS" "" "0000571017" "0" "30" "21" "47532093" "47532093" "subst" "0.00670518" "01804" "COL6A2_000070" "g.47532093G>A" "" "" "" "COL6A2(NM_001849.3):c.316G>A (p.(Glu106Lys)), COL6A2(NM_058175.2):c.316G>A (p.E106K), COL6A2(NM_058175.3):c.316G>A (p.E106K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46112179G>A" "" "likely benign" "" "0000571019" "0" "30" "21" "47532287" "47532287" "subst" "0.00338552" "01943" "COL6A2_000071" "g.47532287C>T" "" "" "" "COL6A2(NM_001849.3):c.510C>T (p.(Cys170=)), COL6A2(NM_058175.2):c.510C>T (p.C170=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46112373C>T" "" "likely benign" "" "0000571020" "0" "30" "21" "47532420" "47532420" "subst" "4.14955E-5" "01943" "COL6A2_000301" "g.47532420G>A" "" "" "" "COL6A2(NM_058175.2):c.643G>A (p.D215N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46112506G>A" "" "likely benign" "" "0000571021" "0" "30" "21" "47532501" "47532501" "subst" "7.49719E-5" "01804" "COL6A2_000432" "g.47532501G>A" "" "" "" "COL6A2(NM_001849.3):c.714+10G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46112587G>A" "" "likely benign" "" "0000571023" "0" "50" "21" "47533977" "47533977" "subst" "0.000434641" "01943" "COL6A2_000305" "g.47533977G>A" "" "" "" "COL6A2(NM_001849.3):c.791G>A (p.(Arg264His)), COL6A2(NM_058175.2):c.791G>A (p.R264H), COL6A2(NM_058175.3):c.791G>A (p.R264H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46114063G>A" "" "VUS" "" "0000571024" "0" "50" "21" "47535935" "47535935" "subst" "0" "01943" "COL6A2_000433" "g.47535935A>T" "" "" "" "COL6A2(NM_001849.3):c.868A>T (p.(Ile290Phe)), COL6A2(NM_058175.2):c.868A>T (p.I290F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46116021A>T" "" "VUS" "" "0000571025" "0" "50" "21" "47538541" "47538541" "subst" "0.000123318" "01804" "COL6A2_000326" "g.47538541G>A" "" "" "" "COL6A2(NM_001849.3):c.1130G>A (p.(Arg377His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46118627G>A" "" "VUS" "" "0000571026" "0" "30" "21" "47538572" "47538572" "subst" "0.00250447" "01804" "COL6A2_000213" "g.47538572C>T" "" "" "" "COL6A2(NM_001849.3):c.1161C>T (p.(Ile387=)), COL6A2(NM_058175.3):c.1161C>T (p.I387=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46118658C>T" "" "likely benign" "" "0000571027" "0" "30" "21" "47540419" "47540419" "subst" "0.000925702" "01943" "COL6A2_000332" "g.47540419C>G" "" "" "" "COL6A2(NM_001849.3):c.1333-10C>G (p.(=)), COL6A2(NM_058175.2):c.1333-10C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46120505C>G" "" "likely benign" "" "0000571028" "0" "50" "21" "47540432" "47540432" "subst" "0.000430883" "02330" "COL6A2_000247" "g.47540432G>A" "" "" "" "COL6A2(NM_001849.3):c.1336G>A (p.(Asp446Asn)), COL6A2(NM_058175.3):c.1336G>A (p.D446N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46120518G>A" "" "VUS" "" "0000571029" "0" "30" "21" "47541016" "47541016" "subst" "0.000669883" "01804" "COL6A2_000434" "g.47541016T>C" "" "" "" "COL6A2(NM_001849.3):c.1437T>C (p.(Ala479=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46121102T>C" "" "likely benign" "" "0000571030" "0" "30" "21" "47541477" "47541477" "subst" "0.00169113" "01804" "COL6A2_000250" "g.47541477G>A" "" "" "" "COL6A2(NM_001849.3):c.1466G>A (p.(Arg489Gln)), COL6A2(NM_058175.2):c.1466G>A (p.R489Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46121563G>A" "" "likely benign" "" "0000571031" "0" "30" "21" "47542060" "47542060" "subst" "0.000397001" "01804" "COL6A2_000435" "g.47542060C>G" "" "" "" "COL6A2(NM_001849.3):c.1560C>G (p.(Pro520=)), COL6A2(NM_058175.2):c.1560C>G (p.P520=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46122146C>G" "" "likely benign" "" "0000571032" "0" "50" "21" "47544625" "47544625" "subst" "2.85663E-5" "01943" "COL6A2_000436" "g.47544625G>A" "" "" "" "COL6A2(NM_058175.2):c.1732G>A (p.E578K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46124711G>A" "" "VUS" "" "0000571033" "0" "30" "21" "47544833" "47544833" "subst" "0.00190503" "01804" "COL6A2_000142" "g.47544833C>T" "" "" "" "COL6A2(NM_001849.3):c.1769C>T (p.(Thr590Met)), COL6A2(NM_001849.4):c.1769C>T (p.T590M), COL6A2(NM_058175.2):c.1769C>T (p.T590M), COL6A2(NM_058175....)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46124919C>T" "" "likely benign" "" "0000571034" "0" "10" "21" "47545376" "47545376" "dup" "0" "02330" "COL6A2_000101" "g.47545376dup" "" "" "" "COL6A2(NM_058175.3):c.1817-3dupC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46125462dup" "" "benign" "" "0000571035" "0" "30" "21" "47545398" "47545398" "subst" "0.000101701" "02330" "COL6A2_000437" "g.47545398C>T" "" "" "" "COL6A2(NM_058175.2):c.1836C>T (p.G612=), COL6A2(NM_058175.3):c.1836C>T (p.G612=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46125484C>T" "" "likely benign" "" "0000571036" "0" "30" "21" "47545507" "47545507" "subst" "0.000587511" "01804" "COL6A2_000438" "g.47545507G>A" "" "" "" "COL6A2(NM_001849.3):c.1945G>A (p.(Ala649Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46125593G>A" "" "likely benign" "" "0000571038" "0" "50" "21" "47545696" "47545696" "subst" "0.00101707" "01804" "COL6A2_000016" "g.47545696C>A" "" "" "" "COL6A2(NM_001849.3):c.1970-3C>A (p.(=)), COL6A2(NM_001849.4):c.1970-3C>A, COL6A2(NM_058175.2):c.1970-3C>A, COL6A2(NM_058175.3):c.1970-3C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46125782C>A" "" "VUS" "" "0000571039" "0" "10" "21" "47545889" "47545889" "subst" "0.00426333" "02330" "COL6A2_000107" "g.47545889C>G" "" "" "" "COL6A2(NM_001849.3):c.2160C>G (p.(Arg720=)), COL6A2(NM_058175.3):c.2160C>G (p.R720=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46125975C>G" "" "benign" "" "0000571041" "0" "50" "21" "47545926" "47545926" "subst" "0" "02327" "COL6A2_000369" "g.47545926G>A" "" "" "" "COL6A2(NM_058175.3):c.2197G>A (p.G733R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46126012G>A" "" "VUS" "" "0000571043" "0" "10" "21" "47546080" "47546080" "subst" "0.00443388" "02330" "COL6A2_000021" "g.47546080G>A" "" "" "" "COL6A2(NM_001849.3):c.2351G>A (p.(Arg784His)), COL6A2(NM_058175.2):c.2351G>A (p.R784H), COL6A2(NM_058175.3):c.2351G>A (p.R784H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46126166G>A" "" "benign" "" "0000571044" "0" "30" "21" "47546080" "47546080" "subst" "0.00443388" "01943" "COL6A2_000021" "g.47546080G>A" "" "" "" "COL6A2(NM_001849.3):c.2351G>A (p.(Arg784His)), COL6A2(NM_058175.2):c.2351G>A (p.R784H), COL6A2(NM_058175.3):c.2351G>A (p.R784H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46126166G>A" "" "likely benign" "" "0000571045" "0" "30" "21" "47546399" "47546400" "ins" "0" "02330" "COL6A2_000439" "g.47546399_47546400insCGGCCCGGCCCGGCC" "" "" "" "COL6A2(NM_001849.3):c.2423-18_2423-17insCGGCCCGGCCCGGCC (p.(=)), COL6A2(NM_058175.3):c.2423-18_2423-17insCGGCCCGGCCCGGCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46126485_46126486insCGGCCCGGCCCGGCC" "" "likely benign" "" "0000571046" "0" "50" "21" "47546415" "47546415" "subst" "0" "02330" "COL6A2_000022" "g.47546415A>G" "" "" "" "COL6A2(NM_058175.3):c.2423-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46126501A>G" "" "VUS" "" "0000571047" "0" "30" "21" "47549240" "47549240" "subst" "0.000101796" "01943" "COL6A2_000440" "g.47549240G>A" "" "" "" "COL6A2(NM_058174.2):c.2592G>A (p.P864=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46129326G>A" "" "likely benign" "" "0000571048" "0" "30" "21" "47549390" "47549390" "subst" "0.000615596" "01804" "COL6A2_000441" "g.47549390G>A" "" "" "" "COL6A2(NM_058174.2):c.2742G>A (p.(Ala914=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46129476G>A" "" "likely benign" "" "0000571049" "0" "10" "21" "47549629" "47549629" "subst" "0" "02330" "COL6A2_000442" "g.47549629T>A" "" "" "" "COL6A2(NM_058175.3):c.*787T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46129715T>A" "" "benign" "" "0000571052" "0" "50" "21" "47551894" "47551894" "subst" "0" "01943" "COL6A2_000264" "g.47551894C>T" "" "" "" "COL6A2(NM_001849.3):c.2488C>T (p.R830W), COL6A2(NM_001849.4):c.2488C>T (p.R830W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46131980C>T" "" "VUS" "" "0000571054" "0" "30" "21" "47551930" "47551930" "subst" "4.25974E-5" "01804" "FTCD_000007" "g.47551930G>A" "" "" "" "COL6A2(NM_001849.3):c.2524G>A (p.(Glu842Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46132016G>A" "" "likely benign" "" "0000571056" "0" "30" "21" "47551964" "47551964" "subst" "0.00253908" "01943" "COL6A2_000025" "g.47551964G>A" "" "" "" "COL6A2(NM_001849.3):c.2558G>A (p.R853Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46132050G>A" "" "likely benign" "" "0000571058" "0" "50" "21" "47551981" "47551981" "subst" "0.000250743" "01804" "COL6A2_000231" "g.47551981G>A" "" "" "" "COL6A2(NM_001849.3):c.2575G>A (p.(Val859Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46132067G>A" "" "VUS" "" "0000571062" "0" "30" "21" "47552034" "47552034" "subst" "2.71553E-5" "01943" "COL6A2_000116" "g.47552034C>T" "" "" "" "COL6A2(NM_001849.3):c.2628C>T (p.R876=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46132120C>T" "" "likely benign" "" "0000571063" "0" "30" "21" "47552154" "47552154" "subst" "0" "01804" "COL6A2_000234" "g.47552154C>A" "" "" "" "COL6A2(NM_001849.3):c.2748C>A (p.H916Q, p.(His916Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46132240C>A" "" "likely benign" "" "0000571065" "0" "30" "21" "47552201" "47552201" "subst" "0.00252178" "02325" "COL6A2_000041" "g.47552201C>T" "" "" "" "COL6A2(NM_001849.3):c.2795C>T (p.P932L, p.(Pro932Leu)), COL6A2(NM_001849.4):c.2795C>T (p.P932L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46132287C>T" "" "likely benign" "" "0000571066" "0" "50" "21" "47552261" "47552261" "subst" "7.91304E-5" "01804" "FTCD_000011" "g.47552261C>T" "" "" "" "COL6A2(NM_001849.3):c.2855C>T (p.(Thr952Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46132347C>T" "" "VUS" "" "0000571067" "0" "30" "21" "47552262" "47552262" "subst" "0.00169053" "01804" "COL6A2_000236" "g.47552262G>A" "" "" "" "COL6A2(NM_001849.3):c.2856G>A (p.(Thr952=)), COL6A2(NM_001849.4):c.2856G>A (p.T952=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46132348G>A" "" "likely benign" "" "0000571068" "0" "30" "21" "47552391" "47552391" "subst" "9.75519E-5" "01943" "FTCD_000012" "g.47552391C>T" "" "" "" "COL6A2(NM_001849.3):c.2985C>T (p.A995=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46132477C>T" "" "likely benign" "" "0000595741" "0" "90" "21" "47545423" "47545423" "subst" "0" "01164" "COL6A2_000015" "g.47545423G>A" "" "" "" "" "ACMG grading: PS3,PM1,PP3,PM2,PP5; reported in Scacheri 2002. Neurology 58: 593; Collins 2012. Neurology 20: 2158" "Germline" "" "rs267606750" "0" "" "" "g.46125509G>A" "" "pathogenic" "ACMG" "0000597308" "1" "90" "21" "47545704" "47545704" "subst" "0" "00006" "COL6A2_000066" "g.47545704C>T" "" "{PMID:Özyilmaz 2019:31066050}" "" "" "ACMG PM2, PP3, PP4" "Germline" "" "rs727502830" "0" "" "" "g.46125790C>T" "" "pathogenic" "ACMG" "0000597309" "1" "90" "21" "47545704" "47545704" "subst" "0" "00006" "COL6A2_000066" "g.47545704C>T" "" "{PMID:Özyilmaz 2019:31066050}" "" "" "ACMG PM2, PP3, PP4" "Germline" "" "rs727502830" "0" "" "" "g.46125790C>T" "" "pathogenic" "ACMG" "0000597310" "1" "50" "21" "47545420" "47545422" "del" "0" "00006" "COL6A2_000443" "g.47545420_47545422del" "" "{PMID:Özyilmaz 2019:31066050}" "" "c.1858_1860delATC" "ACMG PM2, PM4" "Germline" "" "rs767423601" "0" "" "" "g.46125506_46125508del" "" "VUS" "ACMG" "0000618418" "0" "50" "21" "47541536" "47541536" "subst" "4.0862E-6" "01804" "COL6A2_000444" "g.47541536C>T" "" "" "" "COL6A2(NM_001849.3):c.1521+4C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46121622C>T" "" "VUS" "" "0000618419" "0" "70" "21" "47545376" "47545376" "subst" "4.06977E-6" "02327" "COL6A2_000014" "g.47545376C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46125462C>G" "" "likely pathogenic" "" "0000618420" "0" "50" "21" "47545747" "47545747" "subst" "4.0703E-5" "01943" "COL6A2_000445" "g.47545747C>A" "" "" "" "COL6A2(NM_058175.2):c.2018C>A (p.A673D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46125833C>A" "" "VUS" "" "0000618422" "0" "30" "21" "47549137" "47549137" "subst" "1.63605E-5" "01804" "COL6A2_000446" "g.47549137C>T" "" "" "" "COL6A2(NM_058174.2):c.2489C>T (p.(Pro830Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46129223C>T" "" "likely benign" "" "0000618423" "0" "30" "21" "47549298" "47549298" "subst" "0.000236287" "01943" "COL6A2_000447" "g.47549298G>A" "" "" "" "COL6A2(NM_058174.2):c.2650G>A (p.A884T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46129384G>A" "" "likely benign" "" "0000618424" "0" "30" "21" "47551890" "47551890" "subst" "8.66446E-6" "01943" "FTCD_000022" "g.47551890G>T" "" "" "" "COL6A2(NM_001849.3):c.2484G>T (p.T828=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46131976G>T" "" "likely benign" "" "0000618425" "0" "50" "21" "47552005" "47552005" "subst" "0.00140527" "01804" "COL6A2_000130" "g.47552005C>T" "" "" "" "COL6A2(NM_001849.3):c.2599C>T (p.(Arg867Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46132091C>T" "" "VUS" "" "0000629570" "1" "70" "21" "47535922" "47535922" "subst" "0" "00006" "COL6A2_000448" "g.47535922G>C" "1/209 cases" "{PMID:Park 2017:27363342}" "" "" "" "Germline" "" "" "0" "" "" "g.46116008G>C" "" "likely pathogenic (dominant)" "" "0000646778" "1" "50" "21" "47540454" "47540454" "subst" "7.30353E-5" "00006" "COL6A2_000248" "g.47540454G>A" "1/94 cases" "{PMID:Punetha 2016:27854218}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.46120540G>A" "" "VUS" "" "0000646805" "1" "50" "21" "47540432" "47540432" "subst" "0.000430883" "00006" "COL6A2_000247" "g.47540432G>A" "1/94 cases" "{PMID:Punetha 2016:27854218}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.46120518G>A" "" "VUS" "" "0000646819" "0" "50" "21" "47532280" "47532280" "subst" "0" "00006" "COL6A2_000449" "g.47532280G>T" "1/94 cases" "{PMID:Punetha 2016:27854218}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.46112366G>T" "" "VUS" "" "0000650891" "1" "30" "21" "47531859" "47531859" "subst" "0.0216135" "03575" "COL6A2_000069" "g.47531859G>A" "24/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "24 heterozygous, no homozygous; {DB:CLININrs117154313}" "Germline" "" "rs117154313" "0" "" "" "g.46111945G>A" "" "likely benign" "" "0000650892" "1" "30" "21" "47532456" "47532456" "subst" "0.0211517" "03575" "COL6A2_000031" "g.47532456G>A" "64/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "64 heterozygous, no homozygous; {DB:CLININrs35881321}" "Germline" "" "rs35881321" "0" "" "" "g.46112542G>A" "" "likely benign" "" "0000650893" "1" "30" "21" "47532500" "47532500" "subst" "0.0388318" "03575" "COL6A2_000073" "g.47532500C>T" "175/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "175 heterozygous; {DB:CLININrs78822624}" "Germline" "" "rs78822624" "0" "" "" "g.46112586C>T" "" "likely benign" "" "0000650894" "1" "50" "21" "47532733" "47532733" "subst" "2.84634E-5" "03575" "COL6A2_000302" "g.47532733G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs199806576}" "Germline" "" "rs199806576" "0" "" "" "g.46112819G>A" "" "VUS" "" "0000650895" "1" "50" "21" "47541504" "47541504" "subst" "2.03739E-5" "03575" "COL6A2_000030" "g.47541504G>A" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs267606749}" "Germline" "" "rs267606749" "0" "" "" "g.46121590G>A" "" "VUS" "" "0000650896" "1" "50" "21" "47542422" "47542422" "subst" "0.000187587" "03575" "COL6A2_000345" "g.47542422G>A" "2/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs200667230}" "Germline" "" "rs200667230" "0" "" "" "g.46122508G>A" "" "VUS" "" "0000650897" "1" "30" "21" "47544599" "47544599" "subst" "0.000753159" "03575" "COL6A2_000256" "g.47544599G>A" "1/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs147158850}" "Germline" "" "rs147158850" "0" "" "" "g.46124685G>A" "" "likely benign" "" "0000650898" "1" "50" "21" "47544833" "47544833" "subst" "0.00190503" "03575" "COL6A2_000142" "g.47544833C>T" "3/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; {DB:CLININrs142709940}" "Germline" "" "rs142709940" "0" "" "" "g.46124919C>T" "" "VUS" "" "0000650900" "1" "50" "21" "47551895" "47551895" "subst" "6.00019E-5" "03575" "COL6A2_000153" "g.47551895G>A" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs139552940}" "Germline" "" "rs139552940" "0" "" "" "g.46131981G>A" "" "VUS" "" "0000650901" "1" "30" "21" "47551909" "47551909" "subst" "0.00186618" "03575" "COL6A2_000450" "g.47551909G>A" "8/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "8 heterozygous, no homozygous; {DB:CLININrs117668143}" "Germline" "" "rs117668143" "0" "" "" "g.46131995G>A" "" "likely benign" "" "0000650902" "1" "30" "21" "47551964" "47551964" "subst" "0.00253908" "03575" "COL6A2_000025" "g.47551964G>A" "33/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "33 heterozygous; {DB:CLININrs144830948}" "Germline" "" "rs144830948" "0" "" "" "g.46132050G>A" "" "likely benign" "" "0000650903" "1" "50" "21" "47552201" "47552201" "subst" "0.00252178" "03575" "COL6A2_000041" "g.47552201C>T" "9/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 9 heterozygous, no homozygous; {DB:CLININrs117725825}" "Germline" "" "rs117725825" "0" "" "" "g.46132287C>T" "" "VUS" "" "0000650904" "1" "50" "21" "47552366" "47552366" "subst" "8.39856E-5" "03575" "COL6A2_000418" "g.47552366C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs199955442}" "Germline" "" "rs199955442" "0" "" "" "g.46132452C>T" "" "VUS" "" "0000650905" "1" "30" "21" "47552389" "47552389" "subst" "0.00254957" "03575" "COL6A2_000123" "g.47552389G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs35139588}" "Germline" "" "rs35139588" "0" "" "" "g.46132475G>A" "" "likely benign" "" "0000653047" "1" "50" "21" "47545731" "47545731" "subst" "0.000105908" "03575" "COL6A2_000361" "g.47545731G>A" "6/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "6 heterozygous, no homozygous; {DB:CLININrs138948335}" "Germline" "" "rs138948335" "0" "" "" "g.46125817G>A" "" "VUS" "" "0000658859" "0" "70" "21" "47535805" "47535805" "subst" "0" "02327" "COL6A2_000451" "g.47535805G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.46115891G>A" "" "likely pathogenic" "" "0000660443" "0" "90" "21" "47545423" "47545423" "subst" "0" "01164" "COL6A2_000015" "g.47545423G>A" "" "" "" "" "ACMG grading: PM1,PM2,PP1,PP3,PP5; Scacheri et al. 2002. Neurology 58: 593; Collins et al. 2012. Neurology 20: 2158" "Germline" "" "rs267606750" "0" "" "" "g.46125509G>A" "" "pathogenic" "ACMG" "0000660689" "0" "50" "21" "47545827" "47545827" "subst" "4.06395E-6" "01164" "COL6A2_000017" "g.47545827G>A" "" "" "" "" "Lampe et al. 2005. J Med Genet 42: 108-120" "Germline" "" "rs794727418" "0" "" "" "g.46125913G>A" "" "VUS" "" "0000669699" "3" "30" "21" "47532500" "47532500" "subst" "0.0388318" "03575" "COL6A2_000073" "g.47532500C>T" "2/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 homozygous; {DB:CLININrs78822624}" "Germline" "" "rs78822624" "0" "" "" "g.46112586C>T" "" "likely benign" "" "0000669700" "3" "30" "21" "47551964" "47551964" "subst" "0.00253908" "03575" "COL6A2_000025" "g.47551964G>A" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 homozygous; {DB:CLININrs144830948}" "Germline" "" "rs144830948" "0" "" "" "g.46132050G>A" "" "likely benign" "" "0000670723" "0" "90" "21" "47544809" "47544809" "subst" "0" "00006" "COL6A2_000453" "g.47544809G>A" "" "{PMID:Yu 2017:28403181}" "" "" "" "De novo" "" "" "0" "" "" "g.46124895G>A" "" "pathogenic (dominant)" "" "0000670800" "1" "90" "21" "47531403" "47531415" "del" "0" "00006" "COL6A2_000452" "g.47531403_47531415del" "" "{PMID:Yu 2017:28403181}" "" "c.11_23delGCACCTGCTCCGT" "" "Germline" "" "" "0" "" "" "g.46111489_46111501del" "" "pathogenic" "" "0000670889" "2" "90" "21" "47545207" "47545207" "subst" "0" "00006" "COL6A2_000454" "g.47545207G>A" "" "{PMID:Yu 2017:28403181}" "" "" "" "Germline" "" "" "0" "" "" "g.46125293G>A" "" "pathogenic" "" "0000681753" "0" "50" "21" "47532441" "47532441" "subst" "1.65968E-5" "01943" "COL6A2_000455" "g.47532441G>A" "" "" "" "COL6A2(NM_058175.2):c.664G>A (p.D222N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000681754" "0" "50" "21" "47539720" "47539720" "subst" "0" "01943" "COL6A2_000331" "g.47539720G>A" "" "" "" "COL6A2(NM_058175.2):c.1288G>A (p.G430S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000681755" "0" "30" "21" "47542060" "47542060" "subst" "0.000397001" "01943" "COL6A2_000435" "g.47542060C>G" "" "" "" "COL6A2(NM_001849.3):c.1560C>G (p.(Pro520=)), COL6A2(NM_058175.2):c.1560C>G (p.P520=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681756" "0" "50" "21" "47545884" "47545884" "subst" "8.12863E-6" "01943" "COL6A2_000456" "g.47545884C>T" "" "" "" "COL6A2(NM_058175.2):c.2155C>T (p.R719W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000681757" "0" "30" "21" "47545899" "47545899" "subst" "0.00105677" "02326" "COL6A2_000259" "g.47545899C>T" "" "" "" "COL6A2(NM_058175.2):c.2170C>T (p.R724C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681758" "0" "50" "21" "47552249" "47552249" "subst" "3.34169E-5" "01804" "FTCD_000026" "g.47552249C>T" "" "" "" "COL6A2(NM_001849.3):c.2843C>T (p.(Thr948Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000683632" "0" "50" "21" "47546419" "47546419" "subst" "0" "01164" "COL6A2_000457" "g.47546419C>T" "" "" "" "" "ACMG grading: PM2,PP3\r\n13y old male patient, CK not elevated, no neurological deficits" "Germline" "" "" "0" "" "" "" "" "VUS" "ACMG" "0000693078" "0" "50" "21" "47532249" "47532249" "subst" "4.19706E-5" "01943" "COL6A2_000290" "g.47532249G>A" "" "" "" "COL6A2(NM_058175.2):c.472G>A (p.V158M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693079" "0" "30" "21" "47545865" "47545865" "subst" "0.000800566" "02326" "COL6A2_000106" "g.47545865C>T" "" "" "" "COL6A2(NM_058175.2):c.2136C>T (p.D712=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693080" "0" "30" "21" "47552292" "47552292" "subst" "0.000820685" "02326" "COL6A2_000121" "g.47552292C>T" "" "" "" "COL6A2(NM_001849.3):c.2886C>T (p.H962=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000697417" "0" "70" "21" "47536681" "47536681" "subst" "0" "00006" "COL6A2_000191" "g.47536681C>G" "2/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46116767C>G" "" "likely pathogenic" "" "0000697418" "0" "70" "21" "47545921" "47545921" "subst" "0" "00006" "COL6A2_000198" "g.47545921C>T" "2/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46126007C>T" "" "likely pathogenic" "" "0000697419" "0" "70" "21" "47552005" "47552005" "subst" "0.00140527" "00006" "COL6A2_000130" "g.47552005C>T" "2/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46132091C>T" "" "likely pathogenic" "" "0000697420" "0" "70" "21" "47532165" "47532165" "subst" "2.04703E-5" "00006" "COL6A2_000202" "g.47532165C>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46112251C>T" "" "likely pathogenic" "" "0000697421" "0" "70" "21" "47533988" "47533988" "del" "0" "00006" "COL6A2_000192" "g.47533988del" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46114074del" "" "likely pathogenic" "" "0000697422" "0" "70" "21" "47535786" "47535786" "subst" "0" "00006" "COL6A2_000050" "g.47535786G>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46115872G>T" "" "likely pathogenic" "" "0000697423" "0" "70" "21" "47535960" "47535960" "subst" "0" "00006" "COL6A2_000194" "g.47535960G>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46116046G>T" "" "likely pathogenic" "" "0000697424" "0" "70" "21" "47538592" "47538592" "subst" "0" "00006" "COL6A2_000188" "g.47538592T>G" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46118678T>G" "" "likely pathogenic" "" "0000697425" "0" "70" "21" "47539016" "47539016" "subst" "2.48511E-5" "00006" "COL6A2_000195" "g.47539016G>A" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46119102G>A" "" "likely pathogenic" "" "0000697426" "0" "70" "21" "47544833" "47544833" "subst" "0.00190503" "00006" "COL6A2_000142" "g.47544833C>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46124919C>T" "" "likely pathogenic" "" "0000697427" "0" "70" "21" "47545427" "47545427" "subst" "0" "00006" "COL6A2_000196" "g.47545427G>A" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46125513G>A" "" "likely pathogenic" "" "0000697428" "0" "70" "21" "47545502" "47545502" "subst" "0" "00006" "COL6A2_000197" "g.47545502C>G" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46125588C>G" "" "likely pathogenic" "" "0000697429" "0" "70" "21" "47545697" "47545697" "subst" "0" "00006" "COL6A2_000190" "g.47545697A>G" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46125783A>G" "" "likely pathogenic" "" "0000697430" "0" "70" "21" "47545704" "47545704" "subst" "0" "00006" "COL6A2_000066" "g.47545704C>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46125790C>T" "" "likely pathogenic" "" "0000697431" "0" "70" "21" "47545827" "47545827" "subst" "4.06395E-6" "00006" "COL6A2_000017" "g.47545827G>A" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46125913G>A" "" "likely pathogenic" "" "0000697432" "0" "70" "21" "47546005" "47546005" "subst" "0" "00006" "COL6A2_000199" "g.47546005T>C" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46126091T>C" "" "likely pathogenic" "" "0000697433" "0" "70" "21" "47546145" "47546145" "subst" "0" "00006" "COL6A2_000200" "g.47546145T>C" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46126231T>C" "" "likely pathogenic" "" "0000697434" "0" "70" "21" "47546158" "47546158" "subst" "1.70993E-5" "00006" "COL6A2_000189" "g.47546158G>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46126244G>T" "" "likely pathogenic" "" "0000697435" "0" "70" "21" "47549283" "47549283" "subst" "0.000802196" "00006" "COL6A2_000187" "g.47549283G>A" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "NM_058174.2:c.2635G>A (E879K)" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46129369G>A" "" "likely pathogenic" "" "0000697436" "0" "70" "21" "47552224" "47552224" "subst" "0" "00006" "COL6A2_000201" "g.47552224G>C" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.46132310G>C" "" "likely pathogenic" "" "0000712634" "0" "70" "21" "47552236" "47552238" "del" "0" "03779" "COL6A2_000407" "g.47552236_47552238del" "" "" "" "" "" "CLASSIFICATION record" "" "rs769426922" "0" "" "" "" "" "likely pathogenic" "" "0000727982" "0" "50" "21" "47531979" "47531979" "subst" "2.03333E-5" "02329" "COL6A2_000204" "g.47531979T>C" "" "" "" "COL6A2(NM_058175.3):c.202T>C (p.F68L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727983" "0" "30" "21" "47532288" "47532288" "subst" "0.00115034" "02326" "COL6A2_000159" "g.47532288G>A" "" "" "" "COL6A2(NM_001849.3):c.511G>A (p.(Gly171Arg)), COL6A2(NM_001849.4):c.511G>A (p.G171R), COL6A2(NM_058175.2):c.511G>A (p.G171R), COL6A2(NM_058175.3):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727984" "0" "50" "21" "47532319" "47532319" "subst" "6.04141E-5" "01943" "COL6A2_000458" "g.47532319G>A" "" "" "" "COL6A2(NM_058175.2):c.542G>A (p.R181H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727985" "0" "50" "21" "47533977" "47533977" "subst" "0.000434641" "02329" "COL6A2_000305" "g.47533977G>A" "" "" "" "COL6A2(NM_001849.3):c.791G>A (p.(Arg264His)), COL6A2(NM_058175.2):c.791G>A (p.R264H), COL6A2(NM_058175.3):c.791G>A (p.R264H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727986" "0" "50" "21" "47538944" "47538944" "subst" "0" "01943" "COL6A2_000459" "g.47538944G>T" "" "" "" "COL6A2(NM_058175.2):c.1180G>T (p.G394W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727987" "0" "30" "21" "47539033" "47539033" "subst" "4.18975E-5" "01943" "COL6A2_000329" "g.47539033G>A" "" "" "" "COL6A2(NM_058175.2):c.1269G>A (p.P423=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727988" "0" "50" "21" "47544833" "47544833" "subst" "0.00190503" "02325" "COL6A2_000142" "g.47544833C>T" "" "" "" "COL6A2(NM_001849.3):c.1769C>T (p.(Thr590Met)), COL6A2(NM_001849.4):c.1769C>T (p.T590M), COL6A2(NM_058175.2):c.1769C>T (p.T590M), COL6A2(NM_058175....)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727989" "0" "90" "21" "47545690" "47545690" "subst" "0.000106823" "02329" "COL6A2_000056" "g.47545690G>A" "" "" "" "COL6A2(NM_001849.3):c.1970-9G>A (p.?), COL6A2(NM_058175.2):c.1970-9G>A, COL6A2(NM_058175.3):c.1970-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000727990" "0" "50" "21" "47545926" "47545926" "subst" "0" "02329" "COL6A2_000369" "g.47545926G>A" "" "" "" "COL6A2(NM_058175.3):c.2197G>A (p.G733R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727991" "0" "50" "21" "47545962" "47545962" "subst" "4.06755E-5" "02329" "COL6A2_000370" "g.47545962C>T" "" "" "" "COL6A2(NM_058175.3):c.2233C>T (p.R745W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727992" "0" "30" "21" "47546060" "47546060" "subst" "0.000386123" "02326" "COL6A2_000261" "g.47546060C>T" "" "" "" "COL6A2(NM_001849.3):c.2331C>T (p.(Cys777=)), COL6A2(NM_058175.2):c.2331C>T (p.C777=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727993" "0" "50" "21" "47551894" "47551894" "subst" "0" "02329" "COL6A2_000264" "g.47551894C>T" "" "" "" "COL6A2(NM_001849.3):c.2488C>T (p.R830W), COL6A2(NM_001849.4):c.2488C>T (p.R830W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727994" "0" "50" "21" "47551976" "47551987" "dup" "0" "02329" "FTCD_000008" "g.47551976_47551987dup" "" "" "" "COL6A2(NM_001849.4):c.2570_2581dupAGCAGGTGGCGC (p.A860_R861insQQVA)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727995" "0" "50" "21" "47551997" "47551997" "subst" "0" "02329" "FTCD_000010" "g.47551997C>A" "" "" "" "COL6A2(NM_001849.4):c.2591C>A (p.T864K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727996" "0" "50" "21" "47552191" "47552191" "subst" "0.000166165" "02329" "COL6A2_000170" "g.47552191G>A" "" "" "" "COL6A2(NM_001849.4):c.2785G>A (p.(Val929Met), p.V929M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727997" "0" "50" "21" "47552341" "47552341" "subst" "0.000191803" "01943" "COL6A2_000415" "g.47552341G>A" "" "" "" "COL6A2(NM_001849.3):c.2935G>A (p.D979N), COL6A2(NM_001849.4):c.2935G>A (p.(Asp979Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000735979" "0" "70" "21" "47545926" "47545926" "subst" "0" "04016" "COL6A2_000369" "g.47545926G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.46126012G>A" "" "VUS" "" "0000763683" "0" "90" "21" "47552063" "47552085" "del" "0" "04047" "COL6A2_000460" "g.47552063_47552085del" "" "{PMID:Saat 2021:33963534}" "" "g.34049_34071delCCCGGCGAGCAGCAGGTGGCCTT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.46132149_46132171del" "" "pathogenic (dominant)" "" "0000763692" "1" "50" "21" "47532405" "47532405" "subst" "0.000262059" "04047" "COL6A2_000298" "g.47532405G>A" "" "{PMID:Saat 2021:33963534}" "" "g.14395G>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000786825" "3" "70" "21" "47531428" "47531428" "del" "0" "00006" "COL6A2_000461" "g.47531428del" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.46111514del" "" "likely pathogenic" "" "0000786826" "3" "90" "21" "47532087" "47532087" "subst" "4.07329E-6" "00006" "COL6A2_000462" "g.47532087C>T" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.46112173C>T" "" "pathogenic" "" "0000786827" "0" "70" "21" "47535942" "47535942" "subst" "0" "00006" "COL6A2_000167" "g.47535942G>T" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.46116028G>T" "" "likely pathogenic" "" "0000786828" "1" "70" "21" "47539705" "47539712" "dup" "0" "00006" "COL6A2_000463" "g.47539705_47539712dup" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.46119791_46119798dup" "" "likely pathogenic" "" "0000787246" "0" "50" "21" "47541500" "47541500" "subst" "0" "00006" "COL6A2_000465" "g.47541500C>T" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.46121586C>T" "" "VUS" "" "0000787247" "0" "50" "21" "47545794" "47545794" "subst" "2.84483E-5" "00006" "COL6A2_000466" "g.47545794G>A" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "rs560146338" "0" "" "" "g.46125880G>A" "" "VUS" "" "0000787463" "0" "50" "21" "47539744" "47539744" "subst" "0" "00000" "COL6A2_000464" "g.47539744G>A" "" "0" "" "" "" "Germline" "" "" "0" "" "" "g.46119830G>A" "{CV-RCV:000383359.1}" "VUS" "" "0000787464" "2" "70" "21" "47552271" "47552272" "del" "0" "00000" "COL6A2_000468" "g.47552271_47552272del" "" "0" "" "c.2864_2865delAC" "" "Germline" "" "" "0" "" "" "g.46132357_46132358del" "" "likely pathogenic" "" "0000787547" "0" "50" "21" "47546124" "47546124" "subst" "5.06359E-5" "00000" "COL6A2_000467" "g.47546124G>A" "" "0" "" "" "" "Germline" "" "rs372936386" "0" "" "" "g.46126210G>A" "" "VUS" "" "0000809440" "0" "30" "21" "47541477" "47541477" "subst" "0.00169113" "02326" "COL6A2_000250" "g.47541477G>A" "" "" "" "COL6A2(NM_001849.3):c.1466G>A (p.(Arg489Gln)), COL6A2(NM_058175.2):c.1466G>A (p.R489Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809441" "0" "30" "21" "47542794" "47542794" "subst" "0.000944087" "01943" "COL6A2_000469" "g.47542794C>T" "" "" "" "COL6A2(NM_058175.2):c.1614C>T (p.G538=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809442" "0" "30" "21" "47545535" "47545535" "subst" "4.93421E-5" "01804" "COL6A2_000470" "g.47545535A>C" "" "" "" "COL6A2(NM_001849.3):c.1969+4A>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809443" "0" "50" "21" "47545911" "47545911" "subst" "0.000426788" "01943" "COL6A2_000222" "g.47545911G>A" "" "" "" "COL6A2(NM_001849.3):c.2182G>A (p.(Val728Met)), COL6A2(NM_058175.2):c.2182G>A (p.V728M), COL6A2(NM_058175.3):c.2182G>A (p.V728M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809444" "0" "30" "21" "47557195" "47557195" "subst" "8.12203E-6" "01943" "FTCD_000033" "g.47557195G>A" "" "" "" "FTCD(NM_001320412.1):c.1497C>T (p.L499=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000819182" "0" "90" "21" "47535924" "47535924" "subst" "0" "00006" "COL6A2_000471" "g.47535924G>A" "" "{PMID:Chakravorty 2020:33250842}" "" "" "" "Germline" "" "" "0" "" "" "g.46116010G>A" "" "pathogenic (dominant)" "ACMG" "0000819212" "1" "50" "21" "47542428" "47542428" "subst" "4.08017E-6" "00006" "COL6A2_000253" "g.47542428G>A" "" "{PMID:Chakravorty 2020:33250842}" "" "" "" "Germline" "" "" "0" "" "" "g.46122514G>A" "" "VUS" "ACMG" "0000819213" "1" "50" "21" "47545462" "47545462" "subst" "0" "00006" "COL6A2_000472" "g.47545462G>A" "" "{PMID:Chakravorty 2020:33250842}" "" "" "" "Germline" "" "" "0" "" "" "g.46125548G>A" "" "VUS" "ACMG" "0000819262" "2" "90" "21" "47545690" "47545690" "subst" "0.000106823" "00006" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Chakravorty 2020:33250842}" "" "" "" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic (recessive)" "ACMG" "0000819263" "2" "50" "21" "47545697" "47545697" "subst" "0" "00006" "COL6A2_000190" "g.47545697A>G" "" "{PMID:Chakravorty 2020:33250842}" "" "" "" "Germline" "" "" "0" "" "" "g.46125783A>G" "" "VUS" "ACMG" "0000823912" "0" "90" "21" "47551892" "47551892" "del" "0" "03501" "COL6A2_000473" "g.47551892del" "" "{PMID:Karthikeyan 2024:39548682}" "" "c.2486delA" "Novel variant (2021)" "Germline/De novo (untested)" "" "" "0" "" "" "g.46131978del" "" "pathogenic" "" "0000823914" "0" "70" "21" "47552017" "47552017" "subst" "9.92605E-6" "03501" "COL6A2_000151" "g.47552017G>A" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.46132103G>A" "" "likely pathogenic" "" "0000831194" "0" "70" "21" "47535941" "47535941" "subst" "0" "03524" "COL6A2_000474" "g.47535941G>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.46116027G>A" "" "pathogenic (dominant)" "" "0000831316" "3" "50" "21" "47537326" "47537326" "subst" "0.000130769" "00006" "COL6A2_000317" "g.47537326C>T" "" "{PMID:Patel 2021:34925456}" "" "" "" "Germline" "" "rs775751831" "0" "" "" "g.46117412C>T" "" "VUS" "" "0000831337" "0" "90" "21" "47533921" "47533921" "subst" "0" "00006" "COL6A2_000476" "g.47533921G>A" "" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.46114007G>A" "" "pathogenic (dominant)" "" "0000831338" "0" "90" "21" "47535796" "47535796" "subst" "0" "00006" "COL6A2_000132" "g.47535796G>A" "" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.46115882G>A" "" "pathogenic (dominant)" "" "0000831339" "0" "70" "21" "47535924" "47535924" "subst" "0" "00006" "COL6A2_000471" "g.47535924G>A" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.46116010G>A" "" "likely pathogenic (dominant)" "" "0000831340" "0" "70" "21" "47535941" "47535941" "subst" "0" "00006" "COL6A2_000474" "g.47535941G>A" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.46116027G>A" "" "likely pathogenic (dominant)" "" "0000831341" "0" "90" "21" "47535942" "47535942" "subst" "0" "00006" "COL6A2_000134" "g.47535942G>A" "" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.46116028G>A" "" "pathogenic (dominant)" "" "0000831342" "0" "90" "21" "47535968" "47535968" "subst" "0" "00006" "COL6A2_000058" "g.47535968G>A" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.46116054G>A" "" "pathogenic (dominant)" "" "0000831343" "0" "70" "21" "47536321" "47536321" "dup" "0" "00006" "COL6A2_000477" "g.47536321dup" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.46116407dup" "" "likely pathogenic (dominant)" "" "0000831344" "0" "90" "21" "47536682" "47536683" "del" "0" "00006" "COL6A2_000479" "g.47536682_47536683del" "" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "c.955-2_955-1delAG" "" "De novo" "" "" "0" "" "" "g.46116768_46116769del" "" "pathogenic (dominant)" "" "0000831345" "11" "70" "21" "47536564" "47536564" "subst" "0" "00006" "COL6A2_000478" "g.47536564G>T" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46116650G>T" "" "likely pathogenic (recessive)" "" "0000831346" "11" "90" "21" "47537830" "47537830" "subst" "0" "00006" "COL6A2_000150" "g.47537830C>T" "" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46117916C>T" "" "pathogenic (recessive)" "" "0000831347" "21" "90" "21" "47540981" "47540981" "subst" "1.23287E-5" "00006" "COL6A2_000481" "g.47540981C>T" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46121067C>T" "" "pathogenic (recessive)" "" "0000831348" "11" "70" "21" "47541506" "47541506" "subst" "0" "00006" "COL6A2_000482" "g.47541506G>A" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46121592G>A" "" "likely pathogenic (recessive)" "" "0000831349" "11" "90" "21" "47540981" "47540981" "subst" "1.23287E-5" "00006" "COL6A2_000481" "g.47540981C>T" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46121067C>T" "" "pathogenic (recessive)" "" "0000831350" "0" "90" "21" "47542796" "47542796" "subst" "1.22065E-5" "00006" "COL6A2_000483" "g.47542796G>A" "" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.46122882G>A" "" "pathogenic (dominant)" "" "0000831351" "11" "70" "21" "47542825" "47542832" "del" "0" "00006" "COL6A2_000484" "g.47542825_47542832del" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46122911_46122918del" "" "likely pathogenic (recessive)" "" "0000831352" "11" "70" "21" "47545225" "47545225" "subst" "4.10526E-6" "00006" "COL6A2_000485" "g.47545225G>C" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46125311G>C" "" "likely pathogenic (recessive)" "" "0000831353" "21" "70" "21" "47551865" "47551865" "subst" "0" "00006" "COL6A2_000488" "g.47551865C>A" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46131951C>A" "" "likely pathogenic (recessive)" "" "0000831354" "11" "90" "21" "47551954" "47551956" "del" "0" "00006" "COL6A2_000489" "g.47551954_47551956del" "" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "c.2548_2550delCAC" "" "Germline" "" "" "0" "" "" "g.46132040_46132042del" "" "pathogenic (recessive)" "" "0000831355" "21" "90" "21" "47552017" "47552017" "subst" "9.92605E-6" "00006" "COL6A2_000151" "g.47552017G>A" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46132103G>A" "" "pathogenic (recessive)" "" "0000831382" "21" "70" "21" "47531991" "47531991" "subst" "0" "00006" "COL6A2_000475" "g.47531991C>T" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46112077C>T" "" "likely pathogenic (recessive)" "" "0000831384" "21" "90" "21" "47552336" "47552347" "del" "0" "00006" "COL6A2_000492" "g.47552336_47552347del" "" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46132422_46132433del" "" "pathogenic (recessive)" "" "0000831385" "11" "70" "21" "47545862" "47545862" "subst" "0" "00006" "COL6A2_000487" "g.47545862C>G" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46125948C>G" "" "likely pathogenic (recessive)" "" "0000831386" "21" "70" "21" "47545698" "47545698" "subst" "0" "00006" "COL6A2_000486" "g.47545698G>C" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46125784G>C" "" "likely pathogenic (recessive)" "" "0000831387" "21" "70" "21" "47552049" "47552049" "dup" "0" "00006" "COL6A2_000491" "g.47552049dup" "" "{PMID:Fan 2018:29419890}" "" "c.2642_2643insG" "" "Germline" "" "" "0" "" "" "g.46132135dup" "" "likely pathogenic (recessive)" "" "0000831388" "21" "70" "21" "47552412" "47552412" "subst" "0" "00006" "COL6A2_000493" "g.47552412T>G" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46132498T>G" "" "likely pathogenic (recessive)" "" "0000831389" "11" "70" "21" "47552048" "47552048" "del" "0" "00006" "COL6A2_000490" "g.47552048del" "" "{PMID:Fan 2018:29419890}" "" "c.2642delA" "" "Germline" "" "" "0" "" "" "g.46132134del" "" "likely pathogenic (recessive)" "" "0000831391" "11" "70" "21" "47552411" "47552412" "del" "0" "00006" "COL6A2_000064" "g.47552411_47552412del" "" "{PMID:Fan 2018:29419890}" "" "c.3004_3005del" "" "Germline" "" "" "0" "" "" "g.46132497_46132498del" "" "likely pathogenic (recessive)" "" "0000831393" "11" "90" "21" "47551895" "47551895" "subst" "6.00019E-5" "00006" "COL6A2_000153" "g.47551895G>A" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.46131981G>A" "" "pathogenic (recessive)" "" "0000833062" "1" "70" "21" "47536289" "47536289" "subst" "0" "00006" "COL6A2_000494" "g.47536289A>G" "" "{PMID:Gonzalez-Quereda 2020:32403337}" "" "" "" "Germline" "" "" "0" "" "" "g.46116375A>G" "" "likely pathogenic" "" "0000833123" "1" "70" "21" "47535941" "47535941" "subst" "0" "00006" "COL6A2_000474" "g.47535941G>A" "" "{PMID:Gonzalez-Quereda 2020:32403337}" "" "" "" "Germline" "" "" "0" "" "" "g.46116027G>A" "" "likely pathogenic" "" "0000842401" "3" "50" "21" "47552039" "47552039" "subst" "1.65709E-5" "00006" "COL6A2_000391" "g.47552039C>T" "" "{PMID:Sharifi 2021:33481221}" "" "" "" "Germline" "" "" "0" "" "" "g.46132125C>T" "" "VUS" "ACMG" "0000847991" "1" "90" "21" "47538526" "47538526" "subst" "0" "00006" "COL6A2_000495" "g.47538526A>G" "" "{PMID:Hong 2022:35387801}" "" "" "" "Germline" "" "" "0" "" "" "g.46118612A>G" "" "pathogenic (recessive)" "ACMG" "0000847992" "2" "70" "21" "47552182" "47552190" "dup" "0" "00006" "COL6A2_000496" "g.47552182_47552190dup" "" "{PMID:Hong 2022:35387801}" "" "" "" "Germline" "" "" "0" "" "2776_2784dupAATGCCATC" "NC_000021.9:g.46132268_46132276dup" "" "VUS" "ACMG" "0000856033" "0" "50" "21" "47532069" "47532069" "subst" "4.07219E-6" "02329" "COL6A2_000498" "g.47532069G>A" "" "" "" "COL6A2(NM_058175.3):c.292G>A (p.G98S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856034" "0" "30" "21" "47532401" "47532401" "subst" "0" "01943" "COL6A2_000499" "g.47532401G>T" "" "" "" "COL6A2(NM_058175.2):c.624G>T (p.P208=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856035" "0" "50" "21" "47538521" "47538521" "subst" "0.00010696" "01943" "COL6A2_000500" "g.47538521C>A" "" "" "" "COL6A2(NM_058175.2):c.1117-7C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856036" "0" "30" "21" "47541537" "47541537" "subst" "1.22581E-5" "02325" "COL6A2_000501" "g.47541537G>A" "" "" "" "COL6A2(NM_001849.4):c.1521+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856037" "0" "50" "21" "47542443" "47542443" "subst" "0.000167519" "02329" "COL6A2_000346" "g.47542443G>A" "" "" "" "COL6A2(NM_058175.3):c.1606G>A (p.E536K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856038" "0" "30" "21" "47545398" "47545398" "subst" "0.000101701" "01943" "COL6A2_000437" "g.47545398C>T" "" "" "" "COL6A2(NM_058175.2):c.1836C>T (p.G612=), COL6A2(NM_058175.3):c.1836C>T (p.G612=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856039" "0" "50" "21" "47545696" "47545696" "subst" "0.00101707" "01943" "COL6A2_000016" "g.47545696C>A" "" "" "" "COL6A2(NM_001849.3):c.1970-3C>A (p.(=)), COL6A2(NM_001849.4):c.1970-3C>A, COL6A2(NM_058175.2):c.1970-3C>A, COL6A2(NM_058175.3):c.1970-3C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856040" "0" "30" "21" "47545696" "47545696" "subst" "0.00101707" "02325" "COL6A2_000016" "g.47545696C>A" "" "" "" "COL6A2(NM_001849.3):c.1970-3C>A (p.(=)), COL6A2(NM_001849.4):c.1970-3C>A, COL6A2(NM_058175.2):c.1970-3C>A, COL6A2(NM_058175.3):c.1970-3C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866682" "0" "30" "21" "47531412" "47531412" "subst" "0.000461745" "01804" "COL6A2_000274" "g.47531412G>A" "" "" "" "COL6A2(NM_001849.3):c.22G>A (p.(Val8Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866683" "0" "30" "21" "47531966" "47531966" "subst" "0.000101685" "01804" "COL6A2_000497" "g.47531966G>A" "" "" "" "COL6A2(NM_001849.3):c.189G>A (p.(Thr63=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866684" "0" "10" "21" "47532500" "47532500" "subst" "0.0388318" "01804" "COL6A2_000073" "g.47532500C>T" "" "" "" "COL6A2(NM_001849.3):c.714+9C>T (p.(=)), COL6A2(NM_058175.3):c.714+9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000866685" "0" "30" "21" "47540419" "47540419" "subst" "0.000925702" "01804" "COL6A2_000332" "g.47540419C>G" "" "" "" "COL6A2(NM_001849.3):c.1333-10C>G (p.(=)), COL6A2(NM_058175.2):c.1333-10C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866686" "0" "50" "21" "47545812" "47545812" "subst" "4.4702E-5" "02329" "COL6A2_000363" "g.47545812G>A" "" "" "" "COL6A2(NM_058175.3):c.2083G>A (p.E695K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866687" "0" "50" "21" "47545831" "47545831" "subst" "0" "01804" "COL6A2_000502" "g.47545831C>A" "" "" "" "COL6A2(NM_001849.3):c.2102C>A (p.(Thr701Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866688" "0" "30" "21" "47545892" "47545892" "subst" "0.00807094" "01804" "COL6A2_000108" "g.47545892G>A" "" "" "" "COL6A2(NM_001849.3):c.2163G>A (p.(Gln721=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866689" "0" "30" "21" "47546060" "47546060" "subst" "0.000386123" "01804" "COL6A2_000261" "g.47546060C>T" "" "" "" "COL6A2(NM_001849.3):c.2331C>T (p.(Cys777=)), COL6A2(NM_058175.2):c.2331C>T (p.C777=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866690" "0" "50" "21" "47552201" "47552201" "subst" "0.00252178" "01943" "COL6A2_000041" "g.47552201C>T" "" "" "" "COL6A2(NM_001849.3):c.2795C>T (p.P932L, p.(Pro932Leu)), COL6A2(NM_001849.4):c.2795C>T (p.P932L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866691" "0" "30" "21" "47552277" "47552277" "subst" "0.00108076" "01804" "FTCD_000038" "g.47552277G>A" "" "" "" "COL6A2(NM_001849.3):c.2871G>A (p.(Leu957=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866692" "0" "30" "21" "47552386" "47552386" "subst" "0.0115906" "01804" "COL6A2_000122" "g.47552386G>A" "" "" "" "COL6A2(NM_001849.3):c.2980G>A (p.(Ala994Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866693" "0" "30" "21" "47552449" "47552449" "subst" "0.00538973" "01804" "COL6A2_000126" "g.47552449A>C" "" "" "" "COL6A2(NM_001849.3):c.3043A>C (p.(Ile1015Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866694" "0" "50" "21" "47556895" "47556895" "subst" "4.11699E-6" "01943" "FTCD_000039" "g.47556895G>A" "" "" "" "FTCD(NM_001320412.1):c.1612C>T (p.R538W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000869942" "3" "90" "21" "47546395" "47546396" "ins" "0" "01399" "COL6A2_000503" "g.47546395_47546396insAGCCCGGCCCGGCCC" "absent in gnomAD" "{PMID:Bryen 2022:35847480}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46126481_46126482insAGCCCGGCCCGGCCC" "" "likely pathogenic (recessive)" "ACMG" "0000877886" "0" "70" "21" "47535960" "47535960" "subst" "0" "03779" "COL6A2_000504" "g.47535960G>A" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000877887" "0" "90" "21" "47535960" "47535960" "subst" "0" "03779" "COL6A2_000504" "g.47535960G>A" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "pathogenic" "" "0000879759" "21" "50" "21" "47552366" "47552366" "subst" "8.39856E-5" "00006" "COL6A2_000418" "g.47552366C>T" "" "{PMID:Scott 2017:27550220}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000881865" "11" "90" "21" "47542840" "47542848" "del" "0" "03361" "COL6A2_000505" "g.47542840_47542848del" "" "" "" "" "ACMG PM3_strong, PM1, PM2, PP4; mildly affected parent is heterozygous for p.(Lys554_Glu556del) variant, the more severely affected patient carries two COL6A2 variants in trans" "Germline" "" "" "0" "" "" "g.46122926_46122934del" "" "pathogenic (recessive)" "ACMG" "0000895539" "0" "50" "21" "47532345" "47532345" "subst" "0.000177871" "02325" "COL6A2_000293" "g.47532345G>A" "" "" "" "COL6A2(NM_001849.4):c.568G>A (p.V190M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895540" "0" "50" "21" "47532415" "47532415" "subst" "5.40145E-5" "02325" "COL6A2_000300" "g.47532415G>A" "" "" "" "COL6A2(NM_001849.4):c.638G>A (p.R213H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895541" "0" "10" "21" "47532544" "47532544" "subst" "0" "02326" "COL6A2_000506" "g.47532544C>T" "" "" "" "COL6A2(NM_058175.2):c.714+53C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000895542" "0" "50" "21" "47533977" "47533977" "subst" "0.000434641" "01804" "COL6A2_000305" "g.47533977G>A" "" "" "" "COL6A2(NM_001849.3):c.791G>A (p.(Arg264His)), COL6A2(NM_058175.2):c.791G>A (p.R264H), COL6A2(NM_058175.3):c.791G>A (p.R264H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895543" "0" "10" "21" "47537882" "47537882" "subst" "0.529713" "02326" "COL6A2_000081" "g.47537882G>A" "" "" "" "COL6A2(NM_058175.2):c.1116+32G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000895544" "0" "10" "21" "47540573" "47540573" "subst" "0" "02326" "COL6A2_000507" "g.47540573G>A" "" "" "" "COL6A2(NM_058175.2):c.1395+82G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000895545" "0" "10" "21" "47542220" "47542220" "subst" "0" "02326" "COL6A2_000508" "g.47542220C>T" "" "" "" "COL6A2(NM_058175.2):c.1572+148C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000895546" "0" "10" "21" "47544454" "47544454" "subst" "0" "02326" "COL6A2_000509" "g.47544454C>T" "" "" "" "COL6A2(NM_058175.2):c.1672-111C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000895547" "0" "10" "21" "47544541" "47544541" "subst" "0.493105" "02326" "COL6A2_000093" "g.47544541C>G" "" "" "" "COL6A2(NM_058175.2):c.1672-24C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000895548" "0" "90" "21" "47545690" "47545690" "subst" "0.000106823" "02326" "COL6A2_000056" "g.47545690G>A" "" "" "" "COL6A2(NM_001849.3):c.1970-9G>A (p.?), COL6A2(NM_058175.2):c.1970-9G>A, COL6A2(NM_058175.3):c.1970-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000895549" "0" "30" "21" "47546061" "47546061" "subst" "0.000718633" "02326" "COL6A2_000510" "g.47546061G>A" "" "" "" "COL6A2(NM_058175.2):c.2332G>A (p.D778N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895550" "0" "30" "21" "47546080" "47546080" "subst" "0.00443388" "02326" "COL6A2_000021" "g.47546080G>A" "" "" "" "COL6A2(NM_001849.3):c.2351G>A (p.(Arg784His)), COL6A2(NM_058175.2):c.2351G>A (p.R784H), COL6A2(NM_058175.3):c.2351G>A (p.R784H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895551" "0" "30" "21" "47548825" "47548825" "subst" "0.000835353" "02326" "COL6A2_000511" "g.47548825G>A" "" "" "" "COL6A2(NM_058175.2):c.2470G>A (p.G824R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895552" "0" "10" "21" "47551833" "47551833" "subst" "0.552288" "02326" "COL6A2_000112" "g.47551833C>T" "" "" "" "COL6A2(NM_001849.3):c.2462-35C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000895553" "0" "30" "21" "47552089" "47552089" "subst" "0.00128523" "01804" "COL6A2_000034" "g.47552089A>C" "" "" "" "COL6A2(NM_001849.3):c.2683A>C (p.S895R, p.(Ser895Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895554" "0" "50" "21" "47552344" "47552344" "subst" "6.67512E-5" "02325" "FTCD_000041" "g.47552344G>A" "" "" "" "COL6A2(NM_001849.4):c.2938G>A (p.V980M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000909338" "0" "90" "21" "47535840" "47535840" "subst" "0" "04448" "COL6A2_000512" "g.47535840G>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.46115926G>A" "" "pathogenic (dominant)" "ACMG" "0000915469" "0" "50" "21" "47532005" "47532005" "subst" "4.06669E-6" "01804" "COL6A2_000513" "g.47532005G>T" "" "" "" "COL6A2(NM_001849.3):c.228G>T (p.(Gln76His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000915470" "0" "90" "21" "47532372" "47532372" "subst" "0" "02327" "COL6A2_000514" "g.47532372C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000915471" "0" "50" "21" "47545971" "47545971" "subst" "0" "02327" "COL6A2_000515" "g.47545971T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000915472" "0" "30" "21" "47552013" "47552013" "subst" "0.00103584" "01804" "COL6A2_000387" "g.47552013C>T" "" "" "" "COL6A2(NM_001849.3):c.2607C>T (p.(Asp869=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000917124" "1" "90" "21" "47549202" "47549202" "subst" "6.51079E-5" "00006" "COL6A2_000517" "g.47549202C>T" "" "{PMID:Cavdarli 2023:36575883}" "" "" "ACMG PVS1 PM2 PP5" "Germline" "" "rs777172978" "0" "" "" "g.46129288C>T" "" "pathogenic (dominant)" "ACMG" "0000917174" "0" "50" "21" "47546100" "47546100" "subst" "4.17578E-6" "00006" "COL6A2_000516" "g.47546100G>A" "" "{PMID:Cavdarli 2023:36575883}" "" "" "" "Germline" "" "rs1273249543" "0" "" "" "g.46126186G>A" "" "VUS" "" "0000920113" "21" "50" "21" "47538547" "47538547" "subst" "0" "00006" "COL6A2_000480" "g.47538547G>A" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000927102" "0" "30" "21" "47552067" "47552067" "subst" "0.000244048" "01804" "COL6A2_000394" "g.47552067G>A" "" "" "" "COL6A2(NM_001849.3):c.2661G>A (p.(Glu887=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927103" "0" "50" "21" "47552182" "47552182" "subst" "8.53235E-6" "02327" "FTCD_000042" "g.47552182A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931232" "0" "30" "21" "47538979" "47538979" "subst" "0.00051015" "01804" "COL6A2_000518" "g.47538979T>C" "" "" "" "COL6A2(NM_001849.3):c.1215T>C (p.(Pro405=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000931234" "0" "10" "21" "47546399" "47546400" "ins" "0" "01804" "COL6A2_000439" "g.47546399_47546400insCGGCCCGGCCCGGCC" "" "" "" "COL6A2(NM_001849.3):c.2423-18_2423-17insCGGCCCGGCCCGGCC (p.(=)), COL6A2(NM_058175.3):c.2423-18_2423-17insCGGCCCGGCCCGGCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000931635" "21" "30" "21" "47551964" "47551964" "subst" "0.00253908" "00006" "COL6A2_000025" "g.47551964G>A" "" "{PMID:Sajan 2019:30478137}" "" "c.2558G>A (R853Q)" "" "Germline" "" "" "0" "" "" "g.46132050G>A" "" "likely benign" "" "0000936129" "0" "90" "21" "47549202" "47549202" "subst" "6.51079E-5" "00006" "COL6A2_000517" "g.47549202C>T" "" "{PMID:Cavdarli 2023:36575883}" "" "NM_058174.3:c.2554C>T (Gln852Ter)" "ACMG PVS1 PM2 PP5" "Germline/De novo (untested)" "" "rs777172978" "0" "" "" "g.46129288C>T" "" "pathogenic (dominant)" "ACMG" "0000936179" "0" "50" "21" "47546100" "47546100" "subst" "4.17578E-6" "00006" "COL6A2_000516" "g.47546100G>A" "" "{PMID:Cavdarli 2023:36575883}" "" "" "" "Germline/De novo (untested)" "" "rs1273249543" "0" "" "" "g.46126186G>A" "" "VUS" "" "0000945954" "1" "70" "21" "47545827" "47545827" "subst" "4.06395E-6" "00006" "COL6A2_000017" "g.47545827G>A" "" "{PMID:Panades de Oliveira 2019:30706156}" "" "" "ACMG PP3/PP5, PS1, PM2" "Germline" "" "" "0" "" "" "g.46125913G>A" "" "likely pathogenic" "ACMG" "0000945987" "1" "90" "21" "47545690" "47545690" "subst" "0.000106823" "00006" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Westra 2019:31127727}" "" "" "" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic (recessive)" "" "0000945988" "3" "90" "21" "47541029" "47541029" "subst" "1.2336E-5" "00006" "COL6A2_000249" "g.47541029G>A" "" "{PMID:Westra 2019:31127727}" "" "" "" "Germline" "" "" "0" "" "" "g.46121115G>A" "" "pathogenic (recessive)" "" "0000945989" "0" "90" "21" "47533991" "47533991" "del" "0" "00006" "COL6A2_000242" "g.47533991del" "" "{PMID:Westra 2019:31127727}" "" "" "" "De novo" "" "" "0" "" "" "g.46114077del" "" "pathogenic (dominant)" "" "0000945990" "1" "90" "21" "47542840" "47542848" "del" "0" "00006" "COL6A2_000505" "g.47542840_47542848del" "" "{PMID:Westra 2019:31127727}" "" "" "" "Germline" "" "" "0" "" "" "g.46122926_46122934del" "" "pathogenic (recessive)" "" "0000945991" "0" "90" "21" "47533990" "47533991" "dup" "0" "00006" "COL6A2_000241" "g.47533990_47533991dup" "" "{PMID:Westra 2019:31127727}" "" "" "" "De novo" "" "" "0" "" "" "g.46114076_46114077dup" "" "pathogenic (dominant)" "" "0000946063" "1" "50" "21" "47545887" "47545887" "subst" "4.47096E-5" "00006" "COL6A2_000519" "g.47545887C>T" "" "{PMID:Westra 2019:31127727}" "" "" "no variant 2nd chromosome; present in healthy family members; MATR3 (AD) present in healthy family members" "Germline/De novo (untested)" "" "" "0" "" "" "g.46125973C>T" "" "VUS" "" "0000946084" "0" "50" "21" "47544599" "47544599" "subst" "0.000753159" "00006" "COL6A2_000256" "g.47544599G>A" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.46124685G>A" "" "VUS" "" "0000946112" "0" "50" "21" "47540432" "47540432" "subst" "0.000430883" "00006" "COL6A2_000247" "g.47540432G>A" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.46120518G>A" "" "VUS" "" "0000946113" "0" "50" "21" "47545921" "47545921" "subst" "0" "00006" "COL6A2_000198" "g.47545921C>T" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.46126007C>T" "" "VUS" "" "0000946158" "2" "90" "21" "47552033" "47552033" "subst" "0" "00006" "COL6A2_000520" "g.47552033G>A" "" "{PMID:Westra 2019:31127727}" "" "" "" "Germline" "" "" "0" "" "" "g.46132119G>A" "" "pathogenic (recessive)" "" "0000946159" "2" "90" "21" "47551894" "47551894" "subst" "0" "00006" "COL6A2_000264" "g.47551894C>T" "" "{PMID:Westra 2019:31127727}" "" "" "" "Germline" "" "" "0" "" "" "g.46131980C>T" "" "pathogenic (recessive)" "" "0000946179" "0" "50" "21" "47552409" "47552409" "subst" "0.000102174" "00006" "COL6A2_000266" "g.47552409C>A" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.46132495C>A" "" "VUS" "" "0000946215" "0" "50" "21" "47540454" "47540454" "subst" "7.30353E-5" "00006" "COL6A2_000248" "g.47540454G>A" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.46120540G>A" "" "VUS" "" "0000951523" "0" "50" "21" "47532288" "47532288" "subst" "0.00115034" "02325" "COL6A2_000159" "g.47532288G>A" "" "" "" "COL6A2(NM_001849.3):c.511G>A (p.(Gly171Arg)), COL6A2(NM_001849.4):c.511G>A (p.G171R), COL6A2(NM_058175.2):c.511G>A (p.G171R), COL6A2(NM_058175.3):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000954927" "3" "90" "21" "47531504" "47531517" "del" "0" "04618" "COL6A2_000522" "g.47531504_47531517del" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PVS1, PM2_sup, PM3_sup, PP4" "Germline" "?" "" "0" "" "" "g.46111590_46111603del" "#1324140, #476449" "pathogenic (recessive)" "ACMG" "0000954928" "3" "90" "21" "47545690" "47545690" "subst" "0.000106823" "04618" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PS3_VS, PM3_strong, PP4_mod; PMID:19309692, 20576434, 27447704, 25535305, 24314752, 21280092, 29774307" "Germline" "?" "" "0" "" "" "g.46125776G>A" "" "pathogenic (recessive)" "ACMG" "0000954929" "1" "90" "21" "47545690" "47545690" "subst" "0.000106823" "04618" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PS3_VS, PM3_strong, PP4_mod; PMID:19309692, 20576434, 27447704, 25535305, 24314752, 21280092, 29774307" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic (recessive)" "ACMG" "0000954930" "2" "90" "21" "47544816" "47544816" "del" "4.0702E-6" "04618" "COL6A2_000523" "g.47544816del" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PVS1, PM3, PM2_sup, PP4" "Germline" "?" "" "0" "" "" "g.46124902del" "" "pathogenic (recessive)" "ACMG" "0000954931" "3" "70" "21" "47552300" "47552300" "subst" "4.14604E-6" "04618" "COL6A2_000413" "g.47552300G>C" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PM3_strong, PM2_sup, PP3; PMID: 30564623" "Germline" "?" "" "0" "" "" "g.46132386G>C" "VCV000265525.10" "likely pathogenic (recessive)" "ACMG" "0000954941" "0" "90" "21" "47535960" "47535960" "subst" "0" "04618" "COL6A2_000504" "g.47535960G>A" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PS2, PM1, PM5, PM2_sup, PP3, PS4_sup, PP4; PMID:28760337" "Germline/De novo (untested)" "?" "" "0" "" "" "g.46116046G>A" "" "pathogenic (dominant)" "ACMG" "0000955069" "3" "90" "21" "47545690" "47545690" "subst" "0.000106823" "04618" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PS3_VS, PM3_strong, PP4_mod" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic (recessive)" "ACMG" "0000955070" "3" "90" "21" "47545690" "47545690" "subst" "0.000106823" "04618" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PS3_VS, PM3_strong, PP4_mod" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic (recessive)" "ACMG" "0000955071" "3" "90" "21" "47545690" "47545690" "subst" "0.000106823" "04618" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PS3_VS, PM3_strong, PP4_mod" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic (recessive)" "ACMG" "0000955072" "3" "90" "21" "47545690" "47545690" "subst" "0.000106823" "04618" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PS3_VS, PM3_strong, PP4_mod" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic (recessive)" "ACMG" "0000955073" "3" "90" "21" "47545690" "47545690" "subst" "0.000106823" "04618" "COL6A2_000056" "g.47545690G>A" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PS3_VS, PM3_strong, PP4_mod" "Germline" "" "" "0" "" "" "g.46125776G>A" "" "pathogenic (recessive)" "ACMG" "0000970343" "0" "30" "21" "47546399" "47546400" "ins" "0" "01804" "COL6A2_000524" "g.47546399_47546400insCGGCCCGGCCCGGCCCGGCC" "" "" "" "COL6A2(NM_001849.3):c.2423-18_2423-17insCGGCCCGGCCCGGCCCGGCC (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000970349" "0" "30" "21" "47551991" "47551991" "subst" "0.000367304" "01804" "COL6A2_000384" "g.47551991G>A" "" "" "" "COL6A2(NM_001849.3):c.2585G>A (p.(Arg862Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000970352" "0" "30" "21" "47552201" "47552201" "subst" "0.00252178" "02326" "COL6A2_000041" "g.47552201C>T" "" "" "" "COL6A2(NM_001849.3):c.2795C>T (p.P932L, p.(Pro932Leu)), COL6A2(NM_001849.4):c.2795C>T (p.P932L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984041" "0" "30" "21" "47545506" "47545506" "subst" "0.000110133" "01804" "COL6A2_000525" "g.47545506C>T" "" "" "" "COL6A2(NM_001849.4):c.1944C>T (p.(Ile648=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984042" "0" "70" "21" "47545690" "47545690" "subst" "0.000106823" "01804" "COL6A2_000056" "g.47545690G>A" "" "" "" "COL6A2(NM_001849.3):c.1970-9G>A (p.?), COL6A2(NM_058175.2):c.1970-9G>A, COL6A2(NM_058175.3):c.1970-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000984043" "0" "50" "21" "47545713" "47545713" "subst" "4.0828E-6" "01804" "COL6A2_000526" "g.47545713G>A" "" "" "" "COL6A2(NM_001849.4):c.1984G>A (p.(Val662Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984044" "0" "50" "21" "47551957" "47551957" "subst" "0" "01804" "FTCD_000043" "g.47551957A>G" "" "" "" "COL6A2(NM_001849.4):c.2551A>G (p.(Lys851Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984045" "0" "50" "21" "47551990" "47551990" "subst" "0.000107754" "01804" "FTCD_000044" "g.47551990C>T" "" "" "" "COL6A2(NM_001849.3):c.2584C>T (p.(Arg862Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984046" "0" "50" "21" "47552029" "47552029" "subst" "0.000196462" "01804" "FTCD_000045" "g.47552029G>A" "" "" "" "COL6A2(NM_001849.4):c.2623G>A (p.(Ala875Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984047" "0" "50" "21" "47552191" "47552191" "subst" "0.000166165" "01804" "COL6A2_000170" "g.47552191G>A" "" "" "" "COL6A2(NM_001849.4):c.2785G>A (p.(Val929Met), p.V929M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984048" "0" "50" "21" "47552194" "47552194" "subst" "0" "01804" "FTCD_000046" "g.47552194C>T" "" "" "" "COL6A2(NM_001849.4):c.2788C>T (p.(Arg930Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984049" "0" "50" "21" "47552341" "47552341" "subst" "0.000191803" "01804" "COL6A2_000415" "g.47552341G>A" "" "" "" "COL6A2(NM_001849.3):c.2935G>A (p.D979N), COL6A2(NM_001849.4):c.2935G>A (p.(Asp979Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984050" "0" "30" "21" "47552350" "47552350" "subst" "0.00105239" "01804" "FTCD_000047" "g.47552350A>G" "" "" "" "COL6A2(NM_001849.3):c.2944A>G (p.(Met982Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984051" "0" "30" "21" "47552388" "47552388" "subst" "0.000504567" "02326" "COL6A2_000237" "g.47552388C>T" "" "" "" "COL6A2(NM_001849.3):c.2982C>T (p.A994=), COL6A2(NM_001849.4):c.2982C>T (p.A994=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984052" "0" "50" "21" "47552429" "47552429" "subst" "4.31183E-6" "01804" "FTCD_000048" "g.47552429C>G" "" "" "" "COL6A2(NM_001849.4):c.3023C>G (p.(Pro1008Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000989995" "0" "30" "21" "47531890" "47531890" "subst" "3.71171E-5" "03779" "COL6A2_000527" "g.47531890C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs767597831" "0" "" "" "" "" "likely benign" "" "0001005828" "0" "50" "21" "47531470" "47531470" "subst" "3.26496E-5" "01804" "COL6A2_000528" "g.47531470C>T" "" "" "" "COL6A2(NM_001849.3):c.80C>T (p.(Ser27Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005829" "0" "50" "21" "47532090" "47532090" "subst" "4.07305E-6" "01804" "COL6A2_000529" "g.47532090G>A" "" "" "" "COL6A2(NM_001849.3):c.313G>A (p.(Val105Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005830" "0" "30" "21" "47532237" "47532237" "subst" "1.25324E-5" "01804" "COL6A2_000530" "g.47532237G>A" "" "" "" "COL6A2(NM_001849.3):c.460G>A (p.(Val154Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005831" "0" "30" "21" "47532405" "47532405" "subst" "0.000262059" "01804" "COL6A2_000298" "g.47532405G>A" "" "" "" "COL6A2(NM_001849.3):c.628G>A (p.(Glu210Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005832" "0" "50" "21" "47532486" "47532486" "dup" "0" "01804" "COL6A2_000531" "g.47532486dup" "" "" "" "COL6A2(NM_001849.3):c.709dupG (p.(Val237fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005833" "0" "50" "21" "47535935" "47535935" "subst" "0" "01804" "COL6A2_000433" "g.47535935A>T" "" "" "" "COL6A2(NM_001849.3):c.868A>T (p.(Ile290Phe)), COL6A2(NM_058175.2):c.868A>T (p.I290F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005834" "0" "50" "21" "47536591" "47536591" "subst" "0" "02329" "COL6A2_000160" "g.47536591G>A" "" "" "" "COL6A2(NM_058175.3):c.954G>A (p.K318=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005835" "0" "30" "21" "47539014" "47539014" "subst" "3.30344E-5" "01804" "COL6A2_000532" "g.47539014G>A" "" "" "" "COL6A2(NM_001849.3):c.1250G>A (p.(Arg417His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005836" "0" "30" "21" "47540432" "47540432" "subst" "0.000430883" "01804" "COL6A2_000247" "g.47540432G>A" "" "" "" "COL6A2(NM_001849.3):c.1336G>A (p.(Asp446Asn)), COL6A2(NM_058175.3):c.1336G>A (p.D446N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005837" "0" "30" "21" "47544825" "47544825" "subst" "0.000219809" "02326" "COL6A2_000533" "g.47544825C>T" "" "" "" "COL6A2(NM_058175.2):c.1761C>T (p.P587=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005838" "0" "50" "21" "47545433" "47545433" "subst" "0" "01804" "COL6A2_000534" "g.47545433A>G" "" "" "" "COL6A2(NM_001849.3):c.1871A>G (p.(Glu624Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005839" "0" "50" "21" "47545702" "47545702" "subst" "3.27761E-5" "01804" "COL6A2_000535" "g.47545702C>T" "" "" "" "COL6A2(NM_001849.3):c.1973C>T (p.(Thr658Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005840" "0" "50" "21" "47545867" "47545867" "subst" "0" "01804" "COL6A2_000536" "g.47545867G>A" "" "" "" "COL6A2(NM_001849.3):c.2138G>A (p.(Arg713His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005841" "0" "50" "21" "47545911" "47545911" "subst" "0.000426788" "01804" "COL6A2_000222" "g.47545911G>A" "" "" "" "COL6A2(NM_001849.3):c.2182G>A (p.(Val728Met)), COL6A2(NM_058175.2):c.2182G>A (p.V728M), COL6A2(NM_058175.3):c.2182G>A (p.V728M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005842" "0" "50" "21" "47549202" "47549202" "subst" "6.51079E-5" "01804" "COL6A2_000517" "g.47549202C>T" "" "" "" "COL6A2(NM_058174.2):c.2554C>T (p.(Gln852*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005843" "0" "50" "21" "47552269" "47552269" "subst" "2.49379E-5" "01804" "FTCD_000051" "g.47552269G>A" "" "" "" "COL6A2(NM_001849.3):c.2863G>A (p.(Asp955Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005844" "0" "50" "21" "47552383" "47552383" "subst" "4.23417E-6" "01804" "FTCD_000052" "g.47552383C>G" "" "" "" "COL6A2(NM_001849.3):c.2977C>G (p.(Arg993Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005845" "0" "50" "21" "47552435" "47552435" "subst" "4.32893E-6" "01804" "COL6A2_000427" "g.47552435T>G" "" "" "" "COL6A2(NM_001849.3):c.3029T>G (p.(Phe1010Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001008322" "0" "90" "21" "47533921" "47533921" "subst" "0" "00006" "COL6A2_000537" "g.47533921G>C" "" "{PMID:Xie 2024:39198981}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46114007G>C" "" "pathogenic (dominant)" "" "0001008323" "0" "90" "21" "47533921" "47533921" "subst" "0" "00006" "COL6A2_000537" "g.47533921G>C" "" "{PMID:Xie 2024:39198981}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46114007G>C" "" "pathogenic (dominant)" "" "0001008324" "0" "90" "21" "47533921" "47533921" "subst" "0" "00006" "COL6A2_000537" "g.47533921G>C" "" "{PMID:Xie 2024:39198981}" "" "" "" "Germline" "yes" "" "0" "" "" "g.46114007G>C" "" "pathogenic (dominant)" "" "0001010340" "21" "70" "21" "47546143" "47546143" "subst" "0" "03361" "COL6A2_000538" "g.47546143T>C" "" "" "" "" "ACMG PM2, PM3, PP3, PP4" "Germline" "" "" "0" "" "" "g.46126229T>C" "" "likely pathogenic (recessive)" "ACMG" "0001015905" "0" "50" "21" "47541018" "47541018" "subst" "0" "01804" "COL6A2_000539" "g.47541018T>C" "" "" "" "COL6A2(NM_001849.3):c.1439T>C (p.(Leu480Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015906" "0" "30" "21" "47549283" "47549283" "subst" "0.000802196" "01804" "COL6A2_000187" "g.47549283G>A" "" "" "" "COL6A2(NM_058174.2):c.2635G>A (p.(Glu879Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001017453" "11" "50" "21" "47532288" "47532288" "subst" "0.00115034" "00006" "COL6A2_000159" "g.47532288G>A" "" "{PMID:Morales-Rosado 2018:30549423}" "" "" "inherited from unaffected father" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0001019160" "0" "90" "21" "47535831" "47535831" "subst" "0" "00454" "COL6A2_000004" "g.47535831G>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.46115917G>A" "" "pathogenic" "ACMG" "0001027351" "0" "50" "21" "47532264" "47532264" "subst" "4.24218E-6" "02329" "COL6A2_000540" "g.47532264G>A" "" "" "" "COL6A2(NM_058175.3):c.487G>A (p.G163S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001027352" "0" "30" "21" "47532287" "47532287" "subst" "0.00338552" "01804" "COL6A2_000071" "g.47532287C>T" "" "" "" "COL6A2(NM_001849.3):c.510C>T (p.(Cys170=)), COL6A2(NM_058175.2):c.510C>T (p.C170=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043658" "0" "50" "21" "47531496" "47531498" "del" "0" "01804" "COL6A2_000541" "g.47531496_47531498del" "" "" "" "COL6A2(NM_001849.4):c.106_108del (p.(Asn36del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043659" "0" "50" "21" "47532198" "47532198" "subst" "8.2224E-6" "01804" "COL6A2_000542" "g.47532198A>G" "" "" "" "COL6A2(NM_001849.4):c.421A>G (p.(Met141Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043660" "0" "50" "21" "47536706" "47536706" "del" "0" "01804" "COL6A2_000543" "g.47536706del" "" "" "" "COL6A2(NM_001849.4):c.977del (p.(Lys326Argfs*82))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043661" "0" "30" "21" "47537804" "47537804" "subst" "0.000967731" "01804" "COL6A2_000212" "g.47537804C>G" "" "" "" "COL6A2(NM_001849.4):c.1070C>G (p.(Pro357Arg)), COL6A2(NM_058175.3):c.1070C>G (p.P357R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043662" "0" "30" "21" "47544833" "47544833" "subst" "0.00190503" "02326" "COL6A2_000142" "g.47544833C>T" "" "" "" "COL6A2(NM_001849.3):c.1769C>T (p.(Thr590Met)), COL6A2(NM_001849.4):c.1769C>T (p.T590M), COL6A2(NM_058175.2):c.1769C>T (p.T590M), COL6A2(NM_058175....)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043663" "0" "30" "21" "47545422" "47545422" "subst" "2.03378E-5" "01804" "COL6A2_000544" "g.47545422C>T" "" "" "" "COL6A2(NM_001849.4):c.1860C>T (p.(Ile620=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043664" "0" "30" "21" "47545949" "47545949" "subst" "0.00257359" "01804" "COL6A2_000223" "g.47545949T>C" "" "" "" "COL6A2(NM_001849.3):c.2220T>C (p.(Asp740=)), COL6A2(NM_058175.2):c.2220T>C (p.D740=), COL6A2(NM_058175.3):c.2220T>C (p.D740=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043665" "0" "30" "21" "47546090" "47546090" "subst" "2.07545E-5" "01804" "COL6A2_000545" "g.47546090G>A" "" "" "" "COL6A2(NM_001849.3):c.2361G>A (p.(Thr787=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043666" "0" "30" "21" "47549264" "47549264" "subst" "1.62874E-5" "02326" "COL6A2_000546" "g.47549264C>T" "" "" "" "COL6A2(NM_058174.3):c.2616C>T (p.A872=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043667" "0" "30" "21" "47549405" "47549405" "subst" "4.8398E-6" "01804" "COL6A2_000547" "g.47549405A>C" "" "" "" "COL6A2(NM_058174.3):c.2757A>C (p.(*919Tyrext*81))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043668" "0" "30" "21" "47552175" "47552175" "subst" "0.00507529" "02326" "COL6A2_000117" "g.47552175C>T" "" "" "" "COL6A2(NM_001849.3):c.2769C>T (p.(His923=), p.H923=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043669" "0" "50" "21" "47552179" "47552179" "subst" "1.28414E-5" "01804" "FTCD_000053" "g.47552179A>C" "" "" "" "COL6A2(NM_001849.4):c.2773A>C (p.(Ile925Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001045284" "3" "90" "21" "47541407" "47541407" "subst" "0" "00006" "COL6A2_000548" "g.47541407G>A" "" "{PMID:Alazami 2016:27023906}" "" "" "" "Germline" "" "" "0" "" "" "g.46121493G>A" "" "pathogenic (recessive)" "" "0001046799" "0" "50" "21" "47542846" "47542846" "subst" "0" "02325" "COL6A2_000549" "g.47542846G>C" "" "" "" "COL6A2(NM_001849.4):c.1666G>C (p.E556Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046800" "0" "30" "21" "47545949" "47545949" "subst" "0.00257359" "02326" "COL6A2_000223" "g.47545949T>C" "" "" "" "COL6A2(NM_001849.3):c.2220T>C (p.(Asp740=)), COL6A2(NM_058175.2):c.2220T>C (p.D740=), COL6A2(NM_058175.3):c.2220T>C (p.D740=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001047071" "0" "10" "21" "47552386" "47552386" "subst" "0.0115906" "03779" "COL6A2_000122" "g.47552386G>A" "" "" "" "" "" "Unknown" "" "rs117931394" "0" "" "" "" "" "benign" "" "0001047909" "1" "90" "21" "47540432" "47540432" "dup" "0" "04892" "COL6A2_000163" "g.47540432dup" "" "Fortunato 2025, submitted" "" "1333-1_1336insG" "" "Germline" "" "" "0" "" "" "g.46120518dup" "" "pathogenic (dominant)" "" "0001047910" "1" "90" "21" "47540981" "47540981" "subst" "1.23287E-5" "04892" "COL6A2_000481" "g.47540981C>T" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46121067C>T" "" "pathogenic (dominant)" "" "0001047911" "1" "90" "21" "47541468" "47541468" "subst" "4.07491E-6" "04892" "COL6A2_000008" "g.47541468A>G" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46121554A>G" "" "pathogenic" "" "0001047912" "1" "90" "21" "47542799" "47542799" "subst" "0" "04892" "COL6A2_000554" "g.47542799G>A" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46122885G>A" "" "pathogenic" "" "0001047913" "1" "90" "21" "47551966" "47551966" "subst" "0" "04892" "COL6A2_000556" "g.47551966C>T" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46132052C>T" "" "pathogenic (dominant)" "" "0001047914" "3" "90" "21" "47552032" "47552032" "subst" "0" "04892" "COL6A2_000026" "g.47552032C>A" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46132118C>A" "" "pathogenic" "" "0001047915" "1" "90" "21" "47535840" "47535840" "subst" "0" "04892" "COL6A2_000512" "g.47535840G>A" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46115926G>A" "" "pathogenic (dominant)" "" "0001047916" "1" "90" "21" "47535942" "47535942" "subst" "0" "04892" "COL6A2_000134" "g.47535942G>A" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46116028G>A" "" "pathogenic (dominant)" "" "0001047917" "1" "90" "21" "47535784" "47535784" "subst" "0" "04892" "COL6A2_000308" "g.47535784A>G" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46115870A>G" "" "pathogenic (dominant)" "" "0001047918" "1" "90" "21" "47535951" "47535951" "subst" "0" "04892" "COL6A2_000552" "g.47535951G>T" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46116037G>T" "" "pathogenic (dominant)" "" "0001047919" "1" "90" "21" "47535960" "47535960" "subst" "0" "04892" "COL6A2_000504" "g.47535960G>A" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46116046G>A" "" "pathogenic (dominant)" "" "0001047920" "1" "90" "21" "47535814" "47535814" "subst" "0" "04892" "COL6A2_000269" "g.47535814G>A" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46115900G>A" "" "pathogenic (dominant)" "" "0001047921" "1" "90" "21" "47535942" "47535942" "subst" "0" "04892" "COL6A2_000551" "g.47535942G>C" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46116028G>C" "" "pathogenic (dominant)" "" "0001047922" "1" "90" "21" "47536292" "47536292" "subst" "0" "04892" "COL6A2_000139" "g.47536292G>A" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46116378G>A" "" "pathogenic (dominant)" "" "0001047923" "1" "90" "21" "47536301" "47536301" "subst" "0" "04892" "COL6A2_000553" "g.47536301G>T" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46116387G>T" "" "pathogenic (dominant)" "" "0001047924" "1" "90" "21" "47538592" "47538592" "subst" "0" "04892" "COL6A2_000188" "g.47538592T>G" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46118678T>G" "" "pathogenic (dominant)" "" "0001047925" "1" "70" "21" "47545429" "47545429" "subst" "0" "04892" "COL6A2_000555" "g.47545429T>G" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46125515T>G" "" "likely pathogenic (dominant)" "" "0001047926" "1" "70" "21" "47545921" "47545921" "subst" "0" "04892" "COL6A2_000198" "g.47545921C>T" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46126007C>T" "" "likely pathogenic (dominant)" "" "0001047927" "1" "90" "21" "47533966" "47533967" "ins" "0" "04892" "COL6A2_000550" "g.47533966_47533967insCCCCCC" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46114052_46114053insCCCCCC" "" "pathogenic" "" "0001047937" "2" "90" "21" "47545179" "47545179" "subst" "0" "04892" "COL6A2_000012" "g.47545179G>A" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46125265G>A" "" "pathogenic" "" "0001047938" "2" "90" "21" "47546058" "47546058" "subst" "4.1029E-6" "04892" "COL6A2_000020" "g.47546058T>C" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46126144T>C" "" "pathogenic" "" "0001047939" "2" "90" "21" "47552071" "47552071" "subst" "0" "04892" "COL6A2_000557" "g.47552071C>T" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.46132157C>T" "" "pathogenic" "" "0001049550" "3" "90" "21" "47551990" "47551990" "subst" "0.000107754" "00006" "FTCD_000044" "g.47551990C>T" "" "{PMID:Elmas 2019:30426380}" "" "" "" "Germline" "" "" "0" "" "" "g.46132076C>T" "" "pathogenic (recessive)" "" "0001057041" "0" "50" "21" "47541476" "47541476" "subst" "1.63006E-5" "01804" "COL6A2_000558" "g.47541476C>T" "" "" "" "COL6A2(NM_001849.4):c.1465C>T (p.(Arg489Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057042" "0" "50" "21" "47542422" "47542422" "subst" "0.000187587" "01804" "COL6A2_000345" "g.47542422G>A" "" "" "" "COL6A2(NM_001849.4):c.1585G>A (p.(Glu529Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057043" "0" "30" "21" "47542860" "47542860" "subst" "0.000500798" "01804" "COL6A2_000559" "g.47542860C>T" "" "" "" "COL6A2(NM_001849.3):c.1671+9C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001057044" "0" "50" "21" "47544826" "47544826" "subst" "0.000101766" "01804" "COL6A2_000355" "g.47544826G>A" "" "" "" "COL6A2(NM_001849.4):c.1762G>A (p.(Gly588Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057045" "0" "50" "21" "47545487" "47545487" "subst" "8.14372E-6" "01804" "COL6A2_000560" "g.47545487T>C" "" "" "" "COL6A2(NM_001849.4):c.1925T>C (p.(Val642Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057046" "0" "50" "21" "47545930" "47545930" "subst" "3.66029E-5" "01804" "COL6A2_000561" "g.47545930G>A" "" "" "" "COL6A2(NM_001849.4):c.2201G>A (p.(Arg734His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057047" "0" "50" "21" "47549155" "47549155" "subst" "5.71405E-5" "01804" "COL6A2_000562" "g.47549155C>T" "" "" "" "COL6A2(NM_058174.3):c.2507C>T (p.(Thr836Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057934" "0" "70" "21" "47538963" "47538963" "subst" "0" "00006" "COL6A2_000564" "g.47538963G>T" "" "{PMID:Ayala-Ramirez 2025:41066171}" "" "" "" "Germline" "" "rs1555873827" "0" "" "" "g.46119049G>T" "{CV:542968}" "likely pathogenic (recessive)" "" "0001057935" "0" "50" "21" "47532474" "47532474" "subst" "0" "00006" "COL6A2_000563" "g.47532474C>T" "" "{PMID:Ayala-Ramirez 2025:41066171}" "" "" "" "Germline" "" "rs1379543505" "0" "" "" "g.46112560C>T" "{CV:542969}" "VUS" "" "0001057945" "0" "50" "21" "47532066" "47532066" "subst" "8.14379E-6" "00006" "COL6A2_000431" "g.47532066G>A" "" "{PMID:Ayala-Ramirez 2025:41066171}" "" "" "" "Germline" "" "rs750027302" "0" "" "" "g.46112152G>A" "{CV:476478}" "VUS" "" "0001058569" "0" "90" "21" "47545423" "47545423" "subst" "0" "00006" "COL6A2_000015" "g.47545423G>A" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.46125509G>A" "" "pathogenic" "" "0001060906" "0" "50" "21" "47533977" "47533977" "subst" "0.000434641" "00006" "COL6A2_000305" "g.47533977G>A" "" "{PMID:Horbacz 2025:41210864}" "" "" "ACMG PM1, PM2, BP4; 1/142 in controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.46114063G>A" "" "VUS" "ACMG" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes COL6A2 ## Count = 1186 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000084594" "00005472" "90" "954" "0" "954" "0" "c.954G>T" "r.(?)" "p.(Lys318Asn)" "9" "0000084598" "00005472" "90" "801" "2" "801" "2" "c.801+2T>C" "r.spl?" "p.?" "5i" "0000084599" "00005472" "90" "1856" "0" "1861" "0" "c.1856_1861del" "r.(?)" "p.(Val619_Ile620del)" "25" "0000084602" "00005472" "90" "785" "0" "785" "0" "c.785G>A" "r.(?)" "p.(Gly262Asp)" "5" "0000084605" "00005472" "50" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Glu106Lys)" "3" "0000084626" "00005472" "90" "1771" "-1" "1771" "-1" "c.1771-1G>T" "r.spl" "p.?" "23i" "0000084627" "00005472" "70" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.(?)" "p.(Gly657_Arg698del)" "25i" "0000084629" "00005472" "70" "735" "1" "802" "-1" "c.(735+1_802-1)?" "r.736_801del" "p.(del)" "4i_5i" "0000130091" "00005472" "70" "2461" "1" "2461" "1" "c.2461+1G>A" "r.spl" "p.?" "27i" "0000130292" "00005472" "70" "2422" "1" "2422" "1" "c.2422+1G>A" "r.spl" "p.?" "26i" "0000166965" "00005472" "70" "2462" "-2585" "2462" "-2585" "c.2462-2585G>A" "r.(?)" "p.(=)" "27i" "0000166966" "00005472" "70" "2599" "0" "2599" "0" "c.2599C>T" "r.(?)" "p.(Arg867Trp)" "28" "0000169217" "00005472" "00" "988" "0" "988" "0" "c.988G>A" "r.(?)" "p.(Asp330Asn)" "" "0000175275" "00005472" "70" "2276" "0" "2276" "0" "c.2276T>C" "r.(?)" "p.(Ile759Thr)" "" "0000175276" "00005472" "70" "2192" "0" "2192" "0" "c.2192C>T" "r.(?)" "p.(Thr731Met)" "" "0000175277" "00005472" "70" "1865" "0" "1865" "0" "c.1865G>A" "r.(?)" "p.(Ser622Asn)" "" "0000175278" "00005472" "70" "801" "1" "801" "1" "c.801+1del" "r.spl" "p.?" "5i" "0000175279" "00005472" "70" "1252" "0" "1252" "0" "c.1252G>A" "r.(?)" "p.(Gly418Arg)" "" "0000175280" "00005472" "70" "802" "0" "802" "0" "c.802G>T" "r.(?)" "p.(Gly268Cys)" "" "0000175281" "00005472" "70" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ala647Gly)" "" "0000175282" "00005472" "70" "1179" "2" "1179" "2" "c.1179+2T>G" "r.spl" "p.?" "13i" "0000175283" "00005472" "70" "893" "0" "893" "0" "c.893G>T" "r.(?)" "p.(Gly298Val)" "" "0000175284" "00005472" "70" "955" "-3" "955" "-3" "c.955-3C>G" "r.spl?" "p.?" "9i" "0000175285" "00005472" "70" "955" "-3" "955" "-3" "c.955-3C>G" "r.spl?" "p.?" "9i" "0000175286" "00005472" "70" "2098" "0" "2098" "0" "c.2098G>A" "r.(?)" "p.(Gly700Ser)" "" "0000175287" "00005472" "70" "1975" "0" "1975" "0" "c.1975C>T" "r.(?)" "p.(Arg659Cys)" "" "0000175288" "00005472" "70" "1970" "-2" "1970" "-2" "c.1970-2A>G" "r.spl" "p.?" "25i" "0000175289" "00005472" "70" "2192" "0" "2192" "0" "c.2192C>T" "r.(?)" "p.(Thr731Met)" "" "0000175292" "00005472" "70" "2416" "0" "2416" "0" "c.2416T>C" "r.(?)" "p.(Cys806Arg)" "" "0000175293" "00005472" "70" "388" "0" "388" "0" "c.388C>T" "r.(?)" "p.(Arg130Cys)" "" "0000175294" "00005472" "50" "2422" "7" "2422" "7" "c.2422+7G>T" "r.(?)" "p.(=)" "26i" "0000175295" "00005472" "50" "2599" "0" "2599" "0" "c.2599C>T" "r.(?)" "p.(Arg867Trp)" "" "0000175296" "00005472" "70" "1769" "0" "1769" "0" "c.1769C>T" "r.(?)" "p.(Thr590Met)" "" "0000175297" "00005472" "70" "2818" "0" "2818" "0" "c.2818G>C" "r.(?)" "p.(Ala940Pro)" "" "0000175350" "00005472" "90" "1117" "-10" "1117" "-10" "c.1117-10A>G" "r.spl" "p.[Gly373_Lys393del, Gly373Profs*7, Gly373Argfs*52]" "12i" "0000175351" "00005472" "90" "1151" "0" "1151" "0" "c.1151dup" "r.(?)" "p.(Glu386Argfs*65)" "13" "0000175352" "00005472" "90" "1270" "-1" "1270" "-1" "c.1270-1G>C" "r.spl" "p.[Gly424Alafs*138, Gly424Profs*108]" "14i" "0000175353" "00005472" "90" "1771" "-1" "1771" "-1" "c.1771-1G>A" "r.1771_1816del" "p.Glu591Thrfs*148" "23i" "0000175354" "00005472" "90" "1488" "0" "1513" "0" "c.1488_1513del" "r.(?)" "p.(Arg498Glnfs*59)" "18" "0000175356" "00005472" "90" "1591" "0" "1591" "0" "c.1591G>C" "r.(?)" "p.(Gly531Arg)" "20" "0000175357" "00005472" "90" "2274" "0" "2279" "0" "c.2274_2279del" "r.(?)" "p.(Ile759_Gly760del)" "26" "0000175358" "00005472" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.(?)" "" "0000175359" "00005472" "90" "1817" "-3" "1817" "-3" "c.1817-3C>G" "r.spl?" "p.(Cys605_Asp606insGSEVSPVPPDDPATPR)" "24i" "0000175360" "00005472" "90" "1861" "0" "1861" "0" "c.1861G>A" "r.(?)" "p.(Asp621Asn)" "25" "0000175361" "00005472" "90" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl?" "p.(Thr658_Ala698del)" "25i" "0000175362" "00005472" "90" "2098" "0" "2098" "0" "c.2098G>A" "r.(?)" "p.(Gly700Ser)" "26" "0000175363" "00005472" "90" "2319" "0" "2319" "0" "c.2319C>G" "r.(?)" "p.(Tyr773*)" "26" "0000175364" "00005472" "90" "2329" "0" "2329" "0" "c.2329T>C" "r.(?)" "p.(Cys777Arg)" "26" "0000175366" "00005472" "90" "2455" "0" "2461" "37" "c.2455_2461+37delins(33)" "r.?" "p.?" "27_27i" "0000175367" "00005472" "90" "2689" "0" "2691" "0" "c.2689_2691del" "r.(?)" "p.(Asn897del)" "28" "0000175368" "00005472" "90" "2558" "0" "2558" "0" "c.2558G>A" "r.(?)" "p.(Arg853Gln)" "28" "0000175370" "00005472" "90" "2663" "0" "2664" "0" "c.2663_2664dup" "r.(?)" "p.(Gln889Serfs*7)" "28" "0000175371" "00005472" "90" "801" "631" "882" "0" "c.801+631_882del" "r.(?)" "p.(Gly268_Ile294del)" "5i" "0000175372" "00005472" "90" "811" "0" "811" "0" "c.811G>A" "r.(?)" "p.(Gly271Ser)" "6" "0000175373" "00005472" "90" "847" "0" "847" "0" "c.847G>A" "r.(?)" "p.(Gly283Arg)" "6" "0000175374" "00005472" "90" "955" "-2" "955" "-2" "c.955-2A>G" "r.955_999del" "p.Gly319_Lys333del" "9i" "0000175410" "00005472" "90" "811" "0" "811" "0" "c.811G>A" "r.(?)" "p.(Gly271Ser)" "6" "0000175411" "00005472" "90" "1000" "-2" "1000" "-2" "c.1000-2A>G" "r.1000_1053del" "p.Gly334_Arg351del" "10i" "0000175412" "00005472" "90" "2795" "0" "2795" "0" "c.2795C>T" "r.2795c>u" "p.Pro932Leu" "28" "0000175418" "00005472" "90" "801" "631" "882" "0" "c.801+631_882del" "r.(?)" "p.[=, Gly268_Ile294del]" "5i" "0000175420" "00005472" "50" "1861" "0" "1861" "0" "c.1861G>A" "r.(?)" "p.(Asp621Asn)" "25" "0000175421" "00005472" "70" "856" "-3" "856" "-3" "c.856-3C>G" "r.spl?" "p.?" "7" "0000175426" "00005472" "70" "802" "0" "802" "0" "c.802G>T" "r.(spl?)" "p.(Gly268Cys)" "6" "0000175427" "00005472" "70" "1053" "1" "1053" "1" "c.1053+1G>C" "r.spl?" "p.?" "11i" "0000175429" "00005472" "70" "641" "0" "645" "0" "c.641_645del" "r.(?)" "p.(Asn214Ilefs*60)" "3" "0000175432" "00005472" "70" "1770" "1" "1770" "1" "c.1770+1del" "r.spl?" "p.?" "23i" "0000175438" "00005472" "70" "901" "0" "901" "0" "c.901G>A" "r.(?)" "p.(Gly301Ser)" "8" "0000175445" "00005472" "70" "802" "0" "802" "0" "c.802G>A" "r.(?)" "p.(Gly268Ser)" "6" "0000175447" "00005472" "90" "-82" "0" "3357" "0" "c.(?_-82)_(*297_?)del" "r.0" "p.0" "1_28" "0000175456" "00005472" "70" "900" "1" "900" "1" "c.900+1G>A" "r.spl?" "p.?" "7i" "0000175457" "00005472" "70" "2175" "0" "2176" "0" "c.2175_2176del" "r.(?)" "p.(Phe726Cysfs*15)" "26" "0000175461" "00005472" "50" "1905" "0" "1907" "0" "c.1905_1907del" "r.(?)" "p.(Lys635del)" "25" "0000175462" "00005472" "70" "2422" "1" "2422" "1" "c.2422+1G>A" "r.spl?" "p.?" "26i" "0000175465" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.(=)" "25i" "0000175466" "00005472" "70" "2422" "1" "2422" "1" "c.2422+1G>A" "r.spl?" "p.?" "26i" "0000175467" "00005472" "70" "2497" "0" "2497" "0" "c.2497dup" "r.(?)" "p.(Asp833Glyfs*14)" "28" "0000175470" "00005472" "70" "3005" "0" "3006" "0" "c.3005_3006del" "r.(?)" "p.(Tyr1002*)" "28" "0000175471" "00005472" "70" "1496" "0" "1496" "0" "c.1496G>A" "r.(?)" "p.(Gly499Glu)" "18" "0000175472" "00005472" "70" "802" "-1" "802" "-1" "c.802-1G>C" "r.spl?" "p.?" "5i" "0000175478" "00005472" "70" "928" "-2" "928" "-1" "c.928-2_928-1del" "r.spl?" "p.?" "8i" "0000175583" "00005472" "50" "116" "-34" "116" "-34" "c.116-34G>A" "r.(?)" "p.(=)" "2i" "0000175584" "00005472" "50" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Glu106Lys)" "3" "0000175585" "00005472" "50" "510" "0" "510" "0" "c.510C>T" "r.(?)" "p.(=)" "3" "0000175586" "00005472" "10" "663" "0" "663" "0" "c.663C>T" "r.(?)" "p.(=)" "3" "0000175587" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.(?)" "p.(Asp227Asn)" "3" "0000175588" "00005472" "10" "714" "9" "714" "9" "c.714+9C>T" "r.(?)" "p.(=)" "3i" "0000175589" "00005472" "10" "714" "29" "714" "29" "c.714+29G>A" "r.(?)" "p.(=)" "3i" "0000175590" "00005472" "10" "714" "45" "714" "45" "c.714+45C>T" "r.(?)" "p.(=)" "3i" "0000175591" "00005472" "50" "801" "45" "801" "45" "c.801+45C>A" "r.(?)" "p.(=)" "5i" "0000175592" "00005472" "10" "832" "0" "832" "0" "c.832G>A" "r.(?)" "p.(Glu278Lys)" "6" "0000175593" "00005472" "10" "928" "-19" "928" "-19" "c.928-19C>T" "r.(?)" "p.(=)" "8i" "0000175594" "00005472" "50" "955" "-8" "955" "-8" "c.955-8C>T" "r.(?)" "p.(=)" "9i" "0000175595" "00005472" "50" "1116" "22" "1116" "22" "c.1116+22C>T" "r.(?)" "p.(=)" "12i" "0000175596" "00005472" "10" "1116" "32" "1116" "32" "c.1116+32G>A" "r.(?)" "p.(=)" "12i" "0000175597" "00005472" "10" "1196" "0" "1196" "0" "c.1196G>A" "r.(?)" "p.(Ser399Asn)" "14" "0000175598" "00005472" "50" "1251" "0" "1251" "0" "c.1251C>T" "r.(?)" "p.(=)" "14" "0000175599" "00005472" "10" "1332" "26" "1332" "26" "c.1332+26A>G" "r.(?)" "p.(=)" "15i" "0000175600" "00005472" "10" "1333" "-8" "1333" "-8" "c.1333-8T>C" "r.(?)" "p.(=)" "15i" "0000175601" "00005472" "10" "1521" "21" "1521" "21" "c.1521+21A>G" "r.(?)" "p.(=)" "18i" "0000175602" "00005472" "10" "1522" "-36" "1522" "-36" "c.1522-36T>C" "r.(?)" "p.(=)" "18i" "0000175603" "00005472" "50" "1552" "0" "1552" "0" "c.1552C>T" "r.(?)" "p.(Pro518Ser)" "19" "0000175604" "00005472" "10" "1573" "-32" "1573" "-32" "c.1573-32C>T" "r.(?)" "p.(=)" "19i" "0000175605" "00005472" "10" "1609" "-10" "1609" "-10" "c.1609-10C>T" "r.(?)" "p.(=)" "20i" "0000175606" "00005472" "50" "1661" "0" "1661" "0" "c.1661A>G" "r.(?)" "p.(Lys554Arg)" "21" "0000175607" "00005472" "10" "1671" "10" "1671" "10" "c.1671+10A>G" "r.(?)" "p.(=)" "21i" "0000175608" "00005472" "10" "1672" "-37" "1672" "-37" "c.1672-37G>T" "r.(?)" "p.(=)" "21i" "0000175609" "00005472" "10" "1672" "-24" "1672" "-24" "c.1672-24C>G" "r.(?)" "p.(=)" "21i" "0000175610" "00005472" "10" "1734" "35" "1734" "35" "c.1734+35A>G" "r.(?)" "p.(=)" "22i" "0000175611" "00005472" "10" "1735" "-30" "1735" "-30" "c.1735-30A>G" "r.(?)" "p.(=)" "22i" "0000175612" "00005472" "50" "1770" "0" "1770" "0" "c.1770G>A" "r.(?)" "p.(=)" "23" "0000175613" "00005472" "10" "1770" "4" "1770" "4" "c.1770+4G>A" "r.(spl?)" "p.(?)" "23i" "0000175614" "00005472" "10" "1771" "-25" "1771" "-25" "c.1771-25A>G" "r.(?)" "p.(=)" "23i" "0000175615" "00005472" "50" "1816" "18" "1816" "18" "c.1816+18del" "r.(=)" "p.(=)" "24i" "0000175616" "00005472" "10" "1817" "-33" "1817" "-33" "c.1817-33C>T" "r.(?)" "p.(=)" "24i" "0000175617" "00005472" "10" "1817" "-3" "1817" "-3" "c.1817-3dup" "r.(?)" "p.(=)" "24i" "0000175618" "00005472" "50" "1970" "-23" "1970" "-23" "c.1970-23G>C" "r.(?)" "p.(=)" "25i" "0000175619" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3dup" "r.(?)" "p.(=)" "25i" "0000175620" "00005472" "50" "1998" "0" "1998" "0" "c.1998C>G" "r.(?)" "p.(Ser666Arg)" "26" "0000175621" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.(?)" "p.(Arg680His)" "26" "0000175622" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.(?)" "p.(=)" "26" "0000175623" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.(?)" "p.(=)" "26" "0000175624" "00005472" "50" "2113" "0" "2113" "0" "c.2113T>C" "r.(?)" "p.(Ser705Pro)" "26" "0000175625" "00005472" "10" "2136" "0" "2136" "0" "c.2136C>T" "r.(?)" "p.(=)" "26" "0000175626" "00005472" "10" "2160" "0" "2160" "0" "c.2160C>G" "r.(?)" "p.(=)" "26" "0000175627" "00005472" "10" "2163" "0" "2163" "0" "c.2163G>A" "r.(?)" "p.(=)" "26" "0000175628" "00005472" "10" "2184" "0" "2184" "0" "c.2184G>A" "r.(?)" "p.(=)" "26" "0000175629" "00005472" "10" "2423" "-35" "2423" "-35" "c.2423-35C>A" "r.(?)" "p.(=)" "26i" "0000175630" "00005472" "50" "2423" "-22" "2423" "-17" "c.[2423-22_2423-18[4];2423-18_2423-17insA]" "r.(?)" "p.(=)" "26i" "0000175631" "00005472" "50" "2423" "-22" "2423" "-18" "c.2423-22_2423-18[4]" "r.(?)" "p.(=)" "26i" "0000175632" "00005472" "10" "2462" "-35" "2462" "-35" "c.2462-35C>T" "r.(?)" "p.(=)" "27i" "0000175633" "00005472" "10" "2484" "0" "2484" "0" "c.2484G>A" "r.(?)" "p.(=)" "28" "0000175634" "00005472" "10" "2517" "0" "2517" "0" "c.2517C>T" "r.(?)" "p.(=)" "28" "0000175635" "00005472" "90" "2558" "0" "2558" "0" "c.2558G>A" "r.(?)" "p.(Arg853Gln)" "28" "0000175636" "00005472" "50" "2582" "0" "2582" "0" "c.2582G>A" "r.(?)" "p.(Arg861Gln)" "28" "0000175637" "00005472" "50" "2628" "0" "2628" "0" "c.2628C>T" "r.(?)" "p.(=)" "28" "0000175638" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.(?)" "p.(=)" "28" "0000175639" "00005472" "10" "2724" "0" "2724" "0" "c.2724A>G" "r.(?)" "p.(=)" "28" "0000175640" "00005472" "10" "2769" "0" "2769" "0" "c.2769C>T" "r.(?)" "p.(=)" "28" "0000175641" "00005472" "10" "2803" "0" "2803" "0" "c.2803G>A" "r.(?)" "p.(Gly935Arg)" "28" "0000175642" "00005472" "50" "2844" "0" "2844" "0" "c.2844G>A" "r.(?)" "p.(=)" "28" "0000175643" "00005472" "50" "2883" "0" "2883" "0" "c.2883G>A" "r.(?)" "p.(=)" "28" "0000175644" "00005472" "10" "2886" "0" "2886" "0" "c.2886C>T" "r.(?)" "p.(=)" "28" "0000175645" "00005472" "10" "2979" "0" "2979" "0" "c.2979C>T" "r.(?)" "p.(=)" "28" "0000175646" "00005472" "10" "2980" "0" "2980" "0" "c.2980G>A" "r.(?)" "p.(Ala994Thr)" "28" "0000175647" "00005472" "10" "2983" "0" "2983" "0" "c.2983G>A" "r.(?)" "p.(Ala995Thr)" "28" "0000175648" "00005472" "50" "2994" "0" "2994" "0" "c.2994C>T" "r.(?)" "p.(=)" "28" "0000175649" "00005472" "50" "2998" "0" "3000" "0" "c.2998_3000del" "r.(?)" "p.(Lys1000del)" "28" "0000175650" "00005472" "10" "3043" "0" "3043" "0" "c.3043A>C" "r.(?)" "p.(Ile1015Leu)" "28" "0000175763" "00005472" "30" "532" "0" "532" "0" "c.532G>A" "r.(?)" "p.(Glu178Lys)" "3" "0000175779" "00005472" "50" "2599" "0" "2599" "0" "c.2599C>T" "r.(?)" "p.(Arg867Trp)" "28" "0000175799" "00005472" "50" "148" "0" "148" "0" "c.148G>A" "r.(?)" "p.(Val50Met)" "3" "0000175807" "00005472" "90" "802" "0" "802" "0" "c.802G>A" "r.(?)" "p.(Gly268Ser)" "6" "0000175808" "00005472" "90" "812" "0" "812" "0" "c.812G>A" "r.(?)" "p.(Gly271Asp)" "6" "0000175809" "00005472" "90" "812" "0" "812" "0" "c.812G>A" "r.(?)" "p.(Gly271Asp)" "6" "0000175810" "00005472" "90" "839" "0" "839" "0" "c.839G>A" "r.(?)" "p.(Gly280Asp)" "6" "0000175811" "00005472" "90" "847" "0" "847" "0" "c.847G>A" "r.(?)" "p.(Gly283Arg)" "6" "0000175812" "00005472" "90" "875" "0" "875" "0" "c.875G>A" "r.(?)" "p.(Gly292Asp)" "7" "0000175813" "00005472" "90" "883" "0" "883" "0" "c.883G>A" "r.(?)" "p.(Gly295Arg)" "7" "0000175814" "00005472" "90" "1181" "0" "1181" "0" "c.1181G>A" "r.(?)" "p.(Gly394Glu)" "14" "0000175815" "00005472" "90" "1405" "0" "1405" "0" "c.1405G>A" "r.(?)" "p.(Gly469Ser)" "17" "0000175833" "00005472" "90" "901" "0" "901" "0" "c.901G>A" "r.(?)" "p.(Gly301Ser)" "8" "0000175845" "00005472" "90" "902" "0" "902" "0" "c.902G>A" "r.(?)" "p.(Gly301Asp)" "8" "0000175846" "00005472" "90" "848" "0" "848" "0" "c.848G>A" "r.(?)" "p.(Gly283Glu)" "6" "0000175858" "00005472" "90" "802" "0" "802" "0" "c.802G>A" "r.(?)" "p.(Gly268Ser)" "6" "0000175859" "00005472" "90" "802" "0" "802" "0" "c.802G>A" "r.(?)" "p.(Gly268Ser)" "6" "0000175860" "00005472" "90" "802" "0" "802" "0" "c.802G>T" "r.(?)" "p.(Gly268Cys)" "6" "0000175861" "00005472" "90" "902" "0" "902" "0" "c.902G>T" "r.(?)" "p.(Gly301Val)" "8" "0000175864" "00005472" "90" "1769" "0" "1769" "0" "c.1769C>T" "r.(?)" "p.(Thr590Met)" "23" "0000175868" "00005472" "90" "-1" "0" "1521" "1" "c.(?_-1)_(1521+1_?)del" "r.0" "p.0" "_1_18i_" "0000175869" "00005472" "90" "-1" "0" "3061" "0" "c.(?_-1)_(*1_?)del" "r.0" "p.0" "_1_28_" "0000175870" "00005472" "90" "-1" "0" "3061" "0" "c.(?_-1)_(*1_?)del" "r.0" "p.0" "_1_28_" "0000175872" "00005472" "90" "" "0" "" "0" "c.-27(-3053 _-2994)_-27(-900_-856)del" "r.0" "p.0" "1i" "0000175873" "00005472" "10" "663" "0" "663" "0" "c.663C>T" "r.663c>u" "p.=" "3" "0000175874" "00005472" "90" "1096" "0" "1096" "0" "c.1096C>T" "r.0" "p.0" "12" "0000175875" "00005472" "90" "2455" "0" "2455" "0" "c.2455C>T" "r.2455c>u" "p.Gln819*" "27" "0000175878" "00005472" "90" "801" "3" "801" "3" "c.801+3A>C" "r.736_801del" "p.Cys246_Lys267del" "5i" "0000175879" "00005472" "90" "927" "5" "927" "5" "c.927+5G>A" "r.[=, 927+1_928-1ins927+1_928-1]" "p.[=, Gly310fs]" "8i" "0000175880" "00005472" "70" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.[=, 1969_1970ins1970-7_1970-1]" "p.[=, Gly657Alafs*18]" "25i" "0000175881" "00005472" "90" "2455" "0" "2455" "0" "c.2455C>T" "r.2455c>u" "p.Gln819*" "27" "0000175882" "00005472" "90" "2455" "0" "2455" "0" "c.2455C>T" "r.2455c>u" "p.Gln819*" "27" "0000175883" "00005472" "90" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.Glu106Lys" "3" "0000175886" "00005472" "90" "2572" "0" "2572" "0" "c.2572C>T" "r.(?)" "p.(Gln858*)" "28" "0000175887" "00005472" "90" "2489" "0" "2489" "0" "c.2489G>A" "r.spl?" "p.(Arg830Gln)" "28" "0000175890" "00005472" "90" "2351" "0" "2351" "0" "c.2351G>A" "r.(?)" "p.(Arg784His)" "28" "0000175924" "00005472" "10" "2751" "0" "2751" "0" "c.2751G>T" "r.(?)" "p.(=)" "28" "0000175925" "00005472" "90" "2175" "0" "2176" "0" "c.2175_2176del" "r.spl?" "p.(Phe726Cysfs*15)" "26" "0000175926" "00005472" "90" "2329" "0" "2329" "0" "c.2329T>C" "r.(?)" "p.(Cys777Arg)" "26" "0000175927" "00005472" "90" "2455" "0" "2455" "0" "c.2455C>T" "r.2455c>u" "p.Gln819*" "27" "0000175928" "00005472" "90" "2351" "0" "2351" "0" "c.2351G>A" "r.(?)" "p.(Arg784His)" "26" "0000175929" "00005472" "90" "1327" "0" "1327" "0" "c.1327G>T" "r.spl?" "p.(Glu443)" "15" "0000175930" "00005472" "90" "2240" "0" "2240" "0" "c.2240T>A" "r.(?)" "p.(Leu747Gln)" "26" "0000175931" "00005472" "90" "2572" "0" "2572" "0" "c.2572C>T" "r.(?)" "p.(Gln858*)" "28" "0000175932" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.[=, 1969_1970ins1970-7_1970-1]" "p.[=, Thr656fs*]" "25i" "0000175933" "00005472" "90" "875" "0" "875" "0" "c.875G>T" "r.(?)" "p.(Gly292Val)" "7" "0000175934" "00005472" "90" "1769" "0" "1769" "0" "c.1769C>T" "r.(?)" "p.(Thr590Met)" "23" "0000175935" "00005472" "90" "2599" "0" "2599" "0" "c.2599C>T" "r.(?)" "p.(Arg867Trp)" "28" "0000175936" "00005472" "90" "883" "0" "883" "0" "c.883G>A" "r.(?)" "p.(Gly295Arg)" "7" "0000175937" "00005472" "90" "802" "0" "802" "0" "c.802G>A" "r.(?)" "p.(Gly268Ser)" "6" "0000175938" "00005472" "90" "847" "0" "847" "0" "c.847G>A" "r.(?)" "p.(Gly283Arg)" "6" "0000175939" "00005472" "90" "2060" "0" "2060" "0" "c.2060T>C" "r.(?)" "p.(Phe687Ser)" "26" "0000175940" "00005472" "90" "847" "0" "847" "0" "c.847G>A" "r.(?)" "p.(Gly283Arg)" "6" "0000175941" "00005472" "90" "1861" "0" "1861" "0" "c.1861G>A" "r.(?)" "p.(Asp621Asn)" "25" "0000175942" "00005472" "90" "875" "0" "875" "0" "c.875G>T" "r.(?)" "p.(Gly292Val)" "7" "0000175943" "00005472" "90" "2785" "0" "2785" "0" "c.2785G>A" "r.(?)" "p.(Val929Met)" "28" "0000175944" "00005472" "90" "892" "0" "892" "0" "c.892G>A" "r.(?)" "p.(Gly298Arg)" "7" "0000175945" "00005472" "90" "801" "3" "801" "3" "c.801+3A>C" "r.spl?" "p.?" "5i" "0000175946" "00005472" "90" "1770" "1" "1770" "1" "c.1770+1G>A" "r.spl" "p.?" "23i" "0000175947" "00005472" "90" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl?" "p.?" "25i" "0000175948" "00005472" "90" "2098" "0" "2098" "0" "c.2098G>A" "r.(?)" "p.(Gly700Ser)" "26" "0000175949" "00005472" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Arg843Gln)" "28" "0000175950" "00005472" "90" "1498" "0" "1498" "0" "c.1498G>C" "r.(?)" "p.(Asp500His)" "18" "0000175984" "00005472" "90" "954" "0" "954" "0" "c.954G>T" "r.(spl?)" "p.(Lys318Asn)" "9" "0000175985" "00005472" "50" "900" "1" "900" "1" "c.900+1G>A" "r.spl?" "p.?" "7i" "0000175995" "00005472" "10" "1196" "0" "1196" "0" "c.1196A>G" "r.1196a>g" "p.Asn399Ser" "14" "0000175996" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.2039g>a" "p.Arg680His" "26" "0000175997" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000175998" "00005472" "10" "1353" "0" "1353" "0" "c.1353G>C" "r.1353g>c" "p.=" "16" "0000176003" "00005472" "50" "1493" "0" "1493" "0" "c.1493G>A" "r.(?)" "p.Arg498His" "18" "0000176006" "00005472" "10" "1196" "0" "1196" "0" "c.1196A>G" "r.1196a>g" "p.Asn399Ser" "14" "0000176007" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.2039g>a" "p.Arg680His" "26" "0000176008" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.2094g>a" "p.=" "26" "0000176009" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.2097c>u" "p.=" "26" "0000176010" "00005472" "10" "2184" "0" "2184" "0" "c.2184G>A" "r.2184g>a" "p.=" "26" "0000176011" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176012" "00005472" "10" "1353" "0" "1353" "0" "c.1353G>C" "r.1353g>c" "p.=" "16" "0000176013" "00005472" "10" "3116" "0" "3116" "0" "c.*56T>G" "r.*56u>g" "p.=" "28" "0000176014" "00005472" "10" "777" "0" "777" "0" "c.777C>G" "r.777c>g" "p.=" "5" "0000176023" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.2039g>a" "p.Arg680His" "26" "0000176029" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.2039g>a" "p.Arg680His" "26" "0000176030" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176031" "00005472" "10" "2979" "0" "2979" "0" "c.2979C>T" "r.2979c>u" "p.=" "28" "0000176032" "00005472" "10" "3162" "0" "3162" "0" "c.*102C>G" "r.*102c>g" "p.=" "28" "0000176033" "00005472" "10" "1552" "0" "1552" "0" "c.1552C>T" "r.1552c>u" "p.Pro518Ser" "19" "0000176039" "00005472" "90" "1117" "-10" "1117" "-10" "c.1117-10A>G" "r.spl" "p.[Gly373_Lys393del, Gly373Profs*7, Gly373Argfs*52]" "12i" "0000176040" "00005472" "90" "1151" "0" "1151" "0" "c.1151dup" "r.(?)" "p.(Glu386Argfs*65)" "13" "0000176041" "00005472" "90" "1771" "-3" "1771" "-3" "c.1771-3C>G" "r.1771_1816del" "p.Glu591lThrfs*148" "23i" "0000176042" "00005472" "90" "1459" "-2" "1459" "-2" "c.1459-2A>G" "r.1459_1486del" "p.Gly487Aspfs*48" "17i" "0000176043" "00005472" "90" "1770" "5" "1770" "5" "c.1770+5G>A" "r.1734_1770del" "p.Gly579_Thr590del" "23i" "0000176044" "00005472" "90" "1459" "-2" "1459" "-2" "c.1459-2A>G" "r.(?)" "p.(Gly487Aspfs*48)" "17i" "0000176045" "00005472" "90" "2423" "-2" "2423" "-2" "c.2423-2A>G" "r.2423_2461del" "p.Asp808_Thr820del" "26i" "0000176046" "00005472" "50" "2351" "0" "2351" "0" "c.2351G>A" "r.(?)" "p.(Arg784His)" "26" "0000176047" "00005472" "90" "688" "0" "689" "0" "c.688_689dup" "r.(?)" "p.(Ile231Profs*9)" "3" "0000176048" "00005472" "90" "2510" "0" "2510" "0" "c.2510T>C" "r.(?)" "p.(Leu837Pro)" "28" "0000176049" "00005472" "90" "2626" "0" "2626" "0" "c.2626C>A" "r.(?)" "p.(Arg876Ser)" "28" "0000176050" "00005472" "90" "2626" "0" "2626" "0" "c.2626C>A" "r.(?)" "p.(Arg876Ser)" "28" "0000176056" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.679a>g" "p.Asp227Asn" "3" "0000176057" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.2039g>a" "p.Arg680His" "26" "0000176058" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.2094g>a" "p.=" "26" "0000176059" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.2097c>u" "p.=" "26" "0000176060" "00005472" "10" "2184" "0" "2184" "0" "c.2184G>A" "r.2184g>a" "p.=" "26" "0000176061" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176062" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176063" "00005472" "10" "2979" "0" "2979" "0" "c.2979C>T" "r.2979c>u" "p.=" "28" "0000176084" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.679a>g" "p.Asp227Asn" "3" "0000176085" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.679a>g" "p.Asp227Asn" "3" "0000176086" "00005472" "10" "1196" "0" "1196" "0" "c.1196A>G" "r.1196a>g" "p.Asn399Ser" "14" "0000176087" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.2039g>a" "p.Arg680His" "26" "0000176088" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.2094g>a" "p.=" "26" "0000176089" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.2097c>u" "p.=" "26" "0000176090" "00005472" "10" "2184" "0" "2184" "0" "c.2184G>A" "r.2184g>a" "p.=" "26" "0000176091" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176115" "00005472" "10" "2683" "0" "2683" "0" "c.2683A>C" "r.2683a>c" "p.Ser895Arg" "28" "0000176116" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.2039g>a" "p.Arg680His" "26" "0000176117" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.2094g>a" "p.=" "26" "0000176118" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.2097c>u" "p.=" "26" "0000176119" "00005472" "10" "2184" "0" "2184" "0" "c.2184G>A" "r.2184g>a" "p.=" "26" "0000176120" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176121" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176122" "00005472" "10" "2724" "0" "2724" "0" "c.2724A>G" "r.2724a>g" "p.=" "28" "0000176123" "00005472" "10" "2724" "0" "2724" "0" "c.2724A>G" "r.2724a>g" "p.=" "28" "0000176124" "00005472" "10" "2979" "0" "2979" "0" "c.2979C>T" "r.2979c>u" "p.=" "28" "0000176156" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.679a>g" "p.Asp227Asn" "3" "0000176157" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.679a>g" "p.Asp227Asn" "3" "0000176158" "00005472" "10" "1196" "0" "1196" "0" "c.1196A>G" "r.1196a>g" "p.Asn399Ser" "14" "0000176159" "00005472" "10" "1196" "0" "1196" "0" "c.1196A>G" "r.1196a>g" "p.Asn399Ser" "14" "0000176160" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.2039g>a" "p.Arg680His" "26" "0000176161" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.2039g>a" "p.Arg680His" "26" "0000176162" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176163" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176178" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.679a>g" "p.Asp227Asn" "3" "0000176179" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.679a>g" "p.Asp227Asn" "3" "0000176180" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.2094g>a" "p.=" "26" "0000176181" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.2094g>a" "p.=" "26" "0000176182" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.2097c>u" "p.=" "26" "0000176183" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.2097c>u" "p.=" "26" "0000176184" "00005472" "10" "2184" "0" "2184" "0" "c.2184G>A" "r.2184g>a" "p.=" "26" "0000176185" "00005472" "10" "2184" "0" "2184" "0" "c.2184G>A" "r.2184g>a" "p.=" "26" "0000176186" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176187" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176213" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.679a>g" "p.Asp227Asn" "3" "0000176214" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.679a>g" "p.Asp227Asn" "3" "0000176215" "00005472" "10" "1196" "0" "1196" "0" "c.1196A>G" "r.1196a>g" "p.Asn399Ser" "14" "0000176216" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.2039g>a" "p.Arg680His" "26" "0000176217" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.2094g>a" "p.=" "26" "0000176218" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.2097c>u" "p.=" "26" "0000176219" "00005472" "10" "2184" "0" "2184" "0" "c.2184G>A" "r.2184g>a" "p.=" "26" "0000176220" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176238" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.2094g>a" "p.=" "26" "0000176239" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.2094g>a" "p.=" "26" "0000176240" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.2097c>u" "p.=" "26" "0000176241" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.2097c>u" "p.=" "26" "0000176242" "00005472" "10" "2184" "0" "2184" "0" "c.2184G>A" "r.2184g>a" "p.=" "26" "0000176243" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176244" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176264" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.679a>g" "p.Asp227Asn" "3" "0000176265" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.679a>g" "p.Asp227Asn" "3" "0000176266" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.2094g>a" "p.=" "26" "0000176267" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.2094g>a" "p.=" "26" "0000176268" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.2097c>u" "p.=" "26" "0000176269" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.2097c>u" "p.=" "26" "0000176270" "00005472" "10" "2184" "0" "2184" "0" "c.2184G>A" "r.2184g>a" "p.=" "26" "0000176271" "00005472" "10" "2184" "0" "2184" "0" "c.2184G>A" "r.2184g>a" "p.=" "26" "0000176272" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176273" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.2697g>u" "p.=" "28" "0000176292" "00005472" "90" "2386" "0" "2386" "0" "c.2386A>T" "r.(?)" "p.(Lys796*)" "26" "0000176294" "00005472" "50" "2351" "0" "2351" "0" "c.2351G>A" "r.(?)" "p.(Arg784His)" "26" "0000176295" "00005472" "30" "1552" "0" "1552" "0" "c.1552C>T" "r.(?)" "p.(Pro518Ser)" "19" "0000176299" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.1789_1790ins1790-7_1790-1" "p.Glu656Alafs*17" "25i" "0000176300" "00005472" "50" "1817" "-3" "1817" "-3" "c.1817-3dup" "r.(spl?)" "p.(=)" "24i" "0000176305" "00005472" "70" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl?" "p.(=)" "25i" "0000176306" "00005472" "90" "2423" "-1" "2423" "-1" "c.2423-1G>C" "r.spl" "p.?" "26i" "0000176307" "00005472" "70" "2422" "1" "2422" "1" "c.2422+1G>A" "r.spl?" "p.?" "26i" "0000176308" "00005472" "90" "2319" "0" "2319" "0" "c.2319C>G" "r.(?)" "p.(Tyr773*)" "26" "0000176309" "00005472" "70" "3005" "0" "3006" "0" "c.3005_3006del" "r.(?)" "p.(Tyr1002*)" "28" "0000176310" "00005472" "50" "1975" "0" "1975" "0" "c.1975C>T" "r.(?)" "p.(Arg659Cys)" "26" "0000176312" "00005472" "70" "928" "-2" "928" "-1" "c.928-2_928-1del" "r.spl?" "p.?" "8i" "0000176313" "00005472" "90" "1507" "0" "1507" "0" "c.1507C>T" "r.(?)" "p.(Gln503*)" "18" "0000176314" "00005472" "90" "838" "0" "838" "0" "c.838G>A" "r.(?)" "p.(Gly280Ser)" "6" "0000176324" "00005472" "90" "1769" "0" "1769" "0" "c.1769C>T" "r.(?)" "p.(Thr590Met)" "23" "0000176325" "00005472" "90" "1771" "-2" "1771" "-2" "c.1771-2A>T" "r.spl" "p.(Gly591Cys605delThrfs*148)" "23i" "0000176332" "00005472" "30" "507" "0" "507" "0" "c.507C>T" "r.(?)" "p.(=)" "3" "0000176333" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.1789_1790ins1790-7_1790-1" "p.Glu656Alafs*17" "25i" "0000176334" "00005472" "90" "-1" "0" "3061" "0" "c.(?_-1)_(*1_?)del" "r.0" "p.0" "_1_28_" "0000176337" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.2094g>a" "p.=" "26" "0000176338" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.2097c>u" "p.=" "26" "0000176339" "00005472" "90" "2947" "0" "2952" "0" "c.2947_2952del" "r.2947_2952del" "p.Asp983_Val984del" "28" "0000176340" "00005472" "90" "954" "23" "955" "-43" "c.954+23_955-43del" "r.928_954del" "p.Gly310_Lys318del" "9i" "0000176341" "00005472" "10" "2611" "0" "2611" "0" "c.2611G>A" "r.2611g>a" "p.Asp871Asn" "28" "0000176342" "00005472" "50" "2489" "0" "2489" "0" "c.2489G>A" "r.2489g>a" "p.Arg830Gln" "28" "0000176343" "00005472" "50" "2527" "0" "2527" "0" "c.2527C>T" "r.2527c>u" "p.Arg843Trp" "28" "0000176345" "00005472" "10" "1196" "0" "1196" "0" "c.1196G>A" "r.1196g>a" "p.Ser399Asn" "14" "0000176346" "00005472" "90" "1096" "0" "1096" "0" "c.1096C>T" "r.0" "p.0" "12" "0000176347" "00005472" "70" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.[=, 1969_1970ins1970-7_1970-1]" "p.[=, Gly657Alafs*18]" "25i" "0000176348" "00005472" "90" "2455" "0" "2455" "0" "c.2455C>T" "r.2455c>u" "p.Gln819*" "27" "0000176350" "00005472" "90" "2351" "0" "2351" "0" "c.2351G>A" "r.(?)" "p.Arg784His" "26" "0000176352" "00005472" "90" "2572" "0" "2572" "0" "c.2572C>T" "r.(?)" "p.(Gln858*)" "28" "0000176353" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.(=)" "25i" "0000176354" "00005472" "90" "2527" "0" "2527" "0" "c.2527C>T" "r.spl?" "p.(Arg843Trp)" "28" "0000176355" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.(=)" "25i" "0000176357" "00005472" "90" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000176358" "00005472" "90" "2980" "0" "2980" "0" "c.2980G>A" "r.(?)" "p.(Ala994Thr)" "28" "0000176365" "00005472" "10" "954" "0" "954" "0" "c.954G>A" "r.(?)" "p.(=)" "9" "0000176366" "00005472" "90" "2175" "0" "2176" "0" "c.2175_2176del" "r.spl?" "p.(Phe726Cysfs*15)" "26" "0000176367" "00005472" "90" "1832" "0" "1832" "0" "c.1832G>A" "r.(?)" "p.(Cys611Tyr)" "25" "0000176368" "00005472" "90" "2455" "0" "2455" "0" "c.2455C>T" "r.2455c>u" "p.Gln819*" "27" "0000176369" "00005472" "90" "1336" "0" "1336" "0" "c.1336dup" "r.(?)" "p.(Asp446Glyfs*5)" "16" "0000176370" "00005472" "90" "348" "0" "348" "0" "c.348dup" "r.(?)" "p.(Ser117Leufs*159)" "3" "0000176371" "00005472" "90" "2240" "0" "2240" "0" "c.2240T>A" "r.(?)" "p.(Leu747Gln)" "26" "0000176372" "00005472" "90" "2572" "0" "2572" "0" "c.2572C>T" "r.(?)" "p.(Gln858*)" "28" "0000234517" "00005472" "90" "1970" "-7" "1981" "0" "c.1970-7_1981dup" "r.spl" "p.?" "25i_26" "0000247677" "00005472" "10" "2724" "0" "2724" "0" "c.2724A>G" "r.(?)" "p.(Thr908=)" "" "0000247681" "00005472" "10" "1671" "10" "1671" "10" "c.1671+10A>G" "r.(=)" "p.(=)" "" "0000247688" "00005472" "90" "1461" "0" "1461" "0" "c.1461del" "r.(?)" "p.(Ser488LeufsTer57)" "" "0000247690" "00005472" "50" "759" "0" "759" "0" "c.759A>G" "r.(?)" "p.(Glu253=)" "" "0000247691" "00005472" "50" "933" "0" "933" "0" "c.933A>T" "r.(?)" "p.(Glu311Asp)" "" "0000247694" "00005472" "50" "1661" "0" "1661" "0" "c.1661A>G" "r.(?)" "p.(Lys554Arg)" "" "0000248390" "00005472" "10" "2724" "0" "2724" "0" "c.2724A>G" "r.(?)" "p.(Thr908=)" "" "0000248460" "00005472" "10" "1671" "10" "1671" "10" "c.1671+10A>G" "r.(=)" "p.(=)" "" "0000256523" "00005472" "50" "2683" "0" "2683" "0" "c.2683A>C" "r.(?)" "p.(Ser895Arg)" "" "0000264824" "00005472" "30" "3116" "0" "3116" "0" "c.*56T>G" "r.(=)" "p.(=)" "" "0000264825" "00005472" "50" "1063" "0" "1063" "0" "c.1063G>T" "r.(?)" "p.(Gly355Cys)" "" "0000264826" "00005472" "50" "1070" "0" "1070" "0" "c.1070C>G" "r.(?)" "p.(Pro357Arg)" "" "0000264827" "00005472" "50" "1161" "0" "1161" "0" "c.1161C>T" "r.(?)" "p.(Ile387=)" "" "0000264828" "00005472" "50" "1162" "0" "1162" "0" "c.1162G>A" "r.(?)" "p.(Gly388Arg)" "" "0000264829" "00005472" "10" "1196" "0" "1196" "0" "c.1196G>A" "r.(?)" "p.(Ser399Asn)" "" "0000264830" "00005472" "50" "1251" "0" "1251" "0" "c.1251C>T" "r.(?)" "p.(Arg417=)" "" "0000264831" "00005472" "10" "1333" "-8" "1333" "-8" "c.1333-8T>C" "r.(=)" "p.(=)" "" "0000264832" "00005472" "50" "1336" "0" "1336" "0" "c.1336G>C" "r.(?)" "p.(Asp446His)" "" "0000264833" "00005472" "90" "1522" "-1" "1522" "-1" "c.1522-1G>A" "r.spl?" "p.?" "" "0000264834" "00005472" "10" "1552" "0" "1552" "0" "c.1552C>T" "r.(?)" "p.(Pro518Ser)" "" "0000264835" "00005472" "10" "1609" "-10" "1609" "-10" "c.1609-10C>T" "r.(=)" "p.(=)" "" "0000264836" "00005472" "30" "1769" "0" "1769" "0" "c.1769C>T" "r.(?)" "p.(Thr590Met)" "" "0000264837" "00005472" "10" "1770" "4" "1770" "4" "c.1770+4G>A" "r.spl?" "p.?" "" "0000264838" "00005472" "10" "1816" "18" "1816" "18" "c.1816+18del" "r.(=)" "p.(=)" "" "0000264840" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl?" "p.?" "" "0000264841" "00005472" "50" "202" "0" "202" "0" "c.202T>C" "r.(?)" "p.(Phe68Leu)" "" "0000264842" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.(?)" "p.(Arg680His)" "" "0000264843" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.(?)" "p.(Ala698=)" "" "0000264844" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.(?)" "p.(Gly699=)" "" "0000264845" "00005472" "10" "2184" "0" "2184" "0" "c.2184G>A" "r.(?)" "p.(Val728=)" "" "0000264846" "00005472" "50" "2220" "0" "2220" "0" "c.2220T>C" "r.(?)" "p.(Asp740=)" "" "0000264849" "00005472" "30" "2462" "-2571" "2462" "-2571" "c.2462-2571C>T" "r.(=)" "p.(=)" "" "0000264851" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.(?)" "p.(Thr899=)" "" "0000264852" "00005472" "10" "2803" "0" "2803" "0" "c.2803G>A" "r.(?)" "p.(Gly935Arg)" "" "0000264853" "00005472" "10" "2856" "0" "2856" "0" "c.2856G>A" "r.(?)" "p.(Thr952=)" "" "0000264854" "00005472" "10" "2979" "0" "2979" "0" "c.2979C>T" "r.(?)" "p.(Arg993=)" "" "0000264855" "00005472" "10" "2982" "0" "2982" "0" "c.2982C>T" "r.(?)" "p.(Ala994=)" "" "0000264856" "00005472" "10" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Glu106Lys)" "" "0000264857" "00005472" "50" "499" "0" "499" "0" "c.499G>A" "r.(?)" "p.(Gly167Ser)" "" "0000264858" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "" "0000264859" "00005472" "10" "663" "0" "663" "0" "c.663C>T" "r.(?)" "p.(Pro221=)" "" "0000264860" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.(?)" "p.(Asp227Asn)" "" "0000264861" "00005472" "10" "714" "9" "714" "9" "c.714+9C>T" "r.(=)" "p.(=)" "" "0000264862" "00005472" "70" "803" "0" "803" "0" "c.803G>A" "r.(?)" "p.(Gly268Asp)" "" "0000264863" "00005472" "90" "812" "0" "812" "0" "c.812G>A" "r.(?)" "p.(Gly271Asp)" "" "0000264864" "00005472" "90" "855" "2" "855" "2" "c.855+2T>G" "r.spl?" "p.?" "" "0000264865" "00005472" "90" "875" "0" "875" "0" "c.875G>T" "r.(?)" "p.(Gly292Val)" "" "0000264866" "00005472" "10" "928" "-19" "928" "-19" "c.928-19C>T" "r.(=)" "p.(=)" "" "0000264867" "00005472" "50" "955" "-8" "955" "-8" "c.955-8C>T" "r.(=)" "p.(=)" "" "0000264868" "00005472" "50" "988" "0" "988" "0" "c.988G>A" "r.(?)" "p.(Asp330Asn)" "" "0000267001" "00005472" "10" "1196" "0" "1196" "0" "c.1196G>A" "r.(?)" "p.(Ser399Asn)" "" "0000267002" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.(?)" "p.(Arg680His)" "" "0000267003" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.(?)" "p.(Ala698=)" "" "0000267004" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.(?)" "p.(Gly699=)" "" "0000267005" "00005472" "50" "2182" "0" "2182" "0" "c.2182G>A" "r.(?)" "p.(Val728Met)" "" "0000267007" "00005472" "10" "2803" "0" "2803" "0" "c.2803G>A" "r.(?)" "p.(Gly935Arg)" "" "0000267008" "00005472" "10" "663" "0" "663" "0" "c.663C>T" "r.(?)" "p.(Pro221=)" "" "0000267009" "00005472" "10" "928" "-19" "928" "-19" "c.928-19C>T" "r.(=)" "p.(=)" "" "0000270498" "00005472" "30" "1552" "0" "1552" "0" "c.1552C>T" "r.(?)" "p.(Pro518Ser)" "" "0000270499" "00005472" "10" "2803" "0" "2803" "0" "c.2803G>A" "r.(?)" "p.(Gly935Arg)" "" "0000270500" "00005472" "30" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Glu106Lys)" "" "0000270501" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.(?)" "p.(Asp227Asn)" "" "0000270502" "00005472" "90" "875" "0" "875" "0" "c.875G>A" "r.(?)" "p.(Gly292Asp)" "" "0000274276" "00005472" "50" "1769" "0" "1769" "0" "c.1769C>T" "r.(?)" "p.(Thr590Met)" "" "0000274277" "00005472" "30" "2461" "2661" "2461" "2661" "c.2461+2661C>T" "r.(=)" "p.(=)" "" "0000274278" "00005472" "30" "2748" "0" "2748" "0" "c.2748C>A" "r.(?)" "p.(His916Gln)" "" "0000287970" "00005472" "30" "7571" "0" "7571" "0" "c.*4511C>T" "r.(=)" "p.(=)" "" "0000328737" "00005472" "30" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "" "0000328739" "00005472" "30" "679" "0" "679" "0" "c.679G>A" "r.(?)" "p.(Asp227Asn)" "" "0000328740" "00005472" "30" "832" "0" "832" "0" "c.832G>A" "r.(?)" "p.(Glu278Lys)" "" "0000328741" "00005472" "30" "1552" "0" "1552" "0" "c.1552C>T" "r.(?)" "p.(Pro518Ser)" "" "0000328742" "00005472" "30" "1816" "18" "1816" "18" "c.1816+18del" "r.(=)" "p.(=)" "" "0000328744" "00005472" "50" "1970" "-1" "1970" "-1" "c.1970-1G>A" "r.spl?" "p.?" "" "0000328745" "00005472" "50" "2008" "0" "2008" "0" "c.2008A>G" "r.(?)" "p.(Thr670Ala)" "" "0000328746" "00005472" "30" "2160" "0" "2160" "0" "c.2160C>G" "r.(?)" "p.(Arg720=)" "" "0000328747" "00005472" "30" "2234" "0" "2234" "0" "c.2234G>A" "r.(?)" "p.(Arg745Gln)" "" "0000328748" "00005472" "50" "2278" "0" "2278" "0" "c.2278G>A" "r.(?)" "p.(Gly760Arg)" "" "0000328749" "00005472" "30" "2351" "0" "2351" "0" "c.2351G>A" "r.(?)" "p.(Arg784His)" "" "0000328750" "00005472" "50" "2461" "2660" "2461" "2660" "c.2461+2660C>A" "r.(=)" "p.(=)" "" "0000328752" "00005472" "30" "2462" "-2571" "2462" "-2571" "c.2462-2571C>T" "r.(=)" "p.(=)" "" "0000328753" "00005472" "50" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Arg843Gln)" "" "0000328755" "00005472" "50" "2600" "0" "2600" "0" "c.2600G>A" "r.(?)" "p.(Arg867Gln)" "" "0000328756" "00005472" "30" "2697" "0" "2697" "0" "c.2697G>T" "r.(?)" "p.(Thr899=)" "" "0000328757" "00005472" "30" "2769" "0" "2769" "0" "c.2769C>T" "r.(?)" "p.(His923=)" "" "0000328758" "00005472" "30" "2781" "0" "2781" "0" "c.2781C>G" "r.(?)" "p.(Ala927=)" "" "0000328759" "00005472" "30" "2795" "0" "2795" "0" "c.2795C>T" "r.(?)" "p.(Pro932Leu)" "" "0000328760" "00005472" "30" "2983" "0" "2983" "0" "c.2983G>A" "r.(?)" "p.(Ala995Thr)" "" "0000328761" "00005472" "30" "3000" "0" "3000" "0" "c.3000G>A" "r.(?)" "p.(Lys1000=)" "" "0000328762" "00005472" "50" "3017" "0" "3017" "0" "c.3017C>T" "r.(?)" "p.(Ala1006Val)" "" "0000338190" "00005472" "10" "714" "9" "714" "9" "c.714+9C>T" "r.(=)" "p.(=)" "" "0000338193" "00005472" "10" "928" "-19" "928" "-19" "c.928-19C>T" "r.(=)" "p.(=)" "" "0000338194" "00005472" "30" "928" "-19" "928" "-18" "c.928-19_928-18insT" "r.(=)" "p.(=)" "" "0000338195" "00005472" "10" "1333" "-8" "1333" "-8" "c.1333-8T>C" "r.(=)" "p.(=)" "" "0000338196" "00005472" "10" "1572" "3" "1572" "3" "c.1572+3G>A" "r.spl?" "p.?" "" "0000338197" "00005472" "10" "1609" "-10" "1609" "-10" "c.1609-10C>T" "r.(=)" "p.(=)" "" "0000338198" "00005472" "90" "1671" "1" "1671" "1" "c.1671+1G>A" "r.spl?" "p.?" "" "0000338199" "00005472" "10" "1671" "10" "1671" "10" "c.1671+10A>G" "r.(=)" "p.(=)" "" "0000338200" "00005472" "10" "1770" "4" "1770" "4" "c.1770+4G>A" "r.spl?" "p.?" "" "0000338202" "00005472" "30" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl?" "p.?" "" "0000338203" "00005472" "10" "3218" "0" "3218" "0" "c.*158C>T" "r.(=)" "p.(=)" "" "0000340144" "00005472" "30" "1161" "0" "1161" "0" "c.1161C>T" "r.(?)" "p.(Ile387=)" "" "0000340145" "00005472" "10" "2094" "0" "2094" "0" "c.2094G>A" "r.(?)" "p.(Ala698=)" "" "0000340146" "00005472" "10" "2097" "0" "2097" "0" "c.2097C>T" "r.(?)" "p.(Gly699=)" "" "0000340147" "00005472" "10" "2184" "0" "2184" "0" "c.2184G>A" "r.(?)" "p.(Val728=)" "" "0000340148" "00005472" "10" "2331" "0" "2331" "0" "c.2331C>T" "r.(?)" "p.(Cys777=)" "" "0000340149" "00005472" "10" "2697" "0" "2697" "0" "c.2697G>T" "r.(?)" "p.(Thr899=)" "" "0000340150" "00005472" "10" "2724" "0" "2724" "0" "c.2724A>G" "r.(?)" "p.(Thr908=)" "" "0000340151" "00005472" "10" "2979" "0" "2979" "0" "c.2979C>T" "r.(?)" "p.(Arg993=)" "" "0000340740" "00005472" "30" "510" "0" "510" "0" "c.510C>T" "r.(?)" "p.(Cys170=)" "" "0000340756" "00005472" "10" "2163" "0" "2163" "0" "c.2163G>A" "r.(?)" "p.(Gln721=)" "" "0000340903" "00005472" "10" "663" "0" "663" "0" "c.663C>T" "r.(?)" "p.(Pro221=)" "" "0000340991" "00005472" "10" "483" "0" "483" "0" "c.483C>T" "r.(?)" "p.(Thr161=)" "" "0000342931" "00005472" "50" "1358" "0" "1358" "0" "c.1358G>A" "r.(?)" "p.(Arg453His)" "" "0000342994" "00005472" "10" "1466" "0" "1466" "0" "c.1466G>A" "r.(?)" "p.(Arg489Gln)" "" "0000343074" "00005472" "90" "1615" "0" "1615" "0" "c.1615C>T" "r.(?)" "p.(Arg539Ter)" "" "0000343117" "00005472" "50" "1706" "0" "1706" "0" "c.1706G>A" "r.(?)" "p.(Arg569Gln)" "" "0000343256" "00005472" "10" "2039" "0" "2039" "0" "c.2039G>A" "r.(?)" "p.(Arg680His)" "" "0000343322" "00005472" "50" "2213" "0" "2213" "0" "c.2213G>C" "r.(?)" "p.(Arg738Pro)" "" "0000343402" "00005472" "70" "2488" "0" "2488" "0" "c.2488C>T" "r.(?)" "p.(Arg830Trp)" "" "0000343862" "00005472" "50" "3003" "0" "3003" "0" "c.3003C>A" "r.(?)" "p.(Asp1001Glu)" "" "0000344002" "00005472" "10" "679" "0" "679" "0" "c.679G>A" "r.(?)" "p.(Asp227Asn)" "" "0000344103" "00005472" "50" "1336" "0" "1336" "0" "c.1336G>A" "r.(?)" "p.(Asp446Asn)" "" "0000344104" "00005472" "50" "1336" "0" "1336" "0" "c.1336G>C" "r.(?)" "p.(Asp446His)" "" "0000344364" "00005472" "50" "1030" "0" "1030" "0" "c.1030T>G" "r.(?)" "p.(Cys344Gly)" "" "0000344464" "00005472" "90" "2454" "0" "2454" "0" "c.2454C>A" "r.(?)" "p.(Cys818Ter)" "" "0000345047" "00005472" "30" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Glu106Lys)" "" "0000345788" "00005472" "30" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "" "0000345933" "00005472" "90" "802" "0" "802" "0" "c.802G>A" "r.(?)" "p.(Gly268Ser)" "" "0000345955" "00005472" "50" "866" "0" "866" "0" "c.866G>A" "r.(?)" "p.(Gly289Asp)" "" "0000346032" "00005472" "50" "1100" "0" "1100" "0" "c.1100G>A" "r.(?)" "p.(Gly367Glu)" "" "0000346107" "00005472" "50" "1450" "0" "1450" "0" "c.1450G>A" "r.(?)" "p.(Gly484Arg)" "" "0000346116" "00005472" "50" "1469" "0" "1469" "0" "c.1469G>A" "r.(?)" "p.(Gly490Glu)" "" "0000346145" "00005472" "70" "1591" "0" "1591" "0" "c.1591G>A" "r.(?)" "p.(Gly531Ser)" "" "0000346175" "00005472" "70" "1744" "0" "1744" "0" "c.1744G>A" "r.(?)" "p.(Gly582Ser)" "" "0000346229" "00005472" "50" "2098" "0" "2098" "0" "c.2098G>A" "r.(?)" "p.(Gly700Ser)" "" "0000346295" "00005472" "30" "2518" "0" "2518" "0" "c.2518G>A" "r.(?)" "p.(Gly840Ser)" "" "0000346329" "00005472" "10" "2803" "0" "2803" "0" "c.2803G>A" "r.(?)" "p.(Gly935Arg)" "" "0000348486" "00005472" "10" "1552" "0" "1552" "0" "c.1552C>T" "r.(?)" "p.(Pro518Ser)" "" "0000348981" "00005472" "10" "1196" "0" "1196" "0" "c.1196G>A" "r.(?)" "p.(Ser399Asn)" "" "0000349592" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.(=)" "p.(=)" "" "0000351217" "00005472" "50" "2423" "-9" "2423" "-3" "c.2423-9_2423-3del" "r.spl?" "p.?" "" "0000398521" "00005472" "70" "830" "0" "830" "0" "c.830G>A" "r.(?)" "p.(Gly277Glu)" "" "0000439096" "00005472" "50" "2741" "0" "2743" "0" "c.2741_2743del" "r.(?)" "p.Phe914del" "" "0000441101" "00005472" "50" "2054" "0" "2054" "0" "c.2054C>T" "r.(?)" "p.Ser685Leu" "" "0000461681" "00005472" "50" "988" "0" "988" "0" "c.988G>A" "r.(?)" "p.(Asp330Asn)" "10" "0000461682" "00005472" "50" "2893" "0" "2893" "0" "c.2893C>T" "r.(?)" "p.(Arg965Cys)" "28" "0000461683" "00005472" "50" "1663" "0" "1663" "0" "c.1663G>A" "r.(?)" "p.(Gly555Arg)" "21" "0000461684" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl" "p.?" "26" "0000461685" "00005472" "50" "2536" "0" "2536" "0" "c.2536G>A" "r.(?)" "p.(Glu846Lys)" "28" "0000461686" "00005472" "50" "1496" "0" "1496" "0" "c.1496G>A" "r.(?)" "p.(Gly499Glu)" "18" "0000461687" "00005472" "50" "1750" "0" "1750" "0" "c.1750C>T" "r.(?)" "p.(Pro584Ser)" "23" "0000461688" "00005472" "50" "2159" "0" "2159" "0" "c.2159G>A" "r.(?)" "p.(Arg720His)" "26" "0000461689" "00005472" "50" "472" "0" "472" "0" "c.472G>A" "r.(?)" "p.(Val158Met)" "3" "0000461690" "00005472" "50" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Val190Met)" "3" "0000461691" "00005472" "50" "2806" "0" "2806" "0" "c.2806G>A" "r.(?)" "p.(Ala936Thr)" "28" "0000461692" "00005472" "50" "169" "0" "169" "0" "c.169G>A" "r.(?)" "p.(Val57Ile)" "3" "0000461693" "00005472" "50" "2489" "0" "2489" "0" "c.2489G>A" "r.(?)" "p.(Arg830Gln)" "28" "0000461694" "00005472" "50" "2984" "0" "2986" "0" "c.2984_2986del" "r.(?)" "p.(Ala995del)" "28" "0000461695" "00005472" "50" "1060" "0" "1060" "0" "c.1060G>A" "r.(?)" "p.(Asp354Asn)" "12" "0000461696" "00005472" "50" "2009" "0" "2009" "0" "c.2009C>A" "r.(?)" "p.(Thr670Asn)" "26" "0000461697" "00005472" "50" "581" "0" "581" "0" "c.581A>G" "r.(?)" "p.(Gln194Arg)" "3" "0000461698" "00005472" "50" "1129" "0" "1129" "0" "c.1129C>T" "r.(?)" "p.(Arg377Cys)" "13" "0000461699" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000461700" "00005472" "50" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Arg843Gln)" "28" "0000461701" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl" "p.?" "25i" "0000461702" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl" "p.?" "25i" "0000461703" "00005472" "50" "2998" "0" "2998" "0" "c.2998A>G" "r.(?)" "p.(Lys1000Glu)" "28" "0000461704" "00005472" "50" "1070" "0" "1070" "0" "c.1070C>G" "r.(?)" "p.(Pro357Arg)" "12" "0000461705" "00005472" "50" "-6" "0" "-6" "0" "c.-6G>A" "r.spl" "p.(=)" "5\' UTR" "0000461706" "00005472" "50" "1031" "0" "1031" "0" "c.1031G>A" "r.(?)" "p.(Cys344Tyr)" "11" "0000461707" "00005472" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264His)" "5" "0000461708" "00005472" "50" "2785" "0" "2785" "0" "c.2785G>A" "r.(?)" "p.(Val929Met)" "28" "0000461709" "00005472" "50" "2659" "0" "2659" "0" "c.2659G>A" "r.(?)" "p.(Glu887Lys)" "28" "0000461710" "00005472" "50" "1051" "0" "1051" "0" "c.1051C>T" "r.(?)" "p.(Arg351Trp)" "11" "0000461711" "00005472" "50" "176" "0" "176" "0" "c.176T>C" "r.(?)" "p.(Met59Thr)" "3" "0000461712" "00005472" "50" "2950" "0" "2950" "0" "c.2950G>A" "r.(?)" "p.(Val984Met)" "28" "0000461713" "00005472" "50" "2960" "0" "2960" "0" "c.2960C>T" "r.(?)" "p.(Thr987Met)" "28" "0000461714" "00005472" "50" "1117" "-3" "1117" "-3" "c.1117-3C>T" "r.spl" "p.?" "12i" "0000461715" "00005472" "50" "2968" "0" "2968" "0" "c.2968C>G" "r.(?)" "p.(Leu990Val)" "28" "0000461716" "00005472" "70" "866" "0" "866" "0" "c.866G>A" "r.(?)" "p.(Gly289Asp)" "7" "0000461717" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl?" "p.?" "25i" "0000461718" "00005472" "50" "2326" "0" "2326" "0" "c.2326G>A" "r.(?)" "p.(Ala776Thr)" "26" "0000461719" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000461720" "00005472" "50" "2170" "0" "2170" "0" "c.2170C>T" "r.(?)" "p.(Arg724Cys)" "26" "0000461721" "00005472" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.G2065S" "16" "0000461722" "00005472" "50" "2392" "0" "2394" "0" "c.2392_2394del" "r.(?)" "p.(Ile798del)" "26" "0000461723" "00005472" "50" "2611" "0" "2611" "0" "c.2611G>A" "r.(?)" "p.(Asp871Asn)" "35" "0000461724" "00005472" "50" "793" "0" "793" "0" "c.793G>A" "r.(?)" "p.(Gly265Arg)" "5" "0000461725" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000461726" "00005472" "50" "628" "0" "628" "0" "c.628G>A" "r.(?)" "p.(Glu210Lys)" "3" "0000461727" "00005472" "50" "2707" "0" "2707" "0" "c.2707G>A" "r.(?)" "p.(Glu903Lys)" "28" "0000461728" "00005472" "50" "2633" "0" "2633" "0" "c.2633C>T" "r.(?)" "p.(Ala878Val)" "28" "0000461729" "00005472" "50" "1645" "0" "1645" "0" "c.1645G>A" "r.(?)" "p.(Gly549Arg)" "21" "0000461730" "00005472" "50" "2536" "0" "2536" "0" "c.2536G>A" "r.(?)" "p.(Glu846Lys)" "28" "0000461731" "00005472" "50" "2656" "0" "2656" "0" "c.2656G>A" "r.(?)" "p.(Gly886Ser)" "28" "0000461732" "00005472" "50" "2711" "0" "2711" "0" "c.2711C>T" "r.(?)" "p.(Ala904Val)" "28" "0000461733" "00005472" "50" "2233" "0" "2233" "0" "c.2233C>T" "r.(?)" "p.(Arg745Trp)" "26" "0000461734" "00005472" "50" "2377" "0" "2377" "0" "c.2377G>A" "r.(?)" "p.(Val793Ile)" "4" "0000461735" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000461736" "00005472" "50" "1070" "0" "1070" "0" "c.1070C>G" "r.(?)" "p.(Pro357Arg)" "12" "0000461737" "00005472" "70" "1770" "1" "1770" "1" "c.1770+1del" "r.spl" "p.?" "23i" "0000461738" "00005472" "50" "2738" "0" "2740" "0" "c.2738_2740del" "r.spl" "p.(Ser913del)" "28" "0000461739" "00005472" "50" "2626" "0" "2626" "0" "c.2626C>T" "r.(?)" "p.(Arg876Cys)" "28" "0000461740" "00005472" "50" "2629" "0" "2629" "0" "c.2629G>A" "r.(?)" "p.(Val877Met)" "28" "0000461741" "00005472" "50" "0" "0" "0" "0" "c.?" "r.(?)" "p.V117A" "3" "0000461742" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl?" "p.?" "25i" "0000461743" "00005472" "50" "224" "0" "224" "0" "c.224C>T" "r.(?)" "p.(Pro75Leu)" "3" "0000461744" "00005472" "50" "2751" "0" "2751" "0" "c.2751G>T" "r.(?)" "p.(=)" "28" "0000461745" "00005472" "50" "2995" "0" "2995" "0" "c.2995G>A" "r.(?)" "p.(Glu999Lys)" "28" "0000461746" "00005472" "50" "2875" "0" "2875" "0" "c.2875G>C" "r.(?)" "p.(Glu959Gln)" "28" "0000461747" "00005472" "50" "1831" "0" "1831" "0" "c.1831T>C" "r.(?)" "p.(Cys611Arg)" "25" "0000461748" "00005472" "50" "2795" "0" "2795" "0" "c.2795C>T" "r.(?)" "p.(Pro932Leu)" "28" "0000461749" "00005472" "50" "1161" "0" "1161" "0" "c.1161C>T" "r.(?)" "p.(=)" "13" "0000461750" "00005472" "50" "2116" "0" "2116" "0" "c.2116G>C" "r.(?)" "p.(Ala706Pro)" "26" "0000461751" "00005472" "50" "2795" "0" "2795" "0" "c.2795C>T" "r.(?)" "p.(Pro932Leu)" "28" "0000461752" "00005472" "50" "2192" "0" "2192" "0" "c.2192C>T" "r.(?)" "p.(Thr731Met)" "26" "0000461753" "00005472" "50" "988" "0" "988" "0" "c.988G>A" "r.(?)" "p.(Asp330Asn)" "10" "0000461754" "00005472" "50" "988" "0" "988" "0" "c.988G>A" "r.(?)" "p.(Asp330Asn)" "10" "0000461755" "00005472" "50" "2489" "0" "2489" "0" "c.2489G>A" "r.(?)" "p.(Arg830Gln)" "28" "0000461756" "00005472" "50" "2960" "0" "2960" "0" "c.2960C>T" "r.(?)" "p.(Thr987Met)" "28" "0000461757" "00005472" "50" "2935" "0" "2935" "0" "c.2935G>A" "r.(?)" "p.(Asp979Asn)" "28" "0000461758" "00005472" "50" "1472" "0" "1472" "0" "c.1472A>G" "r.(?)" "p.(Asp491Gly)" "18" "0000461759" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000461760" "00005472" "50" "2795" "0" "2795" "0" "c.2795C>T" "r.(?)" "p.(Pro932Leu)" "28" "0000461761" "00005472" "50" "2182" "0" "2182" "0" "c.2182G>A" "r.(?)" "p.(Val728Met)" "26" "0000461762" "00005472" "50" "1496" "0" "1496" "0" "c.1496G>A" "r.(?)" "p.(Gly499Glu)" "18" "0000461763" "00005472" "50" "2810" "0" "2810" "0" "c.2810G>A" "r.(?)" "p.(Arg937Gln)" "28" "0000461764" "00005472" "70" "920" "0" "920" "0" "c.920G>T" "r.(?)" "p.(Gly307Val)" "8" "0000461765" "00005472" "50" "2795" "0" "2795" "0" "c.2795C>T" "r.(?)" "p.(Pro932Leu)" "28" "0000461766" "00005472" "50" "1130" "0" "1130" "0" "c.1130G>A" "r.(?)" "p.(Arg377His)" "13" "0000461767" "00005472" "50" "638" "0" "638" "0" "c.638G>A" "r.(?)" "p.(Arg213His)" "3" "0000461768" "00005472" "90" "2593" "0" "2608" "0" "c.2593_2608dup" "r.(?)" "p.(Asp870Alafs*128)" "28" "0000461769" "00005472" "50" "2795" "0" "2795" "0" "c.2795C>T" "r.(?)" "p.(Pro932Leu)" "28" "0000461770" "00005472" "50" "284" "0" "284" "0" "c.284G>A" "r.(?)" "p.(Arg95His)" "3" "0000461771" "00005472" "50" "2582" "0" "2582" "0" "c.2582G>A" "r.(?)" "p.(Arg861Gln)" "28" "0000461772" "00005472" "50" "1828" "0" "1828" "0" "c.1828C>T" "r.(?)" "p.(Arg610Cys)" "25" "0000461773" "00005472" "50" "2197" "0" "2197" "0" "c.2197G>A" "r.(?)" "p.(Gly733Arg)" "26" "0000461774" "00005472" "90" "1861" "0" "1861" "0" "c.1861G>A" "r.(?)" "p.(Asp621Asn)" "25" "0000461775" "00005472" "50" "446" "0" "446" "0" "c.446G>A" "r.(?)" "p.(Arg149His)" "3" "0000461776" "00005472" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264His)" "5" "0000461777" "00005472" "50" "1336" "0" "1336" "0" "c.1336G>C" "r.(?)" "p.(Asp446His)" "16" "0000461778" "00005472" "50" "2830" "0" "2832" "0" "c.2830_2832del" "r.(?)" "p.(Phe944del)" "28" "0000461779" "00005472" "90" "1053" "1" "1053" "1" "c.1053+1G>A" "r.spl" "p.?" "11i" "0000461780" "00005472" "50" "1012" "0" "1012" "0" "c.1012C>T" "r.(?)" "p.(Arg338Cys)" "11" "0000461781" "00005472" "50" "188" "0" "188" "0" "c.188C>T" "r.(?)" "p.(Thr63Met)" "3" "0000461782" "00005472" "50" "2489" "0" "2489" "0" "c.2489G>A" "r.(?)" "p.(Arg830Gln)" "28" "0000461783" "00005472" "50" "332" "0" "332" "0" "c.332C>T" "r.(?)" "p.(Pro111Leu)" "3" "0000461784" "00005472" "50" "2795" "0" "2795" "0" "c.2795C>T" "r.(?)" "p.(Pro932Leu)" "28" "0000461785" "00005472" "50" "2083" "0" "2083" "0" "c.2083G>A" "r.(?)" "p.(Glu695Lys)" "26" "0000461786" "00005472" "50" "2810" "0" "2810" "0" "c.2810G>A" "r.(?)" "p.(Arg937Gln)" "28" "0000461787" "00005472" "50" "2656" "0" "2656" "0" "c.2656G>A" "r.(?)" "p.(Gly886Ser)" "28" "0000461788" "00005472" "50" "1070" "0" "1070" "0" "c.1070C>G" "r.(?)" "p.(Pro357Arg)" "12" "0000461789" "00005472" "50" "730" "0" "730" "0" "c.730G>A" "r.(?)" "p.(Gly244Arg)" "4" "0000461790" "00005472" "50" "1797" "0" "1797" "0" "c.1797G>C" "r.(?)" "p.(Arg599Ser)" "24" "0000461791" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl" "p.?" "25i" "0000461792" "00005472" "90" "865" "0" "865" "0" "c.865G>T" "r.(?)" "p.(Gly289Cys)" "7" "0000461793" "00005472" "90" "1861" "0" "1861" "0" "c.1861G>A" "r.(?)" "p.(Asp621Asn)" "25" "0000461794" "00005472" "90" "1861" "0" "1861" "0" "c.1861G>A" "r.(?)" "p.(Asp621Asn)" "25" "0000461795" "00005472" "50" "2585" "0" "2585" "0" "c.2585G>A" "r.(?)" "p.(Arg862Gln)" "28" "0000461796" "00005472" "50" "736" "-7" "739" "0" "c.736-7_739del" "r.spl" "p.?" "4i_5" "0000461797" "00005472" "90" "736" "-7" "739" "0" "c.736-7_739del" "r.spl" "p.?" "4i_5" "0000461798" "00005472" "70" "838" "0" "838" "0" "c.838G>C" "r.(?)" "p.(Gly280Arg)" "6" "0000461799" "00005472" "50" "1550" "0" "1550" "0" "c.1550A>C" "r.(?)" "p.(Tyr517Ser)" "19" "0000461800" "00005472" "50" "1336" "0" "1336" "0" "c.1336G>A" "r.(?)" "p.(Asp446Asn)" "16" "0000461801" "00005472" "50" "1043" "0" "1043" "0" "c.1043C>T" "r.(?)" "p.(Pro348Leu)" "11" "0000461802" "00005472" "50" "2935" "0" "2935" "0" "c.2935G>A" "r.(?)" "p.(Asp979Asn)" "28" "0000461803" "00005472" "50" "2785" "0" "2785" "0" "c.2785G>A" "r.(?)" "p.(Val929Met)" "28" "0000461804" "00005472" "50" "2875" "0" "2875" "0" "c.2875G>C" "r.(?)" "p.(Glu959Gln)" "28" "0000461805" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl" "p.?" "25i" "0000461806" "00005472" "50" "643" "0" "643" "0" "c.643G>A" "r.(?)" "p.(Asp215Asn)" "3" "0000461807" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000461808" "00005472" "50" "2171" "0" "2171" "0" "c.2171G>T" "r.(?)" "p.(Arg724Leu)" "26" "0000461809" "00005472" "50" "847" "0" "847" "0" "c.847G>A" "r.(?)" "p.(Gly283Arg)" "6" "0000461810" "00005472" "50" "2002" "0" "2002" "0" "c.2002G>A" "r.(?)" "p.(Glu668Lys)" "26" "0000461811" "00005472" "50" "22" "0" "22" "0" "c.22G>A" "r.(?)" "p.(Val8Met)" "2" "0000461812" "00005472" "70" "2611" "0" "2611" "0" "c.2611G>A" "r.(?)" "p.(Asp871Asn)" "28" "0000461813" "00005472" "50" "2488" "0" "2488" "0" "c.2488C>T" "r.(?)" "p.(Arg830Trp)" "28" "0000461814" "00005472" "50" "2809" "0" "2809" "0" "c.2809C>T" "r.(?)" "p.(Arg937Trp)" "28" "0000461815" "00005472" "50" "2745" "0" "2745" "0" "c.2745G>A" "r.(?)" "p.(=)" "28" "0000461816" "00005472" "90" "900" "1" "900" "1" "c.900+1G>C" "r.spl" "p.?" "7i" "0000461817" "00005472" "50" "901" "0" "901" "0" "c.901G>A" "r.(?)" "p.(Gly301Ser)" "8" "0000461818" "00005472" "50" "1358" "0" "1358" "0" "c.1358G>A" "r.(?)" "p.(Arg453His)" "16" "0000461819" "00005472" "50" "1458" "3" "1458" "6" "c.1458+3_1458+6del" "r.spl" "p.?" "17i" "0000461820" "00005472" "50" "2243" "0" "2243" "0" "c.2243G>A" "r.(?)" "p.(Cys748Tyr)" "26" "0000461821" "00005472" "50" "1336" "0" "1336" "0" "c.1336G>A" "r.(?)" "p.D446N" "16" "0000461822" "00005472" "90" "1458" "1" "1458" "1" "c.1458+1G>A" "r.spl" "p.?" "17i" "0000461823" "00005472" "50" "2848" "0" "2848" "0" "c.2848G>A" "r.(?)" "p.(Gly950Ser)" "28" "0000461824" "00005472" "50" "2962" "0" "2962" "0" "c.2962C>G" "r.(?)" "p.(Leu988Val)" "28" "0000461825" "00005472" "50" "1685" "0" "1685" "0" "c.1685C>T" "r.(?)" "p.(Pro562Leu)" "22" "0000461826" "00005472" "50" "1705" "0" "1705" "0" "c.1705C>T" "r.(?)" "p.(Arg569Trp)" "22" "0000461827" "00005472" "50" "2991" "0" "2991" "0" "c.2991C>G" "r.(?)" "p.(Phe997Leu)" "28" "0000461828" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl?" "p.?" "25i" "0000461829" "00005472" "50" "1288" "0" "1288" "0" "c.1288G>A" "r.(?)" "p.(Gly430Ser)" "15" "0000461830" "00005472" "50" "954" "0" "954" "0" "c.954G>A" "r.(?)" "p.(=)" "9" "0000461831" "00005472" "50" "22" "0" "22" "0" "c.22G>A" "r.(?)" "p.(Val8Met)" "2" "0000461832" "00005472" "50" "2556" "0" "2556" "0" "c.2556C>T" "r.(?)" "p.(=)" "28" "0000461833" "00005472" "50" "2785" "0" "2785" "0" "c.2785G>A" "r.(?)" "p.(Val929Met)" "28" "0000461834" "00005472" "70" "955" "-1" "955" "-1" "c.955-1G>A" "r.spl" "p.?" "9i" "0000461835" "00005472" "90" "1870" "0" "1870" "0" "c.1870G>A" "r.(?)" "p.(Glu624Lys)" "25" "0000461836" "00005472" "90" "856" "-2" "856" "-2" "c.856-2A>C" "r.spl" "p.?" "6i" "0000461837" "00005472" "50" "1070" "0" "1070" "0" "c.1070C>G" "r.(?)" "p.(Pro357Arg)" "12" "0000461838" "00005472" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264His)" "5" "0000461839" "00005472" "90" "1396" "-11" "1396" "-2" "c.1396-11_1396-2del" "r.spl" "p.?" "16i" "0000461840" "00005472" "90" "1861" "0" "1861" "0" "c.1861G>A" "r.(?)" "p.(Asp621Asn)" "25" "0000461841" "00005472" "50" "2607" "0" "2607" "0" "c.2607C>T" "r.(?)" "p.(=)" "28" "0000461842" "00005472" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264His)" "5" "0000461843" "00005472" "90" "1751" "0" "1751" "0" "c.1751del" "r.(?)" "p.(Pro584Leufs*12)" "23" "0000461844" "00005472" "50" "2351" "0" "2351" "0" "c.2351G>C" "r.(?)" "p.(Arg784Pro)" "26" "0000461845" "00005472" "90" "802" "-2" "802" "-2" "c.802-2A>G" "r.spl" "p.?" "5i" "0000461846" "00005472" "50" "2960" "0" "2960" "0" "c.2960C>T" "r.(?)" "p.(Thr987Met)" "28" "0000461847" "00005472" "50" "2960" "0" "2960" "0" "c.2960C>T" "r.(?)" "p.(Thr987Met)" "28" "0000461848" "00005472" "50" "436" "0" "436" "0" "c.436C>T" "r.(?)" "p.(Arg146Trp)" "3" "0000461849" "00005472" "50" "436" "0" "436" "0" "c.436C>T" "r.(?)" "p.(Arg146Trp)" "3" "0000461850" "00005472" "50" "1356" "0" "1356" "0" "c.1356C>T" "r.(?)" "p.(=)" "16" "0000461851" "00005472" "50" "1336" "0" "1336" "0" "c.1336G>A" "r.(?)" "p.(Asp446Asn)" "16" "0000461852" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000461853" "00005472" "50" "545" "0" "545" "0" "c.545A>G" "r.(?)" "p.(Glu182Gly)" "3" "0000461854" "00005472" "50" "627" "0" "627" "0" "c.627C>T" "r.(?)" "p.(=)" "3" "0000461855" "00005472" "50" "2935" "0" "2935" "0" "c.2935G>A" "r.(?)" "p.(Asp979Asn)" "28" "0000461856" "00005472" "50" "2894" "0" "2894" "0" "c.2894G>C" "r.(?)" "p.(Arg965Pro)" "28" "0000461857" "00005472" "50" "1702" "0" "1702" "0" "c.1702C>T" "r.(?)" "p.(Pro568Ser)" "22" "0000461858" "00005472" "50" "1251" "0" "1251" "0" "c.1251C>T" "r.(?)" "p.(=)" "14" "0000461859" "00005472" "50" "2483" "0" "2483" "0" "c.2483C>T" "r.(?)" "p.(Thr828Met)" "28" "0000461860" "00005472" "50" "1333" "-10" "1333" "-10" "c.1333-10C>G" "r.spl" "p.(=)" "15i" "0000461861" "00005472" "50" "2527" "0" "2527" "0" "c.2527C>T" "r.(?)" "p.(Arg843Trp)" "28" "0000461862" "00005472" "50" "410" "0" "410" "0" "c.410C>T" "r.(?)" "p.(Ala137Val)" "3" "0000461863" "00005472" "50" "1585" "0" "1585" "0" "c.1585G>A" "r.(?)" "p.(Glu529Lys)" "20" "0000461864" "00005472" "50" "1573" "0" "1573" "0" "c.1573G>C" "r.(?)" "p.(Gly525Arg)" "20" "0000461865" "00005472" "50" "2575" "0" "2575" "0" "c.2575G>A" "r.(?)" "p.(Val859Met)" "28" "0000461866" "00005472" "50" "2582" "0" "2582" "0" "c.2582G>A" "r.(?)" "p.(Arg861Gln)" "28" "0000461867" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl" "p.?" "25i" "0000461868" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000461869" "00005472" "90" "1615" "0" "1615" "0" "c.1615C>T" "r.(?)" "p.(Arg539*)" "21" "0000461870" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.(=)" "25i" "0000461871" "00005472" "50" "2460" "0" "2460" "0" "c.2460A>C" "r.(?)" "p.(=)" "27" "0000461872" "00005472" "50" "790" "0" "790" "0" "c.790C>T" "r.(?)" "p.(Arg264Cys)" "5" "0000461873" "00005472" "50" "176" "0" "176" "0" "c.176T>C" "r.(?)" "p.(Met59Thr)" "3" "0000461874" "00005472" "50" "2711" "0" "2711" "0" "c.2711C>T" "r.(?)" "p.(Ala904Val)" "28" "0000461875" "00005472" "50" "1762" "0" "1762" "0" "c.1762G>A" "r.(?)" "p.(Gly588Ser)" "23" "0000461876" "00005472" "50" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Val190Met)" "3" "0000461877" "00005472" "90" "1053" "1" "1053" "1" "c.1053+1G>C" "r.spl" "p.?" "11i" "0000461878" "00005472" "90" "1000" "-2" "1000" "-1" "c.1000-2_1000-1inv" "r.spl" "p.?" "10i" "0000461879" "00005472" "50" "2785" "0" "2785" "0" "c.2785G>A" "r.(?)" "p.(Val929Met)" "28" "0000461880" "00005472" "50" "637" "0" "637" "0" "c.637C>T" "r.(?)" "p.(Arg213Cys)" "3" "0000461881" "00005472" "90" "883" "0" "883" "0" "c.883G>A" "r.(?)" "p.(Gly295Arg)" "7" "0000461882" "00005472" "50" "2656" "0" "2656" "0" "c.2656G>A" "r.(?)" "p.(Gly886Ser)" "28" "0000461883" "00005472" "50" "2893" "0" "2893" "0" "c.2893C>T" "r.(?)" "p.(Arg965Cys)" "28" "0000461884" "00005472" "50" "2585" "0" "2585" "0" "c.2585G>A" "r.(?)" "p.(Arg862Gln)" "28" "0000461885" "00005472" "90" "875" "0" "875" "0" "c.875G>T" "r.(?)" "p.(Gly292Val)" "7" "0000461886" "00005472" "50" "2894" "0" "2894" "0" "c.2894G>C" "r.(?)" "p.(Arg965Pro)" "28" "0000461887" "00005472" "50" "2893" "0" "2893" "0" "c.2893C>T" "r.(?)" "p.(Arg965Cys)" "28" "0000461888" "00005472" "50" "1762" "0" "1762" "0" "c.1762G>A" "r.(?)" "p.(Gly588Ser)" "23" "0000461889" "00005472" "50" "2929" "0" "2929" "0" "c.2929G>A" "r.(?)" "p.(Gly977Ser)" "28" "0000461890" "00005472" "50" "2711" "0" "2711" "0" "c.2711C>T" "r.(?)" "p.(Ala904Val)" "28" "0000461891" "00005472" "50" "2575" "0" "2575" "0" "c.2575G>A" "r.(?)" "p.(Val859Met)" "28" "0000461892" "00005472" "50" "1572" "0" "1572" "0" "c.1572C>T" "r.(?)" "p.(=)" "19" "0000461893" "00005472" "50" "3004" "0" "3004" "0" "c.3004T>C" "r.(?)" "p.(Tyr1002His)" "28" "0000461894" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.(=)" "25i" "0000461895" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.(=)" "25i" "0000461896" "00005472" "50" "1336" "0" "1336" "0" "c.1336G>C" "r.(?)" "p.(Asp446His)" "16" "0000461897" "00005472" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264His)" "5" "0000461898" "00005472" "50" "2608" "0" "2608" "0" "c.2608G>A" "r.(?)" "p.(Asp870Asn)" "28" "0000461899" "00005472" "50" "3062" "0" "3062" "0" "c.*2G>A" "r.(?)" "p.(=)" "3\' UTR" "0000461900" "00005472" "50" "2751" "0" "2751" "0" "c.2751G>T" "r.(?)" "p.(=)" "28" "0000461901" "00005472" "50" "115" "10" "115" "10" "c.115+10G>T" "r.spl" "p.(=)" "2i" "0000461902" "00005472" "50" "2749" "0" "2749" "0" "c.2749G>A" "r.(?)" "p.(Val917Met)" "28" "0000461903" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl" "p.?" "25i" "0000461904" "00005472" "50" "2950" "0" "2950" "0" "c.2950G>A" "r.(?)" "p.(Val984Met)" "28" "0000461905" "00005472" "50" "1130" "0" "1130" "0" "c.1130G>A" "r.(?)" "p.(Arg377His)" "13" "0000461906" "00005472" "50" "1333" "-10" "1333" "-10" "c.1333-10C>G" "r.spl" "p.(=)" "15i" "0000461907" "00005472" "50" "1348" "0" "1348" "0" "c.1348G>C" "r.(?)" "p.(Glu450Gln)" "16" "0000461908" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000461909" "00005472" "50" "2197" "0" "2197" "0" "c.2197G>A" "r.(?)" "p.(Gly733Arg)" "26" "0000461910" "00005472" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264His)" "5" "0000461911" "00005472" "90" "1054" "-2" "1054" "-2" "c.1054-2A>G" "r.spl" "p.?" "11i" "0000461912" "00005472" "50" "2435" "0" "2435" "0" "c.2435T>C" "r.(?)" "p.(Val812Ala)" "27" "0000461913" "00005472" "50" "1346" "0" "1346" "0" "c.1346C>G" "r.(?)" "p.(Pro449Arg)" "16" "0000461914" "00005472" "50" "2182" "0" "2182" "0" "c.2182G>A" "r.(?)" "p.(Val728Met)" "26" "0000461915" "00005472" "50" "1333" "-10" "1333" "-10" "c.1333-10C>G" "r.spl" "p.(=)" "15i" "0000461916" "00005472" "50" "2748" "0" "2748" "0" "c.2748C>A" "r.(?)" "p.(His916Gln)" "28" "0000461917" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl?" "p.?" "25i" "0000461918" "00005472" "50" "1336" "0" "1336" "0" "c.1336G>A" "r.(?)" "p.(Asp446Asn)" "16" "0000461919" "00005472" "50" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Val190Met)" "3" "0000461920" "00005472" "50" "596" "0" "596" "0" "c.596A>G" "r.(?)" "p.(Gln199Arg)" "3" "0000461921" "00005472" "50" "229" "0" "229" "0" "c.229T>C" "r.(?)" "p.(Phe77Leu)" "3" "0000461922" "00005472" "50" "2243" "0" "2243" "0" "c.2243G>A" "r.(?)" "p.(Cys748Tyr)" "26" "0000461923" "00005472" "50" "2702" "0" "2722" "0" "c.2702_2722del" "r.(?)" "p.(Ile901_Thr907del)" "28" "0000461924" "00005472" "50" "2798" "0" "2798" "0" "c.2798G>A" "r.(?)" "p.(Arg933His)" "28" "0000461925" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000461926" "00005472" "50" "3046" "0" "3046" "0" "c.3046C>T" "r.(?)" "p.(Arg1016Cys)" "28" "0000461927" "00005472" "50" "2937" "0" "2937" "0" "c.2937C>T" "r.(?)" "p.(=)" "28" "0000461928" "00005472" "50" "115" "6" "115" "6" "c.115+6del" "r.(?)" "p.(?)" "2i" "0000461929" "00005472" "70" "848" "0" "848" "0" "c.848G>A" "r.(?)" "p.(Gly283Glu)" "6" "0000461930" "00005472" "50" "493" "0" "493" "0" "c.493G>A" "r.(?)" "p.(Val165Ile)" "3" "0000461931" "00005472" "50" "2929" "0" "2929" "0" "c.2929G>A" "r.(?)" "p.(Gly977Ser)" "28" "0000461932" "00005472" "50" "2605" "0" "2605" "0" "c.2605G>T" "r.(?)" "p.(Asp869Tyr)" "28" "0000461933" "00005472" "50" "2935" "0" "2935" "0" "c.2935G>A" "r.(?)" "p.(Asp979Asn)" "28" "0000461934" "00005472" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264His)" "5" "0000461935" "00005472" "50" "2894" "0" "2894" "0" "c.2894G>C" "r.(?)" "p.(Arg965Pro)" "28" "0000461936" "00005472" "50" "3025" "0" "3025" "0" "c.3025G>A" "r.(?)" "p.(Gly1009Ser)" "28" "0000461937" "00005472" "50" "2661" "0" "2661" "0" "c.2661G>A" "r.(?)" "p.(=)" "28" "0000461938" "00005472" "50" "1070" "0" "1070" "0" "c.1070C>G" "r.(?)" "p.(Pro357Arg)" "12" "0000461939" "00005472" "50" "2748" "0" "2748" "0" "c.2748C>T" "r.(?)" "p.(=)" "28" "0000461940" "00005472" "50" "94" "0" "94" "0" "c.94G>A" "r.(?)" "p.(Glu32Lys)" "2" "0000461941" "00005472" "50" "1720" "0" "1720" "0" "c.1720G>C" "r.(?)" "p.(Val574Leu)" "22" "0000461942" "00005472" "50" "2582" "0" "2582" "0" "c.2582G>A" "r.(?)" "p.(Arg861Gln)" "28" "0000461943" "00005472" "90" "796" "0" "801" "6" "c.796_801+6del" "r.spl" "p.?" "5_5i" "0000461944" "00005472" "50" "2567" "0" "2567" "0" "c.2567T>C" "r.(?)" "p.(Val856Ala)" "28" "0000461945" "00005472" "50" "2879" "0" "2879" "0" "c.2879C>T" "r.(?)" "p.(Ser960Leu)" "28" "0000461946" "00005472" "50" "22" "0" "22" "0" "c.22G>A" "r.(?)" "p.(Val8Met)" "2" "0000461947" "00005472" "50" "1606" "0" "1606" "0" "c.1606G>A" "r.(?)" "p.(Glu536Lys)" "20" "0000461948" "00005472" "50" "2995" "0" "2995" "0" "c.2995G>A" "r.(?)" "p.(Glu999Lys)" "28" "0000461949" "00005472" "50" "2182" "0" "2184" "0" "c.2182_2184delinsATA" "r.(?)" "p.(Val728Ile)" "26" "0000461950" "00005472" "50" "2882" "0" "2882" "0" "c.2882C>T" "r.(?)" "p.(Ala961Val)" "28" "0000461951" "00005472" "50" "386" "0" "386" "0" "c.386G>A" "r.(?)" "p.(Arg129His)" "3" "0000461952" "00005472" "50" "1277" "0" "1291" "0" "c.1277_1291del" "r.(?)" "p.(Arg426_Gly430del)" "15" "0000461953" "00005472" "50" "2960" "0" "2960" "0" "c.2960C>T" "r.(?)" "p.(Thr987Met)" "28" "0000461954" "00005472" "50" "1493" "0" "1493" "0" "c.1493G>A" "r.(?)" "p.(Arg498His)" "18" "0000461955" "00005472" "50" "3025" "0" "3025" "0" "c.3025G>A" "r.(?)" "p.(Gly1009Ser)" "28" "0000461956" "00005472" "50" "1762" "0" "1762" "0" "c.1762G>A" "r.(?)" "p.(Gly588Ser)" "23" "0000461957" "00005472" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264His)" "5" "0000461958" "00005472" "50" "3034" "0" "3034" "0" "c.3034G>A" "r.(?)" "p.(Asp1012Asn)" "28" "0000461959" "00005472" "50" "1269" "0" "1269" "0" "c.1269G>A" "r.(?)" "p.(=)" "14" "0000461960" "00005472" "50" "2244" "0" "2244" "0" "c.2244C>T" "r.(?)" "p.(=)" "26" "0000461961" "00005472" "50" "2880" "0" "2880" "0" "c.2880G>A" "r.(?)" "p.(=)" "28" "0000461962" "00005472" "50" "2687" "0" "2687" "0" "c.2687A>C" "r.(?)" "p.(His896Pro)" "28" "0000461963" "00005472" "90" "1000" "-2" "1000" "-1" "c.1000-2_1000-1inv" "r.spl" "p.?" "10i" "0000461964" "00005472" "50" "1606" "0" "1606" "0" "c.1606G>A" "r.(?)" "p.(Glu536Lys)" "20" "0000461965" "00005472" "50" "1336" "0" "1336" "0" "c.1336G>C" "r.(?)" "p.(Asp446His)" "16" "0000461966" "00005472" "50" "933" "0" "933" "0" "c.933A>T" "r.(?)" "p.(Glu311Asp)" "9" "0000461967" "00005472" "50" "1403" "0" "1403" "0" "c.1403G>T" "r.(?)" "p.(Arg468Leu)" "17" "0000461968" "00005472" "50" "2894" "0" "2894" "0" "c.2894G>C" "r.(?)" "p.(Arg965Pro)" "28" "0000461969" "00005472" "50" "167" "0" "167" "0" "c.167G>A" "r.(?)" "p.(Ser56Asn)" "3" "0000461970" "00005472" "50" "1585" "0" "1585" "0" "c.1585G>A" "r.(?)" "p.(Glu529Lys)" "20" "0000461971" "00005472" "50" "2798" "0" "2798" "0" "c.2798G>A" "r.(?)" "p.(Arg933His)" "28" "0000461972" "00005472" "90" "1861" "0" "1861" "0" "c.1861G>A" "r.(?)" "p.(Asp621Asn)" "25" "0000461973" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000461974" "00005472" "50" "988" "0" "988" "0" "c.988G>A" "r.(?)" "p.(Asp330Asn)" "10" "0000461975" "00005472" "50" "2711" "0" "2711" "0" "c.2711C>T" "r.(?)" "p.(Ala904Val)" "28" "0000461976" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000461977" "00005472" "50" "988" "0" "988" "0" "c.988G>A" "r.(?)" "p.(Asp330Asn)" "10" "0000461978" "00005472" "50" "181" "0" "181" "0" "c.181T>C" "r.(?)" "p.(Ser61Pro)" "3" "0000461979" "00005472" "50" "628" "0" "628" "0" "c.628G>A" "r.(?)" "p.(Glu210Lys)" "3" "0000461980" "00005472" "50" "2129" "0" "2129" "0" "c.2129C>A" "r.(?)" "p.(Ala710Asp)" "26" "0000461981" "00005472" "90" "1861" "0" "1861" "0" "c.1861G>A" "r.(?)" "p.(Asp621Asn)" "25" "0000461982" "00005472" "50" "1151" "0" "1151" "0" "c.1151C>T" "r.(?)" "p.(Pro384Leu)" "13" "0000461983" "00005472" "50" "1606" "0" "1606" "0" "c.1606G>A" "r.(?)" "p.(Glu536Lys)" "20" "0000461984" "00005472" "50" "2608" "0" "2608" "0" "c.2608G>A" "r.(?)" "p.(Asp870Asn)" "28" "0000461985" "00005472" "90" "1180" "-1" "1180" "-1" "c.1180-1G>C" "r.spl" "p.?" "13i" "0000461986" "00005472" "90" "2611" "0" "2611" "0" "c.2611G>A" "r.(?)" "p.(Asp871Asn)" "28" "0000461987" "00005472" "90" "830" "0" "830" "0" "c.830del" "r.(?)" "p.(Gly277Glufs*131)" "6" "0000461988" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "3" "0000461989" "00005472" "90" "1861" "0" "1861" "0" "c.1861G>A" "r.(?)" "p.(Asp621Asn)" "25" "0000461990" "00005472" "90" "900" "1" "900" "1" "c.900+1G>A" "r.spl" "p.?" "7i" "0000461991" "00005472" "50" "1770" "0" "1770" "0" "c.1770G>A" "r.(?)" "p.(=)" "23" "0000461992" "00005472" "50" "605" "0" "605" "0" "c.605G>A" "r.(?)" "p.(Arg202Gln)" "3" "0000461993" "00005472" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264His)" "5" "0000461994" "00005472" "90" "1561" "0" "1561" "0" "c.1561C>T" "r.(?)" "p.(Arg521*)" "19" "0000461995" "00005472" "50" "1405" "0" "1405" "0" "c.1405G>A" "r.(?)" "p.(Gly469Ser)" "17" "0000461996" "00005472" "50" "2410" "0" "2410" "0" "c.2410G>A" "r.(?)" "p.(Val804Ile)" "26" "0000461997" "00005472" "90" "1751" "0" "1751" "0" "c.1751del" "r.(?)" "p.(Pro584Leufs*12)" "23" "0000461998" "00005472" "50" "2351" "0" "2351" "0" "c.2351G>C" "r.(?)" "p.(Arg784Pro)" "26" "0000461999" "00005472" "50" "2489" "0" "2489" "0" "c.2489G>A" "r.(?)" "p.(Arg830Gln)" "28" "0000462000" "00005472" "50" "3029" "0" "3029" "0" "c.3029T>G" "r.(?)" "p.(Phe1010Cys)" "28" "0000462001" "00005472" "50" "2998" "0" "3000" "0" "c.2998_3000del" "r.(?)" "p.(Lys1000del)" "" "0000571016" "00005472" "50" "289" "0" "289" "0" "c.289G>A" "r.(?)" "p.(Gly97Ser)" "" "0000571017" "00005472" "30" "316" "0" "316" "0" "c.316G>A" "r.(?)" "p.(Glu106Lys)" "" "0000571019" "00005472" "30" "510" "0" "510" "0" "c.510C>T" "r.(?)" "p.(Cys170=)" "" "0000571020" "00005472" "30" "643" "0" "643" "0" "c.643G>A" "r.(?)" "p.(Asp215Asn)" "" "0000571021" "00005472" "30" "714" "10" "714" "10" "c.714+10G>A" "r.(=)" "p.(=)" "" "0000571023" "00005472" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264His)" "" "0000571024" "00005472" "50" "868" "0" "868" "0" "c.868A>T" "r.(?)" "p.(Ile290Phe)" "" "0000571025" "00005472" "50" "1130" "0" "1130" "0" "c.1130G>A" "r.(?)" "p.(Arg377His)" "" "0000571026" "00005472" "30" "1161" "0" "1161" "0" "c.1161C>T" "r.(?)" "p.(Ile387=)" "" "0000571027" "00005472" "30" "1333" "-10" "1333" "-10" "c.1333-10C>G" "r.(=)" "p.(=)" "" "0000571028" "00005472" "50" "1336" "0" "1336" "0" "c.1336G>A" "r.(?)" "p.(Asp446Asn)" "" "0000571029" "00005472" "30" "1437" "0" "1437" "0" "c.1437T>C" "r.(?)" "p.(Ala479=)" "" "0000571030" "00005472" "30" "1466" "0" "1466" "0" "c.1466G>A" "r.(?)" "p.(Arg489Gln)" "" "0000571031" "00005472" "30" "1560" "0" "1560" "0" "c.1560C>G" "r.(?)" "p.(Pro520=)" "" "0000571032" "00005472" "50" "1732" "0" "1732" "0" "c.1732G>A" "r.(?)" "p.(Glu578Lys)" "" "0000571033" "00005472" "30" "1769" "0" "1769" "0" "c.1769C>T" "r.(?)" "p.(Thr590Met)" "" "0000571034" "00005472" "10" "1817" "-3" "1817" "-3" "c.1817-3dup" "r.spl?" "p.?" "" "0000571035" "00005472" "30" "1836" "0" "1836" "0" "c.1836C>T" "r.(?)" "p.(Gly612=)" "" "0000571036" "00005472" "30" "1945" "0" "1945" "0" "c.1945G>A" "r.(?)" "p.(Ala649Thr)" "" "0000571038" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl?" "p.?" "" "0000571039" "00005472" "10" "2160" "0" "2160" "0" "c.2160C>G" "r.(?)" "p.(Arg720=)" "" "0000571041" "00005472" "50" "2197" "0" "2197" "0" "c.2197G>A" "r.(?)" "p.(Gly733Arg)" "" "0000571043" "00005472" "10" "2351" "0" "2351" "0" "c.2351G>A" "r.(?)" "p.(Arg784His)" "" "0000571044" "00005472" "30" "2351" "0" "2351" "0" "c.2351G>A" "r.(?)" "p.(Arg784His)" "" "0000571045" "00005472" "30" "2423" "-18" "2423" "-17" "c.2423-18_2423-17insCGGCCCGGCCCGGCC" "r.(=)" "p.(=)" "" "0000571046" "00005472" "50" "2423" "-2" "2423" "-2" "c.2423-2A>G" "r.spl?" "p.?" "" "0000571047" "00005472" "30" "2462" "-2628" "2462" "-2628" "c.2462-2628G>A" "r.(=)" "p.(=)" "" "0000571048" "00005472" "30" "2462" "-2478" "2462" "-2478" "c.2462-2478G>A" "r.(=)" "p.(=)" "" "0000571049" "00005472" "10" "2462" "-2239" "2462" "-2239" "c.2462-2239T>A" "r.(=)" "p.(=)" "" "0000571052" "00005472" "50" "2488" "0" "2488" "0" "c.2488C>T" "r.(?)" "p.(Arg830Trp)" "" "0000571054" "00005472" "30" "2524" "0" "2524" "0" "c.2524G>A" "r.(?)" "p.(Glu842Lys)" "" "0000571056" "00005472" "30" "2558" "0" "2558" "0" "c.2558G>A" "r.(?)" "p.(Arg853Gln)" "" "0000571058" "00005472" "50" "2575" "0" "2575" "0" "c.2575G>A" "r.(?)" "p.(Val859Met)" "" "0000571062" "00005472" "30" "2628" "0" "2628" "0" "c.2628C>T" "r.(?)" "p.(Arg876=)" "" "0000571063" "00005472" "30" "2748" "0" "2748" "0" "c.2748C>A" "r.(?)" "p.(His916Gln)" "" "0000571065" "00005472" "30" "2795" "0" "2795" "0" "c.2795C>T" "r.(?)" "p.(Pro932Leu)" "" "0000571066" "00005472" "50" "2855" "0" "2855" "0" "c.2855C>T" "r.(?)" "p.(Thr952Met)" "" "0000571067" "00005472" "30" "2856" "0" "2856" "0" "c.2856G>A" "r.(?)" "p.(Thr952=)" "" "0000571068" "00005472" "30" "2985" "0" "2985" "0" "c.2985C>T" "r.(?)" "p.(Ala995=)" "" "0000595741" "00005472" "90" "1861" "0" "1861" "0" "c.1861G>A" "r.(?)" "p.(Asp621Asn)" "" "0000597308" "00005472" "90" "1975" "0" "1975" "0" "c.1975C>T" "r.(?)" "p.(Arg659Cys)" "" "0000597309" "00005472" "90" "1975" "0" "1975" "0" "c.1975C>T" "r.(?)" "p.(Arg659Cys)" "" "0000597310" "00005472" "50" "1858" "0" "1860" "0" "c.1858_1860del" "r.(?)" "p.(Ile620del)" "" "0000618418" "00005472" "50" "1521" "4" "1521" "4" "c.1521+4C>T" "r.spl?" "p.?" "" "0000618419" "00005472" "70" "1817" "-3" "1817" "-3" "c.1817-3C>G" "r.spl?" "p.?" "" "0000618420" "00005472" "50" "2018" "0" "2018" "0" "c.2018C>A" "r.(?)" "p.(Ala673Asp)" "" "0000618422" "00005472" "30" "2461" "2682" "2461" "2682" "c.2461+2682C>T" "r.(=)" "p.(=)" "" "0000618423" "00005472" "30" "2462" "-2570" "2462" "-2570" "c.2462-2570G>A" "r.(=)" "p.(=)" "" "0000618424" "00005472" "30" "2484" "0" "2484" "0" "c.2484G>T" "r.(?)" "p.(Thr828=)" "" "0000618425" "00005472" "50" "2599" "0" "2599" "0" "c.2599C>T" "r.(?)" "p.(Arg867Trp)" "" "0000629570" "00005472" "70" "856" "-1" "856" "-1" "c.856-1G>C" "r.spl" "p.?" "" "0000646778" "00005472" "50" "1358" "0" "1358" "0" "c.1358G>A" "r.(?)" "p.(Arg453His)" "" "0000646805" "00005472" "50" "1336" "0" "1336" "0" "c.1336G>A" "r.(?)" "p.(Asp446Asn)" "" "0000646819" "00005472" "50" "503" "0" "503" "0" "c.503G>T" "r.(?)" "p.(Ser168Ile)" "" "0000650891" "00005472" "30" "116" "-34" "116" "-34" "c.116-34G>A" "r.(=)" "p.(=)" "" "0000650892" "00005472" "30" "679" "0" "679" "0" "c.679G>A" "r.(?)" "p.(Asp227Asn)" "" "0000650893" "00005472" "30" "714" "9" "714" "9" "c.714+9C>T" "r.(=)" "p.(=)" "" "0000650894" "00005472" "50" "730" "0" "730" "0" "c.730G>A" "r.(?)" "p.(Gly244Arg)" "" "0000650895" "00005472" "50" "1493" "0" "1493" "0" "c.1493G>A" "r.(?)" "p.(Arg498His)" "" "0000650896" "00005472" "50" "1585" "0" "1585" "0" "c.1585G>A" "r.(?)" "p.(Glu529Lys)" "" "0000650897" "00005472" "30" "1706" "0" "1706" "0" "c.1706G>A" "r.(?)" "p.(Arg569Gln)" "" "0000650898" "00005472" "50" "1769" "0" "1769" "0" "c.1769C>T" "r.(?)" "p.(Thr590Met)" "" "0000650900" "00005472" "50" "2489" "0" "2489" "0" "c.2489G>A" "r.(?)" "p.(Arg830Gln)" "" "0000650901" "00005472" "30" "2503" "0" "2503" "0" "c.2503G>A" "r.(?)" "p.(Val835Ile)" "" "0000650902" "00005472" "30" "2558" "0" "2558" "0" "c.2558G>A" "r.(?)" "p.(Arg853Gln)" "" "0000650903" "00005472" "50" "2795" "0" "2795" "0" "c.2795C>T" "r.(?)" "p.(Pro932Leu)" "" "0000650904" "00005472" "50" "2960" "0" "2960" "0" "c.2960C>T" "r.(?)" "p.(Thr987Met)" "" "0000650905" "00005472" "30" "2983" "0" "2983" "0" "c.2983G>A" "r.(?)" "p.(Ala995Thr)" "" "0000653047" "00005472" "50" "2002" "0" "2002" "0" "c.2002G>A" "r.(?)" "p.(Glu668Lys)" "" "0000658859" "00005472" "70" "821" "0" "821" "0" "c.821G>A" "r.(?)" "p.(Gly274Asp)" "" "0000660443" "00005472" "90" "1861" "0" "1861" "0" "c.1861G>A" "r.(?)" "p.(Asp621Asn)" "" "0000660689" "00005472" "50" "2098" "0" "2098" "0" "c.2098G>A" "r.(?)" "p.(Gly700Ser)" "" "0000669699" "00005472" "30" "714" "9" "714" "9" "c.714+9C>T" "r.(=)" "p.(=)" "" "0000669700" "00005472" "30" "2558" "0" "2558" "0" "c.2558G>A" "r.(?)" "p.(Arg853Gln)" "" "0000670723" "00005472" "90" "1745" "0" "1745" "0" "c.1745G>A" "r.(?)" "p.(Gly582Asp)" "" "0000670800" "00005472" "90" "13" "0" "25" "0" "c.13_25del" "r.(?)" "p.(Thr5Serfs*62)" "" "0000670889" "00005472" "90" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Glu600Lys)" "" "0000681753" "00005472" "50" "664" "0" "664" "0" "c.664G>A" "r.(?)" "p.(Asp222Asn)" "" "0000681754" "00005472" "50" "1288" "0" "1288" "0" "c.1288G>A" "r.(?)" "p.(Gly430Ser)" "" "0000681755" "00005472" "30" "1560" "0" "1560" "0" "c.1560C>G" "r.(?)" "p.(Pro520=)" "" "0000681756" "00005472" "50" "2155" "0" "2155" "0" "c.2155C>T" "r.(?)" "p.(Arg719Trp)" "" "0000681757" "00005472" "30" "2170" "0" "2170" "0" "c.2170C>T" "r.(?)" "p.(Arg724Cys)" "" "0000681758" "00005472" "50" "2843" "0" "2843" "0" "c.2843C>T" "r.(?)" "p.(Thr948Met)" "" "0000683632" "00005472" "50" "2425" "0" "2425" "0" "c.2425C>T" "r.(?)" "p.(Pro809Ser)" "" "0000693078" "00005472" "50" "472" "0" "472" "0" "c.472G>A" "r.(?)" "p.(Val158Met)" "" "0000693079" "00005472" "30" "2136" "0" "2136" "0" "c.2136C>T" "r.(?)" "p.(Asp712=)" "" "0000693080" "00005472" "30" "2886" "0" "2886" "0" "c.2886C>T" "r.(?)" "p.(His962=)" "" "0000697417" "00005472" "70" "955" "-3" "955" "-3" "c.955-3C>G" "r.spl?" "p.?" "" "0000697418" "00005472" "70" "2192" "0" "2192" "0" "c.2192C>T" "r.(?)" "p.(Thr731Met)" "" "0000697419" "00005472" "70" "2599" "0" "2599" "0" "c.2599C>T" "r.(?)" "p.(Arg867Trp)" "" "0000697420" "00005472" "70" "388" "0" "388" "0" "c.388C>T" "r.(?)" "p.(Arg130Cys)" "" "0000697421" "00005472" "70" "801" "1" "801" "1" "c.801+1del" "r.spl" "p.?" "" "0000697422" "00005472" "70" "802" "0" "802" "0" "c.802G>T" "r.(?)" "p.(Gly268Cys)" "" "0000697423" "00005472" "70" "893" "0" "893" "0" "c.893G>T" "r.(?)" "p.(Gly298Val)" "" "0000697424" "00005472" "70" "1179" "2" "1179" "2" "c.1179+2T>G" "r.spl" "p.?" "" "0000697425" "00005472" "70" "1252" "0" "1252" "0" "c.1252G>A" "r.(?)" "p.(Gly418Arg)" "" "0000697426" "00005472" "70" "1769" "0" "1769" "0" "c.1769C>T" "r.(?)" "p.(Thr590Met)" "" "0000697427" "00005472" "70" "1865" "0" "1865" "0" "c.1865G>A" "r.(?)" "p.(Ser622Asn)" "" "0000697428" "00005472" "70" "1940" "0" "1940" "0" "c.1940C>G" "r.(?)" "p.(Ala647Gly)" "" "0000697429" "00005472" "70" "1970" "-2" "1970" "-2" "c.1970-2A>G" "r.spl" "p.?" "" "0000697430" "00005472" "70" "1975" "0" "1975" "0" "c.1975C>T" "r.(?)" "p.(Arg659Cys)" "" "0000697431" "00005472" "70" "2098" "0" "2098" "0" "c.2098G>A" "r.(?)" "p.(Gly700Ser)" "" "0000697432" "00005472" "70" "2276" "0" "2276" "0" "c.2276T>C" "r.(?)" "p.(Ile759Thr)" "" "0000697433" "00005472" "70" "2416" "0" "2416" "0" "c.2416T>C" "r.(?)" "p.(Cys806Arg)" "" "0000697434" "00005472" "70" "2422" "7" "2422" "7" "c.2422+7G>T" "r.spl?" "p.?" "" "0000697435" "00005472" "70" "2462" "-2585" "2462" "-2585" "c.2462-2585G>A" "r.?" "p.?" "" "0000697436" "00005472" "70" "2818" "0" "2818" "0" "c.2818G>C" "r.(?)" "p.(Ala940Pro)" "" "0000712634" "00005472" "70" "2830" "0" "2832" "0" "c.2830_2832del" "r.(?)" "p.(Phe944del)" "" "0000727982" "00005472" "50" "202" "0" "202" "0" "c.202T>C" "r.(?)" "p.(Phe68Leu)" "" "0000727983" "00005472" "30" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "" "0000727984" "00005472" "50" "542" "0" "542" "0" "c.542G>A" "r.(?)" "p.(Arg181His)" "" "0000727985" "00005472" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264His)" "" "0000727986" "00005472" "50" "1180" "0" "1180" "0" "c.1180G>T" "r.(?)" "p.(Gly394Trp)" "" "0000727987" "00005472" "30" "1269" "0" "1269" "0" "c.1269G>A" "r.(?)" "p.(Pro423=)" "" "0000727988" "00005472" "50" "1769" "0" "1769" "0" "c.1769C>T" "r.(?)" "p.(Thr590Met)" "" "0000727989" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.(=)" "p.(=)" "" "0000727990" "00005472" "50" "2197" "0" "2197" "0" "c.2197G>A" "r.(?)" "p.(Gly733Arg)" "" "0000727991" "00005472" "50" "2233" "0" "2233" "0" "c.2233C>T" "r.(?)" "p.(Arg745Trp)" "" "0000727992" "00005472" "30" "2331" "0" "2331" "0" "c.2331C>T" "r.(?)" "p.(Cys777=)" "" "0000727993" "00005472" "50" "2488" "0" "2488" "0" "c.2488C>T" "r.(?)" "p.(Arg830Trp)" "" "0000727994" "00005472" "50" "2570" "0" "2581" "0" "c.2570_2581dup" "r.(?)" "p.(Ala860_Arg861insGlnGlnValAla)" "" "0000727995" "00005472" "50" "2591" "0" "2591" "0" "c.2591C>A" "r.(?)" "p.(Thr864Lys)" "" "0000727996" "00005472" "50" "2785" "0" "2785" "0" "c.2785G>A" "r.(?)" "p.(Val929Met)" "" "0000727997" "00005472" "50" "2935" "0" "2935" "0" "c.2935G>A" "r.(?)" "p.(Asp979Asn)" "" "0000735979" "00005472" "70" "2197" "0" "2197" "0" "c.2197G>A" "r.(?)" "p.(Gly733Arg)" "26" "0000763683" "00005472" "90" "2657" "0" "2679" "0" "c.2657_2679del" "r.(?)" "p.(Gly886Alafs*99)" "" "0000763692" "00005472" "50" "628" "0" "628" "0" "c.628G>A" "r.(?)" "p.(Glu210Lys)" "" "0000786825" "00005472" "70" "38" "0" "38" "0" "c.38del" "r.(?)" "p.(Gly13GlufsTer58)" "2" "0000786826" "00005472" "90" "310" "0" "310" "0" "c.310C>T" "r.(?)" "p.(Gln104Ter)" "3" "0000786827" "00005472" "70" "875" "0" "875" "0" "c.875G>T" "r.(?)" "p.(Gly292Val)" "7" "0000786828" "00005472" "70" "1270" "-4" "1273" "0" "c.1270-4_1273dup" "r.(?)" "p.(Asp428AlafsTer120)" "15" "0000787246" "00005472" "50" "1489" "0" "1489" "0" "c.1489C>T" "r.(?)" "p.(Pro497Ser)" "18" "0000787247" "00005472" "50" "2065" "0" "2065" "0" "c.2065G>A" "r.(?)" "p.(Glu689Lys)" "26" "0000787463" "00005472" "50" "1312" "0" "1312" "0" "c.1312G>A" "r.(?)" "p.(Asp438Asn)" "15" "0000787464" "00005472" "70" "2865" "0" "2866" "0" "c.2865_2866del" "r.(?)" "p.(Asp955GlufsTer37)" "28" "0000787547" "00005472" "50" "2395" "0" "2395" "0" "c.2395G>A" "r.(?)" "p.(Asp799Asn)" "26" "0000809440" "00005472" "30" "1466" "0" "1466" "0" "c.1466G>A" "r.(?)" "p.(Arg489Gln)" "" "0000809441" "00005472" "30" "1614" "0" "1614" "0" "c.1614C>T" "r.(?)" "p.(Gly538=)" "" "0000809442" "00005472" "30" "1969" "4" "1969" "4" "c.1969+4A>C" "r.spl?" "p.?" "" "0000809443" "00005472" "50" "2182" "0" "2182" "0" "c.2182G>A" "r.(?)" "p.(Val728Met)" "" "0000809444" "00005472" "30" "7789" "0" "7789" "0" "c.*4729G>A" "r.(=)" "p.(=)" "" "0000819182" "00005472" "90" "857" "0" "857" "0" "c.857G>A" "r.(?)" "p.(Gly286Glu)" "" "0000819212" "00005472" "50" "1591" "0" "1591" "0" "c.1591G>A" "r.(?)" "p.(Gly531Ser)" "" "0000819213" "00005472" "50" "1900" "0" "1900" "0" "c.1900G>A" "r.(?)" "p.(Glu634Lys)" "" "0000819262" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.?" "" "0000819263" "00005472" "50" "1970" "-2" "1970" "-2" "c.1970-2A>G" "r.spl" "p.?" "" "0000823912" "00005472" "90" "2486" "0" "2486" "0" "c.2486del" "r.(?)" "p.(Gln829ArgfsTer35)" "28" "0000823914" "00005472" "70" "2611" "0" "2611" "0" "c.2611G>A" "r.(?)" "p.(Asp871Asn)" "28" "0000831194" "00005472" "70" "874" "0" "874" "0" "c.874G>A" "r.(?)" "p.(Gly292Ser)" "7" "0000831316" "00005472" "50" "1012" "0" "1012" "0" "c.1012C>T" "r.(?)" "p.(Arg338Cys)" "11" "0000831337" "00005472" "90" "736" "-1" "736" "-1" "c.736-1G>A" "r.spl" "p.(Cys246_Lys267del)" "4i" "0000831338" "00005472" "90" "812" "0" "812" "0" "c.812G>A" "r.(?)" "p.(Gly271Asp)" "6" "0000831339" "00005472" "70" "857" "0" "857" "0" "c.857G>A" "r.(?)" "p.(Gly286Glu)" "7" "0000831340" "00005472" "70" "874" "0" "874" "0" "c.874G>A" "r.(?)" "p.(Gly292Ser)" "7" "0000831341" "00005472" "90" "875" "0" "875" "0" "c.875G>A" "r.(?)" "p.(Gly292Asp)" "7" "0000831342" "00005472" "90" "900" "1" "900" "1" "c.900+1G>A" "r.spl" "p.?" "8i" "0000831343" "00005472" "70" "927" "3" "927" "4" "c.927+3_927+4insA" "r.spl" "p.?" "9i" "0000831344" "00005472" "90" "955" "-2" "955" "-1" "c.955-2_955-1del" "r.spl" "p.(Gly319_Lys333del)" "9i" "0000831345" "00005472" "70" "928" "-1" "928" "-1" "c.928-1G>T" "r.spl" "p.?" "8i" "0000831346" "00005472" "90" "1096" "0" "1096" "0" "c.1096C>T" "r.(?)" "p.(Arg366Ter)" "12" "0000831347" "00005472" "90" "1402" "0" "1402" "0" "c.1402C>T" "r.(?)" "p.(Arg468Ter)" "17" "0000831348" "00005472" "70" "1495" "0" "1495" "0" "c.1495G>A" "r.(?)" "p.(Gly499Arg)" "18" "0000831349" "00005472" "90" "1402" "0" "1402" "0" "c.1402C>T" "r.(?)" "p.(Arg468Ter)" "17" "0000831350" "00005472" "90" "1616" "0" "1616" "0" "c.1616G>A" "r.(?)" "p.(Arg539Gln)" "21" "0000831351" "00005472" "70" "1645" "0" "1652" "0" "c.1645_1652del" "r.(?)" "p.(Gly549ArgfsTer14)" "21" "0000831352" "00005472" "70" "1816" "0" "1816" "0" "c.1816G>C" "r.(?)" "p.(Asp606His)" "24" "0000831353" "00005472" "70" "2462" "-3" "2462" "-3" "c.2462-3C>A" "r.spl" "p.?" "27i" "0000831354" "00005472" "90" "2548" "0" "2550" "0" "c.2548_2550del" "r.(?)" "p.(His850del)" "28" "0000831355" "00005472" "90" "2611" "0" "2611" "0" "c.2611G>A" "r.(?)" "p.(Asp871Asn)" "28" "0000831382" "00005472" "70" "214" "0" "214" "0" "c.214C>T" "r.(?)" "p.(Gln72Ter)" "3" "0000831384" "00005472" "90" "2930" "0" "2941" "0" "c.2930_2941del" "r.(?)" "p.(Gly977_Val980del)" "28" "0000831385" "00005472" "70" "2133" "0" "2133" "0" "c.2133C>G" "r.(?)" "p.(Tyr711Ter)" "26" "0000831386" "00005472" "70" "1970" "-1" "1970" "-1" "c.1970-1G>C" "r.spl" "p.?" "25i" "0000831387" "00005472" "70" "2643" "0" "2643" "0" "c.2643dup" "r.(?)" "p.(Phe882ValfsTer111)" "28" "0000831388" "00005472" "70" "3006" "0" "3006" "0" "c.3006T>G" "r.(?)" "p.(Tyr1002Ter)" "28" "0000831389" "00005472" "70" "2642" "0" "2642" "0" "c.2642del" "r.(?)" "p.(Gln881ArgfsTer14)" "28" "0000831391" "00005472" "70" "3005" "0" "3006" "0" "c.3005_3006del" "r.(?)" "p.(Tyr1002Ter)" "28" "0000831393" "00005472" "90" "2489" "0" "2489" "0" "c.2489G>A" "r.(?)" "p.(Arg830Gln)" "28" "0000833062" "00005472" "70" "901" "-2" "901" "-2" "c.901-2A>G" "r.spl" "p.?" "" "0000833123" "00005472" "70" "874" "0" "874" "0" "c.874G>A" "r.(?)" "p.(Gly292Ser)" "" "0000842401" "00005472" "50" "2633" "0" "2633" "0" "c.2633C>T" "r.(?)" "p.(Ala878Val)" "" "0000847991" "00005472" "90" "1117" "-2" "1117" "-2" "c.1117-2A>G" "r.1117_1179del" "p.Gly373_Lys393del" "12i" "0000847992" "00005472" "70" "2776" "0" "2784" "0" "c.2776_2784dup" "r.(?)" "p.(Asn926_Ile928dup)" "" "0000856033" "00005472" "50" "292" "0" "292" "0" "c.292G>A" "r.(?)" "p.(Gly98Ser)" "" "0000856034" "00005472" "30" "624" "0" "624" "0" "c.624G>T" "r.(?)" "p.(Pro208=)" "" "0000856035" "00005472" "50" "1117" "-7" "1117" "-7" "c.1117-7C>A" "r.(=)" "p.(=)" "" "0000856036" "00005472" "30" "1521" "5" "1521" "5" "c.1521+5G>A" "r.spl?" "p.?" "" "0000856037" "00005472" "50" "1606" "0" "1606" "0" "c.1606G>A" "r.(?)" "p.(Glu536Lys)" "" "0000856038" "00005472" "30" "1836" "0" "1836" "0" "c.1836C>T" "r.(?)" "p.(Gly612=)" "" "0000856039" "00005472" "50" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl?" "p.?" "" "0000856040" "00005472" "30" "1970" "-3" "1970" "-3" "c.1970-3C>A" "r.spl?" "p.?" "" "0000866682" "00005472" "30" "22" "0" "22" "0" "c.22G>A" "r.(?)" "p.(Val8Met)" "" "0000866683" "00005472" "30" "189" "0" "189" "0" "c.189G>A" "r.(?)" "p.(Thr63=)" "" "0000866684" "00005472" "10" "714" "9" "714" "9" "c.714+9C>T" "r.(=)" "p.(=)" "" "0000866685" "00005472" "30" "1333" "-10" "1333" "-10" "c.1333-10C>G" "r.(=)" "p.(=)" "" "0000866686" "00005472" "50" "2083" "0" "2083" "0" "c.2083G>A" "r.(?)" "p.(Glu695Lys)" "" "0000866687" "00005472" "50" "2102" "0" "2102" "0" "c.2102C>A" "r.(?)" "p.(Thr701Asn)" "" "0000866688" "00005472" "30" "2163" "0" "2163" "0" "c.2163G>A" "r.(?)" "p.(Gln721=)" "" "0000866689" "00005472" "30" "2331" "0" "2331" "0" "c.2331C>T" "r.(?)" "p.(Cys777=)" "" "0000866690" "00005472" "50" "2795" "0" "2795" "0" "c.2795C>T" "r.(?)" "p.(Pro932Leu)" "" "0000866691" "00005472" "30" "2871" "0" "2871" "0" "c.2871G>A" "r.(?)" "p.(Leu957=)" "" "0000866692" "00005472" "30" "2980" "0" "2980" "0" "c.2980G>A" "r.(?)" "p.(Ala994Thr)" "" "0000866693" "00005472" "30" "3043" "0" "3043" "0" "c.3043A>C" "r.(?)" "p.(Ile1015Leu)" "" "0000866694" "00005472" "50" "7489" "0" "7489" "0" "c.*4429G>A" "r.(=)" "p.(=)" "" "0000869942" "00005472" "90" "2423" "-22" "2423" "-21" "c.2423-22_2423-21insAGCCCGGCCCGGCCC" "r.[2423_2461del,2422_2423inscccggcccggcccggccucucuccucucuuccag,2422_2423ins[2422+1_2423-22;agcccggcccggccc;2423-21_2423-1]]" "p.[Asp808_Thr820del,Asp808Alafs*51,Asp808Glyfs*20]" "26i" "0000877886" "00005472" "70" "893" "0" "893" "0" "c.893G>A" "r.(?)" "p.(Gly298Glu)" "" "0000877887" "00005472" "90" "893" "0" "893" "0" "c.893G>A" "r.(?)" "p.(Gly298Glu)" "" "0000879759" "00005472" "50" "2960" "0" "2960" "0" "c.2960C>T" "r.(?)" "p.(Thr987Met)" "" "0000881865" "00005472" "90" "1660" "0" "1668" "0" "c.1660_1668del" "r.(?)" "p.(Lys554_Glu556del)" "21" "0000895539" "00005472" "50" "568" "0" "568" "0" "c.568G>A" "r.(?)" "p.(Val190Met)" "" "0000895540" "00005472" "50" "638" "0" "638" "0" "c.638G>A" "r.(?)" "p.(Arg213His)" "" "0000895541" "00005472" "10" "714" "53" "714" "53" "c.714+53C>T" "r.(=)" "p.(=)" "" "0000895542" "00005472" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264His)" "" "0000895543" "00005472" "10" "1116" "32" "1116" "32" "c.1116+32G>A" "r.(=)" "p.(=)" "" "0000895544" "00005472" "10" "1395" "82" "1395" "82" "c.1395+82G>A" "r.(=)" "p.(=)" "" "0000895545" "00005472" "10" "1572" "148" "1572" "148" "c.1572+148C>T" "r.(=)" "p.(=)" "" "0000895546" "00005472" "10" "1672" "-111" "1672" "-111" "c.1672-111C>T" "r.(=)" "p.(=)" "" "0000895547" "00005472" "10" "1672" "-24" "1672" "-24" "c.1672-24C>G" "r.(=)" "p.(=)" "" "0000895548" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.(=)" "p.(=)" "" "0000895549" "00005472" "30" "2332" "0" "2332" "0" "c.2332G>A" "r.(?)" "p.(Asp778Asn)" "" "0000895550" "00005472" "30" "2351" "0" "2351" "0" "c.2351G>A" "r.(?)" "p.(Arg784His)" "" "0000895551" "00005472" "30" "2461" "2370" "2461" "2370" "c.2461+2370G>A" "r.(=)" "p.(=)" "" "0000895552" "00005472" "10" "2462" "-35" "2462" "-35" "c.2462-35C>T" "r.(=)" "p.(=)" "" "0000895553" "00005472" "30" "2683" "0" "2683" "0" "c.2683A>C" "r.(?)" "p.(Ser895Arg)" "" "0000895554" "00005472" "50" "2938" "0" "2938" "0" "c.2938G>A" "r.(?)" "p.(Val980Met)" "" "0000909338" "00005472" "90" "855" "1" "855" "1" "c.855+1G>A" "r.spl" "p.?" "" "0000915469" "00005472" "50" "228" "0" "228" "0" "c.228G>T" "r.(?)" "p.(Gln76His)" "" "0000915470" "00005472" "90" "595" "0" "595" "0" "c.595C>T" "r.(?)" "p.(Gln199*)" "" "0000915471" "00005472" "50" "2242" "0" "2242" "0" "c.2242T>C" "r.(?)" "p.(Cys748Arg)" "" "0000915472" "00005472" "30" "2607" "0" "2607" "0" "c.2607C>T" "r.(?)" "p.(Asp869=)" "" "0000917124" "00005472" "90" "2554" "0" "2554" "0" "c.2554C>T" "r.(?)" "p.(Gln852Ter)" "" "0000917174" "00005472" "50" "2371" "0" "2371" "0" "c.2371G>A" "r.(?)" "p.(Asp791Asn)" "" "0000920113" "00005472" "50" "1136" "0" "1136" "0" "c.1136G>A" "r.(?)" "p.(Gly379Glu)" "13" "0000927102" "00005472" "30" "2661" "0" "2661" "0" "c.2661G>A" "r.(?)" "p.(Glu887=)" "" "0000927103" "00005472" "50" "2776" "0" "2776" "0" "c.2776A>G" "r.(?)" "p.(Asn926Asp)" "" "0000931232" "00005472" "30" "1215" "0" "1215" "0" "c.1215T>C" "r.(?)" "p.(=)" "" "0000931234" "00005472" "10" "2423" "-18" "2423" "-17" "c.2423-18_2423-17insCGGCCCGGCCCGGCC" "r.(=)" "p.(=)" "" "0000931635" "00005472" "30" "2558" "0" "2558" "0" "c.2558G>A" "r.(?)" "p.(Arg853Gln)" "" "0000936129" "00005472" "90" "2462" "-2666" "2462" "-2666" "c.2462-2666C>T" "r.(?)" "p.(?)" "" "0000936179" "00005472" "50" "2371" "0" "2371" "0" "c.2371G>A" "r.(?)" "p.(Asp791Asn)" "" "0000945954" "00005472" "70" "2098" "0" "2098" "0" "c.2098G>A" "r.(?)" "p.(Gly700Ser)" "" "0000945987" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.(Thr658fs)" "" "0000945988" "00005472" "90" "1450" "0" "1450" "0" "c.1450G>A" "r.(?)" "p.(Gly484Arg)" "" "0000945989" "00005472" "90" "801" "4" "801" "4" "c.801+4del" "r.spl?" "p.?" "" "0000945990" "00005472" "90" "1660" "0" "1668" "0" "c.1660_1668del" "r.(?)" "p.(Lys554_Glu556del)" "" "0000945991" "00005472" "90" "801" "3" "801" "4" "c.801+3_801+4dup" "r.spl?" "p.?" "" "0000946063" "00005472" "50" "2158" "0" "2158" "0" "c.2158C>T" "r.(?)" "p.(Arg720Cys)" "" "0000946084" "00005472" "50" "1706" "0" "1706" "0" "c.1706G>A" "r.(?)" "p.(Arg569Gln)" "" "0000946112" "00005472" "50" "1336" "0" "1336" "0" "c.1336G>A" "r.(?)" "p.(Asp446Asn)" "" "0000946113" "00005472" "50" "2192" "0" "2192" "0" "c.2192C>T" "r.(?)" "p.(Thr731Met)" "" "0000946158" "00005472" "90" "2627" "0" "2627" "0" "c.2627G>A" "r.(?)" "p.(Arg876His)" "" "0000946159" "00005472" "90" "2488" "0" "2488" "0" "c.2488C>T" "r.(?)" "p.(Arg830Trp)" "" "0000946179" "00005472" "50" "3003" "0" "3003" "0" "c.3003C>A" "r.(?)" "p.(Asp1001Glu)" "" "0000946215" "00005472" "50" "1358" "0" "1358" "0" "c.1358G>A" "r.(?)" "p.(Arg453His)" "" "0000951523" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "" "0000954927" "00005472" "90" "114" "0" "115" "12" "c.114_115+12del" "r.spl" "p.?" "2" "0000954928" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.?" "" "0000954929" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.?" "" "0000954930" "00005472" "90" "1752" "0" "1752" "0" "c.1752del" "r.(?)" "p.(Gly585GlufsTer11)" "23" "0000954931" "00005472" "70" "2894" "0" "2894" "0" "c.2894G>C" "r.(?)" "p.(Arg965Pro)" "28" "0000954941" "00005472" "90" "893" "0" "893" "0" "c.893G>A" "r.(?)" "p.(Gly298Glu)" "7" "0000955069" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.(Thr656fs)" "25i" "0000955070" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.(Thr656fs)" "25i" "0000955071" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.(Thr656fs)" "25i" "0000955072" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.(Thr656fs)" "25i" "0000955073" "00005472" "90" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.spl" "p.(Thr656fs)" "25i" "0000970343" "00005472" "30" "2423" "-18" "2423" "-17" "c.2423-18_2423-17insCGGCCCGGCCCGGCCCGGCC" "r.(=)" "p.(=)" "" "0000970349" "00005472" "30" "2585" "0" "2585" "0" "c.2585G>A" "r.(?)" "p.(Arg862Gln)" "" "0000970352" "00005472" "30" "2795" "0" "2795" "0" "c.2795C>T" "r.(?)" "p.(Pro932Leu)" "" "0000984041" "00005472" "30" "1944" "0" "1944" "0" "c.1944C>T" "r.(?)" "p.(=)" "" "0000984042" "00005472" "70" "1970" "-9" "1970" "-9" "c.1970-9G>A" "r.(=)" "p.(=)" "" "0000984043" "00005472" "50" "1984" "0" "1984" "0" "c.1984G>A" "r.(?)" "p.(Val662Met)" "" "0000984044" "00005472" "50" "2551" "0" "2551" "0" "c.2551A>G" "r.(?)" "p.(Lys851Glu)" "" "0000984045" "00005472" "50" "2584" "0" "2584" "0" "c.2584C>T" "r.(?)" "p.(Arg862Trp)" "" "0000984046" "00005472" "50" "2623" "0" "2623" "0" "c.2623G>A" "r.(?)" "p.(Ala875Thr)" "" "0000984047" "00005472" "50" "2785" "0" "2785" "0" "c.2785G>A" "r.(?)" "p.(Val929Met)" "" "0000984048" "00005472" "50" "2788" "0" "2788" "0" "c.2788C>T" "r.(?)" "p.(Arg930Cys)" "" "0000984049" "00005472" "50" "2935" "0" "2935" "0" "c.2935G>A" "r.(?)" "p.(Asp979Asn)" "" "0000984050" "00005472" "30" "2944" "0" "2944" "0" "c.2944A>G" "r.(?)" "p.(Met982Val)" "" "0000984051" "00005472" "30" "2982" "0" "2982" "0" "c.2982C>T" "r.(?)" "p.(Ala994=)" "" "0000984052" "00005472" "50" "3023" "0" "3023" "0" "c.3023C>G" "r.(?)" "p.(Pro1008Arg)" "" "0000989995" "00005472" "30" "116" "-3" "116" "-3" "c.116-3C>T" "r.(?)" "p.(?)" "" "0001005828" "00005472" "50" "80" "0" "80" "0" "c.80C>T" "r.(?)" "p.(Ser27Leu)" "" "0001005829" "00005472" "50" "313" "0" "313" "0" "c.313G>A" "r.(?)" "p.(Val105Met)" "" "0001005830" "00005472" "30" "460" "0" "460" "0" "c.460G>A" "r.(?)" "p.(Val154Ile)" "" "0001005831" "00005472" "30" "628" "0" "628" "0" "c.628G>A" "r.(?)" "p.(Glu210Lys)" "" "0001005832" "00005472" "50" "709" "0" "709" "0" "c.709dup" "r.(?)" "p.(Val237Glyfs*39)" "" "0001005833" "00005472" "50" "868" "0" "868" "0" "c.868A>T" "r.(?)" "p.(Ile290Phe)" "" "0001005834" "00005472" "50" "954" "0" "954" "0" "c.954G>A" "r.(?)" "p.(=)" "" "0001005835" "00005472" "30" "1250" "0" "1250" "0" "c.1250G>A" "r.(?)" "p.(Arg417His)" "" "0001005836" "00005472" "30" "1336" "0" "1336" "0" "c.1336G>A" "r.(?)" "p.(Asp446Asn)" "" "0001005837" "00005472" "30" "1761" "0" "1761" "0" "c.1761C>T" "r.(?)" "p.(=)" "" "0001005838" "00005472" "50" "1871" "0" "1871" "0" "c.1871A>G" "r.(?)" "p.(Glu624Gly)" "" "0001005839" "00005472" "50" "1973" "0" "1973" "0" "c.1973C>T" "r.(?)" "p.(Thr658Met)" "" "0001005840" "00005472" "50" "2138" "0" "2138" "0" "c.2138G>A" "r.(?)" "p.(Arg713His)" "" "0001005841" "00005472" "50" "2182" "0" "2182" "0" "c.2182G>A" "r.(?)" "p.(Val728Met)" "" "0001005842" "00005472" "50" "2462" "-2666" "2462" "-2666" "c.2462-2666C>T" "r.(=)" "p.(=)" "" "0001005843" "00005472" "50" "2863" "0" "2863" "0" "c.2863G>A" "r.(?)" "p.(Asp955Asn)" "" "0001005844" "00005472" "50" "2977" "0" "2977" "0" "c.2977C>G" "r.(?)" "p.(Arg993Gly)" "" "0001005845" "00005472" "50" "3029" "0" "3029" "0" "c.3029T>G" "r.(?)" "p.(Phe1010Cys)" "" "0001008322" "00005472" "90" "736" "-1" "736" "-1" "c.736-1G>C" "r.[736_801del,735_736ins[736-129_736-2;c]]" "p.?" "" "0001008323" "00005472" "90" "736" "-1" "736" "-1" "c.736-1G>C" "r.[736_801del,735_736ins[736-129_736-2;c]]" "p.?" "" "0001008324" "00005472" "90" "736" "-1" "736" "-1" "c.736-1G>C" "r.[736_801del,735_736ins[736-129_736-2;c]]" "p.?" "" "0001010340" "00005472" "70" "2414" "0" "2414" "0" "c.2414T>C" "r.(?)" "p.(Leu805Pro)" "26" "0001015905" "00005472" "50" "1439" "0" "1439" "0" "c.1439T>C" "r.(?)" "p.(Leu480Pro)" "" "0001015906" "00005472" "30" "2462" "-2585" "2462" "-2585" "c.2462-2585G>A" "r.(=)" "p.(=)" "" "0001017453" "00005472" "50" "511" "0" "511" "0" "c.511G>A" "r.(?)" "p.(Gly171Arg)" "" "0001019160" "00005472" "90" "847" "0" "847" "0" "c.847G>A" "r.(?)" "p.(Gly283Arg)" "6" "0001027351" "00005472" "50" "487" "0" "487" "0" "c.487G>A" "r.(?)" "p.(Gly163Ser)" "" "0001027352" "00005472" "30" "510" "0" "510" "0" "c.510C>T" "r.(?)" "p.(Cys170=)" "" "0001043658" "00005472" "50" "106" "0" "108" "0" "c.106_108del" "r.(?)" "p.(Asn36del)" "" "0001043659" "00005472" "50" "421" "0" "421" "0" "c.421A>G" "r.(?)" "p.(Met141Val)" "" "0001043660" "00005472" "50" "977" "0" "977" "0" "c.977del" "r.(?)" "p.(Lys326Argfs*82)" "" "0001043661" "00005472" "30" "1070" "0" "1070" "0" "c.1070C>G" "r.(?)" "p.(Pro357Arg)" "" "0001043662" "00005472" "30" "1769" "0" "1769" "0" "c.1769C>T" "r.(?)" "p.(Thr590Met)" "" "0001043663" "00005472" "30" "1860" "0" "1860" "0" "c.1860C>T" "r.(?)" "p.(=)" "" "0001043664" "00005472" "30" "2220" "0" "2220" "0" "c.2220T>C" "r.(?)" "p.(Asp740=)" "" "0001043665" "00005472" "30" "2361" "0" "2361" "0" "c.2361G>A" "r.(?)" "p.(=)" "" "0001043666" "00005472" "30" "2462" "-2604" "2462" "-2604" "c.2462-2604C>T" "r.(=)" "p.(=)" "" "0001043667" "00005472" "30" "2462" "-2463" "2462" "-2463" "c.2462-2463A>C" "r.(=)" "p.(=)" "" "0001043668" "00005472" "30" "2769" "0" "2769" "0" "c.2769C>T" "r.(?)" "p.(His923=)" "" "0001043669" "00005472" "50" "2773" "0" "2773" "0" "c.2773A>C" "r.(?)" "p.(Ile925Leu)" "" "0001045284" "00005472" "90" "1459" "-63" "1459" "-63" "c.1459-63G>A" "r.spl" "p.?" "" "0001046799" "00005472" "50" "1666" "0" "1666" "0" "c.1666G>C" "r.(?)" "p.(Glu556Gln)" "" "0001046800" "00005472" "30" "2220" "0" "2220" "0" "c.2220T>C" "r.(?)" "p.(Asp740=)" "" "0001047071" "00005472" "10" "2980" "0" "2980" "0" "c.2980G>A" "r.(?)" "p.(Ala994Thr)" "" "0001047909" "00005472" "90" "1336" "0" "1336" "0" "c.1336dup" "r.spl?" "p.(Asp446GlyfsTer5)" "16" "0001047910" "00005472" "90" "1402" "0" "1402" "0" "c.1402C>T" "r.(?)" "p.(Arg468Ter)" "17" "0001047911" "00005472" "90" "1459" "-2" "1459" "-2" "c.1459-2A>G" "r.spl" "p.(Gly487Aspfs*48)" "17i" "0001047912" "00005472" "90" "1619" "0" "1619" "0" "c.1619G>A" "r.(?)" "p.(Gly540Asp)" "21" "0001047913" "00005472" "90" "2560" "0" "2560" "0" "c.2560C>T" "r.(?)" "p.(Arg854Cys)" "27" "0001047914" "00005472" "90" "2626" "0" "2626" "0" "c.2626C>A" "r.(?)" "p.(Arg876Ser)" "28" "0001047915" "00005472" "90" "855" "1" "855" "1" "c.855+1G>A" "r.spl" "p.?" "6i" "0001047916" "00005472" "90" "875" "0" "875" "0" "c.875G>A" "r.(?)" "p.(Gly292Asp)" "7" "0001047917" "00005472" "90" "802" "-2" "802" "-2" "c.802-2A>G" "r.spl" "p.?" "5i" "0001047918" "00005472" "90" "884" "0" "884" "0" "c.884G>T" "r.(?)" "p.(Gly295Val)" "7" "0001047919" "00005472" "90" "893" "0" "893" "0" "c.893G>A" "r.(?)" "p.(Gly298Glu)" "7" "0001047920" "00005472" "90" "830" "0" "830" "0" "c.830G>A" "r.(?)" "p.(Gly277Glu)" "6" "0001047921" "00005472" "90" "875" "0" "875" "0" "c.875G>C" "r.(?)" "p.(Gly292Ala)" "7" "0001047922" "00005472" "90" "902" "0" "902" "0" "c.902G>A" "r.(?)" "p.(Gly301Asp)" "8" "0001047923" "00005472" "90" "911" "0" "911" "0" "c.911G>T" "r.(?)" "p.(Gly304Val)" "8" "0001047924" "00005472" "90" "1179" "2" "1179" "2" "c.1179+2T>G" "r.spl" "p.?" "13i" "0001047925" "00005472" "70" "1867" "0" "1867" "0" "c.1867T>G" "r.(?)" "p.(Ser623Ala)" "25" "0001047926" "00005472" "70" "2192" "0" "2192" "0" "c.2192C>T" "r.(?)" "p.(Thr731Met)" "26" "0001047927" "00005472" "90" "780" "0" "781" "0" "c.780_781insCCCCCC" "r.(?)" "p.(Pro260_Lys261insProPro)" "5" "0001047937" "00005472" "90" "1771" "-1" "1771" "-1" "c.1771-1G>A" "r.spl" "p.(Glu591Thrfs*148)" "23i" "0001047938" "00005472" "90" "2329" "0" "2329" "0" "c.2329T>C" "r.(?)" "p.(Cys777Arg)" "26" "0001047939" "00005472" "90" "2665" "0" "2665" "0" "c.2665C>T" "r.(?)" "p.(Gln889Ter)" "28" "0001049550" "00005472" "90" "2584" "0" "2584" "0" "c.2584C>T" "r.(?)" "p.(Arg862Trp)" "" "0001057041" "00005472" "50" "1465" "0" "1465" "0" "c.1465C>T" "r.(?)" "p.(Arg489Trp)" "" "0001057042" "00005472" "50" "1585" "0" "1585" "0" "c.1585G>A" "r.(?)" "p.(Glu529Lys)" "" "0001057043" "00005472" "30" "1671" "9" "1671" "9" "c.1671+9C>T" "r.(=)" "p.(=)" "" "0001057044" "00005472" "50" "1762" "0" "1762" "0" "c.1762G>A" "r.(?)" "p.(Gly588Ser)" "" "0001057045" "00005472" "50" "1925" "0" "1925" "0" "c.1925T>C" "r.(?)" "p.(Val642Ala)" "" "0001057046" "00005472" "50" "2201" "0" "2201" "0" "c.2201G>A" "r.(?)" "p.(Arg734His)" "" "0001057047" "00005472" "50" "2461" "2700" "2461" "2700" "c.2461+2700C>T" "r.(=)" "p.(=)" "" "0001057934" "00005472" "70" "1199" "0" "1199" "0" "c.1199G>T" "r.(?)" "p.(Gly400Val)" "" "0001057935" "00005472" "50" "697" "0" "697" "0" "c.697C>T" "r.(?)" "p.(Arg233Cys)" "" "0001057945" "00005472" "50" "289" "0" "289" "0" "c.289G>A" "r.(?)" "p.(Gly97Ser)" "" "0001058569" "00005472" "90" "1861" "0" "1861" "0" "c.1861G>A" "r.(?)" "p.(Asp621Asn)" "" "0001060906" "00005472" "50" "791" "0" "791" "0" "c.791G>A" "r.(?)" "p.(Arg264His)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 851 "{{screeningid}}" "{{variantid}}" "0000054644" "0000084594" "0000054648" "0000084598" "0000054649" "0000084599" "0000054649" "0000084626" "0000054652" "0000084602" "0000054654" "0000084627" "0000054655" "0000084605" "0000054655" "0000084629" "0000081005" "0000130091" "0000081206" "0000130292" "0000103537" "0000166965" "0000103537" "0000166966" "0000104476" "0000169217" "0000109174" "0000175275" "0000109175" "0000175276" "0000109176" "0000175293" "0000109177" "0000175277" "0000109177" "0000175294" "0000109177" "0000175295" "0000109178" "0000175278" "0000109178" "0000175296" "0000109179" "0000175279" "0000109180" "0000175280" "0000109186" "0000175281" "0000109189" "0000175282" "0000109192" "0000175283" "0000109193" "0000175284" "0000109194" "0000175285" "0000109195" "0000175286" "0000109196" "0000175287" "0000109196" "0000175297" "0000109206" "0000175288" "0000109206" "0000175292" "0000109208" "0000175289" "0000109223" "0000175995" "0000109223" "0000175996" "0000109223" "0000175997" "0000109223" "0000175998" "0000109236" "0000176003" "0000109238" "0000176006" "0000109238" "0000176007" "0000109238" "0000176008" "0000109238" "0000176009" "0000109238" "0000176010" "0000109238" "0000176011" "0000109238" "0000176012" "0000109238" "0000176013" "0000109238" "0000176014" "0000109239" "0000176023" "0000109241" "0000176029" "0000109241" "0000176030" "0000109241" "0000176031" "0000109241" "0000176032" "0000109241" "0000176033" "0000109246" "0000175350" "0000109246" "0000176039" "0000109247" "0000175351" "0000109247" "0000176040" "0000109248" "0000175352" "0000109248" "0000176041" "0000109249" "0000175353" "0000109249" "0000176042" "0000109250" "0000175354" "0000109252" "0000175356" "0000109253" "0000175357" "0000109253" "0000176043" "0000109254" "0000175358" "0000109254" "0000176044" "0000109255" "0000175359" "0000109256" "0000175360" "0000109257" "0000175361" "0000109258" "0000175362" "0000109259" "0000175363" "0000109259" "0000176045" "0000109260" "0000175364" "0000109261" "0000176046" "0000109262" "0000175366" "0000109262" "0000176047" "0000109263" "0000175367" "0000109263" "0000176048" "0000109264" "0000175368" "0000109265" "0000176049" "0000109265" "0000176050" "0000109266" "0000175370" "0000109267" "0000175371" "0000109268" "0000175372" "0000109269" "0000175373" "0000109270" "0000175374" "0000109289" "0000176056" "0000109289" "0000176057" "0000109289" "0000176058" "0000109289" "0000176059" "0000109289" "0000176060" "0000109289" "0000176061" "0000109289" "0000176062" "0000109289" "0000176063" "0000109290" "0000176084" "0000109290" "0000176085" "0000109290" "0000176086" "0000109290" "0000176087" "0000109290" "0000176088" "0000109290" "0000176089" "0000109290" "0000176090" "0000109290" "0000176091" "0000109291" "0000176115" "0000109291" "0000176116" "0000109291" "0000176117" "0000109291" "0000176118" "0000109291" "0000176119" "0000109291" "0000176120" "0000109291" "0000176121" "0000109291" "0000176122" "0000109291" "0000176123" "0000109291" "0000176124" "0000109292" "0000176156" "0000109292" "0000176157" "0000109292" "0000176158" "0000109292" "0000176159" "0000109292" "0000176160" "0000109292" "0000176161" "0000109292" "0000176162" "0000109292" "0000176163" "0000109293" "0000176178" "0000109293" "0000176179" "0000109293" "0000176180" "0000109293" "0000176181" "0000109293" "0000176182" "0000109293" "0000176183" "0000109293" "0000176184" "0000109293" "0000176185" "0000109293" "0000176186" "0000109293" "0000176187" "0000109294" "0000176213" "0000109294" "0000176214" "0000109294" "0000176215" "0000109294" "0000176216" "0000109294" "0000176217" "0000109294" "0000176218" "0000109294" "0000176219" "0000109294" "0000176220" "0000109295" "0000176238" "0000109295" "0000176239" "0000109295" "0000176240" "0000109295" "0000176241" "0000109295" "0000176242" "0000109295" "0000176243" "0000109295" "0000176244" "0000109296" "0000176264" "0000109296" "0000176265" "0000109296" "0000176266" "0000109296" "0000176267" "0000109296" "0000176268" "0000109296" "0000176269" "0000109296" "0000176270" "0000109296" "0000176271" "0000109296" "0000176272" "0000109296" "0000176273" "0000109306" "0000175410" "0000109307" "0000175411" "0000109308" "0000175412" "0000109314" "0000175418" "0000109316" "0000175420" "0000109317" "0000175421" "0000109317" "0000176292" "0000109322" "0000175426" "0000109323" "0000175427" "0000109325" "0000175429" "0000109328" "0000175432" "0000109328" "0000176294" "0000109334" "0000175438" "0000109334" "0000176295" "0000109341" "0000175445" "0000109343" "0000175447" "0000109343" "0000176299" "0000109344" "0000176300" "0000109352" "0000175456" "0000109353" "0000175457" "0000109357" "0000175461" "0000109357" "0000176305" "0000109358" "0000175462" "0000109361" "0000175465" "0000109361" "0000176306" "0000109362" "0000175466" "0000109362" "0000176307" "0000109363" "0000175467" "0000109363" "0000176308" "0000109366" "0000175470" "0000109366" "0000176309" "0000109367" "0000175471" "0000109367" "0000176310" "0000109368" "0000175472" "0000109374" "0000175478" "0000109374" "0000176312" "0000109479" "0000175583" "0000109480" "0000175584" "0000109481" "0000175585" "0000109482" "0000175586" "0000109483" "0000175587" "0000109484" "0000175588" "0000109485" "0000175589" "0000109486" "0000175590" "0000109487" "0000175591" "0000109488" "0000175592" "0000109489" "0000175593" "0000109490" "0000175594" "0000109491" "0000175595" "0000109492" "0000175596" "0000109493" "0000175597" "0000109494" "0000175598" "0000109495" "0000175599" "0000109496" "0000175600" "0000109497" "0000175601" "0000109498" "0000175602" "0000109499" "0000175603" "0000109500" "0000175604" "0000109501" "0000175605" "0000109502" "0000175606" "0000109503" "0000175607" "0000109504" "0000175608" "0000109505" "0000175609" "0000109506" "0000175610" "0000109507" "0000175611" "0000109508" "0000175612" "0000109509" "0000175613" "0000109510" "0000175614" "0000109511" "0000175615" "0000109512" "0000175616" "0000109513" "0000175617" "0000109514" "0000175618" "0000109515" "0000175619" "0000109516" "0000175620" "0000109517" "0000175621" "0000109518" "0000175622" "0000109519" "0000175623" "0000109520" "0000175624" "0000109521" "0000175625" "0000109522" "0000175626" "0000109523" "0000175627" "0000109524" "0000175628" "0000109525" "0000175629" "0000109526" "0000175630" "0000109527" "0000175631" "0000109528" "0000175632" "0000109529" "0000175633" "0000109530" "0000175634" "0000109531" "0000175635" "0000109532" "0000175636" "0000109533" "0000175637" "0000109534" "0000175638" "0000109535" "0000175639" "0000109536" "0000175640" "0000109537" "0000175641" "0000109538" "0000175642" "0000109539" "0000175643" "0000109540" "0000175644" "0000109541" "0000175645" "0000109542" "0000175646" "0000109543" "0000175647" "0000109544" "0000175648" "0000109545" "0000175649" "0000109546" "0000175650" "0000109659" "0000175763" "0000109659" "0000176313" "0000109659" "0000176314" "0000109675" "0000175779" "0000109695" "0000175799" "0000109703" "0000175807" "0000109704" "0000175808" "0000109705" "0000175809" "0000109706" "0000175810" "0000109707" "0000175811" "0000109708" "0000175812" "0000109708" "0000176324" "0000109709" "0000175813" "0000109709" "0000176325" "0000109710" "0000175814" "0000109711" "0000175815" "0000109729" "0000175833" "0000109740" "0000176332" "0000109741" "0000175845" "0000109742" "0000175846" "0000109754" "0000175858" "0000109755" "0000175859" "0000109756" "0000175860" "0000109757" "0000175861" "0000109760" "0000175864" "0000109764" "0000175868" "0000109764" "0000176333" "0000109765" "0000175869" "0000109765" "0000176334" "0000109766" "0000175870" "0000109768" "0000175872" "0000109768" "0000176337" "0000109768" "0000176338" "0000109768" "0000176339" "0000109769" "0000175873" "0000109769" "0000176340" "0000109770" "0000175874" "0000109770" "0000176341" "0000109771" "0000175875" "0000109771" "0000176342" "0000109771" "0000176343" "0000109774" "0000175878" "0000109774" "0000176345" "0000109775" "0000175879" "0000109775" "0000176346" "0000109776" "0000175880" "0000109776" "0000176347" "0000109777" "0000175881" "0000109777" "0000176348" "0000109778" "0000175882" "0000109779" "0000175883" "0000109780" "0000176350" "0000109782" "0000175886" "0000109782" "0000176352" "0000109783" "0000175887" "0000109783" "0000176353" "0000109783" "0000176354" "0000109784" "0000176355" "0000109784" "0000234517" "0000109786" "0000175890" "0000109786" "0000176357" "0000109787" "0000176358" "0000109820" "0000175924" "0000109820" "0000176365" "0000109821" "0000175925" "0000109821" "0000176366" "0000109822" "0000175926" "0000109822" "0000176367" "0000109823" "0000175927" "0000109823" "0000176368" "0000109824" "0000175928" "0000109824" "0000176369" "0000109825" "0000175929" "0000109825" "0000176370" "0000109826" "0000175930" "0000109826" "0000176371" "0000109827" "0000175931" "0000109827" "0000176372" "0000109828" "0000175932" "0000109829" "0000175933" "0000109830" "0000175934" "0000109831" "0000175935" "0000109832" "0000175936" "0000109833" "0000175937" "0000109834" "0000175938" "0000109835" "0000175939" "0000109836" "0000175940" "0000109837" "0000175941" "0000109838" "0000175942" "0000109839" "0000175943" "0000109840" "0000175944" "0000109841" "0000175945" "0000109842" "0000175946" "0000109843" "0000175947" "0000109844" "0000175948" "0000109845" "0000175949" "0000109846" "0000175950" "0000109880" "0000175984" "0000109881" "0000175985" "0000175657" "0000398521" "0000209013" "0000439096" "0000209968" "0000441101" "0000220554" "0000461681" "0000220598" "0000461682" "0000220606" "0000461683" "0000220611" "0000461684" "0000220626" "0000461685" "0000220639" "0000461686" "0000220691" "0000461687" "0000220717" "0000461688" "0000220727" "0000461689" "0000220730" "0000461690" "0000220733" "0000461691" "0000220736" "0000461692" "0000220740" "0000461693" "0000220749" "0000461694" "0000220764" "0000461695" "0000220775" "0000461696" "0000220787" "0000461697" "0000220824" "0000461698" "0000220830" "0000461699" "0000220841" "0000461700" "0000220853" "0000461701" "0000220853" "0000461702" "0000220861" "0000461703" "0000220880" "0000461704" "0000220882" "0000461705" "0000220886" "0000461706" "0000220887" "0000461707" "0000220896" "0000461708" "0000220918" "0000461709" "0000220921" "0000461710" "0000220936" "0000461711" "0000220943" "0000461712" "0000220949" "0000461713" "0000220960" "0000461714" "0000220962" "0000461715" "0000220990" "0000461716" "0000220991" "0000461717" "0000220995" "0000461718" "0000221000" "0000461719" "0000221017" "0000461720" "0000221025" "0000461721" "0000221026" "0000461722" "0000221027" "0000461723" "0000221051" "0000461724" "0000221076" "0000461725" "0000221080" "0000461726" "0000221092" "0000461727" "0000221094" "0000461728" "0000221102" "0000461729" "0000221120" "0000461730" "0000221132" "0000461731" "0000221150" "0000461732" "0000221151" "0000461733" "0000221163" "0000461734" "0000221164" "0000461735" "0000221168" "0000461736" "0000221169" "0000461737" "0000221169" "0000461738" "0000221173" "0000461739" "0000221177" "0000461740" "0000221183" "0000461741" "0000221207" "0000461742" "0000221208" "0000461743" "0000221211" "0000461744" "0000221213" "0000461745" "0000221216" "0000461746" "0000221241" "0000461747" "0000221244" "0000461748" "0000221254" "0000461749" "0000221254" "0000461750" "0000221259" "0000461751" "0000221271" "0000461752" "0000221292" "0000461753" "0000221292" "0000461754" "0000221326" "0000461755" "0000221327" "0000461756" "0000221335" "0000461757" "0000221340" "0000461758" "0000221377" "0000461759" "0000221385" "0000461760" "0000221388" "0000461761" "0000221389" "0000461762" "0000221389" "0000461763" "0000221392" "0000461764" "0000221425" "0000461765" "0000221439" "0000461766" "0000221440" "0000461767" "0000221488" "0000461768" "0000221488" "0000461769" "0000221490" "0000461770" "0000221501" "0000461771" "0000221513" "0000461772" "0000221529" "0000461773" "0000221532" "0000461774" "0000221555" "0000461775" "0000221581" "0000461776" "0000221586" "0000461777" "0000221601" "0000461778" "0000221604" "0000461779" "0000221604" "0000461780" "0000221608" "0000461781" "0000221609" "0000461782" "0000221611" "0000461783" "0000221612" "0000461784" "0000221616" "0000461785" "0000221625" "0000461786" "0000221626" "0000461787" "0000221633" "0000461788" "0000221680" "0000461789" "0000221681" "0000461790" "0000221687" "0000461791" "0000221705" "0000461792" "0000221709" "0000461793" "0000221714" "0000461794" "0000221728" "0000461795" "0000221741" "0000461796" "0000221742" "0000461797" "0000221746" "0000461798" "0000221772" "0000461799" "0000221790" "0000461800" "0000221802" "0000461801" "0000221825" "0000461802" "0000221830" "0000461803" "0000221836" "0000461804" "0000221850" "0000461805" "0000221856" "0000461806" "0000221877" "0000461807" "0000221879" "0000461808" "0000221892" "0000461809" "0000221895" "0000461810" "0000221912" "0000461811" "0000221915" "0000461812" "0000221923" "0000461813" "0000221923" "0000461814" "0000221925" "0000461815" "0000221928" "0000461816" "0000221930" "0000461817" "0000221935" "0000461818" "0000221936" "0000461819" "0000221936" "0000461820" "0000221939" "0000461821" "0000221950" "0000461822" "0000221984" "0000461823" "0000221992" "0000461824" "0000221993" "0000461825" "0000221994" "0000461826" "0000221996" "0000461827" "0000222010" "0000461828" "0000222014" "0000461829" "0000222020" "0000461830" "0000222023" "0000461831" "0000222026" "0000461832" "0000222029" "0000461833" "0000222034" "0000461834" "0000222034" "0000461835" "0000222043" "0000461836" "0000222055" "0000461837" "0000222063" "0000461838" "0000222065" "0000461839" "0000222071" "0000461840" "0000222079" "0000461841" "0000222096" "0000461842" "0000222099" "0000461843" "0000222099" "0000461844" "0000222101" "0000461845" "0000222123" "0000461846" "0000222130" "0000461847" "0000222131" "0000461848" "0000222131" "0000461849" "0000222138" "0000461850" "0000222151" "0000461851" "0000222157" "0000461852" "0000222166" "0000461853" "0000222166" "0000461854" "0000222196" "0000461855" "0000222212" "0000461856" "0000222213" "0000461857" "0000222216" "0000461858" "0000222219" "0000461859" "0000222237" "0000461860" "0000222248" "0000461861" "0000222266" "0000461862" "0000222268" "0000461863" "0000222275" "0000461864" "0000222276" "0000461865" "0000222309" "0000461866" "0000222316" "0000461867" "0000222322" "0000461868" "0000222327" "0000461869" "0000222327" "0000461870" "0000222339" "0000461871" "0000222345" "0000461872" "0000222348" "0000461873" "0000222356" "0000461874" "0000222360" "0000461875" "0000222397" "0000461876" "0000222450" "0000461877" "0000222452" "0000461878" "0000222487" "0000461879" "0000222492" "0000461880" "0000222498" "0000461881" "0000222508" "0000461882" "0000222513" "0000461883" "0000222522" "0000461884" "0000222525" "0000461885" "0000222541" "0000461886" "0000222546" "0000461887" "0000222549" "0000461888" "0000222557" "0000461889" "0000222558" "0000461890" "0000222575" "0000461891" "0000222577" "0000461892" "0000222577" "0000461893" "0000222578" "0000461894" "0000222579" "0000461895" "0000222594" "0000461896" "0000222602" "0000461897" "0000222610" "0000461898" "0000222611" "0000461899" "0000222619" "0000461900" "0000222622" "0000461901" "0000222622" "0000461902" "0000222629" "0000461903" "0000222645" "0000461904" "0000222660" "0000461905" "0000222663" "0000461906" "0000222664" "0000461907" "0000222669" "0000461908" "0000222672" "0000461909" "0000222706" "0000461910" "0000222722" "0000461911" "0000222722" "0000461912" "0000222738" "0000461913" "0000222743" "0000461914" "0000222747" "0000461915" "0000222758" "0000461916" "0000222766" "0000461917" "0000222776" "0000461918" "0000222785" "0000461919" "0000222785" "0000461920" "0000222791" "0000461921" "0000222814" "0000461922" "0000222814" "0000461923" "0000222829" "0000461924" "0000222839" "0000461925" "0000222846" "0000461926" "0000222865" "0000461927" "0000222869" "0000461928" "0000222874" "0000461929" "0000222886" "0000461930" "0000222905" "0000461931" "0000222918" "0000461932" "0000222920" "0000461933" "0000222935" "0000461934" "0000222955" "0000461935" "0000222957" "0000461936" "0000222972" "0000461937" "0000222973" "0000461938" "0000222978" "0000461939" "0000222988" "0000461940" "0000223002" "0000461941" "0000223005" "0000461942" "0000223008" "0000461943" "0000223058" "0000461944" "0000223074" "0000461945" "0000223112" "0000461946" "0000223123" "0000461947" "0000223139" "0000461948" "0000223159" "0000461949" "0000223197" "0000461950" "0000223197" "0000462001" "0000223226" "0000461951" "0000223259" "0000461952" "0000223275" "0000461953" "0000223276" "0000461954" "0000223286" "0000461955" "0000223288" "0000461956" "0000223301" "0000461957" "0000223305" "0000461958" "0000223311" "0000461959" "0000223316" "0000461960" "0000223325" "0000461961" "0000223328" "0000461962" "0000223395" "0000461963" "0000223409" "0000461964" "0000223422" "0000461965" "0000223426" "0000461966" "0000223440" "0000461967" "0000223474" "0000461968" "0000223475" "0000461969" "0000223483" "0000461970" "0000223484" "0000461971" "0000223487" "0000461972" "0000223493" "0000461973" "0000223515" "0000461974" "0000223526" "0000461975" "0000223531" "0000461976" "0000223535" "0000461977" "0000223537" "0000461978" "0000223571" "0000461979" "0000223573" "0000461980" "0000223581" "0000461981" "0000223584" "0000461982" "0000223615" "0000461983" "0000223626" "0000461984" "0000223634" "0000461985" "0000223645" "0000461986" "0000223645" "0000461987" "0000223682" "0000461988" "0000223694" "0000461989" "0000223699" "0000461990" "0000223701" "0000461991" "0000223714" "0000461992" "0000223717" "0000461993" "0000223728" "0000461994" "0000223742" "0000461995" "0000223746" "0000461996" "0000223759" "0000461997" "0000223759" "0000461998" "0000223760" "0000461999" "0000223782" "0000462000" "0000265163" "0000595741" "0000266602" "0000597308" "0000266603" "0000597309" "0000266604" "0000597310" "0000275533" "0000629570" "0000290154" "0000646778" "0000290157" "0000646819" "0000290181" "0000646805" "0000294202" "0000650891" "0000294203" "0000650892" "0000294204" "0000650893" "0000294205" "0000650894" "0000294206" "0000650895" "0000294207" "0000650896" "0000294208" "0000650897" "0000294209" "0000650898" "0000294211" "0000650900" "0000294212" "0000650901" "0000294213" "0000650902" "0000294214" "0000650903" "0000294215" "0000650904" "0000294216" "0000650905" "0000296358" "0000653047" "0000297780" "0000660443" "0000297979" "0000660689" "0000306011" "0000669699" "0000306012" "0000669700" "0000306906" "0000670723" "0000306983" "0000670800" "0000306983" "0000670889" "0000309152" "0000683632" "0000315328" "0000697417" "0000315329" "0000697418" "0000315330" "0000697419" "0000315331" "0000697420" "0000315332" "0000697421" "0000315333" "0000697422" "0000315334" "0000697423" "0000315335" "0000697424" "0000315336" "0000697425" "0000315337" "0000697426" "0000315338" "0000697427" "0000315339" "0000697428" "0000315340" "0000697429" "0000315341" "0000697430" "0000315342" "0000697431" "0000315343" "0000697432" "0000315344" "0000697433" "0000315345" "0000697434" "0000315346" "0000697435" "0000315347" "0000697436" "0000336554" "0000735979" "0000363215" "0000763683" "0000363222" "0000763692" "0000375474" "0000786825" "0000375475" "0000786826" "0000375476" "0000786827" "0000375476" "0000787463" "0000375477" "0000786828" "0000375477" "0000787464" "0000375806" "0000787547" "0000375895" "0000787246" "0000375896" "0000787247" "0000389911" "0000819182" "0000389942" "0000819212" "0000389942" "0000819262" "0000389943" "0000819213" "0000389943" "0000819263" "0000393249" "0000823912" "0000393251" "0000823914" "0000398900" "0000831194" "0000399010" "0000831316" "0000399032" "0000831337" "0000399033" "0000831338" "0000399034" "0000831339" "0000399035" "0000831340" "0000399036" "0000831341" "0000399037" "0000831342" "0000399038" "0000831343" "0000399039" "0000831344" "0000399040" "0000831345" "0000399040" "0000920113" "0000399041" "0000831346" "0000399042" "0000831347" "0000399043" "0000831348" "0000399044" "0000831349" "0000399045" "0000831350" "0000399046" "0000831351" "0000399047" "0000831352" "0000399048" "0000831353" "0000399049" "0000831354" "0000399050" "0000831355" "0000399077" "0000831382" "0000400255" "0000833062" "0000400316" "0000833123" "0000406170" "0000842401" "0000410630" "0000847991" "0000410630" "0000847992" "0000412596" "0000869942" "0000419655" "0000879759" "0000421234" "0000881865" "0000421234" "0001010340" "0000429726" "0000909338" "0000431834" "0000917124" "0000431884" "0000917174" "0000436941" "0000931635" "0000439985" "0000936129" "0000440035" "0000936179" "0000444105" "0000945954" "0000444130" "0000945987" "0000444130" "0000946158" "0000444131" "0000945988" "0000444132" "0000945989" "0000444133" "0000945990" "0000444133" "0000946159" "0000444134" "0000945991" "0000444206" "0000946063" "0000444227" "0000946084" "0000444227" "0000946179" "0000444227" "0000946215" "0000444256" "0000946112" "0000444257" "0000946113" "0000446579" "0000954927" "0000446580" "0000954928" "0000446581" "0000954929" "0000446581" "0000954930" "0000446583" "0000954931" "0000446592" "0000954941" "0000446710" "0000955069" "0000446711" "0000955070" "0000446712" "0000955071" "0000446713" "0000955072" "0000446714" "0000955073" "0000456153" "0001008322" "0000456154" "0001008323" "0000456155" "0001008324" "0000459429" "0001017453" "0000460169" "0001019160" "0000467472" "0001045284" "0000468186" "0001047909" "0000468187" "0001047910" "0000468188" "0001047911" "0000468188" "0001047937" "0000468189" "0001047912" "0000468189" "0001047938" "0000468190" "0001047913" "0000468191" "0001047914" "0000468192" "0001047915" "0000468193" "0001047916" "0000468194" "0001047917" "0000468195" "0001047918" "0000468196" "0001047919" "0000468197" "0001047920" "0000468198" "0001047921" "0000468199" "0001047922" "0000468200" "0001047923" "0000468201" "0001047924" "0000468202" "0001047925" "0000468203" "0001047926" "0000468204" "0001047927" "0000468204" "0001047939" "0000469286" "0001049550" "0000469884" "0001057934" "0000469884" "0001057935" "0000469891" "0001057945" "0000470447" "0001058569" "0000472369" "0001060906"