### LOVD-version 3000-270 ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = CRB1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "CRB1" "crumbs homolog 1 (Drosophila)" "1" "q31-q32.1" "unknown" "NG_008483.1" "UD_134408203666" "" "http://www.LOVD.nl/CRB1" "Mutations of the Human Crumbs Homologue 1 " "1" "2343" "23418" "604210" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases.
Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/CRB1_NM_201253.2_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00001" "2010-04-29 00:00:00" "00006" "2015-02-27 23:17:43" "00000" "2022-05-09 15:51:19" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00005647" "CRB1" "transcript variant 1" "003" "NM_201253.2" "" "NP_957705.1" "" "" "" "-209" "4797" "4221" "197237334" "197447585" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 13 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00058" "CORD" "dystrophy, cone-rod (CORD)" "" "" "" "" "" "00006" "2012-09-22 11:31:25" "00006" "2020-08-30 09:43:59" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2016-10-22 17:54:40" "00381" "RD" "dystrophy, retinal (RD)" "" "" "" "" "" "00006" "2014-05-09 11:59:52" "00006" "2015-12-07 07:11:25" "00420" "STGD1" "Stargardt disease, type 1 (STGD1)" "AR" "248200" "" "" "" "00006" "2014-06-16 23:00:12" "00006" "2020-11-19 10:59:15" "01507" "PPCRA" "atrophy, chorioretinal, pigmented paravenous (PPCRA)" "AD" "172870" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02286" "RP12" "retinitis pigmentosa, with/without PPRPE, type 12 (RP12)" "AR" "600105" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "03456" "LCA8" "Leber congenital amaurosis, type 8 (LCA-8)" "" "613835" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04210" "LCA" "Leber congenital amaurosis (LCA)" "" "" "" "" "" "00006" "2015-02-27 18:57:11" "" "" "04211" "RPar" "retinitis pigmentosa, autosomal recessive (RPar)" "" "" "" "" "" "00006" "2015-02-27 18:58:57" "" "" "04214" "retinal disease" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00006" "2020-08-25 10:54:40" "04215" "STGD" "Stargardt disease (STGD)" "" "" "" "" "" "00006" "2015-02-27 20:01:12" "" "" "04249" "MCD" "dystrophy, macular (MCD)" "" "" "" "" "" "00006" "2015-05-04 22:10:58" "" "" "04250" "-" "retinal degeneration" "" "" "" "" "" "00006" "2015-05-04 22:12:01" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "CRB1" "01507" "CRB1" "02286" "CRB1" "03456" ## Individuals ## Do not remove or alter this header ## ## Count = 1312 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00016602" "" "" "" "1" "" "00552" "" "" "" "" "" "" "0" "" "" "" "" "00033038" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033039" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033040" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033041" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033042" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033043" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033044" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033045" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033046" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033047" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033048" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033049" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033050" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033051" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033052" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033053" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033054" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033055" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033056" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033057" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033058" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033059" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033060" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033061" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033062" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033063" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033064" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033065" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033066" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033067" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033068" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033069" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033070" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033071" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033072" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033073" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033074" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033075" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033076" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033077" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033078" "" "" "" "1" "" "00006" "{PMID:Henderson 2010:20956273}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00033091" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" "" "00033092" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" "" "00033093" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" "" "00033106" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" "" "00033144" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" "" "00033146" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" "" "00033158" "" "" "" "1" "" "00229" "" "" "M" "" "" "" "0" "" "" "" "" "00033170" "" "" "" "1" "" "00229" "" "" "F" "" "" "" "0" "" "" "" "" "00033344" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "" "" "0" "" "" "" "" "00033348" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "" "" "0" "" "" "" "" "00033693" "" "" "" "1" "" "00243" "" "2-generation family, patient and unaffected heterozygous carrier parents" "M" "no" "India" "" "0" "" "" "India, north" "" "00037774" "" "" "" "1" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00037775" "" "" "" "1" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00037776" "" "" "" "1" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00037777" "" "" "" "1" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "?" "yes" "Netherlands" "" "0" "" "" "Dutch" "" "00037778" "" "" "" "1" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00037779" "" "" "" "1" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "?" "?" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00037780" "" "" "" "1" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00037781" "" "" "" "1" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00037782" "" "" "" "7" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "M" "yes" "Netherlands" "" "0" "" "" "Dutch" "" "00037783" "" "" "" "7" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "F" "yes" "Netherlands" "" "0" "" "" "Dutch" "" "00037784" "" "" "" "7" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "F" "yes" "Netherlands" "" "0" "" "" "Dutch" "" "00037785" "" "" "" "7" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "F" "yes" "Netherlands" "" "0" "" "" "Dutch" "" "00037786" "" "" "" "7" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "F" "yes" "Netherlands" "" "0" "" "" "Dutch" "" "00037787" "" "" "" "7" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "M" "yes" "Netherlands" "" "0" "" "" "Dutch" "" "00037788" "" "" "" "7" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "M" "yes" "Netherlands" "" "0" "" "" "Dutch" "" "00037789" "" "" "" "7" "" "01251" "{PMID:den Hollander 1999:10508521}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00037790" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037791" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037792" "" "" "" "2" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037793" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037794" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037795" "" "" "" "2" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037796" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037797" "" "" "" "2" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037798" "" "" "" "7" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037799" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037800" "" "" "" "7" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037801" "" "" "" "7" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037802" "" "" "" "7" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037803" "" "" "" "7" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037804" "" "" "" "7" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037805" "" "" "" "7" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037806" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037807" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037808" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037809" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037810" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037811" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037812" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037813" "" "" "" "1" "" "01251" "{PMID:Lotery 2001:11231775}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037814" "" "" "" "1" "" "01251" "{PMID:Hollander 2001:11389483}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037815" "" "" "" "2" "" "01251" "{PMID:Hollander 2001:11389483}" "" "M" "no" "? (unknown)" "" "0" "" "" "?" "" "00037816" "" "" "" "2" "" "01251" "{PMID:Hollander 2001:11389483}" "" "M" "no" "? (unknown)" "" "0" "" "" "?" "" "00037817" "" "" "" "1" "" "01251" "{PMID:Hollander 2001:11389483}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037818" "" "" "" "1" "" "01251" "{PMID:Hollander 2001:11389483}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037819" "" "" "" "1" "" "01251" "{PMID:Hollander 2001:11389483}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037820" "" "" "" "1" "" "01251" "{PMID:Hollander 2001:11389483}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037821" "" "" "" "1" "" "01251" "{PMID:Hollander 2001:11389483}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037822" "" "" "" "2" "" "01251" "{PMID:Hollander 2001:11389483}" "2-generation family, 2-affected" "M" "no" "? (unknown)" "" "0" "" "" "?" "" "00037823" "" "" "" "2" "" "01251" "{PMID:Hollander 2001:11389483}" "2-generation family, 2-affected" "M" "no" "? (unknown)" "" "0" "" "" "?" "" "00037824" "" "" "" "2" "" "01251" "{PMID:Hollander 2001:11389483}" "2-generation family, 2-affected" "F" "yes" "? (unknown)" "" "0" "" "" "?" "" "00037825" "" "" "" "2" "" "01251" "{PMID:Hollander 2001:11389483}" "2-generation family, 2-affected" "M" "yes" "? (unknown)" "" "0" "" "" "?" "" "00037826" "" "" "" "2" "" "01251" "{PMID:Hollander 2001:11389483}" "2-generation family, 2-affected" "F" "no" "? (unknown)" "" "0" "" "" "?" "" "00037827" "" "" "" "2" "" "01251" "{PMID:Hollander 2001:11389483}" "2-generation family, 2-affected" "F" "no" "? (unknown)" "" "0" "" "" "?" "" "00037828" "" "" "" "1" "" "01251" "{PMID:Hollander 2001:11389483}" "2-generation family, 1-affected" "M" "no" "? (unknown)" "" "0" "" "" "?" "" "00037829" "" "" "" "3" "" "01251" "{PMID:Hollander 2001:11389483}" "2-generation family, 3-affected" "F" "no" "? (unknown)" "" "0" "" "" "?" "" "00037830" "" "" "" "3" "" "01251" "{PMID:Hollander 2001:11389483}" "2-generation family,3-affected" "M" "no" "? (unknown)" "" "0" "" "" "?" "" "00037831" "" "" "" "3" "" "01251" "{PMID:Hollander 2001:11389483}" "2-generation family, 3-affected" "M" "no" "? (unknown)" "" "0" "" "" "?" "" "00037832" "" "" "" "5" "" "01251" "{PMID:Lotery 2001:11559858}" "4 generations family, 5 affected, 12 unaffected" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037833" "" "" "" "5" "" "01251" "{PMID:Lotery 2001:11559858}" "4 generations family, 5 affected, 12 unaffected" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037834" "" "" "" "5" "" "01251" "{PMID:Lotery 2001:11559858}" "4 generations family, 5 affected, 12 unaffected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037835" "" "" "" "5" "" "01251" "{PMID:Lotery 2001:11559858}" "4 generations family, 5 affected, 12 unaffected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037836" "" "" "" "5" "" "01251" "{PMID:Lotery 2001:11559858}" "4 generations family, 5 affected, 12 unaffected" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037837" "" "" "" "9" "" "01251" "{PMID:Lotery 2001:11559858}" "6 generations family, 9 affected, 30 unaffected, 23 deceased" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037838" "" "" "" "9" "" "01251" "{PMID:Lotery 2001:11559858}" "6 generations family, 9 affected, 30 unaffected, 23 deceased" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037839" "" "" "" "9" "" "01251" "{PMID:Lotery 2001:11559858}" "6 generations family, 9 affected, 30 unaffected, 23 deceased" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037840" "" "" "" "9" "" "01251" "{PMID:Lotery 2001:11559858}" "6 generations family, 9 affected, 30 unaffected, 23 deceased" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037841" "" "" "" "9" "" "01251" "{PMID:Lotery 2001:11559858}" "6 generations family, 9 affected, 30 unaffected, 23 deceased" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037842" "" "" "" "9" "" "01251" "{PMID:Lotery 2001:11559858}" "6 generations family, 9 affected, 30 unaffected, 23 deceased" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037843" "" "" "" "9" "" "01251" "{PMID:Lotery 2001:11559858}" "6 generations family, 9 affected, 30 unaffected, 23 deceased" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037844" "" "" "" "9" "" "01251" "{PMID:Lotery 2001:11559858}" "6 generations family, 9 affected, 30 unaffected, 23 deceased" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037845" "" "" "" "9" "" "01251" "{PMID:Lotery 2001:11559858}" "6 generations family, 9 affected, 30 unaffected, 23 deceased" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037846" "" "" "" "8" "" "01251" "{PMID:Gerber 2002:12567265}" "4 generations family, 8 affected" "M" "yes" "Israel" "" "0" "" "" "Palestinian" "" "00037847" "" "" "" "8" "" "01251" "{PMID:Gerber 2002:12567265}" "4 generations family, 8 affected" "F" "yes" "Israel" "" "0" "" "" "Palestinian" "" "00037848" "" "" "" "8" "" "01251" "{PMID:Gerber 2002:12567265}" "4 generations family, 8 affected" "M" "yes" "Israel" "" "0" "" "" "Palestinian" "" "00037849" "" "" "" "8" "" "01251" "{PMID:Gerber 2002:12567265}" "4 generations family, 8 affected" "F" "yes" "Israel" "" "0" "" "" "Palestinian" "" "00037850" "" "" "" "8" "" "01251" "{PMID:Gerber 2002:12567265}" "4 generations family, 8 affected" "M" "yes" "Israel" "" "0" "" "" "Palestinian" "" "00037851" "" "" "" "8" "" "01251" "{PMID:Gerber 2002:12567265}" "4 generations family, 8 affected" "F" "yes" "Israel" "" "0" "" "" "Palestinian" "" "00037852" "" "" "" "8" "" "01251" "{PMID:Gerber 2002:12567265}" "4 generations family, 8 affected" "F" "yes" "Israel" "" "0" "" "" "Palestinian" "" "00037853" "" "" "" "8" "" "01251" "{PMID:Gerber 2002:12567265}" "4 generations family, 8 affected" "F" "yes" "Israel" "" "0" "" "" "Palestinian" "" "00037854" "" "" "" "6" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 6 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037855" "" "" "" "6" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 6 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037856" "" "" "" "6" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 6 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037857" "" "" "" "6" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 6 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037858" "" "" "" "6" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 6 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037859" "" "" "" "7" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 7 affected" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037860" "" "" "" "7" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 7 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037861" "" "" "" "7" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 7 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037862" "" "" "" "7" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 7 affected" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037863" "" "" "" "7" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 7 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037864" "" "" "" "7" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 7 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037865" "" "" "" "7" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 7 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037866" "" "" "" "8" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 8 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037867" "" "" "" "8" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 8 affected" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037868" "" "" "" "8" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 8 affected" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037869" "" "" "" "8" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 8 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037870" "" "" "" "8" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 8 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037871" "" "" "" "8" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 8 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037872" "" "" "" "8" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 8 affected" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037873" "" "" "" "8" "" "01251" "{PMID:Khaliq 2003:12573663}" "5 generation family, 8 affected" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00037874" "" "" "" "3" "" "01251" "{PMID:Jacobson 2003:12700176}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00037875" "" "" "" "3" "" "01251" "{PMID:Jacobson 2003:12700176}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00037876" "" "" "" "3" "" "01251" "{PMID:Jacobson 2003:12700176}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00037877" "" "" "" "2" "" "01251" "{PMID:Jacobson 2003:12700176}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00037878" "" "" "" "2" "" "01251" "{PMID:Jacobson 2003:12700176}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00037879" "" "" "" "2" "" "01251" "{PMID:Jacobson 2003:12700176}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00037880" "" "" "" "2" "" "01251" "{PMID:Jacobson 2003:12700176}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00037881" "" "" "" "2" "" "01251" "{PMID:Jacobson 2003:12700176}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00037882" "" "" "" "1" "" "01251" "{PMID:Bernal 2003:12843338}" "2 generation family, 1 affected" "F" "yes" "Spain" "" "0" "" "" "Spanish" "" "00037883" "" "" "" "3" "" "01251" "{PMID:Bernal 2003:12843338}" "5 generation family, 3 affected" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00037884" "" "" "" "3" "" "01251" "{PMID:Bernal 2003:12843338}" "5 generation family, 3 affected" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00037885" "" "" "" "3" "" "01251" "{PMID:Bernal 2003:12843338}" "5 generation family, 3 affected" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00037886" "" "" "" "2" "" "01251" "{PMID:Bernal 2003:12843338}" "2 generation family, 2 affected" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00037887" "" "" "" "2" "" "01251" "{PMID:Bernal 2003:12843338}" "2 generation family, 2 affected" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00037888" "" "" "" "2" "" "01251" "{PMID:Bernal 2003:12843338}" "2 generation family, 2 affected" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00037889" "" "" "" "1" "" "01251" "{PMID:Bernal 2003:12843338}" "2 generation family, 1 affected" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00037890" "" "" "" "2" "" "01251" "{PMID:Bernal 2003:12843338}" "2 generation family, 2 affected" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00037891" "" "" "" "2" "" "01251" "{PMID:Bernal 2003:12843338}" "2 generation family, 2 affected" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00037892" "" "" "" "4" "" "01251" "{PMID:Hanein 2004:15024725}" "3 generation family, 5 affected" "F" "yes" "? (unknown)" "" "0" "" "" "?" "" "00037893" "" "" "" "4" "" "01251" "{PMID:Hanein 2004:15024725}" "3 generation family, 5 affected" "M" "yes" "? (unknown)" "" "0" "" "" "?" "" "00037894" "" "" "" "4" "" "01251" "{PMID:Hanein 2004:15024725}" "3 generation family, 5 affected" "M" "?" "? (unknown)" "" "0" "" "" "?" "" "00037895" "" "" "" "4" "" "01251" "{PMID:Hanein 2004:15024725}" "3 generation family, 5 affected" "M" "?" "? (unknown)" "" "0" "" "" "?" "" "00037896" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037897" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "yes" "France" "" "0" "" "" "French" "" "00037898" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037899" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "?" "France" "" "0" "" "" "French" "" "00037900" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "yes" "? (unknown)" "" "0" "" "" "?" "" "00037901" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037902" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037903" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037904" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "?" "France" "" "0" "" "" "French" "" "00037905" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "?" "France" "" "0" "" "" "French" "" "00037906" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "?" "France" "" "0" "" "" "French" "" "00037907" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "?" "France" "" "0" "" "" "French" "" "00037908" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "?" "France" "" "0" "" "" "French" "" "00037909" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "yes" "? (unknown)" "" "0" "" "" "?" "" "00037910" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "yes" "? (unknown)" "" "0" "" "" "?" "" "00037911" "" "" "" "1" "" "01251" "{PMID:Hanein 2004:15024725}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037912" "" "" "" "1" "" "01251" "{PMID:den Hollander 2004:15459956}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037913" "" "" "" "3" "" "01251" "{PMID:den Hollander 2004:15459956}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037914" "" "" "" "3" "" "01251" "{PMID:den Hollander 2004:15459956}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037915" "" "" "" "3" "" "01251" "{PMID:den Hollander 2004:15459956}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037916" "" "" "" "1" "" "01251" "{PMID:den Hollander 2004:15459956}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037917" "" "" "" "1" "" "01251" "{PMID:den Hollander 2004:15459956}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037918" "" "" "" "1" "" "01251" "{PMID:den Hollander 2004:15459956}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037919" "" "" "" "1" "" "01251" "{PMID:den Hollander 2004:15459956}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037920" "" "" "" "2" "" "01251" "{PMID:den Hollander 2004:15459956}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037921" "" "" "" "1" "" "01251" "{PMID:den Hollander 2004:15459956}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037922" "" "" "" "1" "" "01251" "{PMID:den Hollander 2004:15459956}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037923" "" "" "" "1" "" "01251" "{PMID:den Hollander 2004:15459956}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037924" "" "" "" "5" "" "01251" "{PMID:Mckay 2005:15623792}" "4 generation family, 5 affected" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00037925" "" "" "" "5" "" "01251" "{PMID:Mckay 2005:15623792}" "4 generation family, 5 affected" "F" "no" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00037926" "" "" "" "5" "" "01251" "{PMID:Mckay 2005:15623792}" "4 generation family, 5 affected" "F" "no" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00037927" "" "" "" "5" "" "01251" "{PMID:Mckay 2005:15623792}" "4 generation family, 5 affected" "F" "no" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00037928" "" "" "" "5" "" "01251" "{PMID:Mckay 2005:15623792}" "4 generation family, 5 affected" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00037929" "" "" "" "1" "" "01251" "{PMID:Galvin 2005:16205573}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037930" "" "" "" "1" "" "01251" "{PMID:Galvin 2005:16205573}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037931" "" "" "" "1" "" "01251" "{PMID:Galvin 2005:16205573}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037932" "" "" "" "1" "" "01251" "{PMID:Galvin 2005:16205573}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037933" "" "" "" "1" "" "01251" "{PMID:Galvin 2005:16205573}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037934" "" "" "" "1" "" "01251" "{PMID:Galvin 2005:16205573}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037935" "" "" "" "1" "" "01251" "{PMID:Galvin 2005:16205573}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037936" "" "" "" "1" "" "01251" "{PMID:Galvin 2005:16205573}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037937" "" "" "" "1" "" "01251" "{PMID:Booij 2005:16272259}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00037938" "" "" "" "4" "" "01251" "{PMID:Booij 2005:16272259}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00037939" "" "" "" "4" "" "01251" "{PMID:Booij 2005:16272259}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00037940" "" "" "" "4" "" "01251" "{PMID:Booij 2005:16272259}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00037941" "" "" "" "1" "" "01251" "{PMID:Booij 2005:16272259}" "" "?" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00037942" "" "" "" "1" "" "01251" "{PMID:Yzer 2006:16505055}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037943" "" "" "" "1" "" "01251" "{PMID:Yzer 2006:16505055}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037944" "" "" "" "1" "" "01251" "{PMID:Yzer 2006:16505055}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037945" "" "" "" "1" "" "01251" "{PMID:Yzer 2006:16505055}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037946" "" "" "" "1" "" "01251" "{PMID:Yzer 2006:16505055}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037947" "" "" "" "1" "" "01251" "{PMID:Yzer 2006:16505055}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037948" "" "" "" "1" "" "01251" "{PMID:Yzer 2006:16505055}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037949" "" "" "" "1" "" "01251" "{PMID:Yzer 2006:16505055}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037950" "" "" "" "1" "" "01251" "{PMID:Yzer 2006:16505055}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037951" "" "" "" "4" "" "01251" "{PMID:Abouzeid 2006:16543197}" "6 generations family, 4 affected, 31 unaffected" "F" "yes" "United States" "" "0" "" "" "American" "" "00037952" "" "" "" "4" "" "01251" "{PMID:Abouzeid 2006:16543197}" "6 generations family, 4 affected, 31 unaffected" "M" "yes" "United States" "" "0" "" "" "American" "" "00037953" "" "" "" "4" "" "01251" "{PMID:Abouzeid 2006:16543197}" "6 generations family, 4 affected, 31 unaffected" "M" "yes" "United States" "" "0" "" "" "American" "" "00037954" "" "" "" "4" "" "01251" "{PMID:Abouzeid 2006:16543197}" "6 generations family, 4 affected, 31 unaffected" "M" "yes" "United States" "" "0" "" "" "American" "" "00037955" "" "" "" "1" "" "01251" "{PMID:Mezer 2006:16767206}" "" "?" "?" "Canada" "" "0" "" "" "Canadian" "" "00037956" "" "" "" "1" "" "01251" "{PMID:Mezer 2006:16767206}" "" "?" "?" "Canada" "" "0" "" "" "Canadian" "" "00037957" "" "" "" "1" "" "01251" "{PMID:Yzer 2006:16936081}" "2 generation family, 1 affected" "?" "no" "? (unknown)" "" "0" "" "" "?" "" "00037958" "" "" "" "1" "" "01251" "{PMID:Yzer 2006:16936081}" "2 generation family, 1 affected" "?" "no" "? (unknown)" "" "0" "" "" "?" "" "00037959" "" "" "" "1" "" "01251" "{PMID:Yzer 2006:16936081}" "2 generation family, 1 affected" "?" "yes" "? (unknown)" "" "0" "" "" "?" "" "00037960" "" "" "" "3" "" "01251" "{PMID:Yzer 2006:16936081}" "2 generation family, 3 affected" "?" "no" "? (unknown)" "" "0" "" "" "?" "" "00037961" "" "" "" "3" "" "01251" "{PMID:Yzer 2006:16936081}" "2 generation family, 3 affected" "?" "no" "? (unknown)" "" "0" "" "" "?" "" "00037962" "" "" "" "3" "" "01251" "{PMID:Yzer 2006:16936081}" "2 generation family, 3 affected" "?" "no" "? (unknown)" "" "0" "" "" "?" "" "00037963" "" "" "" "1" "" "01251" "{PMID:Preising 2007:17525851}" "1 affected" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037964" "" "" "" "1" "" "01251" "{PMID:Preising 2007:17525851}" "1 affected" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037965" "" "" "" "1" "" "01251" "{PMID:Simonelli 2007:17724218}" "" "?" "?" "Italy" "" "0" "" "" "Italian" "" "00037966" "" "" "" "1" "" "01251" "{PMID:Simonelli 2007:17724218}" "" "?" "?" "Italy" "" "0" "" "" "Italian" "" "00037967" "" "" "" "1" "" "01251" "{PMID:Simonelli 2007:17724218}" "" "?" "?" "Italy" "" "0" "" "" "Italian" "" "00037968" "" "" "" "1" "" "01251" "{PMID:Simonelli 2007:17724218}" "" "?" "?" "Italy" "" "0" "" "" "Italian" "" "00037969" "" "" "" "1" "" "01251" "{PMID:Simonelli 2007:17724218}" "" "?" "?" "Italy" "" "0" "" "" "Italian" "" "00037970" "" "" "" "1" "" "01251" "{PMID:Simonelli 2007:17724218}" "" "?" "?" "Italy" "" "0" "" "" "Italian" "" "00037971" "" "" "" "1" "" "01251" "{PMID:Simonelli 2007:17724218}" "" "?" "?" "Italy" "" "0" "" "" "Italian" "" "00037972" "" "" "" "1" "" "01251" "{PMID:Simonelli 2007:17724218}" "" "?" "?" "Italy" "" "0" "" "" "Italian" "" "00037973" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037974" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037975" "" "" "" "2" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037976" "" "" "" "2" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037977" "" "" "" "3" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037978" "" "" "" "3" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037979" "" "" "" "3" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037980" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037981" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037982" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037983" "" "" "" "2" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037984" "" "" "" "2" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037985" "" "" "" "7" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037986" "" "" "" "7" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037987" "" "" "" "7" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037988" "" "" "" "7" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037989" "" "" "" "7" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037990" "" "" "" "7" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037991" "" "" "" "7" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037992" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037993" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037994" "" "" "" "3" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037995" "" "" "" "3" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037996" "" "" "" "3" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037997" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037998" "" "" "" "6" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00037999" "" "" "" "6" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038000" "" "" "" "6" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038001" "" "" "" "6" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038002" "" "" "" "6" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038003" "" "" "" "6" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038004" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038005" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038006" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038007" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038008" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038009" "" "" "" "2" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038010" "" "" "" "2" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038011" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038012" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038013" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038014" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038015" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038016" "" "" "" "2" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038017" "" "" "" "2" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038018" "" "" "" "3" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038019" "" "" "" "3" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038020" "" "" "" "3" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038021" "" "" "" "8" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038022" "" "" "" "8" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038023" "" "" "" "8" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038024" "" "" "" "8" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038025" "" "" "" "8" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038026" "" "" "" "8" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038027" "" "" "" "8" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038028" "" "" "" "8" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038029" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038030" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038031" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038032" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038033" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038034" "" "" "" "4" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038035" "" "" "" "4" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038036" "" "" "" "4" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038037" "" "" "" "4" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038038" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038039" "" "" "" "25" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038040" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038041" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038042" "" "" "" "3" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038043" "" "" "" "3" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038044" "" "" "" "3" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038045" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038046" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038047" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038048" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038049" "" "" "" "1" "" "01251" "{PMID:Stone 2007:17964524}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038050" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038051" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038052" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "M" "?" "Spain" "" "0" "" "" "Spanish" "" "00038053" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "M" "?" "Spain" "" "0" "" "" "Spanish" "" "00038054" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038055" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038056" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "M" "?" "Spain" "" "0" "" "" "Spanish" "" "00038057" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "F" "?" "Spain" "" "0" "" "" "Spanish" "" "00038058" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "M" "?" "Spain" "" "0" "" "" "Spanish" "" "00038059" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "M" "?" "Spain" "" "0" "" "" "Spanish" "" "00038060" "" "" "" "5" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038061" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "F" "?" "Spain" "" "0" "" "" "Spanish" "" "00038062" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "M" "?" "Spain" "" "0" "" "" "Spanish" "" "00038063" "" "" "" "5" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038064" "" "" "" "5" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038065" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038066" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038067" "" "" "" "4" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038068" "" "" "" "4" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038069" "" "" "" "4" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038070" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038071" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038072" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038073" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038074" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038075" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038076" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038077" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038078" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038079" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038080" "" "" "" "1" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038081" "" "" "" "2" "" "01251" "{PMID:Vallespin 2007:18055816}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038082" "" "" "" "9" "" "01251" "{PMID:Henderson 2007:18055820}" "" "?" "?" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00038083" "" "" "" "9" "" "01251" "{PMID:Henderson 2007:18055820}" "" "?" "?" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00038084" "" "" "" "9" "" "01251" "{PMID:Henderson 2007:18055820}" "" "?" "?" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00038085" "" "" "" "9" "" "01251" "{PMID:Henderson 2007:18055820}" "" "?" "?" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00038086" "" "" "" "9" "" "01251" "{PMID:Henderson 2007:18055820}" "" "?" "?" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00038087" "" "" "" "9" "" "01251" "{PMID:Henderson 2007:18055820}" "" "?" "?" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00038088" "" "" "" "9" "" "01251" "{PMID:Henderson 2007:18055820}" "" "?" "?" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00038089" "" "" "" "9" "" "01251" "{PMID:Henderson 2007:18055820}" "" "?" "?" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00038090" "" "" "" "9" "" "01251" "{PMID:Henderson 2007:18055820}" "" "?" "?" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00038091" "" "" "" "1" "" "01251" "{PMID:den Hollander 2007:18055821}" "" "M" "yes" "Canada" "" "0" "" "" "Quebec" "" "00038092" "" "" "" "1" "" "01251" "{PMID:den Hollander 2007:18055821}" "" "F" "yes" "Canada" "" "0" "" "" "Quebec" "" "00038093" "" "" "" "1" "" "01251" "{PMID:den Hollander 2007:18055821}" "" "M" "yes" "Canada" "" "0" "" "" "Quebec" "" "00038094" "" "" "" "1" "" "01251" "{PMID:den Hollander 2007:18055821}" "" "F" "?" "Germany" "" "0" "" "" "German" "" "00038097" "" "" "" "1" "" "01251" "{PMID:Seong 2008:18682808}" "" "?" "?" "Korea" "" "0" "" "" "Korean" "" "00038098" "" "" "" "1" "" "01251" "{PMID:Bustamante-Aragones 2008:18682814}" "" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00038099" "" "" "" "1" "" "01251" "{PMID:Li 2007:18936139}" "" "?" "?" "Saudi Arabia" "" "0" "" "" "Arab" "" "00038100" "" "" "" "4" "" "01251" "{PMID:Benayoun 2009:19140180}" "" "F" "yes" "Israel" "" "0" "" "" "Israeli" "" "00038101" "" "" "" "4" "" "01251" "{PMID:Benayoun 2009:19140180}" "" "F" "yes" "Israel" "" "0" "" "" "Israeli" "" "00038102" "" "" "" "4" "" "01251" "{PMID:Benayoun 2009:19140180}" "" "F" "yes" "Israel" "" "0" "" "" "Israeli" "" "00038103" "" "" "" "4" "" "01251" "{PMID:Benayoun 2009:19140180}" "" "F" "yes" "Israel" "" "0" "" "" "Israeli" "" "00038104" "" "" "" "2" "" "01251" "{PMID:Tosi 2009:19401883}" "" "M" "?" "? (unknown)" "" "0" "" "" "?" "" "00038105" "" "" "" "2" "" "01251" "{PMID:Tosi 2009:19401883}" "" "F" "?" "? (unknown)" "" "0" "" "" "?" "" "00038106" "" "" "" "4" "" "01251" "{PMID:Aldahmesh 2009:19956407}" "2-generation family,4-affected" "M" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "DGU-F11-II:1" "00038107" "" "" "00038106" "1" "" "01251" "{PMID:Aldahmesh 2009:19956407}" "PatII3" "M" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "DGU-F11-II:3" "00038108" "" "" "00038106" "1" "" "01251" "{PMID:Aldahmesh 2009:19956407}" "PatII6" "M" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "DGU-F11-II:6" "00038109" "" "" "00038106" "1" "" "01251" "{PMID:Aldahmesh 2009:19956407}" "PatII8" "M" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "DGU-F11-II:8" "00038110" "" "" "" "1" "" "01251" "{PMID:Aldahmesh 2009:19956407}" "2-generation family, 1-affected" "F" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "DGU-F12-t1" "00038111" "" "" "" "10" "" "01251" "{PMID:Mckibbin 2010:20065226}" "" "?" "?" "Pakistan" "" "0" "" "" "Pakistani" "" "00038112" "" "" "" "1" "" "01251" "{PMID:Vallespin 2010:20108431}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038113" "" "" "" "1" "" "01251" "{PMID:Clark 2010:20591486}" "" "?" "" "Ireland" "" "0" "" "" "Irish" "" "00038114" "" "" "" "1" "" "01251" "{PMID:Clark 2010:20591486}" "" "?" "" "Ireland" "" "0" "" "" "Irish" "" "00038115" "" "" "" "1" "" "01251" "{PMID:Clark 2010:20591486}" "" "?" "" "Ireland" "" "0" "" "" "Irish" "" "00038116" "" "" "" "1" "" "01251" "{PMID:Clark 2010:20591486}" "" "?" "?" "Ireland" "" "0" "" "" "Irish" "" "00038117" "" "" "" "1" "" "01251" "{PMID:Clark 2010:20591486}" "" "?" "?" "Ireland" "" "0" "" "" "Irish" "" "00038118" "" "" "" "1" "" "01251" "{PMID:Clark 2010:20591486}" "" "?" "?" "Ireland" "" "0" "" "" "Irish" "" "00038119" "" "" "" "1" "" "01251" "{PMID:Clark 2010:20591486}" "" "?" "?" "Ireland" "" "0" "" "" "Irish" "" "00038120" "" "" "" "7" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038121" "" "" "" "7" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038122" "" "" "" "7" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038123" "" "" "" "7" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038124" "" "" "" "7" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038125" "" "" "" "7" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038126" "" "" "" "7" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038127" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038128" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038129" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038130" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038131" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038132" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038133" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038134" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038135" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038136" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038137" "" "" "" "2" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038138" "" "" "" "2" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038139" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038140" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038141" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038142" "" "" "" "1" "" "01251" "{PMID:Coppieters 2010:20683928}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038143" "" "" "" "2" "" "01251" "{PMID:Simpson 2011:21147909}" "2 generations family, 2 affected, 2 unafceted, 1 carrier" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00038144" "" "" "" "2" "" "01251" "{PMID:Simpson 2011:21147909}" "2 generations family, 2 affected, 2 unafceted, 1 carrier" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "British" "" "00038145" "" "" "" "2" "" "01251" "{PMID:Avila-Fernandez 2010:21151602}" "2 generations family, 2 affected, 3 unafceted" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00038146" "" "" "" "2" "" "01251" "{PMID:Avila-Fernandez 2010:21151602}" "2 generations family, 2 affected, 3 unafceted" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00038147" "" "" "" "1" "" "01251" "{PMID:Avila-Fernandez 2010:21151602}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038148" "" "" "" "1" "" "01251" "{PMID:Avila-Fernandez 2010:21151602}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038149" "" "" "" "2" "" "01251" "{PMID:Zenteno 2011:21484995}" "" "F" "?" "Mexico" "" "0" "" "" "Mexican" "" "00038150" "" "" "" "2" "" "01251" "{PMID:Zenteno 2011:21484995}" "" "M" "?" "Mexico" "" "0" "" "" "Mexican" "" "00038151" "" "" "" "1" "" "01251" "{PMID:Li 2011:21602930}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00038152" "" "" "" "1" "" "01251" "{PMID:Li 2011:21602930}" "" "M" "yes" "China" "" "0" "" "" "Chinese" "" "00038153" "" "" "" "1" "" "01251" "{PMID:Li 2011:21602930}" "" "F" "yes" "China" "" "0" "" "" "Chinese" "" "00038154" "" "" "" "1" "" "01251" "{PMID:Li 2011:21602930}" "" "F" "no" "China" "" "0" "" "" "Chinese" "" "00038155" "" "" "" "1" "" "01251" "{PMID:Li 2011:21602930}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00038156" "" "" "" "1" "" "01251" "{PMID:Li 2011:21602930}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00038157" "" "" "" "1" "" "01251" "{PMID:Li 2011:21602930}" "" "F" "no" "China" "" "0" "" "" "Chinese" "" "00038158" "" "" "" "1" "" "01251" "{PMID:Li 2011:21602930}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00038159" "" "" "" "1" "" "01251" "{PMID:Li 2011:21602930}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00038160" "" "" "" "1" "" "01251" "{PMID:Li 2011:21602930}" "" "F" "?" "China" "" "0" "" "" "Chinese" "" "00038161" "" "" "" "8" "" "01251" "{PMID:Aleman 2011:21757580}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00038162" "" "" "" "8" "" "01251" "{PMID:Aleman 2011:21757580}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00038163" "" "" "" "1" "" "01251" "{PMID:Aleman 2011:21757580}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00038164" "" "" "" "8" "" "01251" "{PMID:Aleman 2011:21757580}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00038165" "" "" "" "8" "" "01251" "{PMID:Aleman 2011:21757580}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00038166" "" "" "" "8" "" "01251" "{PMID:Aleman 2011:21757580}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00038167" "" "" "" "8" "" "01251" "{PMID:Aleman 2011:21757580}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00038168" "" "" "" "2" "" "01251" "{PMID:Aleman 2011:21757580}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00038169" "" "" "" "8" "" "01251" "{PMID:Aleman 2011:21757580}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00038170" "" "" "" "1" "" "01251" "{PMID:Aleman 2011:21757580}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00038171" "" "" "" "2" "" "01251" "{PMID:Aleman 2011:21757580}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00038172" "" "" "" "1" "" "01251" "{PMID:Aleman 2011:21757580}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00038173" "" "" "" "1" "" "01251" "{PMID:Aleman 2011:21757580}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00038174" "" "" "" "2" "" "01251" "{PMID:Aleman 2011:21757580}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00038175" "" "" "" "1" "" "01251" "{PMID:Aleman 2011:21757580}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00038176" "" "" "" "1" "" "01251" "{PMID:Aleman 2011:21757580}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00038177" "" "" "" "2" "" "01251" "{PMID:Aleman 2011:21757580}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00038178" "" "" "" "3" "" "01251" "{PMID:Aleman 2011:21757580}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00038179" "" "" "" "1" "" "01251" "{PMID:Aleman 2011:21757580}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00038180" "" "" "" "1" "" "01251" "{PMID:Aleman 2011:21757580}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00038181" "" "" "" "1" "" "01251" "{PMID:Azam 2011:21987686}" "" "?" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00038182" "" "" "" "1" "" "01251" "{PMID:Bujakowska 2012:22065545}" "2 generation family, 1 affected" "F" "no" "France" "" "0" "" "" "French" "" "00038183" "" "" "" "1" "" "01251" "{PMID:Bujakowska 2012:22065545}" "" "M" "no" "France" "" "0" "" "" "French" "" "00038184" "" "" "" "1" "" "01251" "{PMID:Bujakowska 2012:22065545}" "2 generation family, 1 affected" "F" "no" "France" "" "0" "" "" "French" "" "00038185" "" "" "" "1" "" "01251" "{PMID:Bujakowska 2012:22065545}" "3 generation family, 1 affected" "M" "no" "France" "" "0" "" "" "French" "" "00038186" "" "" "" "2" "" "01251" "{PMID:Bujakowska 2012:22065545}" "2 generation family, 2 affected" "M" "yes" "France" "" "0" "" "" "French" "" "00038187" "" "" "" "2" "" "01251" "{PMID:Bujakowska 2012:22065545}" "2 generation family, 2 affected" "F" "no" "France" "" "0" "" "" "French" "" "00038188" "" "" "" "2" "" "01251" "{PMID:Bujakowska 2012:22065545}" "2 generation family, 2 affected" "F" "no" "France" "" "0" "" "" "French" "" "00038189" "" "" "" "2" "" "01251" "{PMID:Bujakowska 2012:22065545}" "2 generation family, 2 affected" "M" "no" "France" "" "0" "" "" "French" "" "00038190" "" "" "" "1" "" "01251" "{PMID:Bujakowska 2012:22065545}" "" "F" "no" "France" "" "0" "" "" "French" "" "00038191" "" "" "" "1" "" "01251" "{PMID:Bujakowska 2012:22065545}" "2 generation family, 1 affected" "F" "no" "France" "" "0" "" "" "French" "" "00038192" "" "" "" "1" "" "01251" "{PMID:Bujakowska 2012:22065545}" "2 generation family, 1 affected" "F" "yes" "France" "" "0" "" "" "French" "" "00038193" "" "" "" "2" "" "01251" "{PMID:Bujakowska 2012:22065545}" "2 generation family, 2 affected" "M" "no" "France" "" "0" "" "" "French" "" "00038194" "" "" "" "2" "" "01251" "{PMID:Bujakowska 2012:22065545}" "2 generation family, 2 affected" "M" "no" "France" "" "0" "" "" "French" "" "00038195" "" "" "" "1" "" "01251" "{PMID:Bujakowska 2012:22065545}" "2 generation family, 1 affected" "F" "no" "France" "" "0" "" "" "French" "" "00038196" "" "" "" "1" "" "01251" "{PMID:Siemiatkowska 2011:22128245}" "2 generations family, 1 affaected" "?" "?" "Indonesia" "" "0" "" "" "Indonesian" "" "00038197" "" "" "" "3" "" "01251" "{PMID:Li 2011:22219627}" "2 generation family, 3 affected" "?" "?" "China" "" "0" "" "" "Chinese" "" "00038198" "" "" "" "3" "" "01251" "{PMID:Li 2011:22219627}" "2 generation family, 3 affected" "?" "?" "China" "" "0" "" "" "Chinese" "" "00038199" "" "" "" "3" "" "01251" "{PMID:Li 2011:22219627}" "2 generation family, 3 affected" "?" "?" "China" "" "0" "" "" "Chinese" "" "00038200" "" "" "" "1" "" "01251" "{PMID:Coppieters 2012:22261762}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038201" "" "" "" "1" "" "01251" "{PMID:Strom 2012:22863181}" "" "M" "no" "United States" "" "0" "" "" "American" "" "00038202" "" "" "" "1" "" "01251" "{PMID:Paterson 2012:22876132}" "" "?" "?" "Australia" "" "0" "" "" "Australian" "" "00038203" "" "" "" "1" "" "01251" "{PMID:Paterson 2012:22876132}" "" "?" "?" "Australia" "" "0" "" "" "Australian" "" "00038204" "" "" "" "1" "" "01251" "{PMID:Paun 2012:23077403}" "" "?" "?" "Turkey" "" "0" "" "" "Turkish" "" "00038205" "" "" "" "8" "" "01251" "{PMID:Jalkh 2014:23362850}" "3 generation family, 8 affected" "F" "yes" "Lebanon" "" "0" "" "" "Lebanese" "" "00038206" "" "" "" "8" "" "01251" "{PMID:Jalkh 2014:23362850}" "3 generation family, 8 affected" "F" "yes" "Lebanon" "" "0" "" "" "Lebanese" "" "00038207" "" "" "" "8" "" "01251" "{PMID:Jalkh 2014:23362850}" "3 generation family, 8 affected" "M" "no" "Lebanon" "" "0" "" "" "Lebanese" "" "00038208" "" "" "" "8" "" "01251" "{PMID:Jalkh 2014:23362850}" "3 generation family, 8 affected" "F" "no" "Lebanon" "" "0" "" "" "Lebanese" "" "00038209" "" "" "" "8" "" "01251" "{PMID:Jalkh 2014:23362850}" "3 generation family, 8 affected" "M" "no" "Lebanon" "" "0" "" "" "Lebanese" "" "00038210" "" "" "" "8" "" "01251" "{PMID:Jalkh 2014:23362850}" "3 generation family, 8 affected" "M" "no" "Lebanon" "" "0" "" "" "Lebanese" "" "00038211" "" "" "" "8" "" "01251" "{PMID:Jalkh 2014:23362850}" "3 generation family, 8 affected" "M" "no" "Lebanon" "" "0" "" "" "Lebanese" "" "00038212" "" "" "" "8" "" "01251" "{PMID:Jalkh 2014:23362850}" "3 generation family, 8 affected" "M" "no" "Lebanon" "" "0" "" "" "Lebanese" "" "00038213" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038214" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038215" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038216" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038217" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038218" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038219" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038220" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038221" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038222" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038223" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038224" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038225" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038226" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038227" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038228" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038229" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038230" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038231" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038232" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038233" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038234" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038235" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038236" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038237" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038238" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038239" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038240" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038241" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038242" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038243" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038244" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038245" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038246" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038247" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038248" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038249" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038250" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038251" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038252" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038253" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038254" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038255" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038256" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038257" "" "" "" "1" "" "01251" "{PMID:Corton 2013:23379534}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038258" "" "" "" "4" "" "01251" "{PMID:Jonsson 2013:23443024}, {PMID:Jonsson 2014:24664696}" "7 generation family, 4 affected" "F" "no" "Sweden" "" "0" "" "" "Swedish" "" "00038259" "" "" "" "4" "" "01251" "{PMID:Jonsson 2013:23443024}, {PMID:Jonsson 2014:24664696}" "7 generation family, 4 affected" "F" "no" "Sweden" "" "0" "" "" "Swedish" "" "00038260" "" "" "" "4" "" "01251" "{PMID:Jonsson 2013:23443024}, {PMID:Jonsson 2014:24664696}" "7 generation family, 4 affected" "F" "no" "Sweden" "" "0" "" "" "Swedish" "" "00038261" "" "" "" "4" "" "01251" "{PMID:Jonsson 2013:23443024}, {PMID:Jonsson 2014:24664696}" "7 generation family, 4 affected" "F" "no" "Sweden" "" "0" "" "" "Swedish" "" "00038262" "" "" "" "7" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Arab, muslim" "" "00038263" "" "" "" "7" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Arab, muslim" "" "00038264" "" "" "" "7" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Arab, muslim" "" "00038265" "" "" "" "7" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Arab, muslim" "" "00038266" "" "" "" "7" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Arab, muslim" "" "00038267" "" "" "" "7" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Arab, muslim" "" "00038268" "" "" "" "1" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Arab, muslim" "" "00038269" "" "" "" "7" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Arab, muslim" "" "00038270" "" "" "" "1" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Arab, muslim" "" "00038271" "" "" "" "3" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Arab, muslim" "" "00038272" "" "" "" "2" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "Iraq" "" "0" "" "" "Jewish" "" "00038273" "" "" "" "3" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Arab, muslim" "" "00038274" "" "" "" "3" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Arab, muslim" "" "00038275" "" "" "" "4" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Jewish;Kurdistan" "" "00038276" "" "" "" "4" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Jewish;Kurdistan" "" "00038277" "" "" "" "4" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Jewish;Kurdistan" "" "00038278" "" "" "" "1" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Jewish-mixed" "" "00038279" "" "" "" "2" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "Iraq" "" "0" "" "" "Jewish" "" "00038280" "" "" "" "4" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Jewish;Kurdistan" "" "00038281" "" "" "" "1" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Jewish;Kurdistan" "" "00038282" "" "" "" "1" "" "01251" "{PMID:Beryozkin 2013:23449718}" "" "?" "?" "" "" "0" "" "" "Arab, muslim" "" "00038283" "" "" "" "1" "" "01251" "{PMID:Tiab 2013:23592920}" "3 generation family, 1 affected" "F" "no" "Switzerland" "" "0" "" "" "Swiss" "" "00038284" "" "" "" "2" "" "01251" "{PMID:Chen 2013:23661368}" "2 generation family, 2 affected" "M" "no" "China" "" "0" "" "" "Chinese" "" "00038285" "" "" "" "2" "" "01251" "{PMID:Chen 2013:23661368}" "2 generation family, 2 affected" "F" "no" "China" "" "0" "" "" "Chinese" "" "00038286" "" "" "" "3" "" "01251" "{PMID:Khan 2013:23767994}" "4 generation family, 3 affecetd" "F" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "" "00038287" "" "" "" "3" "" "01251" "{PMID:Khan 2013:23767994}" "4 generation family, 3 affecetd" "M" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "" "00038288" "" "" "" "3" "" "01251" "{PMID:Khan 2013:23767994}" "4 generation family, 3 affecetd" "M" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "" "00038289" "" "" "" "1" "" "01251" "{PMID:Cordovez 2013:24512366}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00038290" "" "" "" "1" "" "01251" "{PMID:Cordovez 2013:24512366}" "" "M" "?" "United States" "" "0" "" "" "American" "" "00038291" "" "" "" "3" "" "01251" "{PMID:Cordovez 2013:24512366}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00038292" "" "" "" "3" "" "01251" "{PMID:Cordovez 2013:24512366}" "" "F" "?" "United States" "" "0" "" "" "American" "" "00038298" "" "" "" "1" "" "01251" "{PMID:Li 2014:24535598}" "" "M" "?" "China" "" "0" "" "" "Chinese" "" "00038299" "" "" "" "1" "" "01251" "{PMID:Li 2014:24535598}" "" "M" "?" "China" "" "0" "" "" "Chinese" "" "00038300" "" "" "" "1" "" "01251" "{PMID:Li 2014:24535598}" "" "M" "?" "China" "" "0" "" "" "Chinese" "" "00038301" "" "" "" "1" "" "01251" "{PMID:Li 2014:24535598}" "" "F" "?" "China" "" "0" "" "" "Chinese" "" "00038302" "" "" "" "1" "" "01251" "{PMID:Li 2014:24535598}" "" "M" "?" "China" "" "0" "" "" "Chinese" "" "00038303" "" "" "" "1" "" "01251" "{PMID:Li 2014:24535598}" "" "M" "?" "China" "" "0" "" "" "Chinese" "" "00038304" "" "" "" "1" "" "01251" "{PMID:Li 2014:24535598}" "" "F" "?" "China" "" "0" "" "" "Chinese" "" "00038305" "" "" "" "1" "" "01251" "{PMID:Jinda 2014:24618324}" "" "F" "no" "Thailand" "" "0" "" "" "Thai" "" "00038306" "" "" "" "1" "" "01251" "{PMID:Jinda 2014:24618324}" "" "M" "yes" "Thailand" "" "0" "" "" "Thai" "" "00038307" "" "" "" "3" "" "01251" "{PMID:Yang 2014:24715753}" "" "M" "?" "China" "" "0" "" "" "Chinese" "" "00038308" "" "" "" "3" "" "01251" "{PMID:Yang 2014:24715753}" "" "F" "?" "China" "" "0" "" "" "Chinese" "" "00038309" "" "" "" "3" "" "01251" "{PMID:Yang 2014:24715753}" "" "F" "?" "China" "" "0" "" "" "Chinese" "" "00038310" "" "" "" "1" "" "01251" "{PMID:Yang 2014:24715753}" "" "M" "?" "China" "" "0" "" "" "Chinese" "" "00038311" "" "" "" "2" "" "01251" "{PMID:Yang 2014:24715753}" "" "F" "?" "China" "" "0" "" "" "Chinese" "" "00038312" "" "" "" "1" "" "01251" "{PMID:Yang 2014:24715753}" "" "M" "?" "China" "" "0" "" "" "Chinese" "" "00038313" "" "" "" "2" "" "01251" "{PMID:Tsang 2014:24811962}" "2 generation family, 2 affected" "F" "no" "United States" "" "0" "" "" "Irish" "" "00038314" "" "" "" "2" "" "01251" "{PMID:Tsang 2014:24811962}" "2 generation family, 2 affected" "M" "no" "United States" "" "0" "" "" "Irish" "" "00038315" "" "" "" "1" "" "01251" "{PMID:Watson 2014:25133751}" "" "?" "?" "United Kingdom (Great Britain)" "" "0" "" "" "British" "PatB" "00038316" "" "" "" "2" "" "01251" "{PMID:Watson 2014:25133751}" "5 generation family, 2 affected" "M" "yes" "United Kingdom (Great Britain)" "" "0" "" "" "British" "MA1PatV1" "00038317" "" "" "00038316" "1" "" "01251" "{PMID:Watson 2014:25133751}" "" "F" "yes" "United Kingdom (Great Britain)" "" "0" "" "" "British" "MA1PatV5" "00038318" "" "" "" "1" "" "01251" "{PMID:Luhmann 2014:25147295}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038319" "" "" "" "1" "" "01251" "{PMID:Kuniyoshi 2015:25323024}" "" "M" "?" "Japan" "" "0" "" "" "Japanese" "" "00038320" "" "" "" "5" "" "01251" "{PMID:Sánchez-Alcudia 2014:25342620}" "" "F" "" "Spain" "" "0" "" "" "Spanish" "" "00038321" "" "" "" "5" "" "01251" "{PMID:Sánchez-Alcudia 2014:25342620}" "" "F" "" "Spain" "" "0" "" "" "Spanish" "" "00038322" "" "" "00077526" "1" "" "01251" "{PMID:Sánchez-Alcudia 2014:25342620}" "sister" "F" "" "Spain" "" "0" "" "" "Spanish" "RP-0280PatII4" "00038323" "" "" "" "5" "" "01251" "{PMID:Sánchez-Alcudia 2014:25342620}" "" "F" "" "Spain" "" "0" "" "" "Spanish" "" "00038324" "" "" "" "5" "" "01251" "{PMID:Sánchez-Alcudia 2014:25342620}" "" "F" "" "Spain" "" "0" "" "" "Spanish" "" "00038325" "" "" "" "1" "" "01251" "{PMID:Sánchez-Alcudia 2014:25342620}" "" "F" "" "Spain" "" "0" "" "" "Spanish" "" "00038326" "" "" "" "4" "" "01251" "{PMID:Sánchez-Alcudia 2014:25342620}" "" "M" "" "Spain" "" "0" "" "" "Spanish" "" "00038327" "" "" "" "4" "" "01251" "{PMID:Sánchez-Alcudia 2014:25342620}" "" "M" "" "Spain" "" "0" "" "" "Spanish" "" "00038328" "" "" "" "4" "" "01251" "{PMID:Sánchez-Alcudia 2014:25342620}" "" "F" "" "Spain" "" "0" "" "" "Spanish" "" "00038329" "" "" "" "1" "" "01251" "{PMID:Sánchez-Alcudia 2014:25342620}" "" "M" "" "Spain" "" "0" "" "" "Spanish" "" "00038330" "" "" "" "1" "" "01251" "{PMID:Zernant 2005:16123401}" "" "F" "yes" "India" "" "0" "" "" "Indian" "" "00038331" "" "" "" "1" "" "01251" "{PMID:Booij 2011:20801516}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038332" "" "" "" "1" "" "01251" "{PMID:Booij 2011:20801516}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038333" "" "" "" "1" "" "01251" "{PMID:Booij 2011:20801516}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038334" "" "" "" "1" "" "01251" "{PMID:Booij 2011:20801516}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038335" "" "" "" "1" "" "01251" "{PMID:Booij 2011:20801516}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038336" "" "" "" "2" "" "01251" "{PMID:Paterson 2012:22876132}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038337" "" "" "" "2" "" "01251" "{PMID:Paterson 2012:22876132}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038338" "" "" "" "1" "" "01251" "{PMID:González-del Pozo 2011:22164218}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00038339" "" "" "" "1" "" "01251" "{PMID:Coppieters 2012:22261762}" "" "?" "?" "Belgium" "" "0" "" "" "Belgian" "" "00038340" "" "" "" "1" "" "01251" "{PMID:Anasagasti 2013:24416769}" "" "" "" "Spain" "" "0" "" "" "Spanish" "" "00038341" "" "" "" "1" "" "01251" "{PMID:Anasagasti 2013:24416769}" "" "" "" "Spain" "" "0" "" "" "Spanish" "" "00038342" "" "" "" "1" "" "01251" "{PMID:Anasagasti 2013:24416769}" "" "" "" "Spain" "" "0" "" "" "Spanish" "" "00038343" "" "" "" "2" "" "01251" "{PMID:Abu-Safieh 2013:23105016}" "" "?" "?" "Saudi Arabia" "" "0" "" "" "Arab" "" "00038344" "" "" "" "1" "" "01251" "{PMID:Abu-Safieh 2013:23105016}" "" "?" "?" "Saudi Arabia" "" "0" "" "" "Arab" "" "00038345" "" "" "" "4" "" "01251" "{PMID:Abu-Safieh 2013:23105016}" "" "?" "?" "Saudi Arabia" "" "0" "" "" "Arab" "" "00038346" "" "" "" "2" "" "01251" "{PMID:Abu-Safieh 2013:23105016}" "" "?" "?" "Saudi Arabia" "" "0" "" "" "Arab" "" "00038347" "" "" "" "2" "" "01251" "{PMID:Abu-Safieh 2013:23105016}" "" "?" "?" "Saudi Arabia" "" "0" "" "" "Arab" "" "00038348" "" "" "" "1" "" "01251" "{PMID:Abu-Safieh 2013:23105016}" "" "?" "?" "Saudi Arabia" "" "0" "" "" "Arab" "" "00038349" "" "" "" "3" "" "01251" "{PMID:Abu-Safieh 2013:23105016}" "" "?" "?" "Saudi Arabia" "" "0" "" "" "Arab" "" "00038350" "" "" "" "1" "" "01251" "{PMID:Chen 2013:23462753}" "" "?" "?" "China" "" "0" "" "" "Chinese" "" "00038351" "" "" "" "1" "" "01251" "{PMID:Eisenberger 2013:23591405}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038352" "" "" "" "1" "" "01251" "{PMID:Eisenberger 2013:23591405}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038353" "" "" "" "1" "" "01251" "{PMID:Eisenberger 2013:23591405}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038354" "" "" "" "2" "" "01251" "{PMID:Glockle 2013:23591405}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038355" "" "" "" "2" "" "01251" "{PMID:Glockle 2013:23591405}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038356" "" "" "" "1" "" "01251" "{PMID:Glockle 2013:23591405}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038357" "" "" "" "1" "" "01251" "{PMID:Glockle 2013:23591405}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038358" "" "" "" "1" "" "01251" "{PMID:Glöckle 2014:23591405}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "23591405-Pat658" "00038359" "" "" "" "1" "" "01251" "{PMID:Wang 2013:23847139}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038360" "" "" "" "1" "" "01251" "{PMID:Wang 2013:23847139}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038361" "" "" "" "1" "" "01251" "{PMID:Wang 2013:23847139}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038362" "" "" "" "1" "" "01251" "{PMID:Wang 2013:23847139}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038363" "" "" "" "1" "" "01251" "{PMID:Wang 2013:23847139}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038364" "" "" "" "1" "" "01251" "{PMID:Wang 2013:23847139}" "" "?" "?" "? (unknown)" "" "0" "" "" "?" "" "00038365" "" "" "" "1" "" "01251" "{PMID:Huang 2014:25356976}" "" "M" "?" "? (unknown)" "" "0" "" "" "?" "" "00038366" "" "" "" "1" "" "01251" "{PMID:Huang 2014:25356976}" "" "F" "?" "? (unknown)" "" "0" "" "" "?" "" "00038367" "" "" "" "1" "" "01251" "{PMID:Huang 2014:25356976}" "" "M" "?" "? (unknown)" "" "0" "" "" "?" "" "00038368" "" "" "" "1" "" "01251" "{PMID:Huang 2014:25356976}" "" "F" "?" "? (unknown)" "" "0" "" "" "?" "" "00038369" "" "" "" "1" "" "01251" "{PMID:Huang 2014:25356976}" "" "F" "?" "? (unknown)" "" "0" "" "" "?" "" "00038370" "" "" "" "1" "" "01251" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00038371" "" "" "" "1" "" "01251" "{PMID:Xu 2014:24938718}" "" "F" "?" "China" "" "0" "" "" "Chinese" "" "00052643" "" "" "" "1" "" "01424" "{PMID:Vallespin 2007:18055816}" "2-generation family" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00076473" "" "" "" "2" "" "01695" "{PMID:Riveiro-Alvarez 2008:18334942}" "2-generation familly, 2 affected" "M" "?" "Spain" "" "0" "" "" "?" "FamPatII1" "00076474" "" "" "00076473" "1" "" "01695" "{PMID:Riveiro-Alvarez 2008:18334942}" "2-generation familly, 2 affected" "F" "?" "Spain" "" "0" "" "" "?" "FamPatII4" "00100102" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "" "" "Pakistan" "" "0" "" "" "Pakistani" "61186" "00105014" "" "" "" "1" "" "01244" "{PMID:de Castro-Miró 2016:28005958}" "" "F" "no" "Venezuela" "" "0" "" "" "" "2ORG1" "00105022" "" "" "" "1" "" "01244" "{PMID:de Castro-Miró 2016:28005958}" "" "F" "no" "Spain" "" "0" "" "" "" "22ORG1" "00105030" "" "" "" "1" "" "01244" "{PMID:de Castro-Miró 2014:24516651}" "" "F" "no" "Spain" "" "0" "" "" "" "" "00105031" "" "" "" "2" "" "01244" "{PMID:de Castro-Miró 2014:24516651}" "3-generation family, 2 affecteds (2M), unaffected heterozygous carrier parents/relatives" "M" "?" "Spain" "" "0" "" "" "" "10RE-III2" "00105032" "" "" "" "1" "" "01244" "{PMID:de Castro-Miró 2014:24516651}" "" "F" "no" "Spain" "" "0" "" "" "" "" "00105033" "" "" "" "2" "" "01244" "{PMID:de Castro-Miró 2014:24516651}" "2-generation family, affected brother/sister, unaffected heterozygous carrier parents" "F;M" "yes" "Spain" "" "0" "" "" "" "25NCE1/3" "00105034" "" "" "" "3" "" "01244" "{PMID:de Castro-Miró 2014:24516651}" "2-generation family, 2 affected sisters and brother, unaffected heterozygous carrier parents" "M" "yes" "? (unknown)" "" "0" "" "" "" "T5" "00105049" "" "" "00105031" "1" "" "01244" "{PMID:de Castro-Miró 2014:24516651}" "patient 10RE-II6" "M" "" "Spain" "" "0" "" "" "" "10RE-II6" "00155449" "" "" "" "1" "" "01243" "Sharon, submitted" "" "M" "no" "Israel" "" "0" "" "" "Jewish" "" "00155450" "" "" "" "3" "" "01243" "Sharon, submitted" "" "F" "no" "Israel" "" "0" "" "" "Arab-Muslim" "" "00155451" "" "" "" "2" "" "01243" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "family" "F" "no" "Israel" "" "0" "" "" "Jewish-Oriental" "MOL0757" "00155452" "" "" "" "1" "" "01243" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "family" "M" "no" "Israel" "" "0" "" "" "Jewish-Oriental" "MOL0984" "00155453" "" "" "" "3" "" "01243" "Sharon, submitted" "" "F" "yes" "Israel" "" "0" "" "" "Arab-Muslim" "" "00155454" "" "" "" "3" "" "01243" "Sharon, submitted" "" "M" "yes" "Israel" "" "0" "" "" "Arab-Muslim" "" "00155455" "" "" "" "1" "" "01243" "Sharon, submitted" "" "M" "yes" "Israel" "" "0" "" "" "Arab-Muslim" "" "00155456" "" "" "" "2" "" "01243" "{PMID:Sharon 2019:31456290}" "family" "M" "yes" "Israel" "" "0" "" "" "Jewish-Oriental" "MOL0650" "00155457" "" "" "" "1" "" "01243" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "" "M" "yes" "Israel" "" "0" "" "" "Arab-Muslim" "MOL0234" "00155458" "" "" "" "2" "" "01243" "Sharon, submitted" "" "M" "yes" "Israel" "" "0" "" "" "Arab-Muslim" "" "00207678" "" "" "" "1" "" "01244" "" "" "F" "" "" "" "0" "" "" "" "" "00207681" "" "" "" "1" "" "01244" "" "" "F" "" "" "" "0" "" "" "" "" "00207687" "" "" "" "1" "" "01244" "" "" "F" "" "" "" "0" "" "" "" "" "00207694" "" "" "" "1" "" "01244" "" "" "F" "" "" "" "0" "" "" "" "" "00231992" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00231993" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00231994" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00231995" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00231996" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00231997" "" "" "" "37" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00231998" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00231999" "" "" "" "4" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1201 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232000" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232001" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232002" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232003" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232004" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232005" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232006" "" "" "" "180" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232007" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232008" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232009" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232010" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232011" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232012" "" "" "" "15" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232013" "" "" "" "6" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232014" "" "" "" "7" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232015" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232016" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232017" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232018" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232019" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232020" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233603" "" "" "" "10" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00240433" "" "" "" "1" "" "03335" "" "" "M" "" "Mexico" "" "0" "" "" "" "" "00240434" "" "" "" "1" "" "03335" "" "" "M" "" "Mexico" "" "0" "" "" "" "" "00240435" "" "" "" "1" "" "03335" "" "" "F" "" "Mexico" "" "0" "" "" "" "" "00262111" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00269471" "" "" "" "1" "" "03508" "" "" "" "" "" "" "0" "" "" "" "" "00289642" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00289643" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00289644" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295237" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295601" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00308414" "" "" "" "1" "" "00004" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "France" "" "0" "" "" "" "CIC01380" "00308501" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308502" "" "" "" "2" "" "00004" "{PMID:Holtan 2020:31429209}" "2 patients with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308503" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308504" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308505" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308609" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 homozygous patient" "" "" "Norway" "" "0" "" "" "" "" "00308610" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 homozygous patient" "" "" "Norway" "" "0" "" "" "" "" "00309109" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309110" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309111" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309112" "" "" "" "2" "" "00004" "{PMID:Sharon 2019:31456290}" "2 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309115" "" "" "" "2" "" "00004" "{PMID:Sharon 2019:31456290}" "2 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309116" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309117" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309118" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309119" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309120" "" "" "" "2" "" "00004" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "Iraq;Jewish" "" "00309121" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309122" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309123" "" "" "" "1" "" "00004" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "family" "" "" "Israel" "" "0" "" "" "Arab-Muslim" "" "00309124" "" "" "" "3" "" "00004" "{PMID:Sharon 2019:31456290}" "3 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309125" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309126" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309127" "" "" "" "4" "" "00004" "{PMID:Sharon 2019:31456290}" "4 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00320010" "" "" "" "6" "" "00008" "{PMID:Khaliq 2003:12573663}" "" "" "yes" "" "" "0" "" "" "Pakistani" "" "00320011" "" "" "" "9" "" "00008" "{PMID:Khaliq 2003:12573663}" "" "" "yes" "" "" "0" "" "" "Pakistani" "" "00320012" "" "" "" "8" "" "00008" "{PMID:Khaliq 2003:12573663}" "" "" "yes" "" "" "0" "" "" "Pakistani" "" "00325414" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "" "" "" "Mexico" "" "0" "" "" "" "197" "00325428" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "" "" "Mexico" "" "0" "" "" "" "1853" "00325441" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "" "" "" "Mexico" "" "0" "" "" "" "2712" "00325449" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "" "" "" "Mexico" "" "0" "" "" "" "3043" "00325454" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "" "" "" "Mexico" "" "0" "" "" "" "3267" "00325472" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "" "" "" "Mexico" "" "0" "" "" "" "3480" "00325506" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "" "" "Mexico" "" "0" "" "" "" "3793" "00325510" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "" "" "" "Mexico" "" "0" "" "" "" "3904" "00325521" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "" "" "" "Mexico" "" "0" "" "" "" "EC04" "00326693" "" "" "" "1" "" "00008" "{PMID:Mandal 2005:16123440}" "" "" "" "" "" "0" "" "" "" "" "00327932" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "B240055" "00327945" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "B240079" "00327946" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "B240082" "00327952" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "B240212" "00327956" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "B240222" "00327985" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G001018" "00327986" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G001021" "00328016" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Africa" "G001055" "00328085" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G005006" "00328109" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G005227" "00328188" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G007688" "00328232" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Asia-South" "G008148" "00328489" "" "" "" "1" "" "00000" "{PMID:Taylor 2017:28341476}" "no family history retinal disease" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "15003990" "00328497" "" "" "" "1" "" "00000" "{PMID:Taylor 2017:28341476}" "no family history retinal disease" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "14009965" "00328498" "" "" "" "1" "" "00000" "{PMID:Taylor 2017:28341476}" "no family history retinal disease" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "15017062" "00331980" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:29555955}" "patient" "F" "" "Germany" "" "0" "" "" "" "Pat117" "00332193" "" "" "" "1" "" "00000" "{PMID:Bryant 2018:29343940}" "" "" "" "United States" "" "0" "" "" "" "JB274" "00332194" "" "" "" "1" "" "00000" "{PMID:Bryant 2018:29343940}" "" "" "" "United States" "" "0" "" "" "" "JB375" "00332195" "" "" "" "1" "" "00000" "{PMID:Bryant 2018:29343940}" "" "" "" "United States" "" "0" "" "" "" "JB402" "00332267" "" "" "" "1" "" "00000" "{PMID:Porto 2017:29186038}" "proband" "" "" "Brazil" "" "0" "" "" "" "Fam12PatFBP_34" "00332268" "" "" "" "1" "" "00000" "{PMID:Porto 2017:29186038}" "proband" "" "" "Brazil" "" "0" "" "" "" "Fam14PatFBP_36" "00332276" "" "" "" "1" "" "00000" "{PMID:Porto 2017:29186038}" "proband" "" "" "Brazil" "" "0" "" "" "" "Fam36PatFBP_174" "00332366" "" "" "" "2" "" "00000" "{PMID:Thompson 2017:29178642}" "family, 2 affected" "" "" "Australia" "" "0" "" "" "" "Fam306" "00332367" "" "" "" "1" "" "00000" "{PMID:Thompson 2017:29178642}" "" "" "" "Australia" "" "0" "" "" "" "Fam2274" "00332392" "" "" "" "1" "" "00000" "{PMID:Essilfie 2018:29155698}" "" "M" "" "Korea" "" "0" "" "" "" "Pat13" "00332456" "" "" "" "1" "" "00000" "{PMID:Di Iorio 2017:29053603}" "" "" "" "Italy" "" "0" "" "" "" "Pat16" "00332466" "" "" "" "1" "" "00000" "{PMID:Di Iorio 2017:29053603}" "" "" "" "Italy" "" "0" "" "" "" "Pat33" "00332468" "" "" "" "1" "" "00000" "{PMID:Di Iorio 2017:29053603}" "" "" "" "Italy" "" "0" "" "" "" "Pat37" "00333352" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat5" "00333357" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat6" "00333359" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat10" "00333363" "" "" "" "1" "" "00000" "{PMID:Costa 2017:28912962}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat3" "00333398" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD5–05" "00333465" "" "" "" "1" "" "00000" "{PMID:Soens 2017:28714225}" "possible duplicate" "" "" "" "" "0" "" "" "" "FBP_54" "00333817" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "13" "00333818" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "14" "00333819" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "15" "00333820" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "16" "00333821" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "17" "00333822" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "18" "00333899" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "266" "00333923" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "346" "00333924" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "347" "00333938" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "396" "00333946" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "407" "00333947" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "408" "00333948" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "409" "00333969" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "433" "00333970" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "M" "" "(United States)" "" "0" "" "" "" "434" "00333971" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "M" "" "(United States)" "" "0" "" "" "" "435" "00334112" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "649" "00334113" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "650" "00334260" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "818" "00334278" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "960" "00334414" "" "" "" "1" "" "00000" "{PMID:Huang 2017:28512305}" "patient" "" "" "China" "" "0" "" "" "" "RP-052" "00334561" "" "" "" "1" "" "00000" "{PMID:Jinda 2017:28453600}" "patient" "" "" "Thailand" "" "0" "" "" "" "RP022" "00334562" "" "" "" "1" "" "00000" "{PMID:Jinda 2017:28453600}" "patient" "" "" "Thailand" "" "0" "" "" "" "RP023" "00335108" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "no" "Netherlands" "" "0" "" "" "" "70" "00335109" "" "" "" "1" "" "00000" "{PMID:Haer-Wigman 2017:28224992}" "patient" "" "yes" "Netherlands" "" "0" "" "" "" "169" "00335240" "" "" "" "2" "" "00000" "{PMID:Riera 2017:28181551}" "family, several affected" "" "" "Spain" "" "0" "" "" "" "Fi15/29" "00335241" "" "" "" "1" "" "00000" "{PMID:Riera 2017:28181551}" "patient" "" "" "Spain" "" "0" "" "" "" "Fi15/13" "00335268" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "family" "" "" "Spain" "" "0" "" "" "" "Pat14" "00335269" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "family" "" "" "Spain" "" "0" "" "" "" "Pat24" "00335270" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "patient" "" "" "Spain" "" "0" "" "" "" "Pat37" "00335271" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "patient" "" "" "Spain" "" "0" "" "" "" "Pat44" "00335272" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "patient" "" "" "Spain" "" "0" "" "" "" "Pat45" "00335273" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "patient" "" "" "Spain" "" "0" "" "" "" "Pat85" "00335394" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP089" "00335411" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP101" "00335486" "" "" "" "1" "" "00000" "{PMID:Bernardis 2016:28127548}" "familial case" "" "" "Italy" "" "0" "" "" "" "IRD029" "00335487" "" "" "" "1" "" "00000" "{PMID:Bernardis 2016:28127548}" "" "" "" "Italy" "" "0" "" "" "" "IRD030" "00335488" "" "" "" "1" "" "00000" "{PMID:Bernardis 2016:28127548}" "" "" "" "Italy" "" "0" "" "" "" "IRD031" "00335603" "" "" "" "1" "" "00008" "{PMID:Booij 2005:16272259}" "" "" "" "" "" "0" "" "" "" "" "00335604" "" "" "" "1" "" "00008" "{PMID:Booij 2005:16272259}" "" "" "" "" "" "0" "" "" "" "" "00335608" "" "" "" "1" "" "00008" "{PMID:Hameed 2003:12920076}" "" "" "" "" "" "0" "" "" "" "" "00335609" "" "" "" "1" "" "00008" "{PMID:Booij 2005:16272259}" "" "" "" "" "" "0" "" "" "" "" "00335610" "" "" "" "1" "" "00008" "{PMID:Booij 2005:16272259}" "" "" "" "" "" "0" "" "" "" "" "00335971" "" "" "" "3" "" "00000" "{PMID:Sergouniotis 2016:27628848}" "analysis 486 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00358904" "" "" "" "1" "" "00000" "{PMID:Wang 2016:27422788}" "family, 1 affected, unaffected heterozygous carrier parents" "" "" "China" "" "0" "" "" "Han" "Fam16" "00358905" "" "" "" "1" "" "00000" "{PMID:Wang 2016:27422788}" "family, 1 affected, unaffected heterozygous carrier parents" "" "" "China" "" "0" "" "" "Han" "Fam17" "00358958" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71471" "00358966" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "M" "" "Switzerland" "" "0" "" "" "" "Case30421" "00358969" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71133" "00358970" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71161" "00358980" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "M" "" "Switzerland" "" "0" "" "" "" "Case71094" "00359030" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "12014625" "00359032" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "13005842" "00359056" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "13009681" "00359064" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13009682" "00359065" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "11013818" "00359067" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "13001571" "00359074" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "12001399" "00359082" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "11010486" "00359083" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13007873" "00359090" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "12014872" "00359097" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13012618" "00359099" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "12007024" "00359111" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "11000824" "00359130" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13013774" "00359135" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "12016026" "00359146" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "12014047" "00359174" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "12005771" "00359193" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13017339" "00359196" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "13003909" "00359199" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13003354" "00359219" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "12002277" "00359367" "" "" "" "1" "" "00000" "{PMID:Bravo-Gil 2016:27032803}" "see paper" "" "" "Spain" "" "0" "" "" "" "435" "00359370" "" "" "" "1" "" "00000" "{PMID:Bravo-Gil 2016:27032803}" "see paper" "" "" "Spain" "" "0" "" "" "" "353" "00362166" "" "" "" "2" "" "00000" "{PMID:Oishi 2016:26957898}" "2-generation family, 2 affected (2M)" "M" "" "Japan" "" "0" "" "" "" "K6247" "00362905" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2016:26766544}" "family" "" "" "Germany" "" "0" "" "" "" "ARRP17" "00363442" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "family" "" "" "United States" "" "0" "" "" "" "VGJ+4.64" "00363443" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "family" "" "" "United States" "" "0" "" "" "" "3UF+P.83" "00363444" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "family" "" "" "United States" "" "0" "" "" "" "5WL+S.22" "00363454" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "simplex case" "" "" "United States" "" "0" "" "" "" "U7U+9.12" "00363455" "" "" "" "1" "" "00000" "{PMID:Ge 2015:26667666}" "simplex case" "" "" "United States" "" "0" "" "" "" "UEW+W.58" "00363523" "" "" "" "1" "" "00000" "{PMID:Beheshtian 2015:26497376}" "4-generation family, 1 affected (F), unaffected heterozygous carrier parents/relatives" "F" "yes" "Iran" "" "0" "" "" "" "9300042/I-40240" "00363524" "" "" "" "1" "" "00000" "{PMID:Beheshtian 2015:26497376}" "4-generation family, 1 affected (M), unaffected heterozygous carrier parents/relatives" "M" "yes" "Iran" "" "0" "" "" "" "9300043/I-40260" "00363583" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "09DG00277" "00363610" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "10DG0001" "00363628" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "10DG1183" "00363650" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "11DG1394" "00363693" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "12DG0833" "00363728" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "13DG0249" "00363752" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "14DG2055" "00368954" "" "" "" "1" "" "01695" "{PMID:Wang 2014:25097241}" "" "F" "?" "United States" "" "0" "" "" "" "1" "00372059" "" "" "" "1" "" "00000" "{PMID:Vamos 2016:26165328}" "" "" "" "Hungary" "" "0" "" "" "" "CRB1-Pat1" "00372060" "" "" "" "1" "" "00000" "{PMID:Vamos 2016:26165328}" "" "" "" "Hungary" "" "0" "" "" "" "CRB1-Pat2" "00372061" "" "" "" "1" "" "00000" "{PMID:Vamos 2016:26165328}" "" "" "" "Hungary" "" "0" "" "" "" "CRB1-Pat3" "00372068" "" "" "" "1" "" "00000" "{PMID:Srilekha 2015:26147992}" "family" "" "yes" "India" "" "0" "" "" "India-S" "FamLCA-2" "00372409" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "1663858" "00372410" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "1684042" "00372411" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "1548568" "00372426" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "116" "00372427" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "118" "00372428" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "125" "00372429" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "625" "00372430" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "727" "00372431" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "2211522" "00372432" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "1545586" "00372433" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "1636129" "00372459" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "151" "00372462" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "142" "00372463" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "155" "00372464" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "730" "00372465" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "769" "00372466" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "799" "00372467" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "1688659" "00372468" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "1662591" "00372469" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "xh17695" "00372470" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "1714763" "00372497" "" "" "" "1" "" "00000" "{PMID:Wang 2015:26047050}" "index case" "" "" "China" "" "0" "" "" "" "107" "00372625" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "F" "" "China" "" "0" "" "" "" "RP221" "00372651" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "F" "" "China" "" "0" "" "" "" "RP382" "00372652" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "M" "" "China" "" "0" "" "" "" "RP331" "00372670" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "F" "" "China" "" "0" "" "" "" "RP201" "00372673" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "QT770" "00372686" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "M" "" "China" "" "0" "" "" "" "RP223" "00372700" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP380" "00372716" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP255" "00372717" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP267" "00372720" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP277" "00372725" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP308" "00372726" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP322" "00372739" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP240" "00373414" "" "" "" "2" "" "00000" "{PMID:Maria 2015:25775262}" "family" "" "yes" "Pakistan" "" "0" "" "" "" "Fam10" "00373501" "" "" "" "1" "" "00000" "{PMID:Liu 2015:25611614}" "" "F" "" "China" "" "0" "" "" "" "RH17-PatIV3" "00373521" "" "" "" "1" "" "00000" "{PMID:Zaneveld 2015:25474345}" "" "" "" "Canada" "" "0" "" "" "French-Canadian" "Pat55" "00373526" "" "" "" "1" "" "00000" "{PMID:Zaneveld 2015:25474345}" "" "" "" "Canada" "" "0" "" "" "French-Canadian" "Pat80" "00373748" "" "" "" "1" "" "00008" "{PMID:Jacobson 2007:17197551}" "Unknown 2nd variant" "" "" "" "" "0" "" "" "" "" "00373749" "" "" "" "1" "" "00008" "{PMID:Jacobson 2007:17197551}" "" "" "" "" "" "0" "" "" "" "" "00373750" "" "" "" "1" "" "00008" "{PMID:Jacobson 2007:17197551}" "" "" "" "" "" "0" "" "" "" "" "00373751" "" "" "" "1" "" "00008" "{PMID:Jacobson 2007:17197551}" "" "" "" "" "" "0" "" "" "" "" "00373805" "" "" "" "1" "" "00000" "{PMID:Méndez-Vidal 2014:25494902}" "" "" "" "Spain" "" "0" "" "" "" "Pat2" "00373851" "" "" "" "1" "" "00000" "{PMID:Zhao 2015:25472526}" "family" "" "" "Northern Ireland" "" "0" "" "" "" "Rp79" "00373887" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-455-966" "00373890" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-153-408" "00373917" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-405-871" "00373919" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-411-879" "00373929" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-149-401" "00373932" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-513-1053" "00373933" "" "" "" "1" "" "00000" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-513-1054" "00373953" "" "" "" "1" "" "00000" "{PMID:Shen 2015:25377065}" "" "M" "" "China" "" "0" "" "" "" "RP019" "00373954" "" "" "" "1" "" "00000" "{PMID:Shen 2015:25377065}" "" "F" "" "China" "" "0" "" "" "" "RP051" "00373955" "" "" "" "1" "" "00000" "{PMID:Shen 2015:25377065}" "" "F" "" "China" "" "0" "" "" "" "RP173" "00374937" "" "" "" "1" "" "00000" "{PMID:Huang 2015:25356976}" "" "F" "" "China" "" "0" "" "" "" "W93-1" "00375421" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#013" "00376167" "" "" "" "1" "" "00000" "{PMID:Jin 2008:18310263}" "" "" "" "Japan" "" "0" "" "" "" "" "00376240" "" "" "" "1" "" "00000" "{PMID:Jacobson 2008:18463160}" "" "M" "" "" "" "0" "" "" "" "" "00376468" "" "" "" "1" "" "00000" "{PMID:Li-2009:18936139}" "" "" "" "" "" "0" "" "" "Saudi Arabian" "" "00376469" "" "" "" "1" "" "00000" "{PMID:Li-2009:18936139}" "" "" "" "" "" "0" "" "" "Saudi Arabian" "" "00376473" "" "" "" "1" "" "00000" "{PMID:Li-2009:18936139}" "" "" "" "" "" "0" "" "" "Saudi Arabian" "" "00376479" "" "" "" "1" "" "00000" "{PMID:Seong-2008:18682808}" "" "" "" "Korea" "" "0" "" "" "Koreans" "" "00376512" "" "" "" "1" "" "00000" "{PMID:Singh 2009:19339744}" "" "" "yes" "" "" "0" "" "" "Indian" "" "00376714" "" "" "" "1" "" "00000" "{PMID:Vallespin 2007:18055816}" "" "M" "" "Spain" "" "0" "" "" "Spanish" "" "00376758" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "18" "00376762" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "24" "00376766" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "28" "00376782" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "48" "00376785" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "52" "00377170" "" "" "" "1" "" "00000" "Tracewska 2021, MolVis in press" "proband" "F" "no" "Poland" "" "0" "yes" "" "Slavic" "237" "00377192" "" "" "" "1" "" "00000" "Tracewska 2021, MolVis in press" "proband" "F" "no" "Poland" "" "0" "yes" "" "Slavic" "267" "00377201" "" "" "" "1" "" "00000" "Tracewska 2021, MolVis in press" "proband" "M" "no" "Poland" "" "0" "yes" "" "Slavic" "279" "00377523" "" "" "" "1" "" "00000" "{PMID:Hosono2018:29844330}" "proband, family EYE68" "M" "no" "Japan" "" "0" "" "" "Asian" "EYE68" "00377528" "" "" "" "1" "" "00000" "{PMID:Hosono2018:29844330}" "proband, family EYE115" "F" "no" "Japan" "" "0" "" "" "Asian" "EYE115" "00377529" "" "" "" "1" "" "00000" "{PMID:Hosono2018:29844330}" "proband, family EYE121" "F" "no" "Japan" "" "0" "" "" "Asian" "EYE121" "00377816" "" "" "" "1" "" "00000" "{PMID:Avila Fernandez 2010:21151602}" "" "" "" "" "" "0" "" "" "Spanish" "" "00377817" "" "" "" "1" "" "00000" "{PMID:Avila Fernandez 2010:21151602}" "" "" "" "" "" "0" "" "" "Spanish" "" "00377839" "" "" "" "1" "" "00000" "{PMID:Avila Fernandez 2010:21151602}" "" "" "" "" "" "0" "" "" "Spanish" "" "00377890" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "Simonelli et al.,2007 novel" "M" "no" "China" "" "0" "" "" "Chinese" "" "00377891" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "" "F" "no" "China" "" "0" "" "" "Chinese" "" "00377903" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "Both of the twins are affected" "F" "no" "China" "" "0" "" "" "Chinese" "" "00377907" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "den Hollander et al., 2004" "M" "no" "China" "" "0" "" "" "Chinese" "" "00377909" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00377910" "" "" "" "1" "" "00000" "{PMID:li 2011:21602930}" "" "F" "no" "China" "" "0" "" "" "Chinese" "" "00377939" "" "" "" "1" "" "00000" "{PMID: Siemiatkowska 2011:22128245}" "" "M" "no" "Indonesia" "" "0" "" "" "Indonesian" "" "00377950" "" "" "" "1" "" "00000" "{PMID:_Audo-2012:22277662}" "" "" "yes" "" "" "0" "" "" "" "" "00379375" "" "" "" "1" "" "00000" "{PMID:Collin-2011:21217109}" "" "M" "" "Netherlands" "" "0" "" "" "" "" "00379564" "" "" "" "1" "" "00000" "{PMID:O\'Sullivan-2012:22581970}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00379648" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0030" "00379821" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016060104" "00379822" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016060110" "00379823" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "F" "?" "China" "" "0" "" "" "Han Chinese" "2016061401" "00379824" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016082402" "00379825" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016102430" "00379826" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016112804" "00380196" "" "" "" "1" "" "00000" "{PMID:Ezquerra-Inchausti 2018:30337596}" "Family RP200, IV:1" "?" "no" "Spain" "" "0" "" "" "" "IV:1" "00381007" "" "" "" "1" "" "00000" "{PMID:Schorderet-2013:23484092}" "" "" "" "Switzerland" "" "0" "" "" "Swiss, Algerian or Tunisian" "" "00381026" "" "" "" "1" "" "00000" "{PMID:Chen-2013:23661368}" "" "M" "" "China" "" "0" "" "" "Chinese" "" "00381040" "" "" "" "1" "" "00000" "{PMID:Chen-2013:23661368}" "" "" "" "China" "" "0" "" "" "Chinese" "" "00381049" "" "" "" "1" "" "00000" "{PMID:Chen-2013:23661368}" "" "" "" "China" "" "0" "" "" "Chinese" "" "00381084" "" "" "" "1" "" "00000" "{PMID:Jonsson-2013:23443024}" "" "F" "" "Sweden" "" "0" "" "" "Swedish" "" "00381086" "" "" "" "1" "" "00000" "{PMID:Jonsson-2013:23443024}" "" "F" "" "Sweden" "" "0" "" "" "Swedish" "" "00381088" "" "" "" "1" "" "00000" "{PMID:Jonsson-2013:23443024}" "heterozygously present in healthy parents" "F" "" "Sweden" "" "0" "" "" "Swedish" "" "00381089" "" "" "" "1" "" "00000" "{PMID:Jonsson-2013:23443024}" "" "F" "" "Sweden" "" "0" "" "" "Swedish" "" "00381597" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "yes" "Pakistan" "" "0" "" "" "" "" "00381598" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "Turkey" "" "0" "" "" "" "" "00381599" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "no" "Poland" "" "0" "" "" "" "" "00381608" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "no" "Germany" "" "0" "" "" "" "" "00381624" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "no" "Germany" "" "0" "" "" "" "" "00381627" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "Germany" "" "0" "" "" "" "" "00381630" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00381642" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "?" "Turkey" "" "0" "" "" "" "" "00381818" "" "" "" "1" "" "00000" "{PMID:Wang-2014:24154662}" "" "" "" "" "" "0" "" "" "" "" "00381868" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "18" "00381869" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "19" "00381870" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "F" "" "Germany" "" "0" "" "" "" "20" "00381871" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "21" "00381935" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2018:30576320}" "" "F" "" "Germany" "" "0" "" "" "" "4" "00381936" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2018:30576320}" "" "M" "" "Germany" "" "0" "" "" "" "5" "00381937" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2018:30576320}" "" "F" "" "Germany" "" "0" "" "" "" "6" "00381938" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2018:30576320}" "" "M" "" "Germany" "" "0" "" "" "" "7" "00381939" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2018:30576320}" "" "F" "" "Germany" "" "0" "" "" "" "8" "00381940" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2018:30576320}" "" "M" "" "Germany" "" "0" "" "" "" "9" "00381959" "" "" "" "1" "" "00000" "{PMID:Ravesh 2018:30416334}" "FamilyB" "M" "yes" "" "" "0" "" "" "" "III:I" "00382133" "" "" "" "1" "" "00000" "{PMID:Patel 2019:30653986}" "" "?" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "77" "00382266" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "95" "00382267" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "96" "00382268" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "97" "00382269" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "98" "00382270" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "99" "00382271" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "100" "00382272" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "101" "00382275" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "104" "00382530" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "392" "00382531" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "393" "00382532" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "394" "00382533" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "395" "00382534" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "396" "00382535" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "397" "00382536" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "398" "00382786" "" "" "" "1" "" "00000" "{PMID:Azam-2011:21987686}" "" "" "yes" "Pakistan" "" "0" "" "" "pakistani" "" "00383066" "" "" "" "1" "" "00000" "{PMID:Anasagasti-2013:24416769}" "" "" "" "Spain" "" "0" "" "" "" "" "00383080" "" "" "" "1" "" "00000" "{PMID:Anasagasti-2013:24416769}" "" "" "" "Spain" "" "0" "" "" "" "" "00383093" "" "" "" "1" "" "00000" "{PMID:Anasagasti-2013:24416769}" "" "" "" "Spain" "" "0" "" "" "" "" "00383423" "" "" "" "1" "" "00000" "{PMID:Khan 2019:31725702}" "" "F" "" "" "" "0" "" "" "" "" "00383424" "" "" "" "1" "" "00000" "{PMID:Khan 2019:31725702}" "" "M" "" "" "" "0" "" "" "" "" "00383425" "" "" "" "1" "" "00000" "{PMID:Khan 2019:31725702}" "" "F" "" "" "" "0" "" "" "" "" "00383426" "" "" "" "1" "" "00000" "{PMID:Khan 2019:31725702}" "" "M" "" "" "" "0" "" "" "" "" "00383427" "" "" "" "1" "" "00000" "{PMID:Khan 2019:31725702}" "" "M" "" "" "" "0" "" "" "" "" "00383428" "" "" "" "1" "" "00000" "{PMID:Khan 2019:31725702}" "" "M" "" "" "" "0" "" "" "" "" "00383743" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD0170500032" "00383744" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD0170500034" "00383749" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD17031996_A" "00383757" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18070010_A" "00383800" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18184118_B" "00383848" "" "" "" "1" "" "00000" "{PMID:Hariri 2018:31047384}" "" "?" "" "" "" "0" "" "" "" "" "00383849" "" "" "" "1" "" "00000" "{PMID:Hariri 2018:31047384}" "" "?" "" "" "" "0" "" "" "" "" "00383905" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0025" "00383940" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0745" "00383954" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0976" "00383959" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1017" "00383973" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1212" "00383979" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1311" "00383991" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1440" "00383996" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1504" "00383997" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1535" "00384001" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1558" "00384004" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1586" "00384007" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1615" "00384009" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1625" "00384017" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1689" "00384028" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1743" "00384058" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2004" "00384064" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2057" "00384079" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2153" "00384101" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2304" "00384116" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2400" "00384135" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2542" "00384136" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2549" "00384153" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2730" "00384154" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2740" "00384162" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2837" "00384164" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2853" "00384170" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2908" "00384210" "" "" "" "1" "" "00000" "{PMID:Tayebi 2019:30820146}" "" "" "" "Iran" "" "0" "" "" "" "066880" "00384214" "" "" "" "1" "" "00000" "{PMID:Tayebi 2019:30820146}" "" "" "" "Iran" "" "0" "" "" "" "066886" "00384380" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "14102" "00384410" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "14378" "00384476" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "14756" "00384740" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384754" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384755" "" "" "" "12" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384756" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00385008" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19252" "00385017" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19297" "00385030" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19454" "00385036" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19536" "00385037" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19607" "00385039" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19628" "00385049" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19840" "00385057" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "19940" "00385084" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "191008" "00385087" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "191018" "00385090" "" "" "" "1" "" "00000" "{PMID:Xu 2020:31630094}" "" "?" "no" "China" "" "0" "" "" "" "191051" "00385607" "" "" "" "1" "" "00000" "{PMID:de Castro-Miró-2014:24516651}" "" "" "" "" "" "0" "" "" "" "5ORG" "00385608" "" "" "" "2" "" "00000" "{PMID:de Castro-Miró-2014:24516651}" "" "F" "" "" "" "0" "" "" "" "23NCE" "00385609" "" "" "" "1" "" "00000" "{PMID:de Castro-Miró-2014:24516651}" "" "" "" "" "" "0" "" "" "" "94RE" "00385611" "" "" "" "2" "" "00000" "{PMID:de Castro-Miró-2014:24516651}" "" "M" "" "" "" "0" "" "" "" "10RE" "00385613" "" "" "" "2" "" "00000" "{PMID:de Castro-Miró-2014:24516651}" "" "" "" "" "" "0" "" "" "" "25NCE" "00385966" "" "" "" "1" "" "00000" "{PMID:Shanks-2013:22968130}" "novel" "" "" "" "" "0" "" "" "" "" "00385967" "" "" "" "1" "" "00000" "{PMID:Shanks-2013:22968130}" "" "" "" "" "" "0" "" "" "" "" "00386160" "" "" "" "1" "" "00000" "{PMID:RodriguezjalopezMunoz 2020:32036094}" "family fRPN-100, proband" "M" "" "Spain" "" "0" "" "" "" "RPN-234" "00386170" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-125, proband" "F" "" "Spain" "" "0" "" "" "" "RPN-282" "00386199" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "?" "" "Spain" "" "0" "" "" "" "RPN-318" "00386201" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "?" "" "Spain" "" "0" "" "" "" "RPN-320" "00386207" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-162, proband" "F" "" "Spain" "" "0" "" "" "" "RPN-327" "00386224" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-183, proband" "F" "" "Spain" "" "0" "" "" "" "RPN-402" "00386231" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-191, proband" "F" "" "Spain" "" "0" "" "" "" "RPN-426" "00386283" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-84, proband" "M" "" "Spain" "" "0" "" "" "" "RPN-214" "00386569" "" "" "" "1" "" "00000" "{PMID:Zampaglione-2020:32037395}" "" "?" "" "" "" "0" "" "" "" "003-007" "00386721" "" "" "" "1" "" "00000" "{PMID:Zampaglione-2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2856_004441" "00386783" "" "" "" "1" "" "00000" "{PMID:Zampaglione-2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2936_004521" "00386844" "" "" "" "1" "" "00000" "{PMID:Zampaglione-2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI679_001362" "00386857" "" "" "" "1" "" "00000" "{PMID:Zampaglione-2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI765_001498" "00387646" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "34" "00387647" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "35" "00387648" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "36" "00387649" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "37" "00387650" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "38" "00387651" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "39" "00387652" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "40" "00387653" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "41" "00387654" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "42" "00387655" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "43" "00387656" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "44" "00388153" "" "" "" "1" "" "00000" "{PMID:Surl 2020:32165824}" "" "M" "" "Korea" "" "0" "" "" "" "10" "00388196" "" "" "" "1" "" "00006" "{PMID:Lingao 2016:26894784}" "" "" "" "" "" "0" "" "" "" "Pat6" "00388197" "" "" "" "1" "" "00006" "{PMID:Lingao 2016:26894784}" "" "" "" "" "" "0" "" "" "" "Pat7" "00388479" "" "" "" "1" "" "00000" "{PMID:Ellingsford 2018:29074561}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "14015843" "00388940" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 79, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "224" "00388941" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 79, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "225" "00388990" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 92, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "274" "00388991" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 92, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "275" "00388992" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 92, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "276" "00389006" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 95, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "290" "00389024" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 103, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "308" "00389045" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 109, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "329" "00389048" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 110, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "332" "00389049" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 110, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "333" "00389060" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 115, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "344" "00389065" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 118, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "349" "00389066" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 118, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "350" "00389083" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 123, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "367" "00389135" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 135, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "419" "00389138" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 136, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "422" "00389139" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 136, Leber congenital amaurosis, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "423" "00389199" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 159, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "483" "00389291" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 208, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "575" "00389345" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 224, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "629" "00389575" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 355, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "859" "00389643" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 397, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "927" "00389654" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 411, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "938" "00389695" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 443, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "979" "00389708" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 456, cone-rod dystrophy, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "992" "00389828" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 758, cone-rod dystrophy, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1112" "00389945" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 974, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1229" "00389951" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 991, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1235" "00389986" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 1085, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1270" "00390030" "" "" "" "1" "" "00000" "{PMID:Liu 2020:32562694}" "" "?" "" "China" "" "0" "" "" "" "G1514" "00390240" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G001018" "00390241" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G001021" "00390242" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G001055" "00390243" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G005006" "00390244" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G005227" "00390245" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G008148" "00390748" "" "" "" "1" "" "00000" "{PMID:Habibi 2020:32641690}" "Family F5, patient II.1" "F" "" "Tunisia" "" "0" "" "" "" "F5_II.1" "00390749" "" "" "" "1" "" "00000" "{PMID:Habibi 2020:32641690}" "Family F6, patient II.1" "M" "" "Tunisia" "" "0" "" "" "" "F6_II.1" "00390750" "" "" "" "1" "" "00000" "{PMID:Habibi 2020:32641690}" "Family F7, patient II.1" "M" "" "Tunisia" "" "0" "" "" "" "F7_II.1" "00390752" "" "" "" "1" "" "00000" "{PMID:Habibi 2020:32641690}" "Family F8, patient III.3" "F" "" "Tunisia" "" "0" "" "" "" "F8_III.1" "00390793" "" "" "" "1" "" "00000" "{PMID:Booij-2011:20801516}" "" "" "" "" "" "0" "" "" "" "" "00390841" "" "" "" "1" "" "00000" "{PMID:Maggi_2021:33546218}" "" "F" "" "Switzerland" "" "0" "" "" "" "" "00390879" "" "" "" "1" "" "00000" "{PMID:Maggi_2021:33546218}" "" "F" "" "Switzerland" "" "0" "" "" "" "" "00390881" "" "" "" "1" "" "00000" "{PMID:Maggi_2021:33546218}" "" "F" "" "Switzerland" "" "0" "" "" "" "" "00390893" "" "" "" "1" "" "00000" "{PMID:Maggi_2021:33546218}" "" "M" "" "Switzerland" "" "0" "" "" "" "" "00391155" "" "" "" "1" "" "00000" "{PMID:Gliem 2020:32646556}" "" "F" "" "(Germany)" "" "0" "" "" "" "117" "00391354" "" "" "" "1" "" "00000" "{PMID:Méjécase 2020:3278337" "" "?" "" "United Arab Emirates" "" "0" "" "" "" "10" "00391517" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "?" "" "New Zealand" "" "0" "" "" "Pacific" "13" "00391518" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "?" "" "New Zealand" "" "0" "" "" "Pacific" "14" "00391519" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "?" "" "New Zealand" "" "0" "" "" "white" "15" "00391520" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "?" "" "New Zealand" "" "0" "" "" "Asian" "16" "00391521" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "?" "" "New Zealand" "" "0" "" "" "white" "17" "00391522" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "?" "" "New Zealand" "" "0" "" "" "Middle Eastern" "18" "00391523" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "?" "" "New Zealand" "" "0" "" "" "white" "19" "00391524" "" "" "" "1" "" "00000" "{PMID:Hull 2020:32856788}" "" "?" "" "New Zealand" "" "0" "" "" "Indian" "20" "00391627" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "26" "00391628" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "27" "00391629" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "28" "00391630" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "28" "00391631" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "29" "00391632" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "30" "00391633" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "31" "00391634" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "32" "00391635" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "33" "00391636" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "34" "00391637" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "35" "00391638" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "36" "00391639" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "37" "00391721" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "108" "00391722" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "109" "00391723" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "110" "00391724" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "111" "00391725" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "112" "00391726" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "113" "00391727" "" "" "" "1" "" "00000" "{PMID:Sallum 2020:32865313}" "" "?" "" "Brazil" "" "0" "" "" "" "114" "00391865" "" "" "" "1" "" "00000" "{PMID:Repo 2021:32901921}" "" "F" "no" "Finland" "" "0" "" "" "Southeast Asian" "1" "00393338" "" "" "" "1" "" "00000" "{PMID:Ng 2021:33846575}" "" "M" "?" "China" "" "0" "" "" "" "RP-005" "00393339" "" "" "" "1" "" "00000" "{PMID:Ng 2021:33846575}" "" "F" "?" "China" "" "0" "" "" "" "RP-076" "00393340" "" "" "" "1" "" "00000" "{PMID:Ng 2021:33846575}" "" "M" "?" "China" "" "0" "" "" "" "RP-090" "00393341" "" "" "" "1" "" "00000" "{PMID:Ng 2021:33846575}" "" "F" "?" "China" "" "0" "" "" "" "RP-109" "00393443" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393479" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393567" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393593" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393715" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393738" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393754" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393759" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393764" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393778" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393849" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393865" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393889" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393890" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393919" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00394560" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394561" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394562" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394563" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394564" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394565" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394566" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394567" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "yes" "" "" "0" "" "" "" "" "00394568" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "yes" "" "" "0" "" "" "" "" "00394569" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "yes" "" "" "0" "" "" "" "" "00395426" "" "" "" "1" "" "00000" "{PMID:Shen 2021:34130719}" "" "M" "yes" "China" "" "0" "" "" "" "F7‑III" "00395774" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F161" "00395794" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F153" "00395797" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F032" "00395874" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F197" "00396221" "" "" "" "1" "" "00000" "{PMID:SkorczykWerner 2020:33308271}" "" "F" "" "" "" "0" "" "" "Polish" "" "00396224" "" "" "" "1" "" "00000" "{PMID:SkorczykWerner 2020:33308271}" "" "F" "" "" "" "0" "" "" "Polish" "" "00396636" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00405985" "" "" "" "1" "" "00000" "{PMID:Yzer-2005:16505055}" "" "" "" "" "" "0" "" "" "" "4" "00405986" "" "" "" "1" "" "00000" "{PMID:Yzer-2005:16505055}" "" "" "" "" "" "0" "" "" "" "5" "00405987" "" "" "" "1" "" "00000" "{PMID:Yzer-2005:16505055}" "" "" "" "" "" "0" "" "" "" "6" "00405988" "" "" "" "1" "" "00000" "{PMID:Yzer-2005:16505055}" "" "" "" "" "" "0" "" "" "" "7" "00405989" "" "" "" "1" "" "00000" "{PMID:Yzer-2005:16505055}" "" "" "" "" "" "0" "" "" "" "8" "00405990" "" "" "" "1" "" "00000" "{PMID:Yzer-2005:16505055}" "" "" "" "" "" "0" "" "" "" "9" "00405991" "" "" "" "1" "" "00000" "{PMID:Yzer-2005:16505055}" "" "" "" "" "" "0" "" "" "" "10" "00405992" "" "" "" "1" "" "00000" "{PMID:Yzer-2005:16505055}" "" "" "" "" "" "0" "" "" "" "11" "00405993" "" "" "" "1" "" "00000" "{PMID:Yzer-2005:16505055}" "no second allele found" "" "" "" "" "0" "" "" "" "12" "00406003" "" "" "" "1" "" "00000" "{PMID:Wolfson-2015:26312378}" "" "" "" "(United States)" "" "0" "" "" "" "Twin 1" "00406004" "" "" "" "1" "" "00000" "{PMID:Wolfson-2015:26312378}" "" "" "" "(United States)" "" "0" "" "" "" "Twin 2" "00406005" "" "" "" "1" "" "00000" "{PMID:Yang-2016:27670293}" "Father" "M" "yes" "China" "" "0" "" "" "Chinese" "RP-2236: III1" "00406006" "" "" "" "1" "" "00000" "{PMID:Yang-2016:27670293}" "Mother" "F" "yes" "China" "" "0" "" "" "Chinese" "RP-2236: III2" "00406007" "" "" "" "1" "" "00000" "{PMID:Yang-2016:27670293}" "Mother" "M" "yes" "China" "" "0" "" "" "Chinese" "RP-2236: III3" "00406008" "" "" "" "1" "" "00000" "{PMID:Yang-2016:27670293}" "Father" "F" "yes" "China" "" "0" "" "" "Chinese" "RP-2236: III4" "00406009" "" "" "" "1" "" "00000" "{PMID:Yang-2016:27670293}" "Daughter" "F" "yes" "China" "" "0" "" "" "Chinese" "RP-2236: IV:1" "00406010" "" "" "" "1" "" "00000" "{PMID:Yang-2016:27670293}" "Daughter" "F" "yes" "China" "" "0" "" "" "Chinese" "RP-2236: IV:2" "00406011" "" "" "" "1" "" "00000" "{PMID:Yang-2016:27670293}" "Son" "M" "yes" "China" "" "0" "" "" "Chinese" "RP-2236: IV:3" "00406012" "" "" "" "1" "" "00000" "{PMID:Yang-2016:27670293}" "Daughter" "F" "yes" "China" "" "0" "" "" "Chinese" "RP-2236: IV:4" "00406013" "" "" "" "1" "" "00000" "{PMID:Yang-2016:27670293}" "den Hollander AI" "M" "" "India" "" "0" "" "" "Indian" "RP-IC-90: I:1" "00406014" "" "" "" "1" "" "00000" "{PMID:Yang-2016:27670293}" "den Hollander AI" "F" "" "India" "" "0" "" "" "Indian" "RP-IC-90: I:2" "00406015" "" "" "" "1" "" "00000" "{PMID:Yang-2016:27670293}" "den Hollander AI" "M" "" "India" "" "0" "" "" "Indian" "RP-IC-90: II:1" "00406016" "" "" "" "1" "" "00000" "{PMID:Yang-2016:27670293}" "" "" "" "" "" "0" "" "" "" "SP: I-44" "00406017" "" "" "" "1" "" "00000" "{PMID:Yang-2016:27670293}" "" "" "" "" "" "0" "" "" "" "SP: I-7" "00406018" "" "" "" "1" "" "00000" "{PMID:Hasan-2016:26872607}" "" "F" "yes" "Syria" "" "0" "" "" "Syrian" "" "00406019" "" "" "" "1" "" "00000" "{PMID:Hasan-2016:26872607}" "" "M" "yes" "Syria" "" "0" "" "" "Syrian" "" "00406020" "" "" "" "1" "" "00000" "{PMID:Hasan-2016:26872607}" "" "M" "yes" "Syria" "" "0" "" "" "Syrian" "" "00406021" "" "" "" "1" "" "00000" "{PMID:Lu-2016:27806333}" "" "M" "" "China" "" "0" "" "" "Chinese" "II:1" "00406022" "" "" "" "1" "" "00000" "{PMID:Lu-2016:27806333}" "" "M" "" "China" "" "0" "" "" "Chinese" "II:2" "00406023" "" "" "" "1" "" "00000" "{PMID:Lu-2016:27806333}" "" "F" "" "China" "" "0" "" "" "Chinese" "II:3" "00406024" "" "" "" "1" "" "00000" "{PMID:Ghofrani-2017:28460491}" "" "F" "yes" "Iran" "" "0" "" "" "Iranian" "W13-0007: IV-3" "00406025" "" "" "" "1" "" "00000" "{PMID:Ghofrani-2017:28460491}" "" "F" "yes" "Iran" "" "0" "" "" "Iranian" "W13-0007: IV-4" "00406026" "" "" "" "1" "" "00000" "{PMID:Ghofrani-2017:28460491}" "" "F" "yes" "Iran" "" "0" "" "" "Iranian" "W13-1504: V-3" "00406027" "" "" "" "1" "" "00000" "{PMID:Ghofrani-2017:28460491}" "" "F" "yes" "Iran" "" "0" "" "" "Iranian" "W13-1504: V-6" "00406028" "" "" "" "1" "" "00000" "{PMID:Ghofrani-2017:28460491}" "" "M" "" "Iran" "" "0" "" "" "Iranian" "W13-1493: IV-3" "00406029" "" "" "" "1" "" "00000" "{PMID:Ghofrani-2017:28460491}" "" "M" "" "Iran" "" "0" "" "" "Iranian" "W13-1493: IV-7" "00406030" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "1" "00406031" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "2" "00406032" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "3" "00406033" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "4" "00406034" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "5" "00406035" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "6" "00406036" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "7" "00406037" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "8" "00406038" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "9" "00406039" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "10" "00406040" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "11" "00406041" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "12" "00406042" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "13" "00406043" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "14" "00406044" "" "" "" "1" "" "00000" "{PMID:Motta-2017:28819299}" "" "" "" "Brazil" "" "0" "" "" "Brazilian" "15" "00406045" "" "" "" "1" "" "00000" "{PMID:Khan-2018:29391521}" "" "F" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "European" "Leeds-1" "00406046" "" "" "" "1" "" "00000" "{PMID:Khan-2018:29391521}" "" "M" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "European" "MEH1-gc20630" "00406047" "" "" "" "1" "" "00000" "{PMID:Khan-2018:29391521}" "" "M" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "European" "MEH2-gc17649" "00406048" "" "" "" "1" "" "00000" "{PMID:Khan-2018:29391521}" "" "M" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "European" "MEH3-gc17311" "00406049" "" "" "" "1" "" "00000" "{PMID:Khan-2018:29391521}" "" "F" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "European" "MEH4-gc22882" "00406050" "" "" "" "1" "" "00000" "{PMID:Khan-2018:29391521}" "" "M" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "European" "MEH5" "00406051" "" "" "" "1" "" "00000" "{PMID:Khan-2018:29391521}" "" "F" "no" "(United Kingdom (Great Britain))" "" "0" "" "" "European" "BDC6" "00406052" "" "" "" "1" "" "00000" "{PMID:Stingl-2019:31879567}" "" "M" "" "" "" "0" "" "" "" "CRB1-01" "00406053" "" "" "" "1" "" "00000" "{PMID:Stingl-2019:31879567}" "" "F" "" "" "" "0" "" "" "" "CRB1-02" "00406054" "" "" "" "1" "" "00000" "{PMID:Stingl-2019:31879567}" "" "F" "" "" "" "0" "" "" "" "CRB1-04" "00406055" "" "" "" "1" "" "00000" "{PMID:Stingl-2019:31879567}" "" "F" "" "" "" "0" "" "" "" "CRB1-05" "00406056" "" "" "" "1" "" "00000" "{PMID:Stingl-2019:31879567}" "" "F" "" "" "" "0" "" "" "" "CRB1-09" "00406057" "" "" "" "1" "" "00000" "{PMID:Stingl-2019:31879567}" "" "F" "" "" "" "0" "" "" "" "CRB1-10" "00406058" "" "" "" "1" "" "00000" "{PMID:Stingl-2019:31879567}" "" "M" "" "" "" "0" "" "" "" "CRB1-12" "00406059" "" "" "" "1" "" "00000" "{PMID:Stingl-2019:31879567}" "" "M" "" "" "" "0" "" "" "" "CRB1-13" "00406060" "" "" "" "1" "" "00000" "{PMID:Stingl-2019:31879567}" "" "M" "" "" "" "0" "" "" "" "CRB1-15" "00406061" "" "" "" "1" "" "00000" "{PMID:Stingl-2019:31879567}" "" "M" "" "" "" "0" "" "" "" "CRB1-16" "00406062" "" "" "" "1" "" "00000" "{PMID:Saberi-2018:31103025}" "" "M" "" "" "" "0" "" "" "" "LC3288" "00406063" "" "" "" "1" "" "00000" "{PMID:Saberi-2018:31103025}" "" "M" "" "" "" "0" "" "" "" "LC1815" "00406064" "" "" "" "1" "" "00000" "{PMID:Saberi-2018:31103025}" "" "M" "" "" "" "0" "" "" "" "LC2708" "00406065" "" "" "" "1" "" "00000" "{PMID:Khan-2019:31875109}" "" "F" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "P1" "00406066" "" "" "" "1" "" "00000" "{PMID:Khan-2019:31875109}" "" "F" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "P2" "00406067" "" "" "" "1" "" "00000" "{PMID:Ghiam-2020:32322752}" "" "F" "" "" "" "0" "" "" "Caucasian" "P1" "00406068" "" "" "" "1" "" "00000" "{PMID:Liu-2020:32351147}" "" "M" "" "" "" "0" "" "" "Chinese" "P1" "00406069" "" "" "" "2" "" "00000" "{PMID:Zhang-2020:32931148}" "" "F;M" "" "" "" "0" "" "" "" "II:2, II:3" "00406390" "" "" "" "1" "" "00000" "{PMID:Wiszniewski 2011:21153841}" "family Ar-785" "?" "" "United States" "" "0" "" "" "" "?" "00406402" "" "" "" "1" "" "00000" "{PMID:Wiszniewski 2011:21153841}" "family Ar-170" "?" "" "United States" "" "0" "" "" "" "?" "00406403" "" "" "" "1" "" "00000" "{PMID:Wiszniewski 2011:21153841}" "family Ar-597" "?" "" "United States" "" "0" "" "" "" "?" "00406404" "" "" "" "1" "" "00000" "{PMID:Wiszniewski 2011:21153841}" "family Ar-611" "?" "" "United States" "" "0" "" "" "" "?" "00406405" "" "" "" "1" "" "00000" "{PMID:Wiszniewski 2011:21153841}" "family Ar-115" "?" "" "United States" "" "0" "" "" "" "?" "00408061" "" "" "" "1" "" "00000" "{PMID:Chebil 2016:26868535}" "1 patient, 1 family" "?" "" "France" "" "0" "" "" "Tunisia" "Family ?" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 1310 "{{individualid}}" "{{diseaseid}}" "00033038" "00058" "00033039" "04210" "00033040" "00058" "00033041" "04211" "00033042" "04211" "00033043" "04210" "00033044" "04210" "00033045" "00058" "00033046" "00058" "00033047" "00058" "00033048" "00058" "00033049" "00058" "00033050" "00058" "00033051" "00058" "00033052" "00058" "00033053" "04210" "00033054" "04210" "00033055" "00058" "00033056" "04210" "00033057" "00058" "00033058" "04210" "00033059" "04210" "00033060" "04210" "00033061" "04210" "00033062" "04210" "00033063" "00058" "00033064" "04210" "00033065" "04210" "00033066" "04210" "00033067" "04211" "00033068" "04210" "00033069" "04211" "00033070" "04211" "00033071" "04211" "00033072" "00058" "00033073" "00058" "00033074" "00058" "00033075" "00058" "00033076" "04210" "00033077" "04211" "00033078" "00058" "00033091" "04214" "00033092" "04214" "00033093" "04214" "00033106" "04214" "00033144" "04214" "00033146" "04214" "00033158" "04214" "00033170" "04214" "00033344" "04214" "00033348" "04214" "00033693" "04210" "00037774" "04214" "00037775" "04214" "00037776" "04214" "00037777" "04214" "00037778" "04214" "00037779" "04214" "00037780" "04214" "00037781" "04214" "00037782" "04214" "00037783" "04214" "00037784" "04214" "00037785" "04214" "00037786" "04214" "00037787" "04214" "00037788" "04214" "00037789" "04214" "00037790" "04210" "00037791" "04210" "00037792" "04210" "00037793" "04210" "00037794" "04210" "00037795" "04210" "00037796" "04210" "00037797" "04210" "00037798" "04210" "00037799" "04210" "00037800" "04210" "00037801" "04210" "00037802" "04210" "00037803" "04210" "00037804" "04210" "00037805" "04210" "00037806" "04210" "00037807" "04210" "00037808" "04210" "00037809" "04210" "00037810" "04210" "00037811" "04210" "00037812" "04210" "00037813" "04210" "00037814" "04210" "00037815" "04210" "00037816" "04210" "00037817" "04210" "00037818" "04210" "00037819" "04210" "00037820" "04210" "00037821" "04210" "00037822" "04214" "00037823" "04214" "00037824" "04214" "00037825" "04214" "00037826" "04214" "00037827" "04214" "00037828" "04214" "00037829" "04214" "00037830" "04214" "00037831" "04214" "00037832" "04214" "00037833" "04214" "00037834" "04214" "00037835" "04214" "00037836" "04214" "00037837" "04214" "00037838" "04214" "00037839" "04214" "00037840" "04214" "00037841" "04214" "00037842" "04214" "00037843" "04214" "00037844" "04214" "00037845" "04214" "00037846" "04210" "00037847" "04210" "00037848" "04210" "00037849" "04210" "00037850" "04210" "00037851" "04210" "00037852" "04210" "00037853" "04210" "00037854" "04214" "00037855" "04214" "00037856" "04214" "00037857" "04214" "00037858" "04214" "00037859" "04214" "00037860" "04214" "00037861" "04214" "00037862" "04214" "00037863" "04214" "00037864" "04214" "00037865" "04214" "00037866" "04210" "00037867" "04210" "00037868" "04210" "00037869" "04210" "00037870" "04210" "00037871" "04210" "00037872" "04210" "00037873" "04210" "00037874" "04210" "00037875" "04210" "00037876" "04210" "00037877" "04210" "00037878" "04210" "00037879" "04210" "00037880" "04210" "00037881" "04210" "00037882" "04214" "00037883" "04214" "00037884" "04214" "00037885" "04214" "00037886" "04214" "00037887" "04214" "00037888" "04214" "00037889" "04214" "00037890" "04214" "00037891" "04214" "00037892" "04210" "00037893" "04210" "00037894" "04210" "00037895" "04210" "00037896" "04210" "00037897" "04210" "00037898" "04210" "00037899" "04210" "00037900" "04210" "00037901" "04210" "00037902" "04210" "00037903" "04210" "00037904" "04210" "00037905" "04210" "00037906" "04210" "00037907" "04210" "00037908" "04210" "00037909" "04210" "00037910" "04210" "00037911" "04210" "00037912" "02286" "00037913" "02286" "00037914" "02286" "00037915" "02286" "00037916" "02286" "00037917" "02286" "00037918" "02286" "00037919" "02286" "00037920" "02286" "00037921" "02286" "00037922" "04214" "00037923" "04214" "00037924" "01507" "00037925" "01507" "00037926" "01507" "00037927" "01507" "00037928" "01507" "00037929" "04210" "00037930" "04210" "00037931" "04210" "00037932" "04210" "00037933" "04210" "00037934" "04210" "00037935" "04210" "00037936" "04210" "00037937" "04214" "00037938" "04210" "00037939" "04214" "00037940" "04214" "00037941" "02286" "00037942" "04210" "00037943" "04210" "00037944" "04210" "00037945" "04210" "00037946" "04210" "00037947" "04210" "00037948" "04210" "00037949" "04210" "00037950" "04210" "00037951" "04210" "00037952" "04210" "00037953" "04210" "00037954" "04210" "00037955" "04210" "00037956" "04210" "00037957" "04210" "00037958" "04210" "00037959" "04210" "00037960" "04210" "00037961" "04210" "00037962" "04210" "00037963" "04210" "00037964" "04210" "00037965" "04210" "00037966" "04210" "00037967" "04210" "00037968" "04210" "00037969" "04210" "00037970" "04210" "00037971" "04210" "00037972" "04210" "00037973" "04210" "00037974" "04210" "00037975" "04210" "00037976" "04210" "00037977" "04210" "00037978" "04210" "00037979" "04210" "00037980" "04210" "00037981" "04210" "00037982" "04210" "00037983" "04210" "00037984" "04210" "00037985" "04210" "00037986" "04210" "00037987" "04210" "00037988" "04210" "00037989" "04210" "00037990" "04210" "00037991" "04210" "00037992" "04210" "00037993" "04210" "00037994" "04210" "00037995" "04210" "00037996" "04210" "00037997" "04210" "00037998" "04210" "00037999" "04210" "00038000" "04210" "00038001" "04210" "00038002" "04210" "00038003" "04210" "00038004" "04210" "00038005" "04210" "00038006" "04210" "00038007" "04210" "00038008" "04210" "00038009" "04210" "00038010" "04210" "00038011" "04210" "00038012" "04210" "00038013" "04210" "00038014" "04210" "00038015" "04210" "00038016" "04210" "00038017" "04210" "00038018" "04210" "00038019" "04210" "00038020" "04210" "00038021" "04210" "00038022" "04210" "00038023" "04210" "00038024" "04210" "00038025" "04210" "00038026" "04210" "00038027" "04210" "00038028" "04210" "00038029" "04210" "00038030" "04210" "00038031" "04210" "00038032" "04210" "00038033" "04210" "00038034" "04210" "00038035" "04210" "00038036" "04210" "00038037" "04210" "00038038" "04210" "00038039" "04210" "00038040" "04210" "00038041" "04210" "00038042" "04210" "00038043" "04210" "00038044" "04210" "00038045" "04210" "00038046" "04210" "00038047" "04210" "00038048" "04210" "00038049" "04210" "00038050" "04210" "00038051" "04210" "00038052" "04210" "00038053" "04210" "00038054" "04210" "00038055" "04210" "00038056" "04210" "00038057" "04210" "00038058" "04210" "00038059" "04210" "00038060" "04210" "00038061" "04210" "00038062" "04210" "00038063" "04210" "00038064" "04210" "00038065" "04214" "00038066" "04214" "00038067" "04214" "00038068" "04214" "00038069" "04214" "00038070" "04214" "00038071" "04214" "00038072" "04214" "00038073" "04214" "00038074" "04214" "00038075" "04214" "00038076" "04214" "00038077" "04214" "00038078" "04214" "00038079" "04214" "00038080" "04214" "00038081" "04214" "00038082" "04210" "00038083" "04210" "00038084" "04210" "00038085" "04210" "00038086" "04210" "00038087" "04210" "00038088" "04210" "00038089" "04210" "00038090" "04210" "00038091" "04210" "00038092" "04210" "00038093" "04210" "00038094" "04210" "00038097" "04210" "00038098" "04210" "00038099" "04210" "00038100" "04250" "00038101" "04250" "00038102" "04250" "00038103" "04250" "00038104" "00381" "00038105" "00381" "00038106" "04214" "00038107" "04214" "00038108" "04214" "00038109" "04214" "00038110" "04214" "00038111" "04210" "00038112" "04210" "00038113" "04214" "00038114" "04214" "00038115" "04214" "00038116" "04214" "00038117" "04214" "00038118" "04214" "00038119" "04214" "00038120" "04210" "00038121" "04210" "00038122" "04210" "00038123" "04210" "00038124" "04210" "00038125" "04210" "00038126" "04210" "00038127" "04210" "00038128" "04210" "00038129" "04210" "00038130" "04210" "00038131" "04210" "00038132" "04210" "00038133" "04210" "00038134" "04210" "00038135" "04210" "00038136" "04210" "00038137" "00381" "00038138" "00381" "00038139" "00381" "00038140" "00381" "00038141" "00381" "00038142" "00381" "00038143" "04214" "00038144" "04214" "00038145" "04214" "00038146" "04214" "00038147" "04214" "00038148" "04214" "00038149" "04214" "00038150" "04214" "00038151" "04210" "00038152" "04210" "00038153" "04210" "00038154" "04210" "00038155" "04210" "00038156" "04210" "00038157" "04210" "00038158" "04210" "00038159" "04210" "00038160" "04210" "00038161" "04250" "00038162" "04250" "00038163" "04250" "00038164" "04250" "00038165" "04250" "00038166" "04250" "00038167" "04250" "00038168" "04250" "00038169" "04250" "00038170" "04250" "00038171" "04250" "00038172" "04250" "00038173" "04250" "00038174" "04250" "00038175" "04250" "00038176" "04250" "00038177" "04250" "00038178" "04250" "00038179" "04250" "00038180" "04250" "00038181" "04214" "00038182" "04214" "00038183" "04214" "00038184" "04214" "00038185" "04214" "00038186" "04214" "00038187" "04214" "00038188" "04214" "00038189" "04214" "00038190" "04214" "00038191" "04214" "00038192" "04214" "00038193" "04214" "00038194" "04214" "00038195" "04214" "00038196" "04214" "00038197" "04210" "00038198" "04210" "00038199" "04210" "00038200" "04210" "00038201" "04215" "00038202" "04214" "00038203" "04214" "00038204" "00381" "00038205" "04214" "00038206" "04214" "00038207" "04210" "00038208" "04210" "00038209" "00381" "00038210" "00381" "00038211" "00381" "00038212" "04210" "00038213" "04210" "00038214" "00381" "00038215" "00381" "00038216" "00381" "00038217" "00381" "00038218" "00381" "00038219" "00381" "00038220" "00381" "00038221" "00381" "00038222" "00381" "00038223" "00381" "00038224" "00381" "00038225" "04210" "00038226" "04210" "00038227" "04210" "00038228" "00381" "00038229" "00381" "00038230" "00381" "00038231" "00381" "00038232" "00381" "00038233" "00381" "00038234" "04210" "00038235" "00381" "00038236" "00381" "00038237" "00381" "00038238" "04210" "00038239" "04210" "00038240" "00381" "00038241" "04210" "00038242" "04210" "00038243" "04210" "00038244" "04210" "00038245" "00381" "00038246" "00381" "00038247" "00381" "00038248" "04210" "00038249" "00381" "00038250" "04210" "00038251" "00381" "00038252" "04210" "00038253" "00381" "00038254" "00381" "00038255" "00381" "00038256" "00381" "00038257" "00381" "00038258" "04210" "00038259" "04210" "00038260" "04210" "00038261" "04210" "00038262" "04210" "00038263" "04210" "00038264" "04210" "00038265" "04214" "00038266" "04214" "00038267" "04214" "00038268" "04210" "00038269" "04210" "00038270" "04214" "00038271" "04214" "00038272" "04214" "00038273" "04214" "00038274" "04214" "00038275" "04214" "00038276" "04214" "00038277" "04210" "00038278" "04210" "00038279" "04210" "00038280" "04210" "00038281" "04210" "00038282" "04210" "00038283" "04214" "00038284" "04210" "00038285" "04210" "00038286" "00058" "00038287" "00058" "00038288" "00058" "00038289" "04210" "00038290" "04210" "00038291" "04210" "00038292" "04210" "00038298" "00381" "00038299" "00381" "00038300" "00381" "00038301" "00381" "00038302" "00381" "00038303" "00381" "00038304" "00381" "00038305" "04214" "00038306" "04214" "00038307" "00381" "00038308" "00381" "00038309" "00381" "00038310" "00381" "00038311" "00381" "00038312" "00381" "00038313" "04249" "00038314" "04249" "00038315" "04210" "00038316" "04210" "00038317" "04210" "00038318" "04250" "00038319" "00381" "00038320" "04214" "00038321" "04214" "00038322" "04214" "00038323" "04210" "00038324" "04210" "00038325" "04214" "00038326" "04210" "00038327" "04214" "00038328" "04214" "00038329" "04214" "00038330" "04210" "00038331" "04211" "00038332" "04211" "00038333" "04211" "00038334" "04211" "00038335" "04211" "00038336" "04214" "00038337" "04214" "00038338" "04214" "00038339" "04210" "00038340" "04214" "00038341" "04214" "00038342" "04214" "00038343" "04214" "00038344" "04214" "00038345" "04214" "00038346" "04214" "00038347" "00058" "00038348" "04214" "00038349" "04214" "00038350" "04214" "00038351" "04214" "00038352" "04214" "00038353" "04214" "00038354" "04214" "00038355" "04214" "00038356" "04214" "00038357" "04214" "00038358" "04214" "00038359" "04210" "00038360" "04210" "00038361" "04210" "00038362" "04210" "00038363" "04210" "00038364" "04210" "00038365" "04214" "00038366" "04214" "00038367" "04210" "00038368" "04210" "00038369" "04210" "00038370" "04214" "00038371" "04214" "00052643" "04210" "00076473" "00420" "00076474" "04214" "00100102" "00381" "00105014" "04214" "00105022" "04214" "00105030" "04214" "00105031" "04210" "00105032" "04214" "00105033" "04214" "00105034" "04214" "00105049" "04210" "00155449" "04210" "00155450" "04210" "00155451" "04214" "00155452" "04210" "00155453" "04210" "00155454" "04214" "00155455" "04210" "00155456" "04214" "00155457" "04210" "00155458" "04210" "00207678" "04214" "00207681" "04210" "00207687" "04210" "00207694" "04214" "00231992" "04214" "00231993" "04214" "00231994" "04214" "00231995" "04214" "00231996" "04214" "00231997" "04214" "00231998" "04214" "00231999" "04214" "00232000" "04214" "00232001" "04214" "00232002" "04214" "00232003" "04214" "00232004" "04214" "00232005" "04214" "00232006" "04214" "00232007" "04214" "00232008" "04214" "00232009" "04214" "00232010" "04214" "00232011" "04214" "00232012" "04214" "00232013" "04214" "00232014" "04214" "00232015" "04214" "00232016" "04214" "00232017" "04214" "00232018" "04214" "00232019" "04214" "00232020" "04214" "00233603" "04214" "00240433" "00381" "00240434" "00381" "00240435" "00381" "00269471" "04210" "00289642" "00198" "00289643" "00198" "00289644" "00198" "00295237" "00198" "00295601" "00198" "00308414" "04214" "00308501" "04214" "00308502" "04214" "00308503" "04214" "00308504" "04214" "00308505" "04214" "00308609" "04214" "00308610" "04214" "00309109" "04214" "00309110" "04214" "00309111" "04214" "00309112" "04214" "00309115" "04214" "00309116" "04214" "00309117" "04214" "00309118" "04214" "00309119" "04214" "00309120" "04214" "00309121" "04214" "00309122" "04214" "00309123" "04214" "00309124" "04214" "00309125" "04214" "00309126" "04214" "00309127" "04214" "00320010" "04214" "00320011" "04214" "00320012" "04214" "00325414" "04214" "00325428" "04214" "00325441" "04214" "00325449" "04214" "00325454" "04214" "00325472" "04214" "00325506" "04214" "00325510" "04214" "00325521" "04214" "00326693" "04214" "00327932" "04214" "00327945" "04214" "00327946" "04214" "00327952" "04214" "00327956" "04214" "00327985" "04214" "00327986" "04214" "00328016" "04214" "00328085" "04214" "00328109" "04214" "00328188" "04214" "00328232" "04214" "00328489" "04214" "00328497" "04214" "00328498" "04214" "00331980" "04214" "00332193" "04214" "00332194" "04214" "00332195" "04214" "00332267" "04214" "00332268" "04214" "00332276" "04214" "00332366" "04214" "00332367" "04214" "00332392" "04214" "00332456" "04214" "00332466" "04214" "00332468" "04214" "00333352" "04214" "00333357" "04214" "00333359" "04214" "00333363" "04214" "00333398" "04214" "00333465" "04214" "00333817" "04214" "00333818" "04214" "00333819" "04214" "00333820" "04214" "00333821" "04214" "00333822" "04214" "00333899" "04214" "00333923" "04214" "00333924" "04214" "00333938" "04214" "00333946" "04214" "00333947" "04214" "00333948" "04214" "00333969" "04214" "00333970" "04214" "00333971" "04214" "00334112" "04214" "00334113" "04214" "00334260" "04214" "00334278" "04214" "00334414" "04214" "00334561" "04214" "00334562" "04214" "00335108" "00198" "00335109" "00198" "00335240" "04214" "00335241" "04214" "00335268" "04214" "00335269" "04214" "00335270" "04214" "00335271" "04214" "00335272" "04214" "00335273" "04214" "00335394" "04214" "00335411" "04214" "00335486" "04214" "00335487" "04214" "00335488" "04214" "00335603" "04214" "00335604" "04214" "00335608" "04214" "00335609" "04214" "00335610" "04214" "00335971" "04214" "00358904" "04214" "00358905" "04214" "00358958" "04214" "00358966" "04214" "00358969" "04214" "00358970" "04214" "00358980" "04214" "00359030" "04214" "00359032" "04214" "00359056" "04214" "00359064" "04214" "00359065" "04214" "00359067" "04214" "00359074" "04214" "00359082" "04214" "00359083" "04214" "00359090" "04214" "00359097" "04214" "00359099" "04214" "00359111" "04214" "00359130" "04214" "00359135" "04214" "00359146" "04214" "00359174" "04214" "00359193" "04214" "00359196" "04214" "00359199" "04214" "00359219" "04214" "00359367" "04214" "00359370" "04214" "00362166" "04214" "00362905" "04214" "00363442" "04214" "00363443" "04214" "00363444" "04214" "00363454" "04214" "00363455" "04214" "00363523" "04214" "00363524" "04214" "00363583" "04214" "00363610" "04214" "00363628" "04214" "00363650" "04214" "00363693" "04214" "00363728" "04214" "00363752" "04214" "00368954" "04214" "00372059" "04214" "00372060" "04214" "00372061" "04214" "00372068" "04214" "00372409" "04214" "00372410" "04214" "00372411" "04214" "00372426" "04214" "00372427" "04214" "00372428" "04214" "00372429" "04214" "00372430" "04214" "00372431" "04214" "00372432" "04214" "00372433" "04214" "00372459" "04214" "00372462" "04214" "00372463" "04214" "00372464" "04214" "00372465" "04214" "00372466" "04214" "00372467" "04214" "00372468" "04214" "00372469" "04214" "00372470" "04214" "00372497" "04214" "00372625" "04214" "00372651" "04214" "00372652" "04214" "00372670" "04214" "00372673" "04214" "00372686" "04214" "00372700" "04214" "00372716" "04214" "00372717" "04214" "00372720" "04214" "00372725" "04214" "00372726" "04214" "00372739" "04214" "00373414" "04214" "00373501" "04214" "00373521" "04214" "00373526" "04214" "00373748" "04214" "00373749" "04214" "00373750" "04214" "00373751" "04214" "00373805" "04214" "00373851" "04214" "00373887" "04214" "00373890" "04214" "00373917" "04214" "00373919" "04214" "00373929" "04214" "00373932" "04214" "00373933" "04214" "00373953" "04214" "00373954" "04214" "00373955" "04214" "00374937" "04214" "00375421" "04214" "00376167" "04214" "00376240" "04214" "00376468" "04214" "00376469" "04214" "00376473" "04214" "00376479" "04214" "00376512" "04214" "00376714" "04214" "00376758" "04214" "00376762" "04214" "00376766" "04214" "00376782" "04214" "00376785" "04214" "00377170" "04214" "00377192" "04214" "00377201" "04214" "00377523" "04214" "00377528" "04214" "00377529" "04214" "00377816" "04214" "00377817" "04214" "00377839" "04214" "00377890" "04214" "00377891" "04214" "00377903" "04214" "00377907" "04214" "00377909" "04214" "00377910" "04214" "00377939" "04214" "00377950" "04214" "00379375" "04214" "00379564" "04214" "00379648" "04210" "00379821" "04214" "00379822" "04214" "00379823" "04214" "00379824" "04214" "00379825" "04214" "00379826" "04214" "00380196" "04214" "00381007" "04214" "00381026" "04214" "00381040" "04214" "00381049" "04214" "00381084" "04214" "00381086" "04214" "00381088" "04214" "00381089" "04214" "00381597" "04214" "00381598" "04214" "00381599" "04214" "00381608" "04214" "00381624" "04214" "00381627" "04214" "00381630" "04214" "00381642" "04214" "00381818" "04214" "00381868" "04214" "00381869" "04214" "00381870" "04214" "00381871" "04214" "00381935" "04214" "00381936" "04214" "00381937" "04214" "00381938" "04214" "00381939" "04214" "00381940" "04214" "00381959" "04214" "00382133" "02286" "00382266" "04214" "00382267" "04214" "00382268" "04214" "00382269" "04214" "00382270" "04214" "00382271" "04214" "00382272" "04214" "00382275" "04214" "00382530" "04214" "00382531" "04214" "00382532" "04214" "00382533" "04214" "00382534" "04214" "00382535" "04214" "00382536" "04214" "00382786" "04214" "00383066" "04214" "00383080" "04214" "00383093" "04214" "00383423" "04214" "00383424" "04214" "00383425" "04214" "00383426" "04214" "00383427" "04214" "00383428" "04214" "00383743" "04214" "00383744" "04214" "00383749" "04214" "00383757" "04214" "00383800" "04214" "00383848" "04214" "00383849" "04214" "00383905" "04214" "00383940" "04214" "00383954" "04214" "00383959" "04214" "00383973" "04214" "00383979" "04214" "00383991" "04214" "00383996" "04214" "00383997" "04214" "00384001" "04214" "00384004" "04214" "00384007" "04214" "00384009" "04214" "00384017" "04214" "00384028" "04214" "00384058" "04214" "00384064" "04214" "00384079" "04214" "00384101" "04214" "00384116" "04214" "00384135" "04214" "00384136" "04214" "00384153" "04214" "00384154" "04214" "00384162" "04214" "00384164" "04214" "00384170" "04214" "00384210" "04214" "00384214" "04214" "00384380" "04214" "00384410" "04214" "00384476" "04214" "00384740" "04214" "00384754" "04214" "00384755" "04214" "00384756" "04214" "00385008" "04214" "00385017" "04214" "00385030" "04214" "00385036" "04214" "00385037" "04214" "00385039" "04214" "00385049" "04214" "00385057" "04214" "00385084" "04214" "00385087" "04214" "00385090" "04214" "00385607" "04214" "00385608" "04214" "00385609" "04214" "00385611" "04214" "00385613" "04214" "00385966" "04214" "00385967" "04214" "00386160" "04214" "00386170" "04214" "00386199" "04214" "00386201" "04214" "00386207" "04214" "00386224" "04214" "00386231" "04214" "00386283" "04214" "00386569" "04214" "00386721" "04214" "00386783" "04214" "00386844" "04214" "00386857" "04214" "00387646" "04214" "00387647" "04214" "00387648" "04214" "00387649" "04214" "00387650" "04214" "00387651" "04214" "00387652" "04214" "00387653" "04214" "00387654" "04214" "00387655" "04214" "00387656" "04214" "00388153" "04214" "00388196" "04214" "00388197" "04214" "00388479" "04214" "00388940" "04214" "00388941" "04214" "00388990" "04214" "00388991" "04214" "00388992" "04214" "00389006" "04214" "00389024" "04214" "00389045" "04214" "00389048" "04214" "00389049" "04214" "00389060" "04214" "00389065" "04214" "00389066" "04214" "00389083" "04214" "00389135" "04214" "00389138" "04214" "00389139" "04214" "00389199" "04214" "00389291" "04214" "00389345" "04214" "00389575" "04214" "00389643" "04214" "00389654" "04214" "00389695" "04214" "00389708" "04214" "00389828" "04214" "00389945" "04214" "00389951" "04214" "00389986" "04214" "00390030" "04214" "00390240" "04214" "00390241" "04214" "00390242" "04214" "00390243" "04214" "00390244" "04214" "00390245" "04214" "00390748" "04214" "00390749" "04214" "00390750" "04214" "00390752" "04214" "00390793" "04214" "00390841" "04214" "00390879" "04214" "00390881" "04214" "00390893" "04214" "00391155" "04214" "00391354" "04214" "00391517" "04214" "00391518" "04214" "00391519" "04214" "00391520" "04214" "00391521" "04214" "00391522" "04214" "00391523" "04214" "00391524" "04214" "00391627" "04214" "00391628" "04214" "00391629" "04214" "00391630" "04214" "00391631" "04214" "00391632" "04214" "00391633" "04214" "00391634" "04214" "00391635" "04214" "00391636" "04214" "00391637" "04214" "00391638" "04214" "00391639" "04214" "00391721" "04214" "00391722" "04214" "00391723" "04214" "00391724" "04214" "00391725" "04214" "00391726" "04214" "00391727" "04214" "00391865" "04214" "00393338" "04214" "00393339" "04214" "00393340" "04214" "00393341" "04214" "00393443" "04214" "00393479" "04214" "00393567" "04214" "00393593" "04214" "00393715" "04214" "00393738" "04214" "00393754" "04214" "00393759" "04214" "00393764" "04214" "00393778" "04214" "00393849" "04214" "00393865" "04214" "00393889" "04214" "00393890" "04214" "00393919" "04214" "00394560" "04214" "00394561" "04214" "00394562" "04214" "00394563" "04214" "00394564" "04214" "00394565" "04214" "00394566" "04214" "00394567" "04214" "00394568" "04214" "00394569" "04214" "00395426" "04214" "00395774" "04214" "00395794" "04214" "00395797" "04214" "00395874" "04214" "00396221" "04214" "00396224" "04214" "00396636" "04214" "00405985" "04214" "00405986" "04214" "00405987" "04214" "00405988" "04214" "00405989" "04214" "00405990" "04214" "00405991" "04214" "00405992" "04214" "00405993" "04214" "00406003" "04214" "00406004" "04214" "00406005" "04214" "00406006" "04214" "00406007" "04214" "00406008" "04214" "00406009" "04214" "00406010" "04214" "00406011" "04214" "00406012" "04214" "00406013" "04214" "00406014" "04214" "00406015" "04214" "00406016" "04214" "00406017" "04214" "00406018" "04214" "00406019" "04214" "00406020" "04214" "00406021" "04214" "00406022" "04214" "00406023" "04214" "00406024" "04214" "00406025" "04214" "00406026" "04214" "00406027" "04214" "00406028" "04214" "00406029" "04214" "00406030" "04214" "00406031" "04214" "00406032" "04214" "00406033" "04214" "00406034" "04214" "00406035" "04214" "00406036" "04214" "00406037" "04214" "00406038" "04214" "00406039" "04214" "00406040" "04214" "00406041" "04214" "00406042" "04214" "00406043" "04214" "00406044" "04214" "00406045" "04214" "00406046" "04214" "00406047" "04214" "00406048" "04214" "00406049" "04214" "00406050" "04214" "00406051" "04214" "00406052" "04214" "00406053" "04214" "00406054" "04214" "00406055" "04214" "00406056" "04214" "00406057" "04214" "00406058" "04214" "00406059" "04214" "00406060" "04214" "00406061" "04214" "00406062" "04214" "00406063" "04214" "00406064" "04214" "00406065" "04214" "00406066" "04214" "00406067" "04214" "00406068" "04214" "00406069" "04214" "00406390" "04214" "00406402" "04214" "00406403" "04214" "00406404" "04214" "00406405" "04214" "00408061" "04214" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00058, 00198, 00381, 00420, 01507, 02286, 03456, 04210, 04211, 04214, 04215, 04249, 04250 ## Count = 1268 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000026467" "00058" "00033038" "00006" "Unknown" "" "early onset" "" "" "" "" "" "" "" "" "" "" "" "0000026468" "04210" "00033039" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026469" "00058" "00033040" "00006" "Unknown" "" "early onset" "" "" "" "" "" "" "" "" "" "" "" "0000026470" "04211" "00033041" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026471" "04211" "00033042" "00006" "Familial, autosomal recessive" "" "retinal telangiectasia" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026472" "04210" "00033043" "00006" "Unknown" "" "autosomal recessive retinitis pigmentosa (ARRP)" "" "" "" "" "" "" "" "" "" "" "" "0000026473" "04210" "00033044" "00006" "Unknown" "" "autosomal recessive retinitis pigmentosa (ARRP)" "" "" "" "" "" "" "" "" "" "" "" "0000026474" "00058" "00033045" "00006" "Unknown" "" "early onset" "" "" "" "" "" "" "" "" "" "" "" "0000026475" "00058" "00033046" "00006" "Unknown" "" "early onset" "" "" "" "" "" "" "" "" "" "" "" "0000026476" "00058" "00033047" "00006" "Unknown" "" "early onset, retinal telangiectasia, retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "" "" "0000026477" "00058" "00033048" "00006" "Unknown" "" "early onset, retinal telangiectasia, retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "" "" "0000026478" "00058" "00033049" "00006" "Unknown" "" "early onset, retinal telangiectasia, retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "" "" "0000026479" "00058" "00033050" "00006" "Unknown" "" "early onset, retinal telangiectasia, retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "" "" "0000026480" "00058" "00033051" "00006" "Unknown" "" "early onset, retinal telangiectasia, retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "" "" "0000026481" "00058" "00033052" "00006" "Unknown" "" "early onset, retinal telangiectasia, retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "" "" "0000026482" "04210" "00033053" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026483" "04210" "00033054" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026484" "00058" "00033055" "00006" "Unknown" "" "early onset" "" "" "" "" "" "" "" "" "" "" "" "0000026485" "04210" "00033056" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026486" "00058" "00033057" "00006" "Unknown" "" "early onset" "" "" "" "" "" "" "" "" "" "" "" "0000026487" "04210" "00033058" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026488" "04210" "00033059" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026489" "04210" "00033060" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026490" "04210" "00033061" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026491" "04210" "00033062" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026492" "00058" "00033063" "00006" "Unknown" "" "early onset" "" "" "" "" "" "" "" "" "" "" "" "0000026493" "04210" "00033064" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026494" "04210" "00033065" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026495" "04210" "00033066" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026496" "04211" "00033067" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026497" "04210" "00033068" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026498" "04211" "00033069" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026499" "04211" "00033070" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026500" "04211" "00033071" "00006" "Familial, autosomal recessive" "" "retinal telangiectasia" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026501" "00058" "00033072" "00006" "Unknown" "" "early onset" "" "" "" "" "" "" "" "" "" "" "" "0000026502" "00058" "00033073" "00006" "Unknown" "" "early onset" "" "" "" "" "" "" "" "" "" "" "" "0000026503" "00058" "00033074" "00006" "Unknown" "" "early onset" "" "" "" "" "" "" "" "" "" "" "" "0000026504" "00058" "00033075" "00006" "Unknown" "" "early onset, retinal telangiectasia" "" "" "" "" "" "" "" "" "" "" "" "0000026505" "04210" "00033076" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000026506" "04211" "00033077" "00006" "Familial, autosomal recessive" "" "retinal telangiectasia" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026507" "00058" "00033078" "00006" "Unknown" "" "early onset, retinal telangiectasia" "" "" "" "" "" "" "" "" "" "" "" "0000026520" "04214" "00033091" "00229" "Unknown" "<10y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026521" "04214" "00033092" "00229" "Unknown" "20y" "hearing loss" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026522" "04214" "00033093" "00229" "Unknown" "20y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026535" "04214" "00033106" "00229" "Unknown" "68y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026573" "04214" "00033144" "00229" "Unknown" "7y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026575" "04214" "00033146" "00229" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026587" "04214" "00033158" "00229" "Unknown" "19y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026599" "04214" "00033170" "00229" "Unknown" "4y" "retinal degeneration, severe, early onset (EOSRD)" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026773" "04214" "00033344" "00039" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026777" "04214" "00033348" "00039" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000027122" "04210" "00033693" "00243" "Familial, autosomal recessive" "00y00m00d" "" "00y00m00d" "" "" "" "" "" "" "" "" "" "" "0000028317" "04214" "00037774" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028318" "04214" "00037775" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028319" "04214" "00037776" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028320" "04214" "00037777" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028321" "04214" "00037778" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028322" "04214" "00037779" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028323" "04214" "00037780" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028324" "04214" "00037781" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028325" "04214" "00037782" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028326" "04214" "00037783" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028327" "04214" "00037784" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028328" "04214" "00037785" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028329" "04214" "00037786" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028330" "04214" "00037787" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028331" "04214" "00037788" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028332" "04214" "00037789" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028333" "04210" "00037790" "01251" "Unknown" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028334" "04210" "00037791" "01251" "Familial, autosomal recessive" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028335" "04210" "00037792" "01251" "Familial, autosomal recessive" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028336" "04210" "00037793" "01251" "Unknown" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028337" "04210" "00037794" "01251" "Familial, autosomal recessive" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028338" "04210" "00037795" "01251" "Unknown" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028339" "04210" "00037796" "01251" "Familial, autosomal recessive" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028340" "04210" "00037797" "01251" "Unknown" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028341" "04210" "00037798" "01251" "Familial, autosomal recessive" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028342" "04210" "00037799" "01251" "Unknown" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028343" "04210" "00037800" "01251" "Unknown" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028344" "04210" "00037801" "01251" "Unknown" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028345" "04210" "00037802" "01251" "Unknown" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028346" "04210" "00037803" "01251" "Unknown" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028347" "04210" "00037804" "01251" "Familial, autosomal recessive" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028348" "04210" "00037805" "01251" "Familial, autosomal recessive" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028349" "04210" "00037806" "01251" "Unknown" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028350" "04210" "00037807" "01251" "Unknown" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028351" "04210" "00037808" "01251" "Unknown" "" "Night blindness, nystagmus, decreased visual acuity, non-recordable ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028352" "04210" "00037809" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028353" "04210" "00037810" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028354" "04210" "00037811" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028355" "04210" "00037812" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028356" "04210" "00037813" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028357" "04210" "00037814" "01251" "Isolated (sporadic)" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028358" "04210" "00037815" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028359" "04210" "00037816" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028360" "04210" "00037817" "01251" "Isolated (sporadic)" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028361" "04210" "00037818" "01251" "Isolated (sporadic)" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028362" "04210" "00037819" "01251" "Isolated (sporadic)" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028363" "04210" "00037820" "01251" "Isolated (sporadic)" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028364" "04210" "00037821" "01251" "Isolated (sporadic)" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028365" "04214" "00037822" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision" "<10y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028366" "04214" "00037823" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision" "<10y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028367" "04214" "00037824" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision" "28y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028368" "04214" "00037825" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028369" "04214" "00037826" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision" ">10y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028370" "04214" "00037827" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028371" "04214" "00037828" "01251" "Isolated (sporadic)" "" "Night blindness, loss of peripheral vision" "<10y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028372" "04214" "00037829" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision" "<10y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028373" "04214" "00037830" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision" "<10y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028374" "04214" "00037831" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028375" "04214" "00037832" "01251" "Familial, autosomal recessive" "" "Night blindness" "10y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028376" "04214" "00037833" "01251" "Familial, autosomal recessive" "" "Night blindness" "10y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028377" "04214" "00037834" "01251" "Familial, autosomal recessive" "" "Night blindness" "10y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028378" "04214" "00037835" "01251" "Familial, autosomal recessive" "" "Night blindness, diffuse RP, optic disc drusen, nystagmus" "10y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028379" "04214" "00037836" "01251" "Familial, autosomal recessive" "" "Night blindness, diffuse RP, para-arteriolar sheathing, yellow round deposits in posterior pole, posterior subcapsular cataract" "12y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028380" "04214" "00037837" "01251" "Familial, autosomal recessive" "" "Night blindness" "5y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028381" "04214" "00037838" "01251" "Familial, autosomal recessive" "" "Night blindness" "5y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028382" "04214" "00037839" "01251" "Familial, autosomal recessive" "" "Night blindness" "5y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028383" "04214" "00037840" "01251" "Familial, autosomal recessive" "" "Night blindness" "5y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028384" "04214" "00037841" "01251" "Familial, autosomal recessive" "" "Night blindness" "5y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028385" "04214" "00037842" "01251" "Familial, autosomal recessive" "" "Night blindness" "5y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028386" "04214" "00037843" "01251" "Familial, autosomal recessive" "" "Night blindness, diffuse RP, yellow round deposits in posterior pole" "6m" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028387" "04214" "00037844" "01251" "Familial, autosomal recessive" "" "Night blindness" "5y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028388" "04214" "00037845" "01251" "Familial, autosomal recessive" "" "Night blindness" "5y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028389" "04210" "00037846" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028390" "04210" "00037847" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028391" "04210" "00037848" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028392" "04210" "00037849" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028393" "04210" "00037850" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028394" "04210" "00037851" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028395" "04210" "00037852" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028396" "04210" "00037853" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028397" "04214" "00037854" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028398" "04214" "00037855" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028399" "04214" "00037856" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028400" "04214" "00037857" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028401" "04214" "00037858" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028402" "04214" "00037859" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028403" "04214" "00037860" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028404" "04214" "00037861" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028405" "04214" "00037862" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028406" "04214" "00037863" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028407" "04214" "00037864" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028408" "04214" "00037865" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028409" "04210" "00037866" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "" "" "0000028410" "04210" "00037867" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "" "" "0000028411" "04210" "00037868" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "" "" "0000028412" "04210" "00037869" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "" "" "0000028413" "04210" "00037870" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "" "" "0000028414" "04210" "00037871" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "" "" "0000028415" "04210" "00037872" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "" "" "0000028416" "04210" "00037873" "01251" "Familial, autosomal recessive" "" "Macular degeneration, diffuse pigmentary retinopathy, sub-capsular cataract" "" "" "?" "" "" "" "" "" "" "" "" "0000028417" "04210" "00037874" "01251" "Unknown" "" "Photophobia, nystagmus, hyperopia" "2y" "" "?" "" "" "" "" "" "" "" "" "0000028418" "04210" "00037875" "01251" "Unknown" "" "Photophobia, nystagmus, hyperopia" "12y" "" "?" "" "" "" "" "" "" "" "" "0000028419" "04210" "00037876" "01251" "Unknown" "" "Photophobia, nystagmus, hyperopia" "14y" "" "?" "" "" "" "" "" "" "" "" "0000028420" "04210" "00037877" "01251" "Unknown" "" "Photophobia, nystagmus, hyperopia" "18y" "" "?" "" "" "" "" "" "" "" "" "0000028421" "04210" "00037878" "01251" "Unknown" "" "Photophobia, nystagmus, hyperopia" "24y" "" "?" "" "" "" "" "" "" "" "" "0000028422" "04210" "00037879" "01251" "Unknown" "" "Photophobia, nystagmus, hyperopia" "26y" "" "?" "" "" "" "" "" "" "" "" "0000028423" "04210" "00037880" "01251" "Unknown" "" "Photophobia, nystagmus, hyperopia" "29y" "" "?" "" "" "" "" "" "" "" "" "0000028424" "04210" "00037881" "01251" "Unknown" "" "Photophobia, nystagmus, hyperopia" "50y" "" "?" "" "" "" "" "" "" "" "" "0000028425" "04214" "00037882" "01251" "Familial, autosomal recessive" "" "Light perception, pale papilla, constricted arterioles, salt and pepper pigmentation in mid periphery and in posterior pole, more abundant around the macula, extinguished ERG, hyperopia, nystagmus" "15y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028426" "04214" "00037883" "01251" "Familial, autosomal recessive" "" "Nystagmus, dense cataracts, microphthalmus, corneal leukoma secondary to keratoconus" "1y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028427" "04214" "00037884" "01251" "Familial, autosomal recessive" "" "Nystagmus, dense cataracts, microphthalmus, corneal leukoma secondary to keratoconus" "1y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028428" "04214" "00037885" "01251" "Familial, autosomal recessive" "" "Bone spicule pigmentation, pale papilla, constricted arterioles, extinguished ERG, nystagmus" "3y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028429" "04214" "00037886" "01251" "Familial, autosomal recessive" "" "Bone spicule pigmentation in periphery, pale papilla, constricted arterioles, PPRPE in temporal periphery, extinguished ERG, strabismus" "4m" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028430" "04214" "00037887" "01251" "Familial, autosomal recessive" "" "Bone spicule pigmentation in periphery, pale papilla, constricted arterioles, PPRPE in temporal periphery, extinguished ERG, congenital nystagmus" "6m" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028431" "04214" "00037888" "01251" "Familial, autosomal recessive" "" "Bone spicule pigmentation, normal macula, pale papilla, vascular constriction, extinguished ERG, hyperopia" "4y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028432" "04214" "00037889" "01251" "Familial, autosomal recessive" "" "Focal pigmentation in posterior pole, normal papilla, diffuse chorioretinal atrophy, extinguished ERG, cataracts" "13y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028433" "04214" "00037890" "01251" "Familial, autosomal recessive" "" "Bone spicule pigmentation, pale papilla, narrow vessels, extinguished ERG, nystagmus, keratoconus, Franceschetti sign" "0d" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028434" "04214" "00037891" "01251" "Familial, autosomal recessive" "" "Bone spicule pigmentation, pale papilla, narrow vessels, extinguished ERG, nystagmus, Franceschetti sign" "0d" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028435" "04210" "00037892" "01251" "Familial, autosomal recessive" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028436" "04210" "00037893" "01251" "Familial, autosomal recessive" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028437" "04210" "00037894" "01251" "Familial, autosomal recessive" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028438" "04210" "00037895" "01251" "Familial, autosomal recessive" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028439" "04210" "00037896" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028440" "04210" "00037897" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028441" "04210" "00037898" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028442" "04210" "00037899" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028443" "04210" "00037900" "01251" "Familial, autosomal recessive" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028444" "04210" "00037901" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028445" "04210" "00037902" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028446" "04210" "00037903" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028447" "04210" "00037904" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028448" "04210" "00037905" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028449" "04210" "00037906" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028450" "04210" "00037907" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028451" "04210" "00037908" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028452" "04210" "00037909" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028453" "04210" "00037910" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028454" "04210" "00037911" "01251" "Isolated (sporadic)" "" "Severe visual impairment at birth, pendular nystagmus, roving eye movements, eye poking, inability to follow light or objects, normal fundus, extinguished ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028455" "02286" "00037912" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision, strabismus" "" "" "?" "" "" "" "" "" "" "" "" "0000028456" "02286" "00037913" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision, strabismus" "" "" "?" "" "" "" "" "" "" "" "" "0000028457" "02286" "00037914" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision, strabismus" "" "" "?" "" "" "" "" "" "" "" "" "0000028458" "02286" "00037915" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision, strabismus" "" "" "?" "" "" "" "" "" "" "" "" "0000028459" "02286" "00037916" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision, strabismus" "" "" "?" "" "" "" "" "" "" "" "" "0000028460" "02286" "00037917" "01251" "Unknown" "" "Night blindness, loss of peripheral vision, strabismus" "" "" "?" "" "" "" "" "" "" "" "" "0000028461" "02286" "00037918" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision, strabismus" "" "" "?" "" "" "" "" "" "" "" "" "0000028462" "02286" "00037919" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision, strabismus" "" "" "?" "" "" "" "" "" "" "" "" "0000028463" "02286" "00037920" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision, strabismus" "" "" "?" "" "" "" "" "" "" "" "" "0000028464" "02286" "00037921" "01251" "Unknown" "" "Night blindness, loss of peripheral vision, strabismus" "" "" "?" "" "" "" "" "" "" "" "" "0000028465" "04214" "00037922" "01251" "Unknown" "" "Night blindness, loss of peripheral vision, strabismus" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028466" "04214" "00037923" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision, strabismus" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028467" "01507" "00037924" "01251" "Familial, autosomal dominant" "" "Presence of bilaterally symmetrical chorioretinal atrophy, with accumulation of bone corpuscle pigmentation along the retinal veins" "" "" "?" "" "" "" "" "" "" "" "" "0000028468" "01507" "00037925" "01251" "Familial, autosomal dominant" "" "Presence of bilaterally symmetrical chorioretinal atrophy, with accumulation of bone corpuscle pigmentation along the retinal veins" "" "" "?" "" "" "" "" "" "" "" "" "0000028469" "01507" "00037926" "01251" "Familial, autosomal dominant" "" "Presence of bilaterally symmetrical chorioretinal atrophy, with accumulation of bone corpuscle pigmentation along the retinal veins" "" "" "?" "" "" "" "" "" "" "" "" "0000028470" "01507" "00037927" "01251" "Familial, autosomal dominant" "" "Presence of bilaterally symmetrical chorioretinal atrophy, with accumulation of bone corpuscle pigmentation along the retinal veins" "" "" "?" "" "" "" "" "" "" "" "" "0000028471" "01507" "00037928" "01251" "Familial, autosomal dominant" "" "Presence of bilaterally symmetrical chorioretinal atrophy, with accumulation of bone corpuscle pigmentation along the retinal veins" "" "" "?" "" "" "" "" "" "" "" "" "0000028472" "04210" "00037929" "01251" "Unknown" "" "Nyctalopia, photosensitivity" "" "" "?" "" "" "" "" "" "" "" "" "0000028473" "04210" "00037930" "01251" "Unknown" "" "Nyctalopia" "" "" "?" "" "" "" "" "" "" "" "" "0000028474" "04210" "00037931" "01251" "Familial, autosomal recessive" "" "Nyctalopia" "" "" "?" "" "" "" "" "" "" "" "" "0000028475" "04210" "00037932" "01251" "Unknown" "" "Nyctalopia" "" "" "?" "" "" "" "" "" "" "" "" "0000028476" "04210" "00037933" "01251" "Unknown" "" "Nyctalopia, photosensitivity" "" "" "?" "" "" "" "" "" "" "" "" "0000028477" "04210" "00037934" "01251" "Familial, autosomal recessive" "" "Nyctalopia, photosensitivity" "" "" "?" "" "" "" "" "" "" "" "" "0000028478" "04210" "00037935" "01251" "Familial, autosomal recessive" "" "Nyctalopia" "" "" "?" "" "" "" "" "" "" "" "" "0000028479" "04210" "00037936" "01251" "Familial, autosomal recessive" "" "Nyctalopia, photosensitivity" "" "" "?" "" "" "" "" "" "" "" "" "0000028480" "04214" "00037937" "01251" "Familial, autosomal recessive" "" "?" "5y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028481" "04210" "00037938" "01251" "Familial, autosomal recessive" "" "?" "0y" "" "?" "" "" "" "" "" "" "" "" "0000028482" "04214" "00037939" "01251" "Familial, autosomal recessive" "" "isolated" "14y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028483" "04214" "00037940" "01251" "Familial, autosomal recessive" "" "isolated" "2y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028484" "02286" "00037941" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028485" "04210" "00037942" "01251" "Familial, autosomal recessive" "" "Night blindness, nystagmus, pink optic disc; mild narrowing of arterioles; macula shows a glazy, atrophic aspect with round, nummular subretinal pigmentation, retinal periphery shows extensive RPE alterations with some intraretinal pigment migration" "2y" "" "?" "" "" "" "" "" "" "" "" "0000028486" "04210" "00037943" "01251" "Familial, autosomal recessive" "" "Night blindness, nystagmus, pink optic disc with edema and perivascular sheathing mild narrowing of the arterioles showing tortuosities with subretinal white dots along arterioles with PPRPE, macular aplasia with edema and a few intraretinal hemorrhages, atrophic RPE in periphery with PPRPE, nummular and a few spicular pigmentations" "3y" "" "?" "" "" "" "" "" "" "" "" "0000028487" "04210" "00037944" "01251" "Familial, autosomal recessive" "" "Night blindness, nystagmus" "5m" "" "?" "" "" "" "" "" "" "" "" "0000028488" "04210" "00037945" "01251" "Familial, autosomal recessive" "" "Night blindness, photophobia, nystagmus, macular dysplasia" "3y" "" "?" "" "" "" "" "" "" "" "" "0000028489" "04210" "00037946" "01251" "Familial, autosomal recessive" "" "Nystagmus, pale optic disc, no PPRPE, macular multiple nummular pigmentations, coats-like exudative vasculopathy" "9m" "" "?" "" "" "" "" "" "" "" "" "0000028490" "04210" "00037947" "01251" "Familial, autosomal recessive" "" "Night blindness, photophobia, nystagmus, fairly normal optic discs, limited vascular attenuation with relative PPRPE, nummular hyperpigmentation of the macula, retinal periphery and multiple typical white subretinal deposits scattered throughout the fundus" "8y" "" "?" "" "" "" "" "" "" "" "" "0000028491" "04210" "00037948" "01251" "Familial, autosomal recessive" "" "Night blindness, nystagmus, pale optic discs with mild prepapillary fibrosis, vascular attenuation without PPRPE, macular aplasia, several larger areas of subretinal white deposits and confluent nummular intraretinal pigmentation in periphery" "6y" "" "?" "" "" "" "" "" "" "" "" "0000028492" "04210" "00037949" "01251" "Familial, autosomal recessive" "" "Night blindness, nystagmus, full optic discs, normal vessels without PPRPE, macular RPE alterations, several larger areas of nummular intraretinal pigmentation, especially temporal to the macula, diffuse very fine white subretinal deposits" "2y6m" "" "?" "" "" "" "" "" "" "" "" "0000028493" "04210" "00037950" "01251" "Unknown" "" "Night blindness, nystagmus, vascular attenuation, RPE alterations, pale optic discs, maculopathy, cataract" "9y" "" "?" "" "" "" "" "" "" "" "" "0000028494" "04210" "00037951" "01251" "Familial, autosomal recessive" "" "Patches of atrophy, nummular pigmentary, changes in macular and paramacular areas, normal retinal vessels, Salt-and-pepper-like pigmentary mottling, areas of irregular hyperpigmentation" "5m" "" "low visual acuity, night blindness, digito-ocular phenomenon" "" "" "" "" "" "" "" "" "0000028495" "04210" "00037952" "01251" "Familial, autosomal recessive" "" "Chorioretinal atrophy, small areas of hyperpigmentation and stippling, normal retinal vessels, Areas of atrophy and pigment clumping, rare white spots in anterior retina" "14m" "" "low visual acuity, digito-ocular phenomenon" "" "" "" "" "" "" "" "" "0000028496" "04210" "00037953" "01251" "Familial, autosomal recessive" "" "Pigment migration, white spots in anterior retina, normal retinal vessels, Pigment migration in midperipheral retina" "10m" "" "low visual acuity, digito-ocular phenomenon" "" "" "" "" "" "" "" "" "0000028497" "04210" "00037954" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028498" "04210" "00037955" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028499" "04210" "00037956" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028500" "04210" "00037957" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028501" "04210" "00037958" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028502" "04210" "00037959" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028503" "04210" "00037960" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028504" "04210" "00037961" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028505" "04210" "00037962" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028506" "04210" "00037963" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028507" "04210" "00037964" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028508" "04210" "00037965" "01251" "Unknown" "" "Severe loss of visual function early severely reduced or absent scotopic and photopic ERG, roving eye movements/nystagmus, digito-ocular signs (eye poking or rubbing)" "" "" "retinal degeneration" "" "" "" "" "" "" "" "" "0000028509" "04210" "00037966" "01251" "Unknown" "" "Severe loss of visual function early severely reduced or absent scotopic and photopic ERG, roving eye movements/nystagmus, digito-ocular signs (eye poking or rubbing)" "" "" "retinal degeneration" "" "" "" "" "" "" "" "" "0000028510" "04210" "00037967" "01251" "Unknown" "" "Severe loss of visual function early severely reduced or absent scotopic and photopic ERG, roving eye movements/nystagmus, digito-ocular signs (eye poking or rubbing)" "" "" "retinal degeneration" "" "" "" "" "" "" "" "" "0000028511" "04210" "00037968" "01251" "Unknown" "" "Severe loss of visual function early severely reduced or absent scotopic and photopic ERG, roving eye movements/nystagmus, digito-ocular signs (eye poking or rubbing)" "" "" "retinal degeneration" "" "" "" "" "" "" "" "" "0000028512" "04210" "00037969" "01251" "Unknown" "" "Severe loss of visual function early severely reduced or absent scotopic and photopic ERG, roving eye movements/nystagmus, digito-ocular signs (eye poking or rubbing)" "" "" "retinal degeneration" "" "" "" "" "" "" "" "" "0000028513" "04210" "00037970" "01251" "Unknown" "" "Severe loss of visual function early severely reduced or absent scotopic and photopic ERG, roving eye movements/nystagmus, digito-ocular signs (eye poking or rubbing)" "" "" "retinal degeneration" "" "" "" "" "" "" "" "" "0000028514" "04210" "00037971" "01251" "Unknown" "" "Severe loss of visual function early severely reduced or absent scotopic and photopic ERG, roving eye movements/nystagmus, digito-ocular signs (eye poking or rubbing)" "" "" "retinal degeneration" "" "" "" "" "" "" "" "" "0000028515" "04210" "00037972" "01251" "Unknown" "" "Severe loss of visual function early severely reduced or absent scotopic and photopic ERG, roving eye movements/nystagmus, digito-ocular signs (eye poking or rubbing)" "" "" "retinal degeneration" "" "" "" "" "" "" "" "" "0000028516" "04210" "00037973" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028517" "04210" "00037974" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028518" "04210" "00037975" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028519" "04210" "00037976" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028520" "04210" "00037977" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028521" "04210" "00037978" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028522" "04210" "00037979" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028523" "04210" "00037980" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028524" "04210" "00037981" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028525" "04210" "00037982" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028526" "04210" "00037983" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028527" "04210" "00037984" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028528" "04210" "00037985" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028529" "04210" "00037986" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028530" "04210" "00037987" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028531" "04210" "00037988" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028532" "04210" "00037989" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028533" "04210" "00037990" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028534" "04210" "00037991" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028535" "04210" "00037992" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028536" "04210" "00037993" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028537" "04210" "00037994" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028538" "04210" "00037995" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028539" "04210" "00037996" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028540" "04210" "00037997" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028541" "04210" "00037998" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028542" "04210" "00037999" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028543" "04210" "00038000" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028544" "04210" "00038001" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028545" "04210" "00038002" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028546" "04210" "00038003" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028547" "04210" "00038004" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028548" "04210" "00038005" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028549" "04210" "00038006" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028550" "04210" "00038007" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028551" "04210" "00038008" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028552" "04210" "00038009" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028553" "04210" "00038010" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028554" "04210" "00038011" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028555" "04210" "00038012" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028556" "04210" "00038013" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028557" "04210" "00038014" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028558" "04210" "00038015" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028559" "04210" "00038016" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028560" "04210" "00038017" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028561" "04210" "00038018" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028562" "04210" "00038019" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028563" "04210" "00038020" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028564" "04210" "00038021" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028565" "04210" "00038022" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028566" "04210" "00038023" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028567" "04210" "00038024" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028568" "04210" "00038025" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028569" "04210" "00038026" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028570" "04210" "00038027" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028571" "04210" "00038028" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028572" "04210" "00038029" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028573" "04210" "00038030" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028574" "04210" "00038031" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028575" "04210" "00038032" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028576" "04210" "00038033" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028577" "04210" "00038034" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028578" "04210" "00038035" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028579" "04210" "00038036" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028580" "04210" "00038037" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028581" "04210" "00038038" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028582" "04210" "00038039" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028583" "04210" "00038040" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028584" "04210" "00038041" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028585" "04210" "00038042" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028586" "04210" "00038043" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028587" "04210" "00038044" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028588" "04210" "00038045" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028589" "04210" "00038046" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028590" "04210" "00038047" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028591" "04210" "00038048" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028592" "04210" "00038049" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028593" "04210" "00038050" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028594" "04210" "00038051" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028595" "04210" "00038052" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028596" "04210" "00038053" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028597" "04210" "00038054" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028598" "04210" "00038055" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028599" "04210" "00038056" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028600" "04210" "00038057" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028601" "04210" "00038058" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028602" "04210" "00038059" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028603" "04210" "00038060" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028604" "04210" "00038061" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028605" "04210" "00038062" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028606" "04210" "00038063" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028607" "04210" "00038064" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028608" "04214" "00038065" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028609" "04214" "00038066" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028610" "04214" "00038067" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028611" "04214" "00038068" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028612" "04214" "00038069" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028613" "04214" "00038070" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028614" "04214" "00038071" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028615" "04214" "00038072" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028616" "04214" "00038073" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028617" "04214" "00038074" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028618" "04214" "00038075" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028619" "04214" "00038076" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028620" "04214" "00038077" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028621" "04214" "00038078" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028622" "04214" "00038079" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028623" "04214" "00038080" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028624" "04214" "00038081" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028625" "04210" "00038082" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028626" "04210" "00038083" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028627" "04210" "00038084" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028628" "04210" "00038085" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028629" "04210" "00038086" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028630" "04210" "00038087" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028631" "04210" "00038088" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028632" "04210" "00038089" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028633" "04210" "00038090" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028634" "04210" "00038091" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028635" "04210" "00038092" "01251" "Familial, autosomal recessive" "" "?" "0d" "" "?" "" "" "" "" "" "" "" "" "0000028636" "04210" "00038093" "01251" "Familial, autosomal recessive" "" "?" "0d" "" "?" "" "" "" "" "" "" "" "" "0000028637" "04210" "00038094" "01251" "Familial, autosomal recessive" "" "?" "0d" "" "?" "" "" "" "" "" "" "" "" "0000028640" "04210" "00038097" "01251" "Unknown" "" "early onset blindness or severe visual impairment during 1st year of life with oculodigital signs and extinguished or severely reduced ERG; exclusion of other systemic diseases" "" "" "night blindness and diffuse hyperpigmentation in the retina, with vascular attenuation" "" "" "" "" "" "" "" "" "0000028641" "04210" "00038098" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028642" "04210" "00038099" "01251" "Unknown" "" "Photoaversion, nyctalopia, and the oculodigital sign" "" "" "?" "" "" "" "" "" "" "" "" "0000028643" "04250" "00038100" "01251" "Familial, autosomal recessive" "" "early-onset retinal degeneration, bone spicule pigmentation, pale and atrophic optic disc, nystagmus, exotrophia, severe hypermetropia" "" "" "?" "" "" "" "" "" "" "" "" "0000028644" "04250" "00038101" "01251" "Familial, autosomal recessive" "" "early-onset retinal degeneration, bone spicule pigmentation, attenuated vessels, pale and atrophic optic disc, nystagmus, severe hypermetropia" "" "" "?" "" "" "" "" "" "" "" "" "0000028645" "04250" "00038102" "01251" "Familial, autosomal recessive" "" "early-onset retinal degeneration, bone spicule pigmentation, attenuated vessels, pale and atrophic optic disc, nystagmus, severe hypermetropia" "" "" "?" "" "" "" "" "" "" "" "" "0000028646" "04250" "00038103" "01251" "Familial, autosomal recessive" "" "early-onset retinal degeneration, bone spicule pigmentation, attenuated vessels, pale and atrophic optic disc, nystagmus, keratoconus" "" "" "?" "" "" "" "" "" "" "" "" "0000028647" "00381" "00038104" "01251" "Familial, autosomal recessive" "" "early-onset retinal dystrophy, horizontal sensory nystagmus, slightly pale optic nerves, macular atrophy, and nummular pigment clumping in both eyes, diffuse drusen like deposits in the posterior pole, abnormal inner retinal lamination and loss of photoreceptors, extinguished ERG" "" "" "low visual acuity" "" "" "" "" "" "" "" "" "0000028648" "00381" "00038105" "01251" "Familial, autosomal recessive" "" "early-onset retinal dystrophy, horizontal sensory nystagmus, optic nerve pallor, macular atrophy, and peripheral intraretinal pigment migration less severe than her brother" "" "" "low visual acuity" "" "" "" "" "" "" "" "" "0000028649" "04214" "00038106" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028650" "04214" "00038107" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028651" "04214" "00038108" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028652" "04214" "00038109" "01251" "Familial, autosomal recessive" "" "Night blindness, loss of peripheral vision" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028653" "04214" "00038110" "01251" "Isolated (sporadic)" "" "Night blindness, loss of peripheral vision" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028654" "04210" "00038111" "01251" "Familial, autosomal recessive" "" "Impaired vision, amaurotic pupils, and sensory nystagmus" "" "" "?" "" "" "" "" "" "" "" "" "0000028655" "04210" "00038112" "01251" "Unknown" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028656" "04214" "00038113" "01251" "Familial, autosomal recessive" "" "Bone spicule retinal pigmentation, optic disc pallor, visual field constriction, attenuated/abolished ERG" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028657" "04214" "00038114" "01251" "Familial, autosomal recessive" "" "Bone spicule retinal pigmentation, optic disc pallor, visual field constriction, attenuated/abolished ERG" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028658" "04214" "00038115" "01251" "Familial, autosomal recessive" "" "Bone spicule retinal pigmentation, optic disc pallor, visual field constriction, attenuated/abolished ERG" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028659" "04214" "00038116" "01251" "Familial, autosomal recessive" "" "Bone spicule retinal pigmentation, optic disc pallor, visual field constriction, attenuated/abolished ERG" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028660" "04214" "00038117" "01251" "Familial, autosomal recessive" "" "Bone spicule retinal pigmentation, optic disc pallor, visual field constriction, attenuated/abolished ERG" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028661" "04214" "00038118" "01251" "Familial, autosomal recessive" "" "Bone spicule retinal pigmentation, optic disc pallor, visual field constriction, attenuated/abolished ERG" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028662" "04214" "00038119" "01251" "Familial, autosomal recessive" "" "Bone spicule retinal pigmentation, optic disc pallor, visual field constriction, attenuated/abolished ERG" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028663" "04210" "00038120" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028664" "04210" "00038121" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028665" "04210" "00038122" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028666" "04210" "00038123" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028667" "04210" "00038124" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028668" "04210" "00038125" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028669" "04210" "00038126" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028670" "04210" "00038127" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028671" "04210" "00038128" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028672" "04210" "00038129" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028673" "04210" "00038130" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028674" "04210" "00038131" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028675" "04210" "00038132" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028676" "04210" "00038133" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028677" "04210" "00038134" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028678" "04210" "00038135" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028679" "04210" "00038136" "01251" "Familial, autosomal recessive" "" "Congenital onset, severely reduced or absent ERG, nystagmus, oculodigital sign" "" "" "photophobia, night blindness, hyperopia" "" "" "" "" "" "" "" "" "0000028680" "00381" "00038137" "01251" "Familial, autosomal recessive" "" "early-onset retinal dystrophy, bilateral visual loss before the age of 6 months, nystagmus, undetectable or significantly reduced ERG" "1y" "" "?" "" "" "" "" "" "" "" "" "0000028681" "00381" "00038138" "01251" "Familial, autosomal recessive" "" "early-onset retinal dystrophy, bilateral visual loss before the age of 6 months, nystagmus, undetectable or significantly reduced ERG" "1y" "" "?" "" "" "" "" "" "" "" "" "0000028682" "00381" "00038139" "01251" "Familial, autosomal recessive" "" "early-onset retinal dystrophy, bilateral visual loss before the age of 6 months, nystagmus, undetectable or significantly reduced ERG" "1y" "" "?" "" "" "" "" "" "" "" "" "0000028683" "00381" "00038140" "01251" "Familial, autosomal recessive" "" "early-onset retinal dystrophy, bilateral visual loss before the age of 6 months, nystagmus, undetectable or significantly reduced ERG" "1y" "" "?" "" "" "" "" "" "" "" "" "0000028684" "00381" "00038141" "01251" "Familial, autosomal recessive" "" "early-onset retinal dystrophy, bilateral visual loss before the age of 6 months, nystagmus, undetectable or significantly reduced ERG" "1y" "" "?" "" "" "" "" "" "" "" "" "0000028685" "00381" "00038142" "01251" "Familial, autosomal recessive" "" "early-onset retinal dystrophy, bilateral visual loss before the age of 6 months, nystagmus, undetectable or significantly reduced ERG" "1y" "" "?" "" "" "" "" "" "" "" "" "0000028686" "04214" "00038143" "01251" "Familial, autosomal recessive" "" "Attenuation of the retinal vessels, bone spicule pigmentation" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028687" "04214" "00038144" "01251" "Familial, autosomal recessive" "" "Attenuation of the retinal vessels, bone spicule pigmentation" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028688" "04214" "00038145" "01251" "Familial, autosomal recessive" "" "Night blindness, visual field loss before the age of 10 years" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028689" "04214" "00038146" "01251" "Familial, autosomal recessive" "" "Night blindness, visual field loss before the age of 10 years" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028690" "04214" "00038147" "01251" "Familial, autosomal recessive" "" "Night blindness, visual field loss before the age of 10 years" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028691" "04214" "00038148" "01251" "Familial, autosomal recessive" "" "Night blindness, visual field loss after the age of 10 years" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028692" "04214" "00038149" "01251" "Familial, autosomal recessive" "" "nanophthalmos , pendular nystagmus, shallow anterior chamber and open camerular angles, optic disc drusen, mild vascular attenuation, extinguished ERG, diffuse macular thickening" "" "" "low vision since childhood" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028693" "04214" "00038150" "01251" "Familial, autosomal recessive" "" "nanophthalmos" "" "" "low vision since childhood" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028694" "04210" "00038151" "01251" "Unknown" "" "Poor vision, retinal vessel attenuation, pigment deposit" "" "" "onset few months after birth" "" "" "" "" "" "" "" "" "0000028695" "04210" "00038152" "01251" "Familial, autosomal recessive" "" "Poor vision, roving nystagmus, carpet-like retinal degeneration, pigment deposit" "" "" "onset few months after birth" "" "" "" "" "" "" "" "" "0000028696" "04210" "00038153" "01251" "Familial, autosomal recessive" "" "Poor vision, nystagmus, attenuated vessels, no foveal reflex, pigment deposits, extinguished ERG" "" "" "onset few months after birth" "" "" "" "" "" "" "" "" "0000028697" "04210" "00038154" "01251" "Isolated (sporadic)" "" "Poor vision, attenuated vessels, pigment deposits, extinguished ERG" "30m" "" "?" "" "" "" "" "" "" "" "" "0000028698" "04210" "00038155" "01251" "Isolated (sporadic)" "" "Poor vision, nystagmus, attenuated vessels, pigment deposits, extinguished ERG" "2y" "" "?" "" "" "" "" "" "" "" "" "0000028699" "04210" "00038156" "01251" "Isolated (sporadic)" "" "Poor vision, nystagmus, extinguished ERG" "2m" "" "?" "" "" "" "" "" "" "" "" "0000028700" "04210" "00038157" "01251" "Isolated (sporadic)" "" "Nystagmus, attenuated vessels, carpet-like retinal degeneration, no foveal reflex, extinguished ERG" "10m" "" "?" "" "" "" "" "" "" "" "" "0000028701" "04210" "00038158" "01251" "Familial, autosomal recessive" "" "Poor vision, roving nystagmus, oculodigital sign, attenuated vessels, pigment deposits, extinguished ERG" "8m" "" "?" "" "" "" "" "" "" "" "" "0000028702" "04210" "00038159" "01251" "Isolated (sporadic)" "" "Poor vision, nystagmus, attenuated vessels, carpet-like retinal degeneration, macular atrophy" "" "" "onset few months after birth" "" "" "" "" "" "" "" "" "0000028703" "04210" "00038160" "01251" "Unknown" "" "Poor vision, nystagmus, attenuated vessels, pigment deposits, extinguished ERG" "" "" "onset few months after birth" "" "" "" "" "" "" "" "" "0000028704" "04250" "00038161" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "0.6y" "" "?" "" "" "" "" "" "" "" "" "0000028705" "04250" "00038162" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "4y" "" "?" "" "" "" "" "" "" "" "" "0000028706" "04250" "00038163" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "5y" "" "?" "" "" "" "" "" "" "" "" "0000028707" "04250" "00038164" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "8y" "" "?" "" "" "" "" "" "" "" "" "0000028708" "04250" "00038165" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "13y" "" "?" "" "" "" "" "" "" "" "" "0000028709" "04250" "00038166" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "13y" "" "?" "" "" "" "" "" "" "" "" "0000028710" "04250" "00038167" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "20y" "" "?" "" "" "" "" "" "" "" "" "0000028711" "04250" "00038168" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "22y" "" "?" "" "" "" "" "" "" "" "" "0000028712" "04250" "00038169" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "25y" "" "?" "" "" "" "" "" "" "" "" "0000028713" "04250" "00038170" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "25y" "" "?" "" "" "" "" "" "" "" "" "0000028714" "04250" "00038171" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "26y" "" "?" "" "" "" "" "" "" "" "" "0000028715" "04250" "00038172" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "26y" "" "?" "" "" "" "" "" "" "" "" "0000028716" "04250" "00038173" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "27y" "" "?" "" "" "" "" "" "" "" "" "0000028717" "04250" "00038174" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "27y" "" "?" "" "" "" "" "" "" "" "" "0000028718" "04250" "00038175" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "29y" "" "?" "" "" "" "" "" "" "" "" "0000028719" "04250" "00038176" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "34y" "" "?" "" "" "" "" "" "" "" "" "0000028720" "04250" "00038177" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "38y" "" "?" "" "" "" "" "" "" "" "" "0000028721" "04250" "00038178" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "44y" "" "?" "" "" "" "" "" "" "" "" "0000028722" "04250" "00038179" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "47y" "" "?" "" "" "" "" "" "" "" "" "0000028723" "04250" "00038180" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, waxy appearance of the optic nerve head" "48y" "" "?" "" "" "" "" "" "" "" "" "0000028724" "04214" "00038181" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated retinal vessels, pale optic disc, bone spicule pigmentation" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028725" "04214" "00038182" "01251" "Familial, autosomal recessive" "" "Night blindness, little bone spicules, cystoid macular edema" "20y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028726" "04214" "00038183" "01251" "Familial, autosomal recessive" "" "Night blindness, photophobia, decreased vision" "20y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028727" "04214" "00038184" "01251" "Familial, autosomal recessive" "" "Photophobia, bone spicules, perifoveal atrophy, pale optic disc, narrowing of retinal vessels, cystoid macular edema" "12y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028728" "04214" "00038185" "01251" "Familial, autosomal recessive" "" "Night blindness, photophobia, decreased vision, bilateral nuclear cataract, peripheral bone spicules with cystoid macular edema" "39y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028729" "04214" "00038186" "01251" "Familial, autosomal recessive" "" "Decreased vision, moderate RPE changes in the periphery and cystoid macular edema" "6y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028730" "04214" "00038187" "01251" "Familial, autosomal recessive" "" "?" "6y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028731" "04214" "00038188" "01251" "Familial, autosomal recessive" "" "Night blindness, peripheral RPE changes with bone spicules, perifoveal atrophy, pale optic disc, narrowing of retinal vessels" "25y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028732" "04214" "00038189" "01251" "Familial, autosomal recessive" "" "?" "25y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028733" "04214" "00038190" "01251" "Familial, autosomal recessive" "" "Night blindness, photophobia, widespread clumped pigment migration in the posterior pole and periphery, cystoid macular atrophy" "12y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028734" "04214" "00038191" "01251" "Familial, autosomal recessive" "" "Night blindness, photophobia, peripheral bone spicules with perifoveal atrophy" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028735" "04214" "00038192" "01251" "Familial, autosomal recessive" "" "Night blindness, photophobia, widespread clumped pigment migration" "15y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028736" "04214" "00038193" "01251" "Familial, autosomal recessive" "" "Low vision since childhood, widespread clumped pigment migration with relative sparing of the macula" "17y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028737" "04214" "00038194" "01251" "Familial, autosomal recessive" "" "?" "17y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028738" "04214" "00038195" "01251" "Familial, autosomal recessive" "" "Night blindness since childhood, some RPE changes in the periphery, cystoid macular edema" "9y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028739" "04214" "00038196" "01251" "Familial, autosomal recessive" "" "No light perception, attenuated arterioles, bone spicules, pale optic disc" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028740" "04210" "00038197" "01251" "Familial, autosomal recessive" "" "Poor vision, nystagmus, extinguished ERG" "" "" "onset few months after birth" "" "" "" "" "" "" "" "" "0000028741" "04210" "00038198" "01251" "Familial, autosomal recessive" "" "Poor vision, nystagmus, extinguished ERG" "" "" "onset few months after birth" "" "" "" "" "" "" "" "" "0000028742" "04210" "00038199" "01251" "Familial, autosomal recessive" "" "Poor vision, nystagmus, extinguished ERG" "" "" "onset few months after birth" "" "" "" "" "" "" "" "" "0000028743" "04210" "00038200" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028744" "04215" "00038201" "01251" "Familial, autosomal recessive" "" "No peripapillary sparing/flecks, irregular geographic atrophy with RPE changes, thickening on OCT" "" "" "severe vision impairment" "" "" "" "" "" "" "" "" "0000028745" "04214" "00038202" "01251" "Unknown" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028746" "04214" "00038203" "01251" "Unknown" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028747" "00381" "00038204" "01251" "Familial, autosomal recessive" "" "Atrophy of the retina outside of the fovea, spots of hyperpigmentation, optic disc drusen, intraretinal macular edema" "" "" "?" "" "" "" "" "" "" "" "" "0000028748" "04214" "00038205" "01251" "Familial, autosomal recessive" "" "Bilateral nystagmus, cataract, attenuated retinal vessels, salt and pepper pigmentation, optic atrophy" "<10y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028749" "04214" "00038206" "01251" "Familial, autosomal recessive" "" "Pendular nystagmus, cataract, attenuated retinal vessels, salt and pepper pigmentation, optic atrophy" "12y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028750" "04210" "00038207" "01251" "Familial, autosomal recessive" "" "Severe nystagmus, total cataract" "<1y" "" "?" "" "" "" "" "" "" "" "" "0000028751" "04210" "00038208" "01251" "Familial, autosomal recessive" "" "Bilateral pendular nystagmus, total cataract" "<1y" "" "?" "" "" "" "" "" "" "" "" "0000028752" "00381" "00038209" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028753" "00381" "00038210" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028754" "00381" "00038211" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028755" "04210" "00038212" "01251" "Familial, autosomal recessive" "" "Bilateral pendular nystagmus, pale optic nerves, extinguished ERG" "<1y" "" "?" "" "" "" "" "" "" "" "" "0000028756" "04210" "00038213" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028757" "00381" "00038214" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028758" "00381" "00038215" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028759" "00381" "00038216" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028760" "00381" "00038217" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028761" "00381" "00038218" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028762" "00381" "00038219" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028763" "00381" "00038220" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028764" "00381" "00038221" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028765" "00381" "00038222" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028766" "00381" "00038223" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028767" "00381" "00038224" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028768" "04210" "00038225" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028769" "04210" "00038226" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028770" "04210" "00038227" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028771" "00381" "00038228" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028772" "00381" "00038229" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028773" "00381" "00038230" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028774" "00381" "00038231" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028775" "00381" "00038232" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028776" "00381" "00038233" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028777" "04210" "00038234" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028778" "00381" "00038235" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028779" "00381" "00038236" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028780" "00381" "00038237" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028781" "04210" "00038238" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028782" "04210" "00038239" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028783" "00381" "00038240" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028784" "04210" "00038241" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028785" "04210" "00038242" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028786" "04210" "00038243" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028787" "04210" "00038244" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028788" "00381" "00038245" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028789" "00381" "00038246" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028790" "00381" "00038247" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028791" "04210" "00038248" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028792" "00381" "00038249" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028793" "04210" "00038250" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028794" "00381" "00038251" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028795" "04210" "00038252" "01251" "Unknown" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028796" "00381" "00038253" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028797" "00381" "00038254" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028798" "00381" "00038255" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028799" "00381" "00038256" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028800" "00381" "00038257" "01251" "Unknown" "" "early-onset retinal dystrophy" "" "" "?" "" "" "" "" "" "" "" "" "0000028801" "04210" "00038258" "01251" "Familial, autosomal recessive" "" "Severely reduced visual acuity, blindness, nystagmus, convergent strabismus and severe hyperopia, diffuse macular atrophy, cataract" "" "" "?" "" "" "" "" "" "" "" "" "0000028802" "04210" "00038259" "01251" "Familial, autosomal recessive" "" "Severely reduced visual acuity, blindness, nystagmus, convergent strabismus and severe hyperopia, diffuse macular atrophy, cataract" "" "" "?" "" "" "" "" "" "" "" "" "0000028803" "04210" "00038260" "01251" "Familial, autosomal recessive" "" "Severely reduced visual acuity, blindness, nystagmus, convergent strabismus and severe hyperopia, diffuse macular atrophy, cataract" "" "" "?" "" "" "" "" "" "" "" "" "0000028804" "04210" "00038261" "01251" "Familial, autosomal recessive" "" "Severely reduced visual acuity, blindness, nystagmus, convergent strabismus and severe hyperopia, diffuse macular atrophy, cataract" "" "" "?" "" "" "" "" "" "" "" "" "0000028805" "04210" "00038262" "01251" "Familial, autosomal recessive" "" "Non detectable ERG" "2y" "" "?" "" "" "" "" "" "" "" "" "0000028806" "04210" "00038263" "01251" "Familial, autosomal recessive" "" "Non detectable ERG" "1y" "" "?" "" "" "" "" "" "" "" "" "0000028807" "04210" "00038264" "01251" "Familial, autosomal recessive" "" "Non detectable ERG" "2y" "" "?" "" "" "" "" "" "" "" "" "0000028808" "04214" "00038265" "01251" "Familial, autosomal recessive" "" "early-onset retinitis pigmentosa, non detectable ERG" "3y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028809" "04214" "00038266" "01251" "Familial, autosomal recessive" "" "early-onset retinitis pigmentosa, non detectable ERG" "16y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028810" "04214" "00038267" "01251" "Familial, autosomal recessive" "" "early-onset retinitis pigmentosa, non detectable ERG" "3y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028811" "04210" "00038268" "01251" "Familial, autosomal recessive" "" "Non detectable ERG" "6m" "" "?" "" "" "" "" "" "" "" "" "0000028812" "04210" "00038269" "01251" "Familial, autosomal recessive" "" "?" "33y" "" "?" "" "" "" "" "" "" "" "" "0000028813" "04214" "00038270" "01251" "Familial, autosomal recessive" "" "early onset retinitis pigmentosa" "18y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028814" "04214" "00038271" "01251" "Familial, autosomal recessive" "" "early onset retinitis pigmentosa, non detectable ERG" "8y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028815" "04214" "00038272" "01251" "Familial, autosomal recessive" "" "early onset retinitis pigmentosa, non detectable ERG" "16y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028816" "04214" "00038273" "01251" "Familial, autosomal recessive" "" "early onset retinitis pigmentosa, non detectable ERG" "3y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028817" "04214" "00038274" "01251" "Familial, autosomal recessive" "" "early onset retinitis pigmentosa, non detectable ERG" "7y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028818" "04214" "00038275" "01251" "Familial, autosomal recessive" "" "early-onset retinitis pigmentosa, non detectable ERG" "13y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028819" "04214" "00038276" "01251" "Familial, autosomal recessive" "" "early-onset retinitis pigmentosa, non detectable ERG" "21y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028820" "04210" "00038277" "01251" "Familial, autosomal recessive" "" "?" "42y" "" "?" "" "" "" "" "" "" "" "" "0000028821" "04210" "00038278" "01251" "Familial, autosomal recessive" "" "Non detectable ERG" "26y" "" "?" "" "" "" "" "" "" "" "" "0000028822" "04210" "00038279" "01251" "Familial, autosomal recessive" "" "Non detectable ERG" "16y" "" "?" "" "" "" "" "" "" "" "" "0000028823" "04210" "00038280" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028824" "04210" "00038281" "01251" "Familial, autosomal recessive" "" "Non detectable ERG" "6m" "" "?" "" "" "" "" "" "" "" "" "0000028825" "04210" "00038282" "01251" "Familial, autosomal recessive" "" "" "" "" "?" "" "" "" "" "" "" "" "" "0000028826" "04214" "00038283" "01251" "Familial, autosomal recessive" "" "Visual loss began during the third decade. Funduscopic examination and fluorescein angiography revealed typical advanced RP changes with bone spicule-like pigment deposits in the posterior pole and the midperiphery along with retinal atrophy, narrowing of the vessels, and waxy optic discs" "30y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028827" "04210" "00038284" "01251" "Familial, autosomal recessive" "" "Poor vision, nystagmus, attenuated vessels, posterior nummular pigmentation" "" "" "onset few months after birth" "" "" "" "" "" "" "" "" "0000028828" "04210" "00038285" "01251" "Familial, autosomal recessive" "" "Poor vision, attenuated vessels, posterior nummular pigmentation" "" "" "onset few months after birth" "" "" "" "" "" "" "" "" "0000028829" "00058" "00038286" "01251" "Familial, autosomal recessive" "11y" "childhood cone-rod dystrophy and macular cystic degeneration" "11y" "" "progressive visual loss" "" "" "" "" "" "" "" "" "0000028830" "00058" "00038287" "01251" "Familial, autosomal recessive" "7y" "childhood cone-rod dystrophy and macular cystic degeneration" "7y" "" "progressive visual loss" "" "" "" "" "" "" "" "" "0000028831" "00058" "00038288" "01251" "Familial, autosomal recessive" "7y" "childhood cone-rod dystrophy and macular cystic degeneration" "7y" "" "macular cystic degeneration" "" "" "" "" "" "" "" "" "0000028832" "04210" "00038289" "01251" "Familial, autosomal recessive" "5y" "?" "5y" "" "" "" "" "" "" "" "" "" "" "0000028833" "04210" "00038290" "01251" "Familial, autosomal recessive" "13y" "?" "13y" "" "?" "" "" "" "" "" "" "" "" "0000028834" "04210" "00038291" "01251" "Familial, autosomal recessive" "8y" "?" "8y" "" "?" "" "" "" "" "" "" "" "" "0000028835" "04210" "00038292" "01251" "Familial, autosomal recessive" "5y" "?" "5y" "" "" "" "" "" "" "" "" "" "" "0000028841" "00381" "00038298" "01251" "Familial, autosomal recessive" "" "Generalized retinal dystrophy, macular nummular pigmentation, yellowish crystalline-like spots in midperipheral retina, bone-spicule pigmentation at mid-peripheral retina, non-detectable ERG" "1y" "" "nystagmus" "" "" "" "" "" "" "" "" "0000028842" "00381" "00038299" "01251" "Familial, autosomal recessive" "" "Generalized retinal dystrophy, bone-spicule pigmentation at mid-peripheral retina" "" "" "onset early childhood, poor vision, nystagmus" "" "" "" "" "" "" "" "" "0000028843" "00381" "00038300" "01251" "Familial, autosomal recessive" "" "Generalized retinal dystrophy, non-detectable ERG" "" "" "onset early childhood, nystagmus, high hyperopia" "" "" "" "" "" "" "" "" "0000028844" "00381" "00038301" "01251" "Familial, autosomal recessive" "" "Generalized retinal dystrophy, bone-spicule pigmentation at mid-peripheral retina, non-detectable rod ERG and reduced cone ERG" "3y" "" "poor vision" "" "" "" "" "" "" "" "" "0000028845" "00381" "00038302" "01251" "Familial, autosomal recessive" "" "Generalized retinal dystrophy, macular nummular pigmentation, yellowish crystalline-like spots in midperipheral retina, bone-spicule pigmentation at mid-peripheral retina, non-detectable ERG" "2y" "" "poor vision, nystagmus" "" "" "" "" "" "" "" "" "0000028846" "00381" "00038303" "01251" "Familial, autosomal recessive" "" "Generalized retinal dystrophy, non-detectable ERG" "8y" "" "poor vision" "" "" "" "" "" "" "" "" "0000028847" "00381" "00038304" "01251" "Familial, autosomal recessive" "" "Generalized retinal dystrophy, macular nummular pigmentation, bone-spicule pigmentation at mid-peripheral retina, non-detectable rod ERG and reduced cone ERG" "6y" "" "poor vision" "" "" "" "" "" "" "" "" "0000028848" "04214" "00038305" "01251" "Familial, autosomal recessive" "" "Blurred vision since birth, photophobia, poor night vision, pale optic disc, heavy bone spicules 360 degree, macular RPE changes, non-recordable ERG" "11y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028849" "04214" "00038306" "01251" "Familial, autosomal recessive" "" "Progressive visual loss, poor night vision, tearing, photosensitivity, pale optic disc, heavy bone spicules 360 degree, macular RPE changes, non-recordable ERG" "25y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028850" "00381" "00038307" "01251" "Familial, autosomal recessive" "" "Attenuation of retinal arterioles, numerous pigment deposits, and RPE degeneration mainly in the temporal quadrant and the posterior pole" "25y" "" "?" "" "" "" "" "" "" "" "" "0000028851" "00381" "00038308" "01251" "Familial, autosomal recessive" "" "Attenuation of retinal arterioles, numerous pigment deposits, and RPE degeneration mainly in the temporal quadrant and the posterior pole" "" "" "?" "" "" "" "" "" "" "" "" "0000028852" "00381" "00038309" "01251" "Familial, autosomal recessive" "" "Attenuation of retinal arterioles, numerous pigment deposits, and RPE degeneration mainly in the temporal quadrant and the posterior pole" "" "" "?" "" "" "" "" "" "" "" "" "0000028853" "00381" "00038310" "01251" "Familial, autosomal recessive" "" "?" "<1y" "" "?" "" "" "" "" "" "" "" "" "0000028854" "00381" "00038311" "01251" "Familial, autosomal recessive" "" "?" "1y" "" "?" "" "" "" "" "" "" "" "" "0000028855" "00381" "00038312" "01251" "Familial, autosomal recessive" "" "?" "" "" "onset childhood" "" "" "" "" "" "" "" "" "0000028856" "04249" "00038313" "01251" "Familial, autosomal recessive" "" "Macular dystrophy" "25y" "" "decreased visual acuity" "" "" "" "" "" "" "" "" "0000028857" "04249" "00038314" "01251" "Familial, autosomal recessive" "" "Macular dystrophy" "32y" "" "decreased visual acuity" "" "" "" "" "" "" "" "" "0000028858" "04210" "00038315" "01251" "Familial, autosomal recessive" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028859" "04210" "00038316" "01251" "Familial, autosomal recessive" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028860" "04210" "00038317" "01251" "Familial, autosomal recessive" "" "Leber congenital amaurosis" "" "" "?" "" "" "" "" "" "" "" "" "0000028861" "04250" "00038318" "01251" "Unknown" "" "Retinal degeneration" "" "" "?" "" "" "" "" "" "" "" "" "0000028862" "00381" "00038319" "01251" "Familial, autosomal recessive" "" "early-onset retinal dystrophy, night blindness since infancy, de-pigmentation of the retinal pigment epithelium in the mid-periphery, ERGs were reduced, scotomas in the mid-periphery, numerous clumped pigments in the mid-periphery of the retina, bone-spicule pigmentation" "0d" "" "?" "" "" "" "" "" "" "" "" "0000028863" "04214" "00038320" "01251" "Familial, autosomal recessive" "" "Night blindness, diminished visual acuity, general RPE and macular atrophy, cataract, photophobia, hypermetropia, astigmatism" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028864" "04214" "00038321" "01251" "Familial, autosomal recessive" "" "early-onset retinitis pigmentosa, night blindness, cataract, ocular hypertension, nystagmus from birth" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028865" "04214" "00038322" "01251" "Familial, autosomal recessive" "" "early-onset retinitis pigmentosa, night blindness, round pigments distributed across the entire retina, hyperopia, astigmatism, nystagmus" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028866" "04210" "00038323" "01251" "Familial, autosomal recessive" "" "Night blindness since birth, nystagmus, dense cataract, corneal leukoma secondary to keratoconus, microphthalmus" "" "" "?" "" "" "" "" "" "" "" "" "0000028867" "04210" "00038324" "01251" "Familial, autosomal recessive" "" "Night blindness since birth, nystagmus, dense cataract, corneal leukoma secondary to keratoconus, microphthalmus" "" "" "?" "" "" "" "" "" "" "" "" "0000028868" "04214" "00038325" "01251" "Familial, autosomal recessive" "" "Bone spicule pigmentation, pale papilla, constricted arterioles, nystagmus since age 7 months" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028869" "04210" "00038326" "01251" "Familial, autosomal recessive" "" "Low vision, slightly pale optic disc, attenuation of retinal vessels, granular and greyish aspect of RPE, dense yellowish area in all macular region, nystagmus, photophobia" "" "" "?" "" "" "" "" "" "" "" "" "0000028870" "04214" "00038327" "01251" "Familial, autosomal recessive" "" "Night blindness, cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028871" "04214" "00038328" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028872" "04214" "00038329" "01251" "Familial, autosomal recessive" "" "Night blindness, pale optic disc, attenuated retinal vessels, bone spicule pigmentation, peripapillar atrophy, normal macula, photophobia, hearing loss, hypermetropia, astigmatism, subcapsular cataract" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028873" "04210" "00038330" "01251" "Familial, autosomal recessive" "" "Chorioretinal atrophy, extensive pigmentary mottling, narrowing of arterioles, stippling of the macula with extensive area of atrophy, severe keratoconus and cortical cataracts" "" "" "?" "" "" "" "" "" "" "" "" "0000028874" "04211" "00038331" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028875" "04211" "00038332" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028876" "04211" "00038333" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028877" "04211" "00038334" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028878" "04211" "00038335" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028879" "04214" "00038336" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028880" "04214" "00038337" "01251" "Familial, autosomal recessive" "" "Night blindness" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028881" "04214" "00038338" "01251" "Familial, autosomal recessive" "" "Bilateral visual loss, initial hemeralopy, restriction of visual field, gradual increased bone spicule pigmentation, decrease of visual acuity, attenuation of retinal vessels, reduced or undetectable ERG" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028882" "04210" "00038339" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028883" "04214" "00038340" "01251" "Familial, autosomal recessive" "" "Night blindness, peripheral visual loss, pigmentary deposits resembling bone spicules, attenuation of retinal vessels, pallor of the optic disc and diminution in a and b-wave amplitudes on the ERG" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028884" "04214" "00038341" "01251" "Familial, autosomal recessive" "" "Night blindness, peripheral visual loss, pigmentary deposits resembling bone spicules, attenuation of retinal vessels, pallor of the optic disc and diminution in a and b-wave amplitudes on the ERG" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028885" "04214" "00038342" "01251" "Familial, autosomal recessive" "" "Night blindness, peripheral visual loss, pigmentary deposits resembling bone spicules, attenuation of retinal vessels, pallor of the optic disc and diminution in a and b-wave amplitudes on the ERG" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028886" "04214" "00038343" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028887" "04214" "00038344" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028888" "04214" "00038345" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028889" "04214" "00038346" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028890" "00058" "00038347" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "" "" "0000028891" "04214" "00038348" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028892" "04214" "00038349" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028893" "04214" "00038350" "01251" "Familial, autosomal dominant" "" "" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028894" "04214" "00038351" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028895" "04214" "00038352" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028896" "04214" "00038353" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028897" "04214" "00038354" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028898" "04214" "00038355" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028899" "04214" "00038356" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028900" "04214" "00038357" "01251" "Isolated (sporadic)" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028901" "04214" "00038358" "01251" "Isolated (sporadic)" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028902" "04210" "00038359" "01251" "Familial, autosomal recessive" "" "Congenital blindness, congenital nystagmus, lack of detectable signals on an ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028903" "04210" "00038360" "01251" "Familial, autosomal recessive" "" "Congenital blindness, congenital nystagmus, lack of detectable signals on an ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028904" "04210" "00038361" "01251" "Familial, autosomal recessive" "" "Congenital blindness, congenital nystagmus, lack of detectable signals on an ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028905" "04210" "00038362" "01251" "Familial, autosomal recessive" "" "Congenital blindness, congenital nystagmus, lack of detectable signals on an ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028906" "04210" "00038363" "01251" "Familial, autosomal recessive" "" "Congenital blindness, congenital nystagmus, lack of detectable signals on an ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028907" "04210" "00038364" "01251" "Familial, autosomal recessive" "" "Congenital blindness, congenital nystagmus, lack of detectable signals on an ERG" "" "" "?" "" "" "" "" "" "" "" "" "0000028908" "04214" "00038365" "01251" "Isolated (sporadic)" "" "?" "21y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028909" "04214" "00038366" "01251" "Isolated (sporadic)" "" "?" "5y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028910" "04210" "00038367" "01251" "Isolated (sporadic)" "" "?" "4y" "" "?" "" "" "" "" "" "" "" "" "0000028911" "04210" "00038368" "01251" "Isolated (sporadic)" "" "?" "1y" "" "?" "" "" "" "" "" "" "" "" "0000028912" "04210" "00038369" "01251" "Isolated (sporadic)" "" "?" "1y" "" "?" "" "" "" "" "" "" "" "" "0000028913" "04214" "00038370" "01251" "Familial, autosomal recessive" "" "?" "" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028914" "04214" "00038371" "01251" "Isolated (sporadic)" "" "?" "41y" "" "?" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000039220" "04210" "00052643" "01424" "Familial, autosomal recessive" "" "Leber congenital amaurosis; congenital blindness, cone-rod dystrophies, reduced or non-detectable ERG" "" "" "" "" "" "" "" "" "" "" "" "0000056248" "00420" "00076473" "01695" "Familial, autosomal recessive" "" "Stargardt disease; At age 26: visual acuity of 10/100 in both eyes. Funduscopy revealed a maculopathy with RPE atrophy and hyperpigmentation and a few central yellowish flecks. . A slight temporal papillary pallor was present. Static perimetry could not reveal central scotomas, but shallow relative peripheral scotomas in both eyes. The full-field ERG response showed slightly reduced—but still within the normal range—amplitudes for rod, mixed cone-rod, cone single flash, and cone flicker, respectively." "14y" "" "visual acuity loss, photophobia, myopia, and astigmatism" "" "" "" "" "" "" "" "" "0000056249" "04214" "00076474" "01695" "Familial, autosomal recessive" "" "retinitis pigmentosa; Reduced visual acuity (10/100 right eye, 20/100 left eye) and diminished visual fields, hyperopia, astigmatism, and nystagmus. Anterior segments were normal. Funduscopy revealed roundish pigments distributed across the entire retina including peripheral retina, posterior pole, and macular region. The retinal vessels showed filliform constriction, and the optic disc was normal. Visual fields were concentrically constricted with small remaining central and nasal islands (less than 10 degrees). ERG responses (photopic and scotopic) were not discernible from noise anymore. Pigment spots homogeneously scattered through the retina with preservation of the PPRPE" "2y" "" "At 2: deficit of the peripheral visual field, at 14: night vision deficits and reduction of central visual actuity." "" "" "" "" "" "" "retinitis pigmentosa" "" "0000078339" "00381" "00100102" "01769" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000082906" "04214" "00105014" "01244" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000082921" "04214" "00105030" "01244" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000082922" "04210" "00105031" "01244" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000082923" "04214" "00105032" "01244" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000082924" "04214" "00105033" "01244" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000082925" "04214" "00105034" "01244" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000082936" "04214" "00105022" "01244" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000082940" "04210" "00105049" "01244" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000127949" "04210" "00155449" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "LCA" "" "0000127950" "04210" "00155450" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "LCA" "" "0000127951" "04214" "00155451" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127952" "04210" "00155452" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "LCA" "" "0000127953" "04210" "00155453" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "LCA" "" "0000127954" "04214" "00155454" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127955" "04210" "00155455" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "LCA" "" "0000127956" "04214" "00155456" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127957" "04210" "00155457" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "LCA" "" "0000127958" "04210" "00155458" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "LCA" "" "0000155467" "04214" "00207678" "01244" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000155471" "04210" "00207681" "01244" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000155477" "04210" "00207687" "01244" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000155484" "04214" "00207694" "01244" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000155485" "04214" "00207694" "01244" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000207295" "04210" "00269471" "03508" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000223166" "00198" "00295601" "01807" "Unknown" "" "Rod-cone dystrophy (HP:0000510)" "" "" "" "" "" "" "" "" "" "" "" "0000233841" "04214" "00308414" "00004" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000233929" "04214" "00308501" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233930" "04214" "00308502" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233931" "04214" "00308503" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233932" "04214" "00308504" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233933" "04214" "00308505" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000234037" "04214" "00308609" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000234038" "04214" "00308610" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000234429" "04214" "00309109" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234430" "04214" "00309110" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234431" "04214" "00309111" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234432" "04214" "00309112" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234435" "04214" "00309115" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234436" "04214" "00309116" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234437" "04214" "00309117" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234438" "04214" "00309118" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234439" "04214" "00309119" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234440" "04214" "00309120" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234441" "04214" "00309121" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234442" "04214" "00309122" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234443" "04214" "00309123" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234444" "04214" "00309124" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234445" "04214" "00309125" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234446" "04214" "00309126" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000234447" "04214" "00309127" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000242054" "04214" "00320010" "00008" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa with preserved para-arteriolar retinal pigment epithelium" "" "0000242055" "04214" "00320011" "00008" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa with preserved para-arteriolar retinal pigment epithelium" "" "0000242056" "04214" "00320012" "00008" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa with preserved para-arteriolar retinal pigment epithelium" "" "0000243901" "04214" "00325414" "00006" "Familial, autosomal recessive" "" "Leber congenital amaurosis" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000243915" "04214" "00325428" "00006" "Familial, autosomal recessive" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000243928" "04214" "00325441" "00006" "Familial, autosomal recessive" "" "Leber congenital amaurosis" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000243936" "04214" "00325449" "00006" "Familial, autosomal recessive" "" "Leber congenital amaurosis" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000243941" "04214" "00325454" "00006" "Familial, autosomal recessive" "" "cone-rod dystrophy" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000243959" "04214" "00325472" "00006" "Familial, autosomal recessive" "" "Leber congenital amaurosis" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000243993" "04214" "00325506" "00006" "Familial, autosomal recessive" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000243997" "04214" "00325510" "00006" "Familial, autosomal recessive" "" "cone-rod dystrophy" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000244008" "04214" "00325521" "00006" "Unknown" "" "Leber congenital amaurosis" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000245159" "04214" "00326693" "00008" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000246159" "04214" "00327932" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246172" "04214" "00327945" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000246173" "04214" "00327946" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246179" "04214" "00327952" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000246183" "04214" "00327956" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246212" "04214" "00327985" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000246213" "04214" "00327986" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000246243" "04214" "00328016" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000246312" "04214" "00328085" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000246336" "04214" "00328109" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000246415" "04214" "00328188" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000246459" "04214" "00328232" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246715" "04214" "00328489" "00000" "Familial, autosomal recessive" "14y" "retinal dystrophy (HP:0000556)" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000246723" "04214" "00328497" "00000" "Familial, autosomal recessive" "3y" "retinal dystrophy (HP:0000556), macular edema (HP:0040049)" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000246724" "04214" "00328498" "00000" "Familial, autosomal recessive" "12y" "retinal dystrophy (HP:0000556), macular edema (HP:0040049)" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000250171" "04214" "00331980" "00000" "Familial, autosomal dominant" "57y" "reduced visual acuity; scotopic ERG normal; photopic ERG normal" "49y" "" "reduced visual acuity" "" "" "" "" "" "" "macular dystrophy or cone-rod dystrophy" "" "0000250380" "04214" "00332193" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000250381" "04214" "00332194" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000250382" "04214" "00332195" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000250454" "04214" "00332267" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis, early-onset retinal dystrophy" "" "0000250455" "04214" "00332268" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis, early-onset retinal dystrophy" "" "0000250463" "04214" "00332276" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis, early-onset retinal dystrophy" "" "0000250552" "04214" "00332366" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000250553" "04214" "00332367" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000250578" "04214" "00332392" "00000" "Familial, autosomal recessive" "4y" "horizontal pendular nystagmus; fundus mottling granular; oculodigital sign; ERG extinguished" "" "" "" "" "" "" "" "" "LCA" "idiopathic infantile nystagmus" "" "0000250640" "04214" "00332456" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "LCA" "" "0000250650" "04214" "00332466" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "LCA" "" "0000250652" "04214" "00332468" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "EORP" "" "0000251539" "04214" "00333352" "00000" "Familial, autosomal recessive" "64y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251544" "04214" "00333357" "00000" "Familial, X-linked recessive" "39y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251546" "04214" "00333359" "00000" "Familial, autosomal dominant" "37y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251550" "04214" "00333363" "00000" "Unknown" "73y" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251585" "04214" "00333398" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RP" "" "0000251650" "04214" "00333465" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000252002" "04214" "00333817" "00000" "Familial, autosomal recessive" "14y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252003" "04214" "00333818" "00000" "Familial, autosomal recessive" "18y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (with CRB1 signs)" "" "0000252004" "04214" "00333819" "00000" "Familial, autosomal recessive" "7y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (with CRB1 signs)" "" "0000252005" "04214" "00333820" "00000" "Familial, autosomal recessive" "14y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (with CRB1 signs)" "" "0000252006" "04214" "00333821" "00000" "Familial, autosomal recessive" "44y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (with CRB1 signs)" "" "0000252007" "04214" "00333822" "00000" "Familial, autosomal recessive" "52y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252084" "04214" "00333899" "00000" "Familial, autosomal recessive" "55y" "clinical category IA1aiii" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252108" "04214" "00333923" "00000" "Familial, autosomal recessive" "60y" "clinical category IA1b" "" "" "" "" "" "" "" "" "" "cone rod dystrophy" "" "0000252109" "04214" "00333924" "00000" "Familial, autosomal recessive" "45y" "clinical category IA1b" "" "" "" "" "" "" "" "" "" "cone rod dystrophy" "" "0000252123" "04214" "00333938" "00000" "Familial, autosomal recessive" "14y" "clinical category IA2a" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000252131" "04214" "00333946" "00000" "Familial, autosomal recessive" "14y" "clinical category IA2b" "" "" "" "" "" "" "" "" "" "severe early childhood onset retinal dystrophy" "" "0000252132" "04214" "00333947" "00000" "Familial, autosomal recessive" "18y" "clinical category IA2b" "" "" "" "" "" "" "" "" "" "severe early childhood onset retinal dystrophy" "" "0000252133" "04214" "00333948" "00000" "Familial, autosomal recessive" "14y" "clinical category IA2b" "" "" "" "" "" "" "" "" "" "early childhood onset retinal dystrophy" "" "0000252154" "04214" "00333969" "00000" "Familial, autosomal recessive" "8y" "clinical category IA2c" "" "" "" "" "" "" "" "" "" "early childhood onset retinal dystrophy" "" "0000252155" "04214" "00333970" "00000" "Familial, autosomal recessive" "12y" "clinical category IA2c" "" "" "" "" "" "" "" "" "" "early childhood onset retinal dystrophy" "" "0000252156" "04214" "00333971" "00000" "Familial, autosomal recessive" "13y" "clinical category IA2c" "" "" "" "" "" "" "" "" "" "early childhood onset retinal dystrophy with CRB1 signs" "" "0000252297" "04214" "00334112" "00000" "Familial, autosomal recessive" "53y" "clinical category II" "" "" "" "" "" "" "" "" "" "papillocentric macular dystrophy" "" "0000252298" "04214" "00334113" "00000" "Familial, autosomal recessive" "48y" "clinical category II" "" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000252445" "04214" "00334260" "00000" "Familial, autosomal recessive" "84y" "clinical category IIA" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000252463" "04214" "00334278" "00000" "Familial, autosomal recessive" "15y" "clinical category IIIB2" "" "" "" "" "" "" "" "" "" "retinoschisis (AR)" "" "0000252503" "04214" "00334414" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252601" "04214" "00334561" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252602" "04214" "00334562" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252823" "00198" "00335108" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000252824" "00198" "00335109" "00000" "Unknown" "" "19y-diagnosis visual impairment" "" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000252955" "04214" "00335240" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa vs cone-rod dystrophy" "" "0000252956" "04214" "00335241" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000252983" "04214" "00335268" "02485" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252984" "04214" "00335269" "02485" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252985" "04214" "00335270" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252986" "04214" "00335271" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252987" "04214" "00335272" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252988" "04214" "00335273" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253340" "04214" "00335394" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253357" "04214" "00335411" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253431" "04214" "00335486" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253432" "04214" "00335487" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253433" "04214" "00335488" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253886" "04214" "00335971" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000254164" "04214" "00358904" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000254165" "04214" "00358905" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000254256" "04214" "00358958" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000254264" "04214" "00358966" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000254267" "04214" "00358969" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000254268" "04214" "00358970" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000254278" "04214" "00358980" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000254327" "04214" "00359030" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000254329" "04214" "00359032" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000254353" "04214" "00359056" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" "" "0000254361" "04214" "00359064" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" "" "0000254362" "04214" "00359065" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" "" "0000254364" "04214" "00359067" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" "" "0000254371" "04214" "00359074" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" "" "0000254379" "04214" "00359082" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" "" "0000254380" "04214" "00359083" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" "" "0000254387" "04214" "00359090" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" "" "0000254394" "04214" "00359097" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" "" "0000254396" "04214" "00359099" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis or early onset rod-cone dystrophy" "" "0000254408" "04214" "00359111" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254427" "04214" "00359130" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254432" "04214" "00359135" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254443" "04214" "00359146" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254471" "04214" "00359174" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254490" "04214" "00359193" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254493" "04214" "00359196" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254496" "04214" "00359199" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254516" "04214" "00359219" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254638" "04214" "00359367" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000254641" "04214" "00359370" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000257580" "04214" "00362166" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000258271" "04214" "00362905" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258803" "04214" "00363442" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258804" "04214" "00363443" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258805" "04214" "00363444" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258815" "04214" "00363454" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258816" "04214" "00363455" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258872" "04214" "00363523" "00000" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258873" "04214" "00363524" "00000" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258933" "04214" "00363583" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000258960" "04214" "00363610" "00000" "Isolated (sporadic)" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000258978" "04214" "00363628" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000259000" "04214" "00363650" "00000" "Isolated (sporadic)" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy (early onset)" "" "0000259043" "04214" "00363693" "00000" "Isolated (sporadic)" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000259078" "04214" "00363728" "00000" "Isolated (sporadic)" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000259102" "04214" "00363752" "00000" "Isolated (sporadic)" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000264292" "04214" "00368954" "01695" "Unknown" "" "" "<19y" "" "unknown" "" "" "" "" "" "" "pigmentary retinal dystrophy" "" "0000267388" "04214" "00372059" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267389" "04214" "00372060" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267390" "04214" "00372061" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267397" "04214" "00372068" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267724" "04214" "00372409" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267725" "04214" "00372410" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267726" "04214" "00372411" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267741" "04214" "00372426" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267742" "04214" "00372427" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267743" "04214" "00372428" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267744" "04214" "00372429" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267745" "04214" "00372430" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267746" "04214" "00372431" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267747" "04214" "00372432" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267748" "04214" "00372433" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267774" "04214" "00372459" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267777" "04214" "00372462" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267778" "04214" "00372463" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267779" "04214" "00372464" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267780" "04214" "00372465" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267781" "04214" "00372466" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267782" "04214" "00372467" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267783" "04214" "00372468" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267784" "04214" "00372469" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267785" "04214" "00372470" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267812" "04214" "00372497" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000267904" "04214" "00372625" "00000" "Familial, autosomal dominant" "33y" "see paper; ..." "31y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267930" "04214" "00372651" "00000" "Familial, autosomal recessive" "15y" "see paper; ..." "5y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267931" "04214" "00372652" "00000" "Familial, autosomal recessive" "43y" "see paper; ..." "33y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267949" "04214" "00372670" "00000" "Familial, autosomal recessive" "29y" "see paper; ..." "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267952" "04214" "00372673" "00000" "Familial, autosomal recessive" "15y" "see paper; ..." "11y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267965" "04214" "00372686" "00000" "Isolated (sporadic)" "34y" "see paper; ..." "24y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267979" "04214" "00372700" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267995" "04214" "00372716" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267996" "04214" "00372717" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267999" "04214" "00372720" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268004" "04214" "00372725" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268005" "04214" "00372726" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268018" "04214" "00372739" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268690" "04214" "00373414" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268777" "04214" "00373501" "00000" "Familial, autosomal recessive" "27y" "see paper; ..." "3y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268797" "04214" "00373521" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Stargardt macular dystrophy" "" "0000268802" "04214" "00373526" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Stargardt macular dystrophy" "" "0000268971" "04214" "00373748" "00008" "Familial, autosomal recessive" "12y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000268972" "04214" "00373749" "00008" "Familial, autosomal recessive" "14y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000268973" "04214" "00373750" "00008" "Familial, autosomal recessive" "24y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000268974" "04214" "00373751" "00008" "Familial, autosomal recessive" "28y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000269014" "04214" "00373805" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269060" "04214" "00373851" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269096" "04214" "00373887" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000269099" "04214" "00373890" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "fundus albipunctatus" "" "0000269126" "04214" "00373917" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269128" "04214" "00373919" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269138" "04214" "00373929" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269141" "04214" "00373932" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269142" "04214" "00373933" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269162" "04214" "00373953" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269163" "04214" "00373954" "00000" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269164" "04214" "00373955" "00000" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270147" "04214" "00374937" "00000" "Isolated (sporadic)" "10y" "best corrected visual acuity fingers count/0.3" "5y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270635" "04214" "00375421" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271377" "04214" "00376167" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "" "multiplex renitis pigmentosa" "" "0000271448" "04214" "00376240" "00000" "Familial, autosomal recessive" "60y" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000271675" "04214" "00376468" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000271676" "04214" "00376469" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000271680" "04214" "00376473" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000271686" "04214" "00376479" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000271719" "04214" "00376512" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271925" "04214" "00376714" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000271969" "04214" "00376758" "00000" "Familial, autosomal recessive" "76y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271973" "04214" "00376762" "00000" "Familial, autosomal recessive" "21y" "" "" "" "" "" "" "" "" "" "" "Nyctalopia, reduced peripheral vision" "" "0000271977" "04214" "00376766" "00000" "Familial, autosomal recessive" "17y" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000271993" "04214" "00376782" "00000" "Familial, autosomal dominant" "41y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271996" "04214" "00376785" "00000" "Familial, X-linked" "18y" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000272328" "04214" "00377170" "00000" "Familial, autosomal recessive" "60y" "see paper" "6y" "6y" "" "" "" "" "" "" "retinitis pigmentosa, with/without PPRPE, type 12 (RP12)" "retinal disease" "" "0000272350" "04214" "00377192" "00000" "Familial, autosomal recessive" "11y" "see paper" "4y" "6y" "" "" "" "" "" "" "Leber congenital amaurosis, type 8 (LCA-8)" "retinal disease" "" "0000272359" "04214" "00377201" "00000" "Familial, autosomal recessive" "8y" "see paper" "1y" "6y" "" "" "" "" "" "" "Leber congenital amaurosis, type 8 (LCA-8)" "retinal disease" "" "0000272673" "04214" "00377523" "00000" "Isolated (sporadic)" "" "see paper" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "retinal disease" "" "0000272678" "04214" "00377528" "00000" "Isolated (sporadic)" "" "see paper" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "retinal disease" "" "0000272679" "04214" "00377529" "00000" "Isolated (sporadic)" "" "see paper" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "retinal disease" "" "0000272962" "04214" "00377816" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Juvenile Retinitis pigmentaria" "" "0000272963" "04214" "00377817" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Juvenile Retinitis pigmentaria" "" "0000272985" "04214" "00377839" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Typical Retinitis pigmentaria" "" "0000273036" "04214" "00377890" "00000" "Unknown" "1y6m" "" "<1y" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000273037" "04214" "00377891" "00000" "Isolated (sporadic)" "11m" "" "10m" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000273049" "04214" "00377903" "00000" "Unknown" "10y" "" "<1y" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000273053" "04214" "00377907" "00000" "Isolated (sporadic)" "4y5m" "nystagmus, poor vision" "2m" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000273055" "04214" "00377909" "00000" "Isolated (sporadic)" "4y7m" "nystagmus, poor vision" "<1y" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000273056" "04214" "00377910" "00000" "Isolated (sporadic)" "1y6m" "poor vision; roving nystagmus" "<1y" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" "" "0000273085" "04214" "00377939" "00000" "Familial, X-linked" "59y" "" "12y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273096" "04214" "00377950" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273248" "04214" "00379375" "00000" "Unknown" "40y" "" "8y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273492" "04210" "00379648" "03508" "Familial, autosomal recessive" "" "HP:0000662,\tHP:0001129,\tHP:0000007,\tHP:0001483" "" "" "" "" "" "" "" "" "" "" "" "0000273675" "04214" "00379821" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273676" "04214" "00379822" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273677" "04214" "00379823" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273678" "04214" "00379824" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa?" "" "0000273679" "04214" "00379825" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa?" "" "0000273680" "04214" "00379826" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000274051" "04214" "00380196" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000274858" "04214" "00381007" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000274877" "04214" "00381026" "00000" "Isolated (sporadic)" "<1y" "poor vision, nystagmus" "6y10m" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000274891" "04214" "00381040" "00000" "Di-genic" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000274900" "04214" "00381049" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000274935" "04214" "00381084" "00000" "Familial" "43y" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000274937" "04214" "00381086" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000274939" "04214" "00381088" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000274940" "04214" "00381089" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275439" "04214" "00381597" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275440" "04214" "00381598" "00000" "Unknown" "" "" "20y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275441" "04214" "00381599" "00000" "Isolated (sporadic)" "" "" "28y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275450" "04214" "00381608" "00000" "Isolated (sporadic)" "" "" "38y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275466" "04214" "00381624" "00000" "Isolated (sporadic)" "" "" "37y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275469" "04214" "00381627" "00000" "Isolated (sporadic)" "" "" "26y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275472" "04214" "00381630" "00000" "Familial, autosomal recessive" "" "" "6y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275484" "04214" "00381642" "00000" "Familial, autosomal recessive" "" "" "10y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000275660" "04214" "00381818" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa Simplex" "" "0000275710" "04214" "00381868" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275711" "04214" "00381869" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275712" "04214" "00381870" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275713" "04214" "00381871" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275777" "04214" "00381935" "00000" "Familial, autosomal recessive" "45y" "BCVA OD-OS:light perception-hand movement; nystagmus; cataract" "9m" "" "" "" "" "" "" "" "Early onset retinal dystrophy" "" "" "0000275778" "04214" "00381936" "00000" "Familial, autosomal recessive" "61y" "nystagmus; strabismus" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000275779" "04214" "00381937" "00000" "Familial, autosomal recessive" "25y" "nystagmus; cataract" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000275780" "04214" "00381938" "00000" "Familial, autosomal recessive" "27y" "BCVA OD-OS:1/35-1/35; nystagmus; cataract" "6m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000275781" "04214" "00381939" "00000" "Familial, autosomal recessive" "55y" "BCVA OD-OS:light perception; strabismus ; anti-phospholipidsyndrome, asthma" "3y" "" "" "" "" "" "" "" "Early onset retinal dystrophy" "" "" "0000275782" "04214" "00381940" "00000" "Familial, autosomal recessive" "28y" "BCVA OD-OS:1/5-1/5; nystagmus; cataract" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000275801" "04214" "00381959" "00000" "Familial, autosomal recessive" "10y" "" "5m" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000275975" "02286" "00382133" "00000" "Familial, autosomal recessive" "" "retinal dystrophy; MIM, 600105, 613835" "" "" "" "" "" "" "" "" "" "MIM, 600105, 613835" "" "0000276115" "04214" "00382266" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276116" "04214" "00382267" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000276117" "04214" "00382268" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276118" "04214" "00382269" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276119" "04214" "00382270" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276120" "04214" "00382271" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276121" "04214" "00382272" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276124" "04214" "00382275" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276379" "04214" "00382530" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276380" "04214" "00382531" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276381" "04214" "00382532" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276382" "04214" "00382533" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Generalized retinal dystrophy (non-syndromic)" "" "0000276383" "04214" "00382534" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276384" "04214" "00382535" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276385" "04214" "00382536" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276642" "04214" "00382786" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276856" "04214" "00383066" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000276870" "04214" "00383080" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000276883" "04214" "00383093" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000277208" "04214" "00383423" "00000" "Familial, autosomal recessive" "" "" "0y" "" "" "" "" "" "" "" "" "CRB1 phenotype" "" "0000277209" "04214" "00383424" "00000" "Familial, autosomal recessive" "" "" "2y" "" "" "" "" "" "" "" "" "CRB1 phenotype" "" "0000277210" "04214" "00383425" "00000" "Familial, autosomal recessive" "" "" "0y" "" "" "" "" "" "" "" "" "CRB1 phenotype" "" "0000277211" "04214" "00383426" "00000" "Familial, autosomal recessive" "" "" "0y" "" "" "" "" "" "" "" "" "CRB1 phenotype" "" "0000277212" "04214" "00383427" "00000" "Familial, autosomal recessive" "" "" "11y" "" "" "" "" "" "" "" "" "CRB1 phenotype" "" "0000277213" "04214" "00383428" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "CRB1 phenotype" "" "0000277528" "04214" "00383743" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277529" "04214" "00383744" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277534" "04214" "00383749" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277542" "04214" "00383757" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277585" "04214" "00383800" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277633" "04214" "00383848" "00000" "Familial, autosomal recessive" "16y" "BCVA OD-OS: 20/80-20/80" "" "15y" "" "" "" "" "" "" "" "" "" "0000277634" "04214" "00383849" "00000" "Familial, autosomal recessive" "59y" "BCVA OD-OS: 20/60-20/60" "" "59y" "" "" "" "" "" "" "" "" "" "0000277690" "04214" "00383905" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277725" "04214" "00383940" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277739" "04214" "00383954" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277744" "04214" "00383959" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277758" "04214" "00383973" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277764" "04214" "00383979" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277776" "04214" "00383991" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277781" "04214" "00383996" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277782" "04214" "00383997" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277786" "04214" "00384001" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277789" "04214" "00384004" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277792" "04214" "00384007" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277794" "04214" "00384009" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277802" "04214" "00384017" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277813" "04214" "00384028" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277843" "04214" "00384058" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277849" "04214" "00384064" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277864" "04214" "00384079" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277886" "04214" "00384101" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277901" "04214" "00384116" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277920" "04214" "00384135" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277921" "04214" "00384136" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277938" "04214" "00384153" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277939" "04214" "00384154" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277947" "04214" "00384162" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277949" "04214" "00384164" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277955" "04214" "00384170" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277995" "04214" "00384210" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277999" "04214" "00384214" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000278165" "04214" "00384380" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000278195" "04214" "00384410" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000278261" "04214" "00384476" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000278523" "04214" "00384740" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278537" "04214" "00384754" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278538" "04214" "00384755" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278539" "04214" "00384756" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278792" "04214" "00385008" "00000" "Isolated (sporadic)" "26y" "no nyctalopia/photophobia, no nystagmus, best corrected visual acuity right/left eye: 0.01/0.01" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000278801" "04214" "00385017" "00000" "Familial, autosomal recessive" "51y" "nyctalopia, nystagmus, no oculodigital sign, best corrected visual acuity right/left eye: LP/LP" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000278814" "04214" "00385030" "00000" "Isolated (sporadic)" "5y" "no nyctalopia/photophobia, nystagmus, best corrected visual acuity right/left eye: 0.1/0.1" "3y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" "" "0000278820" "04214" "00385036" "00000" "Familial, autosomal recessive" "19y" "no nyctalopia/photophobia, nystagmus, best corrected visual acuity right/left eye: FC/0.1" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000278821" "04214" "00385037" "00000" "Isolated (sporadic)" "35y" "no nyctalopia/photophobia, no nystagmus, no oculodigital sign, best corrected visual acuity right/left eye: 0.01/0.02" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000278823" "04214" "00385039" "00000" "Isolated (sporadic)" "5y" "nyctalopia, nystagmus, best corrected visual acuity right/left eye: NA" "6m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000278833" "04214" "00385049" "00000" "Familial, autosomal recessive" "18y" "nyctalopia, no nystagmus, no oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: HM/HM" "5y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" "" "0000278841" "04214" "00385057" "00000" "Isolated (sporadic)" "38y" "nyctalopia, no nystagmus, no oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: 0.02/FC" "5y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" "" "0000278868" "04214" "00385084" "00000" "Isolated (sporadic)" "5y" "nyctalopia, no nystagmus, no oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: NA" "3y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" "" "0000278871" "04214" "00385087" "00000" "Isolated (sporadic)" "5y" "no nyctalopia/photophobia, nystagmus, no oculodigital sign, best corrected visual acuity right/left eye: NA" "3y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" "" "0000278874" "04214" "00385090" "00000" "Isolated (sporadic)" "6y" "nyctalopia, no nystagmus, no oculodigital sign, ERG extinguished, best corrected visual acuity right/left eye: 0.1/0.05" "3y" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "early onset severe retinal dystrophy" "" "0000279402" "04214" "00385607" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000279403" "04214" "00385608" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000279404" "04214" "00385609" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000279406" "04214" "00385611" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" "" "0000279408" "04214" "00385613" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000279767" "04214" "00385966" "00000" "Familial" "" "" "4y" "" "" "" "" "" "" "" "" "Level congenital Amaurosis" "" "0000279768" "04214" "00385967" "00000" "Familial" "" "" "4y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000279963" "04214" "00386160" "00000" "Familial, autosomal dominant" "67y" "" "" "56y" "" "" "" "" "" "" "late onset��retinal deg" "" "" "0000279973" "04214" "00386170" "00000" "Familial, autosomal dominant" "33y" "" "" "33y" "" "" "" "" "" "" "cone-rod dystrophy" "Best macular dystrophy" "" "0000280002" "04214" "00386199" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000280004" "04214" "00386201" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000280010" "04214" "00386207" "00000" "Familial, autosomal recessive" "22y" "" "" "16y" "" "" "" "" "" "" "Stargardt Disease" "" "" "0000280027" "04214" "00386224" "00000" "Familial, autosomal recessive" "14y" "" "" "5y" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000280034" "04214" "00386231" "00000" "Familial, autosomal recessive" "3y" "" "" "2y" "" "" "" "" "" "" "early onset retinitis pigmentosa" "" "" "0000280086" "04214" "00386283" "00000" "Familial, autosomal recessive" "45y" "" "" "34y" "" "" "" "" "" "" "" "" "" "0000280369" "04214" "00386569" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280521" "04214" "00386721" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280583" "04214" "00386783" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280644" "04214" "00386844" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280657" "04214" "00386857" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000281209" "04214" "00387646" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Childhood retinal disease" "" "0000281210" "04214" "00387647" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Childhood retinal disease" "" "0000281211" "04214" "00387648" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Childhood retinal disease" "" "0000281212" "04214" "00387649" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Childhood retinal disease" "" "0000281213" "04214" "00387650" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Childhood retinal disease" "" "0000281214" "04214" "00387651" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Childhood retinal disease" "" "0000281215" "04214" "00387652" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Childhood retinal disease" "" "0000281216" "04214" "00387653" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Childhood retinal disease" "" "0000281217" "04214" "00387654" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Childhood retinal disease" "" "0000281218" "04214" "00387655" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Childhood retinal disease" "" "0000281219" "04214" "00387656" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Childhood retinal disease" "" "0000281746" "04214" "00388153" "00000" "Unknown" "4y0m" "Nystagmus: 4Hz pendular bilateral symmetric, best corrected visual acuity right eye/left eye: CSM/CSM, fundus: Coloboma like lesion at macula & Pigmentary retinopathy, ERG: Extinguished" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "Leber congenital amaurosis" "" "0000281789" "04214" "00388196" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000281790" "04214" "00388197" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000282031" "04214" "00388479" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy (RD)" "" "0000282481" "04214" "00388940" "00000" "Familial, autosomal recessive" "27y" "age at genetic diagnosis mentioned" "" "20y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282482" "04214" "00388941" "00000" "Familial, autosomal recessive" "25y" "age at genetic diagnosis mentioned" "" "18y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282531" "04214" "00388990" "00000" "Familial, autosomal recessive" "71y" "age at genetic diagnosis mentioned" "" "64y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282532" "04214" "00388991" "00000" "Familial, autosomal recessive" "84y" "age at genetic diagnosis mentioned" "" "77y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282533" "04214" "00388992" "00000" "Familial, autosomal recessive" "79y" "age at genetic diagnosis mentioned" "" "72y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282547" "04214" "00389006" "00000" "Familial, autosomal recessive" "60y" "age at genetic diagnosis mentioned" "" "54y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282565" "04214" "00389024" "00000" "Familial, autosomal recessive" "28y" "age at genetic diagnosis mentioned" "" "22y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282586" "04214" "00389045" "00000" "Familial, autosomal recessive" "37y" "age at genetic diagnosis mentioned" "" "34y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282589" "04214" "00389048" "00000" "Familial, autosomal recessive" "27y" "age at genetic diagnosis mentioned" "" "19y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282590" "04214" "00389049" "00000" "Familial, autosomal recessive" "23y" "age at genetic diagnosis mentioned" "" "16y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282601" "04214" "00389060" "00000" "Familial, autosomal recessive" "12y" "age at genetic diagnosis mentioned" "" "9y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282606" "04214" "00389065" "00000" "Familial, autosomal recessive" "29y" "age at genetic diagnosis mentioned" "" "26y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282607" "04214" "00389066" "00000" "Familial, autosomal recessive" "29y" "age at genetic diagnosis mentioned" "" "26y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282624" "04214" "00389083" "00000" "Familial, autosomal recessive" "42y" "age at genetic diagnosis mentioned" "" "39y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282676" "04214" "00389135" "00000" "Familial, autosomal recessive" "25y" "age at genetic diagnosis mentioned" "" "23y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282679" "04214" "00389138" "00000" "Familial, autosomal recessive" "7y" "age at genetic diagnosis mentioned" "" "6y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282680" "04214" "00389139" "00000" "Familial, autosomal recessive" "5y" "age at genetic diagnosis mentioned" "" "3y" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000282740" "04214" "00389199" "00000" "Familial, autosomal recessive" "29y" "age at genetic diagnosis mentioned" "" "24y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282832" "04214" "00389291" "00000" "Familial, autosomal recessive" "59y" "age at genetic diagnosis mentioned" "" "51y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282886" "04214" "00389345" "00000" "Familial, autosomal recessive" "44y" "age at genetic diagnosis mentioned" "" "37y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000283116" "04214" "00389575" "00000" "Familial, autosomal recessive" "34y" "age at genetic diagnosis mentioned" "" "33y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000283184" "04214" "00389643" "00000" "Isolated (sporadic)" "37y" "age at genetic diagnosis mentioned" "" "31y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283195" "04214" "00389654" "00000" "Isolated (sporadic)" "24y" "age at genetic diagnosis mentioned" "" "17y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283236" "04214" "00389695" "00000" "Isolated (sporadic)" "58y" "age at genetic diagnosis mentioned" "" "56y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283249" "04214" "00389708" "00000" "Familial, autosomal recessive" "64y" "age at genetic diagnosis mentioned" "" "61y" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000283369" "04214" "00389828" "00000" "Familial, autosomal recessive" "54y" "age at genetic diagnosis mentioned" "" "53y" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000283486" "04214" "00389945" "00000" "Isolated (sporadic)" "69y" "age at genetic diagnosis mentioned" "" "67y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283492" "04214" "00389951" "00000" "Isolated (sporadic)" "43y" "age at genetic diagnosis mentioned" "" "40y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283527" "04214" "00389986" "00000" "Isolated (sporadic)" "27y" "age at genetic diagnosis mentioned" "" "26y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283570" "04214" "00390030" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa with early-onset primary angle closure glaucoma" "retinitis pigmentosa with early-onset primary angle closure glaucoma" "" "0000283778" "04214" "00390240" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283779" "04214" "00390241" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283780" "04214" "00390242" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283781" "04214" "00390243" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283782" "04214" "00390244" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283783" "04214" "00390245" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000284236" "04214" "00390748" "00000" "Familial, autosomal recessive" "8y" "Visual acuity right eye_left eye: light perception_light perception, right eye preserved paraarteriolar rpe, peripheral nummular pigment clumping and atrophy left eye coats-like exudative vasculopathy, ERG: extinct response" "0m" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000284237" "04214" "00390749" "00000" "Familial, autosomal recessive" "48y" "Visual acuity right eye/left eye: hand movement_hand movement, cone-rod dystrophy with yellowish macular deposits, mid-peripheral nummular pigment clumping and atrophy, macular atrophy" "10y" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000284238" "04214" "00390750" "00000" "Familial, autosomal recessive" "14y" "Visual acuity right eye/left eye: 1/20_1/20, cone-rod dystrophy with yellowish macular deposits nummular pigment clumping and atrophy, macular disorganization and cysts" "6y" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000284240" "04214" "00390752" "00000" "Familial, autosomal recessive" "44y" "Visual acuity right eye/left eye: light perception_light perception, few bone spicule shaped deposits in the mid periphery along with atrophy of the periphery retina,, early macular atrophy, right eye macular hole, left eye macular atrophy, ERG: altered photopic and scotopic responses" "10y" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000284281" "04214" "00390793" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000284329" "04214" "00390841" "00000" "Unknown" "21y-25y" "" "" "" "" "" "" "" "" "" "" "macular dystrophy (MD)" "" "0000284367" "04214" "00390879" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000284369" "04214" "00390881" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000284381" "04214" "00390893" "00000" "Familial, autosomal recessive" "31y-35y" "" "" "" "" "" "" "" "" "" "" "macular dystrophy (MD)" "" "0000284597" "04214" "00391155" "00000" "Unknown" "57y" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000284794" "04214" "00391354" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa 12 (600105)" "Retinitis pigmentosa 12 (600105)" "" "0000284853" "04214" "00391517" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "" "0000284854" "04214" "00391518" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "" "0000284855" "04214" "00391519" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "" "0000284856" "04214" "00391520" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "" "0000284857" "04214" "00391521" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "" "0000284858" "04214" "00391522" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "" "0000284859" "04214" "00391523" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "early onset severe retinal dystrophy" "" "0000284860" "04214" "00391524" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy" "" "0000284952" "04214" "00391627" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/800;20/400" "2m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284953" "04214" "00391628" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/60:20/100" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284954" "04214" "00391629" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/400;20/400" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284955" "04214" "00391630" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/400;20/400" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284956" "04214" "00391631" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/400;20/400" "<1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284957" "04214" "00391632" "00000" "Unknown" "" "best corrected visual acuity right/left eye: hand movement" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284958" "04214" "00391633" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/80;20/50" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284959" "04214" "00391634" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/3200;20/3200" "<1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284960" "04214" "00391635" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/1600;20/1600" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284961" "04214" "00391636" "00000" "Unknown" "" "best corrected visual acuity right/left eye: light perception" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284962" "04214" "00391637" "00000" "Unknown" "" "best corrected visual acuity right/left eye: hand movement" "3m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284963" "04214" "00391638" "00000" "Unknown" "" "best corrected visual acuity right/left eye: counting fingers;hand movement" "<1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000284964" "04214" "00391639" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/200;20/200" "0m" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000285046" "04214" "00391721" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/30;20/200" "3y" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000285047" "04214" "00391722" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/800;20/800" "4y" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000285048" "04214" "00391723" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/400:20/400" "5y" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000285049" "04214" "00391724" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/60;20/80" "5y" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000285050" "04214" "00391725" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/150;20/800" "6y" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000285051" "04214" "00391726" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/60;20/60" "2y" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000285052" "04214" "00391727" "00000" "Unknown" "" "best corrected visual acuity right/left eye: 20/800;20/800" "7y" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "" "0000285166" "04214" "00391865" "00000" "Isolated (sporadic)" "36y" "best corrected visual acuity right/left eye: 0.03/0.05; nummular fundus pigmentation, beaten bronze appearance and outer retinal atrophy in the macula. Fundus autofluorescence: hypoautofluorescence in the central macula, extending to the peripapillary retina in the both eyes, spectral-domain optical coherence tomography: loss of physiologic lamination of the outer retina, leading to macular atrophy and degeneration, foveal ellipsoid zone was absent. Small hyperreflective dots were found in the inner and outer retinal layers; visual fields showed a relative scotoma in central field and concentrically constricted peripherals fields; full-field electroretinography showed reduced cone function with preserved rod function." "" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000286579" "04214" "00393338" "00000" "Isolated (sporadic)" "41y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000286580" "04214" "00393339" "00000" "Isolated (sporadic)" "46y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000286581" "04214" "00393340" "00000" "Isolated (sporadic)" "48y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000286582" "04214" "00393341" "00000" "Isolated (sporadic)" "53y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000286649" "04214" "00393443" "00000" "Isolated (sporadic)" "27y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286685" "04214" "00393479" "00000" "Isolated (sporadic)" "48y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286773" "04214" "00393567" "00000" "Isolated (sporadic)" "40y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286799" "04214" "00393593" "00000" "Isolated (sporadic)" "6y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" "" "0000286921" "04214" "00393715" "00000" "Isolated (sporadic)" "2y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" "" "0000286944" "04214" "00393738" "00000" "Isolated (sporadic)" "37y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286960" "04214" "00393754" "00000" "Isolated (sporadic)" "26y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286965" "04214" "00393759" "00000" "Isolated (sporadic)" "24y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286970" "04214" "00393764" "00000" "Familial, autosomal dominant" "10y" "" "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis (LCA)" "" "0000286984" "04214" "00393778" "00000" "Isolated (sporadic)" "23y" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" "" "0000287055" "04214" "00393849" "00000" "Isolated (sporadic)" "32y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287071" "04214" "00393865" "00000" "Familial, autosomal recessive" "30y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287095" "04214" "00393889" "00000" "Isolated (sporadic)" "44y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287096" "04214" "00393890" "00000" "Familial, autosomal recessive" "35y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287125" "04214" "00393919" "00000" "Isolated (sporadic)" "26y" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287763" "04214" "00394560" "00000" "Unknown" "49y" "" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287764" "04214" "00394561" "00000" "Familial, autosomal recessive" "29y" "" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287765" "04214" "00394562" "00000" "Familial, autosomal recessive" "56y" "" "6y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287766" "04214" "00394563" "00000" "Familial, autosomal recessive" "56y" "" "20y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287767" "04214" "00394564" "00000" "Familial, autosomal recessive" "52y" "" "6y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287768" "04214" "00394565" "00000" "Familial, autosomal recessive" "26y" "" "4y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287769" "04214" "00394566" "00000" "Familial, autosomal recessive" "39y" "" "5y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287770" "04214" "00394567" "00000" "Familial, autosomal recessive" "40y" "" "1y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287771" "04214" "00394568" "00000" "Familial, autosomal recessive" "51y" "" "4y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287772" "04214" "00394569" "00000" "Familial, autosomal recessive" "72y" "" "5y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000288625" "04214" "00395426" "00000" "Familial, autosomal recessive" "40y" "Central vision impairment, counting fingers at 40 cm/0.01" "45y" "" "" "" "" "" "" "" "cone-rod dystrophy and primary open angle glaucoma" "" "" "0000288936" "04214" "00395774" "00000" "Unknown" "25y" "" "1y" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000288956" "04214" "00395794" "00000" "Unknown" "60y5m" "" "30y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288959" "04214" "00395797" "00000" "Unknown" "19y2m" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289036" "04214" "00395874" "00000" "Unknown" "49y2m" "" "33y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289383" "04214" "00396221" "00000" "Familial, autosomal recessive" "19y" "2 months: nystagmus," "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000289386" "04214" "00396224" "00000" "Familial, autosomal recessive" "32y" "3 years" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000289797" "04214" "00396636" "00000" "Unknown" "75y" "night blindness" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000298484" "04214" "00405985" "00000" "Familial, autosomal recessive" "2y" "night blindness, nystagmus" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298485" "04214" "00405986" "00000" "Familial, autosomal recessive" "3y" "night blindness, nystagmus" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298486" "04214" "00405987" "00000" "Familial, autosomal recessive" "5m" "night blindness, nystagmus" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298487" "04214" "00405988" "00000" "Familial, autosomal recessive" "3y" "night blindness, photophobia, nystagmus" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298488" "04214" "00405989" "00000" "Familial, autosomal recessive" "9m" "?" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298489" "04214" "00405990" "00000" "Familial, autosomal recessive" "8y" "night blindness, photophobia, nystagmus" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298490" "04214" "00405991" "00000" "Familial, autosomal recessive" "6y" "night blindness, nystagmus" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298491" "04214" "00405992" "00000" "Familial, autosomal recessive" "2y6m" "night blindness, nystagmus" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298492" "04214" "00405993" "00000" "Familial, autosomal recessive" "9y" "night blindness, nystagmus" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298502" "04214" "00406003" "00000" "Unknown" "" "CME and mild mottling of the foveal retinal pigment epithelium in both eyes, foveal cystoid abnormalities in the inner and outer retina with secondary mild retinal thickening, coarse retinal lamination, and scattered central ellipsoid zone defects in both eyes" "" "" "" "" "" "" "" "" "" "Cystoid macular edema (CME)" "" "0000298503" "04214" "00406004" "00000" "Unknown" "" "est-corrected visual acuity of 20/50 Ouwith more extensive cystoid abnormalities on optical coherence tomography" "" "" "" "" "" "" "" "" "" "Cystoid macular edema (CME)" "" "0000298504" "04214" "00406005" "00000" "Unknown" "46y" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" "" "0000298505" "04214" "00406006" "00000" "Unknown" "43y" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" "" "0000298506" "04214" "00406007" "00000" "Unknown" "48y" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" "" "0000298507" "04214" "00406008" "00000" "Unknown" "45y" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" "" "0000298508" "04214" "00406009" "00000" "Familial, autosomal recessive" "22y" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" "" "0000298509" "04214" "00406010" "00000" "Familial, autosomal recessive" "18y" "Loss of pigment epithelium" "2y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000298510" "04214" "00406011" "00000" "Familial, autosomal recessive" "16y" "Loss of pigment epithelium" "1y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000298511" "04214" "00406012" "00000" "Familial, autosomal recessive" "19y" "Loss of pigment epithelium" "1y6m" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000298512" "04214" "00406013" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" "" "0000298513" "04214" "00406014" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Healthy carrier" "" "0000298514" "04214" "00406015" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000298515" "04214" "00406016" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000298516" "04214" "00406017" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000298517" "04214" "00406018" "00000" "Familial, autosomal recessive" "18y" "coat’s like vasculopathy" "" "" "bilateral gradual loss of vision since early childhood" "" "" "" "" "" "" "Leber congenital amaurosis (LCA8)" "" "0000298518" "04214" "00406019" "00000" "Familial, autosomal recessive" "12y" "" "" "" "severe vision loss" "" "" "" "" "" "" "Leber congenital amaurosis (LCA8)" "" "0000298519" "04214" "00406020" "00000" "Familial, autosomal recessive" "2y" "" "" "" "severe vision loss" "" "" "" "" "" "" "Leber congenital amaurosis (LCA8)" "" "0000298520" "04214" "00406021" "00000" "Familial, autosomal recessive" "14y" "" "2y" "" "diminished night vision and subsequent progressive loss of his peripheral and central vision, as well as reduced color vision and night blindness" "" "" "" "" "" "" "autosomal-recessive retinitis pigmentosa (ARRP)" "" "0000298521" "04214" "00406022" "00000" "Familial, autosomal recessive" "9y" "" "2y" "" "diminished night vision and subsequent progressive loss of his peripheral and central vision, as well as reduced color vision and night blindness" "" "" "" "" "" "" "autosomal-recessive retinitis pigmentosa (ARRP)" "" "0000298522" "04214" "00406023" "00000" "Familial, autosomal recessive" "7y" "" "2y" "" "poor night and central vision" "" "" "" "" "" "" "autosomal-recessive retinitis pigmentosa (ARRP)" "" "0000298523" "04214" "00406024" "00000" "Familial, autosomal recessive" "6y" "Peripheral bone spicules, attenuated retinal blood vessels, macular degeneration" "34y" "" "" "" "" "" "" "" "" "Retinal Degeneration" "" "0000298524" "04214" "00406025" "00000" "Familial, autosomal recessive" "8y" "Peripheral bone spicules, attenuated retinal blood vessels, macular degeneration" "32y" "" "" "" "" "" "" "" "" "Retinal Degeneration" "" "0000298525" "04214" "00406026" "00000" "Familial, autosomal recessive" "3y" "Peripheral bone spicules, attenuated retinal blood vessels, macular coloboma, nystagmus, cataract" "49y" "" "" "" "" "" "" "" "" "Retinal Degeneration" "" "0000298526" "04214" "00406027" "00000" "Familial, autosomal recessive" "3y" "Peripheral bone spicules, attenuated retinal blood vessels, macular coloboma, nystagmus, cataract" "39y" "" "" "" "" "" "" "" "" "Retinal Degeneration" "" "0000298527" "04214" "00406028" "00000" "Familial, autosomal recessive" "4y" "Not applicable because of severe cataract" "60y" "" "" "" "" "" "" "" "" "Retinal Degeneration" "" "0000298528" "04214" "00406029" "00000" "Familial, autosomal recessive" "4y" "Peripheral bone spicules, attenuated retinal blood vessels, macular degeneration" "43y" "" "" "" "" "" "" "" "" "Retinal Degeneration" "" "0000298529" "04214" "00406030" "00000" "Familial, autosomal recessive" "27y" "Nystagmus; Reduced visual acuity improved with the development of patient." "<1y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298530" "04214" "00406031" "00000" "Familial, autosomal recessive" "6m" "Nystagmus" "0d" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298531" "04214" "00406032" "00000" "Familial, autosomal recessive" "27y" "Nystagmus; Deep reduced visual acuity; mild enophthalmos." "0d" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298532" "04214" "00406033" "00000" "Familial, autosomal recessive" "20y" "Nystagmus; Severe visual loss; Minimum residual temporal visual field in the right eye; Divergent strabismus in the left eye." "<1y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298533" "04214" "00406034" "00000" "Familial, autosomal recessive" "7y" "Non-Nystagmus; Reduced visual acuity; Intermittent exotropia" "0d" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298534" "04214" "00406035" "00000" "Familial, autosomal recessive" "3y" "Nystagmus" "3m" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298535" "04214" "00406036" "00000" "Familial, autosomal recessive" "2y" "Nystagmus; Sub-normal vision" "2m" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298536" "04214" "00406037" "00000" "Familial, autosomal recessive" "16y" "Nystagmus; Progressive reduced visual acuity" "<1y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298537" "04214" "00406038" "00000" "Familial, autosomal recessive" "10y" "Non-Nystagmus; Tubular visual field; Strabismus" "5y" "" "" "" "" "" "" "" "" "early-onset retinal dystrophy (EORD)" "" "0000298538" "04214" "00406039" "00000" "Familial, autosomal recessive" "12y" "Non-Nystagmus; Reduced visual acuity; Nyctalopia" "6y" "" "" "" "" "" "" "" "" "early-onset retinal dystrophy (EORD)" "" "0000298539" "04214" "00406040" "00000" "Familial, autosomal recessive" "9y" "Non-Nystagmus in the beginning; Nyctalopia" "9y" "" "" "" "" "" "" "" "" "cone-rod dystrophy (CRD)" "" "0000298540" "04214" "00406041" "00000" "Familial, autosomal recessive" "24y" "Non-Nystagmus; Reduced central visual acuity." "7y" "" "" "" "" "" "" "" "" "cone-rod dystrophy (CRD)" "" "0000298541" "04214" "00406042" "00000" "Familial, autosomal recessive" "18y" "Non-Nystagmus; Reduced visual acuity even with glasses; Tubular visual field; Nyctalopia" "10y-19y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000298542" "04214" "00406043" "00000" "Familial, autosomal recessive" "47y" "Non-Nystagmus; Convergent strabismus; Hearing loss; Myopia; Glaucoma; Tubular visual field; Nyctalopia" "10y-19y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000298543" "04214" "00406044" "00000" "Familial, autosomal recessive" "59y" "Non-Nystagmus; Tubular visual field; Nyctalopia" ">19y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000298544" "04214" "00406045" "00000" "Unknown" "19y" "" "21y" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000298545" "04214" "00406046" "00000" "Unknown" "3y" "" "8y" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000298546" "04214" "00406047" "00000" "Unknown" "9y" "" "12y" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000298547" "04214" "00406048" "00000" "Unknown" "2y" "" "30y" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000298548" "04214" "00406049" "00000" "Unknown" "0y" "" "24y" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000298549" "04214" "00406050" "00000" "Unknown" "1y" "" "29y" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000298550" "04214" "00406051" "00000" "Unknown" "1y6m" "" "10y" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000298551" "04214" "00406052" "00000" "Unknown" "24y" "" "0y" "" "" "" "" "" "" "" "" "early-onset retinal dystrophy (EORD)" "" "0000298552" "04214" "00406053" "00000" "Unknown" "47y" "" "6y" "" "" "" "" "" "" "" "" "early-onset retinal dystrophy (EORD)" "" "0000298553" "04214" "00406054" "00000" "Unknown" "34y" "" "0y" "" "" "" "" "" "" "" "" "early-onset retinal dystrophy (EORD)" "" "0000298554" "04214" "00406055" "00000" "Unknown" "26y" "" "5y" "" "" "" "" "" "" "" "" "early-onset retinal dystrophy (EORD)" "" "0000298555" "04214" "00406056" "00000" "Unknown" "48y" "" "4y" "" "" "" "" "" "" "" "" "early-onset retinal dystrophy (EORD)" "" "0000298556" "04214" "00406057" "00000" "Unknown" "56y" "" "0y" "" "" "" "" "" "" "" "" "early-onset retinal dystrophy (EORD)" "" "0000298557" "04214" "00406058" "00000" "Unknown" "22y" "" "2y" "" "" "" "" "" "" "" "" "early-onset retinal dystrophy (EORD)" "" "0000298558" "04214" "00406059" "00000" "Unknown" "40y" "" "1y" "" "" "" "" "" "" "" "" "early-onset retinal dystrophy (EORD)" "" "0000298559" "04214" "00406060" "00000" "Unknown" "25y" "" "1y" "" "" "" "" "" "" "" "" "early-onset retinal dystrophy (EORD)" "" "0000298560" "04214" "00406061" "00000" "Unknown" "22y" "" "5y" "" "" "" "" "" "" "" "" "early-onset retinal dystrophy (EORD)" "" "0000298561" "04214" "00406062" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298562" "04214" "00406063" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298563" "04214" "00406064" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA)" "" "0000298564" "04214" "00406065" "00000" "Familial, autosomal recessive" "58y" "" "" "" "" "" "" "" "" "" "" "Severe Leber congenital amaurosis (LCA8)" "" "0000298565" "04214" "00406066" "00000" "Familial, autosomal recessive" "53y" "initially diagnosed as having probable age-related macular degeneration" "" "" "" "" "" "" "" "" "" "Mild Leber congenital amaurosis (LCA8)" "" "0000298566" "04214" "00406067" "00000" "Unknown" "21y" "progressive loss of central and peripheral vision for several years associated with cystoid macular edema of unknown etiology" "" "" "" "" "" "" "" "" "" "retinal degeneration with CME" "" "0000298567" "04214" "00406068" "00000" "Unknown" "29y" "alopecia at 5y, asymmetric face at 13y" "" "" "keratic precipitate, corneal endothelial degeneration, fundus tessellation, pupillary dilation, direct light reflex loss, and visual evoked potential alteration, progressive enophthalmos on the right side" "" "" "" "" "" "" "Progressive hemifacial atrophy (PHA)" "" "0000298568" "04214" "00406069" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "adult onset rod cone dystrophy" "" "0000298877" "04214" "00406390" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000298889" "04214" "00406402" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000298890" "04214" "00406403" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000298891" "04214" "00406404" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000298892" "04214" "00406405" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "" "0000300190" "04214" "00408061" "00000" "Familial, autosomal recessive" "43y" "onset: 4th decade; photophobia: no; nystagmus: no; decline in visual acuity: 4th decade; myopia: no; keratoconus: no; cataract: no; papillary pallor: severe; peripapillary atrophy: yes; white flecks: yes; pigment mottling: yes; vessel attenuation: no; bone spicules: paravascular retina spared; chorioretinal atrophy: moderate; optical coherence tomography: retinal pigment epithelium irregularity, macular thinning; visual field: concentric narrowing;" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 1312 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000016553" "00016602" "1" "00552" "00552" "2014-05-23 12:59:49" "" "" "SEQ-NG-I" "DNA" "" "" "0000033106" "00033038" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033107" "00033039" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033108" "00033040" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033109" "00033041" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033110" "00033042" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033111" "00033043" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033112" "00033044" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033113" "00033045" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033114" "00033046" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033115" "00033047" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033116" "00033048" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033117" "00033049" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033118" "00033050" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033119" "00033051" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033120" "00033052" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033121" "00033053" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033122" "00033054" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033123" "00033055" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033124" "00033056" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033125" "00033057" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033126" "00033058" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033127" "00033059" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033128" "00033060" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033129" "00033061" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033130" "00033062" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033131" "00033063" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033132" "00033064" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033133" "00033065" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033134" "00033066" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033135" "00033067" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033136" "00033068" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033137" "00033069" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033138" "00033070" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033139" "00033071" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033140" "00033072" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033141" "00033073" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033142" "00033074" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033143" "00033075" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033144" "00033076" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033145" "00033077" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033146" "00033078" "1" "00006" "00006" "2011-10-19 11:43:33" "00006" "2012-05-18 13:59:32" "SEQ" "DNA" "" "" "0000033159" "00033091" "1" "00229" "00229" "2012-02-04 16:07:37" "00006" "2012-05-18 13:59:34" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033160" "00033092" "1" "00229" "00229" "2012-02-13 08:29:44" "00006" "2012-05-18 13:59:34" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033161" "00033093" "1" "00229" "00229" "2012-02-04 14:23:49" "00006" "2012-05-18 13:59:34" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033174" "00033106" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:34" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033212" "00033144" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:34" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033214" "00033146" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033226" "00033158" "1" "00229" "00229" "2012-02-13 08:29:44" "00006" "2012-05-18 13:59:32" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033238" "00033170" "1" "00229" "00229" "2012-02-04 15:59:56" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033412" "00033344" "1" "00039" "00039" "2012-09-18 13:14:14" "" "" "SEQ-NG-I" "DNA" "" "" "0000033416" "00033348" "1" "00039" "00039" "2012-09-18 13:45:01" "" "" "SEQ" "DNA" "" "" "0000033761" "00033693" "1" "00243" "00243" "2015-02-18 08:08:04" "" "" "SEQ-NG-I" "DNA" "" "" "0000038005" "00037774" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038006" "00037775" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038007" "00037776" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038008" "00037777" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038009" "00037778" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038010" "00037779" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038011" "00037780" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038012" "00037781" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038013" "00037782" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038014" "00037783" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038015" "00037784" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038016" "00037785" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038017" "00037786" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038018" "00037787" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038019" "00037788" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038020" "00037789" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038021" "00037790" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038022" "00037791" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038023" "00037792" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038024" "00037793" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038025" "00037794" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038026" "00037795" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038027" "00037796" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038028" "00037797" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038029" "00037798" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038030" "00037799" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038031" "00037800" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038032" "00037801" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038033" "00037802" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038034" "00037803" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038035" "00037804" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038036" "00037805" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038037" "00037806" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038038" "00037807" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038039" "00037808" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038040" "00037809" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038041" "00037810" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038042" "00037811" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038043" "00037812" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038044" "00037813" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038045" "00037814" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038046" "00037815" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038047" "00037816" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038048" "00037817" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038049" "00037818" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038050" "00037819" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038051" "00037820" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038052" "00037821" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038053" "00037822" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038054" "00037823" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038055" "00037824" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038056" "00037825" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038057" "00037826" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038058" "00037827" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038059" "00037828" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038060" "00037829" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038061" "00037830" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038062" "00037831" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038063" "00037832" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038064" "00037833" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038065" "00037834" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038066" "00037835" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038067" "00037836" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038068" "00037837" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038069" "00037838" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038070" "00037839" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038071" "00037840" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038072" "00037841" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038073" "00037842" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038074" "00037843" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038075" "00037844" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038076" "00037845" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038077" "00037846" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038078" "00037847" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038079" "00037848" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038080" "00037849" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038081" "00037850" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038082" "00037851" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038083" "00037852" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038084" "00037853" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038085" "00037854" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038086" "00037855" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038087" "00037856" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038088" "00037857" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038089" "00037858" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038090" "00037859" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038091" "00037860" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038092" "00037861" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038093" "00037862" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038094" "00037863" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038095" "00037864" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038096" "00037865" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038097" "00037866" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038098" "00037867" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038099" "00037868" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038100" "00037869" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038101" "00037870" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038102" "00037871" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038103" "00037872" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038104" "00037873" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038105" "00037874" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038106" "00037875" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038107" "00037876" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038108" "00037877" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038109" "00037878" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038110" "00037879" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038111" "00037880" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038112" "00037881" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038113" "00037882" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038114" "00037883" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038115" "00037884" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038116" "00037885" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038117" "00037886" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038118" "00037887" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038119" "00037888" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038120" "00037889" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038121" "00037890" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038122" "00037891" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038123" "00037892" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038124" "00037893" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038125" "00037894" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038126" "00037895" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038127" "00037896" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038128" "00037897" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038129" "00037898" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038130" "00037899" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038131" "00037900" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038132" "00037901" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038133" "00037902" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038134" "00037903" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038135" "00037904" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038136" "00037905" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038137" "00037906" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038138" "00037907" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038139" "00037908" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038140" "00037909" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038141" "00037910" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038142" "00037911" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038143" "00037912" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038144" "00037913" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038145" "00037914" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038146" "00037915" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038147" "00037916" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038148" "00037917" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038149" "00037918" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038150" "00037919" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038151" "00037920" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038152" "00037921" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038153" "00037922" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038154" "00037923" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038155" "00037924" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038156" "00037925" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038157" "00037926" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038158" "00037927" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038159" "00037928" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038160" "00037929" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038161" "00037930" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038162" "00037931" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038163" "00037932" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038164" "00037933" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038165" "00037934" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038166" "00037935" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038167" "00037936" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038168" "00037937" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038169" "00037938" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038170" "00037939" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038171" "00037940" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038172" "00037941" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038173" "00037942" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038174" "00037943" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038175" "00037944" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038176" "00037945" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038177" "00037946" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038178" "00037947" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038179" "00037948" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038180" "00037949" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038181" "00037950" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038182" "00037951" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038183" "00037952" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038184" "00037953" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038185" "00037954" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038186" "00037955" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038187" "00037956" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038188" "00037957" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038189" "00037958" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038190" "00037959" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038191" "00037960" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038192" "00037961" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038193" "00037962" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038194" "00037963" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038195" "00037964" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038196" "00037965" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038197" "00037966" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038198" "00037967" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038199" "00037968" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038200" "00037969" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038201" "00037970" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038202" "00037971" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038203" "00037972" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000038204" "00037973" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038205" "00037974" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038206" "00037975" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038207" "00037976" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038208" "00037977" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038209" "00037978" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038210" "00037979" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038211" "00037980" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038212" "00037981" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038213" "00037982" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038214" "00037983" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038215" "00037984" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038216" "00037985" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038217" "00037986" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038218" "00037987" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038219" "00037988" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038220" "00037989" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038221" "00037990" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038222" "00037991" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038223" "00037992" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038224" "00037993" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038225" "00037994" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038226" "00037995" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038227" "00037996" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038228" "00037997" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038229" "00037998" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038230" "00037999" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038231" "00038000" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038232" "00038001" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038233" "00038002" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038234" "00038003" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038235" "00038004" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038236" "00038005" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038237" "00038006" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038238" "00038007" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038239" "00038008" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038240" "00038009" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038241" "00038010" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038242" "00038011" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038243" "00038012" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038244" "00038013" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038245" "00038014" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038246" "00038015" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038247" "00038016" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038248" "00038017" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038249" "00038018" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038250" "00038019" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038251" "00038020" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038252" "00038021" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038253" "00038022" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038254" "00038023" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038255" "00038024" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038256" "00038025" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038257" "00038026" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038258" "00038027" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038259" "00038028" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038260" "00038029" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038261" "00038030" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038262" "00038031" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038263" "00038032" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038264" "00038033" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038265" "00038034" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038266" "00038035" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038267" "00038036" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038268" "00038037" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038269" "00038038" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038270" "00038039" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038271" "00038040" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038272" "00038041" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038273" "00038042" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038274" "00038043" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038275" "00038044" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038276" "00038045" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038277" "00038046" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038278" "00038047" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038279" "00038048" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038280" "00038049" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038281" "00038050" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038282" "00038051" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038283" "00038052" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038284" "00038053" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038285" "00038054" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038286" "00038055" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038287" "00038056" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038288" "00038057" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038289" "00038058" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038290" "00038059" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038291" "00038060" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038292" "00038061" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038293" "00038062" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038294" "00038063" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038295" "00038064" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038296" "00038065" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038297" "00038066" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038298" "00038067" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038299" "00038068" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038300" "00038069" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038301" "00038070" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038302" "00038071" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038303" "00038072" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038304" "00038073" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038305" "00038074" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038306" "00038075" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038307" "00038076" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038308" "00038077" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038309" "00038078" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038310" "00038079" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038311" "00038080" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038312" "00038081" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038313" "00038082" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ" "DNA" "" "" "0000038314" "00038083" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ" "DNA" "" "" "0000038315" "00038084" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ" "DNA" "" "" "0000038316" "00038085" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ" "DNA" "" "" "0000038317" "00038086" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ" "DNA" "" "" "0000038318" "00038087" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ" "DNA" "" "" "0000038319" "00038088" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ" "DNA" "" "" "0000038320" "00038089" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ" "DNA" "" "" "0000038321" "00038090" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ" "DNA" "" "" "0000038322" "00038091" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA" "DNA" "" "" "0000038323" "00038092" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA" "DNA" "" "" "0000038324" "00038093" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA" "DNA" "" "" "0000038325" "00038094" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA" "DNA" "" "" "0000038328" "00038097" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038329" "00038098" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038330" "00038099" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038331" "00038100" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038332" "00038101" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038333" "00038102" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038334" "00038103" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038335" "00038104" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038336" "00038105" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038337" "00038106" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038338" "00038107" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038339" "00038108" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038340" "00038109" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038341" "00038110" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038342" "00038111" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;PCR;SEQ" "DNA" "" "" "0000038343" "00038112" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038344" "00038113" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038345" "00038114" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038346" "00038115" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038347" "00038116" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038348" "00038117" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038349" "00038118" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038350" "00038119" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038351" "00038120" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038352" "00038121" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038353" "00038122" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038354" "00038123" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038355" "00038124" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038356" "00038125" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038357" "00038126" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038358" "00038127" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038359" "00038128" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038360" "00038129" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038361" "00038130" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038362" "00038131" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038363" "00038132" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038364" "00038133" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038365" "00038134" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038366" "00038135" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038367" "00038136" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038368" "00038137" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038369" "00038138" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038370" "00038139" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038371" "00038140" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038372" "00038141" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038373" "00038142" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038374" "00038143" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038375" "00038144" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038376" "00038145" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038377" "00038146" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038378" "00038147" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038379" "00038148" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038380" "00038149" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038381" "00038150" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038382" "00038151" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038383" "00038152" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038384" "00038153" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038385" "00038154" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038386" "00038155" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038387" "00038156" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038388" "00038157" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038389" "00038158" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038390" "00038159" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038391" "00038160" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038392" "00038161" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038393" "00038162" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038394" "00038163" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038395" "00038164" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038396" "00038165" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038397" "00038166" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038398" "00038167" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038399" "00038168" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038400" "00038169" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038401" "00038170" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038402" "00038171" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038403" "00038172" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038404" "00038173" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038405" "00038174" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038406" "00038175" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038407" "00038176" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038408" "00038177" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038409" "00038178" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038410" "00038179" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038411" "00038180" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "?" "DNA" "" "" "0000038412" "00038181" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038413" "00038182" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038414" "00038183" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038415" "00038184" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038416" "00038185" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038417" "00038186" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ;SEQ-NG" "DNA" "" "" "0000038418" "00038187" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ;SEQ-NG" "DNA" "" "" "0000038419" "00038188" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038420" "00038189" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038421" "00038190" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038422" "00038191" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038423" "00038192" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038424" "00038193" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038425" "00038194" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038426" "00038195" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038427" "00038196" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038428" "00038197" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038429" "00038198" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038430" "00038199" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ;PCR" "DNA" "" "" "0000038431" "00038200" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCRq;SEQ" "DNA" "" "" "0000038432" "00038201" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I" "DNA" "" "" "0000038433" "00038202" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038434" "00038203" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038435" "00038204" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038436" "00038205" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038437" "00038206" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038438" "00038207" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038439" "00038208" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038440" "00038209" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038441" "00038210" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038442" "00038211" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038443" "00038212" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038444" "00038213" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038445" "00038214" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038446" "00038215" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038447" "00038216" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038448" "00038217" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038449" "00038218" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;MCA" "DNA" "" "" "0000038450" "00038219" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;DHPLC" "DNA" "" "" "0000038451" "00038220" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;MCA" "DNA" "" "" "0000038452" "00038221" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;DHPLC" "DNA" "" "" "0000038453" "00038222" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038454" "00038223" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038455" "00038224" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038456" "00038225" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038457" "00038226" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038458" "00038227" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038459" "00038228" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038460" "00038229" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "MCA;PCR;SEQ" "DNA" "" "" "0000038461" "00038230" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038462" "00038231" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038463" "00038232" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038464" "00038233" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;DHPLC" "DNA" "" "" "0000038465" "00038234" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038466" "00038235" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038467" "00038236" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;DHPLC" "DNA" "" "" "0000038468" "00038237" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038469" "00038238" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "MCA" "DNA" "" "" "0000038470" "00038239" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP" "DNA" "" "" "0000038471" "00038240" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;DHPLC" "DNA" "" "" "0000038472" "00038241" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038473" "00038242" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;DHPLC" "DNA" "" "" "0000038474" "00038243" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038475" "00038244" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SSCA" "DNA" "" "" "0000038476" "00038245" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038477" "00038246" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;MCA" "DNA" "" "" "0000038478" "00038247" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;MCA" "DNA" "" "" "0000038479" "00038248" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038480" "00038249" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038481" "00038250" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038482" "00038251" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038483" "00038252" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038484" "00038253" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SSCA" "DNA" "" "" "0000038485" "00038254" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038486" "00038255" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ" "DNA" "" "" "0000038487" "00038256" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038488" "00038257" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;MCA" "DNA" "" "" "0000038489" "00038258" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038490" "00038259" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038491" "00038260" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038492" "00038261" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038493" "00038262" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038494" "00038263" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038495" "00038264" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038496" "00038265" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038497" "00038266" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038498" "00038267" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038499" "00038268" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038500" "00038269" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038501" "00038270" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038502" "00038271" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038503" "00038272" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038504" "00038273" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038505" "00038274" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038506" "00038275" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038507" "00038276" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038508" "00038277" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038509" "00038278" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038510" "00038279" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038511" "00038280" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038512" "00038281" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038513" "00038282" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000038514" "00038283" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR" "DNA" "" "" "0000038515" "00038284" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038516" "00038285" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038517" "00038286" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038518" "00038287" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038519" "00038288" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038520" "00038289" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038521" "00038290" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038522" "00038291" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038523" "00038292" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038529" "00038298" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038530" "00038299" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038531" "00038300" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038532" "00038301" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038533" "00038302" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038534" "00038303" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038535" "00038304" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038536" "00038305" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038537" "00038306" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038538" "00038307" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038539" "00038308" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038540" "00038309" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038541" "00038310" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038542" "00038311" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038543" "00038312" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038544" "00038313" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038545" "00038314" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038546" "00038315" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038547" "00038316" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038548" "00038317" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038549" "00038318" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038550" "00038319" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038551" "00038320" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;DHPLC;SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038552" "00038321" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;DHPLC;SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038553" "00038322" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;DHPLC;SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038554" "00038323" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;DHPLC;SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038555" "00038324" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;DHPLC;SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038556" "00038325" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;DHPLC;SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038557" "00038326" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;DHPLC;SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038558" "00038327" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;DHPLC;SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038559" "00038328" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;DHPLC;SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038560" "00038329" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SSCA;DHPLC;SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038561" "00038330" "1" "01251" "01251" "2015-05-01 22:00:00" "00006" "2015-05-06 09:22:08" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038562" "00038331" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038563" "00038332" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038564" "00038333" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038565" "00038334" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038566" "00038335" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038567" "00038336" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;SSCA;PCR;SEQ" "DNA" "" "" "0000038568" "00038337" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;SSCA;PCR;SEQ" "DNA" "" "" "0000038569" "00038338" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038570" "00038339" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ;SEQ-NG-I" "DNA" "" "" "0000038571" "00038340" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG;MCA;PCR;SEQ" "DNA" "" "" "0000038572" "00038341" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG;MCA;PCR;SEQ" "DNA" "" "" "0000038573" "00038342" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG;MCA;PCR;SEQ" "DNA" "" "" "0000038574" "00038343" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038575" "00038344" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038576" "00038345" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038577" "00038346" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038578" "00038347" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038579" "00038348" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "PCR;SEQ" "DNA" "" "" "0000038580" "00038349" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038581" "00038350" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038582" "00038351" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038583" "00038352" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038584" "00038353" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG;PCR;SEQ" "DNA" "" "" "0000038585" "00038354" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-S;PCR;SEQ" "DNA" "" "" "0000038586" "00038355" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-S;PCR;SEQ" "DNA" "" "" "0000038587" "00038356" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-S;PCR;SEQ" "DNA" "" "" "0000038588" "00038357" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-S;PCR;SEQ" "DNA" "" "" "0000038589" "00038358" "1" "01251" "01251" "2015-05-01 22:00:00" "00006" "2015-05-06 09:29:07" "PCR;SEQ;SEQ-NG-S" "DNA" "" "" "0000038590" "00038359" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-S;PCR;SEQ" "DNA" "" "" "0000038591" "00038360" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-S;PCR;SEQ" "DNA" "" "" "0000038592" "00038361" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-S;PCR;SEQ" "DNA" "" "" "0000038593" "00038362" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-S;PCR;SEQ" "DNA" "" "" "0000038594" "00038363" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-S;PCR;SEQ" "DNA" "" "" "0000038595" "00038364" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-S;PCR;SEQ" "DNA" "" "" "0000038596" "00038365" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038597" "00038366" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038598" "00038367" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038599" "00038368" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038600" "00038369" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000038601" "00038370" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "arraySEQ;PCR;SEQ" "DNA" "" "" "0000038602" "00038371" "1" "01251" "01251" "2015-05-01 22:00:00" "" "" "SEQ-NG-I;PCR;SEQ" "DNA" "" "" "0000052591" "00052643" "1" "01424" "01424" "2015-10-26 17:05:36" "00006" "2015-10-26 17:32:53" "arraySEQ" "DNA" "" "" "0000076649" "00076473" "1" "01695" "01695" "2016-02-22 12:22:09" "00006" "2019-02-14 13:10:47" "PE;PCR;SEQ;DHPLC" "DNA" "" "APEX" "0000076650" "00076474" "1" "01695" "01695" "2016-02-22 12:22:09" "00006" "2019-02-14 13:10:47" "PE;PCR;SEQ;DHPLC" "DNA" "" "APEX" "0000100506" "00100102" "1" "01769" "01769" "2017-01-30 19:44:53" "" "" "SEQ" "DNA" "WBC" "" "0000105488" "00105014" "1" "01244" "01244" "2017-06-15 10:29:34" "" "" "SEQ-NG-I" "DNA" "Whole blood" "" "0000105503" "00105030" "1" "01244" "01244" "2017-06-15 16:10:18" "" "" "SEQ-NG-I" "DNA" "Whole blood" "" "0000105504" "00105031" "1" "01244" "01244" "2017-06-15 16:12:42" "" "" "SEQ-NG-I" "DNA" "Whole blood" "" "0000105505" "00105032" "1" "01244" "01244" "2017-06-15 16:17:04" "" "" "SEQ-NG-I" "DNA" "Whole blood" "" "0000105506" "00105033" "1" "01244" "01244" "2017-06-15 16:20:55" "" "" "SEQ-NG-I" "DNA" "Whole blood" "" "0000105507" "00105034" "1" "01244" "01244" "2017-06-15 16:23:49" "" "" "SEQ-NG-I" "DNA" "Whole blood" "" "0000105518" "00105022" "1" "01244" "00006" "2017-06-16 15:57:25" "" "" "SEQ-NG-I" "DNA" "" "" "0000105522" "00105049" "1" "01244" "00006" "2017-06-16 17:27:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000156314" "00155449" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156315" "00155450" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156316" "00155451" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156317" "00155452" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156318" "00155453" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156319" "00155454" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156320" "00155455" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156321" "00155456" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156322" "00155457" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156323" "00155458" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000208719" "00207678" "1" "01244" "01244" "2018-11-27 16:02:44" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000208722" "00207681" "1" "01244" "01244" "2018-11-27 16:35:27" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000208728" "00207687" "1" "01244" "01244" "2018-11-28 10:13:59" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000208735" "00207694" "1" "01244" "01244" "2018-11-28 15:38:33" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000233091" "00231992" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233092" "00231993" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233093" "00231994" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233094" "00231995" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233095" "00231996" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233096" "00231997" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233097" "00231998" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233098" "00231999" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233099" "00232000" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233100" "00232001" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233101" "00232002" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233102" "00232003" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233103" "00232004" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233104" "00232005" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233105" "00232006" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233106" "00232007" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233107" "00232008" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233108" "00232009" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233109" "00232010" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233110" "00232011" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233111" "00232012" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233112" "00232013" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233113" "00232014" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233114" "00232015" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233115" "00232016" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233116" "00232017" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233117" "00232018" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233118" "00232019" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233119" "00232020" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234702" "00233603" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000241543" "00240433" "1" "03335" "00008" "2019-06-20 17:48:49" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000241544" "00240434" "1" "03335" "00008" "2019-06-20 17:48:49" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000241545" "00240435" "1" "03335" "00008" "2019-06-20 17:48:49" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000263217" "00262111" "1" "01164" "01164" "2019-08-19 09:49:03" "" "" "SEQ-NG-S" "DNA" "" "" "0000270617" "00269471" "1" "03508" "03508" "2019-11-28 13:51:28" "" "" "SEQ-NG" "DNA" "blood" "Targeted gene panel" "0000290810" "00289642" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000290811" "00289643" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000290812" "00289644" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296405" "00295237" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296771" "00295601" "1" "01807" "01807" "2020-03-18 10:50:20" "" "" "SEQ" "DNA" "" "" "0000309558" "00308414" "1" "00004" "00006" "2020-08-26 16:56:47" "" "" "SEQ;SEQ-NG" "DNA" "" "123 gene panel" "0000309646" "00308501" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309647" "00308502" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309648" "00308503" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309649" "00308504" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309650" "00308505" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309754" "00308609" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309755" "00308610" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000310254" "00309109" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310255" "00309110" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310256" "00309111" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310257" "00309112" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310260" "00309115" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310261" "00309116" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310262" "00309117" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310263" "00309118" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310264" "00309119" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310265" "00309120" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310266" "00309121" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310267" "00309122" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310268" "00309123" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310269" "00309124" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310270" "00309125" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310271" "00309126" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310272" "00309127" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000321194" "00320010" "1" "00008" "00008" "2020-11-19 10:13:34" "" "" "HD ;SEQ" "DNA" "Blood" "" "0000321195" "00320011" "1" "00008" "00008" "2020-11-19 10:13:34" "" "" "HD ;SEQ" "DNA" "Blood" "" "0000321196" "00320012" "1" "00008" "00008" "2020-11-19 10:13:34" "" "" "HD ;SEQ" "DNA" "Blood" "" "0000326625" "00325414" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000326639" "00325428" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000326652" "00325441" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000326660" "00325449" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000326665" "00325454" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000326683" "00325472" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000326717" "00325506" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000326721" "00325510" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000326732" "00325521" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000327906" "00326693" "1" "00008" "00008" "2021-01-14 12:28:06" "" "" "arraySEQ" "DNA" "blood" "" "0000329147" "00327932" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES" "0000329160" "00327945" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES" "0000329161" "00327946" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES" "0000329167" "00327952" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES" "0000329171" "00327956" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES" "0000329200" "00327985" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329201" "00327986" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329231" "00328016" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329300" "00328085" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329324" "00328109" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329403" "00328188" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329447" "00328232" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329704" "00328489" "1" "00000" "00006" "2021-01-28 09:35:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000329712" "00328497" "1" "00000" "00006" "2021-01-28 09:35:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000329713" "00328498" "1" "00000" "00006" "2021-01-28 09:35:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000333199" "00331980" "1" "00000" "00006" "2021-02-14 10:12:05" "" "" "SEQ-NG" "DNA" "" "" "0000333413" "00332193" "1" "00000" "00006" "2021-02-15 18:54:26" "" "" "SEQ-NG" "DNA" "" "WES" "0000333414" "00332194" "1" "00000" "00006" "2021-02-15 18:54:26" "" "" "SEQ-NG" "DNA" "" "WES" "0000333415" "00332195" "1" "00000" "00006" "2021-02-15 18:54:26" "" "" "SEQ-NG" "DNA" "" "WES" "0000333487" "00332267" "1" "00000" "00006" "2021-02-16 17:14:33" "" "" "SEQ-NG" "DNA" "" "300-gene panel" "0000333488" "00332268" "1" "00000" "00006" "2021-02-16 17:14:33" "" "" "SEQ-NG" "DNA" "" "300-gene panel" "0000333496" "00332276" "1" "00000" "00006" "2021-02-16 17:14:33" "" "" "SEQ-NG" "DNA" "" "300-gene panel" "0000333589" "00332366" "1" "00000" "00006" "2021-02-17 18:00:14" "" "" "SEQ" "DNA" "" "" "0000333590" "00332367" "1" "00000" "00006" "2021-02-17 18:00:14" "" "" "SEQ" "DNA" "" "" "0000333616" "00332392" "1" "00000" "00006" "2021-02-18 13:23:10" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000333680" "00332456" "1" "00000" "00006" "2021-02-19 15:15:03" "" "" "SEQ-NG" "DNA" "" "150-gene panel" "0000333690" "00332466" "1" "00000" "00006" "2021-02-19 15:15:03" "" "" "SEQ-NG" "DNA" "" "150-gene panel" "0000333692" "00332468" "1" "00000" "00006" "2021-02-19 15:15:03" "" "" "SEQ-NG" "DNA" "" "150-gene panel" "0000334577" "00333352" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel" "0000334582" "00333357" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel" "0000334584" "00333359" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel" "0000334588" "00333363" "1" "00000" "00006" "2021-02-25 10:13:46" "" "" "SEQ-NG" "DNA" "" "132-gene panel" "0000334623" "00333398" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel" "0000334690" "00333465" "1" "00000" "00006" "2021-02-25 16:04:58" "" "" "SEQ" "DNA" "" "" "0000335043" "00333817" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335044" "00333818" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335045" "00333819" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335046" "00333820" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335047" "00333821" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335048" "00333822" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335125" "00333899" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335149" "00333923" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335150" "00333924" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335164" "00333938" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335172" "00333946" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335173" "00333947" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335174" "00333948" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335195" "00333969" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335196" "00333970" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335197" "00333971" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335338" "00334112" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335339" "00334113" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335486" "00334260" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335504" "00334278" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335643" "00334414" "1" "00000" "00006" "2021-02-28 16:11:14" "" "" "SEQ-NG" "DNA" "" "WES" "0000335790" "00334561" "1" "00000" "00006" "2021-03-01 15:50:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000335791" "00334562" "1" "00000" "00006" "2021-03-01 15:50:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000336337" "00335108" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000336338" "00335109" "1" "00000" "00006" "2021-03-04 11:06:46" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000336469" "00335240" "1" "00000" "00006" "2021-03-04 14:06:09" "" "" "SEQ-NG" "DNA" "" "212-gene panel" "0000336470" "00335241" "1" "00000" "00006" "2021-03-04 14:06:09" "" "" "SEQ-NG" "DNA" "" "212-gene panel" "0000336497" "00335268" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000336498" "00335269" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000336499" "00335270" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000336500" "00335271" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000336501" "00335272" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000336502" "00335273" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000336623" "00335394" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel" "0000336640" "00335411" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel" "0000336715" "00335486" "1" "00000" "00006" "2021-03-05 19:30:17" "" "" "SEQ-NG" "DNA" "" "72-gene panel" "0000336716" "00335487" "1" "00000" "00006" "2021-03-05 19:30:17" "" "" "SEQ-NG" "DNA" "" "72-gene panel" "0000336717" "00335488" "1" "00000" "00006" "2021-03-05 19:30:17" "" "" "SEQ-NG" "DNA" "" "72-gene panel" "0000336831" "00335603" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000336832" "00335604" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000336836" "00335608" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000336837" "00335609" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000336838" "00335610" "1" "00008" "00008" "2021-03-07 20:43:50" "" "" "DHPLC;PCR;SEQ" "DNA" "" "" "0000337201" "00335971" "1" "00000" "00006" "2021-03-10 17:05:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000360137" "00358904" "1" "00000" "00006" "2021-03-17 09:43:06" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000360138" "00358905" "1" "00000" "00006" "2021-03-17 09:43:06" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000360195" "00358958" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000360203" "00358966" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000360206" "00358969" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000360207" "00358970" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000360217" "00358980" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000360268" "00359030" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360270" "00359032" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360294" "00359056" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360302" "00359064" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360303" "00359065" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360305" "00359067" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360312" "00359074" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360320" "00359082" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360321" "00359083" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360328" "00359090" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360335" "00359097" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360337" "00359099" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360349" "00359111" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360368" "00359130" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360373" "00359135" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360384" "00359146" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360412" "00359174" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360431" "00359193" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360434" "00359196" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360437" "00359199" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360457" "00359219" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360609" "00359367" "1" "00000" "00006" "2021-03-19 18:50:51" "" "" "SEQ-NG" "DNA" "" "64-gene panel" "0000360612" "00359370" "1" "00000" "00006" "2021-03-19 18:50:51" "" "" "SEQ-NG" "DNA" "" "64-gene panel" "0000363395" "00362166" "1" "00000" "00006" "2021-04-15 15:27:01" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364133" "00362905" "1" "00000" "00006" "2021-04-23 19:25:57" "" "" "SEQ-NG" "DNA" "" "WES" "0000364670" "00363442" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel" "0000364671" "00363443" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel" "0000364672" "00363444" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel" "0000364682" "00363454" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel" "0000364683" "00363455" "1" "00000" "00006" "2021-04-27 10:42:53" "" "" "SEQ-NG" "DNA" "" "195-gene panel" "0000364751" "00363523" "1" "00000" "00006" "2021-04-29 12:09:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000364752" "00363524" "1" "00000" "00006" "2021-04-29 12:09:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000364811" "00363583" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364838" "00363610" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364856" "00363628" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364878" "00363650" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364921" "00363693" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364956" "00363728" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364980" "00363752" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000370182" "00368954" "1" "01695" "01695" "2021-05-03 14:25:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000373286" "00372059" "1" "00000" "00006" "2021-05-06 16:52:04" "" "" "PE;SEQ" "DNA" "" "" "0000373287" "00372060" "1" "00000" "00006" "2021-05-06 16:52:04" "" "" "PE;SEQ" "DNA" "" "" "0000373288" "00372061" "1" "00000" "00006" "2021-05-06 16:52:04" "" "" "PE;SEQ" "DNA" "" "" "0000373296" "00372068" "1" "00000" "00006" "2021-05-06 19:05:11" "" "" "arraySNP;SEQ" "DNA" "" "" "0000373642" "00372409" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373643" "00372410" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373644" "00372411" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373659" "00372426" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373660" "00372427" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373661" "00372428" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373662" "00372429" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373663" "00372430" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373664" "00372431" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373665" "00372432" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373666" "00372433" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373692" "00372459" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373695" "00372462" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373696" "00372463" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373697" "00372464" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373698" "00372465" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373699" "00372466" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373700" "00372467" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373701" "00372468" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373702" "00372469" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373703" "00372470" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373730" "00372497" "1" "00000" "00006" "2021-05-08 09:43:10" "" "" "SEQ-NG" "DNA" "" "163-gene panel" "0000373857" "00372625" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373883" "00372651" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373884" "00372652" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373902" "00372670" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373905" "00372673" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373918" "00372686" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373932" "00372700" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373948" "00372716" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373949" "00372717" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373952" "00372720" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373957" "00372725" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373958" "00372726" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373971" "00372739" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000374649" "00373414" "1" "00000" "00006" "2021-05-14 15:17:31" "" "" "arraySNP;SEQ" "DNA" "" "" "0000374736" "00373501" "1" "00000" "00006" "2021-05-14 19:24:06" "" "" "SEQ-NG" "DNA" "" "316-gene panel" "0000374756" "00373521" "1" "00000" "00006" "2021-05-15 17:36:34" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000374761" "00373526" "1" "00000" "00006" "2021-05-15 17:36:34" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000374981" "00373748" "1" "00008" "00008" "2021-05-19 21:57:41" "" "" "SEQ" "DNA" "" "" "0000374982" "00373749" "1" "00008" "00008" "2021-05-19 21:57:41" "" "" "SEQ" "DNA" "" "" "0000374983" "00373750" "1" "00008" "00008" "2021-05-19 21:57:41" "" "" "SEQ" "DNA" "" "" "0000374984" "00373751" "1" "00008" "00008" "2021-05-19 21:57:41" "" "" "SEQ" "DNA" "" "" "0000375037" "00373805" "1" "00000" "00006" "2021-05-21 12:20:36" "" "" "arraySEQ" "DNA" "" "Reseq" "0000375083" "00373851" "1" "00000" "00006" "2021-05-21 13:56:05" "" "" "SEQ-NG" "DNA" "" "86-gene panel" "0000375119" "00373887" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel" "0000375122" "00373890" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel" "0000375149" "00373917" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel" "0000375151" "00373919" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel" "0000375161" "00373929" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel" "0000375164" "00373932" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel" "0000375165" "00373933" "1" "00000" "00006" "2021-05-21 15:01:30" "" "" "SEQ-NG" "DNA" "" "238-gene panel" "0000375185" "00373953" "1" "00000" "00006" "2021-05-21 16:09:21" "" "" "SEQ-NG" "DNA" "" "" "0000375186" "00373954" "1" "00000" "00006" "2021-05-21 16:09:21" "" "" "SEQ-NG" "DNA" "" "" "0000375187" "00373955" "1" "00000" "00006" "2021-05-21 16:09:21" "" "" "SEQ-NG" "DNA" "" "" "0000376131" "00374937" "1" "00000" "00006" "2021-05-27 14:15:58" "" "" "SEQ-NG" "DNA" "" "284 gene panel" "0000376618" "00375421" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000377363" "00376167" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "DHPLC" "DNA" "blood" "" "0000377436" "00376240" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "?" "DNA" "" "Methods described in Aleman 2007, Jacobson 2006, Jacobson 1987 and Roman 2016" "0000377673" "00376468" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SEQ" "DNA" "blood" "" "0000377674" "00376469" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SEQ" "DNA" "blood" "" "0000377678" "00376473" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCR;SEQ" "DNA" "blood" "" "0000377684" "00376479" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "SEQ;PCR;DHPLC" "DNA" "blood" "" "0000377717" "00376512" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "PCRm;SEQ" "DNA" "blood" "" "0000377920" "00376714" "1" "00000" "00008" "2021-06-25 10:31:56" "" "" "arraySEQ" "DNA" "" "" "0000377964" "00376758" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377968" "00376762" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377972" "00376766" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377988" "00376782" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377991" "00376785" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000378375" "00377170" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378397" "00377192" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378406" "00377201" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378726" "00377523" "1" "00000" "03840" "2021-07-22 15:35:32" "00006" "2021-08-06 16:49:30" "SEQ-NG;SEQ" "DNA" "blood" "Targeted next-generation sequencing" "0000378731" "00377528" "1" "00000" "03840" "2021-07-22 15:35:32" "00006" "2021-08-06 16:49:30" "SEQ-NG;SEQ" "DNA" "blood" "Targeted next-generation sequencing" "0000378732" "00377529" "1" "00000" "03840" "2021-07-22 15:35:32" "00006" "2021-08-06 16:49:30" "SEQ-NG;SEQ" "DNA" "blood" "Targeted next-generation sequencing" "0000379020" "00377816" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PE" "DNA" "blood" "" "0000379021" "00377817" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PE" "DNA" "blood" "" "0000379043" "00377839" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PE" "DNA" "blood" "" "0000379094" "00377890" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" "" "0000379095" "00377891" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" "" "0000379107" "00377903" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" "" "0000379111" "00377907" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" "" "0000379113" "00377909" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" "" "0000379114" "00377910" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "PCR; SEQ" "DNA" "blood" "" "0000379143" "00377939" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "arraySNP" "DNA" "blood" "" "0000379154" "00377950" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "SEQ; SEQ-NG-S" "DNA" "blood" "" "0000380575" "00379375" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "PCR;SEQ; arraySNP" "DNA" "blood" "" "0000380763" "00379564" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000380847" "00379648" "1" "03508" "03508" "2021-08-06 06:38:41" "" "" "SEQ-NG-I" "DNA" "" "" "0000381023" "00379821" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381024" "00379822" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381025" "00379823" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381026" "00379824" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381027" "00379825" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381028" "00379826" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381398" "00380196" "1" "00000" "03840" "2021-08-11 10:47:34" "" "" "SEQ-NG" "DNA" "blood" "" "0000382221" "00381007" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG;SEQp" "DNA" "blood" "targeted exon capture/IROme assay" "0000382240" "00381026" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ" "DNA" "blood" "" "0000382254" "00381040" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ" "DNA" "blood" "" "0000382263" "00381049" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ" "DNA" "blood" "" "0000382298" "00381084" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "arraySNP;SEQ;PCR" "DNA" "blood" "" "0000382300" "00381086" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "arraySNP;SEQ;PCR" "DNA" "blood" "" "0000382302" "00381088" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "arraySNP;SEQ;PCR" "DNA" "blood" "" "0000382303" "00381089" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "arraySNP;SEQ;PCR" "DNA" "blood" "" "0000382813" "00381597" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382814" "00381598" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382815" "00381599" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382824" "00381608" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382840" "00381624" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382843" "00381627" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382846" "00381630" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382858" "00381642" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000383034" "00381818" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "PCR;SEQ-NG" "DNA" "blood or a saliva sample" "" "0000383084" "00381868" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" "" "0000383085" "00381869" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" "" "0000383086" "00381870" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" "" "0000383087" "00381871" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" "" "0000383151" "00381935" "1" "00000" "03840" "2021-09-06 14:12:14" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000383152" "00381936" "1" "00000" "03840" "2021-09-06 14:12:14" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000383153" "00381937" "1" "00000" "03840" "2021-09-06 14:12:14" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000383154" "00381938" "1" "00000" "03840" "2021-09-06 14:12:14" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000383155" "00381939" "1" "00000" "03840" "2021-09-06 14:12:14" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000383156" "00381940" "1" "00000" "03840" "2021-09-06 14:12:14" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000383175" "00381959" "1" "00000" "03840" "2021-09-06 15:35:13" "" "" "SEQ-NG" "DNA" "blood" "whole exome sequencing" "0000383349" "00382133" "1" "00000" "03840" "2021-09-07 10:12:12" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000383480" "00382266" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383481" "00382267" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383482" "00382268" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383483" "00382269" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383484" "00382270" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383485" "00382271" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383486" "00382272" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383489" "00382275" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383744" "00382530" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383745" "00382531" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383746" "00382532" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383747" "00382533" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383748" "00382534" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383749" "00382535" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383750" "00382536" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000384002" "00382786" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "microsat" "DNA" "" "" "0000384290" "00383066" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "SEQ" "DNA" "blood" "" "0000384304" "00383080" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "SEQ" "DNA" "blood" "" "0000384317" "00383093" "1" "00000" "00008" "2021-09-23 02:25:49" "" "" "SEQ" "DNA" "blood" "" "0000384648" "00383423" "1" "00000" "03840" "2021-09-29 09:58:40" "" "" "?" "DNA" "" "retrospective study" "0000384649" "00383424" "1" "00000" "03840" "2021-09-29 09:58:40" "" "" "?" "DNA" "" "retrospective study" "0000384650" "00383425" "1" "00000" "03840" "2021-09-29 09:58:40" "" "" "?" "DNA" "" "retrospective study" "0000384651" "00383426" "1" "00000" "03840" "2021-09-29 09:58:40" "" "" "?" "DNA" "" "retrospective study" "0000384652" "00383427" "1" "00000" "03840" "2021-09-29 09:58:40" "" "" "?" "DNA" "" "retrospective study" "0000384653" "00383428" "1" "00000" "03840" "2021-09-29 09:58:40" "" "" "?" "DNA" "" "retrospective study" "0000384968" "00383743" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000384969" "00383744" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000384974" "00383749" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000384982" "00383757" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000385025" "00383800" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000385073" "00383848" "1" "00000" "03840" "2021-09-29 12:44:05" "" "" "SEQ" "DNA" "" "retrospective analysis" "0000385074" "00383849" "1" "00000" "03840" "2021-09-29 12:44:05" "" "" "SEQ" "DNA" "" "retrospective analysis" "0000385130" "00383905" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385165" "00383940" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385179" "00383954" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP;SEQ" "DNA" "" "" "0000385184" "00383959" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385198" "00383973" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385204" "00383979" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385216" "00383991" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385221" "00383996" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP;SEQ" "DNA" "" "" "0000385222" "00383997" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385226" "00384001" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385229" "00384004" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385232" "00384007" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385234" "00384009" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385242" "00384017" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP;SEQ" "DNA" "" "" "0000385253" "00384028" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385283" "00384058" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385289" "00384064" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385304" "00384079" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385326" "00384101" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385341" "00384116" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385360" "00384135" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385361" "00384136" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385378" "00384153" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385379" "00384154" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385387" "00384162" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385389" "00384164" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385395" "00384170" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385435" "00384210" "1" "00000" "03840" "2021-09-29 13:14:43" "" "" "SEQ-NG-I" "DNA" "blood" "108-gene panel targeted resequencing using MIPs library prep" "0000385439" "00384214" "1" "00000" "03840" "2021-09-29 13:14:43" "" "" "SEQ-NG-I" "DNA" "blood" "108-gene panel targeted resequencing using MIPs library prep" "0000385605" "00384380" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes" "0000385635" "00384410" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes" "0000385701" "00384476" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes" "0000385966" "00384740" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000385980" "00384754" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000385981" "00384755" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000385982" "00384756" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000386237" "00385008" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386246" "00385017" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386259" "00385030" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386265" "00385036" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386266" "00385037" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386268" "00385039" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386278" "00385049" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ" "DNA" "" "Sanger sequencing" "0000386286" "00385057" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386313" "00385084" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386316" "00385087" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386319" "00385090" "1" "00000" "03840" "2021-10-06 17:52:46" "" "" "SEQ-NG" "DNA" "" "targeted next-generation sequencing" "0000386836" "00385607" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "PE" "DNA" "" "" "0000386837" "00385608" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "arraySNP" "DNA" "" "RD-xip" "0000386838" "00385609" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "PE" "DNA" "" "" "0000386840" "00385611" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "arraySNP" "DNA" "" "RD-xip" "0000386842" "00385613" "1" "00000" "00008" "2021-10-13 10:28:12" "" "" "arraySNP" "DNA" "" "RD-xip" "0000387194" "00385966" "1" "00000" "00008" "2021-10-19 12:24:34" "" "" "SEQ-NG;PCR" "DNA" "" "" "0000387195" "00385967" "1" "00000" "00008" "2021-10-19 12:24:34" "" "" "SEQ-NG;PCR" "DNA" "" "" "0000387389" "00386160" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387399" "00386170" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387428" "00386199" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387430" "00386201" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387436" "00386207" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387453" "00386224" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387460" "00386231" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387512" "00386283" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387797" "00386569" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387949" "00386721" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388011" "00386783" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388072" "00386844" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388085" "00386857" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388872" "00387646" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388873" "00387647" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388874" "00387648" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388875" "00387649" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388876" "00387650" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388877" "00387651" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388878" "00387652" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388879" "00387653" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388880" "00387654" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388881" "00387655" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388882" "00387656" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000389392" "00388153" "1" "00000" "03840" "2021-11-02 11:59:44" "" "" "SEQ-NG" "DNA" "blood" "targeted panel-based next-generation sequencing, including deep intronic and regulatory variants or whole exome sequencing" "0000389435" "00388196" "1" "00006" "00006" "2021-11-02 18:56:14" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000389436" "00388197" "1" "00006" "00006" "2021-11-02 18:56:14" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000389720" "00388479" "1" "00000" "00008" "2021-11-04 08:27:28" "" "" "SEQ-NG" "DNA" "" "CNV gene panel next-generation sequencing" "0000390183" "00388940" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000390184" "00388941" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390233" "00388990" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000390234" "00388991" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390235" "00388992" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390249" "00389006" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper" "0000390267" "00389024" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET5 targeted sequencing panel - see paper" "0000390288" "00389045" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000390291" "00389048" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000390292" "00389049" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390303" "00389060" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000390308" "00389065" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390309" "00389066" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390326" "00389083" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390378" "00389135" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390381" "00389138" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390382" "00389139" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390442" "00389199" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET4 targeted sequencing panel - see paper" "0000390534" "00389291" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000390588" "00389345" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper" "0000390818" "00389575" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390886" "00389643" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET5 targeted sequencing panel - see paper" "0000390897" "00389654" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000390938" "00389695" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390951" "00389708" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391071" "00389828" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000391188" "00389945" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391194" "00389951" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391229" "00389986" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000391271" "00390030" "1" "00000" "03840" "2021-11-08 12:45:13" "" "" "SEQ-NG-I" "DNA" "blood" "326 selected genes from whole exome sequencing" "0000391481" "00390240" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391482" "00390241" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391483" "00390242" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391484" "00390243" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391485" "00390244" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391486" "00390245" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391989" "00390748" "1" "00000" "03840" "2021-11-11 19:27:39" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing" "0000391990" "00390749" "1" "00000" "03840" "2021-11-11 19:27:39" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing" "0000391991" "00390750" "1" "00000" "03840" "2021-11-11 19:27:39" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing" "0000391993" "00390752" "1" "00000" "03840" "2021-11-11 19:27:39" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing" "0000392034" "00390793" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "arraySEQ" "DNA" "Blood" "" "0000392082" "00390841" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "SEQ" "DNA" "" "" "0000392120" "00390879" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "SEQ" "DNA" "" "" "0000392122" "00390881" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "SEQ" "DNA" "" "" "0000392134" "00390893" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "SEQ" "DNA" "" "" "0000392397" "00391155" "1" "00000" "03840" "2021-11-13 11:00:19" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing" "0000392596" "00391354" "1" "00000" "03840" "2021-11-15 18:02:17" "" "" "SEQ-NG" "DNA" "" "retrospective case note review, targeted gene panel testing" "0000392759" "00391517" "1" "00000" "03840" "2021-11-17 14:55:16" "" "" "?" "DNA" "blood" "NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families" "0000392760" "00391518" "1" "00000" "03840" "2021-11-17 14:55:16" "" "" "?" "DNA" "blood" "NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families" "0000392761" "00391519" "1" "00000" "03840" "2021-11-17 14:55:16" "" "" "?" "DNA" "blood" "NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families" "0000392762" "00391520" "1" "00000" "03840" "2021-11-17 14:55:16" "" "" "?" "DNA" "blood" "NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families" "0000392763" "00391521" "1" "00000" "03840" "2021-11-17 14:55:16" "" "" "?" "DNA" "blood" "NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families" "0000392764" "00391522" "1" "00000" "03840" "2021-11-17 14:55:16" "" "" "?" "DNA" "blood" "NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families" "0000392765" "00391523" "1" "00000" "03840" "2021-11-17 14:55:16" "" "" "?" "DNA" "blood" "NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families" "0000392766" "00391524" "1" "00000" "03840" "2021-11-17 14:55:16" "" "" "?" "DNA" "blood" "NGS gene panel investigation in 60 families, Sanger sequencing in 27 families, and Asper microarray in 25 families" "0000392868" "00391627" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392869" "00391628" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392870" "00391629" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392871" "00391630" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392872" "00391631" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392873" "00391632" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392874" "00391633" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392875" "00391634" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392876" "00391635" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392877" "00391636" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392878" "00391637" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392879" "00391638" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392880" "00391639" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392962" "00391721" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392963" "00391722" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392964" "00391723" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392965" "00391724" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392966" "00391725" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392967" "00391726" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000392968" "00391727" "1" "00000" "03840" "2021-11-18 13:42:28" "" "" "?" "DNA" "blood" "224 gene IRD panel 93 patients, 280–300 gene IRD panel 21 patients, 20 gene LCA panel 20 patients, from whole exome 1 patient; SNP array 10 patients; Sanger Sequencing from one gene analysis 2 patien" "0000393107" "00391865" "1" "00000" "03840" "2021-11-19 12:39:43" "" "" "SEQ-NG" "DNA" "blood" "whole genome seuqencing with phasing analysis" "0000394586" "00393338" "1" "00000" "03840" "2021-11-29 11:52:56" "" "" "SEQ" "DNA" "blood" "whole exome sequencing" "0000394587" "00393339" "1" "00000" "03840" "2021-11-29 11:52:56" "" "" "SEQ" "DNA" "blood" "whole exome sequencing" "0000394588" "00393340" "1" "00000" "03840" "2021-11-29 11:52:56" "" "" "SEQ" "DNA" "blood" "whole exome sequencing" "0000394589" "00393341" "1" "00000" "03840" "2021-11-29 11:52:56" "" "" "SEQ" "DNA" "blood" "whole exome sequencing" "0000394691" "00393443" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394727" "00393479" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394815" "00393567" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394841" "00393593" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394963" "00393715" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394986" "00393738" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395002" "00393754" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG;MLPA" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395007" "00393759" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395012" "00393764" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395026" "00393778" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395097" "00393849" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395113" "00393865" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395137" "00393889" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395138" "00393890" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395167" "00393919" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395807" "00394560" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395808" "00394561" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395809" "00394562" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395810" "00394563" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395811" "00394564" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395812" "00394565" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395813" "00394566" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395814" "00394567" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395815" "00394568" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395816" "00394569" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000396664" "00395426" "1" "00000" "03840" "2021-12-06 14:47:57" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing" "0000397013" "00395774" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397033" "00395794" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397036" "00395797" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397113" "00395874" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397462" "00396221" "1" "00000" "00008" "2021-12-15 12:47:34" "" "" "SEQ-NG" "DNA" "" "" "0000397465" "00396224" "1" "00000" "00008" "2021-12-15 12:47:34" "" "" "arraySNP" "DNA" "" "" "0000397879" "00396636" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000407226" "00405985" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "?" "DNA" "" "microarray chip" "0000407227" "00405986" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "?" "DNA" "" "microarray chip" "0000407228" "00405987" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "?" "DNA" "" "microarray chip" "0000407229" "00405988" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "?" "DNA" "" "microarray chip" "0000407230" "00405989" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "?" "DNA" "" "microarray chip" "0000407231" "00405990" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "?" "DNA" "" "microarray chip" "0000407232" "00405991" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "?" "DNA" "" "microarray chip" "0000407233" "00405992" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "?" "DNA" "" "microarray chip" "0000407234" "00405993" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "?" "DNA" "" "microarray chip" "0000407244" "00406003" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "comprehensive retinal dystrophy panel" "0000407245" "00406004" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "comprehensive retinal dystrophy panel" "0000407246" "00406005" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407247" "00406006" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407248" "00406007" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407249" "00406008" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407250" "00406009" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407251" "00406010" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407252" "00406011" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407253" "00406012" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407254" "00406013" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407255" "00406014" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407256" "00406015" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407257" "00406016" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407258" "00406017" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407259" "00406018" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407260" "00406019" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407261" "00406020" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407262" "00406021" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "" "0000407263" "00406022" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;PCR" "DNA" "blood" "" "0000407264" "00406023" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;PCR" "DNA" "blood" "" "0000407265" "00406024" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "blood" "homozygosity mapping" "0000407266" "00406025" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "blood" "homozygosity mapping" "0000407267" "00406026" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "blood" "homozygosity mapping" "0000407268" "00406027" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "blood" "homozygosity mapping" "0000407269" "00406028" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "blood" "homozygosity mapping" "0000407270" "00406029" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "blood" "homozygosity mapping" "0000407271" "00406030" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "blood" "Sanger Sequencing Panel" "0000407272" "00406031" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "Next-Generation Sequencing Panel" "0000407273" "00406032" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "blood" "Sanger Sequencing Panel" "0000407274" "00406033" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "blood" "Sanger Sequencing" "0000407275" "00406034" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "Next-Generation Sequencing Panel" "0000407276" "00406035" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "Whole Exome Sequencing" "0000407277" "00406036" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "Next-Generation Sequencing Panel" "0000407278" "00406037" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "Next-Generation Sequencing Panel" "0000407279" "00406038" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "Next-Generation Sequencing Panel" "0000407280" "00406039" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "Next-Generation Sequencing Panel" "0000407281" "00406040" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "Next-Generation Sequencing Panel" "0000407282" "00406041" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "Next-Generation Sequencing Panel" "0000407283" "00406042" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "blood" "Sanger Sequencing Panel" "0000407284" "00406043" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "blood" "Sanger Sequencing" "0000407285" "00406044" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "PE" "DNA" "blood" "Arrayed Primer Extension (APEX)" "0000407286" "00406045" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "" "0000407287" "00406046" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "" "0000407288" "00406047" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "" "0000407289" "00406048" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "" "0000407290" "00406049" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "" "0000407291" "00406050" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "" "0000407292" "00406051" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "blood" "" "0000407293" "00406052" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407294" "00406053" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407295" "00406054" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407296" "00406055" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407297" "00406056" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407298" "00406057" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407299" "00406058" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407300" "00406059" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407301" "00406060" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407302" "00406061" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407303" "00406062" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407304" "00406063" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407305" "00406064" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WES" "0000407306" "00406065" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407307" "00406066" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ" "DNA" "" "" "0000407308" "00406067" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "" "" "0000407309" "00406068" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "SEQ-NG" "DNA" "" "WES" "0000407310" "00406069" "1" "00000" "00008" "2022-03-25 07:05:25" "" "" "RT-PCR;SEQ" "DNA" "" "" "0000407632" "00406390" "1" "00000" "03840" "2022-03-29 19:09:00" "" "" "SEQ" "DNA" "blood" "" "0000407644" "00406402" "1" "00000" "03840" "2022-03-29 19:09:00" "" "" "SEQ" "DNA" "blood" "" "0000407645" "00406403" "1" "00000" "03840" "2022-03-29 19:09:00" "" "" "SEQ" "DNA" "blood" "" "0000407646" "00406404" "1" "00000" "03840" "2022-03-29 19:09:00" "" "" "SEQ" "DNA" "blood" "" "0000407647" "00406405" "1" "00000" "03840" "2022-03-29 19:09:00" "" "" "SEQ" "DNA" "blood" "" "0000409316" "00408061" "1" "00000" "03840" "2022-04-13 12:09:21" "" "" "arraySNP;SEQ" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 1268 "{{screeningid}}" "{{geneid}}" "0000033106" "CRB1" "0000033107" "CRB1" "0000033108" "CRB1" "0000033109" "CRB1" "0000033110" "CRB1" "0000033111" "CRB1" "0000033112" "CRB1" "0000033113" "CRB1" "0000033114" "CRB1" "0000033115" "CRB1" "0000033116" "CRB1" "0000033117" "CRB1" "0000033118" "CRB1" "0000033119" "CRB1" "0000033120" "CRB1" "0000033121" "CRB1" "0000033122" "CRB1" "0000033123" "CRB1" "0000033124" "CRB1" "0000033125" "CRB1" "0000033126" "CRB1" "0000033127" "CRB1" "0000033128" "CRB1" "0000033129" "CRB1" "0000033130" "CRB1" "0000033131" "CRB1" "0000033132" "CRB1" "0000033133" "CRB1" "0000033134" "CRB1" "0000033135" "CRB1" "0000033136" "CRB1" "0000033137" "CRB1" "0000033138" "CRB1" "0000033139" "CRB1" "0000033140" "CRB1" "0000033141" "CRB1" "0000033142" "CRB1" "0000033143" "CRB1" "0000033144" "CRB1" "0000033145" "CRB1" "0000033146" "CRB1" "0000033159" "CC2D2A" "0000033159" "CRB1" "0000033159" "RP2" "0000033159" "SEMA4A" "0000033159" "TOPORS" "0000033160" "CRB1" "0000033160" "TOPORS" "0000033161" "ABCA4" "0000033161" "CRB1" "0000033161" "SEMA4A" "0000033161" "TOPORS" "0000033174" "CRB1" "0000033174" "PDE6B" "0000033174" "SEMA4A" "0000033212" "CRB1" "0000033212" "PDE6B" "0000033212" "SEMA4A" "0000033214" "C2orf71" "0000033214" "CACNA2D4" "0000033214" "CRB1" "0000033214" "PDE6B" "0000033226" "CRB1" "0000033238" "BEST1" "0000033238" "CRB1" "0000033238" "NPHP4" "0000033238" "RLBP1" "0000033412" "CRB1" "0000033416" "CRB1" "0000033761" "CRB1" "0000038005" "CRB1" "0000038006" "CRB1" "0000038007" "CRB1" "0000038008" "CRB1" "0000038009" "CRB1" "0000038010" "CRB1" "0000038011" "CRB1" "0000038012" "CRB1" "0000038013" "CRB1" "0000038014" "CRB1" "0000038015" "CRB1" "0000038016" "CRB1" "0000038017" "CRB1" "0000038018" "CRB1" "0000038019" "CRB1" "0000038020" "CRB1" "0000038021" "CRB1" "0000038022" "CRB1" "0000038023" "CRB1" "0000038024" "CRB1" "0000038025" "CRB1" "0000038026" "CRB1" "0000038027" "CRB1" "0000038028" "CRB1" "0000038029" "CRB1" "0000038030" "CRB1" "0000038031" "CRB1" "0000038032" "CRB1" "0000038033" "CRB1" "0000038034" "CRB1" "0000038035" "CRB1" "0000038036" "CRB1" "0000038037" "CRB1" "0000038038" "CRB1" "0000038039" "CRB1" "0000038040" "CRB1" "0000038041" "CRB1" "0000038042" "CRB1" "0000038043" "CRB1" "0000038044" "CRB1" "0000038045" "CRB1" "0000038046" "CRB1" "0000038047" "CRB1" "0000038048" "CRB1" "0000038049" "CRB1" "0000038050" "CRB1" "0000038051" "CRB1" "0000038052" "CRB1" "0000038053" "CRB1" "0000038054" "CRB1" "0000038055" "CRB1" "0000038056" "CRB1" "0000038057" "CRB1" "0000038058" "CRB1" "0000038059" "CRB1" "0000038060" "CRB1" "0000038061" "CRB1" "0000038062" "CRB1" "0000038063" "CRB1" "0000038064" "CRB1" "0000038065" "CRB1" "0000038066" "CRB1" "0000038067" "CRB1" "0000038068" "CRB1" "0000038069" "CRB1" "0000038070" "CRB1" "0000038071" "CRB1" "0000038072" "CRB1" "0000038073" "CRB1" "0000038074" "CRB1" "0000038075" "CRB1" "0000038076" "CRB1" "0000038077" "CRB1" "0000038078" "CRB1" "0000038079" "CRB1" "0000038080" "CRB1" "0000038081" "CRB1" "0000038082" "CRB1" "0000038083" "CRB1" "0000038084" "CRB1" "0000038085" "CRB1" "0000038086" "CRB1" "0000038087" "CRB1" "0000038088" "CRB1" "0000038089" "CRB1" "0000038090" "CRB1" "0000038091" "CRB1" "0000038092" "CRB1" "0000038093" "CRB1" "0000038094" "CRB1" "0000038095" "CRB1" "0000038096" "CRB1" "0000038097" "CRB1" "0000038098" "CRB1" "0000038099" "CRB1" "0000038100" "CRB1" "0000038101" "CRB1" "0000038102" "CRB1" "0000038103" "CRB1" "0000038104" "CRB1" "0000038105" "CRB1" "0000038106" "CRB1" "0000038107" "CRB1" "0000038108" "CRB1" "0000038109" "CRB1" "0000038110" "CRB1" "0000038111" "CRB1" "0000038112" "CRB1" "0000038113" "CRB1" "0000038114" "CRB1" "0000038115" "CRB1" "0000038116" "CRB1" "0000038117" "CRB1" "0000038118" "CRB1" "0000038119" "CRB1" "0000038120" "CRB1" "0000038121" "CRB1" "0000038122" "CRB1" "0000038123" "CRB1" "0000038124" "CRB1" "0000038125" "CRB1" "0000038126" "CRB1" "0000038127" "CRB1" "0000038128" "CRB1" "0000038129" "CRB1" "0000038130" "CRB1" "0000038131" "CRB1" "0000038132" "CRB1" "0000038133" "CRB1" "0000038134" "CRB1" "0000038135" "CRB1" "0000038136" "CRB1" "0000038137" "CRB1" "0000038138" "CRB1" "0000038139" "CRB1" "0000038140" "CRB1" "0000038141" "CRB1" "0000038142" "CRB1" "0000038143" "CRB1" "0000038144" "CRB1" "0000038145" "CRB1" "0000038146" "CRB1" "0000038147" "CRB1" "0000038148" "CRB1" "0000038149" "CRB1" "0000038150" "CRB1" "0000038151" "CRB1" "0000038152" "CRB1" "0000038153" "CRB1" "0000038154" "CRB1" "0000038155" "CRB1" "0000038156" "CRB1" "0000038157" "CRB1" "0000038158" "CRB1" "0000038159" "CRB1" "0000038160" "CRB1" "0000038161" "CRB1" "0000038162" "CRB1" "0000038163" "CRB1" "0000038164" "CRB1" "0000038165" "CRB1" "0000038166" "CRB1" "0000038167" "CRB1" "0000038168" "CRB1" "0000038169" "CRB1" "0000038170" "CRB1" "0000038171" "CRB1" "0000038172" "CRB1" "0000038173" "CRB1" "0000038174" "CRB1" "0000038175" "CRB1" "0000038176" "CRB1" "0000038177" "CRB1" "0000038178" "CRB1" "0000038179" "CRB1" "0000038180" "CRB1" "0000038181" "CRB1" "0000038182" "CRB1" "0000038183" "CRB1" "0000038184" "CRB1" "0000038185" "CRB1" "0000038186" "CRB1" "0000038187" "CRB1" "0000038188" "CRB1" "0000038189" "CRB1" "0000038190" "CRB1" "0000038191" "CRB1" "0000038192" "CRB1" "0000038193" "CRB1" "0000038194" "CRB1" "0000038195" "CRB1" "0000038196" "CRB1" "0000038197" "CRB1" "0000038198" "CRB1" "0000038199" "CRB1" "0000038200" "CRB1" "0000038201" "CRB1" "0000038202" "CRB1" "0000038203" "CRB1" "0000038204" "CRB1" "0000038205" "CRB1" "0000038206" "CRB1" "0000038207" "CRB1" "0000038208" "CRB1" "0000038209" "CRB1" "0000038210" "CRB1" "0000038211" "CRB1" "0000038212" "CRB1" "0000038213" "CRB1" "0000038214" "CRB1" "0000038215" "CRB1" "0000038216" "CRB1" "0000038217" "CRB1" "0000038218" "CRB1" "0000038219" "CRB1" "0000038220" "CRB1" "0000038221" "CRB1" "0000038222" "CRB1" "0000038223" "CRB1" "0000038224" "CRB1" "0000038225" "CRB1" "0000038226" "CRB1" "0000038227" "CRB1" "0000038228" "CRB1" "0000038229" "CRB1" "0000038230" "CRB1" "0000038231" "CRB1" "0000038232" "CRB1" "0000038233" "CRB1" "0000038234" "CRB1" "0000038235" "CRB1" "0000038236" "CRB1" "0000038237" "CRB1" "0000038238" "CRB1" "0000038239" "CRB1" "0000038240" "CRB1" "0000038241" "CRB1" "0000038242" "CRB1" "0000038243" "CRB1" "0000038244" "CRB1" "0000038245" "CRB1" "0000038246" "CRB1" "0000038247" "CRB1" "0000038248" "CRB1" "0000038249" "CRB1" "0000038250" "CRB1" "0000038251" "CRB1" "0000038252" "CRB1" "0000038253" "CRB1" "0000038254" "CRB1" "0000038255" "CRB1" "0000038256" "CRB1" "0000038257" "CRB1" "0000038258" "CRB1" "0000038259" "CRB1" "0000038260" "CRB1" "0000038261" "CRB1" "0000038262" "CRB1" "0000038263" "CRB1" "0000038264" "CRB1" "0000038265" "CRB1" "0000038266" "CRB1" "0000038267" "CRB1" "0000038268" "CRB1" "0000038269" "CRB1" "0000038270" "CRB1" "0000038271" "CRB1" "0000038272" "CRB1" "0000038273" "CRB1" "0000038274" "CRB1" "0000038275" "CRB1" "0000038276" "CRB1" "0000038277" "CRB1" "0000038278" "CRB1" "0000038279" "CRB1" "0000038280" "CRB1" "0000038281" "CRB1" "0000038282" "CRB1" "0000038283" "CRB1" "0000038284" "CRB1" "0000038285" "CRB1" "0000038286" "CRB1" "0000038287" "CRB1" "0000038288" "CRB1" "0000038289" "CRB1" "0000038290" "CRB1" "0000038291" "CRB1" "0000038292" "CRB1" "0000038293" "CRB1" "0000038294" "CRB1" "0000038295" "CRB1" "0000038296" "CRB1" "0000038297" "CRB1" "0000038298" "CRB1" "0000038299" "CRB1" "0000038300" "CRB1" "0000038301" "CRB1" "0000038302" "CRB1" "0000038303" "CRB1" "0000038304" "CRB1" "0000038305" "CRB1" "0000038306" "CRB1" "0000038307" "CRB1" "0000038308" "CRB1" "0000038309" "CRB1" "0000038310" "CRB1" "0000038311" "CRB1" "0000038312" "CRB1" "0000038313" "CRB1" "0000038314" "CRB1" "0000038315" "CRB1" "0000038316" "CRB1" "0000038317" "CRB1" "0000038318" "CRB1" "0000038319" "CRB1" "0000038320" "CRB1" "0000038321" "CRB1" "0000038322" "CRB1" "0000038323" "CRB1" "0000038324" "CRB1" "0000038325" "CRB1" "0000038328" "CRB1" "0000038329" "CRB1" "0000038330" "CRB1" "0000038331" "CRB1" "0000038332" "CRB1" "0000038333" "CRB1" "0000038334" "CRB1" "0000038335" "CRB1" "0000038336" "CRB1" "0000038337" "CRB1" "0000038338" "CRB1" "0000038339" "CRB1" "0000038340" "CRB1" "0000038341" "CRB1" "0000038342" "CRB1" "0000038343" "CRB1" "0000038344" "CRB1" "0000038345" "CRB1" "0000038346" "CRB1" "0000038347" "CRB1" "0000038348" "CRB1" "0000038349" "CRB1" "0000038350" "CRB1" "0000038351" "CRB1" "0000038352" "CRB1" "0000038353" "CRB1" "0000038354" "CRB1" "0000038355" "CRB1" "0000038356" "CRB1" "0000038357" "CRB1" "0000038358" "CRB1" "0000038359" "CRB1" "0000038360" "CRB1" "0000038361" "CRB1" "0000038362" "CRB1" "0000038363" "CRB1" "0000038364" "CRB1" "0000038365" "CRB1" "0000038366" "CRB1" "0000038367" "CRB1" "0000038368" "CRB1" "0000038369" "CRB1" "0000038370" "CRB1" "0000038371" "CRB1" "0000038372" "CRB1" "0000038373" "CRB1" "0000038374" "CRB1" "0000038375" "CRB1" "0000038376" "CRB1" "0000038377" "CRB1" "0000038378" "CRB1" "0000038379" "CRB1" "0000038380" "CRB1" "0000038381" "CRB1" "0000038382" "CRB1" "0000038383" "CRB1" "0000038384" "CRB1" "0000038385" "CRB1" "0000038386" "CRB1" "0000038387" "CRB1" "0000038388" "CRB1" "0000038389" "CRB1" "0000038390" "CRB1" "0000038391" "CRB1" "0000038392" "CRB1" "0000038393" "CRB1" "0000038394" "CRB1" "0000038395" "CRB1" "0000038396" "CRB1" "0000038397" "CRB1" "0000038398" "CRB1" "0000038399" "CRB1" "0000038400" "CRB1" "0000038401" "CRB1" "0000038402" "CRB1" "0000038403" "CRB1" "0000038404" "CRB1" "0000038405" "CRB1" "0000038406" "CRB1" "0000038407" "CRB1" "0000038408" "CRB1" "0000038409" "CRB1" "0000038410" "CRB1" "0000038411" "CRB1" "0000038412" "CRB1" "0000038413" "CRB1" "0000038414" "CRB1" "0000038415" "CRB1" "0000038416" "CRB1" "0000038417" "CRB1" "0000038418" "CRB1" "0000038419" "CRB1" "0000038420" "CRB1" "0000038421" "CRB1" "0000038422" "CRB1" "0000038423" "CRB1" "0000038424" "CRB1" "0000038425" "CRB1" "0000038426" "CRB1" "0000038427" "CRB1" "0000038428" "CRB1" "0000038429" "CRB1" "0000038430" "CRB1" "0000038431" "CRB1" "0000038432" "CRB1" "0000038433" "CRB1" "0000038434" "CRB1" "0000038435" "CRB1" "0000038436" "CRB1" "0000038437" "CRB1" "0000038438" "CRB1" "0000038439" "CRB1" "0000038440" "CRB1" "0000038441" "CRB1" "0000038442" "CRB1" "0000038443" "CRB1" "0000038444" "CRB1" "0000038445" "CRB1" "0000038446" "CRB1" "0000038447" "CRB1" "0000038448" "CRB1" "0000038449" "CRB1" "0000038450" "CRB1" "0000038451" "CRB1" "0000038452" "CRB1" "0000038453" "CRB1" "0000038454" "CRB1" "0000038455" "CRB1" "0000038456" "CRB1" "0000038457" "CRB1" "0000038458" "CRB1" "0000038459" "CRB1" "0000038460" "CRB1" "0000038461" "CRB1" "0000038462" "CRB1" "0000038463" "CRB1" "0000038464" "CRB1" "0000038465" "CRB1" "0000038466" "CRB1" "0000038467" "CRB1" "0000038468" "CRB1" "0000038469" "CRB1" "0000038470" "CRB1" "0000038471" "CRB1" "0000038472" "CRB1" "0000038473" "CRB1" "0000038474" "CRB1" "0000038475" "CRB1" "0000038476" "CRB1" "0000038477" "CRB1" "0000038478" "CRB1" "0000038479" "CRB1" "0000038480" "CRB1" "0000038481" "CRB1" "0000038482" "CRB1" "0000038483" "CRB1" "0000038484" "CRB1" "0000038485" "CRB1" "0000038486" "CRB1" "0000038487" "CRB1" "0000038488" "CRB1" "0000038489" "CRB1" "0000038490" "CRB1" "0000038491" "CRB1" "0000038492" "CRB1" "0000038493" "CRB1" "0000038494" "CRB1" "0000038495" "CRB1" "0000038496" "CRB1" "0000038497" "CRB1" "0000038498" "CRB1" "0000038499" "CRB1" "0000038500" "CRB1" "0000038501" "CRB1" "0000038502" "CRB1" "0000038503" "CRB1" "0000038504" "CRB1" "0000038505" "CRB1" "0000038506" "CRB1" "0000038507" "CRB1" "0000038508" "CRB1" "0000038509" "CRB1" "0000038510" "CRB1" "0000038511" "CRB1" "0000038512" "CRB1" "0000038513" "CRB1" "0000038514" "CRB1" "0000038515" "CRB1" "0000038516" "CRB1" "0000038517" "CRB1" "0000038518" "CRB1" "0000038519" "CRB1" "0000038520" "CRB1" "0000038521" "CRB1" "0000038522" "CRB1" "0000038523" "CRB1" "0000038529" "CRB1" "0000038530" "CRB1" "0000038531" "CRB1" "0000038532" "CRB1" "0000038533" "CRB1" "0000038534" "CRB1" "0000038535" "CRB1" "0000038536" "CRB1" "0000038537" "CRB1" "0000038538" "CRB1" "0000038539" "CRB1" "0000038540" "CRB1" "0000038541" "CRB1" "0000038542" "CRB1" "0000038543" "CRB1" "0000038544" "CRB1" "0000038545" "CRB1" "0000038546" "CRB1" "0000038547" "CRB1" "0000038548" "CRB1" "0000038549" "CRB1" "0000038550" "CRB1" "0000038551" "CRB1" "0000038552" "CRB1" "0000038553" "CRB1" "0000038554" "CRB1" "0000038555" "CRB1" "0000038556" "CRB1" "0000038557" "CRB1" "0000038558" "CRB1" "0000038559" "CRB1" "0000038560" "CRB1" "0000038561" "AIPL1" "0000038561" "CRB1" "0000038562" "CRB1" "0000038563" "CRB1" "0000038564" "CRB1" "0000038565" "CRB1" "0000038566" "CRB1" "0000038567" "CRB1" "0000038568" "CRB1" "0000038569" "CRB1" "0000038570" "CRB1" "0000038571" "CRB1" "0000038572" "CRB1" "0000038573" "CRB1" "0000038574" "CRB1" "0000038575" "CRB1" "0000038576" "CRB1" "0000038577" "CRB1" "0000038578" "CRB1" "0000038579" "CRB1" "0000038580" "CRB1" "0000038581" "CRB1" "0000038582" "CRB1" "0000038583" "CRB1" "0000038584" "CRB1" "0000038585" "CRB1" "0000038586" "CRB1" "0000038587" "CRB1" "0000038588" "CRB1" "0000038589" "CRB1" "0000038589" "EYS" "0000038590" "CRB1" "0000038591" "CRB1" "0000038592" "CRB1" "0000038593" "CRB1" "0000038594" "CRB1" "0000038595" "CRB1" "0000038596" "CRB1" "0000038597" "CRB1" "0000038598" "CRB1" "0000038599" "CRB1" "0000038600" "CRB1" "0000038601" "CRB1" "0000038602" "CRB1" "0000052591" "CRB1" "0000052591" "RPE65" "0000076649" "ABCA4" "0000076650" "ABCA4" "0000100506" "CRB1" "0000105518" "CNGB3" "0000105518" "CRB1" "0000105518" "ROM1" "0000156314" "CRB1" "0000156315" "CRB1" "0000156316" "CRB1" "0000156317" "CRB1" "0000156318" "CRB1" "0000156319" "CRB1" "0000156320" "CRB1" "0000156321" "CRB1" "0000156322" "CRB1" "0000156323" "CRB1" "0000233091" "CRB1" "0000233092" "CRB1" "0000233093" "CRB1" "0000233094" "CRB1" "0000233095" "CRB1" "0000233096" "CRB1" "0000233097" "CRB1" "0000233098" "CRB1" "0000233099" "CRB1" "0000233100" "CRB1" "0000233101" "CRB1" "0000233102" "CRB1" "0000233103" "CRB1" "0000233104" "CRB1" "0000233105" "CRB1" "0000233106" "CRB1" "0000233107" "CRB1" "0000233108" "CRB1" "0000233109" "CRB1" "0000233110" "CRB1" "0000233111" "CRB1" "0000233112" "CRB1" "0000233113" "CRB1" "0000233114" "CRB1" "0000233115" "CRB1" "0000233116" "CRB1" "0000233117" "CRB1" "0000233118" "CRB1" "0000233119" "CRB1" "0000234702" "CRB1" "0000241543" "CRB1" "0000241544" "CRB1" "0000241545" "CRB1" "0000309558" "CRB1" "0000309646" "CRB1" "0000309647" "CRB1" "0000309648" "CRB1" "0000309649" "CRB1" "0000309650" "CRB1" "0000309754" "CRB1" "0000309755" "CRB1" "0000310254" "CRB1" "0000310255" "CRB1" "0000310256" "CRB1" "0000310257" "CRB1" "0000310260" "CRB1" "0000310261" "CRB1" "0000310262" "CRB1" "0000310263" "CRB1" "0000310264" "CRB1" "0000310265" "CRB1" "0000310266" "CRB1" "0000310267" "CRB1" "0000310268" "CRB1" "0000310269" "CRB1" "0000310270" "CRB1" "0000310271" "CRB1" "0000310272" "CRB1" "0000321194" "CRB1" "0000321195" "CRB1" "0000321196" "CRB1" "0000326625" "CRB1" "0000326639" "CRB1" "0000326652" "CRB1" "0000326660" "CRB1" "0000326665" "CRB1" "0000326683" "CRB1" "0000326717" "CRB1" "0000326721" "CRB1" "0000326732" "CRB1" "0000327906" "CRB1" "0000329147" "CRB1" "0000329160" "CRB1" "0000329161" "CRB1" "0000329167" "CRB1" "0000329171" "CRB1" "0000329200" "CRB1" "0000329201" "CRB1" "0000329231" "CRB1" "0000329300" "CRB1" "0000329324" "CRB1" "0000329403" "CRB1" "0000329447" "CRB1" "0000329704" "CRB1" "0000329712" "CRB1" "0000329713" "CRB1" "0000333199" "CRB1" "0000333487" "CRB1" "0000333487" "PROM1" "0000333488" "CRB1" "0000333496" "CRB1" "0000333589" "CRB1" "0000333590" "CRB1" "0000333616" "CRB1" "0000333680" "CRB1" "0000333690" "CRB1" "0000333692" "CRB1" "0000334577" "CRB1" "0000334582" "RPGR" "0000334584" "RHO" "0000334623" "CRB1" "0000334690" "CRB1" "0000335043" "CRB1" "0000335044" "CRB1" "0000335045" "CRB1" "0000335046" "CRB1" "0000335047" "CRB1" "0000335048" "CRB1" "0000335125" "CRB1" "0000335149" "CRB1" "0000335150" "CRB1" "0000335164" "CRB1" "0000335172" "CRB1" "0000335173" "CRB1" "0000335174" "CRB1" "0000335195" "CRB1" "0000335196" "CRB1" "0000335197" "CRB1" "0000335338" "CRB1" "0000335339" "CRB1" "0000335486" "CRB1" "0000335504" "CRB1" "0000335643" "CRB1" "0000335790" "CRB1" "0000335790" "GUCY2D" "0000335791" "CRB1" "0000336337" "CRB1" "0000336338" "CRB1" "0000336469" "CRB1" "0000336470" "CRB1" "0000336497" "CRB1" "0000336498" "CRB1" "0000336499" "CRB1" "0000336500" "CRB1" "0000336501" "CRB1" "0000336502" "CRB1" "0000336623" "CRB1" "0000336640" "CRB1" "0000336715" "CRB1" "0000336716" "CRB1" "0000336717" "CRB1" "0000336831" "CRB1" "0000336832" "CRB1" "0000336836" "CRB1" "0000336837" "CRB1" "0000336838" "CRB1" "0000337201" "CRB1" "0000360137" "CRB1" "0000360138" "CRB1" "0000363395" "CRB1" "0000364133" "CRB1" "0000364670" "CRB1" "0000364671" "CRB1" "0000364672" "CRB1" "0000364682" "CRB1" "0000364683" "CRB1" "0000364751" "CRB1" "0000364752" "CRB1" "0000364811" "CRB1" "0000364838" "CRB1" "0000364856" "CRB1" "0000364878" "CRB1" "0000364921" "CRB1" "0000364956" "CRB1" "0000364980" "CRB1" "0000370182" "ABCA4" "0000373286" "CRB1" "0000373287" "CRB1" "0000373288" "CRB1" "0000373296" "CRB1" "0000373642" "CRB1" "0000373643" "CRB1" "0000373644" "CRB1" "0000373659" "CRB1" "0000373660" "CRB1" "0000373661" "CRB1" "0000373662" "CRB1" "0000373663" "CRB1" "0000373664" "CRB1" "0000373665" "CRB1" "0000373666" "CRB1" "0000373692" "CRB1" "0000373695" "CRB1" "0000373696" "CRB1" "0000373697" "CRB1" "0000373698" "CRB1" "0000373699" "CRB1" "0000373700" "CRB1" "0000373701" "CRB1" "0000373702" "CRB1" "0000373703" "CRB1" "0000373730" "CRB1" "0000373730" "TOPORS" "0000374649" "CRB1" "0000374736" "CRB1" "0000374756" "CRB1" "0000374761" "CRB1" "0000374981" "CRB1" "0000374981" "RDH12" "0000374981" "RPE65" "0000374982" "CRB1" "0000374982" "RDH12" "0000374982" "RPE65" "0000374983" "CRB2" "0000374983" "RDH12" "0000374983" "RPE65" "0000374984" "CRB1" "0000374984" "RDH12" "0000374984" "RPE65" "0000375037" "CRB1" "0000375083" "CRB1" "0000375119" "CRB1" "0000375122" "CRB1" "0000375149" "CRB1" "0000375151" "CRB1" "0000375161" "CRB1" "0000375164" "CRB1" "0000375165" "CRB1" "0000375185" "CRB1" "0000375186" "CRB1" "0000375187" "CRB1" "0000377363" "CRB1" "0000377436" "NYX" "0000377673" "CRB1" "0000377674" "CRB1" "0000377678" "CRB1" "0000377684" "CRB1" "0000377717" "CRB1" "0000377920" "AIPL1" "0000377920" "CRB1" "0000377920" "CRX" "0000377920" "GUCY2D" "0000377920" "LRAT" "0000377920" "MERTK" "0000377920" "RPE65" "0000377920" "RPGRIP1" "0000378375" "CRB1" "0000378397" "CRB1" "0000378406" "CRB1" "0000379020" "CRB1" "0000379021" "CRB1" "0000379043" "CRB1" "0000379094" "CRB1" "0000379095" "CRB1" "0000379107" "CRB1" "0000379111" "CRB1" "0000379113" "CRB1" "0000379114" "RPGRIP1" "0000379143" "CRB1" "0000379154" "CRB1" "0000380575" "CRB1" "0000380763" "CRB1" "0000381023" "CRB1" "0000381024" "CRB1" "0000381025" "CRB1" "0000381026" "CRB1" "0000381027" "CRB1" "0000381028" "CRB1" "0000381398" "CRB1" "0000382221" "CRX" "0000382240" "CEP290" "0000382254" "CEP290" "0000382263" "NR2E3" "0000382298" "AIPL1" "0000382300" "CRB1" "0000382302" "CRB1" "0000382303" "CRB1" "0000382813" "CRB1" "0000382814" "CRB1" "0000382815" "CRB1" "0000382824" "RP1" "0000382840" "CRB1" "0000382843" "PROM1" "0000382846" "CRB1" "0000382858" "AIPL1" "0000383034" "CRB1" "0000383084" "CRB1" "0000383085" "CRB1" "0000383086" "CRB1" "0000383087" "CRB1" "0000383175" "CRB1" "0000383349" "CRB1" "0000383480" "CRB1" "0000383481" "CRB1" "0000383482" "CRB1" "0000383483" "CRB1" "0000383484" "CRB1" "0000383485" "CRB1" "0000383486" "CRB1" "0000383489" "CRB1" "0000383744" "CRB1" "0000383745" "CRB1" "0000383746" "CRB1" "0000383747" "CRB1" "0000383748" "CRB1" "0000383749" "CRB1" "0000383750" "CRB1" "0000384002" "CRB1" "0000384290" "CRB1" "0000384304" "ROM1" "0000384317" "CRB1" "0000384648" "CRB1" "0000384649" "CRB1" "0000384650" "CRB1" "0000384651" "CRB1" "0000384652" "CRB1" "0000384653" "CRB1" "0000384968" "CRB1" "0000384969" "CRB1" "0000384974" "CRB1" "0000384982" "CRB1" "0000385025" "CRB1" "0000385130" "CRB1" "0000385165" "CRB1" "0000385179" "ZNF408" "0000385184" "CRB1" "0000385198" "CRB1" "0000385204" "CNGB1" "0000385216" "CRB1" "0000385221" "CRB1" "0000385222" "CRB1" "0000385226" "CRB1" "0000385229" "CRB1" "0000385232" "CRB1" "0000385234" "CRB1" "0000385242" "CRB1" "0000385253" "CRB1" "0000385283" "CRB1" "0000385289" "CRB1" "0000385304" "CRB1" "0000385326" "USH2A" "0000385341" "CRB1" "0000385360" "CRB1" "0000385361" "CRB1" "0000385378" "CERKL" "0000385379" "CRB1" "0000385387" "CRB1" "0000385389" "CRB1" "0000385395" "CRB1" "0000385435" "CRB1" "0000385439" "CRB1" "0000385605" "CRB1" "0000385635" "CRB1" "0000385701" "CRB1" "0000385966" "CRB1" "0000385980" "CRB1" "0000385981" "CRB1" "0000385982" "CRB1" "0000386237" "CRB1" "0000386246" "CRB1" "0000386259" "CRB1" "0000386265" "CRB1" "0000386266" "CRB1" "0000386268" "CRB1" "0000386278" "CRB1" "0000386286" "CRB1" "0000386313" "CRB1" "0000386316" "CRB1" "0000386319" "CRB1" "0000386836" "USH2A" "0000386837" "CRB1" "0000386838" "USH2A" "0000386840" "CRB1" "0000386842" "CRB1" "0000387194" "CRB1" "0000387195" "CRB1" "0000387389" "C1QTNF5" "0000387399" "GUCY2D" "0000387428" "CRB1" "0000387430" "ABCA4" "0000387436" "ABCA4" "0000387453" "C21orf2" "0000387460" "CRB1" "0000387512" "EYS" "0000387797" "CRB1" "0000387949" "CRB1" "0000388011" "CRB1" "0000388072" "CRB1" "0000388085" "CRB1" "0000388872" "CRB1" "0000388873" "CRB1" "0000388874" "CRB1" "0000388875" "CRB1" "0000388876" "CRB1" "0000388877" "CRB1" "0000388878" "CRB1" "0000388879" "CRB1" "0000388880" "CRB1" "0000388881" "CRB1" "0000388882" "CRB1" "0000389392" "CRB1" "0000389720" "CRB1" "0000390183" "CRB1" "0000390184" "CRB1" "0000390233" "CRB1" "0000390234" "CRB1" "0000390235" "CRB1" "0000390249" "CRB1" "0000390267" "CRB1" "0000390288" "CRB1" "0000390291" "CRB1" "0000390292" "CRB1" "0000390303" "CRB1" "0000390308" "CRB1" "0000390309" "CRB1" "0000390326" "CRB1" "0000390378" "CRB1" "0000390381" "CRB1" "0000390382" "CRB1" "0000390442" "CRB1" "0000390534" "CRB1" "0000390588" "CRB1" "0000390818" "CRB1" "0000390886" "CRB1" "0000390897" "CRB1" "0000390938" "CRB1" "0000390951" "CRB1" "0000391071" "CRB1" "0000391188" "CRB1" "0000391194" "CRB1" "0000391229" "CRB1" "0000391271" "CRB1" "0000391481" "CRB1" "0000391482" "CRB1" "0000391483" "CRB1" "0000391484" "CRB1" "0000391485" "CRB1" "0000391486" "CRB1" "0000391989" "CRB1" "0000391990" "CRB1" "0000391991" "CRB1" "0000391993" "CRB1" "0000392034" "CRB1" "0000392082" "CRB1" "0000392120" "CRB1" "0000392122" "CRB1" "0000392134" "CRB1" "0000392397" "CRB1" "0000392596" "CRB1" "0000392759" "CRB1" "0000392760" "CRB1" "0000392761" "CRB1" "0000392762" "CRB1" "0000392763" "CRB1" "0000392764" "CRB1" "0000392765" "CRB1" "0000392766" "CRB1" "0000392868" "CRB1" "0000392869" "CRB1" "0000392870" "CRB1" "0000392871" "CRB1" "0000392872" "CRB1" "0000392873" "CRB1" "0000392874" "CRB1" "0000392875" "CRB1" "0000392876" "CRB1" "0000392877" "CRB1" "0000392878" "CRB1" "0000392879" "CRB1" "0000392880" "CRB1" "0000392962" "CRB1" "0000392963" "CRB1" "0000392964" "CRB1" "0000392965" "CRB1" "0000392966" "CRB1" "0000392967" "CRB1" "0000392968" "CRB1" "0000393107" "CRB1" "0000394586" "CRB1" "0000394587" "CRB1" "0000394588" "CRB1" "0000394589" "CRB1" "0000394691" "CRB1" "0000394727" "CRB1" "0000394815" "CRB1" "0000394841" "CRB1" "0000394963" "CRB1" "0000394986" "CRB1" "0000395002" "CRB1" "0000395007" "CRB1" "0000395012" "CRB1" "0000395026" "CRB1" "0000395097" "CRB1" "0000395113" "CRB1" "0000395137" "CRB1" "0000395138" "CRB1" "0000395167" "CRB1" "0000395807" "CRB1" "0000395808" "CRB1" "0000395809" "CRB1" "0000395810" "CRB1" "0000395811" "CRB1" "0000395812" "CRB1" "0000395813" "CRB1" "0000395814" "CRB1" "0000395815" "CRB1" "0000395816" "CRB1" "0000396664" "CRB1" "0000397013" "CRB1" "0000397033" "CRB1" "0000397036" "CRB1" "0000397113" "CRB1" "0000397462" "CRB1" "0000397465" "CRB1" "0000397879" "EYS" "0000407226" "CRB1" "0000407227" "CRB1" "0000407228" "CRB1" "0000407229" "CRB1" "0000407230" "CRB1" "0000407231" "CRB1" "0000407232" "CRB1" "0000407233" "CRB1" "0000407234" "CRB1" "0000407244" "CRB1" "0000407245" "CRB1" "0000407246" "CRB1" "0000407247" "CRB1" "0000407248" "CRB1" "0000407249" "CRB1" "0000407250" "CRB1" "0000407251" "CRB1" "0000407252" "CRB1" "0000407253" "CRB1" "0000407254" "CRB1" "0000407255" "CRB1" "0000407256" "CRB1" "0000407257" "CRB1" "0000407258" "CRB1" "0000407259" "CRB1" "0000407260" "CRB1" "0000407261" "CRB1" "0000407262" "CRB1" "0000407263" "CRB1" "0000407264" "CRB1" "0000407265" "CRB1" "0000407266" "CRB1" "0000407267" "CRB1" "0000407268" "CRB1" "0000407269" "CRB1" "0000407270" "CRB1" "0000407271" "CRB1" "0000407272" "CRB1" "0000407273" "CRB1" "0000407274" "CRB1" "0000407275" "CRB1" "0000407276" "CRB1" "0000407277" "CRB1" "0000407278" "CRB1" "0000407279" "CRB1" "0000407280" "CRB1" "0000407281" "CRB1" "0000407282" "CRB1" "0000407283" "CRB1" "0000407284" "CRB1" "0000407285" "CRB1" "0000407286" "CRB1" "0000407287" "CRB1" "0000407288" "CRB1" "0000407289" "CRB1" "0000407290" "CRB1" "0000407291" "CRB1" "0000407292" "CRB1" "0000407293" "CRB1" "0000407294" "CRB1" "0000407295" "CRB1" "0000407296" "CRB1" "0000407297" "CRB1" "0000407298" "CRB1" "0000407299" "CRB1" "0000407300" "CRB1" "0000407301" "CRB1" "0000407302" "CRB1" "0000407303" "CRB1" "0000407304" "CRB1" "0000407305" "CRB1" "0000407306" "CRB1" "0000407307" "CRB1" "0000407308" "CRB1" "0000407309" "CRB1" "0000407310" "CRB1" "0000407632" "GUCY2D" "0000407644" "CRB1" "0000407645" "CRB1" "0000407646" "CRB1" "0000407647" "CRB1" "0000409316" "CRB1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 2082 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000036423" "3" "70" "1" "197398734" "197398767" "del" "0" "00552" "CRB1_000039" "g.197398734_197398767del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.197429604_197429637del" "" "likely pathogenic" "" "0000059783" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000059784" "2" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000059785" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000059786" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000059787" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000059788" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000059789" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000059790" "2" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000059791" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000059792" "2" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000059793" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000059794" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2010:20956273}" "" "2842G>A" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000059795" "2" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000059796" "0" "70" "1" "197298095" "197298095" "subst" "0.000591041" "00006" "CRB1_000002" "g.197298095T>C" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197328965T>C" "" "likely pathogenic" "" "0000059797" "1" "70" "1" "197298095" "197298095" "subst" "0.000591041" "00229" "CRB1_000002" "g.197298095T>C" "" "{PMID:Neveling 2012:22334370}" "" "" "considered benign for patient (only 1 case of dominant inheritance reported for predicted potentially pathogenic variant); does not segregate with disease" "Germline" "" "" "0" "" "" "g.197328965T>C" "" "likely pathogenic" "" "0000059798" "1" "70" "1" "197298095" "197298095" "subst" "0.000591041" "00229" "CRB1_000002" "g.197298095T>C" "" "{PMID:Neveling 2012:22334370}" "" "" "considered benign for patient (only 1 case of dominant inheritance reported for predicted potentially pathogenic variant), disease-related variants in other gene; does not segregate with disease, not segregating with disease in other family" "Germline" "" "" "0" "" "" "g.197328965T>C" "" "likely pathogenic" "" "0000059799" "0" "70" "1" "197404030" "197404030" "subst" "0.00000407209" "00006" "CRB1_000003" "g.197404030C>T" "" "{PMID:Henderson 2010:20956273}" "" "" "unknown second allele" "Germline" "" "" "0" "" "" "g.197434900C>T" "" "likely pathogenic" "" "0000059800" "0" "70" "1" "197396584" "197396584" "subst" "0.0000122175" "00006" "CRB1_000004" "g.197396584A>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427454A>T" "" "likely pathogenic" "" "0000059801" "2" "70" "1" "197396584" "197396584" "subst" "0.0000122175" "00006" "CRB1_000004" "g.197396584A>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427454A>T" "" "likely pathogenic" "" "0000059802" "1" "70" "1" "197396584" "197396584" "subst" "0.0000122175" "00006" "CRB1_000004" "g.197396584A>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427454A>T" "" "likely pathogenic" "" "0000059803" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00006" "CRB1_000005" "g.197396745C>T" "" "{PMID:Henderson 2010:20956273}" "" "" "This change has been considered as likely pathogenic regardless poor conservation and low pathogenicity predictions. The decision was based on the genetic data - cosegregation, lack in the control alleles" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000059804" "1" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00006" "CRB1_000005" "g.197396745C>T" "" "{PMID:Henderson 2010:20956273}" "" "" "This change has been considered as likely pathogenic regardless poor conservation and low pathogenicity predictions. The decision was based on the genetic data - cosegregation, lack in the control alleles" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000059805" "0" "70" "1" "197404096" "197404096" "subst" "0.00000813835" "00006" "CRB1_000006" "g.197404096C>T" "" "{PMID:Henderson 2010:20956273}" "" "" "Unknown second allele, not found in 100 controls, no cosegregation information" "Germline" "" "" "0" "" "" "g.197434966C>T" "" "likely pathogenic" "" "0000059806" "0" "70" "1" "197404096" "197404096" "subst" "0.00000813835" "00006" "CRB1_000006" "g.197404096C>T" "" "{PMID:Henderson 2010:20956273}" "" "" "Unknown second allele, not found in 100 controls, no cosegregation information" "Germline" "" "" "0" "" "" "g.197434966C>T" "" "likely pathogenic" "" "0000059807" "1" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00006" "CRB1_000007" "g.197396856A>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000059808" "1" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00006" "CRB1_000007" "g.197396856A>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000059809" "1" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00006" "CRB1_000007" "g.197396856A>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000059810" "2" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00006" "CRB1_000007" "g.197396856A>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000059811" "1" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00006" "CRB1_000007" "g.197396856A>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000059812" "1" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00006" "CRB1_000007" "g.197396856A>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000059813" "2" "77" "1" "197446882" "197446882" "subst" "0" "00006" "CRB1_000008" "g.197446882C>A" "" "{PMID:Henderson 2010:20956273}" "" "" "This variant was considered as likely pathogenic because of the change of the nonpolar A in the hydrophobic stretch to a polar D" "Germline" "" "" "0" "" "" "g.197477752C>A" "" "likely pathogenic" "" "0000059814" "2" "77" "1" "197446882" "197446882" "subst" "0" "00006" "CRB1_000008" "g.197446882C>A" "" "{PMID:Henderson 2010:20956273}" "" "" "This variant was considered as likely pathogenic because of the change of the nonpolar A in the hydrophobic stretch to a polar D" "Germline" "" "" "0" "" "" "g.197477752C>A" "" "likely pathogenic" "" "0000059815" "1" "70" "1" "197313508" "197313508" "subst" "0.00000409031" "00006" "CRB1_000009" "g.197313508T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "likely pathogenic" "" "0000059816" "2" "70" "1" "197313508" "197313508" "subst" "0.00000409031" "00006" "CRB1_000009" "g.197313508T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "likely pathogenic" "" "0000059817" "1" "70" "1" "197313508" "197313508" "subst" "0.00000409031" "00006" "CRB1_000009" "g.197313508T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "likely pathogenic" "" "0000059818" "2" "70" "1" "197313508" "197313508" "subst" "0.00000409031" "00006" "CRB1_000009" "g.197313508T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "likely pathogenic" "" "0000059819" "1" "70" "1" "197313508" "197313508" "subst" "0.00000409031" "00006" "CRB1_000009" "g.197313508T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "likely pathogenic" "" "0000059820" "2" "70" "1" "197313508" "197313508" "subst" "0.00000409031" "00006" "CRB1_000009" "g.197313508T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "likely pathogenic" "" "0000059821" "1" "70" "1" "197313508" "197313508" "subst" "0.00000409031" "00006" "CRB1_000009" "g.197313508T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "likely pathogenic" "" "0000059822" "2" "70" "1" "197313508" "197313508" "subst" "0.00000409031" "00006" "CRB1_000009" "g.197313508T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "likely pathogenic" "" "0000059823" "1" "70" "1" "197313508" "197313508" "subst" "0.00000409031" "00006" "CRB1_000009" "g.197313508T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "likely pathogenic" "" "0000059824" "2" "70" "1" "197313508" "197313508" "subst" "0.00000409031" "00006" "CRB1_000009" "g.197313508T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "likely pathogenic" "" "0000059825" "1" "70" "1" "197313508" "197313508" "subst" "0.00000409031" "00006" "CRB1_000009" "g.197313508T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "likely pathogenic" "" "0000059826" "2" "70" "1" "197313508" "197313508" "subst" "0.00000409031" "00006" "CRB1_000009" "g.197313508T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "likely pathogenic" "" "0000059827" "1" "70" "1" "197397003" "197397003" "subst" "0.0000203346" "00006" "CRB1_000010" "g.197397003G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427873G>A" "" "likely pathogenic" "" "0000059828" "1" "70" "1" "197397003" "197397003" "subst" "0.0000203346" "00006" "CRB1_000010" "g.197397003G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427873G>A" "" "likely pathogenic" "" "0000059829" "1" "70" "1" "197397003" "197397003" "subst" "0.0000203346" "00006" "CRB1_000010" "g.197397003G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427873G>A" "" "likely pathogenic" "" "0000059830" "2" "70" "1" "197404300" "197404300" "subst" "0" "00006" "CRB1_000011" "g.197404300G>C" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197435170G>C" "" "likely pathogenic" "" "0000059831" "1" "70" "1" "197404535" "197404535" "dup" "0" "00006" "CRB1_000012" "g.197404535dup" "" "{PMID:Henderson 2010:20956273}" "" "3542dupG" "" "Germline" "" "" "0" "" "" "g.197435405dup" "" "likely pathogenic" "" "0000059832" "2" "70" "1" "197404535" "197404535" "dup" "0" "00006" "CRB1_000012" "g.197404535dup" "" "{PMID:Henderson 2010:20956273}" "" "3542dupG" "" "Germline" "" "" "0" "" "" "g.197435405dup" "" "likely pathogenic" "" "0000059833" "2" "70" "1" "197396677" "197396677" "subst" "0.00000406934" "00006" "CRB1_000013" "g.197396677T>C" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427547T>C" "" "likely pathogenic" "" "0000059834" "2" "70" "1" "197313475" "197313476" "ins" "0" "00006" "CRB1_000014" "g.197313475_197313476insG" "" "{PMID:Henderson 2010:20956273}" "" "Q240fsX20*" "" "Germline" "" "" "0" "" "" "g.197344345_197344346insG" "" "likely pathogenic" "" "0000059835" "2" "70" "1" "197446930" "197446930" "subst" "0" "00006" "CRB1_000015" "g.197446930C>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197477800C>T" "" "likely pathogenic" "" "0000059836" "2" "70" "1" "197404513" "197404513" "subst" "0" "00006" "CRB1_000016" "g.197404513T>G" "" "{PMID:Henderson 2010:20956273}" "" "3655T>G" "" "Germline" "" "" "0" "" "" "g.197435383T>G" "" "likely pathogenic" "" "0000059837" "2" "70" "1" "197404513" "197404513" "subst" "0" "00006" "CRB1_000016" "g.197404513T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197435383T>G" "" "likely pathogenic" "" "0000059838" "2" "70" "1" "197390534" "197390534" "subst" "0.0000324984" "00006" "CRB1_000017" "g.197390534C>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "likely pathogenic" "" "0000059839" "1" "70" "1" "197397132" "197397132" "del" "0" "00006" "CRB1_000018" "g.197397132del" "" "{PMID:Henderson 2010:20956273}" "" "2676delG; Lys892Asnfs*95" "Originally reported as p.K892NfsX95" "Germline" "" "" "0" "" "" "g.197428002del" "" "likely pathogenic" "" "0000059840" "2" "70" "1" "197397132" "197397132" "del" "0" "00006" "CRB1_000018" "g.197397132del" "" "{PMID:Henderson 2010:20956273}" "" "2676delG; Lys892Asnfs*95" "Originally reported as p.K892NfsX95" "Germline" "" "" "0" "" "" "g.197428002del" "" "likely pathogenic" "" "0000059841" "1" "70" "1" "197397132" "197397132" "del" "0" "00006" "CRB1_000018" "g.197397132del" "" "{PMID:Henderson 2010:20956273}" "" "2676delG; Lys892Asnfs*95" "Originally reported as p.K892NfsX95" "Germline" "" "" "0" "" "" "g.197428002del" "" "likely pathogenic" "" "0000059842" "2" "70" "1" "197397132" "197397132" "del" "0" "00006" "CRB1_000018" "g.197397132del" "" "{PMID:Henderson 2010:20956273}" "" "2676delG; Lys892Asnfs*95" "Originally reported as p.K892NfsX95" "Germline" "" "" "0" "" "" "g.197428002del" "" "likely pathogenic" "" "0000059843" "2" "70" "1" "197404001" "197404001" "subst" "0.00000407252" "00006" "CRB1_000019" "g.197404001T>C" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434871T>C" "" "likely pathogenic" "" "0000059844" "2" "70" "1" "197391000" "197391000" "subst" "0.00000406732" "00006" "CRB1_000020" "g.197391000G>A" "" "{PMID:Henderson 2010:20956273}" "" "2043G>A; C681X" "In Henderson (2010) this mutation was denoted as 2043G>A, C681X" "Germline" "" "" "0" "" "" "g.197421870G>A" "" "likely pathogenic" "" "0000059845" "2" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00006" "CRB1_000021" "g.197396689C>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000059846" "1" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00006" "CRB1_000021" "g.197396689C>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000059847" "2" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00229" "CRB1_000021" "g.197396689C>T" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted to affect function, but insufficient evidence for definite conclusion" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000059848" "2" "70" "1" "197404028" "197404028" "subst" "0" "00006" "CRB1_000022" "g.197404028T>C" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197434898T>C" "" "likely pathogenic" "" "0000059849" "1" "70" "1" "197404067" "197404067" "subst" "0" "00006" "CRB1_000023" "g.197404067G>A" "" "{PMID:Henderson 2010:20956273}" "" "S1025A" "Originally reported as S1025A" "Germline" "" "" "0" "" "" "g.197434937G>A" "" "likely pathogenic" "" "0000059850" "2" "70" "1" "197404067" "197404067" "subst" "0" "00006" "CRB1_000023" "g.197404067G>A" "" "{PMID:Henderson 2010:20956273}" "" "S1025A" "Originally reported as S1025A" "Germline" "" "" "0" "" "" "g.197434937G>A" "" "likely pathogenic" "" "0000059851" "1" "70" "1" "197396991" "197396991" "subst" "0.0000122002" "00006" "CRB1_000024" "g.197396991G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427861G>A" "" "likely pathogenic" "" "0000059852" "2" "70" "1" "197396991" "197396991" "subst" "0.0000122002" "00006" "CRB1_000024" "g.197396991G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427861G>A" "" "likely pathogenic" "" "0000059853" "1" "70" "1" "197396991" "197396991" "subst" "0.0000122002" "00006" "CRB1_000024" "g.197396991G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427861G>A" "" "likely pathogenic" "" "0000059854" "2" "70" "1" "197396991" "197396991" "subst" "0.0000122002" "00006" "CRB1_000024" "g.197396991G>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427861G>A" "" "likely pathogenic" "" "0000059855" "1" "70" "1" "197297951" "197297951" "subst" "0" "00006" "CRB1_000025" "g.197297951G>C" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197328821G>C" "" "likely pathogenic" "" "0000059856" "2" "70" "1" "197396961" "197396961" "subst" "0.00019522" "00006" "CRB1_000026" "g.197396961C>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197427831C>A" "" "likely pathogenic" "" "0000059857" "1" "70" "1" "197316557" "197316557" "subst" "0" "00006" "CRB1_000027" "g.197316557T>G" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197347427T>G" "" "likely pathogenic" "" "0000059858" "2" "70" "1" "197404313" "197404313" "subst" "0.00000407847" "00006" "CRB1_000028" "g.197404313T>C" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197435183T>C" "" "likely pathogenic" "" "0000059859" "1" "70" "1" "197390983" "197390983" "subst" "0" "00006" "CRB1_000029" "g.197390983G>T" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197421853G>T" "" "likely pathogenic" "" "0000059860" "2" "70" "1" "197398590" "197398590" "subst" "0.0000284333" "00006" "CRB1_000030" "g.197398590T>A" "" "{PMID:Henderson 2010:20956273}" "" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "likely pathogenic" "" "0000059861" "1" "70" "1" "197297616" "197297616" "subst" "0.000381803" "00229" "CRB1_000031" "g.197297616C>G" "" "{PMID:Neveling 2012:22334370}" "" "" "considered benign for patient (only 1 case of dominant inheritance reported for predicted potentially pathogenic variant); does not segregate with disease, not segregating with disease in other family" "Germline" "" "" "0" "" "" "g.197328486C>G" "" "likely pathogenic" "" "0000059862" "1" "70" "1" "197297616" "197297616" "subst" "0.000381803" "00229" "CRB1_000031" "g.197297616C>G" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted to affect function, but insufficient evidence for definite conclusion" "Germline" "no" "" "0" "" "" "g.197328486C>G" "" "likely pathogenic" "" "0000059863" "1" "10" "1" "197237556" "197237556" "subst" "0.00000406573" "00229" "CRB1_000032" "g.197237556A>G" "" "{PMID:Neveling 2012:22334370}" "" "" "" "Germline" "no" "" "0" "" "" "g.197268426A>G" "" "benign" "" "0000059864" "1" "70" "1" "197390560" "197390560" "subst" "0" "00229" "CRB1_000033" "g.197390560G>T" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted to affect function, but insufficient evidence for definite conclusion" "Germline" "" "" "0" "" "" "g.197421430G>T" "" "likely pathogenic" "" "0000059865" "1" "70" "1" "197398749" "197398749" "subst" "0.0000325529" "00229" "CRB1_000034" "g.197398749G>A" "" "{PMID:Neveling 2012:22334370}" "" "" "considered benign for patient (only 1 case of dominant inheritance reported for predicted potentially pathogenic variant); does not segregate with disease" "Germline" "" "" "0" "" "" "g.197429619G>A" "" "likely pathogenic" "" "0000059866" "1" "10" "1" "197297965" "197297965" "subst" "0.00128897" "00229" "CRB1_000035" "g.197297965G>A" "" "{PMID:Neveling 2012:22334370}" "" "" "predicted benign" "Germline" "no" "" "0" "" "" "g.197328835G>A" "" "benign" "" "0000059867" "11" "90" "1" "197404488" "197404488" "subst" "0" "00039" "CRB1_000037" "g.197404488T>G" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197435358T>G" "" "pathogenic" "" "0000059868" "20" "90" "1" "197404488" "197404488" "subst" "0" "00039" "CRB1_000037" "g.197404488T>G" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197435358T>G" "" "pathogenic" "" "0000059869" "11" "90" "1" "197390387" "197390387" "subst" "0" "00039" "CRB1_000038" "g.197390387G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197421257G>A" "" "pathogenic" "" "0000059870" "2" "90" "1" "197390387" "197390387" "subst" "0" "00039" "CRB1_000038" "g.197390387G>A" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197421257G>A" "" "pathogenic" "" "0000059871" "10" "70" "1" "197326045" "197326046" "ins" "0" "00243" "CRB1_000040" "g.197326045_197326046insTGAG" "" "" "" "" "not in 200 control chromosomes" "Germline" "" "" "0" "" "" "g.197356915_197356916insTGAG" "" "likely pathogenic" "" "0000059872" "20" "70" "1" "197326045" "197326046" "ins" "0" "00243" "CRB1_000040" "g.197326045_197326046insTGAG" "" "" "" "" "not in 200 control chromosomes" "Germline" "" "" "0" "" "" "g.197356915_197356916insTGAG" "" "likely pathogenic" "" "0000065325" "0" "90" "1" "197297963" "197297963" "subst" "0" "01251" "CRB1_000210" "g.197297963C>T" "" "{PMID:den Hollander 1999:10508521}" "BceAI-;HaeIII-;NlaIV-;Sau96I-" "617C>T" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197328833C>T" "" "pathogenic" "" "0000065326" "0" "90" "1" "197313508" "197313508" "subst" "0.00000409031" "01251" "CRB1_000009" "g.197313508T>G" "" "{PMID:den Hollander 1999:10508521}" "ApaI+;BanII+;BmrI+;BsrI+;PspOMI+;HpyCH4III-" "885T>G" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "pathogenic" "" "0000065327" "0" "90" "1" "197390166" "197390166" "subst" "0" "01251" "CRB1_000148" "g.197390166C>G" "" "{PMID:den Hollander 1999:10508521}" "Hpy188III+" "1343C>G" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197421036C>G" "" "pathogenic" "" "0000065328" "3" "90" "1" "197396640" "197396641" "ins" "0" "01251" "CRB1_000231" "g.197396640_197396641ins(Alu)" "" "{PMID:den Hollander 1999:10508521}" "" "2320insAlu" "not in 185 controls\r\nVariant Error [ESYNTAX]: This genomic variant has an error (char 37: Syntax error). Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000065329" "0" "90" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:den Hollander 1999:10508521}" "BsmI+" "2369C>T" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "pathogenic" "" "0000065330" "0" "90" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:den Hollander 1999:10508521}" "BsmI+" "2369C>T" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "pathogenic" "" "0000065331" "0" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:den Hollander 1999:10508521}" "-" "2425C>T" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "" "0000065332" "0" "90" "1" "197398749" "197398749" "subst" "0.0000325529" "01251" "CRB1_000034" "g.197398749G>A" "" "{PMID:den Hollander 1999:10508521}" "-" "2978+5G>A" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197429619G>A" "" "pathogenic" "" "0000065333" "3" "90" "1" "197404115" "197404115" "subst" "0.0000122034" "01251" "CRB1_000163" "g.197404115T>C" "1/200 chromosomes" "{PMID:den Hollander 1999:10508521}" "-" "3257T>C" "" "Germline" "" "" "0" "" "" "g.197434985T>C" "" "pathogenic" "" "0000065334" "3" "90" "1" "197404115" "197404115" "subst" "0.0000122034" "01251" "CRB1_000163" "g.197404115T>C" "1/200 chromosomes" "{PMID:den Hollander 1999:10508521}" "-" "3257T>C" "" "Germline" "" "" "0" "" "" "g.197434985T>C" "" "pathogenic" "" "0000065335" "3" "90" "1" "197404115" "197404115" "subst" "0.0000122034" "01251" "CRB1_000163" "g.197404115T>C" "1/200 chromosomes" "{PMID:den Hollander 1999:10508521}" "-" "3257T>C" "" "Germline" "" "" "0" "" "" "g.197434985T>C" "" "pathogenic" "" "0000065336" "3" "90" "1" "197404115" "197404115" "subst" "0.0000122034" "01251" "CRB1_000163" "g.197404115T>C" "1/200 chromosomes" "{PMID:den Hollander 1999:10508521}" "-" "3257T>C" "" "Germline" "" "" "0" "" "" "g.197434985T>C" "" "pathogenic" "" "0000065337" "3" "90" "1" "197404115" "197404115" "subst" "0.0000122034" "01251" "CRB1_000163" "g.197404115T>C" "1/200 chromosomes" "{PMID:den Hollander 1999:10508521}" "-" "3257T>C" "" "Germline" "" "" "0" "" "" "g.197434985T>C" "" "pathogenic" "" "0000065338" "3" "90" "1" "197404115" "197404115" "subst" "0.0000122034" "01251" "CRB1_000163" "g.197404115T>C" "1/200 chromosomes" "{PMID:den Hollander 1999:10508521}" "-" "3257T>C" "" "Germline" "" "" "0" "" "" "g.197434985T>C" "" "pathogenic" "" "0000065339" "3" "90" "1" "197404115" "197404115" "subst" "0.0000122034" "01251" "CRB1_000163" "g.197404115T>C" "1/200 chromosomes" "{PMID:den Hollander 1999:10508521}" "-" "3257T>C" "" "Germline" "" "" "0" "" "" "g.197434985T>C" "" "pathogenic" "" "0000065340" "0" "90" "1" "197404205" "197404205" "subst" "0.00000406626" "01251" "CRB1_000095" "g.197404205T>C" "" "{PMID:den Hollander 1999:10508521}" "MnlI-" "3347T>C" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197435075T>C" "" "pathogenic" "" "0000065341" "0" "90" "1" "197297909" "197297913" "del" "0" "01251" "CRB1_000216" "g.197297909_197297913del" "1/190 cases" "{PMID:Lotery 2001:11231775}" "HinfI-;MboII-;TfiI-" "5 bp del 143-144" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328779_197328783del" "" "pathogenic" "" "0000065342" "0" "70" "1" "197297911" "197297911" "subst" "0.000158815" "01251" "CRB1_000217" "g.197297911T>G" "1/190 cases" "{PMID:Lotery 2001:11231775}" "EarI+;MlyI+;PleI+;TfiI-" "Phe144Val" "" "Germline" "" "" "0" "" "" "g.197328781T>G" "" "likely pathogenic" "" "0000065343" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "2/190 cases" "{PMID:Lotery 2001:11231775}" "-" "7 bp del 204-207" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065344" "0" "70" "1" "197316487" "197316487" "subst" "0.000479235" "01251" "CRB1_000180" "g.197316487C>T" "1/190 cases" "{PMID:Lotery 2001:11231775}" "CviAII+;FatI+;NlaIII+;BsgI-" "Thr289Met" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197347357C>T" "" "likely pathogenic" "" "0000065345" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01251" "CRB1_000132" "g.197326120G>A" "1/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Cys383Tyr" "" "Germline" "" "" "0" "" "" "g.197356990G>A" "" "likely pathogenic" "" "0000065346" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "2/190 cases" "{PMID:Lotery 2001:11231775}" "-" "7 bp del 612-619" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065347" "0" "70" "1" "197390605" "197390605" "subst" "0.000564756" "01251" "CRB1_000226" "g.197390605T>C" "1/190 cases" "{PMID:Lotery 2001:11231775}" "HincII+;Hpy166II+" "Asn549Asn" "" "Germline" "" "" "0" "" "" "g.197421475T>C" "" "likely pathogenic" "" "0000065348" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "2/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Arg764Cys" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065349" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "7/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065350" "0" "90" "1" "197397004" "197397007" "del" "0" "01251" "CRB1_000167" "g.197397004_197397007del" "1/190 cases" "{PMID:Lotery 2001:11231775}" "CviKI_1-" "4 bp del 850-851" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427874_197427877del" "" "pathogenic" "" "0000065351" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "7/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Cys948Tyr" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065352" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "7/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Cys948Tyr" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065353" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "7/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Cys948Tyr" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065354" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "7/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Cys948Tyr" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065355" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "7/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065356" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "7/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065357" "0" "70" "1" "197404606" "197404606" "subst" "0.00000423952" "01251" "CRB1_000090" "g.197404606G>A" "1/190 cases" "{PMID:Lotery 2001:11231775}" "BfaI+;BciVI-;BssKI-;BstNI-;PspGI-;ScrFI-;StyD4I-" "Gly1205Arg" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197435476G>A" "" "likely pathogenic" "" "0000065358" "0" "70" "1" "197411366" "197411366" "subst" "0.00000406134" "01251" "CRB1_000081" "g.197411366A>C" "1/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Asn1317His" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197442236A>C" "" "likely pathogenic" "" "0000065359" "0" "90" "1" "197411413" "197411413" "subst" "0" "01251" "CRB1_000054" "g.197411413C>A" "1/190 cases" "{PMID:Lotery 2001:11231775}" "BspCNI+;DdeI+;ApeKI-;BbvI-;Fnu4HI-;MwoI-;TseI-" "Cys1332Stop" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197442283C>A" "" "pathogenic" "" "0000065360" "0" "90" "1" "197297593" "197297593" "del" "0" "01251" "CRB1_000065" "g.197297593del" "1/190 cases" "{PMID:Lotery 2001:11231775}" "ApoI-" "1 bp del codon 37" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328463del" "" "pathogenic" "" "0000065361" "0" "70" "1" "197390396" "197390396" "subst" "0" "01251" "CRB1_000155" "g.197390396T>G" "1/190 cases" "{PMID:Lotery 2001:11231775}" "BsaJI+;BstNI+;HphI+;PspGI+" "Cys480Gly" "" "Germline" "" "" "0" "" "" "g.197421266T>G" "" "likely pathogenic" "" "0000065362" "0" "50" "1" "197390386" "197390386" "subst" "0.000255867" "01251" "CRB1_000154" "g.197390386C>T" "1/190 cases" "{PMID:Lotery 2001:11231775}" "BmrI+;BsrI+;BtsI;HpaII-;MspI-;NciI-;ScrFI-" "Thr476Thr" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197421256C>T" "" "VUS" "" "0000065363" "0" "50" "1" "197404164" "197404164" "subst" "0.000126057" "01251" "CRB1_000176" "g.197404164C>T" "1/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Asn1057Asn" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197435034C>T" "" "VUS" "" "0000065364" "0" "70" "1" "197396893" "197396894" "ins" "0" "01251" "CRB1_000127" "g.197396893_197396894insA(100)" "1/190 cases" "{PMID:Lotery 2001:11231775}" "-" ">100 bp poly A ins codon 812-813" "unknown variant 2nd chromosome\r\nVariant Error [ESYNTAX]: This genomic variant has an error (char 39: expected EOF). Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000065365" "10" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Hollander 2001:11389483}" "-" "2978G->A" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065366" "0" "90" "1" "197404292" "197404292" "subst" "0" "01251" "CRB1_000099" "g.197404292T>G" "" "{PMID:Hollander 2001:11389483}" "-" "3434T->G" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197435162T>G" "" "pathogenic" "" "0000065367" "0" "90" "1" "197404292" "197404292" "subst" "0" "01251" "CRB1_000099" "g.197404292T>G" "" "{PMID:Hollander 2001:11389483}" "-" "3434T->G" "" "Germline" "" "" "0" "" "" "g.197435162T>G" "" "pathogenic" "" "0000065368" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Hollander 2001:11389483}" "BfaI+" "2536A->T" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065369" "0" "90" "1" "197411409" "197411409" "subst" "0.00000406184" "01251" "CRB1_000052" "g.197411409G>T" "" "{PMID:Hollander 2001:11389483}" "AluI+;BanII+;BsiHKAI+;SacI+;BbvI-;Fnu4HI-;HaeII-;HhaI-" "4127G->T; Arg1331His" "unknown variant 2nd chromosome; not in 180 controls" "Germline" "" "" "0" "" "" "g.197442279G>T" "" "pathogenic" "" "0000065370" "0" "90" "1" "197404324" "197404324" "subst" "0" "01251" "CRB1_000110" "g.197404324G>T" "" "{PMID:Hollander 2001:11389483}" "DraI+;XmnI-" "3466G->T" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197435194G>T" "" "pathogenic" "" "0000065371" "10" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Hollander 2001:11389483}" "-" "2978G->A" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065372" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Hollander 2001:11389483}" "-" "748-754del" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065373" "1" "90" "1" "197390166" "197390166" "subst" "0" "01251" "CRB1_000148" "g.197390166C>G" "" "{PMID:Hollander 2001:11389483}" "Hpy188III+" "1343C->G" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197421036C>G" "" "pathogenic" "" "0000065374" "1" "90" "1" "197390166" "197390166" "subst" "0" "01251" "CRB1_000148" "g.197390166C>G" "" "{PMID:Hollander 2001:11389483}" "Hpy188III+" "1343C->G" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197421036C>G" "" "pathogenic" "" "0000065375" "0" "90" "1" "197398583" "197398583" "subst" "0.000142177" "01251" "CRB1_000134" "g.197398583A>G" "" "{PMID:Hollander 2001:11389483}" "" "" "unknown variant 2nd chromosome; not in 180 controls" "Germline" "" "" "0" "" "" "g.197429453A>G" "" "pathogenic" "" "0000065376" "0" "90" "1" "197398583" "197398583" "subst" "0.000142177" "01251" "CRB1_000134" "g.197398583A>G" "" "{PMID:Hollander 2001:11389483}" "" "" "unknown variant 2nd chromosome; not in 180 controls" "Germline" "" "" "0" "" "" "g.197429453A>G" "" "pathogenic" "" "0000065377" "21" "90" "1" "197396964" "197396964" "subst" "0" "01251" "CRB1_000165" "g.197396964G>C" "" "{PMID:Hollander 2001:11389483}" "MnlI+;LpnPI-;BsrI+;Cac8I-" "2644G->C" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197427834G>C" "" "pathogenic" "" "0000065378" "21" "90" "1" "197396964" "197396964" "subst" "0" "01251" "CRB1_000165" "g.197396964G>C" "" "{PMID:Hollander 2001:11389483}" "MnlI+;LpnPI-;BsrI+;Cac8I-" "2644G->C" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197427834G>C" "" "pathogenic" "" "0000065379" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Hollander 2001:11389483}" "-" "2978G->A" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065380" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Hollander 2001:11389483}" "BfaI+" "2536A->T" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065381" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Hollander 2001:11389483}" "BfaI+" "2536A->T" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065382" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Hollander 2001:11389483}" "BfaI+" "2536A->T" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065383" "3" "90" "1" "197411378" "197411378" "subst" "0" "01251" "CRB1_000048" "g.197411378T>A" "" "{PMID:Lotery 2001:11559858}" "CviKI_1+;Hpy188III+;BsrI-;BtsIMutI-;TspRI-" "Cys1321Ser" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197442248T>A" "" "pathogenic" "" "0000065384" "3" "90" "1" "197411378" "197411378" "subst" "0" "01251" "CRB1_000048" "g.197411378T>A" "" "{PMID:Lotery 2001:11559858}" "CviKI_1+;Hpy188III+;BsrI-;BtsIMutI-;TspRI-" "Cys1321Ser" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197442248T>A" "" "pathogenic" "" "0000065385" "3" "90" "1" "197411378" "197411378" "subst" "0" "01251" "CRB1_000048" "g.197411378T>A" "" "{PMID:Lotery 2001:11559858}" "CviKI_1+;Hpy188III+;BsrI-;BtsIMutI-;TspRI-" "Cys1321Ser" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197442248T>A" "" "pathogenic" "" "0000065386" "3" "90" "1" "197411378" "197411378" "subst" "0" "01251" "CRB1_000048" "g.197411378T>A" "" "{PMID:Lotery 2001:11559858}" "CviKI_1+;Hpy188III+;BsrI-;BtsIMutI-;TspRI-" "Cys1321Ser" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197442248T>A" "" "pathogenic" "" "0000065387" "3" "90" "1" "197411378" "197411378" "subst" "0" "01251" "CRB1_000048" "g.197411378T>A" "" "{PMID:Lotery 2001:11559858}" "CviKI_1+;Hpy188III+;BsrI-;BtsIMutI-;TspRI-" "Cys1321Ser" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197442248T>A" "" "pathogenic" "" "0000065388" "3" "90" "1" "197404336" "197404345" "del" "0" "01251" "CRB1_000111" "g.197404336_197404345del" "" "{PMID:Lotery 2001:11559858}" "AseI-;CviAII-;FatI-;MseI-;NlaIII-" "3343 (Del 10)" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197435206_197435215del" "" "pathogenic" "" "0000065389" "3" "90" "1" "197404336" "197404345" "del" "0" "01251" "CRB1_000111" "g.197404336_197404345del" "" "{PMID:Lotery 2001:11559858}" "AseI-;CviAII-;FatI-;MseI-;NlaIII-" "3343 (Del 10)" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197435206_197435215del" "" "pathogenic" "" "0000065390" "3" "90" "1" "197404336" "197404345" "del" "0" "01251" "CRB1_000111" "g.197404336_197404345del" "" "{PMID:Lotery 2001:11559858}" "AseI-;CviAII-;FatI-;MseI-;NlaIII-" "3343 (Del 10)" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197435206_197435215del" "" "pathogenic" "" "0000065391" "3" "90" "1" "197404336" "197404345" "del" "0" "01251" "CRB1_000111" "g.197404336_197404345del" "" "{PMID:Lotery 2001:11559858}" "AseI-;CviAII-;FatI-;MseI-;NlaIII-" "3343 (Del 10)" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197435206_197435215del" "" "pathogenic" "" "0000065392" "3" "90" "1" "197404336" "197404345" "del" "0" "01251" "CRB1_000111" "g.197404336_197404345del" "" "{PMID:Lotery 2001:11559858}" "AseI-;CviAII-;FatI-;MseI-;NlaIII-" "3343 (Del 10)" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197435206_197435215del" "" "pathogenic" "" "0000065393" "3" "90" "1" "197404336" "197404345" "del" "0" "01251" "CRB1_000111" "g.197404336_197404345del" "" "{PMID:Lotery 2001:11559858}" "AseI-;CviAII-;FatI-;MseI-;NlaIII-" "3343 (Del 10)" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197435206_197435215del" "" "pathogenic" "" "0000065394" "3" "90" "1" "197404336" "197404345" "del" "0" "01251" "CRB1_000111" "g.197404336_197404345del" "" "{PMID:Lotery 2001:11559858}" "AseI-;CviAII-;FatI-;MseI-;NlaIII-" "3343 (Del 10)" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197435206_197435215del" "" "pathogenic" "" "0000065395" "3" "90" "1" "197404336" "197404345" "del" "0" "01251" "CRB1_000111" "g.197404336_197404345del" "" "{PMID:Lotery 2001:11559858}" "AseI-;CviAII-;FatI-;MseI-;NlaIII-" "3343 (Del 10)" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197435206_197435215del" "" "pathogenic" "" "0000065396" "3" "90" "1" "197404336" "197404345" "del" "0" "01251" "CRB1_000111" "g.197404336_197404345del" "" "{PMID:Lotery 2001:11559858}" "AseI-;CviAII-;FatI-;MseI-;NlaIII-" "3343 (Del 10)" "not in 143 controls" "Germline" "" "" "0" "" "" "g.197435206_197435215del" "" "pathogenic" "" "0000065397" "3" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Gerber 2002:12567265}" "BspCNI-;DdeI-" "del4121-4130" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065398" "3" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Gerber 2002:12567265}" "BspCNI-;DdeI-" "del4121-4130" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065399" "3" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Gerber 2002:12567265}" "BspCNI-;DdeI-" "del4121-4130" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065400" "3" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Gerber 2002:12567265}" "BspCNI-;DdeI-" "del4121-4130" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065401" "3" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Gerber 2002:12567265}" "BspCNI-;DdeI-" "del4121-4130" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065402" "3" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Gerber 2002:12567265}" "BspCNI-;DdeI-" "del4121-4130" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065403" "3" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Gerber 2002:12567265}" "BspCNI-;DdeI-" "del4121-4130" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065404" "3" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Gerber 2002:12567265}" "BspCNI-;DdeI-" "del4121-4130" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065405" "3" "70" "1" "197396991" "197396991" "subst" "0.0000122002" "01251" "CRB1_000024" "g.197396991G>A" "" "{PMID:Khaliq 2003:12573663}" "-" "" "" "Germline" "" "" "0" "" "" "g.197427861G>A" "" "likely pathogenic" "" "0000065406" "3" "70" "1" "197396991" "197396991" "subst" "0.0000122002" "01251" "CRB1_000024" "g.197396991G>A" "" "{PMID:Khaliq 2003:12573663}" "-" "" "" "Germline" "" "" "0" "" "" "g.197427861G>A" "" "likely pathogenic" "" "0000065407" "3" "70" "1" "197396991" "197396991" "subst" "0.0000122002" "01251" "CRB1_000024" "g.197396991G>A" "" "{PMID:Khaliq 2003:12573663}" "-" "" "" "Germline" "" "" "0" "" "" "g.197427861G>A" "" "likely pathogenic" "" "0000065408" "3" "70" "1" "197396991" "197396991" "subst" "0.0000122002" "01251" "CRB1_000024" "g.197396991G>A" "" "{PMID:Khaliq 2003:12573663}" "-" "" "" "Germline" "" "" "0" "" "" "g.197427861G>A" "" "likely pathogenic" "" "0000065409" "3" "70" "1" "197396991" "197396991" "subst" "0.0000122002" "01251" "CRB1_000024" "g.197396991G>A" "" "{PMID:Khaliq 2003:12573663}" "-" "" "" "Germline" "" "" "0" "" "" "g.197427861G>A" "" "likely pathogenic" "" "0000065410" "3" "70" "1" "197404205" "197404205" "subst" "0.00000406626" "01251" "CRB1_000095" "g.197404205T>C" "" "{PMID:Khaliq 2003:12573663}" "MnlI-" "" "" "Germline" "" "" "0" "" "" "g.197435075T>C" "" "likely pathogenic" "" "0000065411" "3" "70" "1" "197404205" "197404205" "subst" "0.00000406626" "01251" "CRB1_000095" "g.197404205T>C" "" "{PMID:Khaliq 2003:12573663}" "MnlI-" "" "" "Germline" "" "" "0" "" "" "g.197435075T>C" "" "likely pathogenic" "" "0000065412" "3" "70" "1" "197404205" "197404205" "subst" "0.00000406626" "01251" "CRB1_000095" "g.197404205T>C" "" "{PMID:Khaliq 2003:12573663}" "MnlI-" "" "" "Germline" "" "" "0" "" "" "g.197435075T>C" "" "likely pathogenic" "" "0000065413" "3" "70" "1" "197404205" "197404205" "subst" "0.00000406626" "01251" "CRB1_000095" "g.197404205T>C" "" "{PMID:Khaliq 2003:12573663}" "MnlI-" "" "" "Germline" "" "" "0" "" "" "g.197435075T>C" "" "likely pathogenic" "" "0000065414" "3" "70" "1" "197404205" "197404205" "subst" "0.00000406626" "01251" "CRB1_000095" "g.197404205T>C" "" "{PMID:Khaliq 2003:12573663}" "MnlI-" "" "" "Germline" "" "" "0" "" "" "g.197435075T>C" "" "likely pathogenic" "" "0000065415" "3" "70" "1" "197404205" "197404205" "subst" "0.00000406626" "01251" "CRB1_000095" "g.197404205T>C" "" "{PMID:Khaliq 2003:12573663}" "MnlI-" "" "" "Germline" "" "" "0" "" "" "g.197435075T>C" "" "likely pathogenic" "" "0000065416" "3" "70" "1" "197404205" "197404205" "subst" "0.00000406626" "01251" "CRB1_000095" "g.197404205T>C" "" "{PMID:Khaliq 2003:12573663}" "MnlI-" "" "" "Germline" "" "" "0" "" "" "g.197435075T>C" "" "likely pathogenic" "" "0000065417" "3" "70" "1" "197403959" "197403959" "subst" "0" "01251" "CRB1_000156" "g.197403959T>C" "" "{PMID:Khaliq 2003:12573663}" "BsrDI+;SspI-" "T->C nt 3101/codon 989" "" "Germline" "" "" "0" "" "" "g.197434829T>C" "" "likely pathogenic" "" "0000065418" "3" "70" "1" "197403959" "197403959" "subst" "0" "01251" "CRB1_000156" "g.197403959T>C" "" "{PMID:Khaliq 2003:12573663}" "BsrDI+;SspI-" "T->C nt 3101/codon 989" "" "Germline" "" "" "0" "" "" "g.197434829T>C" "" "likely pathogenic" "" "0000065419" "3" "70" "1" "197403959" "197403959" "subst" "0" "01251" "CRB1_000156" "g.197403959T>C" "" "{PMID:Khaliq 2003:12573663}" "BsrDI+;SspI-" "T->C nt 3101/codon 989" "" "Germline" "" "" "0" "" "" "g.197434829T>C" "" "likely pathogenic" "" "0000065420" "3" "70" "1" "197403959" "197403959" "subst" "0" "01251" "CRB1_000156" "g.197403959T>C" "" "{PMID:Khaliq 2003:12573663}" "BsrDI+;SspI-" "T->C nt 3101/codon 989" "" "Germline" "" "" "0" "" "" "g.197434829T>C" "" "likely pathogenic" "" "0000065421" "3" "70" "1" "197403959" "197403959" "subst" "0" "01251" "CRB1_000156" "g.197403959T>C" "" "{PMID:Khaliq 2003:12573663}" "BsrDI+;SspI-" "T->C nt 3101/codon 989" "" "Germline" "" "" "0" "" "" "g.197434829T>C" "" "likely pathogenic" "" "0000065422" "3" "70" "1" "197403959" "197403959" "subst" "0" "01251" "CRB1_000156" "g.197403959T>C" "" "{PMID:Khaliq 2003:12573663}" "BsrDI+;SspI-" "T->C nt 3101/codon 989" "" "Germline" "" "" "0" "" "" "g.197434829T>C" "" "likely pathogenic" "" "0000065423" "3" "70" "1" "197403959" "197403959" "subst" "0" "01251" "CRB1_000156" "g.197403959T>C" "" "{PMID:Khaliq 2003:12573663}" "BsrDI+;SspI-" "T->C nt 3101/codon 989" "" "Germline" "" "" "0" "" "" "g.197434829T>C" "" "likely pathogenic" "" "0000065424" "3" "70" "1" "197403959" "197403959" "subst" "0" "01251" "CRB1_000156" "g.197403959T>C" "" "{PMID:Khaliq 2003:12573663}" "BsrDI+;SspI-" "T->C nt 3101/codon 989" "" "Germline" "" "" "0" "" "" "g.197434829T>C" "" "likely pathogenic" "" "0000065425" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Jacobson 2003:12700176}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065426" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Jacobson 2003:12700176}" "-" "" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065427" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Jacobson 2003:12700176}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065428" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Jacobson 2003:12700176}" "-" "" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065429" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Jacobson 2003:12700176}" "-" "" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065430" "0" "70" "1" "197396700" "197396702" "del" "0" "01251" "CRB1_000055" "g.197396700_197396702del" "" "{PMID:Jacobson 2003:12700176}" "BssKI+;BstNI+;PspGI+;ScrFI+;StyD4I+;BccI-" "749del3bp" "" "Unknown" "" "" "0" "" "" "g.197427570_197427572del" "" "likely pathogenic" "" "0000065431" "0" "90" "1" "197297738" "197297739" "dup" "0" "01251" "CRB1_000068" "g.197297738_197297739dup" "" "{PMID:Jacobson 2003:12700176}" "-" "86–87ins2bp" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328608_197328609dup" "" "pathogenic" "" "0000065432" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Jacobson 2003:12700176}" "BfaI+" "Lys801Stop" "" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065433" "3" "90" "1" "197297962" "197297962" "dup" "0" "01251" "CRB1_000209" "g.197297962dup" "" "{PMID:Bernal 2003:12843338}" "-" "nt 478^81 ins G" "" "Germline" "" "" "0" "" "" "g.197328832dup" "" "pathogenic" "" "0000065434" "10" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bernal 2003:12843338}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065435" "10" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bernal 2003:12843338}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065436" "11" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bernal 2003:12843338}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065437" "0" "90" "1" "197396700" "197396702" "del" "0" "01251" "CRB1_000055" "g.197396700_197396702del" "" "{PMID:Bernal 2003:12843338}" "BssKI+;BstNI+;PspGI+;ScrFI+;StyD4I+;BccI-" "nt 2244^47 del 3bp" "" "Germline" "" "" "0" "" "" "g.197427570_197427572del" "" "pathogenic" "" "0000065438" "0" "90" "1" "197396700" "197396702" "del" "0" "01251" "CRB1_000055" "g.197396700_197396702del" "" "{PMID:Bernal 2003:12843338}" "BssKI+;BstNI+;PspGI+;ScrFI+;StyD4I+;BccI-" "nt 2244^47 del 3bp" "" "Germline" "" "" "0" "" "" "g.197427570_197427572del" "" "pathogenic" "" "0000065439" "0" "90" "1" "197397126" "197397126" "subst" "0" "01251" "CRB1_000171" "g.197397126T>G" "" "{PMID:Bernal 2003:12843338}" "AciI+;AluI-;ApeKI-;BbvI-;HpyCH4V-;PvuII-;TseI-" "" "" "Germline" "" "" "0" "" "" "g.197427996T>G" "" "pathogenic" "" "0000065440" "0" "90" "1" "197403879" "197403881" "del" "0" "01251" "CRB1_000145" "g.197403879_197403881del" "" "{PMID:Bernal 2003:12843338}" "-" "nt 2882^88 del 3bp" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197434749_197434751del" "" "pathogenic" "" "0000065441" "0" "90" "1" "197298095" "197298095" "subst" "0.000591041" "01251" "CRB1_000002" "g.197298095T>C" "" "{PMID:Bernal 2003:12843338}" "LpnPI+" "ATA>ACA" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197328965T>C" "" "pathogenic" "" "0000065442" "0" "90" "1" "197298095" "197298095" "subst" "0.000591041" "01251" "CRB1_000002" "g.197298095T>C" "" "{PMID:Bernal 2003:12843338}" "LpnPI+" "ATA>ACA" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197328965T>C" "" "pathogenic" "" "0000065443" "3" "70" "1" "197391086" "197391086" "subst" "0" "01251" "CRB1_000228" "g.197391086G>C" "" "{PMID:Hanein 2004:15024725}" "BcoDI+;BsmAI+" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197421956G>C" "" "likely pathogenic" "" "0000065444" "3" "70" "1" "197404313" "197404313" "subst" "0" "01251" "CRB1_000109" "g.197404313T>G" "" "{PMID:Hanein 2004:15024725}" "MwoI+" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197435183T>G" "" "likely pathogenic" "" "0000065445" "21" "70" "1" "197391086" "197391086" "subst" "0" "01251" "CRB1_000228" "g.197391086G>C" "" "{PMID:Hanein 2004:15024725}" "BcoDI+;BsmAI+" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197421956G>C" "" "likely pathogenic" "" "0000065446" "21" "70" "1" "197391086" "197391086" "subst" "0" "01251" "CRB1_000228" "g.197391086G>C" "" "{PMID:Hanein 2004:15024725}" "BcoDI+;BsmAI+" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197421956G>C" "" "likely pathogenic" "" "0000065447" "0" "70" "1" "197404313" "197404313" "subst" "0" "01251" "CRB1_000109" "g.197404313T>G" "" "{PMID:Hanein 2004:15024725}" "MwoI+" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197435183T>G" "" "likely pathogenic" "" "0000065448" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Hanein 2004:15024725}" "-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065449" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Hanein 2004:15024725}" "Tsp45I-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065450" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Hanein 2004:15024725}" "-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065451" "3" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Hanein 2004:15024725}" "BspCNI-;DdeI-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065452" "0" "90" "1" "197403846" "197403846" "dup" "0" "01251" "CRB1_000143" "g.197403846dup" "" "{PMID:Hanein 2004:15024725}" "MluCI+" "c.2853dupT" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197434716dup" "" "pathogenic" "" "0000065453" "0" "70" "1" "197396677" "197396677" "subst" "0.00000406934" "01251" "CRB1_000013" "g.197396677T>C" "" "{PMID:Hanein 2004:15024725}" "HpyCH4IV+;CviAII-;FatI-;NlaIII-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197427547T>C" "" "likely pathogenic" "" "0000065454" "0" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Hanein 2004:15024725}" "-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000065455" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Hanein 2004:15024725}" "BsmI+" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065456" "0" "70" "1" "197397010" "197397010" "subst" "0.00000406759" "01251" "CRB1_000168" "g.197397010T>C" "" "{PMID:Hanein 2004:15024725}" "CviQI+;RsaI+;BciVI-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197427880T>C" "" "likely pathogenic" "" "0000065457" "0" "70" "1" "197404067" "197404067" "subst" "0" "01251" "CRB1_000162" "g.197404067G>T" "" "{PMID:Hanein 2004:15024725}" "MluCI+" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197434937G>T" "" "likely pathogenic" "" "0000065458" "0" "70" "1" "197404313" "197404313" "subst" "0.00000407847" "01251" "CRB1_000028" "g.197404313T>C" "" "{PMID:Hanein 2004:15024725}" "-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197435183T>C" "" "likely pathogenic" "" "0000065459" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Hanein 2004:15024725}" "-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065460" "3" "70" "1" "197390708" "197390708" "subst" "0" "01251" "CRB1_000196" "g.197390708G>T" "" "{PMID:Hanein 2004:15024725}" "Hpy99I-;TaqI-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197421578G>T" "" "likely pathogenic" "" "0000065461" "3" "90" "1" "197411296" "197411296" "subst" "0" "01251" "CRB1_000077" "g.197411296G>A" "" "{PMID:Hanein 2004:15024725}" "-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197442166G>A" "" "pathogenic" "" "0000065462" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Hanein 2004:15024725}" "-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065463" "0" "70" "1" "197298065" "197298065" "subst" "0.0000121916" "01251" "CRB1_000214" "g.197298065G>T" "" "{PMID:den Hollander 2004:15459956}" "Hpy188III+;HpyAV+;HpyCH4V-;LpnPI-" "" "" "Germline" "" "" "0" "" "" "g.197328935G>T" "" "likely pathogenic" "" "0000065464" "10" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:den Hollander 2004:15459956}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065465" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:den Hollander 2004:15459956}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065466" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:den Hollander 2004:15459956}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065467" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:den Hollander 2004:15459956}" "-" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065468" "0" "70" "1" "197396961" "197396961" "subst" "0.00019522" "01251" "CRB1_000026" "g.197396961C>A" "" "{PMID:den Hollander 2004:15459956}" "LpnPI-" "" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427831C>A" "" "likely pathogenic" "" "0000065469" "0" "70" "1" "197397003" "197397003" "subst" "0.0000203346" "01251" "CRB1_000010" "g.197397003G>A" "" "{PMID:den Hollander 2004:15459956}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.197427873G>A" "" "likely pathogenic" "" "0000065470" "0" "70" "1" "197403950" "197403950" "subst" "0" "01251" "CRB1_000147" "g.197403950A>T" "" "{PMID:den Hollander 2004:15459956}" "MfeI+;MluCI+" "" "" "Germline" "" "" "0" "" "" "g.197434820A>T" "" "likely pathogenic" "" "0000065471" "10" "70" "1" "197404292" "197404292" "subst" "0" "01251" "CRB1_000100" "g.197404292T>A" "" "{PMID:den Hollander 2004:15459956}" "-" "c.3299T>A" "" "Germline" "" "" "0" "" "" "g.197435162T>A" "" "likely pathogenic" "" "0000065472" "0" "70" "1" "197446936" "197446936" "subst" "0.000220166" "01251" "CRB1_000044" "g.197446936G>A" "" "{PMID:den Hollander 2004:15459956}" "BccI+;BceAI-" "" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197477806G>A" "" "likely pathogenic" "" "0000065473" "0" "70" "1" "197403868" "197403868" "subst" "0.0000407163" "01251" "CRB1_000144" "g.197403868G>A" "" "{PMID:den Hollander 2004:15459956}" "AciI-" "" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197434738G>A" "" "likely pathogenic" "" "0000065474" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01251" "CRB1_000191" "g.197390691T>A" "" "{PMID:den Hollander 2004:15459956}" "BcoDI+;BsaI+;BsmAI+;BspCNI+;DdeI+;Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000065475" "21" "70" "1" "197297965" "197297965" "subst" "0.00128897" "01251" "CRB1_000035" "g.197297965G>A" "" "{PMID:Mckay 2005:15623792}" "CviAII+;FatI+;NlaIII+;BceAI-" "c.619G>A" "dominant variant; not in 150 controls" "Germline" "" "" "0" "" "" "g.197328835G>A" "" "likely pathogenic" "" "0000065476" "0" "70" "1" "197297965" "197297965" "subst" "0.00128897" "01251" "CRB1_000035" "g.197297965G>A" "" "{PMID:Mckay 2005:15623792}" "CviAII+;FatI+;NlaIII+;BceAI-" "c.619G>A" "dominant variant; not in 150 controls" "Germline" "" "" "0" "" "" "g.197328835G>A" "" "likely pathogenic" "" "0000065477" "0" "70" "1" "197297965" "197297965" "subst" "0.00128897" "01251" "CRB1_000035" "g.197297965G>A" "" "{PMID:Mckay 2005:15623792}" "CviAII+;FatI+;NlaIII+;BceAI-" "c.619G>A" "dominant variant; not in 150 controls" "Germline" "" "" "0" "" "" "g.197328835G>A" "" "likely pathogenic" "" "0000065478" "21" "70" "1" "197297965" "197297965" "subst" "0.00128897" "01251" "CRB1_000035" "g.197297965G>A" "" "{PMID:Mckay 2005:15623792}" "CviAII+;FatI+;NlaIII+;BceAI-" "c.619G>A" "dominant variant; not in 150 controls" "Germline" "" "" "0" "" "" "g.197328835G>A" "" "likely pathogenic" "" "0000065479" "21" "70" "1" "197297965" "197297965" "subst" "0.00128897" "01251" "CRB1_000035" "g.197297965G>A" "" "{PMID:Mckay 2005:15623792}" "CviAII+;FatI+;NlaIII+;BceAI-" "c.619G>A" "dominant variant; not in 150 controls" "Germline" "" "" "0" "" "" "g.197328835G>A" "" "likely pathogenic" "" "0000065480" "0" "90" "1" "197397004" "197397007" "del" "0" "01251" "CRB1_000167" "g.197397004_197397007del" "" "{PMID:Galvin 2005:16205573}" "CviKI_1-" "4 bp del 850-51" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427874_197427877del" "" "pathogenic" "" "0000065481" "0" "90" "1" "197397004" "197397007" "del" "0" "01251" "CRB1_000167" "g.197397004_197397007del" "" "{PMID:Galvin 2005:16205573}" "CviKI_1-" "4 bp del 850-51" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427874_197427877del" "" "pathogenic" "" "0000065482" "0" "70" "1" "197396713" "197396713" "subst" "0" "01251" "CRB1_000059" "g.197396713T>C" "" "{PMID:Galvin 2005:16205573}" "LpnPI+;BfaI-" "L753P" "" "Germline" "" "" "0" "" "" "g.197427583T>C" "" "likely pathogenic" "" "0000065483" "0" "70" "1" "197396713" "197396713" "subst" "0" "01251" "CRB1_000059" "g.197396713T>C" "" "{PMID:Galvin 2005:16205573}" "LpnPI+;BfaI-" "L753P" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427583T>C" "" "likely pathogenic" "" "0000065484" "0" "70" "1" "197396713" "197396713" "subst" "0" "01251" "CRB1_000059" "g.197396713T>C" "" "{PMID:Galvin 2005:16205573}" "LpnPI+;BfaI-" "L753P" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427583T>C" "" "likely pathogenic" "" "0000065485" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Galvin 2005:16205573}" "-" "7 bp del 204-07" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065486" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Galvin 2005:16205573}" "-" "C948Y" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065487" "0" "70" "1" "197391000" "197391000" "subst" "0.00000406732" "01251" "CRB1_000020" "g.197391000G>A" "" "{PMID:Galvin 2005:16205573}" "-" "C681Y" "" "Germline" "" "" "0" "" "" "g.197421870G>A" "" "likely pathogenic" "" "0000065488" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Booij 2005:16272259}" "BfaI+" "c.2536A>T" "not in 60 controls" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065489" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Booij 2005:16272259}" "-" "" "unknown variant 2nd chromosome; not in 60 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065490" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Booij 2005:16272259}" "-" "" "unknown variant 2nd chromosome; not in 60 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065491" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Booij 2005:16272259}" "-" "" "unknown variant 2nd chromosome; not in 60 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065492" "0" "90" "1" "197390166" "197390166" "subst" "0" "01251" "CRB1_000148" "g.197390166C>G" "" "{PMID:Booij 2005:16272259}" "Hpy188III+" "Ser403X" "not in 60 controls" "Germline" "" "" "0" "" "" "g.197421036C>G" "" "pathogenic" "" "0000065493" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Yzer 2006:16505055}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065494" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Yzer 2006:16505055}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065495" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Yzer 2006:16505055}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065496" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Yzer 2006:16505055}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065497" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Yzer 2006:16505055}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065498" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Yzer 2006:16505055}" "BfaI+" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065499" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Yzer 2006:16505055}" "BfaI+" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065500" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Yzer 2006:16505055}" "BfaI+" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065501" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Yzer 2006:16505055}" "BfaI+" "" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065502" "3" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Abouzeid 2006:16543197}" "-" "G1103R" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000065503" "3" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Abouzeid 2006:16543197}" "-" "G1103R" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000065504" "3" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Abouzeid 2006:16543197}" "-" "G1103R" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000065505" "3" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Abouzeid 2006:16543197}" "-" "G1103R" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000065506" "0" "90" "1" "197411413" "197411413" "subst" "0" "01251" "CRB1_000054" "g.197411413C>A" "" "{PMID:Mezer 2006:16767206}" "BspCNI+;DdeI+;ApeKI-;BbvI-;Fnu4HI-;MwoI-;TseI-" "(Cys1332Stop)" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197442283C>A" "" "pathogenic" "" "0000065507" "0" "90" "1" "197411413" "197411413" "subst" "0" "01251" "CRB1_000054" "g.197411413C>A" "" "{PMID:Mezer 2006:16767206}" "BspCNI+;DdeI+;ApeKI-;BbvI-;Fnu4HI-;MwoI-;TseI-" "(Cys1332Stop)" "" "Germline" "" "" "0" "" "" "g.197442283C>A" "" "pathogenic" "" "0000065508" "11" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Yzer 2006:16936081}" "-" "p.[C948Y]" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065509" "11" "90" "1" "197297979" "197297987" "del" "0" "01251" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Yzer 2006:16936081}" "MluCI-" "p.[D165-I167 del; G454R]" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "pathogenic" "" "0000065510" "3" "90" "1" "197390303" "197390303" "subst" "0" "01251" "CRB1_000152" "g.197390303C>T" "" "{PMID:Yzer 2006:16936081}" "BsrDI-" "p.[Q449X]" "" "Germline" "" "" "0" "" "" "g.197421173C>T" "" "pathogenic" "" "0000065511" "11" "70" "1" "197390421" "197390421" "subst" "0.00000406108" "01251" "CRB1_000202" "g.197390421T>C" "" "{PMID:Yzer 2006:16936081}" "BspCNI+;DdeI+;Hpy188I+" "p.[F488S]" "" "Germline" "" "" "0" "" "" "g.197421291T>C" "" "likely pathogenic" "" "0000065512" "11" "70" "1" "197396713" "197396713" "subst" "0" "01251" "CRB1_000059" "g.197396713T>C" "" "{PMID:Yzer 2006:16936081}" "LpnPI+;BfaI-" "p.[L753P]" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427583T>C" "" "likely pathogenic" "" "0000065513" "11" "70" "1" "197396713" "197396713" "subst" "0" "01251" "CRB1_000059" "g.197396713T>C" "" "{PMID:Yzer 2006:16936081}" "LpnPI+;BfaI-" "p.[L753P]" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427583T>C" "" "likely pathogenic" "" "0000065514" "0" "70" "1" "197237617" "197237617" "subst" "0" "01251" "CRB1_000233" "g.197237617G>A" "" "{PMID:Preising 2007:17525851}" "-" "IVS1+5g>a" "" "Germline" "" "" "0" "" "" "g.197268487G>A" "" "likely pathogenic" "" "0000065515" "0" "90" "1" "197404145" "197404145" "subst" "0" "01251" "CRB1_000173" "g.197404145G>A" "" "{PMID:Preising 2007:17525851}" "BslI-" "p.W1051X (c.3152G>A)" "" "Germline" "" "" "0" "" "" "g.197435015G>A" "" "pathogenic" "" "0000065516" "0" "90" "1" "197297839" "197297839" "subst" "0" "01251" "CRB1_000069" "g.197297839C>T" "" "{PMID:Simonelli 2007:17724218}" "" "c.258C>T" "" "Germline" "" "" "0" "" "" "g.197328709C>T" "" "pathogenic" "" "0000065517" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Simonelli 2007:17724218}" "" "c.2334C>T" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065518" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Simonelli 2007:17724218}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065519" "0" "70" "1" "197397010" "197397010" "subst" "0.00000406759" "01251" "CRB1_000168" "g.197397010T>C" "" "{PMID:Simonelli 2007:17724218}" "" "" "" "Germline" "" "" "0" "" "" "g.197427880T>C" "" "likely pathogenic" "" "0000065520" "0" "70" "1" "197446870" "197446870" "subst" "0" "01251" "CRB1_000186" "g.197446870T>A" "" "{PMID:Simonelli 2007:17724218}" "" "c.4082G>A" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197477740T>A" "" "likely pathogenic" "" "0000065521" "0" "50" "1" "197316487" "197316487" "subst" "0.000479235" "01251" "CRB1_000180" "g.197316487C>T" "" "{PMID:Simonelli 2007:17724218}" "" "" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197347357C>T" "" "VUS" "" "0000065522" "0" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Simonelli 2007:17724218}" "" "" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000065523" "0" "70" "1" "197397010" "197397010" "subst" "0.00000406759" "01251" "CRB1_000168" "g.197397010T>C" "" "{PMID:Simonelli 2007:17724218}" "" "I852T" "" "Germline" "" "" "0" "" "" "g.197427880T>C" "" "likely pathogenic" "" "0000065524" "0" "90" "1" "197237542" "197447010" "" "0" "01251" "CRB1_000000" "g.(?_197237542)_(197447010_?)del" "" "{PMID:Stone 2007:17964524}" "" "700KB del" "unknown variant 2nd chromosome; CRB1 deleted" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000065525" "0" "90" "1" "197237599" "197237599" "dup" "0" "01251" "CRB1_000232" "g.197237599dup" "" "{PMID:Stone 2007:17964524}" "" "Leu19 ins1" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197268469dup" "" "pathogenic" "" "0000065526" "0" "90" "1" "197297593" "197297593" "del" "0" "01251" "CRB1_000065" "g.197297593del" "" "{PMID:Stone 2007:17964524}" "" "Asn37 del1" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328463del" "" "pathogenic" "" "0000065527" "0" "90" "1" "197297593" "197297593" "del" "0" "01251" "CRB1_000065" "g.197297593del" "" "{PMID:Stone 2007:17964524}" "" "Asn37 del1" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328463del" "" "pathogenic" "" "0000065528" "0" "90" "1" "197297738" "197297739" "dup" "0" "01251" "CRB1_000068" "g.197297738_197297739dup" "" "{PMID:Stone 2007:17964524}" "" "Cys85 ins2" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328608_197328609dup" "" "pathogenic" "" "0000065529" "0" "90" "1" "197297738" "197297739" "dup" "0" "01251" "CRB1_000068" "g.197297738_197297739dup" "" "{PMID:Stone 2007:17964524}" "" "Cys85 ins2" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328608_197328609dup" "" "pathogenic" "" "0000065530" "0" "90" "1" "197297738" "197297739" "dup" "0" "01251" "CRB1_000068" "g.197297738_197297739dup" "" "{PMID:Stone 2007:17964524}" "" "Cys85 ins2" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328608_197328609dup" "" "pathogenic" "" "0000065531" "0" "90" "1" "197297909" "197297913" "del" "0" "01251" "CRB1_000216" "g.197297909_197297913del" "" "{PMID:Stone 2007:17964524}" "" "Arg143 del5" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328779_197328783del" "" "pathogenic" "" "0000065532" "0" "70" "1" "197297911" "197297911" "subst" "0.000158815" "01251" "CRB1_000217" "g.197297911T>G" "" "{PMID:Stone 2007:17964524}" "" "Phe144Val" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328781T>G" "" "likely pathogenic" "" "0000065533" "0" "90" "1" "197298003" "197298003" "subst" "0" "01251" "CRB1_000213" "g.197298003T>A" "" "{PMID:Stone 2007:17964524}" "" "Cys174STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328873T>A" "" "pathogenic" "" "0000065534" "0" "70" "1" "197298065" "197298065" "subst" "0.0000121916" "01251" "CRB1_000214" "g.197298065G>T" "" "{PMID:Stone 2007:17964524}" "" "Cys195Phe" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328935G>T" "" "likely pathogenic" "" "0000065535" "0" "70" "1" "197298065" "197298065" "subst" "0.0000121916" "01251" "CRB1_000214" "g.197298065G>T" "" "{PMID:Stone 2007:17964524}" "" "Cys195Phe" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328935G>T" "" "likely pathogenic" "" "0000065536" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Stone 2007:17964524}" "" "Glu204 del7" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065537" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Stone 2007:17964524}" "" "Glu204 del7" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065538" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Stone 2007:17964524}" "" "Glu204 del7" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065539" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Stone 2007:17964524}" "" "Glu204 del7" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065540" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Stone 2007:17964524}" "" "Glu204 del7" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065541" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Stone 2007:17964524}" "" "Glu204 del7" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065542" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Stone 2007:17964524}" "" "Glu204 del7" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065543" "0" "30" "1" "197316487" "197316487" "subst" "0.000479235" "01251" "CRB1_000180" "g.197316487C>T" "" "{PMID:Stone 2007:17964524}" "" "Thr289Met" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197347357C>T" "" "likely benign" "" "0000065544" "0" "90" "1" "197326056" "197326056" "subst" "0.0000081213" "01251" "CRB1_000223" "g.197326056C>T" "" "{PMID:Stone 2007:17964524}" "" "Gln362STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197356926C>T" "" "pathogenic" "" "0000065545" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01251" "CRB1_000132" "g.197326120G>A" "" "{PMID:Stone 2007:17964524}" "" "Cys383Tyr" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197356990G>A" "" "likely pathogenic" "" "0000065546" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01251" "CRB1_000132" "g.197326120G>A" "" "{PMID:Stone 2007:17964524}" "" "Cys383Tyr" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197356990G>A" "" "likely pathogenic" "" "0000065547" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01251" "CRB1_000132" "g.197326120G>A" "" "{PMID:Stone 2007:17964524}" "" "Cys383Tyr" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197356990G>A" "" "likely pathogenic" "" "0000065548" "0" "70" "1" "197326119" "197326119" "subst" "0" "01251" "CRB1_000193" "g.197326119T>C" "" "{PMID:Stone 2007:17964524}" "" "Cys383Arg" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197356989T>C" "" "likely pathogenic" "" "0000065549" "0" "70" "1" "197390396" "197390396" "subst" "0.00000812255" "01251" "CRB1_000195" "g.197390396T>C" "" "{PMID:Stone 2007:17964524}" "" "Cys480Arg" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197421266T>C" "" "likely pathogenic" "" "0000065550" "0" "70" "1" "197390396" "197390396" "subst" "0.00000812255" "01251" "CRB1_000195" "g.197390396T>C" "" "{PMID:Stone 2007:17964524}" "" "Cys480Arg" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197421266T>C" "" "likely pathogenic" "" "0000065551" "0" "70" "1" "197390396" "197390396" "subst" "0.00000812255" "01251" "CRB1_000195" "g.197390396T>C" "" "{PMID:Stone 2007:17964524}" "" "Cys480Arg" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197421266T>C" "" "likely pathogenic" "" "0000065552" "0" "70" "1" "197390396" "197390396" "subst" "0.00000812255" "01251" "CRB1_000195" "g.197390396T>C" "" "{PMID:Stone 2007:17964524}" "" "Cys480Arg" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197421266T>C" "" "likely pathogenic" "" "0000065553" "0" "70" "1" "197390396" "197390396" "subst" "0.00000812255" "01251" "CRB1_000195" "g.197390396T>C" "" "{PMID:Stone 2007:17964524}" "" "Cys480Arg" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197421266T>C" "" "likely pathogenic" "" "0000065554" "0" "70" "1" "197390396" "197390396" "subst" "0.00000812255" "01251" "CRB1_000195" "g.197390396T>C" "" "{PMID:Stone 2007:17964524}" "" "Cys480Arg" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197421266T>C" "" "likely pathogenic" "" "0000065555" "0" "90" "1" "197390398" "197390398" "subst" "0" "01251" "CRB1_000200" "g.197390398T>A" "" "{PMID:Stone 2007:17964524}" "" "Cys480STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197421268T>A" "" "pathogenic" "" "0000065556" "0" "70" "1" "197390421" "197390421" "subst" "0.00000406108" "01251" "CRB1_000202" "g.197390421T>C" "" "{PMID:Stone 2007:17964524}" "" "Phe488Ser" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197421291T>C" "" "likely pathogenic" "" "0000065557" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01251" "CRB1_000191" "g.197390691T>A" "" "{PMID:Stone 2007:17964524}" "" "Val578Glu" "" "Unknown" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000065558" "0" "90" "1" "197390908" "197390908" "subst" "0" "01251" "CRB1_000107" "g.197390908G>A" "" "{PMID:Stone 2007:17964524}" "" "Trp650STOP" "" "Germline" "" "" "0" "" "" "g.197421778G>A" "" "pathogenic" "" "0000065559" "0" "70" "1" "197391000" "197391000" "subst" "0.00000406732" "01251" "CRB1_000020" "g.197391000G>A" "" "{PMID:Stone 2007:17964524}" "" "Cys681Tyr" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197421870G>A" "" "likely pathogenic" "" "0000065560" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Stone 2007:17964524}" "" "Thr745Met" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065561" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Stone 2007:17964524}" "" "Thr745Met" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065562" "0" "70" "1" "197396700" "197396702" "del" "0" "01251" "CRB1_000055" "g.197396700_197396702del" "" "{PMID:Stone 2007:17964524}" "" "Pro748 del3" "" "Germline" "" "" "0" "" "" "g.197427570_197427572del" "" "likely pathogenic" "" "0000065563" "0" "70" "1" "197396704" "197396704" "subst" "0" "01251" "CRB1_000057" "g.197396704G>A" "" "{PMID:Stone 2007:17964524}" "" "Gly750Asp" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427574G>A" "" "likely pathogenic" "" "0000065564" "0" "90" "1" "197396707" "197396707" "subst" "0" "01251" "CRB1_000058" "g.197396707T>A" "" "{PMID:Stone 2007:17964524}" "" "Leu751STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427577T>A" "" "pathogenic" "" "0000065565" "0" "70" "1" "197396713" "197396713" "subst" "0" "01251" "CRB1_000059" "g.197396713T>C" "" "{PMID:Stone 2007:17964524}" "" "Leu753Pro" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427583T>C" "" "likely pathogenic" "" "0000065566" "0" "90" "1" "197396718" "197396727" "del" "0.00000406888" "01251" "CRB1_000060" "g.197396718_197396727del" "" "{PMID:Stone 2007:17964524}" "" "Leu755 del10" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427588_197427597del" "" "pathogenic" "" "0000065567" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Stone 2007:17964524}" "" "Arg764Cys" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065568" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Stone 2007:17964524}" "" "Arg764Cys" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065569" "0" "70" "1" "197396755" "197396755" "subst" "0.0000081414" "01251" "CRB1_000118" "g.197396755T>C" "" "{PMID:Stone 2007:17964524}" "" "Leu767Pro" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427625T>C" "" "likely pathogenic" "" "0000065570" "0" "70" "1" "197396755" "197396755" "subst" "0.0000081414" "01251" "CRB1_000118" "g.197396755T>C" "" "{PMID:Stone 2007:17964524}" "" "Leu767Pro" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427625T>C" "" "likely pathogenic" "" "0000065571" "0" "70" "1" "197396755" "197396755" "subst" "0.0000081414" "01251" "CRB1_000118" "g.197396755T>C" "" "{PMID:Stone 2007:17964524}" "" "Leu767Pro" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427625T>C" "" "likely pathogenic" "" "0000065572" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Stone 2007:17964524}" "" "Lys801STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065573" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Stone 2007:17964524}" "" "Lys801STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065574" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Stone 2007:17964524}" "" "Lys801STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065575" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Stone 2007:17964524}" "" "Lys801STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065576" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Stone 2007:17964524}" "" "Lys801STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065577" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Stone 2007:17964524}" "" "Lys801STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065578" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Stone 2007:17964524}" "" "Lys801STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065579" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Stone 2007:17964524}" "" "Lys801STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065580" "0" "90" "1" "197396868" "197396868" "del" "0" "01251" "CRB1_000125" "g.197396868del" "" "{PMID:Stone 2007:17964524}" "" "Lys804 del1" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427738del" "" "pathogenic" "" "0000065581" "0" "70" "1" "197396917" "197396917" "subst" "0.000240195" "01251" "CRB1_000129" "g.197396917C>T" "" "{PMID:Stone 2007:17964524}" "" "Thr821Met" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427787C>T" "" "likely pathogenic" "" "0000065582" "0" "90" "1" "197397004" "197397007" "del" "0" "01251" "CRB1_000167" "g.197397004_197397007del" "" "{PMID:Stone 2007:17964524}" "" "Gly850 del4" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427874_197427877del" "" "pathogenic" "" "0000065583" "0" "70" "1" "197397029" "197397029" "subst" "0" "01251" "CRB1_000206" "g.197397029C>G" "" "{PMID:Stone 2007:17964524}" "" "Asn858Lys" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427899C>G" "" "likely pathogenic" "" "0000065584" "0" "90" "1" "197397068" "197397068" "dup" "0" "01251" "CRB1_000170" "g.197397068dup" "" "{PMID:Stone 2007:17964524}" "" "Asn871 ins1" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197427938dup" "" "pathogenic" "" "0000065585" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Stone 2007:17964524}" "" "Cys896STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065586" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Stone 2007:17964524}" "" "Cys896STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065587" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Stone 2007:17964524}" "" "Cys896STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065588" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Stone 2007:17964524}" "" "Cys896STOP" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065589" "0" "70" "1" "197398634" "197398634" "subst" "0" "01251" "CRB1_000139" "g.197398634G>C" "" "{PMID:Stone 2007:17964524}" "" "Cys911Ser" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197429504G>C" "" "likely pathogenic" "" "0000065590" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Stone 2007:17964524}" "" "Cys948Tyr" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065591" "0" "70" "1" "197403938" "197403938" "subst" "0" "01251" "CRB1_000146" "g.197403938C>A" "" "{PMID:Stone 2007:17964524}" "" "Thr982Lys" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197434808C>A" "" "likely pathogenic" "" "0000065592" "0" "70" "1" "197404214" "197404214" "subst" "0.0000122015" "01251" "CRB1_000096" "g.197404214T>C" "" "{PMID:Stone 2007:17964524}" "" "Leu1074Ser" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197435084T>C" "" "likely pathogenic" "" "0000065593" "0" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Stone 2007:17964524}" "" "" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000065594" "0" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Stone 2007:17964524}" "" "" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000065595" "0" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Stone 2007:17964524}" "" "" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000065596" "0" "70" "1" "197404313" "197404313" "subst" "0.00000407847" "01251" "CRB1_000028" "g.197404313T>C" "" "{PMID:Stone 2007:17964524}" "" "Leu1107Pro" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197435183T>C" "" "likely pathogenic" "" "0000065597" "0" "70" "1" "197404513" "197404513" "subst" "0" "01251" "CRB1_000016" "g.197404513T>G" "" "{PMID:Stone 2007:17964524}" "" "Cys1174Gly" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197435383T>G" "" "likely pathogenic" "" "0000065598" "0" "70" "1" "197404606" "197404606" "subst" "0.00000423952" "01251" "CRB1_000090" "g.197404606G>A" "" "{PMID:Stone 2007:17964524}" "" "Gly1205Arg" "unknown variant 2nd chromosome\r\nVariant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "g.197435476G>A" "" "likely pathogenic" "" "0000065599" "0" "70" "1" "197411366" "197411366" "subst" "0.00000406134" "01251" "CRB1_000081" "g.197411366A>C" "" "{PMID:Stone 2007:17964524}" "" "Asn1317His" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "g.197442236A>C" "" "likely pathogenic" "" "0000065600" "0" "90" "1" "197411413" "197411413" "subst" "0" "01251" "CRB1_000054" "g.197411413C>A" "" "{PMID:Stone 2007:17964524}" "" "Cys1332STOP" "" "Germline" "" "" "0" "" "" "g.197442283C>A" "" "pathogenic" "" "0000065601" "0" "90" "1" "197297962" "197297962" "dup" "0" "01251" "CRB1_000209" "g.197297962dup" "" "{PMID:Vallespin 2007:18055816}" "-" "c.478-481 insG FS" "" "Germline" "" "" "0" "" "" "g.197328832dup" "" "pathogenic" "" "0000065602" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Vallespin 2007:18055816}" "-" "c.611delAAATAGG FS" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065603" "0" "70" "1" "197298095" "197298095" "subst" "0.000591041" "01251" "CRB1_000002" "g.197298095T>C" "" "{PMID:Vallespin 2007:18055816}" "LpnPI+" "" "unknown variant 2nd chromosome" "Germline" "no" "" "0" "" "" "g.197328965T>C" "" "likely pathogenic" "" "0000065604" "0" "70" "1" "197298095" "197298095" "subst" "0.000591041" "01251" "CRB1_000002" "g.197298095T>C" "" "{PMID:Vallespin 2007:18055816}" "LpnPI+" "" "unknown variant 2nd chromosome" "Germline" "no" "" "0" "" "" "g.197328965T>C" "" "likely pathogenic" "" "0000065605" "0" "70" "1" "197298095" "197298095" "subst" "0.000591041" "01251" "CRB1_000002" "g.197298095T>C" "" "{PMID:Vallespin 2007:18055816}" "LpnPI+" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197328965T>C" "" "likely pathogenic" "" "0000065606" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Vallespin 2007:18055816}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065607" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Vallespin 2007:18055816}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065608" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Vallespin 2007:18055816}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065609" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Vallespin 2007:18055816}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065610" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Vallespin 2007:18055816}" "Tsp45I-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065611" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Vallespin 2007:18055816}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065612" "0" "70" "1" "197396700" "197396702" "del" "0" "01251" "CRB1_000055" "g.197396700_197396702del" "" "{PMID:Vallespin 2007:18055816}" "BssKI+;BstNI+;PspGI+;ScrFI+;StyD4I+;BccI-" "c.2244_2247delATC" "" "Germline" "" "" "0" "" "" "g.197427570_197427572del" "" "likely pathogenic" "" "0000065613" "0" "70" "1" "197396700" "197396702" "del" "0" "01251" "CRB1_000055" "g.197396700_197396702del" "" "{PMID:Vallespin 2007:18055816}" "BssKI+;BstNI+;PspGI+;ScrFI+;StyD4I+;BccI-" "c.2244_2247delATC" "" "Germline" "" "" "0" "" "" "g.197427570_197427572del" "" "likely pathogenic" "" "0000065614" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Vallespin 2007:18055816}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065615" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Vallespin 2007:18055816}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065616" "0" "70" "1" "197411409" "197411409" "subst" "0.00149476" "01251" "CRB1_000041" "g.197411409G>A" "" "{PMID:Vallespin 2007:18055816}" "BsiHKAI+;BtsI+;TspRI+;AfeI-;BbvI-;Fnu4HI-;HaeII-;HhaI-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197442279G>A" "" "likely pathogenic" "" "0000065617" "0" "70" "1" "197411409" "197411409" "subst" "0.00149476" "01251" "CRB1_000041" "g.197411409G>A" "" "{PMID:Vallespin 2007:18055816}" "BsiHKAI+;BtsI+;TspRI+;AfeI-;BbvI-;Fnu4HI-;HaeII-;HhaI-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197442279G>A" "" "likely pathogenic" "" "0000065618" "0" "30" "1" "197316487" "197316487" "subst" "0.000479235" "01251" "CRB1_000180" "g.197316487C>T" "" "{PMID:Vallespin 2007:18055816}" "CviAII+;FatI+;NlaIII+;BsgI-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197347357C>T" "" "likely benign" "" "0000065619" "0" "30" "1" "197316487" "197316487" "subst" "0.000479235" "01251" "CRB1_000180" "g.197316487C>T" "" "{PMID:Vallespin 2007:18055816}" "CviAII+;FatI+;NlaIII+;BsgI-" "" "" "Germline" "" "" "0" "" "" "g.197347357C>T" "" "likely benign" "" "0000065620" "0" "30" "1" "197316487" "197316487" "subst" "0.000479235" "01251" "CRB1_000180" "g.197316487C>T" "" "{PMID:Vallespin 2007:18055816}" "CviAII+;FatI+;NlaIII+;BsgI-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197347357C>T" "" "likely benign" "" "0000065621" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Vallespin 2007:18055816}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065622" "0" "70" "1" "197396761" "197396762" "delins" "0" "01251" "CRB1_000119" "g.197396761_197396762delinsAG" "" "{PMID:Vallespin 2007:18055816}" "AciI-;BstUI-;Fnu4HI-;HhaI-;HinP1I-" "c.2306-2307GC>AG" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427631_197427632delinsAG" "" "likely pathogenic" "" "0000065623" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Vallespin 2007:18055816}" "Tsp45I-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065624" "0" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Vallespin 2007:18055816}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000065625" "0" "70" "1" "197411409" "197411409" "subst" "0.00149476" "01251" "CRB1_000041" "g.197411409G>A" "" "{PMID:Vallespin 2007:18055816}" "BsiHKAI+;Bsp1286I+;TspRI+;AfeI-;BbvI-;Fnu4HI-;HaeII-;HhaI-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197442279G>A" "" "likely pathogenic" "" "0000065626" "0" "90" "1" "197297962" "197297962" "dup" "0" "01251" "CRB1_000209" "g.197297962dup" "" "{PMID:Vallespin 2007:18055816}" "-" "c.478-481 insG FS" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197328832dup" "" "pathogenic" "" "0000065627" "0" "70" "1" "197298095" "197298095" "subst" "0.000591041" "01251" "CRB1_000002" "g.197298095T>C" "" "{PMID:Vallespin 2007:18055816}" "LpnPI+" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197328965T>C" "" "likely pathogenic" "" "0000065628" "0" "70" "1" "197398583" "197398583" "subst" "0.000142177" "01251" "CRB1_000134" "g.197398583A>G" "" "{PMID:Vallespin 2007:18055816}" "AlwNI+;MwoI+;MmeI-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197429453A>G" "" "likely pathogenic" "" "0000065629" "0" "70" "1" "197398616" "197398616" "subst" "0.000272194" "01251" "CRB1_000138" "g.197398616G>A" "" "{PMID:Vallespin 2007:18055816}" "BmrI+;BsrI+;TspRI+;BssKI-;HpaII-;MspI-;NciI-;ScrFI-;StyD4I-" "" "" "Germline" "" "" "0" "" "" "g.197429486G>A" "" "likely pathogenic" "" "0000065630" "0" "70" "1" "197398616" "197398616" "subst" "0.000272194" "01251" "CRB1_000138" "g.197398616G>A" "" "{PMID:Vallespin 2007:18055816}" "BmrI+;BsrI+;TspRI+;BssKI-;HpaII-;MspI-;NciI-;ScrFI-;StyD4I-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197429486G>A" "" "likely pathogenic" "" "0000065631" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Vallespin 2007:18055816}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065632" "0" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Vallespin 2007:18055816}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000065633" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2007:18055820}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065634" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2007:18055820}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065635" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2007:18055820}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065636" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2007:18055820}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065637" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2007:18055820}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065638" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2007:18055820}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065639" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2007:18055820}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065640" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2007:18055820}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065641" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2007:18055820}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065642" "3" "90" "1" "197326056" "197326056" "subst" "0.0000081213" "01251" "CRB1_000223" "g.197326056C>T" "" "{PMID:den Hollander 2007:18055821}" "-" "" "" "Germline" "" "" "0" "" "" "g.197356926C>T" "" "pathogenic" "" "0000065643" "3" "70" "1" "197398718" "197398718" "subst" "0" "01251" "CRB1_000142" "g.197398718G>A" "" "{PMID:den Hollander 2007:18055821}" "CviQI+;RsaI+;BtsIMutI-;Cac8I-;TspRI-" "" "" "Germline" "" "" "0" "" "" "g.197429588G>A" "" "likely pathogenic" "" "0000065644" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:den Hollander 2007:18055821}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065645" "0" "70" "1" "197411412" "197411412" "subst" "0" "01251" "CRB1_000053" "g.197411412G>T" "" "{PMID:den Hollander 2007:18055821}" "TaqI+;ApeKI-;BbvI-;Fnu4HI-;MwoI-;TseI-" "" "" "Germline" "" "" "0" "" "" "g.197442282G>T" "" "likely pathogenic" "" "0000065648" "0" "70" "1" "197325970" "197325970" "subst" "0" "01251" "CRB1_000221" "g.197325970G>A" "" "{PMID:Seong 2008:18682808}" "SfaNI+;BaeGI-;BaeI-;BanI-;Bsp1286I-;NlaIV-" "" "" "Unknown" "" "" "0" "" "" "g.197356840G>A" "" "likely pathogenic" "" "0000065649" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Bustamante-Aragones 2008:18682814}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065650" "0" "70" "1" "197297561" "197297561" "subst" "0" "01251" "CRB1_000062" "g.197297561G>C" "" "{PMID:Li 2007:18936139}" "HpyCH4V-" "C->F" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197328431G>C" "" "likely pathogenic" "" "0000065651" "3" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Benayoun 2009:19140180}" "BspCNI-;DdeI-" "" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065652" "3" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Benayoun 2009:19140180}" "BspCNI-;DdeI-" "" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065653" "3" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Benayoun 2009:19140180}" "BspCNI-;DdeI-" "" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065654" "3" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Benayoun 2009:19140180}" "BspCNI-;DdeI-" "" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065655" "0" "70" "1" "197396700" "197396702" "del" "0" "01251" "CRB1_000055" "g.197396700_197396702del" "" "{PMID:Tosi 2009:19401883}" "BssKI+;BstNI+;PspGI+;ScrFI+;StyD4I+;BccI-" "749del Ser" "" "Germline" "" "" "0" "" "" "g.197427570_197427572del" "" "likely pathogenic" "" "0000065656" "0" "70" "1" "197396700" "197396702" "del" "0" "01251" "CRB1_000055" "g.197396700_197396702del" "" "{PMID:Tosi 2009:19401883}" "BssKI+;BstNI+;PspGI+;ScrFI+;StyD4I+;BccI-" "749del Ser" "" "Germline" "" "" "0" "" "" "g.197427570_197427572del" "" "likely pathogenic" "" "0000065657" "3" "70" "1" "197404151" "197404151" "subst" "0" "01251" "CRB1_000175" "g.197404151T>G" "" "{PMID:Aldahmesh 2009:19956407}" "XcmI-" "c.3159T>G" "" "Germline" "" "" "0" "" "" "g.197435021T>G" "" "likely pathogenic" "" "0000065658" "3" "70" "1" "197404151" "197404151" "subst" "0" "01251" "CRB1_000175" "g.197404151T>G" "" "{PMID:Aldahmesh 2009:19956407}" "XcmI-" "c.3159T>G" "" "Germline" "" "" "0" "" "" "g.197435021T>G" "" "likely pathogenic" "" "0000065659" "3" "70" "1" "197404151" "197404151" "subst" "0" "01251" "CRB1_000175" "g.197404151T>G" "" "{PMID:Aldahmesh 2009:19956407}" "XcmI-" "c.3159T>G" "" "Germline" "" "" "0" "" "" "g.197435021T>G" "" "likely pathogenic" "" "0000065660" "3" "70" "1" "197404151" "197404151" "subst" "0" "01251" "CRB1_000175" "g.197404151T>G" "" "{PMID:Aldahmesh 2009:19956407}" "XcmI-" "c.3159T>G" "" "Germline" "" "" "0" "" "" "g.197435021T>G" "" "likely pathogenic" "" "0000065661" "3" "70" "1" "197297561" "197297561" "subst" "0.00000406981" "01251" "CRB1_000063" "g.197297561G>T" "" "{PMID:Aldahmesh 2009:19956407}" "HpyCH4V-" "c.80G>C" "" "Unknown" "" "" "0" "" "" "g.197328431G>T" "" "likely pathogenic" "" "0000065662" "0" "90" "1" "197297588" "197297588" "subst" "0" "01251" "CRB1_000064" "g.197297588C>G" "" "{PMID:Mckibbin 2010:20065226}" "Hpy188I+" "" "" "Germline" "" "" "0" "" "" "g.197328458C>G" "" "pathogenic" "" "0000065663" "0" "70" "1" "197404475" "197404475" "subst" "0.00000407857" "01251" "CRB1_000082" "g.197404475A>G" "" "{PMID:Vallespin 2010:20108431}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197435345A>G" "" "likely pathogenic" "" "0000065664" "3" "30" "1" "197396762" "197396762" "subst" "0.00162865" "01251" "CRB1_000120" "g.197396762C>T" "" "{PMID:Clark 2010:20591486}" "AciI-;BstUI-;Fnu4HI-;HhaI-;HinP1I-" "R769R" "" "Germline" "" "" "0" "" "" "g.197427632C>T" "" "likely benign" "" "0000065665" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Clark 2010:20591486}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065666" "3" "70" "1" "197397003" "197397003" "subst" "0.0000203346" "01251" "CRB1_000010" "g.197397003G>A" "" "{PMID:Clark 2010:20591486}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.197427873G>A" "" "likely pathogenic" "" "0000065667" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Clark 2010:20591486}" "BsmI+" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065668" "0" "70" "1" "197297616" "197297616" "subst" "0.000381803" "01251" "CRB1_000031" "g.197297616C>G" "" "{PMID:Clark 2010:20591486}" "BsmI+" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197328486C>G" "" "likely pathogenic" "" "0000065669" "0" "70" "1" "197398603" "197398603" "subst" "0" "01251" "CRB1_000136" "g.197398603G>A" "" "{PMID:Clark 2010:20591486}" "-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197429473G>A" "" "likely pathogenic" "" "0000065670" "0" "70" "1" "197446936" "197446936" "subst" "0.000220166" "01251" "CRB1_000044" "g.197446936G>A" "" "{PMID:Clark 2010:20591486}" "BccI+;BceAI-" "c.4283G>A; p.R1383H" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197477806G>A" "" "likely pathogenic" "" "0000065671" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Coppieters 2010:20683928}" "BfaI+" "" "" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065672" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Coppieters 2010:20683928}" "BfaI+" "" "" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065673" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Coppieters 2010:20683928}" "BfaI+" "" "" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065674" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Coppieters 2010:20683928}" "BfaI+" "" "" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065675" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Coppieters 2010:20683928}" "BfaI+" "" "" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065676" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Coppieters 2010:20683928}" "BfaI+" "" "" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065677" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Coppieters 2010:20683928}" "BfaI+" "" "" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065678" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065679" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065680" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065681" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065682" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065683" "0" "90" "1" "197411423" "197411423" "subst" "0.00000406204" "01251" "CRB1_000092" "g.197411423G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197442293G>A" "" "pathogenic" "" "0000065684" "0" "90" "1" "197411423" "197411423" "subst" "0.00000406204" "01251" "CRB1_000092" "g.197411423G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197442293G>A" "" "pathogenic" "" "0000065685" "0" "90" "1" "197396896" "197396897" "del" "0" "01251" "CRB1_000128" "g.197396896_197396897del" "" "{PMID:Coppieters 2010:20683928}" "BsaWI+;HpaII+;LpnPI+;MspI+;AvrII-;BfaI-;BsaJI-;StyI-" "" "" "Unknown" "" "" "0" "" "" "g.197427766_197427767del" "" "pathogenic" "" "0000065686" "0" "90" "1" "197396896" "197396897" "del" "0" "01251" "CRB1_000128" "g.197396896_197396897del" "" "{PMID:Coppieters 2010:20683928}" "BsaWI+;HpaII+;LpnPI+;MspI+;AvrII-;BfaI-;BsaJI-;StyI-" "" "" "Unknown" "" "" "0" "" "" "g.197427766_197427767del" "" "pathogenic" "" "0000065687" "0" "90" "1" "197411296" "197411296" "subst" "0" "01251" "CRB1_000077" "g.197411296G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197442166G>A" "" "pathogenic" "" "0000065688" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065689" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065690" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065691" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065692" "0" "90" "1" "197326056" "197326056" "subst" "0.0000081213" "01251" "CRB1_000223" "g.197326056C>T" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197356926C>T" "" "pathogenic" "" "0000065693" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065694" "0" "70" "1" "197396584" "197396584" "subst" "0.0000122175" "01251" "CRB1_000004" "g.197396584A>T" "" "{PMID:Simpson 2011:21147909}" "-" "" "" "Germline" "" "" "0" "" "" "g.197427454A>T" "" "likely pathogenic" "" "0000065695" "0" "70" "1" "197396584" "197396584" "subst" "0.0000122175" "01251" "CRB1_000004" "g.197396584A>T" "" "{PMID:Simpson 2011:21147909}" "-" "" "" "Germline" "" "" "0" "" "" "g.197427454A>T" "" "likely pathogenic" "" "0000065696" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Avila-Fernandez 2010:21151602}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065697" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Avila-Fernandez 2010:21151602}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065698" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Avila-Fernandez 2010:21151602}" "-" "c.611_617delAAATAGG" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065699" "0" "70" "1" "197398583" "197398583" "subst" "0.000142177" "01251" "CRB1_000134" "g.197398583A>G" "" "{PMID:Avila-Fernandez 2010:21151602}" "AlwNI+;MwoI+;MmeI-" "" "" "Germline" "" "" "0" "" "" "g.197429453A>G" "" "likely pathogenic" "" "0000065700" "10" "90" "1" "197326097" "197326097" "subst" "0" "01251" "CRB1_000192" "g.197326097C>G" "" "{PMID:Zenteno 2011:21484995}" "BfaI+;BmtI+;Cac8I+;NheI+" "" "" "Germline" "" "" "0" "" "" "g.197356967C>G" "" "pathogenic" "" "0000065701" "10" "90" "1" "197326097" "197326097" "subst" "0" "01251" "CRB1_000192" "g.197326097C>G" "" "{PMID:Zenteno 2011:21484995}" "BfaI+;BmtI+;Cac8I+;NheI+" "" "" "Germline" "" "" "0" "" "" "g.197356967C>G" "" "pathogenic" "" "0000065702" "0" "70" "1" "197316487" "197316487" "subst" "0.000479235" "01251" "CRB1_000180" "g.197316487C>T" "" "{PMID:Li 2011:21602930}" "CviAII+;FatI+;NlaIII+;BsgI-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197347357C>T" "" "likely pathogenic" "" "0000065703" "3" "70" "1" "197390789" "197390789" "subst" "0.0000284567" "01251" "CRB1_000102" "g.197390789T>C" "" "{PMID:Li 2011:21602930}" "BslI+" "1834T>C; S611P" "" "Germline" "" "" "0" "" "" "g.197421659T>C" "" "likely pathogenic" "" "0000065704" "3" "70" "1" "197390789" "197390789" "subst" "0.0000284567" "01251" "CRB1_000102" "g.197390789T>C" "" "{PMID:Li 2011:21602930}" "BslI+" "1834T>C; S611P" "" "Germline" "" "" "0" "" "" "g.197421659T>C" "" "likely pathogenic" "" "0000065705" "0" "70" "1" "197390861" "197390861" "subst" "0" "01251" "CRB1_000106" "g.197390861T>C" "" "{PMID:Li 2011:21602930}" "BccI-;BtsCI-;FokI-" "1903T>C; S635P" "" "Germline" "" "" "0" "" "" "g.197421731T>C" "" "likely pathogenic" "" "0000065706" "0" "90" "1" "197391088" "197391088" "subst" "0" "01251" "CRB1_000229" "g.197391088T>G" "" "{PMID:Li 2011:21602930}" "-" "" "" "Germline" "" "" "0" "" "" "g.197421958T>G" "" "pathogenic" "" "0000065707" "0" "70" "1" "197396677" "197396677" "subst" "0.00000406934" "01251" "CRB1_000013" "g.197396677T>C" "" "{PMID:Li 2011:21602930}" "HpyCH4IV+;CviAII-;FatI-;NlaIII-" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427547T>C" "" "likely pathogenic" "" "0000065708" "0" "90" "1" "197404669" "197404669" "subst" "0.0000204062" "01251" "CRB1_000115" "g.197404669G>T" "" "{PMID:Li 2011:21602930}" "MluCI+;NlaIV-;XcmI-" "G1226X" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197435539G>T" "" "pathogenic" "" "0000065709" "0" "90" "1" "197411424" "197411424" "subst" "0" "01251" "CRB1_000094" "g.197411424T>G" "" "{PMID:Li 2011:21602930}" "-" "" "" "Germline" "" "" "0" "" "" "g.197442294T>G" "" "pathogenic" "" "0000065710" "0" "90" "1" "197404669" "197404669" "subst" "0.0000204062" "01251" "CRB1_000115" "g.197404669G>T" "" "{PMID:Li 2011:21602930}" "MluCI+;NlaIV-;XcmI-" "G1226X" "" "Germline" "" "" "0" "" "" "g.197435539G>T" "" "pathogenic" "" "0000065711" "0" "70" "1" "197404486" "197404486" "subst" "0.00000815867" "01251" "CRB1_000084" "g.197404486T>C" "" "{PMID:Li 2011:21602930}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435356T>C" "" "likely pathogenic" "" "0000065712" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065713" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065714" "0" "70" "1" "197298091" "197298093" "del" "0" "01251" "CRB1_000215" "g.197298091_197298093del" "" "{PMID:Aleman 2011:21757580}" "-" "p.Glu204del7" "" "Germline" "" "" "0" "" "" "g.197328961_197328963del" "" "likely pathogenic" "" "0000065715" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065716" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065717" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065718" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065719" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01251" "CRB1_000191" "g.197390691T>A" "" "{PMID:Aleman 2011:21757580}" "BcoDI+;BsaI+;BsmAI+;BspCNI+;DdeI+;Tsp45I-" "p.Val578Glu" "" "Germline" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000065720" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065721" "0" "70" "1" "197396697" "197396699" "del" "0" "01251" "CRB1_000117" "g.197396697_197396699del" "" "{PMID:Aleman 2011:21757580}" "BccI-" "p.Pro748del3" "" "Germline" "" "" "0" "" "" "g.197427567_197427569del" "" "likely pathogenic" "" "0000065722" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Aleman 2011:21757580}" "-" "p.Arg764Cys" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065723" "0" "70" "1" "197397010" "197397010" "subst" "0.00000406759" "01251" "CRB1_000168" "g.197397010T>C" "" "{PMID:Aleman 2011:21757580}" "CviQI+;RsaI+;BciVI-" "p.Ile852Thr" "" "Germline" "" "" "0" "" "" "g.197427880T>C" "" "likely pathogenic" "" "0000065724" "0" "70" "1" "197390387" "197390387" "subst" "0" "01251" "CRB1_000038" "g.197390387G>A" "" "{PMID:Aleman 2011:21757580}" "BstNI+;PspGI+;SexAI+;HpaII-;MspI-;NciI-" "p.Gly477Arg" "" "Germline" "" "" "0" "" "" "g.197421257G>A" "" "likely pathogenic" "" "0000065725" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01251" "CRB1_000191" "g.197390691T>A" "" "{PMID:Aleman 2011:21757580}" "BcoDI+;BsaI+;BsmAI+;BspCNI+;DdeI+;Tsp45I-" "p.Val578Glu" "" "Germline" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000065726" "0" "90" "1" "197297734" "197297735" "ins" "0" "01251" "CRB1_000067" "g.197297734_197297735insAA" "" "{PMID:Aleman 2011:21757580}" "AflII+;MseI+;SmlI+" "p.Cys85ins2" "" "Germline" "" "" "0" "" "" "g.197328604_197328605insAA" "" "pathogenic" "" "0000065727" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01251" "CRB1_000132" "g.197326120G>A" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys383Tyr" "" "Germline" "" "" "0" "" "" "g.197356990G>A" "" "likely pathogenic" "" "0000065728" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065729" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065730" "0" "70" "1" "197390387" "197390387" "subst" "0" "01251" "CRB1_000038" "g.197390387G>A" "" "{PMID:Aleman 2011:21757580}" "BstNI+;PspGI+;SexAI+;HpaII-;MspI-;NciI-" "p.Gly477Arg" "" "Germline" "" "" "0" "" "" "g.197421257G>A" "" "likely pathogenic" "" "0000065731" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Aleman 2011:21757580}" "BfaI+" "p.Lys801X" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065732" "3" "70" "1" "197404289" "197404289" "subst" "0" "01251" "CRB1_000098" "g.197404289C>A" "" "{PMID:Azam 2011:21987686}" "CviQI-;RsaI-" "" "" "Germline" "" "" "0" "" "" "g.197435159C>A" "" "likely pathogenic" "" "0000065733" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Bujakowska 2012:22065545}" "-" "" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065734" "0" "90" "1" "197390227" "197390227" "subst" "0" "01251" "CRB1_000149" "g.197390227C>A" "" "{PMID:Bujakowska 2012:22065545}" "BsrDI-" "c.1269C>A" "" "Germline" "" "" "0" "" "" "g.197421097C>A" "" "pathogenic" "" "0000065735" "0" "70" "1" "197390708" "197390708" "subst" "0" "01251" "CRB1_000196" "g.197390708G>T" "" "{PMID:Bujakowska 2012:22065545}" "Hpy99I-;TaqI-" "" "" "Germline" "" "" "0" "" "" "g.197421578G>T" "" "likely pathogenic" "" "0000065736" "0" "90" "1" "197390921" "197390921" "del" "0" "01251" "CRB1_000108" "g.197390921del" "" "{PMID:Bujakowska 2012:22065545}" "BsaJI-" "c.1963delC" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197421791del" "" "pathogenic" "" "0000065737" "3" "70" "1" "197396674" "197396674" "subst" "0" "01251" "CRB1_000203" "g.197396674C>T" "" "{PMID:Bujakowska 2012:22065545}" "EarI+;MboII+" "" "" "Germline" "" "" "0" "" "" "g.197427544C>T" "" "likely pathogenic" "" "0000065738" "0" "70" "1" "197396674" "197396674" "subst" "0" "01251" "CRB1_000203" "g.197396674C>T" "" "{PMID:Bujakowska 2012:22065545}" "EarI+;MboII+" "" "" "Germline" "" "" "0" "" "" "g.197427544C>T" "" "likely pathogenic" "" "0000065739" "0" "70" "1" "197396677" "197396677" "subst" "0.00000406934" "01251" "CRB1_000013" "g.197396677T>C" "" "{PMID:Bujakowska 2012:22065545}" "HpyCH4IV+;CviAII-;FatI-;NlaIII-" "" "" "Germline" "" "" "0" "" "" "g.197427547T>C" "" "likely pathogenic" "" "0000065740" "0" "70" "1" "197396677" "197396677" "subst" "0.00000406934" "01251" "CRB1_000013" "g.197396677T>C" "" "{PMID:Bujakowska 2012:22065545}" "HpyCH4IV+;CviAII-;FatI-;NlaIII-" "" "" "Germline" "" "" "0" "" "" "g.197427547T>C" "" "likely pathogenic" "" "0000065741" "0" "70" "1" "197396961" "197396961" "subst" "0.00019522" "01251" "CRB1_000026" "g.197396961C>A" "" "{PMID:Bujakowska 2012:22065545}" "LpnPI-" "" "" "Germline" "" "" "0" "" "" "g.197427831C>A" "" "likely pathogenic" "" "0000065742" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bujakowska 2012:22065545}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065743" "3" "90" "1" "197404652" "197404653" "delins" "0" "01251" "CRB1_000112" "g.197404652_197404653delinsA" "" "{PMID:Bujakowska 2012:22065545}" "HinfI-;HphI-;MlyI-;PleI-;Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197435522_197435523delinsA" "" "pathogenic" "" "0000065744" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bujakowska 2012:22065545}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065745" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bujakowska 2012:22065545}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065746" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bujakowska 2012:22065545}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065747" "0" "90" "1" "197411331" "197411331" "subst" "0.00000406128" "01251" "CRB1_000079" "g.197411331C>T" "" "{PMID:Siemiatkowska 2011:22128245}" "AlwI-" "" "" "Germline" "" "" "0" "" "" "g.197442201C>T" "" "pathogenic" "" "0000065748" "21" "70" "1" "197404214" "197404214" "subst" "0.0000122015" "01251" "CRB1_000096" "g.197404214T>C" "" "{PMID:Li 2011:22219627}" "BstBI+;TaqI+" "" "" "Germline" "" "" "0" "" "" "g.197435084T>C" "" "likely pathogenic" "" "0000065749" "21" "70" "1" "197404214" "197404214" "subst" "0.0000122015" "01251" "CRB1_000096" "g.197404214T>C" "" "{PMID:Li 2011:22219627}" "BstBI+;TaqI+" "" "" "Germline" "" "" "0" "" "" "g.197435084T>C" "" "likely pathogenic" "" "0000065750" "21" "70" "1" "197404214" "197404214" "subst" "0.0000122015" "01251" "CRB1_000096" "g.197404214T>C" "" "{PMID:Li 2011:22219627}" "BstBI+;TaqI+" "" "" "Germline" "" "" "0" "" "" "g.197435084T>C" "" "likely pathogenic" "" "0000065751" "0" "90" "1" "197396896" "197396897" "del" "0" "01251" "CRB1_000128" "g.197396896_197396897del" "" "{PMID:Coppieters 2012:22261762}" "BsaWI+;HpaII+;LpnPI+;MspI+;AvrII-;BfaI-;BsaJI-;StyI-" "" "" "Germline" "" "" "0" "" "" "g.197427766_197427767del" "" "pathogenic" "" "0000065752" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Strom 2012:22863181}" "BfaI+" "p.K801X" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065753" "0" "70" "1" "197397003" "197397003" "subst" "0.0000203346" "01251" "CRB1_000010" "g.197397003G>A" "" "{PMID:Paterson 2012:22876132}" "AluI+" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427873G>A" "" "likely pathogenic" "" "0000065754" "0" "70" "1" "197397003" "197397003" "subst" "0.0000203346" "01251" "CRB1_000010" "g.197397003G>A" "" "{PMID:Paterson 2012:22876132}" "AluI+" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427873G>A" "" "likely pathogenic" "" "0000065755" "0" "70" "1" "197396953" "197396953" "subst" "0" "01251" "CRB1_000164" "g.197396953G>A" "" "{PMID:Paun 2012:23077403}" "BccI+" "" "" "Germline" "" "" "0" "" "" "g.197427823G>A" "" "likely pathogenic" "" "0000065756" "3" "90" "1" "197390730" "197390733" "del" "0" "01251" "CRB1_000199" "g.197390730_197390733del" "" "{PMID:Jalkh 2014:23362850}" "BtgZI-;HpyCH4V-;NsiI-;SfaNI-" "c.1772_1775delGCAT" "" "Germline" "" "" "0" "" "" "g.197421600_197421603del" "" "pathogenic" "" "0000065757" "3" "90" "1" "197390730" "197390733" "del" "0" "01251" "CRB1_000199" "g.197390730_197390733del" "" "{PMID:Jalkh 2014:23362850}" "BtgZI-;HpyCH4V-;NsiI-;SfaNI-" "c.1772_1775delGCAT" "" "Germline" "" "" "0" "" "" "g.197421600_197421603del" "" "pathogenic" "" "0000065758" "21" "90" "1" "197390730" "197390733" "del" "0" "01251" "CRB1_000199" "g.197390730_197390733del" "" "{PMID:Jalkh 2014:23362850}" "BtgZI-;HpyCH4V-;NsiI-;SfaNI-" "c.1772_1775delGCAT" "" "Germline" "" "" "0" "" "" "g.197421600_197421603del" "" "pathogenic" "" "0000065759" "21" "90" "1" "197390730" "197390733" "del" "0" "01251" "CRB1_000199" "g.197390730_197390733del" "" "{PMID:Jalkh 2014:23362850}" "BtgZI-;HpyCH4V-;NsiI-;SfaNI-" "c.1772_1775delGCAT" "" "Germline" "" "" "0" "" "" "g.197421600_197421603del" "" "pathogenic" "" "0000065760" "21" "90" "1" "197390730" "197390733" "del" "0" "01251" "CRB1_000199" "g.197390730_197390733del" "" "{PMID:Jalkh 2014:23362850}" "BtgZI-;HpyCH4V-;NsiI-;SfaNI-" "c.1772_1775delGCAT" "" "Germline" "" "" "0" "" "" "g.197421600_197421603del" "" "pathogenic" "" "0000065761" "21" "90" "1" "197390730" "197390733" "del" "0" "01251" "CRB1_000199" "g.197390730_197390733del" "" "{PMID:Jalkh 2014:23362850}" "BtgZI-;HpyCH4V-;NsiI-;SfaNI-" "c.1772_1775delGCAT" "" "Germline" "" "" "0" "" "" "g.197421600_197421603del" "" "pathogenic" "" "0000065762" "21" "90" "1" "197390730" "197390733" "del" "0" "01251" "CRB1_000199" "g.197390730_197390733del" "" "{PMID:Jalkh 2014:23362850}" "BtgZI-;HpyCH4V-;NsiI-;SfaNI-" "c.1772_1775delGCAT" "" "Germline" "" "" "0" "" "" "g.197421600_197421603del" "" "pathogenic" "" "0000065763" "11" "90" "1" "197390730" "197390733" "del" "0" "01251" "CRB1_000199" "g.197390730_197390733del" "" "{PMID:Jalkh 2014:23362850}" "BtgZI-;HpyCH4V-;NsiI-;SfaNI-" "c.1772_1775delGCAT" "" "Germline" "" "" "0" "" "" "g.197421600_197421603del" "" "pathogenic" "" "0000065764" "0" "90" "1" "197297962" "197297962" "dup" "0" "01251" "CRB1_000209" "g.197297962dup" "" "{PMID:Corton 2013:23379534}" "-" "c.481dupG" "" "Germline" "" "" "0" "" "" "g.197328832dup" "" "pathogenic" "" "0000065765" "0" "90" "1" "197297962" "197297962" "dup" "0" "01251" "CRB1_000209" "g.197297962dup" "" "{PMID:Corton 2013:23379534}" "-" "c.481dupG" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197328832dup" "" "pathogenic" "" "0000065766" "0" "70" "1" "197297979" "197297987" "del" "0" "01251" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Corton 2013:23379534}" "MluCI-" "" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000065767" "0" "70" "1" "197297979" "197297987" "del" "0" "01251" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Corton 2013:23379534}" "MluCI-" "" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000065768" "0" "70" "1" "197297979" "197297987" "del" "0" "01251" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Corton 2013:23379534}" "MluCI-" "" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000065769" "0" "70" "1" "197297979" "197297987" "del" "0" "01251" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Corton 2013:23379534}" "MluCI-" "" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000065770" "0" "70" "1" "197297979" "197297987" "del" "0" "01251" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Corton 2013:23379534}" "MluCI-" "" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000065771" "0" "70" "1" "197297979" "197297987" "del" "0" "01251" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Corton 2013:23379534}" "MluCI-" "" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000065772" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Corton 2013:23379534}" "-" "c.613_629del" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065773" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Corton 2013:23379534}" "-" "c.613_629del" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065774" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Corton 2013:23379534}" "-" "c.613_629del" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065775" "0" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Corton 2013:23379534}" "-" "c.613_629del" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065776" "0" "70" "1" "197390562" "197390562" "subst" "0" "01251" "CRB1_000225" "g.197390562T>C" "" "{PMID:Corton 2013:23379534}" "HpaII+,MspI+;BpmI-" "" "" "Germline" "" "" "0" "" "" "g.197421432T>C" "" "likely pathogenic" "" "0000065777" "0" "70" "1" "197390648" "197390648" "subst" "0" "01251" "CRB1_000236" "g.197390648G>T" "" "{PMID:Corton 2013:23379534}" "AluI+;CviKI_1+;BccI-;BtgZI-" "" "" "Germline" "" "" "0" "" "" "g.197421518G>T" "" "likely pathogenic" "" "0000065778" "0" "70" "1" "197390648" "197390648" "subst" "0" "01251" "CRB1_000236" "g.197390648G>T" "" "{PMID:Corton 2013:23379534}" "AluI+;CviKI_1+;BccI-;BtgZI-" "" "" "Germline" "" "" "0" "" "" "g.197421518G>T" "" "likely pathogenic" "" "0000065779" "0" "70" "1" "197390648" "197390648" "subst" "0" "01251" "CRB1_000236" "g.197390648G>T" "" "{PMID:Corton 2013:23379534}" "AluI+;CviKI_1+;BccI-;BtgZI-" "" "" "Germline" "" "" "0" "" "" "g.197421518G>T" "" "likely pathogenic" "" "0000065780" "0" "70" "1" "197390660" "197390660" "subst" "0" "01251" "CRB1_000234" "g.197390660C>T" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197421530C>T" "" "likely pathogenic" "" "0000065781" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Corton 2013:23379534}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065782" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Corton 2013:23379534}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065783" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Corton 2013:23379534}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065784" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Corton 2013:23379534}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065785" "0" "70" "1" "197396700" "197396702" "del" "0" "01251" "CRB1_000055" "g.197396700_197396702del" "" "{PMID:Corton 2013:23379534}" "BssKI+;BstNI+;PspGI+;ScrFI+;StyD4I+;BccI-" "c.2244_2247delATC" "" "Germline" "" "" "0" "" "" "g.197427570_197427572del" "" "likely pathogenic" "" "0000065786" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065787" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065788" "0" "70" "1" "197396746" "197396746" "subst" "0.0000122099" "01251" "CRB1_000061" "g.197396746G>A" "" "{PMID:Corton 2013:23379534}" "CviAII+;FatI+;NlaIII+" "" "" "Germline" "" "" "0" "" "" "g.197427616G>A" "" "likely pathogenic" "" "0000065789" "0" "70" "1" "197396764" "197396764" "subst" "0" "01251" "CRB1_000122" "g.197396764G>T" "" "{PMID:Corton 2013:23379534}" "HgaI+;Hpy188I+;AciI-;Fnu4HI-" "" "" "Germline" "" "" "0" "" "" "g.197427634G>T" "" "likely pathogenic" "" "0000065790" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Corton 2013:23379534}" "BfaI+" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065791" "0" "90" "1" "197396920" "197396920" "subst" "0" "01251" "CRB1_000130" "g.197396920G>A" "" "{PMID:Corton 2013:23379534}" "SnaBI+" "" "" "Germline" "" "" "0" "" "" "g.197427790G>A" "" "pathogenic" "" "0000065792" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Corton 2013:23379534}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065793" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Corton 2013:23379534}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065794" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065795" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065796" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065797" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065798" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065799" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065800" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065801" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065802" "0" "70" "1" "197403995" "197403995" "subst" "0" "01251" "CRB1_000158" "g.197403995T>A" "" "{PMID:Corton 2013:23379534}" "SspI-" "" "" "Germline" "" "" "0" "" "" "g.197434865T>A" "" "likely pathogenic" "" "0000065803" "0" "90" "1" "197404145" "197404145" "subst" "0" "01251" "CRB1_000173" "g.197404145G>A" "" "{PMID:Corton 2013:23379534}" "BslI-" "" "" "Germline" "" "" "0" "" "" "g.197435015G>A" "" "pathogenic" "" "0000065804" "0" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000065805" "0" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000065806" "0" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000065807" "0" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000065808" "0" "70" "1" "197407807" "197407807" "dup" "0" "01251" "CRB1_000076" "g.197407807dup" "" "{PMID:Corton 2013:23379534}" "-" "c.3878+2insT" "" "Germline" "" "" "0" "" "" "g.197438677dup" "" "likely pathogenic" "" "0000065809" "10" "90" "1" "197397012" "197397012" "subst" "0" "01251" "CRB1_000169" "g.197397012C>T" "" "{PMID:Jonsson 2013:23443024}, {PMID:Jonsson 2014:24664696}" "DdeI+;BciVI-" "" "" "Germline" "" "" "0" "" "" "g.197427882C>T" "" "pathogenic" "" "0000065810" "10" "90" "1" "197397012" "197397012" "subst" "0" "01251" "CRB1_000169" "g.197397012C>T" "" "{PMID:Jonsson 2013:23443024}, {PMID:Jonsson 2014:24664696}" "DdeI+;BciVI-" "" "" "Germline" "" "" "0" "" "" "g.197427882C>T" "" "pathogenic" "" "0000065811" "10" "90" "1" "197397012" "197397012" "subst" "0" "01251" "CRB1_000169" "g.197397012C>T" "" "{PMID:Jonsson 2013:23443024}, {PMID:Jonsson 2014:24664696}" "DdeI+;BciVI-" "" "" "Germline" "" "" "0" "" "" "g.197427882C>T" "" "pathogenic" "" "0000065812" "10" "90" "1" "197397012" "197397012" "subst" "0" "01251" "CRB1_000169" "g.197397012C>T" "" "{PMID:Jonsson 2013:23443024}, {PMID:Jonsson 2014:24664696}" "DdeI+;BciVI-" "" "" "Germline" "" "" "0" "" "" "g.197427882C>T" "" "pathogenic" "" "0000065813" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01251" "CRB1_000191" "g.197390691T>A" "" "{PMID:Beryozkin 2013:23449718}" "BcoDI+;BsaI+;BsmAI+;BspCNI+;DdeI+;Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000065814" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01251" "CRB1_000191" "g.197390691T>A" "" "{PMID:Beryozkin 2013:23449718}" "BcoDI+;BsaI+;BsmAI+;BspCNI+;DdeI+;Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000065815" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01251" "CRB1_000191" "g.197390691T>A" "" "{PMID:Beryozkin 2013:23449718}" "BcoDI+;BsaI+;BsmAI+;BspCNI+;DdeI+;Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000065816" "0" "70" "1" "197390802" "197390802" "subst" "0" "01251" "CRB1_000105" "g.197390802G>T" "" "{PMID:Beryozkin 2013:23449718}" "Hpy166II-" "c.1846G>T" "" "Germline" "" "" "0" "" "" "g.197421672G>T" "" "likely pathogenic" "" "0000065817" "0" "70" "1" "197390802" "197390802" "subst" "0" "01251" "CRB1_000105" "g.197390802G>T" "" "{PMID:Beryozkin 2013:23449718}" "Hpy166II-" "c.1846G>T" "" "Germline" "" "" "0" "" "" "g.197421672G>T" "" "likely pathogenic" "" "0000065818" "0" "70" "1" "197390802" "197390802" "subst" "0" "01251" "CRB1_000105" "g.197390802G>T" "" "{PMID:Beryozkin 2013:23449718}" "Hpy166II-" "c.1846G>T" "" "Germline" "" "" "0" "" "" "g.197421672G>T" "" "likely pathogenic" "" "0000065819" "0" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Beryozkin 2013:23449718}" "BspCNI-;DdeI-" "c.4121_4130del10" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000065820" "0" "70" "1" "197390802" "197390802" "subst" "0" "01251" "CRB1_000105" "g.197390802G>T" "" "{PMID:Beryozkin 2013:23449718}" "Hpy166II-" "c.1846G>T" "" "Germline" "" "" "0" "" "" "g.197421672G>T" "" "likely pathogenic" "" "0000065821" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Beryozkin 2013:23449718}" "BsmI+" "c.2236C>T" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065822" "0" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000065823" "0" "70" "1" "197396953" "197396953" "subst" "0" "01251" "CRB1_000164" "g.197396953G>A" "" "{PMID:Beryozkin 2013:23449718}" "BccI+" "" "" "Germline" "" "" "0" "" "" "g.197427823G>A" "" "likely pathogenic" "" "0000065824" "0" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000065825" "0" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000065826" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01251" "CRB1_000132" "g.197326120G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197356990G>A" "" "likely pathogenic" "" "0000065827" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01251" "CRB1_000132" "g.197326120G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197356990G>A" "" "likely pathogenic" "" "0000065828" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01251" "CRB1_000132" "g.197326120G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197356990G>A" "" "likely pathogenic" "" "0000065829" "0" "70" "1" "197297936" "197297936" "subst" "0" "01251" "CRB1_000218" "g.197297936G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197328806G>A" "" "likely pathogenic" "" "0000065830" "0" "70" "1" "197396953" "197396953" "subst" "0" "01251" "CRB1_000164" "g.197396953G>A" "" "{PMID:Beryozkin 2013:23449718}" "BccI+" "" "" "Germline" "" "" "0" "" "" "g.197427823G>A" "" "likely pathogenic" "" "0000065831" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01251" "CRB1_000132" "g.197326120G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197356990G>A" "" "likely pathogenic" "" "0000065832" "0" "90" "1" "197297905" "197297905" "subst" "0" "01251" "CRB1_000070" "g.197297905G>T" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197328775G>T" "" "pathogenic" "" "0000065833" "0" "90" "1" "197390800" "197390800" "del" "0" "01251" "CRB1_000104" "g.197390800del" "" "{PMID:Beryozkin 2013:23449718}" "BslI" "c.1842delT, (p.Gly614Glyfs*6)" "" "Germline" "" "" "0" "" "" "g.197421670del" "" "pathogenic" "" "0000065834" "10" "70" "1" "197396746" "197396746" "subst" "0.0000122099" "01251" "CRB1_000061" "g.197396746G>A" "" "{PMID:Tiab 2013:23592920}" "CviAII+;FatI+;NlaIII+" "" "" "Germline" "" "" "0" "" "" "g.197427616G>A" "" "likely pathogenic" "" "0000065835" "10" "70" "1" "197390799" "197390799" "subst" "0.000020326" "01251" "CRB1_000103" "g.197390799G>T" "" "{PMID:Chen 2013:23661368}" "-" "" "" "Germline" "" "" "0" "" "" "g.197421669G>T" "" "likely pathogenic" "" "0000065836" "10" "70" "1" "197390799" "197390799" "subst" "0.000020326" "01251" "CRB1_000103" "g.197390799G>T" "" "{PMID:Chen 2013:23661368}" "-" "" "" "Germline" "" "" "0" "" "" "g.197421669G>T" "" "likely pathogenic" "" "0000065837" "3" "70" "1" "197297561" "197297561" "subst" "0.00000406981" "01251" "CRB1_000063" "g.197297561G>T" "" "{PMID:Khan 2013:23767994}" "HpyCH4V-" "" "" "Germline" "" "" "0" "" "" "g.197328431G>T" "" "likely pathogenic" "" "0000065838" "3" "70" "1" "197297561" "197297561" "subst" "0.00000406981" "01251" "CRB1_000063" "g.197297561G>T" "" "{PMID:Khan 2013:23767994}" "HpyCH4V-" "" "" "Germline" "" "" "0" "" "" "g.197328431G>T" "" "likely pathogenic" "" "0000065839" "3" "70" "1" "197297561" "197297561" "subst" "0.00000406981" "01251" "CRB1_000063" "g.197297561G>T" "" "{PMID:Khan 2013:23767994}" "HpyCH4V-" "" "" "Germline" "" "" "0" "" "" "g.197328431G>T" "" "likely pathogenic" "" "0000065840" "21" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Cordovez 2013:24512366}" "-" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065841" "0" "90" "1" "197446793" "197446793" "subst" "0.00000407594" "01251" "CRB1_000181" "g.197446793G>A" "" "{PMID:Cordovez 2013:24512366}" "-" "" "" "Germline" "" "" "0" "" "" "g.197477663G>A" "" "pathogenic" "" "0000065842" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Cordovez 2013:24512366}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065843" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Cordovez 2013:24512366}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065849" "0" "70" "1" "197404481" "197404481" "subst" "0.0000163207" "01251" "CRB1_000083" "g.197404481G>T" "" "{PMID:Li 2014:24535598}" "BsrDI-" "" "" "Germline" "" "" "0" "" "" "g.197435351G>T" "" "likely pathogenic" "" "0000065850" "0" "90" "1" "197297619" "197297619" "del" "0" "01251" "CRB1_000066" "g.197297619del" "" "{PMID:Li 2014:24535598}" "-" "c.[136delA]" "" "Germline" "" "" "0" "" "" "g.197328489del" "" "pathogenic" "" "0000065851" "0" "70" "1" "197396677" "197396677" "subst" "0.00000406934" "01251" "CRB1_000013" "g.197396677T>C" "" "{PMID:Li 2014:24535598}" "HpyCH4IV+;CviAII-;FatI-;NlaIII-" "" "" "Germline" "" "" "0" "" "" "g.197427547T>C" "" "likely pathogenic" "" "0000065852" "0" "70" "1" "197404010" "197404010" "subst" "0" "01251" "CRB1_000160" "g.197404010C>A" "" "{PMID:Li 2014:24535598}" "FspEI-;HinfI-;LpnPI-;TfiI-" "" "" "Germline" "" "" "0" "" "" "g.197434880C>A" "" "likely pathogenic" "" "0000065853" "0" "70" "1" "197390799" "197390799" "subst" "0.000020326" "01251" "CRB1_000103" "g.197390799G>T" "" "{PMID:Li 2014:24535598}" "-" "" "" "Germline" "" "" "0" "" "" "g.197421669G>T" "" "likely pathogenic" "" "0000065854" "0" "70" "1" "197390799" "197390799" "subst" "0.000020326" "01251" "CRB1_000103" "g.197390799G>T" "" "{PMID:Li 2014:24535598}" "-" "" "" "Germline" "" "" "0" "" "" "g.197421669G>T" "" "likely pathogenic" "" "0000065855" "0" "70" "1" "197397126" "197397126" "subst" "0" "01251" "CRB1_000171" "g.197397126T>G" "" "{PMID:Li 2014:24535598}" "AciI+;AluI-;ApeKI-;BbvI-;HpyCH4V-;PvuII-;TseI-" "" "" "Germline" "" "" "0" "" "" "g.197427996T>G" "" "likely pathogenic" "" "0000065856" "3" "70" "1" "197404435" "197404435" "subst" "0" "01251" "CRB1_000074" "g.197404435T>C" "" "{PMID:Jinda 2014:24618324}" "LpnPI-" "" "" "Germline" "" "" "0" "" "" "g.197435305T>C" "" "likely pathogenic (recessive)" "" "0000065857" "3" "70" "1" "197396994" "197396994" "subst" "0" "01251" "CRB1_000166" "g.197396994T>A" "" "{PMID:Jinda 2014:24618324}" "-" "" "" "Germline" "" "" "0" "" "" "g.197427864T>A" "" "likely pathogenic" "" "0000065858" "0" "70" "1" "197404453" "197404453" "subst" "0" "01251" "CRB1_000078" "g.197404453T>A" "" "{PMID:Yang 2014:24715753}" "TspRI+" "" "" "Germline" "" "" "0" "" "" "g.197435323T>A" "" "likely pathogenic" "" "0000065859" "0" "70" "1" "197404453" "197404453" "subst" "0" "01251" "CRB1_000078" "g.197404453T>A" "" "{PMID:Yang 2014:24715753}" "TspRI+" "" "" "Germline" "" "" "0" "" "" "g.197435323T>A" "" "likely pathogenic" "" "0000065860" "0" "70" "1" "197404453" "197404453" "subst" "0" "01251" "CRB1_000078" "g.197404453T>A" "" "{PMID:Yang 2014:24715753}" "TspRI+" "" "" "Germline" "" "" "0" "" "" "g.197435323T>A" "" "likely pathogenic" "" "0000065861" "0" "70" "1" "197390789" "197390789" "subst" "0.0000284567" "01251" "CRB1_000102" "g.197390789T>C" "" "{PMID:Yang 2014:24715753}" "BslI+" "" "" "Germline" "" "" "0" "" "" "g.197421659T>C" "" "likely pathogenic" "" "0000065862" "0" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "01251" "CRB1_000017" "g.197390534C>T" "" "{PMID:Yang 2014:24715753}" "AcuI+" "" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "" "0000065863" "0" "70" "1" "197390387" "197390387" "subst" "0" "01251" "CRB1_000038" "g.197390387G>A" "" "{PMID:Yang 2014:24715753}" "BstNI+;PspGI+;SexAI+;HpaII-;MspI-;NciI-" "" "" "Germline" "" "" "0" "" "" "g.197421257G>A" "" "likely pathogenic" "" "0000065864" "11" "70" "1" "197411408" "197411408" "subst" "0.00002031" "01251" "CRB1_000051" "g.197411408C>T" "" "{PMID:Tsang 2014:24811962}" "AfeI-;HaeII-;HhaI-;HinP1I-" "R1331C" "" "Germline" "" "" "0" "" "" "g.197442278C>T" "" "likely pathogenic" "" "0000065865" "11" "70" "1" "197411408" "197411408" "subst" "0.00002031" "01251" "CRB1_000051" "g.197411408C>T" "" "{PMID:Tsang 2014:24811962}" "AfeI-;HaeII-;HhaI-;HinP1I-" "R1331C" "" "Germline" "" "" "0" "" "" "g.197442278C>T" "" "likely pathogenic" "" "0000065866" "0" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "01251" "CRB1_000017" "g.197390534C>T" "" "{PMID:Watson 2014:25133751}" "AcuI+" "" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "" "0000065867" "3" "90" "1" "197398734" "197398767" "del" "0" "01251" "CRB1_000039" "g.197398734_197398767del" "" "{PMID:Watson 2014:25133751}" "-" "" "" "Germline" "" "" "0" "" "" "g.197429604_197429637del" "" "pathogenic" "" "0000065868" "3" "90" "1" "197398734" "197398767" "del" "0" "01251" "CRB1_000039" "g.197398734_197398767del" "" "{PMID:Watson 2014:25133751}" "-" "" "" "Germline" "" "" "0" "" "" "g.197429604_197429637del" "" "pathogenic" "" "0000065869" "10" "90" "1" "197404472" "197404472" "del" "0" "01251" "CRB1_000080" "g.197404472del" "" "{PMID:Luhmann 2014:25147295}" "MspJI-" "c.3481delC" "mouse model" "Germline" "" "" "0" "" "" "g.197435342del" "" "pathogenic" "" "0000065870" "0" "90" "1" "197298136" "197298139" "del" "0" "01251" "CRB1_000179" "g.197298136_197298139del" "" "{PMID:Kuniyoshi 2015:25323024}" "-" "c.652+1_652+4delGTAA" "" "Germline" "" "" "0" "" "" "g.197329006_197329009del" "" "pathogenic" "" "0000065871" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sánchez-Alcudia 2014:25342620}" "-" "p.C948Y" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065872" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sánchez-Alcudia 2014:25342620}" "-" "p.C948Y" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065873" "1" "90" "1" "197396921" "197396921" "subst" "0" "01251" "CRB1_000131" "g.197396921G>A" "" "{PMID:Sánchez-Alcudia 2014:25342620}" "-" "p.W822*" "ABCA4 p.Asn1805Asp (heterozygous)" "Germline" "" "" "0" "" "" "g.197427791G>A" "" "pathogenic" "" "0000065874" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sánchez-Alcudia 2014:25342620}" "-" "p.C948Y" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065875" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sánchez-Alcudia 2014:25342620}" "-" "p.C948Y" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065876" "3" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Sánchez-Alcudia 2014:25342620}" "-" "p.I1100T" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000065877" "3" "70" "1" "197403995" "197403995" "subst" "0" "01251" "CRB1_000158" "g.197403995T>A" "" "{PMID:Sánchez-Alcudia 2014:25342620}" "SspI-" "p.I1001N" "" "Germline" "" "" "0" "" "" "g.197434865T>A" "" "likely pathogenic" "" "0000065878" "3" "70" "1" "197403995" "197403995" "subst" "0" "01251" "CRB1_000158" "g.197403995T>A" "" "{PMID:Sánchez-Alcudia 2014:25342620}" "SspI-" "p.I1001N" "" "Germline" "" "" "0" "" "" "g.197434865T>A" "" "likely pathogenic" "" "0000065879" "3" "70" "1" "197403995" "197403995" "subst" "0" "01251" "CRB1_000158" "g.197403995T>A" "" "{PMID:Sánchez-Alcudia 2014:25342620}" "SspI-" "p.I1001N" "" "Germline" "" "" "0" "" "" "g.197434865T>A" "" "likely pathogenic" "" "0000065880" "3" "70" "1" "197404475" "197404475" "subst" "0.00000407857" "01251" "CRB1_000082" "g.197404475A>G" "" "{PMID:Sánchez-Alcudia 2014:25342620}" "-" "p.Y1161C" "" "Germline" "" "" "0" "" "" "g.197435345A>G" "" "likely pathogenic" "" "0000065881" "11" "70" "1" "197411409" "197411409" "subst" "0.00149476" "01251" "CRB1_000041" "g.197411409G>A" "" "{PMID:Zernant 2005:16123401}" "" "CRB1 R1331H" "unknown variant 2nd chromosome; not in 200 controls; modifier allele with AIPL1:R302L" "Germline" "" "" "0" "" "" "g.197442279G>A" "" "likely pathogenic" "" "0000065882" "0" "70" "1" "197404115" "197404115" "subst" "0.0000122034" "01251" "CRB1_000163" "g.197404115T>C" "" "{PMID:Booij 2011:20801516}" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197434985T>C" "" "likely pathogenic" "" "0000065883" "0" "70" "1" "197298095" "197298095" "subst" "0.000591041" "01251" "CRB1_000002" "g.197298095T>C" "" "{PMID:Booij 2011:20801516}" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197328965T>C" "" "likely pathogenic" "" "0000065884" "0" "70" "1" "197411409" "197411409" "subst" "0.00149476" "01251" "CRB1_000041" "g.197411409G>A" "" "{PMID:Booij 2011:20801516}" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197442279G>A" "" "likely pathogenic" "" "0000065885" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Booij 2011:20801516}" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065886" "0" "70" "1" "197398749" "197398749" "subst" "0.0000325529" "01251" "CRB1_000034" "g.197398749G>A" "" "{PMID:Booij 2011:20801516}" "" "" "" "Germline" "" "" "0" "" "" "g.197429619G>A" "" "likely pathogenic" "" "0000065887" "0" "70" "1" "197397003" "197397003" "subst" "0.0000203346" "01251" "CRB1_000010" "g.197397003G>A" "" "{PMID:Paterson 2012:22876132}" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427873G>A" "" "likely pathogenic" "" "0000065888" "0" "70" "1" "197397003" "197397003" "subst" "0.0000203346" "01251" "CRB1_000010" "g.197397003G>A" "" "{PMID:Paterson 2012:22876132}" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427873G>A" "" "likely pathogenic" "" "0000065889" "10" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:González-del Pozo 2011:22164218}" "" "" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065890" "0" "90" "1" "197396896" "197396897" "del" "0" "01251" "CRB1_000128" "g.197396896_197396897del" "" "{PMID:Coppieters 2012:22261762}" "" "" "" "Germline" "" "" "0" "" "" "g.197427766_197427767del" "" "pathogenic" "" "0000065891" "1" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Anasagasti 2013:24416769}" "" "CRB1 p.Thr126Met" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065892" "1" "50" "1" "197298112" "197298112" "subst" "0" "01251" "CRB1_000177" "g.197298112A>T" "0.01" "{PMID:Anasagasti 2013:24416769}" "" "CRB1 p.Ile211Phe" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197328982A>T" "" "VUS" "" "0000065893" "1" "30" "1" "197398571" "197398571" "subst" "0.00214943" "01251" "CRB1_000172" "g.197398571C>T" "0.01" "{PMID:Anasagasti 2013:24416769}" "" "CRB1 c.820-8C>T" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197429441C>T" "" "likely benign" "" "0000065894" "10" "70" "1" "197297561" "197297561" "subst" "0.00000406981" "01251" "CRB1_000063" "g.197297561G>T" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197328431G>T" "" "likely pathogenic" "" "0000065895" "10" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065896" "10" "70" "1" "197404488" "197404488" "subst" "0" "01251" "CRB1_000037" "g.197404488T>G" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197435358T>G" "" "likely pathogenic" "" "0000065897" "10" "70" "1" "197404488" "197404488" "subst" "0" "01251" "CRB1_000037" "g.197404488T>G" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197435358T>G" "" "likely pathogenic" "" "0000065898" "10" "70" "1" "197297561" "197297561" "subst" "0.00000406981" "01251" "CRB1_000063" "g.197297561G>T" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197328431G>T" "" "likely pathogenic" "" "0000065899" "10" "90" "1" "197390982" "197390982" "subst" "0" "01251" "CRB1_000227" "g.197390982G>A" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197421852G>A" "" "pathogenic" "" "0000065900" "10" "70" "1" "197390387" "197390387" "subst" "0" "01251" "CRB1_000038" "g.197390387G>A" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197421257G>A" "" "likely pathogenic" "" "0000065901" "0" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "01251" "CRB1_000017" "g.197390534C>T" "" "{PMID:Chen 2013:23462753}" "" "" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "" "0000065902" "10" "70" "1" "197390417" "197390417" "subst" "0" "01251" "CRB1_000201" "g.197390417T>C" "" "{PMID:Eisenberger 2013:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.197421287T>C" "" "likely pathogenic" "" "0000065903" "0" "70" "1" "197391000" "197391000" "subst" "0.00000406732" "01251" "CRB1_000020" "g.197391000G>A" "" "{PMID:Eisenberger 2013:23591405}" "" "c.2042G>A p.Cys681Tyr" "" "Germline" "" "" "0" "" "" "g.197421870G>A" "" "likely pathogenic" "" "0000065904" "0" "70" "1" "197396822" "197396822" "subst" "0" "01251" "CRB1_000124" "g.197396822T>A" "" "{PMID:Eisenberger 2013:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.197427692T>A" "" "likely pathogenic" "" "0000065905" "10" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Glockle 2013:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065906" "10" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Glockle 2013:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065907" "0" "90" "1" "197297987" "197297987" "del" "0" "01251" "CRB1_000212" "g.197297987del" "" "{PMID:Glockle 2013:23591405}" "" "G169VfsX37" "" "Germline" "" "" "0" "" "" "g.197328857del" "" "pathogenic" "" "0000065908" "10" "70" "1" "197396703" "197396703" "subst" "0" "01251" "CRB1_000056" "g.197396703G>A" "" "{PMID:Glockle 2013:23591405}" "" "c.2248G>A, p.G750S" "" "Germline" "" "" "0" "" "" "g.197427573G>A" "" "likely pathogenic" "" "0000065909" "0" "70" "1" "197396943" "197396943" "subst" "0.0000772791" "01251" "CRB1_000042" "g.197396943A>T" "" "{PMID:Glöckle 2014:23591405}" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.197427813A>T" "" "likely pathogenic" "" "0000065910" "10" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Wang 2013:23847139}" "" "c.610_616del, p.I205DfsX133" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000065911" "0" "70" "1" "197390396" "197390396" "subst" "0.00000812255" "01251" "CRB1_000195" "g.197390396T>C" "" "{PMID:Wang 2013:23847139}" "" "" "" "Germline" "" "" "0" "" "" "g.197421266T>C" "" "likely pathogenic" "" "0000065912" "10" "90" "1" "197411413" "197411413" "subst" "0" "01251" "CRB1_000054" "g.197411413C>A" "" "{PMID:Wang 2013:23847139}" "" "c.3996C>A, p.C1332X" "" "Germline" "" "" "0" "" "" "g.197442283C>A" "" "pathogenic" "" "0000065913" "10" "90" "1" "197316605" "197316605" "subst" "0" "01251" "CRB1_000220" "g.197316605G>A" "" "{PMID:Wang 2013:23847139}" "" "" "" "Germline" "" "" "0" "" "" "g.197347475G>A" "" "pathogenic" "" "0000065914" "10" "90" "1" "197404680" "197404680" "subst" "0" "01251" "CRB1_000189" "g.197404680C>A" "" "{PMID:Wang 2013:23847139}" "" "G1229X" "" "Germline" "" "" "0" "" "" "g.197435550C>A" "" "pathogenic" "" "0000065915" "10" "90" "1" "197390397" "197390397" "subst" "0.00000812249" "01251" "CRB1_000198" "g.197390397G>C" "" "{PMID:Wang 2013:23847139}" "" "" "" "Germline" "" "" "0" "" "" "g.197421267G>C" "" "pathogenic" "" "0000065916" "0" "70" "1" "197396935" "197396935" "subst" "0" "01251" "CRB1_000205" "g.197396935G>A" "" "{PMID:Huang 2014:25356976}" "" "" "" "Germline" "" "" "0" "" "" "g.197427805G>A" "" "likely pathogenic" "" "0000065917" "10" "90" "1" "197404669" "197404669" "subst" "0.0000204062" "01251" "CRB1_000115" "g.197404669G>T" "" "{PMID:Huang 2014:25356976}" "" "G1226X" "" "Germline" "" "" "0" "" "" "g.197435539G>T" "" "pathogenic" "" "0000065918" "0" "70" "1" "197297936" "197297936" "subst" "0" "01251" "CRB1_000218" "g.197297936G>A" "" "{PMID:Huang 2014:25356976}" "" "" "" "Germline" "" "" "0" "" "" "g.197328806G>A" "" "likely pathogenic" "" "0000065919" "0" "70" "1" "197390799" "197390799" "subst" "0.000020326" "01251" "CRB1_000103" "g.197390799G>T" "" "{PMID:Huang 2014:25356976}" "" "" "" "Germline" "" "" "0" "" "" "g.197421669G>T" "" "likely pathogenic" "" "0000065920" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01251" "CRB1_000132" "g.197326120G>A" "" "{PMID:Huang 2014:25356976}" "" "" "" "Germline" "" "" "0" "" "" "g.197356990G>A" "" "likely pathogenic" "" "0000065921" "10" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "01251" "CRB1_000017" "g.197390534C>T" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "" "0000065922" "0" "70" "1" "197398613" "197398613" "subst" "0" "01251" "CRB1_000137" "g.197398613C>G" "" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.197429483C>G" "" "likely pathogenic" "" "0000065923" "0" "90" "1" "197297963" "197297963" "subst" "0" "01251" "CRB1_000210" "g.197297963C>T" "" "{PMID:den Hollander 1999:10508521}" "BceAI-;HaeIII-;NlaIV-;Sau96I-" "617C>T" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197328833C>T" "" "pathogenic" "" "0000065924" "0" "90" "1" "197313508" "197313508" "subst" "0.00000409031" "01251" "CRB1_000009" "g.197313508T>G" "" "{PMID:den Hollander 1999:10508521}" "ApaI+;BanII+;BmrI+;BsrI+;PspOMI+;HpyCH4III-" "885T>G" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197344378T>G" "" "pathogenic" "" "0000065925" "0" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:den Hollander 1999:10508521}" "Hpy188III+" "2425C>T" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "" "0000065926" "0" "90" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:den Hollander 1999:10508521}" "BsmI+" "2369C>T" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "pathogenic" "" "0000065927" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:den Hollander 1999:10508521}" "-" "2978G>A" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065928" "0" "90" "1" "197403976" "197403976" "subst" "0" "01251" "CRB1_000157" "g.197403976G>T" "" "{PMID:den Hollander 1999:10508521}" "-" "3118G>T" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197434846G>T" "" "pathogenic" "" "0000065929" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:den Hollander 1999:10508521}" "-" "2978G>A" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065930" "0" "90" "1" "197404205" "197404205" "subst" "0.00000406626" "01251" "CRB1_000095" "g.197404205T>C" "" "{PMID:den Hollander 1999:10508521}" "MnlI-" "3347T>C" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197435075T>C" "" "pathogenic" "" "0000065931" "0" "70" "1" "197390368" "197390368" "subst" "0" "01251" "CRB1_000153" "g.197390368G>A" "1/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Leu470Leu" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.197421238G>A" "" "likely pathogenic" "" "0000065932" "0" "70" "1" "197390396" "197390396" "subst" "0.00000812255" "01251" "CRB1_000195" "g.197390396T>C" "1/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Cys480Arg" "" "Germline" "" "" "0" "" "" "g.197421266T>C" "" "likely pathogenic" "" "0000065933" "0" "90" "1" "197397068" "197397068" "dup" "0" "01251" "CRB1_000170" "g.197397068dup" "1/190 cases" "{PMID:Lotery 2001:11231775}" "MfeI+;MluCI+;NsiI-" "1 bp ins T 871" "" "Germline" "" "" "0" "" "" "g.197427938dup" "" "pathogenic" "" "0000065934" "0" "70" "1" "197391000" "197391000" "subst" "0.00000406732" "01251" "CRB1_000020" "g.197391000G>A" "1/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Cys681Tyr" "" "Germline" "" "" "0" "" "" "g.197421870G>A" "" "likely pathogenic" "" "0000065935" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "2/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Arg764Cys" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065936" "0" "90" "1" "197297738" "197297739" "dup" "0" "01251" "CRB1_000068" "g.197297738_197297739dup" "1/190 cases" "{PMID:Lotery 2001:11231775}" "-" "2 bp ins codon 86-87" "" "Germline" "" "" "0" "" "" "g.197328608_197328609dup" "" "pathogenic" "" "0000065937" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "7/190 cases" "{PMID:Lotery 2001:11231775}" "-" "Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065938" "0" "70" "1" "197390396" "197390396" "subst" "0" "01251" "CRB1_000155" "g.197390396T>G" "1/190 cases" "{PMID:Lotery 2001:11231775}" "BsaJI+;BstNI+;HphI+;PspGI+" "Cys480Gly" "" "Germline" "" "" "0" "" "" "g.197421266T>G" "" "likely pathogenic" "" "0000065939" "20" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Hollander 2001:11389483}" "-" "2978G->A" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065940" "0" "90" "1" "197411414" "197411414" "subst" "0" "01251" "CRB1_000088" "g.197411414G>T" "" "{PMID:Hollander 2001:11389483}" "BfaI+;MnlI-" "4132G->T" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197442284G>T" "" "pathogenic" "" "0000065941" "0" "90" "1" "197411414" "197411414" "subst" "0" "01251" "CRB1_000088" "g.197411414G>T" "" "{PMID:Hollander 2001:11389483}" "BfaI+;MnlI-" "4132G->T" "" "Germline" "" "" "0" "" "" "g.197442284G>T" "" "pathogenic" "" "0000065942" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Hollander 2001:11389483}" "BfaI+" "2536A->T" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065943" "0" "90" "1" "197407806" "197407806" "subst" "0" "01251" "CRB1_000075" "g.197407806G>T" "" "{PMID:Hollander 2001:11389483}" "DraI+;XmnI-" "4013+1G->T" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197438676G>T" "" "pathogenic" "" "0000065944" "20" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Hollander 2001:11389483}" "-" "2978G->A" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065945" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Hollander 2001:11389483}" "BfaI+" "2536A->T" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065946" "1" "90" "1" "197390256" "197390256" "subst" "0.00000406194" "01251" "CRB1_000150" "g.197390256A>G" "" "{PMID:Hollander 2001:11389483}" "Hpy188III+" "1433A->G" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197421126A>G" "" "pathogenic" "" "0000065947" "21" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Hollander 2001:11389483}" "-" "2425C->T" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "" "0000065948" "1" "90" "1" "197390256" "197390256" "subst" "0.00000406194" "01251" "CRB1_000150" "g.197390256A>G" "" "{PMID:Hollander 2001:11389483}" "Hpy188III+" "1433A->G" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197421126A>G" "" "pathogenic" "" "0000065949" "21" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Hollander 2001:11389483}" "-" "2425C->T" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "" "0000065950" "21" "90" "1" "197446868" "197446868" "subst" "0" "01251" "CRB1_000185" "g.197446868G>A" "" "{PMID:Hollander 2001:11389483}" "MnlI+;LpnPI-;BsrI+;Cac8I-" "4195G->A" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197477738G>A" "" "pathogenic" "" "0000065951" "1" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Hollander 2001:11389483}" "-" "2978G->A" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065952" "21" "90" "1" "197446868" "197446868" "subst" "0" "01251" "CRB1_000185" "g.197446868G>A" "" "{PMID:Hollander 2001:11389483}" "MnlI+;LpnPI-;BsrI+;Cac8I-" "4195G->A" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197477738G>A" "" "pathogenic" "" "0000065953" "1" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Hollander 2001:11389483}" "-" "2978G->A" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065954" "0" "90" "1" "197398749" "197398749" "subst" "0.0000325529" "01251" "CRB1_000034" "g.197398749G>A" "" "{PMID:Hollander 2001:11389483}" "-" "2978+5G->A" "" "Germline" "" "" "0" "" "" "g.197429619G>A" "" "pathogenic" "" "0000065955" "0" "90" "1" "197404534" "197404534" "subst" "0" "01251" "CRB1_000085" "g.197404534T>C" "" "{PMID:Hollander 2001:11389483}" "BsmI-" "2676T->C" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197435404T>C" "" "pathogenic" "" "0000065956" "0" "90" "1" "197404534" "197404534" "subst" "0" "01251" "CRB1_000085" "g.197404534T>C" "" "{PMID:Hollander 2001:11389483}" "BsmI-" "2676T->C" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197435404T>C" "" "pathogenic" "" "0000065957" "0" "90" "1" "197404534" "197404534" "subst" "0" "01251" "CRB1_000085" "g.197404534T>C" "" "{PMID:Hollander 2001:11389483}" "BsmI-" "2676T->C" "not in 180 controls" "Germline" "" "" "0" "" "" "g.197435404T>C" "" "pathogenic" "" "0000065958" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Jacobson 2003:12700176}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065959" "0" "70" "1" "197404646" "197404646" "subst" "0" "01251" "CRB1_000093" "g.197404646G>T" "" "{PMID:Jacobson 2003:12700176}" "Hpy188III+" "" "" "Unknown" "" "" "0" "" "" "g.197435516G>T" "" "likely pathogenic" "" "0000065960" "0" "70" "1" "197396700" "197396702" "del" "0" "01251" "CRB1_000055" "g.197396700_197396702del" "" "{PMID:Jacobson 2003:12700176}" "BssKI+;BstNI+;PspGI+;ScrFI+;StyD4I+;BccI-" "749del3bp" "" "Unknown" "" "" "0" "" "" "g.197427570_197427572del" "" "likely pathogenic" "" "0000065961" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Jacobson 2003:12700176}" "BfaI+" "Lys801Stop" "" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065962" "20" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bernal 2003:12843338}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065963" "20" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bernal 2003:12843338}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065964" "21" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Bernal 2003:12843338}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000065965" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bernal 2003:12843338}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065966" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bernal 2003:12843338}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000065967" "0" "90" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Bernal 2003:12843338}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "pathogenic" "" "0000065968" "11" "70" "1" "197404313" "197404313" "subst" "0" "01251" "CRB1_000109" "g.197404313T>G" "" "{PMID:Hanein 2004:15024725}" "MwoI+" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197435183T>G" "" "likely pathogenic" "" "0000065969" "11" "70" "1" "197404313" "197404313" "subst" "0" "01251" "CRB1_000109" "g.197404313T>G" "" "{PMID:Hanein 2004:15024725}" "MwoI+" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197435183T>G" "" "likely pathogenic" "" "0000065970" "0" "70" "1" "197404313" "197404313" "subst" "0" "01251" "CRB1_000109" "g.197404313T>G" "" "{PMID:Hanein 2004:15024725}" "MwoI+" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197435183T>G" "" "likely pathogenic" "" "0000065971" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Hanein 2004:15024725}" "Tsp45I-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000065972" "0" "70" "1" "197411378" "197411378" "subst" "0" "01251" "CRB1_000048" "g.197411378T>A" "" "{PMID:Hanein 2004:15024725}" "CviKI_1+;Hpy188III+;BsrI-;BtsIMutI-;TspRI-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197442248T>A" "" "likely pathogenic" "" "0000065973" "0" "90" "1" "197403846" "197403846" "dup" "0" "01251" "CRB1_000143" "g.197403846dup" "" "{PMID:Hanein 2004:15024725}" "MluCI+" "c.2853dupT" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197434716dup" "" "pathogenic" "" "0000065974" "0" "90" "1" "197411405" "197411405" "del" "0" "01251" "CRB1_000049" "g.197411405del" "" "{PMID:Hanein 2004:15024725}" "HpyCH4IV+;CviAII-;FatI-;NlaIII-" "c.3988delG" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197442275del" "" "pathogenic" "" "0000065975" "0" "90" "1" "197404340" "197404340" "del" "0" "01251" "CRB1_000071" "g.197404340del" "" "{PMID:Hanein 2004:15024725}" "-" "c.3347delT" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197435210del" "" "pathogenic" "" "0000065976" "0" "70" "1" "197404067" "197404067" "subst" "0" "01251" "CRB1_000162" "g.197404067G>T" "" "{PMID:Hanein 2004:15024725}" "BsmI+" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197434937G>T" "" "likely pathogenic" "" "0000065977" "0" "90" "1" "197411423" "197411423" "subst" "0.00000406204" "01251" "CRB1_000092" "g.197411423G>A" "" "{PMID:Hanein 2004:15024725}" "-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197442293G>A" "" "pathogenic" "" "0000065978" "0" "70" "1" "197404313" "197404313" "subst" "0.00000407847" "01251" "CRB1_000028" "g.197404313T>C" "" "{PMID:Hanein 2004:15024725}" "-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197435183T>C" "" "likely pathogenic" "" "0000065979" "0" "70" "1" "197404313" "197404313" "subst" "0.00000407847" "01251" "CRB1_000028" "g.197404313T>C" "" "{PMID:Hanein 2004:15024725}" "-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197435183T>C" "" "likely pathogenic" "" "0000065980" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Hanein 2004:15024725}" "-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065981" "0" "90" "1" "197396934" "197396934" "subst" "0" "01251" "CRB1_000204" "g.197396934G>T" "" "{PMID:Hanein 2004:15024725}" "-" "" "not in 96 controls" "Germline" "" "" "0" "" "" "g.197427804G>T" "" "pathogenic" "" "0000065982" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:den Hollander 2004:15459956}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065983" "20" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:den Hollander 2004:15459956}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065984" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:den Hollander 2004:15459956}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065985" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:den Hollander 2004:15459956}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065986" "0" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:den Hollander 2004:15459956}" "BfaI+" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000065987" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:den Hollander 2004:15459956}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065988" "0" "70" "1" "197404420" "197404420" "del" "0" "01251" "CRB1_000073" "g.197404420del" "" "{PMID:den Hollander 2004:15459956}" "-" "c.3427deIT" "" "Germline" "" "" "0" "" "" "g.197435290del" "" "likely pathogenic" "" "0000065989" "20" "70" "1" "197404292" "197404292" "subst" "0" "01251" "CRB1_000100" "g.197404292T>A" "" "{PMID:den Hollander 2004:15459956}" "-" "c.3299T>A" "" "Germline" "" "" "0" "" "" "g.197435162T>A" "" "likely pathogenic" "" "0000065990" "0" "70" "1" "197390718" "197390718" "subst" "0" "01251" "CRB1_000197" "g.197390718G>A" "" "{PMID:den Hollander 2004:15459956}" "LpnPI-" "" "" "Germline" "" "" "0" "" "" "g.197421588G>A" "" "likely pathogenic" "" "0000065991" "0" "70" "1" "197390421" "197390421" "subst" "0.00000406108" "01251" "CRB1_000202" "g.197390421T>C" "" "{PMID:Galvin 2005:16205573}" "BspCNI+;DdeI+;Hpy188I+" "F488S" "" "Germline" "" "" "0" "" "" "g.197421291T>C" "" "likely pathogenic" "" "0000065992" "0" "70" "1" "197390396" "197390396" "subst" "0.00000812255" "01251" "CRB1_000195" "g.197390396T>C" "" "{PMID:Galvin 2005:16205573}" "-" "C480R" "" "Germline" "" "" "0" "" "" "g.197421266T>C" "" "likely pathogenic" "" "0000065993" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Galvin 2005:16205573}" "-" "R764C" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065994" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Galvin 2005:16205573}" "BfaI+" "K801X" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000065995" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Booij 2005:16272259}" "-" "" "not in 60 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000065996" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Booij 2005:16272259}" "-" "Arg764Cys" "not in 60 controls" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000065997" "0" "90" "1" "197404657" "197404657" "subst" "0" "01251" "CRB1_000113" "g.197404657C>T" "" "{PMID:Yzer 2006:16505055}" "BfaI+;SpeI+;BsrI-;BtsIMutI-;HphI-;TspRI-;XcmI-" "" "" "Germline" "" "" "0" "" "" "g.197435527C>T" "" "pathogenic" "" "0000065998" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Yzer 2006:16505055}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000065999" "0" "70" "1" "197398749" "197398749" "subst" "0.0000325529" "01251" "CRB1_000034" "g.197398749G>A" "" "{PMID:Yzer 2006:16505055}" "-" "c.3664C>T" "" "Germline" "" "" "0" "" "" "g.197429619G>A" "" "likely pathogenic" "" "0000066000" "0" "70" "1" "197398749" "197398749" "subst" "0.0000325529" "01251" "CRB1_000034" "g.197398749G>A" "" "{PMID:Yzer 2006:16505055}" "-" "c.3664C>T" "" "Germline" "" "" "0" "" "" "g.197429619G>A" "" "likely pathogenic" "" "0000066001" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Yzer 2006:16505055}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066002" "0" "90" "1" "197326056" "197326056" "subst" "0.0000081213" "01251" "CRB1_000223" "g.197326056C>T" "" "{PMID:Yzer 2006:16505055}" "-" "" "" "Germline" "" "" "0" "" "" "g.197356926C>T" "" "pathogenic" "" "0000066003" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Yzer 2006:16505055}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000066004" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Yzer 2006:16505055}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000066005" "21" "70" "1" "197396713" "197396713" "subst" "0" "01251" "CRB1_000059" "g.197396713T>C" "" "{PMID:Yzer 2006:16936081}" "LpnPI+;BfaI-" "p.[L753P]" "" "Germline" "" "" "0" "" "" "g.197427583T>C" "" "likely pathogenic" "" "0000066006" "0" "70" "1" "197391000" "197391000" "subst" "0.00000406732" "01251" "CRB1_000020" "g.197391000G>A" "" "{PMID:Preising 2007:17525851}" "-" "p.C681Y (c.2042G>A)" "" "Germline" "" "" "0" "" "" "g.197421870G>A" "" "likely pathogenic" "" "0000066007" "0" "90" "1" "197297839" "197297839" "subst" "0" "01251" "CRB1_000069" "g.197297839C>T" "" "{PMID:Simonelli 2007:17724218}" "" "c.258C>T" "" "Germline" "" "" "0" "" "" "g.197328709C>T" "" "pathogenic" "" "0000066008" "0" "70" "1" "197390271" "197390271" "subst" "0" "01251" "CRB1_000151" "g.197390271G>A" "" "{PMID:Simonelli 2007:17724218}" "" "" "" "Germline" "" "" "0" "" "" "g.197421141G>A" "" "likely pathogenic" "" "0000066009" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Simonelli 2007:17724218}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000066010" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Simonelli 2007:17724218}" "" "c.2334C>T" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066011" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Simonelli 2007:17724218}" "" "T745M" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066012" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01251" "CRB1_000191" "g.197390691T>A" "" "{PMID:Stone 2007:17964524}" "" "Val578Glu" "" "Unknown" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000066013" "0" "90" "1" "197390908" "197390908" "subst" "0" "01251" "CRB1_000107" "g.197390908G>A" "" "{PMID:Stone 2007:17964524}" "" "Trp650STOP" "" "Germline" "" "" "0" "" "" "g.197421778G>A" "" "pathogenic" "" "0000066014" "0" "70" "1" "197396700" "197396702" "del" "0" "01251" "CRB1_000055" "g.197396700_197396702del" "" "{PMID:Stone 2007:17964524}" "" "Pro748 del3" "" "Germline" "" "" "0" "" "" "g.197427570_197427572del" "" "likely pathogenic" "" "0000066015" "0" "90" "1" "197411413" "197411413" "subst" "0" "01251" "CRB1_000054" "g.197411413C>A" "" "{PMID:Stone 2007:17964524}" "" "Cys1332STOP" "" "Germline" "" "" "0" "" "" "g.197442283C>A" "" "pathogenic" "" "0000066016" "0" "90" "1" "197297962" "197297962" "dup" "0" "01251" "CRB1_000209" "g.197297962dup" "" "{PMID:Vallespin 2007:18055816}" "-" "c.478-481 insG FS" "" "Germline" "" "" "0" "" "" "g.197328832dup" "" "pathogenic" "" "0000066017" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Vallespin 2007:18055816}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066018" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Vallespin 2007:18055816}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000066019" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Vallespin 2007:18055816}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000066020" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Vallespin 2007:18055816}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000066021" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Vallespin 2007:18055816}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066022" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Vallespin 2007:18055816}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066023" "0" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Vallespin 2007:18055816}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000066024" "0" "30" "1" "197316487" "197316487" "subst" "0.000479235" "01251" "CRB1_000180" "g.197316487C>T" "" "{PMID:Vallespin 2007:18055816}" "CviAII+;FatI+;NlaIII+;BsgI-" "" "" "Germline" "" "" "0" "" "" "g.197347357C>T" "" "likely benign" "" "0000066025" "0" "70" "1" "197398616" "197398616" "subst" "0.000272194" "01251" "CRB1_000138" "g.197398616G>A" "" "{PMID:Vallespin 2007:18055816}" "BmrI+;BsrI+;TspRI+;HpaII-;MspI-;NciI-;ScrFI-;StyD4I-" "" "" "Germline" "" "" "0" "" "" "g.197429486G>A" "" "likely pathogenic" "" "0000066026" "0" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Vallespin 2007:18055816}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000066027" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2007:18055820}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066028" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Henderson 2007:18055820}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066029" "0" "70" "1" "197411412" "197411412" "subst" "0" "01251" "CRB1_000053" "g.197411412G>T" "" "{PMID:den Hollander 2007:18055821}" "TaqI+;ApeKI-;BbvI-;Fnu4HI-;MwoI-;TseI-" "" "" "Germline" "" "" "0" "" "" "g.197442282G>T" "" "likely pathogenic" "" "0000066032" "0" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "01251" "CRB1_000017" "g.197390534C>T" "" "{PMID:Seong 2008:18682808}" "AcuI+" "" "" "Unknown" "" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "" "0000066033" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bustamante-Aragones 2008:18682814}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066034" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Tosi 2009:19401883}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066035" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Tosi 2009:19401883}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066036" "0" "90" "1" "197297588" "197297588" "subst" "0" "01251" "CRB1_000064" "g.197297588C>G" "" "{PMID:Mckibbin 2010:20065226}" "Hpy188I+" "" "" "Germline" "" "" "0" "" "" "g.197328458C>G" "" "pathogenic" "" "0000066037" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Coppieters 2010:20683928}" "BfaI+" "" "" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000066038" "0" "90" "1" "197326056" "197326056" "subst" "0.0000081213" "01251" "CRB1_000223" "g.197326056C>T" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197356926C>T" "" "pathogenic" "" "0000066039" "0" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "" "0000066040" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Coppieters 2010:20683928}" "Tsp45I-" "" "" "Unknown" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000066041" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Coppieters 2010:20683928}" "Tsp45I-" "" "" "Unknown" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000066042" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000066043" "0" "90" "1" "197446793" "197446793" "subst" "0.00000407594" "01251" "CRB1_000182" "g.197446793G>T" "" "{PMID:Coppieters 2010:20683928}" "" "" "" "Unknown" "" "" "0" "" "" "g.197477663G>T" "" "pathogenic" "" "0000066044" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000066045" "0" "90" "1" "197411405" "197411405" "subst" "0.0000040618" "01251" "CRB1_000050" "g.197411405G>T" "" "{PMID:Coppieters 2010:20683928}" "BfaI+;BmtI+;CviKI_1+;NheI+" "" "" "Unknown" "" "" "0" "" "" "g.197442275G>T" "" "pathogenic" "" "0000066046" "0" "90" "1" "197398749" "197398749" "subst" "0.0000325529" "01251" "CRB1_000034" "g.197398749G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197429619G>A" "" "pathogenic" "" "0000066047" "0" "90" "1" "197398749" "197398749" "subst" "0.0000325529" "01251" "CRB1_000034" "g.197398749G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197429619G>A" "" "pathogenic" "" "0000066048" "0" "90" "1" "197398749" "197398749" "subst" "0.0000325529" "01251" "CRB1_000034" "g.197398749G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197429619G>A" "" "pathogenic" "" "0000066049" "0" "90" "1" "197398749" "197398749" "subst" "0.0000325529" "01251" "CRB1_000034" "g.197398749G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197429619G>A" "" "pathogenic" "" "0000066050" "0" "90" "1" "197398749" "197398749" "subst" "0.0000325529" "01251" "CRB1_000034" "g.197398749G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197429619G>A" "" "pathogenic" "" "0000066051" "0" "90" "1" "197404706" "197404709" "dup" "0" "01251" "CRB1_000190" "g.197404706_197404709dup" "" "{PMID:Coppieters 2010:20683928}" "Cac8I+" "" "" "Unknown" "" "" "0" "" "" "g.197435576_197435579dup" "" "pathogenic" "" "0000066052" "0" "90" "1" "197404706" "197404709" "dup" "0" "01251" "CRB1_000190" "g.197404706_197404709dup" "" "{PMID:Coppieters 2010:20683928}" "Cac8I+" "" "" "Unknown" "" "" "0" "" "" "g.197435576_197435579dup" "" "pathogenic" "" "0000066053" "0" "90" "1" "197411296" "197411296" "subst" "0" "01251" "CRB1_000077" "g.197411296G>A" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197442166G>A" "" "pathogenic" "" "0000066054" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Coppieters 2010:20683928}" "BfaI+" "" "" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000066055" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Coppieters 2010:20683928}" "BfaI+" "" "" "Unknown" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000066056" "0" "70" "1" "197316550" "197316550" "subst" "0" "01251" "CRB1_000219" "g.197316550G>A" "" "{PMID:Coppieters 2010:20683928}" "Tsp45I-" "" "" "Unknown" "" "" "0" "" "" "g.197347420G>A" "" "likely pathogenic" "" "0000066057" "0" "70" "1" "197390430" "197390430" "subst" "0" "01251" "CRB1_000224" "g.197390430A>T" "" "{PMID:Coppieters 2010:20683928}" "BccI-;BtgZI-" "" "" "Unknown" "" "" "0" "" "" "g.197421300A>T" "" "likely pathogenic" "" "0000066058" "0" "90" "1" "197326056" "197326056" "subst" "0.0000081213" "01251" "CRB1_000223" "g.197326056C>T" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197356926C>T" "" "pathogenic" "" "0000066059" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Coppieters 2010:20683928}" "-" "" "" "Unknown" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000066060" "0" "70" "1" "197397003" "197397003" "subst" "0.0000203346" "01251" "CRB1_000010" "g.197397003G>A" "" "{PMID:Simpson 2011:21147909}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.197427873G>A" "" "likely pathogenic" "" "0000066061" "0" "70" "1" "197397003" "197397003" "subst" "0.0000203346" "01251" "CRB1_000010" "g.197397003G>A" "" "{PMID:Simpson 2011:21147909}" "AluI+" "" "" "Germline" "" "" "0" "" "" "g.197427873G>A" "" "likely pathogenic" "" "0000066062" "0" "90" "1" "197411405" "197411405" "subst" "0.0000040618" "01251" "CRB1_000050" "g.197411405G>T" "" "{PMID:Avila-Fernandez 2010:21151602}" "BfaI+;BmtI+;CviKI_1+;NheI+" "" "" "Germline" "" "" "0" "" "" "g.197442275G>T" "" "pathogenic" "" "0000066063" "0" "90" "1" "197411405" "197411405" "subst" "0.0000040618" "01251" "CRB1_000050" "g.197411405G>T" "" "{PMID:Avila-Fernandez 2010:21151602}" "BfaI+;BmtI+;CviKI_1+;NheI+" "" "" "Germline" "" "" "0" "" "" "g.197442275G>T" "" "pathogenic" "" "0000066064" "20" "90" "1" "197326097" "197326097" "subst" "0" "01251" "CRB1_000192" "g.197326097C>G" "" "{PMID:Zenteno 2011:21484995}" "BfaI+;BmtI+;Cac8I+;NheI+" "" "" "Germline" "" "" "0" "" "" "g.197356967C>G" "" "pathogenic" "" "0000066065" "20" "90" "1" "197326097" "197326097" "subst" "0" "01251" "CRB1_000192" "g.197326097C>G" "" "{PMID:Zenteno 2011:21484995}" "BfaI+;BmtI+;Cac8I+;NheI+" "" "" "Germline" "" "" "0" "" "" "g.197356967C>G" "" "pathogenic" "" "0000066066" "0" "90" "1" "197411424" "197411424" "subst" "0" "01251" "CRB1_000094" "g.197411424T>G" "" "{PMID:Li 2011:21602930}" "-" "" "" "Germline" "" "" "0" "" "" "g.197442294T>G" "" "pathogenic" "" "0000066067" "0" "90" "1" "197446792" "197446792" "subst" "0.00000407578" "01251" "CRB1_000208" "g.197446792A>G" "" "{PMID:Li 2011:21602930}" "-" "" "" "Germline" "" "" "0" "" "" "g.197477662A>G" "" "pathogenic" "" "0000066068" "0" "90" "1" "197411424" "197411424" "subst" "0" "01251" "CRB1_000094" "g.197411424T>G" "" "{PMID:Li 2011:21602930}" "-" "" "" "Germline" "" "" "0" "" "" "g.197442294T>G" "" "pathogenic" "" "0000066069" "0" "90" "1" "197404669" "197404669" "subst" "0.0000204062" "01251" "CRB1_000115" "g.197404669G>T" "" "{PMID:Li 2011:21602930}" "MluCI+;NlaIV-;XcmI-" "G1226X" "" "Germline" "" "" "0" "" "" "g.197435539G>T" "" "pathogenic" "" "0000066070" "0" "90" "1" "197411424" "197411424" "subst" "0" "01251" "CRB1_000094" "g.197411424T>G" "" "{PMID:Li 2011:21602930}" "-" "" "" "Germline" "" "" "0" "" "" "g.197442294T>G" "" "pathogenic" "" "0000066071" "2" "90" "1" "197237542" "197447010" "" "0" "01251" "CRB1_000000" "g.(?_197237542)_(197447010_?)del" "" "{PMID:Aleman 2011:21757580}" "-" "deletion of CRB1" "CRB1 deleted" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000066072" "0" "70" "1" "197446836" "197446838" "del" "0" "01251" "CRB1_000184" "g.197446836_197446838del" "" "{PMID:Aleman 2011:21757580}" "AlwNI-;BspCNI-;BtsIMutI-;CviKI_1-;DdeI-;TspRI-" "p.Ser1350del1" "" "Germline" "" "" "0" "" "" "g.197477706_197477708del" "" "likely pathogenic" "" "0000066073" "0" "70" "1" "197390396" "197390396" "subst" "0.00000812255" "01251" "CRB1_000195" "g.197390396T>C" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys480Arg" "" "Germline" "" "" "0" "" "" "g.197421266T>C" "" "likely pathogenic" "" "0000066074" "0" "70" "1" "197404646" "197404646" "subst" "0" "01251" "CRB1_000093" "g.197404646G>T" "" "{PMID:Aleman 2011:21757580}" "Hpy188III+" "p.Cys1218Phe" "" "Germline" "" "" "0" "" "" "g.197435516G>T" "" "likely pathogenic" "" "0000066075" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066076" "0" "70" "1" "197325976" "197325976" "subst" "0" "01251" "CRB1_000222" "g.197325976A>C" "" "{PMID:Aleman 2011:21757580}" "BmrI-;BsrI-;BtsIMutI-;TspRI-" "p.Gln335Pro" "" "Germline" "" "" "0" "" "" "g.197356846A>C" "" "likely pathogenic" "" "0000066077" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066078" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01251" "CRB1_000191" "g.197390691T>A" "" "{PMID:Aleman 2011:21757580}" "BcoDI+;BsaI+;BsmAI+;BspCNI+;DdeI+;Tsp45I-" "p.Val578Glu" "" "Germline" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000066079" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Aleman 2011:21757580}" "-" "p.Cys948Tyr" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066080" "0" "70" "1" "197396697" "197396699" "del" "0" "01251" "CRB1_000117" "g.197396697_197396699del" "" "{PMID:Aleman 2011:21757580}" "BccI-" "p.Pro748del3" "" "Germline" "" "" "0" "" "" "g.197427567_197427569del" "" "likely pathogenic" "" "0000066081" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Aleman 2011:21757580}" "-" "p.Arg764Cys" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000066082" "0" "70" "1" "197404283" "197404283" "subst" "0" "01251" "CRB1_000097" "g.197404283T>G" "" "{PMID:Aleman 2011:21757580}" "BcgI (2)+;TaqI+;DdeI-" "p.Leu1097Arg" "" "Germline" "" "" "0" "" "" "g.197435153T>G" "" "likely pathogenic" "" "0000066083" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Aleman 2011:21757580}" "-" "p.Arg764Cys" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000066084" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01251" "CRB1_000191" "g.197390691T>A" "" "{PMID:Aleman 2011:21757580}" "BcoDI+;BsaI+;BsmAI+;BspCNI+;DdeI+;Tsp45I-" "p.Val578Glu" "" "Germline" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000066085" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Aleman 2011:21757580}" "BsmI+" "p.Thr745Met" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066086" "0" "90" "1" "197397066" "197397067" "ins" "0" "01251" "CRB1_000207" "g.197397066_197397067insT" "" "{PMID:Aleman 2011:21757580}" "NdeI+" "p.Asn871ins1" "" "Germline" "" "" "0" "" "" "g.197427936_197427937insT" "" "pathogenic" "" "0000066087" "0" "70" "1" "197446970" "197446970" "subst" "0" "01251" "CRB1_000046" "g.197446970G>C" "" "{PMID:Aleman 2011:21757580}" "-" "p.Trp1370Cys" "Original paper is based on old numbering" "Germline" "" "" "0" "" "" "g.197477840G>C" "" "likely pathogenic" "" "0000066088" "0" "70" "1" "197390718" "197390718" "subst" "0" "01251" "CRB1_000197" "g.197390718G>A" "" "{PMID:Aleman 2011:21757580}" "LpnPI-" "p.Cys587Tyr" "" "Germline" "" "" "0" "" "" "g.197421588G>A" "" "likely pathogenic" "" "0000066089" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Aleman 2011:21757580}" "-" "p.Arg764Cys" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000066090" "0" "70" "1" "197404214" "197404214" "subst" "0.0000122015" "01251" "CRB1_000096" "g.197404214T>C" "" "{PMID:Aleman 2011:21757580}" "BstBI+;TaqI+" "p.Leu1074Ser" "" "Germline" "" "" "0" "" "" "g.197435084T>C" "" "likely pathogenic" "" "0000066091" "0" "70" "1" "197396820" "197396822" "del" "0" "01251" "CRB1_000123" "g.197396820_197396822del" "" "{PMID:Bujakowska 2012:22065545}" "Hpy188III+;MseI-" "c.2365_2367delAAT" "" "Germline" "" "" "0" "" "" "g.197427690_197427692del" "" "likely pathogenic" "" "0000066092" "0" "70" "1" "197396961" "197396961" "subst" "0.00019522" "01251" "CRB1_000026" "g.197396961C>A" "" "{PMID:Bujakowska 2012:22065545}" "LpnPI-" "" "" "Germline" "" "" "0" "" "" "g.197427831C>A" "" "likely pathogenic" "" "0000066093" "0" "70" "1" "197396961" "197396961" "subst" "0.00019522" "01251" "CRB1_000026" "g.197396961C>A" "" "{PMID:Bujakowska 2012:22065545}" "LpnPI-" "" "" "Germline" "" "" "0" "" "" "g.197427831C>A" "" "likely pathogenic" "" "0000066094" "0" "70" "1" "197396674" "197396674" "subst" "0" "01251" "CRB1_000203" "g.197396674C>T" "" "{PMID:Bujakowska 2012:22065545}" "EarI+;MboII+" "" "" "Germline" "" "" "0" "" "" "g.197427544C>T" "" "likely pathogenic" "" "0000066095" "0" "70" "1" "197404586" "197404586" "subst" "0" "01251" "CRB1_000087" "g.197404586A>G" "" "{PMID:Bujakowska 2012:22065545}" "Cac8I+;LpnPI+" "" "" "Germline" "" "" "0" "" "" "g.197435456A>G" "" "likely pathogenic" "" "0000066096" "0" "70" "1" "197404586" "197404586" "subst" "0" "01251" "CRB1_000087" "g.197404586A>G" "" "{PMID:Bujakowska 2012:22065545}" "Cac8I+;LpnPI+" "" "" "Germline" "" "" "0" "" "" "g.197435456A>G" "" "likely pathogenic" "" "0000066097" "0" "70" "1" "197396961" "197396961" "subst" "0.00019522" "01251" "CRB1_000026" "g.197396961C>A" "" "{PMID:Bujakowska 2012:22065545}" "LpnPI-" "" "" "Germline" "" "" "0" "" "" "g.197427831C>A" "" "likely pathogenic" "" "0000066098" "0" "70" "1" "197404661" "197404661" "subst" "0" "01251" "CRB1_000114" "g.197404661G>C" "" "{PMID:Bujakowska 2012:22065545}" "AleI-;BtsIMutI-;MslI-;TspRI-" "" "" "Germline" "" "" "0" "" "" "g.197435531G>C" "" "likely pathogenic" "" "0000066099" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bujakowska 2012:22065545}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066100" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bujakowska 2012:22065545}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066101" "0" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Bujakowska 2012:22065545}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000066102" "0" "90" "1" "197411331" "197411331" "subst" "0.00000406128" "01251" "CRB1_000079" "g.197411331C>T" "" "{PMID:Siemiatkowska 2011:22128245}" "AlwI-" "" "" "Germline" "" "" "0" "" "" "g.197442201C>T" "" "pathogenic" "" "0000066103" "10" "90" "1" "197398577" "197398577" "subst" "0" "01251" "CRB1_000132" "g.197398577A>C" "" "{PMID:Li 2011:22219627}" "-" "" "" "Germline" "" "" "0" "" "" "g.197429447A>C" "" "pathogenic" "" "0000066104" "10" "90" "1" "197398577" "197398577" "subst" "0" "01251" "CRB1_000132" "g.197398577A>C" "" "{PMID:Li 2011:22219627}" "-" "" "" "Germline" "" "" "0" "" "" "g.197429447A>C" "" "pathogenic" "" "0000066105" "10" "90" "1" "197398577" "197398577" "subst" "0" "01251" "CRB1_000132" "g.197398577A>C" "" "{PMID:Li 2011:22219627}" "-" "" "" "Germline" "" "" "0" "" "" "g.197429447A>C" "" "pathogenic" "" "0000066106" "0" "90" "1" "197404706" "197404709" "dup" "0" "01251" "CRB1_000190" "g.197404706_197404709dup" "" "{PMID:Coppieters 2012:22261762}" "Cac8I+" "" "" "Germline" "" "" "0" "" "" "g.197435576_197435579dup" "" "pathogenic" "" "0000066107" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Strom 2012:22863181}" "BfaI+" "p.K801X" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000066108" "0" "70" "1" "197396953" "197396953" "subst" "0" "01251" "CRB1_000164" "g.197396953G>A" "" "{PMID:Paun 2012:23077403}" "BccI+" "" "" "Germline" "" "" "0" "" "" "g.197427823G>A" "" "likely pathogenic" "" "0000066109" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Jalkh 2014:23362850}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066110" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Jalkh 2014:23362850}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066111" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Jalkh 2014:23362850}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066112" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Jalkh 2014:23362850}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066113" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Jalkh 2014:23362850}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066114" "21" "90" "1" "197390730" "197390733" "del" "0" "01251" "CRB1_000199" "g.197390730_197390733del" "" "{PMID:Jalkh 2014:23362850}" "BtgZI-;HpyCH4V-;NsiI-;SfaNI-" "c.1772_1775delGCAT" "" "Germline" "" "" "0" "" "" "g.197421600_197421603del" "" "pathogenic" "" "0000066115" "0" "90" "1" "197297962" "197297962" "dup" "0" "01251" "CRB1_000209" "g.197297962dup" "" "{PMID:Corton 2013:23379534}" "-" "c.481dupG" "" "Germline" "" "" "0" "" "" "g.197328832dup" "" "pathogenic" "" "0000066116" "0" "70" "1" "197297979" "197297987" "del" "0" "01251" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Corton 2013:23379534}" "MluCI-" "" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000066117" "0" "90" "1" "197326119" "197326128" "del" "0" "01251" "CRB1_000194" "g.197326119_197326128del" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197356989_197356998del" "" "pathogenic" "" "0000066118" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Corton 2013:23379534}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066119" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Corton 2013:23379534}" "-" "c.2234C>T" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000066120" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Corton 2013:23379534}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000066121" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066122" "0" "90" "1" "197396682" "197396682" "del" "0" "01251" "CRB1_000116" "g.197396682del" "" "{PMID:Corton 2013:23379534}" "-" "c.2227delG" "" "Germline" "" "" "0" "" "" "g.197427552del" "" "pathogenic" "" "0000066123" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066124" "0" "90" "1" "197411423" "197411423" "subst" "0.00000406204" "01251" "CRB1_000092" "g.197411423G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197442293G>A" "" "pathogenic" "" "0000066125" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066126" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01251" "CRB1_000030" "g.197398590T>A" "" "{PMID:Corton 2013:23379534}" "Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000066127" "0" "70" "1" "197403995" "197403995" "subst" "0" "01251" "CRB1_000158" "g.197403995T>A" "" "{PMID:Corton 2013:23379534}" "SspI-" "" "" "Germline" "" "" "0" "" "" "g.197434865T>A" "" "likely pathogenic" "" "0000066128" "0" "70" "1" "197404007" "197404007" "subst" "0.0000244351" "01251" "CRB1_000159" "g.197404007A>T" "" "{PMID:Corton 2013:23379534}" "HinfI-;TfiI-" "" "" "Germline" "" "" "0" "" "" "g.197434877A>T" "" "likely pathogenic" "" "0000066129" "0" "70" "1" "197446930" "197446930" "subst" "0" "01251" "CRB1_000015" "g.197446930C>T" "" "{PMID:Corton 2013:23379534}" "BbvCI+;Bpu10I+;BseYI-" "" "" "Germline" "" "" "0" "" "" "g.197477800C>T" "" "likely pathogenic" "" "0000066130" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Corton 2013:23379534}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066131" "0" "90" "1" "197396871" "197396871" "subst" "0" "01251" "CRB1_000126" "g.197396871G>T" "" "{PMID:Corton 2013:23379534}" "ApoI+;MseI+" "" "" "Germline" "" "" "0" "" "" "g.197427741G>T" "" "pathogenic" "" "0000066132" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066133" "0" "90" "1" "197411405" "197411405" "subst" "0.0000040618" "01251" "CRB1_000050" "g.197411405G>T" "" "{PMID:Corton 2013:23379534}" "BfaI+;BmtI+;CviKI_1+;NheI+" "" "" "Germline" "" "" "0" "" "" "g.197442275G>T" "" "pathogenic" "" "0000066134" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066135" "0" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Corton 2013:23379534}" "-" "c.3299G>T" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000066136" "0" "90" "1" "197411405" "197411405" "subst" "0.0000040618" "01251" "CRB1_000050" "g.197411405G>T" "" "{PMID:Corton 2013:23379534}" "BfaI+;BmtI+;CviKI_1+;NheI+" "" "" "Germline" "" "" "0" "" "" "g.197442275G>T" "" "pathogenic" "" "0000066137" "0" "90" "1" "197446956" "197446956" "subst" "0.00000815295" "01251" "CRB1_000045" "g.197446956C>T" "" "{PMID:Corton 2013:23379534}" "BspCNI+;DdeI+;LpnPI+;AvaI-;BsoBI-" "" "" "Germline" "" "" "0" "" "" "g.197477826C>T" "" "pathogenic" "" "0000066138" "0" "90" "1" "197398707" "197398707" "dup" "0" "01251" "CRB1_000140" "g.197398707dup" "" "{PMID:Corton 2013:23379534}" "BsaWI+;HphI+" "c.2805dupG" "" "Germline" "" "" "0" "" "" "g.197429577dup" "" "pathogenic" "" "0000066139" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Corton 2013:23379534}" "BfaI+" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000066140" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066141" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066142" "0" "70" "1" "197403995" "197403995" "subst" "0" "01251" "CRB1_000158" "g.197403995T>A" "" "{PMID:Corton 2013:23379534}" "SspI-" "" "" "Germline" "" "" "0" "" "" "g.197434865T>A" "" "likely pathogenic" "" "0000066143" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066144" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066145" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066146" "0" "70" "1" "197404150" "197404150" "subst" "0.0000040663" "01251" "CRB1_000174" "g.197404150A>G" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435020A>G" "" "likely pathogenic" "" "0000066147" "0" "70" "1" "197404150" "197404150" "subst" "0.0000040663" "01251" "CRB1_000174" "g.197404150A>G" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435020A>G" "" "likely pathogenic" "" "0000066148" "0" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000066149" "0" "90" "1" "197404600" "197404600" "subst" "0" "01251" "CRB1_000089" "g.197404600G>T" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435470G>T" "" "pathogenic" "" "0000066150" "0" "90" "1" "197411405" "197411405" "subst" "0.0000040618" "01251" "CRB1_000050" "g.197411405G>T" "" "{PMID:Corton 2013:23379534}" "BfaI+;BmtI+;CviKI_1+;NheI+" "" "" "Germline" "" "" "0" "" "" "g.197442275G>T" "" "pathogenic" "" "0000066151" "0" "70" "1" "197404475" "197404475" "subst" "0.00000407857" "01251" "CRB1_000082" "g.197404475A>G" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435345A>G" "" "likely pathogenic" "" "0000066152" "0" "90" "1" "197411417" "197411417" "del" "0" "01251" "CRB1_000091" "g.197411417del" "" "{PMID:Corton 2013:23379534}" "MnlI-" "c.4000delG" "" "Germline" "" "" "0" "" "" "g.197442287del" "" "pathogenic" "" "0000066153" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066154" "0" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000066155" "0" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "01251" "CRB1_000101" "g.197404292T>C" "" "{PMID:Corton 2013:23379534}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000066156" "0" "70" "1" "197404744" "197404745" "del" "0" "01251" "CRB1_000072" "g.197404744_197404745del" "" "{PMID:Corton 2013:23379534}" "-" "c.3749+1_3749+2delGT" "" "Germline" "" "" "0" "" "" "g.197435614_197435615del" "" "likely pathogenic" "" "0000066157" "0" "70" "1" "197398598" "197398598" "subst" "0" "01251" "CRB1_000135" "g.197398598G>C" "" "{PMID:Corton 2013:23379534}" "BfuAI+;BspMI+;MnlI-" "" "" "Germline" "" "" "0" "" "" "g.197429468G>C" "" "likely pathogenic" "" "0000066158" "20" "90" "1" "197397012" "197397012" "subst" "0" "01251" "CRB1_000169" "g.197397012C>T" "" "{PMID:Jonsson 2013:23443024}, {PMID:Jonsson 2014:24664696}" "DdeI+;BciVI-" "" "" "Germline" "" "" "0" "" "" "g.197427882C>T" "" "pathogenic" "" "0000066159" "20" "90" "1" "197397012" "197397012" "subst" "0" "01251" "CRB1_000169" "g.197397012C>T" "" "{PMID:Jonsson 2013:23443024}, {PMID:Jonsson 2014:24664696}" "DdeI+;BciVI-" "" "" "Germline" "" "" "0" "" "" "g.197427882C>T" "" "pathogenic" "" "0000066160" "20" "90" "1" "197397012" "197397012" "subst" "0" "01251" "CRB1_000169" "g.197397012C>T" "" "{PMID:Jonsson 2013:23443024}, {PMID:Jonsson 2014:24664696}" "DdeI+;BciVI-" "" "" "Germline" "" "" "0" "" "" "g.197427882C>T" "" "pathogenic" "" "0000066161" "20" "90" "1" "197397012" "197397012" "subst" "0" "01251" "CRB1_000169" "g.197397012C>T" "" "{PMID:Jonsson 2013:23443024}, {PMID:Jonsson 2014:24664696}" "DdeI+;BciVI-" "" "" "Germline" "" "" "0" "" "" "g.197427882C>T" "" "pathogenic" "" "0000066162" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01251" "CRB1_000191" "g.197390691T>A" "" "{PMID:Beryozkin 2013:23449718}" "BcoDI+;BsaI+;BsmAI+;BspCNI+;DdeI+;Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000066163" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01251" "CRB1_000191" "g.197390691T>A" "" "{PMID:Beryozkin 2013:23449718}" "BcoDI+;BsaI+;BsmAI+;BspCNI+;DdeI+;Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000066164" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01251" "CRB1_000191" "g.197390691T>A" "" "{PMID:Beryozkin 2013:23449718}" "BcoDI+;BsaI+;BsmAI+;BspCNI+;DdeI+;Tsp45I-" "" "" "Germline" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000066165" "0" "70" "1" "197390802" "197390802" "subst" "0" "01251" "CRB1_000105" "g.197390802G>T" "" "{PMID:Beryozkin 2013:23449718}" "Hpy166II-" "c.1846G>T" "" "Germline" "" "" "0" "" "" "g.197421672G>T" "" "likely pathogenic" "" "0000066166" "0" "70" "1" "197390802" "197390802" "subst" "0" "01251" "CRB1_000105" "g.197390802G>T" "" "{PMID:Beryozkin 2013:23449718}" "Hpy166II-" "c.1846G>T" "" "Germline" "" "" "0" "" "" "g.197421672G>T" "" "likely pathogenic" "" "0000066167" "0" "70" "1" "197390802" "197390802" "subst" "0" "01251" "CRB1_000105" "g.197390802G>T" "" "{PMID:Beryozkin 2013:23449718}" "Hpy166II-" "c.1846G>T" "" "Germline" "" "" "0" "" "" "g.197421672G>T" "" "likely pathogenic" "" "0000066168" "0" "90" "1" "197446909" "197446918" "del" "0" "01251" "CRB1_000043" "g.197446909_197446918del" "" "{PMID:Beryozkin 2013:23449718}" "BspCNI-;DdeI-" "c.4121_4130del10" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000066169" "0" "70" "1" "197390802" "197390802" "subst" "0" "01251" "CRB1_000105" "g.197390802G>T" "" "{PMID:Beryozkin 2013:23449718}" "Hpy166II-" "c.1846G>T" "" "Germline" "" "" "0" "" "" "g.197421672G>T" "" "likely pathogenic" "" "0000066170" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Beryozkin 2013:23449718}" "BsmI+" "c.2236C>T" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066171" "0" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000066172" "0" "70" "1" "197396953" "197396953" "subst" "0" "01251" "CRB1_000164" "g.197396953G>A" "" "{PMID:Beryozkin 2013:23449718}" "BccI+" "" "" "Germline" "" "" "0" "" "" "g.197427823G>A" "" "likely pathogenic" "" "0000066173" "0" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000066174" "0" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000066175" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01251" "CRB1_000132" "g.197326120G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197356990G>A" "" "likely pathogenic" "" "0000066176" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01251" "CRB1_000132" "g.197326120G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197356990G>A" "" "likely pathogenic" "" "0000066177" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01251" "CRB1_000132" "g.197326120G>A" "" "{PMID:Beryozkin 2013:23449718}" "-" "" "" "Germline" "" "" "0" "" "" "g.197356990G>A" "" "likely pathogenic" "" "0000066178" "0" "70" "1" "197397010" "197397010" "subst" "0.00000406759" "01251" "CRB1_000168" "g.197397010T>C" "" "{PMID:Beryozkin 2013:23449718}" "CviQI+;RsaI+;BciVI-" "" "" "Germline" "" "" "0" "" "" "g.197427880T>C" "" "likely pathogenic" "" "0000066179" "0" "70" "1" "197396953" "197396953" "subst" "0" "01251" "CRB1_000164" "g.197396953G>A" "" "{PMID:Beryozkin 2013:23449718}" "BccI+" "" "" "Germline" "" "" "0" "" "" "g.197427823G>A" "" "likely pathogenic" "" "0000066180" "0" "90" "1" "197398582" "197398586" "del" "0" "01251" "CRB1_000133" "g.197398582_197398586del" "" "{PMID:Beryozkin 2013:23449718}" "BsmFI+;MmeI-" "c.2678_2682del5bpCCAAC" "" "Germline" "" "" "0" "" "" "g.197429452_197429456del" "" "pathogenic" "" "0000066181" "0" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "01251" "CRB1_000017" "g.197390534C>T" "" "{PMID:Beryozkin 2013:23449718}" "AcuI+" "" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "" "0000066182" "0" "90" "1" "197390800" "197390800" "del" "0" "01251" "CRB1_000104" "g.197390800del" "" "{PMID:Beryozkin 2013:23449718}" "BslI" "c.1842delT, (p.Gly614Glyfs*6)" "" "Germline" "" "" "0" "" "" "g.197421670del" "" "pathogenic" "" "0000066183" "20" "70" "1" "197396746" "197396746" "subst" "0.0000122099" "01251" "CRB1_000061" "g.197396746G>A" "" "{PMID:Tiab 2013:23592920}" "CviAII+;FatI+;NlaIII+" "" "" "Germline" "" "" "0" "" "" "g.197427616G>A" "" "likely pathogenic" "" "0000066184" "20" "70" "1" "197390799" "197390799" "subst" "0.000020326" "01251" "CRB1_000103" "g.197390799G>T" "" "{PMID:Chen 2013:23661368}" "-" "" "" "Germline" "" "" "0" "" "" "g.197421669G>T" "" "likely pathogenic" "" "0000066185" "20" "70" "1" "197390799" "197390799" "subst" "0.000020326" "01251" "CRB1_000103" "g.197390799G>T" "" "{PMID:Chen 2013:23661368}" "-" "" "" "Germline" "" "" "0" "" "" "g.197421669G>T" "" "likely pathogenic" "" "0000066186" "21" "90" "1" "197404540" "197404540" "del" "0" "01251" "CRB1_000086" "g.197404540del" "" "{PMID:Cordovez 2013:24512366}" "XmnI+" "c.3547delT" "" "Germline" "" "" "0" "" "" "g.197435410del" "" "pathogenic" "" "0000066187" "0" "70" "1" "197396626" "197396626" "subst" "0.0000081355" "01251" "CRB1_000230" "g.197396626A>G" "" "{PMID:Cordovez 2013:24512366}" "-" "" "" "Germline" "" "" "0" "" "" "g.197427496A>G" "" "likely pathogenic" "" "0000066188" "0" "70" "1" "197446793" "197446793" "subst" "0" "01251" "CRB1_000183" "g.197446793A>G" "" "{PMID:Cordovez 2013:24512366}" "-" "" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.197477663A>G" "" "likely pathogenic" "" "0000066189" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Cordovez 2013:24512366}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066195" "0" "90" "1" "197404669" "197404669" "subst" "0.0000204062" "01251" "CRB1_000115" "g.197404669G>T" "" "{PMID:Li 2014:24535598}" "MluCI+;NlaIV-;XcmI-" "" "" "Germline" "" "" "0" "" "" "g.197435539G>T" "" "pathogenic" "" "0000066196" "0" "70" "1" "197404010" "197404010" "subst" "0" "01251" "CRB1_000160" "g.197404010C>A" "" "{PMID:Li 2014:24535598}" "FspEI-;HinfI-;LpnPI-;TfiI-" "" "" "Germline" "" "" "0" "" "" "g.197434880C>A" "" "likely pathogenic" "" "0000066197" "0" "90" "1" "197446877" "197446884" "dup" "0" "01251" "CRB1_000187" "g.197446877_197446884dup" "" "{PMID:Li 2014:24535598}" "-" "c.[4089dupTGTTGCTT]" "" "Germline" "" "" "0" "" "" "g.197477747_197477754dup" "" "pathogenic" "" "0000066198" "0" "90" "1" "197404669" "197404669" "subst" "0.0000204062" "01251" "CRB1_000115" "g.197404669G>T" "" "{PMID:Li 2014:24535598}" "MluCI+;NlaIV-;XcmI-" "" "" "Germline" "" "" "0" "" "" "g.197435539G>T" "" "pathogenic" "" "0000066199" "0" "70" "1" "197390799" "197390799" "subst" "0.000020326" "01251" "CRB1_000103" "g.197390799G>T" "" "{PMID:Li 2014:24535598}" "-" "" "" "Germline" "" "" "0" "" "" "g.197421669G>T" "" "likely pathogenic" "" "0000066200" "0" "70" "1" "197411408" "197411408" "subst" "0.00002031" "01251" "CRB1_000051" "g.197411408C>T" "" "{PMID:Li 2014:24535598}" "AfeI-;HaeII-;HhaI-;HinP1I-" "" "" "Germline" "" "" "0" "" "" "g.197442278C>T" "" "likely pathogenic" "" "0000066201" "0" "90" "1" "197411424" "197411424" "subst" "0" "01251" "CRB1_000094" "g.197411424T>G" "" "{PMID:Li 2014:24535598}" "-" "" "" "Germline" "" "" "0" "" "" "g.197442294T>G" "" "pathogenic" "" "0000066203" "0" "70" "1" "197446995" "197446995" "subst" "0" "01251" "CRB1_000047" "g.197446995G>C" "" "{PMID:Yang 2014:24715753}" "AlwNI+;BslI-" "" "" "Germline" "" "" "0" "" "" "g.197477865G>C" "" "likely pathogenic" "" "0000066204" "0" "70" "1" "197446995" "197446995" "subst" "0" "01251" "CRB1_000047" "g.197446995G>C" "" "{PMID:Yang 2014:24715753}" "AlwNI+;BslI-" "" "" "Germline" "" "" "0" "" "" "g.197477865G>C" "" "likely pathogenic" "" "0000066205" "0" "70" "1" "197446995" "197446995" "subst" "0" "01251" "CRB1_000047" "g.197446995G>C" "" "{PMID:Yang 2014:24715753}" "AlwNI+;BslI-" "" "" "Germline" "" "" "0" "" "" "g.197477865G>C" "" "likely pathogenic" "" "0000066206" "0" "90" "1" "197404052" "197404052" "del" "0" "01251" "CRB1_000161" "g.197404052del" "" "{PMID:Yang 2014:24715753}" "MwoI+" "c.3059delT" "" "Germline" "" "" "0" "" "" "g.197434922del" "" "pathogenic" "" "0000066207" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Yang 2014:24715753}" "BsmI+" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066208" "0" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "01251" "CRB1_000017" "g.197390534C>T" "" "{PMID:Yang 2014:24715753}" "AcuI+" "" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "" "0000066209" "21" "70" "1" "197446930" "197446930" "subst" "0" "01251" "CRB1_000015" "g.197446930C>T" "" "{PMID:Tsang 2014:24811962}" "BbvCI+;Bpu10I+;BseYI-" "P1381L" "" "Germline" "" "" "0" "" "" "g.197477800C>T" "" "likely pathogenic" "" "0000066210" "21" "70" "1" "197446930" "197446930" "subst" "0" "01251" "CRB1_000015" "g.197446930C>T" "" "{PMID:Tsang 2014:24811962}" "BbvCI+;Bpu10I+;BseYI-" "P1381L" "" "Germline" "" "" "0" "" "" "g.197477800C>T" "" "likely pathogenic" "" "0000066211" "0" "70" "1" "197404300" "197404300" "subst" "0.0000285556" "01251" "CRB1_000188" "g.197404300G>A" "" "{PMID:Watson 2014:25133751}" "-" "" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "likely pathogenic" "" "0000066212" "20" "90" "1" "197404472" "197404472" "del" "0" "01251" "CRB1_000080" "g.197404472del" "" "{PMID:Luhmann 2014:25147295}" "MspJI-" "c.3481delC" "mouse model" "Germline" "" "" "0" "" "" "g.197435342del" "" "pathogenic" "" "0000066213" "0" "90" "1" "197298135" "197298135" "dup" "0" "01251" "CRB1_000178" "g.197298135dup" "" "{PMID:Kuniyoshi 2015:25323024}" "-" "c.652+1_652+2insT" "" "Germline" "" "" "0" "" "" "g.197329005dup" "" "pathogenic" "" "0000066214" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Booij 2011:20801516}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066215" "20" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:González-del Pozo 2011:22164218}" "" "" "not in 100 controls" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066216" "0" "90" "1" "197404706" "197404709" "dup" "0" "01251" "CRB1_000190" "g.197404706_197404709dup" "" "{PMID:Coppieters 2012:22261762}" "" "c.3713_3716dup (p.Cys1240ProfsX24)" "" "Germline" "" "" "0" "" "" "g.197435576_197435579dup" "" "pathogenic" "" "0000066217" "20" "70" "1" "197297561" "197297561" "subst" "0.00000406981" "01251" "CRB1_000063" "g.197297561G>T" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197328431G>T" "" "likely pathogenic" "" "0000066218" "20" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "01251" "CRB1_000021" "g.197396689C>T" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000066219" "20" "70" "1" "197404488" "197404488" "subst" "0" "01251" "CRB1_000037" "g.197404488T>G" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197435358T>G" "" "likely pathogenic" "" "0000066220" "20" "70" "1" "197404488" "197404488" "subst" "0" "01251" "CRB1_000037" "g.197404488T>G" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197435358T>G" "" "likely pathogenic" "" "0000066221" "20" "70" "1" "197297561" "197297561" "subst" "0.00000406981" "01251" "CRB1_000063" "g.197297561G>T" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197328431G>T" "" "likely pathogenic" "" "0000066222" "20" "90" "1" "197390982" "197390982" "subst" "0" "01251" "CRB1_000227" "g.197390982G>A" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197421852G>A" "" "pathogenic" "" "0000066223" "20" "70" "1" "197390387" "197390387" "subst" "0" "01251" "CRB1_000038" "g.197390387G>A" "" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.197421257G>A" "" "likely pathogenic" "" "0000066224" "20" "70" "1" "197390417" "197390417" "subst" "0" "01251" "CRB1_000201" "g.197390417T>C" "" "{PMID:Eisenberger 2013:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.197421287T>C" "" "likely pathogenic" "" "0000066225" "0" "70" "1" "197396763" "197396763" "subst" "0.00000407216" "01251" "CRB1_000121" "g.197396763G>C" "" "{PMID:Eisenberger 2013:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.197427633G>C" "" "likely pathogenic" "" "0000066226" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "01251" "CRB1_000007" "g.197396856A>T" "" "{PMID:Eisenberger 2013:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000066227" "20" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Glockle 2013:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066228" "20" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Glockle 2013:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000066229" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01251" "CRB1_000005" "g.197396745C>T" "" "{PMID:Glockle 2013:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000066230" "20" "70" "1" "197396703" "197396703" "subst" "0" "01251" "CRB1_000056" "g.197396703G>A" "" "{PMID:Glockle 2013:23591405}" "" "c.2248G>A, p.G750S" "" "Germline" "" "" "0" "" "" "g.197427573G>A" "" "likely pathogenic" "" "0000066231" "20" "90" "1" "197298094" "197298100" "del" "0" "01251" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Wang 2013:23847139}" "" "c.610_616del, p.I205DfsX133" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000066232" "0" "90" "1" "197403938" "197403938" "subst" "0" "01251" "CRB1_000146" "g.197403938C>A" "" "{PMID:Wang 2013:23847139}" "" "c.2945C>A, p.T982K" "" "Germline" "" "" "0" "" "" "g.197434808C>A" "" "pathogenic" "" "0000066233" "20" "90" "1" "197411413" "197411413" "subst" "0" "01251" "CRB1_000054" "g.197411413C>A" "" "{PMID:Wang 2013:23847139}" "" "c.3996C>A, p.C1332X" "" "Germline" "" "" "0" "" "" "g.197442283C>A" "" "pathogenic" "" "0000066234" "20" "90" "1" "197316605" "197316605" "subst" "0" "01251" "CRB1_000220" "g.197316605G>A" "" "{PMID:Wang 2013:23847139}" "" "" "" "Germline" "" "" "0" "" "" "g.197347475G>A" "" "pathogenic" "" "0000066235" "20" "90" "1" "197404680" "197404680" "subst" "0" "01251" "CRB1_000189" "g.197404680C>A" "" "{PMID:Wang 2013:23847139}" "" "G1229X" "" "Germline" "" "" "0" "" "" "g.197435550C>A" "" "pathogenic" "" "0000066236" "20" "90" "1" "197390397" "197390397" "subst" "0.00000812249" "01251" "CRB1_000198" "g.197390397G>C" "" "{PMID:Wang 2013:23847139}" "" "" "" "Germline" "" "" "0" "" "" "g.197421267G>C" "" "pathogenic" "" "0000066237" "0" "90" "1" "197297619" "197297619" "del" "0" "01251" "CRB1_000066" "g.197297619del" "" "{PMID:Huang 2014:25356976}" "" "c.137delA" "" "Germline" "" "" "0" "" "" "g.197328489del" "" "pathogenic" "" "0000066238" "20" "90" "1" "197404669" "197404669" "subst" "0.0000204062" "01251" "CRB1_000115" "g.197404669G>T" "" "{PMID:Huang 2014:25356976}" "" "G1226X" "" "Germline" "" "" "0" "" "" "g.197435539G>T" "" "pathogenic" "" "0000066239" "0" "90" "1" "197390943" "197390943" "subst" "0" "01251" "CRB1_000235" "g.197390943C>A" "" "{PMID:Huang 2014:25356976}" "" "" "" "Germline" "" "" "0" "" "" "g.197421813C>A" "" "pathogenic" "" "0000066240" "0" "70" "1" "197404435" "197404435" "subst" "0" "01251" "CRB1_000074" "g.197404435T>C" "" "{PMID:Huang 2014:25356976}" "" "" "" "Germline" "" "" "0" "" "" "g.197435305T>C" "" "likely pathogenic" "" "0000066241" "0" "70" "1" "197396953" "197396953" "subst" "0" "01251" "CRB1_000164" "g.197396953G>A" "" "{PMID:Huang 2014:25356976}" "" "" "" "Germline" "" "" "0" "" "" "g.197427823G>A" "" "likely pathogenic" "" "0000066242" "20" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "01251" "CRB1_000017" "g.197390534C>T" "" "{PMID:Oishi 2014:25324289}" "" "" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "" "0000066243" "0" "70" "1" "197398711" "197398711" "subst" "0.000235799" "01251" "CRB1_000141" "g.197398711G>A" "" "{PMID:Xu 2014:24938718}" "" "c.2809G>A p.A937T" "" "Germline" "" "" "0" "" "" "g.197429581G>A" "" "likely pathogenic" "" "0000082498" "1" "50" "1" "197403836" "197403836" "subst" "0.000211939" "01424" "CRB1_000001" "g.197403836G>A" "" "{PMID:Vallespin 2007:18055816}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "VUS" "" "0000162805" "3" "90" "1" "197297914" "197297914" "subst" "0" "01769" "CRB1_000237" "g.197297914T>C" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "needs Curator approval" "" "g.197328784T>C" "" "pathogenic" "" "0000170922" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "01244" "CRB1_000030" "g.197398590T>A" "" "{PMID:de Castro-Miró 2016:28005958}" "" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "ACMG" "0000170923" "0" "70" "1" "197398744" "197398744" "subst" "0" "01244" "CRB1_000238" "g.197398744T>C" "" "{PMID:de Castro-Miró 2016:28005958}" "" "" "" "Germline" "" "" "0" "" "" "g.197429614T>C" "" "likely pathogenic" "ACMG" "0000170943" "3" "70" "1" "197390660" "197390660" "subst" "0" "01244" "CRB1_000234" "g.197390660C>T" "" "{PMID:de Castro-Miró 2014:24516651}" "" "" "" "Germline" "" "" "0" "" "" "g.197421530C>T" "" "likely pathogenic" "" "0000170944" "2" "90" "1" "197404744" "197404745" "del" "0" "01244" "CRB1_000072" "g.197404744_197404745del" "" "{PMID:de Castro-Miró 2014:24516651}" "" "" "" "Germline" "" "" "0" "" "" "g.197435614_197435615del" "" "pathogenic" "" "0000170945" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01244" "CRB1_000001" "g.197403836G>A" "" "{PMID:de Castro-Miró 2014:24516651}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000170946" "3" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "01244" "CRB1_000005" "g.197396745C>T" "" "{PMID:de Castro-Miró 2014:24516651}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000170947" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01244" "CRB1_000001" "g.197403836G>A" "" "{PMID:de Castro-Miró 2014:24516651}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000170948" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01244" "CRB1_000001" "g.197403836G>A" "" "{PMID:de Castro-Miró 2014:24516651}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000170964" "0" "70" "1" "197390660" "197390660" "subst" "0" "01244" "CRB1_000234" "g.197390660C>T" "" "{PMID:de Castro-Miró 2016:28005958}" "" "" "" "Germline" "" "" "0" "" "" "g.197421530C>T" "" "VUS" "ACMG" "0000170971" "3" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01244" "CRB1_000001" "g.197403836G>A" "" "{PMID:de Castro-Miró 2014:24516651}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000245399" "0" "10" "1" "197298081" "197298081" "subst" "0.000731957" "02330" "CRB1_000243" "g.197298081A>G" "" "" "" "CRB1(NM_001257965.1):c.393A>G (p.T131=), CRB1(NM_001257965.2):c.393A>G (p.T131=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197328951A>G" "" "benign" "" "0000245441" "0" "10" "1" "197390944" "197390944" "subst" "0.000674885" "02330" "CRB1_000248" "g.197390944A>G" "" "" "" "CRB1(NM_001257965.2):c.1779A>G (p.S593=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197421814A>G" "" "benign" "" "0000245589" "0" "50" "1" "197396853" "197396853" "subst" "0.000146654" "02330" "CRB1_000250" "g.197396853A>G" "" "" "" "CRB1(NM_001257965.2):c.2191A>G (p.I731V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197427723A>G" "" "VUS" "" "0000248476" "0" "10" "1" "197390368" "197390368" "subst" "0.982345" "02325" "CRB1_000246" "g.197390368A>G" "" "" "" "CRB1(NM_001257965.2):c.1203A>G (p.L401=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "benign" "" "0000248964" "0" "10" "1" "197297540" "197297540" "subst" "0.447651" "02325" "CRB1_000239" "g.197297540A>T" "" "" "" "CRB1(NM_001257965.2):c.-137-12A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197328410A>T" "" "benign" "" "0000254124" "0" "30" "1" "197298081" "197298081" "subst" "0.000731957" "01943" "CRB1_000243" "g.197298081A>G" "" "" "" "CRB1(NM_001257965.1):c.393A>G (p.T131=), CRB1(NM_001257965.2):c.393A>G (p.T131=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197328951A>G" "" "likely benign" "" "0000256527" "0" "50" "1" "197404057" "197404057" "subst" "0.00000407007" "01943" "CRB1_000253" "g.197404057A>T" "" "" "" "CRB1(NM_001257965.1):c.2992A>T (p.S998C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197434927A>T" "" "VUS" "" "0000264996" "0" "90" "1" "197390303" "197390303" "subst" "0" "02330" "CRB1_000152" "g.197390303C>T" "" "" "" "CRB1(NM_001257965.2):c.1138C>T (p.Q380*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197421173C>T" "" "pathogenic" "" "0000264997" "0" "90" "1" "197390799" "197390799" "subst" "0.000020326" "02330" "CRB1_000103" "g.197390799G>T" "" "" "" "CRB1(NM_001257965.2):c.1634G>T (p.G545V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197421669G>T" "" "pathogenic" "" "0000264998" "0" "10" "1" "197391061" "197391061" "subst" "0.00108115" "02330" "CRB1_000249" "g.197391061C>G" "" "" "" "CRB1(NM_001257965.1):c.1896C>G (p.P632=), CRB1(NM_001257965.2):c.1896C>G (p.P632=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197421931C>G" "" "benign" "" "0000264999" "0" "30" "1" "197398216" "197398216" "subst" "0" "02330" "CRB1_000251" "g.197398216T>C" "" "" "" "CRB1(NM_001257965.2):c.2582T>C (p.F861S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197429086T>C" "" "likely benign" "" "0000265000" "0" "50" "1" "197297979" "197297987" "del" "0" "02330" "CRB1_000241" "g.197297979_197297987del" "" "" "" "CRB1(NM_001257965.1):c.291_299delAATTGATGG (p.I98_G100del), CRB1(NM_001257965.2):c.291_299delAATTGATGG (p.I98_G100del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197328849_197328857del" "" "VUS" "" "0000265001" "0" "90" "1" "197403976" "197403976" "subst" "0" "02330" "CRB1_000157" "g.197403976G>T" "" "" "" "CRB1(NM_001257965.2):c.2911G>T (p.E971*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197434846G>T" "" "pathogenic" "" "0000265002" "0" "90" "1" "197404115" "197404115" "subst" "0.0000122034" "02330" "CRB1_000163" "g.197404115T>C" "" "" "" "CRB1(NM_001257965.2):c.3050T>C (p.M1017T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197434985T>C" "" "pathogenic" "" "0000265003" "0" "30" "1" "197298000" "197298000" "subst" "0.00000406227" "02330" "CRB1_000242" "g.197298000C>T" "" "" "" "CRB1(NM_001257965.2):c.312C>T (p.F104=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197328870C>T" "" "likely benign" "" "0000265004" "0" "10" "1" "197404386" "197404386" "subst" "0.0000448255" "02330" "CRB1_000254" "g.197404386T>C" "" "" "" "CRB1(NM_001257965.2):c.3321T>C (p.N1107=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197435256T>C" "" "benign" "" "0000265005" "0" "50" "1" "197298095" "197298095" "subst" "0.000591041" "02330" "CRB1_000002" "g.197298095T>C" "" "" "" "CRB1(NM_001257965.1):c.407T>C (p.I136T), CRB1(NM_001257965.2):c.407T>C (p.I136T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197328965T>C" "" "VUS" "" "0000265006" "0" "10" "1" "197326115" "197326115" "subst" "0.00000406065" "02330" "CRB1_000244" "g.197326115T>C" "" "" "" "CRB1(NM_001257965.2):c.936T>C (p.Y312=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197356985T>C" "" "benign" "" "0000265007" "0" "10" "1" "197390110" "197390110" "subst" "0.0000245166" "02330" "CRB1_000245" "g.197390110C>T" "" "" "" "CRB1(NM_001257965.2):c.965-20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197420980C>T" "" "benign" "" "0000274384" "0" "50" "1" "197297616" "197297616" "subst" "0.000381803" "01943" "CRB1_000031" "g.197297616C>G" "" "" "" "CRB1(NM_201253.2):c.135C>G (p.C45W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197328486C>G" "" "VUS" "" "0000274385" "0" "30" "1" "197390605" "197390605" "subst" "0.000564756" "01943" "CRB1_000226" "g.197390605T>C" "" "" "" "CRB1(NM_001257965.1):c.1440T>C (p.N480=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197421475T>C" "" "likely benign" "" "0000274386" "0" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "01943" "CRB1_000005" "g.197396745C>T" "" "" "" "CRB1(NM_001257965.1):c.2083C>T (p.R695C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "" "0000274387" "0" "30" "1" "197396762" "197396762" "subst" "0.00162865" "01943" "CRB1_000120" "g.197396762C>T" "" "" "" "CRB1(NM_001257965.1):c.2100C>T (p.R700=), CRB1(NM_001257965.2):c.2100C>T (p.R700=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197427632C>T" "" "likely benign" "" "0000274388" "0" "30" "1" "197398248" "197398248" "subst" "0" "01943" "CRB1_000252" "g.197398248C>T" "" "" "" "CRB1(NM_001257965.1):c.2604+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197429118C>T" "" "likely benign" "" "0000274389" "0" "30" "1" "197398616" "197398616" "subst" "0.000272194" "01943" "CRB1_000138" "g.197398616G>A" "" "" "" "CRB1(NM_001257965.1):c.2642G>A (p.R881Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197429486G>A" "" "likely benign" "" "0000274390" "0" "50" "1" "197398711" "197398711" "subst" "0.000235799" "01943" "CRB1_000141" "g.197398711G>A" "" "" "" "CRB1(NM_001257965.1):c.2737G>A (p.A913T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197429581G>A" "" "VUS" "" "0000321223" "0" "50" "1" "197168772" "197168772" "subst" "0" "01804" "ZBTB41_000001" "g.197168772C>T" "" "" "" "ZBTB41(NM_194314.2):c.832G>A (p.(Asp278Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197199642C>T" "" "VUS" "" "0000321224" "0" "50" "1" "197390753" "197390753" "subst" "0" "01804" "CRB1_000247" "g.197390753C>T" "" "" "" "CRB1(NM_001193640.1):c.1459C>T (p.(Leu487Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197421623C>T" "" "VUS" "" "0000337428" "0" "10" "1" "197297540" "197297540" "subst" "0.447651" "02327" "CRB1_000239" "g.197297540A>T" "" "" "" "CRB1(NM_001257965.2):c.-137-12A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197328410A>T" "" "benign" "" "0000337429" "0" "50" "1" "197316444" "197316444" "subst" "0" "02327" "CRB1_000256" "g.197316444A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197347314A>G" "" "VUS" "" "0000337430" "0" "10" "1" "197391101" "197391101" "subst" "0.00410002" "02327" "CRB1_000259" "g.197391101A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197421971A>C" "" "benign" "" "0000337431" "0" "70" "1" "197398749" "197398749" "subst" "0.0000325529" "02327" "CRB1_000034" "g.197398749G>A" "" "" "" "CRB1(NM_001257965.1):c.2770+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197429619G>A" "" "likely pathogenic" "" "0000343262" "0" "50" "1" "197391014" "197391014" "subst" "0" "02327" "CRB1_000258" "g.197391014C>T" "" "" "" "CRB1(NM_001257965.2):c.1849C>T (p.R617C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197421884C>T" "" "VUS" "" "0000343345" "0" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "02327" "CRB1_000005" "g.197396745C>T" "" "" "" "CRB1(NM_001257965.1):c.2083C>T (p.R695C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "" "0000343349" "0" "10" "1" "197396761" "197396761" "subst" "0.00437325" "02327" "CRB1_000260" "g.197396761G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197427631G>A" "" "benign" "" "0000344258" "0" "70" "1" "197411297" "197411297" "subst" "0" "02327" "CRB1_000265" "g.197411297T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197442167T>C" "" "likely pathogenic" "" "0000344288" "0" "50" "1" "197297996" "197297996" "subst" "0.0000040625" "02327" "CRB1_000255" "g.197297996G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197328866G>C" "" "VUS" "" "0000344396" "0" "50" "1" "197297616" "197297616" "subst" "0.000381803" "02327" "CRB1_000031" "g.197297616C>G" "" "" "" "CRB1(NM_201253.2):c.135C>G (p.C45W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197328486C>G" "" "VUS" "" "0000344476" "0" "50" "1" "197398744" "197398744" "subst" "0" "02327" "CRB1_000262" "g.197398744T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197429614T>A" "" "VUS" "" "0000344791" "0" "90" "1" "197326056" "197326056" "subst" "0.0000081213" "02327" "CRB1_000223" "g.197326056C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197356926C>T" "" "pathogenic" "" "0000345044" "0" "90" "1" "197404165" "197404165" "subst" "0" "02327" "CRB1_000263" "g.197404165G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197435035G>T" "" "pathogenic" "" "0000345710" "0" "50" "1" "197446951" "197446951" "subst" "0.0000244586" "02327" "CRB1_000266" "g.197446951G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197477821G>A" "" "VUS" "" "0000346323" "0" "50" "1" "197398658" "197398658" "subst" "0" "02327" "CRB1_000261" "g.197398658G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197429528G>T" "" "VUS" "" "0000346855" "0" "90" "1" "197404412" "197404412" "subst" "0" "02327" "CRB1_000264" "g.197404412T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197435282T>A" "" "pathogenic" "" "0000347651" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "02327" "CRB1_000007" "g.197396856A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000348589" "0" "70" "1" "197396961" "197396961" "subst" "0.00019522" "02327" "CRB1_000026" "g.197396961C>A" "" "" "" "CRB1(NM_001257965.2):c.2299C>A (p.P767T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197427831C>A" "" "likely pathogenic" "" "0000348989" "0" "90" "1" "197390166" "197390166" "subst" "0" "02327" "CRB1_000148" "g.197390166C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197421036C>G" "" "pathogenic" "" "0000349620" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "02327" "CRB1_000021" "g.197396689C>T" "" "" "" "CRB1(NM_001257965.1):c.2027C>T (p.T676M), CRB1(NM_001257965.2):c.2027C>T (p.T676M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000349638" "0" "50" "1" "197396917" "197396917" "subst" "0.000240195" "02327" "CRB1_000129" "g.197396917C>T" "" "" "" "CRB1(NM_001257965.2):c.2255C>T (p.T752M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197427787C>T" "" "VUS" "" "0000349665" "0" "70" "1" "197403938" "197403938" "subst" "0" "02327" "CRB1_000146" "g.197403938C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197434808C>A" "" "likely pathogenic" "" "0000349672" "0" "90" "1" "197404145" "197404145" "subst" "0" "02327" "CRB1_000173" "g.197404145G>A" "" "" "" "CRB1(NM_201253.2):c.3152G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197435015G>A" "" "pathogenic" "" "0000350097" "0" "50" "1" "197390256" "197390256" "subst" "0.00000406194" "02327" "CRB1_000150" "g.197390256A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197421126A>G" "" "VUS" "" "0000351005" "0" "10" "1" "197447037" "197447037" "subst" "0.0615454" "02327" "CRB1_000267" "g.197447037T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.197477907T>C" "" "benign" "" "0000358236" "21" "90" "1" "197297905" "197297905" "subst" "0" "01243" "CRB1_000070" "g.197297905G>T" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.197328775G>T" "" "pathogenic" "" "0000358237" "21" "70" "1" "197297936" "197297936" "subst" "0" "01243" "CRB1_000218" "g.197297936G>A" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.197328806G>A" "" "likely pathogenic" "" "0000358238" "3" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01243" "CRB1_000132" "g.197326120G>A" "" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000358239" "0" "70" "1" "197326120" "197326120" "subst" "0.00000406065" "01243" "CRB1_000132" "g.197326120G>A" "" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000358240" "3" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "01243" "CRB1_000191" "g.197390691T>A" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.197421561T>A" "" "likely pathogenic" "" "0000358241" "3" "70" "1" "197390802" "197390802" "subst" "0" "01243" "CRB1_000105" "g.197390802G>T" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.197421672G>T" "" "likely pathogenic" "" "0000358242" "3" "90" "1" "197396685" "197396685" "subst" "0.0000122113" "01243" "CRB1_000268" "g.197396685C>T" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.197427555C>T" "" "pathogenic" "" "0000358243" "3" "70" "1" "197396953" "197396953" "subst" "0" "01243" "CRB1_000164" "g.197396953G>A" "" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "g.197427823G>A" "" "likely pathogenic (recessive)" "" "0000358244" "3" "90" "1" "197404300" "197404300" "subst" "0.0000285556" "01243" "CRB1_000188" "g.197404300G>A" "" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "" "3306G>A" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "pathogenic (recessive)" "" "0000358245" "3" "90" "1" "197446909" "197446918" "del" "0" "01243" "CRB1_000043" "g.197446909_197446918del" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.197477779_197477788del" "" "pathogenic" "" "0000358434" "11" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "01243" "CRB1_000017" "g.197390534C>T" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "" "0000358435" "11" "70" "1" "197397010" "197397010" "subst" "0.00000406759" "01243" "CRB1_000168" "g.197397010T>C" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.197427880T>C" "" "likely pathogenic" "" "0000358436" "0" "90" "1" "197398582" "197398586" "del" "0" "01243" "CRB1_000133" "g.197398582_197398586del" "" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "g.197429452_197429456del" "" "pathogenic" "" "0000438659" "1" "90" "1" "197396689" "197396689" "subst" "0.0000691884" "01244" "CRB1_000021" "g.197396689C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "pathogenic" "" "0000438660" "2" "90" "1" "197411405" "197411405" "subst" "0.0000040618" "01244" "CRB1_000050" "g.197411405G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.197442275G>T" "" "pathogenic" "" "0000438664" "1" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01244" "CRB1_000001" "g.197403836G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000438665" "2" "90" "1" "197411405" "197411405" "subst" "0.0000040618" "01244" "CRB1_000050" "g.197411405G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.197442275G>T" "" "pathogenic" "" "0000438672" "1" "90" "1" "197390403" "197390411" "del" "0" "01244" "CRB1_000269" "g.197390403_197390411del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.197421273_197421281del" "" "pathogenic" "" "0000438673" "2" "90" "1" "197398685" "197398685" "subst" "0" "01244" "CRB1_000270" "g.197398685G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.197429555G>A" "" "pathogenic" "" "0000438684" "3" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "01244" "CRB1_000005" "g.197396745C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "" "0000475799" "0" "90" "1" "197297564" "197297564" "dup" "0" "02591" "CRB1_000271" "g.197297564dup" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197328434dup" "" "pathogenic" "" "0000475800" "0" "90" "1" "197297621" "197297621" "dup" "0" "02591" "CRB1_000272" "g.197297621dup" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197328491dup" "" "pathogenic" "" "0000475801" "0" "50" "1" "197297759" "197297759" "subst" "0" "02591" "CRB1_000273" "g.197297759G>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197328629G>C" "" "VUS" "" "0000475802" "0" "50" "1" "197298067" "197298067" "subst" "0" "02591" "CRB1_000274" "g.197298067A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197328937A>G" "" "VUS" "" "0000475803" "0" "90" "1" "197298134" "197298134" "del" "0" "02591" "CRB1_000275" "g.197298134del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197329004del" "" "pathogenic" "" "0000475804" "0" "50" "1" "197313422" "197313422" "subst" "0.000676429" "02591" "CRB1_000276" "g.197313422G>A" "37/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs114846212" "0" "" "" "g.197344292G>A" "" "VUS" "" "0000475805" "0" "50" "1" "197313515" "197313515" "subst" "0" "02591" "CRB1_000277" "g.197313515G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197344385G>A" "" "VUS" "" "0000475806" "0" "50" "1" "197316597" "197316597" "subst" "0.0000121854" "02591" "CRB1_000278" "g.197316597C>T" "4/1201 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs773386179" "0" "" "" "g.197347467C>T" "" "VUS" "" "0000475807" "0" "50" "1" "197390147" "197390147" "subst" "0.000186946" "02591" "CRB1_000279" "g.197390147G>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs114264441" "0" "" "" "g.197421017G>C" "" "VUS" "" "0000475808" "0" "50" "1" "197390183" "197390183" "subst" "0" "02591" "CRB1_000280" "g.197390183G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197421053G>A" "" "VUS" "" "0000475809" "0" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "02591" "CRB1_000017" "g.197390534C>T" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs114342808" "0" "" "" "g.197421404C>T" "" "pathogenic" "" "0000475810" "0" "90" "1" "197390718" "197390718" "subst" "0" "02591" "CRB1_000197" "g.197390718G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197421588G>A" "" "pathogenic" "" "0000475811" "0" "50" "1" "197396664" "197396664" "subst" "0" "02591" "CRB1_000281" "g.197396664A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs142129159" "0" "" "" "g.197427534A>G" "" "VUS" "" "0000475812" "0" "90" "1" "197396685" "197396685" "subst" "0.0000122113" "02591" "CRB1_000268" "g.197396685C>T" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs150412614" "0" "" "" "g.197427555C>T" "" "pathogenic" "" "0000475813" "0" "10" "1" "197396761" "197396761" "subst" "0.00437325" "02591" "CRB1_000260" "g.197396761G>A" "180/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs62636287" "0" "" "" "g.197427631G>A" "" "benign" "" "0000475814" "0" "90" "1" "197396763" "197396763" "subst" "0.0000203608" "02591" "CRB1_000282" "g.197396763G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs767648174" "0" "" "" "g.197427633G>A" "" "pathogenic" "" "0000475815" "3" "50" "1" "197396818" "197396818" "subst" "0" "02591" "CRB1_000283" "g.197396818T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197427688T>C" "" "VUS" "" "0000475816" "0" "50" "1" "197396871" "197396871" "subst" "0.00000814564" "02591" "CRB1_000284" "g.197396871G>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs766411096" "0" "" "" "g.197427741G>C" "" "VUS" "" "0000475817" "0" "90" "1" "197396917" "197396917" "subst" "0.000240195" "02591" "CRB1_000129" "g.197396917C>T" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs142857810" "0" "" "" "g.197427787C>T" "" "pathogenic" "" "0000475818" "0" "50" "1" "197398108" "197398108" "subst" "0.0000405752" "02591" "CRB1_000285" "g.197398108A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197428978A>G" "" "VUS" "" "0000475819" "0" "90" "1" "197398616" "197398616" "subst" "0.000272194" "02591" "CRB1_000138" "g.197398616G>A" "15/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs114052315" "0" "" "" "g.197429486G>A" "" "pathogenic" "" "0000475820" "0" "90" "1" "197398711" "197398711" "subst" "0.000235799" "02591" "CRB1_000141" "g.197398711G>A" "6/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs114630940" "0" "" "" "g.197429581G>A" "" "pathogenic" "" "0000475821" "0" "50" "1" "197398724" "197398724" "subst" "0.0000121986" "02591" "CRB1_000286" "g.197398724C>T" "7/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs77334581" "0" "" "" "g.197429594C>T" "" "VUS" "" "0000475822" "0" "50" "1" "197404061" "197404061" "subst" "0" "02591" "CRB1_000287" "g.197404061T>G" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197434931T>G" "" "VUS" "" "0000475823" "0" "50" "1" "197404073" "197404073" "subst" "0" "02591" "CRB1_000288" "g.197404073A>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197434943A>T" "" "VUS" "" "0000475824" "0" "50" "1" "197404645" "197404645" "subst" "0.00000410132" "02591" "CRB1_000289" "g.197404645T>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197435515T>G" "" "VUS" "" "0000475825" "0" "10" "1" "197404688" "197404688" "subst" "0.0004488" "02591" "CRB1_000290" "g.197404688A>G" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs142090517" "0" "" "" "g.197435558A>G" "" "benign" "" "0000475826" "0" "50" "1" "197404703" "197404703" "subst" "0" "02591" "CRB1_000291" "g.197404703C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.197435573C>T" "" "VUS" "" "0000475827" "0" "50" "1" "197407751" "197407751" "subst" "0.000105739" "02591" "CRB1_000292" "g.197407751C>G" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs138089138" "0" "" "" "g.197438621C>G" "" "VUS" "" "0000477410" "3" "10" "1" "197396761" "197396761" "subst" "0.00437325" "02591" "CRB1_000260" "g.197396761G>A" "10/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs62636287" "0" "" "" "g.197427631G>A" "" "benign" "" "0000487553" "11" "70" "1" "197398699" "197398699" "subst" "0" "03335" "CRB1_000293" "g.197398699T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.197429569T>C" "" "pathogenic (recessive)" "" "0000487554" "0" "70" "1" "197404151" "197404151" "subst" "0" "03335" "CRB1_000294" "g.197404151T>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.197435021T>A" "" "pathogenic (recessive)" "" "0000487555" "0" "90" "1" "197407749" "197407749" "subst" "0" "03335" "CRB1_000295" "g.197407749C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.197438619C>A" "" "pathogenic (recessive)" "" "0000504673" "0" "50" "1" "197168819" "197168823" "del" "0" "01804" "CRB1_000296" "g.197168819_197168823del" "" "" "" "ZBTB41(NM_194314.2):c.784_788del (p.(Lys262Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197199689_197199693del" "" "VUS" "" "0000504674" "0" "50" "1" "197297616" "197297616" "subst" "0.000381803" "02330" "CRB1_000031" "g.197297616C>G" "" "" "" "CRB1(NM_201253.2):c.135C>G (p.C45W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197328486C>G" "" "VUS" "" "0000504675" "0" "30" "1" "197297757" "197297757" "subst" "0.00000406118" "01804" "CRB1_000297" "g.197297757G>C" "" "" "" "CRB1(NM_001193640.1):c.276G>C (p.(Arg92Ser)), CRB1(NM_001257965.1):c.69G>C (p.R23S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197328627G>C" "" "likely benign" "" "0000504676" "0" "70" "1" "197297842" "197297842" "del" "0" "02330" "CRB1_000298" "g.197297842del" "" "" "" "CRB1(NM_001257965.2):c.154delC (p.H52Mfs*27)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197328712del" "" "likely pathogenic" "" "0000504677" "0" "30" "1" "197297965" "197297965" "subst" "0.00128897" "02327" "CRB1_000035" "g.197297965G>A" "" "" "" "CRB1(NM_001257965.1):c.277G>A (p.V93M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197328835G>A" "" "likely benign" "" "0000504678" "0" "50" "1" "197297979" "197297987" "del" "0" "01943" "CRB1_000211" "g.197297979_197297987del" "" "" "" "CRB1(NM_001257965.1):c.291_299delAATTGATGG (p.I98_G100del), CRB1(NM_001257965.2):c.291_299delAATTGATGG (p.I98_G100del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197328849_197328857del" "" "VUS" "" "0000504679" "0" "50" "1" "197390751" "197390751" "subst" "0.00000406646" "01943" "CRB1_000299" "g.197390751C>T" "" "" "" "CRB1(NM_001193640.1):c.1457C>T (p.(Pro486Leu)), CRB1(NM_001257965.1):c.1586C>T (p.P529L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197421621C>T" "" "VUS" "" "0000504680" "0" "50" "1" "197390751" "197390751" "subst" "0.00000406646" "01804" "CRB1_000299" "g.197390751C>T" "" "" "" "CRB1(NM_001193640.1):c.1457C>T (p.(Pro486Leu)), CRB1(NM_001257965.1):c.1586C>T (p.P529L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197421621C>T" "" "VUS" "" "0000504681" "0" "70" "1" "197390850" "197390850" "subst" "0.00000406455" "02330" "CRB1_000257" "g.197390850A>G" "" "" "" "CRB1(NM_001257965.2):c.1685A>G (p.Y562C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197421720A>G" "" "likely pathogenic" "" "0000504682" "0" "50" "1" "197390919" "197390919" "subst" "0" "01943" "CRB1_000300" "g.197390919C>T" "" "" "" "CRB1(NM_001257965.1):c.1754C>T (p.T585I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197421789C>T" "" "VUS" "" "0000504683" "0" "50" "1" "197391014" "197391014" "subst" "0" "02330" "CRB1_000258" "g.197391014C>T" "" "" "" "CRB1(NM_001257965.2):c.1849C>T (p.R617C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197421884C>T" "" "VUS" "" "0000504684" "0" "50" "1" "197391061" "197391061" "subst" "0.00108115" "01943" "CRB1_000249" "g.197391061C>G" "" "" "" "CRB1(NM_001257965.1):c.1896C>G (p.P632=), CRB1(NM_001257965.2):c.1896C>G (p.P632=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197421931C>G" "" "VUS" "" "0000504685" "0" "30" "1" "197396577" "197396577" "subst" "0" "02330" "CRB1_000301" "g.197396577A>G" "" "" "" "CRB1(NM_001257965.2):c.1922-7A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197427447A>G" "" "likely benign" "" "0000504686" "0" "90" "1" "197396689" "197396689" "subst" "0.0000691884" "02330" "CRB1_000021" "g.197396689C>T" "" "" "" "CRB1(NM_001257965.1):c.2027C>T (p.T676M), CRB1(NM_001257965.2):c.2027C>T (p.T676M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197427559C>T" "" "pathogenic" "" "0000504687" "0" "30" "1" "197396762" "197396762" "subst" "0.00162865" "02330" "CRB1_000120" "g.197396762C>T" "" "" "" "CRB1(NM_001257965.1):c.2100C>T (p.R700=), CRB1(NM_001257965.2):c.2100C>T (p.R700=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197427632C>T" "" "likely benign" "" "0000504688" "0" "50" "1" "197396953" "197396953" "subst" "0" "02327" "CRB1_000164" "g.197396953G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197427823G>A" "" "VUS" "" "0000504689" "0" "50" "1" "197398583" "197398583" "subst" "0.000142177" "01943" "CRB1_000134" "g.197398583A>G" "" "" "" "CRB1(NM_001257965.1):c.2609A>G (p.N870S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197429453A>G" "" "VUS" "" "0000504690" "0" "50" "1" "197398589" "197398589" "subst" "0" "02327" "CRB1_000302" "g.197398589G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197429459G>A" "" "VUS" "" "0000504691" "0" "30" "1" "197398595" "197398595" "subst" "0" "01804" "CRB1_000303" "g.197398595A>C" "" "" "" "CRB1(NM_001193640.1):c.2357A>C (p.(Asn786Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197429465A>C" "" "likely benign" "" "0000504692" "0" "30" "1" "197398708" "197398708" "subst" "0.0000406577" "01943" "CRB1_000304" "g.197398708G>A" "" "" "" "CRB1(NM_001257965.1):c.2734G>A (p.G912R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197429578G>A" "" "likely benign" "" "0000504693" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "02327" "CRB1_000001" "g.197403836G>A" "" "" "" "CRB1(NM_001257965.1):c.2771G>A (p.C924Y), CRB1(NM_001257965.2):c.2771G>A (p.C924Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197434706G>A" "" "pathogenic" "" "0000504694" "0" "30" "1" "197403969" "197403969" "subst" "0.000191415" "02330" "CRB1_000305" "g.197403969A>G" "" "" "" "CRB1(NM_001257965.2):c.2904A>G (p.A968=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197434839A>G" "" "likely benign" "" "0000504695" "0" "90" "1" "197403976" "197403976" "subst" "0" "02327" "CRB1_000157" "g.197403976G>T" "" "" "" "CRB1(NM_001257965.2):c.2911G>T (p.E971*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197434846G>T" "" "pathogenic" "" "0000504696" "0" "50" "1" "197403988" "197403988" "subst" "0.00000407256" "02330" "CRB1_000306" "g.197403988C>T" "" "" "" "CRB1(NM_001257965.2):c.2923C>T (p.L975F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197434858C>T" "" "VUS" "" "0000504697" "0" "50" "1" "197404214" "197404214" "subst" "0.0000122015" "02327" "CRB1_000096" "g.197404214T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197435084T>C" "" "VUS" "" "0000504698" "0" "50" "1" "197446848" "197446848" "subst" "0.000187588" "02330" "CRB1_000307" "g.197446848G>A" "" "" "" "CRB1(NM_001257965.2):c.3988G>A (p.A1330T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197477718G>A" "" "VUS" "" "0000504699" "0" "30" "1" "197446893" "197446893" "subst" "0.0000081622" "01943" "CRB1_000308" "g.197446893A>G" "" "" "" "CRB1(NM_001257965.1):c.4033A>G (p.T1345A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197477763A>G" "" "likely benign" "" "0000504700" "0" "70" "1" "197446956" "197446956" "subst" "0.00000815295" "02330" "CRB1_000045" "g.197446956C>T" "" "" "" "CRB1(NM_001257965.2):c.4096C>T (p.R1366*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197477826C>T" "" "likely pathogenic" "" "0000504701" "0" "50" "1" "197446959" "197446959" "subst" "0.0000203819" "02325" "CRB1_000309" "g.197446959G>C" "" "" "" "CRB1(NM_001257965.2):c.4099G>C (p.V1367L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197477829G>C" "" "VUS" "" "0000593697" "0" "70" "1" "197297979" "197297987" "del" "0" "01164" "CRB1_000211" "g.197297979_197297987del" "" "" "" "" "ACMG grading: PM3,PM4,PS4; reported in Corton 2013. Orphanet J Rare Dis 8: 20; Zaneveld 2015. Genet Med 17: 262; Carss 2017. Am J Hum Genet 100: 75; Birtel 2018. Sci Rep 8: 4824; Khan 2018. Eur J Hum Genet 26: 687-694" "Germline" "" "rs748136623" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "ACMG" "0000604395" "11" "70" "1" "197390166" "197390166" "subst" "0" "03508" "CRB1_000148" "g.197390166C>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.197421036C>G" "" "pathogenic (recessive)" "" "0000604396" "21" "70" "1" "197390534" "197390534" "subst" "0.0000324984" "03508" "CRB1_000017" "g.197390534C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "pathogenic (recessive)" "" "0000605050" "0" "30" "1" "197297964" "197297964" "subst" "0.0000569295" "02330" "CRB1_000310" "g.197297964C>T" "" "" "" "CRB1(NM_001257965.2):c.276C>T (p.A92=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197328834C>T" "" "likely benign" "" "0000605051" "0" "50" "1" "197396855" "197396855" "subst" "0" "01804" "CRB1_000311" "g.197396855C>G" "" "" "" "CRB1(NM_001193640.1):c.2064C>G (p.(Ile688Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197427725C>G" "" "VUS" "" "0000605052" "0" "50" "1" "197397091" "197397091" "subst" "0.0000244147" "01943" "CRB1_000312" "g.197397091T>C" "" "" "" "CRB1(NM_001257965.1):c.2429T>C (p.V810A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197427961T>C" "" "VUS" "" "0000605053" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "01943" "CRB1_000001" "g.197403836G>A" "" "" "" "CRB1(NM_001257965.1):c.2771G>A (p.C924Y), CRB1(NM_001257965.2):c.2771G>A (p.C924Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197434706G>A" "" "pathogenic" "" "0000605054" "0" "50" "1" "197404585" "197404585" "subst" "0.00000863379" "01943" "CRB1_000313" "g.197404585T>C" "" "" "" "CRB1(NM_001257965.1):c.3520T>C (p.Y1174H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197435455T>C" "" "VUS" "" "0000605055" "0" "90" "1" "197411405" "197411405" "del" "0" "02327" "CRB1_000314" "g.197411405del" "" "" "" "CRB1(NM_001257965.2):c.3916delG (p.E1306Sfs*11)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197442275del" "" "pathogenic" "" "0000605056" "0" "30" "1" "197411409" "197411409" "subst" "0.00149476" "02330" "CRB1_000041" "g.197411409G>A" "" "" "" "CRB1(NM_001257965.1):c.3920G>A (p.R1307H), CRB1(NM_001257965.2):c.3920G>A (p.R1307H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197442279G>A" "" "likely benign" "" "0000605057" "0" "30" "1" "197411409" "197411409" "subst" "0.00149476" "01943" "CRB1_000041" "g.197411409G>A" "" "" "" "CRB1(NM_001257965.1):c.3920G>A (p.R1307H), CRB1(NM_001257965.2):c.3920G>A (p.R1307H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197442279G>A" "" "likely benign" "" "0000620464" "0" "70" "1" "197396964" "197396964" "subst" "0" "02330" "CRB1_000165" "g.197396964G>C" "" "" "" "CRB1(NM_001257965.2):c.2302G>C (p.D768H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197427834G>C" "" "likely pathogenic" "" "0000620465" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "02330" "CRB1_000001" "g.197403836G>A" "" "" "" "CRB1(NM_001257965.1):c.2771G>A (p.C924Y), CRB1(NM_001257965.2):c.2771G>A (p.C924Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197434706G>A" "" "pathogenic" "" "0000647499" "1" "50" "1" "197297965" "197297965" "subst" "0.00128897" "03575" "CRB1_000035" "g.197297965G>A" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; {DB:CLININrs137853138}" "Germline" "" "rs137853138" "0" "" "" "g.197328835G>A" "" "VUS" "" "0000647500" "1" "90" "1" "197396689" "197396689" "subst" "0.0000691884" "03575" "CRB1_000021" "g.197396689C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs28939720}" "Germline" "" "rs28939720" "0" "" "" "g.197427559C>T" "" "pathogenic" "" "0000647501" "1" "90" "1" "197403976" "197403976" "subst" "0" "03575" "CRB1_000157" "g.197403976G>T" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs62635655}" "Germline" "" "rs62635655" "0" "" "" "g.197434846G>T" "" "pathogenic" "" "0000653094" "1" "90" "1" "197404292" "197404292" "subst" "0" "03575" "CRB1_000099" "g.197404292T>G" "1/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs62635659.1}" "Germline" "" "rs62635659" "0" "" "" "g.197435162T>G" "" "pathogenic" "" "0000653482" "0" "90" "1" "197398714" "197398714" "subst" "0" "01807" "CRB1_000315" "g.197398714C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.197429584C>T" "" "pathogenic" "" "0000653841" "0" "90" "1" "197397133" "197397133" "subst" "0" "02327" "CRB1_000316" "g.197397133T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.197428003T>C" "" "pathogenic" "" "0000675590" "0" "50" "1" "197398679" "197398679" "subst" "0" "01943" "CRB1_000317" "g.197398679A>G" "" "" "" "CRB1(NM_001257965.1):c.2705A>G (p.Q902R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000684423" "3" "70" "1" "197411411" "197411411" "subst" "0" "00004" "CRB1_000321" "g.197411411T>G" "" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "Germline" "" "" "0" "" "" "g.197442281T>G" "" "likely pathogenic (recessive)" "" "0000684519" "1" "70" "1" "197298095" "197298095" "subst" "0.000591041" "00004" "CRB1_000002" "g.197298095T>C" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000684520" "1" "70" "1" "197316487" "197316487" "subst" "0.000479235" "00004" "CRB1_000180" "g.197316487C>T" "2/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000684521" "1" "70" "1" "197390625" "197390625" "subst" "0" "00004" "CRB1_000319" "g.197390625T>C" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "NM_001257965.1:c.1460T>C" "" "Germline" "" "" "0" "" "" "g.197421495T>C" "" "likely pathogenic" "" "0000684522" "1" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00004" "CRB1_000005" "g.197396745C>T" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000684523" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00004" "CRB1_000001" "g.197403836G>A" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "NM_001257965.1:c.2771G>A" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000684627" "3" "70" "1" "197297588" "197297588" "subst" "0" "00004" "CRB1_000064" "g.197297588C>G" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000684628" "3" "70" "1" "197411413" "197411413" "subst" "0" "00004" "CRB1_000054" "g.197411413C>A" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000685165" "0" "90" "1" "197297905" "197297905" "subst" "0" "00004" "CRB1_000070" "g.197297905G>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685166" "0" "90" "1" "197297905" "197297905" "subst" "0" "00004" "CRB1_000070" "g.197297905G>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685167" "0" "70" "1" "197297936" "197297936" "subst" "0" "00004" "CRB1_000218" "g.197297936G>A" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685168" "0" "90" "1" "197313541" "197313541" "subst" "0" "00004" "CRB1_000318" "g.197313541T>A" "2/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685171" "0" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "00004" "CRB1_000017" "g.197390534C>T" "2/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685172" "0" "70" "1" "197390625" "197390625" "subst" "0" "00004" "CRB1_000319" "g.197390625T>C" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685173" "0" "70" "1" "197390691" "197390691" "subst" "0.00000406762" "00004" "CRB1_000191" "g.197390691T>A" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685174" "0" "70" "1" "197390802" "197390802" "subst" "0" "00004" "CRB1_000105" "g.197390802G>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685175" "0" "90" "1" "197396685" "197396685" "subst" "0.0000122113" "00004" "CRB1_000268" "g.197396685C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685176" "3" "90" "1" "197396953" "197396953" "subst" "0" "00004" "CRB1_000164" "g.197396953G>A" "2/2420 IRD families" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000685177" "0" "70" "1" "197397010" "197397010" "subst" "0.00000406759" "00004" "CRB1_000168" "g.197397010T>C" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685178" "0" "90" "1" "197398582" "197398586" "del" "0" "00004" "CRB1_000133" "g.197398582_197398586del" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685179" "3" "90" "1" "197404300" "197404300" "subst" "0.0000285556" "00004" "CRB1_000188" "g.197404300G>A" "3/2420 IRD families" "{PMID:Sharon 2015:26261414}, {PMID:Sharon 2019:31456290}" "" "3306G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000685180" "0" "90" "1" "197404300" "197404300" "subst" "0.0000285556" "00004" "CRB1_000188" "g.197404300G>A" "3/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685181" "0" "70" "1" "197411408" "197411408" "subst" "0" "00004" "CRB1_000320" "g.197411408C>G" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685182" "0" "90" "1" "197411423" "197411423" "subst" "0.00000406204" "00004" "CRB1_000092" "g.197411423G>A" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685183" "0" "90" "1" "197446909" "197446918" "del" "0" "00004" "CRB1_000043" "g.197446909_197446918del" "4/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000687977" "0" "30" "1" "197297623" "197297623" "subst" "0.00000406144" "01943" "CRB1_000322" "g.197297623T>A" "" "" "" "CRB1(NM_201253.2):c.142T>A (p.F48I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000687978" "0" "30" "1" "197297757" "197297757" "subst" "0.00000406118" "01943" "CRB1_000297" "g.197297757G>C" "" "" "" "CRB1(NM_001193640.1):c.276G>C (p.(Arg92Ser)), CRB1(NM_001257965.1):c.69G>C (p.R23S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000704000" "3" "70" "1" "197396991" "197396991" "subst" "0.0000122002" "00008" "CRB1_000024" "g.197396991G>A" "" "{PMID:Khaliq 2003:12573663}" "" "2536G>A / Gly846Arg" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000704001" "3" "70" "1" "197404340" "197404340" "subst" "0" "00008" "CRB1_000323" "g.197404340T>C" "" "{PMID:Khaliq 2003:12573663}" "" "3347T>C / Leu1071Pro" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000704002" "3" "70" "1" "" "" "subst" "" "00008" "NPHS2_000000" "g.?" "" "{PMID:Khaliq 2003:12573663}" "" "3101T>C / Leu989Thr" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000710217" "1" "90" "1" "197326097" "197326097" "subst" "0" "00006" "CRB1_000192" "g.197326097C>G" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.197356967C>G" "" "pathogenic" "" "0000710231" "3" "90" "1" "197326097" "197326097" "subst" "0" "00006" "CRB1_000192" "g.197326097C>G" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.197356967C>G" "" "pathogenic" "" "0000710244" "3" "90" "1" "197404007" "197404007" "subst" "0.0000244351" "00006" "CRB1_000159" "g.197404007A>T" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.197434877A>T" "" "pathogenic" "" "0000710252" "1" "90" "1" "197407749" "197407749" "subst" "0" "00006" "CRB1_000295" "g.197407749C>A" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "ACMG PVS1, PM2, PP4" "Germline" "" "" "0" "" "" "g.197438619C>A" "" "pathogenic" "ACMG" "0000710257" "3" "90" "1" "197396961" "197396961" "subst" "0.00019522" "00006" "CRB1_000026" "g.197396961C>A" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.197427831C>A" "" "pathogenic" "" "0000710275" "1" "90" "1" "197298094" "197298100" "del" "0" "00006" "CRB1_000175" "g.197298094_197298100del" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "613_619delATAGGAA" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic" "" "0000710309" "3" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "00006" "CRB1_000005" "g.197396745C>T" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "" "0000710313" "3" "90" "1" "197316557" "197316557" "subst" "0" "00006" "CRB1_000027" "g.197316557T>G" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.197347427T>G" "" "pathogenic" "" "0000710324" "1" "50" "1" "197396745" "197396745" "subst" "0.0000773427" "00006" "CRB1_000005" "g.197396745C>T" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "VUS" "" "0000710332" "2" "70" "1" "197404151" "197404151" "subst" "0" "00006" "CRB1_000294" "g.197404151T>A" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "ACMG PM2, PM3, PM5, PP3, PP4" "Germline" "" "" "0" "" "" "g.197435021T>A" "" "likely pathogenic" "ACMG" "0000710344" "2" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "00006" "CRB1_000005" "g.197396745C>T" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "" "0000710351" "2" "70" "1" "197398699" "197398699" "subst" "0" "00006" "CRB1_000293" "g.197398699T>C" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "ACMG PM1, PM2, PM3, PP3, PP4" "Germline" "" "" "0" "" "" "g.197429569T>C" "" "likely pathogenic" "ACMG" "0000711699" "1" "70" "1" "197396928" "197396928" "subst" "0.0000366321" "00008" "CRB1_000324" "g.197396928G>A" "" "{PMID:Mandal 2005:16123440}" "" "G2473A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000713270" "3" "90" "1" "197390631" "197390631" "subst" "0.0000325103" "00000" "CRB1_000330" "g.197390631T>C" "" "{PMID:Carss 2017:28041643}" "" "1:197390631T>C ENST00000367400.3:c.1673T>C (Ile558Thr)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713283" "3" "90" "1" "197390871" "197390871" "subst" "0.000016259" "00000" "CRB1_000332" "g.197390871C>T" "" "{PMID:Carss 2017:28041643}" "" "1:197390871C>T ENST00000367400.3:c.1913C>T (Ser638Leu)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713284" "3" "90" "1" "197397094" "197397094" "subst" "0" "00000" "CRB1_000335" "g.197397094A>G" "" "{PMID:Carss 2017:28041643}" "" "1:197397094A>G ENST00000367400.3:c.2639A>G (Asn880Ser)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713290" "0" "90" "1" "197297735" "197297735" "subst" "0" "00000" "CRB1_000325" "g.197297735G>A" "" "{PMID:Carss 2017:28041643}" "" "1:197297735G>A ENST00000367400.3:c.254G>A (Cys85Tyr)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713294" "3" "90" "1" "197404669" "197404669" "subst" "0.0000204062" "00000" "CRB1_000115" "g.197404669G>T" "" "{PMID:Carss 2017:28041643}" "" "1:197404669G>T ENST00000367400.3:c.3676G>T (Gly1226Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713323" "0" "90" "1" "197390670" "197390670" "subst" "0.00000406643" "00000" "CRB1_000331" "g.197390670A>C" "" "{PMID:Carss 2017:28041643}" "" "1:197390670A>C ENST00000367400.3:c.1712A>C (Glu571Ala)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713324" "0" "90" "1" "197325978" "197325978" "subst" "0" "00000" "CRB1_000328" "g.197325978T>C" "" "{PMID:Carss 2017:28041643}" "" "1:197325978T>C ENST00000367400.3:c.1006T>C (Cys336Arg)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713354" "0" "90" "1" "197390141" "197390141" "subst" "0" "00000" "CRB1_000329" "g.197390141G>T" "" "{PMID:Carss 2017:28041643}" "" "1:197390141G>T ENST00000367400.3:c.1183G>T (Glu395Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713423" "0" "90" "1" "197297974" "197297982" "del" "0.000642125" "00000" "CRB1_000326" "g.197297974_197297982del" "" "{PMID:Carss 2017:28041643}" "" "1:197297973GGATGGAATT>G ENST00000367400.3:c.498_506delAATTGATGG (Ile167_Gly169del)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713447" "0" "90" "1" "197297974" "197297982" "del" "0.000642125" "00000" "CRB1_000326" "g.197297974_197297982del" "" "{PMID:Carss 2017:28041643}" "" "1:197297973GGATGGAATT>G ENST00000367400.3:c.498_506delAATTGATGG (Ile167_Gly169del)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713526" "0" "70" "1" "197398749" "197398749" "subst" "0.0000325529" "00000" "CRB1_000034" "g.197398749G>A" "" "{PMID:Carss 2017:28041643}" "" "1:197398749G>A ENST00000367400.3:c.2842+5G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000713570" "3" "90" "1" "197390975" "197390975" "subst" "0" "00000" "CRB1_000333" "g.197390975A>G" "" "{PMID:Carss 2017:28041643}" "" "1:197390975A>G ENST00000367400.3:c.2017A>G (Lys673Glu)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713700" "0" "90" "1" "197404535" "197404536" "ins" "0" "00000" "CRB1_000337" "g.197404535_197404536insG" "" "{PMID:Carss 2017:28041643}" "" "1:197404534T>TG ENST00000367400.3:c.3542dupG (Cys1181TrpfsTer13)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713714" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Carss 2017:28041643}" "" "1:197403836G>A ENST00000367400.3:c.2843G>A (Cys948Tyr)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713715" "0" "90" "1" "197396584" "197396584" "subst" "0.0000122175" "00000" "CRB1_000004" "g.197396584A>T" "" "{PMID:Carss 2017:28041643}" "" "1:197396584A>T ENST00000367400.3:c.2129A>T (Glu710Val)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713734" "0" "90" "1" "197396673" "197396674" "ins" "0" "00000" "CRB1_000334" "g.197396673_197396674insC" "" "{PMID:Carss 2017:28041643}" "" "1:197396673T>TC ENST00000367400.3:c.2220dupC (Met741HisfsTer49)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713768" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "00000" "CRB1_000030" "g.197398590T>A" "" "{PMID:Carss 2017:28041643}" "" "1:197398590T>A ENST00000367400.3:c.2688T>A (Cys896Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713779" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "00000" "CRB1_000030" "g.197398590T>A" "" "{PMID:Carss 2017:28041643}" "" "1:197398590T>A ENST00000367400.3:c.2688T>A (Cys896Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713851" "3" "90" "1" "197398741" "197398741" "subst" "0.0000854096" "00000" "CRB1_000336" "g.197398741G>A" "" "{PMID:Carss 2017:28041643}" "" "1:197398741G>A ENST00000367400.3:c.2839G>A (Glu947Lys)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000714061" "3" "70" "1" "197316601" "197316601" "subst" "0" "00000" "CRB1_000327" "g.197316601G>T" "" "{PMID:Taylor 2017:28341476}" "" "" "" "Germline" "" "" "0" "" "" "g.197347471G>T" "" "likely pathogenic (recessive)" "" "0000714069" "2" "70" "1" "197298065" "197298065" "subst" "0.0000121916" "00000" "CRB1_000214" "g.197298065G>T" "" "{PMID:Taylor 2017:28341476}" "" "" "" "Germline" "" "" "0" "" "" "g.197328935G>T" "" "likely pathogenic (recessive)" "" "0000714070" "3" "70" "1" "197396991" "197396991" "subst" "0.0000122002" "00000" "CRB1_000024" "g.197396991G>A" "" "{PMID:Taylor 2017:28341476}" "" "" "" "Germline" "" "" "0" "" "" "g.197427861G>A" "" "likely pathogenic (recessive)" "" "0000714104" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Taylor 2017:28341476}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic (recessive)" "" "0000717060" "0" "30" "1" "197297688" "197297688" "subst" "0.00000406108" "01943" "CRB1_000338" "g.197297688C>T" "" "" "" "CRB1(NM_201253.2):c.207C>T (p.N69=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000717061" "0" "50" "1" "197298095" "197298095" "subst" "0.000591041" "01943" "CRB1_000002" "g.197298095T>C" "" "" "" "CRB1(NM_001257965.1):c.407T>C (p.I136T), CRB1(NM_001257965.2):c.407T>C (p.I136T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000717062" "0" "50" "1" "197313467" "197313467" "subst" "0" "01943" "CRB1_000339" "g.197313467G>C" "" "" "" "CRB1(NM_001257965.1):c.502G>C (p.A168P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000717063" "0" "90" "1" "197396689" "197396689" "subst" "0.0000691884" "01943" "CRB1_000021" "g.197396689C>T" "" "" "" "CRB1(NM_001257965.1):c.2027C>T (p.T676M), CRB1(NM_001257965.2):c.2027C>T (p.T676M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000717064" "0" "50" "1" "197396917" "197396917" "subst" "0.000240195" "02330" "CRB1_000129" "g.197396917C>T" "" "" "" "CRB1(NM_001257965.2):c.2255C>T (p.T752M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000730623" "3" "90" "1" "197328849" "197328857" "del" "0" "00000" "CRB1_000211" "g.197328849_197328857del" "" "{PMID:Birtel 2018:29555955}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000730987" "3" "70" "1" "197396755" "197396755" "subst" "0.0000081414" "00000" "CRB1_000118" "g.197396755T>C" "" "{PMID:Bryant 2018:29343940}" "" "" "" "Germline" "" "" "0" "" "" "g.197427625T>C" "" "likely pathogenic (recessive)" "" "0000730988" "1" "70" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Bryant 2018:29343940}" "" "" "" "Germline" "" "rs114342808" "0" "" "" "g.197421404C>T" "" "likely pathogenic (recessive)" "" "0000730989" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bryant 2018:29343940}" "" "" "" "Germline" "" "rs62645748" "0" "" "" "g.197434706G>A" "" "likely pathogenic (recessive)" "" "0000731043" "2" "70" "1" "197390387" "197390387" "subst" "0" "00000" "CRB1_000038" "g.197390387G>A" "" "{PMID:Bryant 2018:29343940}" "" "" "" "Germline" "" "rs866822473" "0" "" "" "g.197421257G>A" "" "likely pathogenic (recessive)" "" "0000731046" "2" "70" "1" "197411405" "197411405" "subst" "0.0000040618" "00000" "CRB1_000050" "g.197411405G>T" "" "{PMID:Bryant 2018:29343940}" "" "" "" "Germline" "" "" "0" "" "" "g.197442275G>T" "" "likely pathogenic (recessive)" "" "0000731141" "1" "90" "1" "197446848" "197446848" "subst" "0" "00000" "CRB1_000307" "g.197446848G>A" "" "{PMID:Porto 2017:29186038}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000731142" "1" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Porto 2017:29186038}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000731150" "3" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Porto 2017:29186038}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic (recessive)" "" "0000731167" "2" "90" "1" "197390718" "197390718" "subst" "0" "00000" "CRB1_000197" "g.197390718G>A" "" "{PMID:Porto 2017:29186038}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000731169" "2" "90" "1" "197390591" "197390591" "subst" "0" "00000" "CRB1_000340" "g.197390591T>C" "" "{PMID:Porto 2017:29186038}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000731265" "21" "70" "1" "197390751" "197390751" "del" "0" "00000" "CRB1_000341" "g.197390751del" "" "{PMID:Thompson 2017:29178642}" "" "" "" "Germline" "" "" "0" "" "" "g.197421621del" "" "likely pathogenic (recessive)" "" "0000731266" "2" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Thompson 2017:29178642}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic (recessive)" "" "0000731287" "11" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Thompson 2017:29178642}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic (recessive)" "" "0000731288" "1" "70" "1" "197298094" "197298100" "del" "0" "00000" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Thompson 2017:29178642}" "" "" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "likely pathogenic (recessive)" "" "0000731318" "11" "70" "1" "197390166" "197390166" "subst" "0" "00000" "CRB1_000148" "g.197390166C>G" "" "{PMID:Essilfie 2018:29155698}" "" "" "" "Germline" "" "" "0" "" "" "g.197421036C>G" "" "likely pathogenic (recessive)" "" "0000731343" "21" "70" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Essilfie 2018:29155698}" "" "" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "likely pathogenic (recessive)" "" "0000731429" "1" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:DiIorio 2017:29053603}" "" "NM_001193640:c.1898C>T" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic (recessive)" "" "0000731439" "1" "70" "1" "197237599" "197237599" "dup" "0" "00000" "CRB1_000232" "g.197237599dup" "" "{PMID:DiIorio 2017:29053603}" "" "c.55_56insT" "" "Germline" "" "" "0" "" "" "g.197268469dup" "" "likely pathogenic (recessive)" "" "0000731441" "3" "70" "1" "197390271" "197390271" "subst" "0" "00000" "CRB1_000151" "g.197390271G>A" "" "{PMID:DiIorio 2017:29053603}" "" "NM_001193640:c.977G>A" "" "Germline" "" "" "0" "" "" "g.197421141G>A" "" "likely pathogenic (recessive)" "" "0000731453" "2" "70" "1" "197404420" "197404420" "del" "0" "00000" "CRB1_000073" "g.197404420del" "" "{PMID:DiIorio 2017:29053603}" "" "NM_001193640:c.3091del" "" "Germline" "" "" "0" "" "" "g.197435290del" "" "likely pathogenic (recessive)" "" "0000731458" "2" "70" "1" "197391051" "197391051" "subst" "0" "00000" "CRB1_000342" "g.197391051G>A" "" "{PMID:DiIorio 2017:29053603}" "" "NM_001193640:c.1757G>A" "" "Germline" "" "" "0" "" "" "g.197421921G>A" "" "likely pathogenic (recessive)" "" "0000732433" "3" "90" "1" "197390394" "197390394" "subst" "0" "00000" "CRB1_000345" "g.197390394T>C" "" "{PMID:Costa 2017:28912962}" "" "" "" "Germline" "" "" "0" "" "" "g.197421264T>C" "" "pathogenic" "" "0000732444" "0" "90" "1" "197404203" "197404203" "subst" "0.00000406603" "00000" "CRB1_000349" "g.197404203C>A" "" "{PMID:Costa 2017:28912962}" "" "" "" "Germline" "" "" "0" "" "" "g.197435073C>A" "" "pathogenic" "" "0000732472" "0" "50" "1" "197298095" "197298095" "subst" "0.000591041" "00000" "CRB1_000002" "g.197298095T>C" "" "{PMID:Costa 2017:28912962}" "" "" "" "Germline" "" "" "0" "" "" "g.197328965T>C" "" "VUS" "" "0000732481" "0" "50" "1" "197298095" "197298095" "subst" "0.000591041" "00000" "CRB1_000002" "g.197298095T>C" "" "{PMID:Costa 2017:28912962}" "" "" "" "Germline" "" "" "0" "" "" "g.197328965T>C" "" "VUS" "" "0000732555" "0" "70" "1" "197411400" "197411400" "subst" "0.00000812315" "00000" "CRB1_000352" "g.197411400C>A" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "rs762975680" "0" "" "" "g.197442270C>A" "" "likely pathogenic" "" "0000732670" "3" "70" "1" "197398744" "197398744" "subst" "0" "00000" "CRB1_000238" "g.197398744T>C" "" "{PMID:Soens 2017:28714225}" "" "NM_001193640.1:c.2506T>C" "r.(del-exon) effect on splicing predicted from mini-gene splicing assay" "Germline" "" "" "0" "" "" "g.197429614T>C" "" "likely pathogenic" "" "0000733052" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000733053" "1" "70" "1" "197404007" "197404007" "subst" "0.0000244351" "00000" "CRB1_000159" "g.197404007A>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197434877A>T" "" "likely pathogenic" "" "0000733054" "1" "70" "1" "197404007" "197404007" "subst" "0.0000244351" "00000" "CRB1_000159" "g.197404007A>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197434877A>T" "" "likely pathogenic" "" "0000733055" "1" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000733056" "1" "70" "1" "197396584" "197396584" "subst" "0.0000122175" "00000" "CRB1_000004" "g.197396584A>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197427454A>T" "" "likely pathogenic" "" "0000733057" "1" "70" "1" "197407798" "197407798" "subst" "0" "00000" "CRB1_000351" "g.197407798G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197438668G>A" "" "likely pathogenic" "" "0000733134" "1" "70" "1" "197390394" "197390394" "subst" "0" "00000" "CRB1_000345" "g.197390394T>C" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197421264T>C" "" "likely pathogenic" "" "0000733158" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000733159" "1" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Stone 2017:28559085}" "" "493_501delGATGGAATT/1183G>A" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000733173" "1" "70" "1" "197411423" "197411423" "subst" "0.00000406204" "00000" "CRB1_000092" "g.197411423G>A" "" "{PMID:Stone 2017:28559085}" "" "IVS11+1G>A" "" "Germline" "" "" "0" "" "" "g.197442293G>A" "" "likely pathogenic" "" "0000733181" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000733182" "1" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000733183" "3" "70" "1" "197291313" "197316144" "dup" "0" "00000" "CRB1_000343" "g.197291313_197316144dup" "" "{PMID:Stone 2017:28559085}" "" "dup ex4-5, chr1:197291313-197316144dup" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000733204" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000733205" "1" "70" "1" "197298065" "197298065" "subst" "0.0000121916" "00000" "CRB1_000214" "g.197298065G>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197328935G>T" "" "likely pathogenic" "" "0000733206" "1" "70" "1" "197398590" "197398590" "subst" "0.0000284333" "00000" "CRB1_000030" "g.197398590T>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "likely pathogenic" "" "0000733347" "1" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Stone 2017:28559085}" "" "493_501delGATGGAATT" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000733348" "1" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Stone 2017:28559085}" "" "493_501delGATGGAATT" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000733495" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000733513" "1" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Stone 2017:28559085}" "" "493_501delGATGGAATT" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000733522" "2" "70" "1" "197298094" "197298100" "del" "0" "00000" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Stone 2017:28559085}" "" "610_616delGAAATAG" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "likely pathogenic" "" "0000733523" "2" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000733524" "2" "70" "1" "197404214" "197404214" "subst" "0.0000122015" "00000" "CRB1_000096" "g.197404214T>C" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197435084T>C" "" "likely pathogenic" "" "0000733525" "2" "70" "1" "197396763" "197396763" "subst" "0.0000203608" "00000" "CRB1_000282" "g.197396763G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197427633G>A" "" "likely pathogenic" "" "0000733526" "2" "70" "1" "197404616" "197404616" "subst" "0" "00000" "CRB1_000350" "g.197404616G>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197435486G>T" "" "likely pathogenic" "" "0000733527" "2" "70" "1" "197390625" "197390625" "subst" "0" "00000" "CRB1_000319" "g.197390625T>C" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197421495T>C" "" "likely pathogenic" "" "0000733583" "2" "70" "1" "197396763" "197396763" "subst" "0.0000203608" "00000" "CRB1_000282" "g.197396763G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197427633G>A" "" "likely pathogenic" "" "0000733599" "2" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Stone 2017:28559085}" "" "493_501delGATGGAATT" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000733600" "2" "70" "1" "197404067" "197404067" "subst" "0" "00000" "CRB1_000023" "g.197404067G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197434937G>A" "" "likely pathogenic" "" "0000733611" "2" "70" "1" "197390874" "197390874" "subst" "0" "00000" "CRB1_000347" "g.197390874T>C" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197421744T>C" "" "likely pathogenic" "" "0000733617" "2" "70" "1" "197391063" "197391063" "subst" "0.00000407947" "00000" "CRB1_000348" "g.197391063A>G" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197421933A>G" "" "likely pathogenic" "" "0000733618" "2" "70" "1" "197297909" "197297913" "del" "0" "00000" "CRB1_000216" "g.197297909_197297913del" "" "{PMID:Stone 2017:28559085}" "" "428_432delGATTC" "" "Germline" "" "" "0" "" "" "g.197328779_197328783del" "" "likely pathogenic" "" "0000733634" "2" "70" "1" "197298065" "197298065" "subst" "0.0000121916" "00000" "CRB1_000214" "g.197298065G>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197328935G>T" "" "likely pathogenic" "" "0000733635" "2" "70" "1" "197396704" "197396704" "subst" "0" "00000" "CRB1_000057" "g.197396704G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197427574G>A" "" "likely pathogenic" "" "0000733636" "2" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000733725" "2" "70" "1" "197390592" "197390592" "subst" "0" "00000" "CRB1_000346" "g.197390592C>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197421462C>A" "" "likely pathogenic" "" "0000733726" "2" "70" "1" "197396626" "197396626" "subst" "0.0000081355" "00000" "CRB1_000230" "g.197396626A>G" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197427496A>G" "" "likely pathogenic" "" "0000733869" "2" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Stone 2017:28559085}" "" "493_501delGATGGAATT" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000733883" "2" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000733912" "1" "70" "1" "197390141" "197390141" "subst" "0.0000284567" "00000" "CRB1_000344" "g.197390141G>A" "" "{PMID:Stone 2017:28559085}" "" "493_501delGATGGAATT/1183G>A" "" "Germline" "" "" "0" "" "" "g.197421011G>A" "" "likely pathogenic" "" "0000734337" "1" "70" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Huang 2017:28512305}" "" "" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "likely pathogenic" "" "0000734391" "2" "70" "1" "197404435" "197404435" "subst" "0" "00000" "CRB1_000074" "g.197404435T>C" "" "{PMID:Huang 2017:28512305}" "" "" "" "Germline" "" "" "0" "" "" "g.197435305T>C" "" "likely pathogenic" "" "0000734689" "3" "70" "1" "197404435" "197404435" "subst" "0" "00000" "CRB1_000074" "g.197404435T>C" "" "{PMID:Jinda 2017:28453600}" "" "" "" "Germline" "" "" "0" "" "" "g.197435305T>C" "" "likely pathogenic (recessive)" "" "0000734690" "3" "70" "1" "197396994" "197396994" "subst" "0" "00000" "CRB1_000166" "g.197396994T>A" "" "{PMID:Jinda 2017:28453600}" "" "" "" "Germline" "" "" "0" "" "" "g.197427864T>A" "" "likely pathogenic (recessive)" "" "0000735612" "0" "70" "1" "197316444" "197316444" "subst" "0" "00000" "CRB1_000256" "g.197316444A>G" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.197347314A>G" "" "likely pathogenic" "" "0000735613" "0" "90" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "pathogenic" "" "0000735734" "0" "70" "1" "197404165" "197404165" "subst" "0" "00000" "CRB1_000263" "g.197404165G>T" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.197435035G>T" "" "likely pathogenic" "" "0000735735" "0" "90" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "pathogenic" "" "0000735844" "1" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Riera 2017:28181551}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000735845" "1" "70" "1" "197298094" "197298100" "del" "0" "00000" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Riera 2017:28181551}" "" "611_617del" "" "Germline" "yes" "" "0" "" "" "g.197328964_197328970del" "" "likely pathogenic" "" "0000735864" "2" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Riera 2017:28181551}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000735865" "2" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Riera 2017:28181551}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000735893" "1" "70" "1" "197396682" "197396682" "del" "0" "02485" "CRB1_000116" "g.197396682del" "" "{PMID:Bravo-Gil 2017:28157192}" "" "c.2227delG" "" "Germline" "yes" "" "0" "" "" "g.197427552del" "" "likely pathogenic" "" "0000735894" "1" "70" "1" "197298094" "197298100" "del" "0" "02485" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197328964_197328970del" "" "likely pathogenic" "" "0000735895" "1" "70" "1" "197298094" "197298100" "del" "0" "02485" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.197328964_197328970del" "" "likely pathogenic" "" "0000735896" "3" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "02485" "CRB1_000005" "g.197396745C>T" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000735897" "3" "70" "1" "197313607" "197313607" "subst" "0" "02485" "CRB1_000353" "g.197313607G>A" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.197344477G>A" "" "likely pathogenic" "" "0000735898" "1" "70" "1" "197446794" "197446794" "subst" "0" "02485" "CRB1_000355" "g.197446794T>A" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.197477664T>A" "" "likely pathogenic" "" "0000735956" "2" "70" "1" "197403836" "197403836" "subst" "0.000211939" "02485" "CRB1_000001" "g.197403836G>A" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000735957" "2" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "02485" "CRB1_000101" "g.197404292T>C" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000735958" "2" "70" "1" "197297979" "197297987" "del" "0" "02485" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000735959" "2" "70" "1" "197446870" "197446870" "subst" "0" "02485" "CRB1_000186" "g.197446870T>A" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.197477740T>A" "" "likely pathogenic" "" "0000736068" "3" "90" "1" "197404435" "197404435" "subst" "0" "00000" "CRB1_000074" "g.197404435T>C" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.197435305T>C" "" "pathogenic" "" "0000736085" "1" "70" "1" "197297619" "197297619" "del" "0" "00000" "CRB1_000066" "g.197297619del" "" "{PMID:Huang 2018:29641573}" "" "c.138delA" "" "Germline" "" "" "0" "" "" "g.197328489del" "" "likely pathogenic" "" "0000736128" "2" "70" "1" "197390799" "197390799" "subst" "0.000020326" "00000" "CRB1_000103" "g.197390799G>T" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.197421669G>T" "" "likely pathogenic" "" "0000736205" "3" "90" "1" "197396655" "197396655" "subst" "0" "00000" "CRB1_000354" "g.197396655G>A" "" "{PMID:Bernardis 2016:28127548}" "" "" "" "Germline" "" "" "0" "" "" "g.197427525G>A" "" "pathogenic" "" "0000736206" "3" "90" "1" "197396655" "197396655" "subst" "0" "00000" "CRB1_000354" "g.197396655G>A" "" "{PMID:Bernardis 2016:28127548}" "" "" "" "Germline" "" "" "0" "" "" "g.197427525G>A" "" "pathogenic" "" "0000736207" "3" "90" "1" "197396655" "197396655" "subst" "0" "00000" "CRB1_000354" "g.197396655G>A" "" "{PMID:Bernardis 2016:28127548}" "" "" "" "Germline" "" "" "0" "" "" "g.197427525G>A" "" "pathogenic" "" "0000736367" "1" "10" "1" "" "" "" "" "00008" "NPHS2_000000" "g.?" "" "{PMID:Booij 2005:16272259}" "" "6147T>C" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000736368" "1" "10" "1" "" "" "" "" "00008" "NPHS2_000000" "g.?" "" "{PMID:Booij 2005:16272259}" "" "IVS3-35C>T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000736372" "1" "10" "1" "" "" "" "" "00008" "NPHS2_000000" "g.?" "" "{PMID:Hameed 2003:12920076}; {PMID:Booij 2005:16272259}" "" "IVS1-12A>T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000736373" "1" "10" "1" "" "" "" "" "00008" "NPHS2_000000" "g.?" "" "{PMID:Booij 2005:16272259}" "" "IVS4+34C>T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000736374" "1" "10" "1" "" "" "" "" "00008" "NPHS2_000000" "g.?" "" "{PMID:Booij 2005:16272259}" "" "IVS4-54C>A" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000736831" "1" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "3/486 individuals" "{PMID:Sergouniotis 2016:27628848}" "" "" "no genotypes reported" "Germline" "" "rs748136623" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000759835" "1" "70" "1" "" "" "" "" "00000" "NPHS2_000000" "g.?" "" "{PMID:Wang 2016:27422788}" "" "c.G1613A p.W538X" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000759836" "1" "70" "1" "" "" "" "" "00000" "NPHS2_000000" "g.?" "" "{PMID:Wang 2016:27422788}" "" "c.T1364C p.L455P" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000759869" "2" "70" "1" "" "" "" "" "00000" "NPHS2_000000" "g.?" "" "{PMID:Wang 2016:27422788}" "" "c.T3106C p.C1036R" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000759870" "2" "70" "1" "" "" "" "" "00000" "NPHS2_000000" "g.?" "" "{PMID:Wang 2016:27422788}" "" "c.1922-1G > C NA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000759933" "3" "90" "1" "197396685" "197396685" "subst" "0.0000122113" "00000" "CRB1_000268" "g.197396685C>T" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.197427555C>T" "" "pathogenic (recessive)" "" "0000759934" "1" "90" "1" "197298028" "197298028" "subst" "0" "00000" "CRB1_000357" "g.197298028T>C" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.197328898T>C" "" "pathogenic (recessive)" "" "0000759958" "2" "90" "1" "197398589" "197398589" "subst" "0" "00000" "CRB1_000362" "g.197398589G>C" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.197429459G>C" "" "pathogenic (recessive)" "" "0000760009" "0" "50" "1" "197398744" "197398744" "subst" "0" "00000" "CRB1_000238" "g.197398744T>C" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.197429614T>C" "" "VUS" "" "0000760037" "0" "50" "1" "197446827" "197446827" "del" "0" "00000" "CRB1_000367" "g.197446827del" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.197477697del" "" "VUS" "" "0000760097" "0" "50" "1" "197297616" "197297616" "subst" "0.000381803" "00000" "CRB1_000031" "g.197297616C>G" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.197328486C>G" "" "VUS" "" "0000760160" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000760162" "0" "50" "1" "197325978" "197325978" "subst" "0" "00000" "CRB1_000328" "g.197325978T>C" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197356848T>C" "" "VUS" "" "0000760186" "0" "70" "1" "197404030" "197404030" "subst" "0.00000407209" "00000" "CRB1_000003" "g.197404030C>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434900C>T" "" "likely pathogenic" "" "0000760194" "0" "70" "1" "197404007" "197404007" "subst" "0.0000244351" "00000" "CRB1_000159" "g.197404007A>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434877A>T" "" "likely pathogenic" "" "0000760195" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000760197" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000760204" "3" "70" "1" "197404067" "197404067" "subst" "0" "00000" "CRB1_000023" "g.197404067G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434937G>A" "" "likely pathogenic" "" "0000760212" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000760213" "0" "50" "1" "197403862" "197403862" "subst" "0" "00000" "CRB1_000365" "g.197403862C>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434732C>T" "" "VUS" "" "0000760220" "0" "70" "1" "197397003" "197397003" "subst" "0.0000203346" "00000" "CRB1_000010" "g.197397003G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197427873G>A" "" "likely pathogenic" "" "0000760227" "0" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000760229" "0" "50" "1" "197403835" "197403835" "subst" "0" "00000" "CRB1_000364" "g.197403835G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434705G>A" "" "VUS" "" "0000760241" "0" "50" "1" "197396763" "197396763" "subst" "0.0000203608" "00000" "CRB1_000282" "g.197396763G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197427633G>A" "" "VUS" "" "0000760260" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000760265" "0" "50" "1" "197446947" "197446947" "subst" "0" "00000" "CRB1_000368" "g.197446947G>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197477817G>T" "" "VUS" "" "0000760276" "0" "50" "1" "197396764" "197396764" "subst" "0" "00000" "CRB1_000360" "g.197396764G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197427634G>A" "" "VUS" "" "0000760304" "0" "50" "1" "197313565" "197313565" "dup" "0" "00000" "CRB1_000358" "g.197313565dup" "" "{PMID:Ellingford 2016:27208204}" "" "807dupA" "" "Germline" "" "" "0" "" "" "g.197344435dup" "" "VUS" "" "0000760323" "3" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000760326" "0" "50" "1" "197398735" "197398735" "subst" "0" "00000" "CRB1_000363" "g.197398735G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197429605G>A" "" "VUS" "" "0000760329" "0" "70" "1" "197396820" "197396822" "del" "0" "00000" "CRB1_000123" "g.197396820_197396822del" "" "{PMID:Ellingford 2016:27208204}" "" "2365_2367delAAT" "" "Germline" "" "" "0" "" "" "g.197427690_197427692del" "" "likely pathogenic" "" "0000760349" "0" "70" "1" "197297979" "197297991" "del" "0" "00000" "CRB1_000356" "g.197297979_197297991del" "" "{PMID:Ellingford 2016:27208204}" "" "498_506delAATTGATGGTTA" "" "Germline" "" "" "0" "" "" "g.197328849_197328861del" "" "likely pathogenic" "" "0000760423" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000760425" "0" "70" "1" "197396584" "197396584" "subst" "0.0000122175" "00000" "CRB1_000004" "g.197396584A>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197427454A>T" "" "likely pathogenic" "" "0000760438" "0" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000760441" "0" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000760442" "0" "70" "1" "197298065" "197298065" "subst" "0.0000121916" "00000" "CRB1_000214" "g.197298065G>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197328935G>T" "" "likely pathogenic" "" "0000760447" "0" "70" "1" "197398590" "197398590" "subst" "0.0000284333" "00000" "CRB1_000030" "g.197398590T>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "likely pathogenic" "" "0000760448" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000760453" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000760457" "0" "50" "1" "197390570" "197390571" "ins" "0" "00000" "CRB1_000359" "g.197390570_197390571insCTTA" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197421440_197421441insCTTA" "" "VUS" "" "0000760459" "0" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000760465" "0" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000760475" "0" "70" "1" "197298065" "197298065" "subst" "0.0000121916" "00000" "CRB1_000214" "g.197298065G>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197328935G>T" "" "likely pathogenic" "" "0000760477" "0" "70" "1" "197398590" "197398590" "subst" "0.0000284333" "00000" "CRB1_000030" "g.197398590T>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "likely pathogenic" "" "0000760481" "0" "50" "1" "197404010" "197404010" "subst" "0" "00000" "CRB1_000366" "g.197404010C>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434880C>T" "" "VUS" "" "0000760488" "0" "70" "1" "197398590" "197398590" "subst" "0.0000284333" "00000" "CRB1_000030" "g.197398590T>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197429460T>A" "" "likely pathogenic" "" "0000760495" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000760496" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000760501" "0" "70" "1" "197396584" "197396584" "subst" "0.0000122175" "00000" "CRB1_000004" "g.197396584A>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.197427454A>T" "" "likely pathogenic" "" "0000760654" "1" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Bravo-Gil 2016:27032803}" "" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "" "0000760674" "0" "90" "1" "197411405" "197411405" "subst" "0.0000040618" "00000" "CRB1_000050" "g.197411405G>T" "" "{PMID:Bravo-Gil 2016:27032803}" "" "" "" "Germline" "" "" "0" "" "" "g.197442275G>T" "" "pathogenic" "" "0000760676" "2" "90" "1" "197397037" "197397037" "del" "0" "00000" "CRB1_000361" "g.197397037del" "" "{PMID:Bravo-Gil 2016:27032803}" "" "2579delA" "" "Germline" "" "" "0" "" "" "g.197427907del" "" "pathogenic" "" "0000764032" "3" "70" "1" "197298136" "197298139" "del" "0" "00000" "CRB1_000179" "g.197298136_197298139del" "" "{PMID:Oishi 2016:26957898}" "" "" "" "Germline" "" "" "0" "" "" "g.197329006_197329009del" "" "likely pathogenic" "" "0000764895" "1" "70" "1" "197297888" "197297888" "subst" "0.0000040792" "00000" "CRB1_000369" "g.197297888G>A" "" "{PMID:Weisschuh 2016:26766544}" "" "" "" "Germline" "" "" "0" "" "" "g.197328758G>A" "" "likely pathogenic (recessive)" "" "0000764930" "2" "70" "1" "197390423" "197390423" "subst" "0" "00000" "CRB1_000370" "g.197390423G>T" "" "{PMID:Weisschuh 2016:26766544}" "" "" "" "Germline" "" "" "0" "" "" "g.197421293G>T" "" "likely pathogenic (recessive)" "" "0000765545" "3" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000765546" "3" "90" "1" "197411378" "197411378" "subst" "0" "00000" "CRB1_000378" "g.197411378T>C" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.197442248T>C" "" "pathogenic" "" "0000765547" "1" "90" "1" "197411414" "197411414" "subst" "0.000016248" "00000" "CRB1_000379" "g.197411414G>A" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.197442284G>A" "" "pathogenic" "" "0000765557" "3" "90" "1" "197396956" "197396956" "subst" "0.00000406729" "00000" "CRB1_000374" "g.197396956G>A" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.197427826G>A" "" "pathogenic" "" "0000765558" "1" "90" "1" "197404705" "197404705" "subst" "0.00000408767" "00000" "CRB1_000376" "g.197404705T>C" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.197435575T>C" "" "pathogenic" "" "0000765588" "2" "90" "1" "197407780" "197407780" "subst" "0" "00000" "CRB1_000377" "g.197407780T>C" "" "{PMID:Ge 2015:26667666}" "" "" "" "Germline" "" "" "0" "" "" "g.197438650T>C" "" "pathogenic" "" "0000765596" "2" "90" "1" "197297738" "197297739" "dup" "0" "00000" "CRB1_000068" "g.197297738_197297739dup" "" "{PMID:Ge 2015:26667666}" "" "252_253insTG" "" "Germline" "" "" "0" "" "" "g.197328608_197328609dup" "" "pathogenic" "" "0000765658" "3" "90" "1" "197398685" "197398685" "subst" "0" "00000" "CRB1_000270" "g.197398685G>A" "" "{PMID:Beheshtian 2015:26497376}" "" "NM_001257965.1:c.2711G>A" "" "Germline" "yes" "" "0" "" "" "g.197429555G>A" "" "pathogenic (recessive)" "" "0000765659" "3" "90" "1" "197390211" "197390211" "dup" "0" "00000" "CRB1_000372" "g.197390211dup" "" "{PMID:Beheshtian 2015:26497376}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197421081dup" "" "pathogenic (recessive)" "" "0000765753" "0" "70" "1" "197390138" "197390138" "subst" "0" "00000" "CRB1_000371" "g.197390138T>C" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.197421008T>C" "" "likely pathogenic" "" "0000765780" "0" "70" "1" "197396785" "197396791" "del" "0" "00000" "CRB1_000373" "g.197396785_197396791del" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.197427655_197427661del" "" "likely pathogenic" "" "0000765798" "0" "70" "1" "197390138" "197390138" "subst" "0" "00000" "CRB1_000371" "g.197390138T>C" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.197421008T>C" "" "likely pathogenic" "" "0000765820" "0" "70" "1" "197390138" "197390138" "subst" "0" "00000" "CRB1_000371" "g.197390138T>C" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.197421008T>C" "" "likely pathogenic" "" "0000765863" "0" "70" "1" "197398603" "197398603" "subst" "0" "00000" "CRB1_000375" "g.197398603G>T" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.197429473G>T" "" "likely pathogenic" "" "0000765898" "0" "70" "1" "197297561" "197297561" "subst" "0.00000406981" "00000" "CRB1_000063" "g.197297561G>T" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.197328431G>T" "" "likely pathogenic" "" "0000765922" "0" "70" "1" "197390421" "197390421" "subst" "0.00000406108" "00000" "CRB1_000202" "g.197390421T>C" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.197421291T>C" "" "likely pathogenic" "" "0000783255" "3" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Vamos 2016:26165328}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic (recessive)" "" "0000783256" "1" "90" "1" "197396991" "197396991" "subst" "0" "00000" "CRB1_000390" "g.197396991G>T" "" "{PMID:Vamos 2016:26165328}" "" "" "" "Germline" "" "" "0" "" "" "g.197427861G>T" "" "pathogenic (recessive)" "" "0000783257" "1" "90" "1" "197397010" "197397010" "subst" "0.00000406759" "00000" "CRB1_000168" "g.197397010T>C" "" "{PMID:Vamos 2016:26165328}" "" "" "" "Germline" "" "" "0" "" "" "g.197427880T>C" "" "pathogenic (recessive)" "" "0000783259" "2" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Vamos 2016:26165328}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic (recessive)" "" "0000783260" "2" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Vamos 2016:26165328}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic (recessive)" "" "0000783268" "3" "90" "1" "197404300" "197404300" "subst" "0.0000285556" "00000" "CRB1_000188" "g.197404300G>A" "" "{PMID:Srilekha 2015:26147992}" "" "" "" "Germline" "" "" "0" "" "" "g.197435170G>A" "" "pathogenic (recessive)" "" "0000783790" "3" "90" "1" "197404669" "197404669" "subst" "0.0000204062" "00000" "CRB1_000115" "g.197404669G>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197435539G>T" "" "pathogenic" "" "0000783791" "3" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Wang 2015:26047050}" "" "1756C>T (R526X)" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "" "0000783792" "3" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Wang 2015:26047050}" "" "1756C>T (R526X)" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "" "0000783807" "3" "90" "1" "197403859" "197403859" "subst" "0" "00000" "CRB1_000394" "g.197403859G>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197434729G>T" "" "pathogenic" "" "0000783808" "1" "90" "1" "197325980" "197325980" "subst" "0" "00000" "CRB1_000382" "g.197325980T>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197356850T>A" "" "pathogenic" "" "0000783809" "1" "90" "1" "197396627" "197396627" "subst" "0.00000406742" "00000" "CRB1_000386" "g.197396627T>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197427497T>A" "" "pathogenic" "" "0000783810" "1" "90" "1" "197390695" "197390713" "del" "0" "00000" "CRB1_000384" "g.197390695_197390713del" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197421565_197421583del" "" "pathogenic" "" "0000783811" "1" "90" "1" "197313421" "197313421" "subst" "0" "00000" "CRB1_000381" "g.197313421T>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197344291T>A" "" "pathogenic" "" "0000783812" "1" "90" "1" "197396967" "197396967" "subst" "0" "00000" "CRB1_000389" "g.197396967A>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197427837A>T" "" "pathogenic" "" "0000783813" "1" "90" "1" "197390789" "197390789" "subst" "0.0000284567" "00000" "CRB1_000102" "g.197390789T>C" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197421659T>C" "" "pathogenic" "" "0000783814" "1" "90" "1" "" "" "" "" "00000" "NPHS2_000000" "g.?" "" "{PMID:Wang 2015:26047050}" "" "652+2G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000783840" "3" "50" "1" "197404211" "197404211" "subst" "0" "00000" "CRB1_000396" "g.197404211T>C" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197435081T>C" "" "VUS" "" "0000783843" "1" "50" "1" "197396826" "197396826" "subst" "0" "00000" "CRB1_000387" "g.197396826G>C" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197427696G>C" "" "VUS" "" "0000783844" "1" "50" "1" "197404481" "197404481" "subst" "0.0000163207" "00000" "CRB1_000083" "g.197404481G>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197435351G>T" "" "VUS" "" "0000783845" "1" "50" "1" "197297580" "197297580" "del" "0" "00000" "CRB1_000380" "g.197297580del" "" "{PMID:Wang 2015:26047050}" "" "98del" "" "Germline" "" "" "0" "" "" "g.197328450del" "" "VUS" "" "0000783846" "1" "50" "1" "197398717" "197398717" "subst" "0" "00000" "CRB1_000393" "g.197398717T>G" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197429587T>G" "" "VUS" "" "0000783847" "1" "50" "1" "197396871" "197396871" "subst" "0.00000814564" "00000" "CRB1_000284" "g.197396871G>C" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197427741G>C" "" "VUS" "" "0000783848" "1" "50" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "VUS" "" "0000783849" "1" "50" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Wang 2015:26047050}" "" "1756C>T (R526X)" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "VUS" "" "0000783850" "1" "50" "1" "197390160" "197390160" "subst" "0" "00000" "CRB1_000383" "g.197390160G>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197421030G>A" "" "VUS" "" "0000783851" "1" "50" "1" "197398717" "197398717" "subst" "0" "00000" "CRB1_000393" "g.197398717T>G" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197429587T>G" "" "VUS" "" "0000783878" "1" "50" "1" "197396627" "197396627" "subst" "0.00000406742" "00000" "CRB1_000386" "g.197396627T>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197427497T>A" "" "VUS" "" "0000783910" "2" "90" "1" "197390789" "197390789" "subst" "0.0000284567" "00000" "CRB1_000102" "g.197390789T>C" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197421659T>C" "" "pathogenic" "" "0000783911" "2" "90" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "pathogenic" "" "0000783912" "2" "90" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "pathogenic" "" "0000783913" "2" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "" "0000783914" "2" "90" "1" "197404669" "197404669" "subst" "0.0000204062" "00000" "CRB1_000115" "g.197404669G>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197435539G>T" "" "pathogenic" "" "0000783915" "2" "90" "1" "197396996" "197396997" "del" "0" "00000" "CRB1_000391" "g.197396996_197396997del" "" "{PMID:Wang 2015:26047050}" "" "2540_2541delTC" "" "Germline" "" "" "0" "" "" "g.197427866_197427867del" "" "pathogenic" "" "0000783916" "2" "90" "1" "197390789" "197390789" "subst" "0.0000284567" "00000" "CRB1_000102" "g.197390789T>C" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197421659T>C" "" "pathogenic" "" "0000783937" "2" "50" "1" "197398587" "197398587" "dup" "0" "00000" "CRB1_000392" "g.197398587dup" "" "{PMID:Wang 2015:26047050}" "" "2681_2682insC" "" "Germline" "" "" "0" "" "" "g.197429457dup" "" "VUS" "" "0000783938" "2" "50" "1" "197411424" "197411424" "subst" "0" "00000" "CRB1_000094" "g.197411424T>G" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197442294T>G" "" "VUS" "" "0000783939" "2" "50" "1" "197390955" "197390955" "subst" "0" "00000" "CRB1_000385" "g.197390955T>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197421825T>A" "" "VUS" "" "0000783940" "2" "50" "1" "197404145" "197404145" "subst" "0" "00000" "CRB1_000173" "g.197404145G>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197435015G>A" "" "VUS" "" "0000783941" "2" "50" "1" "197398616" "197398616" "subst" "0.000272194" "00000" "CRB1_000138" "g.197398616G>A" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197429486G>A" "" "VUS" "" "0000783942" "2" "50" "1" "197404669" "197404669" "subst" "0.0000204062" "00000" "CRB1_000115" "g.197404669G>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197435539G>T" "" "VUS" "" "0000783943" "2" "50" "1" "197404016" "197404016" "subst" "0.00000407213" "00000" "CRB1_000395" "g.197404016T>C" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197434886T>C" "" "VUS" "" "0000783944" "2" "50" "1" "197396917" "197396917" "subst" "0" "00000" "CRB1_000388" "g.197396917C>G" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197427787C>G" "" "VUS" "" "0000783945" "2" "50" "1" "197404669" "197404669" "subst" "0.0000204062" "00000" "CRB1_000115" "g.197404669G>T" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197435539G>T" "" "VUS" "" "0000783969" "2" "50" "1" "197404435" "197404435" "subst" "0" "00000" "CRB1_000074" "g.197404435T>C" "" "{PMID:Wang 2015:26047050}" "" "" "" "Germline" "" "" "0" "" "" "g.197435305T>C" "" "VUS" "" "0000784261" "0" "70" "1" "197313422" "197313422" "subst" "0.000676429" "00000" "CRB1_000276" "g.197313422G>A" "6/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs114846212" "0" "" "" "g.197344292G>A" "" "likely pathogenic (recessive)" "" "0000784262" "0" "70" "1" "197313422" "197313422" "subst" "0.000676429" "00000" "CRB1_000276" "g.197313422G>A" "6/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs114846212" "0" "" "" "g.197344292G>A" "" "likely pathogenic (recessive)" "" "0000784270" "0" "70" "1" "197313422" "197313422" "subst" "0.000676429" "00000" "CRB1_000276" "g.197313422G>A" "6/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs114846212" "0" "" "" "g.197344292G>A" "" "likely pathogenic (recessive)" "" "0000784271" "0" "70" "1" "197390147" "197390147" "subst" "0.000186946" "00000" "CRB1_000279" "g.197390147G>C" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs114264441" "0" "" "" "g.197421017G>C" "" "likely pathogenic (recessive)" "" "0000784284" "0" "50" "1" "197446831" "197446831" "subst" "0.00000407614" "00000" "CRB1_000401" "g.197446831T>C" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.197477701T>C" "" "VUS" "" "0000784299" "0" "70" "1" "197404669" "197404669" "subst" "0.0000204062" "00000" "CRB1_000115" "g.197404669G>T" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.197435539G>T" "" "likely pathogenic (recessive)" "" "0000784300" "0" "70" "1" "197313422" "197313422" "subst" "0.000676429" "00000" "CRB1_000276" "g.197313422G>A" "6/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs114846212" "0" "" "" "g.197344292G>A" "" "likely pathogenic (recessive)" "" "0000784365" "0" "70" "1" "197390985" "197390985" "subst" "0" "00000" "CRB1_000399" "g.197390985G>A" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.197421855G>A" "" "likely pathogenic (recessive)" "" "0000784375" "0" "70" "1" "197313422" "197313422" "subst" "0.000676429" "00000" "CRB1_000276" "g.197313422G>A" "6/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs114846212" "0" "" "" "g.197344292G>A" "" "likely pathogenic (recessive)" "" "0000784376" "0" "70" "1" "197411424" "197411424" "subst" "0" "00000" "CRB1_000094" "g.197411424T>G" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.197442294T>G" "" "likely pathogenic (recessive)" "" "0000784381" "0" "70" "1" "197446918" "197446918" "subst" "0" "00000" "CRB1_000402" "g.197446918G>A" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.197477788G>A" "" "likely pathogenic (recessive)" "" "0000784408" "0" "70" "1" "197390789" "197390789" "subst" "0.0000284567" "00000" "CRB1_000102" "g.197390789T>C" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.197421659T>C" "" "likely pathogenic (recessive)" "" "0000784409" "0" "70" "1" "197313422" "197313422" "subst" "0.000676429" "00000" "CRB1_000276" "g.197313422G>A" "6/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs114846212" "0" "" "" "g.197344292G>A" "" "likely pathogenic (recessive)" "" "0000784533" "0" "50" "1" "197398711" "197398711" "subst" "0.000235799" "00000" "CRB1_000141" "g.197398711G>A" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs114630940" "0" "" "" "g.197429581G>A" "" "VUS" "" "0000785462" "3" "90" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Maria 2015:25775262}" "" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "pathogenic (recessive)" "" "0000785561" "3" "90" "1" "197390774" "197390774" "subst" "0" "00000" "CRB1_000398" "g.197390774T>C" "" "{PMID:Liu 2015:25611614}" "" "c.1816T>C" "" "Germline" "" "" "0" "" "" "g.197421644T>C" "" "pathogenic (recessive)" "" "0000785596" "1" "90" "1" "197298116" "197298116" "subst" "0" "00000" "CRB1_000397" "g.197298116G>A" "" "{PMID:Zaneveld 2015:25474345}" "" "" "" "Germline" "" "" "0" "" "" "g.197328986G>A" "" "pathogenic (recessive)" "" "0000785601" "1" "90" "1" "197404679" "197404679" "subst" "0.00000815947" "00000" "CRB1_000400" "g.197404679G>C" "" "{PMID:Zaneveld 2015:25474345}" "" "NM_001193640:3350G>C" "" "Germline" "" "" "0" "" "" "g.197435549G>C" "" "pathogenic (recessive)" "" "0000785605" "2" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Zaneveld 2015:25474345}" "" "M_001193640:2507G>A" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic (recessive)" "" "0000785607" "2" "90" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Zaneveld 2015:25474345}" "" "" "" "Germline" "" "" "0" "" "" "g.197328849_197328857del" "" "pathogenic (recessive)" "" "0000785962" "1" "77" "1" "197403836" "197403836" "subst" "0.000211939" "00008" "CRB1_000001" "g.197403836G>A" "" "{PMID:Jacobson 2007:17197551}" "" "C948Y" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000785963" "0" "77" "1" "197404646" "197404646" "subst" "0" "00008" "CRB1_000093" "g.197404646G>T" "" "{PMID:Jacobson 2007:17197551}" "" "C1218F" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000785964" "0" "77" "1" "197403836" "197403836" "subst" "0.000211939" "00008" "CRB1_000001" "g.197403836G>A" "" "{PMID:Jacobson 2007:17197551}" "" "C948Y" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000785965" "0" "77" "1" "" "" "" "" "00008" "NPHS2_000000" "g.?" "" "{PMID:Jacobson 2007:17197551}" "" "V13361" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000785966" "0" "77" "1" "197396745" "197396745" "subst" "0.0000773427" "00008" "CRB1_000005" "g.197396745C>T" "" "{PMID:Jacobson 2007:17197551}" "" "R764C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000785967" "3" "77" "1" "197313507" "197313509" "del" "0" "00008" "CRB1_000403" "g.197313507_197313509del" "" "{PMID:Jacobson 2007:17197551}" "" "749del3bp" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000786298" "3" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Méndez-Vidal 2014:25494902}" "" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "" "0000786350" "1" "90" "1" "197396584" "197396584" "subst" "0.0000122175" "00000" "CRB1_000004" "g.197396584A>T" "" "{PMID:Zhao 2015:25472526}" "" "" "" "Germline" "" "" "0" "" "" "g.197427454A>T" "" "pathogenic" "" "0000786391" "2" "90" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Zhao 2015:25472526}" "" "" "" "Germline" "" "" "0" "" "" "g.197427559C>T" "" "pathogenic" "" "0000786414" "3" "90" "1" "197298094" "197298100" "del" "0" "00000" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Consugar 2015:25412400}" "" "613_619delATAGGAA" "" "Germline" "yes" "" "0" "" "" "g.197328964_197328970del" "" "pathogenic (recessive)" "" "0000786417" "1" "90" "1" "197390645" "197390645" "subst" "0.00000406474" "00000" "CRB1_000405" "g.197390645A>G" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197421515A>G" "" "pathogenic (recessive)" "" "0000786444" "3" "90" "1" "197396961" "197396961" "subst" "0.00019522" "00000" "CRB1_000026" "g.197396961C>A" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197427831C>A" "" "pathogenic (recessive)" "" "0000786446" "1" "90" "1" "197390396" "197390396" "subst" "0.00000812255" "00000" "CRB1_000195" "g.197390396T>C" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197421266T>C" "" "pathogenic (recessive)" "" "0000786456" "1" "90" "1" "197396584" "197396584" "subst" "0.0000122175" "00000" "CRB1_000004" "g.197396584A>T" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197427454A>T" "" "pathogenic (recessive)" "" "0000786459" "1" "90" "1" "197325970" "197325970" "subst" "0" "00000" "CRB1_000404" "g.197325970G>C" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197356840G>C" "" "pathogenic (recessive)" "" "0000786460" "1" "90" "1" "197325970" "197325970" "subst" "0" "00000" "CRB1_000404" "g.197325970G>C" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197356840G>C" "" "pathogenic (recessive)" "" "0000786479" "2" "90" "1" "197391001" "197391001" "subst" "0" "00000" "CRB1_000406" "g.197391001T>G" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197421871T>G" "" "pathogenic (recessive)" "" "0000786492" "2" "90" "1" "197396961" "197396961" "subst" "0.00019522" "00000" "CRB1_000026" "g.197396961C>A" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197427831C>A" "" "pathogenic (recessive)" "" "0000786497" "2" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197427615C>T" "" "pathogenic (recessive)" "" "0000786499" "2" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197427726A>T" "" "pathogenic (recessive)" "" "0000786500" "2" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Consugar 2015:25412400}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197427726A>T" "" "pathogenic (recessive)" "" "0000786515" "1" "70" "1" "197390789" "197390789" "subst" "0.0000284567" "00000" "CRB1_000102" "g.197390789T>C" "4/586 cases" "{PMID:Shen 2015:25377065}" "" "" "" "Germline" "" "" "0" "" "" "g.197421659T>C" "" "likely pathogenic" "" "0000786516" "3" "70" "1" "197390789" "197390789" "subst" "0.0000284567" "00000" "CRB1_000102" "g.197390789T>C" "4/586 cases" "{PMID:Shen 2015:25377065}" "" "" "" "Germline" "" "" "0" "" "" "g.197421659T>C" "" "likely pathogenic" "" "0000786517" "3" "70" "1" "197404435" "197404435" "subst" "0" "00000" "CRB1_000074" "g.197404435T>C" "1/586 cases" "{PMID:Shen 2015:25377065}" "" "" "" "Germline" "" "" "0" "" "" "g.197435305T>C" "" "likely pathogenic" "" "0000786519" "2" "70" "1" "197390799" "197390799" "subst" "0.000020326" "00000" "CRB1_000103" "g.197390799G>T" "1/586 cases" "{PMID:Shen 2015:25377065}" "" "" "" "Germline" "" "" "0" "" "" "g.197421669G>T" "" "likely pathogenic" "" "0000787664" "1" "70" "1" "197390789" "197390789" "subst" "0.0000284567" "00000" "CRB1_000102" "g.197390789T>C" "" "{PMID:Huang 2015:25356976}" "" "" "" "Germline" "yes" "" "0" "" "" "g.197421659T>C" "" "likely pathogenic" "" "0000787714" "2" "70" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "0" "" "" "" "Germline" "yes" "" "0" "" "" "g.197421404C>T" "" "likely pathogenic" "" "0000787731" "2" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00006" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sanchez-Alcudia 2014:25342620}" "" "C948Y" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000787746" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Riveiro-Alvarez 2008:18334942}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000787748" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "01251" "CRB1_000001" "g.197403836G>A" "" "{PMID:Riveiro-Alvarez 2008:18334942}" "-" "" "" "Germline" "" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000787749" "0" "90" "1" "197396920" "197396920" "subst" "0" "01251" "CRB1_000130" "g.197396920G>A" "" "{PMID:Riveiro-Alvarez 2008:18334942}" "SnaBI+" "" "" "Germline" "" "" "0" "" "" "g.197427790G>A" "" "pathogenic" "" "0000788426" "0" "50" "1" "197396917" "197396917" "subst" "0.000240195" "00000" "CRB1_000129" "g.197396917C>T" "" "{PMID:Katagiri 2014:25268133}" "" "C2462T" "" "Germline" "" "rs142857810" "0" "" "" "g.197427787C>T" "" "VUS" "" "0000789680" "0" "90" "1" "197403965" "197403965" "subst" "0" "00000" "CRB1_000407" "g.197403965A>T" "" "{PMID:Jin 2008:18310263}" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000789765" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Jacobson 2008:18463160}" "" "LCA8(CRB1):Cys948Tyr" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000789766" "0" "90" "1" "197404646" "197404646" "subst" "0" "00000" "CRB1_000093" "g.197404646G>T" "" "{PMID:Jacobson 2008:18463160}" "" "LCA8(CRB1): Cys1218Phe" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000790087" "3" "90" "1" "197297574" "197297574" "subst" "0" "00000" "CRB1_000410" "g.197297574C>T" "" "{PMID:Li-2009:18936139}" "" "93C?T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000790088" "3" "90" "1" "197297574" "197297574" "subst" "0" "00000" "CRB1_000410" "g.197297574C>T" "" "{PMID:Li-2009:18936139}" "" "93C?T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000790092" "0" "10" "1" "197237569" "197237569" "subst" "0" "00000" "CRB1_000408" "g.197237569G>T" "" "{PMID:Li-2009:18936139}" "" "27G?T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000790099" "0" "30" "1" "197398711" "197398711" "subst" "0.000235799" "00000" "CRB1_000141" "g.197398711G>A" "" "{PMID:Seong-2008:18682808}" "" "c.2809G>A(A937T)" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000790141" "3" "50" "1" "197398617" "197398617" "subst" "0.000536224" "00000" "CRB1_000414" "g.197398617G>A" "" "{PMID:Singh 2009:19339744}" "" "c.2715G>A" "Other changes detected in the proband: rs58879207, rs3902057" "Germline" "" "" "0" "" "" "" "" "unclassified" "" "0000790324" "0" "50" "1" "197398616" "197398616" "subst" "0.000272194" "00000" "CRB1_000138" "g.197398616G>A" "" "{PMID:Vallespin 2007:18055816}" "" "c.2714G>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000790497" "0" "50" "1" "197297642" "197297642" "subst" "0.000402079" "00000" "CRB1_000411" "g.197297642G>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs140428156" "0" "" "" "g.197328512G>T" "" "VUS" "" "0000790513" "0" "50" "1" "197390289" "197390289" "subst" "0.0000162492" "00000" "CRB1_000412" "g.197390289G>A" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.197421159G>A" "" "VUS" "" "0000790537" "0" "50" "1" "197407674" "197407674" "subst" "0.000463871" "00000" "CRB1_000415" "g.197407674T>C" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs187937543" "0" "" "" "g.197438544T>C" "" "VUS" "" "0000790591" "0" "50" "1" "197390996" "197390996" "subst" "0" "00000" "CRB1_000413" "g.197390996C>G" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.197421866C>G" "" "VUS" "" "0000790609" "0" "50" "1" "197237582" "197237582" "subst" "0.0000243863" "00000" "CRB1_000409" "g.197237582C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.197268452C>T" "" "VUS" "" "0000790660" "0" "50" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs62645748" "0" "" "" "g.197434706G>A" "" "VUS" "" "0000791130" "1" "70" "1" "197396626" "197396626" "subst" "0.0000081355" "00000" "CRB1_000230" "g.197396626A>G" "0,00037 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.197427496A>G" "" "likely pathogenic" "ACMG" "0000791152" "21" "70" "1" "197391000" "197391000" "subst" "0.00000406732" "00000" "CRB1_000020" "g.197391000G>A" "0,00025 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.197421870G>A" "" "likely pathogenic" "ACMG" "0000791161" "3" "70" "1" "197404402" "197404402" "subst" "0" "00000" "CRB1_000416" "g.197404402T>C" "0,00012 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.197435272T>C" "" "likely pathogenic" "ACMG" "0000791238" "2" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "0,00062 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "ACMG" "0000791244" "11" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "0,00062 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "ACMG" "0000791579" "21" "90" "1" "197313426" "197313426" "dup" "0" "00000" "CRB1_000418" "g.197313426dup" "" "{PMID:Hosono2018:29844330}" "" "c.668dupT" "heterozygous, causative variant" "Germline" "yes" "" "0" "" "" "g.197344296dup" "" "pathogenic" "ACMG" "0000791584" "21" "90" "1" "197390292" "197390698" "del" "0" "00000" "CRB1_000420" "g.197390292_197390698del" "" "{PMID:Hosono2018:29844330}" "" "c.1334_1740del" "heterozygous, causative variant" "Germline" "yes" "" "0" "" "" "g.197421162_197421568del" "" "pathogenic" "ACMG" "0000791585" "10" "90" "1" "197237544" "197237544" "subst" "0" "00000" "CRB1_000417" "g.197237544T>C" "" "{PMID:Hosono2018:29844330}" "" "c.2T>C" "heterozygous, causative variant" "Germline" "yes" "" "0" "" "" "g.197268414T>C" "" "pathogenic" "ACMG" "0000791609" "11" "90" "1" "197390525" "197390525" "dup" "0" "00000" "CRB1_000421" "g.197390525dup" "" "{PMID:Hosono2018:29844330}" "" "c.1567dupC" "heterozygous, causative variant" "Germline" "yes" "" "0" "" "" "g.197421395dup" "" "pathogenic" "ACMG" "0000791610" "21" "90" "1" "197344361" "197344361" "dup" "0" "00000" "CRB1_000419" "g.197344361dup" "" "{PMID:Hosono2018:29844330}" "" "c.733dupG" "heterozygous, causative variant" "Germline" "yes" "" "0" "" "" "g.197313491dup" "" "pathogenic" "ACMG" "0000791616" "11" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Hosono2018:29844330}" "" "c.1576C>T" "heterozygous, causative variant" "Germline" "yes" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "ACMG" "0000791617" "21" "70" "1" "197404061" "197404061" "subst" "0" "00000" "CRB1_000287" "g.197404061T>G" "" "{PMID:Hosono2018:29844330}" "" "c.3068T>G" "heterozygous, causative variant" "Germline" "yes" "" "0" "" "" "g.197434931T>G" "" "likely pathogenic" "ACMG" "0000792046" "3" "90" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Avila Fernandez 2010:21151602}" "" "c.2234C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000792047" "3" "90" "1" "197411405" "197411405" "subst" "0.0000040618" "00000" "CRB1_000050" "g.197411405G>T" "" "{PMID:Avila Fernandez 2010:21151602}" "" "c.3988G>T" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000792048" "3" "90" "1" "197298092" "197298098" "del" "0" "00000" "CRB1_000423" "g.197298092_197298098delAAATAGG" "" "{PMID:Avila Fernandez 2010:21151602}" "" "c.611_617delAAATAGG" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000792088" "3" "90" "1" "197398583" "197398583" "subst" "0.000142177" "00000" "CRB1_000134" "g.197398583A>G" "" "{PMID:Avila Fernandez 2010:21151602}" "" "C.2681A>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000792164" "0" "10" "1" "197316487" "197316487" "subst" "0.000479235" "00000" "CRB1_000180" "g.197316487C>T" "1/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "866C>T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000792165" "0" "90" "1" "197404669" "197404669" "subst" "0.0000204062" "00000" "CRB1_000115" "g.197404669G>T" "2/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "3676G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000792177" "0" "10" "1" "197404486" "197404486" "subst" "0.00000815867" "00000" "CRB1_000084" "g.197404486T>C" "1/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "3493T>C" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000792178" "0" "10" "1" "197411424" "197411424" "subst" "0" "00000" "CRB1_000094" "g.197411424T>G" "3/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "4005+2T>G" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000792187" "0" "10" "1" "197396677" "197396677" "subst" "0.00000406934" "00000" "CRB1_000013" "g.197396677T>C" "1/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "2222T>C" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000792190" "3" "10" "1" "197404669" "197404669" "subst" "0.0000204062" "00000" "CRB1_000115" "g.197404669G>T" "2/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "3676G>T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000792191" "0" "10" "1" "197404669" "197404669" "subst" "0.0000204062" "00000" "CRB1_000115" "g.197404669G>T" "" "{PMID:li 2011:21602930}" "" "3676G>T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000792195" "0" "10" "1" "197390270" "197390270" "subst" "0" "00000" "NPHS2_000000" "g.?" "1/87 cases; 0/96 controls" "{PMID:li 2011:21602930}" "" "1312C>T" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000792225" "3" "90" "1" "197411331" "197411331" "subst" "0.00000406128" "00000" "CRB1_000079" "g.197411331C>T" "" "{PMID: Siemiatkowska 2011:22128245}" "" "c.3914C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000792251" "3" "90" "1" "197396674" "197396674" "subst" "0" "00000" "CRB1_000203" "g.197396674C>T" "" "{PMID:_Audo-2012:22277662}" "" "c.2219C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000793720" "3" "70" "1" "197297963" "197297963" "subst" "0" "00000" "CRB1_000210" "g.197297963C>T" "0/360 controls" "{PMID:Collin-2011:21217109}" "" "c.482C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000793955" "0" "70" "1" "197297965" "197297965" "subst" "0.00128897" "00000" "CRB1_000035" "g.197297965G>A" "" "{PMID:O\'Sullivan-2012:22581970}" "" "c.484G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000794058" "0" "70" "1" "197390534" "197390534" "subst" "0.0000324984" "03508" "CRB1_000017" "g.197390534C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "pathogenic" "ACMG" "0000794059" "0" "70" "1" "197390535" "197390535" "subst" "0" "03508" "CRB1_000422" "g.197390535G>C" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794299" "3" "70" "1" "197390799" "197390799" "subst" "0" "00000" "CRB1_000427" "g.197390799G>A" "" "{PMID:Wang 2018:30029497}" "" "NM_201253.2:c.1841G>A, NP_957705.1:p.(Gly614Asp), NC_000001.10:g.197390799G>A" "" "Germline" "?" "" "0" "" "" "g.197421669G>A" "" "likely pathogenic" "ACMG" "0000794300" "0" "70" "1" "197390682" "197390682" "subst" "0.00000406749" "00000" "CRB1_000426" "g.197390682C>T" "" "{PMID:Wang 2018:30029497}" "" "NM_201253.2:c.1724C>T, NP_957705.1:p.(Ala575Val), NC_000001.10:g.197390682C>T" "" "Germline" "?" "" "0" "" "" "g.197421552C>T" "" "likely pathogenic" "ACMG" "0000794301" "0" "90" "1" "197407789" "197407789" "subst" "0" "00000" "CRB1_000429" "g.197407789G>A" "" "{PMID:Wang 2018:30029497}" "" "NM_201253.2:c.3862G>A, NP_957705.1:p.(Gly1288Ser), NC_000001.10:g.197407789G>A" "" "Germline" "?" "" "0" "" "" "g.197438659G>A" "" "pathogenic" "ACMG" "0000794302" "0" "90" "1" "197398616" "197398616" "subst" "0.000272194" "00000" "CRB1_000138" "g.197398616G>A" "" "{PMID:Wang 2018:30029497}" "" "NM_201253.2:c.2714G>A, NP_957705.1:p.(Arg905Gln), NC_000001.10:g.197398616G>A" "" "Germline" "?" "" "0" "" "" "g.197429486G>A" "" "pathogenic" "ACMG" "0000794303" "0" "90" "1" "197398711" "197398711" "subst" "0.000235799" "00000" "CRB1_000141" "g.197398711G>A" "" "{PMID:Wang 2018:30029497}" "" "NM_201253.2:c.2809G>A, NP_957705.1:p.(Ala937Thr), NC_000001.10:g.197398711G>A" "" "Germline" "?" "" "0" "" "" "g.197429581G>A" "" "pathogenic" "ACMG" "0000794304" "0" "70" "1" "197391014" "197391014" "subst" "0" "00000" "CRB1_000258" "g.197391014C>T" "" "{PMID:Wang 2018:30029497}" "" "NM_201253.2:c.2056C>T, NP_957705.1:p.(Arg686Cys), NC_000001.10:g.197391014C>T" "" "Germline" "?" "" "0" "" "" "g.197421884C>T" "" "likely pathogenic" "ACMG" "0000794305" "0" "90" "1" "197396996" "197396997" "del" "0" "00000" "CRB1_000391" "g.197396996_197396997del" "" "{PMID:Wang 2018:30029497}" "" "NM_201253.2:c.2541_2542del, NP_957705.1:p.(Phe848GlnfsTer60), NC_000001.10:g.197396996_197396997del" "" "Germline" "?" "" "0" "" "" "g.197427866_197427867del" "" "pathogenic" "ACMG" "0000794306" "3" "90" "1" "197446995" "197446995" "subst" "0" "00000" "CRB1_000047" "g.197446995G>C" "" "{PMID:Wang 2018:30029497}" "" "NM_201253.2:c.4207G>C, NP_957705.1:p.(Glu1403Gln), NC_000001.10:g.197446995G>C" "" "Germline" "?" "" "0" "" "" "g.197477865G>C" "" "pathogenic" "ACMG" "0000794307" "0" "90" "1" "197297620" "197297620" "del" "0" "00000" "CRB1_000424" "g.197297620del" "" "{PMID:Wang 2018:30029497}" "" "NM_201253.2:c.139del, NP_957705.1:p.(Asp47IlefsTer24), NC_000001.10:g.197297620del" "" "Germline" "?" "" "0" "" "" "g.197328490del" "" "pathogenic" "ACMG" "0000794308" "0" "90" "1" "197403974" "197403975" "del" "0" "00000" "CRB1_000428" "g.197403974_197403975del" "" "{PMID:Wang 2018:30029497}" "" "NM_201253.2:c.2981_2982del, NP_957705.1:p.(Lys994ArgfsTer3), NC_000001.10:g.197403974_197403975del" "" "Germline" "?" "" "0" "" "" "g.197434844_197434845del" "" "pathogenic" "ACMG" "0000794833" "21" "50" "1" "197297925" "197297933" "del" "0" "00000" "CRB1_000425" "g.197297925_197297933del" "" "{PMID:Ezquerra-Inchausti 2018:30337596}" "" "NM_201253, c.444_452del, p.Asp148_Asp150del" "" "Germline" "yes" "" "0" "" "" "g.197328795_197328803del" "" "VUS" "" "0000794834" "11" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Ezquerra-Inchausti 2018:30337596}" "" "NM_201253, c.2843G>A, p.Cys948Tyr" "" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000795937" "0" "50" "19" "" "" "" "" "00000" "NPHS1_000138" "g.?" "" "{PMID:Schorderet-2013:23484092}" "" "p.CRX-Q105X" "Mother healthy heterozygous carrier" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000795960" "0" "30" "1" "197397096" "197397096" "subst" "0" "00000" "CRB1_000431" "g.197397096G>T" "" "{PMID:Chen-2013:23661368}" "" "c.2641G>T" "" "Unknown" "" "" "0" "" "" "" "" "likely benign" "" "0000795988" "0" "30" "1" "197398711" "197398711" "subst" "0.000235799" "00000" "CRB1_000141" "g.197398711G>A" "" "{PMID:Chen-2013:23661368}" "" "c.2809G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely benign" "" "0000796005" "0" "30" "1" "197390954" "197390954" "subst" "0.0000243964" "00000" "CRB1_000430" "g.197390954G>A" "" "{PMID:Chen-2013:23661368}" "" "c.1996G>A" "unknown variant 2nd chromosome" "Unknown" "" "" "0" "" "" "" "" "likely benign" "" "0000796052" "3" "90" "1" "197397012" "197397012" "subst" "0" "00000" "CRB1_000169" "g.197397012C>T" "" "{PMID:Jonsson-2013:23443024}" "" "c.2557C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796057" "3" "90" "1" "197397012" "197397012" "subst" "0" "00000" "CRB1_000169" "g.197397012C>T" "" "{PMID:Jonsson-2013:23443024}" "" "c.2557C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796059" "3" "90" "1" "197397012" "197397012" "subst" "0" "00000" "CRB1_000169" "g.197397012C>T" "" "{PMID:Jonsson-2013:23443024}" "" "c.2557C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796060" "3" "90" "1" "197397012" "197397012" "subst" "0" "00000" "CRB1_000169" "g.197397012C>T" "" "{PMID:Jonsson-2013:23443024}" "" "c.2557C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000796671" "3" "90" "1" "197390417" "197390417" "subst" "0" "00000" "CRB1_000201" "g.197390417T>C" "" "{PMID:Eisenberger-2013:24265693}" "" "c.1459T>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796673" "3" "90" "1" "197398746" "197398746" "subst" "0" "00000" "CRB1_000432" "g.197398746T>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2842+2T>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796674" "0" "70" "1" "197391000" "197391000" "subst" "0.00000406732" "00000" "CRB1_000020" "g.197391000G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2042G>A" "" "Germline" "" "rs62636266" "0" "" "" "" "" "likely pathogenic" "" "0000796675" "0" "90" "1" "197396763" "197396763" "subst" "0.00000407216" "00000" "CRB1_000121" "g.197396763G>C" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2308G>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796698" "0" "70" "1" "197404115" "197404115" "subst" "0.0000122034" "00000" "CRB1_000163" "g.197404115T>C" "" "{PMID:Eisenberger-2013:24265693}" "" "c.3122T>C" "" "Germline" "" "rs62635656" "0" "" "" "" "" "likely pathogenic" "" "0000796726" "0" "90" "1" "197396822" "197396822" "subst" "0" "00000" "CRB1_000124" "g.197396822T>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2367T>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796727" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2401A>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796736" "0" "70" "1" "197391000" "197391000" "subst" "0.00000406732" "00000" "CRB1_000020" "g.197391000G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2042G>A" "" "Germline" "" "rs62636266" "0" "" "" "" "" "likely pathogenic" "" "0000796741" "3" "90" "1" "197390138" "197390138" "subst" "0" "00000" "CRB1_000371" "g.197390138T>C" "" "{PMID:Eisenberger-2013:24265693}" "" "c.1180T>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000796769" "0" "70" "1" "197404390" "197404390" "subst" "0.00117376" "00000" "CRB1_000433" "g.197404390G>A" "" "{PMID:Eisenberger-2013:24265693}" "" "c.3397G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000797018" "0" "50" "1" "197407711" "197407711" "subst" "0" "00000" "CRB1_000434" "g.197407711G>A" "" "{PMID:Wang-2014:24154662}" "" "NM_001193640:c.3448G>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000797076" "0" "90" "1" "197326120" "197326120" "subst" "0.00000406065" "00000" "CRB1_000132" "g.197326120G>A" "" "{PMID:Birtel 2018:30543658}" "" "c.1148G>A , p.Cys383Tyr" "Heterozygous" "Germline" "?" "rs62645754" "0" "" "" "g.197356990G>A" "" "pathogenic" "ACMG" "0000797077" "3" "90" "1" "197404114" "197404114" "subst" "0.00000406788" "00000" "CRB1_000445" "g.197404114A>G" "" "{PMID:Birtel 2018:30543658}" "" "c.3121A>G, p.Met1041Val" "Homozygous" "Germline" "yes" "rs781705903" "0" "" "" "g.197434984A>G" "" "pathogenic" "ACMG" "0000797078" "0" "90" "1" "197391000" "197391000" "subst" "0.00000406732" "00000" "CRB1_000020" "g.197391000G>A" "" "{PMID:Birtel 2018:30543658}" "" "c.2042G>A , p.Cys681Tyr" "Heterozygous" "Germline" "yes" "rs62636266" "0" "" "" "g.197421870G>A" "" "pathogenic" "ACMG" "0000797079" "3" "90" "1" "197326120" "197326120" "subst" "0.00000406065" "00000" "CRB1_000132" "g.197326120G>A" "" "{PMID:Birtel 2018:30543658}" "" "c.1148G>A, p.Cys383Tyr" "Homozygous" "Germline" "yes" "rs62645754" "0" "" "" "g.197356990G>A" "" "pathogenic" "ACMG" "0000797155" "0" "70" "1" "197390903" "197390903" "subst" "0" "00000" "CRB1_000441" "g.197390903G>T" "" "{PMID:Birtel 2018:30543658}" "" "c.1945G>T, p.Asp649Tyr" "Heterozygous" "Germline" "" "" "0" "" "" "g.197421773G>T" "" "likely pathogenic" "ACMG" "0000797156" "0" "70" "1" "197396763" "197396763" "subst" "0.00000407216" "00000" "CRB1_000121" "g.197396763G>C" "" "{PMID:Birtel 2018:30543658}" "" "c.2308G>C, p.Gly770Arg" "Heterozygous" "Germline" "" "" "0" "" "" "g.197427633G>C" "" "likely pathogenic" "ACMG" "0000797174" "0" "50" "1" "197398700" "197398700" "subst" "0" "00000" "CRB1_000444" "g.197398700G>A" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.2798G>A/p.C933Y, allele 2: c.2843G>A/p.C948Y" "heterozygous" "Germline" "yes" "" "0" "" "" "g.197429570G>A" "" "VUS" "ACMG" "0000797175" "0" "70" "1" "197446827" "197446827" "del" "0" "00000" "CRB1_000367" "g.197446827del" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.4039del/p.T1347Lfs*5, allele 2: c.2843G>A/p.C948Y" "heterozygous" "Germline" "?" "" "0" "" "" "g.197477697del" "" "likely pathogenic" "ACMG" "0000797176" "0" "70" "1" "197297891" "197297891" "del" "0" "00000" "CRB1_000436" "g.197297891del" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.410del/p.P137Lfs*11, allele 2: c.2843G>A/p.C948Y" "heterozygous" "Germline" "?" "" "0" "" "" "g.197328761del" "" "likely pathogenic" "ACMG" "0000797177" "0" "70" "1" "197237613" "197237613" "subst" "0.0000040654" "00000" "CRB1_000435" "g.197237613G>A" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.70+1G>A/p.?, allele 2: c.2042G>A/p.C681Y" "heterozygous" "Germline" "yes" "" "0" "" "" "g.197268483G>A" "" "likely pathogenic" "ACMG" "0000797178" "0" "50" "1" "197396763" "197396763" "subst" "0.0000203608" "00000" "CRB1_000282" "g.197396763G>A" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.2308G>A/p.G770S, allele 2: c.2843G>A/p.C948Y" "heterozygous" "Germline" "?" "" "0" "" "" "g.197427633G>A" "" "VUS" "ACMG" "0000797179" "0" "70" "1" "197391030" "197391030" "subst" "0" "00000" "CRB1_000442" "g.197391030G>A" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.2072G>A/p.W691*, allele 2: c.2843G>A/p.C948Y" "heterozygous" "Germline" "?" "" "0" "" "" "g.197421900G>A" "" "likely pathogenic" "ACMG" "0000797198" "0" "50" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.2798G>A/p.C933Y, allele 2: c.2843G>A/p.C948Y" "heterozygous" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "VUS" "ACMG" "0000797199" "0" "50" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.4039del/p.T1347Lfs*5, allele 2: c.2843G>A/p.C948Y" "heterozygous" "Germline" "?" "" "0" "" "" "g.197434706G>A" "" "VUS" "ACMG" "0000797200" "0" "50" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.410del/p.P137Lfs*11, allele 2: c.2843G>A/p.C948Y" "heterozygous" "Germline" "?" "" "0" "" "" "g.197434706G>A" "" "VUS" "ACMG" "0000797201" "0" "50" "1" "197391000" "197391000" "subst" "0.00000406732" "00000" "CRB1_000020" "g.197391000G>A" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.70+1G>A/p.?, allele 2: c.2042G>A/p.C681Y" "heterozygous" "Germline" "yes" "" "0" "" "" "g.197421870G>A" "" "VUS" "ACMG" "0000797202" "0" "50" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.2308G>A/p.G770S, allele 2: c.2843G>A/p.C948Y" "heterozygous" "Germline" "?" "" "0" "" "" "g.197434706G>A" "" "VUS" "ACMG" "0000797203" "0" "50" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2018:30576320}" "" "allele 1: c.2072G>A/p.W691*, allele 2: c.2843G>A/p.C948Y" "heterozygous" "Germline" "?" "" "0" "" "" "g.197434706G>A" "" "VUS" "ACMG" "0000797214" "3" "70" "1" "197396844" "197396844" "subst" "0" "00000" "CRB1_000443" "g.197396844T>C" "" "{PMID:Ravesh 2018:30416334}" "" "c.2389T>C;p.(S797P)" "" "Germline" "yes" "" "0" "" "" "g.197427714T>C" "" "likely pathogenic" "ACMG" "0000797410" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Patel 2019:30653986}" "" "different transcript: NM_001193640.1(CRB1):c.2507G-->A, c.3670-1G-->A; p.Cys836Tyr, p.?" "no Sanger sequencing; potentially compound heterozygous" "Germline" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000797453" "0" "70" "1" "197446793" "197446793" "subst" "0.00000407594" "00000" "CRB1_000181" "g.197446793G>A" "" "{PMID:Patel 2019:30653986}" "" "different transcript: NM_001193640.1(CRB1):c.2507G-->A, c.3670-1G-->A; p.Cys836Tyr, p.?" "no Sanger sequencing; potentially compound heterozygous" "Germline" "?" "" "0" "" "" "g.197477663G>A" "" "likely pathogenic" "" "0000797589" "0" "70" "1" "197404114" "197404114" "subst" "0.00000406788" "00000" "CRB1_000445" "g.197404114A>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.3121A>G, p.(Met1041Val), c.3916_3921del, p.(Cys1306_Val1307del)" "" "Germline" "?" "" "0" "" "" "g.197434984A>G" "" "likely pathogenic" "ACMG" "0000797590" "0" "70" "1" "197411333" "197411338" "del" "0" "00000" "CRB1_000446" "g.197411333_197411338del" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.3121A>G, p.(Met1041Val), c.3916_3921del, p.(Cys1306_Val1307del)" "" "Germline" "?" "" "0" "" "" "g.197442203_197442208del" "" "likely pathogenic" "ACMG" "0000797591" "0" "50" "1" "197446942" "197446942" "subst" "0" "00000" "CRB1_000447" "g.197446942A>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.613_619del, p.(Ile205Aspfs*13), c.4154A>G, p.(Glu1385Gly)" "" "Germline" "?" "" "0" "" "" "g.197477812A>G" "" "VUS" "ACMG" "0000797592" "0" "70" "1" "197298094" "197298100" "del" "0" "00000" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.613_619del, p.(Ile205Aspfs*13), c.4154A>G, p.(Glu1385Gly)" "" "Germline" "?" "" "0" "" "" "g.197328964_197328970del" "" "likely pathogenic" "ACMG" "0000797593" "3" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.2290C>T, p.(Arg764Cys), c.2290C>T, p.(Arg764Cys)" "homozygous" "Germline" "?" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "ACMG" "0000797594" "0" "70" "1" "197298094" "197298100" "del" "0" "00000" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.613_619del, p.(Ile205Aspfs*13), c.2234C>T, p.(Thr745Met)" "" "Germline" "?" "" "0" "" "" "g.197328964_197328970del" "" "likely pathogenic" "ACMG" "0000797595" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.613_619del, p.(Ile205Aspfs*13), c.2234C>T, p.(Thr745Met)" "" "Germline" "?" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "ACMG" "0000797596" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.1892A>G, p.(Tyr631Cys), c.2401A>T, p.(Lys801*)" "" "Germline" "?" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "ACMG" "0000797597" "0" "50" "1" "197390850" "197390850" "subst" "0.00000406455" "00000" "CRB1_000257" "g.197390850A>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.1892A>G, p.(Tyr631Cys), c.2401A>T, p.(Lys801*)" "" "Germline" "?" "" "0" "" "" "g.197421720A>G" "" "VUS" "ACMG" "0000797598" "0" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.1182C>A, p.(Cys394*), c.2290C>T, p.(Arg764Cys)" "" "Germline" "?" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "ACMG" "0000797599" "0" "70" "1" "197390140" "197390140" "subst" "0.0000121968" "00000" "CRB1_000438" "g.197390140C>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.1182C>A, p.(Cys394*), c.2290C>T, p.(Arg764Cys)" "" "Germline" "?" "" "0" "" "" "g.197421010C>A" "" "likely pathogenic" "ACMG" "0000797600" "0" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.2290C>T, p.(Arg764Cys), c.2843G>A, p.(Cys948Tyr)" "" "Germline" "?" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "ACMG" "0000797601" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.2290C>T, p.(Arg764Cys), c.2843G>A, p.(Cys948Tyr)" "" "Germline" "?" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "ACMG" "0000797604" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.508T>C, p.(Tyr170His), c.2843G>A, p.(Cys948Tyr)" "" "Germline" "?" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "ACMG" "0000797605" "0" "50" "1" "197297989" "197297989" "subst" "0" "00000" "CRB1_000437" "g.197297989T>C" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.508T>C, p.(Tyr170His), c.2843G>A, p.(Cys948Tyr)" "" "Germline" "?" "" "0" "" "" "g.197328859T>C" "" "VUS" "ACMG" "0000797988" "0" "70" "1" "197390514" "197390514" "subst" "0" "00000" "CRB1_000439" "g.197390514C>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.1556C>A, p.(Pro519Gln)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.197421384C>A" "" "likely pathogenic" "ACMG" "0000797989" "0" "90" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.2843G>A, p.(Cys948Tyr)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.197434706G>A" "" "pathogenic" "ACMG" "0000797990" "0" "70" "1" "197298095" "197298095" "subst" "0.000591041" "00000" "CRB1_000002" "g.197298095T>C" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.614T>C, p.(Ile205Thr)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.197328965T>C" "" "likely pathogenic" "ACMG" "0000797991" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.2401A>T, p.(Lys801*)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "ACMG" "0000797992" "0" "70" "1" "197390851" "197390851" "subst" "0" "00000" "CRB1_000440" "g.197390851T>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.1893T>G, p.(Tyr631*)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.197421721T>G" "" "likely pathogenic" "ACMG" "0000797993" "0" "70" "1" "197297616" "197297616" "subst" "0.000381803" "00000" "CRB1_000031" "g.197297616C>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.135 C>G, p.(Cys45Trp)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.197328486C>G" "" "likely pathogenic" "ACMG" "0000797994" "0" "70" "1" "197297616" "197297616" "subst" "0.000381803" "00000" "CRB1_000031" "g.197297616C>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "CRB1 c.135C>G, p.(Cys45Trp)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.197328486C>G" "" "likely pathogenic" "ACMG" "0000798419" "3" "50" "1" "197404289" "197404289" "subst" "0" "00000" "CRB1_000098" "g.197404289C>A" "" "{PMID:Azam-2011:21987686}" "" "c.3296C>A," "" "Unknown" "" "" "0" "" "" "" "" "unclassified" "" "0000798988" "0" "30" "1" "197297965" "197297965" "subst" "0.00128897" "01943" "CRB1_000035" "g.197297965G>A" "" "" "" "CRB1(NM_001257965.1):c.277G>A (p.V93M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000798989" "0" "90" "1" "197298093" "197298102" "del" "0" "02330" "CRB1_000448" "g.197298093_197298102del" "" "" "" "CRB1(NM_001257965.2):c.405_414delAATAGGAAGA (p.E135Dfs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000798990" "0" "50" "1" "197396961" "197396961" "subst" "0.00019522" "02330" "CRB1_000026" "g.197396961C>A" "" "" "" "CRB1(NM_001257965.2):c.2299C>A (p.P767T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000798991" "0" "50" "1" "197398749" "197398749" "subst" "0.0000325529" "01943" "CRB1_000034" "g.197398749G>A" "" "" "" "CRB1(NM_001257965.1):c.2770+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000798992" "0" "70" "1" "197411405" "197411405" "del" "0" "02330" "CRB1_000049" "g.197411405del" "" "" "" "CRB1(NM_001257965.2):c.3916delG (p.E1306Sfs*11)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000798993" "0" "50" "1" "197447002" "197447002" "subst" "0" "02330" "CRB1_000449" "g.197447002T>C" "" "" "" "CRB1(NM_001257965.2):c.4142T>C (p.L1381P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000810870" "0" "90" "1" "197237575" "197237575" "del" "0" "00000" "CRB1_000450" "g.197237575del" "" "{PMID:Anasagasti-2013:24416769}" "" "p.Thr126Met" "" "Germline" "yes" "rs28939720" "0" "" "" "" "" "pathogenic (recessive)" "" "0000810896" "0" "90" "1" "197313570" "197313570" "subst" "0" "00000" "CRB1_000451" "g.197313570C>T" "0.01" "{PMID:Anasagasti-2013:24416769}" "" "c.820-8C>Tdel2123C" "" "Germline" "yes" "rs73071678" "0" "" "" "" "" "pathogenic (recessive)" "" "0000810924" "0" "90" "1" "197298112" "197298112" "subst" "0" "00000" "CRB1_000177" "g.197298112A>T" "0.33" "{PMID:Anasagasti-2013:24416769}" "" "p.Ile211Phe" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000811408" "3" "70" "1" "197398572" "197398572" "subst" "0" "00000" "CRB1_000460" "g.197398572T>A" "" "{PMID:Khan 2019:31725702}" "" "Allele 1 c.2677-7T>A (p.?), Allele 2 c.2677-7T>A (p.?)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197429442T>A" "" "likely pathogenic" "" "0000811409" "3" "70" "1" "197396960" "197396963" "del" "0" "00000" "CRB1_000459" "g.197396960_197396963del" "" "{PMID:Khan 2019:31725702}" "" "Allele 1 c.2505_2508del (p.Pro836Thrfs*19), Allele 2 c.2505_2508del (p.Pro836Thrfs*19)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197427830_197427833del" "" "likely pathogenic" "" "0000811410" "3" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Khan 2019:31725702}" "" "Allele 1 c.2234C>T (p.Thr745Met), Allele 2 c.2234C>T (p.Thr745Met)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000811411" "0" "70" "1" "197403904" "197403904" "subst" "0" "00000" "CRB1_000461" "g.197403904A>G" "" "{PMID:Khan 2019:31725702}" "" "Allele 1 c.2911A>G (p.Arg971Gly, Allele 2 c.3447G>C (p.Leu1149Phe)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197434774A>G" "" "likely pathogenic" "" "0000811412" "0" "70" "1" "197404440" "197404440" "subst" "0" "00000" "CRB1_000463" "g.197404440G>C" "" "{PMID:Khan 2019:31725702}" "" "Allele 1 c.2911A>G (p.Arg971Gly, Allele 2 c.3447G>C (p.Leu1149Phe)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197435310G>C" "" "likely pathogenic" "" "0000811413" "3" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Khan 2019:31725702}" "" "Allele 1 c.2234C>T, p.(Thr745Met), Allele 2 c.2234C>T, p.(Thr745Met)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000811414" "3" "70" "1" "197411378" "197411378" "subst" "0" "00000" "CRB1_000465" "g.197411378T>G" "" "{PMID:Khan 2019:31725702}" "" "Allele 1 c.3961T>G (p.Cys1321Gly), Allele 2 c.3961T>G (p.Cys1321Gly)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197442248T>G" "" "likely pathogenic" "" "0000811809" "0" "70" "4" "197411331" "197411331" "subst" "0" "00000" "CRB1_000079" "g.197411331C>T" "" "{PMID:Gao 2019:31054281}" "" "c.3914C>T, p.Pro1305Leu" "heterozygous" "Germline" "?" "" "0" "" "" "g.197442201C>T" "" "likely pathogenic" "" "0000811810" "0" "70" "4" "197411331" "197411331" "subst" "0" "00000" "CRB1_000079" "g.197411331C>T" "" "{PMID:Gao 2019:31054281}" "" "c.3914C>T, p.Pro1305Leu" "heterozygous" "Germline" "?" "" "0" "" "" "g.197442201C>T" "" "likely pathogenic" "" "0000811815" "0" "70" "14" "197411331" "197411331" "subst" "0" "00000" "CRB1_000079" "g.197411331C>T" "" "{PMID:Gao 2019:31054281}" "" "c.3914C>T, p.Pro1305Leu" "heterozygous" "Germline" "?" "" "0" "" "" "g.197442201C>T" "" "likely pathogenic" "" "0000811823" "0" "70" "6" "197396627" "197396627" "subst" "0" "00000" "CRB1_000386" "g.197396627T>A" "" "{PMID:Gao 2019:31054281}" "" "c.2172T>A, p.Tyr724Ter" "heterozygous" "Germline" "?" "" "0" "" "" "g.197427497T>A" "" "likely pathogenic" "" "0000811866" "0" "70" "2" "197407803" "197407803" "subst" "0" "00000" "CRB1_000001" "g.197407803A>G" "" "{PMID:Gao 2019:31054281}" "" "c.3876A>G, p.Glu1292Glu" "heterozygous" "Germline" "?" "" "0" "" "" "g.197438673A>G" "" "likely pathogenic" "" "0000811946" "3" "70" "1" "197326097" "197326097" "subst" "0" "00000" "CRB1_000192" "g.197326097C>G" "" "{PMID:Hariri 2018:31047384}" "" "c.1125C/G (p.Tyr375\'\') (homozygous; \'\'-premature termination)" "" "Germline" "?" "" "0" "" "" "g.197356967C>G" "" "likely pathogenic" "" "0000811947" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Hariri 2018:31047384}" "" "c.498_506del9, p.Cys948Tyr:c.2843G/A (alleles in trans)" "" "Germline" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000811948" "0" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Hariri 2018:31047384}" "" "c.498_506del9, p.Cys948Tyr:c.2843G/A (alleles in trans)" "" "Germline" "?" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000812008" "3" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "00000" "CRB1_000101" "g.197404292T>C" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.9 c.3299T>C p.(Ile1100Thr), Ex.9 c.3299T>C p.(Ile1100Thr)" "homozygous" "Germline" "yes" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000812059" "0" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.2 c.498_506del p.(Ile167_Gly169del), Ex.7 c.2290C>T p.(Arg764Cys)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000812060" "0" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.2 c.498_506del p.(Ile167_Gly169del), Ex.7 c.2290C>T p.(Arg764Cys)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000812081" "0" "70" "1" "197297911" "197297911" "subst" "0.000158815" "00000" "CRB1_000217" "g.197297911T>G" "" "{PMID:Martin Merida 2019:30902645}" "" "ZNF408 Ex.5 c.1621C>T p.(Arg541Cys), Ex.5 c.1621C>T p.(Arg541Cys), CRB1: p.(Phe144Val) Ex.2 c.430T>G" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197328781T>G" "" "likely pathogenic" "" "0000812088" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.7 c.2234C>T p.(Thr745Met), Ex.7 c.2416G>T p.(Glu806*)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000812089" "0" "70" "1" "197396871" "197396871" "subst" "0" "00000" "CRB1_000126" "g.197396871G>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.7 c.2234C>T p.(Thr745Met), Ex.7 c.2416G>T p.(Glu806*)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197427741G>T" "" "likely pathogenic" "" "0000812112" "3" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "00000" "CRB1_000101" "g.197404292T>C" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.9 c.3299T>C p.(Ile1100Thr), Ex.9 c.3299T>C p.(Ile1100Thr)" "homozygous" "Germline" "yes" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000812122" "0" "70" "1" "197298094" "197298100" "del" "0" "00000" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Martin Merida 2019:30902645}" "" "CNGB1 Ex.11 c.801del p.(Leu267Phefs*10), Ex.21 c.2104T>A p.(Tyr702Asn), CRB1: Ex.2 c.613_619del (p.Ile205Aspfs*13)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197328964_197328970del" "" "likely pathogenic" "" "0000812141" "3" "70" "1" "197398598" "197398598" "subst" "0" "00000" "CRB1_000135" "g.197398598G>C" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.8 c.2696G>C p.(Gly899Ala), IVS10 c.3878+2dup p.(?)" "homozygous" "Germline" "yes" "" "0" "" "" "g.197429468G>C" "" "likely pathogenic" "" "0000812149" "0" "70" "1" "197390660" "197390660" "subst" "0" "00000" "CRB1_000234" "g.197390660C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.6 c.1702C>T p.(His568Tyr), Ex.12 c.4142C>T p.(Pro1381Leu)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197421530C>T" "" "likely pathogenic" "" "0000812150" "0" "70" "1" "197446930" "197446930" "subst" "0" "00000" "CRB1_000015" "g.197446930C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.6 c.1702C>T p.(His568Tyr), Ex.12 c.4142C>T p.(Pro1381Leu)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197477800C>T" "" "likely pathogenic" "" "0000812151" "0" "70" "1" "197390648" "197390648" "subst" "0" "00000" "CRB1_000236" "g.197390648G>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.6 c.1690G>T p.(Asp564Tyr), Ex.9 c.3014A>T p.(Asp1005Val)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197421518G>T" "" "likely pathogenic" "" "0000812152" "0" "70" "1" "197404007" "197404007" "subst" "0.0000244351" "00000" "CRB1_000159" "g.197404007A>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.6 c.1690G>T p.(Asp564Tyr), Ex.9 c.3014A>T p.(Asp1005Val)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197434877A>T" "" "likely pathogenic" "" "0000812159" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.9 c.2843G>A p.(Cys948Tyr), Ex.9 c.3607G>T p.(Glu1203*)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000812160" "0" "70" "1" "197404600" "197404600" "subst" "0" "00000" "CRB1_000089" "g.197404600G>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.9 c.2843G>A p.(Cys948Tyr), Ex.9 c.3607G>T p.(Glu1203*)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197435470G>T" "" "likely pathogenic" "" "0000812163" "3" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.7 c.2234C>T p.(Thr745Met), Ex.7 c.2234C>T p.(Thr745Met)" "homozygous" "Germline" "yes" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000812167" "0" "70" "1" "197404292" "197404292" "subst" "0.0000040783" "00000" "CRB1_000101" "g.197404292T>C" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.9 c.3299T>C p.(Ile1100Thr), IVS9 c.3749+2_3749+3del p.(?)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197435162T>C" "" "likely pathogenic" "" "0000812168" "0" "70" "1" "197404744" "197404745" "del" "0" "00000" "CRB1_000072" "g.197404744_197404745del" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.9 c.3299T>C p.(Ile1100Thr), IVS9 c.3749+2_3749+3del p.(?)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197435614_197435615del" "" "likely pathogenic" "" "0000812171" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.9 c.2843G>A p.(Cys948Tyr), Ex.9 c.3157A>G p.(Met1053Val)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000812172" "0" "70" "1" "197404150" "197404150" "subst" "0.0000040663" "00000" "CRB1_000174" "g.197404150A>G" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.9 c.2843G>A p.(Cys948Tyr), Ex.9 c.3157A>G p.(Met1053Val)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197435020A>G" "" "likely pathogenic" "" "0000812183" "0" "70" "1" "197396746" "197396746" "subst" "0.0000122099" "00000" "CRB1_000061" "g.197396746G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.7 c.2291G>A p.(Arg764His), Ex.12 c.4168C>T p.(Arg1390*)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197427616G>A" "" "likely pathogenic" "" "0000812184" "0" "70" "1" "197446956" "197446956" "subst" "0.00000815295" "00000" "CRB1_000045" "g.197446956C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.7 c.2291G>A p.(Arg764His), Ex.12 c.4168C>T p.(Arg1390*)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197477826C>T" "" "likely pathogenic" "" "0000812201" "0" "70" "1" "197297962" "197297962" "subst" "0" "00000" "CRB1_000452" "g.197297962G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.2 c.481G>A p.(Ala161Thr), IVS2 c.653-1G>T p.(?)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197328832G>A" "" "likely pathogenic" "" "0000812202" "0" "70" "1" "197313410" "197313410" "subst" "0.0000164016" "00000" "CRB1_000454" "g.197313410G>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.2 c.481G>A p.(Ala161Thr), IVS2 c.653-1G>T p.(?)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197344280G>T" "" "likely pathogenic" "" "0000812251" "0" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.2 c.498_506del p.(Ile167_Gly169del), Ex.7 c.2234C>T p.(Thr745Met)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000812252" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.2 c.498_506del p.(Ile167_Gly169del), Ex.7 c.2234C>T p.(Thr745Met)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000812261" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.9 c.2843G>A p.(Cys948Tyr), Ex.9 c.2843G>A p.(Cys948Tyr)" "homozygous" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000812284" "0" "70" "1" "197391012" "197391012" "subst" "0.00000406851" "00000" "CRB1_000456" "g.197391012G>C" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.6 c.2054G>C p.(Gly685Ala), Ex.12 c.4142C>T p.(Pro1381Leu)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197421882G>C" "" "likely pathogenic" "" "0000812285" "0" "70" "1" "197446930" "197446930" "subst" "0" "00000" "CRB1_000015" "g.197446930C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.6 c.2054G>C p.(Gly685Ala), Ex.12 c.4142C>T p.(Pro1381Leu)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197477800C>T" "" "likely pathogenic" "" "0000812323" "0" "70" "1" "197446936" "197446936" "subst" "0.000220166" "00000" "CRB1_000044" "g.197446936G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "USH2A Ex.13 c.2276G>T p.(Cys759Phe), Ex.13 c.2276G>T p.(Cys759Phe), CRB1 : Ex.12 c.4148G>A p.(Arg1383His)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197477806G>A" "" "likely pathogenic" "" "0000812347" "3" "70" "1" "197298094" "197298100" "del" "0" "00000" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.2 c.613_619del p.(Ile205Aspfs*13), Ex.2 c.613_619del p.(Ile205Aspfs*13)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197328964_197328970del" "" "likely pathogenic" "" "0000812379" "0" "70" "1" "197396583" "197396583" "subst" "0" "00000" "CRB1_000458" "g.197396583G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 IVS6 c.2129-1G>A p.(?), Ex.9 c.3482A>G p.(Tyr1161Cys)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197427453G>A" "" "likely pathogenic" "" "0000812380" "0" "70" "1" "197404475" "197404475" "subst" "0.00000407857" "00000" "CRB1_000082" "g.197404475A>G" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 IVS6 c.2129-1G>A p.(?), Ex.9 c.3482A>G p.(Tyr1161Cys)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197435345A>G" "" "likely pathogenic" "" "0000812381" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.9 c.2843G>A p.(Cys948Tyr), Ex.9 c.2843G>A p.(Cys948Tyr)" "homozygous" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000812411" "0" "70" "1" "197396746" "197396746" "subst" "0.0000122099" "00000" "CRB1_000061" "g.197396746G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "CERKL Ex.1 c.182T>A p.(Val61Glu), Ex.1 c.182T>A p.(Val61Glu), CRB1: Ex.7 c.2291G>A p.(Arg764His)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197427616G>A" "" "likely pathogenic" "" "0000812412" "0" "70" "1" "197390660" "197390660" "subst" "0" "00000" "CRB1_000234" "g.197390660C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.6 c.1702C>T (p.His568Tyr), Ex.9 c.3308G>T p.(Gly1103Val)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197421530C>T" "" "likely pathogenic" "" "0000812413" "0" "70" "1" "197404301" "197404301" "subst" "0" "00000" "CRB1_000462" "g.197404301G>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.6 c.1702C>T (p.His568Tyr), Ex.9 c.3308G>T p.(Gly1103Val)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197435171G>T" "" "likely pathogenic" "" "0000812421" "3" "70" "1" "197396746" "197396746" "subst" "0.0000122099" "00000" "CRB1_000061" "g.197396746G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.7 c.2291G>A p.(Arg764His), Ex.7 c.2291G>A p.(Arg764His)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197427616G>A" "" "likely pathogenic" "" "0000812424" "0" "70" "1" "197298094" "197298100" "del" "0" "00000" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.2 c.613_619del (p.Ile205Aspfs*13), IVS2 c.653-1G>T p.(?)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197328964_197328970del" "" "likely pathogenic" "" "0000812425" "0" "70" "1" "197313410" "197313410" "subst" "0.0000164016" "00000" "CRB1_000454" "g.197313410G>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.2 c.613_619del (p.Ile205Aspfs*13), IVS2 c.653-1G>T p.(?)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197344280G>T" "" "likely pathogenic" "" "0000812434" "0" "70" "1" "197297962" "197297962" "dup" "0" "00000" "CRB1_000209" "g.197297962dup" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.2 c.481dup p.(Ala161Glyfs*8), Ex.7 c.2488A>T p.(Ile830Phe)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197328832dup" "" "likely pathogenic" "" "0000812435" "0" "70" "1" "197396943" "197396943" "subst" "0.0000772791" "00000" "CRB1_000042" "g.197396943A>T" "" "{PMID:Martin Merida 2019:30902645}" "" "CRB1 Ex.2 c.481dup p.(Ala161Glyfs*8), Ex.7 c.2488A>T p.(Ile830Phe)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197427813A>T" "" "likely pathogenic" "" "0000812483" "3" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Tayebi 2019:30820146}" "" "c.2234C>T, p.(Thr745Met)" "Homozygous" "Germline" "yes" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000812488" "3" "70" "1" "197298029" "197298029" "subst" "0" "00000" "CRB1_000453" "g.197298029G>A" "" "{PMID:Tayebi 2019:30820146}" "" "c.548G>A, p.(Cys183Tyr)" "Homozygous" "Germline" "yes" "" "0" "" "" "g.197328899G>A" "" "likely pathogenic" "" "0000812696" "0" "70" "1" "197313473" "197313473" "subst" "0" "00000" "CRB1_000455" "g.197313473T>C" "" "{PMID:Wang 2019:31106028}" "" "c.715T>C, p.(Cys239Arg)" "heterozygous" "Germline" "?" "" "0" "" "" "g.197344343T>C" "" "likely pathogenic" "" "0000812697" "0" "70" "1" "197397094" "197397094" "subst" "0" "00000" "CRB1_000335" "g.197397094A>G" "" "{PMID:Wang 2019:31106028}" "" "c.2639A>G, p.(Asn880Ser)" "heterozygous" "Germline" "?" "" "0" "" "" "g.197427964A>G" "" "likely pathogenic" "" "0000812731" "0" "90" "1" "197396582" "197396582" "subst" "0" "00000" "CRB1_000457" "g.197396582A>G" "" "{PMID:Wang 2019:31106028}" "" "c.2129-2A>G, p.?" "heterozygous" "Germline" "?" "" "0" "" "" "g.197427452A>G" "" "pathogenic" "" "0000812732" "0" "70" "1" "197396826" "197396826" "subst" "0" "00000" "CRB1_000387" "g.197396826G>C" "" "{PMID:Wang 2019:31106028}" "" "c.2371G>C, p.(Gly791Arg)" "heterozygous" "Germline" "?" "" "0" "" "" "g.197427696G>C" "" "likely pathogenic" "" "0000812811" "0" "90" "1" "197407734" "197407734" "subst" "0" "00000" "CRB1_000464" "g.197407734C>A" "" "{PMID:Wang 2019:31106028}" "" "c.3807C>A, p.(Tyr1269*)" "single heterozygous variant in a recessive gene" "Germline" "?" "" "0" "" "" "g.197438604C>A" "" "pathogenic" "" "0000813181" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.2843G.A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000813197" "0" "30" "1" "197297616" "197297616" "subst" "0.000381803" "00000" "CRB1_000031" "g.197297616C>G" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.135C>G" "" "Germline" "no" "" "0" "" "" "" "" "likely benign" "" "0000813198" "0" "30" "1" "197411303" "197411303" "subst" "0" "00000" "CRB1_000472" "g.197411303A>C" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.3886A>C" "" "Germline" "no" "" "0" "" "" "" "" "likely benign" "" "0000813199" "0" "30" "1" "197411377" "197411377" "subst" "0" "00000" "CRB1_000474" "g.197411377G>C" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.3960G>C" "" "Germline" "no" "" "0" "" "" "" "" "likely benign" "" "0000813644" "1" "70" "1" "197390363" "197390363" "subst" "0" "00000" "CRB1_000468" "g.197390363T>G" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.219772T>G, c.1405T>G, p.C469G" "" "Germline" "yes" "" "0" "" "" "g.197421233T>G" "" "likely pathogenic" "ACMG" "0000813653" "1" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.219943C>T, c.1576C>T, p.R526X" "" "Germline" "yes" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "ACMG" "0000813666" "1" "90" "1" "197398749" "197398749" "subst" "0.0000325529" "00000" "CRB1_000034" "g.197398749G>A" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.228158G>A, c.2842+5G>A" "" "Germline" "yes" "" "0" "" "" "g.197429619G>A" "" "pathogenic" "ACMG" "0000813672" "1" "90" "1" "197396677" "197396677" "subst" "0.00000406934" "00000" "CRB1_000013" "g.197396677T>C" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.226086T>C, c.2222T>C, p.M741T" "" "Germline" "yes" "" "0" "" "" "g.197427547T>C" "" "pathogenic" "ACMG" "0000813673" "0" "90" "1" "197297769" "197297769" "subst" "0" "00000" "CRB1_000466" "g.197297769C>A" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.127178C>A, c.288C>A, p.C96X" "" "Unknown" "?" "" "0" "" "" "g.197328639C>A" "" "pathogenic" "ACMG" "0000813675" "0" "70" "1" "197404435" "197404435" "subst" "0" "00000" "CRB1_000074" "g.197404435T>C" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.233844T>C, c.3442T>C, p.C1148R" "" "Unknown" "?" "" "0" "" "" "g.197435305T>C" "" "likely pathogenic" "ACMG" "0000813685" "1" "90" "1" "197325960" "197325960" "subst" "0" "00000" "CRB1_000467" "g.197325960G>A" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.155553G>A, c.989+1G>A" "error in annotation: it must be either c.989-1G>A or c.988+1G>A" "Germline" "yes" "" "0" "" "" "g.197356830G>A" "" "pathogenic" "ACMG" "0000813693" "1" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.219943C>T, c.1576C>T, p.R526X" "" "Germline" "yes" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "ACMG" "0000813720" "1" "70" "1" "197390363" "197390363" "subst" "0" "00000" "CRB1_000468" "g.197390363T>G" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.219772T>G, c.1405T>G, p.C469G" "" "Germline" "yes" "" "0" "" "" "g.197421233T>G" "" "likely pathogenic" "ACMG" "0000813723" "3" "90" "1" "197396967" "197396967" "subst" "0" "00000" "CRB1_000389" "g.197396967A>T" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.226376A>T, c.2512A>T, p.K838X" "" "Germline" "yes" "" "0" "" "" "g.197427837A>T" "" "pathogenic" "ACMG" "0000813726" "1" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.219943C>T, c.1576C>T, p.R526X" "" "Germline" "yes" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "ACMG" "0000813742" "2" "70" "1" "197390480" "197390480" "subst" "0" "00000" "CRB1_000469" "g.197390480T>C" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.219889T>C, c.1522T>C, p.C508R" "" "Germline" "yes" "" "0" "" "" "g.197421350T>C" "" "likely pathogenic" "ACMG" "0000813748" "2" "90" "1" "197396967" "197396967" "subst" "0" "00000" "CRB1_000389" "g.197396967A>T" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.226376A>T, c.2512A>T, p.K838X" "" "Germline" "yes" "" "0" "" "" "g.197427837A>T" "" "pathogenic" "ACMG" "0000813755" "2" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.219943C>T, c.1576C>T, p.R526X" "" "Germline" "yes" "" "0" "" "" "g.197421404C>T" "" "pathogenic" "ACMG" "0000813757" "2" "90" "1" "197396735" "197396735" "subst" "0" "00000" "CRB1_000471" "g.197396735T>A" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.226144T>A, c.2280T>A, p.Y760X" "" "Germline" "yes" "" "0" "" "" "g.197427605T>A" "" "pathogenic" "ACMG" "0000813758" "0" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.226154C>T, c.2290C>T, p. R764C" "" "Unknown" "?" "" "0" "" "" "g.197427615C>T" "" "pathogenic" "ACMG" "0000813760" "0" "90" "1" "197411363" "197411366" "del" "0" "00000" "CRB1_000473" "g.197411363_197411366del" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.240771_240774delACTC, c.3945_3948delACTC, p.L1316Tfs24" "" "Unknown" "?" "" "0" "" "" "g.197442233_197442236del" "" "pathogenic" "ACMG" "0000813765" "2" "70" "1" "197446918" "197446918" "subst" "0" "00000" "CRB1_000402" "g.197446918G>A" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.276327G>A, c.4130G>A, p.G1377E" "" "Germline" "yes" "" "0" "" "" "g.197477788G>A" "" "likely pathogenic" "ACMG" "0000813769" "2" "90" "1" "197407789" "197407789" "subst" "0" "00000" "CRB1_000429" "g.197407789G>A" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.237198G>A, c.3862G>A, p.G1288S" "" "Germline" "yes" "" "0" "" "" "g.197438659G>A" "" "pathogenic" "ACMG" "0000813784" "2" "90" "1" "197390501" "197390501" "subst" "0" "00000" "CRB1_000470" "g.197390501C>T" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.219910C>T, c.1543C>T, p.Q515X" "" "Germline" "yes" "" "0" "" "" "g.197421371C>T" "" "pathogenic" "ACMG" "0000813787" "2" "70" "1" "197396703" "197396703" "subst" "0" "00000" "CRB1_000056" "g.197396703G>A" "" "{PMID:Xu 2020:31630094}" "" "CRB1 NM_201253: g.226112G>A, c.2248G>A, p.G750S" "" "Germline" "yes" "" "0" "" "" "g.197427573G>A" "" "likely pathogenic" "ACMG" "0000814596" "3" "70" "1" "197390660" "197390660" "subst" "0" "00000" "CRB1_000234" "g.197390660C>T" "" "{PMID:de Castro-Miró-2014:24516651}" "" "c.1702C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000814597" "0" "70" "1" "197404744" "197404745" "del" "0" "00000" "CRB1_000072" "g.197404744_197404745del" "" "{PMID:de Castro-Miró-2014:24516651}" "" "c.3749+2_3749+3del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000814598" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:de Castro-Miró-2014:24516651}" "" "c.2843G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000814599" "3" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:de Castro-Miró-2014:24516651}" "" "c.2290C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000814600" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:de Castro-Miró-2014:24516651}" "" "c.2843G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000814601" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:de Castro-Miró-2014:24516651}" "" "c.2843G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000814681" "0" "50" "1" "197396745" "197396745" "subst" "0.0000773427" "03779" "CRB1_000005" "g.197396745C>T" "" "" "" "" "" "Unknown" "" "rs62635654" "0" "" "" "" "" "VUS" "" "0000815073" "0" "90" "1" "197396689" "197396689" "subst" "0" "00000" "CRB1_000477" "g.197396689C>A" "" "{PMID:Shanks 2013:22968130}" "" "745K" "dbSNP entry for T745M" "Germline" "" "rs28939720" "0" "" "" "" "" "pathogenic" "" "0000815074" "0" "90" "1" "197398749" "197398749" "" "0" "00000" "CRB1_000479" "g.197398749?" "" "{PMID:Shanks 2013:22968130}" "" "c.2842+5" "" "Germline" "" "rs28939720" "0" "" "" "" "" "pathogenic" "" "0000815312" "0" "50" "1" "197411409" "197411409" "subst" "0.00149476" "00000" "CRB1_000041" "g.197411409G>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "CRB1:NM_201253 c.G3992A, p.R1331H" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.197442279G>A" "" "VUS" "ACMG" "0000815344" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "00000" "CRB1_000030" "g.197398590T>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "CRB1:NM_201253 c.T2688A, p.C896X" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "ACMG" "0000815418" "0" "50" "1" "197298095" "197298095" "subst" "0.000591041" "00000" "CRB1_000002" "g.197298095T>C" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "CRB1:NM_201253 c.T614C, p.I205T" "heterozygous, individual solved, variant non-causal" "Germline" "?" "" "0" "" "" "g.197328965T>C" "" "VUS" "ACMG" "0000815423" "0" "50" "1" "197397031" "197397031" "subst" "0.00000406765" "00000" "CRB1_000478" "g.197397031A>G" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "CRB1:NM_201253 c.A2576G, p.N859S" "heterozygous, individual solved, variant non-causal" "Germline" "?" "" "0" "" "" "g.197427901A>G" "" "VUS" "ACMG" "0000815470" "0" "50" "1" "197298095" "197298095" "subst" "0.000591041" "00000" "CRB1_000002" "g.197298095T>C" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "CRB1:NM_201253 c.T614C, p.I205T" "heterozygous, individual solved, variant non-causal" "Germline" "?" "" "0" "" "" "g.197328965T>C" "" "VUS" "ACMG" "0000815489" "0" "50" "1" "197298095" "197298095" "subst" "0.000591041" "00000" "CRB1_000002" "g.197298095T>C" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "CRB1:NM_201253 c.T614C, p.I205T" "heterozygous, individual solved, variant non-causal" "Germline" "?" "" "0" "" "" "g.197328965T>C" "" "VUS" "ACMG" "0000815496" "0" "70" "1" "197297962" "197297962" "subst" "0" "00000" "CRB1_000452" "g.197297962G>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "CRB1:NM_201253 c.G481A, p.A161T" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.197328832G>A" "" "likely pathogenic" "ACMG" "0000815548" "0" "70" "1" "197297968" "197297968" "subst" "0" "00000" "CRB1_000475" "g.197297968T>G" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "CRB1:NM_201253 c.T487G, p.C163G" "heterozygous, individual solved, variant non-causal" "Germline" "?" "" "0" "" "" "g.197328838T>G" "" "likely pathogenic" "ACMG" "0000815596" "0" "50" "1" "197390706" "197390706" "subst" "0" "00000" "CRB1_000476" "g.197390706T>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "CRB1:NM_201253 c.T1748A, p.I583N" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.197421576T>A" "" "VUS" "ACMG" "0000815955" "0" "70" "1" "197396626" "197396626" "subst" "0.0000081355" "00000" "CRB1_000230" "g.197396626A>G" "" "{PMID:Zampaglione-2020:32037395}" "" "CRB1 c.2171A>G, p.Tyr724Cys" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197427496A>G" "" "likely pathogenic" "" "0000816107" "0" "50" "1" "197403973" "197403973" "subst" "0" "00000" "CRB1_000485" "g.197403973A>G" "" "{PMID:Zampaglione-2020:32037395}" "" "CRB1 c.2980A>G, p.Lys994Glu" "conflicting in silico model predictions, heterozygous" "Unknown" "?" "" "0" "" "" "g.197434843A>G" "" "VUS" "" "0000816169" "0" "50" "1" "197391050" "197391050" "subst" "0" "00000" "CRB1_000482" "g.197391050T>C" "" "{PMID:Zampaglione-2020:32037395}" "" "CRB1 c.2092T>C, p.Cys698Arg" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197421920T>C" "" "VUS" "" "0000816230" "0" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Zampaglione-2020:32037395}" "" "CRB1 c.498_506del, p.Ile167_Gly169del" "Unable to find ClinVar entry, heterozygous" "Unknown" "?" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000816243" "0" "90" "1" "197326056" "197326056" "subst" "0.0000081213" "00000" "CRB1_000223" "g.197326056C>T" "" "{PMID:Zampaglione-2020:32037395}" "" "CRB1 c.1084C>T, p.Gln362Ter" "Classified as pathogenic by GeneDx in ClinVar, heterozygous" "Unknown" "?" "" "0" "" "" "g.197356926C>T" "" "pathogenic" "" "0000816307" "0" "90" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Zampaglione-2020:32037395}" "" "c.2401A>T, p.Lys801Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197427726A>T" "" "pathogenic" "" "0000816428" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "00000" "CRB1_000030" "g.197398590T>A" "" "{PMID:Zampaglione-2020:32037395}" "" "c.2688T>A, p.Cys896Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000816473" "0" "50" "1" "197397088" "197397088" "subst" "0" "00000" "CRB1_000484" "g.197397088T>C" "" "{PMID:Zampaglione-2020:32037395}" "" "c.2633T>C, p.Leu878Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197427958T>C" "" "VUS" "" "0000816521" "0" "90" "1" "197396718" "197396727" "del" "0.00000406888" "00000" "CRB1_000060" "g.197396718_197396727del" "" "{PMID:Zampaglione-2020:32037395}" "" "c.2263_2272del, p.Leu755AlafsTer10" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197427588_197427597del" "" "pathogenic" "" "0000816528" "0" "90" "1" "197313421" "197313422" "del" "0" "00000" "CRB1_000480" "g.197313421_197313422del" "" "{PMID:Zampaglione-2020:32037395}" "" "c.663_664del, p.Cys221Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197344291_197344292del" "" "pathogenic" "" "0000817660" "1" "70" "1" "197390624" "197390625" "dup" "0" "00000" "CRB1_000481" "g.197390624_197390625dup" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 c.1666_1667dupCT; c.3110_3143dupTGACCCTTTCCATGACAGACCCACTGTCCCAGAC" "no protein change given, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197421494_197421495dup" "" "likely pathogenic" "" "0000817661" "2" "70" "1" "197404103" "197404136" "dup" "0" "00000" "CRB1_000486" "g.197404103_197404136dup" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 c.1666_1667dupCT; c.3110_3143dupTGACCCTTTCCATGACAGACCCACTGTCCCAGAC" "no protein change given, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197434973_197435006dup" "" "likely pathogenic" "" "0000817662" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 c.2843G>A; c.2843G>A" "no protein change given, homozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000817663" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 c.2843G>A; c.2843G>A" "no protein change given, homozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000817664" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 c.2843G>A; c.2843G>A" "no protein change given, homozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000817665" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 c.2843G>A; c.2264T>C" "no protein change given, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000817666" "2" "70" "1" "197396719" "197396719" "subst" "0" "00000" "CRB1_000483" "g.197396719T>C" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 c.2843G>A; c.2264T>C" "no protein change given, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197427589T>C" "" "likely pathogenic" "" "0000817667" "1" "70" "1" "197404103" "197404136" "dup" "0" "00000" "CRB1_000486" "g.197404103_197404136dup" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 c.3110_3143dup34; c.2843G>A" "no protein change given, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197434973_197435006dup" "" "likely pathogenic" "" "0000817668" "2" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 c.3110_3143dup34; c.2843G>A" "no protein change given, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000817669" "1" "70" "1" "197411405" "197411405" "del" "0" "00000" "CRB1_000049" "g.197411405del" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 c.3988delG; c.2501G>A" "no protein change given, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197442275del" "" "likely pathogenic" "" "0000817670" "2" "70" "1" "197396956" "197396956" "subst" "0.00000406729" "00000" "CRB1_000374" "g.197396956G>A" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 c.3988delG; c.2501G>A" "no protein change given, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197427826G>A" "" "likely pathogenic" "" "0000817671" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 c.2843G>A; c.2843G>A" "no protein change given, homozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000817672" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 c.2843G>A; c.2843G>A" "no protein change given, most probably a different transcript, NM_001139443.1(BEST1):c.599del, RCV001008799.3, homozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000817673" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 2843G>A; 2843G>A" "no protein change given, homozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000817674" "3" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Zanolli 2020:32141364}" "" "CRB1 2843G>A; 2843G>A" "no protein change given, homozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000818416" "11" "90" "1" "197390166" "197390166" "subst" "0" "00000" "CRB1_000148" "g.197390166C>G" "" "{PMID:Surl 2020:32165824}" "" "c.1208C>G:p.(Ser403*)" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.197421036C>G" "" "pathogenic (recessive)" "ACMG" "0000818417" "21" "90" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Surl 2020:32165824}" "" "c.1576C>T:p.(Arg526*)" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.197421404C>T" "" "pathogenic (recessive)" "ACMG" "0000818494" "1" "90" "1" "197446793" "197446793" "subst" "0.00000407594" "00006" "CRB1_000181" "g.197446793G>A" "" "{PMID:Lingao 2016:26894784}" "" "c.4006IVS-1G>A" "" "Germline" "" "" "0" "" "" "g.197477663G>A" "" "pathogenic (recessive)" "" "0000818495" "1" "90" "1" "197396745" "197396745" "subst" "0.0000773427" "00006" "CRB1_000005" "g.197396745C>T" "" "{PMID:Lingao 2016:26894784}" "" "" "" "Germline" "" "" "0" "" "" "g.197427615C>T" "" "pathogenic (recessive)" "" "0000818502" "2" "90" "1" "197396626" "197396626" "subst" "0.0000081355" "00006" "CRB1_000230" "g.197396626A>G" "" "{PMID:Lingao 2016:26894784}" "" "" "" "Germline" "" "" "0" "" "" "g.197427496A>G" "" "pathogenic (recessive)" "" "0000818503" "2" "90" "1" "197404540" "197404540" "del" "0" "00006" "CRB1_000086" "g.197404540del" "" "{PMID:Lingao 2016:26894784}" "" "c.3547delT" "" "Germline" "" "" "0" "" "" "g.197435410del" "" "pathogenic (recessive)" "" "0000818945" "0" "70" "1" "197358137" "197397855" "del" "0" "00000" "CRB1_000487" "g.(197326144_197390129)_(197397132_197398578)del" "" "{PMID:Ellingsford 2018:29074561}" "" "chr1:197390125–197397136" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000818946" "0" "70" "1" "197404114" "197404114" "subst" "0.00000406788" "00000" "CRB1_000445" "g.197404114A>G" "" "{PMID:Ellingsford 2018:29074561}" "" "c.3121A>G p.(Met1041Val)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000819528" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2843G>A/p.C948Y, variant 2: c.2843G>A/p.C948Y" "solved, homozygous" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000819529" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2843G>A/p.C948Y, variant 2: c.2843G>A/p.C948Y" "solved, homozygous" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000819578" "1" "70" "1" "197297987" "197297987" "del" "0" "00000" "CRB1_000212" "g.197297987del" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.506del/p.G169Vfs*37, variant 2: c.2290C>T/p.R764C" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197328857del" "" "likely pathogenic" "" "0000819579" "1" "70" "1" "197297987" "197297987" "del" "0" "00000" "CRB1_000212" "g.197297987del" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.506del/p.G169Vfs*37, variant 2: c.2290C>T/p.R764C" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197328857del" "" "likely pathogenic" "" "0000819580" "1" "70" "1" "197297987" "197297987" "del" "0" "00000" "CRB1_000212" "g.197297987del" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.506del/p.G169Vfs*37, variant 2: c.2290C>T/p.R764C" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197328857del" "" "likely pathogenic" "" "0000819594" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2843G>A/p.C948Y, variant 2: c.2843G>A/p.C948Y" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000819612" "1" "70" "1" "197396685" "197396685" "subst" "0.0000122113" "00000" "CRB1_000268" "g.197396685C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.223C>T/p.R744*, variant 2: c.223C>T/p.R744*" "error in annotation, typing mistake, c.223C>T should be c.2230C>T, solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197427555C>T" "" "likely pathogenic" "" "0000819633" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2843G>A/p.C948Y, variant 2: c.2843G>A/p.C948Y" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000819636" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2843G>A/p.C948Y, variant 2: c.2843G>A/p.C948Y" "solved, homozygous" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000819637" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2843G>A/p.C948Y, variant 2: c.2843G>A/p.C948Y" "solved, homozygous" "Germline" "yes" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000819648" "1" "70" "1" "197396588" "197396588" "subst" "0" "00000" "CRB1_000492" "g.197396588T>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2133T>A/p.Y711*, variant 2: c.2809G>C/p.A937P" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197427458T>A" "" "likely pathogenic" "" "0000819653" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2843G>A/p.C948Y, variant 2: c.2843G>A/p.C948Y" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000819654" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2843G>A/p.C948Y, variant 2: c.2843G>A/p.C948Y" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000819671" "1" "70" "1" "197297987" "197297987" "del" "0" "00000" "CRB1_000212" "g.197297987del" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.506del/p.G169Vfs*37, variant 2: c. 3086T>A/p.V1029E" "possibly solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197328857del" "" "likely pathogenic" "" "0000819723" "1" "70" "1" "197396953" "197396953" "subst" "0" "00000" "CRB1_000164" "g.197396953G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2498G>A/p.G833D, variant 2: c.3442T>C/p.C1148R" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197427823G>A" "" "likely pathogenic" "" "0000819726" "1" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2290C>T/p.R764C, variant 2: c.2843G>A/p.C948Y" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000819727" "1" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2290C>T/p.R764C, variant 2: c.2843G>A/p.C948Y" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000819787" "1" "70" "1" "197390441" "197390441" "del" "0" "00000" "CRB1_000490" "g.197390441del" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.1483del/p.W495Gfs*7, variant 2: c.3934T>A/p.C1312S" "possibly solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197421311del" "" "likely pathogenic" "" "0000819879" "1" "70" "1" "197396703" "197396703" "subst" "0" "00000" "CRB1_000056" "g.197396703G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1 : c.2248G>A/p.G750S, variant 2 : c.2248G>A/p.G750S" "solved, homozygous" "Germline" "yes" "" "0" "" "" "g.197427573G>A" "" "likely pathogenic" "" "0000819933" "1" "70" "1" "197396685" "197396685" "subst" "0.0000122113" "00000" "CRB1_000268" "g.197396685C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2230C>T/p.R744*, variant 2: c.2230C>T/p.R744*" "solved, homozygous" "Germline" "yes" "" "0" "" "" "g.197427555C>T" "" "likely pathogenic" "" "0000820163" "1" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2290C>T/p.R764C, variant 2: c.2401A>T/p.K801*" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000820231" "1" "70" "1" "197313561" "197313564" "del" "0" "00000" "CRB1_000488" "g.197313561_197313564del" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.803_806del/p.S268Nfs*33, variant 2: c.2234C>T/p.T745M" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197344431_197344434del" "" "likely pathogenic" "" "0000820242" "1" "70" "1" "197326145" "197326145" "subst" "0" "00000" "CRB1_000489" "g.197326145T>G" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.1171+2T>G/p.?, variant 2: c.1171+2T>G/p.?" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.197357015T>G" "" "likely pathogenic" "" "0000820283" "1" "70" "1" "197297888" "197297888" "subst" "0.0000040792" "00000" "CRB1_000369" "g.197297888G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.407G>A/p.C136Y, variant 2 :Duplication exon 8" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197328758G>A" "" "likely pathogenic" "" "0000820296" "1" "70" "1" "197390808" "197390808" "subst" "0" "00000" "CRB1_000491" "g.197390808C>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.1850C>A/p.P617Q, variant 2: c.1850C>A/p.P617Q" "possibly solved, homozygous" "Unknown" "?" "" "0" "" "" "g.197421678C>A" "" "likely pathogenic" "" "0000820416" "1" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.498_506del/p.I167_G169del, variant 2: c.2401A>T/p.K801*" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000820533" "1" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2234C>T/p.T745M, variant 2: c.2234C>T/p.T745M" "solved, homozygous" "Unknown" "?" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000820539" "1" "70" "1" "197298094" "197298100" "del" "0" "00000" "CRB1_000175" "g.197298094_197298100del" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.613_619del/p.I205Dfs*13, variant 2: c.3062T>C/p.L1021P" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197328964_197328970del" "" "likely pathogenic" "" "0000820574" "1" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2401A>T/p.K801*, variant 2: c.2687G>A/p.C896Y" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000820674" "1" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.506del/p.G169Vfs*37, variant 2: c.2290C>T/p.R764C" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000820675" "1" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.506del/p.G169Vfs*37, variant 2: c.2290C>T/p.R764C" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000820676" "1" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.506del/p.G169Vfs*37, variant 2: c.2290C>T/p.R764C" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197427615C>T" "" "likely pathogenic" "" "0000820680" "1" "70" "1" "197396685" "197396685" "subst" "0.0000122113" "00000" "CRB1_000268" "g.197396685C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.223C>T/p.R744*, variant 2: c.223C>T/p.R744*" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197427555C>T" "" "likely pathogenic" "" "0000820688" "1" "70" "1" "197398711" "197398711" "subst" "0" "00000" "CRB1_000495" "g.197398711G>C" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2133T>A/p.Y711*, variant 2: c.2809G>C/p.A937P" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197429581G>C" "" "likely pathogenic" "" "0000820694" "1" "70" "1" "197404079" "197404079" "subst" "0" "00000" "CRB1_000497" "g.197404079T>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.506del/p.G169Vfs*37, variant 2: c. 3086T>A/p.V1029E" "possibly solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197434949T>A" "" "likely pathogenic" "" "0000820705" "1" "70" "1" "197404435" "197404435" "subst" "0" "00000" "CRB1_000074" "g.197404435T>C" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2498G>A/p.G833D, variant 2: c.3442T>C/p.C1148R" "solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197435305T>C" "" "likely pathogenic" "" "0000820707" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2290C>T/p.R764C, variant 2: c.2843G>A/p.C948Y" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000820708" "1" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2290C>T/p.R764C, variant 2: c.2843G>A/p.C948Y" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000820721" "1" "70" "1" "197411351" "197411351" "subst" "0" "00000" "CRB1_000499" "g.197411351T>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.1483del/p.W495Gfs*7, variant 2: c.3934T>A/p.C1312S" "possibly solved, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.197442221T>A" "" "likely pathogenic" "" "0000820830" "1" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2290C>T/p.R764C, variant 2: c.2401A>T/p.K801*" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000820846" "1" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.803_806del/p.S268Nfs*33, variant 2: c.2234C>T/p.T745M" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197427559C>T" "" "likely pathogenic" "" "0000820856" "1" "70" "1" "" "" "" "" "00000" "NPHS2_000000" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.407G>A/p.C136Y, variant 2 :Duplication exon 8" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000820906" "1" "70" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.498_506del/p.I167_G169del, variant 2: c.2401A>T/p.K801*" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197427726A>T" "" "likely pathogenic" "" "0000820962" "1" "70" "1" "197404055" "197404055" "subst" "0" "00000" "CRB1_000496" "g.197404055T>C" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.613_619del/p.I205Dfs*13, variant 2: c.3062T>C/p.L1021P" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197434925T>C" "" "likely pathogenic" "" "0000820983" "1" "70" "1" "197398589" "197398589" "subst" "0" "00000" "CRB1_000302" "g.197398589G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "CRB1, variant 1: c.2401A>T/p.K801*, variant 2: c.2687G>A/p.C896Y" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.197429459G>A" "" "likely pathogenic" "" "0000821007" "0" "70" "1" "197390799" "197390799" "subst" "0.000020326" "00000" "CRB1_000103" "g.197390799G>T" "1/64" "{PMID:Liu 2020:32562694}" "" "CRB1 c.1841G>T, p.Gly614Val" "homozygous" "Germline/De novo (untested)" "?" "rs763111500" "0" "" "" "g.197421669G>T" "" "likely pathogenic" "" "0000821230" "0" "70" "1" "197390670" "197390670" "subst" "0.00000406643" "00000" "CRB1_000331" "g.197390670A>C" "" "{PMID:Turro 2020:32581362}" "" "CRB1 c.1712A>C, p.Glu571Ala" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197421540A>C" "" "likely pathogenic" "" "0000821231" "0" "70" "1" "197325978" "197325978" "subst" "0" "00000" "CRB1_000328" "g.197325978T>C" "" "{PMID:Turro 2020:32581362}" "" "CRB1 c.1006T>C, p.Cys336Arg" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197356848T>C" "" "likely pathogenic" "" "0000821232" "0" "70" "1" "197390141" "197390141" "subst" "0" "00000" "CRB1_000329" "g.197390141G>T" "" "{PMID:Turro 2020:32581362}" "" "CRB1 c.1183G>T, p.Glu395Ter" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197421011G>T" "" "likely pathogenic" "" "0000821233" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "00000" "CRB1_000030" "g.197398590T>A" "" "{PMID:Turro 2020:32581362}" "" "CRB1 c.2688T>A, p.Cys896Ter" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000821234" "0" "90" "1" "197398590" "197398590" "subst" "0.0000284333" "00000" "CRB1_000030" "g.197398590T>A" "" "{PMID:Turro 2020:32581362}" "" "CRB1 c.2688T>A, p.Cys896Ter" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197429460T>A" "" "pathogenic" "" "0000821235" "3" "70" "1" "197390975" "197390975" "subst" "0" "00000" "CRB1_000333" "g.197390975A>G" "" "{PMID:Turro 2020:32581362}" "" "CRB1 c.2017A>G, p.Lys673Glu" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197421845A>G" "" "likely pathogenic" "" "0000821544" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Turro 2020:32581362}" "" "CRB1 c.2843G>A, p.Cys948Tyr" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "" "0000821545" "0" "70" "1" "197396584" "197396584" "subst" "0.0000122175" "00000" "CRB1_000004" "g.197396584A>T" "" "{PMID:Turro 2020:32581362}" "" "CRB1 c.2129A>T, p.Glu710Val" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197427454A>T" "" "likely pathogenic" "" "0000821546" "0" "70" "1" "197396675" "197396675" "dup" "0" "00000" "CRB1_000493" "g.197396675dup" "" "{PMID:Turro 2020:32581362}" "" "CRB1 c.2220dupC, p.Met741HisfsTer49" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197427545dup" "" "likely pathogenic" "" "0000821547" "0" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Turro 2020:32581362}" "" "CRB1 c.498_506delAATTGATGG, p.Ile167_Gly169del" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000821548" "0" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Turro 2020:32581362}" "" "CRB1 c.498_506delAATTGATGG, p.Ile167_Gly169del" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000821549" "3" "70" "1" "197398741" "197398741" "subst" "0.0000854096" "00000" "CRB1_000336" "g.197398741G>A" "" "{PMID:Turro 2020:32581362}" "" "CRB1 c.2839G>A, p.Glu947Lys" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.197429611G>A" "" "likely pathogenic" "" "0000822062" "3" "70" "1" "197407806" "197407806" "subst" "0.00000406752" "00000" "CRB1_000498" "g.197407806G>A" "" "{PMID:Habibi 2020:32641690}" "" "CRB1 c.[3542 + 1G > A];[3542 + 1G > A], -" "different transcript: NM_001193640.1:c.3542+1G>A, homozygous" "Germline" "?" "" "0" "" "" "g.197438676G>A" "" "likely pathogenic" "" "0000822063" "3" "70" "1" "197396961" "197396961" "subst" "0.00019522" "00000" "CRB1_000026" "g.197396961C>A" "" "{PMID:Habibi 2020:32641690}" "" "CRB1 c.[2506C > A];[2506C > A], p.[P836T];[P836T]" "homozygous" "Germline" "?" "" "0" "" "" "g.197427831C>A" "" "likely pathogenic" "" "0000822064" "3" "70" "1" "197391063" "197391063" "subst" "0.00000407947" "00000" "CRB1_000348" "g.197391063A>G" "" "{PMID:Habibi 2020:32641690}" "" "CRB1 c.[ 2105A > G];[ 2105A > G], p.[Y702C];[Y702C]" "homozygous" "Germline" "?" "" "0" "" "" "g.197421933A>G" "" "likely pathogenic" "" "0000822066" "3" "70" "1" "197391063" "197391063" "subst" "0.00000407947" "00000" "CRB1_000348" "g.197391063A>G" "" "{PMID:Habibi 2020:32641690}" "" "CRB1 c.[ 2105A > G];[ 2105A > G], p.[Y702C];[Y702C]" "homozygous" "Germline" "?" "" "0" "" "" "g.197421933A>G" "" "likely pathogenic" "" "0000822116" "0" "70" "1" "197398749" "197398749" "subst" "0.0000325529" "00000" "CRB1_000034" "g.197398749G>A" "" "{PMID:Booij-2011:20801516}" "" "c.2842+5G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000822191" "0" "70" "1" "197390430" "197390430" "subst" "0" "00000" "CRB1_000224" "g.197390430A>T" "" "{PMID:Maggi_2021:33546218}" "" "c.1472A>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000822192" "0" "70" "1" "197396753" "197396753" "subst" "0" "00000" "CRB1_000494" "g.197396753G>A" "" "{PMID:Maggi_2021:33546218}" "" "c.2298G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000822263" "0" "70" "1" "197396685" "197396685" "subst" "0.0000122113" "00000" "CRB1_000268" "g.197396685C>T" "" "{PMID:Maggi_2021:33546218}" "" "c.2230C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000822264" "0" "70" "1" "197396685" "197396685" "subst" "0.0000122113" "00000" "CRB1_000268" "g.197396685C>T" "" "{PMID:Maggi_2021:33546218}" "" "c.2230C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000822267" "0" "70" "1" "197298028" "197298028" "subst" "0" "00000" "CRB1_000357" "g.197298028T>C" "" "{PMID:Maggi_2021:33546218}" "" "c.547T>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000822268" "0" "70" "1" "197398589" "197398589" "subst" "0" "00000" "CRB1_000362" "g.197398589G>C" "" "{PMID:Maggi_2021:33546218}" "" "c.2687G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000822293" "1" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Maggi_2021:33546218}" "" "c.498_506del" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "" "0000822294" "1" "70" "1" "197396745" "197396745" "subst" "0.0000773427" "00000" "CRB1_000005" "g.197396745C>T" "" "{PMID:Maggi_2021:33546218}" "" "c.2290C>T" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "" "0000822688" "3" "70" "1" "197297979" "197297987" "del" "0" "00000" "CRB1_000211" "g.197297979_197297987del" "" "{PMID:Gliem 2020:32646556}" "" "CRB1 c.498_506del, p.Ile167_Gly169del" "homozygous" "Unknown" "?" "" "0" "" "" "g.197328849_197328857del" "" "likely pathogenic" "" "0000822939" "0" "70" "1" "197396961" "197396961" "subst" "0.00019522" "00000" "CRB1_000026" "g.197396961C>A" "" "{PMID:Méjécase 2020:32783370}" "" "CRB1 c.2506C>A p.(Pro836Thr)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197427831C>A" "" "likely pathogenic" "" "0000822976" "0" "70" "1" "197398745" "197398745" "delins" "0" "00000" "CRB1_000504" "g.197398745delinsAA" "" "{PMID:Méjécase 2020:32783370}" "" "CRB1 c.2842+1delinsAA" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197429615delinsAA" "" "likely pathogenic" "" "0000823194" "3" "50" "1" "197297588" "197297588" "subst" "0" "00000" "CRB1_000500" "g.197297588C>A" "" "{PMID:Hull 2020:32856788}" "" "CRB1 nucleotide 1, protein 1:c.107C>A, p.Ser36*" "homozygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.197328458C>A" "" "VUS" "" "0000823195" "0" "50" "1" "197390138" "197390138" "subst" "0" "00000" "CRB1_000371" "g.197390138T>C" "" "{PMID:Hull 2020:32856788}" "" "CRB1 nucleotide 1, protein 1:c.1180T>C, p.Cys394Arg nucleotide 2, protein 2:c.2843G>A, p.Cys948Tyr" "heterozygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.197421008T>C" "" "VUS" "" "0000823196" "0" "50" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Hull 2020:32856788}" "" "CRB1 nucleotide 1, protein 1:exon5del, qPCR nucleotide 2, protein 2:c.2843G>A, p.Cys948Tyr" "heterozygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.197434706G>A" "" "VUS" "" "0000823197" "0" "50" "1" "197390589" "197390589" "subst" "0" "00000" "CRB1_000201" "g.197390589T>C" "" "{PMID:Hull 2020:32856788}" "" "CRB1 nucleotide 1, protein 1:c.1459T>C, p.Ser487Pro nucleotide 2, protein 2:c.1631T>C, p.Leu544Ser" "heterozygous, ACMG classified, novel (Table 2)" "Germline" "?" "" "0" "" "" "g.197421459T>C" "" "VUS" "ACMG" "0000823198" "0" "50" "1" "197396677" "197396677" "subst" "0.00000406934" "00000" "CRB1_000013" "g.197396677T>C" "" "{PMID:Hull 2020:32856788}" "" "CRB1 nucleotide 1, protein 1:c.2222T>C, p.Met741Thr nucleotide 2, protein 2:c.4006-1G>A, p.?" "heterozygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.197427547T>C" "" "VUS" "" "0000823199" "3" "50" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Hull 2020:32856788}" "" "CRB1 nucleotide 1, protein 1:c.2234C>T, p.Thr745Met" "homozygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.197427559C>T" "" "VUS" "" "0000823200" "3" "50" "1" "197396856" "197396856" "subst" "0.0000529514" "00000" "CRB1_000007" "g.197396856A>T" "" "{PMID:Hull 2020:32856788}" "" "CRB1 nucleotide 1, protein 1:c.2401A>T, p.Lys801*" "homozygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.197427726A>T" "" "VUS" "" "0000823201" "3" "50" "1" "197404067" "197404067" "subst" "0" "00000" "CRB1_000023" "g.197404067G>A" "" "{PMID:Hull 2020:32856788}" "" "CRB1 nucleotide 1, protein 1:c.3074G>A, p.Ser1025Asn nucleotide 2, protein 2:," "homozygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.197434937G>A" "" "VUS" "" "0000823267" "0" "50" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Hull 2020:32856788}" "" "CRB1 nucleotide 1, protein 1:c.1180T>C, p.Cys394Arg nucleotide 2, protein 2:c.2843G>A, p.Cys948Tyr" "heterozygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.197434706G>A" "" "VUS" "" "0000823268" "0" "50" "1" "" "" "" "" "00000" "NPHS2_000000" "g.?" "" "{PMID:Hull 2020:32856788}" "" "CRB1 nucleotide 1, protein 1:exon5del, qPCR nucleotide 2, protein 2:c.2843G>A, p.Cys948Tyr" "heterozygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.?" "" "VUS" "" "0000823269" "0" "50" "1" "197390417" "197390417" "subst" "0" "00000" "CRB1_000201" "g.197390417T>C" "" "{PMID:Hull 2020:32856788}" "" "CRB1 nucleotide 1, protein 1:c.1459T>C, p.Ser487Pro nucleotide 2, protein 2:c.1631T>C, p.Leu544Ser" "heterozygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.197421287T>C" "" "VUS" "" "0000823270" "0" "50" "1" "197446793" "197446793" "subst" "0.00000407594" "00000" "CRB1_000181" "g.197446793G>A" "" "{PMID:Hull 2020:32856788}" "" "CRB1 nucleotide 1, protein 1:c.2222T>C, p.Met741Thr nucleotide 2, protein 2:c.4006-1G>A, p.?" "heterozygous, ACMG unclassified - no access to supplementary table 2" "Germline" "?" "" "0" "" "" "g.197477663G>A" "" "VUS" "" "0000823337" "0" "70" "1" "197404455" "197404456" "del" "0" "00000" "CRB1_000505" "g.197404455_197404456del" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.3462_3463deITG; p.Cys1154Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197435325_197435326del" "" "likely pathogenic" "ACMG" "0000823338" "0" "90" "1" "197404669" "197404669" "subst" "0.0000204062" "00000" "CRB1_000115" "g.197404669G>T" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.3676G>T; p.GIy1226Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197435539G>T" "" "pathogenic" "ACMG" "0000823339" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2843G>A; p.Cys948Tyr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "ACMG" "0000823340" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2843G>A; p.Cys948Tyr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "ACMG" "0000823341" "0" "90" "1" "197316605" "197316605" "subst" "0" "00000" "CRB1_000220" "g.197316605G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.984G>A; p.Trp328Ter" "homozygous" "Unknown" "?" "" "0" "" "" "g.197347475G>A" "" "pathogenic" "ACMG" "0000823342" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2843G>A; p.Cys948Tyr" "homozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "ACMG" "0000823343" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2843G>A; p.Cys948Tyr" "homozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "ACMG" "0000823344" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2843G>A; p.Cys948Tyr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "ACMG" "0000823345" "0" "90" "1" "197316605" "197316605" "subst" "0" "00000" "CRB1_000220" "g.197316605G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.984G>A; p.Trp328Ter" "homozygous" "Unknown" "?" "" "0" "" "" "g.197347475G>A" "" "pathogenic" "ACMG" "0000823346" "0" "70" "1" "197398744" "197398744" "subst" "0" "00000" "CRB1_000238" "g.197398744T>C" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2842T>C; p.Cys948Arg" "homozygous" "Unknown" "?" "" "0" "" "" "g.197429614T>C" "" "likely pathogenic" "ACMG" "0000823347" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2843G>A; p.Cys948Tyr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "ACMG" "0000823348" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2843G>A; p.Cys948Tyr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "ACMG" "0000823349" "0" "90" "1" "197316605" "197316605" "subst" "0" "00000" "CRB1_000220" "g.197316605G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.984G>A; p.Trp328Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197347475G>A" "" "pathogenic" "ACMG" "0000823431" "0" "70" "1" "197398744" "197398744" "subst" "0" "00000" "CRB1_000238" "g.197398744T>C" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2842T>C; p.Cys948Arg" "homozygous" "Unknown" "?" "" "0" "" "" "g.197429614T>C" "" "likely pathogenic" "ACMG" "0000823433" "0" "90" "1" "" "" "" "" "00000" "NPHS2_000000" "g.?" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 Exon 6-7 duplication; p.?" "heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "pathogenic" "ACMG" "0000823434" "0" "70" "1" "197297757" "197297775" "delins" "0" "00000" "CRB1_000501" "g.197297757_197297775delinsTGAACACTGTAC" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.276 294deIinsTGAACACTGTAC; p. Arg92SerfsTer54" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197328627_197328645delinsTGAACACTGTAC" "" "likely pathogenic" "ACMG" "0000823435" "0" "50" "1" "197446930" "197446930" "subst" "0" "00000" "CRB1_000015" "g.197446930C>T" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.4142C>T; p.Pro1381Leu" "homozygous" "Unknown" "?" "" "0" "" "" "g.197477800C>T" "" "VUS" "ACMG" "0000823436" "0" "50" "1" "197396961" "197396961" "subst" "0.00019522" "00000" "CRB1_000026" "g.197396961C>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2506C>A; p.Pro836Thr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197427831C>A" "" "VUS" "ACMG" "0000823437" "0" "90" "1" "197446956" "197446956" "subst" "0.00000815295" "00000" "CRB1_000045" "g.197446956C>T" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.4168C>T; p.Arg1390Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197477826C>T" "" "pathogenic" "ACMG" "0000823438" "0" "70" "1" "197398744" "197398744" "subst" "0" "00000" "CRB1_000238" "g.197398744T>C" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2842T>C; p.Cys948Arg" "homozygous" "Unknown" "?" "" "0" "" "" "g.197429614T>C" "" "likely pathogenic" "ACMG" "0000823488" "0" "70" "1" "197398744" "197398744" "subst" "0" "00000" "CRB1_000238" "g.197398744T>C" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2842T>C; p.Cys948Arg" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197429614T>C" "" "likely pathogenic" "ACMG" "0000823489" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2843G>A; p.Cys948Tyr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "ACMG" "0000823490" "0" "50" "1" "197390591" "197390591" "subst" "0" "00000" "CRB1_000340" "g.197390591T>C" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.1633T>C; p.Ser545Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197421461T>C" "" "VUS" "ACMG" "0000823491" "0" "50" "1" "197390591" "197390591" "subst" "0" "00000" "CRB1_000340" "g.197390591T>C" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.1633T>C; p.Ser545Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197421461T>C" "" "VUS" "ACMG" "0000823492" "0" "90" "1" "197396988" "197396994" "del" "0" "00000" "CRB1_000503" "g.197396988_197396994del" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2533_2539deIGGTGGAT; p.GIy845SerfsTer9" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197427858_197427864del" "" "pathogenic" "ACMG" "0000823493" "0" "70" "1" "197398744" "197398744" "subst" "0" "00000" "CRB1_000238" "g.197398744T>C" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2842T>C; p.Cys948Arg" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197429614T>C" "" "likely pathogenic" "ACMG" "0000823494" "0" "90" "1" "197396988" "197396994" "del" "0" "00000" "CRB1_000503" "g.197396988_197396994del" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2533_2539deIGGTGGAT; p.GIy845SerfsTer9" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197427858_197427864del" "" "pathogenic" "ACMG" "0000823495" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2843G>A; p.Cys948Tyr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "ACMG" "0000823537" "0" "70" "1" "197403836" "197403836" "subst" "0.000211939" "00000" "CRB1_000001" "g.197403836G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2843G>A; p.Cys948Tyr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197434706G>A" "" "likely pathogenic" "ACMG" "0000823538" "0" "50" "1" "197396961" "197396961" "subst" "0.00019522" "00000" "CRB1_000026" "g.197396961C>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2506C>A; p.Pro836Thr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197427831C>A" "" "VUS" "ACMG" "0000823540" "0" "70" "1" "197391000" "197391000" "subst" "0.00000406732" "00000" "CRB1_000020" "g.197391000G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2042G>A; p.Cys681Tyr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197421870G>A" "" "likely pathogenic" "ACMG" "0000823542" "0" "50" "1" "197396746" "197396746" "subst" "0.0000122099" "00000" "CRB1_000061" "g.197396746G>A" "" "{PMID:Sallum 2020:32865313}" "" "CRB1 c.2291G>A; p.Arg764His" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197427616G>A" "" "VUS" "ACMG" "0000823718" "2" "50" "1" "197390140" "197390140" "subst" "0.0000853777" "00000" "CRB1_000502" "g.197390140C>T" "" "{PMID:Repo 2021:32901921}" "" "CRB1, chr1:197390140C>T, c.1182C>T, p.Cys394=, rs115352681" "heterozygous" "Unknown" "?" "rs115352681" "0" "" "" "g.197421010C>T" "" "VUS" "ACMG" "0000823720" "2" "90" "1" "197404435" "197404435" "subst" "0" "00000" "CRB1_000074" "g.197404435T>C" "" "{PMID:Repo 2021:32901921}" "" "CRB1, chr1:197404435T>C, c.3442T>C, p.Cys1148Arg, na" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197435305T>C" "" "pathogenic" "ACMG" "0000823721" "1" "70" "1" "197446997" "197446997" "subst" "0" "00000" "CRB1_000506" "g.197446997G>T" "" "{PMID:Repo 2021:32901921}" "" "CRB1, chr1:197446997G>T, c.4209G>T, p.Glu1403Asp, na" "heterozygous" "Unknown" "?" "" "0" "" "" "g.197477867G>T" "" "likely pathogenic" "ACMG" "0000825516" "0" "50" "1" "197396665" "197396665" "subst" "0" "00000" "CRB1_000512" "g.197396665T>C" "" "{PMID:Ng 2021:33846575}" "" "CRB1 c.2210T>C, p.I737T" "no zygosity and pathogenicity classification indicated" "Unknown" "?" "" "0" "" "" "g.197427535T>C" "" "VUS" "" "0000825517" "0" "50" "1" "197404481" "197404481" "subst" "0.0000163207" "00000" "CRB1_000083" "g.197404481G>T" "" "{PMID:Ng 2021:33846575}" "" "CRB1 c.3488G>T, p.C1163F" "no zygosity and pathogenicity classification indicated" "Unknown" "?" "" "0" "" "" "g.197435351G>T" "" "VUS" "" "0000825518" "0" "50" "1" "197313422" "197313422" "subst" "0.000676429" "00000" "CRB1_000276" "g.197313422G>A" "" "{PMID:Ng 2021:33846575}" "" "CRB1 c.664G>A, p.E222K" "no zygosity and pathogenicity classification indicated" "Unknown" "?" "" "0" "" "" "g.197344292G>A" "" "VUS" "" "0000825519" "0" "50" "1" "197407789" "197407789" "subst" "0" "00000" "CRB1_000429" "g.197407789G>A" "" "{PMID:Ng 2021:33846575}" "" "CRB1 c.3862G>A, p.G1288S" "no zygosity and pathogenicity classification indicated" "Unknown" "?" "" "0" "" "" "g.197438659G>A" "" "VUS" "" "0000825582" "0" "50" "1" "197404688" "197404688" "subst" "0.0004488" "00000" "CRB1_000290" "g.197404688A>G" "" "{PMID:Ng 2021:33846575}" "" "CRB1 c.3695A>G, p.H1232R" "no zygosity and pathogenicity classification indicated" "Unknown" "?" "" "0" "" "" "g.197435558A>G" "" "VUS" "" "0000825668" "0" "70" "1" "197391014" "197391014" "subst" "0" "00000" "CRB1_000258" "g.197391014C>T" "" "{PMID:Liu-2020:33090715}" "" "c.2056C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825669" "0" "70" "1" "197396996" "197396997" "del" "0" "00000" "CRB1_000391" "g.197396996_197396997del" "" "{PMID:Liu-2020:33090715}" "" "c.2540_2541delTC" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825722" "0" "70" "1" "197398616" "197398616" "subst" "0.000272194" "00000" "CRB1_000138" "g.197398616G>A" "" "{PMID:Liu-2020:33090715}" "" "c.2714G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825723" "0" "70" "1" "197398711" "197398711" "subst" "0.000235799" "00000" "CRB1_000141" "g.197398711G>A" "" "{PMID:Liu-2020:33090715}" "" "c.2809G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825856" "3" "70" "1" "197446995" "197446995" "subst" "0" "00000" "CRB1_000047" "g.197446995G>C" "" "{PMID:Liu-2020:33090715}" "" "c.4207G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825894" "0" "70" "1" "197297620" "197297620" "del" "0" "00000" "CRB1_000424" "g.197297620del" "" "{PMID:Liu-2020:33090715}" "" "c.139delG" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825895" "0" "70" "1" "197403974" "197403975" "del" "0" "00000" "CRB1_000428" "g.197403974_197403975del" "" "{PMID:Liu-2020:33090715}" "" "c.2978_2979delAA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826085" "0" "70" "1" "197390326" "197390326" "subst" "0" "00000" "CRB1_000510" "g.197390326C>A" "" "{PMID:Liu-2020:33090715}" "" "c.1368C>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826086" "0" "70" "1" "197396967" "197396967" "subst" "0" "00000" "CRB1_000389" "g.197396967A>T" "" "{PMID:Liu-2020:33090715}" "" "c.2512A>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826123" "0" "70" "1" "197390159" "197390159" "subst" "0" "00000" "CRB1_000509" "g.197390159T>A" "" "{PMID:Liu-2020:33090715}" "" "c.1201T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826124" "0" "70" "1" "197404159" "197404159" "subst" "0.0000040662" "00000" "CRB1_000520" "g.197404159G>A" "" "{PMID:Liu-2020:33090715}" "" "c.3166G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826125" "0" "70" "1" "197404208" "197404208" "subst" "0" "00000" "CRB1_000521" "g.197404208A>T" "" "{PMID:Liu-2020:33090715}" "" "c.3215A>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000826146" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Liu-2020:33090715}" "" "c.2234C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826147" "0" "70" "1" "197390129" "197407806" "dup" "0" "00000" "CRB1_000508" "g.197390129_197407806dup" "" "{PMID:Liu-2020:33090715}" "" "E6-8dup" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826154" "0" "70" "1" "197325970" "197325970" "subst" "0" "00000" "CRB1_000221" "g.197325970G>A" "" "{PMID:Liu-2020:33090715}" "" "c.998G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826155" "0" "70" "1" "197396763" "197396763" "subst" "0.0000203608" "00000" "CRB1_000282" "g.197396763G>A" "" "{PMID:Liu-2020:33090715}" "" "c.2308G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826161" "0" "70" "1" "197396689" "197396689" "subst" "0.0000691884" "00000" "CRB1_000021" "g.197396689C>T" "" "{PMID:Liu-2020:33090715}" "" "c.2234C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826162" "0" "70" "1" "197411330" "197411330" "subst" "0" "00000" "CRB1_000524" "g.197411330C>T" "" "{PMID:Liu-2020:33090715}" "" "c.3913C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826183" "0" "70" "1" "197396826" "197396826" "subst" "0" "00000" "CRB1_000387" "g.197396826G>C" "" "{PMID:Liu-2020:33090715}" "" "c.2371G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826184" "0" "70" "1" "197396967" "197396967" "subst" "0" "00000" "CRB1_000389" "g.197396967A>T" "" "{PMID:Liu-2020:33090715}" "" "c.2512A>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826290" "3" "70" "1" "197297561" "197297561" "subst" "0.00000406981" "00000" "CRB1_000063" "g.197297561G>T" "" "{PMID:Liu-2020:33090715}" "" "c.80G>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826315" "0" "70" "1" "197390534" "197390534" "subst" "0.0000324984" "00000" "CRB1_000017" "g.197390534C>T" "" "{PMID:Liu-2020:33090715}" "" "c.1576C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826316" "0" "70" "1" "197446995" "197446995" "subst" "0" "00000" "CRB1_000047" "g.197446995G>C" "" "{PMID:Liu-2020:33090715}" "" "c.4207G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826352" "0" "70" "1" "197396879" "197396879" "subst" "0" "00000" "CRB1_000515" "g.197396879C>G" "" "{PMID:Liu-2020:33090715}" "" "c.2424C>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826353" "0" "70" "1" "197391021" "197391021" "dup" "0" "00000" "CRB1_000511" "g.197391021dup" "" "{PMID:Liu-2020:33090715}" "" "c.