### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = COL6A3) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "COL6A3" "collagen, type VI, alpha 3" "2" "q37" "unknown" "LRG_473" "UD_132084467717" "" "http://www.LOVD.nl/COL6A3" "" "1" "2213" "1293" "120250" "1" "1" "1" "1" "This database is one of the gene variant databases from the:The database was initiated with the help of Anne Lampe, based on the review article Lampe AK, Bushby KMD (2005). Collagen VI related muscle disorders. J. Med. Genet. 42: 673-685." "" "g" "https://databases.lovd.nl/shared/refseq/COL6A3_codingDNA.html" "1" "" "This database is one of the gene variant databases from the \"Leiden Muscular Dystrophy pages\" (LMDp)." "-1" "" "-1" "00001" "2005-02-28 00:00:00" "00006" "2019-03-03 13:51:51" "00006" "2025-11-07 14:42:36" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00005473" "COL6A3" "transcript variant 1" "003" "NM_004369.3" "" "NP_004360.2" "" "" "" "-285" "10296" "9534" "238322850" "238232655" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 20 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00244" "MYOP" "myopathy (MYOP)" "" "" "" "" "" "00006" "2013-10-12 23:00:55" "00006" "2019-06-19 11:52:31" "00344" "EE" "encephalopathy, epileptic (EE)" "" "" "" "" "" "00006" "2014-03-12 21:57:45" "00006" "2015-12-07 07:11:25" "00360" "MDC" "dystrophy, muscular, congenital (MDC)" "" "" "" "" "" "00006" "2014-03-21 23:02:36" "00006" "2018-07-03 16:30:02" "01273" "hCK" "hyperCKemia (hCK, elevated serum creatine phosphokinase)" "AD" "123320" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01448" "BTHLM1A" "myopathy, Bethlem, type 1A" "AD;AR" "158810" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2025-09-09 12:19:34" "01945" "UCMD" "dystrophy, muscular, congenital, Ullrich" "AD;AR;Di" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2025-09-09 12:22:46" "04167" "SCA" "ataxia, spinocerebellar (SCA)" "" "" "" "" "" "00006" "2014-12-24 11:54:32" "00006" "2015-12-08 23:59:30" "04327" "CRS" "craniosynostosis (CRS)" "" "" "" "" "" "00006" "2015-09-12 20:59:03" "" "" "04426" "DYT27" "dystonia, type 27 (DYT-27)" "AR" "616411" "" "" "" "00000" "2015-09-23 10:25:22" "00006" "2021-12-10 21:51:32" "05100" "UCMD" "dystrophy, muscular, congenital, Ullrich (UCMD)" "" "" "" "" "" "00006" "2015-11-08 10:59:55" "00006" "2017-07-28 15:01:18" "05121" "MD" "dystrophy, muscular (MD)" "" "" "" "" "" "00006" "2016-01-24 01:27:29" "" "" "05126" "LGMD" "dystrophy, muscular, limb-girdle (LGMD)" "" "" "" "" "" "00006" "2016-01-26 06:05:36" "" "" "05324" "DMD" "dystrophy, muscular, Duchenne type (DMD)" "XLR" "310200" "" "" "" "00006" "2017-09-01 17:41:21" "00006" "2021-12-10 21:51:32" "05358" "BTHLM" "myopathy, Bethlem (BTHLM)" "" "" "" "" "" "00006" "2017-12-28 09:26:43" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "05618" "NMD" "neuromuscular disorder (NMD)" "" "" "" "" "" "00006" "2019-07-02 19:46:12" "" "" "07175" "BTHLM1C" "myopathy, Bethlem, type 1C" "AD;AR" "620726" "" "" "" "00006" "2025-09-09 12:17:27" "" "" "07179" "UCMD1C" "dystrophy, Uhlrich, muscular, congenital, type 1C" "AD;AR" "620728" "" "" "" "00006" "2025-09-09 12:26:40" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 5 "{{geneid}}" "{{diseaseid}}" "COL6A3" "01945" "COL6A3" "04426" "COL6A3" "05358" "COL6A3" "07175" "COL6A3" "07179" ## Individuals ## Do not remove or alter this header ## ## Count = 794 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00054694" "" "" "" "1" "" "01458" "{PMID:O\'Grady 2016:27159402}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "Australia" ">23y" "0" "" "" "" "Pat23" "00054698" "" "" "" "1" "" "01458" "{PMID:O\'Grady 2016:27159402}" "" "M" "" "Australia" ">14y" "0" "" "" "" "Pat63" "00054702" "" "" "" "1" "" "01458" "{PMID:O\'Grady 2016:27159402}" "" "M" "" "Australia" ">10y" "0" "" "" "" "Pat85" "00080859" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected parents" "" "" "" "" "0" "" "" "" "" "00102743" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "no" "Germany" "" "0" "" "" "" "MYO-SEQ Pat1" "00103084" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat2" "00108716" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat17" "00108718" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat19" "00108720" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "F" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat20" "00108722" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat22" "00108725" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "F" "yes" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat25" "00108734" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat33" "00108735" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "F" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat34" "00108736" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "?" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat35" "00108738" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "F" "no" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat4" "00108742" "" "" "" "1" "" "01955" "MYO-SEQ project, UK" "" "M" "yes" "United Kingdom (Great Britain)" "" "0" "" "" "" "MYO-SEQ Pat8" "00108755" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108757" "" "" "" "1" "" "00449" "{PMID:Giusti 2005:16130093}" "" "" "" "Turkey" "" "0" "" "" "" "P2" "00108768" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "first degree relatives, no confirmatory data" "" "" "" "" "0" "" "" "" "Pat28, Pat29" "00108772" "" "" "" "1" "" "00449" "{PMID:Giusti 2005:16130093}" "" "" "" "Italy" "" "0" "" "" "" "P4" "00108773" "" "" "" "1" "" "00449" "{PMID:Giusti 2005:16130093}" "" "" "yes" "Turkey" "" "0" "" "" "" "P1" "00108774" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "Pat43" "00108775" "" "" "" "1" "" "00449" "{PMID:Giusti 2005:16130093}" "" "" "" "Belgium" "" "0" "" "" "" "P5" "00108799" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108805" "" "" "" "1" "" "00006" "{PMID:Demir 2002:11992252}, {OMIM120250:0003}" "" "" "" "Italy" "" "0" "" "" "" "-" "00108807" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108808" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108809" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108810" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108811" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108812" "" "" "" "1" "" "00006" "{PMID:Pan 1998:9536084}, {OMIM120250:0001}" "large 3 generation family" "" "" "United States" "" "0" "" "" "" "-" "00108813" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108814" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108815" "" "" "" "1" "" "00006" "{PMID:Pepe 1999:10399756}" "2 generation family" "" "" "" "" "0" "" "" "" "-" "00108816" "" "" "" "1" "" "00006" "{PMID:Baker 2005:15563506}, {OMIM120250:0004}" "" "" "" "" "" "0" "" "" "" "-" "00108817" "" "" "" "3" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108818" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108819" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108820" "" "" "" "3" "" "00006" "{PMID:Demir 2002:11992252}, {OMIM120250:0002}" "brother and 2 sisters" "" "" "Morocco" "" "0" "" "" "" "-" "00108821" "" "" "" "1" "" "00006" "{PMID:Demir 2002:11992252}" "" "" "" "" "" "0" "" "" "" "-" "00108822" "" "" "" "1" "" "00006" "{PMID:Lampe 2005:15689448}" "" "" "" "" "" "0" "" "" "" "?" "00108823" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "Australia" "" "0" "" "" "" "?" "00108824" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "United States" "" "0" "" "" "" "?" "00108825" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "United States" "" "0" "" "" "" "?" "00108826" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "F" "" "Australia" "" "0" "" "" "" "?" "00108827" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "New Zealand" "" "0" "" "" "" "?" "00108828" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "Australia" "" "0" "" "" "" "?" "00108829" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "?" "00108830" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "Australia" "" "0" "" "" "" "?" "00108843" "" "" "" "1" "" "00006" "{PMID:Baker 2007:17886299}" "" "M" "" "Australia" "" "0" "" "" "" "?" "00108852" "" "" "" "1" "" "00464" "" "" "F" "" "Saudi Arabia" "" "0" "" "" "Arab" "?" "00108863" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00108864" "" "" "" "1" "" "00464" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00108869" "" "" "" "1" "" "00464" "" "" "" "" "Saudi Arabia" "" "0" "" "" "Arab" "?" "00108879" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00108880" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00108882" "" "" "" "1" "" "00464" "" "" "" "" "Canada" "" "0" "" "" "" "?" "00108883" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00108890" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00108894" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00108904" "" "" "" "1" "" "00464" "" "" "F" "" "Saudi Arabia" "" "0" "" "" "Arab" "?" "00108905" "" "" "" "1" "" "00464" "" "" "M" "" "Saudi Arabia" "" "0" "" "" "Arab" "?" "00109081" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109082" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109083" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109084" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109085" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109086" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109087" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109088" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109089" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109090" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109091" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109092" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109093" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109094" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109095" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109096" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109097" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109098" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109099" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109100" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109101" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109102" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109103" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109104" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109105" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109106" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109107" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109108" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109109" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109110" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109111" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109112" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109113" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109114" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109115" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109116" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109117" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109118" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109119" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109120" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109121" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109122" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109123" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109124" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109125" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109126" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109127" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109128" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109129" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109130" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109131" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109132" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109133" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109134" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109135" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109136" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109137" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109138" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109139" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109140" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109141" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109142" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109143" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109144" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109145" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109146" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109147" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109148" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109149" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109150" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109151" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109152" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109153" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109154" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109155" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109156" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109157" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109158" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109159" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109160" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109161" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109162" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109163" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109164" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109165" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109166" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109167" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109168" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109169" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109170" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109171" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109172" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109173" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109174" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109175" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109176" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109177" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109178" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109179" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109180" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109181" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109182" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109183" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109184" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109185" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109186" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109187" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109188" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109189" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109190" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109191" "" "" "" "1" "" "00430" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00109218" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "F" "" "(United States)" "" "0" "" "" "" "Gly_23" "00109227" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_32" "00109235" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_40" "00109244" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "M" "" "(United States)" "" "0" "" "" "" "Gly_49" "00109246" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "M" "" "(United States)" "" "0" "" "" "" "Gly_51" "00109247" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "son is Gly_53" "F" "" "(United States)" "" "0" "" "" "" "Gly_52" "00109248" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "mother is Gly_52" "M" "" "(United States)" "" "0" "" "" "" "Gly_53" "00109249" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "F" "" "(United States)" "" "0" "" "" "" "Gly_54" "00109250" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "M" "" "(United States)" "" "0" "" "" "" "Gly_55" "00109251" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_56" "00109252" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "F" "" "(United States)" "" "0" "" "" "" "Gly_57" "00109253" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "father is Gly_59" "M" "" "(United States)" "" "0" "" "" "" "Gly_58" "00109254" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "son is Gly_58" "M" "" "(United States)" "" "0" "" "" "" "Gly_59" "00109255" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_60" "00109256" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "mother is Gly_62" "F" "" "(United States)" "" "0" "" "" "" "Gly_61" "00109257" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "daughter is Gly_61" "F" "" "(United States)" "" "0" "" "" "" "Gly_62" "00109262" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "M" "" "(United States)" "" "0" "" "" "" "Gly_67" "00109264" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "M" "" "(United States)" "" "0" "" "" "" "Gly_69" "00109265" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_70" "00109268" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "F" "" "(United States)" "" "0" "" "" "" "Gly_73" "00109269" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "F" "" "(United States)" "" "0" "" "" "" "Gly_74" "00109272" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "F" "" "(United States)" "" "0" "" "" "" "Gly_77" "00109292" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "" "" "" "(United States)" "" "0" "" "" "" "Gly_97" "00109293" "" "" "" "1" "" "00537" "{PMID:Butterfield:24038877}" "unaffacted father patient Gly_23" "M" "" "(United States)" "" "0" "" "" "" "Gly_23f" "00109315" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109319" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109322" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109381" "" "" "" "1" "" "00472" "" "" "" "" "" "" "0" "" "" "Arabic" "?" "00109382" "" "" "" "1" "" "00472" "" "" "" "" "" "" "0" "" "" "Arabic" "?" "00109383" "" "" "" "1" "" "00472" "" "" "" "" "" "" "0" "" "" "Arabic" "?" "00109384" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109385" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109386" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109387" "" "" "" "1" "" "00472" "" "" "" "" "Spain" "" "0" "" "" "" "?" "00109388" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109389" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109390" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109391" "" "" "" "1" "" "00472" "" "" "" "" "Spain" "" "0" "" "" "" "?" "00109392" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109393" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109394" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109395" "" "" "" "1" "" "00472" "" "" "" "" "Spain" "" "0" "" "" "" "?" "00109396" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109397" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109398" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109399" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109400" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109401" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109402" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109403" "" "" "" "1" "" "00472" "" "" "" "" "" "" "0" "" "" "Arabic" "?" "00109404" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109405" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109406" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109407" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109408" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109409" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109410" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109411" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109412" "" "" "" "1" "" "00472" "" "" "" "" "Italy" "" "0" "" "" "" "?" "00109413" "" "" "" "1" "" "00472" "" "" "" "" "Morocco" "" "0" "" "" "" "?" "00109418" "" "" "" "1" "" "02188" "" "" "M" "" "" "" "0" "" "" "" "F4P" "00109421" "" "" "" "1" "" "01715" "" "" "F" "yes" "Iran" "" "0" "" "" "" "" "00174767" "" "" "" "1" "" "00006" "{PMID:Fichna 2018:29970176}, {PMID:Macias 2021:34720847}" "" "M" "" "Poland" "" "0" "" "" "" "Pat901;B10" "00174768" "" "" "" "1" "" "00006" "{PMID:Fichna 2018:29970176}, {PMID:Macias 2021:34720847}" "" "F" "" "Poland" "" "0" "" "" "" "Pat7;PatB9" "00174769" "" "" "" "1" "" "00006" "{PMID:Fichna 2018:29970176}" "high CK in father" "M" "" "Poland" "" "0" "" "" "" "Pat275" "00174785" "" "" "" "1" "" "00006" "{PMID:Fichna 2018:29970176}, {PMID:Macias 2021:34720847}" "" "M" "" "Poland" "" "0" "" "" "" "Pat19;PatA2" "00174794" "" "" "" "2" "" "00006" "{PMID:Fichna 2018:29970176}, {PMID:Macias 2021:34720847}" "2-eneration family, affected sister/brother" "F" "" "Poland" "" "0" "" "" "" "Pat214;A5(II1)" "00177016" "" "" "" "1" "" "02552" "" "" "M" "no" "Switzerland" "" "0" "" "" "" "73068" "00207952" "" "" "" "1" "" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "" "00208534" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00208614" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00208793" "" "" "" "1" "" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "" "00219425" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219496" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219521" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219530" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219537" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219539" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219542" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219551" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219554" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219558" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219571" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219591" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219594" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219596" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219597" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219628" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219640" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219642" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219650" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219660" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219662" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219675" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219696" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219707" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219722" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219734" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219740" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219756" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219764" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219771" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219773" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219780" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219786" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219789" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219793" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219822" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219823" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219826" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219831" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219855" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219859" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219866" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219882" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219894" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219897" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219899" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219900" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219902" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219907" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219910" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219923" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219938" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219947" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219948" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219949" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219960" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219963" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219973" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219974" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219975" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219978" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219979" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219983" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00219987" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220003" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220004" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220027" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220031" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220041" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220046" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220047" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220051" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220057" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220063" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220070" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220071" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220072" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220074" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220076" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220080" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220109" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220112" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220113" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220123" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220130" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220138" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220146" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220152" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220159" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220161" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220162" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220166" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220187" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220188" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220193" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220196" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220213" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220217" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220231" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220236" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220245" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220250" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220259" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220263" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220271" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220277" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220278" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220284" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220287" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}, {PMID:Pan 2024:39663110}" "" "M" "" "United States" "" "0" "" "" "" "Pat;RNA009" "00220296" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220308" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220323" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220333" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220335" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220367" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220371" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220380" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220410" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220422" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220429" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220439" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220442" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220456" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220460" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220464" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220471" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220474" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220476" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220478" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220487" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220493" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220508" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220511" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220515" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220523" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220524" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220532" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220538" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220544" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220547" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220551" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220560" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220572" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220582" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220589" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220611" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220612" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220630" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220634" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220635" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220639" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220647" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220654" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220667" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220686" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220688" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220691" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220704" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220705" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220717" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220720" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220736" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220758" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220775" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220783" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220784" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220788" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220802" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220803" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220815" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220816" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220818" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220824" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220828" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220829" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220848" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220854" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220860" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220862" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220872" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220892" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220894" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220901" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220909" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220913" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220922" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220924" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220925" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220954" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220957" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220968" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220970" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220972" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220991" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00220998" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221005" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221007" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221011" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221021" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221031" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221041" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221049" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221053" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221055" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221066" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221069" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221071" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221075" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221098" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221105" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221106" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221117" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221134" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221143" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221153" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221161" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221162" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221178" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221182" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221186" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221190" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221201" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221205" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221206" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221242" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221250" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221251" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221253" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221292" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221316" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221324" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221337" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221345" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221375" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221388" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221389" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221394" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221402" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221422" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221424" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221429" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221454" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221458" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221460" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221483" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221486" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221510" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221524" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221546" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221548" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221550" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221553" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221555" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221559" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221563" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221570" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221573" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221596" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221599" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221603" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221614" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221615" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221620" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221622" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221624" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221625" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221642" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221652" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221657" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221659" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221663" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221667" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221671" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221674" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221678" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221683" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221697" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221711" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221712" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221713" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221731" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221733" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221738" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221746" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221764" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221771" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221777" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221781" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221782" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221789" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221791" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221794" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221801" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221802" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221803" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221811" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221814" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221816" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221823" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221826" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221831" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221836" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221838" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221843" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221847" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221848" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221855" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221864" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221868" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221875" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221883" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221885" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221892" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221899" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221900" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221901" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221903" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221904" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221907" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221909" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221917" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221919" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221921" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221936" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221938" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221944" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221948" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221950" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221965" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221969" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221987" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00221992" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222001" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222004" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222007" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222008" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222009" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222017" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222021" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222034" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222049" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222053" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222055" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222056" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222065" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222072" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222073" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222098" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222101" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222118" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222123" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222129" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222132" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222146" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222150" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222154" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222160" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222165" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222167" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222176" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222186" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222200" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222207" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222223" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222226" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222228" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222229" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222237" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222244" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222246" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222266" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222268" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222270" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222283" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222287" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222289" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222301" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222305" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222307" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222325" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222342" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222345" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222347" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222350" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222364" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222375" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222390" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222394" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222396" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222399" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222406" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222411" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222413" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222426" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222427" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222436" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222446" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222450" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222468" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222479" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222480" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222485" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222495" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222499" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222514" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222517" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222520" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222531" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222533" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222534" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222537" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222557" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222567" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222570" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222572" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222573" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222584" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222592" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222595" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222603" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222607" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222609" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222624" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222628" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222633" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222651" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222656" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222664" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222665" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222682" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222684" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222689" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222702" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222707" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222711" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222715" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222736" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222739" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00222740" "" "" "" "1" "" "00430" "{PMID:Nallamilli 2018:30564623}" "" "" "" "(United States)" "" "0" "" "" "" "30564623-Pat" "00248145" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00248401" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00265904" "" "" "" "1" "" "00006" "{PMID:Cummings 2017:28424332}" "" "" "" "" "" "0" "" "" "" "PatD11" "00269870" "" "" "" "1" "" "03524" "" "" "F" "" "" "" "0" "" "" "" "" "00274294" "" "" "" "1" "" "00006" "{PMID:Reddy 2017:27708273}" "" "M" "" "United States" "" "0" "" "" "Europe, white" "Fam965" "00274295" "" "" "" "1" "" "00006" "{PMID:Reddy 2017:27708273}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "United States" "" "0" "" "" "Europe, white" "Fam1093" "00274296" "" "" "" "1" "" "00006" "{PMID:Reddy 2017:27708273}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "United States" "" "0" "" "" "Europe, white" "Fam1115" "00288979" "" "" "" "1" "" "00006" "{PMID:Punetha 2016:27854218}" "analysis 94 myopathy cases" "" "" "" "" "0" "" "" "" "Pat33" "00288989" "" "" "" "1" "" "00006" "{PMID:Punetha 2016:27854218}" "analysis 94 myopathy cases" "" "" "" "" "0" "" "" "" "Pat43" "00288995" "" "" "" "1" "" "00006" "{PMID:Punetha 2016:27854218}" "analysis 94 myopathy cases" "" "" "" "" "0" "" "" "" "Pat49" "00288998" "" "" "" "1" "" "00006" "{PMID:Punetha 2016:27854218}" "analysis 94 myopathy cases" "" "" "" "" "0" "" "" "" "Pat52" "00289005" "" "" "" "1" "" "00006" "{PMID:Punetha 2016:27854218}" "analysis 94 myopathy cases" "" "" "" "" "0" "" "" "" "Pat59" "00292648" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00292649" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00292650" "" "" "" "152" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00292651" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00292652" "" "" "" "26" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00292653" "" "" "" "41" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00292654" "" "" "" "172" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00292655" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295179" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295549" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00296673" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00296869" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00304803" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304804" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00307312" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00311127" "" "" "" "1" "" "00006" "contact me for details" "" "" "" "Denmark" "" "0" "" "" "" "private email" "00314175" "" "" "" "7" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314176" "" "" "" "2" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314177" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314178" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314179" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314180" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314181" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314182" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314183" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314184" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314185" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314186" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00333493" "" "" "" "1" "" "00454" "" "" "M" "" "Argentina" "" "" "" "yeslimb" "" "#907" "00363162" "" "" "" "1" "" "00454" "Luce 2021, submitted" "" "M" "" "Argentina" "" "0" "" "" "" "#587" "00374278" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-4466" "00374703" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-3614" "00374704" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-2208" "00388626" "" "" "" "1" "" "00006" "{PMID:Chakravorty 2020:33250842}" "" "M" "" "India" "" "0" "" "" "India" "Pat64" "00388702" "" "" "" "1" "" "00006" "{PMID:Chakravorty 2020:33250842}" "" "F" "" "India" "" "0" "" "" "India" "Pat36" "00391936" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "no" "India" "" "0" "yes" "" "" "MDCRC/0118/B-130" "00391996" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "yes" "India" "" "0" "yes" "" "" "MDCRC/1577/DBI-1293" "00392008" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "yes" "India" "" "0" "yes" "" "" "MDCRC/1867/DBI-1509" "00392011" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "no" "India" "" "0" "yes" "" "" "MDCRC/1910/DBI-1532" "00392012" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "yes" "India" "" "0" "yes" "" "" "MDCRC/1912/DBI-1534" "00392029" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "no" "India" "" "0" "yes" "" "" "MDCRC/2192/DBI-1747" "00392033" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "yes" "India" "" "0" "yes" "" "Indian" "MDCRC/2091/DBI-1664" "00397809" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U32" "00397810" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U11" "00397811" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U29" "00397812" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U8" "00397813" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U12" "00397814" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U13" "00397815" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U21" "00397816" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U36" "00397817" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U24" "00397818" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U33" "00397819" "" "" "" "1" "" "00006" "{PMID:Fan 2018:29419890}" "" "" "" "China" "" "0" "" "" "" "U40" "00399032" "" "" "" "1" "" "00006" "{PMID:Gonzalez-Quereda 2020:32403337}" "patient" "F" "" "Spain" "" "0" "" "" "" "P80" "00399045" "" "" "" "1" "" "00006" "{PMID:Gonzalez-Quereda 2020:32403337}" "patient" "M" "" "Spain" "" "0" "" "" "" "P104" "00402407" "" "" "" "1" "" "01929" "{PMID:Cerino 2022:35741838}" "" "M" "yes" "Chile" "" "0" "" "" "Hispanic" "P56/Myo128" "00426476" "" "" "" "1" "" "03652" "" "index case" "F" "no" "Argentina" "" "0" "" "" "" "" "00428473" "" "" "" "2" "" "04448" "" "" "M" "likely" "China" "" "0" "" "" "" "" "00428474" "" "" "" "1" "" "04448" "" "" "F" "yes" "China" "" "" "" "" "" "" "00428475" "" "" "" "1" "" "04448" "" "" "M" "yes" "China" "" "" "" "" "" "" "00442622" "" "" "" "1" "" "00006" "{PMID:Panades de Oliveira 2019:30706156}" "patient, no family history" "F" "" "Spain" "" "0" "" "" "" "Fam8PatA" "00442623" "" "" "" "2" "" "00006" "{PMID:Panades de Oliveira 2019:30706156}" "family, 2 affected sibs" "M" "" "Spain" "" "0" "" "" "" "Fam9PatA" "00442624" "" "" "00442623" "1" "" "00006" "{PMID:Panades de Oliveira 2019:30706156}" "brother" "M" "" "Spain" "" "0" "" "" "" "Fam9PatB" "00442625" "" "" "" "3" "" "00006" "{PMID:Panades de Oliveira 2019:30706156}" "family, 3 affected sibs" "F" "" "Spain" "" "0" "" "" "" "Fam10PatA" "00442626" "" "" "00442625" "1" "" "00006" "{PMID:Panades de Oliveira 2019:30706156}" "sister" "F" "" "Spain" "" "0" "" "" "" "Fam10PatB" "00442627" "" "" "00442625" "1" "" "00006" "{PMID:Panades de Oliveira 2019:30706156}" "brother" "M" "" "Spain" "" "0" "" "" "" "Fam10PatC" "00442628" "" "" "" "1" "" "00006" "{PMID:Panades de Oliveira 2019:30706156}" "patient, father probable Bethlem disease (deceased, contractures)" "F" "" "Spain" "" "0" "" "" "" "Fam11PatA" "00442651" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat23" "00442652" "" "" "" "2" "" "00006" "{PMID:Westra 2019:31127727}" "family, affected mother/son" "M" "" "" "" "0" "" "" "" "Pat24" "00442653" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "F" "" "" "" "0" "" "" "" "Pat25" "00442723" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "F" "" "" "" "0" "" "" "" "Pat95" "00442744" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "F" "" "" "" "0" "" "" "" "Pat116" "00442770" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat142" "00442771" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat143" "00442784" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat156" "00443843" "" "" "" "1" "" "00006" "{PMID:Imafidon 2021:34136434}" "incidental finding" "" "" "Netherlands" "" "0" "" "" "" "Case1" "00444069" "" "" "" "1" "" "00006" "{PMID:Sarker 2023:38057384}" "no family history" "M" "" "Bangladesh" "" "0" "" "" "" "PID_155" "00444070" "" "" "" "1" "" "00006" "{PMID:Sarker 2023:38057384}" "no family history" "M" "" "Bangladesh" "" "0" "" "" "" "PID_123" "00445014" "" "" "" "1" "" "04618" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "M" "no" "France" "" "0" "" "" "" "F12" "00445024" "" "" "" "2" "" "04618" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "M" "no" "France" "" "0" "" "" "" "F24" "00447962" "" "" "" "4" "" "00006" "{PMID:Chia 2018:29784083}" "2-generation family, 2 affected, unaffectedheteroczugous carrier parents/sibs" "M" "yes" "Jordan" "" "0" "" "" "" "FamPatII1" "00447963" "" "" "00447962" "1" "" "00006" "{PMID:Chia 2018:29784083}" "affected sister" "F" "yes" "Jordan" "" "0" "" "" "" "FamPatII4" "00451031" "" "" "" "1" "" "00006" "{PMID:Chen 2024:38756899}" "" "M" "no" "China" "" "0" "" "" "" "Pat1" "00460280" "" "" "" "1" "" "00006" "{PMID:Marti 2025:39666917}" "patient, no family history" "" "" "Spain" "" "0" "" "" "" "Pat51" "00466542" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Turkey" "" "0" "" "" "" "Pat111" "00466543" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "" "" "0" "" "" "" "Pat116" "00466544" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat120" "00466545" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "" "" "0" "" "" "" "Pat121" "00466546" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat122" "00466547" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat130" "00466548" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat133" "00466549" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "" "" "0" "" "" "" "Pat135" "00466550" "" "" "" "1" "" "04892" "Fortunato 2025, submitted" "" "" "" "Italy" "" "0" "" "" "" "Pat138" "00467557" "" "" "" "1" "" "00006" "{PMID:Vorontsova 2025:41096657}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Russia" "" "0" "" "" "" "PatN1" "00468042" "" "" "" "1" "" "00006" "{PMID:Shadrina 2016:26770814}" "4-generation family, 5 affected (5M)" "M" "" "Russia" "" "0" "" "" "" "family" "00468229" "" "" "" "1" "" "00006" "{PMID:Ayala-Ramirez 2025:41066171}" "patient" "M" "" "Colombia" "" "0" "" "" "" "Pat182" "00468234" "" "" "" "1" "" "00006" "{PMID:Ayala-Ramirez 2025:41066171}" "patient" "M" "" "Colombia" "" "0" "" "" "" "Pat177" "00468240" "" "" "" "1" "" "00006" "{PMID:Ayala-Ramirez 2025:41066171}" "patient" "M" "" "Colombia" "" "0" "" "" "" "Pat155" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 792 "{{individualid}}" "{{diseaseid}}" "00054694" "00360" "00054698" "00360" "00054702" "00360" "00080859" "01945" "00102743" "01448" "00103084" "01448" "00108716" "01448" "00108718" "01448" "00108720" "01448" "00108722" "01448" "00108725" "01448" "00108734" "01448" "00108735" "01448" "00108736" "05100" "00108738" "01448" "00108742" "01448" "00108755" "01448" "00108757" "05100" "00108768" "01448" "00108772" "05100" "00108773" "05100" "00108774" "01448" "00108775" "05100" "00108799" "05100" "00108805" "05100" "00108807" "01448" "00108808" "05100" "00108809" "01448" "00108810" "01448" "00108811" "01448" "00108812" "01448" "00108813" "01448" "00108814" "05100" "00108815" "01448" "00108816" "05100" "00108817" "05100" "00108818" "01448" "00108819" "05100" "00108820" "05100" "00108821" "05100" "00108822" "01448" "00108823" "01448" "00108824" "01448" "00108825" "01448" "00108826" "01448" "00108827" "01448" "00108828" "01448" "00108829" "01448" "00108830" "01448" "00108843" "05100" "00108852" "05100" "00108863" "05100" "00108864" "01448" "00108869" "05100" "00108879" "05100" "00108880" "00244" "00108882" "00244" "00108883" "05100" "00108890" "05100" "00108894" "00360" "00108904" "00198" "00108905" "05100" "00109081" "00198" "00109082" "00198" "00109083" "00198" "00109084" "00198" "00109085" "00198" "00109086" "00198" "00109087" "00198" "00109088" "00198" "00109089" "00198" "00109090" "00198" "00109091" "00198" "00109092" "00198" "00109093" "00198" "00109094" "00198" "00109095" "00198" "00109096" "00198" "00109097" "00198" "00109098" "00198" "00109099" "00198" "00109100" "00198" "00109101" "00198" "00109102" "00198" "00109103" "00198" "00109104" "00198" "00109105" "00198" "00109106" "00198" "00109107" "00198" "00109108" "00198" "00109109" "00198" "00109110" "00198" "00109111" "00198" "00109112" "00198" "00109113" "00198" "00109114" "00198" "00109115" "00198" "00109116" "00198" "00109117" "00198" "00109118" "00198" "00109119" "00198" "00109120" "00198" "00109121" "00198" "00109122" "00198" "00109123" "00198" "00109124" "00198" "00109125" "00198" "00109126" "00198" "00109127" "00198" "00109128" "00198" "00109129" "00198" "00109130" "00198" "00109131" "00198" "00109132" "00198" "00109133" "00198" "00109134" "00198" "00109135" "00198" "00109136" "00198" "00109137" "00198" "00109138" "00198" "00109139" "00198" "00109140" "00198" "00109141" "00198" "00109142" "00198" "00109143" "00198" "00109144" "00198" "00109145" "00198" "00109146" "00198" "00109147" "00198" "00109148" "00198" "00109149" "00198" "00109150" "00198" "00109151" "00198" "00109152" "00198" "00109153" "00198" "00109154" "00198" "00109155" "00198" "00109156" "00198" "00109157" "00198" "00109158" "00198" "00109159" "00198" "00109160" "00198" "00109161" "00198" "00109162" "00198" "00109163" "00198" "00109164" "00198" "00109165" "00198" "00109166" "00198" "00109167" "00198" "00109168" "00198" "00109169" "00198" "00109170" "00198" "00109171" "00198" "00109172" "00198" "00109173" "00198" "00109174" "00198" "00109175" "00198" "00109176" "00198" "00109177" "00198" "00109178" "00198" "00109179" "00198" "00109180" "00198" "00109181" "00198" "00109182" "00198" "00109183" "00198" "00109184" "00198" "00109185" "00198" "00109186" "00198" "00109187" "00198" "00109188" "00198" "00109189" "00198" "00109190" "00198" "00109191" "00198" "00109218" "05100" "00109227" "00198" "00109235" "00198" "00109244" "05100" "00109246" "05100" "00109247" "01448" "00109248" "01448" "00109249" "05100" "00109250" "05100" "00109251" "00198" "00109252" "05100" "00109253" "01448" "00109254" "01448" "00109255" "00198" "00109256" "05100" "00109257" "00000" "00109262" "05100" "00109264" "05100" "00109265" "00198" "00109268" "05100" "00109269" "00198" "00109272" "05100" "00109292" "00198" "00109293" "00000" "00109315" "00198" "00109319" "05100" "00109322" "01448" "00109381" "05100" "00109382" "05100" "00109383" "05100" "00109384" "01448" "00109385" "00198" "00109386" "05100" "00109387" "01448" "00109388" "01448" "00109389" "05100" "00109390" "01448" "00109391" "05100" "00109392" "01448" "00109393" "05100" "00109394" "05100" "00109395" "00000" "00109396" "01448" "00109397" "00198" "00109398" "00000" "00109399" "01448" "00109400" "00198" "00109401" "05100" "00109402" "01448" "00109403" "05100" "00109404" "01448" "00109405" "05100" "00109406" "01448" "00109407" "05100" "00109408" "05100" "00109409" "01448" "00109410" "05100" "00109411" "01448" "00109412" "00000" "00109413" "00000" "00109418" "01945" "00109421" "00198" "00174767" "05126" "00174768" "05126" "00174769" "05126" "00174785" "05126" "00174794" "05126" "00177016" "00344" "00219425" "05126" "00219496" "05126" "00219521" "05126" "00219530" "05126" "00219537" "05126" "00219539" "05126" "00219542" "05126" "00219551" "05126" "00219554" "05126" "00219558" "05126" "00219571" "05126" "00219591" "05126" "00219594" "05126" "00219596" "05126" "00219597" "05126" "00219628" "05126" "00219640" "05126" "00219642" "05126" "00219650" "05126" "00219660" "05126" "00219662" "05126" "00219675" "05126" "00219696" "05126" "00219707" "05126" "00219722" "05126" "00219734" "04327" "00219734" "05126" "00219740" "04327" "00219740" "05126" "00219756" "00000" "00219756" "05126" "00219764" "05126" "00219771" "05126" "00219773" "05126" "00219780" "05126" "00219786" "05126" "00219789" "05126" "00219793" "05126" "00219822" "05126" "00219823" "05126" "00219826" "05126" "00219831" "05126" "00219855" "05126" "00219859" "05126" "00219866" "05126" "00219882" "05126" "00219894" "05126" "00219897" "05126" "00219899" "05126" "00219900" "05126" "00219902" "05126" "00219907" "05126" "00219910" "05126" "00219923" "05126" "00219938" "05126" "00219947" "05126" "00219948" "05126" "00219949" "05126" "00219960" "05126" "00219963" "05126" "00219973" "05126" "00219974" "05126" "00219975" "05126" "00219978" "05126" "00219979" "05126" "00219983" "05126" "00219987" "05126" "00220003" "05126" "00220004" "05126" "00220027" "05126" "00220031" "05126" "00220041" "05126" "00220046" "05126" "00220047" "05126" "00220051" "05126" "00220057" "05126" "00220063" "05126" "00220070" "05126" "00220071" "05126" "00220072" "05126" "00220074" "05126" "00220076" "05126" "00220080" "05126" "00220109" "05126" "00220112" "05126" "00220113" "05126" "00220123" "05126" "00220130" "05126" "00220138" "05126" "00220146" "05126" "00220152" "05126" "00220159" "05126" "00220161" "05126" "00220162" "05126" "00220166" "05126" "00220187" "05126" "00220188" "05126" "00220193" "05126" "00220196" "05126" "00220213" "05126" "00220217" "05126" "00220231" "05126" "00220236" "05126" "00220245" "05126" "00220250" "05126" "00220259" "05126" "00220263" "05126" "00220271" "05126" "00220277" "05126" "00220278" "05126" "00220284" "05126" "00220287" "05126" "00220296" "05126" "00220308" "05126" "00220323" "05126" "00220333" "05126" "00220335" "05126" "00220367" "05126" "00220371" "05126" "00220380" "05126" "00220410" "05126" "00220422" "05126" "00220429" "05126" "00220439" "05126" "00220442" "05126" "00220456" "05126" "00220460" "05126" "00220464" "05126" "00220471" "05126" "00220474" "05126" "00220476" "05126" "00220478" "05126" "00220487" "05126" "00220493" "05126" "00220508" "05126" "00220511" "05126" "00220515" "05126" "00220523" "05126" "00220524" "05126" "00220532" "05126" "00220538" "05126" "00220544" "05126" "00220547" "05126" "00220551" "05126" "00220560" "05126" "00220572" "05126" "00220582" "05126" "00220589" "05126" "00220611" "05126" "00220612" "05126" "00220630" "05126" "00220634" "05126" "00220635" "05126" "00220639" "05126" "00220647" "05126" "00220654" "05126" "00220667" "05126" "00220686" "05126" "00220688" "05126" "00220691" "05126" "00220704" "05126" "00220705" "05126" "00220717" "05126" "00220720" "05126" "00220736" "05126" "00220758" "05126" "00220775" "05126" "00220783" "05126" "00220784" "05126" "00220788" "05126" "00220802" "05126" "00220803" "05126" "00220815" "05126" "00220816" "05126" "00220818" "05126" "00220824" "05126" "00220828" "05126" "00220829" "05126" "00220848" "05126" "00220854" "05126" "00220860" "05126" "00220862" "05126" "00220872" "05126" "00220892" "05126" "00220894" "05126" "00220901" "05126" "00220909" "05126" "00220913" "05126" "00220922" "05126" "00220924" "05126" "00220925" "05126" "00220954" "05126" "00220957" "05126" "00220968" "05126" "00220970" "05126" "00220972" "05126" "00220991" "05126" "00220998" "05126" "00221005" "05126" "00221007" "05126" "00221011" "05126" "00221021" "05126" "00221031" "05126" "00221041" "05126" "00221049" "05126" "00221053" "05126" "00221055" "05126" "00221066" "05126" "00221069" "05126" "00221071" "05126" "00221075" "05126" "00221098" "05126" "00221105" "05126" "00221106" "05126" "00221117" "05126" "00221134" "05126" "00221143" "05126" "00221153" "05126" "00221161" "05126" "00221162" "05126" "00221178" "05126" "00221182" "05126" "00221186" "05126" "00221190" "05126" "00221201" "05126" "00221205" "05126" "00221206" "05126" "00221242" "05126" "00221250" "05126" "00221251" "05126" "00221253" "05126" "00221292" "05126" "00221316" "05126" "00221324" "05126" "00221337" "05126" "00221345" "05126" "00221375" "05126" "00221388" "05126" "00221389" "05126" "00221394" "05126" "00221402" "05126" "00221422" "05126" "00221424" "05126" "00221429" "05126" "00221454" "05126" "00221458" "05126" "00221460" "05126" "00221483" "05126" "00221486" "05126" "00221510" "05126" "00221524" "05126" "00221546" "05126" "00221548" "05126" "00221550" "05126" "00221553" "05126" "00221555" "05126" "00221559" "05126" "00221563" "05126" "00221570" "05126" "00221573" "05126" "00221596" "05126" "00221599" "05126" "00221603" "05126" "00221614" "05126" "00221615" "05126" "00221620" "05126" "00221622" "05126" "00221624" "05126" "00221625" "05126" "00221642" "05126" "00221652" "05126" "00221657" "05126" "00221659" "05126" "00221663" "05126" "00221667" "05126" "00221671" "05126" "00221674" "05126" "00221678" "05126" "00221683" "05126" "00221697" "05126" "00221711" "05126" "00221712" "05126" "00221713" "05126" "00221731" "05126" "00221733" "05126" "00221738" "05126" "00221746" "05126" "00221764" "05126" "00221771" "05126" "00221777" "05126" "00221781" "05126" "00221782" "05126" "00221789" "05126" "00221791" "05126" "00221794" "05126" "00221801" "05126" "00221802" "05126" "00221803" "05126" "00221811" "05126" "00221814" "05126" "00221816" "05126" "00221823" "05126" "00221826" "05126" "00221831" "05126" "00221836" "05126" "00221838" "05126" "00221843" "05126" "00221847" "05126" "00221848" "05126" "00221855" "05126" "00221864" "05126" "00221868" "05126" "00221875" "05126" "00221883" "05126" "00221885" "05126" "00221892" "05126" "00221899" "05126" "00221900" "05126" "00221901" "05126" "00221903" "05126" "00221904" "05126" "00221907" "05126" "00221909" "05126" "00221917" "05126" "00221919" "05126" "00221921" "05126" "00221936" "05126" "00221938" "05126" "00221944" "05126" "00221948" "05126" "00221950" "05126" "00221965" "05126" "00221969" "05126" "00221987" "05126" "00221992" "05126" "00222001" "05126" "00222004" "05126" "00222007" "05126" "00222008" "05126" "00222009" "05126" "00222017" "05126" "00222021" "05126" "00222034" "05126" "00222049" "05126" "00222053" "05126" "00222055" "05126" "00222056" "05126" "00222065" "05126" "00222072" "05126" "00222073" "05126" "00222098" "05126" "00222101" "05126" "00222118" "05126" "00222123" "05126" "00222129" "05126" "00222132" "05126" "00222146" "05126" "00222150" "05126" "00222154" "05126" "00222160" "05126" "00222165" "05126" "00222167" "05126" "00222176" "05126" "00222186" "05126" "00222200" "05126" "00222207" "05126" "00222223" "05126" "00222226" "05126" "00222228" "05126" "00222229" "05126" "00222237" "05126" "00222244" "05126" "00222246" "05126" "00222266" "05126" "00222268" "05126" "00222270" "05126" "00222283" "05126" "00222287" "05126" "00222289" "05126" "00222301" "05126" "00222305" "05126" "00222307" "05126" "00222325" "05126" "00222342" "05126" "00222345" "05126" "00222347" "05126" "00222350" "05126" "00222364" "05126" "00222375" "05126" "00222390" "05126" "00222394" "05126" "00222396" "05126" "00222399" "05126" "00222406" "05126" "00222411" "05126" "00222413" "05126" "00222426" "05126" "00222427" "05126" "00222436" "05126" "00222446" "05126" "00222450" "05126" "00222468" "05126" "00222479" "05126" "00222480" "05126" "00222485" "05126" "00222495" "05126" "00222499" "05126" "00222514" "05126" "00222517" "05126" "00222520" "05126" "00222531" "05126" "00222533" "05126" "00222534" "05126" "00222537" "05126" "00222557" "05126" "00222567" "05126" "00222570" "05126" "00222572" "05126" "00222573" "05126" "00222584" "05126" "00222592" "05126" "00222595" "05126" "00222603" "05126" "00222607" "05126" "00222609" "05126" "00222624" "05126" "00222628" "05126" "00222633" "05126" "00222651" "05126" "00222656" "05126" "00222664" "05126" "00222665" "05126" "00222682" "05126" "00222684" "05126" "00222689" "05126" "00222702" "05126" "00222707" "05126" "00222711" "05126" "00222715" "05126" "00222736" "05126" "00222739" "05126" "00222740" "05126" "00265904" "05121" "00269870" "05100" "00274294" "05126" "00274295" "05126" "00274296" "05126" "00288979" "00360" "00288989" "00360" "00288995" "05126" "00288998" "00360" "00289005" "00244" "00292648" "00198" "00292649" "00198" "00292650" "00198" "00292651" "00198" "00292652" "00198" "00292653" "00198" "00292654" "00198" "00292655" "00198" "00295179" "00198" "00295549" "00198" "00296673" "00198" "00296869" "00198" "00304803" "00198" "00304804" "00198" "00307312" "00198" "00311127" "00198" "00314175" "05126" "00314176" "05126" "00314177" "05126" "00314178" "05126" "00314179" "05126" "00314180" "05126" "00314181" "05126" "00314182" "05126" "00314183" "05126" "00314184" "05126" "00314185" "05126" "00314186" "05126" "00333493" "05121" "00363162" "05121" "00374278" "00198" "00374703" "00198" "00374704" "00198" "00388626" "00244" "00388702" "00244" "00391936" "05324" "00391996" "05324" "00392008" "05324" "00392011" "05324" "00392012" "05324" "00392029" "05324" "00392033" "05324" "00397809" "05121" "00397810" "05121" "00397811" "05121" "00397812" "05121" "00397813" "05121" "00397814" "05121" "00397815" "05121" "00397816" "05121" "00397817" "05121" "00397818" "05121" "00397819" "05121" "00399032" "05618" "00399045" "05618" "00402407" "01945" "00426476" "05100" "00426476" "05358" "00428473" "05100" "00428474" "05100" "00428475" "05100" "00442622" "05358" "00442623" "05358" "00442624" "05358" "00442625" "05358" "00442626" "05358" "00442627" "05358" "00442628" "05358" "00442651" "05618" "00442652" "05618" "00442653" "05618" "00442723" "05618" "00442744" "05618" "00442770" "05618" "00442771" "05618" "00442784" "05618" "00443843" "00198" "00444069" "05324" "00444070" "05324" "00445014" "05358" "00445024" "05358" "00447962" "05611" "00447963" "05611" "00451031" "05121" "00460280" "01273" "00466542" "05121" "00466543" "00244" "00466544" "00244" "00466545" "00244" "00466546" "00244" "00466547" "00244" "00466548" "00244" "00466549" "00244" "00466550" "00244" "00467557" "05121" "00468042" "04167" "00468229" "00244" "00468234" "00244" "00468240" "00244" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00198, 00244, 00344, 00360, 01273, 01448, 01945, 04167, 04327, 04426, 05100, 05121, 05126, 05324, 05358, 05611, 05618, 07175, 07179 ## Count = 330 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000041373" "00360" "00054694" "01458" "Familial, autosomal dominant" "23y" "infantile hypotonia, congenital femur fracture, walked age 2 years, progression with wheelchair dependency by 12y, distal laxity, hyperkeratosis pilaris, restrictive lung disease; CPK mild elevation (282); histology dystrophic" "" "" "" "IHC COLVI;" "" "" "" "" "" "" "" "0000041377" "00360" "00054698" "01458" "Familial, autosomal dominant" "14y" "congenital hip dislocation, proximal weakness, distal laxity, contractures; CPK mild elevation (475); IHC COLVI; histology dystrophic" "2y" "" "" "" "" "" "" "" "" "" "" "0000041381" "00360" "00054702" "01458" "Familial, autosomal dominant" "10y" "infantile hypotonia, arthrogryposis, congenital hip dislocation, gross motor delay, walked with support at 3 years, mild facial weakness, ptosis, contractures, mild scoliosis; CPK normal; IHC COLVI; histology dystrophic" "" "" "" "" "" "" "" "" "" "" "" "0000060428" "01945" "00080859" "01758" "Familial, autosomal recessive" "" "Ullrich congenital muscular dystrophy 1 (OMIM:254090)" "" "" "" "" "" "" "" "" "" "" "" "0000081211" "01448" "00103084" "01955" "Unknown" "" "" "00y" "" "" "" "" "" "" "" "" "" "" "0000081293" "01448" "00102743" "01955" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086190" "01448" "00108716" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086192" "01448" "00108718" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086194" "01448" "00108720" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086196" "01448" "00108722" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086199" "01448" "00108725" "01955" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086208" "01448" "00108734" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086209" "01448" "00108735" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086210" "05100" "00108736" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086212" "01448" "00108738" "01955" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086216" "01448" "00108742" "01955" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086228" "01448" "00108755" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086230" "05100" "00108757" "00449" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086241" "01448" "00108768" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086245" "05100" "00108772" "00449" "Isolated (sporadic)" "" "mild" "" "" "" "" "" "" "" "" "" "" "" "0000086246" "05100" "00108773" "00449" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086247" "01448" "00108774" "00006" "Unknown" "" "severe" "" "" "" "" "" "" "" "" "" "" "" "0000086248" "05100" "00108775" "00449" "Isolated (sporadic)" "" "mild" "" "" "" "" "" "" "" "" "" "" "" "0000086272" "05100" "00108799" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086278" "05100" "00108805" "00006" "Unknown" "" "mild" "" "" "" "" "" "" "" "" "" "" "" "0000086280" "01448" "00108807" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086281" "05100" "00108808" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086282" "01448" "00108809" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086283" "01448" "00108810" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086284" "01448" "00108811" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086285" "01448" "00108812" "00006" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086286" "01448" "00108813" "00006" "Unknown" "" "severe" "" "" "" "" "" "" "" "" "" "" "" "0000086287" "05100" "00108814" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086288" "01448" "00108815" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086289" "05100" "00108816" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086290" "05100" "00108817" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086291" "01448" "00108818" "00006" "Unknown" "" "severe" "" "" "" "" "" "" "" "" "" "" "" "0000086292" "05100" "00108819" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086293" "05100" "00108820" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086294" "05100" "00108821" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086295" "01448" "00108822" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086296" "01448" "00108823" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086297" "01448" "00108824" "00006" "Unknown" "" "CPK normal" "" "" "" "" "" "" "" "" "" "" "" "0000086298" "01448" "00108825" "00006" "Unknown" "" "CPK increased" "" "" "" "" "" "" "" "" "" "" "" "0000086299" "01448" "00108826" "00006" "Unknown" "" "CPK increased" "" "" "" "" "" "" "" "" "" "" "" "0000086300" "01448" "00108827" "00006" "Unknown" "" "CPK normal" "" "" "" "" "" "" "" "" "" "" "" "0000086301" "01448" "00108828" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086302" "01448" "00108829" "00006" "Unknown" "" "CPK normal" "" "" "" "" "" "" "" "" "" "" "" "0000086303" "01448" "00108830" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086316" "05100" "00108843" "00006" "Unknown" "" "CPK normal" "" "" "" "" "" "" "" "" "" "" "" "0000086325" "05100" "00108852" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086336" "05100" "00108863" "00464" "Unknown" "" "proximall weakness; contractures; CPK ~400" "" "" "" "" "" "" "" "" "" "" "" "0000086337" "01448" "00108864" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086342" "05100" "00108869" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086352" "05100" "00108879" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086353" "00244" "00108880" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086355" "00244" "00108882" "00464" "Unknown" "" "congenital myopathy" "" "" "" "" "" "" "" "" "" "" "" "0000086356" "05100" "00108883" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086363" "05100" "00108890" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086367" "00360" "00108894" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086377" "00198" "00108904" "00464" "Unknown" "" "collagenopathy, type VI; rigid spine" "" "" "" "" "" "" "" "" "" "" "" "0000086378" "05100" "00108905" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086554" "00198" "00109081" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086555" "00198" "00109082" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086556" "00198" "00109083" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086557" "00198" "00109084" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086558" "00198" "00109085" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086559" "00198" "00109086" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086560" "00198" "00109087" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086561" "00198" "00109088" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086562" "00198" "00109089" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086563" "00198" "00109090" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086564" "00198" "00109091" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086565" "00198" "00109092" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086566" "00198" "00109093" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086567" "00198" "00109094" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086568" "00198" "00109095" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086569" "00198" "00109096" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086570" "00198" "00109097" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086571" "00198" "00109098" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086572" "00198" "00109099" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086573" "00198" "00109100" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086574" "00198" "00109101" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086575" "00198" "00109102" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086576" "00198" "00109103" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086577" "00198" "00109104" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086578" "00198" "00109105" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086579" "00198" "00109106" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086580" "00198" "00109107" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086581" "00198" "00109108" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086582" "00198" "00109109" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086583" "00198" "00109110" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086584" "00198" "00109111" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086585" "00198" "00109112" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086586" "00198" "00109113" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086587" "00198" "00109114" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086588" "00198" "00109115" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086589" "00198" "00109116" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086590" "00198" "00109117" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086591" "00198" "00109118" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086592" "00198" "00109119" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086593" "00198" "00109120" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086594" "00198" "00109121" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086595" "00198" "00109122" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086596" "00198" "00109123" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086597" "00198" "00109124" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086598" "00198" "00109125" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086599" "00198" "00109126" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086600" "00198" "00109127" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086601" "00198" "00109128" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086602" "00198" "00109129" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086603" "00198" "00109130" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086604" "00198" "00109131" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086605" "00198" "00109132" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086606" "00198" "00109133" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086607" "00198" "00109134" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086608" "00198" "00109135" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086609" "00198" "00109136" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086610" "00198" "00109137" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086611" "00198" "00109138" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086612" "00198" "00109139" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086613" "00198" "00109140" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086614" "00198" "00109141" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086615" "00198" "00109142" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086616" "00198" "00109143" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086617" "00198" "00109144" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086618" "00198" "00109145" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086619" "00198" "00109146" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086620" "00198" "00109147" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086621" "00198" "00109148" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086622" "00198" "00109149" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086623" "00198" "00109150" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086624" "00198" "00109151" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086625" "00198" "00109152" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086626" "00198" "00109153" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086627" "00198" "00109154" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086628" "00198" "00109155" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086629" "00198" "00109156" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086630" "00198" "00109157" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086631" "00198" "00109158" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086632" "00198" "00109159" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086633" "00198" "00109160" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086634" "00198" "00109161" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086635" "00198" "00109162" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086636" "00198" "00109163" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086637" "00198" "00109164" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086638" "00198" "00109165" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086639" "00198" "00109166" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086640" "00198" "00109167" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086641" "00198" "00109168" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086642" "00198" "00109169" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086643" "00198" "00109170" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086644" "00198" "00109171" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086645" "00198" "00109172" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086646" "00198" "00109173" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086647" "00198" "00109174" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086648" "00198" "00109175" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086649" "00198" "00109176" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086650" "00198" "00109177" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086651" "00198" "00109178" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086652" "00198" "00109179" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086653" "00198" "00109180" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086654" "00198" "00109181" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086655" "00198" "00109182" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086656" "00198" "00109183" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086657" "00198" "00109184" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086658" "00198" "00109185" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086659" "00198" "00109186" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086660" "00198" "00109187" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086661" "00198" "00109188" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086662" "00198" "00109189" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086663" "00198" "00109190" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086664" "00198" "00109191" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086691" "05100" "00109218" "00537" "Isolated (sporadic)" "" "intermediate; ambulatory with assistive devices (7y); walk-17m; wheelchair-bound >7y" "" "" "" "" "" "" "" "" "" "" "" "0000086700" "00198" "00109227" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086708" "00198" "00109235" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086717" "05100" "00109244" "00537" "Isolated (sporadic)" "" "first wheelchair use 8y; walk-18m; wheelchair-bound >8y" "" "" "" "" "" "" "" "" "" "" "" "0000086719" "05100" "00109246" "00537" "Isolated (sporadic)" "" "intermediate; walk-15m; wheelchair-bound >27y" "" "" "" "" "" "" "" "" "" "" "" "0000086720" "01448" "00109247" "00537" "Familial, autosomal dominant" "" "walk-12m; wheelchair-bound" "" "" "" "" "" "" "" "" "" "" "" "0000086721" "01448" "00109248" "00537" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086722" "05100" "00109249" "00537" "Unknown" "" "intermediate; ambulatory with assistive devices (19y); wheelchair-bound >19y" "" "" "" "" "" "" "" "" "" "" "" "0000086723" "05100" "00109250" "00537" "Isolated (sporadic)" "" "severe, early onset; never walked; wheelchair-bound 3y" "" "" "" "" "" "" "" "" "" "" "" "0000086724" "00198" "00109251" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086725" "05100" "00109252" "00537" "Isolated (sporadic)" "" "part time wheelchair (17y); 8y-first wheelchair use; walk-24m; wheelchair-bound >17y" "" "" "" "" "" "" "" "" "" "" "" "0000086726" "01448" "00109253" "00537" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086727" "01448" "00109254" "00537" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086728" "00198" "00109255" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086729" "05100" "00109256" "00537" "Familial, autosomal recessive" "" "ambulatory with assistive devices (5y); walk-18m; wheelchair-bound >5y" "" "" "" "" "" "" "" "" "" "" "" "0000086730" "00000" "00109257" "00537" "Isolated (sporadic)" "" "clinically unaffected" "" "" "" "" "" "" "" "" "" "" "" "0000086735" "05100" "00109262" "00537" "Isolated (sporadic)" "" "intermediate; walk-18m; wheelchair-bound >6y" "" "" "" "" "" "" "" "" "" "" "" "0000086737" "05100" "00109264" "00537" "Isolated (sporadic)" "" "intermediate; wheelchair-bound >7y" "" "" "" "" "" "" "" "" "" "" "" "0000086738" "00198" "00109265" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086741" "05100" "00109268" "00537" "Unknown" "" "intermediate; walk-18m; wheelchair-bound >6y" "" "" "" "" "" "" "" "" "" "" "" "0000086742" "00198" "00109269" "00537" "Isolated (sporadic)" "" "myopathy, collagen VI-NOS; walk-20m; wheelchair-bound >2y" "" "" "" "" "" "" "" "" "" "" "" "0000086745" "05100" "00109272" "00537" "Familial, autosomal recessive" "" "wheelchair-bound 10y" "" "" "" "" "" "" "" "" "" "" "" "0000086765" "00198" "00109292" "00537" "Unknown" "" "myopathy, collagen VI-NOS" "" "" "" "" "" "" "" "" "" "" "" "0000086766" "00000" "00109293" "00537" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086788" "00198" "00109315" "00472" "Isolated (sporadic)" "" "myosclerosis" "" "" "" "" "" "" "" "" "" "" "" "0000086792" "05100" "00109319" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086795" "01448" "00109322" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086854" "05100" "00109381" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086855" "05100" "00109382" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086856" "05100" "00109383" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086857" "01448" "00109384" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086858" "00198" "00109385" "00472" "Isolated (sporadic)" "" "dystrophy, muscular, congenital, Ullrich (UCMD); myopathy, Bethlem (BM)" "" "" "" "" "" "" "" "" "" "" "" "0000086859" "05100" "00109386" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086860" "01448" "00109387" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086861" "01448" "00109388" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086862" "05100" "00109389" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086863" "01448" "00109390" "00472" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086864" "05100" "00109391" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086865" "01448" "00109392" "00472" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086866" "05100" "00109393" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086867" "05100" "00109394" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086868" "00000" "00109395" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086869" "01448" "00109396" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086870" "00198" "00109397" "00472" "Isolated (sporadic)" "" "dystrophy, muscular, congenital, Ullrich (UCMD); myopathy, Bethlem (BM)" "" "" "" "" "" "" "" "" "" "" "" "0000086871" "00000" "00109398" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086872" "01448" "00109399" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086873" "00198" "00109400" "00472" "Isolated (sporadic)" "" "dystrophy, muscular, congenital, Ullrich (UCMD); myopathy, Bethlem (BM)" "" "" "" "" "" "" "" "" "" "" "" "0000086874" "05100" "00109401" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086875" "01448" "00109402" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086876" "05100" "00109403" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086877" "01448" "00109404" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086878" "05100" "00109405" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086879" "01448" "00109406" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086880" "05100" "00109407" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086881" "05100" "00109408" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086882" "01448" "00109409" "00472" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086883" "05100" "00109410" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086884" "01448" "00109411" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086885" "00000" "00109412" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086886" "00000" "00109413" "00472" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000086891" "01945" "00109418" "02188" "Familial, autosomal dominant" "" "congenital arthrogryposis, bilateral hip dislocation; severe proximal weakness, distal finger hyperlaxity with long finger contractures; rigid spine; FVC 0.30" "" "" "" "" "" "" "" "" "" "" "" "0000086894" "00198" "00109421" "01715" "Familial, autosomal recessive" "" "Bethlem myopathy or Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "" "" "" "0000139594" "05126" "00174767" "00006" "Isolated (sporadic)" "41y" "onset overt symptoms adulthood; CPK raised 1.9x; progressive limb-girdle weakness; generalized muscle atrophy; scapular winging, mild distal upper limb weakness; waddling gait with knee hyperextension" "" "" "" "" "" "" "" "" "" "limb-girdle muscular dystrophy" "" "0000139595" "05126" "00174768" "00006" "Isolated (sporadic)" "14y" "onset overt symptoms childhood; CPK raised 7x; limb-girdle weakness, ambulation preserved" "" "" "" "" "" "" "" "" "" "limb-girdle muscular dystrophy" "" "0000139596" "05126" "00174769" "00006" "Isolated (sporadic)" "16y" "onset overt symptoms adolescence; CPK raised 6x; hyper-CKmia with transient heat-induced muscle stiffening; normal ambulation" "" "" "" "" "" "" "" "" "" "limb-girdle muscular dystrophy" "" "0000139612" "05126" "00174785" "00006" "Familial, autosomal recessive" "76y" "onset overt symptoms adolescence; CPK raised 7x; waddling gait from adolescence; myalgia and progression of lower limb weakness after upper respiratory tract infection in 8th decade; cardiac arrhythmias; diffuse muscle atrophy, hyperlordosis; waddling gait" "" "" "" "" "" "" "" "" "" "limb-girdle muscular dystrophy" "" "0000139621" "05126" "00174794" "00006" "Familial, autosomal recessive" "41y" "onset overt symptoms adulthood; CPK raised 22x; progressive limb-girdle weakness; diffuse muscle atrophy; waddling gait" "" "" "" "" "" "" "" "" "" "limb-girdle muscular dystrophy" "" "0000141833" "00344" "00177016" "02552" "Familial, autosomal recessive" "" "HP:0000407\r\nHP:0001285\r\nHP:0012043\r\nHP:0000565\r\nHP:0002015\r\nHP:0000276\r\nHP:0000275\r\nHP:0000286\r\nHP:0000431\r\nHP:0002705\r\nHP:0012098\r\nHP:0005257\r\nHP:0000953" "00y05m" "" "" "" "" "" "" "" "" "" "" "0000157207" "00198" "00208534" "01164" "Unknown" "" "HP:0010549 (Weakness due to upper motor neuron dysfunction); HP:0003236 (Elevated serum creatine phosphokinase)" "" "" "" "" "" "" "" "" "" "" "" "0000157241" "00198" "00208614" "01164" "Unknown" "" "HP:0001332 (Dystonia)" "" "" "" "" "" "" "" "" "" "" "" "0000157406" "00198" "00208793" "01164" "Unknown" "" "HP:0011805 (Abnormality of muscle morphology); HP:0003198 (Myopathy)" "" "" "" "" "" "" "" "" "" "" "" "0000187146" "00198" "00248145" "01164" "Unknown" "" "HP:0003198 (Myopathy); HP:0011805 (Abnormality of muscle morphology)" "" "" "" "" "" "" "" "" "" "" "" "0000187395" "00198" "00248401" "01164" "Unknown" "" "HP:0003198 (Myopathy); HP:0003560 (Muscular dystrophy)" "" "" "" "" "" "" "" "" "" "" "" "0000203681" "05121" "00265904" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000207666" "05100" "00269870" "03524" "Familial" "" "Gait disturbance HP:0001288" "" "" "" "" "" "" "" "" "" "" "" "0000209239" "05126" "00274294" "00006" "Familial, autosomal dominant" "" "elevated CK level (300\'s); muscle histology myopathic; ambulatory" "15y" "" "" "" "" "" "" "" "" "LGMD" "" "0000209240" "05126" "00274295" "00006" "Isolated (sporadic)" "" "elevated CK level (300’s); muscle histology myopathic; no cardiac/respiratory complications; WCB-hip dysplasia at birth" "2y" "" "" "" "" "" "" "" "" "LGMD" "" "0000209241" "05126" "00274296" "00006" "Isolated (sporadic)" "" "elevated CK level (900’s); muscle histology dystrophic; ambulatory" "2y" "" "" "" "" "" "" "" "" "LGMD" "" "0000222614" "00360" "00288979" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "congenital muscular dystrophy" "" "0000222624" "00360" "00288989" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "congenital muscular dystrophy" "" "0000222630" "05126" "00288995" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "LGMD" "" "0000222633" "00360" "00288998" "00006" "Unknown" "" "CMD, COLVI lookalike" "" "" "" "" "" "" "" "" "" "congenital muscular dystrophy" "" "0000222640" "00244" "00289005" "00006" "Unknown" "" "distal myopathy" "" "" "" "" "" "" "" "" "" "distal myopathy" "" "0000223114" "00198" "00295549" "01164" "Unknown" "" "Abnormality of muscle physiology (HP:0011804); Abnormality of the musculature of the upper limbs (HP:0001446); Abnormality of the palate (HP:0000174); Dysphagia (HP:0002015); Myopathic facies (HP:0002058); High palate (HP:0000218); Elevated serum creatine phosphokinase (HP:0003236); Axial muscle weakness (HP:0003327); Abnormal levels of creatine kinase in blood (HP:0040081)" "" "" "" "" "" "" "" "" "" "" "" "0000224074" "00198" "00296673" "01164" "Unknown" "" "Abnormality of muscle morphology (HP:0011805); Myopathy (HP:0003198)" "" "" "" "" "" "" "" "" "" "" "" "0000224266" "00198" "00296869" "01164" "Unknown" "" "Muscular dystrophy (HP:0003560)" "" "" "" "" "" "" "" "" "" "" "" "0000233111" "00198" "00307312" "01164" "Unknown" "" "Myopathy (HP:0003198)" "" "" "" "" "" "" "" "" "" "" "" "0000236382" "00198" "00311127" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "movement disorder" "" "0000251679" "05121" "00333493" "00454" "Familial, autosomal dominant" "" "" "22y" "" "HP:0002141" "" "" "" "" "" "" "MD" "" "0000258528" "05121" "00363162" "00454" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000269488" "00198" "00374278" "00006" "Familial, autosomal dominant" "" "Motor delay and muscle weakness" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000269913" "00198" "00374703" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269914" "00198" "00374704" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000282166" "00244" "00388626" "00006" "Familial, autosomal recessive" "28y" "proximal muscle weakness; CK level 22855 IU/L; difficulty running, change in gait, wasting of calves, biceps lump; most-affected muscles: Gastrocnemius, Iliopsoas, hip adductors, hamstrings, and quadriceps" "25y" "" "" "IHC no DYSF" "" "" "" "" "" "" "" "0000282242" "00244" "00388702" "00006" "Familial, autosomal recessive" "10y" "distal muscle weakness, proximal muscle weakness; CK level 615 IU/L; Vastus lateralis muscle MRI showing “sandwich” sign; Difficulty getting up from ground and toe walking;Finger flexors and tendo-achilis contractures; Most-affected muscles: Hip extensors and adductors, ankle dorsiflexors" "4y6m" "" "" "" "" "" "" "" "" "" "" "0000285226" "05324" "00391936" "03501" "Unknown" "23y" "calf muscle hypertrophy (HP:0008981), Gowers sign (HP:0003391), difficulty climbing stairs (HP:0003551)" "15y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000285286" "05324" "00391996" "03501" "Unknown" "4y" "delayed fine motor development (HP:0010862), Gowers sign (HP:0003391), frequent falls (HP:0002359), difficulty climbing stairs (HP:0003551), proximal muscle weakness (HP:0003701)" "3y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000285298" "05324" "00392008" "03501" "Unknown" "14y" "proximal muscle weakness (HP:0003701)" "10y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000285301" "05324" "00392011" "03501" "Unknown" "9y" "" "2y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000285302" "05324" "00392012" "03501" "Unknown" "14y" "calf muscle hypertrophy (HP:0008981), Gowers sign (HP:0003391), frequent falls (HP:0002359), difficulty climbing stairs (HP:0003551), difficulty walking (HP:0002355), waddling gait (HP:0002515), proximal muscle weakness (HP:0003701)" "4y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000285319" "05324" "00392029" "03501" "Unknown" "4y" "delayed fine motor development (HP:0010862), calf muscle hypertrophy (HP:0008981), Gowers sign (HP:0003391), frequent falls (HP:0002359), difficulty climbing stairs (HP:0003551), difficulty walking (HP:0002355), waddling gait (HP:0002515), proximal muscle weakness (HP:0003701)" "3y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000285323" "05324" "00392033" "03501" "Unknown" "10y" "difficulty climbing stairs (HP:0003551), difficulty walking (HP:0002355), Gowers sign (HP:0003391), calf muscle hypertrophy (HP:0008981), proximal muscle weakness (HP:0003701), waddling gait (HP:0002515), toe walking (HP:0040083), frequent falls (HP:0002359)" "9y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000290936" "05121" "00397809" "00006" "Isolated (sporadic)" "" "mild Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290937" "05121" "00397810" "00006" "Familial, autosomal recessive" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290938" "05121" "00397811" "00006" "Isolated (sporadic)" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290939" "05121" "00397812" "00006" "Isolated (sporadic)" "" "early severe Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290940" "05121" "00397813" "00006" "Isolated (sporadic)" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290941" "05121" "00397814" "00006" "Isolated (sporadic)" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290942" "05121" "00397815" "00006" "Isolated (sporadic)" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290943" "05121" "00397816" "00006" "Isolated (sporadic)" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290944" "05121" "00397817" "00006" "Isolated (sporadic)" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290945" "05121" "00397818" "00006" "Isolated (sporadic)" "" "moderate-progressive Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000290946" "05121" "00397819" "00006" "Isolated (sporadic)" "" "mild Ullrich congenital muscular dystrophy" "" "" "" "" "" "" "" "" "UCMD1" "Ullrich congenital muscular dystrophy" "" "0000292120" "05618" "00399032" "00006" "Unknown" "" "serum CK 781 U/L" "10y" "" "" "" "" "" "" "" "" "neuromuscular disorder" "" "0000292133" "05618" "00399045" "00006" "Unknown" "" "raised serum CK 2 fold; muscle biopsy yype 1 fiber predominance" "20y-30y" "" "" "" "" "" "" "" "" "COL6-realted myopathy" "" "0000295169" "05126" "00402407" "01929" "Familial, autosomal recessive" "16y" "LGMDR22-COL6A3 related myopathy" "12y" "19y" "LGMW" "" "" "" "" "" "LGMDR22-COL6A3 related myopathy" "LGMD" "" "0000319378" "05100" "00428473" "04448" "Familial, autosomal dominant" "" "" "" "06y" "" "" "" "" "" "" "UCMD" "" "" "0000319379" "05100" "00428474" "04448" "Familial, autosomal dominant" "" "" "" "04y" "" "" "" "" "" "" "UCMD" "" "" "0000331969" "05358" "00442622" "00006" "Unknown" "" "CK 800 IU/L; MRI muscle typical; muscle biopsy dystrophy; onset childhood; weakness cervical, proximal UL and LL; contractures elbows, ankles; no scoliosis; no cutaneous alterations; reduced maximal expiratory pressure" "" "27y" "weakness" "" "" "" "" "" "BTHLM1" "Bethlem myopathy" "" "0000331970" "05358" "00442623" "00006" "Unknown" "" "CK 4000 IU/L; MRI muscle typical; muscle biopsy dystrophy, rimmed vacuoles; onset childhood; weakness proximal LL; contractures interphalangeal, ankles; no scoliosis; no cutaneous alterations; no entilatory insufficiency" "" "42y" "weakness" "" "" "" "" "" "" "Bethlem myopathy" "" "0000331971" "05358" "00442624" "00006" "Unknown" "" "CK 1000 IU/L; MRI muscle typical; no weaknes; contractures interphalangeal, ankles; no scoliosis; no cutaneous alterations; no entilatory insufficiency" "" "48y" "hyperckemia" "" "" "" "" "" "" "Bethlem myopathy" "" "0000331972" "05358" "00442625" "00006" "Unknown" "" "CK 250 IU/L; MRI muscle typical; muscle biopsy dystrophy; weakness distal UL and proximal LL; no contractures; no scoliosis; no cutaneous alterations; no entilatory insufficiency" "40y" "63y" "weakness" "" "" "" "" "" "" "Bethlem myopathy" "" "0000331973" "05358" "00442626" "00006" "Unknown" "" "CK <170 IU/L; MRI muscle typical; muscle biopsy dystrophy; weakness distal UL and proximal LL; no contractures; no scoliosis; no cutaneous alterations; no entilatory insufficiency" "64y" "67y" "weakness" "" "" "" "" "" "" "Bethlem myopathy" "" "0000331974" "05358" "00442627" "00006" "Unknown" "" "CK 220 IU/L; MRI muscle typical; weakness proximal UL and LL; contractures interphalangeal, wrists; no scoliosis; cheloids; no entilatory insufficiency" "52y" "55y" "weakness" "" "" "" "" "" "" "Bethlem myopathy" "" "0000331975" "05358" "00442628" "00006" "Unknown" "" "CK 830 IU/L; MRI muscle typical; onset childhood; weakness distal LL; contractures interphalangeal, ankles; no scoliosis; no cutaneous alterations; no entilatory insufficiency" "" "19y" "weakness, contractures" "" "" "" "" "" "BTHLM1" "Bethlem myopathy" "" "0000331998" "05618" "00442651" "00006" "Isolated (sporadic)" "" "Hypotonia, joint contractures and joint laxity" "" "" "" "" "" "" "" "" "" "hypotonia" "" "0000331999" "05618" "00442652" "00006" "Familial, autosomal dominant" "19y" "see paper; ..., limb girdle muscle weakness with neonatal hip dysplasia and contractures of Achilles tendon and elbow; muscle biopsy: mild myopathic changes with core-like structures;" "18y" "" "" "" "" "" "" "" "" "Limb girdle muscle weakness" "" "0000332000" "05618" "00442653" "00006" "Isolated (sporadic)" "33y" "Limb girdle muscle weakness with exercise intolerance, unilateral ptosis and reduced vital capacity; muscle biopsy: type 1 fiber size predominance with presence of internal nuclei and mild necrosis; CK = 1720 U/l" "28y" "" "" "" "" "" "" "" "" "hyperCKaemie, limb girdle muscle weakness, opthalmoplegia" "" "0000332070" "05618" "00442723" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Brody syndrome" "" "0000332091" "05618" "00442744" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "exercise intolerance" "" "0000332117" "05618" "00442770" "00006" "Unknown" "" "Myopathy and cardiac conduction abormalites" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000332118" "05618" "00442771" "00006" "Unknown" "" "Exercise intolerance, cramps, hyperCKaemia, apical hypertrophic cardiomyopathy" "" "" "" "" "" "" "" "" "" "exercise intolerance" "" "0000332131" "05618" "00442784" "00006" "Unknown" "" "Muscle weakness and hypotonia" "" "" "" "" "" "" "" "" "" "muscle weakness" "" "0000333120" "00198" "00443843" "00006" "Isolated (sporadic)" "" "myopathy" "" "" "" "" "" "" "" "" "" "incidental finding" "" "0000333326" "05324" "00444069" "00006" "Unknown" "2y" "no calf hypertrophy; Gower sign positive; elevated CPK level (453 U/L); feeding difficulties; no toe walking; poor walking/running ability; poor ability climbing stairs; no waddling feet/gait; no seizure; muscle weakness; skinny legs/arms; delayed developmental milestones; no intellectual disability; no delayed speech; not hyperactive" "" "" "" "" "" "" "" "" "" "DMD" "" "0000333327" "05324" "00444070" "00006" "Familial, autosomal recessive" "" "no calf hypertrophy; Gower sign positive; elevated CPK level (5987 U/L); no feeding difficulties; no toe walking; poor walking/running ability; no difficulty climbing stairs; no waddling feet/gait; no seizure; no muscle weakness; no skinny legs/arms; normal developmental milestones; no intellectual disability; no delayed speech; not hyperactive" "" "" "" "" "" "" "" "" "" "DMD" "" "0000334266" "05358" "00445014" "04618" "Unknown" "" "difficulties to run during childhood; 55y-difficulties to walk" "08y" "55y" "" "" "" "" "" "" "BTHLM1" "Bethlem myopathy" "" "0000334277" "05358" "00445024" "04618" "Di-genic" "" "" "08y" "43y" "" "" "" "" "" "" "BTHLM1" "Bethlem myopathy" "" "0000337152" "05611" "00447962" "00006" "Familial, autosomal recessive" "" "see paper; ..., birth at term, weight 3.2kg, length 50cm, OFC 35cm; 11y-growth failure, height 149cm (<5th), weight 30kg (<5th), OFC 54.5cm; severe developmental delay; never walked; no speech; seizures; convulsions; EEG abnormal; hypotonia, spastic; MRI brain 11y-normal; no behavioural anomalies" "" "" "" "" "" "" "" "" "MRT63" "intellectual disability" "" "0000337153" "05611" "00447963" "00006" "Familial, autosomal recessive" "" "see paper; ..., birth at term, weight 3.1kg, length 49cm, OFC 34cm; 4y-growth failure, height 108cm (15th), weight 16kg (5th), OFC 47.5cm; severe developmental delay; never walked; no speech; seizures; convulsions; EEG abnormal; hypotonia, spastic; MRI brain 4y-normal; no behavioural anomalies" "" "" "" "" "" "" "" "" "MRT63" "intellectual disability" "" "0000340087" "05121" "00451031" "00006" "Familial, autosomal recessive" "08y" "see paper; ... abnormal gait; X-ray left hip dislocation, right hip subluxation/dysplasia right acetabulum; slight muscle weakness, unequal length lower limbs;mild scoliosis" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000347904" "05126" "00220287" "00006" "Unknown" "12y" "see paper; ..., muscle weakness, myopathy, toe-walker; EMG abnormal; elevated CK level" "04y" "" "" "HC Dys-rod/Dys-C presen, Dys-N weak/absent; DGCa weak/absent" "" "" "" "" "" "muscle weakness" "" "0000348009" "01273" "00460280" "00006" "Unknown" "10y-18y" "exercise intolerance; elevated CK level 1000-1200 UI/L; non-specific myopathic features; MRI muscle focal fat replacement vastus lateralis, collagen sign; EMG myopathic" "" "" "" "IHC normal sarcolemma immunostaining, normal COL6" "" "" "" "" "" "exercise intolerance" "" "0000351905" "05121" "00466542" "04892" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "UCMD1C" "Uhlrich congenital muscular dystrophy" "" "0000351906" "00244" "00466543" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "INT/BM" "intermediate/Bethlem myopthy" "" "0000351907" "00244" "00466544" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "INT/BM" "intermediate/Bethlem myopthy" "" "0000351908" "00244" "00466545" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "INT/BM" "intermediate/Bethlem myopthy" "" "0000351909" "00244" "00466546" "04892" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "BTHLM1C" "Bethlem myopthy" "" "0000351910" "00244" "00466547" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "BTHLM1C" "Bethlem myopthy" "" "0000351911" "00244" "00466548" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "BTHLM1C" "Bethlem myopthy" "" "0000351912" "00244" "00466549" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "BTHLM1C" "Bethlem myopthy" "" "0000351913" "00244" "00466550" "04892" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "BTHLM1C" "Bethlem myopthy" "" "0000352764" "05121" "00467557" "00006" "Isolated (sporadic)" "04y" "see paper; ..., speech delay, strabismus; no delayed walking, proximal weakness, waddling gait, Gowers’ Sign, calf muscle hypertrophy, intellectual disability; EMG myogenic" "01y" "" "speech delay, strabismus" "" "" "" "" "" "DMD" "" "" "0000353194" "04167" "00468042" "00006" "Familial, autosomal dominant" "" "see paper; ..., mild" "" "" "" "" "" "" "" "" "SCA29" "spinocerebellar ataxia" "" "0000353381" "00244" "00468229" "00006" "Unknown" "32y" "" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000353386" "00244" "00468234" "00006" "Unknown" "4y" "" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000353392" "00244" "00468240" "00006" "Unknown" "6y" "" "" "" "" "" "" "" "" "" "" "myopathy" "" ## Screenings ## Do not remove or alter this header ## ## Count = 794 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000054643" "00054694" "1" "01458" "01458" "2015-11-08 12:06:11" "" "" "SEQ" "DNA" "" "" "0000054647" "00054698" "1" "01458" "01458" "2015-11-08 12:06:11" "" "" "SEQ" "DNA" "" "" "0000054651" "00054702" "1" "01458" "01458" "2015-11-08 12:06:11" "" "" "SEQ" "DNA" "" "" "0000080971" "00080859" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000103525" "00102743" "1" "01955" "01955" "2017-04-04 10:11:08" "00006" "2017-04-11 15:23:32" "SEQ-NG-I" "DNA" "blood" "" "0000103537" "00103084" "1" "01955" "01955" "2017-04-04 16:24:54" "" "" "SEQ-NG-I" "RNA" "blood" "" "0000109181" "00108716" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109183" "00108718" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109185" "00108720" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109187" "00108722" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109190" "00108725" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109199" "00108734" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109200" "00108735" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109201" "00108736" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109203" "00108738" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109207" "00108742" "1" "01955" "00006" "2017-07-26 13:46:05" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000109221" "00108755" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:43" "SEQ" "DNA" "" "" "0000109223" "00108757" "1" "00449" "00006" "2005-09-15 10:35:56" "00006" "2012-11-02 20:40:46" "RT-PCR;SEQ;DHPLC" "DNA;RNA" "" "" "0000109234" "00108768" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:43" "SEQ" "DNA" "" "" "0000109238" "00108772" "1" "00449" "00006" "2005-09-15 10:39:32" "00006" "2012-11-02 20:40:44" "RT-PCR;SEQ;DHPLC" "DNA;RNA" "" "" "0000109239" "00108773" "1" "00449" "00006" "2005-09-14 08:08:01" "00006" "2012-11-02 20:40:46" "RT-PCR;SEQ;DHPLC" "DNA;RNA" "" "" "0000109240" "00108774" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:43" "SEQ" "DNA" "" "" "0000109241" "00108775" "1" "00449" "00006" "2005-09-15 10:42:19" "00006" "2012-11-02 20:40:44" "RT-PCR;SEQ;DHPLC" "DNA;RNA" "" "" "0000109265" "00108799" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109271" "00108805" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109273" "00108807" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109274" "00108808" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109275" "00108809" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109276" "00108810" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109277" "00108811" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109278" "00108812" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "RT-PCR;CSGE;SEQ" "DNA;RNA" "" "" "0000109279" "00108813" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA;RNA" "" "" "0000109280" "00108814" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA;RNA" "" "" "0000109281" "00108815" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-03-09 19:12:07" "RT-PCR;HD;SEQ" "DNA;RNA" "" "" "0000109282" "00108816" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-03-09 19:15:47" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109283" "00108817" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA;RNA" "" "" "0000109284" "00108818" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109285" "00108819" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA;RNA" "" "" "0000109286" "00108820" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109287" "00108821" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109288" "00108822" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:45" "SEQ" "DNA" "" "" "0000109289" "00108823" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109290" "00108824" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109291" "00108825" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109292" "00108826" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109293" "00108827" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109294" "00108828" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109295" "00108829" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109296" "00108830" "1" "00006" "00006" "2008-10-12 12:37:16" "00006" "2012-11-02 20:40:43" "RT-PCR;PTT;SEQ" "DNA;RNA" "" "" "0000109309" "00108843" "1" "00006" "00006" "2005-02-28 22:00:00" "00006" "2012-11-02 20:40:46" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109318" "00108852" "1" "00464" "00006" "2009-04-08 22:07:56" "00006" "2012-11-02 20:40:46" "SEQ" "DNA" "" "" "0000109329" "00108863" "1" "00464" "00006" "2010-01-29 22:25:35" "00006" "2012-11-02 20:40:46" "PCR;SEQ" "DNA" "" "" "0000109330" "00108864" "1" "00464" "00006" "2010-02-03 18:12:49" "00006" "2012-11-02 20:40:46" "PCR;SEQ" "DNA" "" "" "0000109335" "00108869" "1" "00464" "00006" "2010-08-10 18:57:06" "00006" "2012-11-02 20:40:46" "PCR;SEQ" "DNA" "" "" "0000109345" "00108879" "1" "00464" "00006" "2010-11-23 21:55:29" "00006" "2012-11-02 20:40:44" "PCR;SEQ" "DNA" "" "" "0000109346" "00108880" "1" "00464" "00006" "2010-11-23 22:01:48" "00006" "2012-11-02 20:40:46" "PCR;SEQ" "DNA" "" "" "0000109348" "00108882" "1" "00464" "00006" "2011-05-02 22:09:18" "00006" "2012-11-02 20:40:46" "PCR;SEQ" "DNA" "" "" "0000109349" "00108883" "1" "00464" "00006" "2011-08-30 22:19:14" "00006" "2012-11-02 20:40:46" "PCR;SEQ" "DNA" "" "" "0000109356" "00108890" "1" "00464" "00006" "2011-09-02 19:01:33" "00006" "2012-11-02 20:40:46" "PCR;SEQ" "DNA" "" "" "0000109360" "00108894" "1" "00464" "00006" "2011-11-29 17:52:26" "00006" "2012-11-02 20:40:46" "PCR;SEQ" "DNA" "" "" "0000109370" "00108904" "1" "00464" "00006" "2012-10-19 15:53:40" "00006" "2012-10-23 22:23:11" "PCR;SEQ" "DNA" "" "" "0000109371" "00108905" "1" "00464" "00006" "2012-10-19 16:45:59" "00006" "2012-10-23 22:25:35" "PCR;SEQ" "DNA" "" "" "0000109547" "00109081" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109548" "00109082" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109549" "00109083" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109550" "00109084" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109551" "00109085" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109552" "00109086" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109553" "00109087" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109554" "00109088" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109555" "00109089" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109556" "00109090" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109557" "00109091" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109558" "00109092" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109559" "00109093" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109560" "00109094" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109561" "00109095" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109562" "00109096" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109563" "00109097" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109564" "00109098" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109565" "00109099" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109566" "00109100" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109567" "00109101" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109568" "00109102" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109569" "00109103" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109570" "00109104" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109571" "00109105" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109572" "00109106" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109573" "00109107" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109574" "00109108" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109575" "00109109" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109576" "00109110" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109577" "00109111" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109578" "00109112" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109579" "00109113" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109580" "00109114" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109581" "00109115" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109582" "00109116" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109583" "00109117" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109584" "00109118" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109585" "00109119" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109586" "00109120" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109587" "00109121" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109588" "00109122" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109589" "00109123" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109590" "00109124" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109591" "00109125" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109592" "00109126" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109593" "00109127" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109594" "00109128" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109595" "00109129" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109596" "00109130" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109597" "00109131" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109598" "00109132" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109599" "00109133" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109600" "00109134" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109601" "00109135" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109602" "00109136" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109603" "00109137" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109604" "00109138" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109605" "00109139" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109606" "00109140" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109607" "00109141" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109608" "00109142" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109609" "00109143" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109610" "00109144" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109611" "00109145" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109612" "00109146" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109613" "00109147" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109614" "00109148" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109615" "00109149" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109616" "00109150" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109617" "00109151" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109618" "00109152" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109619" "00109153" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109620" "00109154" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109621" "00109155" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109622" "00109156" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109623" "00109157" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109624" "00109158" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109625" "00109159" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109626" "00109160" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109627" "00109161" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109628" "00109162" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109629" "00109163" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109630" "00109164" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109631" "00109165" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109632" "00109166" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109633" "00109167" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109634" "00109168" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109635" "00109169" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109636" "00109170" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109637" "00109171" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109638" "00109172" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109639" "00109173" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109640" "00109174" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109641" "00109175" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109642" "00109176" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109643" "00109177" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109644" "00109178" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109645" "00109179" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109646" "00109180" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109647" "00109181" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109648" "00109182" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109649" "00109183" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109650" "00109184" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109651" "00109185" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109652" "00109186" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109653" "00109187" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109654" "00109188" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109655" "00109189" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109656" "00109190" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109657" "00109191" "1" "00430" "00006" "2012-10-22 12:56:06" "" "" "SEQ" "DNA" "" "" "0000109684" "00109218" "1" "00537" "00006" "2013-08-01 16:51:22" "" "" "PCR;SEQ" "DNA" "" "" "0000109693" "00109227" "1" "00537" "00006" "2013-08-01 16:51:22" "" "" "PCR;SEQ" "DNA" "" "" "0000109701" "00109235" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109710" "00109244" "1" "00537" "00006" "2013-08-01 16:54:59" "" "" "PCR;SEQ" "DNA" "" "" "0000109712" "00109246" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109713" "00109247" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109714" "00109248" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109715" "00109249" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109716" "00109250" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109717" "00109251" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109718" "00109252" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109719" "00109253" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109720" "00109254" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109721" "00109255" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109722" "00109256" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109723" "00109257" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109728" "00109262" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109730" "00109264" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109731" "00109265" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109734" "00109268" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109735" "00109269" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109738" "00109272" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109758" "00109292" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109759" "00109293" "1" "00537" "00006" "2013-08-01 16:57:33" "" "" "PCR;SEQ" "DNA" "" "" "0000109781" "00109315" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109785" "00109319" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109788" "00109322" "1" "00472" "00006" "2014-03-23 12:57:16" "" "" "SEQ" "DNA" "" "" "0000109847" "00109381" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109848" "00109382" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109849" "00109383" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109850" "00109384" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109851" "00109385" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109852" "00109386" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109853" "00109387" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109854" "00109388" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109855" "00109389" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109856" "00109390" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109857" "00109391" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109858" "00109392" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109859" "00109393" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109860" "00109394" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109861" "00109395" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109862" "00109396" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109863" "00109397" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109864" "00109398" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109865" "00109399" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109866" "00109400" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000109867" "00109401" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109868" "00109402" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109869" "00109403" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109870" "00109404" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109871" "00109405" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109872" "00109406" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109873" "00109407" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109874" "00109408" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109875" "00109409" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109876" "00109410" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109877" "00109411" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109878" "00109412" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109879" "00109413" "1" "00472" "00006" "2014-03-23 13:26:46" "" "" "SEQ" "DNA" "" "" "0000109884" "00109418" "1" "02188" "00006" "2014-07-10 10:11:45" "00006" "2014-07-11 16:17:09" "PCR" "DNA" "" "" "0000109887" "00109421" "1" "01715" "00006" "2016-02-19 00:42:46" "00006" "2016-03-18 13:10:02" "SEQ-NG-I" "DNA" "" "" "0000175658" "00174767" "1" "00006" "00006" "2018-08-10 19:10:48" "" "" "SEQ-NG" "DNA" "" "WES" "0000175659" "00174768" "1" "00006" "00006" "2018-08-10 19:10:48" "" "" "SEQ-NG" "DNA" "" "WES" "0000175660" "00174769" "1" "00006" "00006" "2018-08-10 19:10:48" "" "" "SEQ-NG" "DNA" "" "WES" "0000175676" "00174785" "1" "00006" "00006" "2018-08-10 19:10:48" "" "" "SEQ-NG" "DNA" "" "WES" "0000175685" "00174794" "1" "00006" "00006" "2018-08-10 19:10:48" "" "" "SEQ-NG" "DNA" "" "WES" "0000177908" "00177016" "1" "02552" "02552" "2018-08-16 12:13:33" "02552" "2018-08-16 12:19:22" "SEQ-NG-I" "DNA" "blood" "WES" "0000208997" "00207952" "1" "01164" "01164" "2018-12-04 16:43:50" "" "" "SEQ-NG" "DNA" "" "" "0000209582" "00208534" "1" "01164" "01164" "2018-12-10 11:04:21" "" "" "SEQ-NG" "DNA" "" "" "0000209663" "00208614" "1" "01164" "01164" "2018-12-12 12:06:07" "" "" "SEQ-NG" "DNA" "" "" "0000209842" "00208793" "1" "01164" "01164" "2018-12-17 10:13:33" "" "" "SEQ-NG" "DNA" "" "" "0000220496" "00219425" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220567" "00219496" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220592" "00219521" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220601" "00219530" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220608" "00219537" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220610" "00219539" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220613" "00219542" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220622" "00219551" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220625" "00219554" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220629" "00219558" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220642" "00219571" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220662" "00219591" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220665" "00219594" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220667" "00219596" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220668" "00219597" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220699" "00219628" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220711" "00219640" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220713" "00219642" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220721" "00219650" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220731" "00219660" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220733" "00219662" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220746" "00219675" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220767" "00219696" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220778" "00219707" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220793" "00219722" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220805" "00219734" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220811" "00219740" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220827" "00219756" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220835" "00219764" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220842" "00219771" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220844" "00219773" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220851" "00219780" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220857" "00219786" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220860" "00219789" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220864" "00219793" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220893" "00219822" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220894" "00219823" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220897" "00219826" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220902" "00219831" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220926" "00219855" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220930" "00219859" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220937" "00219866" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220953" "00219882" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220965" "00219894" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220968" "00219897" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220970" "00219899" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220971" "00219900" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220973" "00219902" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220978" "00219907" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220981" "00219910" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000220994" "00219923" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221009" "00219938" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221018" "00219947" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221019" "00219948" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221020" "00219949" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221031" "00219960" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221034" "00219963" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221044" "00219973" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221045" "00219974" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221046" "00219975" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221049" "00219978" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221050" "00219979" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221054" "00219983" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221058" "00219987" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221074" "00220003" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221075" "00220004" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221098" "00220027" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221102" "00220031" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221112" "00220041" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221117" "00220046" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221118" "00220047" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221122" "00220051" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221128" "00220057" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221134" "00220063" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221141" "00220070" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221142" "00220071" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221143" "00220072" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221145" "00220074" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221147" "00220076" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221151" "00220080" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221180" "00220109" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221183" "00220112" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221184" "00220113" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221194" "00220123" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221201" "00220130" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221209" "00220138" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221217" "00220146" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221223" "00220152" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221230" "00220159" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221232" "00220161" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221233" "00220162" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221237" "00220166" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221258" "00220187" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221259" "00220188" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221264" "00220193" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221267" "00220196" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221284" "00220213" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221288" "00220217" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221302" "00220231" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221307" "00220236" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221316" "00220245" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221321" "00220250" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221330" "00220259" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221334" "00220263" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221342" "00220271" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221348" "00220277" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221349" "00220278" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221355" "00220284" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221358" "00220287" "1" "00430" "00006" "2019-02-06 14:15:12" "00006" "2025-01-19 14:34:19" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "targeted gene panel" "0000221367" "00220296" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221379" "00220308" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221394" "00220323" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221404" "00220333" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221406" "00220335" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221438" "00220367" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221442" "00220371" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221451" "00220380" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221481" "00220410" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221493" "00220422" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221500" "00220429" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221510" "00220439" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221513" "00220442" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221527" "00220456" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221531" "00220460" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221535" "00220464" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221542" "00220471" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221545" "00220474" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221547" "00220476" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221549" "00220478" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221558" "00220487" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221564" "00220493" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221579" "00220508" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221582" "00220511" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221586" "00220515" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221594" "00220523" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221595" "00220524" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221603" "00220532" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221609" "00220538" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221615" "00220544" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221618" "00220547" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221622" "00220551" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221631" "00220560" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221643" "00220572" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221653" "00220582" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221660" "00220589" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221682" "00220611" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221683" "00220612" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221701" "00220630" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221705" "00220634" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221706" "00220635" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221710" "00220639" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221718" "00220647" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221725" "00220654" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221738" "00220667" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221757" "00220686" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221759" "00220688" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221762" "00220691" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221775" "00220704" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221776" "00220705" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221788" "00220717" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221791" "00220720" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221807" "00220736" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221829" "00220758" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221846" "00220775" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221854" "00220783" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221855" "00220784" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221859" "00220788" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221873" "00220802" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221874" "00220803" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221886" "00220815" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221887" "00220816" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221889" "00220818" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221895" "00220824" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221899" "00220828" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221900" "00220829" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221919" "00220848" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221925" "00220854" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221931" "00220860" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221933" "00220862" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221943" "00220872" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221963" "00220892" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221965" "00220894" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221972" "00220901" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221980" "00220909" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221984" "00220913" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221993" "00220922" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221995" "00220924" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000221996" "00220925" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222025" "00220954" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222028" "00220957" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222039" "00220968" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222041" "00220970" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222043" "00220972" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222062" "00220991" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222069" "00220998" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222076" "00221005" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222078" "00221007" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222082" "00221011" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222092" "00221021" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222102" "00221031" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222112" "00221041" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222120" "00221049" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222124" "00221053" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222126" "00221055" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222137" "00221066" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222140" "00221069" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222142" "00221071" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222146" "00221075" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222169" "00221098" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222176" "00221105" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222177" "00221106" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222188" "00221117" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222205" "00221134" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222214" "00221143" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222224" "00221153" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222232" "00221161" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222233" "00221162" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222249" "00221178" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222253" "00221182" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222257" "00221186" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222261" "00221190" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222272" "00221201" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222276" "00221205" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222277" "00221206" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222313" "00221242" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222321" "00221250" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222322" "00221251" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222324" "00221253" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222363" "00221292" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222387" "00221316" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222395" "00221324" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222408" "00221337" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222416" "00221345" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222446" "00221375" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222459" "00221388" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222460" "00221389" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222465" "00221394" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222473" "00221402" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222493" "00221422" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222495" "00221424" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222500" "00221429" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222525" "00221454" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222529" "00221458" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222531" "00221460" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222554" "00221483" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222557" "00221486" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222581" "00221510" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222595" "00221524" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222617" "00221546" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222619" "00221548" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222621" "00221550" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222624" "00221553" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222626" "00221555" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222630" "00221559" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222634" "00221563" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222641" "00221570" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222644" "00221573" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222667" "00221596" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222670" "00221599" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222674" "00221603" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222685" "00221614" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222686" "00221615" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222691" "00221620" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222693" "00221622" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222695" "00221624" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222696" "00221625" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222713" "00221642" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222723" "00221652" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222728" "00221657" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222730" "00221659" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222734" "00221663" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222738" "00221667" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222742" "00221671" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222745" "00221674" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222749" "00221678" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222754" "00221683" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222768" "00221697" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222782" "00221711" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222783" "00221712" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222784" "00221713" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222802" "00221731" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222804" "00221733" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222809" "00221738" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222817" "00221746" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222835" "00221764" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222842" "00221771" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222848" "00221777" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222852" "00221781" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222853" "00221782" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222860" "00221789" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222862" "00221791" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222865" "00221794" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222872" "00221801" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222873" "00221802" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222874" "00221803" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222882" "00221811" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222885" "00221814" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222887" "00221816" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222894" "00221823" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222897" "00221826" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222902" "00221831" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222907" "00221836" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222909" "00221838" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222914" "00221843" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222918" "00221847" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222919" "00221848" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222926" "00221855" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222935" "00221864" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222939" "00221868" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222946" "00221875" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222954" "00221883" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222956" "00221885" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222963" "00221892" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222970" "00221899" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222971" "00221900" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222972" "00221901" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222974" "00221903" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222975" "00221904" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222978" "00221907" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222980" "00221909" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222988" "00221917" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222990" "00221919" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000222992" "00221921" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223007" "00221936" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223009" "00221938" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223015" "00221944" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223019" "00221948" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223021" "00221950" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223036" "00221965" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223040" "00221969" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223058" "00221987" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223063" "00221992" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223072" "00222001" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223075" "00222004" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223078" "00222007" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223079" "00222008" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223080" "00222009" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223088" "00222017" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223092" "00222021" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223105" "00222034" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223120" "00222049" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223124" "00222053" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223126" "00222055" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223127" "00222056" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223136" "00222065" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223143" "00222072" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223144" "00222073" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223169" "00222098" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223172" "00222101" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223189" "00222118" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223194" "00222123" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223200" "00222129" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223203" "00222132" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223217" "00222146" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223221" "00222150" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223225" "00222154" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223231" "00222160" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223236" "00222165" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223238" "00222167" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223247" "00222176" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223257" "00222186" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223271" "00222200" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223278" "00222207" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223294" "00222223" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223297" "00222226" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223299" "00222228" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223300" "00222229" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223308" "00222237" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223315" "00222244" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223317" "00222246" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223337" "00222266" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223339" "00222268" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223341" "00222270" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223354" "00222283" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223358" "00222287" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223360" "00222289" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223372" "00222301" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223376" "00222305" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223378" "00222307" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223396" "00222325" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223413" "00222342" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223416" "00222345" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223418" "00222347" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223421" "00222350" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223435" "00222364" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223446" "00222375" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223461" "00222390" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223465" "00222394" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223467" "00222396" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223470" "00222399" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223477" "00222406" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223482" "00222411" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223484" "00222413" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223497" "00222426" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223498" "00222427" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223507" "00222436" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223517" "00222446" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223521" "00222450" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223539" "00222468" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223550" "00222479" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223551" "00222480" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223556" "00222485" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223566" "00222495" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223570" "00222499" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223585" "00222514" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223588" "00222517" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223591" "00222520" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223602" "00222531" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223604" "00222533" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223605" "00222534" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223608" "00222537" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223628" "00222557" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223638" "00222567" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223641" "00222570" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223643" "00222572" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223644" "00222573" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223655" "00222584" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223663" "00222592" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223666" "00222595" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223674" "00222603" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223678" "00222607" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223680" "00222609" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223695" "00222624" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223699" "00222628" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223704" "00222633" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223722" "00222651" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223727" "00222656" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223735" "00222664" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223736" "00222665" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223753" "00222682" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223755" "00222684" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223760" "00222689" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223773" "00222702" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223778" "00222707" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223782" "00222711" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223786" "00222715" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223807" "00222736" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223810" "00222739" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000223811" "00222740" "1" "00430" "00006" "2019-02-06 14:15:12" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000249250" "00248145" "1" "01164" "01164" "2019-07-19 11:43:17" "" "" "SEQ-NG-S" "DNA" "" "" "0000249505" "00248401" "1" "01164" "01164" "2019-07-23 17:05:24" "" "" "SEQ-NG-S" "DNA" "" "" "0000267024" "00265904" "1" "00006" "00006" "2019-10-11 12:24:56" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000271023" "00269870" "1" "03524" "03524" "2019-12-10 09:27:46" "" "" "SEQ-NG" "DNA" "" "" "0000275450" "00274294" "1" "00006" "00006" "2019-12-28 16:38:54" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000275451" "00274295" "1" "00006" "00006" "2019-12-28 16:38:54" "" "" "SEQ;SEQ-NG" "DNA" "" "WES trio" "0000275452" "00274296" "1" "00006" "00006" "2019-12-28 16:38:54" "" "" "SEQ;SEQ-NG" "DNA" "" "WES trio" "0000290147" "00288979" "1" "00006" "00006" "2020-02-24 21:34:22" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000290157" "00288989" "1" "00006" "00006" "2020-02-24 21:34:22" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000290163" "00288995" "1" "00006" "00006" "2020-02-24 21:34:22" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000290166" "00288998" "1" "00006" "00006" "2020-02-24 21:34:22" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000290173" "00289005" "1" "00006" "00006" "2020-02-24 21:34:22" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000293816" "00292648" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293817" "00292649" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293818" "00292650" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293819" "00292651" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293820" "00292652" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293821" "00292653" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293822" "00292654" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000293823" "00292655" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296347" "00295179" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296719" "00295549" "1" "01164" "01164" "2020-03-18 10:47:39" "" "" "SEQ-NG-S" "DNA" "" "" "0000297783" "00296673" "1" "01164" "01164" "2020-04-10 08:50:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000297979" "00296869" "1" "01164" "01164" "2020-04-14 14:31:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000305932" "00304803" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305933" "00304804" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000308453" "00307312" "1" "01164" "01164" "2020-08-10 12:22:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000312281" "00311127" "1" "00006" "00006" "2020-09-18 16:31:30" "" "" "SEQ" "DNA" "" "" "0000315348" "00314175" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315349" "00314176" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315350" "00314177" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315351" "00314178" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315352" "00314179" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315353" "00314180" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315354" "00314181" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315355" "00314182" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315356" "00314183" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315357" "00314184" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315358" "00314185" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315359" "00314186" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000334719" "00333493" "1" "00454" "00454" "2021-02-25 21:08:28" "" "" "SEQ-NG" "DNA" "blood" "WES, insilico gen panel" "0000364390" "00363162" "1" "00454" "00008" "2021-04-24 06:26:29" "" "" "SEQ-NG-I" "DNA" "BLOOD" "" "0000375472" "00374278" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375897" "00374703" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375898" "00374704" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000389868" "00388626" "1" "00006" "00006" "2021-11-04 20:51:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000389944" "00388702" "1" "00006" "00006" "2021-11-04 20:51:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000393178" "00391936" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, COL6A3, LAMA2, BAG3, COL6A1, COL6A2, SGCB, CAPN3, DYSF, FLNC, SGCA, SGCD, SGCG, PLEC, SYNE1" "0000393238" "00391996" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, COL6A3, SYNE1" "0000393250" "00392008" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, COL6A3, COL12A1" "0000393253" "00392011" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, SYNE1, COL6A3" "0000393254" "00392012" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, COL6A3, COL6A3" "0000393271" "00392029" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, COL6A3" "0000393275" "00392033" "1" "03501" "00006" "2021-11-19 15:49:45" "03501" "2022-02-10 09:47:03" "SEQ-NG" "DNA" "Nil" "screened DMD, COL6A3" "0000399051" "00397809" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399052" "00397810" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399053" "00397811" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399054" "00397812" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399055" "00397813" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399056" "00397814" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399057" "00397815" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399058" "00397816" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399059" "00397817" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399060" "00397818" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000399061" "00397819" "1" "00006" "00006" "2021-12-29 09:59:04" "" "" "SEQ" "DNA" "" "COL6A1, COL6A2, COL6A3" "0000400277" "00399032" "1" "00006" "00006" "2022-01-15 16:40:49" "" "" "SEQ;SEQ-NG" "DNA" "" "166-gene panel" "0000400290" "00399045" "1" "00006" "00006" "2022-01-15 16:40:49" "" "" "SEQ;SEQ-NG" "DNA" "" "166-gene panel" "0000403648" "00402407" "1" "01929" "01929" "2022-02-06 01:20:01" "" "" "SEQ-NG-I" "DNA" "Saliva" "Invitae Comprehensive Neuromuscular Panel" "0000427796" "00426476" "1" "03652" "03652" "2022-11-30 19:07:50" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000429885" "00428473" "1" "04448" "04448" "2023-01-04 10:34:04" "" "" "SEQ-NG" "DNA" "blood" "" "0000429886" "00428474" "1" "04448" "04448" "2023-01-04 10:41:12" "" "" "SEQ-NG" "DNA" "blood" "" "0000429887" "00428475" "1" "04448" "04448" "2023-01-04 10:45:03" "" "" "SEQ-NG" "DNA" "blood" "" "0000444106" "00442622" "1" "00006" "00006" "2023-11-23 09:55:12" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000444107" "00442623" "1" "00006" "00006" "2023-11-23 09:55:12" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000444108" "00442624" "1" "00006" "00006" "2023-11-23 09:55:12" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000444109" "00442625" "1" "00006" "00006" "2023-11-23 09:55:12" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000444110" "00442626" "1" "00006" "00006" "2023-11-23 09:55:12" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000444111" "00442627" "1" "00006" "00006" "2023-11-23 09:55:12" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000444112" "00442628" "1" "00006" "00006" "2023-11-23 09:55:12" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000444135" "00442651" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444136" "00442652" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444137" "00442653" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444207" "00442723" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000444228" "00442744" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000444254" "00442770" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000444255" "00442771" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000444268" "00442784" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000445340" "00443843" "1" "00006" "00006" "2023-12-03 12:04:23" "" "" "arraySNP;SEQ-NG" "DNA" "" "gene panel" "0000445566" "00444069" "1" "00006" "00006" "2023-12-11 17:21:28" "" "" "PCRm;SEQ-NG" "DNA" "" "WES" "0000445567" "00444070" "1" "00006" "00006" "2023-12-11 17:21:28" "" "" "PCRm;SEQ-NG" "DNA" "" "WES" "0000446584" "00445014" "1" "04618" "04618" "2023-12-29 16:20:19" "" "" "SEQ-NG" "DNA" "" "" "0000446594" "00445024" "1" "04618" "04618" "2023-12-29 17:24:24" "" "" "SEQ-NG" "DNA" "" "" "0000449535" "00447962" "1" "00006" "00006" "2024-02-05 12:59:22" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000449536" "00447963" "1" "00006" "00006" "2024-02-05 12:59:22" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000452630" "00451031" "1" "00006" "00006" "2024-05-31 09:43:25" "" "" "PCRq;SEQ;SEQ-NG" "DNA" "" "WES" "0000461911" "00460280" "1" "00006" "00006" "2025-01-22 12:23:09" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000468205" "00466542" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468206" "00466543" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468207" "00466544" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468208" "00466545" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468209" "00466546" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468210" "00466547" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468211" "00466548" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468212" "00466549" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000468213" "00466550" "1" "04892" "00006" "2025-09-09 13:30:20" "" "" "SEQ-NG" "DNA" "" "" "0000469221" "00467557" "1" "00006" "00006" "2025-10-21 14:18:26" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000469708" "00468042" "1" "00006" "00006" "2025-11-07 10:18:28" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000469895" "00468229" "1" "00006" "00006" "2025-11-07 14:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000469900" "00468234" "1" "00006" "00006" "2025-11-07 14:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000469906" "00468240" "1" "00006" "00006" "2025-11-07 14:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 320 "{{screeningid}}" "{{geneid}}" "0000054643" "COL6A3" "0000054647" "COL6A3" "0000054651" "COL6A3" "0000080971" "COL6A3" "0000109181" "COL6A3" "0000109183" "COL6A3" "0000109185" "COL6A3" "0000109187" "COL6A3" "0000109190" "COL6A3" "0000109199" "COL6A3" "0000109200" "COL6A3" "0000109201" "COL6A3" "0000109203" "COL6A3" "0000109207" "COL6A3" "0000109221" "COL6A1" "0000109221" "COL6A3" "0000109223" "COL6A1" "0000109223" "COL6A2" "0000109223" "COL6A3" "0000109234" "COL6A1" "0000109234" "COL6A3" "0000109238" "COL6A1" "0000109238" "COL6A2" "0000109238" "COL6A3" "0000109239" "COL6A1" "0000109239" "COL6A2" "0000109239" "COL6A3" "0000109240" "COL6A1" "0000109240" "COL6A3" "0000109241" "COL6A1" "0000109241" "COL6A2" "0000109241" "COL6A3" "0000109265" "COL6A2" "0000109265" "COL6A3" "0000109271" "COL6A3" "0000109273" "COL6A3" "0000109274" "COL6A3" "0000109275" "COL6A3" "0000109276" "COL6A3" "0000109277" "COL6A3" "0000109278" "COL6A3" "0000109279" "COL6A3" "0000109280" "COL6A3" "0000109281" "COL6A3" "0000109282" "COL6A3" "0000109283" "COL6A3" "0000109284" "COL6A3" "0000109285" "COL6A3" "0000109286" "COL6A3" "0000109287" "COL6A3" "0000109288" "COL6A3" "0000109289" "COL6A1" "0000109289" "COL6A2" "0000109289" "COL6A3" "0000109290" "COL6A1" "0000109290" "COL6A2" "0000109290" "COL6A3" "0000109291" "COL6A1" "0000109291" "COL6A2" "0000109291" "COL6A3" "0000109292" "COL6A1" "0000109292" "COL6A2" "0000109292" "COL6A3" "0000109293" "COL6A1" "0000109293" "COL6A2" "0000109293" "COL6A3" "0000109294" "COL6A1" "0000109294" "COL6A2" "0000109294" "COL6A3" "0000109295" "COL6A1" "0000109295" "COL6A2" "0000109295" "COL6A3" "0000109296" "COL6A1" "0000109296" "COL6A2" "0000109296" "COL6A3" "0000109309" "COL6A3" "0000109318" "COL6A3" "0000109329" "COL6A3" "0000109330" "COL6A3" "0000109335" "COL6A3" "0000109345" "COL6A1" "0000109345" "COL6A3" "0000109346" "COL6A3" "0000109348" "COL6A3" "0000109349" "COL6A3" "0000109356" "COL6A3" "0000109360" "COL6A3" "0000109370" "COL6A3" "0000109371" "COL6A3" "0000109547" "COL6A3" "0000109548" "COL6A3" "0000109549" "COL6A3" "0000109550" "COL6A3" "0000109551" "COL6A3" "0000109552" "COL6A3" "0000109553" "COL6A3" "0000109554" "COL6A3" "0000109555" "COL6A3" "0000109556" "COL6A3" "0000109557" "COL6A3" "0000109558" "COL6A3" "0000109559" "COL6A3" "0000109560" "COL6A3" "0000109561" "COL6A3" "0000109562" "COL6A3" "0000109563" "COL6A3" "0000109564" "COL6A3" "0000109565" "COL6A3" "0000109566" "COL6A3" "0000109567" "COL6A3" "0000109568" "COL6A3" "0000109569" "COL6A3" "0000109570" "COL6A3" "0000109571" "COL6A3" "0000109572" "COL6A3" "0000109573" "COL6A3" "0000109574" "COL6A3" "0000109575" "COL6A3" "0000109576" "COL6A3" "0000109577" "COL6A3" "0000109578" "COL6A3" "0000109579" "COL6A3" "0000109580" "COL6A3" "0000109581" "COL6A3" "0000109582" "COL6A3" "0000109583" "COL6A3" "0000109584" "COL6A3" "0000109585" "COL6A3" "0000109586" "COL6A3" "0000109587" "COL6A3" "0000109588" "COL6A3" "0000109589" "COL6A3" "0000109590" "COL6A3" "0000109591" "COL6A3" "0000109592" "COL6A3" "0000109593" "COL6A3" "0000109594" "COL6A3" "0000109595" "COL6A3" "0000109596" "COL6A3" "0000109597" "COL6A3" "0000109598" "COL6A3" "0000109599" "COL6A3" "0000109600" "COL6A3" "0000109601" "COL6A3" "0000109602" "COL6A3" "0000109603" "COL6A3" "0000109604" "COL6A3" "0000109605" "COL6A3" "0000109606" "COL6A3" "0000109607" "COL6A3" "0000109608" "COL6A3" "0000109609" "COL6A3" "0000109610" "COL6A3" "0000109611" "COL6A3" "0000109612" "COL6A3" "0000109613" "COL6A3" "0000109614" "COL6A3" "0000109615" "COL6A3" "0000109616" "COL6A3" "0000109617" "COL6A3" "0000109618" "COL6A3" "0000109619" "COL6A3" "0000109620" "COL6A3" "0000109621" "COL6A3" "0000109622" "COL6A3" "0000109623" "COL6A3" "0000109624" "COL6A3" "0000109625" "COL6A3" "0000109626" "COL6A3" "0000109627" "COL6A3" "0000109628" "COL6A3" "0000109629" "COL6A3" "0000109630" "COL6A3" "0000109631" "COL6A3" "0000109632" "COL6A3" "0000109633" "COL6A3" "0000109634" "COL6A3" "0000109635" "COL6A3" "0000109636" "COL6A3" "0000109637" "COL6A3" "0000109638" "COL6A3" "0000109639" "COL6A3" "0000109640" "COL6A3" "0000109641" "COL6A3" "0000109642" "COL6A3" "0000109643" "COL6A3" "0000109644" "COL6A3" "0000109645" "COL6A3" "0000109646" "COL6A3" "0000109647" "COL6A3" "0000109648" "COL6A3" "0000109649" "COL6A3" "0000109650" "COL6A3" "0000109651" "COL6A3" "0000109652" "COL6A3" "0000109653" "COL6A3" "0000109654" "COL6A3" "0000109655" "COL6A3" "0000109656" "COL6A3" "0000109657" "COL6A3" "0000109684" "COL6A1" "0000109684" "COL6A3" "0000109693" "COL6A1" "0000109693" "COL6A3" "0000109701" "COL6A1" "0000109701" "COL6A3" "0000109710" "COL6A2" "0000109710" "COL6A3" "0000109712" "COL6A3" "0000109713" "COL6A3" "0000109714" "COL6A3" "0000109715" "COL6A3" "0000109716" "COL6A3" "0000109717" "COL6A3" "0000109718" "COL6A3" "0000109719" "COL6A3" "0000109720" "COL6A3" "0000109721" "COL6A3" "0000109722" "COL6A3" "0000109723" "COL6A3" "0000109728" "COL6A3" "0000109730" "COL6A3" "0000109731" "COL6A3" "0000109734" "COL6A1" "0000109734" "COL6A3" "0000109735" "COL6A1" "0000109735" "COL6A3" "0000109738" "COL6A3" "0000109758" "COL6A3" "0000109759" "COL6A3" "0000109781" "COL6A3" "0000109785" "COL6A3" "0000109788" "COL6A1" "0000109788" "COL6A3" "0000109847" "COL6A3" "0000109848" "COL6A3" "0000109849" "COL6A3" "0000109850" "COL6A3" "0000109851" "COL6A3" "0000109852" "COL6A3" "0000109853" "COL6A3" "0000109854" "COL6A3" "0000109855" "COL6A3" "0000109856" "COL6A3" "0000109857" "COL6A3" "0000109858" "COL6A3" "0000109859" "COL6A3" "0000109860" "COL6A3" "0000109861" "COL6A3" "0000109862" "COL6A3" "0000109863" "COL6A3" "0000109864" "COL6A3" "0000109865" "COL6A3" "0000109866" "COL6A3" "0000109867" "COL6A3" "0000109868" "COL6A3" "0000109869" "COL6A3" "0000109870" "COL6A3" "0000109871" "COL6A3" "0000109872" "COL6A3" "0000109873" "COL6A3" "0000109874" "COL6A3" "0000109875" "COL6A3" "0000109876" "COL6A3" "0000109877" "COL6A3" "0000109878" "COL6A3" "0000109879" "COL6A3" "0000109884" "COL6A3" "0000109887" "COL6A3" "0000267024" "COL6A3" "0000271023" "COL6A3" "0000275450" "COL6A3" "0000275451" "COL6A3" "0000275452" "COL6A3" "0000290147" "COL6A3" "0000290157" "COL6A3" "0000290163" "MYH7" "0000290166" "COL6A3" "0000290173" "COL6A3" "0000315348" "COL6A3" "0000315349" "COL6A3" "0000315350" "COL6A3" "0000315351" "COL6A3" "0000315352" "COL6A3" "0000315353" "COL6A3" "0000315354" "COL6A3" "0000315355" "COL6A3" "0000315356" "COL6A3" "0000315357" "COL6A3" "0000315358" "COL6A3" "0000315359" "COL6A3" "0000334719" "COL6A3" "0000364390" "COL6A3" "0000375472" "COL6A1" "0000375897" "COL6A3" "0000375898" "COL6A3" "0000393275" "DMD" "0000393275" "SGCA" "0000393275" "SGCB" "0000393275" "SGCD" "0000393275" "SGCE" "0000393275" "SGCG" "0000399051" "COL6A3" "0000399052" "COL6A3" "0000399053" "COL6A3" "0000399054" "COL6A3" "0000399055" "COL6A3" "0000399056" "COL6A3" "0000399057" "COL6A3" "0000399058" "COL6A3" "0000399059" "COL6A3" "0000399060" "COL6A3" "0000399061" "COL6A3" "0000429885" "COL6A3" "0000429886" "COL6A3" "0000429887" "COL6A3" "0000445566" "DMD" "0000445567" "DMD" "0000452630" "COL6A3" "0000469221" "DMD" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 1496 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000084593" "1" "90" "2" "238269763" "238269763" "subst" "0" "01458" "COL6A3_000012" "g.238269763C>T" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "De novo" "" "" "0" "" "" "g.237361120C>T" "" "pathogenic (dominant)" "" "0000084597" "1" "90" "2" "238268030" "238268030" "subst" "0" "01458" "COL6A3_000186" "g.238268030C>A" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "De novo" "" "" "0" "" "" "g.237359387C>A" "" "pathogenic" "" "0000084601" "1" "90" "2" "238268792" "238268792" "subst" "0" "01458" "COL6A3_000152" "g.238268792C>T" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "De novo" "" "" "0" "" "" "g.237360149C>T" "" "pathogenic" "" "0000130301" "3" "70" "2" "238249424" "238249424" "del" "0" "01758" "COL6A3_000187" "g.238249424del" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "Germline" "" "" "0" "" "" "g.237340781del" "" "likely pathogenic" "ACMG" "0000166958" "1" "90" "2" "238253152" "238253152" "subst" "0" "01955" "COL6A3_000189" "g.238253152C>A" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. It is not present in EXAC. Phenotype consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.237344509C>A" "" "pathogenic" "" "0000166964" "0" "70" "2" "238277602" "238277602" "subst" "2.03077E-5" "01955" "COL6A3_000188" "g.238277602C>T" "" "MYO-SEQ project" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. It is not present in EXAC. Found in combination with compound heterozygous COL6A2 variants. Phenotype consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.237368959C>T" "" "likely pathogenic" "" "0000167163" "2" "90" "2" "238256455" "238256455" "subst" "0" "01955" "COL6A3_000002" "g.238256455G>A" "" "MYO-SEQ project, UK" "" "" "The variant is reported pathogenic in ClinVar, predicted disease causing in Mutation Taster and is not present in EXAC. Phenotype is consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.237347812G>A" "" "pathogenic" "" "0000175299" "3" "70" "2" "238253214" "238253214" "subst" "0.000629523" "01955" "COL6A3_000191" "g.238253214T>C" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. Reported pathogenic in ClinVar. Phenotype consistent with COLVI myopathy. Found as a homozygous change." "Germline" "?" "" "0" "" "" "g.237344571T>C" "" "likely pathogenic" "" "0000175300" "3" "70" "2" "238253214" "238253214" "subst" "0.000629523" "01955" "COL6A3_000191" "g.238253214T>C" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. It is reported pathogenic/uncertain significance in ClinVar. Homozygous change. Phenotype consistent with COLVI myopathy." "Unknown" "?" "" "0" "" "" "g.237344571T>C" "" "likely pathogenic" "" "0000175302" "1" "70" "2" "238247656" "238247656" "subst" "0" "01955" "COL6A3_000190" "g.238247656A>T" "" "MYO-SEQ project, UK" "" "" "The variant is predicted disease causing in mutation taster. Not present in EXAC or other control populations. Reported with a damaging missense." "Unknown" "?" "" "0" "" "" "g.237339013A>T" "" "likely pathogenic" "" "0000175303" "3" "70" "2" "238253214" "238253214" "subst" "0.000629523" "01955" "COL6A3_000191" "g.238253214T>C" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. Reported pathogenic in ClinVar. Phenotype consistent with COLVI myopathy. Found as a homozygous change." "Unknown" "?" "" "0" "" "" "g.237344571T>C" "" "likely pathogenic" "" "0000175304" "0" "70" "2" "238271966" "238271966" "subst" "4.06062E-6" "01955" "COL6A3_000192" "g.238271966C>T" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. Phenotype consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.237363323C>T" "" "likely pathogenic" "" "0000175305" "0" "70" "2" "238255201" "238255201" "subst" "8.12176E-6" "01955" "COL6A3_000196" "g.238255201G>A" "" "MYO-SEQ project, UK" "" "" "The variant is rare and predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM." "Unknown" "" "" "0" "" "" "g.237346558G>A" "" "likely pathogenic" "" "0000175306" "0" "70" "2" "238296531" "238296531" "subst" "5.69597E-5" "01955" "COL6A3_000194" "g.238296531G>A" "" "MYO-SEQ project, UK" "" "" "The variant is rare and predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM." "Germline" "" "" "0" "" "" "g.237387888G>A" "" "likely pathogenic" "" "0000175307" "0" "70" "2" "238268793" "238268793" "subst" "0" "01955" "COL6A3_000195" "g.238268793C>T" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. It is not present in EXAC or other control populations. Reported pathogenic in ClinVar" "Germline" "" "" "0" "" "" "g.237360150C>T" "" "likely pathogenic" "" "0000175308" "0" "70" "2" "238269775" "238269775" "subst" "0" "01955" "COL6A3_000166" "g.238269775C>T" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. There is 1 case in EXAC and of uncertain significance in ClinVar however. Phenotype consistent with COLVI myopathy." "Germline" "?" "" "0" "" "" "g.237361132C>T" "" "likely pathogenic" "" "0000175309" "3" "70" "2" "238277250" "238277250" "subst" "0" "01955" "COL6A3_000193" "g.238277250G>A" "" "MYO-SEQ project, UK" "" "" "Also has a homozygous SGCG variant (reported in ClinVar as pathogenic). Homozygous missense variant predicted damaging in Polyphen, mutation taster and FATHMM. Not present in Exac or other contol populations." "Germline" "" "" "0" "" "" "g.237368607G>A" "" "likely pathogenic" "" "0000175311" "2" "70" "2" "238253214" "238253214" "subst" "0.000629523" "01955" "COL6A3_000191" "g.238253214T>C" "" "MYO-SEQ project, UK" "" "" "The variant is predicted damaging or disease causing in Polyphen, Mutation Taster and FATHMM. It is reported pathogenic/uncertain significance in ClinVar. Phenotype consistent with COLVI myopathy." "Unknown" "?" "" "0" "" "" "g.237344571T>C" "" "likely pathogenic" "" "0000175327" "0" "10" "2" "238249630" "238249630" "subst" "0.396917" "00449" "COL6A3_000037" "g.238249630C>T" "" "{PMID:Giusti 2005:16130093}" "" "" "" "Germline" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000175343" "0" "10" "2" "238277573" "238277573" "subst" "0.238071" "00449" "COL6A3_000025" "g.238277573C>A" "" "{PMID:Giusti 2005:16130093}" "" "" "" "Germline" "" "" "0" "" "" "g.237368930C>A" "" "benign" "" "0000175369" "0" "90" "2" "238280476" "238280476" "subst" "0.00989733" "00006" "COL6A3_000006" "g.238280476C>T" "1/75" "{PMID:Lampe 2005:15689448}" "" "" "individuals, no confirmatory data; protein domain N4" "Germline" "" "" "0" "" "" "g.237371833C>T" "" "pathogenic" "" "0000175375" "11" "90" "2" "238290062" "238290062" "subst" "0" "00006" "COL6A3_000001" "g.238290062G>A" "" "{PMID:Demir 2002:11992252}, {OMIM120250:0003}" "" "" "0/200 control chromosomes; alternative splicing; protein domain N8" "Germline" "" "" "0" "" "" "g.237381419G>A" "" "pathogenic" "" "0000175377" "1" "90" "2" "238285445" "238285445" "subst" "0.00020732" "00006" "COL6A3_000003" "g.238285445T>C" "1/79" "{PMID:Lampe 2005:15689448}" "" "" "individuals, no confirmatory data; protein domain N6" "Germline" "" "" "0" "" "" "g.237376802T>C" "" "pathogenic" "" "0000175378" "1" "90" "2" "238283543" "238283543" "subst" "0.00296708" "00006" "COL6A3_000004" "g.238283543C>T" "1/79" "{PMID:Lampe 2005:15689448}" "" "" "individuals, no confirmatory data; protein domain N5" "Germline" "" "" "0" "" "" "g.237374900C>T" "" "pathogenic" "" "0000175379" "1" "90" "2" "238280504" "238280504" "subst" "0.0062857" "00006" "COL6A3_000005" "g.238280504C>T" "1/79" "{PMID:Lampe 2005:15689448}" "" "" "individuals, no confirmatory data; protein domain N4" "Germline" "" "" "0" "" "" "g.237371861C>T" "" "pathogenic" "" "0000175380" "1" "70" "2" "238277707" "238277707" "subst" "0.000524932" "00006" "COL6A3_000007" "g.238277707T>C" "1/79 cases" "{PMID:Lampe 2005:15689448}" "" "" "individuals, no confirmatory data; protein domain N3" "Germline" "" "" "0" "" "" "g.237369064T>C" "" "likely pathogenic" "" "0000175381" "1" "90" "2" "238275794" "238275794" "subst" "0" "00006" "COL6A3_000009" "g.238275794C>T" "1/79" "{PMID:Lampe 2005:15689448}" "" "" "protein domain N2" "Germline" "" "" "0" "" "" "g.237367151C>T" "" "pathogenic" "" "0000175382" "1" "90" "2" "238275794" "238275794" "subst" "0" "00006" "COL6A3_000009" "g.238275794C>T" "" "{PMID:Pan 1998:09536084}, {OMIM120250:0001}" "AluI" "" "0/338 control chromosomes; interferes with protein folding; chr.2 linked; protein domain N2" "Germline" "" "" "0" "" "" "g.237367151C>T" "" "pathogenic" "" "0000175383" "1" "90" "2" "238269763" "238269763" "subst" "0" "00006" "COL6A3_000012" "g.238269763C>T" "1/79" "{PMID:Lampe 2005:15689448}" "" "" "protein domain N1/TH" "Germline" "" "" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000175384" "1" "90" "2" "238269797" "238269826" "del" "0" "00006" "COL6A3_000013" "g.238269797_238269826del" "1/78" "{PMID:Lampe 2005:15689448}" "" "6157-9_6177del" "protein domain TH" "Germline" "" "" "0" "" "" "g.237361154_237361183del" "" "pathogenic" "" "0000175385" "1" "90" "2" "238269808" "238269808" "subst" "0" "00006" "COL6A3_000014" "g.238269808C>T" "" "{PMID:Pepe 1999:10399756}" "MaeI;MspI" "" "0/100 control chromosomes; protein domain TH" "De novo" "" "" "0" "" "" "g.237361165C>T" "" "pathogenic" "" "0000175386" "1" "90" "2" "238269763" "238269763" "subst" "0" "00006" "COL6A3_000012" "g.238269763C>T" "" "{PMID:Baker 2005:15563506}, {OMIM120250:0004}" "" "" "protein domain TH; de novo, in patient" "De novo" "" "" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000175387" "1" "90" "2" "238269763" "238269763" "subst" "0" "00006" "COL6A3_000012" "g.238269763C>T" "3/78" "{PMID:Lampe 2005:15689448}" "" "" "protein domain TH" "Germline" "" "" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000175388" "1" "90" "2" "238268774" "238268774" "subst" "0" "00006" "COL6A3_000016" "g.238268774C>T" "1/79" "{PMID:Lampe 2005:15689448}" "" "" "protein domain TH" "Germline" "" "" "0" "" "" "g.237360131C>T" "" "pathogenic" "" "0000175389" "1" "90" "2" "238259773" "238259773" "subst" "0" "00006" "COL6A3_000018" "g.238259773C>T" "1/79" "{PMID:Lampe 2005:15689448}" "" "" "individuals, parents het; protein domain TH" "Germline" "" "" "0" "" "" "g.237351130C>T" "" "pathogenic" "" "0000175390" "11" "90" "2" "238257251" "238257251" "subst" "4.06583E-6" "00006" "COL6A3_000019" "g.238257251C>T" "" "{PMID:Demir 2002:11992252}, {OMIM120250:0002}" "MaeII" "" "0/100 control chromosomes; protein domain TH" "Germline" "" "" "0" "" "" "g.237348608C>T" "" "pathogenic" "" "0000175391" "11" "90" "2" "238256455" "238256455" "subst" "0" "00006" "COL6A3_000020" "g.238256455G>A" "" "{PMID:Demir 2002:11992252}" "" "" "0/200 control chromosomes; protein domain TH" "Germline" "" "" "0" "" "" "g.237347812G>A" "" "pathogenic" "" "0000175392" "1" "90" "2" "238244921" "238244921" "subst" "0.00381934" "00006" "COL6A3_000021" "g.238244921G>A" "1/79" "{PMID:Lampe 2005:15689448}" "" "" "individuals, no confirmatory data; protein domain C3" "Germline" "" "" "0" "" "" "g.237336278G>A" "" "pathogenic" "" "0000175413" "1" "90" "2" "238269762" "238269763" "delins" "0" "00006" "COL6A3_000028" "g.238269762_238269763delinsGA" "" "{PMID:Baker 2007:17886299}, {OMIM120250:0005}" "" "" "" "Germline" "" "" "0" "" "" "g.237361119_237361120delinsGA" "" "pathogenic" "" "0000175422" "0" "70" "2" "238268033" "238268033" "subst" "0" "00464" "COL6A3_000048" "g.238268033T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237359390T>C" "" "likely pathogenic" "" "0000175433" "1" "70" "2" "238267895" "238267895" "subst" "0" "00464" "COL6A3_000049" "g.238267895T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237359252T>C" "" "likely pathogenic" "" "0000175434" "0" "70" "2" "238268766" "238268766" "subst" "0" "00464" "COL6A3_000050" "g.238268766C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237360123C>A" "" "likely pathogenic" "" "0000175439" "10" "70" "2" "238266527" "238266527" "subst" "0" "00464" "COL6A3_000051" "g.238266527T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237357884T>C" "" "likely pathogenic" "" "0000175450" "0" "50" "2" "238290184" "238290184" "subst" "0.000968992" "00464" "COL6A3_000015" "g.238290184C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237381541C>T" "" "VUS" "" "0000175452" "11" "30" "2" "238280443" "238280443" "subst" "0.00051621" "00464" "COL6A3_000052" "g.238280443G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237371800G>A" "" "likely benign" "" "0000175453" "0" "70" "2" "238269789" "238269789" "subst" "0" "00464" "COL6A3_000053" "g.238269789C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237361146C>T" "" "likely pathogenic" "" "0000175460" "0" "90" "2" "238269763" "238269763" "subst" "0" "00464" "COL6A3_000012" "g.238269763C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000175464" "21" "30" "2" "238283543" "238283543" "subst" "0.00296708" "00464" "COL6A3_000004" "g.238283543C>T" "" "" "" "" "inherited from healthy mother" "Germline" "" "" "0" "" "" "g.237374900C>T" "" "likely benign" "" "0000175474" "0" "70" "2" "238269762" "238269762" "dup" "0" "00464" "COL6A3_000054" "g.238269762dup" "" "" "" "" "decreased col6 staining in muscle biopsy" "Germline" "" "" "0" "" "" "g.237361119dup" "" "likely pathogenic" "" "0000175475" "0" "90" "2" "238269763" "238269763" "subst" "0" "00464" "COL6A3_000012" "g.238269763C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000175651" "0" "50" "2" "238305387" "238305387" "subst" "0" "00430" "COL6A3_000056" "g.238305387G>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237396744G>T" "" "VUS" "" "0000175652" "0" "90" "2" "238303764" "238303764" "subst" "5.32516E-5" "00430" "COL6A3_000057" "g.238303764G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237395121G>A" "" "pathogenic" "" "0000175653" "0" "50" "2" "238303518" "238303518" "subst" "1.22182E-5" "00430" "COL6A3_000058" "g.238303518C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237394875C>T" "" "VUS" "" "0000175654" "0" "10" "2" "238296807" "238296807" "subst" "0.000762509" "00430" "COL6A3_000059" "g.238296807T>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237388164T>C" "" "benign" "" "0000175655" "0" "50" "2" "238296769" "238296769" "subst" "0.0147315" "00430" "COL6A3_000060" "g.238296769G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237388126G>A" "" "VUS" "" "0000175656" "0" "10" "2" "238296655" "238296655" "subst" "0.00587428" "00430" "COL6A3_000061" "g.238296655G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237388012G>A" "" "benign" "" "0000175657" "0" "50" "2" "238296355" "238296355" "subst" "0.00589232" "00430" "COL6A3_000062" "g.238296355G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237387712G>A" "" "VUS" "" "0000175658" "0" "50" "2" "238296306" "238296306" "subst" "0.00401582" "00430" "COL6A3_000063" "g.238296306G>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237387663G>C" "" "VUS" "" "0000175659" "0" "10" "2" "238296273" "238296273" "subst" "0.000672871" "00430" "COL6A3_000064" "g.238296273C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237387630C>T" "" "benign" "" "0000175660" "0" "10" "2" "238290159" "238290159" "subst" "0.00618378" "00430" "COL6A3_000065" "g.238290159T>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237381516T>C" "" "benign" "" "0000175661" "0" "50" "2" "238290066" "238290066" "subst" "0.0112668" "00430" "COL6A3_000022" "g.238290066G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237381423G>A" "" "VUS" "" "0000175662" "0" "10" "2" "238289984" "238289984" "subst" "0.00745626" "00430" "COL6A3_000066" "g.238289984C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237381341C>G" "" "benign" "" "0000175663" "0" "10" "2" "238289980" "238289980" "subst" "0.00745614" "00430" "COL6A3_000067" "g.238289980G>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237381337G>C" "" "benign" "" "0000175664" "0" "10" "2" "238289817" "238289817" "subst" "0.0010119" "00430" "COL6A3_000068" "g.238289817G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237381174G>A" "" "benign" "" "0000175665" "0" "10" "2" "238289669" "238289669" "subst" "0.00469077" "00430" "COL6A3_000069" "g.238289669C>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237381026C>A" "" "benign" "" "0000175666" "0" "10" "2" "238287862" "238287862" "subst" "0.00719767" "00430" "COL6A3_000070" "g.238287862C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237379219C>T" "" "benign" "" "0000175667" "0" "10" "2" "238287800" "238287800" "subst" "0.0060661" "00430" "COL6A3_000071" "g.238287800C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237379157C>T" "" "benign" "" "0000175668" "0" "10" "2" "238287357" "238287357" "subst" "0.0265411" "00430" "COL6A3_000072" "g.238287357C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237378714C>T" "" "benign" "" "0000175669" "0" "10" "2" "238287288" "238287288" "subst" "0.026569" "00430" "COL6A3_000073" "g.238287288C>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237378645C>A" "" "benign" "" "0000175670" "0" "10" "2" "238285431" "238285431" "subst" "0.00322076" "00430" "COL6A3_000074" "g.238285431G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237376788G>A" "" "benign" "" "0000175671" "0" "10" "2" "238283679" "238283679" "subst" "0.0046851" "00430" "COL6A3_000075" "g.238283679C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237375036C>T" "" "benign" "" "0000175672" "0" "10" "2" "238283647" "238283647" "subst" "0.00354616" "00430" "COL6A3_000076" "g.238283647G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237375004G>A" "" "benign" "" "0000175673" "0" "10" "2" "238283605" "238283605" "subst" "0.234224" "00430" "COL6A3_000023" "g.238283605G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237374962G>A" "" "benign" "" "0000175674" "0" "90" "2" "238283543" "238283543" "subst" "0.00296708" "00430" "COL6A3_000004" "g.238283543C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237374900C>T" "" "pathogenic" "" "0000175675" "0" "50" "2" "238283511" "238283511" "subst" "4.08147E-6" "00430" "COL6A3_000077" "g.238283511G>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237374868G>T" "" "VUS" "" "0000175676" "0" "10" "2" "238283472" "238283472" "subst" "0.037234" "00430" "COL6A3_000078" "g.238283472T>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237374829T>G" "" "benign" "" "0000175677" "0" "10" "2" "238283314" "238283314" "subst" "0.00327406" "00430" "COL6A3_000079" "g.238283314C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237374671C>T" "" "benign" "" "0000175678" "0" "50" "2" "238280706" "238280706" "subst" "0.000223883" "00430" "COL6A3_000080" "g.238280706G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237372063G>A" "" "VUS" "" "0000175679" "0" "10" "2" "238280570" "238280570" "subst" "0.000300654" "00430" "COL6A3_000081" "g.238280570C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237371927C>T" "" "benign" "" "0000175680" "0" "30" "2" "238280476" "238280476" "subst" "0.00989733" "00430" "COL6A3_000006" "g.238280476C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237371833C>T" "" "likely benign" "" "0000175681" "0" "10" "2" "238280366" "238280366" "subst" "0.013894" "00430" "COL6A3_000082" "g.238280366C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237371723C>T" "" "benign" "" "0000175682" "0" "10" "2" "238280358" "238280358" "subst" "0.0102711" "00430" "COL6A3_000083" "g.238280358C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237371715C>T" "" "benign" "" "0000175683" "0" "10" "2" "238277795" "238277795" "subst" "0.285002" "00430" "COL6A3_000024" "g.238277795A>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237369152A>G" "" "benign" "" "0000175684" "0" "10" "2" "238277573" "238277573" "subst" "0.238071" "00430" "COL6A3_000025" "g.238277573C>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237368930C>A" "" "benign" "" "0000175685" "0" "10" "2" "238277423" "238277423" "subst" "0.00079191" "00430" "COL6A3_000084" "g.238277423C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237368780C>T" "" "benign" "" "0000175686" "0" "10" "2" "238277379" "238277379" "subst" "0.00999326" "00430" "COL6A3_000026" "g.238277379C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237368736C>T" "" "benign" "" "0000175687" "0" "50" "2" "238277258" "238277258" "subst" "0.000125913" "00430" "COL6A3_000085" "g.238277258G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237368615G>A" "" "VUS" "" "0000175688" "0" "50" "2" "238277233" "238277233" "subst" "8.12374E-6" "00430" "COL6A3_000086" "g.238277233C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237368590C>T" "" "VUS" "" "0000175689" "0" "10" "2" "238277211" "238277211" "subst" "0.0102198" "00430" "COL6A3_000087" "g.238277211C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237368568C>T" "" "benign" "" "0000175690" "0" "10" "2" "238275730" "238275730" "subst" "0.00484613" "00430" "COL6A3_000088" "g.238275730C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237367087C>T" "" "benign" "" "0000175691" "0" "50" "2" "238275660" "238275660" "subst" "0" "00430" "COL6A3_000089" "g.238275660C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237367017C>T" "" "VUS" "" "0000175692" "0" "10" "2" "238275569" "238275569" "subst" "0.00779664" "00430" "COL6A3_000090" "g.238275569T>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237366926T>C" "" "benign" "" "0000175693" "0" "50" "2" "238275412" "238275412" "subst" "3.24857E-5" "00430" "COL6A3_000091" "g.238275412G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237366769G>A" "" "VUS" "" "0000175694" "0" "10" "2" "238272965" "238272965" "subst" "0.00632246" "00430" "COL6A3_000092" "g.238272965C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237364322C>G" "" "benign" "" "0000175695" "0" "10" "2" "238271890" "238271890" "dup" "0" "00430" "COL6A3_000093" "g.238271890dup" "" "" "" "6063+13dupT" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237363247dup" "" "benign" "" "0000175696" "0" "50" "2" "238270382" "238270382" "subst" "0" "00430" "COL6A3_000094" "g.238270382C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237361739C>G" "" "VUS" "" "0000175697" "0" "10" "2" "238270378" "238270378" "subst" "0.0114599" "00430" "COL6A3_000095" "g.238270378G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237361735G>A" "" "benign" "" "0000175698" "0" "50" "2" "238270377" "238270377" "subst" "1.21831E-5" "00430" "COL6A3_000096" "g.238270377C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237361734C>T" "" "VUS" "" "0000175699" "0" "50" "2" "238269833" "238269833" "subst" "0.00429788" "00430" "COL6A3_000097" "g.238269833C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237361190C>T" "" "VUS" "" "0000175700" "0" "50" "2" "238269781" "238269781" "subst" "0" "00430" "COL6A3_000098" "g.238269781C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237361138C>T" "" "VUS" "" "0000175701" "0" "90" "2" "238269763" "238269763" "subst" "0" "00430" "COL6A3_000012" "g.238269763C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000175702" "0" "50" "2" "238268806" "238268806" "subst" "4.0655E-6" "00430" "COL6A3_000099" "g.238268806T>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237360163T>C" "" "VUS" "" "0000175703" "0" "50" "2" "238268805" "238268805" "subst" "0.000947185" "00430" "COL6A3_000100" "g.238268805G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237360162G>A" "" "VUS" "" "0000175704" "0" "50" "2" "238268765" "238268765" "subst" "0" "00430" "COL6A3_000101" "g.238268765C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237360122C>T" "" "VUS" "" "0000175705" "0" "90" "2" "238268730" "238268730" "subst" "0" "00430" "COL6A3_000102" "g.238268730C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237360087C>T" "" "pathogenic" "" "0000175706" "0" "10" "2" "238268681" "238268681" "subst" "0.010136" "00430" "COL6A3_000103" "g.238268681G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237360038G>A" "" "benign" "" "0000175707" "0" "50" "2" "238267965" "238267965" "subst" "6.09429E-5" "00430" "COL6A3_000104" "g.238267965G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237359322G>A" "" "VUS" "" "0000175708" "0" "10" "2" "238267717" "238267717" "subst" "0.212185" "00430" "COL6A3_000029" "g.238267717C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237359074C>T" "" "benign" "" "0000175709" "0" "10" "2" "238267634" "238267634" "subst" "0.00258425" "00430" "COL6A3_000105" "g.238267634T>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237358991T>C" "" "benign" "" "0000175710" "0" "10" "2" "238263604" "238263604" "del" "0.000852575" "00430" "COL6A3_000106" "g.238263604del" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237354961del" "" "benign" "" "0000175711" "0" "50" "2" "238263547" "238263547" "subst" "8.1604E-6" "00430" "COL6A3_000107" "g.238263547C>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237354904C>A" "" "VUS" "" "0000175712" "0" "50" "2" "238262093" "238262093" "subst" "8.22896E-6" "00430" "COL6A3_000108" "g.238262093C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237353450C>G" "" "VUS" "" "0000175713" "0" "10" "2" "238262021" "238262021" "subst" "0.0414876" "00430" "COL6A3_000109" "g.238262021G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237353378G>A" "" "benign" "" "0000175714" "0" "10" "2" "238258814" "238258814" "subst" "0.542393" "00430" "COL6A3_000030" "g.238258814C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000175715" "0" "50" "2" "238258741" "238258741" "subst" "8.13656E-6" "00430" "COL6A3_000110" "g.238258741C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237350098C>T" "" "VUS" "" "0000175716" "0" "10" "2" "238257353" "238257353" "subst" "0.147327" "00430" "COL6A3_000111" "g.238257353A>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237348710A>G" "" "benign" "" "0000175717" "0" "10" "2" "238257228" "238257228" "subst" "0.0311962" "00430" "COL6A3_000112" "g.238257228G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237348585G>A" "" "benign" "" "0000175718" "0" "10" "2" "238257213" "238257213" "subst" "0.114974" "00430" "COL6A3_000113" "g.238257213C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237348570C>G" "" "benign" "" "0000175719" "0" "10" "2" "238257013" "238257013" "subst" "0.114359" "00430" "COL6A3_000031" "g.238257013G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000175720" "0" "50" "2" "238256507" "238256507" "subst" "0.000760658" "00430" "COL6A3_000114" "g.238256507G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237347864G>A" "" "VUS" "" "0000175721" "0" "10" "2" "238256498" "238256498" "subst" "0.00482132" "00430" "COL6A3_000115" "g.238256498T>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237347855T>C" "" "benign" "" "0000175722" "0" "10" "2" "238255152" "238255152" "subst" "0.00520199" "00430" "COL6A3_000116" "g.238255152T>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237346509T>G" "" "benign" "" "0000175723" "0" "10" "2" "238255120" "238255120" "subst" "0.14994" "00430" "COL6A3_000117" "g.238255120C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237346477C>T" "" "benign" "" "0000175724" "0" "10" "2" "238253653" "238253653" "subst" "0.000894258" "00430" "COL6A3_000118" "g.238253653C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237345010C>T" "" "benign" "" "0000175725" "0" "10" "2" "238253518" "238253518" "subst" "0.0326514" "00430" "COL6A3_000119" "g.238253518C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237344875C>T" "" "benign" "" "0000175726" "0" "50" "2" "238253403" "238253403" "subst" "0.000834169" "00430" "COL6A3_000120" "g.238253403G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237344760G>A" "" "VUS" "" "0000175727" "0" "10" "2" "238253332" "238253332" "subst" "0.0318083" "00430" "COL6A3_000121" "g.238253332G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237344689G>A" "" "benign" "" "0000175728" "0" "10" "2" "238253261" "238253261" "subst" "0.000528086" "00430" "COL6A3_000122" "g.238253261G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237344618G>A" "" "benign" "" "0000175729" "0" "10" "2" "238253152" "238253152" "subst" "0.0289343" "00430" "COL6A3_000034" "g.238253152C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237344509C>T" "" "benign" "" "0000175730" "0" "10" "2" "238253149" "238253149" "subst" "0.112914" "00430" "COL6A3_000123" "g.238253149G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237344506G>A" "" "benign" "" "0000175731" "0" "10" "2" "238253065" "238253065" "subst" "0.127718" "00430" "COL6A3_000035" "g.238253065C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000175732" "0" "10" "2" "238253016" "238253016" "subst" "0.00383687" "00430" "COL6A3_000124" "g.238253016G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237344373G>A" "" "benign" "" "0000175733" "0" "10" "2" "238252972" "238252972" "subst" "0.00484331" "00430" "COL6A3_000125" "g.238252972C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237344329C>G" "" "benign" "" "0000175734" "0" "50" "2" "238250839" "238250839" "subst" "0.0674127" "00430" "COL6A3_000126" "g.238250839G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237342196G>A" "" "VUS" "" "0000175735" "0" "50" "2" "238250788" "238250788" "subst" "9.34283E-5" "00430" "COL6A3_000127" "g.238250788A>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237342145A>G" "" "VUS" "" "0000175736" "0" "50" "2" "238249780" "238249780" "subst" "0.000812132" "00430" "COL6A3_000128" "g.238249780G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237341137G>A" "" "VUS" "" "0000175737" "0" "10" "2" "238249717" "238249717" "subst" "0.0754022" "00430" "COL6A3_000036" "g.238249717G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000175738" "0" "10" "2" "238249630" "238249630" "subst" "0.396917" "00430" "COL6A3_000037" "g.238249630C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000175739" "0" "10" "2" "238249564" "238249564" "subst" "0.00484445" "00430" "COL6A3_000129" "g.238249564T>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237340921T>G" "" "benign" "" "0000175740" "0" "50" "2" "238249551" "238249551" "subst" "4.48186E-5" "00430" "COL6A3_000130" "g.238249551C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237340908C>T" "" "VUS" "" "0000175741" "0" "10" "2" "238249549" "238249549" "subst" "0.00123475" "00430" "COL6A3_000131" "g.238249549C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237340906C>T" "" "benign" "" "0000175742" "0" "10" "2" "238249414" "238249414" "subst" "0.00483693" "00430" "COL6A3_000132" "g.238249414T>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237340771T>C" "" "benign" "" "0000175743" "0" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00430" "COL6A3_000039" "g.238249108T>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000175744" "0" "50" "2" "238249075" "238249075" "subst" "0.000178123" "00430" "COL6A3_000133" "g.238249075C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237340432C>G" "" "VUS" "" "0000175745" "0" "50" "2" "238247794" "238247794" "subst" "0.0078952" "00430" "COL6A3_000134" "g.238247794G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237339151G>A" "" "VUS" "" "0000175746" "0" "10" "2" "238247734" "238247734" "subst" "0.0658182" "00430" "COL6A3_000040" "g.238247734C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237339091C>G" "" "benign" "" "0000175747" "0" "10" "2" "238244963" "238244963" "subst" "0.631261" "00430" "COL6A3_000041" "g.238244963A>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237336320A>G" "" "benign" "" "0000175748" "0" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00430" "COL6A3_000042" "g.238244923C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000175749" "0" "10" "2" "238244921" "238244921" "subst" "0.00381934" "00430" "COL6A3_000021" "g.238244921G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237336278G>A" "" "benign" "" "0000175750" "0" "10" "2" "238244875" "238244877" "del" "0" "00430" "COL6A3_000043" "g.238244875_238244877del" "" "" "" "8877_8879delTGC" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237336232_237336234del" "" "benign" "" "0000175751" "0" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00430" "COL6A3_000044" "g.238244781T>C" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000175752" "0" "10" "2" "238243464" "238243464" "subst" "0.763921" "00430" "COL6A3_000045" "g.238243464C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237334821C>G" "" "benign" "" "0000175753" "0" "10" "2" "238243429" "238243429" "subst" "0.00110457" "00430" "COL6A3_000136" "g.238243429G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237334786G>A" "" "benign" "" "0000175754" "0" "10" "2" "238243375" "238243375" "subst" "0.0260362" "00430" "COL6A3_000137" "g.238243375C>T" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237334732C>T" "" "benign" "" "0000175755" "0" "10" "2" "238243369" "238243369" "subst" "0.0309244" "00430" "COL6A3_000138" "g.238243369G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237334726G>A" "" "benign" "" "0000175756" "0" "10" "2" "238243292" "238243292" "subst" "0.385382" "00430" "COL6A3_000046" "g.238243292G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000175757" "0" "10" "2" "238243285" "238243285" "subst" "0.107227" "00430" "COL6A3_000047" "g.238243285G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237334642G>A" "" "benign" "" "0000175758" "0" "50" "2" "238234400" "238234400" "subst" "2.9211E-5" "00430" "COL6A3_000139" "g.238234400G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237325757G>A" "" "VUS" "" "0000175759" "0" "10" "2" "238234285" "238234285" "subst" "0.0135931" "00430" "COL6A3_000140" "g.238234285A>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237325642A>G" "" "benign" "" "0000175760" "0" "10" "2" "238233483" "238233483" "subst" "0.290644" "00430" "COL6A3_000141" "g.238233483G>A" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237324840G>A" "" "benign" "" "0000175761" "0" "10" "2" "238233410" "238233410" "subst" "0.143911" "00430" "COL6A3_000142" "g.238233410C>G" "" "" "" "" "from website {DBsub-Emory}" "Germline" "" "" "0" "" "" "g.237324767C>G" "" "benign" "" "0000175805" "0" "50" "2" "238245111" "238245111" "subst" "5.27897E-5" "00537" "COL6A3_000144" "g.238245111T>C" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237336468T>C" "" "VUS" "" "0000175816" "1" "90" "2" "238269816" "238269816" "subst" "0" "00537" "COL6A3_000149" "g.238269816C>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237361173C>A" "" "pathogenic" "" "0000175817" "21" "90" "2" "238269799" "238269799" "subst" "0" "00537" "COL6A3_000150" "g.238269799C>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "yes" "" "0" "" "" "g.237361156C>A" "" "pathogenic" "" "0000175818" "1" "90" "2" "238269799" "238269799" "subst" "0" "00537" "COL6A3_000150" "g.238269799C>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "yes" "" "0" "" "" "g.237361156C>A" "" "pathogenic" "" "0000175819" "1" "90" "2" "238268774" "238268774" "subst" "0" "00537" "COL6A3_000016" "g.238268774C>T" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237360131C>T" "" "pathogenic" "" "0000175820" "1" "90" "2" "238268793" "238268793" "subst" "0" "00537" "COL6A3_000151" "g.238268793C>A" "" "{PMID:Butterfield:24038877}" "" "" "" "De novo" "yes" "" "0" "" "" "g.237360150C>A" "" "pathogenic" "" "0000175821" "1" "90" "2" "238268792" "238268792" "subst" "0" "00537" "COL6A3_000152" "g.238268792C>T" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237360149C>T" "" "pathogenic" "" "0000175822" "1" "90" "2" "238268784" "238268784" "subst" "0" "00537" "COL6A3_000153" "g.238268784C>G" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237360141C>G" "" "pathogenic" "" "0000175823" "11" "90" "2" "238268021" "238268021" "subst" "0" "00537" "COL6A3_000154" "g.238268021C>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "yes" "" "0" "" "" "g.237359378C>A" "" "pathogenic" "" "0000175824" "1" "90" "2" "238268021" "238268021" "subst" "0" "00537" "COL6A3_000154" "g.238268021C>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "yes" "" "0" "" "" "g.237359378C>A" "" "pathogenic" "" "0000175825" "1" "90" "2" "238268021" "238268021" "subst" "0" "00537" "COL6A3_000154" "g.238268021C>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237359378C>A" "" "pathogenic" "" "0000175826" "1" "50" "2" "238269793" "238269793" "subst" "0" "00537" "COL6A3_000155" "g.238269793G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "yes" "" "0" "" "" "g.237361150G>A" "" "VUS" "" "0000175827" "1" "90" "2" "238257027" "238257027" "subst" "0" "00537" "COL6A3_000156" "g.238257027C>T" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237348384C>T" "" "pathogenic" "" "0000175832" "1" "90" "2" "238268784" "238268784" "subst" "0" "00537" "COL6A3_000153" "g.238268784C>G" "" "{PMID:Butterfield:24038877}" "" "" "" "De novo" "yes" "" "0" "" "" "g.237360141C>G" "" "pathogenic" "" "0000175834" "1" "90" "2" "238268783" "238268783" "subst" "0" "00537" "COL6A3_000157" "g.238268783C>T" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237360140C>T" "" "pathogenic" "" "0000175835" "1" "90" "2" "238269789" "238269789" "subst" "0" "00537" "COL6A3_000053" "g.238269789C>T" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237361146C>T" "" "pathogenic" "" "0000175838" "0" "90" "2" "238275918" "238275918" "subst" "0.000644997" "00537" "COL6A3_000145" "g.238275918C>T" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237367275C>T" "" "pathogenic" "" "0000175839" "0" "30" "2" "238270378" "238270378" "subst" "0.0114599" "00537" "COL6A3_000095" "g.238270378G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237361735G>A" "" "likely benign" "" "0000175842" "1" "90" "2" "238255172" "238255172" "subst" "0" "00537" "COL6A3_000158" "g.238255172C>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237346529C>A" "" "pathogenic" "" "0000175862" "1" "90" "2" "238268766" "238268766" "subst" "0" "00537" "COL6A3_000050" "g.238268766C>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237360123C>A" "" "pathogenic" "" "0000175863" "0" "50" "2" "238289767" "238289767" "subst" "0.00216865" "00537" "COL6A3_000143" "g.238289767T>C" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "yes" "" "0" "" "" "g.237381124T>C" "" "VUS" "" "0000175885" "11" "90" "21" "238273074" "238273074" "subst" "0" "00472" "COL6A3_000161" "g.238273074G>A" "" "" "" "" "Variant Error [EREF/0]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000175889" "11" "90" "21" "238250807" "238250807" "subst" "0" "00472" "COL6A3_000163" "g.238250807G>C" "" "" "" "" "Variant Error [EREF/0]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000175951" "1" "50" "2" "238285949" "238285949" "subst" "0" "00472" "COL6A3_000164" "g.238285949C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237377306C>T" "" "VUS" "" "0000175952" "11" "50" "2" "238289664" "238289664" "subst" "4.87341E-5" "00472" "COL6A3_000165" "g.238289664G>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.237381021G>T" "" "VUS" "" "0000175953" "0" "50" "2" "238277670" "238277670" "subst" "0.000134066" "00472" "COL6A3_000168" "g.238277670T>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237369027T>A" "" "VUS" "" "0000175954" "0" "50" "2" "238296655" "238296655" "subst" "0.00587428" "00472" "COL6A3_000061" "g.238296655G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237388012G>A" "" "VUS" "" "0000175955" "21" "50" "2" "238285431" "238285431" "subst" "0.00322076" "00472" "COL6A3_000074" "g.238285431G>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.237376788G>A" "" "VUS" "" "0000175956" "1" "90" "2" "238296807" "238296807" "subst" "0.000762509" "00472" "COL6A3_000059" "g.238296807T>C" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237388164T>C" "" "pathogenic" "" "0000175957" "1" "90" "2" "238267995" "238267995" "subst" "0" "00472" "COL6A3_000172" "g.238267995G>C" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237359352G>C" "" "pathogenic" "" "0000175958" "1" "90" "2" "238277707" "238277707" "subst" "0.000524932" "00472" "COL6A3_000007" "g.238277707T>C" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237369064T>C" "" "pathogenic" "" "0000175959" "1" "90" "2" "238258798" "238258798" "subst" "0" "00472" "COL6A3_000173" "g.238258798C>G" "" "" "" "" "" "De novo" "yes" "" "0" "" "" "g.237350155C>G" "" "pathogenic" "" "0000175960" "11" "90" "2" "238275902" "238275902" "subst" "0" "00472" "COL6A3_000174" "g.238275902A>C" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.237367259A>C" "" "pathogenic" "" "0000175961" "1" "90" "2" "238269759" "238269759" "subst" "0" "00472" "COL6A3_000175" "g.238269759C>T" "" "" "" "" "" "De novo" "yes" "" "0" "" "" "g.237361116C>T" "" "pathogenic" "" "0000175962" "11" "90" "2" "238275795" "238275795" "subst" "0" "00472" "COL6A3_000176" "g.238275795C>A" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.237367152C>A" "" "pathogenic" "" "0000175963" "1" "90" "2" "238268730" "238268730" "subst" "0" "00472" "COL6A3_000102" "g.238268730C>T" "" "" "" "" "" "De novo" "yes" "" "0" "" "" "g.237360087C>T" "" "pathogenic" "" "0000175964" "1" "90" "2" "238253403" "238253403" "subst" "0.000834169" "00472" "COL6A3_000120" "g.238253403G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237344760G>A" "" "pathogenic" "" "0000175965" "1" "90" "2" "238269775" "238269775" "subst" "0" "00472" "COL6A3_000166" "g.238269775C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237361132C>T" "" "pathogenic" "" "0000175966" "1" "90" "2" "238269808" "238269808" "subst" "0" "00472" "COL6A3_000177" "g.238269808C>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237361165C>A" "" "pathogenic" "" "0000175967" "1" "90" "2" "238258849" "238258849" "subst" "0" "00472" "COL6A3_000178" "g.238258849C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237350206C>T" "" "pathogenic" "" "0000175968" "1" "90" "2" "238275795" "238275795" "subst" "0" "00472" "COL6A3_000176" "g.238275795C>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237367152C>A" "" "pathogenic" "" "0000175969" "1" "90" "2" "238269816" "238269816" "subst" "0" "00472" "COL6A3_000149" "g.238269816C>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237361173C>A" "" "pathogenic" "" "0000175970" "21" "90" "2" "238277247" "238277247" "subst" "1.62455E-5" "00472" "COL6A3_000179" "g.238277247G>A" "" "" "" "" "no RNA expression (NMD)" "Germline" "yes" "" "0" "" "" "g.237368604G>A" "" "pathogenic" "" "0000175971" "1" "90" "2" "238269763" "238269763" "subst" "0" "00472" "COL6A3_000012" "g.238269763C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000175972" "1" "90" "2" "238269775" "238269775" "subst" "0" "00472" "COL6A3_000166" "g.238269775C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237361132C>T" "" "pathogenic" "" "0000175973" "1" "90" "2" "238268789" "238268789" "subst" "7.31273E-5" "00472" "COL6A3_000148" "g.238268789G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237360146G>A" "" "pathogenic" "" "0000175974" "1" "90" "2" "238275795" "238275795" "subst" "0" "00472" "COL6A3_000176" "g.238275795C>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237367152C>A" "" "pathogenic" "" "0000175975" "1" "90" "2" "238269763" "238269763" "dup" "0" "00472" "COL6A3_000012" "g.238269763C>T" "" "" "" "" "" "De novo" "yes" "" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000175976" "1" "90" "2" "238274382" "238274385" "subst" "0" "00472" "COL6A3_000180" "g.238274382_238274385dup" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237365739_237365742dup" "" "pathogenic" "" "0000175977" "1" "90" "2" "238268789" "238268789" "subst" "7.31273E-5" "00472" "COL6A3_000148" "g.238268789G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237360146G>A" "" "pathogenic" "" "0000175978" "1" "90" "2" "238269763" "238269763" "subst" "0" "00472" "COL6A3_000012" "g.238269763C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000175979" "11" "90" "2" "238274655" "238274655" "subst" "0" "00472" "COL6A3_000181" "g.238274655C>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.237366012C>T" "" "pathogenic" "" "0000175980" "1" "90" "2" "238269816" "238269816" "subst" "0" "00472" "COL6A3_000149" "g.238269816C>A" "" "" "" "" "" "De novo" "yes" "" "0" "" "" "g.237361173C>A" "" "pathogenic" "" "0000175981" "1" "90" "2" "238268783" "238268783" "subst" "0" "00472" "COL6A3_000157" "g.238268783C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237360140C>T" "" "pathogenic" "" "0000175982" "1" "90" "2" "238275699" "238275710" "del" "0" "00472" "COL6A3_000182" "g.238275699_238275710del" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237367056_237367067del" "" "pathogenic" "" "0000175983" "1" "90" "2" "238277670" "238277670" "subst" "0.000134066" "00472" "COL6A3_000168" "g.238277670T>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237369027T>A" "" "pathogenic" "" "0000175988" "0" "90" "2" "238268775" "238268775" "subst" "0" "02188" "COL6A3_000183" "g.238268775C>A" "" "" "" "" "mother appears mosaic" "Germline" "yes" "" "0" "" "" "g.237360132C>A" "" "pathogenic" "" "0000175991" "10" "70" "2" "238245109" "238245109" "del" "0" "01715" "COL6A3_000184" "g.238245109del" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.237336466del" "" "likely pathogenic" "" "0000175993" "1" "50" "2" "238272006" "238272006" "subst" "4.06065E-5" "00006" "COL6A3_000010" "g.238272006C>T" "1/79" "{PMID:Lampe 2005:15689448}" "" "" "no confirmatory data; protein domain N1" "Germline" "" "" "0" "" "" "g.237363363C>T" "" "VUS" "" "0000175999" "3" "10" "2" "238258814" "238258814" "subst" "0.542393" "00449" "COL6A3_000030" "g.238258814C>G" "" "{PMID:Giusti 2005:16130093}" "" "" "" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000176000" "3" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00449" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Giusti 2005:16130093}" "" "A8820G" "" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176001" "3" "10" "2" "238243292" "238243292" "subst" "0.385382" "00449" "COL6A3_000046" "g.238243292G>A" "" "{PMID:Giusti 2005:16130093}" "" "C9203T (Thr3068Ile)" "" "Germline" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000176002" "1" "50" "2" "238270398" "238270398" "subst" "0" "00006" "COL6A3_000011" "g.238270398C>T" "" "{PMID:Lampe 2005:15689448}" "" "" "protein domain TH" "Germline" "" "" "0" "" "" "g.237361755C>T" "" "VUS" "" "0000176015" "0" "10" "2" "238253065" "238253065" "subst" "0.127718" "00449" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Giusti 2005:16130093}" "" "G7596A" "" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176016" "0" "10" "2" "238247734" "238247734" "subst" "0.0658182" "00449" "COL6A3_000040" "g.238247734C>G" "" "{PMID:Giusti 2005:16130093}" "" "" "" "Germline" "" "" "0" "" "" "g.237339091C>G" "" "benign" "" "0000176017" "3" "10" "2" "238244963" "238244963" "subst" "0.631261" "00449" "COL6A3_000041" "g.238244963A>G" "" "{PMID:Giusti 2005:16130093}" "" "C8780T" "" "Germline" "" "" "0" "" "" "g.237336320A>G" "" "benign" "" "0000176018" "3" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00449" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Giusti 2005:16130093}" "" "A8820G" "" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176019" "0" "10" "2" "238243464" "238243464" "subst" "0.763921" "00449" "COL6A3_000045" "g.238243464C>G" "" "{PMID:Giusti 2005:16130093}" "" "C9031G" "" "Germline" "" "" "0" "" "" "g.237334821C>G" "" "benign" "" "0000176024" "0" "10" "2" "238258814" "238258814" "subst" "0.542393" "00449" "COL6A3_000030" "g.238258814C>G" "" "{PMID:Giusti 2005:16130093}" "" "" "" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000176025" "3" "10" "2" "238249630" "238249630" "subst" "0.396917" "00449" "COL6A3_000037" "g.238249630C>T" "" "{PMID:Giusti 2005:16130093}" "" "" "" "Germline" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000176026" "3" "10" "2" "238243292" "238243292" "subst" "0.385382" "00449" "COL6A3_000046" "g.238243292G>A" "" "{PMID:Giusti 2005:16130093}" "" "C9203T (Thr3068Ile)" "" "Germline" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000176027" "1" "10" "2" "238287746" "238287746" "subst" "0.00150325" "00006" "COL6A2_000000" "g.238287746C>T" "1/79" "{PMID15689448:Lampe 2005}" "" "" "change of uncertain and questionable significance in 1/79 individuals; protein domain N7" "Germline" "" "" "0" "" "" "g.237379103C>T" "" "benign" "" "0000176034" "0" "10" "2" "238258814" "238258814" "subst" "0.542393" "00449" "COL6A3_000030" "g.238258814C>G" "" "{PMID:Giusti 2005:16130093}" "" "" "" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000176035" "0" "10" "2" "238249630" "238249630" "subst" "0.396917" "00449" "COL6A3_000037" "g.238249630C>T" "" "{PMID:Giusti 2005:16130093}" "" "" "" "Germline" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000176036" "0" "10" "2" "238244963" "238244963" "subst" "0.631261" "00449" "COL6A3_000041" "g.238244963A>G" "" "{PMID:Giusti 2005:16130093}" "" "C8780T" "" "Germline" "" "" "0" "" "" "g.237336320A>G" "" "benign" "" "0000176037" "3" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00449" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Giusti 2005:16130093}" "" "A8820G" "" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176038" "3" "10" "2" "238243464" "238243464" "subst" "0.763921" "00449" "COL6A3_000045" "g.238243464C>G" "" "{PMID:Giusti 2005:16130093}" "" "C9031G" "" "Germline" "" "" "0" "" "" "g.237334821C>G" "" "benign" "" "0000176051" "0" "90" "2" "238275810" "238275810" "subst" "0.000150421" "00006" "COL6A3_000008" "g.238275810C>T" "1/75" "{PMID:Lampe 2005:15689448}" "" "" "individuals, no confirmatory data; protein domain N2" "Germline" "" "" "0" "" "" "g.237367167C>T" "" "pathogenic" "" "0000176052" "21" "90" "2" "238290062" "238290062" "subst" "0" "00006" "COL6A3_000001" "g.238290062G>A" "" "{PMID:Demir 2002:11992252}, {OMIM120250:0003}" "" "" "0/200 control chromosomes; alternative splicing; protein domain N8" "Germline" "" "" "0" "" "" "g.237381419G>A" "" "pathogenic" "" "0000176053" "21" "90" "2" "238257251" "238257251" "subst" "4.06583E-6" "00006" "COL6A3_000019" "g.238257251C>T" "" "{PMID:Demir 2002:11992252}, {OMIM120250:0002}" "MaeII" "" "0/100 control chromosomes; protein domain TH" "Germline" "" "" "0" "" "" "g.237348608C>T" "" "pathogenic" "" "0000176054" "21" "90" "2" "238256455" "238256455" "subst" "0" "00006" "COL6A3_000020" "g.238256455G>A" "" "{PMID:Demir 2002:11992252}" "" "" "0/200 control chromosomes; protein domain TH" "Germline" "" "" "0" "" "" "g.237347812G>A" "" "pathogenic" "" "0000176064" "0" "10" "2" "238287746" "238287746" "subst" "0.00150325" "00006" "COL6A2_000000" "g.238287746C>T" "" "{PMID:Baker 2007:17886299}" "" "" "N7" "Germline" "" "" "0" "" "" "g.237379103C>T" "" "benign" "" "0000176065" "0" "10" "2" "238258814" "238258814" "subst" "0.542393" "00006" "COL6A3_000030" "g.238258814C>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000176066" "1" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176067" "2" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176068" "1" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176069" "2" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176070" "1" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176071" "2" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176072" "0" "10" "2" "238249630" "238249630" "subst" "0.396917" "00006" "COL6A3_000037" "g.238249630C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000176073" "1" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00006" "COL6A3_000039" "g.238249108T>C" "" "{PMID:Baker 2007:17886299}" "" "8451G>A" "C2" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000176074" "2" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00006" "COL6A3_000039" "g.238249108T>C" "" "{PMID:Baker 2007:17886299}" "" "8451G>A" "C2" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000176075" "0" "10" "2" "238244963" "238244963" "subst" "0.631261" "00006" "COL6A3_000041" "g.238244963A>G" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336320A>G" "" "benign" "" "0000176076" "1" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00006" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176077" "2" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00006" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176078" "1" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00006" "COL6A3_000044" "g.238244781T>C" "" "{PMID:Baker 2007:17886299}" "" "8959G>A (Val2987Met)" "C3" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000176079" "2" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00006" "COL6A3_000044" "g.238244781T>C" "" "{PMID:Baker 2007:17886299}" "" "8959G>A (Val2987Met)" "C3" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000176080" "0" "10" "2" "238243464" "238243464" "subst" "0.763921" "00006" "COL6A3_000045" "g.238243464C>G" "" "{PMID:Baker 2007:17886299}" "" "9031C>G (Pro3011Ala)" "C4" "Germline" "" "" "0" "" "" "g.237334821C>G" "" "benign" "" "0000176081" "0" "10" "2" "238243292" "238243292" "subst" "0.385382" "00006" "COL6A3_000046" "g.238243292G>A" "" "{PMID:Baker 2007:17886299}" "" "9203C>T (Thr3068Ile)" "C4" "Germline" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000176092" "0" "10" "2" "238290066" "238290066" "subst" "0.0112668" "00006" "COL6A3_000022" "g.238290066G>A" "" "{PMID:Baker 2007:17886299}" "" "" "N8" "Germline" "" "" "0" "" "" "g.237381423G>A" "" "benign" "" "0000176093" "0" "10" "2" "238283605" "238283605" "subst" "0.234224" "00006" "COL6A3_000023" "g.238283605G>A" "" "{PMID:Baker 2007:17886299}" "" "" "N5" "Germline" "" "" "0" "" "" "g.237374962G>A" "" "benign" "" "0000176094" "0" "10" "2" "238277795" "238277795" "subst" "0.285002" "00006" "COL6A3_000024" "g.238277795A>G" "" "{PMID:Baker 2007:17886299}" "" "" "N3" "Germline" "" "" "0" "" "" "g.237369152A>G" "" "benign" "" "0000176095" "0" "10" "2" "238277573" "238277573" "subst" "0.238071" "00006" "COL6A3_000025" "g.238277573C>A" "" "{PMID:Baker 2007:17886299}" "" "" "N3" "Germline" "" "" "0" "" "" "g.237368930C>A" "" "benign" "" "0000176096" "0" "10" "2" "238258814" "238258814" "subst" "0.542393" "00006" "COL6A3_000030" "g.238258814C>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000176097" "1" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176098" "2" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176099" "1" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176100" "2" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176101" "0" "10" "2" "238253304" "238253304" "subst" "0" "00006" "COL6A3_000033" "g.238253304C>T" "" "{PMID:Baker 2007:17886299}" "" "" "also in unaffected relatives; C1" "Germline" "" "" "0" "" "" "g.237344661C>T" "" "benign" "" "0000176102" "0" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176103" "1" "10" "2" "238249717" "238249717" "subst" "0.0754022" "00006" "COL6A3_000036" "g.238249717G>A" "" "{PMID:Baker 2007:17886299}" "" "7842T>C" "C2" "Germline" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000176104" "2" "10" "2" "238249717" "238249717" "subst" "0.0754022" "00006" "COL6A3_000036" "g.238249717G>A" "" "{PMID:Baker 2007:17886299}" "" "7842T>C" "C2" "Germline" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000176105" "1" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00006" "COL6A3_000039" "g.238249108T>C" "" "{PMID:Baker 2007:17886299}" "" "8451G>A" "C2" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000176106" "2" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00006" "COL6A3_000039" "g.238249108T>C" "" "{PMID:Baker 2007:17886299}" "" "8451G>A" "C2" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000176107" "0" "10" "2" "238247734" "238247734" "subst" "0.0658182" "00006" "COL6A3_000040" "g.238247734C>G" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.237339091C>G" "" "benign" "" "0000176108" "1" "10" "2" "238244963" "238244963" "subst" "0.631261" "00006" "COL6A3_000041" "g.238244963A>G" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336320A>G" "" "benign" "" "0000176109" "2" "10" "2" "238244963" "238244963" "subst" "0.631261" "00006" "COL6A3_000041" "g.238244963A>G" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336320A>G" "" "benign" "" "0000176110" "1" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00006" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176111" "2" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00006" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176112" "1" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00006" "COL6A3_000044" "g.238244781T>C" "" "{PMID:Baker 2007:17886299}" "" "8959G>A (Val2987Met)" "C3" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000176113" "2" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00006" "COL6A3_000044" "g.238244781T>C" "" "{PMID:Baker 2007:17886299}" "" "8959G>A (Val2987Met)" "C3" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000176114" "0" "10" "2" "238243464" "238243464" "subst" "0.763921" "00006" "COL6A3_000045" "g.238243464C>G" "" "{PMID:Baker 2007:17886299}" "" "9031C>G (Pro3011Ala)" "C4" "Germline" "" "" "0" "" "" "g.237334821C>G" "" "benign" "" "0000176125" "0" "10" "2" "238277795" "238277795" "subst" "0.285002" "00006" "COL6A3_000024" "g.238277795A>G" "" "{PMID:Baker 2007:17886299}" "" "" "N3" "Germline" "" "" "0" "" "" "g.237369152A>G" "" "benign" "" "0000176126" "0" "10" "2" "238277573" "238277573" "subst" "0.238071" "00006" "COL6A3_000025" "g.238277573C>A" "" "{PMID:Baker 2007:17886299}" "" "" "N3" "Germline" "" "" "0" "" "" "g.237368930C>A" "" "benign" "" "0000176127" "0" "10" "2" "238277379" "238277379" "subst" "0.00999326" "00006" "COL6A3_000026" "g.238277379C>T" "" "{PMID:Baker 2007:17886299}" "" "" "N3" "Germline" "" "" "0" "" "" "g.237368736C>T" "" "benign" "" "0000176128" "0" "90" "2" "238275653" "238275653" "subst" "0" "00006" "COL6A3_000027" "g.238275653A>C" "" "{PMID:Baker 2007:17886299}, {OMIM120250:0006}" "" "" "N2" "Germline" "" "" "0" "" "" "g.237367010A>C" "" "pathogenic" "" "0000176129" "0" "10" "2" "238267717" "238267717" "subst" "0.212185" "00006" "COL6A3_000029" "g.238267717C>T" "" "{PMID:Baker 2007:17886299}" "" "" "helix" "Germline" "" "" "0" "" "" "g.237359074C>T" "" "benign" "" "0000176130" "1" "10" "2" "238258814" "238258814" "subst" "0.542393" "00006" "COL6A3_000030" "g.238258814C>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000176131" "2" "10" "2" "238258814" "238258814" "subst" "0.542393" "00006" "COL6A3_000030" "g.238258814C>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000176132" "1" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176133" "2" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176134" "1" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176135" "2" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176136" "1" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176137" "2" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176138" "1" "10" "2" "238249717" "238249717" "subst" "0.0754022" "00006" "COL6A3_000036" "g.238249717G>A" "" "{PMID:Baker 2007:17886299}" "" "7842T>C" "C2" "Germline" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000176139" "2" "10" "2" "238249717" "238249717" "subst" "0.0754022" "00006" "COL6A3_000036" "g.238249717G>A" "" "{PMID:Baker 2007:17886299}" "" "7842T>C" "C2" "Germline" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000176140" "1" "10" "2" "238249630" "238249630" "subst" "0.396917" "00006" "COL6A3_000037" "g.238249630C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000176141" "2" "10" "2" "238249630" "238249630" "subst" "0.396917" "00006" "COL6A3_000037" "g.238249630C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000176142" "1" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00006" "COL6A3_000039" "g.238249108T>C" "" "{PMID:Baker 2007:17886299}" "" "8451G>A" "C2" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000176143" "2" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00006" "COL6A3_000039" "g.238249108T>C" "" "{PMID:Baker 2007:17886299}" "" "8451G>A" "C2" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000176144" "1" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00006" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176145" "2" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00006" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176146" "1" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00006" "COL6A3_000044" "g.238244781T>C" "" "{PMID:Baker 2007:17886299}" "" "8959G>A (Val2987Met)" "C3" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000176147" "2" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00006" "COL6A3_000044" "g.238244781T>C" "" "{PMID:Baker 2007:17886299}" "" "8959G>A (Val2987Met)" "C3" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000176148" "1" "10" "2" "238243292" "238243292" "subst" "0.385382" "00006" "COL6A3_000046" "g.238243292G>A" "" "{PMID:Baker 2007:17886299}" "" "9203C>T (Thr3068Ile)" "C4" "Germline" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000176149" "2" "10" "2" "238243292" "238243292" "subst" "0.385382" "00006" "COL6A3_000046" "g.238243292G>A" "" "{PMID:Baker 2007:17886299}" "" "9203C>T (Thr3068Ile)" "C4" "Germline" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000176150" "1" "10" "2" "238243285" "238243285" "subst" "0.107227" "00006" "COL6A3_000047" "g.238243285G>A" "" "{PMID:Baker 2007:17886299}" "" "9210C>T" "C4" "Germline" "" "" "0" "" "" "g.237334642G>A" "" "benign" "" "0000176151" "2" "10" "2" "238243285" "238243285" "subst" "0.107227" "00006" "COL6A3_000047" "g.238243285G>A" "" "{PMID:Baker 2007:17886299}" "" "9210C>T" "C4" "Germline" "" "" "0" "" "" "g.237334642G>A" "" "benign" "" "0000176164" "0" "10" "2" "238258814" "238258814" "subst" "0.542393" "00006" "COL6A3_000030" "g.238258814C>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000176165" "1" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176166" "2" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176167" "1" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176168" "2" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176169" "1" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176170" "2" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176171" "0" "10" "2" "238249717" "238249717" "subst" "0.0754022" "00006" "COL6A3_000036" "g.238249717G>A" "" "{PMID:Baker 2007:17886299}" "" "7842T>C" "C2" "Germline" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000176172" "0" "10" "2" "238249630" "238249630" "subst" "0.396917" "00006" "COL6A3_000037" "g.238249630C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000176173" "0" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00006" "COL6A3_000039" "g.238249108T>C" "" "{PMID:Baker 2007:17886299}" "" "8451G>A" "C2" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000176174" "0" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00006" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176175" "0" "10" "2" "238244875" "238244877" "del" "0" "00006" "COL6A3_000043" "g.238244875_238244877del" "" "{PMID:Baker 2007:17886299}" "" "8874_8875insGCT" "C3" "Germline" "" "" "0" "" "" "g.237336232_237336234del" "" "benign" "" "0000176176" "0" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00006" "COL6A3_000044" "g.238244781T>C" "" "{PMID:Baker 2007:17886299}" "" "8959G>A (Val2987Met)" "C3" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000176177" "0" "10" "2" "238243292" "238243292" "subst" "0.385382" "00006" "COL6A3_000046" "g.238243292G>A" "" "{PMID:Baker 2007:17886299}" "" "9203C>T (Thr3068Ile)" "C4" "Germline" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000176188" "1" "10" "2" "238258814" "238258814" "subst" "0.542393" "00006" "COL6A3_000030" "g.238258814C>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000176189" "2" "10" "2" "238258814" "238258814" "subst" "0.542393" "00006" "COL6A3_000030" "g.238258814C>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000176190" "1" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176191" "2" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176192" "1" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176193" "2" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176194" "1" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176195" "2" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176196" "1" "10" "2" "238249717" "238249717" "subst" "0.0754022" "00006" "COL6A3_000036" "g.238249717G>A" "" "{PMID:Baker 2007:17886299}" "" "7842T>C" "C2" "Germline" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000176197" "2" "10" "2" "238249717" "238249717" "subst" "0.0754022" "00006" "COL6A3_000036" "g.238249717G>A" "" "{PMID:Baker 2007:17886299}" "" "7842T>C" "C2" "Germline" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000176198" "1" "10" "2" "238249630" "238249630" "subst" "0.396917" "00006" "COL6A3_000037" "g.238249630C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000176199" "2" "10" "2" "238249630" "238249630" "subst" "0.396917" "00006" "COL6A3_000037" "g.238249630C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000176200" "1" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00006" "COL6A3_000039" "g.238249108T>C" "" "{PMID:Baker 2007:17886299}" "" "8451G>A" "C2" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000176201" "2" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00006" "COL6A3_000039" "g.238249108T>C" "" "{PMID:Baker 2007:17886299}" "" "8451G>A" "C2" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000176202" "1" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00006" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176203" "2" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00006" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176204" "1" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00006" "COL6A3_000044" "g.238244781T>C" "" "{PMID:Baker 2007:17886299}" "" "8959G>A (Val2987Met)" "C3" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000176205" "2" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00006" "COL6A3_000044" "g.238244781T>C" "" "{PMID:Baker 2007:17886299}" "" "8959G>A (Val2987Met)" "C3" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000176206" "1" "10" "2" "238243292" "238243292" "subst" "0.385382" "00006" "COL6A3_000046" "g.238243292G>A" "" "{PMID:Baker 2007:17886299}" "" "9203C>T (Thr3068Ile)" "C4" "Germline" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000176207" "2" "10" "2" "238243292" "238243292" "subst" "0.385382" "00006" "COL6A3_000046" "g.238243292G>A" "" "{PMID:Baker 2007:17886299}" "" "9203C>T (Thr3068Ile)" "C4" "Germline" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000176221" "0" "10" "2" "238277795" "238277795" "subst" "0.285002" "00006" "COL6A3_000024" "g.238277795A>G" "" "{PMID:Baker 2007:17886299}" "" "" "N3" "Germline" "" "" "0" "" "" "g.237369152A>G" "" "benign" "" "0000176222" "0" "10" "2" "238277573" "238277573" "subst" "0.238071" "00006" "COL6A3_000025" "g.238277573C>A" "" "{PMID:Baker 2007:17886299}" "" "" "N3" "Germline" "" "" "0" "" "" "g.237368930C>A" "" "benign" "" "0000176223" "0" "10" "2" "238258814" "238258814" "subst" "0.542393" "00006" "COL6A3_000030" "g.238258814C>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000176224" "1" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176225" "2" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176226" "1" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176227" "2" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176228" "0" "10" "2" "238253152" "238253152" "subst" "0.0289343" "00006" "COL6A3_000034" "g.238253152C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344509C>T" "" "benign" "" "0000176229" "0" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176230" "0" "10" "2" "238249717" "238249717" "subst" "0.0754022" "00006" "COL6A3_000036" "g.238249717G>A" "" "{PMID:Baker 2007:17886299}" "" "7842T>C" "C2" "Germline" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000176231" "0" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00006" "COL6A3_000039" "g.238249108T>C" "" "{PMID:Baker 2007:17886299}" "" "8451G>A" "C2" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000176232" "0" "10" "2" "238247734" "238247734" "subst" "0.0658182" "00006" "COL6A3_000040" "g.238247734C>G" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.237339091C>G" "" "benign" "" "0000176233" "0" "10" "2" "238244963" "238244963" "subst" "0.631261" "00006" "COL6A3_000041" "g.238244963A>G" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336320A>G" "" "benign" "" "0000176234" "0" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00006" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176235" "0" "10" "2" "238244875" "238244877" "del" "0" "00006" "COL6A3_000043" "g.238244875_238244877del" "" "{PMID:Baker 2007:17886299}" "" "8874_8875insGCT" "C3" "Germline" "" "" "0" "" "" "g.237336232_237336234del" "" "benign" "" "0000176236" "0" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00006" "COL6A3_000044" "g.238244781T>C" "" "{PMID:Baker 2007:17886299}" "" "8959G>A (Val2987Met)" "C3" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000176245" "0" "10" "2" "238267717" "238267717" "subst" "0.212185" "00006" "COL6A3_000029" "g.238267717C>T" "" "{PMID:Baker 2007:17886299}" "" "" "helix" "Germline" "" "" "0" "" "" "g.237359074C>T" "" "benign" "" "0000176246" "0" "10" "2" "238258814" "238258814" "subst" "0.542393" "00006" "COL6A3_000030" "g.238258814C>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000176247" "0" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176248" "1" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176249" "2" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176250" "1" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176251" "2" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176252" "1" "10" "2" "238249717" "238249717" "subst" "0.0754022" "00006" "COL6A3_000036" "g.238249717G>A" "" "{PMID:Baker 2007:17886299}" "" "7842T>C" "C2" "Germline" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000176253" "2" "10" "2" "238249717" "238249717" "subst" "0.0754022" "00006" "COL6A3_000036" "g.238249717G>A" "" "{PMID:Baker 2007:17886299}" "" "7842T>C" "C2" "Germline" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000176254" "0" "10" "2" "238249630" "238249630" "subst" "0.396917" "00006" "COL6A3_000037" "g.238249630C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000176255" "1" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00006" "COL6A3_000039" "g.238249108T>C" "" "{PMID:Baker 2007:17886299}" "" "8451G>A" "C2" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000176256" "2" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00006" "COL6A3_000039" "g.238249108T>C" "" "{PMID:Baker 2007:17886299}" "" "8451G>A" "C2" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000176257" "1" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00006" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176258" "2" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00006" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176259" "1" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00006" "COL6A3_000044" "g.238244781T>C" "" "{PMID:Baker 2007:17886299}" "" "8959G>A (Val2987Met)" "C3" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000176260" "2" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00006" "COL6A3_000044" "g.238244781T>C" "" "{PMID:Baker 2007:17886299}" "" "8959G>A (Val2987Met)" "C3" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000176261" "0" "10" "2" "238243292" "238243292" "subst" "0.385382" "00006" "COL6A3_000046" "g.238243292G>A" "" "{PMID:Baker 2007:17886299}" "" "9203C>T (Thr3068Ile)" "C4" "Germline" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000176274" "0" "10" "2" "238277795" "238277795" "subst" "0.285002" "00006" "COL6A3_000024" "g.238277795A>G" "" "{PMID:Baker 2007:17886299}" "" "" "N3" "Germline" "" "" "0" "" "" "g.237369152A>G" "" "benign" "" "0000176275" "0" "10" "2" "238277573" "238277573" "subst" "0.238071" "00006" "COL6A3_000025" "g.238277573C>A" "" "{PMID:Baker 2007:17886299}" "" "" "N3" "Germline" "" "" "0" "" "" "g.237368930C>A" "" "benign" "" "0000176276" "0" "10" "2" "238258814" "238258814" "subst" "0.542393" "00006" "COL6A3_000030" "g.238258814C>G" "" "{PMID:Baker 2007:17886299}" "" "" "helix" "Germline" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000176277" "1" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176278" "2" "10" "2" "238257013" "238257013" "subst" "0.114359" "00006" "COL6A3_000031" "g.238257013G>A" "" "{PMID:Baker 2007:17886299}" "" "6945T>C" "helix" "Germline" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000176279" "1" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176280" "2" "10" "2" "238253369" "238253369" "subst" "0" "00006" "COL6A3_000032" "g.238253369T>A" "" "{PMID:Baker 2007:17886299}" "" "7292T>A" "C1" "Germline" "" "" "0" "" "" "g.237344726T>A" "" "benign" "" "0000176281" "0" "10" "2" "238253152" "238253152" "subst" "0.0289343" "00006" "COL6A3_000034" "g.238253152C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344509C>T" "" "benign" "" "0000176282" "1" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176283" "2" "10" "2" "238253065" "238253065" "subst" "0.127718" "00006" "COL6A3_000035" "g.238253065C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C1" "Germline" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000176284" "0" "10" "2" "238249717" "238249717" "subst" "0.0754022" "00006" "COL6A3_000036" "g.238249717G>A" "" "{PMID:Baker 2007:17886299}" "" "7842T>C" "C2" "Germline" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000176285" "0" "10" "2" "238249630" "238249630" "subst" "0.396917" "00006" "COL6A3_000037" "g.238249630C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000176286" "0" "10" "2" "238249579" "238249579" "subst" "0" "00006" "COL6A3_000038" "g.238249579G>A" "" "{PMID:Baker 2007:17886299}" "" "" "C2" "Germline" "" "" "0" "" "" "g.237340936G>A" "" "benign" "" "0000176287" "0" "10" "2" "238249108" "238249108" "subst" "0.0749322" "00006" "COL6A3_000039" "g.238249108T>C" "" "{PMID:Baker 2007:17886299}" "" "8451G>A" "C2" "Germline" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000176288" "0" "10" "2" "238244923" "238244923" "subst" "0.0750104" "00006" "COL6A3_000042" "g.238244923C>T" "" "{PMID:Baker 2007:17886299}" "" "" "C3" "Germline" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000176289" "0" "10" "2" "238244875" "238244877" "del" "0" "00006" "COL6A3_000043" "g.238244875_238244877del" "" "{PMID:Baker 2007:17886299}" "" "8874_8875insGCT" "C3" "Germline" "" "" "0" "" "" "g.237336232_237336234del" "" "benign" "" "0000176290" "0" "10" "2" "238244781" "238244781" "subst" "0.0760959" "00006" "COL6A3_000044" "g.238244781T>C" "" "{PMID:Baker 2007:17886299}" "" "8959G>A (Val2987Met)" "C3" "Germline" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000176291" "0" "10" "2" "238243292" "238243292" "subst" "0.385382" "00006" "COL6A3_000046" "g.238243292G>A" "" "{PMID:Baker 2007:17886299}" "" "9203C>T (Thr3068Ile)" "C4" "Germline" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000176296" "20" "70" "2" "238266527" "238266527" "subst" "0" "00464" "COL6A3_000051" "g.238266527T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237357884T>C" "" "likely pathogenic" "" "0000176301" "0" "70" "2" "238253699" "238253699" "dup" "0" "00464" "COL6A3_000017" "g.238253699dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237345056dup" "" "likely pathogenic" "" "0000176302" "0" "30" "2" "238277379" "238277379" "subst" "0.00999326" "00464" "COL6A3_000026" "g.238277379C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237368736C>T" "" "likely benign" "" "0000176303" "0" "50" "2" "238244921" "238244921" "subst" "0.00381934" "00464" "COL6A3_000021" "g.238244921G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237336278G>A" "" "VUS" "" "0000176311" "0" "50" "2" "238267183" "238267183" "subst" "4.06095E-6" "00464" "COL6A3_000055" "g.238267183A>G" "" "" "" "" "decreased col6 staining in muscle biopsy" "Germline" "" "" "0" "" "" "g.237358540A>G" "" "VUS" "" "0000176320" "11" "50" "2" "238289767" "238289767" "subst" "0.00216865" "00537" "COL6A3_000143" "g.238289767T>C" "" "{PMID:Butterfield:24038877}" "" "" "unaffected father carries this allele" "Germline" "yes" "" "0" "" "" "g.237381124T>C" "" "VUS" "" "0000176321" "1" "50" "2" "238242176" "238242176" "subst" "0.000832555" "00537" "COL6A3_000147" "g.238242176G>C" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237333533G>C" "" "VUS" "" "0000176326" "1" "50" "2" "238268789" "238268789" "subst" "7.31273E-5" "00537" "COL6A3_000148" "g.238268789G>A" "" "{PMID:Butterfield:24038877}" "" "" "" "Germline" "?" "" "0" "" "" "g.237360146G>A" "" "VUS" "" "0000176327" "21" "90" "21" "238257027" "238257027" "subst" "0" "00537" "COL6A3_000156" "g.238257027C>T" "" "{PMID:Butterfield:24038877}" "" "" "Variant Error [EREF/0]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000176331" "2" "90" "21" "238275786" "238275786" "subst" "0" "00537" "COL6A3_000159" "g.238275786delG" "" "{PMID:Butterfield:24038877}" "" "" "Variant Error [EREF/0]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "?" "" "0" "" "" "" "" "pathogenic" "" "0000176351" "21" "90" "2" "238296314" "238296314" "subst" "8.14438E-6" "00472" "COL6A3_000160" "g.238296314A>G" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.237387671A>G" "" "pathogenic" "" "0000176356" "21" "90" "2" "238255172" "238255172" "subst" "0" "00472" "COL6A3_000162" "g.238255172C>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.237346529C>T" "" "pathogenic" "" "0000176359" "1" "50" "2" "238280543" "238280543" "subst" "0.000605617" "00472" "COL6A3_000171" "g.238280543C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237371900C>T" "" "VUS" "" "0000176374" "2" "50" "2" "238275730" "238275730" "subst" "0.00484613" "00472" "COL6A3_000088" "g.238275730C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237367087C>T" "" "VUS" "" "0000176375" "11" "50" "2" "238269775" "238269775" "subst" "0" "00472" "COL6A3_000166" "g.238269775C>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.237361132C>T" "" "VUS" "" "0000176376" "1" "90" "2" "238270380" "238270380" "subst" "0" "00472" "COL6A3_000167" "g.238270380A>C" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237361737A>C" "" "pathogenic" "" "0000176377" "0" "50" "2" "238249550" "238249550" "subst" "0.000619135" "00472" "COL6A3_000169" "g.238249550G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237340907G>A" "" "VUS" "" "0000176378" "0" "50" "2" "238287862" "238287862" "subst" "0.00719767" "00472" "COL6A3_000070" "g.238287862C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237379219C>T" "" "VUS" "" "0000176379" "1" "90" "2" "238287800" "238287800" "subst" "0.0060661" "00472" "COL6A3_000071" "g.238287800C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237379157C>T" "" "pathogenic" "" "0000176380" "21" "50" "21" "238280491" "238280491" "subst" "0" "00472" "COL6A3_000170" "g.238280491G>A" "" "" "" "" "Variant Error [EREF/0]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Germline" "yes" "" "0" "" "" "" "" "VUS" "" "0000176381" "2" "90" "2" "238253016" "238253016" "subst" "0.00383687" "00472" "COL6A3_000124" "g.238253016G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.237344373G>A" "" "pathogenic" "" "0000176383" "20" "70" "2" "238245109" "238245109" "del" "0" "01715" "COL6A3_000184" "g.238245109del" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.237336466del" "" "likely pathogenic" "" "0000245732" "0" "10" "2" "238277795" "238277795" "subst" "0.285002" "02330" "COL6A3_000024" "g.238277795A>G" "" "" "" "COL6A3(NM_004369.3):c.4311T>C (p.I1437=), COL6A3(NM_004369.4):c.4311T>C (p.I1437=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237369152A>G" "" "benign" "" "0000245843" "0" "10" "2" "238234285" "238234285" "subst" "0.0135931" "02330" "COL6A3_000140" "g.238234285A>G" "" "" "" "COL6A3(NM_004369.3):c.9411T>C (p.(Cys3137=)), COL6A3(NM_004369.4):c.9411T>C (p.C3137=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237325642A>G" "" "benign" "" "0000245939" "0" "10" "2" "238257353" "238257353" "subst" "0.147327" "02330" "COL6A3_000111" "g.238257353A>G" "" "" "" "COL6A3(NM_004369.4):c.6880-47T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237348710A>G" "" "benign" "" "0000245940" "0" "10" "2" "238322579" "238322579" "subst" "0" "02330" "COL6A3_000238" "g.238322579A>G" "" "" "" "COL6A3(NM_004369.4):c.-31+17T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237413936A>G" "" "benign" "" "0000245982" "0" "30" "2" "238289977" "238289977" "subst" "0.00125084" "02330" "COL6A3_000236" "g.238289977A>G" "" "" "" "COL6A3(NM_004369.4):c.1478T>C (p.V493A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237381334A>G" "" "likely benign" "" "0000250954" "0" "10" "2" "238277795" "238277795" "subst" "0.285002" "02326" "COL6A3_000024" "g.238277795A>G" "" "" "" "COL6A3(NM_004369.3):c.4311T>C (p.I1437=), COL6A3(NM_004369.4):c.4311T>C (p.I1437=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237369152A>G" "" "benign" "" "0000253517" "0" "10" "2" "238280781" "238280781" "subst" "0.00174404" "01943" "COL6A3_000228" "g.238280781A>C" "" "" "" "COL6A3(NM_004369.3):c.3879T>G (p.D1293E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237372138A>C" "" "benign" "" "0000255033" "0" "30" "2" "238287313" "238287313" "subst" "0.00238809" "01943" "COL6A3_000233" "g.238287313A>G" "" "" "" "COL6A3(NM_004369.3):c.2463T>C (p.S821=, p.(Ser821=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237378670A>G" "" "likely benign" "" "0000264869" "0" "10" "2" "238232752" "238232752" "del" "0" "02330" "COL6A3_000197" "g.238232752del" "" "" "" "COL6A3(NM_004369.4):c.*665delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237324109del" "" "benign" "" "0000264870" "0" "30" "2" "238232752" "238232752" "subst" "0" "02330" "COL6A3_000198" "g.238232752C>A" "" "" "" "COL6A3(NM_004369.4):c.*665G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237324109C>A" "" "likely benign" "" "0000264871" "0" "10" "2" "238233410" "238233410" "subst" "0.143911" "02330" "COL6A3_000142" "g.238233410C>G" "" "" "" "COL6A3(NM_004369.4):c.*7G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237324767C>G" "" "benign" "" "0000264872" "0" "10" "2" "238296355" "238296355" "subst" "0.00589232" "02330" "COL6A3_000062" "g.238296355G>A" "" "" "" "COL6A3(NM_004369.3):c.1182C>T (p.(Thr394=)), COL6A3(NM_004369.4):c.1182C>T (p.T394=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237387712G>A" "" "benign" "" "0000264873" "0" "10" "2" "238296306" "238296306" "subst" "0.00401582" "02330" "COL6A3_000063" "g.238296306G>C" "" "" "" "COL6A3(NM_004369.3):c.1231C>G (p.L411V, p.(Leu411Val)), COL6A3(NM_004369.4):c.1231C>G (p.L411V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237387663G>C" "" "benign" "" "0000264874" "0" "10" "2" "238290159" "238290159" "subst" "0.00618378" "02330" "COL6A3_000065" "g.238290159T>C" "" "" "" "COL6A3(NM_004369.3):c.1313-17A>G (p.(=)), COL6A3(NM_004369.4):c.1313-17A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237381516T>C" "" "benign" "" "0000264875" "0" "10" "2" "238289984" "238289984" "subst" "0.00745626" "02330" "COL6A3_000066" "g.238289984C>G" "" "" "" "COL6A3(NM_004369.3):c.1471G>C (p.(Asp491His), p.D491H), COL6A3(NM_004369.4):c.1471G>C (p.D491H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237381341C>G" "" "benign" "" "0000264876" "0" "10" "2" "238289980" "238289980" "subst" "0.00745614" "02330" "COL6A3_000067" "g.238289980G>C" "" "" "" "COL6A3(NM_004369.3):c.1475C>G (p.(Thr492Ser), p.T492S), COL6A3(NM_004369.4):c.1475C>G (p.T492S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237381337G>C" "" "benign" "" "0000264877" "0" "90" "2" "238303764" "238303764" "subst" "5.32516E-5" "02330" "COL6A3_000057" "g.238303764G>A" "" "" "" "COL6A3(NM_004369.4):c.175C>T (p.R59*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237395121G>A" "" "pathogenic" "" "0000264878" "0" "30" "2" "238287799" "238287799" "subst" "7.75605E-5" "02330" "COL6A3_000234" "g.238287799G>A" "" "" "" "COL6A3(NM_004369.4):c.1977C>T (p.R659=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237379156G>A" "" "likely benign" "" "0000264879" "0" "10" "2" "238287357" "238287357" "subst" "0.0265411" "02330" "COL6A3_000072" "g.238287357C>T" "" "" "" "COL6A3(NM_004369.3):c.2419G>A (p.(Ala807Thr), p.A807T), COL6A3(NM_004369.4):c.2419G>A (p.A807T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237378714C>T" "" "benign" "" "0000264880" "0" "10" "2" "238287288" "238287288" "subst" "0.026569" "02330" "COL6A3_000073" "g.238287288C>A" "" "" "" "COL6A3(NM_004369.3):c.2488G>T (p.(Ala830Ser), p.A830S), COL6A3(NM_004369.4):c.2488G>T (p.A830S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237378645C>A" "" "benign" "" "0000264881" "0" "50" "2" "238285445" "238285445" "subst" "0.00020732" "02330" "COL6A3_000003" "g.238285445T>C" "" "" "" "COL6A3(NM_004369.4):c.3040A>G (p.K1014E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237376802T>C" "" "VUS" "" "0000264882" "0" "10" "2" "238283679" "238283679" "subst" "0.0046851" "02330" "COL6A3_000075" "g.238283679C>T" "" "" "" "COL6A3(NM_004369.3):c.3071-16G>A (p.(=)), COL6A3(NM_004369.4):c.3071-16G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237375036C>T" "" "benign" "" "0000264884" "0" "10" "2" "238283605" "238283605" "subst" "0.234224" "02330" "COL6A3_000023" "g.238283605G>A" "" "" "" "COL6A3(NM_004369.3):c.3129C>T (p.G1043=), COL6A3(NM_004369.4):c.3129C>T (p.G1043=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237374962G>A" "" "benign" "" "0000264885" "0" "10" "2" "238283472" "238283472" "subst" "0.037234" "02330" "COL6A3_000078" "g.238283472T>G" "" "" "" "COL6A3(NM_004369.3):c.3262A>C (p.(Lys1088Gln)), COL6A3(NM_004369.4):c.3262A>C (p.K1088Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237374829T>G" "" "benign" "" "0000264886" "0" "30" "2" "238283464" "238283464" "subst" "0.0016295" "02330" "COL6A3_000231" "g.238283464G>A" "" "" "" "COL6A3(NM_004369.3):c.3270C>T (p.D1090=), COL6A3(NM_004369.4):c.3270C>T (p.D1090=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237374821G>A" "" "likely benign" "" "0000264887" "0" "30" "2" "238280358" "238280358" "subst" "0.0102711" "02330" "COL6A3_000083" "g.238280358C>T" "" "" "" "COL6A3(NM_004369.3):c.4285+17G>A (p.(=)), COL6A3(NM_057165.5):c.3684G>A (p.S1228=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237371715C>T" "" "likely benign" "" "0000264888" "0" "10" "2" "238280553" "238280553" "subst" "0.00532339" "02330" "COL6A3_000226" "g.238280553G>A" "" "" "" "COL6A3(NM_004369.3):c.4107C>T (p.(Ile1369=)), COL6A3(NM_004369.4):c.4107C>T (p.I1369=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237371910G>A" "" "benign" "" "0000264889" "0" "10" "2" "238277573" "238277573" "subst" "0.238071" "02330" "COL6A3_000025" "g.238277573C>A" "" "" "" "COL6A3(NM_004369.3):c.4533G>T (p.G1511=), COL6A3(NM_004369.4):c.4533G>T (p.G1511=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237368930C>A" "" "benign" "" "0000264890" "0" "10" "2" "238277379" "238277379" "subst" "0.00999326" "02330" "COL6A3_000026" "g.238277379C>T" "" "" "" "COL6A3(NM_004369.3):c.4727G>A (p.(Arg1576Gln), p.R1576Q), COL6A3(NM_004369.4):c.4727G>A (p.R1576Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237368736C>T" "" "benign" "" "0000264891" "0" "10" "2" "238277211" "238277211" "subst" "0.0102198" "02330" "COL6A3_000087" "g.238277211C>T" "" "" "" "COL6A3(NM_004369.3):c.4895G>A (p.(Arg1632Gln)), COL6A3(NM_004369.4):c.4895G>A (p.R1632Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237368568C>T" "" "benign" "" "0000264892" "0" "10" "2" "238275569" "238275569" "subst" "0.00779664" "02330" "COL6A3_000090" "g.238275569T>C" "" "" "" "COL6A3(NM_004369.3):c.5261A>G (p.(Lys1754Arg), p.K1754R), COL6A3(NM_004369.4):c.5261A>G (p.K1754R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237366926T>C" "" "benign" "" "0000264894" "0" "50" "2" "238271906" "238271906" "subst" "0.000625371" "02330" "COL6A3_000220" "g.238271906G>A" "" "" "" "COL6A3(NM_004369.4):c.6053C>T (p.A2018V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237363263G>A" "" "VUS" "" "0000264895" "0" "10" "2" "238271890" "238271890" "dup" "0" "02330" "COL6A3_000219" "g.238271890dup" "" "" "" "COL6A3(NM_004369.3):c.6063+13dupT, COL6A3(NM_004369.4):c.6063+13dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237363247dup" "" "benign" "" "0000264897" "0" "10" "2" "238269871" "238269871" "subst" "0" "02330" "COL6A3_000217" "g.238269871C>G" "" "" "" "COL6A3(NM_004369.4):c.6157-54G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237361228C>G" "" "benign" "" "0000264898" "0" "90" "2" "238269763" "238269763" "subst" "0" "02330" "COL6A3_000012" "g.238269763C>T" "" "" "" "COL6A3(NM_004369.4):c.6210+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000264899" "0" "90" "2" "238268730" "238268730" "subst" "0" "02330" "COL6A3_000102" "g.238268730C>T" "" "" "" "COL6A3(NM_004369.4):c.6282+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237360087C>T" "" "pathogenic" "" "0000264900" "0" "90" "2" "238268021" "238268021" "subst" "0" "02330" "COL6A3_000154" "g.238268021C>A" "" "" "" "COL6A3(NM_004369.4):c.6293G>T (p.G2098V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237359378C>A" "" "pathogenic" "" "0000264901" "0" "10" "2" "238267717" "238267717" "subst" "0.212185" "02330" "COL6A3_000029" "g.238267717C>T" "" "" "" "COL6A3(NM_004369.4):c.6369G>A (p.L2123=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237359074C>T" "" "benign" "" "0000264902" "0" "30" "2" "238262021" "238262021" "subst" "0.0414876" "02330" "COL6A3_000109" "g.238262021G>A" "" "" "" "COL6A3(NM_004369.3):c.6653C>T (p.(Pro2218Leu)), COL6A3(NM_004369.4):c.6653C>T (p.P2218L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237353378G>A" "" "likely benign" "" "0000264903" "0" "10" "2" "238258814" "238258814" "subst" "0.542393" "02330" "COL6A3_000030" "g.238258814C>G" "" "" "" "COL6A3(NM_004369.3):c.6855G>C (p.G2285=), COL6A3(NM_004369.4):c.6855G>C (p.G2285=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000264904" "0" "10" "2" "238257213" "238257213" "subst" "0.114974" "02330" "COL6A3_000113" "g.238257213C>G" "" "" "" "COL6A3(NM_004369.4):c.6930+43G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237348570C>G" "" "benign" "" "0000264905" "0" "10" "2" "238257013" "238257013" "subst" "0.114359" "02330" "COL6A3_000031" "g.238257013G>A" "" "" "" "COL6A3(NM_004369.4):c.6945C>T (p.F2315=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000264906" "0" "10" "2" "238256498" "238256498" "subst" "0.00482132" "02330" "COL6A3_000115" "g.238256498T>C" "" "" "" "COL6A3(NM_004369.3):c.6981A>G (p.(Glu2327=)), COL6A3(NM_004369.4):c.6981A>G (p.E2327=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237347855T>C" "" "benign" "" "0000264907" "0" "10" "2" "238255152" "238255152" "subst" "0.00520199" "02330" "COL6A3_000116" "g.238255152T>G" "" "" "" "COL6A3(NM_004369.3):c.7086A>C (p.(Gly2362=)), COL6A3(NM_004369.4):c.7086A>C (p.G2362=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237346509T>G" "" "benign" "" "0000264908" "0" "10" "2" "238255120" "238255120" "subst" "0.14994" "02330" "COL6A3_000117" "g.238255120C>T" "" "" "" "COL6A3(NM_004369.4):c.7092+26G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237346477C>T" "" "benign" "" "0000264909" "0" "10" "2" "238253332" "238253332" "subst" "0.0318083" "02330" "COL6A3_000121" "g.238253332G>A" "" "" "" "COL6A3(NM_004369.3):c.7329C>T (p.(=)), COL6A3(NM_004369.4):c.7329C>T (p.A2443=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344689G>A" "" "benign" "" "0000264910" "0" "50" "2" "238253214" "238253214" "subst" "0.000629523" "02330" "COL6A3_000191" "g.238253214T>C" "" "" "" "COL6A3(NM_004369.4):c.7447A>G (p.K2483E, p.(Lys2483Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344571T>C" "" "VUS" "" "0000264911" "0" "10" "2" "238253152" "238253152" "subst" "0.0289343" "02330" "COL6A3_000034" "g.238253152C>T" "" "" "" "COL6A3(NM_004369.3):c.7509G>A (p.(Arg2503=), p.R2503=), COL6A3(NM_004369.4):c.7509G>A (p.R2503=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344509C>T" "" "benign" "" "0000264912" "0" "10" "2" "238253149" "238253149" "subst" "0.112914" "02330" "COL6A3_000123" "g.238253149G>A" "" "" "" "COL6A3(NM_004369.4):c.7512C>T (p.N2504=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344506G>A" "" "benign" "" "0000264913" "0" "10" "2" "238253065" "238253065" "subst" "0.127718" "02330" "COL6A3_000035" "g.238253065C>T" "" "" "" "COL6A3(NM_004369.4):c.7596G>A (p.K2532=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000264914" "0" "10" "2" "238252972" "238252972" "subst" "0.00484331" "02330" "COL6A3_000125" "g.238252972C>G" "" "" "" "COL6A3(NM_004369.4):c.7668+21G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344329C>G" "" "benign" "" "0000264915" "0" "10" "2" "238296769" "238296769" "subst" "0.0147315" "02330" "COL6A3_000060" "g.238296769G>A" "" "" "" "COL6A3(NM_004369.3):c.768C>T (p.(Val256=)), COL6A3(NM_004369.4):c.768C>T (p.V256=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237388126G>A" "" "benign" "" "0000264916" "0" "10" "2" "238249717" "238249717" "subst" "0.0754022" "02330" "COL6A3_000036" "g.238249717G>A" "" "" "" "COL6A3(NM_004369.4):c.7842C>T (p.S2614=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000264917" "0" "10" "2" "238249630" "238249630" "subst" "0.396917" "02330" "COL6A3_000037" "g.238249630C>T" "" "" "" "COL6A3(NM_004369.4):c.7929G>A (p.A2643=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000264918" "0" "10" "2" "238249564" "238249564" "subst" "0.00484445" "02330" "COL6A3_000129" "g.238249564T>G" "" "" "" "COL6A3(NM_004369.3):c.7995A>C (p.(Ala2665=)), COL6A3(NM_004369.4):c.7995A>C (p.A2665=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237340921T>G" "" "benign" "" "0000264919" "0" "10" "2" "238249549" "238249549" "subst" "0.00123475" "02330" "COL6A3_000131" "g.238249549C>T" "" "" "" "COL6A3(NM_004369.4):c.8010G>A (p.A2670=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237340906C>T" "" "benign" "" "0000264920" "0" "10" "2" "238249414" "238249414" "subst" "0.00483693" "02330" "COL6A3_000132" "g.238249414T>C" "" "" "" "COL6A3(NM_004369.3):c.8145A>G (p.(Leu2715=)), COL6A3(NM_004369.4):c.8145A>G (p.L2715=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237340771T>C" "" "benign" "" "0000264921" "0" "10" "2" "238249108" "238249108" "subst" "0.0749322" "02330" "COL6A3_000039" "g.238249108T>C" "" "" "" "COL6A3(NM_004369.4):c.8451A>G (p.P2817=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000264922" "0" "50" "2" "238249075" "238249075" "subst" "0.000178123" "02330" "COL6A3_000133" "g.238249075C>G" "" "" "" "COL6A3(NM_004369.4):c.8464+20G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237340432C>G" "" "VUS" "" "0000264923" "0" "10" "2" "238247734" "238247734" "subst" "0.0658182" "02330" "COL6A3_000040" "g.238247734C>G" "" "" "" "COL6A3(NM_004369.4):c.8491G>C (p.D2831H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237339091C>G" "" "benign" "" "0000264924" "0" "50" "2" "238245019" "238245019" "subst" "0.000105581" "02330" "COL6A3_000206" "g.238245019G>A" "" "" "" "COL6A3(NM_004369.3):c.8724C>T (p.A2908=), COL6A3(NM_004369.4):c.8724C>T (p.A2908=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237336376G>A" "" "VUS" "" "0000264925" "0" "50" "2" "238244924" "238244924" "subst" "0.000178744" "02330" "COL6A3_000205" "g.238244924G>A" "" "" "" "COL6A3(NM_004369.3):c.8819C>T (p.(Thr2940Met)), COL6A3(NM_004369.4):c.8819C>T (p.T2940M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237336281G>A" "" "VUS" "" "0000264926" "0" "10" "2" "238244923" "238244923" "subst" "0.0750104" "02330" "COL6A3_000042" "g.238244923C>T" "" "" "" "COL6A3(NM_004369.4):c.8820G>A (p.T2940=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000264927" "0" "10" "2" "238244921" "238244921" "subst" "0.00381934" "02330" "COL6A3_000021" "g.238244921G>A" "" "" "" "COL6A3(NM_004369.3):c.8822C>T (p.(Ala2941Val), p.A2941V), COL6A3(NM_004369.4):c.8822C>T (p.A2941V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237336278G>A" "" "benign" "" "0000264928" "0" "10" "2" "238244875" "238244877" "del" "0" "02330" "COL6A3_000043" "g.238244875_238244877del" "" "" "" "COL6A3(NM_004369.4):c.8877_8879delTGC (p.A2960del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237336232_237336234del" "" "benign" "" "0000264929" "0" "10" "2" "238244781" "238244781" "subst" "0.0760959" "02330" "COL6A3_000044" "g.238244781T>C" "" "" "" "COL6A3(NM_004369.4):c.8962A>G (p.M2988V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000264930" "0" "50" "2" "238243486" "238243486" "subst" "0.000369819" "02330" "COL6A3_000203" "g.238243486G>A" "" "" "" "COL6A3(NM_004369.3):c.9012C>T (p.(=)), COL6A3(NM_004369.4):c.9012C>T (p.S3004=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334843G>A" "" "VUS" "" "0000264931" "0" "10" "2" "238243464" "238243464" "subst" "0.763921" "02330" "COL6A3_000045" "g.238243464C>G" "" "" "" "COL6A3(NM_004369.3):c.9034G>C (p.A3012P), COL6A3(NM_004369.4):c.9034G>C (p.A3012P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334821C>G" "" "benign" "" "0000264932" "0" "10" "2" "238243375" "238243375" "subst" "0.0260362" "02330" "COL6A3_000137" "g.238243375C>T" "" "" "" "COL6A3(NM_004369.3):c.9123G>A (p.(Thr3041=), p.T3041=), COL6A3(NM_004369.4):c.9123G>A (p.T3041=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334732C>T" "" "benign" "" "0000264933" "0" "50" "2" "238243370" "238243370" "subst" "0.00111272" "02330" "COL6A3_000201" "g.238243370C>T" "" "" "" "COL6A3(NM_004369.4):c.9128G>A (p.R3043H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334727C>T" "" "VUS" "" "0000264934" "0" "10" "2" "238243369" "238243369" "subst" "0.0309244" "02330" "COL6A3_000138" "g.238243369G>A" "" "" "" "COL6A3(NM_004369.3):c.9129C>T (p.(=)), COL6A3(NM_004369.4):c.9129C>T (p.R3043=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334726G>A" "" "benign" "" "0000264935" "0" "10" "2" "238243292" "238243292" "subst" "0.385382" "02330" "COL6A3_000046" "g.238243292G>A" "" "" "" "COL6A3(NM_004369.3):c.9206C>T (p.T3069I), COL6A3(NM_004369.4):c.9206C>T (p.T3069I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000264936" "0" "10" "2" "238243285" "238243285" "subst" "0.107227" "02330" "COL6A3_000047" "g.238243285G>A" "" "" "" "COL6A3(NM_004369.4):c.9213C>T (p.H3071=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334642G>A" "" "benign" "" "0000264937" "0" "10" "2" "238233483" "238233483" "subst" "0.290644" "02330" "COL6A3_000141" "g.238233483G>A" "" "" "" "COL6A3(NM_004369.3):c.9494-26C>T, COL6A3(NM_004369.4):c.9494-26C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237324840G>A" "" "benign" "" "0000267010" "0" "10" "2" "238233410" "238233410" "subst" "0.143911" "02325" "COL6A3_000142" "g.238233410C>G" "" "" "" "COL6A3(NM_004369.4):c.*7G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237324767C>G" "" "benign" "" "0000267011" "0" "10" "2" "238258814" "238258814" "subst" "0.542393" "02325" "COL6A3_000030" "g.238258814C>G" "" "" "" "COL6A3(NM_004369.3):c.6855G>C (p.G2285=), COL6A3(NM_004369.4):c.6855G>C (p.G2285=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000267012" "0" "10" "2" "238249630" "238249630" "subst" "0.396917" "02325" "COL6A3_000037" "g.238249630C>T" "" "" "" "COL6A3(NM_004369.4):c.7929G>A (p.A2643=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000267013" "0" "10" "2" "238243464" "238243464" "subst" "0.763921" "02325" "COL6A3_000045" "g.238243464C>G" "" "" "" "COL6A3(NM_004369.3):c.9034G>C (p.A3012P), COL6A3(NM_004369.4):c.9034G>C (p.A3012P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334821C>G" "" "benign" "" "0000267014" "0" "10" "2" "238243292" "238243292" "subst" "0.385382" "02325" "COL6A3_000046" "g.238243292G>A" "" "" "" "COL6A3(NM_004369.3):c.9206C>T (p.T3069I), COL6A3(NM_004369.4):c.9206C>T (p.T3069I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000270503" "0" "30" "2" "238289984" "238289984" "subst" "0.00745626" "02326" "COL6A3_000066" "g.238289984C>G" "" "" "" "COL6A3(NM_004369.3):c.1471G>C (p.(Asp491His), p.D491H), COL6A3(NM_004369.4):c.1471G>C (p.D491H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237381341C>G" "" "likely benign" "" "0000270504" "0" "30" "2" "238289980" "238289980" "subst" "0.00745614" "02326" "COL6A3_000067" "g.238289980G>C" "" "" "" "COL6A3(NM_004369.3):c.1475C>G (p.(Thr492Ser), p.T492S), COL6A3(NM_004369.4):c.1475C>G (p.T492S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237381337G>C" "" "likely benign" "" "0000270505" "0" "30" "2" "238287357" "238287357" "subst" "0.0265411" "02326" "COL6A3_000072" "g.238287357C>T" "" "" "" "COL6A3(NM_004369.3):c.2419G>A (p.(Ala807Thr), p.A807T), COL6A3(NM_004369.4):c.2419G>A (p.A807T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237378714C>T" "" "likely benign" "" "0000270506" "0" "30" "2" "238287288" "238287288" "subst" "0.026569" "02326" "COL6A3_000073" "g.238287288C>A" "" "" "" "COL6A3(NM_004369.3):c.2488G>T (p.(Ala830Ser), p.A830S), COL6A3(NM_004369.4):c.2488G>T (p.A830S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237378645C>A" "" "likely benign" "" "0000270507" "0" "30" "2" "238280366" "238280366" "subst" "0.013894" "02326" "COL6A3_000082" "g.238280366C>T" "" "" "" "COL6A3(NM_004369.3):c.4285+9G>A (p.(=)), COL6A3(NM_057165.5):c.3676G>A (p.G1226R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237371723C>T" "" "likely benign" "" "0000270508" "0" "10" "2" "238277573" "238277573" "subst" "0.238071" "02326" "COL6A3_000025" "g.238277573C>A" "" "" "" "COL6A3(NM_004369.3):c.4533G>T (p.G1511=), COL6A3(NM_004369.4):c.4533G>T (p.G1511=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237368930C>A" "" "benign" "" "0000270509" "0" "30" "2" "238277379" "238277379" "subst" "0.00999326" "02326" "COL6A3_000026" "g.238277379C>T" "" "" "" "COL6A3(NM_004369.3):c.4727G>A (p.(Arg1576Gln), p.R1576Q), COL6A3(NM_004369.4):c.4727G>A (p.R1576Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237368736C>T" "" "likely benign" "" "0000270510" "0" "30" "2" "238275569" "238275569" "subst" "0.00779664" "02326" "COL6A3_000090" "g.238275569T>C" "" "" "" "COL6A3(NM_004369.3):c.5261A>G (p.(Lys1754Arg), p.K1754R), COL6A3(NM_004369.4):c.5261A>G (p.K1754R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237366926T>C" "" "likely benign" "" "0000270511" "0" "90" "2" "238269819" "238269819" "subst" "0" "02326" "COL6A3_000216" "g.238269819T>C" "" "" "" "COL6A3(NM_004369.3):c.6157-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237361176T>C" "" "pathogenic" "" "0000270512" "0" "10" "2" "238258814" "238258814" "subst" "0.542393" "02326" "COL6A3_000030" "g.238258814C>G" "" "" "" "COL6A3(NM_004369.3):c.6855G>C (p.G2285=), COL6A3(NM_004369.4):c.6855G>C (p.G2285=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000270513" "0" "50" "2" "238258801" "238258801" "subst" "0.000105597" "02326" "COL6A3_000215" "g.238258801G>A" "" "" "" "COL6A3(NM_004369.3):c.6868C>T (p.R2290C), COL6A3(NM_004369.4):c.6868C>T (p.(Arg2290Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237350158G>A" "" "VUS" "" "0000270514" "0" "10" "2" "238243464" "238243464" "subst" "0.763921" "02326" "COL6A3_000045" "g.238243464C>G" "" "" "" "COL6A3(NM_004369.3):c.9034G>C (p.A3012P), COL6A3(NM_004369.4):c.9034G>C (p.A3012P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334821C>G" "" "benign" "" "0000270515" "0" "10" "2" "238243292" "238243292" "subst" "0.385382" "02326" "COL6A3_000046" "g.238243292G>A" "" "" "" "COL6A3(NM_004369.3):c.9206C>T (p.T3069I), COL6A3(NM_004369.4):c.9206C>T (p.T3069I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000274279" "0" "30" "2" "238283203" "238283203" "subst" "5.28022E-5" "01943" "COL6A3_000230" "g.238283203G>C" "" "" "" "COL6A3(NM_004369.3):c.3531C>G (p.T1177=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237374560G>C" "" "likely benign" "" "0000274280" "0" "30" "2" "238280557" "238280557" "subst" "0.000422616" "01943" "COL6A3_000227" "g.238280557G>A" "" "" "" "COL6A3(NM_004369.3):c.4103C>T (p.T1368M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237371914G>A" "" "likely benign" "" "0000274281" "0" "30" "2" "238274605" "238274605" "subst" "1.22307E-5" "01943" "COL6A3_000224" "g.238274605G>A" "" "" "" "COL6A3(NM_004369.3):c.5574C>T (p.F1858=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237365962G>A" "" "likely benign" "" "0000274282" "0" "50" "2" "238274346" "238274346" "subst" "0.000240828" "01943" "COL6A3_000221" "g.238274346C>G" "" "" "" "COL6A3(NM_004369.3):c.5833G>C (p.V1945L), COL6A3(NM_004369.4):c.5833G>C (p.V1945L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237365703C>G" "" "VUS" "" "0000274283" "0" "50" "2" "238296807" "238296807" "subst" "0.000762509" "01943" "COL6A3_000059" "g.238296807T>C" "" "" "" "COL6A3(NM_004369.3):c.730A>G (p.I244V, p.(Ile244Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237388164T>C" "" "VUS" "" "0000274284" "0" "30" "2" "238253260" "238253260" "subst" "0.000150308" "01943" "COL6A3_000211" "g.238253260C>T" "" "" "" "COL6A3(NM_004369.3):c.7401G>A (p.S2467=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344617C>T" "" "likely benign" "" "0000274285" "0" "50" "2" "238250725" "238250725" "subst" "1.62475E-5" "01943" "COL6A3_000210" "g.238250725G>A" "" "" "" "COL6A3(NM_004369.3):c.7748C>T (p.T2583M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237342082G>A" "" "VUS" "" "0000274286" "0" "50" "2" "238249370" "238249370" "subst" "0.000967755" "01943" "COL6A3_000209" "g.238249370G>T" "" "" "" "COL6A3(NM_004369.3):c.8189C>A (p.A2730D, p.(Ala2730Asp)), COL6A3(NM_004369.4):c.8189C>A (p.A2730D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000274287" "0" "50" "2" "238244897" "238244897" "subst" "0.000109886" "01943" "COL6A3_000204" "g.238244897G>A" "" "" "" "COL6A3(NM_004369.3):c.8846C>T (p.P2949L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237336254G>A" "" "VUS" "" "0000274288" "0" "50" "2" "238243284" "238243284" "subst" "2.03174E-5" "01943" "COL6A3_000200" "g.238243284C>T" "" "" "" "COL6A3(NM_004369.3):c.9214G>A (p.G3072R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334641C>T" "" "VUS" "" "0000328194" "0" "70" "2" "238234221" "238234221" "subst" "0" "01804" "COL6A3_000199" "g.238234221C>A" "" "" "" "COL6A3(NM_004369.3):c.9475G>T (p.(Glu3159Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237325578C>A" "" "likely pathogenic" "" "0000328195" "0" "30" "2" "238243375" "238243375" "subst" "0.0260362" "01804" "COL6A3_000137" "g.238243375C>T" "" "" "" "COL6A3(NM_004369.3):c.9123G>A (p.(Thr3041=), p.T3041=), COL6A3(NM_004369.4):c.9123G>A (p.T3041=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334732C>T" "" "likely benign" "" "0000328196" "0" "50" "2" "238243435" "238243437" "del" "4.06098E-6" "01804" "COL6A3_000202" "g.238243435_238243437del" "" "" "" "COL6A3(NM_004369.3):c.9061_9063del (p.(Asp3021del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334792_237334794del" "" "VUS" "" "0000328200" "0" "30" "2" "238253152" "238253152" "subst" "0.0289343" "01804" "COL6A3_000034" "g.238253152C>T" "" "" "" "COL6A3(NM_004369.3):c.7509G>A (p.(Arg2503=), p.R2503=), COL6A3(NM_004369.4):c.7509G>A (p.R2503=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344509C>T" "" "likely benign" "" "0000328201" "0" "30" "2" "238253302" "238253302" "subst" "0.000276517" "01804" "COL6A3_000212" "g.238253302C>T" "" "" "" "COL6A3(NM_004369.3):c.7359G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344659C>T" "" "likely benign" "" "0000328202" "0" "30" "2" "238253835" "238253835" "subst" "0.000178869" "01804" "COL6A3_000213" "g.238253835C>T" "" "" "" "COL6A3(NM_004369.3):c.7114G>A (p.(Asp2372Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237345192C>T" "" "likely benign" "" "0000328203" "0" "50" "2" "238257288" "238257288" "subst" "6.502E-5" "01804" "COL6A3_000214" "g.238257288C>T" "" "" "" "COL6A3(NM_004369.3):c.6898G>A (p.(Gly2300Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237348645C>T" "" "VUS" "" "0000328204" "0" "50" "2" "238258801" "238258801" "subst" "0.000105597" "01804" "COL6A3_000215" "g.238258801G>A" "" "" "" "COL6A3(NM_004369.3):c.6868C>T (p.R2290C), COL6A3(NM_004369.4):c.6868C>T (p.(Arg2290Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237350158G>A" "" "VUS" "" "0000328205" "0" "30" "2" "238269833" "238269833" "subst" "0.00429788" "01804" "COL6A3_000097" "g.238269833C>T" "" "" "" "COL6A3(NM_004369.3):c.6157-16G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237361190C>T" "" "likely benign" "" "0000328206" "0" "30" "2" "238270378" "238270378" "subst" "0.0114599" "01804" "COL6A3_000095" "g.238270378G>A" "" "" "" "COL6A3(NM_004369.3):c.6156+4C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237361735G>A" "" "likely benign" "" "0000328208" "0" "50" "2" "238274570" "238274570" "subst" "0.00043906" "01804" "COL6A3_000223" "g.238274570C>T" "" "" "" "COL6A3(NM_004369.3):c.5609G>A (p.(Ser1870Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237365927C>T" "" "VUS" "" "0000328209" "0" "30" "2" "238275569" "238275569" "subst" "0.00779664" "01804" "COL6A3_000090" "g.238275569T>C" "" "" "" "COL6A3(NM_004369.3):c.5261A>G (p.(Lys1754Arg), p.K1754R), COL6A3(NM_004369.4):c.5261A>G (p.K1754R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237366926T>C" "" "likely benign" "" "0000328210" "0" "30" "2" "238277211" "238277211" "subst" "0.0102198" "01804" "COL6A3_000087" "g.238277211C>T" "" "" "" "COL6A3(NM_004369.3):c.4895G>A (p.(Arg1632Gln)), COL6A3(NM_004369.4):c.4895G>A (p.R1632Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237368568C>T" "" "likely benign" "" "0000328211" "0" "30" "2" "238277379" "238277379" "subst" "0.00999326" "01804" "COL6A3_000026" "g.238277379C>T" "" "" "" "COL6A3(NM_004369.3):c.4727G>A (p.(Arg1576Gln), p.R1576Q), COL6A3(NM_004369.4):c.4727G>A (p.R1576Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237368736C>T" "" "likely benign" "" "0000328213" "0" "30" "2" "238280358" "238280358" "subst" "0.0102711" "01804" "COL6A3_000083" "g.238280358C>T" "" "" "" "COL6A3(NM_004369.3):c.4285+17G>A (p.(=)), COL6A3(NM_057165.5):c.3684G>A (p.S1228=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237371715C>T" "" "likely benign" "" "0000328215" "0" "30" "2" "238280553" "238280553" "subst" "0.00532339" "01804" "COL6A3_000226" "g.238280553G>A" "" "" "" "COL6A3(NM_004369.3):c.4107C>T (p.(Ile1369=)), COL6A3(NM_004369.4):c.4107C>T (p.I1369=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237371910G>A" "" "likely benign" "" "0000328218" "0" "50" "2" "238283646" "238283646" "subst" "0.000460579" "01804" "COL6A3_000232" "g.238283646C>T" "" "" "" "COL6A3(NM_004369.3):c.3088G>A (p.V1030M, p.(Val1030Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237375003C>T" "" "VUS" "" "0000328219" "0" "30" "2" "238287288" "238287288" "subst" "0.026569" "01804" "COL6A3_000073" "g.238287288C>A" "" "" "" "COL6A3(NM_004369.3):c.2488G>T (p.(Ala830Ser), p.A830S), COL6A3(NM_004369.4):c.2488G>T (p.A830S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237378645C>A" "" "likely benign" "" "0000328220" "0" "30" "2" "238287313" "238287313" "subst" "0.00238809" "01804" "COL6A3_000233" "g.238287313A>G" "" "" "" "COL6A3(NM_004369.3):c.2463T>C (p.S821=, p.(Ser821=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237378670A>G" "" "likely benign" "" "0000328221" "0" "30" "2" "238287357" "238287357" "subst" "0.0265411" "01804" "COL6A3_000072" "g.238287357C>T" "" "" "" "COL6A3(NM_004369.3):c.2419G>A (p.(Ala807Thr), p.A807T), COL6A3(NM_004369.4):c.2419G>A (p.A807T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237378714C>T" "" "likely benign" "" "0000328222" "0" "50" "2" "238289767" "238289767" "subst" "0.00216865" "01804" "COL6A3_000143" "g.238289767T>C" "" "" "" "COL6A3(NM_004369.3):c.1688A>G (p.D563G, p.(Asp563Gly)), COL6A3(NM_004369.4):c.1688A>G (p.D563G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237381124T>C" "" "VUS" "" "0000328224" "0" "30" "2" "238289980" "238289980" "subst" "0.00745614" "01804" "COL6A3_000067" "g.238289980G>C" "" "" "" "COL6A3(NM_004369.3):c.1475C>G (p.(Thr492Ser), p.T492S), COL6A3(NM_004369.4):c.1475C>G (p.T492S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237381337G>C" "" "likely benign" "" "0000328225" "0" "30" "2" "238289984" "238289984" "subst" "0.00745626" "01804" "COL6A3_000066" "g.238289984C>G" "" "" "" "COL6A3(NM_004369.3):c.1471G>C (p.(Asp491His), p.D491H), COL6A3(NM_004369.4):c.1471G>C (p.D491H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237381341C>G" "" "likely benign" "" "0000328226" "0" "30" "2" "238290066" "238290066" "subst" "0.0112668" "01804" "COL6A3_000022" "g.238290066G>A" "" "" "" "COL6A3(NM_004369.3):c.1389C>T (p.(Ala463=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237381423G>A" "" "likely benign" "" "0000328227" "0" "50" "2" "238296761" "238296761" "subst" "0.000381441" "01804" "COL6A3_000237" "g.238296761G>A" "" "" "" "COL6A3(NM_004369.3):c.776C>T (p.(Ala259Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237388118G>A" "" "VUS" "" "0000337575" "0" "10" "2" "238233410" "238233410" "subst" "0.143911" "02327" "COL6A3_000142" "g.238233410C>G" "" "" "" "COL6A3(NM_004369.4):c.*7G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237324767C>G" "" "benign" "" "0000337576" "0" "90" "2" "238269763" "238269763" "subst" "0" "02327" "COL6A3_000012" "g.238269763C>T" "" "" "" "COL6A3(NM_004369.4):c.6210+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000337578" "0" "10" "2" "238283679" "238283679" "subst" "0.0046851" "02327" "COL6A3_000075" "g.238283679C>T" "" "" "" "COL6A3(NM_004369.3):c.3071-16G>A (p.(=)), COL6A3(NM_004369.4):c.3071-16G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237375036C>T" "" "benign" "" "0000337579" "0" "10" "2" "238290159" "238290159" "subst" "0.00618378" "02327" "COL6A3_000065" "g.238290159T>C" "" "" "" "COL6A3(NM_004369.3):c.1313-17A>G (p.(=)), COL6A3(NM_004369.4):c.1313-17A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237381516T>C" "" "benign" "" "0000337580" "0" "10" "2" "238322579" "238322579" "subst" "0" "02327" "COL6A3_000238" "g.238322579A>G" "" "" "" "COL6A3(NM_004369.4):c.-31+17T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237413936A>G" "" "benign" "" "0000339720" "0" "10" "2" "238234285" "238234285" "subst" "0.0135931" "02327" "COL6A3_000140" "g.238234285A>G" "" "" "" "COL6A3(NM_004369.3):c.9411T>C (p.(Cys3137=)), COL6A3(NM_004369.4):c.9411T>C (p.C3137=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237325642A>G" "" "benign" "" "0000339721" "0" "10" "2" "238243285" "238243285" "subst" "0.107227" "02327" "COL6A3_000047" "g.238243285G>A" "" "" "" "COL6A3(NM_004369.4):c.9213C>T (p.H3071=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334642G>A" "" "benign" "" "0000339722" "0" "10" "2" "238243369" "238243369" "subst" "0.0309244" "02327" "COL6A3_000138" "g.238243369G>A" "" "" "" "COL6A3(NM_004369.3):c.9129C>T (p.(=)), COL6A3(NM_004369.4):c.9129C>T (p.R3043=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334726G>A" "" "benign" "" "0000339723" "0" "10" "2" "238243375" "238243375" "subst" "0.0260362" "02327" "COL6A3_000137" "g.238243375C>T" "" "" "" "COL6A3(NM_004369.3):c.9123G>A (p.(Thr3041=), p.T3041=), COL6A3(NM_004369.4):c.9123G>A (p.T3041=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334732C>T" "" "benign" "" "0000339724" "0" "10" "2" "238244923" "238244923" "subst" "0.0750104" "02327" "COL6A3_000042" "g.238244923C>T" "" "" "" "COL6A3(NM_004369.4):c.8820G>A (p.T2940=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237336280C>T" "" "benign" "" "0000339725" "0" "10" "2" "238249108" "238249108" "subst" "0.0749322" "02327" "COL6A3_000039" "g.238249108T>C" "" "" "" "COL6A3(NM_004369.4):c.8451A>G (p.P2817=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237340465T>C" "" "benign" "" "0000339726" "0" "10" "2" "238249630" "238249630" "subst" "0.396917" "02327" "COL6A3_000037" "g.238249630C>T" "" "" "" "COL6A3(NM_004369.4):c.7929G>A (p.A2643=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237340987C>T" "" "benign" "" "0000339727" "0" "10" "2" "238249717" "238249717" "subst" "0.0754022" "02327" "COL6A3_000036" "g.238249717G>A" "" "" "" "COL6A3(NM_004369.4):c.7842C>T (p.S2614=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237341074G>A" "" "benign" "" "0000339728" "0" "10" "2" "238253065" "238253065" "subst" "0.127718" "02327" "COL6A3_000035" "g.238253065C>T" "" "" "" "COL6A3(NM_004369.4):c.7596G>A (p.K2532=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344422C>T" "" "benign" "" "0000339729" "0" "10" "2" "238253149" "238253149" "subst" "0.112914" "02327" "COL6A3_000123" "g.238253149G>A" "" "" "" "COL6A3(NM_004369.4):c.7512C>T (p.N2504=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344506G>A" "" "benign" "" "0000339730" "0" "10" "2" "238253332" "238253332" "subst" "0.0318083" "02327" "COL6A3_000121" "g.238253332G>A" "" "" "" "COL6A3(NM_004369.3):c.7329C>T (p.(=)), COL6A3(NM_004369.4):c.7329C>T (p.A2443=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344689G>A" "" "benign" "" "0000339731" "0" "10" "2" "238257013" "238257013" "subst" "0.114359" "02327" "COL6A3_000031" "g.238257013G>A" "" "" "" "COL6A3(NM_004369.4):c.6945C>T (p.F2315=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237348370G>A" "" "benign" "" "0000339732" "0" "10" "2" "238258814" "238258814" "subst" "0.542393" "02327" "COL6A3_000030" "g.238258814C>G" "" "" "" "COL6A3(NM_004369.3):c.6855G>C (p.G2285=), COL6A3(NM_004369.4):c.6855G>C (p.G2285=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237350171C>G" "" "benign" "" "0000339733" "0" "10" "2" "238267717" "238267717" "subst" "0.212185" "02327" "COL6A3_000029" "g.238267717C>T" "" "" "" "COL6A3(NM_004369.4):c.6369G>A (p.L2123=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237359074C>T" "" "benign" "" "0000339734" "0" "10" "2" "238277573" "238277573" "subst" "0.238071" "02327" "COL6A3_000025" "g.238277573C>A" "" "" "" "COL6A3(NM_004369.3):c.4533G>T (p.G1511=), COL6A3(NM_004369.4):c.4533G>T (p.G1511=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237368930C>A" "" "benign" "" "0000339735" "0" "10" "2" "238277795" "238277795" "subst" "0.285002" "02327" "COL6A3_000024" "g.238277795A>G" "" "" "" "COL6A3(NM_004369.3):c.4311T>C (p.I1437=), COL6A3(NM_004369.4):c.4311T>C (p.I1437=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237369152A>G" "" "benign" "" "0000339736" "0" "10" "2" "238283605" "238283605" "subst" "0.234224" "02327" "COL6A3_000023" "g.238283605G>A" "" "" "" "COL6A3(NM_004369.3):c.3129C>T (p.G1043=), COL6A3(NM_004369.4):c.3129C>T (p.G1043=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237374962G>A" "" "benign" "" "0000339737" "0" "30" "2" "238296472" "238296472" "subst" "0.000398821" "02327" "COL6A3_000251" "g.238296472G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237387829G>A" "" "likely benign" "" "0000339738" "0" "10" "2" "238322885" "238322885" "subst" "0" "02327" "COL6A3_000556" "g.238322885G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237414242G>C" "" "benign" "" "0000340653" "0" "10" "2" "238290066" "238290066" "subst" "0.0112668" "02327" "COL6A3_000022" "g.238290066G>A" "" "" "" "COL6A3(NM_004369.3):c.1389C>T (p.(Ala463=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237381423G>A" "" "benign" "" "0000340678" "0" "10" "2" "238253152" "238253152" "subst" "0.0289343" "02327" "COL6A3_000034" "g.238253152C>T" "" "" "" "COL6A3(NM_004369.3):c.7509G>A (p.(Arg2503=), p.R2503=), COL6A3(NM_004369.4):c.7509G>A (p.R2503=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344509C>T" "" "benign" "" "0000340688" "0" "10" "2" "238287862" "238287862" "subst" "0.00719767" "02327" "COL6A3_000070" "g.238287862C>T" "" "" "" "COL6A3(NM_004369.3):c.1914G>A (p.(Arg638=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237379219C>T" "" "benign" "" "0000340816" "0" "30" "2" "238277783" "238277783" "subst" "2.87739E-5" "02327" "COL6A3_000247" "g.238277783G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237369140G>A" "" "likely benign" "" "0000340844" "0" "10" "2" "238296751" "238296751" "subst" "0.000381026" "02327" "COL6A3_000252" "g.238296751G>A" "" "" "" "COL6A3(NM_004369.3):c.786C>T (p.L262=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237388108G>A" "" "benign" "" "0000340880" "0" "10" "2" "238296655" "238296655" "subst" "0.00587428" "02327" "COL6A3_000061" "g.238296655G>A" "" "" "" "COL6A3(NM_004369.3):c.882C>T (p.(Phe294=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237388012G>A" "" "benign" "" "0000341051" "0" "10" "2" "238296769" "238296769" "subst" "0.0147315" "02327" "COL6A3_000060" "g.238296769G>A" "" "" "" "COL6A3(NM_004369.3):c.768C>T (p.(Val256=)), COL6A3(NM_004369.4):c.768C>T (p.V256=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237388126G>A" "" "benign" "" "0000341357" "0" "10" "2" "238243464" "238243464" "subst" "0.763921" "02327" "COL6A3_000045" "g.238243464C>G" "" "" "" "COL6A3(NM_004369.3):c.9034G>C (p.A3012P), COL6A3(NM_004369.4):c.9034G>C (p.A3012P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334821C>G" "" "benign" "" "0000341514" "0" "10" "2" "238289669" "238289669" "subst" "0.00469077" "02327" "COL6A3_000069" "g.238289669C>A" "" "" "" "COL6A3(NM_004369.3):c.1786G>T (p.(Ala596Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237381026C>A" "" "benign" "" "0000341816" "0" "50" "2" "238280906" "238280906" "subst" "0.000130348" "02327" "COL6A3_000248" "g.238280906G>A" "" "" "" "COL6A3(NM_004369.4):c.3754C>T (p.(Arg1252Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237372263G>A" "" "VUS" "" "0000342185" "0" "90" "2" "238271967" "238271967" "subst" "1.21822E-5" "02327" "COL6A3_000243" "g.238271967G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237363324G>A" "" "pathogenic" "" "0000342307" "0" "50" "2" "238261166" "238261166" "subst" "0" "02327" "COL6A3_000239" "g.238261166C>T" "" "" "" "COL6A3(NM_004369.3):c.6752G>A (p.(Arg2251Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237352523C>T" "" "VUS" "" "0000342381" "0" "50" "2" "238253403" "238253403" "subst" "0.000834169" "02327" "COL6A3_000120" "g.238253403G>A" "" "" "" "COL6A3(NM_004369.3):c.7258C>T (p.(Arg2420Trp)), COL6A3(NM_004369.4):c.7258C>T (p.R2420W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237344760G>A" "" "VUS" "" "0000343157" "0" "50" "2" "238305447" "238305447" "subst" "0.000117788" "02327" "COL6A3_000253" "g.238305447C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237396804C>T" "" "VUS" "" "0000343219" "0" "10" "2" "238287800" "238287800" "subst" "0.0060661" "02327" "COL6A3_000071" "g.238287800C>T" "" "" "" "COL6A3(NM_004369.3):c.1976G>A (p.(Arg659His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237379157C>T" "" "benign" "" "0000343873" "0" "50" "2" "238283514" "238283514" "subst" "4.0814E-6" "02327" "COL6A3_000250" "g.238283514C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237374871C>T" "" "VUS" "" "0000345210" "0" "50" "2" "238274445" "238274445" "subst" "2.43657E-5" "02327" "COL6A3_000245" "g.238274445C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237365802C>T" "" "VUS" "" "0000345227" "0" "50" "2" "238269775" "238269775" "subst" "0" "02327" "COL6A3_000166" "g.238269775C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237361132C>T" "" "VUS" "" "0000345798" "0" "90" "2" "238275521" "238275521" "subst" "4.06068E-6" "02327" "COL6A3_000246" "g.238275521C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237366878C>A" "" "pathogenic" "" "0000347155" "0" "10" "2" "238296306" "238296306" "subst" "0.00401582" "02327" "COL6A3_000063" "g.238296306G>C" "" "" "" "COL6A3(NM_004369.3):c.1231C>G (p.L411V, p.(Leu411Val)), COL6A3(NM_004369.4):c.1231C>G (p.L411V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237387663G>C" "" "benign" "" "0000347369" "0" "10" "2" "238283472" "238283472" "subst" "0.037234" "02327" "COL6A3_000078" "g.238283472T>G" "" "" "" "COL6A3(NM_004369.3):c.3262A>C (p.(Lys1088Gln)), COL6A3(NM_004369.4):c.3262A>C (p.K1088Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237374829T>G" "" "benign" "" "0000347806" "0" "10" "2" "238244963" "238244963" "subst" "0.631261" "02327" "COL6A3_000041" "g.238244963A>G" "" "" "" "COL6A3(NM_004369.3):c.8780T>C (p.M2927T), COL6A3(NM_004369.4):c.8780T>C (p.M2927T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237336320A>G" "" "benign" "" "0000347809" "0" "10" "2" "238244781" "238244781" "subst" "0.0760959" "02327" "COL6A3_000044" "g.238244781T>C" "" "" "" "COL6A3(NM_004369.4):c.8962A>G (p.M2988V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237336138T>C" "" "benign" "" "0000347981" "0" "50" "2" "238268762" "238268762" "subst" "0" "02327" "COL6A3_000240" "g.238268762A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237360119A>T" "" "VUS" "" "0000348290" "0" "10" "2" "238262021" "238262021" "subst" "0.0414876" "02327" "COL6A3_000109" "g.238262021G>A" "" "" "" "COL6A3(NM_004369.3):c.6653C>T (p.(Pro2218Leu)), COL6A3(NM_004369.4):c.6653C>T (p.P2218L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237353378G>A" "" "benign" "" "0000349342" "0" "50" "2" "238274402" "238274402" "subst" "1.62499E-5" "02327" "COL6A3_000244" "g.238274402G>A" "" "" "" "COL6A3(NM_004369.4):c.5777C>T (p.T1926M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237365759G>A" "" "VUS" "" "0000349434" "0" "10" "2" "238243292" "238243292" "subst" "0.385382" "02327" "COL6A3_000046" "g.238243292G>A" "" "" "" "COL6A3(NM_004369.3):c.9206C>T (p.T3069I), COL6A3(NM_004369.4):c.9206C>T (p.T3069I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237334649G>A" "" "benign" "" "0000351059" "0" "90" "2" "238269763" "238269763" "subst" "0" "02327" "COL6A3_000241" "g.238269763C>A" "" "" "" "COL6A3(NM_004369.3):c.6210+1G>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237361120C>A" "" "pathogenic" "" "0000351060" "0" "10" "2" "238269833" "238269833" "subst" "0.00429788" "02327" "COL6A3_000097" "g.238269833C>T" "" "" "" "COL6A3(NM_004369.3):c.6157-16G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237361190C>T" "" "benign" "" "0000351061" "0" "90" "2" "238270380" "238270380" "subst" "0" "02327" "COL6A3_000242" "g.238270380A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.237361737A>G" "" "pathogenic" "" "0000398522" "1" "50" "2" "238280504" "238280504" "subst" "0.0062857" "00006" "COL6A3_000005" "g.238280504C>T" "" "{PMID:Fichna 2018:29970176}" "" "" "ACMG grading: PP4, PP5; classified as pathogenic by UniProt; additional variants in NEB, TTN" "Germline" "" "" "0" "" "" "g.237371861C>T" "" "VUS" "ACMG" "0000398523" "2" "50" "2" "238253403" "238253403" "subst" "0.000834169" "00006" "COL6A3_000120" "g.238253403G>A" "" "{PMID:Fichna 2018:29970176}" "" "" "ACMG grading: PP3; additional variants in NEB, TTN" "Germline" "" "" "0" "" "" "g.237344760G>A" "" "VUS" "ACMG" "0000398524" "1" "90" "2" "238267211" "238267211" "subst" "0" "00006" "COL6A3_000256" "g.238267211G>A" "" "{PMID:Fichna 2018:29970176}" "" "" "ACMG grading: PVS1, PM2, PM4, PP2; additional variants in FLNC" "Germline" "" "" "0" "" "" "g.237358568G>A" "" "likely pathogenic" "ACMG" "0000398525" "2" "50" "2" "238253214" "238253214" "subst" "0.000629523" "00006" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Fichna 2018:29970176}" "" "" "ACMG grading: PP3; additional variants in FLNC" "Germline" "" "" "0" "" "" "g.237344571T>C" "" "VUS" "ACMG" "0000398526" "1" "50" "2" "238280557" "238280557" "subst" "0.000422616" "00006" "COL6A3_000227" "g.238280557G>A" "" "{PMID:Fichna 2018:29970176}" "" "" "additional variants in DAG1, NEB, SYNE1, TTN" "Germline" "" "" "0" "" "" "g.237371914G>A" "" "VUS" "" "0000398527" "2" "50" "2" "238253469" "238253469" "subst" "3.68538E-5" "00006" "COL6A3_000255" "g.238253469C>T" "" "{PMID:Fichna 2018:29970176}" "" "" "ACMG grading: PM2, PP3; additional variants in DAG1, NEB, SYNE1, TTN" "Germline" "" "" "0" "" "" "g.237344826C>T" "" "VUS" "ACMG" "0000406022" "0" "50" "2" "238274523" "238274523" "subst" "0" "02552" "COL6A3_000254" "g.238274523G>A" "" "{PMID:Papuc 2019:30552426}" "" "" "" "De novo" "" "" "0" "" "" "g.237365880G>A" "" "VUS" "" "0000439065" "0" "50" "2" "238289588" "238289588" "subst" "0.000146558" "01164" "COL6A3_000257" "g.238289588G>A" "" "" "" "" "" "Germline" "" "rs372022185" "0" "" "" "g.237380945G>A" "" "VUS" "ACMG" "0000439735" "0" "50" "2" "238280485" "238280485" "subst" "0" "01164" "COL6A3_000259" "g.238280485C>T" "" "" "" "" "not regarded causative since missense variants in COL6A3 other than glycine substitutions within the triple helical domain are not regarded as pathogenic." "Germline" "" "" "0" "" "" "g.237371842C>T" "" "VUS" "ACMG" "0000439875" "0" "50" "2" "238277491" "238277491" "subst" "8.12209E-6" "01164" "COL6A3_000258" "g.238277491C>T" "" "" "" "" "ACMG grading: PM2,PP3" "Germline" "" "rs762767186" "0" "" "" "g.237368848C>T" "" "VUS" "ACMG" "0000440068" "0" "50" "2" "238287581" "238287581" "subst" "0.000125918" "01164" "COL6A3_000260" "g.238287581G>A" "" "" "" "" "not regarded causative for phenotype" "Germline" "" "rs370719148" "0" "" "" "g.237378938G>A" "" "VUS" "ACMG" "0000462002" "1" "50" "2" "238256440" "238256440" "subst" "0.000211644" "00430" "COL6A3_000328" "g.238256440G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237347797G>A" "" "VUS" "" "0000462003" "1" "50" "2" "238245073" "238245093" "del" "0" "00430" "COL6A3_000282" "g.238245073_238245093del" "" "{PMID:Nallamilli 2018:30564623}" "" "8670_8690delAACCACCACAACAAAGCCTGT" "" "Germline" "" "" "0" "" "" "g.237336430_237336450del" "" "VUS" "" "0000462004" "1" "50" "2" "238274346" "238274346" "subst" "0.000240828" "00430" "COL6A3_000221" "g.238274346C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in COL6A3" "Germline" "" "" "0" "" "" "g.237365703C>G" "" "VUS" "" "0000462005" "1" "50" "2" "238274589" "238274589" "subst" "8.14147E-6" "00430" "COL6A3_000374" "g.238274589C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in COL6A3" "Germline" "" "" "0" "" "" "g.237365946C>T" "" "VUS" "" "0000462006" "1" "50" "2" "238275489" "238275489" "subst" "7.71511E-5" "00430" "COL6A3_000384" "g.238275489T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in COL6A3" "Germline" "" "" "0" "" "" "g.237366846T>C" "" "VUS" "" "0000462007" "1" "50" "2" "238250767" "238250767" "subst" "0" "00430" "COL6A3_000310" "g.238250767G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in COL6A3" "Germline" "" "" "0" "" "" "g.237342124G>C" "" "VUS" "" "0000462008" "1" "50" "2" "238274346" "238274346" "subst" "0.000240828" "00430" "COL6A3_000221" "g.238274346C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237365703C>G" "" "VUS" "" "0000462009" "1" "50" "2" "238283288" "238283288" "subst" "0.000569036" "00430" "COL6A3_000430" "g.238283288C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237374645C>T" "" "VUS" "" "0000462010" "1" "50" "2" "238280443" "238280443" "subst" "0.00051621" "00430" "COL6A3_000052" "g.238280443G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237371800G>A" "" "VUS" "" "0000462011" "1" "50" "2" "238296417" "238296417" "subst" "9.36986E-5" "00430" "COL6A3_000497" "g.238296417C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237387774C>T" "" "VUS" "" "0000462012" "1" "50" "2" "238303649" "238303649" "subst" "2.03098E-5" "00430" "COL6A3_000520" "g.238303649C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237395006C>T" "" "VUS" "" "0000462013" "1" "50" "2" "238296530" "238296530" "subst" "8.13557E-6" "00430" "COL6A3_000503" "g.238296530C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237387887C>T" "" "VUS" "" "0000462014" "1" "50" "2" "238283080" "238283080" "subst" "2.87182E-5" "00430" "COL6A3_000424" "g.238283080C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237374437C>T" "" "VUS" "" "0000462015" "1" "50" "2" "238274357" "238274357" "subst" "1.63087E-5" "00430" "COL6A3_000367" "g.238274357G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237365714G>A" "" "VUS" "" "0000462016" "1" "50" "2" "238290128" "238290128" "subst" "0" "00430" "COL6A3_000491" "g.238290128T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237381485T>C" "" "VUS" "" "0000462017" "1" "50" "2" "238274560" "238274560" "subst" "0.000585237" "00430" "COL6A3_000372" "g.238274560G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237365917G>A" "" "VUS" "" "0000462018" "1" "50" "2" "238253181" "238253181" "subst" "0" "00430" "COL6A3_000317" "g.238253181C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344538C>A" "" "VUS" "" "0000462019" "1" "50" "2" "238287571" "238287571" "subst" "0.000658232" "00430" "COL6A3_000468" "g.238287571G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378928G>A" "" "VUS" "" "0000462020" "1" "50" "2" "238273002" "238273002" "subst" "0" "00430" "COL6A3_000364" "g.238273002G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237364359G>A" "" "VUS" "" "0000462021" "1" "50" "2" "238283115" "238283115" "subst" "4.06597E-6" "00430" "COL6A3_000425" "g.238283115G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237374472G>T" "" "VUS" "" "0000462022" "1" "50" "2" "238280758" "238280758" "subst" "0.000256364" "00430" "COL6A3_000415" "g.238280758C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237372115C>T" "" "VUS" "" "0000462023" "1" "50" "2" "238249370" "238249370" "subst" "0.000967755" "00430" "COL6A3_000209" "g.238249370G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000462024" "1" "50" "2" "238290133" "238290133" "subst" "0" "00430" "COL6A3_000492" "g.238290133A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237381490A>G" "" "VUS" "" "0000462025" "1" "90" "2" "238275820" "238275820" "subst" "0" "00430" "COL6A3_000389" "g.238275820A>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237367177A>T" "" "pathogenic" "" "0000462026" "1" "50" "2" "238274654" "238274654" "subst" "0" "00430" "COL6A3_000376" "g.238274654C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237366011C>T" "" "VUS" "" "0000462027" "1" "50" "2" "238243318" "238243318" "subst" "1.62488E-5" "00430" "COL6A3_000269" "g.238243318G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237334675G>C" "" "VUS" "" "0000462028" "1" "50" "2" "238296513" "238296513" "subst" "0.000801419" "00430" "COL6A3_000500" "g.238296513C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237387870C>T" "" "VUS" "" "0000462029" "1" "50" "2" "238275605" "238275605" "subst" "4.06085E-6" "00430" "COL6A3_000386" "g.238275605C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237366962C>T" "" "VUS" "" "0000462030" "1" "50" "2" "238287332" "238287332" "subst" "6.49736E-5" "00430" "COL6A3_000458" "g.238287332G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378689G>T" "" "VUS" "" "0000462031" "1" "50" "2" "238269775" "238269775" "subst" "0" "00430" "COL6A3_000166" "g.238269775C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237361132C>T" "" "VUS" "" "0000462032" "1" "50" "2" "238289857" "238289857" "subst" "0" "00430" "COL6A3_000482" "g.238289857C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381214C>G" "" "VUS" "" "0000462033" "1" "50" "2" "238249370" "238249370" "subst" "0.000967755" "00430" "COL6A3_000209" "g.238249370G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000462034" "1" "50" "2" "238303832" "238303832" "subst" "3.72621E-5" "00430" "COL6A3_000524" "g.238303832G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237395189G>A" "" "VUS" "" "0000462035" "1" "50" "2" "238244924" "238244924" "subst" "0.000178744" "00430" "COL6A3_000205" "g.238244924G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336281G>A" "" "VUS" "" "0000462036" "1" "50" "2" "238289659" "238289660" "delins" "0" "00430" "COL6A3_000478" "g.238289659_238289660delinsAT" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237381016_237381017delinsAT" "" "VUS" "" "0000462037" "1" "50" "2" "238283227" "238283227" "subst" "0.000105616" "00430" "COL6A3_000429" "g.238283227G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237374584G>A" "" "VUS" "" "0000462038" "1" "50" "2" "238283289" "238283289" "subst" "0.000182891" "00430" "COL6A3_000431" "g.238283289G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237374646G>A" "" "VUS" "" "0000462039" "1" "50" "2" "238283529" "238283529" "subst" "0.000412882" "00430" "COL6A3_000438" "g.238283529C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237374886C>T" "" "VUS" "" "0000462040" "1" "90" "2" "238256455" "238256455" "subst" "0" "00430" "COL6A3_000002" "g.238256455G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237347812G>A" "" "pathogenic" "" "0000462041" "1" "90" "2" "238253214" "238253214" "subst" "0.000629523" "00430" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237344571T>C" "" "pathogenic" "" "0000462042" "1" "50" "2" "238277707" "238277707" "subst" "0.000524932" "00430" "COL6A3_000007" "g.238277707T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237369064T>C" "" "VUS" "" "0000462043" "1" "50" "2" "238267210" "238267210" "subst" "4.46762E-5" "00430" "COL6A3_000344" "g.238267210C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237358567C>T" "" "VUS" "" "0000462044" "1" "50" "2" "238283289" "238283289" "subst" "0.000182891" "00430" "COL6A3_000431" "g.238283289G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374646G>A" "" "VUS" "" "0000462045" "1" "50" "2" "238245111" "238245111" "subst" "5.27897E-5" "00430" "COL6A3_000144" "g.238245111T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237336468T>C" "" "VUS" "" "0000462046" "1" "50" "2" "238283403" "238283403" "subst" "7.32827E-5" "00430" "COL6A3_000434" "g.238283403C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237374760C>T" "" "VUS" "" "0000462047" "1" "50" "2" "238249370" "238249370" "subst" "0.000967755" "00430" "COL6A3_000209" "g.238249370G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000462048" "1" "50" "2" "238245107" "238245107" "subst" "0.000824312" "00430" "COL6A3_000284" "g.238245107G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237336464G>A" "" "VUS" "" "0000462049" "1" "50" "2" "238243318" "238243318" "subst" "1.62488E-5" "00430" "COL6A3_000269" "g.238243318G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237334675G>C" "" "VUS" "" "0000462050" "1" "50" "2" "238249550" "238249550" "subst" "0.000619135" "00430" "COL6A3_000169" "g.238249550G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340907G>A" "" "VUS" "" "0000462051" "1" "50" "2" "238249316" "238249316" "subst" "0.000162472" "00430" "COL6A3_000295" "g.238249316G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340673G>A" "" "VUS" "" "0000462052" "1" "50" "2" "238277596" "238277596" "subst" "0.000414277" "00430" "COL6A3_000402" "g.238277596G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237368953G>A" "" "VUS" "" "0000462053" "1" "50" "2" "238280408" "238280410" "del" "0" "00430" "COL6A3_000407" "g.238280408_238280410del" "" "{PMID:Nallamilli 2018:30564623}" "" "4252_4254delAAG" "" "Germline" "" "" "0" "" "" "g.237371765_237371767del" "" "VUS" "" "0000462054" "1" "50" "2" "238244852" "238244852" "subst" "0.000155094" "00430" "COL6A3_000277" "g.238244852G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237336209G>A" "" "VUS" "" "0000462055" "1" "50" "2" "238244852" "238244852" "subst" "0.000155094" "00430" "COL6A3_000277" "g.238244852G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237336209G>A" "" "VUS" "" "0000462056" "1" "50" "2" "238296449" "238296449" "subst" "3.66399E-5" "00430" "COL6A3_000498" "g.238296449C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237387806C>T" "" "VUS" "" "0000462057" "1" "50" "2" "238280716" "238280716" "subst" "2.84872E-5" "00430" "COL6A3_000413" "g.238280716G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237372073G>A" "" "VUS" "" "0000462058" "1" "50" "2" "238287837" "238287837" "subst" "1.23017E-5" "00430" "COL6A3_000475" "g.238287837A>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237379194A>T" "" "VUS" "" "0000462059" "1" "50" "2" "238277707" "238277707" "subst" "0.000524932" "00430" "COL6A3_000007" "g.238277707T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237369064T>C" "" "VUS" "" "0000462060" "1" "50" "2" "238242176" "238242176" "subst" "0.000832555" "00430" "COL6A3_000147" "g.238242176G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237333533G>C" "" "VUS" "" "0000462061" "1" "50" "2" "238277218" "238277218" "subst" "9.7515E-5" "00430" "COL6A3_000392" "g.238277218G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368575G>A" "" "VUS" "" "0000462062" "1" "50" "2" "238277218" "238277218" "subst" "9.7515E-5" "00430" "COL6A3_000392" "g.238277218G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368575G>A" "" "VUS" "" "0000462063" "1" "50" "2" "238274544" "238274544" "subst" "8.12863E-5" "00430" "COL6A3_000371" "g.238274544C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237365901C>T" "" "VUS" "" "0000462064" "1" "50" "2" "238253103" "238253103" "subst" "2.84375E-5" "00430" "COL6A3_000314" "g.238253103T>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344460T>A" "" "VUS" "" "0000462065" "1" "50" "2" "238249316" "238249316" "subst" "0.000162472" "00430" "COL6A3_000295" "g.238249316G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340673G>A" "" "VUS" "" "0000462066" "1" "50" "2" "238283165" "238283165" "subst" "1.21867E-5" "00430" "COL6A3_000428" "g.238283165G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374522G>T" "" "VUS" "" "0000462067" "1" "90" "2" "238269819" "238269819" "subst" "0" "00430" "COL6A3_000359" "g.238269819T>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237361176T>G" "" "pathogenic" "" "0000462068" "1" "50" "2" "238274657" "238274657" "subst" "0" "00430" "COL6A3_000377" "g.238274657A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237366014A>G" "" "VUS" "" "0000462069" "1" "90" "2" "238269819" "238269819" "subst" "0" "00430" "COL6A3_000359" "g.238269819T>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237361176T>G" "" "pathogenic" "" "0000462070" "1" "90" "2" "238269819" "238269819" "subst" "0" "00430" "COL6A3_000359" "g.238269819T>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237361176T>G" "" "pathogenic" "" "0000462071" "1" "90" "2" "238269819" "238269819" "subst" "0" "00430" "COL6A3_000359" "g.238269819T>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237361176T>G" "" "pathogenic" "" "0000462072" "1" "50" "2" "238253147" "238253147" "subst" "4.0624E-6" "00430" "COL6A3_000315" "g.238253147C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344504C>A" "" "VUS" "" "0000462073" "1" "50" "2" "238249782" "238249782" "subst" "2.0402E-5" "00430" "COL6A3_000306" "g.238249782T>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237341139T>A" "" "VUS" "" "0000462074" "1" "50" "2" "238233467" "238233467" "subst" "0.000528345" "00430" "COL6A3_000262" "g.238233467G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237324824G>A" "" "VUS" "" "0000462075" "1" "50" "2" "238277707" "238277707" "subst" "0.000524932" "00430" "COL6A3_000007" "g.238277707T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237369064T>C" "" "VUS" "" "0000462076" "1" "50" "2" "238269775" "238269775" "subst" "0" "00430" "COL6A3_000166" "g.238269775C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237361132C>T" "" "VUS" "" "0000462077" "1" "50" "2" "238258798" "238258798" "subst" "0" "00430" "COL6A3_000335" "g.238258798C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237350155C>A" "" "VUS" "" "0000462078" "1" "50" "2" "238245107" "238245107" "subst" "0.000824312" "00430" "COL6A3_000284" "g.238245107G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336464G>A" "" "VUS" "" "0000462079" "1" "50" "2" "238249370" "238249370" "subst" "0.000967755" "00430" "COL6A3_000209" "g.238249370G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000462080" "1" "50" "2" "238275627" "238275627" "subst" "0" "00430" "COL6A3_000387" "g.238275627C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237366984C>A" "" "VUS" "" "0000462081" "1" "50" "2" "238249370" "238249370" "subst" "0.000967755" "00430" "COL6A3_000209" "g.238249370G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000462082" "1" "50" "2" "238290070" "238290070" "subst" "0.000114716" "00430" "COL6A3_000488" "g.238290070T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381427T>C" "" "VUS" "" "0000462083" "1" "50" "2" "238290070" "238290070" "subst" "0.000114716" "00430" "COL6A3_000488" "g.238290070T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381427T>C" "" "VUS" "" "0000462084" "1" "50" "2" "238268758" "238268758" "subst" "1.21856E-5" "00430" "COL6A3_000352" "g.238268758C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237360115C>T" "" "VUS" "" "0000462085" "1" "90" "2" "238269819" "238269819" "subst" "0" "00430" "COL6A3_000359" "g.238269819T>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237361176T>G" "" "pathogenic" "" "0000462086" "1" "50" "2" "238249551" "238249551" "subst" "4.48186E-5" "00430" "COL6A3_000130" "g.238249551C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340908C>T" "" "VUS" "" "0000462087" "1" "50" "2" "238243351" "238243351" "subst" "2.43667E-5" "00430" "COL6A3_000270" "g.238243351G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237334708G>A" "" "VUS" "" "0000462088" "1" "50" "2" "238285956" "238285956" "subst" "3.38667E-5" "00430" "COL6A3_000453" "g.238285956G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237377313G>A" "" "VUS" "" "0000462089" "1" "50" "2" "238280543" "238280543" "subst" "0.000605617" "00430" "COL6A3_000171" "g.238280543C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237371900C>T" "" "VUS" "" "0000462090" "1" "50" "2" "238289694" "238289694" "subst" "0.00128333" "00430" "COL6A3_000480" "g.238289694G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381051G>A" "" "VUS" "" "0000462091" "1" "50" "2" "238283315" "238283315" "subst" "0.000447402" "00430" "COL6A3_000432" "g.238283315G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374672G>A" "" "VUS" "" "0000462092" "1" "50" "2" "238244924" "238244924" "subst" "0.000178744" "00430" "COL6A3_000205" "g.238244924G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336281G>A" "" "VUS" "" "0000462093" "1" "50" "2" "238274354" "238274354" "subst" "0.000118313" "00430" "COL6A3_000366" "g.238274354G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237365711G>A" "" "VUS" "" "0000462094" "1" "50" "2" "238289942" "238289942" "subst" "0" "00430" "COL6A3_000485" "g.238289942T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381299T>C" "" "VUS" "" "0000462095" "1" "50" "2" "238289832" "238289832" "subst" "0.000239785" "00430" "COL6A3_000235" "g.238289832G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381189G>A" "" "VUS" "" "0000462096" "1" "50" "2" "238303450" "238303450" "subst" "0.00122759" "00430" "COL6A3_000514" "g.238303450C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237394807C>T" "" "VUS" "" "0000462097" "1" "90" "2" "238268793" "238268793" "subst" "0" "00430" "COL6A3_000195" "g.238268793C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237360150C>T" "" "pathogenic" "" "0000462098" "1" "50" "2" "238296761" "238296761" "subst" "0.000381441" "00430" "COL6A3_000237" "g.238296761G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237388118G>A" "" "VUS" "" "0000462099" "1" "50" "2" "238296320" "238296320" "subst" "1.62963E-5" "00430" "COL6A3_000493" "g.238296320C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237387677C>T" "" "VUS" "" "0000462100" "1" "50" "2" "238243437" "238243437" "subst" "0.00012183" "00430" "COL6A3_000272" "g.238243437C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in COL6A3" "Germline" "" "" "0" "" "" "g.237334794C>G" "" "VUS" "" "0000462101" "1" "50" "2" "238253220" "238253220" "subst" "3.65524E-5" "00430" "COL6A3_000319" "g.238253220T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "2 variants detected in COL6A3" "Germline" "" "" "0" "" "" "g.237344577T>C" "" "VUS" "" "0000462102" "1" "50" "2" "238242173" "238242173" "subst" "4.06108E-6" "00430" "COL6A3_000267" "g.238242173G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237333530G>T" "" "VUS" "" "0000462103" "1" "50" "2" "238283145" "238283145" "subst" "2.43799E-5" "00430" "COL6A3_000427" "g.238283145C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in COL6A3" "Germline" "" "" "0" "" "" "g.237374502C>T" "" "VUS" "" "0000462104" "1" "50" "2" "238253214" "238253214" "subst" "0.000629523" "00430" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in COL6A3" "Germline" "" "" "0" "" "" "g.237344571T>C" "" "VUS" "" "0000462105" "1" "50" "2" "238261169" "238261169" "subst" "0.000103166" "00430" "COL6A3_000340" "g.238261169G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237352526G>A" "" "VUS" "" "0000462106" "1" "50" "2" "238253147" "238253147" "subst" "4.0624E-6" "00430" "COL6A3_000315" "g.238253147C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344504C>A" "" "VUS" "" "0000462107" "1" "50" "2" "238249215" "238249215" "subst" "0" "00430" "COL6A3_000293" "g.238249215C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant in COL6A3" "Germline" "" "" "0" "" "" "g.237340572C>T" "" "VUS" "" "0000462108" "1" "50" "2" "238243437" "238243437" "subst" "0.00012183" "00430" "COL6A3_000272" "g.238243437C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237334794C>G" "" "VUS" "" "0000462109" "1" "50" "2" "238269781" "238269781" "subst" "0" "00430" "COL6A3_000098" "g.238269781C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237361138C>T" "" "VUS" "" "0000462110" "1" "50" "2" "238285501" "238285501" "subst" "0" "00430" "COL6A3_000445" "g.238285501G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237376858G>A" "" "VUS" "" "0000462111" "1" "50" "2" "238287332" "238287332" "subst" "6.49736E-5" "00430" "COL6A3_000458" "g.238287332G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378689G>T" "" "VUS" "" "0000462112" "1" "50" "2" "238283543" "238283543" "subst" "0.00296708" "00430" "COL6A3_000004" "g.238283543C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237374900C>T" "" "VUS" "" "0000462113" "1" "50" "2" "238280543" "238280543" "subst" "0.000605617" "00430" "COL6A3_000171" "g.238280543C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237371900C>T" "" "VUS" "" "0000462114" "1" "50" "2" "238287815" "238287815" "subst" "2.45389E-5" "00430" "COL6A3_000474" "g.238287815T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237379172T>C" "" "VUS" "" "0000462115" "1" "50" "2" "238280543" "238280543" "subst" "0.000605617" "00430" "COL6A3_000171" "g.238280543C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237371900C>T" "" "VUS" "" "0000462116" "1" "50" "2" "238242176" "238242176" "subst" "0.000832555" "00430" "COL6A3_000147" "g.238242176G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237333533G>C" "" "VUS" "" "0000462117" "1" "50" "2" "238258801" "238258801" "subst" "0.000105597" "00430" "COL6A3_000215" "g.238258801G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237350158G>A" "" "VUS" "" "0000462118" "1" "50" "2" "238285960" "238285960" "subst" "9.31872E-5" "00430" "COL6A3_000454" "g.238285960A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237377317A>G" "" "VUS" "" "0000462119" "1" "50" "2" "238253054" "238253054" "subst" "2.43744E-5" "00430" "COL6A3_000312" "g.238253054G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237344411G>A" "" "VUS" "" "0000462120" "1" "50" "2" "238272006" "238272006" "subst" "4.06065E-5" "00430" "COL6A3_000010" "g.238272006C>T" "" "{PMID:Nallamilli 2018:30564623}, {PMID:Pan 2024:39663110}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237363363C>T" "" "VUS" "" "0000462121" "1" "50" "2" "238303819" "238303821" "del" "0" "00430" "COL6A3_000523" "g.238303819_238303821del" "" "{PMID:Nallamilli 2018:30564623}" "" "121_123delATA" "no second variant" "Germline" "" "" "0" "" "" "g.237395176_237395178del" "" "VUS" "" "0000462122" "1" "50" "2" "238242176" "238242176" "subst" "0.000832555" "00430" "COL6A3_000147" "g.238242176G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237333533G>C" "" "VUS" "" "0000462123" "1" "50" "2" "238280536" "238280536" "del" "0" "00430" "COL6A3_000410" "g.238280536del" "" "{PMID:Nallamilli 2018:30564623}" "" "4124delA" "" "Germline" "" "" "0" "" "" "g.237371893del" "" "VUS" "" "0000462124" "1" "50" "2" "238234278" "238234278" "subst" "0" "00430" "COL6A3_000265" "g.238234278A>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237325635A>C" "" "VUS" "" "0000462125" "1" "50" "2" "238287515" "238287515" "subst" "1.21868E-5" "00430" "COL6A3_000465" "g.238287515T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378872T>C" "" "VUS" "" "0000462126" "1" "50" "2" "238277218" "238277218" "subst" "9.7515E-5" "00430" "COL6A3_000392" "g.238277218G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368575G>A" "" "VUS" "" "0000462127" "1" "50" "2" "238287801" "238287801" "subst" "0.000220523" "00430" "COL6A3_000473" "g.238287801G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237379158G>A" "" "VUS" "" "0000462128" "1" "50" "2" "238283139" "238283139" "subst" "0" "00430" "COL6A3_000426" "g.238283139G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374496G>C" "" "VUS" "" "0000462129" "1" "50" "2" "238257252" "238257252" "subst" "0.00010571" "00430" "COL6A3_000332" "g.238257252G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237348609G>A" "" "VUS" "" "0000462130" "1" "90" "2" "238269763" "238269763" "subst" "0" "00430" "COL6A3_000012" "g.238269763C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000462131" "1" "50" "2" "238244939" "238244939" "subst" "0.000609394" "00430" "COL6A3_000279" "g.238244939G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237336296G>A" "" "VUS" "" "0000462132" "1" "50" "2" "238277707" "238277707" "subst" "0.000524932" "00430" "COL6A3_000007" "g.238277707T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237369064T>C" "" "VUS" "" "0000462133" "1" "50" "2" "238249370" "238249370" "subst" "0.000967755" "00430" "COL6A3_000209" "g.238249370G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000462134" "1" "50" "2" "238234338" "238234338" "subst" "7.31321E-5" "00430" "COL6A3_000266" "g.238234338T>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237325695T>G" "" "VUS" "" "0000462135" "1" "90" "2" "238267848" "238267848" "subst" "0" "00430" "COL6A3_000347" "g.238267848C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237359205C>A" "" "pathogenic" "" "0000462136" "1" "50" "2" "238274346" "238274346" "subst" "0.000240828" "00430" "COL6A3_000221" "g.238274346C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237365703C>G" "" "VUS" "" "0000462137" "1" "50" "2" "238245107" "238245107" "subst" "0.000824312" "00430" "COL6A3_000284" "g.238245107G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336464G>A" "" "VUS" "" "0000462138" "1" "50" "2" "238273074" "238273074" "subst" "0.00039012" "00430" "COL6A3_000161" "g.238273074G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237364431G>A" "" "VUS" "" "0000462139" "1" "50" "2" "238296323" "238296323" "subst" "0.0001751" "00430" "COL6A3_000494" "g.238296323A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237387680A>G" "" "VUS" "" "0000462140" "1" "50" "2" "238249727" "238249727" "subst" "4.47762E-5" "00430" "COL6A3_000305" "g.238249727G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237341084G>A" "" "VUS" "" "0000462141" "1" "70" "2" "238269781" "238269781" "subst" "0" "00430" "COL6A3_000356" "g.238269781C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237361138C>G" "" "likely pathogenic" "" "0000462142" "1" "50" "2" "238277596" "238277596" "subst" "0.000414277" "00430" "COL6A3_000402" "g.238277596G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368953G>A" "" "VUS" "" "0000462143" "1" "50" "2" "238283289" "238283289" "subst" "0.000182891" "00430" "COL6A3_000431" "g.238283289G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237374646G>A" "" "VUS" "" "0000462144" "1" "50" "2" "238296515" "238296515" "subst" "4.88222E-5" "00430" "COL6A3_000501" "g.238296515C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237387872C>T" "" "VUS" "" "0000462145" "1" "50" "2" "238243493" "238243493" "subst" "8.1283E-6" "00430" "COL6A3_000274" "g.238243493T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237334850T>C" "" "VUS" "" "0000462146" "1" "50" "2" "238249791" "238249791" "subst" "1.22528E-5" "00430" "COL6A3_000307" "g.238249791T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237341148T>C" "" "VUS" "" "0000462147" "1" "50" "2" "238249710" "238249710" "subst" "0.000203764" "00430" "COL6A3_000304" "g.238249710C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237341067C>T" "" "VUS" "" "0000462148" "1" "50" "2" "238249316" "238249316" "subst" "0.000162472" "00430" "COL6A3_000295" "g.238249316G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340673G>A" "" "VUS" "" "0000462149" "1" "50" "2" "238253584" "238253584" "subst" "7.33496E-5" "00430" "COL6A3_000326" "g.238253584C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344941C>T" "" "VUS" "" "0000462150" "1" "50" "2" "238249550" "238249550" "subst" "0.000619135" "00430" "COL6A3_000169" "g.238249550G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340907G>A" "" "VUS" "" "0000462151" "1" "50" "2" "238244939" "238244939" "subst" "0.000609394" "00430" "COL6A3_000279" "g.238244939G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336296G>A" "" "VUS" "" "0000462152" "1" "50" "2" "238253403" "238253403" "subst" "0.000834169" "00430" "COL6A3_000120" "g.238253403G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344760G>A" "" "VUS" "" "0000462153" "1" "50" "2" "238290105" "238290105" "subst" "0" "00430" "COL6A3_000490" "g.238290105C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237381462C>T" "" "VUS" "" "0000462154" "1" "50" "2" "238249316" "238249316" "subst" "0.000162472" "00430" "COL6A3_000295" "g.238249316G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340673G>A" "" "VUS" "" "0000462155" "1" "50" "2" "238280519" "238280519" "subst" "2.84581E-5" "00430" "COL6A3_000409" "g.238280519T>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237371876T>A" "" "VUS" "" "0000462156" "1" "50" "2" "238253147" "238253147" "subst" "4.0624E-6" "00430" "COL6A3_000315" "g.238253147C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237344504C>A" "" "VUS" "" "0000462157" "1" "50" "2" "238283496" "238283496" "subst" "8.14916E-6" "00430" "COL6A3_000436" "g.238283496A>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374853A>T" "" "VUS" "" "0000462158" "1" "50" "2" "238250719" "238250719" "subst" "0" "00430" "COL6A3_000308" "g.238250719T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237342076T>C" "" "VUS" "" "0000462159" "1" "50" "2" "238274499" "238274499" "subst" "8.9351E-5" "00430" "COL6A3_000368" "g.238274499G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237365856G>A" "" "VUS" "" "0000462160" "1" "70" "2" "238267848" "238267848" "subst" "0" "00430" "COL6A3_000348" "g.238267848C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237359205C>T" "" "likely pathogenic" "" "0000462161" "1" "70" "2" "238267848" "238267848" "subst" "0" "00430" "COL6A3_000348" "g.238267848C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237359205C>T" "" "likely pathogenic" "" "0000462162" "1" "50" "2" "238249370" "238249370" "subst" "0.000967755" "00430" "COL6A3_000209" "g.238249370G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000462163" "1" "50" "2" "238280557" "238280557" "subst" "0.000422616" "00430" "COL6A3_000227" "g.238280557G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237371914G>A" "" "VUS" "" "0000462164" "1" "50" "2" "238261167" "238261167" "subst" "0.000314359" "00430" "COL6A3_000339" "g.238261167G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237352524G>A" "" "VUS" "" "0000462165" "1" "70" "2" "238267848" "238267848" "subst" "0" "00430" "COL6A3_000348" "g.238267848C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237359205C>T" "" "likely pathogenic" "" "0000462166" "1" "50" "2" "238261167" "238261167" "subst" "0.000314359" "00430" "COL6A3_000339" "g.238261167G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237352524G>A" "" "VUS" "" "0000462167" "1" "50" "2" "238274657" "238274657" "subst" "0" "00430" "COL6A3_000378" "g.238274657A>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237366014A>C" "" "VUS" "" "0000462168" "1" "50" "2" "238253403" "238253403" "subst" "0.000834169" "00430" "COL6A3_000120" "g.238253403G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237344760G>A" "" "VUS" "" "0000462169" "1" "50" "2" "238280539" "238280539" "subst" "0.000101593" "00430" "COL6A3_000411" "g.238280539T>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237371896T>A" "" "VUS" "" "0000462170" "1" "50" "2" "238245107" "238245107" "subst" "0.000824312" "00430" "COL6A3_000284" "g.238245107G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237336464G>A" "" "VUS" "" "0000462171" "1" "50" "2" "238277380" "238277380" "subst" "2.84252E-5" "00430" "COL6A3_000396" "g.238277380G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237368737G>A" "" "VUS" "" "0000462172" "1" "50" "2" "238303364" "238303364" "subst" "8.12374E-6" "00430" "COL6A3_000512" "g.238303364G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237394721G>A" "" "VUS" "" "0000462173" "1" "50" "2" "238274544" "238274544" "subst" "8.12863E-5" "00430" "COL6A3_000371" "g.238274544C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237365901C>T" "" "VUS" "" "0000462174" "1" "50" "2" "238289693" "238289693" "subst" "1.21832E-5" "00430" "COL6A3_000479" "g.238289693C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237381050C>T" "" "VUS" "" "0000462175" "1" "50" "2" "238269775" "238269775" "subst" "0" "00430" "COL6A3_000166" "g.238269775C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237361132C>T" "" "VUS" "" "0000462176" "1" "90" "2" "238296777" "238296777" "del" "0" "00430" "COL6A3_000509" "g.238296777del" "" "{PMID:Nallamilli 2018:30564623}" "" "761delG" "" "Germline" "" "" "0" "" "" "g.237388134del" "" "pathogenic" "" "0000462177" "1" "50" "2" "238285622" "238285622" "subst" "0" "00430" "COL6A3_000450" "g.238285622G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237376979G>A" "" "VUS" "" "0000462178" "1" "50" "2" "238296329" "238296329" "subst" "0.000105927" "00430" "COL6A3_000495" "g.238296329G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237387686G>A" "" "VUS" "" "0000462179" "1" "50" "2" "238280819" "238280819" "subst" "1.21936E-5" "00430" "COL6A3_000417" "g.238280819T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237372176T>C" "" "VUS" "" "0000462180" "1" "50" "2" "238233467" "238233467" "subst" "0.000528345" "00430" "COL6A3_000262" "g.238233467G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237324824G>A" "" "VUS" "" "0000462181" "1" "50" "2" "238250745" "238250745" "subst" "0" "00430" "COL6A3_000309" "g.238250745G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237342102G>A" "" "VUS" "" "0000462182" "1" "50" "2" "238283289" "238283289" "subst" "0.000182891" "00430" "COL6A3_000431" "g.238283289G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237374646G>A" "" "VUS" "" "0000462183" "1" "50" "2" "238261997" "238261997" "subst" "8.12381E-6" "00430" "COL6A3_000341" "g.238261997G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237353354G>A" "" "VUS" "" "0000462184" "1" "50" "2" "238290085" "238290085" "subst" "1.23803E-5" "00430" "COL6A3_000489" "g.238290085C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237381442C>A" "" "VUS" "" "0000462185" "1" "70" "2" "238268004" "238268004" "subst" "0" "00430" "COL6A3_000350" "g.238268004C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237359361C>A" "" "likely pathogenic" "" "0000462186" "1" "50" "2" "238244999" "238244999" "subst" "3.25622E-5" "00430" "COL6A3_000280" "g.238244999G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336356G>A" "" "VUS" "" "0000462187" "1" "50" "2" "238249366" "238249366" "subst" "0.000313041" "00430" "COL6A3_000297" "g.238249366T>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340723T>G" "" "VUS" "" "0000462188" "1" "50" "2" "238280945" "238280945" "subst" "1.23504E-5" "00430" "COL6A3_000421" "g.238280945C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237372302C>T" "" "VUS" "" "0000462189" "1" "50" "2" "238243289" "238243289" "subst" "0.000109687" "00430" "COL6A3_000268" "g.238243289T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237334646T>C" "" "VUS" "" "0000462190" "1" "50" "2" "238249606" "238249606" "subst" "0.000239912" "00430" "COL6A3_000302" "g.238249606C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340963C>T" "" "VUS" "" "0000462191" "1" "50" "2" "238289609" "238289609" "subst" "4.06455E-6" "00430" "COL6A3_000476" "g.238289609T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237380966T>C" "" "VUS" "" "0000462192" "1" "50" "2" "238255193" "238255193" "subst" "0" "00430" "COL6A3_000327" "g.238255193G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237346550G>A" "" "VUS" "" "0000462193" "1" "50" "2" "238277271" "238277271" "subst" "0.000125892" "00430" "COL6A3_000394" "g.238277271G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237368628G>A" "" "VUS" "" "0000462194" "1" "50" "2" "238275452" "238275452" "subst" "0" "00430" "COL6A3_000383" "g.238275452C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237366809C>T" "" "VUS" "" "0000462195" "1" "50" "2" "238285978" "238285978" "subst" "1.27766E-5" "00430" "COL6A3_000456" "g.238285978C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237377335C>A" "" "VUS" "" "0000462196" "1" "50" "2" "238280919" "238280919" "subst" "2.44692E-5" "00430" "COL6A3_000420" "g.238280919C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237372276C>G" "" "VUS" "" "0000462197" "1" "50" "2" "238280758" "238280758" "subst" "0.000256364" "00430" "COL6A3_000415" "g.238280758C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237372115C>T" "" "VUS" "" "0000462198" "1" "50" "2" "238296531" "238296531" "subst" "5.69597E-5" "00430" "COL6A3_000194" "g.238296531G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237387888G>A" "" "VUS" "" "0000462199" "1" "50" "2" "238283447" "238283447" "subst" "2.03161E-5" "00430" "COL6A3_000435" "g.238283447C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374804C>T" "" "VUS" "" "0000462200" "1" "50" "2" "238285621" "238285621" "subst" "6.90378E-5" "00430" "COL6A3_000449" "g.238285621C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237376978C>T" "" "VUS" "" "0000462201" "1" "50" "2" "238253403" "238253403" "subst" "0.000834169" "00430" "COL6A3_000120" "g.238253403G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237344760G>A" "" "VUS" "" "0000462202" "1" "50" "2" "238273074" "238273074" "subst" "0.00039012" "00430" "COL6A3_000161" "g.238273074G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237364431G>A" "" "VUS" "" "0000462203" "1" "50" "2" "238249316" "238249316" "subst" "0.000162472" "00430" "COL6A3_000295" "g.238249316G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340673G>A" "" "VUS" "" "0000462204" "1" "50" "2" "238277782" "238277782" "subst" "3.28596E-5" "00430" "COL6A3_000405" "g.238277782C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237369139C>T" "" "VUS" "" "0000462205" "1" "50" "2" "238280984" "238280984" "subst" "0.000147339" "00430" "COL6A3_000422" "g.238280984C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237372341C>T" "" "VUS" "" "0000462206" "1" "50" "2" "238275691" "238275691" "subst" "8.52958E-5" "00430" "COL6A3_000388" "g.238275691C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237367048C>T" "" "VUS" "" "0000462207" "1" "50" "2" "238303232" "238303232" "subst" "0" "00430" "COL6A3_000511" "g.238303232G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237394589G>A" "" "VUS" "" "0000462208" "1" "50" "2" "238287484" "238287484" "subst" "0.0007556" "00430" "COL6A3_000464" "g.238287484G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237378841G>A" "" "VUS" "" "0000462209" "1" "50" "2" "238285477" "238285477" "subst" "6.90372E-5" "00430" "COL6A3_000444" "g.238285477C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237376834C>T" "" "VUS" "" "0000462210" "1" "50" "2" "238256447" "238256447" "subst" "1.25913E-5" "00430" "COL6A3_000329" "g.238256447T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237347804T>C" "" "VUS" "" "0000462211" "1" "50" "2" "238289917" "238289917" "subst" "0.000381754" "00430" "COL6A3_000483" "g.238289917C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381274C>T" "" "VUS" "" "0000462212" "1" "50" "2" "238296638" "238296640" "del" "0" "00430" "COL6A3_000504" "g.238296638_238296640del" "" "{PMID:Nallamilli 2018:30564623}" "" "898_900delTCC" "no second variant" "Germline" "" "" "0" "" "" "g.237387995_237387997del" "" "VUS" "" "0000462213" "1" "50" "2" "238303524" "238303524" "subst" "1.22183E-5" "00430" "COL6A3_000518" "g.238303524C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237394881C>T" "" "VUS" "" "0000462214" "1" "70" "2" "238268801" "238268801" "subst" "0" "00430" "COL6A3_000354" "g.238268801C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237360158C>T" "" "likely pathogenic" "" "0000462215" "1" "50" "2" "238275438" "238275438" "subst" "0" "00430" "COL6A3_000382" "g.238275438G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237366795G>A" "" "VUS" "" "0000462216" "1" "50" "2" "238280613" "238280613" "subst" "0.000284571" "00430" "COL6A3_000412" "g.238280613G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237371970G>A" "" "VUS" "" "0000462217" "1" "90" "2" "238296777" "238296777" "del" "0" "00430" "COL6A3_000509" "g.238296777del" "" "{PMID:Nallamilli 2018:30564623}" "" "761delG" "no second variant" "Germline" "" "" "0" "" "" "g.237388134del" "" "pathogenic" "" "0000462218" "1" "50" "2" "238249527" "238249527" "subst" "0" "00430" "COL6A3_000300" "g.238249527C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340884C>T" "" "VUS" "" "0000462219" "1" "50" "2" "238249184" "238249184" "subst" "0" "00430" "COL6A3_000291" "g.238249184T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340541T>C" "" "VUS" "" "0000462220" "1" "50" "2" "238277429" "238277429" "subst" "0.000138076" "00430" "COL6A3_000399" "g.238277429G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368786G>A" "" "VUS" "" "0000462221" "1" "50" "2" "238280759" "238280759" "subst" "6.91715E-5" "00430" "COL6A3_000416" "g.238280759G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237372116G>A" "" "VUS" "" "0000462222" "1" "50" "2" "238287571" "238287571" "subst" "0.000658232" "00430" "COL6A3_000468" "g.238287571G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378928G>A" "" "VUS" "" "0000462223" "1" "50" "2" "238274530" "238274530" "subst" "0" "00430" "COL6A3_000369" "g.238274530G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237365887G>T" "" "VUS" "" "0000462224" "1" "50" "2" "238266038" "238266038" "subst" "0" "00430" "COL6A3_000343" "g.238266038G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237357395G>A" "" "VUS" "" "0000462225" "1" "50" "2" "238296778" "238296778" "subst" "9.03699E-5" "00430" "COL6A3_000510" "g.238296778G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237388135G>A" "" "VUS" "" "0000462226" "1" "50" "2" "238253397" "238253397" "subst" "0" "00430" "COL6A3_000325" "g.238253397G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344754G>C" "" "VUS" "" "0000462227" "1" "50" "2" "238258801" "238258801" "subst" "0.000105597" "00430" "COL6A3_000215" "g.238258801G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237350158G>A" "" "VUS" "" "0000462228" "1" "50" "2" "238253403" "238253403" "subst" "0.000834169" "00430" "COL6A3_000120" "g.238253403G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344760G>A" "" "VUS" "" "0000462229" "1" "50" "2" "238272006" "238272006" "subst" "4.06065E-5" "00430" "COL6A3_000010" "g.238272006C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237363363C>T" "" "VUS" "" "0000462230" "1" "50" "2" "238271919" "238271919" "subst" "2.43639E-5" "00430" "COL6A3_000362" "g.238271919C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237363276C>A" "" "VUS" "" "0000462231" "1" "50" "2" "238280557" "238280557" "subst" "0.000422616" "00430" "COL6A3_000227" "g.238280557G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237371914G>A" "" "VUS" "" "0000462232" "1" "50" "2" "238285477" "238285477" "subst" "6.90372E-5" "00430" "COL6A3_000444" "g.238285477C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237376834C>T" "" "VUS" "" "0000462233" "1" "50" "2" "238283363" "238283363" "subst" "2.44302E-5" "00430" "COL6A3_000433" "g.238283363G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374720G>A" "" "VUS" "" "0000462234" "1" "50" "2" "238296638" "238296640" "del" "0" "00430" "COL6A3_000504" "g.238296638_238296640del" "" "{PMID:Nallamilli 2018:30564623}" "" "898_900delTCC" "no second variant" "Germline" "" "" "0" "" "" "g.237387995_237387997del" "" "VUS" "" "0000462235" "1" "50" "2" "238287473" "238287473" "subst" "3.65586E-5" "00430" "COL6A3_000463" "g.238287473C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378830C>T" "" "VUS" "" "0000462236" "1" "50" "2" "238253148" "238253148" "subst" "8.93699E-5" "00430" "COL6A3_000316" "g.238253148C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344505C>T" "" "VUS" "" "0000462237" "1" "50" "2" "238289917" "238289917" "subst" "0.000381754" "00430" "COL6A3_000483" "g.238289917C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381274C>T" "" "VUS" "" "0000462238" "1" "50" "2" "238303655" "238303655" "subst" "1.62487E-5" "00430" "COL6A3_000521" "g.238303655G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237395012G>A" "" "VUS" "" "0000462239" "1" "50" "2" "238274645" "238274645" "subst" "4.12239E-6" "00430" "COL6A3_000375" "g.238274645C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237366002C>A" "" "VUS" "" "0000462240" "1" "50" "2" "238247760" "238247760" "subst" "0" "00430" "COL6A3_000287" "g.238247760C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237339117C>T" "" "VUS" "" "0000462241" "1" "50" "2" "238273074" "238273074" "subst" "0.00039012" "00430" "COL6A3_000161" "g.238273074G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237364431G>A" "" "VUS" "" "0000462242" "1" "50" "2" "238277596" "238277596" "subst" "0.000414277" "00430" "COL6A3_000402" "g.238277596G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368953G>A" "" "VUS" "" "0000462243" "1" "50" "2" "238296323" "238296323" "subst" "0.0001751" "00430" "COL6A3_000494" "g.238296323A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237387680A>G" "" "VUS" "" "0000462244" "1" "50" "2" "238283315" "238283315" "subst" "0.000447402" "00430" "COL6A3_000432" "g.238283315G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374672G>A" "" "VUS" "" "0000462245" "1" "50" "2" "238249251" "238249251" "subst" "4.06081E-6" "00430" "COL6A3_000294" "g.238249251C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340608C>T" "" "VUS" "" "0000462246" "1" "90" "2" "238267879" "238267922" "del" "0" "00430" "COL6A3_000349" "g.238267879_238267922del" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237359236_237359279del" "" "pathogenic" "" "0000462247" "1" "50" "2" "238253236" "238253236" "subst" "0" "00430" "COL6A3_000320" "g.238253236G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344593G>T" "" "VUS" "" "0000462248" "1" "50" "2" "238247727" "238247727" "subst" "1.21885E-5" "00430" "COL6A3_000286" "g.238247727C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237339084C>T" "" "VUS" "" "0000462249" "1" "50" "2" "238296320" "238296320" "subst" "1.62963E-5" "00430" "COL6A3_000493" "g.238296320C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237387677C>T" "" "VUS" "" "0000462250" "1" "50" "2" "238296387" "238296387" "subst" "5.70121E-5" "00430" "COL6A3_000496" "g.238296387C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237387744C>T" "" "VUS" "" "0000462251" "1" "50" "2" "238296515" "238296515" "subst" "4.06851E-6" "00430" "COL6A3_000502" "g.238296515C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237387872C>A" "" "VUS" "" "0000462252" "1" "50" "2" "238253054" "238253054" "subst" "2.43744E-5" "00430" "COL6A3_000312" "g.238253054G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344411G>A" "" "VUS" "" "0000462253" "1" "50" "2" "238245107" "238245107" "subst" "0.000824312" "00430" "COL6A3_000284" "g.238245107G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336464G>A" "" "VUS" "" "0000462254" "1" "50" "2" "238283565" "238283565" "subst" "0" "00430" "COL6A3_000440" "g.238283565T>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374922T>A" "" "VUS" "" "0000462255" "1" "50" "2" "238259820" "238259820" "subst" "0.000113707" "00430" "COL6A3_000338" "g.238259820C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237351177C>T" "" "VUS" "" "0000462256" "1" "50" "2" "238280557" "238280557" "subst" "0.000422616" "00430" "COL6A3_000227" "g.238280557G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237371914G>A" "" "VUS" "" "0000462257" "1" "50" "2" "238274346" "238274346" "subst" "0.000240828" "00430" "COL6A3_000221" "g.238274346C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237365703C>G" "" "VUS" "" "0000462258" "1" "50" "2" "238289588" "238289588" "subst" "0.000146558" "00430" "COL6A3_000257" "g.238289588G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237380945G>A" "" "VUS" "" "0000462259" "1" "50" "2" "238275404" "238275404" "subst" "0" "00430" "COL6A3_000380" "g.238275404C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237366761C>T" "" "VUS" "" "0000462260" "1" "50" "2" "238253835" "238253835" "subst" "0.000178869" "00430" "COL6A3_000213" "g.238253835C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237345192C>T" "" "VUS" "" "0000462261" "1" "50" "2" "238250788" "238250788" "subst" "9.34283E-5" "00430" "COL6A3_000127" "g.238250788A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237342145A>G" "" "VUS" "" "0000462262" "1" "50" "2" "238249370" "238249370" "subst" "0.000967755" "00430" "COL6A3_000209" "g.238249370G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000462263" "1" "50" "2" "238296492" "238296492" "subst" "0" "00430" "COL6A3_000499" "g.238296492C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237387849C>A" "" "VUS" "" "0000462264" "1" "50" "2" "238253285" "238253285" "subst" "2.03153E-5" "00430" "COL6A3_000321" "g.238253285C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344642C>T" "" "VUS" "" "0000462265" "1" "50" "2" "238243455" "238243455" "subst" "4.06138E-6" "00430" "COL6A3_000273" "g.238243455G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237334812G>A" "" "VUS" "" "0000462266" "1" "50" "2" "238287580" "238287580" "subst" "1.62483E-5" "00430" "COL6A3_000469" "g.238287580C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237378937C>T" "" "VUS" "" "0000462267" "1" "50" "2" "238280945" "238280945" "subst" "1.23504E-5" "00430" "COL6A3_000421" "g.238280945C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237372302C>T" "" "VUS" "" "0000462268" "1" "50" "2" "238280519" "238280519" "subst" "2.84581E-5" "00430" "COL6A3_000409" "g.238280519T>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237371876T>A" "" "VUS" "" "0000462269" "1" "50" "2" "238287746" "238287746" "subst" "4.06283E-6" "00430" "COL6A3_000471" "g.238287746C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237379103C>A" "" "VUS" "" "0000462270" "1" "50" "2" "238285430" "238285430" "subst" "9.7739E-5" "00430" "COL6A3_000443" "g.238285430C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237376787C>T" "" "VUS" "" "0000462271" "1" "50" "2" "238249419" "238249419" "subst" "0" "00430" "COL6A3_000299" "g.238249419C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340776C>T" "" "VUS" "" "0000462272" "1" "50" "2" "238274346" "238274346" "subst" "0.000240828" "00430" "COL6A3_000221" "g.238274346C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237365703C>G" "" "VUS" "" "0000462273" "1" "50" "2" "238287545" "238287545" "subst" "0.000211262" "00430" "COL6A3_000466" "g.238287545G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378902G>A" "" "VUS" "" "0000462274" "1" "50" "2" "238244875" "238244877" "dup" "0" "00430" "COL6A3_000278" "g.238244875_238244877dup" "" "{PMID:Nallamilli 2018:30564623}" "" "8877_8879dupTGC" "" "Germline" "" "" "0" "" "" "g.237336232_237336234dup" "" "VUS" "" "0000462275" "1" "50" "2" "238243382" "238243382" "subst" "0.00017055" "00430" "COL6A3_000271" "g.238243382G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237334739G>A" "" "VUS" "" "0000462276" "1" "50" "2" "238253835" "238253835" "subst" "0.000178869" "00430" "COL6A3_000213" "g.238253835C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237345192C>T" "" "VUS" "" "0000462277" "1" "50" "2" "238303501" "238303501" "subst" "1.62813E-5" "00430" "COL6A3_000517" "g.238303501G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237394858G>A" "" "VUS" "" "0000462278" "1" "50" "2" "238274560" "238274560" "subst" "0.000585237" "00430" "COL6A3_000372" "g.238274560G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237365917G>A" "" "VUS" "" "0000462279" "1" "50" "2" "238285729" "238285729" "subst" "3.24868E-5" "00430" "COL6A3_000451" "g.238285729G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237377086G>A" "" "VUS" "" "0000462280" "1" "50" "2" "238253835" "238253835" "subst" "0.000178869" "00430" "COL6A3_000213" "g.238253835C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237345192C>T" "" "VUS" "" "0000462281" "1" "50" "2" "238280543" "238280543" "subst" "0.000605617" "00430" "COL6A3_000171" "g.238280543C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237371900C>T" "" "VUS" "" "0000462282" "1" "50" "2" "238280759" "238280759" "subst" "6.91715E-5" "00430" "COL6A3_000416" "g.238280759G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237372116G>A" "" "VUS" "" "0000462283" "1" "50" "2" "238249200" "238249200" "subst" "6.09102E-5" "00430" "COL6A3_000292" "g.238249200C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340557C>T" "" "VUS" "" "0000462284" "1" "50" "2" "238277409" "238277409" "subst" "3.65497E-5" "00430" "COL6A3_000397" "g.238277409G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368766G>A" "" "VUS" "" "0000462285" "1" "50" "2" "238290023" "238290023" "subst" "2.84419E-5" "00430" "COL6A3_000487" "g.238290023C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237381380C>T" "" "VUS" "" "0000462286" "1" "50" "2" "238296644" "238296644" "subst" "1.62468E-5" "00430" "COL6A3_000505" "g.238296644G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237388001G>A" "" "VUS" "" "0000462287" "1" "50" "2" "238259820" "238259820" "subst" "0.000113707" "00430" "COL6A3_000338" "g.238259820C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237351177C>T" "" "VUS" "" "0000462288" "1" "50" "2" "238249370" "238249370" "subst" "0.000967755" "00430" "COL6A3_000209" "g.238249370G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000462289" "1" "50" "2" "238303687" "238303687" "subst" "4.47144E-5" "00430" "COL6A3_000522" "g.238303687G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237395044G>A" "" "VUS" "" "0000462290" "1" "50" "2" "238289917" "238289917" "subst" "0.000381754" "00430" "COL6A3_000483" "g.238289917C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237381274C>T" "" "VUS" "" "0000462291" "1" "50" "2" "238234237" "238234237" "subst" "0" "00430" "COL6A3_000263" "g.238234237T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237325594T>C" "" "VUS" "" "0000462292" "1" "50" "2" "238289917" "238289917" "subst" "0.000381754" "00430" "COL6A3_000483" "g.238289917C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237381274C>T" "" "VUS" "" "0000462293" "1" "50" "2" "238268025" "238268025" "subst" "8.61256E-5" "00430" "COL6A3_000351" "g.238268025G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237359382G>A" "" "VUS" "" "0000462294" "1" "50" "2" "238249583" "238249583" "subst" "4.06875E-6" "00430" "COL6A3_000301" "g.238249583T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340940T>C" "" "VUS" "" "0000462295" "1" "50" "2" "238249323" "238249323" "subst" "1.62483E-5" "00430" "COL6A3_000296" "g.238249323C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340680C>T" "" "VUS" "" "0000462296" "1" "50" "2" "238243437" "238243437" "subst" "0.00012183" "00430" "COL6A3_000272" "g.238243437C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237334794C>G" "" "VUS" "" "0000462297" "1" "50" "2" "238262034" "238262034" "subst" "3.65577E-5" "00430" "COL6A3_000342" "g.238262034C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237353391C>T" "" "VUS" "" "0000462298" "1" "50" "2" "238277596" "238277596" "subst" "0.000414277" "00430" "COL6A3_000402" "g.238277596G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237368953G>A" "" "VUS" "" "0000462299" "1" "50" "2" "238283315" "238283315" "subst" "0.000447402" "00430" "COL6A3_000432" "g.238283315G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237374672G>A" "" "VUS" "" "0000462300" "1" "50" "2" "238253286" "238253286" "subst" "5.28344E-5" "00430" "COL6A3_000322" "g.238253286G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237344643G>A" "" "VUS" "" "0000462301" "1" "50" "2" "238274534" "238274534" "subst" "0.00011379" "00430" "COL6A3_000370" "g.238274534G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237365891G>A" "" "VUS" "" "0000462302" "1" "50" "2" "238275437" "238275437" "subst" "0.00011776" "00430" "COL6A3_000381" "g.238275437C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237366794C>T" "" "VUS" "" "0000462303" "1" "50" "2" "238303450" "238303450" "subst" "0.00122759" "00430" "COL6A3_000514" "g.238303450C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237394807C>T" "" "VUS" "" "0000462304" "1" "50" "2" "238275534" "238275534" "subst" "0" "00430" "COL6A3_000385" "g.238275534G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237366891G>C" "" "VUS" "" "0000462305" "1" "90" "2" "238253214" "238253214" "subst" "0.000629523" "00430" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237344571T>C" "" "pathogenic" "" "0000462306" "1" "50" "2" "238233467" "238233467" "subst" "0.000528345" "00430" "COL6A3_000262" "g.238233467G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237324824G>A" "" "VUS" "" "0000462307" "1" "50" "2" "238269794" "238269794" "subst" "6.49762E-5" "00430" "COL6A3_000357" "g.238269794G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237361151G>A" "" "VUS" "" "0000462308" "1" "50" "2" "238250788" "238250788" "subst" "9.34283E-5" "00430" "COL6A3_000127" "g.238250788A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237342145A>G" "" "VUS" "" "0000462309" "1" "50" "2" "238274569" "238274569" "subst" "0.00130074" "00430" "COL6A3_000373" "g.238274569G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237365926G>T" "" "VUS" "" "0000462310" "1" "50" "2" "238296638" "238296640" "del" "0" "00430" "COL6A3_000504" "g.238296638_238296640del" "" "{PMID:Nallamilli 2018:30564623}" "" "898_900delTCC" "" "Germline" "" "" "0" "" "" "g.237387995_237387997del" "" "VUS" "" "0000462311" "1" "70" "2" "238267732" "238267732" "subst" "0" "00430" "COL6A3_000346" "g.238267732C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237359089C>T" "" "likely pathogenic" "" "0000462312" "1" "50" "2" "238280905" "238280905" "subst" "0.000256504" "00430" "COL6A3_000419" "g.238280905C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237372262C>T" "" "VUS" "" "0000462313" "1" "50" "2" "238280543" "238280543" "subst" "0.000605617" "00430" "COL6A3_000171" "g.238280543C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237371900C>T" "" "VUS" "" "0000462314" "1" "50" "2" "238296676" "238296676" "subst" "3.25478E-5" "00430" "COL6A3_000506" "g.238296676G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237388033G>A" "" "VUS" "" "0000462315" "1" "50" "2" "238275846" "238275846" "subst" "0" "00430" "COL6A3_000390" "g.238275846C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237367203C>A" "" "VUS" "" "0000462316" "1" "50" "2" "238287484" "238287484" "subst" "0.0007556" "00430" "COL6A3_000464" "g.238287484G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237378841G>A" "" "VUS" "" "0000462317" "1" "50" "2" "238305427" "238305427" "subst" "0" "00430" "COL6A3_000525" "g.238305427C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237396784C>A" "" "VUS" "" "0000462318" "1" "50" "2" "238270472" "238270472" "subst" "0" "00430" "COL6A3_000360" "g.238270472G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237361829G>A" "" "VUS" "" "0000462319" "1" "50" "2" "238253293" "238253293" "subst" "2.03214E-5" "00430" "COL6A3_000323" "g.238253293C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237344650C>T" "" "VUS" "" "0000462320" "1" "50" "2" "238289693" "238289693" "subst" "1.21832E-5" "00430" "COL6A3_000479" "g.238289693C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237381050C>T" "" "VUS" "" "0000462321" "1" "50" "2" "238287545" "238287545" "subst" "0.000211262" "00430" "COL6A3_000466" "g.238287545G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237378902G>A" "" "VUS" "" "0000462322" "1" "50" "2" "238268025" "238268025" "subst" "8.61256E-5" "00430" "COL6A3_000351" "g.238268025G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237359382G>A" "" "VUS" "" "0000462323" "1" "50" "2" "238233443" "238233443" "subst" "4.9351E-5" "00430" "COL6A3_000261" "g.238233443C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237324800C>T" "" "VUS" "" "0000462324" "1" "50" "2" "238274499" "238274499" "subst" "8.9351E-5" "00430" "COL6A3_000368" "g.238274499G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237365856G>A" "" "VUS" "" "0000462325" "1" "50" "2" "238249316" "238249316" "subst" "0.000162472" "00430" "COL6A3_000295" "g.238249316G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340673G>A" "" "VUS" "" "0000462326" "1" "50" "2" "238249398" "238249398" "subst" "0" "00430" "COL6A3_000298" "g.238249398A>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340755A>C" "" "VUS" "" "0000462327" "1" "50" "2" "238296638" "238296640" "del" "0" "00430" "COL6A3_000504" "g.238296638_238296640del" "" "{PMID:Nallamilli 2018:30564623}" "" "898_900delTCC" "no second variant" "Germline" "" "" "0" "" "" "g.237387995_237387997del" "" "VUS" "" "0000462328" "1" "50" "2" "238253304" "238253304" "subst" "0" "00430" "COL6A3_000033" "g.238253304C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344661C>T" "" "VUS" "" "0000462329" "1" "50" "2" "238280823" "238280823" "subst" "1.21948E-5" "00430" "COL6A3_000418" "g.238280823G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237372180G>T" "" "VUS" "" "0000462330" "1" "50" "2" "238287473" "238287473" "subst" "3.65586E-5" "00430" "COL6A3_000463" "g.238287473C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237378830C>T" "" "VUS" "" "0000462331" "1" "50" "2" "238277262" "238277262" "subst" "4.06121E-6" "00430" "COL6A3_000393" "g.238277262G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368619G>T" "" "VUS" "" "0000462332" "1" "50" "2" "238285445" "238285445" "subst" "0.00020732" "00430" "COL6A3_000003" "g.238285445T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237376802T>C" "" "VUS" "" "0000462333" "1" "50" "2" "238253071" "238253071" "subst" "3.24979E-5" "00430" "COL6A3_000313" "g.238253071C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237344428C>T" "" "VUS" "" "0000462334" "1" "50" "2" "238253403" "238253403" "subst" "0.000834169" "00430" "COL6A3_000120" "g.238253403G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344760G>A" "" "VUS" "" "0000462335" "1" "50" "2" "238253286" "238253286" "subst" "5.28344E-5" "00430" "COL6A3_000322" "g.238253286G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344643G>A" "" "VUS" "" "0000462336" "1" "50" "2" "238303565" "238303565" "subst" "0" "00430" "COL6A3_000519" "g.238303565A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237394922A>G" "" "VUS" "" "0000462337" "1" "50" "2" "238275360" "238275360" "subst" "0.000113701" "00430" "COL6A3_000379" "g.238275360G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237366717G>A" "" "VUS" "" "0000462338" "1" "50" "2" "238303649" "238303649" "subst" "2.03098E-5" "00430" "COL6A3_000520" "g.238303649C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237395006C>T" "" "VUS" "" "0000462339" "1" "50" "2" "238280726" "238280726" "subst" "4.88345E-5" "00430" "COL6A3_000414" "g.238280726C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237372083C>T" "" "VUS" "" "0000462340" "1" "90" "2" "238268730" "238268730" "subst" "0" "00430" "COL6A3_000102" "g.238268730C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237360087C>T" "" "pathogenic" "" "0000462341" "1" "50" "2" "238256988" "238256988" "subst" "6.09127E-5" "00430" "COL6A3_000331" "g.238256988T>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237348345T>G" "" "VUS" "" "0000462342" "1" "50" "2" "238283616" "238283616" "subst" "0.000192901" "00430" "COL6A3_000441" "g.238283616C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237374973C>T" "" "VUS" "" "0000462343" "1" "50" "2" "238257287" "238257287" "subst" "6.09583E-5" "00430" "COL6A3_000333" "g.238257287C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237348644C>T" "" "VUS" "" "0000462344" "1" "50" "2" "238280557" "238280557" "subst" "0.000422616" "00430" "COL6A3_000227" "g.238280557G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237371914G>A" "" "VUS" "" "0000462345" "1" "50" "2" "238257252" "238257252" "subst" "0.00010571" "00430" "COL6A3_000332" "g.238257252G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237348609G>A" "" "VUS" "" "0000462346" "1" "50" "2" "238287452" "238287452" "subst" "0" "00430" "COL6A3_000460" "g.238287452C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378809C>A" "" "VUS" "" "0000462347" "1" "50" "2" "238285576" "238285576" "subst" "0" "00430" "COL6A3_000448" "g.238285576G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237376933G>C" "" "VUS" "" "0000462348" "1" "50" "2" "238269759" "238269759" "subst" "0" "00430" "COL6A3_000355" "g.238269759C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237361116C>A" "" "VUS" "" "0000462349" "1" "50" "2" "238283511" "238283511" "subst" "0.000465287" "00430" "COL6A3_000437" "g.238283511G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374868G>A" "" "VUS" "" "0000462350" "1" "50" "2" "238249727" "238249727" "subst" "4.47762E-5" "00430" "COL6A3_000305" "g.238249727G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237341084G>A" "" "VUS" "" "0000462351" "1" "50" "2" "238273074" "238273074" "subst" "0.00039012" "00430" "COL6A3_000161" "g.238273074G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237364431G>A" "" "VUS" "" "0000462352" "1" "50" "2" "238277681" "238277681" "subst" "8.12698E-6" "00430" "COL6A3_000403" "g.238277681A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237369038A>G" "" "VUS" "" "0000462353" "1" "50" "2" "238285553" "238285553" "subst" "2.03031E-5" "00430" "COL6A3_000447" "g.238285553C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237376910C>T" "" "VUS" "" "0000462354" "1" "50" "2" "238289953" "238289953" "subst" "4.06138E-6" "00430" "COL6A3_000486" "g.238289953G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381310G>A" "" "VUS" "" "0000462355" "1" "50" "2" "238277596" "238277596" "subst" "0.000414277" "00430" "COL6A3_000402" "g.238277596G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368953G>A" "" "VUS" "" "0000462356" "1" "70" "2" "238275794" "238275794" "subst" "0" "00430" "COL6A3_000009" "g.238275794C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237367151C>T" "" "likely pathogenic" "" "0000462357" "1" "50" "2" "238271990" "238271990" "subst" "1.62425E-5" "00430" "COL6A3_000363" "g.238271990C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237363347C>T" "" "VUS" "" "0000462358" "1" "70" "2" "238275794" "238275794" "subst" "0" "00430" "COL6A3_000009" "g.238275794C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237367151C>T" "" "likely pathogenic" "" "0000462359" "1" "50" "2" "238287801" "238287801" "subst" "0.000220523" "00430" "COL6A3_000473" "g.238287801G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237379158G>A" "" "VUS" "" "0000462360" "1" "50" "2" "238274445" "238274445" "subst" "2.43657E-5" "00430" "COL6A3_000245" "g.238274445C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237365802C>T" "" "VUS" "" "0000462361" "1" "50" "2" "238244939" "238244939" "subst" "0.000609394" "00430" "COL6A3_000279" "g.238244939G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336296G>A" "" "VUS" "" "0000462362" "1" "50" "2" "238287596" "238287596" "subst" "3.24923E-5" "00430" "COL6A3_000470" "g.238287596T>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378953T>G" "" "VUS" "" "0000462363" "1" "50" "2" "238303478" "238303478" "subst" "4.06729E-5" "00430" "COL6A3_000516" "g.238303478G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237394835G>A" "" "VUS" "" "0000462364" "1" "50" "2" "238283139" "238283139" "subst" "0" "00430" "COL6A3_000426" "g.238283139G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374496G>C" "" "VUS" "" "0000462365" "1" "50" "2" "238280426" "238280426" "subst" "0" "00430" "COL6A3_000408" "g.238280426T>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237371783T>A" "" "VUS" "" "0000462366" "1" "50" "2" "238289953" "238289953" "subst" "4.06138E-6" "00430" "COL6A3_000486" "g.238289953G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381310G>A" "" "VUS" "" "0000462367" "1" "50" "2" "238285960" "238285960" "subst" "9.31872E-5" "00430" "COL6A3_000454" "g.238285960A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237377317A>G" "" "VUS" "" "0000462368" "1" "50" "2" "238245104" "238245104" "subst" "1.62429E-5" "00430" "COL6A3_000283" "g.238245104G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336461G>A" "" "VUS" "" "0000462369" "1" "50" "2" "238275852" "238275852" "subst" "0" "00430" "COL6A3_000391" "g.238275852G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237367209G>A" "" "VUS" "" "0000462370" "1" "50" "2" "238277596" "238277596" "subst" "0.000414277" "00430" "COL6A3_000402" "g.238277596G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368953G>A" "" "VUS" "" "0000462371" "1" "50" "2" "238287801" "238287801" "subst" "0.000220523" "00430" "COL6A3_000473" "g.238287801G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237379158G>A" "" "VUS" "" "0000462372" "1" "50" "2" "238244939" "238244939" "subst" "0.000609394" "00430" "COL6A3_000279" "g.238244939G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237336296G>A" "" "VUS" "" "0000462373" "1" "90" "2" "238277271" "238277271" "subst" "0" "00430" "COL6A3_000395" "g.238277271G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237368628G>T" "" "pathogenic" "" "0000462374" "1" "50" "2" "238253220" "238253220" "subst" "3.65524E-5" "00430" "COL6A3_000319" "g.238253220T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237344577T>C" "" "VUS" "" "0000462375" "1" "70" "2" "238259790" "238259790" "subst" "0" "00430" "COL6A3_000336" "g.238259790C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237351147C>T" "" "likely pathogenic" "" "0000462376" "1" "50" "2" "238296323" "238296323" "subst" "0.0001751" "00430" "COL6A3_000494" "g.238296323A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237387680A>G" "" "VUS" "" "0000462377" "1" "50" "2" "238280758" "238280758" "subst" "0.000256364" "00430" "COL6A3_000415" "g.238280758C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237372115C>T" "" "VUS" "" "0000462378" "1" "50" "2" "238283616" "238283616" "subst" "0.000192901" "00430" "COL6A3_000441" "g.238283616C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374973C>T" "" "VUS" "" "0000462379" "1" "50" "2" "238303478" "238303478" "subst" "4.06729E-5" "00430" "COL6A3_000516" "g.238303478G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237394835G>A" "" "VUS" "" "0000462380" "1" "90" "2" "238267848" "238267848" "subst" "0" "00430" "COL6A3_000348" "g.238267848C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237359205C>T" "" "pathogenic" "" "0000462381" "1" "50" "2" "238245107" "238245107" "subst" "0.000824312" "00430" "COL6A3_000284" "g.238245107G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237336464G>A" "" "VUS" "" "0000462382" "1" "50" "2" "238285885" "238285885" "subst" "8.59564E-5" "00430" "COL6A3_000452" "g.238285885T>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237377242T>A" "" "VUS" "" "0000462383" "1" "50" "2" "238245107" "238245107" "subst" "0.000824312" "00430" "COL6A3_000284" "g.238245107G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237336464G>A" "" "VUS" "" "0000462384" "1" "50" "2" "238287470" "238287470" "subst" "4.46798E-5" "00430" "COL6A3_000461" "g.238287470G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378827G>A" "" "VUS" "" "0000462385" "1" "50" "2" "238277596" "238277596" "subst" "0.000414277" "00430" "COL6A3_000402" "g.238277596G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368953G>A" "" "VUS" "" "0000462386" "1" "50" "2" "238267678" "238267678" "subst" "2.43653E-5" "00430" "COL6A3_000345" "g.238267678C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237359035C>G" "" "VUS" "" "0000462387" "1" "50" "2" "238249166" "238249166" "subst" "4.46722E-5" "00430" "COL6A3_000289" "g.238249166A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340523A>G" "" "VUS" "" "0000462388" "1" "90" "2" "238267848" "238267848" "subst" "0" "00430" "COL6A3_000348" "g.238267848C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237359205C>T" "" "pathogenic" "" "0000462389" "1" "50" "2" "238274336" "238274336" "subst" "0" "00430" "COL6A3_000365" "g.238274336C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237365693C>T" "" "VUS" "" "0000462390" "1" "50" "2" "238287545" "238287545" "subst" "0.000211262" "00430" "COL6A3_000466" "g.238287545G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237378902G>A" "" "VUS" "" "0000462391" "1" "50" "2" "238283547" "238283547" "subst" "1.22778E-5" "00430" "COL6A3_000439" "g.238283547C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237374904C>T" "" "VUS" "" "0000462392" "1" "70" "2" "238275794" "238275794" "subst" "0" "00430" "COL6A3_000009" "g.238275794C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237367151C>T" "" "likely pathogenic" "" "0000462393" "1" "50" "2" "238234239" "238234239" "subst" "4.06111E-6" "00430" "COL6A3_000264" "g.238234239C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237325596C>G" "" "VUS" "" "0000462394" "1" "50" "2" "238277596" "238277596" "subst" "0.000414277" "00430" "COL6A3_000402" "g.238277596G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368953G>A" "" "VUS" "" "0000462395" "1" "50" "2" "238289917" "238289917" "subst" "0.000381754" "00430" "COL6A3_000483" "g.238289917C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381274C>T" "" "VUS" "" "0000462396" "1" "50" "2" "238285445" "238285445" "subst" "0.00020732" "00430" "COL6A3_000003" "g.238285445T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237376802T>C" "" "VUS" "" "0000462397" "1" "50" "2" "238280919" "238280919" "subst" "2.44692E-5" "00430" "COL6A3_000420" "g.238280919C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237372276C>G" "" "VUS" "" "0000462398" "1" "50" "2" "238249550" "238249550" "subst" "0.000619135" "00430" "COL6A3_000169" "g.238249550G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340907G>A" "" "VUS" "" "0000462399" "1" "50" "2" "238253200" "238253200" "subst" "4.06147E-6" "00430" "COL6A3_000318" "g.238253200C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344557C>T" "" "VUS" "" "0000462400" "1" "50" "2" "238256506" "238256506" "subst" "0" "00430" "COL6A3_000330" "g.238256506G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237347863G>T" "" "VUS" "" "0000462401" "1" "50" "2" "238287558" "238287558" "subst" "6.09399E-5" "00430" "COL6A3_000467" "g.238287558G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378915G>A" "" "VUS" "" "0000462402" "1" "50" "2" "238296761" "238296761" "subst" "0.000381441" "00430" "COL6A3_000237" "g.238296761G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237388118G>A" "" "VUS" "" "0000462403" "1" "50" "2" "238249316" "238249316" "subst" "0.000162472" "00430" "COL6A3_000295" "g.238249316G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340673G>A" "" "VUS" "" "0000462404" "1" "50" "2" "238274544" "238274544" "subst" "8.12863E-5" "00430" "COL6A3_000371" "g.238274544C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237365901C>T" "" "VUS" "" "0000462405" "1" "50" "2" "238244897" "238244897" "subst" "0.000109886" "00430" "COL6A3_000204" "g.238244897G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336254G>A" "" "VUS" "" "0000462406" "1" "50" "2" "238289626" "238289626" "subst" "4.06329E-6" "00430" "COL6A3_000477" "g.238289626G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237380983G>A" "" "VUS" "" "0000462407" "1" "50" "2" "238245107" "238245107" "subst" "0.000824312" "00430" "COL6A3_000284" "g.238245107G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237336464G>A" "" "VUS" "" "0000462408" "1" "50" "2" "238249551" "238249551" "subst" "4.48186E-5" "00430" "COL6A3_000130" "g.238249551C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340908C>T" "" "VUS" "" "0000462409" "1" "50" "2" "238277435" "238277435" "subst" "9.74635E-5" "00430" "COL6A3_000400" "g.238277435G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237368792G>A" "" "VUS" "" "0000462410" "1" "50" "2" "238303232" "238303232" "subst" "0" "00430" "COL6A3_000511" "g.238303232G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237394589G>A" "" "VUS" "" "0000462411" "1" "50" "2" "238289715" "238289715" "subst" "0" "00430" "COL6A3_000481" "g.238289715A>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381072A>C" "" "VUS" "" "0000462412" "1" "50" "2" "238253403" "238253403" "subst" "0.000834169" "00430" "COL6A3_000120" "g.238253403G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344760G>A" "" "VUS" "" "0000462413" "1" "50" "2" "238285418" "238285418" "subst" "1.22291E-5" "00430" "COL6A3_000442" "g.238285418G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237376775G>A" "" "VUS" "" "0000462414" "1" "50" "2" "238287288" "238287288" "subst" "8.12757E-6" "00430" "COL6A3_000457" "g.238287288C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378645C>T" "" "VUS" "" "0000462415" "1" "50" "2" "0" "0" "" "0" "00430" "COL6A3_000000" "g.?" "" "{PMID:Nallamilli 2018:30564623}" "" "1285G>A (E429K)" "no second variant" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000462416" "1" "50" "2" "238303389" "238303389" "subst" "2.03098E-5" "00430" "COL6A3_000513" "g.238303389C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237394746C>T" "" "VUS" "" "0000462417" "1" "90" "2" "238268783" "238268783" "subst" "0" "00430" "COL6A3_000157" "g.238268783C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237360140C>T" "" "pathogenic" "" "0000462418" "1" "50" "2" "238285961" "238285961" "subst" "0" "00430" "COL6A3_000455" "g.238285961A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237377318A>G" "" "VUS" "" "0000462419" "1" "50" "2" "238253835" "238253835" "subst" "0.000178869" "00430" "COL6A3_000213" "g.238253835C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237345192C>T" "" "VUS" "" "0000462420" "1" "50" "2" "238287426" "238287426" "subst" "1.62485E-5" "00430" "COL6A3_000459" "g.238287426C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378783C>T" "" "VUS" "" "0000462421" "1" "90" "2" "238270476" "238270476" "subst" "0" "00430" "COL6A3_000361" "g.238270476T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237361833T>C" "" "pathogenic" "" "0000462422" "1" "90" "2" "238253214" "238253214" "subst" "0.000629523" "00430" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237344571T>C" "" "pathogenic" "" "0000462423" "1" "50" "2" "238259793" "238259793" "subst" "0" "00430" "COL6A3_000337" "g.238259793T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237351150T>C" "" "VUS" "" "0000462424" "1" "50" "2" "238287332" "238287332" "subst" "6.49736E-5" "00430" "COL6A3_000458" "g.238287332G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378689G>T" "" "VUS" "" "0000462425" "1" "50" "2" "238277443" "238277443" "subst" "0.000121829" "00430" "COL6A3_000401" "g.238277443C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368800C>T" "" "VUS" "" "0000462426" "1" "50" "2" "238245045" "238245045" "subst" "0" "00430" "COL6A3_000281" "g.238245045T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336402T>C" "" "VUS" "" "0000462427" "1" "50" "2" "238296698" "238296698" "subst" "3.26145E-5" "00430" "COL6A3_000507" "g.238296698C>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237388055C>A" "" "VUS" "" "0000462428" "1" "50" "2" "238249680" "238249680" "subst" "0.000142723" "00430" "COL6A3_000303" "g.238249680C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237341037C>T" "" "VUS" "" "0000462429" "1" "50" "2" "238280389" "238280389" "subst" "4.56178E-5" "00430" "COL6A3_000406" "g.238280389C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237371746C>T" "" "VUS" "" "0000462430" "1" "70" "2" "238268775" "238268775" "subst" "0" "00430" "COL6A3_000353" "g.238268775C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237360132C>T" "" "likely pathogenic" "" "0000462431" "1" "50" "2" "238285533" "238285533" "subst" "0" "00430" "COL6A3_000446" "g.238285533C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237376890C>G" "" "VUS" "" "0000462432" "1" "50" "2" "238268806" "238268806" "subst" "4.0655E-6" "00430" "COL6A3_000099" "g.238268806T>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237360163T>C" "" "VUS" "" "0000462433" "1" "50" "2" "238249370" "238249370" "subst" "0.000967755" "00430" "COL6A3_000209" "g.238249370G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000462434" "1" "50" "2" "238283363" "238283363" "subst" "2.44302E-5" "00430" "COL6A3_000433" "g.238283363G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374720G>A" "" "VUS" "" "0000462435" "1" "50" "2" "238303478" "238303478" "subst" "4.06729E-5" "00430" "COL6A3_000516" "g.238303478G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237394835G>A" "" "VUS" "" "0000462436" "1" "50" "2" "238243318" "238243318" "subst" "1.62488E-5" "00430" "COL6A3_000269" "g.238243318G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237334675G>C" "" "VUS" "" "0000462437" "1" "50" "2" "238244819" "238244819" "subst" "2.05467E-5" "00430" "COL6A3_000276" "g.238244819G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336176G>A" "" "VUS" "" "0000462438" "1" "50" "2" "238280906" "238280906" "subst" "0.000130348" "00430" "COL6A3_000248" "g.238280906G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237372263G>A" "" "VUS" "" "0000462439" "1" "50" "2" "238261169" "238261169" "subst" "0.000103166" "00430" "COL6A3_000340" "g.238261169G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237352526G>A" "" "VUS" "" "0000462440" "1" "50" "2" "238259820" "238259820" "subst" "0.000113707" "00430" "COL6A3_000338" "g.238259820C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237351177C>T" "" "VUS" "" "0000462441" "1" "50" "2" "238249182" "238249182" "subst" "1.62433E-5" "00430" "COL6A3_000290" "g.238249182C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340539C>T" "" "VUS" "" "0000462442" "1" "50" "2" "238249123" "238249123" "subst" "2.84852E-5" "00430" "COL6A3_000288" "g.238249123G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237340480G>A" "" "VUS" "" "0000462443" "1" "50" "2" "238249370" "238249370" "subst" "0.000967755" "00430" "COL6A3_000209" "g.238249370G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000462444" "1" "50" "2" "238249550" "238249550" "subst" "0.000619135" "00430" "COL6A3_000169" "g.238249550G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340907G>A" "" "VUS" "" "0000462445" "1" "50" "2" "238277417" "238277417" "subst" "4.06098E-6" "00430" "COL6A3_000398" "g.238277417G>C" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237368774G>C" "" "VUS" "" "0000462446" "1" "70" "2" "238257296" "238257296" "subst" "0" "00430" "COL6A3_000334" "g.238257296C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237348653C>G" "" "likely pathogenic" "" "0000462447" "1" "70" "2" "238257296" "238257296" "subst" "0" "00430" "COL6A3_000334" "g.238257296C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237348653C>G" "" "likely pathogenic" "" "0000462448" "1" "50" "2" "238296735" "238296735" "subst" "1.63617E-5" "00430" "COL6A3_000508" "g.238296735G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237388092G>A" "" "VUS" "" "0000462449" "1" "50" "2" "238296735" "238296735" "subst" "1.63617E-5" "00430" "COL6A3_000508" "g.238296735G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237388092G>A" "" "VUS" "" "0000462450" "1" "50" "2" "238296735" "238296735" "subst" "1.63617E-5" "00430" "COL6A3_000508" "g.238296735G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237388092G>A" "" "VUS" "" "0000462451" "1" "50" "2" "238283070" "238283070" "subst" "0" "00430" "COL6A3_000423" "g.238283070G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374427G>A" "" "VUS" "" "0000462452" "1" "50" "2" "238277670" "238277670" "subst" "0.000134066" "00430" "COL6A3_000168" "g.238277670T>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237369027T>A" "" "VUS" "" "0000462453" "1" "50" "2" "238245168" "238245168" "subst" "0" "00430" "COL6A3_000285" "g.238245168G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336525G>T" "" "VUS" "" "0000462454" "1" "90" "2" "238277740" "238277740" "subst" "8.1722E-6" "00430" "COL6A3_000404" "g.238277740G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237369097G>A" "" "pathogenic" "" "0000462455" "1" "50" "2" "238296323" "238296323" "subst" "0.0001751" "00430" "COL6A3_000494" "g.238296323A>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237387680A>G" "" "VUS" "" "0000462456" "1" "50" "2" "238287747" "238287747" "subst" "0.000150338" "00430" "COL6A3_000472" "g.238287747G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237379104G>A" "" "VUS" "" "0000462457" "1" "50" "2" "238253396" "238253396" "subst" "8.46274E-6" "00430" "COL6A3_000324" "g.238253396C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344753C>T" "" "VUS" "" "0000462458" "1" "50" "2" "238280906" "238280906" "subst" "0.000130348" "00430" "COL6A3_000248" "g.238280906G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "" "Germline" "" "" "0" "" "" "g.237372263G>A" "" "VUS" "" "0000462459" "1" "50" "2" "238287471" "238287471" "subst" "0.000219345" "00430" "COL6A3_000462" "g.238287471C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237378828C>T" "" "VUS" "" "0000462460" "1" "50" "2" "238303472" "238303472" "subst" "1.21997E-5" "00430" "COL6A3_000515" "g.238303472T>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237394829T>G" "" "VUS" "" "0000462461" "1" "50" "2" "238289941" "238289941" "subst" "1.21841E-5" "00430" "COL6A3_000484" "g.238289941T>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381298T>A" "" "VUS" "" "0000462462" "1" "50" "2" "238283514" "238283514" "subst" "4.0814E-6" "00430" "COL6A3_000250" "g.238283514C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237374871C>T" "" "VUS" "" "0000462463" "1" "90" "2" "238243533" "238243533" "subst" "1.63054E-5" "00430" "COL6A3_000275" "g.238243533C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237334890C>G" "" "pathogenic" "" "0000462464" "1" "50" "2" "238243382" "238243382" "subst" "0.00017055" "00430" "COL6A3_000271" "g.238243382G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237334739G>A" "" "VUS" "" "0000462465" "1" "50" "2" "238250786" "238250786" "subst" "4.0621E-6" "00430" "COL6A3_000311" "g.238250786C>G" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237342143C>G" "" "VUS" "" "0000462466" "1" "50" "2" "238289941" "238289941" "subst" "1.21841E-5" "00430" "COL6A3_000484" "g.238289941T>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237381298T>A" "" "VUS" "" "0000462467" "1" "70" "2" "238269807" "238269807" "subst" "0" "00430" "COL6A3_000358" "g.238269807C>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237361164C>T" "" "likely pathogenic" "" "0000462468" "1" "50" "2" "238253054" "238253054" "subst" "2.43744E-5" "00430" "COL6A3_000312" "g.238253054G>A" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237344411G>A" "" "VUS" "" "0000462469" "1" "50" "2" "238245168" "238245168" "subst" "0" "00430" "COL6A3_000285" "g.238245168G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237336525G>T" "" "VUS" "" "0000462470" "1" "50" "2" "238249370" "238249370" "subst" "0.000967755" "00430" "COL6A3_000209" "g.238249370G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000462471" "1" "50" "2" "238249370" "238249370" "subst" "0.000967755" "00430" "COL6A3_000209" "g.238249370G>T" "" "{PMID:Nallamilli 2018:30564623}" "" "" "no second variant" "Germline" "" "" "0" "" "" "g.237340727G>T" "" "VUS" "" "0000515181" "0" "30" "2" "238234285" "238234285" "subst" "0.0135931" "01804" "COL6A3_000140" "g.238234285A>G" "" "" "" "COL6A3(NM_004369.3):c.9411T>C (p.(Cys3137=)), COL6A3(NM_004369.4):c.9411T>C (p.C3137=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237325642A>G" "" "likely benign" "" "0000515182" "0" "50" "2" "238234338" "238234338" "subst" "0" "01943" "COL6A3_000528" "g.238234338T>C" "" "" "" "COL6A3(NM_004369.3):c.9358A>G (p.T3120A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237325695T>C" "" "VUS" "" "0000515183" "0" "50" "2" "238234400" "238234400" "subst" "2.9211E-5" "02330" "COL6A3_000139" "g.238234400G>A" "" "" "" "COL6A3(NM_004369.4):c.9329-33C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237325757G>A" "" "VUS" "" "0000515184" "0" "30" "2" "238243429" "238243429" "subst" "0.00110457" "01804" "COL6A3_000136" "g.238243429G>A" "" "" "" "COL6A3(NM_004369.3):c.9069C>T (p.(Thr3023=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237334786G>A" "" "likely benign" "" "0000515185" "0" "30" "2" "238244921" "238244921" "subst" "0.00381934" "01804" "COL6A3_000021" "g.238244921G>A" "" "" "" "COL6A3(NM_004369.3):c.8822C>T (p.(Ala2941Val), p.A2941V), COL6A3(NM_004369.4):c.8822C>T (p.A2941V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237336278G>A" "" "likely benign" "" "0000515186" "0" "10" "2" "238244963" "238244963" "subst" "0.631261" "02330" "COL6A3_000041" "g.238244963A>G" "" "" "" "COL6A3(NM_004369.3):c.8780T>C (p.M2927T), COL6A3(NM_004369.4):c.8780T>C (p.M2927T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237336320A>G" "" "benign" "" "0000515187" "0" "10" "2" "238244963" "238244963" "subst" "0.631261" "02325" "COL6A3_000041" "g.238244963A>G" "" "" "" "COL6A3(NM_004369.3):c.8780T>C (p.M2927T), COL6A3(NM_004369.4):c.8780T>C (p.M2927T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237336320A>G" "" "benign" "" "0000515188" "0" "10" "2" "238244963" "238244963" "subst" "0.631261" "02326" "COL6A3_000041" "g.238244963A>G" "" "" "" "COL6A3(NM_004369.3):c.8780T>C (p.M2927T), COL6A3(NM_004369.4):c.8780T>C (p.M2927T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237336320A>G" "" "benign" "" "0000515189" "0" "30" "2" "238245008" "238245008" "subst" "0.00619882" "01804" "COL6A3_000529" "g.238245008G>A" "" "" "" "COL6A3(NM_004369.3):c.8735C>T (p.(Pro2912Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237336365G>A" "" "likely benign" "" "0000515190" "0" "50" "2" "238245107" "238245107" "subst" "0.000824312" "01943" "COL6A3_000284" "g.238245107G>A" "" "" "" "COL6A3(NM_004369.3):c.8636C>T (p.T2879M, p.(Thr2879Met)), COL6A3(NM_004369.4):c.8636C>T (p.T2879M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237336464G>A" "" "VUS" "" "0000515191" "0" "50" "2" "238245107" "238245107" "subst" "0.000824312" "01804" "COL6A3_000284" "g.238245107G>A" "" "" "" "COL6A3(NM_004369.3):c.8636C>T (p.T2879M, p.(Thr2879Met)), COL6A3(NM_004369.4):c.8636C>T (p.T2879M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237336464G>A" "" "VUS" "" "0000515193" "0" "10" "2" "238247734" "238247734" "subst" "0.0658182" "02327" "COL6A3_000040" "g.238247734C>G" "" "" "" "COL6A3(NM_004369.4):c.8491G>C (p.D2831H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237339091C>G" "" "benign" "" "0000515194" "0" "30" "2" "238249210" "238249210" "subst" "0" "01943" "COL6A3_000531" "g.238249210T>C" "" "" "" "COL6A3(NM_004369.3):c.8349A>G (p.V2783=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237340567T>C" "" "likely benign" "" "0000515195" "0" "50" "2" "238249251" "238249251" "subst" "4.06081E-6" "02327" "COL6A3_000294" "g.238249251C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237340608C>T" "" "VUS" "" "0000515196" "0" "50" "2" "238249316" "238249316" "subst" "0.000162472" "01804" "COL6A3_000295" "g.238249316G>A" "" "" "" "COL6A3(NM_004369.3):c.8243C>T (p.(Pro2748Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237340673G>A" "" "VUS" "" "0000515197" "0" "50" "2" "238249358" "238249358" "subst" "8.12883E-5" "01943" "COL6A3_000532" "g.238249358C>T" "" "" "" "COL6A3(NM_004369.3):c.8201G>A (p.R2734Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237340715C>T" "" "VUS" "" "0000515198" "0" "30" "2" "238249631" "238249631" "subst" "0.00186792" "01804" "COL6A3_000533" "g.238249631G>A" "" "" "" "COL6A3(NM_004369.3):c.7928C>T (p.(Ala2643Val), p.A2643V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237340988G>A" "" "likely benign" "" "0000515199" "0" "30" "2" "238250736" "238250736" "subst" "0" "01943" "COL6A3_000534" "g.238250736C>T" "" "" "" "COL6A3(NM_004369.3):c.7737G>A (p.E2579=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237342093C>T" "" "likely benign" "" "0000515200" "0" "50" "2" "238253094" "238253094" "subst" "0" "02327" "COL6A3_000535" "g.238253094A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237344451A>T" "" "VUS" "" "0000515202" "0" "30" "2" "238253305" "238253305" "subst" "1.22075E-5" "01804" "COL6A3_000537" "g.238253305G>C" "" "" "" "COL6A3(NM_004369.3):c.7356C>G (p.(Asn2452Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237344662G>C" "" "likely benign" "" "0000515203" "0" "50" "2" "238253437" "238253437" "subst" "8.24205E-6" "01804" "COL6A3_000538" "g.238253437G>C" "" "" "" "COL6A3(NM_004369.3):c.7224C>G (p.(Asp2408Glu)), COL6A3(NM_004369.4):c.7224C>G (p.D2408E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237344794G>C" "" "VUS" "" "0000515204" "0" "30" "2" "238253497" "238253497" "subst" "8.16753E-5" "01804" "COL6A3_000539" "g.238253497T>C" "" "" "" "COL6A3(NM_004369.3):c.7175-11A>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237344854T>C" "" "likely benign" "" "0000515205" "0" "50" "2" "238258801" "238258801" "subst" "0.000105597" "01943" "COL6A3_000215" "g.238258801G>A" "" "" "" "COL6A3(NM_004369.3):c.6868C>T (p.R2290C), COL6A3(NM_004369.4):c.6868C>T (p.(Arg2290Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237350158G>A" "" "VUS" "" "0000515207" "0" "30" "2" "238262021" "238262021" "subst" "0.0414876" "01804" "COL6A3_000109" "g.238262021G>A" "" "" "" "COL6A3(NM_004369.3):c.6653C>T (p.(Pro2218Leu)), COL6A3(NM_004369.4):c.6653C>T (p.P2218L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237353378G>A" "" "likely benign" "" "0000515209" "0" "10" "2" "238263593" "238263593" "subst" "0.00861744" "01804" "COL6A3_000542" "g.238263593T>A" "" "" "" "COL6A3(NM_004369.3):c.6592-16A>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237354950T>A" "" "benign" "" "0000515210" "0" "90" "2" "238267847" "238267847" "subst" "0" "02325" "COL6A3_000543" "g.238267847A>G" "" "" "" "COL6A3(NM_004369.4):c.6354+2T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237359204A>G" "" "pathogenic" "" "0000515211" "0" "50" "2" "238267872" "238267872" "subst" "4.06075E-6" "01943" "COL6A3_000544" "g.238267872G>C" "" "" "" "COL6A3(NM_004369.3):c.6331C>G (p.L2111V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237359229G>C" "" "VUS" "" "0000515212" "0" "50" "2" "238268789" "238268789" "subst" "7.31273E-5" "01804" "COL6A3_000148" "g.238268789G>A" "" "" "" "COL6A3(NM_004369.3):c.6224C>T (p.(Pro2075Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237360146G>A" "" "VUS" "" "0000515216" "0" "50" "2" "238274535" "238274539" "dup" "0" "02330" "COL6A3_000546" "g.238274535_238274539dup" "" "" "" "COL6A3(NM_004369.4):c.5641_5645dupCGCTC (p.P1883Afs*50)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237365892_237365896dup" "" "VUS" "" "0000515217" "0" "30" "2" "238274560" "238274560" "subst" "0.000585237" "01804" "COL6A3_000372" "g.238274560G>A" "" "" "" "COL6A3(NM_004369.3):c.5619C>T (p.(His1873=), p.H1873=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237365917G>A" "" "likely benign" "" "0000515219" "0" "30" "2" "238275436" "238275436" "subst" "0.000166487" "01943" "COL6A3_000548" "g.238275436G>A" "" "" "" "COL6A3(NM_004369.3):c.5394C>T (p.R1798=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237366793G>A" "" "likely benign" "" "0000515222" "0" "10" "2" "238277379" "238277379" "subst" "0.00999326" "02327" "COL6A3_000026" "g.238277379C>T" "" "" "" "COL6A3(NM_004369.3):c.4727G>A (p.(Arg1576Gln), p.R1576Q), COL6A3(NM_004369.4):c.4727G>A (p.R1576Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237368736C>T" "" "benign" "" "0000515223" "0" "50" "2" "238277596" "238277596" "subst" "0.000414277" "01943" "COL6A3_000402" "g.238277596G>A" "" "" "" "COL6A3(NM_004369.3):c.4510C>T (p.R1504W), COL6A3(NM_004369.4):c.4510C>T (p.(Arg1504Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237368953G>A" "" "VUS" "" "0000515224" "0" "50" "2" "238277602" "238277602" "subst" "2.03077E-5" "01804" "COL6A3_000188" "g.238277602C>T" "" "" "" "COL6A3(NM_004369.3):c.4504G>A (p.(Ala1502Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237368959C>T" "" "VUS" "" "0000515226" "0" "50" "2" "238277800" "238277800" "subst" "0" "02327" "COL6A3_000551" "g.238277800C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237369157C>G" "" "VUS" "" "0000515227" "0" "30" "2" "238280366" "238280366" "subst" "0.013894" "01804" "COL6A3_000082" "g.238280366C>T" "" "" "" "COL6A3(NM_004369.3):c.4285+9G>A (p.(=)), COL6A3(NM_057165.5):c.3676G>A (p.G1226R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237371723C>T" "" "likely benign" "" "0000515228" "0" "30" "2" "238280443" "238280443" "subst" "0.00051621" "01943" "COL6A3_000052" "g.238280443G>A" "" "" "" "COL6A3(NM_004369.3):c.4217C>T (p.T1406M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237371800G>A" "" "likely benign" "" "0000515230" "0" "50" "2" "238280539" "238280539" "subst" "0.000101593" "02327" "COL6A3_000411" "g.238280539T>A" "" "" "" "COL6A3(NM_004369.4):c.4121A>T (p.(Asp1374Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237371896T>A" "" "VUS" "" "0000515231" "0" "30" "2" "238280543" "238280543" "subst" "0.000605617" "01943" "COL6A3_000171" "g.238280543C>T" "" "" "" "COL6A3(NM_004369.3):c.4117G>A (p.A1373T, p.(Ala1373Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237371900C>T" "" "likely benign" "" "0000515232" "0" "50" "2" "238280557" "238280557" "subst" "0.000422616" "02327" "COL6A3_000227" "g.238280557G>A" "" "" "" "COL6A3(NM_004369.3):c.4103C>T (p.T1368M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237371914G>A" "" "VUS" "" "0000515234" "0" "30" "2" "238280706" "238280706" "subst" "0.000223883" "01943" "COL6A3_000080" "g.238280706G>A" "" "" "" "COL6A3(NM_004369.3):c.3954C>T (p.Y1318=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237372063G>A" "" "likely benign" "" "0000515236" "0" "30" "2" "238283288" "238283288" "subst" "0.000569036" "01943" "COL6A3_000430" "g.238283288C>T" "" "" "" "COL6A3(NM_004369.3):c.3446G>A (p.R1149Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237374645C>T" "" "likely benign" "" "0000515238" "0" "30" "2" "238283472" "238283472" "subst" "0.037234" "01804" "COL6A3_000078" "g.238283472T>G" "" "" "" "COL6A3(NM_004369.3):c.3262A>C (p.(Lys1088Gln)), COL6A3(NM_004369.4):c.3262A>C (p.K1088Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237374829T>G" "" "likely benign" "" "0000515241" "0" "50" "2" "238283646" "238283646" "subst" "0.000460579" "01943" "COL6A3_000232" "g.238283646C>T" "" "" "" "COL6A3(NM_004369.3):c.3088G>A (p.V1030M, p.(Val1030Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237375003C>T" "" "VUS" "" "0000515242" "0" "30" "2" "238283647" "238283647" "subst" "0.00354616" "01943" "COL6A3_000076" "g.238283647G>A" "" "" "" "COL6A3(NM_004369.3):c.3087C>T (p.D1029=, p.(Asp1029=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237375004G>A" "" "likely benign" "" "0000515243" "0" "30" "2" "238283647" "238283647" "subst" "0.00354616" "01804" "COL6A3_000076" "g.238283647G>A" "" "" "" "COL6A3(NM_004369.3):c.3087C>T (p.D1029=, p.(Asp1029=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237375004G>A" "" "likely benign" "" "0000515246" "0" "30" "2" "238289669" "238289669" "subst" "0.00469077" "01804" "COL6A3_000069" "g.238289669C>A" "" "" "" "COL6A3(NM_004369.3):c.1786G>T (p.(Ala596Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237381026C>A" "" "likely benign" "" "0000515247" "0" "30" "2" "238289817" "238289817" "subst" "0.0010119" "01804" "COL6A3_000068" "g.238289817G>A" "" "" "" "COL6A3(NM_004369.3):c.1638C>T (p.(Ala546=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237381174G>A" "" "likely benign" "" "0000515250" "0" "50" "2" "238296513" "238296513" "subst" "0.000801419" "02325" "COL6A3_000500" "g.238296513C>T" "" "" "" "COL6A3(NM_004369.3):c.1024G>A (p.V342M), COL6A3(NM_004369.4):c.1024G>A (p.V342M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237387870C>T" "" "VUS" "" "0000515252" "0" "30" "2" "238296807" "238296807" "subst" "0.000762509" "01804" "COL6A3_000059" "g.238296807T>C" "" "" "" "COL6A3(NM_004369.3):c.730A>G (p.I244V, p.(Ile244Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237388164T>C" "" "likely benign" "" "0000577978" "0" "50" "2" "238268789" "238268789" "subst" "7.31273E-5" "01164" "COL6A3_000148" "g.238268789G>A" "" "" "" "" "" "Germline" "" "rs113331139" "0" "" "" "g.237360146G>A" "" "VUS" "ACMG" "0000578288" "0" "70" "2" "238271967" "238271967" "subst" "1.21822E-5" "01164" "COL6A3_000243" "g.238271967G>A" "" "" "" "" "reported in Brinas 2010. Ann Neurol 68: 511" "Germline" "" "rs750471097" "0" "" "" "g.237363324G>A" "" "likely pathogenic" "ACMG" "0000578289" "0" "70" "2" "238253214" "238253214" "subst" "0.000629523" "01164" "COL6A3_000191" "g.238253214T>C" "" "" "" "" "ACMG grading: PM2,PM3,PP3,PP5; reported in Brinas 2010. Ann Neurol 68: 511; Hunter 2015. Mol Genet Genomic Med 4: 283-301" "Germline" "" "rs139260335" "0" "" "" "g.237344571T>C" "" "likely pathogenic" "ACMG" "0000578292" "0" "50" "2" "238285526" "238285526" "subst" "3.65453E-5" "01164" "COL6A3_000557" "g.238285526C>T" "" "" "" "" "" "Germline" "" "rs140437593" "0" "" "" "g.237376883C>T" "" "VUS" "ACMG" "0000597886" "0" "90" "2" "238267732" "238267732" "subst" "0" "00006" "COL6A3_000346" "g.238267732C>T" "" "{PMID:Cummings 2017:28424332}" "" "" "" "De novo" "" "" "0" "" "" "g.237359089C>T" "" "pathogenic (dominant)" "" "0000607823" "0" "50" "2" "238249370" "238249370" "subst" "0.000967755" "01804" "COL6A3_000209" "g.238249370G>T" "" "" "" "COL6A3(NM_004369.3):c.8189C>A (p.A2730D, p.(Ala2730Asp)), COL6A3(NM_004369.4):c.8189C>A (p.A2730D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237340727G>T" "" "VUS" "" "0000607824" "0" "50" "2" "238259816" "238259816" "subst" "0" "02327" "COL6A3_000558" "g.238259816C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237351173C>T" "" "VUS" "" "0000607827" "0" "30" "2" "238274359" "238274359" "subst" "0.000582893" "01943" "COL6A3_000545" "g.238274359G>A" "" "" "" "COL6A3(NM_004369.3):c.5820C>T (p.S1940=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237365716G>A" "" "likely benign" "" "0000607828" "0" "30" "2" "238285924" "238285924" "subst" "3.76717E-5" "01943" "COL6A3_000561" "g.238285924A>G" "" "" "" "COL6A3(NM_004369.3):c.2561T>C (p.V854A, p.(Val854Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237377281A>G" "" "likely benign" "" "0000607829" "0" "50" "2" "238287612" "238287612" "subst" "0" "01943" "COL6A3_000563" "g.238287612C>T" "" "" "" "COL6A3(NM_004369.3):c.2164G>A (p.A722T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237378969C>T" "" "VUS" "" "0000607830" "0" "30" "2" "238287746" "238287746" "subst" "0.00150325" "01804" "COL6A2_000000" "g.238287746C>T" "" "" "" "COL6A3(NM_004369.3):c.2030G>A (p.(Arg677His), p.R677H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237379103C>T" "" "likely benign" "" "0000607831" "0" "30" "2" "238296417" "238296417" "subst" "9.36986E-5" "02327" "COL6A3_000497" "g.238296417C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237387774C>T" "" "likely benign" "" "0000607832" "0" "30" "2" "238296780" "238296780" "subst" "0" "01804" "COL6A3_000565" "g.238296780T>C" "" "" "" "COL6A3(NM_004369.3):c.757A>G (p.(Thr253Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237388137T>C" "" "likely benign" "" "0000607833" "0" "30" "2" "238303654" "238303654" "subst" "4.06207E-5" "01943" "COL6A3_000566" "g.238303654C>T" "" "" "" "COL6A3(NM_004369.3):c.285G>A (p.T95=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237395011C>T" "" "likely benign" "" "0000620991" "0" "50" "2" "238280823" "238280823" "subst" "1.21948E-5" "01943" "COL6A3_000418" "g.238280823G>T" "" "" "" "COL6A3(NM_004369.3):c.3837C>A (p.D1279E, p.(Asp1279Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237372180G>T" "" "VUS" "" "0000620992" "0" "50" "2" "238283511" "238283511" "subst" "0.000465287" "01943" "COL6A3_000437" "g.238283511G>A" "" "" "" "COL6A3(NM_004369.3):c.3223C>T (p.R1075W), COL6A3(NM_004369.4):c.3223C>T (p.(Arg1075Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237374868G>A" "" "VUS" "" "0000620993" "0" "30" "2" "238287281" "238287281" "subst" "8.12955E-6" "01943" "COL6A3_000562" "g.238287281G>A" "" "" "" "COL6A3(NM_004369.3):c.2495C>T (p.P832L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237378638G>A" "" "likely benign" "" "0000620994" "0" "50" "2" "238289567" "238289567" "subst" "0" "01943" "COL6A3_000564" "g.238289567T>C" "" "" "" "COL6A3(NM_004369.3):c.1888A>G (p.T630A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237380924T>C" "" "VUS" "" "0000624867" "3" "50" "2" "238253214" "238253214" "subst" "0.000629523" "03524" "COL6A3_000191" "g.238253214T>C" "" "" "" "" "published in PMID:20576434, 28688748, 30706156, 26247046" "Germline" "" "rs139260335" "0" "" "" "g.237344571T>C" "" "VUS" "ACMG" "0000629457" "1" "90" "2" "238280504" "238280504" "subst" "0.0062857" "00006" "COL6A3_000005" "g.238280504C>T" "" "{PMID:Reddy 2017:27708273}" "" "" "" "Germline" "" "" "0" "" "" "g.237371861C>T" "" "pathogenic (dominant)" "" "0000629458" "0" "90" "2" "238268032" "238268032" "subst" "0" "00006" "COL6A3_000567" "g.238268032G>A" "" "{PMID:Reddy 2017:27708273}" "" "" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "De novo" "" "" "0" "" "" "g.237359389G>A" "" "pathogenic (dominant)" "" "0000629459" "0" "90" "2" "238270381" "238270381" "subst" "0" "00006" "COL6A3_000568" "g.238270381C>T" "" "{PMID:Reddy 2017:27708273}" "" "" "" "De novo" "" "" "0" "" "" "g.237361738C>T" "" "pathogenic (dominant)" "" "0000646771" "1" "70" "2" "238253397" "238253397" "subst" "4.22944E-6" "00006" "COL6A3_000570" "g.238253397G>A" "1/94 cases" "{PMID:Punetha 2016:27854218}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.237344754G>A" "" "likely pathogenic (recessive)" "" "0000646781" "1" "50" "2" "238287558" "238287558" "subst" "6.09399E-5" "00006" "COL6A3_000467" "g.238287558G>A" "1/94 cases" "{PMID:Punetha 2016:27854218}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.237378915G>A" "" "VUS" "" "0000646790" "1" "50" "2" "238249391" "238249391" "subst" "9.35233E-5" "00006" "COL6A3_000569" "g.238249391A>G" "1/94 cases" "{PMID:Punetha 2016:27854218}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.237340748A>G" "" "VUS" "" "0000646797" "1" "50" "2" "238280504" "238280504" "subst" "0.0062857" "00006" "COL6A3_000005" "g.238280504C>T" "1/94 cases" "{PMID:Punetha 2016:27854218}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.237371861C>T" "" "VUS" "" "0000646821" "0" "50" "2" "238280504" "238280504" "subst" "0.0062857" "00006" "COL6A3_000005" "g.238280504C>T" "1/94 cases" "{PMID:Punetha 2016:27854218}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.237371861C>T" "" "VUS" "" "0000650505" "1" "50" "2" "238249710" "238249710" "subst" "0.000203764" "03575" "COL6A3_000304" "g.238249710C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs138285547}" "Germline" "" "rs138285547" "0" "" "" "g.237341067C>T" "" "VUS" "" "0000650506" "1" "50" "2" "238258811" "238258811" "del" "0" "03575" "COL6A3_000571" "g.238258811del" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "no interpretation available; 1 heterozygous, no homozygous; {DB:CLININrs794729205}" "Germline" "" "rs794729205" "0" "" "" "g.237350168del" "" "VUS" "" "0000650507" "1" "10" "2" "238262021" "238262021" "subst" "0.0414876" "03575" "COL6A3_000109" "g.238262021G>A" "152/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "152 heterozygous; {DB:CLININrs36117715}" "Germline" "" "rs36117715" "0" "" "" "g.237353378G>A" "" "benign" "" "0000650508" "1" "90" "2" "238269763" "238269763" "subst" "0" "03575" "COL6A3_000012" "g.238269763C>T" "1/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs398124126}" "Germline" "" "rs398124126" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000650509" "1" "50" "2" "238280504" "238280504" "subst" "0.0062857" "03575" "COL6A3_000005" "g.238280504C>T" "26/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 26 heterozygous, no homozygous; {DB:CLININrs146092501}" "Germline" "" "rs146092501" "0" "" "" "g.237371861C>T" "" "VUS" "" "0000650510" "1" "30" "2" "238290066" "238290066" "subst" "0.0112668" "03575" "COL6A3_000022" "g.238290066G>A" "41/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "41 heterozygous, no homozygous; {DB:CLININrs112896869}" "Germline" "" "rs112896869" "0" "" "" "g.237381423G>A" "" "likely benign" "" "0000650511" "1" "30" "2" "238296769" "238296769" "subst" "0.0147315" "03575" "COL6A3_000060" "g.238296769G>A" "172/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "172 heterozygous; {DB:CLININrs79606264}" "Germline" "" "rs79606264" "0" "" "" "g.237388126G>A" "" "likely benign" "" "0000650512" "1" "70" "2" "238303764" "238303764" "subst" "5.32516E-5" "03575" "COL6A3_000057" "g.238303764G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs398124119}" "Germline" "" "rs398124119" "0" "" "" "g.237395121G>A" "" "likely pathogenic" "" "0000653036" "1" "30" "2" "238253016" "238253016" "subst" "0.00383687" "03575" "COL6A3_000124" "g.238253016G>A" "1/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs151079701}" "Germline" "" "rs151079701" "0" "" "" "g.237344373G>A" "" "likely benign" "" "0000653417" "0" "50" "2" "238275717" "238275717" "subst" "0" "01164" "COL6A3_000572" "g.238275717C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237367074C>A" "" "VUS" "ACMG" "0000654597" "0" "30" "2" "238303252" "238303252" "subst" "4.06279E-6" "01943" "COL6A3_000576" "g.238303252C>T" "" "" "" "COL6A3(NM_004369.3):c.687G>A (p.T229=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.237394609C>T" "" "likely benign" "" "0000660446" "0" "50" "2" "238280737" "238280737" "subst" "7.73181E-5" "01164" "COL6A3_000577" "g.238280737C>T" "" "" "" "" "ACMG grading: BP4,PM2" "Germline" "" "rs774461787" "0" "" "" "g.237372094C>T" "" "VUS" "ACMG" "0000660690" "0" "70" "2" "238243533" "238243533" "subst" "1.63054E-5" "01164" "COL6A3_000275" "g.238243533C>G" "" "" "" "" "Zech et al. 2015. Am J Hum Genet 4: 883-893" "Germline" "" "rs767517186" "0" "" "" "g.237334890C>G" "" "likely pathogenic" "" "0000669620" "3" "10" "2" "238262021" "238262021" "subst" "0.0414876" "03575" "COL6A3_000109" "g.238262021G>A" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 homozygous; {DB:CLININrs36117715}" "Germline" "" "rs36117715" "0" "" "" "g.237353378G>A" "" "benign" "" "0000669621" "3" "30" "2" "238296769" "238296769" "subst" "0.0147315" "03575" "COL6A3_000060" "g.238296769G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs79606264}" "Germline" "" "rs79606264" "0" "" "" "g.237388126G>A" "" "likely benign" "" "0000676562" "0" "30" "2" "238243281" "238243281" "subst" "0.000117827" "01943" "COL6A3_000578" "g.238243281T>C" "" "" "" "COL6A3(NM_004369.3):c.9217A>G (p.S3073G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000676563" "0" "30" "2" "238243453" "238243453" "subst" "0.000121858" "01943" "COL6A3_000579" "g.238243453G>A" "" "" "" "COL6A3(NM_004369.3):c.9045C>T (p.P3015=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000676564" "0" "30" "2" "238245019" "238245019" "subst" "0.000105581" "01943" "COL6A3_000206" "g.238245019G>A" "" "" "" "COL6A3(NM_004369.3):c.8724C>T (p.A2908=), COL6A3(NM_004369.4):c.8724C>T (p.A2908=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000676565" "0" "30" "2" "238268724" "238268724" "subst" "2.03178E-5" "01943" "COL6A3_000580" "g.238268724G>A" "" "" "" "COL6A3(NM_004369.3):c.6282+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000676566" "0" "30" "2" "238275771" "238275771" "subst" "0.00181586" "01804" "COL6A3_000581" "g.238275771G>A" "" "" "" "COL6A3(NM_004369.3):c.5059C>T (p.(Pro1687Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000676567" "0" "30" "2" "238277603" "238277603" "subst" "0.00034118" "01943" "COL6A3_000582" "g.238277603G>A" "" "" "" "COL6A3(NM_004369.3):c.4503C>T (p.D1501=, p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000676568" "0" "30" "2" "238289694" "238289694" "subst" "0.00128333" "01943" "COL6A3_000480" "g.238289694G>A" "" "" "" "COL6A3(NM_004369.3):c.1761C>T (p.A587=, p.(Ala587=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000676570" "0" "30" "2" "238296306" "238296306" "subst" "0.00401582" "01943" "COL6A3_000063" "g.238296306G>C" "" "" "" "COL6A3(NM_004369.3):c.1231C>G (p.L411V, p.(Leu411Val)), COL6A3(NM_004369.4):c.1231C>G (p.L411V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000676571" "0" "30" "2" "238296601" "238296601" "subst" "0.000158386" "01943" "COL6A3_000583" "g.238296601G>A" "" "" "" "COL6A3(NM_004369.3):c.936C>T (p.L312=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682861" "0" "50" "2" "238287470" "238287470" "subst" "4.46798E-5" "01164" "COL6A3_000461" "g.238287470G>A" "" "" "" "" "ACMG grading: PM2\r\n57y old patient with clinical suspicioun of Bethlem Myopathy" "Germline" "" "rs753966526" "0" "" "" "" "" "VUS" "ACMG" "0000688707" "0" "50" "2" "238280758" "238280758" "subst" "0.000256364" "01943" "COL6A3_000415" "g.238280758C>T" "" "" "" "COL6A3(NM_004369.3):c.3902G>A (p.R1301Q, p.(Arg1301Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000688708" "0" "50" "2" "238289767" "238289767" "subst" "0.00216865" "01943" "COL6A3_000143" "g.238289767T>C" "" "" "" "COL6A3(NM_004369.3):c.1688A>G (p.D563G, p.(Asp563Gly)), COL6A3(NM_004369.4):c.1688A>G (p.D563G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693857" "0" "50" "2" "238255190" "238255190" "subst" "0" "00006" "COL6A3_000584" "g.238255190C>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.237346547C>A" "" "VUS" "" "0000697437" "0" "70" "2" "238253214" "238253214" "subst" "0.000629523" "00006" "COL6A3_000191" "g.238253214T>C" "7/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.237344571T>C" "" "likely pathogenic" "" "0000697438" "0" "70" "2" "238277250" "238277250" "subst" "0" "00006" "COL6A3_000193" "g.238277250G>A" "2/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.237368607G>A" "" "likely pathogenic" "" "0000697439" "0" "70" "2" "238247656" "238247656" "subst" "0" "00006" "COL6A3_000190" "g.238247656A>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.237339013A>T" "" "likely pathogenic" "" "0000697440" "0" "70" "2" "238253152" "238253152" "subst" "0" "00006" "COL6A3_000189" "g.238253152C>A" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.237344509C>A" "" "likely pathogenic" "" "0000697441" "0" "70" "2" "238253331" "238253331" "subst" "4.08968E-6" "00006" "COL6A3_000585" "g.238253331G>A" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.237344688G>A" "" "likely pathogenic" "" "0000697442" "0" "70" "2" "238255201" "238255201" "subst" "8.12176E-6" "00006" "COL6A3_000196" "g.238255201G>A" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.237346558G>A" "" "likely pathogenic" "" "0000697443" "0" "70" "2" "238256455" "238256455" "subst" "0" "00006" "COL6A3_000002" "g.238256455G>A" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.237347812G>A" "" "likely pathogenic" "" "0000697444" "0" "70" "2" "238268793" "238268793" "subst" "0" "00006" "COL6A3_000195" "g.238268793C>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.237360150C>T" "" "likely pathogenic" "" "0000697445" "0" "70" "2" "238269775" "238269775" "subst" "0" "00006" "COL6A3_000166" "g.238269775C>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.237361132C>T" "" "likely pathogenic" "" "0000697446" "0" "70" "2" "238271966" "238271966" "subst" "4.06062E-6" "00006" "COL6A3_000192" "g.238271966C>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.237363323C>T" "" "likely pathogenic" "" "0000697447" "0" "70" "2" "238272009" "238272009" "subst" "4.06072E-6" "00006" "COL6A3_000586" "g.238272009G>A" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.237363366G>A" "" "likely pathogenic" "" "0000697448" "0" "70" "2" "238277602" "238277602" "subst" "2.03077E-5" "00006" "COL6A3_000188" "g.238277602C>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.237368959C>T" "" "likely pathogenic" "" "0000718631" "0" "30" "2" "238233443" "238233443" "subst" "4.9351E-5" "01943" "COL6A3_000261" "g.238233443C>T" "" "" "" "COL6A3(NM_004369.3):c.9508G>A (p.G3170R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000718632" "0" "50" "2" "238234241" "238234241" "subst" "0" "01943" "COL6A3_000587" "g.238234241A>T" "" "" "" "COL6A3(NM_004369.3):c.9455T>A (p.F3152Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718633" "0" "50" "2" "238242176" "238242176" "subst" "0.000832555" "01943" "COL6A3_000147" "g.238242176G>C" "" "" "" "COL6A3(NM_004369.3):c.9245C>G (p.P3082R, p.(Pro3082Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718634" "0" "50" "2" "238247694" "238247694" "subst" "4.06128E-6" "02329" "COL6A3_000530" "g.238247694G>T" "" "" "" "COL6A3(NM_004369.4):c.8531C>A (p.P2844H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718635" "0" "50" "2" "238249550" "238249550" "subst" "0.000619135" "01943" "COL6A3_000169" "g.238249550G>A" "" "" "" "COL6A3(NM_004369.3):c.8009C>T (p.A2670V), COL6A3(NM_004369.4):c.8009C>T (p.(Ala2670Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718636" "0" "30" "2" "238249780" "238249780" "subst" "0.000812132" "01943" "COL6A3_000128" "g.238249780G>A" "" "" "" "COL6A3(NM_004369.3):c.7779C>T (p.I2593=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000718637" "0" "50" "2" "238253214" "238253214" "subst" "0.000629523" "02329" "COL6A3_000191" "g.238253214T>C" "" "" "" "COL6A3(NM_004369.4):c.7447A>G (p.K2483E, p.(Lys2483Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718638" "0" "50" "2" "238253259" "238253259" "subst" "0.000125923" "02329" "COL6A3_000536" "g.238253259C>T" "" "" "" "COL6A3(NM_004369.4):c.7402G>A (p.V2468I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718639" "0" "50" "2" "238253492" "238253492" "subst" "0.000102141" "02329" "COL6A3_000574" "g.238253492G>C" "" "" "" "COL6A3(NM_004369.4):c.7175-6C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718640" "0" "70" "2" "238268775" "238268775" "subst" "0" "02327" "COL6A3_000353" "g.238268775C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000718641" "0" "50" "2" "238269784" "238269784" "subst" "4.06091E-6" "02329" "COL6A3_000560" "g.238269784G>A" "" "" "" "COL6A3(NM_004369.4):c.6190C>T (p.P2064S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718642" "0" "50" "2" "238273020" "238273020" "subst" "0" "02329" "COL6A3_000588" "g.238273020T>C" "" "" "" "COL6A3(NM_004369.4):c.5890A>G (p.R1964G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718643" "0" "30" "2" "238273074" "238273074" "subst" "0.00039012" "01943" "COL6A3_000161" "g.238273074G>A" "" "" "" "COL6A3(NM_004369.3):c.5839-3C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000718644" "0" "50" "2" "238274346" "238274346" "subst" "0.000240828" "02329" "COL6A3_000221" "g.238274346C>G" "" "" "" "COL6A3(NM_004369.3):c.5833G>C (p.V1945L), COL6A3(NM_004369.4):c.5833G>C (p.V1945L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718645" "0" "50" "2" "238274402" "238274402" "subst" "1.62499E-5" "02329" "COL6A3_000244" "g.238274402G>A" "" "" "" "COL6A3(NM_004369.4):c.5777C>T (p.T1926M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718646" "0" "70" "2" "238274535" "238274539" "dup" "0" "02329" "COL6A3_000546" "g.238274535_238274539dup" "" "" "" "COL6A3(NM_004369.4):c.5641_5645dupCGCTC (p.P1883Afs*50)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000718647" "0" "50" "2" "238275411" "238275411" "subst" "4.06065E-5" "01943" "COL6A3_000589" "g.238275411C>T" "" "" "" "COL6A3(NM_004369.3):c.5419G>A (p.E1807K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718648" "0" "50" "2" "238275456" "238275456" "subst" "1.21819E-5" "02329" "COL6A3_000549" "g.238275456T>C" "" "" "" "COL6A3(NM_004369.3):c.5374A>G (p.N1792D), COL6A3(NM_004369.4):c.5374A>G (p.N1792D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718649" "0" "70" "2" "238277317" "238277317" "subst" "8.1211E-6" "02329" "COL6A3_000550" "g.238277317G>A" "" "" "" "COL6A3(NM_004369.4):c.4789C>T (p.R1597*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000718650" "0" "50" "2" "238277670" "238277670" "subst" "0.000134066" "02329" "COL6A3_000168" "g.238277670T>A" "" "" "" "COL6A3(NM_004369.4):c.4436A>T (p.Q1479L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718651" "0" "30" "2" "238277707" "238277707" "subst" "0.000524932" "01943" "COL6A3_000007" "g.238277707T>C" "" "" "" "COL6A3(NM_004369.3):c.4399A>G (p.N1467D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000718652" "0" "30" "2" "238280504" "238280504" "subst" "0.0062857" "01943" "COL6A3_000005" "g.238280504C>T" "" "" "" "COL6A3(NM_004369.3):c.4156G>A (p.E1386K, p.(Glu1386Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000718653" "0" "50" "2" "238283174" "238283174" "subst" "4.06217E-6" "02329" "COL6A3_000552" "g.238283174G>A" "" "" "" "COL6A3(NM_004369.4):c.3560C>T (p.A1187V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718654" "0" "30" "2" "238283410" "238283410" "subst" "0.000195241" "01943" "COL6A3_000590" "g.238283410G>A" "" "" "" "COL6A3(NM_004369.3):c.3324C>T (p.T1108=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000718655" "0" "50" "2" "238283601" "238283601" "subst" "4.10256E-6" "02329" "COL6A3_000553" "g.238283601G>A" "" "" "" "COL6A3(NM_004369.4):c.3133C>T (p.P1045S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718656" "0" "90" "2" "238283613" "238283613" "del" "0" "02329" "COL6A3_000554" "g.238283613del" "" "" "" "COL6A3(NM_004369.4):c.3121delA (p.R1041Gfs*7)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000718657" "0" "30" "2" "238287631" "238287631" "subst" "2.84354E-5" "01943" "COL6A3_000591" "g.238287631C>A" "" "" "" "COL6A3(NM_004369.3):c.2145G>T (p.S715=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000718658" "0" "50" "2" "238289917" "238289917" "subst" "0.000381754" "01804" "COL6A3_000483" "g.238289917C>T" "" "" "" "COL6A3(NM_004369.3):c.1538G>A (p.R513Q, p.(Arg513Gln)), COL6A3(NM_004369.4):c.1538G>A (p.R513Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718659" "0" "50" "2" "238289926" "238289926" "subst" "1.21837E-5" "02329" "COL6A3_000555" "g.238289926G>A" "" "" "" "COL6A3(NM_004369.4):c.1529C>T (p.T510I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718660" "0" "50" "2" "238296513" "238296513" "subst" "0.000801419" "01943" "COL6A3_000500" "g.238296513C>T" "" "" "" "COL6A3(NM_004369.3):c.1024G>A (p.V342M), COL6A3(NM_004369.4):c.1024G>A (p.V342M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718661" "0" "30" "2" "238303450" "238303450" "subst" "0.00122759" "02326" "COL6A3_000514" "g.238303450C>T" "" "" "" "COL6A3(NM_004369.3):c.489G>A (p.A163=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000732720" "20" "50" "2" "238249550" "238249550" "subst" "0.000619135" "00454" "COL6A3_000169" "g.238249550G>A" "" "" "" "" "" "Germline" "" "rs142851023" "" "" "" "" "" "VUS" "" "0000765170" "0" "70" "2" "238269816" "238269816" "subst" "0" "00454" "COL6A3_000592" "g.238269816C>T" "" "Luce 2021, submitted" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000787248" "0" "50" "2" "238280960" "238280960" "subst" "4.98961E-5" "00006" "COL6A3_000594" "g.238280960C>T" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "rs747082651" "0" "" "" "g.237372317C>T" "" "VUS" "" "0000787249" "0" "50" "2" "238268789" "238268789" "subst" "0" "00006" "COL6A3_000593" "g.238268789G>T" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.237360146G>T" "" "VUS" "" "0000787462" "0" "50" "2" "238253286" "238253286" "subst" "5.28344E-5" "00000" "COL6A3_000322" "g.238253286G>A" "" "0" "" "" "" "Germline" "" "rs371066956" "0" "" "" "g.237344643G>A" "{CV-RCV:000653572.1}" "VUS" "" "0000800492" "0" "30" "2" "238244924" "238244924" "subst" "0.000178744" "01804" "COL6A3_000205" "g.238244924G>A" "" "" "" "COL6A3(NM_004369.3):c.8819C>T (p.(Thr2940Met)), COL6A3(NM_004369.4):c.8819C>T (p.T2940M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800493" "0" "30" "2" "238247774" "238247774" "del" "0" "01943" "COL6A3_000207" "g.238247774del" "" "" "" "COL6A3(NM_004369.3):c.8465-7delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800494" "0" "50" "2" "238249370" "238249370" "subst" "0.000967755" "02329" "COL6A3_000209" "g.238249370G>T" "" "" "" "COL6A3(NM_004369.3):c.8189C>A (p.A2730D, p.(Ala2730Asp)), COL6A3(NM_004369.4):c.8189C>A (p.A2730D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800495" "0" "50" "2" "238249514" "238249514" "subst" "4.06626E-6" "01943" "COL6A3_000595" "g.238249514G>A" "" "" "" "COL6A3(NM_004369.3):c.8045C>T (p.P2682L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800496" "0" "30" "2" "238255126" "238255126" "subst" "0.000223365" "01804" "COL6A3_000596" "g.238255126A>G" "" "" "" "COL6A3(NM_004369.3):c.7092+20T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800497" "0" "50" "2" "238261167" "238261167" "subst" "0.000314359" "01943" "COL6A3_000339" "g.238261167G>A" "" "" "" "COL6A3(NM_004369.3):c.6751C>T (p.R2251W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800498" "0" "30" "2" "238269764" "238269764" "subst" "0.000138092" "01943" "COL6A3_000597" "g.238269764G>A" "" "" "" "COL6A3(NM_004369.3):c.6210C>T (p.P2070=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800499" "0" "30" "2" "238280439" "238280439" "subst" "1.62586E-5" "01943" "COL6A3_000598" "g.238280439G>C" "" "" "" "COL6A3(NM_004369.3):c.4221C>G (p.P1407=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800500" "0" "30" "2" "238280514" "238280514" "subst" "0.000248062" "01943" "COL6A3_000599" "g.238280514C>T" "" "" "" "COL6A3(NM_004369.3):c.4146G>A (p.S1382=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800501" "0" "30" "2" "238280769" "238280769" "subst" "5.28644E-5" "01943" "COL6A3_000600" "g.238280769G>A" "" "" "" "COL6A3(NM_004369.3):c.3891C>T (p.N1297=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800502" "0" "30" "2" "238289832" "238289832" "subst" "0.000239785" "01943" "COL6A3_000235" "g.238289832G>A" "" "" "" "COL6A3(NM_004369.3):c.1623C>T (p.A541=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800503" "0" "50" "2" "238296649" "238296649" "subst" "4.06187E-6" "01943" "COL6A3_000601" "g.238296649C>G" "" "" "" "COL6A3(NM_004369.3):c.888G>C (p.L296F, p.(Leu296Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800504" "0" "50" "2" "238296716" "238296716" "subst" "4.0816E-6" "01943" "COL6A3_000602" "g.238296716A>T" "" "" "" "COL6A3(NM_004369.3):c.821T>A (p.I274N, p.(Ile274Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800505" "0" "50" "2" "238296810" "238296810" "subst" "0" "01943" "COL6A3_000603" "g.238296810T>C" "" "" "" "COL6A3(NM_004369.3):c.727A>G (p.I243V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800506" "0" "30" "2" "238303450" "238303450" "subst" "0.00122759" "01943" "COL6A3_000514" "g.238303450C>T" "" "" "" "COL6A3(NM_004369.3):c.489G>A (p.A163=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800507" "0" "70" "2" "238303764" "238303764" "subst" "5.32516E-5" "02329" "COL6A3_000057" "g.238303764G>A" "" "" "" "COL6A3(NM_004369.4):c.175C>T (p.R59*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000819214" "3" "50" "2" "238249256" "238249258" "del" "0" "00006" "COL6A3_000605" "g.238249256_238249258del" "" "{PMID:Chakravorty 2020:33250842}" "" "c.8301_8303delCTT (Y2767_F2768del)" "" "Germline" "" "" "0" "" "" "g.237340613_237340615del" "" "VUS" "ACMG" "0000819289" "0" "90" "2" "238274416" "238274416" "del" "0" "00006" "COL6A3_000604" "g.238274416del" "" "{PMID:Chakravorty 2020:33250842}" "" "5766delC" "" "Germline" "" "" "0" "" "" "g.237365773del" "" "pathogenic" "" "0000823841" "0" "70" "2" "238287746" "238287746" "subst" "0.00150325" "03501" "COL6A2_000000" "g.238287746C>T" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.237379103C>T" "" "likely pathogenic" "" "0000823901" "0" "50" "2" "238274354" "238274354" "subst" "0.000118313" "03501" "COL6A3_000366" "g.238274354G>A" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.237365711G>A" "" "VUS" "" "0000823913" "0" "70" "2" "238253061" "238253061" "subst" "0" "03501" "COL6A3_000606" "g.238253061A>C" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "Novel variant (2021)" "Germline/De novo (untested)" "" "" "0" "" "" "g.237344418A>C" "" "likely pathogenic" "" "0000823917" "0" "50" "2" "238277701" "238277701" "subst" "2.03407E-5" "03501" "COL6A3_000609" "g.238277701C>G" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "Novel variant (2021)" "Germline/De novo (untested)" "" "" "0" "" "" "g.237369058C>G" "" "VUS" "" "0000823934" "0" "70" "2" "238272991" "238272991" "subst" "4.06326E-6" "03501" "COL6A3_000608" "g.238272991A>G" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "Novel variant (2021)" "Germline/De novo (untested)" "" "" "0" "" "" "g.237364348A>G" "" "likely pathogenic" "" "0000823938" "0" "50" "2" "238274534" "238274534" "subst" "0.00011379" "03501" "COL6A3_000370" "g.238274534G>A" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.237365891G>A" "" "VUS" "" "0000823973" "0" "50" "2" "238280816" "238280816" "subst" "0.000199166" "03501" "COL6A3_000610" "g.238280816C>T" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.237372173C>T" "" "VUS" "" "0000823974" "0" "50" "2" "238267166" "238267166" "subst" "8.12209E-6" "03501" "COL6A3_000607" "g.238267166G>C" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.237358523G>C" "" "VUS" "" "0000829137" "0" "50" "2" "238280504" "238280504" "subst" "0.0062857" "00006" "COL6A3_000005" "g.238280504C>T" "" "{PMID:Macias 2021:34720847}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000829155" "0" "50" "2" "238280504" "238280504" "subst" "0.0062857" "00006" "COL6A3_000005" "g.238280504C>T" "" "{PMID:Macias 2021:34720847}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000831356" "0" "70" "2" "238277579" "238277587" "del" "0" "00006" "COL6A3_000616" "g.238277579_238277587del" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.237368936_237368944del" "" "likely pathogenic (dominant)" "" "0000831357" "21" "90" "2" "238269793" "238269793" "subst" "0" "00006" "COL6A3_000155" "g.238269793G>A" "" "{PMID:Fan 2018:29419890}" "" "" "" "Germline" "" "" "0" "" "" "g.237361150G>A" "" "pathogenic (recessive)" "" "0000831358" "0" "90" "2" "238269780" "238269780" "subst" "0" "00006" "COL6A3_000615" "g.238269780C>T" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.237361137C>T" "" "pathogenic (dominant)" "" "0000831359" "0" "90" "2" "238269763" "238269763" "subst" "0" "00006" "COL6A3_000012" "g.238269763C>T" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.237361120C>T" "" "pathogenic (dominant)" "" "0000831360" "0" "90" "2" "238269759" "238269759" "subst" "0" "00006" "COL6A3_000175" "g.238269759C>T" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.237361116C>T" "" "pathogenic (dominant)" "" "0000831361" "0" "90" "2" "238269759" "238269759" "subst" "0" "00006" "COL6A3_000175" "g.238269759C>T" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.237361116C>T" "" "pathogenic (dominant)" "" "0000831362" "0" "90" "2" "238268783" "238268783" "subst" "0" "00006" "COL6A3_000157" "g.238268783C>T" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.237360140C>T" "" "pathogenic (dominant)" "" "0000831363" "0" "90" "2" "238268775" "238268775" "subst" "0" "00006" "COL6A3_000183" "g.238268775C>A" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.237360132C>A" "" "pathogenic (dominant)" "" "0000831364" "0" "70" "2" "238268046" "238268046" "subst" "0" "00006" "COL6A3_000614" "g.238268046G>T" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.237359403G>T" "" "likely pathogenic (dominant)" "" "0000831365" "0" "70" "2" "238268032" "238268032" "subst" "0" "00006" "COL6A3_000612" "g.238268032C>T" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.237359389C>T" "" "likely pathogenic (dominant)" "" "0000831366" "0" "70" "2" "238268032" "238268032" "subst" "0" "00006" "COL6A3_000613" "g.238268032C>A" "" "{PMID:Fan 2018:29419890}" "" "" "" "De novo" "" "" "0" "" "" "g.237359389C>A" "" "likely pathogenic (dominant)" "" "0000831390" "21" "90" "2" "238244875" "238244877" "del" "0" "00006" "COL6A3_000043" "g.238244875_238244877del" "" "{PMID:Zhang 2014:24801232}, {PMID:Fan 2018:29419890}" "" "c.8877_8879delTGC" "" "Germline" "" "" "0" "" "" "g.237336232_237336234del" "" "pathogenic (recessive)" "" "0000831392" "11" "70" "2" "238247752" "238247753" "del" "0" "00006" "COL6A3_000611" "g.238247752_238247753del" "" "{PMID:Fan 2018:29419890}" "" "c.8472_8473delTG" "" "Germline" "" "" "0" "" "" "g.237339109_237339110del" "" "likely pathogenic (recessive)" "" "0000833084" "3" "70" "2" "238253214" "238253214" "subst" "0.000629523" "00006" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Gonzalez-Quereda 2020:32403337}" "" "" "" "Germline" "" "" "0" "" "" "g.237344571T>C" "" "likely pathogenic" "" "0000833097" "3" "70" "2" "238253214" "238253214" "subst" "0.000629523" "00006" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Gonzalez-Quereda 2020:32403337}" "" "" "" "Germline" "" "" "0" "" "" "g.237344571T>C" "" "likely pathogenic" "" "0000839162" "3" "90" "2" "238277207" "238277207" "del" "0" "01929" "COL6A3_000630" "g.238277207del" "" "{PMID:Cerino 2022:35741838}" "" "" "ACGM PVS1_strong, PM2, PS2, PM3, PP4_mod, PP5" "Germline" "" "" "0" "" "" "g.237368564del" "RCV001049713" "pathogenic (recessive)" "ACMG" "0000849799" "0" "30" "2" "238234209" "238234209" "subst" "4.06157E-6" "01943" "COL6A3_000618" "g.238234209C>T" "" "" "" "COL6A3(NM_004369.3):c.9487G>A (p.A3163T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000849800" "0" "30" "2" "238249631" "238249631" "subst" "0.00186792" "02326" "COL6A3_000533" "g.238249631G>A" "" "" "" "COL6A3(NM_004369.3):c.7928C>T (p.(Ala2643Val), p.A2643V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000849801" "0" "30" "2" "238283464" "238283464" "subst" "0.0016295" "01943" "COL6A3_000231" "g.238283464G>A" "" "" "" "COL6A3(NM_004369.3):c.3270C>T (p.D1090=), COL6A3(NM_004369.4):c.3270C>T (p.D1090=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000849802" "0" "50" "2" "238283510" "238283510" "subst" "0" "02329" "COL6A3_000626" "g.238283510C>T" "" "" "" "COL6A3(NM_004369.4):c.3224G>A (p.R1075Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000849803" "0" "50" "2" "238289917" "238289917" "subst" "0.000381754" "01943" "COL6A3_000483" "g.238289917C>T" "" "" "" "COL6A3(NM_004369.3):c.1538G>A (p.R513Q, p.(Arg513Gln)), COL6A3(NM_004369.4):c.1538G>A (p.R513Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000858414" "0" "30" "2" "238233467" "238233467" "subst" "0.000528345" "01804" "COL6A3_000262" "g.238233467G>A" "" "" "" "COL6A3(NM_004369.3):c.9494-10C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858415" "0" "30" "2" "238243369" "238243369" "subst" "0.0309244" "01804" "COL6A3_000138" "g.238243369G>A" "" "" "" "COL6A3(NM_004369.3):c.9129C>T (p.(=)), COL6A3(NM_004369.4):c.9129C>T (p.R3043=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858416" "0" "30" "2" "238243408" "238243408" "subst" "0" "01804" "COL6A3_000619" "g.238243408C>T" "" "" "" "COL6A3(NM_004369.3):c.9090G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858417" "0" "30" "2" "238243520" "238243520" "subst" "0.000285042" "01804" "COL6A3_000620" "g.238243520C>T" "" "" "" "COL6A3(NM_004369.3):c.8978G>A (p.(Arg2993His)), COL6A3(NM_004369.4):c.8978G>A (p.R2993H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858418" "0" "30" "2" "238249414" "238249414" "subst" "0.00483693" "01804" "COL6A3_000132" "g.238249414T>C" "" "" "" "COL6A3(NM_004369.3):c.8145A>G (p.(Leu2715=)), COL6A3(NM_004369.4):c.8145A>G (p.L2715=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858419" "0" "50" "2" "238249484" "238249484" "subst" "4.06276E-5" "01804" "COL6A3_000621" "g.238249484T>C" "" "" "" "COL6A3(NM_004369.3):c.8075A>G (p.(Tyr2692Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000858420" "0" "30" "2" "238249552" "238249552" "subst" "0.00032985" "01943" "COL6A3_000622" "g.238249552G>A" "" "" "" "COL6A3(NM_004369.3):c.8007C>T (p.H2669=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858421" "0" "30" "2" "238249564" "238249564" "subst" "0.00484445" "01804" "COL6A3_000129" "g.238249564T>G" "" "" "" "COL6A3(NM_004369.3):c.7995A>C (p.(Ala2665=)), COL6A3(NM_004369.4):c.7995A>C (p.A2665=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858422" "0" "50" "2" "238249656" "238249656" "subst" "4.07438E-6" "01943" "COL6A3_000623" "g.238249656A>G" "" "" "" "COL6A3(NM_004369.3):c.7903T>C (p.F2635L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000858423" "0" "10" "2" "238253152" "238253152" "subst" "0.0289343" "02326" "COL6A3_000034" "g.238253152C>T" "" "" "" "COL6A3(NM_004369.3):c.7509G>A (p.(Arg2503=), p.R2503=), COL6A3(NM_004369.4):c.7509G>A (p.R2503=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000858424" "0" "30" "2" "238253332" "238253332" "subst" "0.0318083" "01804" "COL6A3_000121" "g.238253332G>A" "" "" "" "COL6A3(NM_004369.3):c.7329C>T (p.(=)), COL6A3(NM_004369.4):c.7329C>T (p.A2443=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858425" "0" "70" "2" "238253397" "238253397" "subst" "4.22944E-6" "01804" "COL6A3_000570" "g.238253397G>A" "" "" "" "COL6A3(NM_004369.3):c.7264C>T (p.(Arg2422Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000858426" "0" "30" "2" "238255152" "238255152" "subst" "0.00520199" "01804" "COL6A3_000116" "g.238255152T>G" "" "" "" "COL6A3(NM_004369.3):c.7086A>C (p.(Gly2362=)), COL6A3(NM_004369.4):c.7086A>C (p.G2362=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858427" "0" "30" "2" "238256498" "238256498" "subst" "0.00482132" "01804" "COL6A3_000115" "g.238256498T>C" "" "" "" "COL6A3(NM_004369.3):c.6981A>G (p.(Glu2327=)), COL6A3(NM_004369.4):c.6981A>G (p.E2327=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858428" "0" "90" "2" "238269763" "238269763" "subst" "0" "01804" "COL6A3_000241" "g.238269763C>A" "" "" "" "COL6A3(NM_004369.3):c.6210+1G>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000858429" "0" "30" "2" "238275456" "238275456" "subst" "1.21819E-5" "01943" "COL6A3_000549" "g.238275456T>C" "" "" "" "COL6A3(NM_004369.3):c.5374A>G (p.N1792D), COL6A3(NM_004369.4):c.5374A>G (p.N1792D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858430" "0" "50" "2" "238275618" "238275618" "subst" "0" "01804" "COL6A3_000624" "g.238275618G>A" "" "" "" "COL6A3(NM_004369.3):c.5212C>T (p.(Arg1738Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000858431" "0" "50" "2" "238275810" "238275810" "subst" "0.000150421" "01943" "COL6A3_000008" "g.238275810C>T" "" "" "" "COL6A3(NM_004369.3):c.5020G>A (p.D1674N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000858432" "0" "30" "2" "238277613" "238277613" "subst" "1.62467E-5" "01804" "COL6A3_000625" "g.238277613G>A" "" "" "" "COL6A3(NM_004369.3):c.4493C>T (p.(Pro1498Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858433" "0" "30" "2" "238280476" "238280476" "subst" "0.00989733" "01804" "COL6A3_000006" "g.238280476C>T" "" "" "" "COL6A3(NM_004369.3):c.4184G>A (p.(Arg1395Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858434" "0" "30" "2" "238280504" "238280504" "subst" "0.0062857" "01804" "COL6A3_000005" "g.238280504C>T" "" "" "" "COL6A3(NM_004369.3):c.4156G>A (p.E1386K, p.(Glu1386Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858435" "0" "30" "2" "238280737" "238280737" "subst" "7.73181E-5" "01943" "COL6A3_000577" "g.238280737C>T" "" "" "" "COL6A3(NM_004369.3):c.3923G>A (p.R1308Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858436" "0" "30" "2" "238280984" "238280984" "subst" "0.000147339" "01804" "COL6A3_000422" "g.238280984C>T" "" "" "" "COL6A3(NM_004369.3):c.3680-4G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858437" "0" "30" "2" "238283679" "238283679" "subst" "0.0046851" "01804" "COL6A3_000075" "g.238283679C>T" "" "" "" "COL6A3(NM_004369.3):c.3071-16G>A (p.(=)), COL6A3(NM_004369.4):c.3071-16G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858438" "0" "30" "2" "238296762" "238296762" "subst" "0.000188693" "01943" "COL6A3_000627" "g.238296762C>T" "" "" "" "COL6A3(NM_004369.3):c.775G>A (p.A259T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858439" "0" "10" "2" "238296769" "238296769" "subst" "0.0147315" "01804" "COL6A3_000060" "g.238296769G>A" "" "" "" "COL6A3(NM_004369.3):c.768C>T (p.(Val256=)), COL6A3(NM_004369.4):c.768C>T (p.V256=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000858440" "0" "30" "2" "238303314" "238303314" "subst" "2.43698E-5" "01943" "COL6A3_000628" "g.238303314T>C" "" "" "" "COL6A3(NM_004369.3):c.625A>G (p.I209V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858441" "0" "30" "2" "238303403" "238303403" "subst" "0" "01804" "COL6A3_000629" "g.238303403T>C" "" "" "" "COL6A3(NM_004369.3):c.536A>G (p.(Asp179Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000874592" "0" "70" "2" "238274654" "238274654" "subst" "0" "03779" "COL6A3_000376" "g.238274654C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs886042678" "0" "" "" "" "" "likely pathogenic" "" "0000885025" "0" "70" "2" "238243533" "238243533" "subst" "1.63054E-5" "02329" "COL6A3_000275" "g.238243533C>G" "" "" "" "COL6A3(NM_004369.4):c.8966-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000885026" "0" "30" "2" "238245107" "238245107" "subst" "0.000824312" "02326" "COL6A3_000284" "g.238245107G>A" "" "" "" "COL6A3(NM_004369.3):c.8636C>T (p.T2879M, p.(Thr2879Met)), COL6A3(NM_004369.4):c.8636C>T (p.T2879M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885027" "0" "50" "2" "238249596" "238249596" "subst" "4.87975E-5" "02329" "COL6A3_000631" "g.238249596G>C" "" "" "" "COL6A3(NM_004369.4):c.7963C>G (p.P2655A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000885028" "0" "10" "2" "238250839" "238250839" "subst" "0.0674127" "02326" "COL6A3_000126" "g.238250839G>A" "" "" "" "COL6A3(NM_004369.3):c.7669-35C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000885029" "0" "50" "2" "238253403" "238253403" "subst" "0.000834169" "02325" "COL6A3_000120" "g.238253403G>A" "" "" "" "COL6A3(NM_004369.3):c.7258C>T (p.(Arg2420Trp)), COL6A3(NM_004369.4):c.7258C>T (p.R2420W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000885030" "0" "50" "2" "238256488" "238256488" "subst" "0" "02329" "COL6A3_000632" "g.238256488T>G" "" "" "" "COL6A3(NM_004369.4):c.6991A>C (p.N2331H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000885032" "0" "10" "2" "238271890" "238271890" "dup" "0" "02326" "COL6A3_000093" "g.238271890dup" "" "" "" "COL6A3(NM_004369.3):c.6063+13dupT, COL6A3(NM_004369.4):c.6063+13dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000885033" "0" "30" "2" "238274560" "238274560" "subst" "0.000585237" "02326" "COL6A3_000372" "g.238274560G>A" "" "" "" "COL6A3(NM_004369.3):c.5619C>T (p.(His1873=), p.H1873=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885034" "0" "10" "2" "238274828" "238274828" "subst" "0" "02326" "COL6A3_000633" "g.238274828C>A" "" "" "" "COL6A3(NM_004369.3):c.5501-150G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000885035" "0" "30" "2" "238275730" "238275730" "subst" "0.00484613" "01804" "COL6A3_000088" "g.238275730C>T" "" "" "" "COL6A3(NM_004369.3):c.5100G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885036" "0" "30" "2" "238277603" "238277603" "subst" "0.00034118" "01804" "COL6A3_000582" "g.238277603G>A" "" "" "" "COL6A3(NM_004369.3):c.4503C>T (p.D1501=, p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885037" "0" "30" "2" "238277794" "238277794" "subst" "0" "01804" "COL6A3_000634" "g.238277794C>T" "" "" "" "COL6A3(NM_004369.3):c.4312G>A (p.(Val1438Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885038" "0" "30" "2" "238280491" "238280491" "subst" "0.000260446" "01804" "COL6A3_000170" "g.238280491G>A" "" "" "" "COL6A3(NM_004369.3):c.4169C>T (p.(Ser1390Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885039" "0" "30" "2" "238280557" "238280557" "subst" "0.000422616" "02326" "COL6A3_000227" "g.238280557G>A" "" "" "" "COL6A3(NM_004369.3):c.4103C>T (p.T1368M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885040" "0" "50" "2" "238283315" "238283315" "subst" "0.000447402" "01804" "COL6A3_000432" "g.238283315G>A" "" "" "" "COL6A3(NM_004369.3):c.3419C>T (p.(Thr1140Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000885041" "0" "50" "2" "238283544" "238283544" "subst" "0.000143244" "01804" "COL6A3_000635" "g.238283544G>A" "" "" "" "COL6A3(NM_004369.3):c.3190C>T (p.(Arg1064Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000885043" "0" "30" "2" "238287805" "238287805" "subst" "1.2256E-5" "02326" "COL6A3_000637" "g.238287805A>G" "" "" "" "COL6A3(NM_004369.3):c.1971T>C (p.Y657=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885044" "0" "30" "2" "238289767" "238289767" "subst" "0.00216865" "02326" "COL6A3_000143" "g.238289767T>C" "" "" "" "COL6A3(NM_004369.3):c.1688A>G (p.D563G, p.(Asp563Gly)), COL6A3(NM_004369.4):c.1688A>G (p.D563G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000885045" "0" "50" "2" "238289918" "238289918" "subst" "1.21841E-5" "02325" "COL6A3_000638" "g.238289918G>C" "" "" "" "COL6A3(NM_004369.4):c.1537C>G (p.R513G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000885046" "0" "10" "2" "238290159" "238290159" "subst" "0.00618378" "01804" "COL6A3_000065" "g.238290159T>C" "" "" "" "COL6A3(NM_004369.3):c.1313-17A>G (p.(=)), COL6A3(NM_004369.4):c.1313-17A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000885047" "0" "10" "2" "238296306" "238296306" "subst" "0.00401582" "01804" "COL6A3_000063" "g.238296306G>C" "" "" "" "COL6A3(NM_004369.3):c.1231C>G (p.L411V, p.(Leu411Val)), COL6A3(NM_004369.4):c.1231C>G (p.L411V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000885048" "0" "50" "2" "238296649" "238296649" "subst" "4.06187E-6" "01804" "COL6A3_000601" "g.238296649C>G" "" "" "" "COL6A3(NM_004369.3):c.888G>C (p.L296F, p.(Leu296Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000885049" "0" "50" "2" "238296716" "238296716" "subst" "4.0816E-6" "01804" "COL6A3_000602" "g.238296716A>T" "" "" "" "COL6A3(NM_004369.3):c.821T>A (p.I274N, p.(Ile274Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000885050" "0" "50" "2" "238303389" "238303389" "subst" "2.03098E-5" "02329" "COL6A3_000513" "g.238303389C>T" "" "" "" "COL6A3(NM_004369.4):c.550G>A (p.A184T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000885051" "0" "50" "2" "238303472" "238303472" "subst" "0" "02329" "COL6A3_000639" "g.238303472T>C" "" "" "" "COL6A3(NM_004369.4):c.467A>G (p.D156G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000885052" "0" "10" "2" "238303906" "238303906" "subst" "0" "02326" "COL6A3_000640" "g.238303906A>G" "" "" "" "COL6A3(NM_004369.3):c.92-59T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000905248" "0" "70" "2" "238269816" "238269816" "subst" "0" "03652" "COL6A3_000592" "g.238269816C>T" "" "" "" "" "" "De novo" "-" "" "0" "" "" "g.237361173C>T" "" "pathogenic" "ACMG" "0000909545" "1" "90" "2" "238268021" "238268021" "subst" "0" "04448" "COL6A3_000154" "g.238268021C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.237359378C>A" "" "likely pathogenic" "ACMG" "0000909546" "0" "90" "2" "238269763" "238269763" "subst" "0" "04448" "COL6A3_000241" "g.238269763C>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.237361120C>A" "" "pathogenic (dominant)" "ACMG" "0000909547" "0" "90" "2" "238268006" "238268006" "subst" "0" "04448" "COL6A3_000641" "g.238268006T>C" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.237359363T>C" "" "pathogenic (dominant)" "ACMG" "0000911638" "0" "30" "2" "238243486" "238243486" "subst" "0.000369819" "01804" "COL6A3_000203" "g.238243486G>A" "" "" "" "COL6A3(NM_004369.3):c.9012C>T (p.(=)), COL6A3(NM_004369.4):c.9012C>T (p.S3004=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000911639" "0" "50" "2" "238249270" "238249270" "subst" "2.03051E-5" "02329" "COL6A3_000642" "g.238249270T>G" "" "" "" "COL6A3(NM_004369.4):c.8289A>C (p.K2763N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000911640" "0" "50" "2" "238249391" "238249391" "subst" "9.35233E-5" "01804" "COL6A3_000569" "g.238249391A>G" "" "" "" "COL6A3(NM_004369.3):c.8168T>C (p.(Ile2723Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000911641" "0" "50" "2" "238250791" "238250791" "subst" "4.06286E-6" "01804" "COL6A3_000643" "g.238250791G>A" "" "" "" "COL6A3(NM_004369.3):c.7682C>T (p.(Ala2561Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000911642" "0" "50" "2" "238253403" "238253403" "subst" "0.000834169" "01804" "COL6A3_000120" "g.238253403G>A" "" "" "" "COL6A3(NM_004369.3):c.7258C>T (p.(Arg2420Trp)), COL6A3(NM_004369.4):c.7258C>T (p.R2420W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000911643" "0" "10" "2" "238280504" "238280504" "subst" "0.0062857" "02326" "COL6A3_000005" "g.238280504C>T" "" "" "" "COL6A3(NM_004369.3):c.4156G>A (p.E1386K, p.(Glu1386Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000911644" "0" "50" "2" "238296323" "238296323" "subst" "0.0001751" "02329" "COL6A3_000494" "g.238296323A>G" "" "" "" "COL6A3(NM_004369.4):c.1214T>C (p.F405S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000923658" "0" "50" "2" "238245107" "238245107" "subst" "0.000824312" "02325" "COL6A3_000284" "g.238245107G>A" "" "" "" "COL6A3(NM_004369.3):c.8636C>T (p.T2879M, p.(Thr2879Met)), COL6A3(NM_004369.4):c.8636C>T (p.T2879M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000923659" "0" "50" "2" "238253437" "238253437" "subst" "8.24205E-6" "02325" "COL6A3_000538" "g.238253437G>C" "" "" "" "COL6A3(NM_004369.3):c.7224C>G (p.(Asp2408Glu)), COL6A3(NM_004369.4):c.7224C>G (p.D2408E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000923660" "0" "50" "2" "238289767" "238289767" "subst" "0.00216865" "02325" "COL6A3_000143" "g.238289767T>C" "" "" "" "COL6A3(NM_004369.3):c.1688A>G (p.D563G, p.(Asp563Gly)), COL6A3(NM_004369.4):c.1688A>G (p.D563G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000923661" "0" "90" "2" "238296777" "238296777" "del" "0" "02325" "COL6A3_000509" "g.238296777del" "" "" "" "COL6A3(NM_004369.4):c.761del (p.(Gly254GlufsTer13)), COL6A3(NM_004369.4):c.761delG (p.G254Efs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000928564" "0" "30" "2" "238249101" "238249101" "subst" "0.000658643" "02326" "COL6A3_000644" "g.238249101C>T" "" "" "" "COL6A3(NM_004369.3):c.8458G>A (p.V2820I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000928565" "0" "70" "2" "238270381" "238270381" "subst" "0" "02327" "COL6A3_000568" "g.238270381C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000928566" "0" "50" "2" "238275681" "238275681" "subst" "8.12381E-6" "02329" "COL6A3_000645" "g.238275681C>T" "" "" "" "COL6A3(NM_004369.3):c.5149G>A (p.(Ala1717Thr)), COL6A3(NM_004369.4):c.5149G>A (p.A1717T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000943932" "0" "50" "2" "238272028" "238272028" "subst" "0" "03779" "COL6A3_000646" "g.238272028C>G" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" "" "0000945955" "1" "50" "2" "238253214" "238253214" "subst" "0.000629523" "00006" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Panades de Oliveira 2019:30706156}" "" "" "ACMG PP3" "Germline" "" "" "0" "" "" "g.237344571T>C" "" "VUS" "ACMG" "0000945956" "3" "50" "2" "238253214" "238253214" "subst" "0.000629523" "00006" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Panades de Oliveira 2019:30706156}" "" "" "ACMG PP1/PP3" "Germline" "" "" "0" "" "" "g.237344571T>C" "" "VUS" "ACMG" "0000945957" "3" "50" "2" "238253214" "238253214" "subst" "0.000629523" "00006" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Panades de Oliveira 2019:30706156}" "" "" "ACMG PP1/PP3" "Germline" "" "" "0" "" "" "g.237344571T>C" "" "VUS" "ACMG" "0000945958" "2" "50" "2" "238267883" "238267885" "del" "0" "00006" "COL6A3_000648" "g.238267883_238267885del" "" "{PMID:Panades de Oliveira 2019:30706156}" "" "" "ACMG PP1, PM2, PM4" "Germline" "" "" "0" "" "" "g.237359240_237359242del" "" "VUS" "ACMG" "0000945959" "2" "50" "2" "238267883" "238267885" "del" "0" "00006" "COL6A3_000648" "g.238267883_238267885del" "" "{PMID:Panades de Oliveira 2019:30706156}" "" "" "ACMG PP1, PM2, PM4" "Germline" "" "" "0" "" "" "g.237359240_237359242del" "" "VUS" "ACMG" "0000945960" "2" "50" "2" "238267883" "238267885" "del" "0" "00006" "COL6A3_000648" "g.238267883_238267885del" "" "{PMID:Panades de Oliveira 2019:30706156}" "" "" "ACMG PP1, PM2, PM4" "Germline" "" "" "0" "" "" "g.237359240_237359242del" "" "VUS" "ACMG" "0000945961" "3" "50" "2" "238253214" "238253214" "subst" "0.000629523" "00006" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Panades de Oliveira 2019:30706156}" "" "" "ACMG PP3" "Germline" "" "" "0" "" "" "g.237344571T>C" "" "VUS" "ACMG" "0000945962" "1" "70" "2" "238247686" "238247686" "del" "0" "00006" "COL6A3_000647" "g.238247686del" "" "{PMID:Panades de Oliveira 2019:30706156}" "" "8540_8540delA" "ACMG PVS1, PM2" "Germline" "" "" "0" "" "" "g.237339043del" "" "likely pathogenic" "ACMG" "0000945992" "0" "90" "2" "238269763" "238269763" "subst" "0" "00006" "COL6A3_000012" "g.238269763C>T" "" "{PMID:Westra 2019:31127727}" "" "" "" "De novo" "" "" "0" "" "" "g.237361120C>T" "" "pathogenic (dominant)" "" "0000945993" "21" "90" "2" "238270408" "238270408" "subst" "0" "00006" "COL6A3_000649" "g.238270408C>T" "" "{PMID:Westra 2019:31127727}" "" "" "" "Germline" "" "" "0" "" "" "g.237361765C>T" "" "pathogenic (dominant)" "" "0000945994" "0" "90" "2" "238275521" "238275521" "subst" "4.06068E-6" "00006" "COL6A3_000246" "g.238275521C>A" "" "{PMID:Westra 2019:31127727}" "" "" "" "De novo" "" "" "0" "" "" "g.237366878C>A" "" "pathogenic (dominant)" "" "0000946064" "11" "50" "2" "238305447" "238305447" "subst" "0.000117788" "00006" "COL6A3_000253" "g.238305447C>T" "" "{PMID:Westra 2019:31127727}" "" "" "no variant 2nd chromosome; present in healthy father" "Germline" "" "" "0" "" "" "g.237396804C>T" "" "VUS" "" "0000946085" "0" "50" "2" "238261166" "238261166" "subst" "0" "00006" "COL6A3_000239" "g.238261166C>T" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.237352523C>T" "" "VUS" "" "0000946110" "0" "50" "2" "238257288" "238257288" "subst" "6.502E-5" "00006" "COL6A3_000214" "g.238257288C>T" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.237348645C>T" "" "VUS" "" "0000946111" "0" "50" "2" "238283435" "238283443" "del" "0" "00006" "COL6A3_000249" "g.238283435_238283443del" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.237374792_237374800del" "" "VUS" "" "0000946124" "0" "50" "2" "238269775" "238269775" "subst" "0" "00006" "COL6A3_000166" "g.238269775C>T" "" "{PMID:Westra 2019:31127727}" "" "" "present in mother with limb girdle muscle dystrophy; CACNA1S does not explain clinics" "Germline/De novo (untested)" "" "" "0" "" "" "g.237361132C>T" "" "VUS" "" "0000947798" "0" "30" "2" "238244921" "238244921" "subst" "0.00381934" "02326" "COL6A3_000021" "g.238244921G>A" "" "" "" "COL6A3(NM_004369.3):c.8822C>T (p.(Ala2941Val), p.A2941V), COL6A3(NM_004369.4):c.8822C>T (p.A2941V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000947799" "0" "30" "2" "238296513" "238296513" "subst" "0.000801419" "02326" "COL6A3_000500" "g.238296513C>T" "" "" "" "COL6A3(NM_004369.3):c.1024G>A (p.V342M), COL6A3(NM_004369.4):c.1024G>A (p.V342M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000952258" "0" "90" "2" "238267847" "238267847" "subst" "0" "00006" "COL6A3_000543" "g.238267847A>G" "" "{PMID:Imafidon 2021:34136434}" "" "" "" "De novo" "" "" "0" "" "" "g.237359204A>G" "" "pathogenic" "" "0000952593" "1" "90" "2" "238280702" "238280705" "dup" "0" "00006" "COL6A3_000650" "g.238280702_238280705dup" "" "{PMID:Sarker 2023:38057384}" "" "3958_3959insGTGT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.237372059_237372062dup" "" "pathogenic" "" "0000952600" "1" "90" "2" "238269763" "238269763" "subst" "0" "00006" "COL6A3_000012" "g.238269763C>T" "" "{PMID:Sarker 2023:38057384}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.237361120C>T" "" "pathogenic" "" "0000954932" "2" "70" "2" "238253214" "238253214" "subst" "0.000629523" "04618" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PM3_strong, PP1_mod, PP3\r\nPMID: 26247046, 30706156 ,33749658, 33596003, 32448721, 33749658, 26247046, 30706156, 32403337" "Germline" "?" "" "0" "" "" "g.237344571T>C" "" "likely pathogenic (recessive)" "ACMG" "0000954933" "1" "70" "2" "238234368" "238234368" "subst" "0" "04618" "COL6A3_000651" "g.238234368C>A" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PVS1_strong, PM3, PM2_sup, PP\r\nPMID 433749658" "Germline" "?" "" "0" "" "" "g.237325725C>A" "" "likely pathogenic (recessive)" "ACMG" "0000954944" "0" "70" "2" "238253214" "238253214" "subst" "0.000629523" "04618" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Morel 2023:38155714}, {DOI:Morel 2023:10.3389/fgene.2023.1242277}" "" "" "ACMG PM3_strong, PP1_mod, PP3; PMID:33749658" "Germline" "yes" "" "0" "" "" "g.237344571T>C" "" "likely pathogenic (recessive)" "ACMG" "0000959854" "3" "50" "2" "238277211" "238277211" "subst" "0.0102198" "00006" "COL6A3_000087" "g.238277211C>T" "" "{PMID:Chia 2018:29784083}" "" "" "" "Germline" "" "" "0" "" "" "g.237368568C>T" "" "likely benign" "" "0000959927" "3" "50" "2" "238277211" "238277211" "subst" "0.0102198" "00006" "COL6A3_000087" "g.238277211C>T" "" "{PMID:Chia 2018:29784083}" "" "" "" "Germline" "" "" "0" "" "" "g.237368568C>T" "" "likely benign" "" "0000960054" "0" "10" "2" "238258842" "238258842" "subst" "0" "03779" "COL6A3_000652" "g.238258842C>G" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "benign" "" "0000960055" "0" "50" "2" "238258842" "238258842" "subst" "0" "03779" "COL6A3_000652" "g.238258842C>G" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" "" "0000961986" "0" "50" "2" "238280823" "238280823" "subst" "1.21948E-5" "01804" "COL6A3_000418" "g.238280823G>T" "" "" "" "COL6A3(NM_004369.3):c.3837C>A (p.D1279E, p.(Asp1279Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000961989" "0" "10" "2" "238285431" "238285431" "subst" "0.00322076" "01804" "COL6A3_000074" "g.238285431G>A" "" "" "" "COL6A3(NM_004369.3):c.3054C>T (p.(Asn1018=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000975099" "0" "50" "2" "238234338" "238234338" "subst" "7.31321E-5" "01804" "COL6A3_000266" "g.238234338T>G" "" "" "" "COL6A3(NM_004369.4):c.9358A>C (p.(Thr3120Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975100" "0" "50" "2" "238245002" "238245002" "subst" "0" "01804" "COL6A3_000655" "g.238245002G>T" "" "" "" "COL6A3(NM_004369.3):c.8741C>A (p.(Pro2914His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975101" "0" "30" "2" "238249462" "238249462" "subst" "0.000540343" "01804" "COL6A3_000656" "g.238249462C>T" "" "" "" "COL6A3(NM_004369.3):c.8097G>A (p.(Val2699=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000975102" "0" "50" "2" "238249550" "238249550" "subst" "0.000619135" "01804" "COL6A3_000169" "g.238249550G>A" "" "" "" "COL6A3(NM_004369.3):c.8009C>T (p.A2670V), COL6A3(NM_004369.4):c.8009C>T (p.(Ala2670Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975103" "0" "50" "2" "238249664" "238249664" "subst" "0" "01804" "COL6A3_000657" "g.238249664A>G" "" "" "" "COL6A3(NM_004369.4):c.7895T>C (p.(Leu2632Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975104" "0" "50" "2" "238258791" "238258791" "subst" "8.12328E-6" "01804" "COL6A3_000658" "g.238258791G>A" "" "" "" "COL6A3(NM_004369.4):c.6878C>T (p.(Thr2293Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975105" "0" "50" "2" "238273074" "238273074" "subst" "0.00039012" "01804" "COL6A3_000161" "g.238273074G>A" "" "" "" "COL6A3(NM_004369.3):c.5839-3C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975106" "0" "50" "2" "238277596" "238277596" "subst" "0.000414277" "01804" "COL6A3_000402" "g.238277596G>A" "" "" "" "COL6A3(NM_004369.3):c.4510C>T (p.R1504W), COL6A3(NM_004369.4):c.4510C>T (p.(Arg1504Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975107" "0" "50" "2" "238280539" "238280539" "subst" "0.000101593" "01804" "COL6A3_000411" "g.238280539T>A" "" "" "" "COL6A3(NM_004369.4):c.4121A>T (p.(Asp1374Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975108" "0" "50" "2" "238280906" "238280906" "subst" "0.000130348" "01804" "COL6A3_000248" "g.238280906G>A" "" "" "" "COL6A3(NM_004369.4):c.3754C>T (p.(Arg1252Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975109" "0" "50" "2" "238287545" "238287545" "subst" "0.000211262" "01804" "COL6A3_000466" "g.238287545G>A" "" "" "" "COL6A3(NM_004369.4):c.2231C>T (p.(Pro744Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975110" "0" "30" "2" "238287746" "238287746" "subst" "0.00150325" "02326" "COL6A2_000000" "g.238287746C>T" "" "" "" "COL6A3(NM_004369.3):c.2030G>A (p.(Arg677His), p.R677H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000975111" "0" "50" "2" "238296450" "238296450" "subst" "2.03535E-5" "01804" "COL6A3_000659" "g.238296450G>A" "" "" "" "COL6A3(NM_004369.4):c.1087C>T (p.(Arg363Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000986974" "11" "90" "2" "238267881" "238267881" "subst" "0" "00006" "COL6A3_000660" "g.238267881C>A" "" "{PMID:Chen 2024:38756899}" "" "" "ACMG PVS1, PM2" "Germline" "" "" "0" "" "" "g.237359238C>A" "" "pathogenic (recessive)" "ACMG" "0000986975" "21" "90" "2" "238267848" "238267894" "del" "0" "00006" "COL6A3_000661" "g.(?_238267848)_(238267894_?)del" "" "{PMID:Chen 2024:38756899}" "" "del ex19" "ACMG PVS1, PM2, PM3" "Germline" "" "" "0" "" "" "g.(?_237359205)_(237359251_?)del" "" "likely pathogenic (recessive)" "ACMG" "0000987756" "0" "50" "2" "238257266" "238257266" "subst" "1.21909E-5" "03779" "COL6A3_000662" "g.238257266C>G" "" "" "" "" "" "CLASSIFICATION record" "" "rs778845754" "0" "" "" "" "" "VUS" "" "0000989369" "0" "90" "2" "238272009" "238272009" "subst" "4.06072E-6" "03779" "COL6A3_000586" "g.238272009G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs771941724" "0" "" "" "" "" "pathogenic" "" "0000992667" "0" "30" "2" "238242105" "238242105" "subst" "0" "01804" "COL6A3_000663" "g.238242105G>C" "" "" "" "COL6A3(NM_004369.3):c.9316C>G (p.(Leu3106Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992668" "0" "30" "2" "238242176" "238242176" "subst" "0.000832555" "01804" "COL6A3_000147" "g.238242176G>C" "" "" "" "COL6A3(NM_004369.3):c.9245C>G (p.P3082R, p.(Pro3082Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992669" "0" "30" "2" "238247710" "238247710" "subst" "1.21839E-5" "01804" "COL6A3_000664" "g.238247710A>T" "" "" "" "COL6A3(NM_004369.3):c.8515T>A (p.(Phe2839Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992670" "0" "50" "2" "238249394" "238249394" "subst" "4.0663E-6" "01804" "COL6A3_000665" "g.238249394G>A" "" "" "" "COL6A3(NM_004369.3):c.8165C>T (p.(Thr2722Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992671" "0" "50" "2" "238250800" "238250800" "subst" "8.12916E-6" "01804" "COL6A3_000666" "g.238250800T>C" "" "" "" "COL6A3(NM_004369.3):c.7673A>G (p.(Asn2558Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992672" "0" "30" "2" "238253834" "238253834" "subst" "0" "01804" "COL6A3_000667" "g.238253834T>C" "" "" "" "COL6A3(NM_004369.3):c.7115A>G (p.(Asp2372Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992673" "0" "30" "2" "238261166" "238261166" "subst" "0" "01804" "COL6A3_000239" "g.238261166C>T" "" "" "" "COL6A3(NM_004369.3):c.6752G>A (p.(Arg2251Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992674" "0" "30" "2" "238262020" "238262020" "subst" "0.000312761" "01804" "COL6A3_000540" "g.238262020C>T" "" "" "" "COL6A3(NM_004369.3):c.6654G>A (p.(Pro2218=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992675" "0" "50" "2" "238266477" "238266477" "subst" "1.21828E-5" "01804" "COL6A3_000668" "g.238266477C>T" "" "" "" "COL6A3(NM_004369.3):c.6520G>A (p.(Gly2174Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992676" "0" "50" "2" "238268024" "238268024" "subst" "2.04928E-5" "01804" "COL6A3_000669" "g.238268024C>T" "" "" "" "COL6A3(NM_004369.3):c.6290G>A (p.(Arg2097Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992677" "0" "50" "2" "238269792" "238269792" "subst" "1.62446E-5" "01804" "COL6A3_000670" "g.238269792C>T" "" "" "" "COL6A3(NM_004369.3):c.6182G>A (p.(Arg2061Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992678" "0" "70" "2" "238271942" "238271942" "subst" "0" "01804" "COL6A3_000671" "g.238271942A>G" "" "" "" "COL6A3(NM_004369.3):c.6017T>C (p.(Leu2006Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000992679" "0" "50" "2" "238274385" "238274385" "subst" "0" "01804" "COL6A3_000672" "g.238274385C>T" "" "" "" "COL6A3(NM_004369.3):c.5794G>A (p.(Val1932Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992680" "0" "50" "2" "238274499" "238274499" "subst" "8.9351E-5" "01804" "COL6A3_000368" "g.238274499G>A" "" "" "" "COL6A3(NM_004369.3):c.5680C>T (p.(Pro1894Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992681" "0" "30" "2" "238275353" "238275353" "subst" "0" "01804" "COL6A3_000673" "g.238275353G>C" "" "" "" "COL6A3(NM_004369.3):c.5477C>G (p.(Pro1826Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992682" "0" "50" "2" "238275681" "238275681" "subst" "8.12381E-6" "01804" "COL6A3_000645" "g.238275681C>T" "" "" "" "COL6A3(NM_004369.3):c.5149G>A (p.(Ala1717Thr)), COL6A3(NM_004369.4):c.5149G>A (p.A1717T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992683" "0" "30" "2" "238275918" "238275918" "subst" "0.000644997" "01804" "COL6A3_000145" "g.238275918C>T" "" "" "" "COL6A3(NM_004369.3):c.4912G>A (p.(Ala1638Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992684" "0" "30" "2" "238277276" "238277276" "subst" "0" "01804" "COL6A3_000674" "g.238277276C>T" "" "" "" "COL6A3(NM_004369.3):c.4830G>A (p.(Met1610Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992685" "0" "50" "2" "238277670" "238277670" "subst" "4.0626E-6" "01804" "COL6A3_000675" "g.238277670T>C" "" "" "" "COL6A3(NM_004369.3):c.4436A>G (p.(Gln1479Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992686" "0" "50" "2" "238277790" "238277790" "subst" "0" "01804" "COL6A3_000676" "g.238277790A>G" "" "" "" "COL6A3(NM_004369.3):c.4316T>C (p.(Phe1439Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992687" "0" "30" "2" "238280543" "238280543" "subst" "0.000605617" "01804" "COL6A3_000171" "g.238280543C>T" "" "" "" "COL6A3(NM_004369.3):c.4117G>A (p.A1373T, p.(Ala1373Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992688" "0" "50" "2" "238280650" "238280650" "subst" "4.07143E-6" "01804" "COL6A3_000677" "g.238280650G>A" "" "" "" "COL6A3(NM_004369.3):c.4010C>T (p.(Pro1337Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992689" "0" "50" "2" "238280758" "238280758" "subst" "0.000256364" "01804" "COL6A3_000415" "g.238280758C>T" "" "" "" "COL6A3(NM_004369.3):c.3902G>A (p.R1301Q, p.(Arg1301Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992690" "0" "50" "2" "238280854" "238280854" "subst" "0" "01804" "COL6A3_000678" "g.238280854G>A" "" "" "" "COL6A3(NM_004369.3):c.3806C>T (p.(Thr1269Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992691" "0" "50" "2" "238285417" "238285417" "subst" "0" "01804" "COL6A3_000679" "g.238285417G>T" "" "" "" "COL6A3(NM_004369.3):c.3068C>A (p.(Pro1023Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992692" "0" "30" "2" "238285423" "238285423" "subst" "0" "01804" "COL6A3_000680" "g.238285423G>T" "" "" "" "COL6A3(NM_004369.3):c.3062C>A (p.(Pro1021Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992693" "0" "50" "2" "238285621" "238285621" "subst" "6.90378E-5" "01804" "COL6A3_000449" "g.238285621C>T" "" "" "" "COL6A3(NM_004369.3):c.2864G>A (p.(Arg955His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992694" "0" "50" "2" "238285820" "238285820" "subst" "4.46911E-5" "01804" "COL6A3_000681" "g.238285820G>A" "" "" "" "COL6A3(NM_004369.3):c.2665C>T (p.(Arg889Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992695" "0" "30" "2" "238287419" "238287419" "subst" "1.21843E-5" "01804" "COL6A3_000682" "g.238287419A>G" "" "" "" "COL6A3(NM_004369.3):c.2357T>C (p.(Leu786Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992696" "0" "50" "2" "238287452" "238287452" "subst" "1.62487E-5" "01804" "COL6A3_000683" "g.238287452C>T" "" "" "" "COL6A3(NM_004369.3):c.2324G>A (p.(Cys775Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992697" "0" "50" "2" "238287558" "238287558" "subst" "6.09399E-5" "01804" "COL6A3_000467" "g.238287558G>A" "" "" "" "COL6A3(NM_004369.3):c.2218C>T (p.(Arg740Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992698" "0" "50" "2" "238287801" "238287801" "subst" "0.000220523" "01804" "COL6A3_000473" "g.238287801G>A" "" "" "" "COL6A3(NM_004369.3):c.1975C>T (p.(Arg659Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992699" "0" "50" "2" "238290097" "238290097" "subst" "0" "01804" "COL6A3_000684" "g.238290097G>A" "" "" "" "COL6A3(NM_004369.3):c.1358C>T (p.(Ser453Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992700" "0" "10" "2" "238296355" "238296355" "subst" "0.00589232" "01804" "COL6A3_000062" "g.238296355G>A" "" "" "" "COL6A3(NM_004369.3):c.1182C>T (p.(Thr394=)), COL6A3(NM_004369.4):c.1182C>T (p.T394=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000992701" "0" "50" "2" "238296636" "238296638" "del" "0" "01804" "COL6A3_000685" "g.238296636_238296638del" "" "" "" "COL6A3(NM_004369.3):c.902_904delCCA (p.(Thr301del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000992702" "0" "30" "2" "238303649" "238303649" "subst" "2.03098E-5" "01804" "COL6A3_000520" "g.238303649C>T" "" "" "" "COL6A3(NM_004369.3):c.290G>A (p.(Arg97His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992703" "0" "50" "2" "238303827" "238303827" "subst" "4.13199E-6" "01804" "COL6A3_000686" "g.238303827C>T" "" "" "" "COL6A3(NM_004369.3):c.112G>A (p.(Ala38Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001013690" "0" "10" "2" "238233483" "238233483" "subst" "0.290644" "02326" "COL6A3_000141" "g.238233483G>A" "" "" "" "COL6A3(NM_004369.3):c.9494-26C>T, COL6A3(NM_004369.4):c.9494-26C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001013691" "0" "10" "2" "238243375" "238243375" "subst" "0.0260362" "02326" "COL6A3_000137" "g.238243375C>T" "" "" "" "COL6A3(NM_004369.3):c.9123G>A (p.(Thr3041=), p.T3041=), COL6A3(NM_004369.4):c.9123G>A (p.T3041=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001013692" "0" "30" "2" "238280544" "238280544" "subst" "1.21911E-5" "01804" "COL6A3_000687" "g.238280544G>A" "" "" "" "COL6A3(NM_004369.3):c.4116C>T (p.(Asn1372=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001013693" "0" "30" "2" "238283461" "238283461" "subst" "0.000154411" "01804" "COL6A3_000688" "g.238283461G>A" "" "" "" "COL6A3(NM_004369.3):c.3273C>T (p.(Val1091=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001013694" "0" "30" "2" "238283536" "238283536" "subst" "8.99847E-5" "02326" "COL6A3_000689" "g.238283536G>A" "" "" "" "COL6A3(NM_004369.3):c.3198C>T (p.R1066=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001013695" "0" "10" "2" "238283605" "238283605" "subst" "0.234224" "02326" "COL6A3_000023" "g.238283605G>A" "" "" "" "COL6A3(NM_004369.3):c.3129C>T (p.G1043=), COL6A3(NM_004369.4):c.3129C>T (p.G1043=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001013696" "0" "50" "2" "238289917" "238289917" "subst" "0.000381754" "02329" "COL6A3_000483" "g.238289917C>T" "" "" "" "COL6A3(NM_004369.3):c.1538G>A (p.R513Q, p.(Arg513Gln)), COL6A3(NM_004369.4):c.1538G>A (p.R513Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001013697" "0" "70" "2" "238296777" "238296777" "del" "0" "02329" "COL6A3_000509" "g.238296777del" "" "" "" "COL6A3(NM_004369.4):c.761del (p.(Gly254GlufsTer13)), COL6A3(NM_004369.4):c.761delG (p.G254Efs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001020306" "0" "50" "2" "238249328" "238249328" "subst" "3.65637E-5" "03779" "COL6A3_000690" "g.238249328G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs373680762" "0" "" "" "" "" "VUS" "" "0001021270" "0" "50" "2" "238275489" "238275489" "subst" "7.71511E-5" "00006" "COL6A3_000384" "g.238275489T>C" "" "{PMID:Marti 2025:39666917}" "" "" "" "Germline" "" "" "0" "" "" "g.237366846T>C" "" "VUS" "" "0001024559" "0" "50" "2" "238287629" "238287629" "subst" "0.000308712" "02329" "COL6A3_000691" "g.238287629C>T" "" "" "" "COL6A3(NM_004369.4):c.2147G>A (p.G716D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001030186" "0" "50" "2" "238267850" "238267850" "subst" "0" "03779" "COL6A3_000692" "g.238267850T>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0001033135" "0" "50" "2" "238244875" "238244877" "dup" "0" "01804" "COL6A3_000278" "g.238244875_238244877dup" "" "" "" "COL6A3(NM_004369.4):c.8877_8879dup (p.(Ala2960dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033136" "0" "50" "2" "238249122" "238249122" "subst" "2.03499E-5" "01804" "COL6A3_000693" "g.238249122C>T" "" "" "" "COL6A3(NM_004369.4):c.8437G>A (p.(Gly2813Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033137" "0" "50" "2" "238249654" "238249654" "subst" "8.1487E-6" "01804" "COL6A3_000694" "g.238249654G>C" "" "" "" "COL6A3(NM_004369.4):c.7905C>G (p.(Phe2635Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033138" "0" "50" "2" "238249751" "238249751" "subst" "1.22134E-5" "01804" "COL6A3_000695" "g.238249751C>T" "" "" "" "COL6A3(NM_004369.4):c.7808G>A (p.(Arg2603Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033139" "0" "30" "2" "238251957" "238251957" "subst" "0" "01804" "COL6A3_000696" "g.238251957G>T" "" "" "" "COL6A3(NM_004369.4):c.7668+1036C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001033140" "0" "90" "2" "238253214" "238253214" "subst" "0.000629523" "01804" "COL6A3_000191" "g.238253214T>C" "" "" "" "COL6A3(NM_004369.4):c.7447A>G (p.K2483E, p.(Lys2483Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001033141" "0" "70" "2" "238259802" "238259802" "subst" "8.12203E-6" "01804" "COL6A3_000697" "g.238259802G>A" "" "" "" "COL6A3(NM_004369.4):c.6787C>T (p.(Arg2263*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001033142" "0" "50" "2" "238268750" "238268750" "subst" "8.12493E-5" "01804" "COL6A3_000698" "g.238268750G>A" "" "" "" "COL6A3(NM_004369.4):c.6263C>T (p.(Pro2088Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033143" "0" "50" "2" "238274346" "238274346" "subst" "0" "01804" "COL6A3_000699" "g.238274346C>A" "" "" "" "COL6A3(NM_004369.4):c.5833G>T (p.(Val1945Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033144" "0" "50" "2" "238280704" "238280704" "subst" "0" "01804" "COL6A3_000700" "g.238280704A>G" "" "" "" "COL6A3(NM_004369.4):c.3956T>C (p.(Val1319Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033145" "0" "50" "2" "238283262" "238283262" "subst" "2.43787E-5" "01804" "COL6A3_000701" "g.238283262C>T" "" "" "" "COL6A3(NM_004369.4):c.3472G>A (p.(Gly1158Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033146" "0" "50" "2" "238283511" "238283511" "subst" "0.000465287" "01804" "COL6A3_000437" "g.238283511G>A" "" "" "" "COL6A3(NM_004369.3):c.3223C>T (p.R1075W), COL6A3(NM_004369.4):c.3223C>T (p.(Arg1075Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033147" "0" "50" "2" "238285841" "238285841" "subst" "8.12968E-6" "01804" "COL6A3_000702" "g.238285841C>T" "" "" "" "COL6A3(NM_004369.4):c.2644G>A (p.(Asp882Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033148" "0" "50" "2" "238287470" "238287470" "subst" "4.46798E-5" "01804" "COL6A3_000461" "g.238287470G>A" "" "" "" "COL6A3(NM_004369.4):c.2306C>T (p.(Ala769Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033149" "0" "30" "2" "238287800" "238287800" "subst" "0.0060661" "01804" "COL6A3_000071" "g.238287800C>T" "" "" "" "COL6A3(NM_004369.3):c.1976G>A (p.(Arg659His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001033150" "0" "30" "2" "238287862" "238287862" "subst" "0.00719767" "01804" "COL6A3_000070" "g.238287862C>T" "" "" "" "COL6A3(NM_004369.3):c.1914G>A (p.(Arg638=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001033151" "0" "50" "2" "238296638" "238296640" "del" "0" "01804" "COL6A3_000504" "g.238296638_238296640del" "" "" "" "COL6A3(NM_004369.4):c.898_900del (p.(Ser300del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001033152" "0" "30" "2" "238296655" "238296655" "subst" "0.00587428" "01804" "COL6A3_000061" "g.238296655G>A" "" "" "" "COL6A3(NM_004369.3):c.882C>T (p.(Phe294=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001033153" "0" "30" "2" "238296751" "238296751" "subst" "0.000381026" "02326" "COL6A3_000252" "g.238296751G>A" "" "" "" "COL6A3(NM_004369.3):c.786C>T (p.L262=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001033154" "0" "90" "2" "238296777" "238296777" "del" "0" "01804" "COL6A3_000509" "g.238296777del" "" "" "" "COL6A3(NM_004369.4):c.761del (p.(Gly254GlufsTer13)), COL6A3(NM_004369.4):c.761delG (p.G254Efs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001045817" "0" "50" "2" "238243520" "238243520" "subst" "0.000285042" "02325" "COL6A3_000620" "g.238243520C>T" "" "" "" "COL6A3(NM_004369.3):c.8978G>A (p.(Arg2993His)), COL6A3(NM_004369.4):c.8978G>A (p.R2993H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001045818" "0" "90" "2" "238243533" "238243533" "subst" "1.63054E-5" "02327" "COL6A3_000275" "g.238243533C>G" "" "" "" "COL6A3(NM_004369.4):c.8966-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001045819" "0" "50" "2" "238277704" "238277704" "subst" "2.8477E-5" "01804" "COL6A3_000703" "g.238277704T>C" "" "" "" "COL6A3(NM_004369.3):c.4402A>G (p.(Ile1468Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001045820" "0" "30" "2" "238285924" "238285924" "subst" "3.76717E-5" "01804" "COL6A3_000561" "g.238285924A>G" "" "" "" "COL6A3(NM_004369.3):c.2561T>C (p.V854A, p.(Val854Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001045821" "0" "30" "2" "238289694" "238289694" "subst" "0.00128333" "01804" "COL6A3_000480" "g.238289694G>A" "" "" "" "COL6A3(NM_004369.3):c.1761C>T (p.A587=, p.(Ala587=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001047928" "3" "90" "2" "238268032" "238268032" "del" "0" "04892" "COL6A3_000706" "g.238268032del" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.237359389del" "" "pathogenic" "" "0001047929" "1" "90" "2" "238280539" "238280539" "subst" "0.000101593" "04892" "COL6A3_000411" "g.238280539T>A" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.237371896T>A" "" "pathogenic (dominant)" "" "0001047930" "1" "90" "2" "238268784" "238268784" "subst" "0" "04892" "COL6A3_000153" "g.238268784C>G" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.237360141C>G" "" "pathogenic (dominant)" "" "0001047931" "1" "90" "2" "238253407" "238253407" "subst" "0" "04892" "COL6A3_000705" "g.238253407G>T" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.237344764G>T" "" "pathogenic (dominant)" "" "0001047932" "3" "90" "2" "238290062" "238290062" "subst" "0" "04892" "COL6A3_000001" "g.238290062G>A" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.237381419G>A" "" "pathogenic" "" "0001047933" "1" "90" "2" "238270382" "238270382" "subst" "0" "04892" "COL6A3_000708" "g.238270382C>A" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.237361739C>A" "" "pathogenic (dominant)" "" "0001047934" "1" "90" "2" "238269808" "238269808" "subst" "0" "04892" "COL6A3_000014" "g.238269808C>T" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.237361165C>T" "" "pathogenic (dominant)" "" "0001047935" "1" "90" "2" "238269763" "238269763" "subst" "0" "04892" "COL6A3_000707" "g.238269763C>G" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.237361120C>G" "" "pathogenic (dominant)" "" "0001047936" "1" "90" "2" "238253193" "238253193" "subst" "0" "04892" "COL6A3_000704" "g.238253193C>T" "" "Fortunato 2025, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.237344550C>T" "" "pathogenic (dominant)" "" "0001049448" "11" "50" "2" "238280557" "238280557" "subst" "0.000422616" "00006" "COL6A3_000227" "g.238280557G>A" "" "{PMID:Vorontsova 2025:41096657}" "" "" "inherited from healthy father" "Germline" "" "" "0" "" "" "g.237371914G>A" "" "VUS" "" "0001051148" "0" "50" "2" "238243382" "238243382" "subst" "0.00017055" "01804" "COL6A3_000271" "g.238243382G>A" "" "" "" "COL6A3(NM_004369.4):c.9116C>T (p.(Thr3039Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001051149" "0" "50" "2" "238249422" "238249422" "subst" "8.12896E-5" "01804" "COL6A3_000709" "g.238249422T>C" "" "" "" "COL6A3(NM_004369.4):c.8137A>G (p.(Arg2713Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001051150" "0" "50" "2" "238262019" "238262019" "subst" "4.06151E-6" "01804" "COL6A3_000710" "g.238262019C>T" "" "" "" "COL6A3(NM_004369.4):c.6655G>A (p.(Gly2219Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001051151" "0" "30" "2" "238274569" "238274569" "subst" "0.00130074" "01804" "COL6A3_000373" "g.238274569G>T" "" "" "" "COL6A3(NM_004369.3):c.5610C>A (p.(Ser1870Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001051152" "0" "70" "2" "238296525" "238296525" "del" "0" "01804" "COL6A3_000711" "g.238296525del" "" "" "" "COL6A3(NM_004369.4):c.1016del (p.(Gly339Alafs*15))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001057749" "1" "70" "2" "238280504" "238280504" "subst" "0.0062857" "00006" "COL6A3_000005" "g.238280504C>T" "" "{PMID:Shadrina 2016:26770814}" "" "" "" "Germline" "" "rs146092501" "0" "" "" "g.237371861C>T" "" "VUS" "" "0001057910" "0" "70" "2" "238253214" "238253214" "subst" "0.000629523" "00006" "COL6A3_000191" "g.238253214T>C" "" "{PMID:Ayala-Ramirez 2025:41066171}" "" "" "" "Germline" "" "rs139260335" "0" "" "" "g.237344571T>C" "{CV:196977}" "likely pathogenic" "" "0001057949" "0" "50" "2" "238252993" "238252993" "subst" "0" "00006" "COL6A3_000712" "g.238252993C>A" "" "{PMID:Ayala-Ramirez 2025:41066171}" "" "" "" "Germline" "" "rs1553547891" "0" "" "" "g.237344350C>A" "{CV:542979}" "VUS" "" "0001057957" "0" "50" "2" "238253286" "238253286" "subst" "5.28344E-5" "00006" "COL6A3_000322" "g.238253286G>A" "" "{PMID:Ayala-Ramirez 2025:41066171}" "" "" "" "Germline" "" "rs371066956" "0" "" "" "g.237344643G>A" "{CV:284557}" "VUS" "" "0001057964" "0" "50" "2" "238283310" "238283310" "subst" "2.44047E-5" "00006" "COL6A3_000713" "g.238283310C>T" "" "{PMID:Ayala-Ramirez 2025:41066171}" "" "" "" "Germline" "" "rs777599612" "0" "" "" "g.237374667C>T" "{CV:542962}" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes COL6A3 ## Count = 1496 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000084593" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl" "p.?" "16i" "0000084597" "00005473" "90" "6284" "0" "6284" "0" "c.6284G>T" "r.(?)" "p.(Gly2095Val)" "18" "0000084601" "00005473" "90" "6221" "0" "6221" "0" "c.6221G>A" "r.(?)" "p.(Gly2074Asp)" "17" "0000130301" "00005473" "70" "8136" "0" "8136" "0" "c.8136del" "r.(?)" "p.(Arg2713Glyfs*3)" "38" "0000166958" "00005473" "90" "7509" "0" "7509" "0" "c.7509G>T" "r.(?)" "p.(Arg2503Ser)" "36" "0000166964" "00005473" "70" "4504" "0" "4504" "0" "c.4504G>A" "r.(?)" "p.(Ala1502Thr)" "10" "0000167163" "00005473" "90" "7024" "0" "7024" "0" "c.7024C>T" "r.(?)" "p.(Arg2342*)" "31" "0000175299" "00005473" "70" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000175300" "00005473" "70" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000175302" "00005473" "70" "8567" "2" "8567" "2" "c.8567+2T>A" "r.spl" "p.?" "" "0000175303" "00005473" "70" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000175304" "00005473" "70" "5993" "0" "5993" "0" "c.5993G>A" "r.(?)" "p.(Arg1998Gln)" "" "0000175305" "00005473" "70" "7037" "0" "7037" "0" "c.7037C>T" "r.(?)" "p.(Ser2346Leu)" "" "0000175306" "00005473" "70" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Trp)" "" "0000175307" "00005473" "70" "6220" "0" "6220" "0" "c.6220G>A" "r.(?)" "p.(Gly2074Ser)" "" "0000175308" "00005473" "70" "6199" "0" "6199" "0" "c.6199G>A" "r.(?)" "p.(Glu2067Lys)" "" "0000175309" "00005473" "70" "4856" "0" "4856" "0" "c.4856C>T" "r.(?)" "p.(Thr1619Ile)" "" "0000175311" "00005473" "70" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000175327" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.7929g>a" "p.=" "38" "0000175343" "00005473" "10" "4533" "0" "4533" "0" "c.4533G>T" "r.4533g>u" "p.=" "10" "0000175369" "00005473" "90" "4184" "0" "4184" "0" "c.4184G>A" "r.(?)" "p.(Arg1395Gln)" "9" "0000175375" "00005473" "90" "1393" "0" "1393" "0" "c.1393C>T" "r.(?)" "p.(Arg465*)" "5" "0000175377" "00005473" "90" "3040" "0" "3040" "0" "c.3040A>G" "r.(?)" "p.(Lys1014Glu)" "7" "0000175378" "00005473" "90" "3191" "0" "3191" "0" "c.3191G>A" "r.(?)" "p.(Arg1064Gln)" "8" "0000175379" "00005473" "90" "4156" "0" "4156" "0" "c.4156G>A" "r.(?)" "p.(Glu1386Lys)" "9" "0000175380" "00005473" "70" "4399" "0" "4399" "0" "c.4399A>G" "r.(?)" "p.(Asn1467Asp)" "10" "0000175381" "00005473" "90" "5036" "0" "5036" "0" "c.5036G>A" "r.(?)" "p.(Gly1679Glu)" "11" "0000175382" "00005473" "90" "5036" "0" "5036" "0" "c.5036G>A" "r.(?)" "p.(Gly1679Glu)" "11" "0000175383" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.6157_6210del" "p.Asp2022_Lys2052del" "16i" "0000175384" "00005473" "90" "6157" "-8" "6178" "0" "c.6157-8_6178del" "r.6157_6210del" "p.Gly2053_Pro2070del" "15i" "0000175385" "00005473" "90" "6166" "0" "6166" "0" "c.6166G>A" "r.(?)" "p.(Gly2056Arg)" "16" "0000175386" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl" "p.(Gly2053_Pro2070del)" "16i" "0000175387" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.6157_6210del" "p.Gly2053_Pro2070del" "16i" "0000175388" "00005473" "90" "6239" "0" "6239" "0" "c.6239G>A" "r.(?)" "p.(Gly2080Asp)" "17" "0000175389" "00005473" "90" "6816" "0" "6816" "0" "c.6816G>A" "r.6753_6816del" "p.Gly2252_Lys2272del" "27" "0000175390" "00005473" "90" "6930" "5" "6930" "5" "c.6930+5G>A" "r.6880_6930del" "p.Gly2294_Lys2310del" "29i" "0000175391" "00005473" "90" "7024" "0" "7024" "0" "c.7024C>T" "r.(?)" "p.(Arg2342*)" "31" "0000175392" "00005473" "90" "8822" "0" "8822" "0" "c.8822C>T" "r.(?)" "p.(Ala2941Val)" "40" "0000175413" "00005473" "90" "6210" "1" "6210" "2" "c.6210+1_6210+2delinsTC" "r.6157_6210del" "p.Asp2022_Lys2052del" "16i" "0000175422" "00005473" "70" "6283" "-2" "6283" "-2" "c.6283-2A>G" "r.spl?" "p.?" "17i" "0000175433" "00005473" "70" "6310" "-2" "6310" "-2" "c.6310-2A>G" "r.spl?" "p.(del?)" "18i" "0000175434" "00005473" "70" "6247" "0" "6247" "0" "c.6247G>T" "r.(?)" "p.(Gly2083Cys)" "17" "0000175439" "00005473" "70" "6472" "-2" "6472" "-2" "c.6472-2A>G" "r.spl?" "p.(del?)" "21i" "0000175450" "00005473" "50" "1313" "-42" "1313" "-42" "c.1313-42G>A" "r.(spl?)" "p.(fs*?)" "4i" "0000175452" "00005473" "30" "4217" "0" "4217" "0" "c.4217C>T" "r.(?)" "p.(Thr1406Met)" "9" "0000175453" "00005473" "70" "6185" "0" "6185" "0" "c.6185G>A" "r.(?)" "p.(Gly2062Asp)" "16" "0000175460" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl?" "p.?" "16i" "0000175464" "00005473" "30" "3191" "0" "3191" "0" "c.3191G>A" "r.(?)" "p.(Arg1064Gln)" "8" "0000175474" "00005473" "70" "6210" "2" "6210" "2" "c.6210+2dup" "r.(spl?)" "p.?" "16i" "0000175475" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl" "p.?" "16i" "0000175651" "00005473" "50" "74" "0" "74" "0" "c.74C>A" "r.(?)" "p.(Ala25Asp)" "2" "0000175652" "00005473" "90" "175" "0" "175" "0" "c.175C>T" "r.(?)" "p.(Arg59*)" "3" "0000175653" "00005473" "50" "421" "0" "421" "0" "c.421G>A" "r.(?)" "p.(Gly141Arg)" "3" "0000175654" "00005473" "10" "730" "0" "730" "0" "c.730A>G" "r.(?)" "p.(Ile244Val)" "4" "0000175655" "00005473" "50" "768" "0" "768" "0" "c.768C>T" "r.(?)" "p.(=)" "4" "0000175656" "00005473" "10" "882" "0" "882" "0" "c.882C>T" "r.(?)" "p.(=)" "4" "0000175657" "00005473" "50" "1182" "0" "1182" "0" "c.1182C>T" "r.(?)" "p.(=)" "4" "0000175658" "00005473" "50" "1231" "0" "1231" "0" "c.1231C>G" "r.(?)" "p.(Leu411Val)" "4" "0000175659" "00005473" "10" "1264" "0" "1264" "0" "c.1264G>A" "r.(?)" "p.(Val422Met)" "4" "0000175660" "00005473" "10" "1313" "-17" "1313" "-17" "c.1313-17A>G" "r.(?)" "p.(=)" "4i" "0000175661" "00005473" "50" "1389" "0" "1389" "0" "c.1389C>T" "r.(?)" "p.(=)" "5" "0000175662" "00005473" "10" "1471" "0" "1471" "0" "c.1471G>C" "r.(?)" "p.(Asp491His)" "5" "0000175663" "00005473" "10" "1475" "0" "1475" "0" "c.1475C>G" "r.(?)" "p.(Thr492Ser)" "5" "0000175664" "00005473" "10" "1638" "0" "1638" "0" "c.1638C>T" "r.(?)" "p.(=)" "5" "0000175665" "00005473" "10" "1786" "0" "1786" "0" "c.1786G>T" "r.(?)" "p.(Ala596Ser)" "5" "0000175666" "00005473" "10" "1914" "0" "1914" "0" "c.1914G>A" "r.(?)" "p.(=)" "6" "0000175667" "00005473" "10" "1976" "0" "1976" "0" "c.1976G>A" "r.(?)" "p.(Arg659His)" "6" "0000175668" "00005473" "10" "2419" "0" "2419" "0" "c.2419G>A" "r.(?)" "p.(Ala807Thr)" "6" "0000175669" "00005473" "10" "2488" "0" "2488" "0" "c.2488G>T" "r.(?)" "p.(Ala830Ser)" "6" "0000175670" "00005473" "10" "3054" "0" "3054" "0" "c.3054C>T" "r.(?)" "p.(=)" "7" "0000175671" "00005473" "10" "3071" "-16" "3071" "-16" "c.3071-16G>A" "r.(?)" "p.(=)" "7i" "0000175672" "00005473" "10" "3087" "0" "3087" "0" "c.3087C>T" "r.(?)" "p.(=)" "8" "0000175673" "00005473" "10" "3129" "0" "3129" "0" "c.3129C>T" "r.(?)" "p.(=)" "8" "0000175674" "00005473" "90" "3191" "0" "3191" "0" "c.3191G>A" "r.(?)" "p.(Arg1064Gln)" "8" "0000175675" "00005473" "50" "3223" "0" "3223" "0" "c.3223C>A" "r.(?)" "p.(=)" "8" "0000175676" "00005473" "10" "3262" "0" "3262" "0" "c.3262A>C" "r.(?)" "p.(Lys1088Gln)" "8" "0000175677" "00005473" "10" "3420" "0" "3420" "0" "c.3420G>A" "r.(?)" "p.(=)" "8" "0000175678" "00005473" "50" "3954" "0" "3954" "0" "c.3954C>T" "r.(?)" "p.(=)" "9" "0000175679" "00005473" "10" "4090" "0" "4090" "0" "c.4090G>A" "r.(?)" "p.(Val1364Met)" "9" "0000175680" "00005473" "30" "4184" "0" "4184" "0" "c.4184G>A" "r.(?)" "p.(Arg1395Gln)" "9" "0000175681" "00005473" "10" "4285" "9" "4285" "9" "c.4285+9G>A" "r.(?)" "p.(=)" "9i" "0000175682" "00005473" "10" "4285" "17" "4285" "17" "c.4285+17G>A" "r.(?)" "p.(=)" "9i" "0000175683" "00005473" "10" "4311" "0" "4311" "0" "c.4311T>C" "r.(?)" "p.(=)" "10" "0000175684" "00005473" "10" "4533" "0" "4533" "0" "c.4533G>T" "r.(?)" "p.(=)" "10" "0000175685" "00005473" "10" "4683" "0" "4683" "0" "c.4683G>A" "r.(?)" "p.(=)" "10" "0000175686" "00005473" "10" "4727" "0" "4727" "0" "c.4727G>A" "r.(?)" "p.(Arg1576Gln)" "10" "0000175687" "00005473" "50" "4848" "0" "4848" "0" "c.4848C>T" "r.(?)" "p.(=)" "10" "0000175688" "00005473" "50" "4873" "0" "4873" "0" "c.4873G>A" "r.(?)" "p.(Val1625Met)" "10" "0000175689" "00005473" "10" "4895" "0" "4895" "0" "c.4895G>A" "r.(?)" "p.(Arg1632Gln)" "10" "0000175690" "00005473" "10" "5100" "0" "5100" "0" "c.5100G>A" "r.(?)" "p.(=)" "11" "0000175691" "00005473" "50" "5170" "0" "5170" "0" "c.5170G>A" "r.(?)" "p.(Glu1724Lys)" "11" "0000175692" "00005473" "10" "5261" "0" "5261" "0" "c.5261A>G" "r.(?)" "p.(Lys1754Arg)" "11" "0000175693" "00005473" "50" "5418" "0" "5418" "0" "c.5418C>T" "r.(?)" "p.(=)" "11" "0000175694" "00005473" "10" "5917" "28" "5917" "28" "c.5917+28G>C" "r.(?)" "p.(=)" "13i" "0000175695" "00005473" "10" "6063" "13" "6063" "13" "c.6063+13dup" "r.(?)" "p.(=)" "14i" "0000175696" "00005473" "50" "6156" "0" "6156" "0" "c.6156G>C" "r.(?)" "p.(Lys2052Asn)" "15" "0000175697" "00005473" "10" "6156" "4" "6156" "4" "c.6156+4C>T" "r.(spl?)" "p.(?)" "15i" "0000175698" "00005473" "50" "6156" "5" "6156" "5" "c.6156+5G>A" "r.(spl?)" "p.(?)" "15i" "0000175699" "00005473" "50" "6157" "-16" "6157" "-16" "c.6157-16G>A" "r.(?)" "p.(=)" "15i" "0000175700" "00005473" "50" "6193" "0" "6193" "0" "c.6193G>A" "r.(?)" "p.(Gly2065Ser)" "16" "0000175701" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl" "p.?" "16i" "0000175702" "00005473" "50" "6211" "-4" "6211" "-4" "c.6211-4A>G" "r.(?)" "p.(=)" "16i" "0000175703" "00005473" "50" "6211" "-3" "6211" "-3" "c.6211-3C>T" "r.(?)" "p.(=)" "16i" "0000175704" "00005473" "50" "6248" "0" "6248" "0" "c.6248G>A" "r.(?)" "p.(Gly2083Asp)" "17" "0000175705" "00005473" "90" "6282" "1" "6282" "1" "c.6282+1G>A" "r.spl" "p.?" "17i" "0000175706" "00005473" "10" "6282" "50" "6282" "50" "c.6282+50C>T" "r.(?)" "p.(=)" "17i" "0000175707" "00005473" "50" "6309" "40" "6309" "40" "c.6309+40C>T" "r.(?)" "p.(=)" "18i" "0000175708" "00005473" "10" "6369" "0" "6369" "0" "c.6369G>A" "r.(?)" "p.(=)" "20" "0000175709" "00005473" "10" "6408" "44" "6408" "44" "c.6408+44A>G" "r.(?)" "p.(=)" "20i" "0000175710" "00005473" "10" "6592" "-27" "6592" "-27" "c.6592-27del" "r.(=)" "p.(=)" "23i" "0000175711" "00005473" "50" "6622" "0" "6622" "0" "c.6622G>T" "r.(?)" "p.(Ala2208Ser)" "24" "0000175712" "00005473" "50" "6628" "-47" "6628" "-47" "c.6628-47G>C" "r.(?)" "p.(=)" "24i" "0000175713" "00005473" "10" "6653" "0" "6653" "0" "c.6653C>T" "r.(?)" "p.(Pro2218Leu)" "25" "0000175714" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.(?)" "p.(=)" "28" "0000175715" "00005473" "50" "6879" "49" "6879" "49" "c.6879+49G>A" "r.(?)" "p.(=)" "28i" "0000175716" "00005473" "10" "6880" "-47" "6880" "-47" "c.6880-47T>C" "r.(?)" "p.(=)" "28i" "0000175717" "00005473" "10" "6930" "28" "6930" "28" "c.6930+28C>T" "r.(?)" "p.(=)" "29i" "0000175718" "00005473" "10" "6930" "43" "6930" "43" "c.6930+43G>C" "r.(?)" "p.(=)" "29i" "0000175719" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.(?)" "p.(=)" "30" "0000175720" "00005473" "50" "6972" "0" "6972" "0" "c.6972C>T" "r.(?)" "p.(=)" "31" "0000175721" "00005473" "10" "6981" "0" "6981" "0" "c.6981A>G" "r.(?)" "p.(=)" "31" "0000175722" "00005473" "10" "7086" "0" "7086" "0" "c.7086A>C" "r.(?)" "p.(=)" "32" "0000175723" "00005473" "10" "7092" "26" "7092" "26" "c.7092+26G>A" "r.(?)" "p.(=)" "32i" "0000175724" "00005473" "10" "7162" "48" "7162" "48" "c.7162+48G>A" "r.(?)" "p.(=)" "34i" "0000175725" "00005473" "10" "7175" "-32" "7175" "-32" "c.7175-32G>A" "r.(?)" "p.(=)" "35i" "0000175726" "00005473" "50" "7258" "0" "7258" "0" "c.7258C>T" "r.(?)" "p.(Arg2420Trp)" "36" "0000175727" "00005473" "10" "7329" "0" "7329" "0" "c.7329C>T" "r.(?)" "p.(=)" "36" "0000175728" "00005473" "10" "7400" "0" "7400" "0" "c.7400C>T" "r.(?)" "p.(Ser2467Leu)" "36" "0000175729" "00005473" "10" "7509" "0" "7509" "0" "c.7509G>A" "r.(?)" "p.(=)" "36" "0000175730" "00005473" "10" "7512" "0" "7512" "0" "c.7512C>T" "r.(?)" "p.(=)" "36" "0000175731" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.(?)" "p.(=)" "36" "0000175732" "00005473" "10" "7645" "0" "7645" "0" "c.7645C>T" "r.(?)" "p.(Arg2549Trp)" "36" "0000175733" "00005473" "10" "7668" "21" "7668" "21" "c.7668+21G>C" "r.(?)" "p.(=)" "36i" "0000175734" "00005473" "50" "7669" "-35" "7669" "-35" "c.7669-35C>T" "r.(?)" "p.(=)" "36i" "0000175735" "00005473" "50" "7685" "0" "7685" "0" "c.7685T>C" "r.(?)" "p.(Val2562Ala)" "37" "0000175736" "00005473" "50" "7779" "0" "7779" "0" "c.7779C>T" "r.(?)" "p.(=)" "38" "0000175737" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.(?)" "p.(=)" "38" "0000175738" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.(?)" "p.(=)" "38" "0000175739" "00005473" "10" "7995" "0" "7995" "0" "c.7995A>C" "r.(?)" "p.(=)" "38" "0000175740" "00005473" "50" "8008" "0" "8008" "0" "c.8008G>A" "r.(?)" "p.(Ala2670Thr)" "38" "0000175741" "00005473" "10" "8010" "0" "8010" "0" "c.8010G>A" "r.(?)" "p.(=)" "38" "0000175742" "00005473" "10" "8145" "0" "8145" "0" "c.8145A>G" "r.(?)" "p.(=)" "38" "0000175743" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.(?)" "p.(=)" "38" "0000175744" "00005473" "50" "8464" "20" "8464" "20" "c.8464+20G>C" "r.(?)" "p.(=)" "38i" "0000175745" "00005473" "50" "8465" "-34" "8465" "-34" "c.8465-34C>T" "r.(?)" "p.(=)" "38i" "0000175746" "00005473" "10" "8491" "0" "8491" "0" "c.8491G>C" "r.(?)" "p.(Asp2831His)" "39" "0000175747" "00005473" "10" "8780" "0" "8780" "0" "c.8780T>C" "r.(?)" "p.(Met2927Thr)" "40" "0000175748" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.(?)" "p.(=)" "40" "0000175749" "00005473" "10" "8822" "0" "8822" "0" "c.8822C>T" "r.(?)" "p.(Ala2941Val)" "40" "0000175750" "00005473" "10" "8877" "0" "8879" "0" "c.8877_8879del" "r.(?)" "p.(Ala2960del)" "40" "0000175751" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.(?)" "p.(Met2988Val)" "40" "0000175752" "00005473" "10" "9034" "0" "9034" "0" "c.9034G>C" "r.(?)" "p.(Ala3012Pro)" "41" "0000175753" "00005473" "10" "9069" "0" "9069" "0" "c.9069C>T" "r.(?)" "p.(=)" "41" "0000175754" "00005473" "10" "9123" "0" "9123" "0" "c.9123G>A" "r.(?)" "p.(=)" "41" "0000175755" "00005473" "10" "9129" "0" "9129" "0" "c.9129C>T" "r.(?)" "p.(=)" "41" "0000175756" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.(?)" "p.(Thr3069Ile)" "41" "0000175757" "00005473" "10" "9213" "0" "9213" "0" "c.9213C>T" "r.(?)" "p.(=)" "41" "0000175758" "00005473" "50" "9329" "-33" "9329" "-33" "c.9329-33C>T" "r.(?)" "p.(=)" "42i" "0000175759" "00005473" "10" "9411" "0" "9411" "0" "c.9411T>C" "r.(?)" "p.(=)" "43" "0000175760" "00005473" "10" "9494" "-26" "9494" "-26" "c.9494-26C>T" "r.(?)" "p.(=)" "43i" "0000175761" "00005473" "10" "9541" "0" "9541" "0" "c.*7G>C" "r.(?)" "p.(=)" "44" "0000175805" "00005473" "50" "8632" "0" "8632" "0" "c.8632A>G" "r.(?)" "p.(Thr2878Ala)" "40" "0000175816" "00005473" "90" "6158" "0" "6158" "0" "c.6158G>T" "r.(?)" "p.(Gly2053Val)" "16" "0000175817" "00005473" "90" "6175" "0" "6175" "0" "c.6175G>T" "r.(?)" "p.(Gly2059Cys)" "16" "0000175818" "00005473" "90" "6175" "0" "6175" "0" "c.6175G>T" "r.(?)" "p.(Gly2059Cys)" "16" "0000175819" "00005473" "90" "6239" "0" "6239" "0" "c.6239G>A" "r.(?)" "p.(Gly2080Asp)" "17" "0000175820" "00005473" "90" "6220" "0" "6220" "0" "c.6220G>T" "r.(?)" "p.(Gly2074Cys)" "17" "0000175821" "00005473" "90" "6221" "0" "6221" "0" "c.6221G>A" "r.(?)" "p.(Gly2074Asp)" "17" "0000175822" "00005473" "90" "6229" "0" "6229" "0" "c.6229G>C" "r.(?)" "p.(Gly2077Arg)" "17" "0000175823" "00005473" "90" "6293" "0" "6293" "0" "c.6293G>T" "r.(?)" "p.(Gly2098Val)" "18" "0000175824" "00005473" "90" "6293" "0" "6293" "0" "c.6293G>T" "r.(?)" "p.(Gly2098Val)" "18" "0000175825" "00005473" "90" "6293" "0" "6293" "0" "c.6293G>T" "r.(?)" "p.(Gly2098Val)" "18" "0000175826" "00005473" "50" "6181" "0" "6181" "0" "c.6181C>T" "r.(?)" "p.(Arg2061*)" "16" "0000175827" "00005473" "90" "6931" "0" "6931" "0" "c.6931G>A" "r.(?)" "p.(Gly2311Arg)" "30" "0000175832" "00005473" "90" "6229" "0" "6229" "0" "c.6229G>C" "r.(?)" "p.(Gly2077Arg)" "17" "0000175834" "00005473" "90" "6230" "0" "6230" "0" "c.6230G>A" "r.(?)" "p.(Gly2077Asp)" "17" "0000175835" "00005473" "90" "6185" "0" "6185" "0" "c.6185G>A" "r.(?)" "p.(Gly2062Asp)" "16" "0000175838" "00005473" "90" "4912" "0" "4912" "0" "c.4912G>A" "r.(?)" "p.(Ala1638Thr)" "11" "0000175839" "00005473" "30" "6156" "4" "6156" "4" "c.6156+4C>T" "r.spl" "p.?" "15i" "0000175842" "00005473" "90" "7066" "0" "7066" "0" "c.7066G>T" "r.(?)" "p.(Gly2356*)" "32" "0000175862" "00005473" "90" "6247" "0" "6247" "0" "c.6247G>T" "r.(?)" "p.(Gly2083Cys)" "17" "0000175863" "00005473" "50" "1688" "0" "1688" "0" "c.1688A>G" "r.(?)" "p.(Asp563Gly)" "5" "0000175885" "00005473" "90" "5839" "-3" "5839" "-3" "c.5839-3C>T" "r.spl?" "p.?" "12i" "0000175889" "00005473" "90" "7669" "-3" "7669" "-3" "c.7669-3C>G" "r.spl?" "p.?" "36i" "0000175951" "00005473" "50" "2536" "0" "2536" "0" "c.2536G>A" "r.(?)" "p.(Ala846Thr)" "7" "0000175952" "00005473" "50" "1791" "0" "1791" "0" "c.1791C>A" "r.(?)" "p.(Phe597Leu)" "5" "0000175953" "00005473" "50" "4436" "0" "4436" "0" "c.4436A>T" "r.(?)" "p.(Gln1479Leu)" "10" "0000175954" "00005473" "50" "882" "0" "882" "0" "c.882C>T" "r.(?)" "p.(=)" "6" "0000175955" "00005473" "50" "3054" "0" "3054" "0" "c.3054C>T" "r.(?)" "p.(=)" "7" "0000175956" "00005473" "90" "730" "0" "730" "0" "c.730A>G" "r.(?)" "p.(Ile244Val)" "4" "0000175957" "00005473" "90" "6309" "10" "6309" "10" "c.6309+10C>G" "r.spl?" "p.(=)" "18i" "0000175958" "00005473" "90" "4399" "0" "4399" "0" "c.4399A>G" "r.(?)" "p.(Asn1467Asp)" "10" "0000175959" "00005473" "90" "6871" "0" "6871" "0" "c.6871G>C" "r.(?)" "p.(Gly2291Arg)" "28" "0000175960" "00005473" "90" "4928" "0" "4928" "0" "c.4928T>G" "r.(?)" "p.(Leu1643Arg)" "11" "0000175961" "00005473" "90" "6210" "5" "6210" "5" "c.6210+5G>A" "r.spl?" "p.?" "16i" "0000175962" "00005473" "90" "5035" "0" "5035" "0" "c.5035G>T" "r.(?)" "p.(Gly1679Trp)" "11" "0000175963" "00005473" "90" "6282" "1" "6282" "1" "c.6282+1G>A" "r.spl?" "p.?" "17i" "0000175964" "00005473" "90" "7258" "0" "7258" "0" "c.7258C>T" "r.(?)" "p.(Arg2420Trp)" "36" "0000175965" "00005473" "90" "6199" "0" "6199" "0" "c.6199G>A" "r.(?)" "p.(Glu2067Lys)" "16" "0000175966" "00005473" "90" "6166" "0" "6166" "0" "c.6166G>T" "r.(?)" "p.(Gly2056Arg)" "16" "0000175967" "00005473" "90" "6820" "0" "6820" "0" "c.6820G>A" "r.(?)" "p.(Glu2274Lys)" "28" "0000175968" "00005473" "90" "5035" "0" "5035" "0" "c.5035G>T" "r.(?)" "p.(Gly1679Trp)" "11" "0000175969" "00005473" "90" "6158" "0" "6158" "0" "c.6158G>T" "r.(?)" "p.(Gly2053Val)" "16" "0000175970" "00005473" "90" "4859" "0" "4859" "0" "c.4859C>T" "r.0" "p.0" "10" "0000175971" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl?" "p.?" "16i" "0000175972" "00005473" "90" "6199" "0" "6199" "0" "c.6199G>A" "r.(?)" "p.(Glu2067Lys)" "16" "0000175973" "00005473" "90" "6224" "0" "6224" "0" "c.6224C>T" "r.(?)" "p.(Pro2057Leu)" "17" "0000175974" "00005473" "90" "5035" "0" "5035" "0" "c.5035G>T" "r.(?)" "p.(Gly1679Trp)" "11" "0000175975" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl?" "p.?" "16i" "0000175976" "00005473" "90" "5794" "0" "5797" "0" "c.5794_5797dup" "r.(?)" "p.(Tyr1933Cysfs*22)" "12" "0000175977" "00005473" "90" "6224" "0" "6224" "0" "c.6224C>T" "r.(?)" "p.(Pro2057Leu)" "17" "0000175978" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl?" "p.?" "16i" "0000175979" "00005473" "90" "5524" "0" "5524" "0" "c.5524G>A" "r.(?)" "p.(Gly1842Arg)" "12" "0000175980" "00005473" "90" "6158" "0" "6158" "0" "c.6158G>T" "r.(?)" "p.(Gly2053Val)" "16" "0000175981" "00005473" "90" "6230" "0" "6230" "0" "c.6230G>A" "r.(?)" "p.(Gly2077Asp)" "17" "0000175982" "00005473" "90" "5126" "0" "5137" "0" "c.5126_5137del" "r.(?)" "p.(Val1709_Lys1712del)" "11" "0000175983" "00005473" "90" "4436" "0" "4436" "0" "c.4436A>T" "r.(?)" "p.(Gln1479Leu)" "10" "0000175988" "00005473" "90" "6238" "0" "6238" "0" "c.6238G>T" "r.(?)" "p.(Gly2080Cys)" "17" "0000175991" "00005473" "70" "8634" "0" "8634" "0" "c.8634del" "r.(?)" "p.(Thr2879Argfs*5)" "40" "0000175993" "00005473" "50" "5953" "0" "5953" "0" "c.5953G>A" "r.(?)" "p.(Val1985Met)" "14" "0000175999" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.6855g>c" "p.=" "28" "0000176000" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176001" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.9206c>u" "p.Thr3069Ile" "41" "0000176002" "00005473" "50" "6140" "0" "6140" "0" "c.6140G>A" "r.(?)" "p.(Gly2047Asp)" "15" "0000176015" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176016" "00005473" "10" "8491" "0" "8491" "0" "c.8491G>C" "r.8491g>c" "p.Asp2831His" "39" "0000176017" "00005473" "10" "8780" "0" "8780" "0" "c.8780T>C" "r.8780u>c" "p.Met2927Thr" "40" "0000176018" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176019" "00005473" "10" "9034" "0" "9034" "0" "c.9034G>C" "r.9034g>c" "p.Ala3012Pro" "41" "0000176024" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.6855g>c" "p.=" "28" "0000176025" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.7929g>a" "p.=" "38" "0000176026" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.9206c>u" "p.Thr3069Ile" "41" "0000176027" "00005473" "10" "2030" "0" "2030" "0" "c.2030G>A" "r.(?)" "p.(Arg677His)" "6" "0000176034" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.6855g>c" "p.=" "28" "0000176035" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.7929g>a" "p.=" "38" "0000176036" "00005473" "10" "8780" "0" "8780" "0" "c.8780T>C" "r.8780u>c" "p.Met2927Thr" "40" "0000176037" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176038" "00005473" "10" "9034" "0" "9034" "0" "c.9034G>C" "r.9034g>c" "p.Ala3012Pro" "41" "0000176051" "00005473" "90" "5020" "0" "5020" "0" "c.5020G>A" "r.(?)" "p.(Asp1674Asn)" "11" "0000176052" "00005473" "90" "1393" "0" "1393" "0" "c.1393C>T" "r.(?)" "p.(Arg465*)" "5" "0000176053" "00005473" "90" "6930" "5" "6930" "5" "c.6930+5G>A" "r.6880_6930del" "p.Gly2294_Lys2310del" "29i" "0000176054" "00005473" "90" "7024" "0" "7024" "0" "c.7024C>T" "r.(?)" "p.(Arg2342*)" "31" "0000176064" "00005473" "10" "2030" "0" "2030" "0" "c.2030G>A" "r.2030g>a" "p.Arg677His" "6" "0000176065" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.6855g>c" "p.=" "28" "0000176066" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176067" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176068" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176069" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176070" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176071" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176072" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.7929g>a" "p.=" "38" "0000176073" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.8451a>g" "p.=" "38" "0000176074" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.8451a>g" "p.=" "38" "0000176075" "00005473" "10" "8780" "0" "8780" "0" "c.8780T>C" "r.8780u>c" "p.Met2927Thr" "40" "0000176076" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176077" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176078" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.8962a>g" "p.Met2988Val" "40" "0000176079" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.8962a>g" "p.Met2988Val" "40" "0000176080" "00005473" "10" "9034" "0" "9034" "0" "c.9034G>C" "r.9034g>c" "p.Ala3012Pro" "41" "0000176081" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.9206c>u" "p.Thr3069Ile" "41" "0000176092" "00005473" "10" "1389" "0" "1389" "0" "c.1389C>T" "r.1389c>u" "p.=" "5" "0000176093" "00005473" "10" "3129" "0" "3129" "0" "c.3129C>T" "r.3129c>u" "p.=" "8" "0000176094" "00005473" "10" "4311" "0" "4311" "0" "c.4311T>C" "r.4311u>c" "p.=" "10" "0000176095" "00005473" "10" "4533" "0" "4533" "0" "c.4533G>T" "r.4533g>u" "p.=" "10" "0000176096" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.6855g>c" "p.=" "28" "0000176097" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176098" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176099" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176100" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176101" "00005473" "10" "7357" "0" "7357" "0" "c.7357G>A" "r.7357g>a" "p.Glu2453Lys" "36" "0000176102" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176103" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.7842c>u" "p.=" "38" "0000176104" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.7842c>u" "p.=" "38" "0000176105" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.8451a>g" "p.=" "38" "0000176106" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.8451a>g" "p.=" "38" "0000176107" "00005473" "10" "8491" "0" "8491" "0" "c.8491G>C" "r.8491g>c" "p.Asp2831His" "39" "0000176108" "00005473" "10" "8780" "0" "8780" "0" "c.8780T>C" "r.8780u>c" "p.Met2927Thr" "40" "0000176109" "00005473" "10" "8780" "0" "8780" "0" "c.8780T>C" "r.8780u>c" "p.Met2927Thr" "40" "0000176110" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176111" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176112" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.8962a>g" "p.Met2988Val" "40" "0000176113" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.8962a>g" "p.Met2988Val" "40" "0000176114" "00005473" "10" "9034" "0" "9034" "0" "c.9034G>C" "r.9034g>c" "p.Ala3012Pro" "41" "0000176125" "00005473" "10" "4311" "0" "4311" "0" "c.4311T>C" "r.4311u>c" "p.=" "10" "0000176126" "00005473" "10" "4533" "0" "4533" "0" "c.4533G>T" "r.4533g>u" "p.=" "10" "0000176127" "00005473" "10" "4727" "0" "4727" "0" "c.4727G>A" "r.4727g>a" "p.Arg1576Gln" "10" "0000176128" "00005473" "90" "5177" "0" "5177" "0" "c.5177T>G" "r.5177u>g" "p.Leu1726Arg" "11" "0000176129" "00005473" "10" "6369" "0" "6369" "0" "c.6369G>A" "r.6369g>a" "p.=" "20" "0000176130" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.6855g>c" "p.=" "28" "0000176131" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.6855g>c" "p.=" "28" "0000176132" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176133" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176134" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176135" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176136" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176137" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176138" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.7842c>u" "p.=" "38" "0000176139" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.7842c>u" "p.=" "38" "0000176140" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.7929g>a" "p.=" "38" "0000176141" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.7929g>a" "p.=" "38" "0000176142" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.8451a>g" "p.=" "38" "0000176143" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.8451a>g" "p.=" "38" "0000176144" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176145" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176146" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.8962a>g" "p.Met2988Val" "40" "0000176147" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.8962a>g" "p.Met2988Val" "40" "0000176148" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.9206c>u" "p.Thr3069Ile" "41" "0000176149" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.9206c>u" "p.Thr3069Ile" "41" "0000176150" "00005473" "10" "9213" "0" "9213" "0" "c.9213C>T" "r.9213c>u" "p.=" "41" "0000176151" "00005473" "10" "9213" "0" "9213" "0" "c.9213C>T" "r.9213c>u" "p.=" "41" "0000176164" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.6855g>c" "p.=" "28" "0000176165" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176166" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176167" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176168" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176169" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176170" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176171" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.7842c>u" "p.=" "38" "0000176172" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.7929g>a" "p.=" "38" "0000176173" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.8451a>g" "p.=" "38" "0000176174" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176175" "00005473" "10" "8877" "0" "8879" "0" "c.8877_8879del" "r.8877_8879del" "p.Ala2960del" "40" "0000176176" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.8962a>g" "p.Met2988Val" "40" "0000176177" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.9206c>u" "p.Thr3069Ile" "41" "0000176188" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.6855g>c" "p.=" "28" "0000176189" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.6855g>c" "p.=" "28" "0000176190" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176191" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176192" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176193" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176194" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176195" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176196" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.7842c>u" "p.=" "38" "0000176197" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.7842c>u" "p.=" "38" "0000176198" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.7929g>a" "p.=" "38" "0000176199" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.7929g>a" "p.=" "38" "0000176200" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.8451a>g" "p.=" "38" "0000176201" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.8451a>g" "p.=" "38" "0000176202" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176203" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176204" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.8962a>g" "p.Met2988Val" "40" "0000176205" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.8962a>g" "p.Met2988Val" "40" "0000176206" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.9206c>u" "p.Thr3069Ile" "41" "0000176207" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.9206c>u" "p.Thr3069Ile" "41" "0000176221" "00005473" "10" "4311" "0" "4311" "0" "c.4311T>C" "r.4311u>c" "p.=" "10" "0000176222" "00005473" "10" "4533" "0" "4533" "0" "c.4533G>T" "r.4533g>u" "p.=" "10" "0000176223" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.6855g>c" "p.=" "28" "0000176224" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176225" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176226" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176227" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176228" "00005473" "10" "7509" "0" "7509" "0" "c.7509G>A" "r.7509g>a" "p.=" "36" "0000176229" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176230" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.7842c>u" "p.=" "38" "0000176231" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.8451a>g" "p.=" "38" "0000176232" "00005473" "10" "8491" "0" "8491" "0" "c.8491G>C" "r.8491g>c" "p.Asp2831His" "39" "0000176233" "00005473" "10" "8780" "0" "8780" "0" "c.8780T>C" "r.8780u>c" "p.Met2927Thr" "40" "0000176234" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176235" "00005473" "10" "8877" "0" "8879" "0" "c.8877_8879del" "r.8877_8879del" "p.Ala2960del" "40" "0000176236" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.8962a>g" "p.Met2988Val" "40" "0000176245" "00005473" "10" "6369" "0" "6369" "0" "c.6369G>A" "r.6369g>a" "p.=" "20" "0000176246" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.6855g>c" "p.=" "28" "0000176247" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176248" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176249" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176250" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176251" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176252" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.7842c>u" "p.=" "38" "0000176253" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.7842c>u" "p.=" "38" "0000176254" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.7929g>a" "p.=" "38" "0000176255" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.8451a>g" "p.=" "38" "0000176256" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.8451a>g" "p.=" "38" "0000176257" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176258" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176259" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.8962a>g" "p.Met2988Val" "40" "0000176260" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.8962a>g" "p.Met2988Val" "40" "0000176261" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.9206c>u" "p.Thr3069Ile" "41" "0000176274" "00005473" "10" "4311" "0" "4311" "0" "c.4311T>C" "r.4311u>c" "p.=" "10" "0000176275" "00005473" "10" "4533" "0" "4533" "0" "c.4533G>T" "r.4533g>u" "p.=" "10" "0000176276" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.6855g>c" "p.=" "28" "0000176277" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176278" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.6945c>u" "p.=" "30" "0000176279" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176280" "00005473" "10" "7292" "0" "7292" "0" "c.7292A>T" "r.7292a>u" "p.Asp2431Val" "36" "0000176281" "00005473" "10" "7509" "0" "7509" "0" "c.7509G>A" "r.7509g>a" "p.=" "36" "0000176282" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176283" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.7596g>a" "p.=" "36" "0000176284" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.7842c>u" "p.=" "38" "0000176285" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.7929g>a" "p.=" "38" "0000176286" "00005473" "10" "7980" "0" "7980" "0" "c.7980C>T" "r.7980c>u" "p.=" "38" "0000176287" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.8451a>g" "p.=" "38" "0000176288" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.8820g>a" "p.=" "40" "0000176289" "00005473" "10" "8877" "0" "8879" "0" "c.8877_8879del" "r.8877_8879del" "p.Ala2960del" "40" "0000176290" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.8962a>g" "p.Met2988Val" "40" "0000176291" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.9206c>u" "p.Thr3069Ile" "41" "0000176296" "00005473" "70" "6472" "-2" "6472" "-2" "c.6472-2A>G" "r.spl?" "p.(del?)" "21i" "0000176301" "00005473" "70" "7162" "2" "7162" "2" "c.7162+2dup" "r.spl?" "p.?" "34i" "0000176302" "00005473" "30" "4727" "0" "4727" "0" "c.4727G>A" "r.(?)" "p.(Arg1576Gln)" "10" "0000176303" "00005473" "50" "8822" "0" "8822" "0" "c.8822C>T" "r.(?)" "p.(Ala2941Val)" "40" "0000176311" "00005473" "50" "6452" "0" "6452" "0" "c.6452T>C" "r.(?)" "p.(Val2151Ala)" "21" "0000176320" "00005473" "50" "1688" "0" "1688" "0" "c.1688A>G" "r.(?)" "p.(Asp563Gly)" "5" "0000176321" "00005473" "50" "9245" "0" "9245" "0" "c.9245C>G" "r.(?)" "p.(Pro3082Arg)" "42" "0000176326" "00005473" "50" "6224" "0" "6224" "0" "c.6224C>T" "r.(?)" "p.(Pro2057Leu)" "17" "0000176327" "00005473" "90" "6931" "0" "6931" "0" "c.6931G>A" "r.(?)" "p.(Gly2311Arg)" "30" "0000176331" "00005473" "90" "5044" "0" "5044" "0" "c.5044delC" "r.(?)" "p.(Gln1682Serfs*12)" "11" "0000176351" "00005473" "90" "1223" "0" "1223" "0" "c.1223T>C" "r.(?)" "p.(Phe408Ser)" "4" "0000176356" "00005473" "90" "7066" "0" "7066" "0" "c.7066G>A" "r.(?)" "p.(Gly2356Arg)" "32" "0000176359" "00005473" "50" "4117" "0" "4117" "0" "c.4117G>A" "r.(?)" "p.(Ala1373Thr)" "9" "0000176374" "00005473" "50" "5100" "0" "5100" "0" "c.5100G>A" "r.(?)" "p.(=)" "11i" "0000176375" "00005473" "50" "6199" "0" "6199" "0" "c.6199G>A" "r.(?)" "p.(Glu2067Lys)" "16" "0000176376" "00005473" "90" "6156" "2" "6156" "2" "c.6156+2T>G" "r.spl?" "p.?" "15i" "0000176377" "00005473" "50" "8009" "0" "8009" "0" "c.8009C>T" "r.(?)" "p.(Ala2670Val)" "38" "0000176378" "00005473" "50" "1914" "0" "1914" "0" "c.1914G>A" "r.(?)" "p.(=)" "6" "0000176379" "00005473" "90" "1976" "0" "1976" "0" "c.1976G>A" "r.(?)" "p.(Arg659His)" "4" "0000176380" "00005473" "50" "4169" "0" "4169" "0" "c.4169C>T" "r.(?)" "p.(Ser1390Leu)" "9" "0000176381" "00005473" "90" "7645" "0" "7645" "0" "c.7645C>T" "r.(?)" "p.(Arg2549Trp)" "36" "0000176383" "00005473" "70" "8634" "0" "8634" "0" "c.8634del" "r.(?)" "p.(Thr2879Argfs*5)" "40" "0000245732" "00005473" "10" "4311" "0" "4311" "0" "c.4311T>C" "r.(?)" "p.(Ile1437=)" "" "0000245843" "00005473" "10" "9411" "0" "9411" "0" "c.9411T>C" "r.(?)" "p.(Cys3137=)" "" "0000245939" "00005473" "10" "6880" "-47" "6880" "-47" "c.6880-47T>C" "r.(=)" "p.(=)" "" "0000245940" "00005473" "10" "-31" "17" "-31" "17" "c.-31+17T>C" "r.(=)" "p.(=)" "" "0000245982" "00005473" "30" "1478" "0" "1478" "0" "c.1478T>C" "r.(?)" "p.(Val493Ala)" "" "0000250954" "00005473" "10" "4311" "0" "4311" "0" "c.4311T>C" "r.(?)" "p.(Ile1437=)" "" "0000253517" "00005473" "10" "3879" "0" "3879" "0" "c.3879T>G" "r.(?)" "p.(Asp1293Glu)" "" "0000255033" "00005473" "30" "2463" "0" "2463" "0" "c.2463T>C" "r.(?)" "p.(Ser821=)" "" "0000264869" "00005473" "10" "10199" "0" "10199" "0" "c.*665del" "r.(?)" "p.(=)" "" "0000264870" "00005473" "30" "10199" "0" "10199" "0" "c.*665G>T" "r.(=)" "p.(=)" "" "0000264871" "00005473" "10" "9541" "0" "9541" "0" "c.*7G>C" "r.(=)" "p.(=)" "" "0000264872" "00005473" "10" "1182" "0" "1182" "0" "c.1182C>T" "r.(?)" "p.(Thr394=)" "" "0000264873" "00005473" "10" "1231" "0" "1231" "0" "c.1231C>G" "r.(?)" "p.(Leu411Val)" "" "0000264874" "00005473" "10" "1313" "-17" "1313" "-17" "c.1313-17A>G" "r.(=)" "p.(=)" "" "0000264875" "00005473" "10" "1471" "0" "1471" "0" "c.1471G>C" "r.(?)" "p.(Asp491His)" "" "0000264876" "00005473" "10" "1475" "0" "1475" "0" "c.1475C>G" "r.(?)" "p.(Thr492Ser)" "" "0000264877" "00005473" "90" "175" "0" "175" "0" "c.175C>T" "r.(?)" "p.(Arg59Ter)" "" "0000264878" "00005473" "30" "1977" "0" "1977" "0" "c.1977C>T" "r.(?)" "p.(Arg659=)" "" "0000264879" "00005473" "10" "2419" "0" "2419" "0" "c.2419G>A" "r.(?)" "p.(Ala807Thr)" "" "0000264880" "00005473" "10" "2488" "0" "2488" "0" "c.2488G>T" "r.(?)" "p.(Ala830Ser)" "" "0000264881" "00005473" "50" "3040" "0" "3040" "0" "c.3040A>G" "r.(?)" "p.(Lys1014Glu)" "" "0000264882" "00005473" "10" "3071" "-16" "3071" "-16" "c.3071-16G>A" "r.(=)" "p.(=)" "" "0000264884" "00005473" "10" "3129" "0" "3129" "0" "c.3129C>T" "r.(?)" "p.(Gly1043=)" "" "0000264885" "00005473" "10" "3262" "0" "3262" "0" "c.3262A>C" "r.(?)" "p.(Lys1088Gln)" "" "0000264886" "00005473" "30" "3270" "0" "3270" "0" "c.3270C>T" "r.(?)" "p.(Asp1090=)" "" "0000264887" "00005473" "30" "4285" "17" "4285" "17" "c.4285+17G>A" "r.(=)" "p.(=)" "" "0000264888" "00005473" "10" "4107" "0" "4107" "0" "c.4107C>T" "r.(?)" "p.(Ile1369=)" "" "0000264889" "00005473" "10" "4533" "0" "4533" "0" "c.4533G>T" "r.(?)" "p.(Gly1511=)" "" "0000264890" "00005473" "10" "4727" "0" "4727" "0" "c.4727G>A" "r.(?)" "p.(Arg1576Gln)" "" "0000264891" "00005473" "10" "4895" "0" "4895" "0" "c.4895G>A" "r.(?)" "p.(Arg1632Gln)" "" "0000264892" "00005473" "10" "5261" "0" "5261" "0" "c.5261A>G" "r.(?)" "p.(Lys1754Arg)" "" "0000264894" "00005473" "50" "6053" "0" "6053" "0" "c.6053C>T" "r.(?)" "p.(Ala2018Val)" "" "0000264895" "00005473" "10" "6063" "13" "6063" "13" "c.6063+13dup" "r.(=)" "p.(=)" "" "0000264897" "00005473" "10" "6157" "-54" "6157" "-54" "c.6157-54G>C" "r.(=)" "p.(=)" "" "0000264898" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl?" "p.?" "" "0000264899" "00005473" "90" "6282" "1" "6282" "1" "c.6282+1G>A" "r.spl?" "p.?" "" "0000264900" "00005473" "90" "6293" "0" "6293" "0" "c.6293G>T" "r.(?)" "p.(Gly2098Val)" "" "0000264901" "00005473" "10" "6369" "0" "6369" "0" "c.6369G>A" "r.(?)" "p.(Leu2123=)" "" "0000264902" "00005473" "30" "6653" "0" "6653" "0" "c.6653C>T" "r.(?)" "p.(Pro2218Leu)" "" "0000264903" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.(?)" "p.(Gly2285=)" "" "0000264904" "00005473" "10" "6930" "43" "6930" "43" "c.6930+43G>C" "r.(=)" "p.(=)" "" "0000264905" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.(?)" "p.(Phe2315=)" "" "0000264906" "00005473" "10" "6981" "0" "6981" "0" "c.6981A>G" "r.(?)" "p.(Glu2327=)" "" "0000264907" "00005473" "10" "7086" "0" "7086" "0" "c.7086A>C" "r.(?)" "p.(Gly2362=)" "" "0000264908" "00005473" "10" "7092" "26" "7092" "26" "c.7092+26G>A" "r.(=)" "p.(=)" "" "0000264909" "00005473" "10" "7329" "0" "7329" "0" "c.7329C>T" "r.(?)" "p.(Ala2443=)" "" "0000264910" "00005473" "50" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000264911" "00005473" "10" "7509" "0" "7509" "0" "c.7509G>A" "r.(?)" "p.(Arg2503=)" "" "0000264912" "00005473" "10" "7512" "0" "7512" "0" "c.7512C>T" "r.(?)" "p.(Asn2504=)" "" "0000264913" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.(?)" "p.(Lys2532=)" "" "0000264914" "00005473" "10" "7668" "21" "7668" "21" "c.7668+21G>C" "r.(=)" "p.(=)" "" "0000264915" "00005473" "10" "768" "0" "768" "0" "c.768C>T" "r.(?)" "p.(Val256=)" "" "0000264916" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.(?)" "p.(Ser2614=)" "" "0000264917" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.(?)" "p.(Ala2643=)" "" "0000264918" "00005473" "10" "7995" "0" "7995" "0" "c.7995A>C" "r.(?)" "p.(Ala2665=)" "" "0000264919" "00005473" "10" "8010" "0" "8010" "0" "c.8010G>A" "r.(?)" "p.(Ala2670=)" "" "0000264920" "00005473" "10" "8145" "0" "8145" "0" "c.8145A>G" "r.(?)" "p.(Leu2715=)" "" "0000264921" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.(?)" "p.(Pro2817=)" "" "0000264922" "00005473" "50" "8464" "20" "8464" "20" "c.8464+20G>C" "r.(=)" "p.(=)" "" "0000264923" "00005473" "10" "8491" "0" "8491" "0" "c.8491G>C" "r.(?)" "p.(Asp2831His)" "" "0000264924" "00005473" "50" "8724" "0" "8724" "0" "c.8724C>T" "r.(?)" "p.(Ala2908=)" "" "0000264925" "00005473" "50" "8819" "0" "8819" "0" "c.8819C>T" "r.(?)" "p.(Thr2940Met)" "" "0000264926" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.(?)" "p.(Thr2940=)" "" "0000264927" "00005473" "10" "8822" "0" "8822" "0" "c.8822C>T" "r.(?)" "p.(Ala2941Val)" "" "0000264928" "00005473" "10" "8877" "0" "8879" "0" "c.8877_8879del" "r.(?)" "p.(Ala2960del)" "" "0000264929" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.(?)" "p.(Met2988Val)" "" "0000264930" "00005473" "50" "9012" "0" "9012" "0" "c.9012C>T" "r.(?)" "p.(Ser3004=)" "" "0000264931" "00005473" "10" "9034" "0" "9034" "0" "c.9034G>C" "r.(?)" "p.(Ala3012Pro)" "" "0000264932" "00005473" "10" "9123" "0" "9123" "0" "c.9123G>A" "r.(?)" "p.(Thr3041=)" "" "0000264933" "00005473" "50" "9128" "0" "9128" "0" "c.9128G>A" "r.(?)" "p.(Arg3043His)" "" "0000264934" "00005473" "10" "9129" "0" "9129" "0" "c.9129C>T" "r.(?)" "p.(Arg3043=)" "" "0000264935" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.(?)" "p.(Thr3069Ile)" "" "0000264936" "00005473" "10" "9213" "0" "9213" "0" "c.9213C>T" "r.(?)" "p.(His3071=)" "" "0000264937" "00005473" "10" "9494" "-26" "9494" "-26" "c.9494-26C>T" "r.(=)" "p.(=)" "" "0000267010" "00005473" "10" "9541" "0" "9541" "0" "c.*7G>C" "r.(=)" "p.(=)" "" "0000267011" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.(?)" "p.(Gly2285=)" "" "0000267012" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.(?)" "p.(Ala2643=)" "" "0000267013" "00005473" "10" "9034" "0" "9034" "0" "c.9034G>C" "r.(?)" "p.(Ala3012Pro)" "" "0000267014" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.(?)" "p.(Thr3069Ile)" "" "0000270503" "00005473" "30" "1471" "0" "1471" "0" "c.1471G>C" "r.(?)" "p.(Asp491His)" "" "0000270504" "00005473" "30" "1475" "0" "1475" "0" "c.1475C>G" "r.(?)" "p.(Thr492Ser)" "" "0000270505" "00005473" "30" "2419" "0" "2419" "0" "c.2419G>A" "r.(?)" "p.(Ala807Thr)" "" "0000270506" "00005473" "30" "2488" "0" "2488" "0" "c.2488G>T" "r.(?)" "p.(Ala830Ser)" "" "0000270507" "00005473" "30" "4285" "9" "4285" "9" "c.4285+9G>A" "r.(=)" "p.(=)" "" "0000270508" "00005473" "10" "4533" "0" "4533" "0" "c.4533G>T" "r.(?)" "p.(Gly1511=)" "" "0000270509" "00005473" "30" "4727" "0" "4727" "0" "c.4727G>A" "r.(?)" "p.(Arg1576Gln)" "" "0000270510" "00005473" "30" "5261" "0" "5261" "0" "c.5261A>G" "r.(?)" "p.(Lys1754Arg)" "" "0000270511" "00005473" "90" "6157" "-2" "6157" "-2" "c.6157-2A>G" "r.spl?" "p.?" "" "0000270512" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.(?)" "p.(Gly2285=)" "" "0000270513" "00005473" "50" "6868" "0" "6868" "0" "c.6868C>T" "r.(?)" "p.(Arg2290Cys)" "" "0000270514" "00005473" "10" "9034" "0" "9034" "0" "c.9034G>C" "r.(?)" "p.(Ala3012Pro)" "" "0000270515" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.(?)" "p.(Thr3069Ile)" "" "0000274279" "00005473" "30" "3531" "0" "3531" "0" "c.3531C>G" "r.(?)" "p.(Thr1177=)" "" "0000274280" "00005473" "30" "4103" "0" "4103" "0" "c.4103C>T" "r.(?)" "p.(Thr1368Met)" "" "0000274281" "00005473" "30" "5574" "0" "5574" "0" "c.5574C>T" "r.(?)" "p.(Phe1858=)" "" "0000274282" "00005473" "50" "5833" "0" "5833" "0" "c.5833G>C" "r.(?)" "p.(Val1945Leu)" "" "0000274283" "00005473" "50" "730" "0" "730" "0" "c.730A>G" "r.(?)" "p.(Ile244Val)" "" "0000274284" "00005473" "30" "7401" "0" "7401" "0" "c.7401G>A" "r.(?)" "p.(Ser2467=)" "" "0000274285" "00005473" "50" "7748" "0" "7748" "0" "c.7748C>T" "r.(?)" "p.(Thr2583Met)" "" "0000274286" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "" "0000274287" "00005473" "50" "8846" "0" "8846" "0" "c.8846C>T" "r.(?)" "p.(Pro2949Leu)" "" "0000274288" "00005473" "50" "9214" "0" "9214" "0" "c.9214G>A" "r.(?)" "p.(Gly3072Arg)" "" "0000328194" "00005473" "70" "9475" "0" "9475" "0" "c.9475G>T" "r.(?)" "p.(Glu3159Ter)" "" "0000328195" "00005473" "30" "9123" "0" "9123" "0" "c.9123G>A" "r.(?)" "p.(Thr3041=)" "" "0000328196" "00005473" "50" "9061" "0" "9063" "0" "c.9061_9063del" "r.(?)" "p.(Asp3021del)" "" "0000328200" "00005473" "30" "7509" "0" "7509" "0" "c.7509G>A" "r.(?)" "p.(Arg2503=)" "" "0000328201" "00005473" "30" "7359" "0" "7359" "0" "c.7359G>A" "r.(?)" "p.(Glu2453=)" "" "0000328202" "00005473" "30" "7114" "0" "7114" "0" "c.7114G>A" "r.(?)" "p.(Asp2372Asn)" "" "0000328203" "00005473" "50" "6898" "0" "6898" "0" "c.6898G>A" "r.(?)" "p.(Gly2300Arg)" "" "0000328204" "00005473" "50" "6868" "0" "6868" "0" "c.6868C>T" "r.(?)" "p.(Arg2290Cys)" "" "0000328205" "00005473" "30" "6157" "-16" "6157" "-16" "c.6157-16G>A" "r.(=)" "p.(=)" "" "0000328206" "00005473" "30" "6156" "4" "6156" "4" "c.6156+4C>T" "r.spl?" "p.?" "" "0000328208" "00005473" "50" "5609" "0" "5609" "0" "c.5609G>A" "r.(?)" "p.(Ser1870Asn)" "" "0000328209" "00005473" "30" "5261" "0" "5261" "0" "c.5261A>G" "r.(?)" "p.(Lys1754Arg)" "" "0000328210" "00005473" "30" "4895" "0" "4895" "0" "c.4895G>A" "r.(?)" "p.(Arg1632Gln)" "" "0000328211" "00005473" "30" "4727" "0" "4727" "0" "c.4727G>A" "r.(?)" "p.(Arg1576Gln)" "" "0000328213" "00005473" "30" "4285" "17" "4285" "17" "c.4285+17G>A" "r.(=)" "p.(=)" "" "0000328215" "00005473" "30" "4107" "0" "4107" "0" "c.4107C>T" "r.(?)" "p.(Ile1369=)" "" "0000328218" "00005473" "50" "3088" "0" "3088" "0" "c.3088G>A" "r.(?)" "p.(Val1030Met)" "" "0000328219" "00005473" "30" "2488" "0" "2488" "0" "c.2488G>T" "r.(?)" "p.(Ala830Ser)" "" "0000328220" "00005473" "30" "2463" "0" "2463" "0" "c.2463T>C" "r.(?)" "p.(Ser821=)" "" "0000328221" "00005473" "30" "2419" "0" "2419" "0" "c.2419G>A" "r.(?)" "p.(Ala807Thr)" "" "0000328222" "00005473" "50" "1688" "0" "1688" "0" "c.1688A>G" "r.(?)" "p.(Asp563Gly)" "" "0000328224" "00005473" "30" "1475" "0" "1475" "0" "c.1475C>G" "r.(?)" "p.(Thr492Ser)" "" "0000328225" "00005473" "30" "1471" "0" "1471" "0" "c.1471G>C" "r.(?)" "p.(Asp491His)" "" "0000328226" "00005473" "30" "1389" "0" "1389" "0" "c.1389C>T" "r.(?)" "p.(Ala463=)" "" "0000328227" "00005473" "50" "776" "0" "776" "0" "c.776C>T" "r.(?)" "p.(Ala259Val)" "" "0000337575" "00005473" "10" "9541" "0" "9541" "0" "c.*7G>C" "r.(=)" "p.(=)" "" "0000337576" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl?" "p.?" "" "0000337578" "00005473" "10" "3071" "-16" "3071" "-16" "c.3071-16G>A" "r.(=)" "p.(=)" "" "0000337579" "00005473" "10" "1313" "-17" "1313" "-17" "c.1313-17A>G" "r.(=)" "p.(=)" "" "0000337580" "00005473" "10" "-31" "17" "-31" "17" "c.-31+17T>C" "r.(=)" "p.(=)" "" "0000339720" "00005473" "10" "9411" "0" "9411" "0" "c.9411T>C" "r.(?)" "p.(Cys3137=)" "" "0000339721" "00005473" "10" "9213" "0" "9213" "0" "c.9213C>T" "r.(?)" "p.(His3071=)" "" "0000339722" "00005473" "10" "9129" "0" "9129" "0" "c.9129C>T" "r.(?)" "p.(Arg3043=)" "" "0000339723" "00005473" "10" "9123" "0" "9123" "0" "c.9123G>A" "r.(?)" "p.(Thr3041=)" "" "0000339724" "00005473" "10" "8820" "0" "8820" "0" "c.8820G>A" "r.(?)" "p.(Thr2940=)" "" "0000339725" "00005473" "10" "8451" "0" "8451" "0" "c.8451A>G" "r.(?)" "p.(Pro2817=)" "" "0000339726" "00005473" "10" "7929" "0" "7929" "0" "c.7929G>A" "r.(?)" "p.(Ala2643=)" "" "0000339727" "00005473" "10" "7842" "0" "7842" "0" "c.7842C>T" "r.(?)" "p.(Ser2614=)" "" "0000339728" "00005473" "10" "7596" "0" "7596" "0" "c.7596G>A" "r.(?)" "p.(Lys2532=)" "" "0000339729" "00005473" "10" "7512" "0" "7512" "0" "c.7512C>T" "r.(?)" "p.(Asn2504=)" "" "0000339730" "00005473" "10" "7329" "0" "7329" "0" "c.7329C>T" "r.(?)" "p.(Ala2443=)" "" "0000339731" "00005473" "10" "6945" "0" "6945" "0" "c.6945C>T" "r.(?)" "p.(Phe2315=)" "" "0000339732" "00005473" "10" "6855" "0" "6855" "0" "c.6855G>C" "r.(?)" "p.(Gly2285=)" "" "0000339733" "00005473" "10" "6369" "0" "6369" "0" "c.6369G>A" "r.(?)" "p.(Leu2123=)" "" "0000339734" "00005473" "10" "4533" "0" "4533" "0" "c.4533G>T" "r.(?)" "p.(Gly1511=)" "" "0000339735" "00005473" "10" "4311" "0" "4311" "0" "c.4311T>C" "r.(?)" "p.(Ile1437=)" "" "0000339736" "00005473" "10" "3129" "0" "3129" "0" "c.3129C>T" "r.(?)" "p.(Gly1043=)" "" "0000339737" "00005473" "30" "1065" "0" "1065" "0" "c.1065C>T" "r.(?)" "p.(Ala355=)" "" "0000339738" "00005473" "10" "-320" "0" "-320" "0" "c.-320C>G" "r.(?)" "p.(=)" "" "0000340653" "00005473" "10" "1389" "0" "1389" "0" "c.1389C>T" "r.(?)" "p.(Ala463=)" "" "0000340678" "00005473" "10" "7509" "0" "7509" "0" "c.7509G>A" "r.(?)" "p.(Arg2503=)" "" "0000340688" "00005473" "10" "1914" "0" "1914" "0" "c.1914G>A" "r.(?)" "p.(Arg638=)" "" "0000340816" "00005473" "30" "4323" "0" "4323" "0" "c.4323C>T" "r.(?)" "p.(Ile1441=)" "" "0000340844" "00005473" "10" "786" "0" "786" "0" "c.786C>T" "r.(?)" "p.(Leu262=)" "" "0000340880" "00005473" "10" "882" "0" "882" "0" "c.882C>T" "r.(?)" "p.(Phe294=)" "" "0000341051" "00005473" "10" "768" "0" "768" "0" "c.768C>T" "r.(?)" "p.(Val256=)" "" "0000341357" "00005473" "10" "9034" "0" "9034" "0" "c.9034G>C" "r.(?)" "p.(Ala3012Pro)" "" "0000341514" "00005473" "10" "1786" "0" "1786" "0" "c.1786G>T" "r.(?)" "p.(Ala596Ser)" "" "0000341816" "00005473" "50" "3754" "0" "3754" "0" "c.3754C>T" "r.(?)" "p.(Arg1252Cys)" "" "0000342185" "00005473" "90" "5992" "0" "5992" "0" "c.5992C>T" "r.(?)" "p.(Arg1998Ter)" "" "0000342307" "00005473" "50" "6752" "0" "6752" "0" "c.6752G>A" "r.(?)" "p.(Arg2251Gln)" "" "0000342381" "00005473" "50" "7258" "0" "7258" "0" "c.7258C>T" "r.(?)" "p.(Arg2420Trp)" "" "0000343157" "00005473" "50" "14" "0" "14" "0" "c.14G>A" "r.(?)" "p.(Arg5Gln)" "" "0000343219" "00005473" "10" "1976" "0" "1976" "0" "c.1976G>A" "r.(?)" "p.(Arg659His)" "" "0000343873" "00005473" "50" "3220" "0" "3220" "0" "c.3220G>A" "r.(?)" "p.(Asp1074Asn)" "" "0000345210" "00005473" "50" "5734" "0" "5734" "0" "c.5734G>A" "r.(?)" "p.(Glu1912Lys)" "" "0000345227" "00005473" "50" "6199" "0" "6199" "0" "c.6199G>A" "r.(?)" "p.(Glu2067Lys)" "" "0000345798" "00005473" "90" "5309" "0" "5309" "0" "c.5309G>T" "r.(?)" "p.(Gly1770Val)" "" "0000347155" "00005473" "10" "1231" "0" "1231" "0" "c.1231C>G" "r.(?)" "p.(Leu411Val)" "" "0000347369" "00005473" "10" "3262" "0" "3262" "0" "c.3262A>C" "r.(?)" "p.(Lys1088Gln)" "" "0000347806" "00005473" "10" "8780" "0" "8780" "0" "c.8780T>C" "r.(?)" "p.(Met2927Thr)" "" "0000347809" "00005473" "10" "8962" "0" "8962" "0" "c.8962A>G" "r.(?)" "p.(Met2988Val)" "" "0000347981" "00005473" "50" "6251" "0" "6251" "0" "c.6251T>A" "r.(?)" "p.(Phe2084Tyr)" "" "0000348290" "00005473" "10" "6653" "0" "6653" "0" "c.6653C>T" "r.(?)" "p.(Pro2218Leu)" "" "0000349342" "00005473" "50" "5777" "0" "5777" "0" "c.5777C>T" "r.(?)" "p.(Thr1926Met)" "" "0000349434" "00005473" "10" "9206" "0" "9206" "0" "c.9206C>T" "r.(?)" "p.(Thr3069Ile)" "" "0000351059" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>T" "r.spl?" "p.?" "" "0000351060" "00005473" "10" "6157" "-16" "6157" "-16" "c.6157-16G>A" "r.(=)" "p.(=)" "" "0000351061" "00005473" "90" "6156" "2" "6156" "2" "c.6156+2T>C" "r.spl?" "p.?" "" "0000398522" "00005473" "50" "4156" "0" "4156" "0" "c.4156G>A" "r.(?)" "p.(Glu1386Lys)" "" "0000398523" "00005473" "50" "7258" "0" "7258" "0" "c.7258C>T" "r.(?)" "p.(Arg2420Trp)" "" "0000398524" "00005473" "90" "6424" "0" "6424" "0" "c.6424C>T" "r.(?)" "p.(Arg2142*)" "" "0000398525" "00005473" "50" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000398526" "00005473" "50" "4103" "0" "4103" "0" "c.4103C>T" "r.(?)" "p.(Thr1368Met)" "" "0000398527" "00005473" "50" "7192" "0" "7192" "0" "c.7192G>A" "r.(?)" "p.(Val2398Ile)" "" "0000406022" "00005473" "50" "5656" "0" "5656" "0" "c.5656C>T" "r.(?)" "p.(Arg1886Cys)" "" "0000439065" "00005473" "50" "1867" "0" "1867" "0" "c.1867C>T" "r.(?)" "p.Pro623Ser" "" "0000439735" "00005473" "50" "4175" "0" "4175" "0" "c.4175G>A" "r.(?)" "p.Ser1392Asn" "" "0000439875" "00005473" "50" "4615" "0" "4615" "0" "c.4615G>A" "r.(?)" "p.Gly1539Arg" "" "0000440068" "00005473" "50" "2195" "0" "2195" "0" "c.2195C>T" "r.(?)" "p.Thr732Met" "" "0000462002" "00005473" "50" "7029" "10" "7029" "10" "c.7029+10C>T" "r.spl" "p.(=)" "31" "0000462003" "00005473" "50" "8670" "0" "8690" "0" "c.8670_8690del" "r.(?)" "p.(Thr2892_Thr2898del)" "40" "0000462004" "00005473" "50" "5833" "0" "5833" "0" "c.5833G>C" "r.(?)" "p.(Val1945Leu)" "12" "0000462005" "00005473" "50" "5590" "0" "5590" "0" "c.5590G>A" "r.(?)" "p.(Ala1864Thr)" "12" "0000462006" "00005473" "50" "5341" "0" "5341" "0" "c.5341A>G" "r.(?)" "p.(Ile1781Val)" "11" "0000462007" "00005473" "50" "7706" "0" "7706" "0" "c.7706C>G" "r.(?)" "p.(Pro2569Arg)" "37" "0000462008" "00005473" "50" "5833" "0" "5833" "0" "c.5833G>C" "r.(?)" "p.(Val1945Leu)" "12" "0000462009" "00005473" "50" "3446" "0" "3446" "0" "c.3446G>A" "r.(?)" "p.(Arg1149Gln)" "8" "0000462010" "00005473" "50" "4217" "0" "4217" "0" "c.4217C>T" "r.(?)" "p.(Thr1406Met)" "9" "0000462011" "00005473" "50" "1120" "0" "1120" "0" "c.1120G>A" "r.(?)" "p.(Val374Met)" "4" "0000462012" "00005473" "50" "290" "0" "290" "0" "c.290G>A" "r.(?)" "p.(Arg97His)" "3" "0000462013" "00005473" "50" "1007" "0" "1007" "0" "c.1007G>A" "r.(?)" "p.(Arg336Gln)" "4" "0000462014" "00005473" "50" "3654" "0" "3654" "0" "c.3654G>A" "r.(?)" "p.(=)" "8" "0000462015" "00005473" "50" "5822" "0" "5822" "0" "c.5822C>T" "r.(?)" "p.(Ser1941Leu)" "12" "0000462016" "00005473" "50" "1327" "0" "1327" "0" "c.1327A>G" "r.(?)" "p.(Lys443Glu)" "5" "0000462017" "00005473" "50" "5619" "0" "5619" "0" "c.5619C>T" "r.(?)" "p.(=)" "12" "0000462018" "00005473" "50" "7480" "0" "7480" "0" "c.7480G>T" "r.(?)" "p.(Val2494Leu)" "36" "0000462019" "00005473" "50" "2205" "0" "2205" "0" "c.2205C>T" "r.(?)" "p.(=)" "6" "0000462020" "00005473" "50" "5908" "0" "5908" "0" "c.5908C>T" "r.(?)" "p.(Arg1970Cys)" "13" "0000462021" "00005473" "50" "3619" "0" "3619" "0" "c.3619C>A" "r.(?)" "p.(Gln1207Lys)" "8" "0000462022" "00005473" "50" "3902" "0" "3902" "0" "c.3902G>A" "r.(?)" "p.(Arg1301Gln)" "9" "0000462023" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "38" "0000462024" "00005473" "50" "1322" "0" "1322" "0" "c.1322T>C" "r.(?)" "p.(Val441Ala)" "5" "0000462025" "00005473" "90" "5010" "0" "5010" "0" "c.5010T>A" "r.(?)" "p.(Tyr1670*)" "11" "0000462026" "00005473" "50" "5525" "0" "5525" "0" "c.5525G>A" "r.(?)" "p.(Gly1842Glu)" "12" "0000462027" "00005473" "50" "9180" "0" "9180" "0" "c.9180C>G" "r.(?)" "p.(Cys3060Trp)" "41" "0000462028" "00005473" "50" "1024" "0" "1024" "0" "c.1024G>A" "r.(?)" "p.(Val342Met)" "4" "0000462029" "00005473" "50" "5225" "0" "5225" "0" "c.5225G>A" "r.(?)" "p.(Arg1742Gln)" "11" "0000462030" "00005473" "50" "2444" "0" "2444" "0" "c.2444C>A" "r.(?)" "p.(Pro815His)" "6" "0000462031" "00005473" "50" "6199" "0" "6199" "0" "c.6199G>A" "r.(?)" "p.(Glu2067Lys)" "16" "0000462032" "00005473" "50" "1598" "0" "1598" "0" "c.1598G>C" "r.(?)" "p.(Arg533Pro)" "5" "0000462033" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "38" "0000462034" "00005473" "50" "107" "0" "107" "0" "c.107C>T" "r.(?)" "p.(Ala36Val)" "3" "0000462035" "00005473" "50" "8819" "0" "8819" "0" "c.8819C>T" "r.(?)" "p.(Thr2940Met)" "40" "0000462036" "00005473" "50" "1795" "0" "1796" "0" "c.1795_1796delinsAT" "r.(?)" "p.(Ser599Ile)" "5" "0000462037" "00005473" "50" "3507" "0" "3507" "0" "c.3507C>T" "r.(?)" "p.(=)" "8" "0000462038" "00005473" "50" "3445" "0" "3445" "0" "c.3445C>T" "r.(?)" "p.(Arg1149Trp)" "8" "0000462039" "00005473" "50" "3205" "0" "3205" "0" "c.3205G>A" "r.(?)" "p.(Val1069Met)" "8" "0000462040" "00005473" "90" "7024" "0" "7024" "0" "c.7024C>T" "r.(?)" "p.(Arg2342*)" "31" "0000462041" "00005473" "90" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "36" "0000462042" "00005473" "50" "4399" "0" "4399" "0" "c.4399A>G" "r.(?)" "p.(Asn1467Asp)" "10" "0000462043" "00005473" "50" "6425" "0" "6425" "0" "c.6425G>A" "r.(?)" "p.(Arg2142Gln)" "21" "0000462044" "00005473" "50" "3445" "0" "3445" "0" "c.3445C>T" "r.(?)" "p.(Arg1149Trp)" "8" "0000462045" "00005473" "50" "8632" "0" "8632" "0" "c.8632A>G" "r.(?)" "p.(Thr2878Ala)" "40" "0000462046" "00005473" "50" "3331" "0" "3331" "0" "c.3331G>A" "r.(?)" "p.(Ala1111Thr)" "8" "0000462047" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "38" "0000462048" "00005473" "50" "8636" "0" "8636" "0" "c.8636C>T" "r.(?)" "p.(Thr2879Met)" "40" "0000462049" "00005473" "50" "9180" "0" "9180" "0" "c.9180C>G" "r.(?)" "p.(Cys3060Trp)" "41" "0000462050" "00005473" "50" "8009" "0" "8009" "0" "c.8009C>T" "r.(?)" "p.(Ala2670Val)" "38" "0000462051" "00005473" "50" "8243" "0" "8243" "0" "c.8243C>T" "r.(?)" "p.(Pro2748Leu)" "38" "0000462052" "00005473" "50" "4510" "0" "4510" "0" "c.4510C>T" "r.(?)" "p.(Arg1504Trp)" "10" "0000462053" "00005473" "50" "4252" "0" "4254" "0" "c.4252_4254del" "r.(?)" "p.(Lys1418del)" "9" "0000462054" "00005473" "50" "8891" "0" "8891" "0" "c.8891C>T" "r.(?)" "p.(Ala2964Val)" "40" "0000462055" "00005473" "50" "8891" "0" "8891" "0" "c.8891C>T" "r.(?)" "p.(Ala2964Val)" "40" "0000462056" "00005473" "50" "1088" "0" "1088" "0" "c.1088G>A" "r.(?)" "p.(Arg363His)" "4" "0000462057" "00005473" "50" "3944" "0" "3944" "0" "c.3944C>T" "r.(?)" "p.(Ala1315Val)" "9" "0000462058" "00005473" "50" "1939" "0" "1939" "0" "c.1939T>A" "r.(?)" "p.(Ser647Thr)" "6" "0000462059" "00005473" "50" "4399" "0" "4399" "0" "c.4399A>G" "r.(?)" "p.(Asn1467Asp)" "10" "0000462060" "00005473" "50" "9245" "0" "9245" "0" "c.9245C>G" "r.(?)" "p.(Pro3082Arg)" "42" "0000462061" "00005473" "50" "4888" "0" "4888" "0" "c.4888C>T" "r.(?)" "p.(Pro1630Ser)" "10" "0000462062" "00005473" "50" "4888" "0" "4888" "0" "c.4888C>T" "r.(?)" "p.(Pro1630Ser)" "10" "0000462063" "00005473" "50" "5635" "0" "5635" "0" "c.5635G>A" "r.(?)" "p.(Gly1879Ser)" "12" "0000462064" "00005473" "50" "7558" "0" "7558" "0" "c.7558A>T" "r.(?)" "p.(Thr2520Ser)" "36" "0000462065" "00005473" "50" "8243" "0" "8243" "0" "c.8243C>T" "r.(?)" "p.(Pro2748Leu)" "38" "0000462066" "00005473" "50" "3569" "0" "3569" "0" "c.3569C>A" "r.(?)" "p.(Thr1190Asn)" "8" "0000462067" "00005473" "90" "6157" "-2" "6157" "-2" "c.6157-2A>C" "r.spl" "p.?" "15i" "0000462068" "00005473" "50" "5522" "0" "5522" "0" "c.5522T>C" "r.(?)" "p.(Leu1841Pro)" "12" "0000462069" "00005473" "90" "6157" "-2" "6157" "-2" "c.6157-2A>C" "r.spl" "p.?" "15i" "0000462070" "00005473" "90" "6157" "-2" "6157" "-2" "c.6157-2A>C" "r.spl" "p.?" "15i" "0000462071" "00005473" "90" "6157" "-2" "6157" "-2" "c.6157-2A>C" "r.spl" "p.?" "15i" "0000462072" "00005473" "50" "7514" "0" "7514" "0" "c.7514G>T" "r.(?)" "p.(Gly2505Val)" "36" "0000462073" "00005473" "50" "7777" "0" "7777" "0" "c.7777A>T" "r.(?)" "p.(Ile2593Phe)" "38" "0000462074" "00005473" "50" "9494" "-10" "9494" "-10" "c.9494-10C>T" "r.(?)" "p.(?)" "43i" "0000462075" "00005473" "50" "4399" "0" "4399" "0" "c.4399A>G" "r.(?)" "p.(Asn1467Asp)" "10" "0000462076" "00005473" "50" "6199" "0" "6199" "0" "c.6199G>A" "r.(?)" "p.(Glu2067Lys)" "16" "0000462077" "00005473" "50" "6871" "0" "6871" "0" "c.6871G>T" "r.(?)" "p.(Gly2291Trp)" "28" "0000462078" "00005473" "50" "8636" "0" "8636" "0" "c.8636C>T" "r.(?)" "p.(Thr2879Met)" "40" "0000462079" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "38" "0000462080" "00005473" "50" "5203" "0" "5203" "0" "c.5203G>T" "r.(?)" "p.(Ala1735Ser)" "11" "0000462081" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "38" "0000462082" "00005473" "50" "1385" "0" "1385" "0" "c.1385A>G" "r.(?)" "p.(Asn462Ser)" "5" "0000462083" "00005473" "50" "1385" "0" "1385" "0" "c.1385A>G" "r.(?)" "p.(Asn462Ser)" "5" "0000462084" "00005473" "50" "6255" "0" "6255" "0" "c.6255G>A" "r.(?)" "p.(=)" "17" "0000462085" "00005473" "90" "6157" "-2" "6157" "-2" "c.6157-2A>C" "r.spl" "p.?" "15i" "0000462086" "00005473" "50" "8008" "0" "8008" "0" "c.8008G>A" "r.(?)" "p.(Ala2670Thr)" "38" "0000462087" "00005473" "50" "9147" "0" "9147" "0" "c.9147C>T" "r.(?)" "p.(=)" "41" "0000462088" "00005473" "50" "2529" "0" "2529" "0" "c.2529C>T" "r.(?)" "p.(=)" "7" "0000462089" "00005473" "50" "4117" "0" "4117" "0" "c.4117G>A" "r.(?)" "p.(Ala1373Thr)" "9" "0000462090" "00005473" "50" "1761" "0" "1761" "0" "c.1761C>T" "r.(?)" "p.(=)" "5" "0000462091" "00005473" "50" "3419" "0" "3419" "0" "c.3419C>T" "r.(?)" "p.(Thr1140Met)" "8" "0000462092" "00005473" "50" "8819" "0" "8819" "0" "c.8819C>T" "r.(?)" "p.(Thr2940Met)" "40" "0000462093" "00005473" "50" "5825" "0" "5825" "0" "c.5825C>T" "r.(?)" "p.(Pro1942Leu)" "12" "0000462094" "00005473" "50" "1513" "0" "1513" "0" "c.1513A>G" "r.(?)" "p.(Lys505Glu)" "5" "0000462095" "00005473" "50" "1623" "0" "1623" "0" "c.1623C>T" "r.(?)" "p.(=)" "5" "0000462096" "00005473" "50" "489" "0" "489" "0" "c.489G>A" "r.(?)" "p.(=)" "3" "0000462097" "00005473" "90" "6220" "0" "6220" "0" "c.6220G>A" "r.(?)" "p.(Gly2074Ser)" "17" "0000462098" "00005473" "50" "776" "0" "776" "0" "c.776C>T" "r.(?)" "p.(Ala259Val)" "4" "0000462099" "00005473" "50" "1217" "0" "1217" "0" "c.1217G>A" "r.(?)" "p.(Arg406His)" "4" "0000462100" "00005473" "50" "9061" "0" "9061" "0" "c.9061G>C" "r.(?)" "p.(Asp3021His)" "41" "0000462101" "00005473" "50" "7441" "0" "7441" "0" "c.7441A>G" "r.(?)" "p.(Thr2481Ala)" "36" "0000462102" "00005473" "50" "9248" "0" "9248" "0" "c.9248C>A" "r.(?)" "p.(Pro3083His)" "42" "0000462103" "00005473" "50" "3589" "0" "3589" "0" "c.3589G>A" "r.(?)" "p.(Val1197Ile)" "8" "0000462104" "00005473" "50" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "36" "0000462105" "00005473" "50" "6749" "0" "6749" "0" "c.6749C>T" "r.(?)" "p.(Pro2250Leu)" "26" "0000462106" "00005473" "50" "7514" "0" "7514" "0" "c.7514G>T" "r.(?)" "p.(Gly2505Val)" "36" "0000462107" "00005473" "50" "8344" "0" "8344" "0" "c.8344G>A" "r.(?)" "p.(Glu2782Lys)" "38" "0000462108" "00005473" "50" "9061" "0" "9061" "0" "c.9061G>C" "r.(?)" "p.(Asp3021His)" "41" "0000462109" "00005473" "50" "6193" "0" "6193" "0" "c.6193G>A" "r.(?)" "p.(Gly2065Ser)" "16" "0000462110" "00005473" "50" "2984" "0" "2984" "0" "c.2984C>T" "r.(?)" "p.(Ala995Val)" "7" "0000462111" "00005473" "50" "2444" "0" "2444" "0" "c.2444C>A" "r.(?)" "p.(Pro815His)" "6" "0000462112" "00005473" "50" "3191" "0" "3191" "0" "c.3191G>A" "r.(?)" "p.(Arg1064Gln)" "8" "0000462113" "00005473" "50" "4117" "0" "4117" "0" "c.4117G>A" "r.(?)" "p.(Ala1373Thr)" "9" "0000462114" "00005473" "50" "1961" "0" "1961" "0" "c.1961A>G" "r.(?)" "p.(Asn654Ser)" "6" "0000462115" "00005473" "50" "4117" "0" "4117" "0" "c.4117G>A" "r.(?)" "p.(Ala1373Thr)" "9" "0000462116" "00005473" "50" "9245" "0" "9245" "0" "c.9245C>G" "r.(?)" "p.(Pro3082Arg)" "42" "0000462117" "00005473" "50" "6868" "0" "6868" "0" "c.6868C>T" "r.(?)" "p.(Arg2290Cys)" "28" "0000462118" "00005473" "50" "2525" "0" "2525" "0" "c.2525T>C" "r.(?)" "p.(Phe842Ser)" "7" "0000462119" "00005473" "50" "7607" "0" "7607" "0" "c.7607C>T" "r.(?)" "p.(Ala2536Val)" "36" "0000462120" "00005473" "50" "5953" "0" "5953" "0" "c.5953G>A" "r.5953G>A" "p.Val1985Met" "14" "0000462121" "00005473" "50" "121" "0" "123" "0" "c.121_123del" "r.(?)" "p.(Ile41del)" "3" "0000462122" "00005473" "50" "9245" "0" "9245" "0" "c.9245C>G" "r.(?)" "p.(Pro3082Arg)" "42" "0000462123" "00005473" "50" "4124" "0" "4124" "0" "c.4124del" "r.(?)" "p.(Gln1375Argfs*5)" "9" "0000462124" "00005473" "50" "9418" "0" "9418" "0" "c.9418T>G" "r.(?)" "p.(Phe3140Val)" "43" "0000462125" "00005473" "50" "2261" "0" "2261" "0" "c.2261A>G" "r.(?)" "p.(Gln754Arg)" "6" "0000462126" "00005473" "50" "4888" "0" "4888" "0" "c.4888C>T" "r.(?)" "p.(Pro1630Ser)" "10" "0000462127" "00005473" "50" "1975" "0" "1975" "0" "c.1975C>T" "r.(?)" "p.(Arg659Cys)" "6" "0000462128" "00005473" "50" "3595" "0" "3595" "0" "c.3595C>G" "r.(?)" "p.(Gln1199Glu)" "8" "0000462129" "00005473" "50" "6930" "4" "6930" "4" "c.6930+4C>T" "r.spl?" "p.?" "29i" "0000462130" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl" "p.?" "16i" "0000462131" "00005473" "50" "8804" "0" "8804" "0" "c.8804C>T" "r.(?)" "p.(Ala2935Val)" "40" "0000462132" "00005473" "50" "4399" "0" "4399" "0" "c.4399A>G" "r.(?)" "p.(Asn1467Asp)" "10" "0000462133" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "38" "0000462134" "00005473" "50" "9358" "0" "9358" "0" "c.9358A>C" "r.(?)" "p.(Thr3120Pro)" "43" "0000462135" "00005473" "90" "6354" "1" "6354" "1" "c.6354+1G>T" "r.spl" "p.?" "19i" "0000462136" "00005473" "50" "5833" "0" "5833" "0" "c.5833G>C" "r.(?)" "p.(Val1945Leu)" "12" "0000462137" "00005473" "50" "8636" "0" "8636" "0" "c.8636C>T" "r.(?)" "p.(Thr2879Met)" "40" "0000462138" "00005473" "50" "5839" "-3" "5839" "-3" "c.5839-3C>T" "r.spl?" "p.(?)" "12i" "0000462139" "00005473" "50" "1214" "0" "1214" "0" "c.1214T>C" "r.(?)" "p.(Phe405Ser)" "4" "0000462140" "00005473" "50" "7832" "0" "7832" "0" "c.7832C>T" "r.(?)" "p.(Ala2611Val)" "38" "0000462141" "00005473" "70" "6193" "0" "6193" "0" "c.6193G>C" "r.(?)" "p.(Gly2065Arg)" "16" "0000462142" "00005473" "50" "4510" "0" "4510" "0" "c.4510C>T" "r.(?)" "p.(Arg1504Trp)" "10" "0000462143" "00005473" "50" "3445" "0" "3445" "0" "c.3445C>T" "r.(?)" "p.(Arg1149Trp)" "8" "0000462144" "00005473" "50" "1022" "0" "1022" "0" "c.1022G>A" "r.(?)" "p.(Arg341His)" "4" "0000462145" "00005473" "50" "9005" "0" "9005" "0" "c.9005A>G" "r.(?)" "p.(Glu3002Gly)" "41" "0000462146" "00005473" "50" "7768" "0" "7768" "0" "c.7768A>G" "r.(?)" "p.(Ile2590Val)" "38" "0000462147" "00005473" "50" "7849" "0" "7849" "0" "c.7849G>A" "r.(?)" "p.(Asp2617Asn)" "38" "0000462148" "00005473" "50" "8243" "0" "8243" "0" "c.8243C>T" "r.(?)" "p.(Pro2748Leu)" "38" "0000462149" "00005473" "50" "7174" "0" "7174" "0" "c.7174G>A" "r.(?)" "p.(Gly2392Arg)" "35" "0000462150" "00005473" "50" "8009" "0" "8009" "0" "c.8009C>T" "r.(?)" "p.(Ala2670Val)" "38" "0000462151" "00005473" "50" "8804" "0" "8804" "0" "c.8804C>T" "r.(?)" "p.(Ala2935Val)" "40" "0000462152" "00005473" "50" "7258" "0" "7258" "0" "c.7258C>T" "r.(?)" "p.(Arg2420Trp)" "36" "0000462153" "00005473" "50" "1350" "0" "1350" "0" "c.1350G>A" "r.(?)" "p.(=)" "5" "0000462154" "00005473" "50" "8243" "0" "8243" "0" "c.8243C>T" "r.(?)" "p.(Pro2748Leu)" "38" "0000462155" "00005473" "50" "4141" "0" "4141" "0" "c.4141A>T" "r.(?)" "p.(Ile1381Phe)" "9" "0000462156" "00005473" "50" "7514" "0" "7514" "0" "c.7514G>T" "r.(?)" "p.(Gly2505Val)" "36" "0000462157" "00005473" "50" "3238" "0" "3238" "0" "c.3238T>A" "r.(?)" "p.(Phe1080Ile)" "8" "0000462158" "00005473" "50" "7754" "0" "7754" "0" "c.7754A>G" "r.(?)" "p.(His2585Arg)" "37" "0000462159" "00005473" "50" "5680" "0" "5680" "0" "c.5680C>T" "r.(?)" "p.(Pro1894Ser)" "12" "0000462160" "00005473" "70" "6354" "1" "6354" "1" "c.6354+1G>A" "r.spl" "p.?" "19i" "0000462161" "00005473" "70" "6354" "1" "6354" "1" "c.6354+1G>A" "r.spl" "p.?" "19i" "0000462162" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "38" "0000462163" "00005473" "50" "4103" "0" "4103" "0" "c.4103C>T" "r.(?)" "p.(Thr1368Met)" "9" "0000462164" "00005473" "50" "6751" "0" "6751" "0" "c.6751C>T" "r.(?)" "p.(Arg2251Trp)" "26" "0000462165" "00005473" "70" "6354" "1" "6354" "1" "c.6354+1G>A" "r.spl" "p.?" "19i" "0000462166" "00005473" "50" "6751" "0" "6751" "0" "c.6751C>T" "r.(?)" "p.(Arg2251Trp)" "26" "0000462167" "00005473" "50" "5522" "0" "5522" "0" "c.5522T>G" "r.(?)" "p.(Leu1841Arg)" "12" "0000462168" "00005473" "50" "7258" "0" "7258" "0" "c.7258C>T" "r.(?)" "p.(Arg2420Trp)" "36" "0000462169" "00005473" "50" "4121" "0" "4121" "0" "c.4121A>T" "r.(?)" "p.(Asp1374Val)" "9" "0000462170" "00005473" "50" "8636" "0" "8636" "0" "c.8636C>T" "r.(?)" "p.(Thr2879Met)" "40" "0000462171" "00005473" "50" "4726" "0" "4726" "0" "c.4726C>T" "r.(?)" "p.(Arg1576Trp)" "10" "0000462172" "00005473" "50" "575" "0" "575" "0" "c.575C>T" "r.(?)" "p.(Pro192Leu)" "3" "0000462173" "00005473" "50" "5635" "0" "5635" "0" "c.5635G>A" "r.(?)" "p.(Gly1879Ser)" "12" "0000462174" "00005473" "50" "1762" "0" "1762" "0" "c.1762G>A" "r.(?)" "p.(Asp588Asn)" "5" "0000462175" "00005473" "50" "6199" "0" "6199" "0" "c.6199G>A" "r.(?)" "p.(Glu2067Lys)" "16" "0000462176" "00005473" "90" "761" "0" "761" "0" "c.761del" "r.(?)" "p.(Gly254Glufs*13)" "4" "0000462177" "00005473" "50" "2863" "0" "2863" "0" "c.2863C>T" "r.(?)" "p.(Arg955Cys)" "7" "0000462178" "00005473" "50" "1208" "0" "1208" "0" "c.1208C>T" "r.(?)" "p.(Pro403Leu)" "4" "0000462179" "00005473" "50" "3841" "0" "3841" "0" "c.3841A>G" "r.(?)" "p.(Lys1281Glu)" "9" "0000462180" "00005473" "50" "9494" "-10" "9494" "-10" "c.9494-10C>T" "r.spl" "p.(=)" "43i" "0000462181" "00005473" "50" "7728" "0" "7728" "0" "c.7728C>T" "r.(?)" "p.(=)" "37" "0000462182" "00005473" "50" "3445" "0" "3445" "0" "c.3445C>T" "r.(?)" "p.(Arg1149Trp)" "8" "0000462183" "00005473" "50" "6677" "0" "6677" "0" "c.6677C>T" "r.(?)" "p.(Thr2226Ile)" "25" "0000462184" "00005473" "50" "1370" "0" "1370" "0" "c.1370G>T" "r.(?)" "p.(Gly457Val)" "5" "0000462185" "00005473" "70" "6309" "1" "6309" "1" "c.6309+1G>T" "r.spl" "p.?" "18i" "0000462186" "00005473" "50" "8744" "0" "8744" "0" "c.8744C>T" "r.(?)" "p.(Ala2915Val)" "40" "0000462187" "00005473" "50" "8193" "0" "8193" "0" "c.8193A>C" "r.(?)" "p.(=)" "38" "0000462188" "00005473" "50" "3715" "0" "3715" "0" "c.3715G>A" "r.(?)" "p.(Asp1239Asn)" "9" "0000462189" "00005473" "50" "9209" "0" "9209" "0" "c.9209A>G" "r.(?)" "p.(Tyr3070Cys)" "41" "0000462190" "00005473" "50" "7953" "0" "7953" "0" "c.7953G>A" "r.(?)" "p.(Met2651Ile)" "38" "0000462191" "00005473" "50" "1846" "0" "1846" "0" "c.1846A>G" "r.(?)" "p.(Met616Val)" "5" "0000462192" "00005473" "50" "7045" "0" "7045" "0" "c.7045C>T" "r.(?)" "p.(Pro2349Ser)" "32" "0000462193" "00005473" "50" "4835" "0" "4835" "0" "c.4835C>T" "r.(?)" "p.(Ser1612Leu)" "10" "0000462194" "00005473" "50" "5378" "0" "5378" "0" "c.5378G>A" "r.(?)" "p.(Ser1793Asn)" "11" "0000462195" "00005473" "50" "2507" "0" "2507" "0" "c.2507G>T" "r.(?)" "p.(Arg836Leu)" "7" "0000462196" "00005473" "50" "3741" "0" "3741" "0" "c.3741G>C" "r.(?)" "p.(Glu1247Asp)" "9" "0000462197" "00005473" "50" "3902" "0" "3902" "0" "c.3902G>A" "r.(?)" "p.(Arg1301Gln)" "9" "0000462198" "00005473" "50" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Trp)" "4" "0000462199" "00005473" "50" "3287" "0" "3287" "0" "c.3287G>A" "r.(?)" "p.(Arg1096His)" "8" "0000462200" "00005473" "50" "2864" "0" "2864" "0" "c.2864G>A" "r.(?)" "p.(Arg955His)" "7" "0000462201" "00005473" "50" "7258" "0" "7258" "0" "c.7258C>T" "r.(?)" "p.(Arg2420Trp)" "36" "0000462202" "00005473" "50" "5839" "-3" "5839" "-3" "c.5839-3C>T" "r.spl?" "p.?" "12i" "0000462203" "00005473" "50" "8243" "0" "8243" "0" "c.8243C>T" "r.(?)" "p.(Pro2748Leu)" "38" "0000462204" "00005473" "50" "4324" "0" "4324" "0" "c.4324G>A" "r.(?)" "p.(Asp1442Asn)" "10" "0000462205" "00005473" "50" "3680" "-4" "3680" "-4" "c.3680-4G>A" "r.spl?" "p.?" "8i" "0000462206" "00005473" "50" "5139" "0" "5139" "0" "c.5139G>A" "r.(?)" "p.(=)" "11" "0000462207" "00005473" "50" "707" "0" "707" "0" "c.707C>T" "r.(?)" "p.(Thr236Ile)" "3" "0000462208" "00005473" "50" "2292" "0" "2292" "0" "c.2292C>T" "r.(?)" "p.(=)" "6" "0000462209" "00005473" "50" "3008" "0" "3008" "0" "c.3008G>A" "r.(?)" "p.(Gly1003Glu)" "7" "0000462210" "00005473" "50" "7029" "3" "7029" "3" "c.7029+3A>G" "r.spl?" "p.?" "31i" "0000462211" "00005473" "50" "1538" "0" "1538" "0" "c.1538G>A" "r.(?)" "p.(Arg513Gln)" "5" "0000462212" "00005473" "50" "898" "0" "900" "0" "c.898_900del" "r.(?)" "p.(Ser300del)" "4" "0000462213" "00005473" "50" "415" "0" "415" "0" "c.415G>A" "r.(?)" "p.(Gly139Ser)" "3" "0000462214" "00005473" "70" "6212" "0" "6212" "0" "c.6212G>A" "r.(?)" "p.(Gly2071Asp)" "17" "0000462215" "00005473" "50" "5392" "0" "5392" "0" "c.5392C>T" "r.(?)" "p.(Arg1798Cys)" "11" "0000462216" "00005473" "50" "4047" "0" "4047" "0" "c.4047C>T" "r.(?)" "p.(=)" "9" "0000462217" "00005473" "90" "761" "0" "761" "0" "c.761del" "r.(?)" "p.(Gly254Glufs*13)" "4" "0000462218" "00005473" "50" "8032" "0" "8032" "0" "c.8032G>A" "r.(?)" "p.(Ala2678Thr)" "38" "0000462219" "00005473" "50" "8375" "0" "8375" "0" "c.8375A>G" "r.(?)" "p.(Asp2792Gly)" "38" "0000462220" "00005473" "50" "4677" "0" "4677" "0" "c.4677C>T" "r.(?)" "p.(=)" "10" "0000462221" "00005473" "50" "3901" "0" "3901" "0" "c.3901C>T" "r.(?)" "p.(Arg1301Trp)" "9" "0000462222" "00005473" "50" "2205" "0" "2205" "0" "c.2205C>T" "r.(?)" "p.(=)" "6" "0000462223" "00005473" "50" "5649" "0" "5649" "0" "c.5649C>A" "r.(?)" "p.(=)" "12" "0000462224" "00005473" "50" "6538" "-4" "6538" "-4" "c.6538-4C>T" "r.spl?" "p.?" "22i" "0000462225" "00005473" "50" "759" "0" "759" "0" "c.759C>T" "r.(?)" "p.(=)" "4" "0000462226" "00005473" "50" "7264" "0" "7264" "0" "c.7264C>G" "r.(?)" "p.(Arg2422Gly)" "36" "0000462227" "00005473" "50" "6868" "0" "6868" "0" "c.6868C>T" "r.(?)" "p.(Arg2290Cys)" "28" "0000462228" "00005473" "50" "7258" "0" "7258" "0" "c.7258C>T" "r.(?)" "p.(Arg2420Trp)" "36" "0000462229" "00005473" "50" "5953" "0" "5953" "0" "c.5953G>A" "r.(?)" "p.(Val1985Met)" "14" "0000462230" "00005473" "50" "6040" "0" "6040" "0" "c.6040G>T" "r.(?)" "p.(Asp2014Tyr)" "14" "0000462231" "00005473" "50" "4103" "0" "4103" "0" "c.4103C>T" "r.(?)" "p.(Thr1368Met)" "9" "0000462232" "00005473" "50" "3008" "0" "3008" "0" "c.3008G>A" "r.(?)" "p.(Gly1003Glu)" "7" "0000462233" "00005473" "50" "3371" "0" "3371" "0" "c.3371C>T" "r.(?)" "p.(Ala1124Val)" "8" "0000462234" "00005473" "50" "898" "0" "900" "0" "c.898_900del" "r.(?)" "p.(Ser300del)" "4" "0000462235" "00005473" "50" "2303" "0" "2303" "0" "c.2303G>A" "r.(?)" "p.(Arg768His)" "6" "0000462236" "00005473" "50" "7513" "0" "7513" "0" "c.7513G>A" "r.(?)" "p.(Gly2505Arg)" "36" "0000462237" "00005473" "50" "1538" "0" "1538" "0" "c.1538G>A" "r.(?)" "p.(Arg513Gln)" "5" "0000462238" "00005473" "50" "284" "0" "284" "0" "c.284C>T" "r.(?)" "p.(Thr95Met)" "3" "0000462239" "00005473" "50" "5534" "0" "5534" "0" "c.5534G>T" "r.(?)" "p.(Gly1845Val)" "12" "0000462240" "00005473" "50" "8465" "0" "8465" "0" "c.8465G>A" "r.(?)" "p.(Ser2822Asn)" "39" "0000462241" "00005473" "50" "5839" "-3" "5839" "-3" "c.5839-3C>T" "r.spl?" "p.?" "12i" "0000462242" "00005473" "50" "4510" "0" "4510" "0" "c.4510C>T" "r.(?)" "p.(Arg1504Trp)" "10" "0000462243" "00005473" "50" "1214" "0" "1214" "0" "c.1214T>C" "r.(?)" "p.(Phe405Ser)" "4" "0000462244" "00005473" "50" "3419" "0" "3419" "0" "c.3419C>T" "r.(?)" "p.(Thr1140Met)" "8" "0000462245" "00005473" "50" "8308" "0" "8308" "0" "c.8308G>A" "r.(?)" "p.(Val2770Met)" "38" "0000462246" "00005473" "90" "6310" "-28" "6325" "0" "c.6310-28_6325del" "r.spl" "p.?" "18i_19" "0000462247" "00005473" "50" "7425" "0" "7425" "0" "c.7425C>A" "r.(?)" "p.(Asn2475Lys)" "36" "0000462248" "00005473" "50" "8498" "0" "8498" "0" "c.8498G>A" "r.(?)" "p.(Arg2833Lys)" "39" "0000462249" "00005473" "50" "1217" "0" "1217" "0" "c.1217G>A" "r.(?)" "p.(Arg406His)" "4" "0000462250" "00005473" "50" "1150" "0" "1150" "0" "c.1150G>A" "r.(?)" "p.(Ala384Thr)" "4" "0000462251" "00005473" "50" "1022" "0" "1022" "0" "c.1022G>T" "r.(?)" "p.(Arg341Leu)" "4" "0000462252" "00005473" "50" "7607" "0" "7607" "0" "c.7607C>T" "r.(?)" "p.(Ala2536Val)" "36" "0000462253" "00005473" "50" "8636" "0" "8636" "0" "c.8636C>T" "r.(?)" "p.(Thr2879Met)" "40" "0000462254" "00005473" "50" "3169" "0" "3169" "0" "c.3169A>T" "r.(?)" "p.(Ser1057Cys)" "8" "0000462255" "00005473" "50" "6769" "0" "6769" "0" "c.6769G>A" "r.(?)" "p.(Ala2257Thr)" "27" "0000462256" "00005473" "50" "4103" "0" "4103" "0" "c.4103C>T" "r.(?)" "p.(Thr1368Met)" "9" "0000462257" "00005473" "50" "5833" "0" "5833" "0" "c.5833G>C" "r.(?)" "p.(Val1945Leu)" "12" "0000462258" "00005473" "50" "1867" "0" "1867" "0" "c.1867C>T" "r.(?)" "p.(Pro623Ser)" "5" "0000462259" "00005473" "50" "5426" "0" "5426" "0" "c.5426G>A" "r.(?)" "p.(Ser1809Asn)" "11" "0000462260" "00005473" "50" "7114" "0" "7114" "0" "c.7114G>A" "r.(?)" "p.(Asp2372Asn)" "33" "0000462261" "00005473" "50" "7685" "0" "7685" "0" "c.7685T>C" "r.(?)" "p.(Val2562Ala)" "37" "0000462262" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "38" "0000462263" "00005473" "50" "1045" "0" "1045" "0" "c.1045G>T" "r.(?)" "p.(Val349Leu)" "4" "0000462264" "00005473" "50" "7376" "0" "7376" "0" "c.7376G>A" "r.(?)" "p.(Arg2459Gln)" "36" "0000462265" "00005473" "50" "9043" "0" "9043" "0" "c.9043C>T" "r.(?)" "p.(Pro3015Ser)" "41" "0000462266" "00005473" "50" "2196" "0" "2196" "0" "c.2196G>A" "r.(?)" "p.(=)" "6" "0000462267" "00005473" "50" "3715" "0" "3715" "0" "c.3715G>A" "r.(?)" "p.(Asp1239Asn)" "9" "0000462268" "00005473" "50" "4141" "0" "4141" "0" "c.4141A>T" "r.(?)" "p.(Ile1381Phe)" "9" "0000462269" "00005473" "50" "2030" "0" "2030" "0" "c.2030G>T" "r.(?)" "p.(Arg677Leu)" "6" "0000462270" "00005473" "50" "3055" "0" "3055" "0" "c.3055G>A" "r.(?)" "p.(Gly1019Arg)" "7" "0000462271" "00005473" "50" "8140" "0" "8140" "0" "c.8140G>A" "r.(?)" "p.(Ala2714Thr)" "38" "0000462272" "00005473" "50" "5833" "0" "5833" "0" "c.5833G>C" "r.(?)" "p.(Val1945Leu)" "12" "0000462273" "00005473" "50" "2231" "0" "2231" "0" "c.2231C>T" "r.(?)" "p.(Pro744Leu)" "6" "0000462274" "00005473" "50" "8877" "0" "8879" "0" "c.8877_8879dup" "r.(?)" "p.(Ala2960dup)" "40" "0000462275" "00005473" "50" "9116" "0" "9116" "0" "c.9116C>T" "r.(?)" "p.(Thr3039Met)" "41" "0000462276" "00005473" "50" "7114" "0" "7114" "0" "c.7114G>A" "r.(?)" "p.(Asp2372Asn)" "33" "0000462277" "00005473" "50" "438" "0" "438" "0" "c.438C>T" "r.(?)" "p.(=)" "3" "0000462278" "00005473" "50" "5619" "0" "5619" "0" "c.5619C>T" "r.(?)" "p.(=)" "12" "0000462279" "00005473" "50" "2756" "0" "2756" "0" "c.2756C>T" "r.(?)" "p.(Ala919Val)" "7" "0000462280" "00005473" "50" "7114" "0" "7114" "0" "c.7114G>A" "r.(?)" "p.(Asp2372Asn)" "33" "0000462281" "00005473" "50" "4117" "0" "4117" "0" "c.4117G>A" "r.(?)" "p.(Ala1373Thr)" "9" "0000462282" "00005473" "50" "3901" "0" "3901" "0" "c.3901C>T" "r.(?)" "p.(Arg1301Trp)" "9" "0000462283" "00005473" "50" "8359" "0" "8359" "0" "c.8359G>A" "r.(?)" "p.(Ala2787Thr)" "38" "0000462284" "00005473" "50" "4697" "0" "4697" "0" "c.4697C>T" "r.(?)" "p.(Ser1566Leu)" "10" "0000462285" "00005473" "50" "1432" "0" "1432" "0" "c.1432G>A" "r.(?)" "p.(Gly478Arg)" "5" "0000462286" "00005473" "50" "893" "0" "893" "0" "c.893C>T" "r.(?)" "p.(Thr298Ile)" "4" "0000462287" "00005473" "50" "6769" "0" "6769" "0" "c.6769G>A" "r.(?)" "p.(Ala2257Thr)" "27" "0000462288" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "38" "0000462289" "00005473" "50" "252" "0" "252" "0" "c.252C>T" "r.(?)" "p.(=)" "3" "0000462290" "00005473" "50" "1538" "0" "1538" "0" "c.1538G>A" "r.(?)" "p.(Arg513Gln)" "5" "0000462291" "00005473" "50" "9459" "0" "9459" "0" "c.9459A>G" "r.(?)" "p.(=)" "43" "0000462292" "00005473" "50" "1538" "0" "1538" "0" "c.1538G>A" "r.(?)" "p.(Arg513Gln)" "5" "0000462293" "00005473" "50" "6289" "0" "6289" "0" "c.6289C>T" "r.(?)" "p.(Arg2097Trp)" "18" "0000462294" "00005473" "50" "7976" "0" "7976" "0" "c.7976A>G" "r.(?)" "p.(Gln2659Arg)" "38" "0000462295" "00005473" "50" "8236" "0" "8236" "0" "c.8236G>A" "r.(?)" "p.(Glu2746Lys)" "38" "0000462296" "00005473" "50" "9061" "0" "9061" "0" "c.9061G>C" "r.(?)" "p.(Asp3021His)" "41" "0000462297" "00005473" "50" "6640" "0" "6640" "0" "c.6640G>A" "r.(?)" "p.(Gly2214Ser)" "25" "0000462298" "00005473" "50" "4510" "0" "4510" "0" "c.4510C>T" "r.(?)" "p.(Arg1504Trp)" "10" "0000462299" "00005473" "50" "3419" "0" "3419" "0" "c.3419C>T" "r.(?)" "p.(Thr1140Met)" "8" "0000462300" "00005473" "50" "7375" "0" "7375" "0" "c.7375C>T" "r.(?)" "p.(Arg2459Trp)" "36" "0000462301" "00005473" "50" "5645" "0" "5645" "0" "c.5645C>T" "r.(?)" "p.(Ser1882Leu)" "12" "0000462302" "00005473" "50" "5393" "0" "5393" "0" "c.5393G>A" "r.(?)" "p.(Arg1798His)" "11" "0000462303" "00005473" "50" "489" "0" "489" "0" "c.489G>A" "r.(?)" "p.(=)" "3" "0000462304" "00005473" "50" "5296" "0" "5296" "0" "c.5296C>G" "r.(?)" "p.(Leu1766Val)" "11" "0000462305" "00005473" "90" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "36" "0000462306" "00005473" "50" "9494" "-10" "9494" "-10" "c.9494-10C>T" "r.(?)" "p.(?)" "43i" "0000462307" "00005473" "50" "6180" "0" "6180" "0" "c.6180C>T" "r.(?)" "p.(=)" "16" "0000462308" "00005473" "50" "7685" "0" "7685" "0" "c.7685T>C" "r.(?)" "p.(Val2562Ala)" "37" "0000462309" "00005473" "50" "5610" "0" "5610" "0" "c.5610C>A" "r.(?)" "p.(Ser1870Arg)" "12" "0000462310" "00005473" "50" "898" "0" "900" "0" "c.898_900del" "r.(?)" "p.(Ser300del)" "4" "0000462311" "00005473" "70" "6355" "-1" "6355" "-1" "c.6355-1G>A" "r.spl" "p.?" "19i" "0000462312" "00005473" "50" "3755" "0" "3755" "0" "c.3755G>A" "r.(?)" "p.(Arg1252His)" "9" "0000462313" "00005473" "50" "4117" "0" "4117" "0" "c.4117G>A" "r.(?)" "p.(Ala1373Thr)" "9" "0000462314" "00005473" "50" "861" "0" "861" "0" "c.861C>T" "r.(?)" "p.(=)" "4" "0000462315" "00005473" "50" "4984" "0" "4984" "0" "c.4984G>T" "r.(?)" "p.(Val1662Leu)" "11" "0000462316" "00005473" "50" "2292" "0" "2292" "0" "c.2292C>T" "r.(?)" "p.(=)" "6" "0000462317" "00005473" "50" "34" "0" "34" "0" "c.34G>T" "r.(?)" "p.(Val12Phe)" "2" "0000462318" "00005473" "50" "6066" "0" "6066" "0" "c.6066C>T" "r.(?)" "p.(=)" "15" "0000462319" "00005473" "50" "7368" "0" "7368" "0" "c.7368G>A" "r.(?)" "p.(=)" "36" "0000462320" "00005473" "50" "1762" "0" "1762" "0" "c.1762G>A" "r.(?)" "p.(Asp588Asn)" "5" "0000462321" "00005473" "50" "2231" "0" "2231" "0" "c.2231C>T" "r.(?)" "p.(Pro744Leu)" "6" "0000462322" "00005473" "50" "6289" "0" "6289" "0" "c.6289C>T" "r.(?)" "p.(Arg2097Trp)" "18" "0000462323" "00005473" "50" "9508" "0" "9508" "0" "c.9508G>A" "r.(?)" "p.(Gly3170Arg)" "44" "0000462324" "00005473" "50" "5680" "0" "5680" "0" "c.5680C>T" "r.(?)" "p.(Pro1894Ser)" "12" "0000462325" "00005473" "50" "8243" "0" "8243" "0" "c.8243C>T" "r.(?)" "p.(Pro2748Leu)" "38" "0000462326" "00005473" "50" "8161" "0" "8161" "0" "c.8161T>G" "r.(?)" "p.(Tyr2721Asp)" "38" "0000462327" "00005473" "50" "898" "0" "900" "0" "c.898_900del" "r.(?)" "p.(Ser300del)" "4" "0000462328" "00005473" "50" "7357" "0" "7357" "0" "c.7357G>A" "r.(?)" "p.(Glu2453Lys)" "36" "0000462329" "00005473" "50" "3837" "0" "3837" "0" "c.3837C>A" "r.(?)" "p.(Asp1279Glu)" "9" "0000462330" "00005473" "50" "2303" "0" "2303" "0" "c.2303G>A" "r.(?)" "p.(Arg768His)" "6" "0000462331" "00005473" "50" "4844" "0" "4844" "0" "c.4844C>A" "r.(?)" "p.(Pro1615His)" "10" "0000462332" "00005473" "50" "3040" "0" "3040" "0" "c.3040A>G" "r.(?)" "p.(Lys1014Glu)" "7" "0000462333" "00005473" "50" "7590" "0" "7590" "0" "c.7590G>A" "r.(?)" "p.(=)" "36" "0000462334" "00005473" "50" "7258" "0" "7258" "0" "c.7258C>T" "r.(?)" "p.(Arg2420Trp)" "36" "0000462335" "00005473" "50" "7375" "0" "7375" "0" "c.7375C>T" "r.(?)" "p.(Arg2459Trp)" "36" "0000462336" "00005473" "50" "374" "0" "374" "0" "c.374T>C" "r.(?)" "p.(Ile125Thr)" "3" "0000462337" "00005473" "50" "5470" "0" "5470" "0" "c.5470C>T" "r.(?)" "p.(Leu1824Phe)" "11" "0000462338" "00005473" "50" "290" "0" "290" "0" "c.290G>A" "r.(?)" "p.(Arg97His)" "3" "0000462339" "00005473" "50" "3934" "0" "3934" "0" "c.3934G>A" "r.(?)" "p.(Val1312Met)" "9" "0000462340" "00005473" "90" "6282" "1" "6282" "1" "c.6282+1G>A" "r.spl" "p.?" "17i" "0000462341" "00005473" "50" "6966" "4" "6966" "4" "c.6966+4A>C" "r.spl?" "p.?" "30i" "0000462342" "00005473" "50" "3118" "0" "3118" "0" "c.3118G>A" "r.(?)" "p.(Val1040Ile)" "8" "0000462343" "00005473" "50" "6899" "0" "6899" "0" "c.6899G>A" "r.(?)" "p.(Gly2300Glu)" "29" "0000462344" "00005473" "50" "4103" "0" "4103" "0" "c.4103C>T" "r.(?)" "p.(Thr1368Met)" "9" "0000462345" "00005473" "50" "6930" "4" "6930" "4" "c.6930+4C>T" "r.spl?" "p.?" "29i" "0000462346" "00005473" "50" "2324" "0" "2324" "0" "c.2324G>T" "r.(?)" "p.(Cys775Phe)" "6" "0000462347" "00005473" "50" "2909" "0" "2909" "0" "c.2909C>G" "r.(?)" "p.(Pro970Arg)" "7" "0000462348" "00005473" "50" "6210" "5" "6210" "5" "c.6210+5G>T" "r.spl?" "p.?" "16i" "0000462349" "00005473" "50" "3223" "0" "3223" "0" "c.3223C>T" "r.(?)" "p.(Arg1075Trp)" "8" "0000462350" "00005473" "50" "7832" "0" "7832" "0" "c.7832C>T" "r.(?)" "p.(Ala2611Val)" "38" "0000462351" "00005473" "50" "5839" "-3" "5839" "-3" "c.5839-3C>T" "r.spl?" "p.?" "12i" "0000462352" "00005473" "50" "4425" "0" "4425" "0" "c.4425T>C" "r.(?)" "p.(=)" "10" "0000462353" "00005473" "50" "2932" "0" "2932" "0" "c.2932G>A" "r.(?)" "p.(Ala978Thr)" "7" "0000462354" "00005473" "50" "1502" "0" "1502" "0" "c.1502C>T" "r.(?)" "p.(Thr501Ile)" "5" "0000462355" "00005473" "50" "4510" "0" "4510" "0" "c.4510C>T" "r.(?)" "p.(Arg1504Trp)" "10" "0000462356" "00005473" "70" "5036" "0" "5036" "0" "c.5036G>A" "r.(?)" "p.(Gly1679Glu)" "11" "0000462357" "00005473" "50" "5969" "0" "5969" "0" "c.5969G>A" "r.(?)" "p.(Arg1990Gln)" "14" "0000462358" "00005473" "70" "5036" "0" "5036" "0" "c.5036G>A" "r.(?)" "p.(Gly1679Glu)" "11" "0000462359" "00005473" "50" "1975" "0" "1975" "0" "c.1975C>T" "r.(?)" "p.(Arg659Cys)" "6" "0000462360" "00005473" "50" "5734" "0" "5734" "0" "c.5734G>A" "r.(?)" "p.(Glu1912Lys)" "12" "0000462361" "00005473" "50" "8804" "0" "8804" "0" "c.8804C>T" "r.(?)" "p.(Ala2935Val)" "40" "0000462362" "00005473" "50" "2180" "0" "2180" "0" "c.2180A>C" "r.(?)" "p.(Tyr727Ser)" "6" "0000462363" "00005473" "50" "461" "0" "461" "0" "c.461C>T" "r.(?)" "p.(Ser154Leu)" "3" "0000462364" "00005473" "50" "3595" "0" "3595" "0" "c.3595C>G" "r.(?)" "p.(Gln1199Glu)" "8" "0000462365" "00005473" "50" "4234" "0" "4234" "0" "c.4234A>T" "r.(?)" "p.(Thr1412Ser)" "9" "0000462366" "00005473" "50" "1502" "0" "1502" "0" "c.1502C>T" "r.(?)" "p.(Thr501Ile)" "5" "0000462367" "00005473" "50" "2525" "0" "2525" "0" "c.2525T>C" "r.(?)" "p.(Phe842Ser)" "7" "0000462368" "00005473" "50" "8639" "0" "8639" "0" "c.8639C>T" "r.(?)" "p.(Thr2880Met)" "40" "0000462369" "00005473" "50" "4978" "0" "4978" "0" "c.4978C>T" "r.(?)" "p.(Arg1660Cys)" "11" "0000462370" "00005473" "50" "4510" "0" "4510" "0" "c.4510C>T" "r.(?)" "p.(Arg1504Trp)" "10" "0000462371" "00005473" "50" "1975" "0" "1975" "0" "c.1975C>T" "r.(?)" "p.(Arg659Cys)" "6" "0000462372" "00005473" "50" "8804" "0" "8804" "0" "c.8804C>T" "r.(?)" "p.(Ala2935Val)" "40" "0000462373" "00005473" "90" "4835" "0" "4835" "0" "c.4835C>A" "r.(?)" "p.(Ser1612*)" "10" "0000462374" "00005473" "50" "7441" "0" "7441" "0" "c.7441A>G" "r.(?)" "p.(Thr2481Ala)" "36" "0000462375" "00005473" "70" "6799" "0" "6799" "0" "c.6799G>A" "r.(?)" "p.(Gly2267Ser)" "27" "0000462376" "00005473" "50" "1214" "0" "1214" "0" "c.1214T>C" "r.(?)" "p.(Phe405Ser)" "4" "0000462377" "00005473" "50" "3902" "0" "3902" "0" "c.3902G>A" "r.(?)" "p.(Arg1301Gln)" "9" "0000462378" "00005473" "50" "3118" "0" "3118" "0" "c.3118G>A" "r.(?)" "p.(Val1040Ile)" "8" "0000462379" "00005473" "50" "461" "0" "461" "0" "c.461C>T" "r.(?)" "p.(Ser154Leu)" "3" "0000462380" "00005473" "90" "6354" "1" "6354" "1" "c.6354+1G>A" "r.spl" "p.?" "19i" "0000462381" "00005473" "50" "8636" "0" "8636" "0" "c.8636C>T" "r.(?)" "p.(Thr2879Met)" "40" "0000462382" "00005473" "50" "2600" "0" "2600" "0" "c.2600A>T" "r.(?)" "p.(Asn867Ile)" "7" "0000462383" "00005473" "50" "8636" "0" "8636" "0" "c.8636C>T" "r.(?)" "p.(Thr2879Met)" "40" "0000462384" "00005473" "50" "2306" "0" "2306" "0" "c.2306C>T" "r.(?)" "p.(Ala769Val)" "6" "0000462385" "00005473" "50" "4510" "0" "4510" "0" "c.4510C>T" "r.(?)" "p.(Arg1504Trp)" "10" "0000462386" "00005473" "50" "6408" "0" "6408" "0" "c.6408G>C" "r.(?)" "p.(Arg2136Ser)" "20" "0000462387" "00005473" "50" "8393" "0" "8393" "0" "c.8393T>C" "r.(?)" "p.(Val2798Ala)" "38" "0000462388" "00005473" "90" "6354" "1" "6354" "1" "c.6354+1G>A" "r.spl" "p.?" "19i" "0000462389" "00005473" "50" "5838" "5" "5838" "5" "c.5838+5G>A" "r.spl?" "p.?" "12i" "0000462390" "00005473" "50" "2231" "0" "2231" "0" "c.2231C>T" "r.(?)" "p.(Pro744Leu)" "6" "0000462391" "00005473" "50" "3187" "0" "3187" "0" "c.3187G>A" "r.(?)" "p.(Asp1063Asn)" "8" "0000462392" "00005473" "70" "5036" "0" "5036" "0" "c.5036G>A" "r.(?)" "p.(Gly1679Glu)" "11" "0000462393" "00005473" "50" "9457" "0" "9457" "0" "c.9457G>C" "r.(?)" "p.(Gly3153Arg)" "43" "0000462394" "00005473" "50" "4510" "0" "4510" "0" "c.4510C>T" "r.(?)" "p.(Arg1504Trp)" "10" "0000462395" "00005473" "50" "1538" "0" "1538" "0" "c.1538G>A" "r.(?)" "p.(Arg513Gln)" "5" "0000462396" "00005473" "50" "3040" "0" "3040" "0" "c.3040A>G" "r.(?)" "p.(Lys1014Glu)" "7" "0000462397" "00005473" "50" "3741" "0" "3741" "0" "c.3741G>C" "r.(?)" "p.(Glu1247Asp)" "9" "0000462398" "00005473" "50" "8009" "0" "8009" "0" "c.8009C>T" "r.(?)" "p.(Ala2670Val)" "38" "0000462399" "00005473" "50" "7461" "0" "7461" "0" "c.7461G>A" "r.(?)" "p.(=)" "36" "0000462400" "00005473" "50" "6973" "0" "6973" "0" "c.6973C>A" "r.(?)" "p.(Pro2325Thr)" "31" "0000462401" "00005473" "50" "2218" "0" "2218" "0" "c.2218C>T" "r.(?)" "p.(Arg740Cys)" "6" "0000462402" "00005473" "50" "776" "0" "776" "0" "c.776C>T" "r.(?)" "p.(Ala259Val)" "4" "0000462403" "00005473" "50" "8243" "0" "8243" "0" "c.8243C>T" "r.(?)" "p.(Pro2748Leu)" "38" "0000462404" "00005473" "50" "5635" "0" "5635" "0" "c.5635G>A" "r.(?)" "p.(Gly1879Ser)" "12" "0000462405" "00005473" "50" "8846" "0" "8846" "0" "c.8846C>T" "r.(?)" "p.(Pro2949Leu)" "40" "0000462406" "00005473" "50" "1829" "0" "1829" "0" "c.1829C>T" "r.(?)" "p.(Ala610Val)" "5" "0000462407" "00005473" "50" "8636" "0" "8636" "0" "c.8636C>T" "r.(?)" "p.(Thr2879Met)" "40" "0000462408" "00005473" "50" "8008" "0" "8008" "0" "c.8008G>A" "r.(?)" "p.(Ala2670Thr)" "38" "0000462409" "00005473" "50" "4671" "0" "4671" "0" "c.4671C>T" "r.(?)" "p.(=)" "10" "0000462410" "00005473" "50" "707" "0" "707" "0" "c.707C>T" "r.(?)" "p.(Thr236Ile)" "3" "0000462411" "00005473" "50" "1740" "0" "1740" "0" "c.1740T>G" "r.(?)" "p.(Phe580Leu)" "5" "0000462412" "00005473" "50" "7258" "0" "7258" "0" "c.7258C>T" "r.(?)" "p.(Arg2420Trp)" "36" "0000462413" "00005473" "50" "3067" "0" "3067" "0" "c.3067C>T" "r.(?)" "p.(Pro1023Ser)" "7" "0000462414" "00005473" "50" "2488" "0" "2488" "0" "c.2488G>A" "r.(?)" "p.(Ala830Thr)" "6" "0000462415" "00005473" "50" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "19" "0000462416" "00005473" "50" "550" "0" "550" "0" "c.550G>A" "r.(?)" "p.(Ala184Thr)" "3" "0000462417" "00005473" "90" "6230" "0" "6230" "0" "c.6230G>A" "r.(?)" "p.(Gly2077Asp)" "17" "0000462418" "00005473" "50" "2524" "0" "2524" "0" "c.2524T>C" "r.(?)" "p.(Phe842Ser)" "7" "0000462419" "00005473" "50" "7114" "0" "7114" "0" "c.7114G>A" "r.(?)" "p.(Asp2372Asn)" "33" "0000462420" "00005473" "50" "2350" "0" "2350" "0" "c.2350G>A" "r.(?)" "p.(Ala784Thr)" "6" "0000462421" "00005473" "90" "6064" "-2" "6064" "-2" "c.6064-2A>G" "r.spl" "p.?" "14i" "0000462422" "00005473" "90" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "36" "0000462423" "00005473" "50" "6796" "0" "6796" "0" "c.6796A>G" "r.(?)" "p.(Thr2266Ala)" "27" "0000462424" "00005473" "50" "2444" "0" "2444" "0" "c.2444C>A" "r.(?)" "p.(Pro815His)" "6" "0000462425" "00005473" "50" "4663" "0" "4663" "0" "c.4663G>A" "r.(?)" "p.(Asp1555Asn)" "10" "0000462426" "00005473" "50" "8698" "0" "8698" "0" "c.8698A>G" "r.(?)" "p.(Ile2900Val)" "40" "0000462427" "00005473" "50" "839" "0" "839" "0" "c.839G>T" "r.(?)" "p.(Arg280Leu)" "4" "0000462428" "00005473" "50" "7879" "0" "7879" "0" "c.7879G>A" "r.(?)" "p.(Ala2627Thr)" "38" "0000462429" "00005473" "50" "4271" "0" "4271" "0" "c.4271G>A" "r.(?)" "p.(Arg1424His)" "9" "0000462430" "00005473" "70" "6238" "0" "6238" "0" "c.6238G>A" "r.(?)" "p.(Gly2080Ser)" "17" "0000462431" "00005473" "50" "2952" "0" "2952" "0" "c.2952G>C" "r.(?)" "p.(Glu984Asp)" "7" "0000462432" "00005473" "50" "6211" "-4" "6211" "-4" "c.6211-4A>G" "r.spl?" "p.?" "16i" "0000462433" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "38" "0000462434" "00005473" "50" "3371" "0" "3371" "0" "c.3371C>T" "r.(?)" "p.(Ala1124Val)" "8" "0000462435" "00005473" "50" "461" "0" "461" "0" "c.461C>T" "r.(?)" "p.(Ser154Leu)" "3" "0000462436" "00005473" "50" "9180" "0" "9180" "0" "c.9180C>G" "r.(?)" "p.(Cys3060Trp)" "41" "0000462437" "00005473" "50" "8924" "0" "8924" "0" "c.8924C>T" "r.(?)" "p.(Ala2975Val)" "40" "0000462438" "00005473" "50" "3754" "0" "3754" "0" "c.3754C>T" "r.(?)" "p.(Arg1252Cys)" "9" "0000462439" "00005473" "50" "6749" "0" "6749" "0" "c.6749C>T" "r.(?)" "p.(Pro2250Leu)" "26" "0000462440" "00005473" "50" "6769" "0" "6769" "0" "c.6769G>A" "r.(?)" "p.(Ala2257Thr)" "27" "0000462441" "00005473" "50" "8377" "0" "8377" "0" "c.8377G>A" "r.(?)" "p.(Val2793Ile)" "38" "0000462442" "00005473" "50" "8436" "0" "8436" "0" "c.8436C>T" "r.(?)" "p.(=)" "38" "0000462443" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "38" "0000462444" "00005473" "50" "8009" "0" "8009" "0" "c.8009C>T" "r.(?)" "p.(Ala2670Val)" "38" "0000462445" "00005473" "50" "4689" "0" "4689" "0" "c.4689C>G" "r.(?)" "p.(Ile1563Met)" "10" "0000462446" "00005473" "70" "6890" "0" "6890" "0" "c.6890G>C" "r.(?)" "p.(Gly2297Ala)" "29" "0000462447" "00005473" "70" "6890" "0" "6890" "0" "c.6890G>C" "r.(?)" "p.(Gly2297Ala)" "29" "0000462448" "00005473" "50" "802" "0" "802" "0" "c.802C>T" "r.(?)" "p.(Leu268Phe)" "4" "0000462449" "00005473" "50" "802" "0" "802" "0" "c.802C>T" "r.(?)" "p.(Leu268Phe)" "4" "0000462450" "00005473" "50" "802" "0" "802" "0" "c.802C>T" "r.(?)" "p.(Leu268Phe)" "4" "0000462451" "00005473" "50" "3664" "0" "3664" "0" "c.3664C>T" "r.(?)" "p.(Pro1222Ser)" "8" "0000462452" "00005473" "50" "4436" "0" "4436" "0" "c.4436A>T" "r.(?)" "p.(Gln1479Leu)" "10" "0000462453" "00005473" "50" "8575" "0" "8575" "0" "c.8575C>A" "r.(?)" "p.(Pro2859Thr)" "40" "0000462454" "00005473" "90" "4366" "0" "4366" "0" "c.4366C>T" "r.(?)" "p.(Arg1456*)" "10" "0000462455" "00005473" "50" "1214" "0" "1214" "0" "c.1214T>C" "r.(?)" "p.(Phe405Ser)" "4" "0000462456" "00005473" "50" "2029" "0" "2029" "0" "c.2029C>T" "r.(?)" "p.(Arg677Cys)" "6" "0000462457" "00005473" "50" "7265" "0" "7265" "0" "c.7265G>A" "r.(?)" "p.(Arg2422Gln)" "36" "0000462458" "00005473" "50" "3754" "0" "3754" "0" "c.3754C>T" "r.(?)" "p.(Arg1252Cys)" "9" "0000462459" "00005473" "50" "2305" "0" "2305" "0" "c.2305G>A" "r.(?)" "p.(Ala769Thr)" "6" "0000462460" "00005473" "50" "467" "0" "467" "0" "c.467A>C" "r.(?)" "p.(Asp156Ala)" "3" "0000462461" "00005473" "50" "1514" "0" "1514" "0" "c.1514A>T" "r.(?)" "p.(Lys505Ile)" "5" "0000462462" "00005473" "50" "3220" "0" "3220" "0" "c.3220G>A" "r.(?)" "p.(Asp1074Asn)" "8" "0000462463" "00005473" "90" "8966" "-1" "8966" "-1" "c.8966-1G>C" "r.spl" "p.?" "40i" "0000462464" "00005473" "50" "9116" "0" "9116" "0" "c.9116C>T" "r.(?)" "p.(Thr3039Met)" "41" "0000462465" "00005473" "50" "7687" "0" "7687" "0" "c.7687G>C" "r.(?)" "p.(Gly2563Arg)" "37" "0000462466" "00005473" "50" "1514" "0" "1514" "0" "c.1514A>T" "r.(?)" "p.(Lys505Ile)" "5" "0000462467" "00005473" "70" "6167" "0" "6167" "0" "c.6167G>A" "r.(?)" "p.(Gly2056Glu)" "16" "0000462468" "00005473" "50" "7607" "0" "7607" "0" "c.7607C>T" "r.(?)" "p.(Ala2536Val)" "36" "0000462469" "00005473" "50" "8575" "0" "8575" "0" "c.8575C>A" "r.(?)" "p.(Pro2859Thr)" "40" "0000462470" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "38" "0000462471" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "38" "0000515181" "00005473" "30" "9411" "0" "9411" "0" "c.9411T>C" "r.(?)" "p.(Cys3137=)" "" "0000515182" "00005473" "50" "9358" "0" "9358" "0" "c.9358A>G" "r.(?)" "p.(Thr3120Ala)" "" "0000515183" "00005473" "50" "9329" "-33" "9329" "-33" "c.9329-33C>T" "r.(=)" "p.(=)" "" "0000515184" "00005473" "30" "9069" "0" "9069" "0" "c.9069C>T" "r.(?)" "p.(Thr3023=)" "" "0000515185" "00005473" "30" "8822" "0" "8822" "0" "c.8822C>T" "r.(?)" "p.(Ala2941Val)" "" "0000515186" "00005473" "10" "8780" "0" "8780" "0" "c.8780T>C" "r.(?)" "p.(Met2927Thr)" "" "0000515187" "00005473" "10" "8780" "0" "8780" "0" "c.8780T>C" "r.(?)" "p.(Met2927Thr)" "" "0000515188" "00005473" "10" "8780" "0" "8780" "0" "c.8780T>C" "r.(?)" "p.(Met2927Thr)" "" "0000515189" "00005473" "30" "8735" "0" "8735" "0" "c.8735C>T" "r.(?)" "p.(Pro2912Leu)" "" "0000515190" "00005473" "50" "8636" "0" "8636" "0" "c.8636C>T" "r.(?)" "p.(Thr2879Met)" "" "0000515191" "00005473" "50" "8636" "0" "8636" "0" "c.8636C>T" "r.(?)" "p.(Thr2879Met)" "" "0000515193" "00005473" "10" "8491" "0" "8491" "0" "c.8491G>C" "r.(?)" "p.(Asp2831His)" "" "0000515194" "00005473" "30" "8349" "0" "8349" "0" "c.8349A>G" "r.(?)" "p.(Val2783=)" "" "0000515195" "00005473" "50" "8308" "0" "8308" "0" "c.8308G>A" "r.(?)" "p.(Val2770Met)" "" "0000515196" "00005473" "50" "8243" "0" "8243" "0" "c.8243C>T" "r.(?)" "p.(Pro2748Leu)" "" "0000515197" "00005473" "50" "8201" "0" "8201" "0" "c.8201G>A" "r.(?)" "p.(Arg2734Gln)" "" "0000515198" "00005473" "30" "7928" "0" "7928" "0" "c.7928C>T" "r.(?)" "p.(Ala2643Val)" "" "0000515199" "00005473" "30" "7737" "0" "7737" "0" "c.7737G>A" "r.(?)" "p.(Glu2579=)" "" "0000515200" "00005473" "50" "7567" "0" "7567" "0" "c.7567T>A" "r.(?)" "p.(Ser2523Thr)" "" "0000515202" "00005473" "30" "7356" "0" "7356" "0" "c.7356C>G" "r.(?)" "p.(Asn2452Lys)" "" "0000515203" "00005473" "50" "7224" "0" "7224" "0" "c.7224C>G" "r.(?)" "p.(Asp2408Glu)" "" "0000515204" "00005473" "30" "7175" "-11" "7175" "-11" "c.7175-11A>G" "r.(=)" "p.(=)" "" "0000515205" "00005473" "50" "6868" "0" "6868" "0" "c.6868C>T" "r.(?)" "p.(Arg2290Cys)" "" "0000515207" "00005473" "30" "6653" "0" "6653" "0" "c.6653C>T" "r.(?)" "p.(Pro2218Leu)" "" "0000515209" "00005473" "10" "6592" "-16" "6592" "-16" "c.6592-16A>T" "r.(=)" "p.(=)" "" "0000515210" "00005473" "90" "6354" "2" "6354" "2" "c.6354+2T>C" "r.spl?" "p.?" "" "0000515211" "00005473" "50" "6331" "0" "6331" "0" "c.6331C>G" "r.(?)" "p.(Leu2111Val)" "" "0000515212" "00005473" "50" "6224" "0" "6224" "0" "c.6224C>T" "r.(?)" "p.(Pro2075Leu)" "" "0000515216" "00005473" "50" "5641" "0" "5645" "0" "c.5641_5645dup" "r.(?)" "p.(Pro1883AlafsTer50)" "" "0000515217" "00005473" "30" "5619" "0" "5619" "0" "c.5619C>T" "r.(?)" "p.(His1873=)" "" "0000515219" "00005473" "30" "5394" "0" "5394" "0" "c.5394C>T" "r.(?)" "p.(Arg1798=)" "" "0000515222" "00005473" "10" "4727" "0" "4727" "0" "c.4727G>A" "r.(?)" "p.(Arg1576Gln)" "" "0000515223" "00005473" "50" "4510" "0" "4510" "0" "c.4510C>T" "r.(?)" "p.(Arg1504Trp)" "" "0000515224" "00005473" "50" "4504" "0" "4504" "0" "c.4504G>A" "r.(?)" "p.(Ala1502Thr)" "" "0000515226" "00005473" "50" "4306" "0" "4306" "0" "c.4306G>C" "r.(?)" "p.(Asp1436His)" "" "0000515227" "00005473" "30" "4285" "9" "4285" "9" "c.4285+9G>A" "r.(=)" "p.(=)" "" "0000515228" "00005473" "30" "4217" "0" "4217" "0" "c.4217C>T" "r.(?)" "p.(Thr1406Met)" "" "0000515230" "00005473" "50" "4121" "0" "4121" "0" "c.4121A>T" "r.(?)" "p.(Asp1374Val)" "" "0000515231" "00005473" "30" "4117" "0" "4117" "0" "c.4117G>A" "r.(?)" "p.(Ala1373Thr)" "" "0000515232" "00005473" "50" "4103" "0" "4103" "0" "c.4103C>T" "r.(?)" "p.(Thr1368Met)" "" "0000515234" "00005473" "30" "3954" "0" "3954" "0" "c.3954C>T" "r.(?)" "p.(Tyr1318=)" "" "0000515236" "00005473" "30" "3446" "0" "3446" "0" "c.3446G>A" "r.(?)" "p.(Arg1149Gln)" "" "0000515238" "00005473" "30" "3262" "0" "3262" "0" "c.3262A>C" "r.(?)" "p.(Lys1088Gln)" "" "0000515241" "00005473" "50" "3088" "0" "3088" "0" "c.3088G>A" "r.(?)" "p.(Val1030Met)" "" "0000515242" "00005473" "30" "3087" "0" "3087" "0" "c.3087C>T" "r.(?)" "p.(Asp1029=)" "" "0000515243" "00005473" "30" "3087" "0" "3087" "0" "c.3087C>T" "r.(?)" "p.(Asp1029=)" "" "0000515246" "00005473" "30" "1786" "0" "1786" "0" "c.1786G>T" "r.(?)" "p.(Ala596Ser)" "" "0000515247" "00005473" "30" "1638" "0" "1638" "0" "c.1638C>T" "r.(?)" "p.(Ala546=)" "" "0000515250" "00005473" "50" "1024" "0" "1024" "0" "c.1024G>A" "r.(?)" "p.(Val342Met)" "" "0000515252" "00005473" "30" "730" "0" "730" "0" "c.730A>G" "r.(?)" "p.(Ile244Val)" "" "0000577978" "00005473" "50" "6224" "0" "6224" "0" "c.6224C>T" "r.(?)" "p.(Pro2075Leu)" "" "0000578288" "00005473" "70" "5992" "0" "5992" "0" "c.5992C>T" "r.(?)" "p.Arg1998*" "" "0000578289" "00005473" "70" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.Lys2483Glu" "" "0000578292" "00005473" "50" "2959" "0" "2959" "0" "c.2959G>A" "r.(?)" "p.Val987Met" "" "0000597886" "00005473" "90" "6355" "-1" "6355" "-1" "c.6355-1G>A" "r.6355_6408del" "p.Leu2123_Gly2140del" "" "0000607823" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "" "0000607824" "00005473" "50" "6773" "0" "6773" "0" "c.6773G>A" "r.(?)" "p.(Gly2258Asp)" "" "0000607827" "00005473" "30" "5820" "0" "5820" "0" "c.5820C>T" "r.(?)" "p.(Ser1940=)" "" "0000607828" "00005473" "30" "2561" "0" "2561" "0" "c.2561T>C" "r.(?)" "p.(Val854Ala)" "" "0000607829" "00005473" "50" "2164" "0" "2164" "0" "c.2164G>A" "r.(?)" "p.(Ala722Thr)" "" "0000607830" "00005473" "30" "2030" "0" "2030" "0" "c.2030G>A" "r.(?)" "p.(Arg677His)" "" "0000607831" "00005473" "30" "1120" "0" "1120" "0" "c.1120G>A" "r.(?)" "p.(Val374Met)" "" "0000607832" "00005473" "30" "757" "0" "757" "0" "c.757A>G" "r.(?)" "p.(Thr253Ala)" "" "0000607833" "00005473" "30" "285" "0" "285" "0" "c.285G>A" "r.(?)" "p.(Thr95=)" "" "0000620991" "00005473" "50" "3837" "0" "3837" "0" "c.3837C>A" "r.(?)" "p.(Asp1279Glu)" "" "0000620992" "00005473" "50" "3223" "0" "3223" "0" "c.3223C>T" "r.(?)" "p.(Arg1075Trp)" "" "0000620993" "00005473" "30" "2495" "0" "2495" "0" "c.2495C>T" "r.(?)" "p.(Pro832Leu)" "" "0000620994" "00005473" "50" "1888" "0" "1888" "0" "c.1888A>G" "r.(?)" "p.(Thr630Ala)" "" "0000624867" "00005473" "50" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "36" "0000629457" "00005473" "90" "4156" "0" "4156" "0" "c.4156G>A" "r.(?)" "p.(Glu1386Lys)" "" "0000629458" "00005473" "90" "6283" "-1" "6283" "-1" "c.6283-1C>T" "r.spl" "p.?" "" "0000629459" "00005473" "90" "6156" "1" "6156" "1" "c.6156+1G>A" "r.spl" "p.?" "" "0000646771" "00005473" "70" "7264" "0" "7264" "0" "c.7264C>T" "r.(?)" "p.(Arg2422*)" "" "0000646781" "00005473" "50" "2218" "0" "2218" "0" "c.2218C>T" "r.(?)" "p.(Arg740Cys)" "" "0000646790" "00005473" "50" "8168" "0" "8168" "0" "c.8168T>C" "r.(?)" "p.(Ile2723Thr)" "" "0000646797" "00005473" "50" "4156" "0" "4156" "0" "c.4156G>A" "r.(?)" "p.(Glu1386Lys)" "" "0000646821" "00005473" "50" "4156" "0" "4156" "0" "c.4156G>A" "r.(?)" "p.(Glu1386Lys)" "" "0000650505" "00005473" "50" "7849" "0" "7849" "0" "c.7849G>A" "r.(?)" "p.(Asp2617Asn)" "" "0000650506" "00005473" "50" "6859" "0" "6859" "0" "c.6859del" "r.(?)" "p.(Arg2287Glyfs*44)" "" "0000650507" "00005473" "10" "6653" "0" "6653" "0" "c.6653C>T" "r.(?)" "p.(Pro2218Leu)" "" "0000650508" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl?" "p.?" "" "0000650509" "00005473" "50" "4156" "0" "4156" "0" "c.4156G>A" "r.(?)" "p.(Glu1386Lys)" "" "0000650510" "00005473" "30" "1389" "0" "1389" "0" "c.1389C>T" "r.(=)" "p.(=)" "" "0000650511" "00005473" "30" "768" "0" "768" "0" "c.768C>T" "r.(=)" "p.(=)" "" "0000650512" "00005473" "70" "175" "0" "175" "0" "c.175C>T" "r.(?)" "p.(Arg59*)" "" "0000653036" "00005473" "30" "7645" "0" "7645" "0" "c.7645C>T" "r.(?)" "p.(Arg2549Trp)" "" "0000653417" "00005473" "50" "5113" "0" "5113" "0" "c.5113G>T" "r.(?)" "p.(Ala1705Ser)" "" "0000654597" "00005473" "30" "687" "0" "687" "0" "c.687G>A" "r.(?)" "p.(Thr229=)" "" "0000660446" "00005473" "50" "3923" "0" "3923" "0" "c.3923G>A" "r.(?)" "p.(Arg1308Gln)" "" "0000660690" "00005473" "70" "8966" "-1" "8966" "-1" "c.8966-1G>C" "r.(?)" "p.(?)" "" "0000669620" "00005473" "10" "6653" "0" "6653" "0" "c.6653C>T" "r.(?)" "p.(Pro2218Leu)" "" "0000669621" "00005473" "30" "768" "0" "768" "0" "c.768C>T" "r.(=)" "p.(=)" "" "0000676562" "00005473" "30" "9217" "0" "9217" "0" "c.9217A>G" "r.(?)" "p.(Ser3073Gly)" "" "0000676563" "00005473" "30" "9045" "0" "9045" "0" "c.9045C>T" "r.(?)" "p.(Pro3015=)" "" "0000676564" "00005473" "30" "8724" "0" "8724" "0" "c.8724C>T" "r.(?)" "p.(Ala2908=)" "" "0000676565" "00005473" "30" "6282" "7" "6282" "7" "c.6282+7C>T" "r.(=)" "p.(=)" "" "0000676566" "00005473" "30" "5059" "0" "5059" "0" "c.5059C>T" "r.(?)" "p.(Pro1687Ser)" "" "0000676567" "00005473" "30" "4503" "0" "4503" "0" "c.4503C>T" "r.(?)" "p.(Asp1501=)" "" "0000676568" "00005473" "30" "1761" "0" "1761" "0" "c.1761C>T" "r.(?)" "p.(Ala587=)" "" "0000676570" "00005473" "30" "1231" "0" "1231" "0" "c.1231C>G" "r.(?)" "p.(Leu411Val)" "" "0000676571" "00005473" "30" "936" "0" "936" "0" "c.936C>T" "r.(?)" "p.(Leu312=)" "" "0000682861" "00005473" "50" "2306" "0" "2306" "0" "c.2306C>T" "r.(?)" "p.(Ala769Val)" "" "0000688707" "00005473" "50" "3902" "0" "3902" "0" "c.3902G>A" "r.(?)" "p.(Arg1301Gln)" "" "0000688708" "00005473" "50" "1688" "0" "1688" "0" "c.1688A>G" "r.(?)" "p.(Asp563Gly)" "" "0000693857" "00005473" "50" "7048" "0" "7048" "0" "c.7048G>T" "r.(?)" "p.(Gly2350Trp)" "" "0000697437" "00005473" "70" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000697438" "00005473" "70" "4856" "0" "4856" "0" "c.4856C>T" "r.(?)" "p.(Thr1619Ile)" "" "0000697439" "00005473" "70" "8567" "2" "8567" "2" "c.8567+2T>A" "r.spl" "p.?" "" "0000697440" "00005473" "70" "7509" "0" "7509" "0" "c.7509G>T" "r.(?)" "p.(Arg2503Ser)" "" "0000697441" "00005473" "70" "7330" "0" "7330" "0" "c.7330C>T" "r.(?)" "p.(Arg2444Trp)" "" "0000697442" "00005473" "70" "7037" "0" "7037" "0" "c.7037C>T" "r.(?)" "p.(Ser2346Leu)" "" "0000697443" "00005473" "70" "7024" "0" "7024" "0" "c.7024C>T" "r.(?)" "p.(Arg2342*)" "" "0000697444" "00005473" "70" "6220" "0" "6220" "0" "c.6220G>A" "r.(?)" "p.(Gly2074Ser)" "" "0000697445" "00005473" "70" "6199" "0" "6199" "0" "c.6199G>A" "r.(?)" "p.(Glu2067Lys)" "" "0000697446" "00005473" "70" "5993" "0" "5993" "0" "c.5993G>A" "r.(?)" "p.(Arg1998Gln)" "" "0000697447" "00005473" "70" "5950" "0" "5950" "0" "c.5950C>T" "r.(?)" "p.(Arg1984*)" "" "0000697448" "00005473" "70" "4504" "0" "4504" "0" "c.4504G>A" "r.(?)" "p.(Ala1502Thr)" "" "0000718631" "00005473" "30" "9508" "0" "9508" "0" "c.9508G>A" "r.(?)" "p.(Gly3170Arg)" "" "0000718632" "00005473" "50" "9455" "0" "9455" "0" "c.9455T>A" "r.(?)" "p.(Phe3152Tyr)" "" "0000718633" "00005473" "50" "9245" "0" "9245" "0" "c.9245C>G" "r.(?)" "p.(Pro3082Arg)" "" "0000718634" "00005473" "50" "8531" "0" "8531" "0" "c.8531C>A" "r.(?)" "p.(Pro2844His)" "" "0000718635" "00005473" "50" "8009" "0" "8009" "0" "c.8009C>T" "r.(?)" "p.(Ala2670Val)" "" "0000718636" "00005473" "30" "7779" "0" "7779" "0" "c.7779C>T" "r.(?)" "p.(Ile2593=)" "" "0000718637" "00005473" "50" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000718638" "00005473" "50" "7402" "0" "7402" "0" "c.7402G>A" "r.(?)" "p.(Val2468Ile)" "" "0000718639" "00005473" "50" "7175" "-6" "7175" "-6" "c.7175-6C>G" "r.(=)" "p.(=)" "" "0000718640" "00005473" "70" "6238" "0" "6238" "0" "c.6238G>A" "r.(?)" "p.(Gly2080Ser)" "" "0000718641" "00005473" "50" "6190" "0" "6190" "0" "c.6190C>T" "r.(?)" "p.(Pro2064Ser)" "" "0000718642" "00005473" "50" "5890" "0" "5890" "0" "c.5890A>G" "r.(?)" "p.(Arg1964Gly)" "" "0000718643" "00005473" "30" "5839" "-3" "5839" "-3" "c.5839-3C>T" "r.spl?" "p.?" "" "0000718644" "00005473" "50" "5833" "0" "5833" "0" "c.5833G>C" "r.(?)" "p.(Val1945Leu)" "" "0000718645" "00005473" "50" "5777" "0" "5777" "0" "c.5777C>T" "r.(?)" "p.(Thr1926Met)" "" "0000718646" "00005473" "70" "5641" "0" "5645" "0" "c.5641_5645dup" "r.(?)" "p.(Pro1883AlafsTer50)" "" "0000718647" "00005473" "50" "5419" "0" "5419" "0" "c.5419G>A" "r.(?)" "p.(Glu1807Lys)" "" "0000718648" "00005473" "50" "5374" "0" "5374" "0" "c.5374A>G" "r.(?)" "p.(Asn1792Asp)" "" "0000718649" "00005473" "70" "4789" "0" "4789" "0" "c.4789C>T" "r.(?)" "p.(Arg1597Ter)" "" "0000718650" "00005473" "50" "4436" "0" "4436" "0" "c.4436A>T" "r.(?)" "p.(Gln1479Leu)" "" "0000718651" "00005473" "30" "4399" "0" "4399" "0" "c.4399A>G" "r.(?)" "p.(Asn1467Asp)" "" "0000718652" "00005473" "30" "4156" "0" "4156" "0" "c.4156G>A" "r.(?)" "p.(Glu1386Lys)" "" "0000718653" "00005473" "50" "3560" "0" "3560" "0" "c.3560C>T" "r.(?)" "p.(Ala1187Val)" "" "0000718654" "00005473" "30" "3324" "0" "3324" "0" "c.3324C>T" "r.(?)" "p.(Thr1108=)" "" "0000718655" "00005473" "50" "3133" "0" "3133" "0" "c.3133C>T" "r.(?)" "p.(Pro1045Ser)" "" "0000718656" "00005473" "90" "3121" "0" "3121" "0" "c.3121del" "r.(?)" "p.(Arg1041GlyfsTer7)" "" "0000718657" "00005473" "30" "2145" "0" "2145" "0" "c.2145G>T" "r.(?)" "p.(Ser715=)" "" "0000718658" "00005473" "50" "1538" "0" "1538" "0" "c.1538G>A" "r.(?)" "p.(Arg513Gln)" "" "0000718659" "00005473" "50" "1529" "0" "1529" "0" "c.1529C>T" "r.(?)" "p.(Thr510Ile)" "" "0000718660" "00005473" "50" "1024" "0" "1024" "0" "c.1024G>A" "r.(?)" "p.(Val342Met)" "" "0000718661" "00005473" "30" "489" "0" "489" "0" "c.489G>A" "r.(?)" "p.(Ala163=)" "" "0000732720" "00005473" "50" "8009" "0" "8009" "0" "c.8009C>T" "r.(?)" "p.(Ala2670Val)" "38" "0000765170" "00005473" "70" "6158" "0" "6158" "0" "c.6158G>A" "r.(?)" "p.(Gly2053Asp)" "16" "0000787248" "00005473" "50" "3700" "0" "3700" "0" "c.3700G>A" "r.(?)" "p.(Val1234Met)" "9" "0000787249" "00005473" "50" "6224" "0" "6224" "0" "c.6224C>A" "r.(?)" "p.(Pro2075Gln)" "17" "0000787462" "00005473" "50" "7375" "0" "7375" "0" "c.7375C>T" "r.(?)" "p.(Arg2459Trp)" "36" "0000800492" "00005473" "30" "8819" "0" "8819" "0" "c.8819C>T" "r.(?)" "p.(Thr2940Met)" "" "0000800493" "00005473" "30" "8465" "-7" "8465" "-7" "c.8465-7del" "r.(=)" "p.(=)" "" "0000800494" "00005473" "50" "8189" "0" "8189" "0" "c.8189C>A" "r.(?)" "p.(Ala2730Asp)" "" "0000800495" "00005473" "50" "8045" "0" "8045" "0" "c.8045C>T" "r.(?)" "p.(Pro2682Leu)" "" "0000800496" "00005473" "30" "7092" "20" "7092" "20" "c.7092+20T>C" "r.(=)" "p.(=)" "" "0000800497" "00005473" "50" "6751" "0" "6751" "0" "c.6751C>T" "r.(?)" "p.(Arg2251Trp)" "" "0000800498" "00005473" "30" "6210" "0" "6210" "0" "c.6210C>T" "r.(?)" "p.(Pro2070=)" "" "0000800499" "00005473" "30" "4221" "0" "4221" "0" "c.4221C>G" "r.(?)" "p.(Pro1407=)" "" "0000800500" "00005473" "30" "4146" "0" "4146" "0" "c.4146G>A" "r.(?)" "p.(Ser1382=)" "" "0000800501" "00005473" "30" "3891" "0" "3891" "0" "c.3891C>T" "r.(?)" "p.(Asn1297=)" "" "0000800502" "00005473" "30" "1623" "0" "1623" "0" "c.1623C>T" "r.(?)" "p.(Ala541=)" "" "0000800503" "00005473" "50" "888" "0" "888" "0" "c.888G>C" "r.(?)" "p.(Leu296Phe)" "" "0000800504" "00005473" "50" "821" "0" "821" "0" "c.821T>A" "r.(?)" "p.(Ile274Asn)" "" "0000800505" "00005473" "50" "727" "0" "727" "0" "c.727A>G" "r.(?)" "p.(Ile243Val)" "" "0000800506" "00005473" "30" "489" "0" "489" "0" "c.489G>A" "r.(?)" "p.(Ala163=)" "" "0000800507" "00005473" "70" "175" "0" "175" "0" "c.175C>T" "r.(?)" "p.(Arg59Ter)" "" "0000819214" "00005473" "50" "8305" "0" "8307" "0" "c.8305_8307del" "r.(?)" "p.(Phe2769del)" "" "0000819289" "00005473" "90" "5766" "0" "5766" "0" "c.5766del" "r.(?)" "p.(Tyr1923Thrfs*8)" "" "0000823841" "00005473" "70" "2030" "0" "2030" "0" "c.2030G>A" "r.(?)" "p.(Arg677His)" "6" "0000823901" "00005473" "50" "5825" "0" "5825" "0" "c.5825C>T" "r.(?)" "p.(Pro1942Leu)" "12" "0000823913" "00005473" "70" "7600" "0" "7600" "0" "c.7600T>G" "r.(?)" "p.(Ser2534Ala)" "36" "0000823917" "00005473" "50" "4405" "0" "4405" "0" "c.4405G>C" "r.(?)" "p.(Gly1469Arg)" "10" "0000823934" "00005473" "70" "5917" "2" "5917" "2" "c.5917+2T>C" "r.spl" "p.?" "13i" "0000823938" "00005473" "50" "5645" "0" "5645" "0" "c.5645C>T" "r.(?)" "p.(Ser1882Leu)" "12" "0000823973" "00005473" "50" "3844" "0" "3844" "0" "c.3844G>A" "r.(?)" "p.(Val1282Met)" "9" "0000823974" "00005473" "50" "6469" "0" "6469" "0" "c.6469C>G" "r.(?)" "p.(Pro2157Ala)" "21" "0000829137" "00005473" "50" "4156" "0" "4156" "0" "c.4156G>A" "r.(?)" "p.(Glu1386Lys)" "" "0000829155" "00005473" "50" "4156" "0" "4156" "0" "c.4156G>A" "r.(?)" "p.(Glu1386Lys)" "" "0000831356" "00005473" "70" "4519" "0" "4527" "0" "c.4519_4527del" "r.(?)" "p.(Arg1507_Arg1509del)" "10" "0000831357" "00005473" "90" "6181" "0" "6181" "0" "c.6181C>T" "r.(?)" "p.(Arg2061Ter)" "16" "0000831358" "00005473" "90" "6194" "0" "6194" "0" "c.6194G>A" "r.(?)" "p.(Gly2065Asp)" "16" "0000831359" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl" "p.?" "16i" "0000831360" "00005473" "90" "6210" "5" "6210" "5" "c.6210+5G>A" "r.spl?" "p.?" "16i" "0000831361" "00005473" "90" "6210" "5" "6210" "5" "c.6210+5G>A" "r.spl?" "p.?" "16i" "0000831362" "00005473" "90" "6230" "0" "6230" "0" "c.6230G>A" "r.(?)" "p.(Gly2077Asp)" "17" "0000831363" "00005473" "90" "6238" "0" "6238" "0" "c.6238G>T" "r.(?)" "p.(Gly2080Cys)" "17" "0000831364" "00005473" "70" "6283" "-15" "6283" "-15" "c.6283-15C>A" "r.spl?" "p.?" "17i" "0000831365" "00005473" "70" "6283" "-1" "6283" "-1" "c.6283-1G>A" "r.spl" "p.?" "17i" "0000831366" "00005473" "70" "6283" "-1" "6283" "-1" "c.6283-1G>T" "r.spl" "p.?" "17i" "0000831390" "00005473" "90" "8877" "0" "8879" "0" "c.8877_8879del" "r.(?)" "p.(Ala2960del)" "40" "0000831392" "00005473" "70" "8472" "0" "8473" "0" "c.8472_8473del" "r.(?)" "p.(Ala2825PhefsTer12)" "39" "0000833084" "00005473" "70" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000833097" "00005473" "70" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000839162" "00005473" "90" "4899" "0" "4899" "0" "c.4899del" "r.(?)" "p.(Glu1634Argfs*32)" "5" "0000849799" "00005473" "30" "9487" "0" "9487" "0" "c.9487G>A" "r.(?)" "p.(Ala3163Thr)" "" "0000849800" "00005473" "30" "7928" "0" "7928" "0" "c.7928C>T" "r.(?)" "p.(Ala2643Val)" "" "0000849801" "00005473" "30" "3270" "0" "3270" "0" "c.3270C>T" "r.(?)" "p.(Asp1090=)" "" "0000849802" "00005473" "50" "3224" "0" "3224" "0" "c.3224G>A" "r.(?)" "p.(Arg1075Gln)" "" "0000849803" "00005473" "50" "1538" "0" "1538" "0" "c.1538G>A" "r.(?)" "p.(Arg513Gln)" "" "0000858414" "00005473" "30" "9494" "-10" "9494" "-10" "c.9494-10C>T" "r.(=)" "p.(=)" "" "0000858415" "00005473" "30" "9129" "0" "9129" "0" "c.9129C>T" "r.(?)" "p.(Arg3043=)" "" "0000858416" "00005473" "30" "9090" "0" "9090" "0" "c.9090G>A" "r.(?)" "p.(Gln3030=)" "" "0000858417" "00005473" "30" "8978" "0" "8978" "0" "c.8978G>A" "r.(?)" "p.(Arg2993His)" "" "0000858418" "00005473" "30" "8145" "0" "8145" "0" "c.8145A>G" "r.(?)" "p.(Leu2715=)" "" "0000858419" "00005473" "50" "8075" "0" "8075" "0" "c.8075A>G" "r.(?)" "p.(Tyr2692Cys)" "" "0000858420" "00005473" "30" "8007" "0" "8007" "0" "c.8007C>T" "r.(?)" "p.(His2669=)" "" "0000858421" "00005473" "30" "7995" "0" "7995" "0" "c.7995A>C" "r.(?)" "p.(Ala2665=)" "" "0000858422" "00005473" "50" "7903" "0" "7903" "0" "c.7903T>C" "r.(?)" "p.(Phe2635Leu)" "" "0000858423" "00005473" "10" "7509" "0" "7509" "0" "c.7509G>A" "r.(?)" "p.(Arg2503=)" "" "0000858424" "00005473" "30" "7329" "0" "7329" "0" "c.7329C>T" "r.(?)" "p.(Ala2443=)" "" "0000858425" "00005473" "70" "7264" "0" "7264" "0" "c.7264C>T" "r.(?)" "p.(Arg2422Ter)" "" "0000858426" "00005473" "30" "7086" "0" "7086" "0" "c.7086A>C" "r.(?)" "p.(Gly2362=)" "" "0000858427" "00005473" "30" "6981" "0" "6981" "0" "c.6981A>G" "r.(?)" "p.(Glu2327=)" "" "0000858428" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>T" "r.spl?" "p.?" "" "0000858429" "00005473" "30" "5374" "0" "5374" "0" "c.5374A>G" "r.(?)" "p.(Asn1792Asp)" "" "0000858430" "00005473" "50" "5212" "0" "5212" "0" "c.5212C>T" "r.(?)" "p.(Arg1738Cys)" "" "0000858431" "00005473" "50" "5020" "0" "5020" "0" "c.5020G>A" "r.(?)" "p.(Asp1674Asn)" "" "0000858432" "00005473" "30" "4493" "0" "4493" "0" "c.4493C>T" "r.(?)" "p.(Pro1498Leu)" "" "0000858433" "00005473" "30" "4184" "0" "4184" "0" "c.4184G>A" "r.(?)" "p.(Arg1395Gln)" "" "0000858434" "00005473" "30" "4156" "0" "4156" "0" "c.4156G>A" "r.(?)" "p.(Glu1386Lys)" "" "0000858435" "00005473" "30" "3923" "0" "3923" "0" "c.3923G>A" "r.(?)" "p.(Arg1308Gln)" "" "0000858436" "00005473" "30" "3680" "-4" "3680" "-4" "c.3680-4G>A" "r.spl?" "p.?" "" "0000858437" "00005473" "30" "3071" "-16" "3071" "-16" "c.3071-16G>A" "r.(=)" "p.(=)" "" "0000858438" "00005473" "30" "775" "0" "775" "0" "c.775G>A" "r.(?)" "p.(Ala259Thr)" "" "0000858439" "00005473" "10" "768" "0" "768" "0" "c.768C>T" "r.(?)" "p.(Val256=)" "" "0000858440" "00005473" "30" "625" "0" "625" "0" "c.625A>G" "r.(?)" "p.(Ile209Val)" "" "0000858441" "00005473" "30" "536" "0" "536" "0" "c.536A>G" "r.(?)" "p.(Asp179Gly)" "" "0000874592" "00005473" "70" "5525" "0" "5525" "0" "c.5525G>A" "r.(?)" "p.(Gly1842Glu)" "" "0000885025" "00005473" "70" "8966" "-1" "8966" "-1" "c.8966-1G>C" "r.spl?" "p.?" "" "0000885026" "00005473" "30" "8636" "0" "8636" "0" "c.8636C>T" "r.(?)" "p.(Thr2879Met)" "" "0000885027" "00005473" "50" "7963" "0" "7963" "0" "c.7963C>G" "r.(?)" "p.(Pro2655Ala)" "" "0000885028" "00005473" "10" "7669" "-35" "7669" "-35" "c.7669-35C>T" "r.(=)" "p.(=)" "" "0000885029" "00005473" "50" "7258" "0" "7258" "0" "c.7258C>T" "r.(?)" "p.(Arg2420Trp)" "" "0000885030" "00005473" "50" "6991" "0" "6991" "0" "c.6991A>C" "r.(?)" "p.(Asn2331His)" "" "0000885032" "00005473" "10" "6063" "13" "6063" "13" "c.6063+13dup" "r.(=)" "p.(=)" "" "0000885033" "00005473" "30" "5619" "0" "5619" "0" "c.5619C>T" "r.(?)" "p.(His1873=)" "" "0000885034" "00005473" "10" "5501" "-150" "5501" "-150" "c.5501-150G>T" "r.(=)" "p.(=)" "" "0000885035" "00005473" "30" "5100" "0" "5100" "0" "c.5100G>A" "r.(?)" "p.(Arg1700=)" "" "0000885036" "00005473" "30" "4503" "0" "4503" "0" "c.4503C>T" "r.(?)" "p.(Asp1501=)" "" "0000885037" "00005473" "30" "4312" "0" "4312" "0" "c.4312G>A" "r.(?)" "p.(Val1438Ile)" "" "0000885038" "00005473" "30" "4169" "0" "4169" "0" "c.4169C>T" "r.(?)" "p.(Ser1390Leu)" "" "0000885039" "00005473" "30" "4103" "0" "4103" "0" "c.4103C>T" "r.(?)" "p.(Thr1368Met)" "" "0000885040" "00005473" "50" "3419" "0" "3419" "0" "c.3419C>T" "r.(?)" "p.(Thr1140Met)" "" "0000885041" "00005473" "50" "3190" "0" "3190" "0" "c.3190C>T" "r.(?)" "p.(Arg1064Trp)" "" "0000885043" "00005473" "30" "1971" "0" "1971" "0" "c.1971T>C" "r.(?)" "p.(Tyr657=)" "" "0000885044" "00005473" "30" "1688" "0" "1688" "0" "c.1688A>G" "r.(?)" "p.(Asp563Gly)" "" "0000885045" "00005473" "50" "1537" "0" "1537" "0" "c.1537C>G" "r.(?)" "p.(Arg513Gly)" "" "0000885046" "00005473" "10" "1313" "-17" "1313" "-17" "c.1313-17A>G" "r.(=)" "p.(=)" "" "0000885047" "00005473" "10" "1231" "0" "1231" "0" "c.1231C>G" "r.(?)" "p.(Leu411Val)" "" "0000885048" "00005473" "50" "888" "0" "888" "0" "c.888G>C" "r.(?)" "p.(Leu296Phe)" "" "0000885049" "00005473" "50" "821" "0" "821" "0" "c.821T>A" "r.(?)" "p.(Ile274Asn)" "" "0000885050" "00005473" "50" "550" "0" "550" "0" "c.550G>A" "r.(?)" "p.(Ala184Thr)" "" "0000885051" "00005473" "50" "467" "0" "467" "0" "c.467A>G" "r.(?)" "p.(Asp156Gly)" "" "0000885052" "00005473" "10" "92" "-59" "92" "-59" "c.92-59T>C" "r.(=)" "p.(=)" "" "0000905248" "00005473" "70" "6158" "0" "6158" "0" "c.6158G>A" "r.(?)" "p.(Gly2053Asp)" "16" "0000909545" "00005473" "90" "6293" "0" "6293" "0" "c.6293G>T" "r.(?)" "p.(Gly2098Val)" "" "0000909546" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>T" "r.spl" "p.?" "" "0000909547" "00005473" "90" "6308" "0" "6308" "0" "c.6308A>G" "r.(?)" "p.(Lys2103Arg)" "" "0000911638" "00005473" "30" "9012" "0" "9012" "0" "c.9012C>T" "r.(?)" "p.(Ser3004=)" "" "0000911639" "00005473" "50" "8289" "0" "8289" "0" "c.8289A>C" "r.(?)" "p.(Lys2763Asn)" "" "0000911640" "00005473" "50" "8168" "0" "8168" "0" "c.8168T>C" "r.(?)" "p.(Ile2723Thr)" "" "0000911641" "00005473" "50" "7682" "0" "7682" "0" "c.7682C>T" "r.(?)" "p.(Ala2561Val)" "" "0000911642" "00005473" "50" "7258" "0" "7258" "0" "c.7258C>T" "r.(?)" "p.(Arg2420Trp)" "" "0000911643" "00005473" "10" "4156" "0" "4156" "0" "c.4156G>A" "r.(?)" "p.(Glu1386Lys)" "" "0000911644" "00005473" "50" "1214" "0" "1214" "0" "c.1214T>C" "r.(?)" "p.(Phe405Ser)" "" "0000923658" "00005473" "50" "8636" "0" "8636" "0" "c.8636C>T" "r.(?)" "p.(Thr2879Met)" "" "0000923659" "00005473" "50" "7224" "0" "7224" "0" "c.7224C>G" "r.(?)" "p.(Asp2408Glu)" "" "0000923660" "00005473" "50" "1688" "0" "1688" "0" "c.1688A>G" "r.(?)" "p.(Asp563Gly)" "" "0000923661" "00005473" "90" "761" "0" "761" "0" "c.761del" "r.(?)" "p.(Gly254Glufs*13)" "" "0000928564" "00005473" "30" "8458" "0" "8458" "0" "c.8458G>A" "r.(?)" "p.(Val2820Ile)" "" "0000928565" "00005473" "70" "6156" "1" "6156" "1" "c.6156+1G>A" "r.spl?" "p.?" "" "0000928566" "00005473" "50" "5149" "0" "5149" "0" "c.5149G>A" "r.(?)" "p.(Ala1717Thr)" "" "0000943932" "00005473" "50" "5931" "0" "5931" "0" "c.5931G>C" "r.(?)" "p.(Leu1977Phe)" "" "0000945955" "00005473" "50" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000945956" "00005473" "50" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000945957" "00005473" "50" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000945958" "00005473" "50" "6320" "0" "6322" "0" "c.6320_6322del" "r.(?)" "p.(Gly2107del)" "" "0000945959" "00005473" "50" "6320" "0" "6322" "0" "c.6320_6322del" "r.(?)" "p.(Gly2107del)" "" "0000945960" "00005473" "50" "6320" "0" "6322" "0" "c.6320_6322del" "r.(?)" "p.(Gly2107del)" "" "0000945961" "00005473" "50" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0000945962" "00005473" "70" "8540" "0" "8540" "0" "c.8540del" "r.(?)" "p.(Asn2847ThrfsTer3)" "" "0000945992" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl" "p.?" "" "0000945993" "00005473" "90" "6130" "0" "6130" "0" "c.6130G>A" "r.(?)" "p.(Gly2044Arg)" "" "0000945994" "00005473" "90" "5309" "0" "5309" "0" "c.5309G>T" "r.(?)" "p.(Gly1770Val)" "" "0000946064" "00005473" "50" "14" "0" "14" "0" "c.14G>A" "r.(?)" "p.(Arg5Gln)" "" "0000946085" "00005473" "50" "6752" "0" "6752" "0" "c.6752G>A" "r.(?)" "p.(Arg2251Gln)" "" "0000946110" "00005473" "50" "6898" "0" "6898" "0" "c.6898G>A" "r.(?)" "p.(Gly2300Arg)" "" "0000946111" "00005473" "50" "3295" "0" "3303" "0" "c.3295_3303del" "r.(?)" "p.(Thr1099_Leu1101del)" "" "0000946124" "00005473" "50" "6199" "0" "6199" "0" "c.6199G>A" "r.(?)" "p.(Glu2067Lys)" "" "0000947798" "00005473" "30" "8822" "0" "8822" "0" "c.8822C>T" "r.(?)" "p.(Ala2941Val)" "" "0000947799" "00005473" "30" "1024" "0" "1024" "0" "c.1024G>A" "r.(?)" "p.(Val342Met)" "" "0000952258" "00005473" "90" "6354" "2" "6354" "2" "c.6354+2T>C" "r.spl?" "p.?" "" "0000952593" "00005473" "90" "3955" "0" "3958" "0" "c.3955_3958dup" "r.(?)" "p.(Ser1320CysfsTer15)" "9" "0000952600" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>A" "r.spl" "p.?" "16" "0000954932" "00005473" "70" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "36" "0000954933" "00005473" "70" "9329" "-1" "9329" "-1" "c.9329-1G>T" "r.spl" "p.?" "" "0000954944" "00005473" "70" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "36" "0000959854" "00005473" "50" "4895" "0" "4895" "0" "c.4895G>A" "r.(?)" "p.(Arg1632Gln)" "" "0000959927" "00005473" "50" "4895" "0" "4895" "0" "c.4895G>A" "r.(?)" "p.(Arg1632Gln)" "" "0000960054" "00005473" "10" "6827" "0" "6827" "0" "c.6827G>C" "r.(?)" "p.(Gly2276Ala)" "" "0000960055" "00005473" "50" "6827" "0" "6827" "0" "c.6827G>C" "r.(?)" "p.(Gly2276Ala)" "" "0000961986" "00005473" "50" "3837" "0" "3837" "0" "c.3837C>A" "r.(?)" "p.(Asp1279Glu)" "" "0000961989" "00005473" "10" "3054" "0" "3054" "0" "c.3054C>T" "r.(?)" "p.(=)" "" "0000975099" "00005473" "50" "9358" "0" "9358" "0" "c.9358A>C" "r.(?)" "p.(Thr3120Pro)" "" "0000975100" "00005473" "50" "8741" "0" "8741" "0" "c.8741C>A" "r.(?)" "p.(Pro2914His)" "" "0000975101" "00005473" "30" "8097" "0" "8097" "0" "c.8097G>A" "r.(?)" "p.(=)" "" "0000975102" "00005473" "50" "8009" "0" "8009" "0" "c.8009C>T" "r.(?)" "p.(Ala2670Val)" "" "0000975103" "00005473" "50" "7895" "0" "7895" "0" "c.7895T>C" "r.(?)" "p.(Leu2632Pro)" "" "0000975104" "00005473" "50" "6878" "0" "6878" "0" "c.6878C>T" "r.(?)" "p.(Thr2293Met)" "" "0000975105" "00005473" "50" "5839" "-3" "5839" "-3" "c.5839-3C>T" "r.spl?" "p.?" "" "0000975106" "00005473" "50" "4510" "0" "4510" "0" "c.4510C>T" "r.(?)" "p.(Arg1504Trp)" "" "0000975107" "00005473" "50" "4121" "0" "4121" "0" "c.4121A>T" "r.(?)" "p.(Asp1374Val)" "" "0000975108" "00005473" "50" "3754" "0" "3754" "0" "c.3754C>T" "r.(?)" "p.(Arg1252Cys)" "" "0000975109" "00005473" "50" "2231" "0" "2231" "0" "c.2231C>T" "r.(?)" "p.(Pro744Leu)" "" "0000975110" "00005473" "30" "2030" "0" "2030" "0" "c.2030G>A" "r.(?)" "p.(Arg677His)" "" "0000975111" "00005473" "50" "1087" "0" "1087" "0" "c.1087C>T" "r.(?)" "p.(Arg363Cys)" "" "0000986974" "00005473" "90" "6322" "0" "6322" "0" "c.6322G>T" "r.(?)" "p.(Glu2108*)" "" "0000986975" "00005473" "90" "6310" "-1" "6354" "1" "c.(?_6310-1)_(6354+1_?)del" "r.?" "p.?" "_19_" "0000987756" "00005473" "50" "6920" "0" "6920" "0" "c.6920G>C" "r.(?)" "p.(Arg2307Thr)" "" "0000989369" "00005473" "90" "5950" "0" "5950" "0" "c.5950C>T" "r.(?)" "p.(Arg1984Ter)" "" "0000992667" "00005473" "30" "9316" "0" "9316" "0" "c.9316C>G" "r.(?)" "p.(Leu3106Val)" "" "0000992668" "00005473" "30" "9245" "0" "9245" "0" "c.9245C>G" "r.(?)" "p.(Pro3082Arg)" "" "0000992669" "00005473" "30" "8515" "0" "8515" "0" "c.8515T>A" "r.(?)" "p.(Phe2839Ile)" "" "0000992670" "00005473" "50" "8165" "0" "8165" "0" "c.8165C>T" "r.(?)" "p.(Thr2722Ile)" "" "0000992671" "00005473" "50" "7673" "0" "7673" "0" "c.7673A>G" "r.(?)" "p.(Asn2558Ser)" "" "0000992672" "00005473" "30" "7115" "0" "7115" "0" "c.7115A>G" "r.(?)" "p.(Asp2372Gly)" "" "0000992673" "00005473" "30" "6752" "0" "6752" "0" "c.6752G>A" "r.(?)" "p.(Arg2251Gln)" "" "0000992674" "00005473" "30" "6654" "0" "6654" "0" "c.6654G>A" "r.(?)" "p.(Pro2218=)" "" "0000992675" "00005473" "50" "6520" "0" "6520" "0" "c.6520G>A" "r.(?)" "p.(Gly2174Ser)" "" "0000992676" "00005473" "50" "6290" "0" "6290" "0" "c.6290G>A" "r.(?)" "p.(Arg2097Gln)" "" "0000992677" "00005473" "50" "6182" "0" "6182" "0" "c.6182G>A" "r.(?)" "p.(Arg2061Gln)" "" "0000992678" "00005473" "70" "6017" "0" "6017" "0" "c.6017T>C" "r.(?)" "p.(Leu2006Pro)" "" "0000992679" "00005473" "50" "5794" "0" "5794" "0" "c.5794G>A" "r.(?)" "p.(Val1932Ile)" "" "0000992680" "00005473" "50" "5680" "0" "5680" "0" "c.5680C>T" "r.(?)" "p.(Pro1894Ser)" "" "0000992681" "00005473" "30" "5477" "0" "5477" "0" "c.5477C>G" "r.(?)" "p.(Pro1826Arg)" "" "0000992682" "00005473" "50" "5149" "0" "5149" "0" "c.5149G>A" "r.(?)" "p.(Ala1717Thr)" "" "0000992683" "00005473" "30" "4912" "0" "4912" "0" "c.4912G>A" "r.(?)" "p.(Ala1638Thr)" "" "0000992684" "00005473" "30" "4830" "0" "4830" "0" "c.4830G>A" "r.(?)" "p.(Met1610Ile)" "" "0000992685" "00005473" "50" "4436" "0" "4436" "0" "c.4436A>G" "r.(?)" "p.(Gln1479Arg)" "" "0000992686" "00005473" "50" "4316" "0" "4316" "0" "c.4316T>C" "r.(?)" "p.(Phe1439Ser)" "" "0000992687" "00005473" "30" "4117" "0" "4117" "0" "c.4117G>A" "r.(?)" "p.(Ala1373Thr)" "" "0000992688" "00005473" "50" "4010" "0" "4010" "0" "c.4010C>T" "r.(?)" "p.(Pro1337Leu)" "" "0000992689" "00005473" "50" "3902" "0" "3902" "0" "c.3902G>A" "r.(?)" "p.(Arg1301Gln)" "" "0000992690" "00005473" "50" "3806" "0" "3806" "0" "c.3806C>T" "r.(?)" "p.(Thr1269Ile)" "" "0000992691" "00005473" "50" "3068" "0" "3068" "0" "c.3068C>A" "r.(?)" "p.(Pro1023Gln)" "" "0000992692" "00005473" "30" "3062" "0" "3062" "0" "c.3062C>A" "r.(?)" "p.(Pro1021Gln)" "" "0000992693" "00005473" "50" "2864" "0" "2864" "0" "c.2864G>A" "r.(?)" "p.(Arg955His)" "" "0000992694" "00005473" "50" "2665" "0" "2665" "0" "c.2665C>T" "r.(?)" "p.(Arg889Cys)" "" "0000992695" "00005473" "30" "2357" "0" "2357" "0" "c.2357T>C" "r.(?)" "p.(Leu786Pro)" "" "0000992696" "00005473" "50" "2324" "0" "2324" "0" "c.2324G>A" "r.(?)" "p.(Cys775Tyr)" "" "0000992697" "00005473" "50" "2218" "0" "2218" "0" "c.2218C>T" "r.(?)" "p.(Arg740Cys)" "" "0000992698" "00005473" "50" "1975" "0" "1975" "0" "c.1975C>T" "r.(?)" "p.(Arg659Cys)" "" "0000992699" "00005473" "50" "1358" "0" "1358" "0" "c.1358C>T" "r.(?)" "p.(Ser453Leu)" "" "0000992700" "00005473" "10" "1182" "0" "1182" "0" "c.1182C>T" "r.(?)" "p.(Thr394=)" "" "0000992701" "00005473" "50" "902" "0" "904" "0" "c.902_904del" "r.(?)" "p.(Thr301del)" "" "0000992702" "00005473" "30" "290" "0" "290" "0" "c.290G>A" "r.(?)" "p.(Arg97His)" "" "0000992703" "00005473" "50" "112" "0" "112" "0" "c.112G>A" "r.(?)" "p.(Ala38Thr)" "" "0001013690" "00005473" "10" "9494" "-26" "9494" "-26" "c.9494-26C>T" "r.(=)" "p.(=)" "" "0001013691" "00005473" "10" "9123" "0" "9123" "0" "c.9123G>A" "r.(?)" "p.(Thr3041=)" "" "0001013692" "00005473" "30" "4116" "0" "4116" "0" "c.4116C>T" "r.(?)" "p.(=)" "" "0001013693" "00005473" "30" "3273" "0" "3273" "0" "c.3273C>T" "r.(?)" "p.(=)" "" "0001013694" "00005473" "30" "3198" "0" "3198" "0" "c.3198C>T" "r.(?)" "p.(=)" "" "0001013695" "00005473" "10" "3129" "0" "3129" "0" "c.3129C>T" "r.(?)" "p.(Gly1043=)" "" "0001013696" "00005473" "50" "1538" "0" "1538" "0" "c.1538G>A" "r.(?)" "p.(Arg513Gln)" "" "0001013697" "00005473" "70" "761" "0" "761" "0" "c.761del" "r.(?)" "p.(Gly254Glufs*13)" "" "0001020306" "00005473" "50" "8231" "0" "8231" "0" "c.8231C>T" "r.(?)" "p.(Thr2744Met)" "" "0001021270" "00005473" "50" "5341" "0" "5341" "0" "c.5341A>G" "r.(?)" "p.(Ile1781Val)" "" "0001024559" "00005473" "50" "2147" "0" "2147" "0" "c.2147G>A" "r.(?)" "p.(Gly716Asp)" "" "0001030186" "00005473" "50" "6353" "0" "6353" "0" "c.6353A>G" "r.(?)" "p.(Asp2118Gly)" "" "0001033135" "00005473" "50" "8877" "0" "8879" "0" "c.8877_8879dup" "r.(?)" "p.(Ala2960dup)" "" "0001033136" "00005473" "50" "8437" "0" "8437" "0" "c.8437G>A" "r.(?)" "p.(Gly2813Arg)" "" "0001033137" "00005473" "50" "7905" "0" "7905" "0" "c.7905C>G" "r.(?)" "p.(Phe2635Leu)" "" "0001033138" "00005473" "50" "7808" "0" "7808" "0" "c.7808G>A" "r.(?)" "p.(Arg2603Lys)" "" "0001033139" "00005473" "30" "7668" "1036" "7668" "1036" "c.7668+1036C>A" "r.(=)" "p.(=)" "" "0001033140" "00005473" "90" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0001033141" "00005473" "70" "6787" "0" "6787" "0" "c.6787C>T" "r.(?)" "p.(Arg2263*)" "" "0001033142" "00005473" "50" "6263" "0" "6263" "0" "c.6263C>T" "r.(?)" "p.(Pro2088Leu)" "" "0001033143" "00005473" "50" "5833" "0" "5833" "0" "c.5833G>T" "r.(?)" "p.(Val1945Leu)" "" "0001033144" "00005473" "50" "3956" "0" "3956" "0" "c.3956T>C" "r.(?)" "p.(Val1319Ala)" "" "0001033145" "00005473" "50" "3472" "0" "3472" "0" "c.3472G>A" "r.(?)" "p.(Gly1158Ser)" "" "0001033146" "00005473" "50" "3223" "0" "3223" "0" "c.3223C>T" "r.(?)" "p.(Arg1075Trp)" "" "0001033147" "00005473" "50" "2644" "0" "2644" "0" "c.2644G>A" "r.(?)" "p.(Asp882Asn)" "" "0001033148" "00005473" "50" "2306" "0" "2306" "0" "c.2306C>T" "r.(?)" "p.(Ala769Val)" "" "0001033149" "00005473" "30" "1976" "0" "1976" "0" "c.1976G>A" "r.(?)" "p.(Arg659His)" "" "0001033150" "00005473" "30" "1914" "0" "1914" "0" "c.1914G>A" "r.(?)" "p.(Arg638=)" "" "0001033151" "00005473" "50" "898" "0" "900" "0" "c.898_900del" "r.(?)" "p.(Ser300del)" "" "0001033152" "00005473" "30" "882" "0" "882" "0" "c.882C>T" "r.(?)" "p.(Phe294=)" "" "0001033153" "00005473" "30" "786" "0" "786" "0" "c.786C>T" "r.(?)" "p.(Leu262=)" "" "0001033154" "00005473" "90" "761" "0" "761" "0" "c.761del" "r.(?)" "p.(Gly254Glufs*13)" "" "0001045817" "00005473" "50" "8978" "0" "8978" "0" "c.8978G>A" "r.(?)" "p.(Arg2993His)" "" "0001045818" "00005473" "90" "8966" "-1" "8966" "-1" "c.8966-1G>C" "r.spl?" "p.?" "" "0001045819" "00005473" "50" "4402" "0" "4402" "0" "c.4402A>G" "r.(?)" "p.(Ile1468Val)" "" "0001045820" "00005473" "30" "2561" "0" "2561" "0" "c.2561T>C" "r.(?)" "p.(Val854Ala)" "" "0001045821" "00005473" "30" "1761" "0" "1761" "0" "c.1761C>T" "r.(?)" "p.(Ala587=)" "" "0001047928" "00005473" "90" "6284" "0" "6284" "0" "c.6284del" "r.(?)" "p.(Gly2095AlafsTer12)" "18" "0001047929" "00005473" "90" "4121" "0" "4121" "0" "c.4121A>T" "r.(?)" "p.(Asp1374Val)" "9" "0001047930" "00005473" "90" "6229" "0" "6229" "0" "c.6229G>C" "r.(?)" "p.(Gly2077Arg)" "17" "0001047931" "00005473" "90" "7254" "0" "7254" "0" "c.7254C>A" "r.(?)" "p.(Phe2418Leu)" "36" "0001047932" "00005473" "90" "1393" "0" "1393" "0" "c.1393C>T" "r.(?)" "p.(Arg465Ter)" "5" "0001047933" "00005473" "90" "6156" "0" "6156" "0" "c.6156G>T" "r.(?)" "p.(Lys2052Asn)" "15" "0001047934" "00005473" "90" "6166" "0" "6166" "0" "c.6166G>A" "r.(?)" "p.(Gly2056Arg)" "16" "0001047935" "00005473" "90" "6210" "1" "6210" "1" "c.6210+1G>C" "r.(?)" "p.(Gly2053_Pro2070del)" "16i" "0001047936" "00005473" "90" "7468" "0" "7468" "0" "c.7468G>A" "r.(?)" "p.(Ala2490Thr)" "36" "0001049448" "00005473" "50" "4103" "0" "4103" "0" "c.4103C>T" "r.(?)" "p.(Thr1368Met)" "" "0001051148" "00005473" "50" "9116" "0" "9116" "0" "c.9116C>T" "r.(?)" "p.(Thr3039Met)" "" "0001051149" "00005473" "50" "8137" "0" "8137" "0" "c.8137A>G" "r.(?)" "p.(Arg2713Gly)" "" "0001051150" "00005473" "50" "6655" "0" "6655" "0" "c.6655G>A" "r.(?)" "p.(Gly2219Ser)" "" "0001051151" "00005473" "30" "5610" "0" "5610" "0" "c.5610C>A" "r.(?)" "p.(Ser1870Arg)" "" "0001051152" "00005473" "70" "1016" "0" "1016" "0" "c.1016del" "r.(?)" "p.(Gly339Alafs*15)" "" "0001057749" "00005473" "70" "4156" "0" "4156" "0" "c.4156G>A" "r.(?)" "p.(Glu1386Lys)" "" "0001057910" "00005473" "70" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Lys2483Glu)" "" "0001057949" "00005473" "50" "7668" "0" "7668" "0" "c.7668G>T" "r.(?)" "p.(Gln2556His)" "" "0001057957" "00005473" "50" "7375" "0" "7375" "0" "c.7375C>T" "r.(?)" "p.(Arg2459Trp)" "" "0001057964" "00005473" "50" "3424" "0" "3424" "0" "c.3424G>A" "r.(?)" "p.(Asp1142Asn)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 1017 "{{screeningid}}" "{{variantid}}" "0000054643" "0000084593" "0000054647" "0000084597" "0000054651" "0000084601" "0000080971" "0000130301" "0000103525" "0000166958" "0000103525" "0000167163" "0000103537" "0000166964" "0000109181" "0000175299" "0000109183" "0000175300" "0000109185" "0000175302" "0000109185" "0000175311" "0000109187" "0000175303" "0000109190" "0000175304" "0000109199" "0000175305" "0000109200" "0000175306" "0000109201" "0000175307" "0000109203" "0000175308" "0000109207" "0000175309" "0000109221" "0000175993" "0000109223" "0000175327" "0000109223" "0000175999" "0000109223" "0000176000" "0000109223" "0000176001" "0000109234" "0000176002" "0000109238" "0000176015" "0000109238" "0000176016" "0000109238" "0000176017" "0000109238" "0000176018" "0000109238" "0000176019" "0000109239" "0000175343" "0000109239" "0000176024" "0000109239" "0000176025" "0000109239" "0000176026" "0000109240" "0000176027" "0000109241" "0000176034" "0000109241" "0000176035" "0000109241" "0000176036" "0000109241" "0000176037" "0000109241" "0000176038" "0000109265" "0000175369" "0000109265" "0000176051" "0000109271" "0000175375" "0000109271" "0000176052" "0000109273" "0000175377" "0000109274" "0000175378" "0000109275" "0000175379" "0000109276" "0000175380" "0000109277" "0000175381" "0000109278" "0000175382" "0000109279" "0000175383" "0000109280" "0000175384" "0000109281" "0000175385" "0000109282" "0000175386" "0000109283" "0000175387" "0000109284" "0000175388" "0000109285" "0000175389" "0000109286" "0000175390" "0000109286" "0000176053" "0000109287" "0000175391" "0000109287" "0000176054" "0000109288" "0000175392" "0000109289" "0000176064" "0000109289" "0000176065" "0000109289" "0000176066" "0000109289" "0000176067" "0000109289" "0000176068" "0000109289" "0000176069" "0000109289" "0000176070" "0000109289" "0000176071" "0000109289" "0000176072" "0000109289" "0000176073" "0000109289" "0000176074" "0000109289" "0000176075" "0000109289" "0000176076" "0000109289" "0000176077" "0000109289" "0000176078" "0000109289" "0000176079" "0000109289" "0000176080" "0000109289" "0000176081" "0000109290" "0000176092" "0000109290" "0000176093" "0000109290" "0000176094" "0000109290" "0000176095" "0000109290" "0000176096" "0000109290" "0000176097" "0000109290" "0000176098" "0000109290" "0000176099" "0000109290" "0000176100" "0000109290" "0000176101" "0000109290" "0000176102" "0000109290" "0000176103" "0000109290" "0000176104" "0000109290" "0000176105" "0000109290" "0000176106" "0000109290" "0000176107" "0000109290" "0000176108" "0000109290" "0000176109" "0000109290" "0000176110" "0000109290" "0000176111" "0000109290" "0000176112" "0000109290" "0000176113" "0000109290" "0000176114" "0000109291" "0000176125" "0000109291" "0000176126" "0000109291" "0000176127" "0000109291" "0000176128" "0000109291" "0000176129" "0000109291" "0000176130" "0000109291" "0000176131" "0000109291" "0000176132" "0000109291" "0000176133" "0000109291" "0000176134" "0000109291" "0000176135" "0000109291" "0000176136" "0000109291" "0000176137" "0000109291" "0000176138" "0000109291" "0000176139" "0000109291" "0000176140" "0000109291" "0000176141" "0000109291" "0000176142" "0000109291" "0000176143" "0000109291" "0000176144" "0000109291" "0000176145" "0000109291" "0000176146" "0000109291" "0000176147" "0000109291" "0000176148" "0000109291" "0000176149" "0000109291" "0000176150" "0000109291" "0000176151" "0000109292" "0000176164" "0000109292" "0000176165" "0000109292" "0000176166" "0000109292" "0000176167" "0000109292" "0000176168" "0000109292" "0000176169" "0000109292" "0000176170" "0000109292" "0000176171" "0000109292" "0000176172" "0000109292" "0000176173" "0000109292" "0000176174" "0000109292" "0000176175" "0000109292" "0000176176" "0000109292" "0000176177" "0000109293" "0000176188" "0000109293" "0000176189" "0000109293" "0000176190" "0000109293" "0000176191" "0000109293" "0000176192" "0000109293" "0000176193" "0000109293" "0000176194" "0000109293" "0000176195" "0000109293" "0000176196" "0000109293" "0000176197" "0000109293" "0000176198" "0000109293" "0000176199" "0000109293" "0000176200" "0000109293" "0000176201" "0000109293" "0000176202" "0000109293" "0000176203" "0000109293" "0000176204" "0000109293" "0000176205" "0000109293" "0000176206" "0000109293" "0000176207" "0000109294" "0000176221" "0000109294" "0000176222" "0000109294" "0000176223" "0000109294" "0000176224" "0000109294" "0000176225" "0000109294" "0000176226" "0000109294" "0000176227" "0000109294" "0000176228" "0000109294" "0000176229" "0000109294" "0000176230" "0000109294" "0000176231" "0000109294" "0000176232" "0000109294" "0000176233" "0000109294" "0000176234" "0000109294" "0000176235" "0000109294" "0000176236" "0000109295" "0000176245" "0000109295" "0000176246" "0000109295" "0000176247" "0000109295" "0000176248" "0000109295" "0000176249" "0000109295" "0000176250" "0000109295" "0000176251" "0000109295" "0000176252" "0000109295" "0000176253" "0000109295" "0000176254" "0000109295" "0000176255" "0000109295" "0000176256" "0000109295" "0000176257" "0000109295" "0000176258" "0000109295" "0000176259" "0000109295" "0000176260" "0000109295" "0000176261" "0000109296" "0000176274" "0000109296" "0000176275" "0000109296" "0000176276" "0000109296" "0000176277" "0000109296" "0000176278" "0000109296" "0000176279" "0000109296" "0000176280" "0000109296" "0000176281" "0000109296" "0000176282" "0000109296" "0000176283" "0000109296" "0000176284" "0000109296" "0000176285" "0000109296" "0000176286" "0000109296" "0000176287" "0000109296" "0000176288" "0000109296" "0000176289" "0000109296" "0000176290" "0000109296" "0000176291" "0000109309" "0000175413" "0000109318" "0000175422" "0000109329" "0000175433" "0000109330" "0000175434" "0000109335" "0000175439" "0000109335" "0000176296" "0000109345" "0000176301" "0000109345" "0000176302" "0000109346" "0000175450" "0000109346" "0000176303" "0000109348" "0000175452" "0000109349" "0000175453" "0000109356" "0000175460" "0000109360" "0000175464" "0000109370" "0000175474" "0000109370" "0000176311" "0000109371" "0000175475" "0000109547" "0000175651" "0000109548" "0000175652" "0000109549" "0000175653" "0000109550" "0000175654" "0000109551" "0000175655" "0000109552" "0000175656" "0000109553" "0000175657" "0000109554" "0000175658" "0000109555" "0000175659" "0000109556" "0000175660" "0000109557" "0000175661" "0000109558" "0000175662" "0000109559" "0000175663" "0000109560" "0000175664" "0000109561" "0000175665" "0000109562" "0000175666" "0000109563" "0000175667" "0000109564" "0000175668" "0000109565" "0000175669" "0000109566" "0000175670" "0000109567" "0000175671" "0000109568" "0000175672" "0000109569" "0000175673" "0000109570" "0000175674" "0000109571" "0000175675" "0000109572" "0000175676" "0000109573" "0000175677" "0000109574" "0000175678" "0000109575" "0000175679" "0000109576" "0000175680" "0000109577" "0000175681" "0000109578" "0000175682" "0000109579" "0000175683" "0000109580" "0000175684" "0000109581" "0000175685" "0000109582" "0000175686" "0000109583" "0000175687" "0000109584" "0000175688" "0000109585" "0000175689" "0000109586" "0000175690" "0000109587" "0000175691" "0000109588" "0000175692" "0000109589" "0000175693" "0000109590" "0000175694" "0000109591" "0000175695" "0000109592" "0000175696" "0000109593" "0000175697" "0000109594" "0000175698" "0000109595" "0000175699" "0000109596" "0000175700" "0000109597" "0000175701" "0000109598" "0000175702" "0000109599" "0000175703" "0000109600" "0000175704" "0000109601" "0000175705" "0000109602" "0000175706" "0000109603" "0000175707" "0000109604" "0000175708" "0000109605" "0000175709" "0000109606" "0000175710" "0000109607" "0000175711" "0000109608" "0000175712" "0000109609" "0000175713" "0000109610" "0000175714" "0000109611" "0000175715" "0000109612" "0000175716" "0000109613" "0000175717" "0000109614" "0000175718" "0000109615" "0000175719" "0000109616" "0000175720" "0000109617" "0000175721" "0000109618" "0000175722" "0000109619" "0000175723" "0000109620" "0000175724" "0000109621" "0000175725" "0000109622" "0000175726" "0000109623" "0000175727" "0000109624" "0000175728" "0000109625" "0000175729" "0000109626" "0000175730" "0000109627" "0000175731" "0000109628" "0000175732" "0000109629" "0000175733" "0000109630" "0000175734" "0000109631" "0000175735" "0000109632" "0000175736" "0000109633" "0000175737" "0000109634" "0000175738" "0000109635" "0000175739" "0000109636" "0000175740" "0000109637" "0000175741" "0000109638" "0000175742" "0000109639" "0000175743" "0000109640" "0000175744" "0000109641" "0000175745" "0000109642" "0000175746" "0000109643" "0000175747" "0000109644" "0000175748" "0000109645" "0000175749" "0000109646" "0000175750" "0000109647" "0000175751" "0000109648" "0000175752" "0000109649" "0000175753" "0000109650" "0000175754" "0000109651" "0000175755" "0000109652" "0000175756" "0000109653" "0000175757" "0000109654" "0000175758" "0000109655" "0000175759" "0000109656" "0000175760" "0000109657" "0000175761" "0000109684" "0000176320" "0000109693" "0000176321" "0000109701" "0000175805" "0000109710" "0000176326" "0000109712" "0000175816" "0000109713" "0000175817" "0000109714" "0000175818" "0000109715" "0000175819" "0000109716" "0000175820" "0000109717" "0000175821" "0000109718" "0000175822" "0000109719" "0000175823" "0000109720" "0000175824" "0000109721" "0000175825" "0000109722" "0000175826" "0000109722" "0000176327" "0000109723" "0000175827" "0000109728" "0000175832" "0000109730" "0000175834" "0000109731" "0000175835" "0000109734" "0000175838" "0000109735" "0000175839" "0000109738" "0000175842" "0000109738" "0000176331" "0000109758" "0000175862" "0000109759" "0000175863" "0000109781" "0000175885" "0000109781" "0000176351" "0000109785" "0000175889" "0000109785" "0000176356" "0000109788" "0000176359" "0000109847" "0000175951" "0000109847" "0000176374" "0000109848" "0000175952" "0000109848" "0000176375" "0000109849" "0000175953" "0000109849" "0000176376" "0000109849" "0000176377" "0000109850" "0000175954" "0000109850" "0000176378" "0000109850" "0000176379" "0000109851" "0000175955" "0000109851" "0000176380" "0000109852" "0000175956" "0000109852" "0000176381" "0000109853" "0000175957" "0000109854" "0000175958" "0000109855" "0000175959" "0000109856" "0000175960" "0000109857" "0000175961" "0000109858" "0000175962" "0000109859" "0000175963" "0000109860" "0000175964" "0000109861" "0000175965" "0000109862" "0000175966" "0000109863" "0000175967" "0000109864" "0000175968" "0000109865" "0000175969" "0000109866" "0000175970" "0000109867" "0000175971" "0000109868" "0000175972" "0000109869" "0000175973" "0000109870" "0000175974" "0000109871" "0000175975" "0000109872" "0000175976" "0000109873" "0000175977" "0000109874" "0000175978" "0000109875" "0000175979" "0000109876" "0000175980" "0000109877" "0000175981" "0000109878" "0000175982" "0000109879" "0000175983" "0000109884" "0000175988" "0000109887" "0000175991" "0000109887" "0000176383" "0000175658" "0000398522" "0000175658" "0000398523" "0000175659" "0000398524" "0000175659" "0000398525" "0000175660" "0000398526" "0000175660" "0000398527" "0000175676" "0000829137" "0000175685" "0000829155" "0000177908" "0000406022" "0000208997" "0000439065" "0000209582" "0000439735" "0000209663" "0000439875" "0000209842" "0000440068" "0000220496" "0000462002" "0000220496" "0000462003" "0000220567" "0000462004" "0000220592" "0000462005" "0000220601" "0000462006" "0000220608" "0000462007" "0000220610" "0000462008" "0000220613" "0000462009" "0000220613" "0000462010" "0000220622" "0000462011" "0000220625" "0000462012" "0000220629" "0000462013" "0000220629" "0000462014" "0000220642" "0000462015" "0000220662" "0000462016" "0000220665" "0000462017" "0000220667" "0000462018" "0000220668" "0000462019" "0000220699" "0000462020" "0000220711" "0000462021" "0000220713" "0000462022" "0000220721" "0000462023" "0000220731" "0000462024" "0000220731" "0000462025" "0000220733" "0000462026" "0000220746" "0000462027" "0000220767" "0000462028" "0000220778" "0000462029" "0000220793" "0000462030" "0000220805" "0000462031" "0000220811" "0000462032" "0000220827" "0000462033" "0000220835" "0000462034" "0000220842" "0000462035" "0000220844" "0000462036" "0000220851" "0000462037" "0000220857" "0000462038" "0000220860" "0000462039" "0000220864" "0000462040" "0000220864" "0000462041" "0000220893" "0000462042" "0000220894" "0000462043" "0000220897" "0000462044" "0000220902" "0000462045" "0000220926" "0000462046" "0000220930" "0000462047" "0000220937" "0000462048" "0000220953" "0000462049" "0000220965" "0000462050" "0000220968" "0000462051" "0000220970" "0000462052" "0000220971" "0000462053" "0000220973" "0000462054" "0000220973" "0000462055" "0000220978" "0000462056" "0000220978" "0000462057" "0000220981" "0000462058" "0000220994" "0000462059" "0000221009" "0000462060" "0000221018" "0000462061" "0000221019" "0000462062" "0000221020" "0000462063" "0000221031" "0000462064" "0000221034" "0000462065" "0000221044" "0000462066" "0000221045" "0000462067" "0000221046" "0000462068" "0000221049" "0000462069" "0000221050" "0000462070" "0000221054" "0000462071" "0000221058" "0000462072" "0000221058" "0000462073" "0000221074" "0000462074" "0000221075" "0000462075" "0000221098" "0000462076" "0000221102" "0000462077" "0000221112" "0000462078" "0000221117" "0000462079" "0000221118" "0000462080" "0000221122" "0000462081" "0000221128" "0000462082" "0000221128" "0000462083" "0000221134" "0000462084" "0000221141" "0000462085" "0000221142" "0000462086" "0000221143" "0000462087" "0000221145" "0000462088" "0000221147" "0000462089" "0000221151" "0000462090" "0000221180" "0000462091" "0000221183" "0000462092" "0000221184" "0000462093" "0000221194" "0000462094" "0000221201" "0000462095" "0000221209" "0000462096" "0000221217" "0000462097" "0000221223" "0000462098" "0000221230" "0000462099" "0000221232" "0000462100" "0000221233" "0000462101" "0000221233" "0000462102" "0000221237" "0000462103" "0000221258" "0000462104" "0000221259" "0000462105" "0000221264" "0000462106" "0000221267" "0000462107" "0000221284" "0000462108" "0000221288" "0000462109" "0000221302" "0000462110" "0000221307" "0000462111" "0000221316" "0000462112" "0000221321" "0000462113" "0000221330" "0000462114" "0000221334" "0000462115" "0000221342" "0000462116" "0000221348" "0000462117" "0000221349" "0000462118" "0000221355" "0000462119" "0000221358" "0000462120" "0000221367" "0000462121" "0000221379" "0000462122" "0000221394" "0000462123" "0000221394" "0000462124" "0000221404" "0000462125" "0000221406" "0000462126" "0000221438" "0000462127" "0000221442" "0000462128" "0000221451" "0000462129" "0000221481" "0000462130" "0000221493" "0000462131" "0000221500" "0000462132" "0000221510" "0000462133" "0000221513" "0000462134" "0000221527" "0000462135" "0000221531" "0000462136" "0000221535" "0000462137" "0000221542" "0000462138" "0000221545" "0000462139" "0000221545" "0000462140" "0000221547" "0000462141" "0000221549" "0000462142" "0000221558" "0000462143" "0000221564" "0000462144" "0000221579" "0000462145" "0000221582" "0000462146" "0000221586" "0000462147" "0000221594" "0000462148" "0000221595" "0000462149" "0000221603" "0000462150" "0000221609" "0000462151" "0000221615" "0000462152" "0000221618" "0000462153" "0000221618" "0000462154" "0000221622" "0000462155" "0000221631" "0000462156" "0000221643" "0000462157" "0000221653" "0000462158" "0000221660" "0000462159" "0000221682" "0000462160" "0000221683" "0000462161" "0000221701" "0000462162" "0000221705" "0000462163" "0000221706" "0000462164" "0000221710" "0000462165" "0000221718" "0000462166" "0000221725" "0000462167" "0000221738" "0000462168" "0000221757" "0000462169" "0000221759" "0000462170" "0000221762" "0000462171" "0000221775" "0000462172" "0000221776" "0000462173" "0000221788" "0000462174" "0000221791" "0000462175" "0000221807" "0000462176" "0000221829" "0000462177" "0000221846" "0000462178" "0000221854" "0000462179" "0000221855" "0000462180" "0000221859" "0000462181" "0000221873" "0000462182" "0000221874" "0000462183" "0000221886" "0000462184" "0000221887" "0000462185" "0000221889" "0000462186" "0000221895" "0000462187" "0000221899" "0000462188" "0000221900" "0000462189" "0000221919" "0000462190" "0000221925" "0000462191" "0000221931" "0000462192" "0000221933" "0000462193" "0000221943" "0000462194" "0000221963" "0000462195" "0000221965" "0000462196" "0000221972" "0000462197" "0000221980" "0000462198" "0000221984" "0000462199" "0000221993" "0000462200" "0000221993" "0000462201" "0000221995" "0000462202" "0000221996" "0000462203" "0000222025" "0000462204" "0000222028" "0000462205" "0000222028" "0000462206" "0000222039" "0000462207" "0000222041" "0000462208" "0000222041" "0000462209" "0000222043" "0000462210" "0000222062" "0000462211" "0000222069" "0000462212" "0000222076" "0000462213" "0000222078" "0000462214" "0000222082" "0000462215" "0000222092" "0000462216" "0000222102" "0000462217" "0000222112" "0000462218" "0000222120" "0000462219" "0000222124" "0000462220" "0000222126" "0000462221" "0000222137" "0000462222" "0000222140" "0000462223" "0000222142" "0000462224" "0000222146" "0000462225" "0000222169" "0000462226" "0000222176" "0000462227" "0000222177" "0000462228" "0000222188" "0000462229" "0000222205" "0000462230" "0000222214" "0000462231" "0000222224" "0000462232" "0000222232" "0000462233" "0000222233" "0000462234" "0000222249" "0000462235" "0000222253" "0000462236" "0000222257" "0000462237" "0000222261" "0000462238" "0000222272" "0000462239" "0000222276" "0000462240" "0000222277" "0000462241" "0000222313" "0000462242" "0000222321" "0000462243" "0000222322" "0000462244" "0000222324" "0000462245" "0000222363" "0000462246" "0000222387" "0000462247" "0000222395" "0000462248" "0000222408" "0000462249" "0000222416" "0000462250" "0000222446" "0000462251" "0000222459" "0000462252" "0000222460" "0000462253" "0000222465" "0000462254" "0000222473" "0000462255" "0000222493" "0000462256" "0000222495" "0000462257" "0000222500" "0000462258" "0000222525" "0000462259" "0000222529" "0000462260" "0000222531" "0000462261" "0000222554" "0000462262" "0000222557" "0000462263" "0000222581" "0000462264" "0000222595" "0000462265" "0000222617" "0000462266" "0000222619" "0000462267" "0000222621" "0000462268" "0000222624" "0000462269" "0000222626" "0000462270" "0000222630" "0000462271" "0000222634" "0000462272" "0000222641" "0000462273" "0000222644" "0000462274" "0000222667" "0000462275" "0000222670" "0000462276" "0000222674" "0000462277" "0000222685" "0000462278" "0000222686" "0000462279" "0000222691" "0000462280" "0000222693" "0000462281" "0000222695" "0000462282" "0000222696" "0000462283" "0000222713" "0000462284" "0000222723" "0000462285" "0000222728" "0000462286" "0000222730" "0000462287" "0000222734" "0000462288" "0000222738" "0000462289" "0000222742" "0000462290" "0000222745" "0000462291" "0000222749" "0000462292" "0000222754" "0000462293" "0000222754" "0000462294" "0000222768" "0000462295" "0000222782" "0000462296" "0000222783" "0000462297" "0000222784" "0000462298" "0000222802" "0000462299" "0000222804" "0000462300" "0000222809" "0000462301" "0000222817" "0000462302" "0000222835" "0000462303" "0000222842" "0000462304" "0000222848" "0000462305" "0000222852" "0000462306" "0000222853" "0000462307" "0000222860" "0000462308" "0000222862" "0000462309" "0000222865" "0000462310" "0000222872" "0000462311" "0000222873" "0000462312" "0000222874" "0000462313" "0000222882" "0000462314" "0000222885" "0000462315" "0000222887" "0000462316" "0000222894" "0000462317" "0000222897" "0000462318" "0000222902" "0000462319" "0000222907" "0000462320" "0000222909" "0000462321" "0000222914" "0000462322" "0000222918" "0000462323" "0000222919" "0000462324" "0000222926" "0000462325" "0000222935" "0000462326" "0000222939" "0000462327" "0000222946" "0000462328" "0000222954" "0000462329" "0000222956" "0000462330" "0000222963" "0000462331" "0000222970" "0000462332" "0000222970" "0000462333" "0000222971" "0000462334" "0000222972" "0000462335" "0000222974" "0000462336" "0000222974" "0000462337" "0000222975" "0000462338" "0000222978" "0000462339" "0000222980" "0000462340" "0000222988" "0000462341" "0000222988" "0000462342" "0000222988" "0000462343" "0000222990" "0000462344" "0000222992" "0000462345" "0000223007" "0000462346" "0000223009" "0000462347" "0000223015" "0000462348" "0000223019" "0000462349" "0000223021" "0000462350" "0000223036" "0000462351" "0000223036" "0000462352" "0000223040" "0000462353" "0000223058" "0000462354" "0000223063" "0000462355" "0000223072" "0000462356" "0000223072" "0000462357" "0000223075" "0000462358" "0000223078" "0000462359" "0000223079" "0000462360" "0000223080" "0000462361" "0000223088" "0000462362" "0000223092" "0000462363" "0000223105" "0000462364" "0000223120" "0000462365" "0000223124" "0000462366" "0000223126" "0000462367" "0000223127" "0000462368" "0000223136" "0000462369" "0000223143" "0000462370" "0000223144" "0000462371" "0000223144" "0000462372" "0000223169" "0000462373" "0000223169" "0000462374" "0000223172" "0000462375" "0000223189" "0000462376" "0000223194" "0000462377" "0000223200" "0000462378" "0000223203" "0000462379" "0000223217" "0000462380" "0000223221" "0000462381" "0000223225" "0000462382" "0000223231" "0000462383" "0000223236" "0000462384" "0000223238" "0000462385" "0000223247" "0000462386" "0000223247" "0000462387" "0000223257" "0000462388" "0000223271" "0000462389" "0000223278" "0000462390" "0000223278" "0000462391" "0000223294" "0000462392" "0000223297" "0000462393" "0000223299" "0000462394" "0000223300" "0000462395" "0000223308" "0000462396" "0000223315" "0000462397" "0000223317" "0000462398" "0000223337" "0000462399" "0000223339" "0000462400" "0000223341" "0000462401" "0000223354" "0000462402" "0000223358" "0000462403" "0000223360" "0000462404" "0000223372" "0000462405" "0000223376" "0000462406" "0000223378" "0000462407" "0000223396" "0000462408" "0000223413" "0000462409" "0000223413" "0000462410" "0000223416" "0000462411" "0000223418" "0000462412" "0000223421" "0000462413" "0000223435" "0000462414" "0000223446" "0000462415" "0000223461" "0000462416" "0000223465" "0000462417" "0000223467" "0000462418" "0000223470" "0000462419" "0000223477" "0000462420" "0000223482" "0000462421" "0000223482" "0000462422" "0000223484" "0000462423" "0000223497" "0000462424" "0000223498" "0000462425" "0000223507" "0000462426" "0000223517" "0000462427" "0000223521" "0000462428" "0000223539" "0000462429" "0000223550" "0000462430" "0000223551" "0000462431" "0000223556" "0000462432" "0000223556" "0000462433" "0000223566" "0000462434" "0000223570" "0000462435" "0000223585" "0000462436" "0000223588" "0000462437" "0000223591" "0000462438" "0000223602" "0000462439" "0000223604" "0000462440" "0000223605" "0000462441" "0000223605" "0000462442" "0000223608" "0000462443" "0000223628" "0000462444" "0000223638" "0000462445" "0000223641" "0000462446" "0000223643" "0000462447" "0000223644" "0000462448" "0000223655" "0000462449" "0000223663" "0000462450" "0000223666" "0000462451" "0000223674" "0000462452" "0000223678" "0000462453" "0000223680" "0000462454" "0000223695" "0000462455" "0000223699" "0000462456" "0000223704" "0000462457" "0000223722" "0000462458" "0000223727" "0000462459" "0000223735" "0000462460" "0000223736" "0000462461" "0000223753" "0000462462" "0000223755" "0000462463" "0000223760" "0000462464" "0000223773" "0000462465" "0000223778" "0000462466" "0000223782" "0000462467" "0000223786" "0000462468" "0000223807" "0000462469" "0000223810" "0000462470" "0000223811" "0000462471" "0000249250" "0000577978" "0000249505" "0000578288" "0000249505" "0000578289" "0000249505" "0000578292" "0000267024" "0000597886" "0000271023" "0000624867" "0000275450" "0000629457" "0000275451" "0000629458" "0000275452" "0000629459" "0000290147" "0000646771" "0000290157" "0000646781" "0000290163" "0000646821" "0000290166" "0000646790" "0000290173" "0000646797" "0000293816" "0000650505" "0000293817" "0000650506" "0000293818" "0000650507" "0000293819" "0000650508" "0000293820" "0000650509" "0000293821" "0000650510" "0000293822" "0000650511" "0000293823" "0000650512" "0000296347" "0000653036" "0000296719" "0000653417" "0000297783" "0000660446" "0000297979" "0000660690" "0000305932" "0000669620" "0000305933" "0000669621" "0000308453" "0000682861" "0000312281" "0000693857" "0000315348" "0000697437" "0000315349" "0000697438" "0000315350" "0000697439" "0000315351" "0000697440" "0000315352" "0000697441" "0000315353" "0000697442" "0000315354" "0000697443" "0000315355" "0000697444" "0000315356" "0000697445" "0000315357" "0000697446" "0000315358" "0000697447" "0000315359" "0000697448" "0000334719" "0000732720" "0000364390" "0000765170" "0000375472" "0000787462" "0000375897" "0000787248" "0000375898" "0000787249" "0000389868" "0000819289" "0000389944" "0000819214" "0000393178" "0000823841" "0000393238" "0000823901" "0000393250" "0000823913" "0000393253" "0000823973" "0000393254" "0000823917" "0000393254" "0000823974" "0000393271" "0000823934" "0000393275" "0000823938" "0000399051" "0000831356" "0000399052" "0000831357" "0000399053" "0000831358" "0000399054" "0000831359" "0000399055" "0000831360" "0000399056" "0000831361" "0000399057" "0000831362" "0000399058" "0000831363" "0000399059" "0000831364" "0000399060" "0000831365" "0000399061" "0000831366" "0000400277" "0000833084" "0000400290" "0000833097" "0000403648" "0000839162" "0000427796" "0000905248" "0000429885" "0000909545" "0000429886" "0000909546" "0000429887" "0000909547" "0000444106" "0000945955" "0000444106" "0000945962" "0000444107" "0000945956" "0000444108" "0000945957" "0000444109" "0000945958" "0000444110" "0000945959" "0000444111" "0000945960" "0000444112" "0000945961" "0000444135" "0000945992" "0000444136" "0000945993" "0000444137" "0000945994" "0000444207" "0000946064" "0000444228" "0000946085" "0000444254" "0000946110" "0000444255" "0000946111" "0000444268" "0000946124" "0000445340" "0000952258" "0000445566" "0000952600" "0000445567" "0000952593" "0000446584" "0000954932" "0000446584" "0000954933" "0000446594" "0000954944" "0000449535" "0000959854" "0000449536" "0000959927" "0000452630" "0000986974" "0000452630" "0000986975" "0000461911" "0001021270" "0000468205" "0001047928" "0000468206" "0001047929" "0000468207" "0001047930" "0000468208" "0001047931" "0000468209" "0001047932" "0000468210" "0001047933" "0000468211" "0001047934" "0000468212" "0001047935" "0000468213" "0001047936" "0000469221" "0001049448" "0000469708" "0001057749" "0000469895" "0001057910" "0000469895" "0001057949" "0000469900" "0001057957" "0000469906" "0001057964"